Stimulation transcutanée du nerf vague by pain-therapy

PROTOCOLE DE STIMULATION DU NERF VAGUE TENS Eco2 avec électrode auriculaire réf. 101013 Principales indications :

Epilepsie - Dépression – Acouphènes – Hypertension - Troubles digestifs - Colon irritable - Intestin irritable – Hypersensibilité – Fibromyalgie – Algoneurodystrophie Douleurs viscérales et pelviennes

Programmes recommandés : P03 (2 Hz, 250 µs) U02 (10 Hz, 180 µs) P02 (80 Hz, 150 µs)

Fréquence :

2 séances de 20 minutes par jour -

Démarrer une séance :

Humidifier l’électrode auriculaire (réf. 101013) avec le spray conducteur TENS (réf. 101014)

Positionner l’électrode auriculaire dans le conduit auriculaire de l’oreille gauche.

Relier le câble de l’électrode auriculaire à l’appareil sur le canal de gauche (canal 1)

Placer l’interrupteur de l’appareil sur la position ON pour mettre en marche l’appareil avec le bouton ●.

Choisir le programme (qui a été recommandé par votre équipe soignante) à l’aide de la touche P.

Régler l’intensité du courant à l’aide des flèches ˄ et ˅ correspondant au canal sélectionné (canal 1).

Conseils d’utilisation :

Augmenter l’intensité jusqu’à ce que le patient ressente des fourmillements. L’intensité ressentie doit toujours rester confortable. Schwa Medico France

Tel : 03.89.49.73.61

Fonction du Nerf Vague et principe d’action de la stimulation : Le nerf vague ou pneumogastrique contrôle les cordes vocales, permet de déglutir, maintient le larynx ouvert pour respirer, ralentit le rythme cardiaque (quand c'est nécessaire), démarre et contrôle la digestion, provoque les réactions d'inflammation, influence de nombreuses glandes endocriniennes, qui influencent les fonctions vitales : glandes surrénales (hormones du stress), thyroïde, pancréas, qui produit l'insuline qui régule le sucre sanguin et le stockage des graisses. 80 à 90 % des fibres du nerf vague servent à envoyer de l'information de vos organes et de votre système digestif vers votre cerveau. Il relaye l'information provenant du « système nerveux entérique », ou « second cerveau », constitué de 200 millions de neurones le long des intestins, et qui sert à contrôler la digestion. La Stimulation du Nerf Vague ou Nerf Pneumogastrique entraîne la sécrétion d’acétylcholine (neurotransmetteur) qui permet le passage de l’influx nerveux dont la conduction se fait grâce à une zone de contact (synapse, fente synaptique) situés entre deux cellules (neurones). Cette stimulation déclenche alors les effets suivants : • • • •

Un ralentissement de la fréquence des battements du cœur Une diminution du calibre des bronches Un renforcement de la contraction des muscles lisses (muscles autonomes) du tube digestif Une augmentation de la sécrétion de salive et de sucs digestifs

La fonction végétative du nerf vague intéresse le cœur et les vaisseaux qu'il modère. Le nerf vague possède également une fonction hypotensive (diminution de la tension artérielle). L'action végétative du nerf vague s'applique également aux glandes surrénales, au pancréas, à la thyroïde, aux glandes endocriniennes, à l'appareil trachéobroncho-pulmonaire et à l'appareil digestif.

Bibliographie : -

Stimulation nerveuse transcutanée du parasympathique au niveau de l’oreille. Largeron. Annales Françaises d’Anesthésie et de Réanimation 33S (2014) A162–A167 Transcutaneous vagus nerve stimulation. J. Ellrich in European Neurological Review 2011 New directions in the treatment of pelvic pain. Udoji-Ness in Pain Management (2013). Treatment of chronic migraine with transcutaneous stimulation of the auricular branch of the vagal nerve (auricular t-VNS): a randomized, monocentric clinical trial. Straube et al. The Journal of Headache and Pain (2015) Transcutaneous electrical stimulation at auricular acupoints innervated by auricular branch of vagus nerve pairing tone for tinnitus: study protocol for a randomized controlled clinical trial. Li et al. Trials (2015) Effectiveness of transcutaneous electrical stimulation for chronic tinnitus. Lee. Acta OtoLaryngologica (2014) Transcutaneous vagus nerve stimulation: retrospective assessment of cardiac safety in a pilot study. Peter M. Kreuze rin Frontiers in Psychiatry (2012)

Schwa Medico France

Tel : 03.89.49.73.61

Positionnement de lâ&#x20AC;&#x2122;ĂŠlectrode auriculaire dans la stimulation du nerf vague

PRESCRIPTION D’UN NEUROSTIMULATEUR TRANSCUTANÉ TENS ECO2 POUR STIMULATION AURICULAIRE DU NERF VAGUE

PATIENT Nom et Prénom Adresse Téléphone • Location d’un neurostimulateur type TENS ECO 2 pour une durée de ………….mois. (réf. 104062, ACL 3401048905512, LPP 1189940) • Achat d’un neurostimulateur TENS ECO2 (réf. 104062, ACL 3401048905512, LPP 1183468) •

Electrode auriculaire pour stimulation du nerf vague (réf. 101013)

•

Spray conducteur TENS pour électrode auriculaire (réf. 101014)

-----------------------------------------------------------------------------------------------------------• Achat de 2 sachets d’électrodes autocollantes réutilisables STIMEX par mois pour neurostimulateur transcutané pour une durée de ……..mois. électrodes Stimex 50×50 mm (ACL 3401078701931, LPP 1134240) électrodes Stimex ∅ 32 mm (ACL 3401078701702, LPP 1134240) électrodes Stimex ∅ 50 mm (ACL 3401095150712, LPP 1134240) électrodes Stimex 50×90 mm (ACL 3401078701870, LPP 1134240) électrodes Argent Supérieur 50×50 mm (ACL 3401020321453, LPP 1134240) ------------------------------------------------------------------------------------------------------------Date : Nom du médecin : Signature :

Si cet appareil n’est pas disponible, merci de contacter SCHWA-MEDICO au 03 89 49 73 61

NIH Public Access Author Manuscript Pain Manag. Author manuscript; available in PMC 2014 July 01.

NIH-PA Author Manuscript

Published in final edited form as: Pain Manag. 2013 September ; 3(5): 387–394. doi:10.2217/pmt.13.40.

New directions in the treatment of pelvic pain Mercy A Udoji1 and Timothy J Ness*,1 1Department of Anesthesiology, University of Alabama at Birmingham, AL, USA

SUMMARY

NIH-PA Author Manuscript

The treatment of chronic pelvic pain in both females and males is a challenge for pain clinicians. Standard therapies are multimodal in nature with use of behavioral, medical and procedural therapeutics. In recent years, our understanding of the neuro biology of this disorder has improved and novel approaches have focused on neuro modulatory options, novel pharmacology and complementary/alternative medicine options. This review briefly examines newly employed therapeutic options, while restating currently utilized options. The current state-of-the-art treatment includes focal therapies for identified pathologies and empiric trials of other options for care when precise sources of the chronic pelvic pain are ill defined.

Overview of disease process

NIH-PA Author Manuscript

Chronic pelvic pain (CPP) is most commonly defined as continuous or intermittent pain that occurs in the lower abdomen or pelvic area that is cyclical or noncyclical in nature, and causes functional limitation in activities of daily living or reduced quality of life [1]. CPP is more prevalent in females, with an estimated worldwide prevalence of 2.1–24%. The annual cost to the USA's health system has been reported to be greater than US$800 million. Up to two-thirds of patients with CPP do not carry a definitive diagnosis [1,2]. The emotional toll on the patient, family and healthcare providers is immeasurable, as all parties involved become frustrated by the lack of progress that is common in the management of this disorder. The signs and symptoms of CPP vary from patient to patient with regards to location and intensity, as well as presence or absence of associated urinary symptoms and sexual dysfunction. To further confound the issue, innervation of the pelvis is complex, making diagnosis of pain originating in this region of the body very difficult [1]. In addition to a thorough history and physical examination, careful utilization of laboratory and imaging studies should be used to help make the appropriate diagnosis. The etiology of CPP is multifactorial and its pathophysiology is complex and incompletely understood [1]. CPP can arise from a multitude of causes in various organ systems, including gastrointestinal (e.g., inflammatory bowel disease and irritable bowel syndrome), neurologic (nerve entrapment and disc herniation), gynecologic (e.g., endometriosis and pelvic inflammatory disease), urologic (e.g., bladder pain syndrome and prostatitis) and musculoskeletal (e.g., sacroiliac joint dysfunction and symphysis pubis dysfunction) (Table 1) [2]. Coexisting painful disorders may be present and serve to enhance the overall pain symptoms through mechanisms of cross-organ sensitization resulting in viscero–visceral or viscerosomatic hyper-algesia [3]. Treatment of defined disorders follows typical treatment

© 2013 Future Medicine Ltd * Author for correspondence: Tel.: +1 205 975 9643; tjness@uab.edu. Financial & competing interests disclosure The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed. No writing assistance was utilized in the production of this manuscript.

Udoji and Ness

Page 2

NIH-PA Author Manuscript

pathways with the use of anti-inflammatory therapies (focal or systemic) when inflammation is identified and the use of neuropathic pain medications when clear pathology is identified within local neurological structures. In many cases, the precise pathology is not identified. In these instances, pathophysiologic theories suggest that CPP may be a result of abnormal CNS responses that maintain the perception of pain in the absence of acute injury [4], taking the features of a subtype of complex regional pain syndrome [5], or more simply as â&#x20AC;&#x2DC;central sensitizationâ&#x20AC;&#x2122; of the CNS with a decrease in pain thresholds and increase in normal pain intensities [6]. Since CPP often has mixed elements of neuropathic pain, inflammation and complex regional pain syndrome, patients may respond favorably to central acting medications, as well as stimulation of the CNS and peripheral nervous system.

New knowledge related to the neurobiology of pelvic pain

NIH-PA Author Manuscript

To meet the challenges posed by inadequately controlled pelvic pain, basic science studies have sought to define the mechanisms whereby this pain is generated and to define potential novel targets for therapeutics. There have been significant new findings related to genetic and epigenetic mechanisms associated with the development of abdominal/pelvic pains. Polymorphisms related to catechol-O-methyl transferase and Îź-opioid receptors have been associated with differing rates of postoperative pain in patients undergoing radical prostatectomy or hysterectomy by abdominal approaches [7]. By identifying a genetic basis to the variability of pain and response to therapies it may be possible to identify therapies that are as unique as different individuals. A patient's underlying genetics are modified by epigenetic mechanisms that turn different genes on or off within an individual's DNA and the past few years have observed a huge expansion in our understanding of how such gene modulation may alter pain sensitivity or responses to therapies. Drugs that alter epigenetic mechanisms, such as histone deacetlyase inhibitors, have been demonstrated to reduce hyperalgesia associated with experimental endometriosis [8] and prostatitis [9]. miRNAs have been implicated as sources of pain associated with cystitis and endometriosis, further modifying gene expression [10,11].

NIH-PA Author Manuscript

The neurophysiology of pelvic organ sensation has become progressively more defined and has recently been demonstrated to extend beyond neurons alone to include epithelial cells in the periphery and glial cells in the CNS [12]. In general, it has been demonstrated that the transduction interactions between epithelium and primary afferents produce specificity of sensory processing for individual pelvic organs. However, CNS processing of this specific information then contributes to nonspecificity by allowing for a convergence of sensory inputs on common sensory structures in the dorsal horn of the spinal cord. Notably, these neurons appear to follow a common set of modulatory mechanisms with little difference noted between inputs from different visceral structures. There is logic to having specificity associated with primary afferent nerves innervating visceral structures due to the differences each organ may have in their local environment. The simplest comparison is between the bladder (which holds sterile urine) and the colon (which contains a sewer of bacteria). Activation of TLR-4 mucosal surface receptors by gram negative bacteria in the bladder results in an innate immune response with induction of an inflammatory cascade which then produces changes in the transduction mechanism of primary afferent neurons and resultant pain and urgency. Such mechanisms are absent in the colon which is full of Gram-negative bacteria. There are sub-populations of primary afferents that have been demonstrated to have different receptor expression and transduction properties that differ in prevalence dependent upon the organ of study [13,14]. Additionally, a small number of afferents with branches to more than one pelvic organ have been identified [15].

Pain Manag. Author manuscript; available in PMC 2014 July 01.

Udoji and Ness

Page 3

NIH-PA Author Manuscript

As noted above, in contrast to the specific patterns of activity noted in primary afferent neurons, second order neuronal responses to visceral stimuli have been demonstrated to have great similarity in responses independent of the organ being stimulated. Recent studies have observed modulation of dorsal horn responses by presentation of environmental stressors, such as footshock [16] or intravesical TRPV1 channel activation [17]. A comparison of dorsal horn neuron studies related to bladder distension and those related to distension of the colon/rectum fails to make any distinction between the two different neuronal populations, with parallel studies demonstrating similar convergence with somatic structures, modulation by centrally acting drugs and other CNS mechanisms. Future studies utilizing subtler modulations may tease apart differences in existent second order neuron populations.

NIH-PA Author Manuscript

Multiple models of pain associated with pelvic structures are continually being developed, including those associated with ovarian pain, cystitis, prostatitis, endometriosis and colitis (for a review of endometriosis models, see [18]). A particularly notable new model utilizes uropathogenic Escherichia coli to produce persistent pelvic mechanical sensitivity to probing following urinary tract infection even after treatment of the infection [19]. ‘Crosstalk’ between pelvic organ structures has been demonstrated by multiple studies with inflammation of one organ, such as the colon, producing alterations in the sensitivity of other organs, such as the bladder. Such ‘cross-talk’ has been treated effectively in animal models with the analgesic tramadol [20]. An interesting study by Malykhina et al. demonstrated that TRPV1 mechanisms were associated with this cross-talk, but unfortunately also demonstrated that treatments related to TRPV1 mechanisms, such as intravesical resiniferatoxin, may not be effective because those treatments while decreasing cross-talk mechanisms, increase sensitivity to somatic stimulation [17]. Multiple novel targets for therapy have been identified by preclinical trials, which include sodium channel blocking agents, drugs that modulate CD4+ T cells, receptors such as CXCR3/CCL2/CCL3, vascular endothelial growth factor receptors, glutamate transporters, calcium/calmodulin-dependent protein kinase II, macrophage migration inhibitory factor receptors, serotonin 1A receptors, cannabinoid receptors and melatonin receptors [21]. The targets that prove to be useful will depend on further refinement of their actions and toxicities.

Current management options

NIH-PA Author Manuscript

Since evidence-based management options for CPP with and without defined pathology are limited, as few therapeutics have ‘proven’ clinical efficacy, a multidisciplinary approach to the treatment of these patients is essential (Table 2). Frequently, the diagnosis assigned to a painful condition is dependent on the initial specialist who evaluated the patient: urologists assign urological diagnoses; gynecologists assign gynecological diagnoses. A prudent approach for any pain clinician is to take a fresh look at existent evaluations and to assess the multiple etiologies that are possible, but not considered. A phenotypic approach championed by Nickel et al. and Shoakes et al. is the UPOINT system, which has six domains: urinary, psychosocial, organ-specific, infection, neurologic/systemic and muscle tenderness [22,23]. These domains define potential lines of diagnostic investigation and suggest treatment options in relation to urogenital pain, thereby giving some structure to their clinical approach. The UPOINT approach has been extended and modified by some international organizations to the broader category of pelvic pain [24] and appears to be a valid initial approach to a patient's pain complaints. If the underlying cause of the pain is defined, then subsequent treatment is centered on that particular etiology, otherwise a more global ‘empiric’ approach must be taken. Diagnostic laparoscopy, lysis of adhesions and exploratory laparotomy are the most common procedures performed in this population of patients. Medication management also plays a vital role. Opiates, muscle relaxants,

Pain Manag. Author manuscript; available in PMC 2014 July 01.

Udoji and Ness

Page 4

NIH-PA Author Manuscript

antidepressants and anticonvulsants have all been used with varying efficacy. In recent years, interventional techniques have moved to the forefront as management has shifted away from invasive surgical exploration to minimally invasive and percutaneous procedures. Focal local anesthetic and depot steroid injections at neuraxial and peripheral sites have been commonly employed. The successful use of neuromodulation (including spinal cord and posterior tibial nerve stimulators) and radio frequency thermocoagulation has been well documented in published literature [25,26]. Adjuvant techniques, including biofeedback, acupuncture and massage, are used as part of a true multimodal treatment approach.

New trends in clinical management with neuromodulation

NIH-PA Author Manuscript

Neuromodulation/nerve stimulation are now central to the management of refractory CPP. Neuromodulation typically targets the S2–S4 nerve roots even though the pelvis is innervated by peripheral sympathetic (T12–L2) and somatic (S2–4), as well as parasympathetic (S2–4) nerve structures. Therefore, lead placement at the sacral level may appear to cover the appropriate painful area for the patient, but may not lead to satisfactory improvement in clinical symptoms. At this time, pain providers have yet to reach a consensus with regards to optimal lead placement. Percutaneous posterior tibial nerve and sacral lead placement continue to be the most common approach, but with only limited support when using evidence-based medical evaluations [27]. There is new evidence that altering lead location can increase success rates in complex patients. Hunter et al. have described lead placement as high as T6/7 and as low as the conus with positive results [28]. The success of high lead placement is attributed to the non dermatomal distribution of visceral pain fibers and the assumption that at higher levels, a greater percentage of visceral fiber coverage is achieved [28]. Placement of leads in the sub-cutaneous tissue of the lower abdomen, as well as pudendal nerve neuromodulation, has also been described in difficult to treat patients with encouraging results [29,30]. Vagal nerve stimulation is used in the management of intractable seizure disorders, but has known antinociceptive effects. The exact mechanism of this analgesic effect is unknown, but is thought to be mediated by afferent input to the nucleus tractus solitarius and higher centers [31]. Noninvasive approaches to vagal nerve stimulation (transcutaneous vagus nerve stimulation) involve stimulation of its auricular branch in the ear. Respiratory gated auricular vagal afferent nerve stimulation (RAVANS) synchronizes vagal stimulation with respiration. In patients with CPP due to endometriosis, RAVANS revealed a trend towards reduction of evoked deep pain intensity and temporal summation of mechanical pain [32].

NIH-PA Author Manuscript

The use of primary motor cortex stimulation for CPP necessitates implantation of an electrode in the extradural space to stimulate the motor cortex corresponding to the appropriate painful area as identified by repeated transcranial magnetic stimulation. A case report by Louppe et al. described the use of this technique in two patients with chronic intractable perineal pain. After electrode and stimulator implantation, both patients experienced significant reduction of their pain symptoms, which was sustained at the end of a follow-up period of approximately 1.5 years [32]. Transcutaneous electrical stimulation is associated with a moderate degree of success in this population [33]. Intravaginal electrical stimulation is a more invasive type of transcutaneous electrical stimulation. Its efficacy was tested with a randomized, double-blind crossover trial of 26 women with CPP. The authors assessed pain severity at the end of 20 weeks of twice-weekly 30-min therapy sessions, reporting that it was associated with greater pain relief than placebo [34].

Pain Manag. Author manuscript; available in PMC 2014 July 01.

Udoji and Ness

Page 5

New trends in medical management NIH-PA Author Manuscript

Despite the aforementioned advances in therapy, medications continue to be central to the management of CPP. Tricyclic antidepressants, a-adrenergic blockers, gabapentin and pregabalin all show promise in the treatment of this disorder (Table 2). However, in randomized clinical trials, they have not been proven to be clearly superior to placebo and are sometimes associated with severe, dose-limiting side effects. Topical formulations (i.e., amitriptyline–ketamine cream) have been reported to be an effective alternative for patients who may be intolerant of higher doses of some oral medications [35]. COX inhibitors help manage the inflammatory component of pain caused by CPP owing to its ability to decrease prostaglandin production. It may also inhibit central processes that can propagate chronic pain [36]. There is some thought that autoimmune mechanisms play a role in CPP prompting clinicians to trial systemic corticosteroid therapy. The reported advantages of systemic steroid use include better pain and quality-of-life scores. Notably, there have not been any double-blind randomized controlled trials completed to confirm or refute the validity of these results [36]. Given the life-altering adverse effects associated with chronic steroid use, practitioners must carefully weigh the risk–benefit ratio on a patient-by-patient basis prior to choosing this course of therapy.

NIH-PA Author Manuscript NIH-PA Author Manuscript

N-methyl-d-aspartate glutamate receptor antagonists have analgesic effects secondary to their ability to reduce excitatory neurotransmission in the CNS. Memantine is an N-methylD-aspartate receptor that has demonstrated some early successes in managing the symptoms of CPP [36]. Changes in NGF levels expressed from the prostatic fluid of males suffering from CPP have been implicated in disease severity [37]. NGF has also been implicated in the pathogenesis of CPP. A monoclonal antibody directed against NGF (tanezumab) is currently being investigated for use in this pain syndrome [36,38]. TNF-α is a proinflammatory cytokine that promotes the production of IL-1 and IL-6. There is a relatively large body of evidence in the form of case reports and series supporting its use in the management of patients with severe endometriosis. In a recent Cochrane review, only one randomized clinical trial evaluating the efficacy of anti-TNF-α medications was found in the literature prompting the authors to conclude that there was insufficient evidence for or against the use of this class of medications in the management of pelvic pain due to endometriosis [39]. Aromatase inhibitors (anastrozole and letrozole) are emerging as viable options in the management of women with CPP induced by endo metriosis. While there are no randomized clinical trials in the literature to support its use, multiple nonrandomized studies and case series support their efficacy in reducing the pain and burden of endo metriomas with minimal side effects [40]. In animal models, thiazolidinediones can reduce endo metriosis lesions without affecting their fertility. In a preliminary study designed to evaluate the efficacy of thiazolidinediones as a treatment for endometriosis-related CPP, the authors noted both a decrease in opiate consumption and a decrease in pain as measured by the McGill pain questionnaire in two out of three patients [41]. It must be noted that this class of medication carries a black box warning from the US FDA due to increased risk of myocardial events in patients with risk factors, limiting its overall utility [41]. Npalmitoylethanolamine and transpolydatin are two anti-inflammatory and antinociceptive agents that may provide benefits for the CPP patient. Giugliano et al. conducted a prospective study of 47 patients with endometriosis and CPP who received these two medications. Their results suggested that intensity of endometriotic pain decreased over time with the use of N- palmitoylethanolamine and transpolydatin [42].

New trends in complementary & alternative medicine Physical therapy, dietary therapy and complementary and alternative medicines are useful adjuvants to traditional therapies. Physical therapy utilizing myofascial release techniques

Pain Manag. Author manuscript; available in PMC 2014 July 01.

Udoji and Ness

Page 6

NIH-PA Author Manuscript

and pelvic floor muscle exercises is regularly used in multimodal treatment plans. Fitzgerald et al. determined the feasibility of performing a randomized clinical trial comparing two types of physical therapy for patients with urologic CPP. Their results were notable for a better response in patients managed with myofascial physical therapy as opposed to global therapeutic massage [43]. In 2011, a randomized clinical trial evaluated the efficacy of yoga in relieving the pain of patients with known primary dysmenorrhea. Its results indicated that the performance of yoga poses during menses (cobra, cat and fish poses) were associated with significant decrease in pain duration and intensity compared with the control [44]. If these results are borne out, a similar technique could be applied to the treatment of patients with CPP. Acupuncture has grown in popularity and is now used to manage a variety of pain disorders, as well as postoperative nausea and vomiting. Regarding acupuncture and CPP, reports about the successful use of acupuncture or acupuncture with electrical stimulation pepper the literature and in general they have been positive, with significant decreases in pain scores over placebo noted in a majority of the studies [33,45,46].

NIH-PA Author Manuscript

Dietary therapy is based on evidence that a higher intake of fresh fruit and vegetables containing high amounts of antioxidants is associated with increased immune function and decreased free radical/oxidative stress to the body. This therapy recommends increasing the patient's intake of natural inhibitors of COX function (vitamins and n-3 fatty acids). These serve to boost the body's natural ability to fight free radicals and reduce pain via a reduction in prostaglandin and inflammatory cytokine production [47]. It should be noted that work in this arena has been largely experimental. Twice-daily use of quercetin (a red wine/green tea extract) was shown to improve male CPP in double-blind, placebo-controlled trials [48]. In murine models, there is ongoing research to evaluate epigallocatechin-3-gallate, a component of green tea that is thought to be responsible for its antiangiogenic, antioxidant and anti proliferative effects; and reservatrol, found on grape skin, responsible for antioxidant and anti-inflammatory effects of red wine. The authors tested these agents by transplanting endometriosis-like lesions into mice and randomized the animals to receive reservatrol or epigallo catechin-3-gallate. Their results showed significant suppression of the development of endometriosis lesions in treated mice in both groups, but the epigallocatechin-3-gallate group showed a greater degree of suppression of these lesions compared with the reservatrol group [49].

Conclusion & future perspective

NIH-PA Author Manuscript

CPP is a complex disorder whose prevalence in the general population is comparable to asthma, chronic back pain or migraine headaches [50]. With poorly understood etiology and pathophysiology, management of this disorder mandates the use of a multidisciplinary approach. There are a variety of interventional, surgical, and medical and alternative approaches available to treat this disorder; however, none of them have been proven to be consistently effective and so novel therapies such as those presented in this report have been employed. The current state-of-the-art treatment for CPP often involves a trial and error approach in order to attain the best results for any individual patient. Research on this disorder is extensive and ongoing. The use of neuromodulatory/neurostimulatory methods presents significant potential for interventions related to pain that is unresponsive to more traditional medical and behavioral therapies. Hopefully, within the next 5â&#x20AC;&#x201C;10 years, sufficient well-controlled randomized clinical trials will have been performed that clinical practice can be evidence-based, rather than anecdote-based. Given the significant emotional, physical and healthcare costs associated with CPP, there is a vital need for these trials to be performed.

Pain Manag. Author manuscript; available in PMC 2014 July 01.

Udoji and Ness

Page 7

Acknowledgments TJ Ness receives support from NIH DK51413 for studies of pelvic pain.

NIH-PA Author Manuscript

References Papers of special note have been highlighted as: ■ of interest ■■ of considerable interest

NIH-PA Author Manuscript NIH-PA Author Manuscript

1. Daniels JP, Khalid SK. Chronic pelvic pain in women. BMJ. 2010; 341:c4834. [PubMed: 20923840] 2. Ortiz DD. Chronic pelvic pain in women. Am. Fam. Phys. 2008; 77:1535–1542. 3. Giamberardino MA, Costantini R, Affaitati G, et al. Viscero–visceral hyperalgesia: characterization in different clinical models. Pain. 2010; 151:307–322. [PubMed: 20638177] 4. Marcelissen T, Jacobs R, van Kerrebroeck P, de Wachter S. Sacral neuromodulation as a treatment for chronic pelvic pain. J. Urol. 2011; 186:387–393. [PubMed: 21683381] 5. Janicki TI. Chronic pelvic pain as a form of complex regional pain syndrome. Clin. Obstet. Gynecol. 2003; 46(4):797–803. [PubMed: 14595221] 6. Cheong Y, William Stones R. Chronic pelvic pain: aetiology and therapy. Best Pract. Res. Clin. Obstet. Gynaecol. 2006; 20(5):695–711. [PubMed: 16765092] 7■■. Kolesnikov Y, Gabovits B, Levin A, et al. Chronic pain after lower abdominal surgery: do catechol-O-methyl transferase/opioid receptor m-1 polymorphisms contribute? Mol. Pain. 2013; 9:19. [PubMed: 23566343] [This clinical basic science study in humans demonstrated that genetic variation may help explain why some patients experience acute pain that resolves and others develop chronic pain processes.] 8. Lu Y, Nie J, Liu X, Zheng Y, Guo SW. Trichostatin A, a histone deacetylase inhibitor, reduces lesion growth and hyperalgesia in experimentally induced endometriosis in mice. Hum. Reprod. 2010; 25:1014–1025. [PubMed: 20118114] 9. Zhang ZY, Schluesener HJ. HDAC inhibitor MS-275 attenuates the inflammatory reaction in rat experimental autoimmune prostatitis. Prostate. 2012; 72:90–99. [PubMed: 21538420] 10■. Hawkins SM, Creighton CJ, Han DY, et al. Functional microRNA involved in endometriosis. Mol. Endocrinol. 2011; 25:821–832. [PubMed: 21436257] [Suggests that circulating miRNAs generated by endometrial lesions may have systemic pain-sensitizing effects through epigenetic mechanisms.] 11■. Sengupta JN, Pochiraju S, Kannampalli P, et al. MicroRNA-mediated GABA Aa-1 receptor subunit down-regulation in adult spinal cord following neonatal cystitis-induced chronic visceral pain in rats. Pain. 2013; 154:59–70. [PubMed: 23273104] [Suggests a precise epigenetic mechanism associated with CNS disinhibition, which is produced by epigenetic mechanisms that may explain some features of interstitial cystitis.] 12. Birder LA, Wolf-Johnston AS, Chib MK, Buffington CA, Roppolo JR, Hanna-Mitchell AT. Beyond neurons: involvement of urothelial and glial cells in bladder function. Neurourol. Urodyn. 2010; 29:88–96. [PubMed: 20025015] 13. Hughes PA, Brierly SM, Martin CM, Brookes SJ, Linden DR, Blackshaw LA. Post-inflammatory colonic afferent sensitization: different subtypes, different pathways and different time courses. Gut. 2009; 58:1333–1341. [PubMed: 19324867] 14. Feng B, Gebhart GF. Characterization of silent afferents in the pelvic and splanchnic innervations of the mouse colorectum. Am. J. Physiol. Gastrointest. Liver Physiol. 2011; 300:G170–G180. [PubMed: 21071510] 15. Chen Y, Wu X, Liu J, Tang W, Zhao T, Zhang J. Distribution of convergent afferents innervating bladder and prostate at dorsal root ganglia in rats. Urology. 2010; 76:764, e1–e6. [PubMed: 20655579]

Pain Manag. Author manuscript; available in PMC 2014 July 01.

Udoji and Ness

Page 8

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

16. Robbins MT, Deberry J, Randich A, Ness TJ. Footshock stress differentially affects responses of two subpopulations of spinal dorsal horn neurons to urinary bladder distension in rats. Brain Res. 2011; 1386:118–126. [PubMed: 21376017] 17. Malykhina AP, Qin C, Lei Q, Pan XQ, Greenwood-van Meerveld B, Foreman RD. Differential effects of intravesical resiniferatoxin on excitability of bladder spinal s neurons upon colon– bladder cross-sensitization. Brain Res. 2013; 1491:213–224. [PubMed: 23146715] 18. Stratton P, Berkley KJ. Chronic pelvic pain and endometriosis: translational evidence of the relationship and implications. Hum. Reprod. Update. 2011; 17:327–346. [PubMed: 21106492] 19■. Rudick CN, Berry RE, Johnson JR, et al. Uropathogenic Escherichia coli induces chronic pelvic pain. Basic science investigation that suggests that certain strains of Escherichia coli may produce long-lasting sensory changes in the bladder, even after antibiotic treatment. Infect. Immun. 2011; 79:628–635. 20. Lopopolo M, Affaitati G, Fabrizio A, et al. Effects of tramadol on viscero–visceral hyperalgesia in a rat model of endometriosis plus uteteral calculosis. Fundam. Clin. Pharmacol. 2013 doi:10.1111/ fcp.12038 Epub ahead of print. 21. Mickle A, Sood M, Zhang A, Shahmohammadi G, Sengupta JM, Miranda A. Antinociceptive effects of melatonin in a rat model of post-inflammatory visceral hyperalgesia: a centrally mediated process. Pain. 2010; 149:555–564. [PubMed: 20413219] 22. Nickel JC, Shoskes D, Irvine-Bird K. Clinical phenotyping of women with interstitial cystitis/ painful bladder syndrome: a key to classification and potentially improved management. J. Urol. 2009; 182:155–160. [PubMed: 19447429] 23. Shoskes DA, Nickel JC, Kattan MW. Phenotypically directed multimodal therapy for chronic prostatitis/chronic pelvic pain syndrome: a prospective study using UPOINT. Urology. 2010; 75:1249–1253. [PubMed: 20363491] 24. Engeler DS, Baranowski AP, Dinis-Oliveira P, et al. The 2013 EAU guidelines on chronic pelvic pain: is management of chronic pelvic pain a habit, a philosophy, or a science? 10 years of development. Eur. Urol. 2013; 64(3):431–439. [PubMed: 23684447] 25. van Balken MR, Vandoninck V, Messelink B, et al. Percutaneous tibial nerve stimulation as neuromodulative treatment of chronic pelvic pain. Eur. Urol. 2003; 43(2):158–163. [PubMed: 12565774] 26. Kapural L, Narouze SN, Janicki TI, Mekhail N. Spinal cord stimulation is an effective treatment for the chronic intractable visceral pelvic pain. Pain Med. 2006; 7(5):440–443. [PubMed: 17014604] 27. Tirlapur SA, Vlismas A, Ball E, Khan KS. Nerve stimulation for chronic pelvic pain and bladder pain syndrome: a systematic review. Acta Obstet. Gynecol. Scand. 2013; 92:881–887. [PubMed: 23710833] 28■■. Hunter C, Dave N, Diwan S, Deer T. Neuromodulation of pelvic visceral pain: review of the literature and case series of potential novel targets for treatment. Pain Pract. 2013; 13(1):3–17. [PubMed: 22521096] [Good clinical review coupled with a case series providing anecdotal evidence for the use of neuromodulatory methods in the treatment of pelvic pain.] 29. Al Tamimi M, Davids HR, Barolat G, Krutsch J, Ford T. Subcutaneous peripheral nerve stimulation treatment for chronic pelvic pain. Neuromodulation. 2008; 11(4):277–281. [PubMed: 22151141] 30. Carmel M, Lebel M, Tu le M. Pudendal nerve neuromodulation with neurophysiology guidance: a potential treatment option for refractory chronic pelvi-perineal pain. Int. Urogynecol. J. 2010; 21(5):613–616. [PubMed: 20012596] 31. Napadow V, Edwards RR, Cahalan CM, et al. Evoked pain analgesia in chronic pelvic pain patients using respiratory-gated auricular vagal afferent nerve stimulation. Pain Med. 2012; 13(6): 777–789. [PubMed: 22568773] 32. Louppe J, Nguyen J, Robert R, et al. Motor cortex stimulation in refractory pelvic and perineal pain: report of two successful cases. Neurourol. Urodynam. 2013; 32:53–57. 33. Schneider MP, Tellenbach M, Mordasini L, Thalmann GN, Kessler TM. Refractory chronic pelvic pain syndrome in men: can transcutaneous electrical nerve stimulation help? BJU Int. 2013; 112:E159–E163. [PubMed: 23433012]

Pain Manag. Author manuscript; available in PMC 2014 July 01.

Udoji and Ness

Page 9

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

34. de Bernardes NO, Marques A, Ganunny C, Bahamondes L. Use of intravaginal electrical stimulation for the treatment of chronic pelvic pain: a randomized, double-blind, crossover clinical trial. J. Reprod. Med. 2010; 55(1–2):19–24. [PubMed: 20337203] 35. Poterucha TJ, Murphy SL, Rho RH, et al. Topical amitriptyline-ketamine for treatment of rectal, genital, and perineal pain and discomfort. Pain Physician. 2012; 15:485–488. [PubMed: 23159965] 36. Strauss AC, Dimitrakov JD. New treatments for chronic prostatitis/chronic pelvic pain syndrome. Nat. Rev. Urol. 2010; 7(3):127–135. [PubMed: 20142810] 37. Watanabe T, Inoue M, Sasaki K, et al. Nerve growth factor level in the prostatic fluid of patients with chronic prostatitis/chronic pelvic pain syndrome is correlated with symptoms severity and response to treatment. BJU Int. 2011; 108(2):248–251. [PubMed: 20883485] 38. Miller LJ, Fischer KA, Goralnick SJ, et al. Nerve growth factor and chronic prostatitis/chronic pelvic pain syndrome. Urology. 2002; 59:603–608. [PubMed: 11927336] 39■. Lu D, Song H, Shi G. Anti TNF-alpha treatment for pelvic pain associated with endometriosis. Cochrane Database Syst. Rev. 2013; 3:CD008088. [PubMed: 23543560] [Evidence-based evaluation of one of the novel therapies for pelvic pain.] 40. Nothnick WB. The emerging use of aromatase inhibitors for endometriosis treatment. Reprod. Biol. Endocrinol. 2011; 9:87. [PubMed: 21693036] 41. Moravek MB, Ward EA, Lebovic DI. Thiazolidinediones as therapy for endometriosis: a case series. Gynecol. Obstet. Invest. 2009; 68:167–170. [PubMed: 19641325] 42. Gugliano E, Cagnazzo E, Soave I, Monte GL, Wenger JM, Marci R. The adjuvant use of Npalmitoylethanolamine and trasnpolydatin in the treatment of endometriotic pain. Eur. J. Obstet. Gynecol. Reprod. Biol. 2013; 168:209–213. [PubMed: 23415738] 43■. Fitzgerald MP, Anderson RU, Potts J, et al. Randomized multicenter feasibility trial of myofascial physical therapy for the treatment of urological chronic pelvic pain syndromes. J. Urol. 2013; 189:S75–S85. [PubMed: 23234638] [Clinical trial providing equivocal support for physical therapy interventions in relation to chronic pelvic pain of presumed initial urogenital origin.] 44. Rakhshaee Z. Effect of three yoga poses (cobra, cat and fish poses) in women with primary dysmenorrheal: a randomized clinical trial. J. Pediatr. Adolesc. Gynecol. 2011; 24(4):192–196. [PubMed: 21514190] 45. Lee SH, Lee BC. Use of acupuncture as a treatment method for chronic prostatitis/chronic pelvic pain syndromes. Curr. Urol. Rep. 2011; 12(4):288–296. [PubMed: 21472420] 46. Capodice JL, Zhezhen J, Bemis DL, et al. A pilot study on acupuncture for lower urinary tract symptoms related to chronic prostatitis/chronic pelvic pain. Chin. Med. 2007; 6(2) 47. Sesti F, Capozzolo T, Pietropolli A, Collalti M, Bollea MR, Piccione E. Dietary therapy: a new strategy for management of chronic pelvic pain. Nutr. Res. Rev. 2011; 24:31–38. 48■. Wehbe SA, Fariello JY, Whitmore K. Minimally invasive therapies for chronic pelvic pain syndrome. Curr. Urol. Rep. 2010; 11:276–285. [PubMed: 20449696] [Good clinical review that includes a discussion of complementary and alternative methods of treatment.] 49. Ricci AG, Olivares CN, Bilotas MA, et al. Natural therapies assessment for the treatment of endometriosis. Hum. Reprod. 2013; 28:178–188. [PubMed: 23081870] 50. Howard FM. Chronic pelvic pain. Obstet. Gynecol. 2003; 101(3):594–611. [PubMed: 12636968]

Pain Manag. Author manuscript; available in PMC 2014 July 01.

Udoji and Ness

Page 10

Practice Points

NIH-PA Author Manuscript

■ Chronic pelvic pain can have gastroenterological, urogenital, musculoskeletal and neurological origins. ■ Therapeutics are initially driven by any identified pathologies within these organ systems. ■ Identification of the inflammatory processes indicates the use of focal or systemic anti-inflammatory therapies. ■ Neuropathic processes indicate the use of neuromodulatory therapeutics and neuropathic pain-related medications, including the use of antidepressants, anticonvulsants and other agents. ■ When generators of pain are poorly defined, systematic empiric trials of agents may be appropriate; initial trials assume a potential for neuropathic causes. ■ Behavioral interventions are always appropriate when pain involves body areas associated with private functions, including defecation, urination and sexual function.

NIH-PA Author Manuscript

■ Complementary and alternative medicine therapeutics have a highly appropriate place in the treatment of a disorder not treated well by traditional medicine.

NIH-PA Author Manuscript Pain Manag. Author manuscript; available in PMC 2014 July 01.

Udoji and Ness

Page 11

Table 1

Causes of chronic pelvic pain.

NIH-PA Author Manuscript

Type of pain

Cause

Neurologic

Nerve entrapment, nerve irritation, shingles, disc herniation, abdominal epilepsy, abdominal migraine, Tarlov cysts

Gynecologic

Endometriosis, pelvic inflammatory disease, adnexal pathology (e.g., ovarian cysts), pelvic congestion syndrome, pelvic floor hypertonia, vulvodynia, tumors (e.g., fibroids), ovarian remnant syndrome

Urologic

Bladder pain syndrome/interstitial cystitis, urethral pain syndrome, chronic prostatitis, prostate pain syndrome, penile pain syndrome

Gastrointestinal

Irritable bowel syndrome, Crohn's disease, diverticular disease, ulcerative colitis, chronic appendicitis, cancer, adhesions (after abdominal surgery)

Musculoskeletal

Sacroiliac joint dysfunction, symphysis pubis dysfunction, pelvic ring hypermobility, coccygeal pain, myofascial pain, piriformis syndrome, fibromyalgia

NIH-PA Author Manuscript NIH-PA Author Manuscript Pain Manag. Author manuscript; available in PMC 2014 July 01.

Udoji and Ness

Page 12

Table 2

Current management of pelvic pain.

NIH-PA Author Manuscript

Management type

Method

Surgical

Diagnostic laparascopy, exploratory laparotomy, lysis of adhesions, presacral neurectomy, paracervical denervation, uterovaginal ganglion excision

Medication

Tricyclic antidepressants, anticonvulsants, opiates, muscle relaxants, antibiotics, Îą-blockers, pentosan polysulfate

Interventional procedures

Radiofrequency thermocoagulation (pulsed, cooled and so on), sympathetic nerve blocks, neurolysis (cryo or chemical), neuromodulation (spinal cord or peripheral nerve stimulators), botulinum toxin injections

Physical therapy

TENS unit, massage, ultrasound, pelvic floor training, myofascial release

Other/complementary and alternative medicine

Acupuncture, psychological counseling, behavioral modification, guided imagery, biofeedback, phytotherapy, ultrasound

TENS: Transcutaneous electrical nerve stimulation.

NIH-PA Author Manuscript NIH-PA Author Manuscript Pain Manag. Author manuscript; available in PMC 2014 July 01.

NIH Public Access Author Manuscript Pain Med. Author manuscript; available in PMC 2012 September 1.

NIH-PA Author Manuscript

Published in final edited form as: Pain Med. 2011 September ; 12(9): 1406–1413. doi:10.1111/j.1526-4637.2011.01203.x.

Safety and efficacy of vagus nerve stimulation in Fibromyalgia: A Phase I/II proof of concept trial

NIH-PA Author Manuscript

Gudrun Lange, PhD, Malvin N. Janal, PhD, Allen Maniker, MD, Jennifer FitzGibbons, APN, Malusha Fobler, BA, Dane Cook, PhD, and Benjamin H. Natelson, MD UMDNJ-New Jersey Medical School, Department of Radiology, Newark, NJ (Dr Lange, Ms FitzGibbons and Ms Fobler), UMDNJ-New Jersey Medical School, Department of Psychiatry (Dr Janal), UMDNJ-New Jersey Medical School, Department of Neuroscience (Dr Natelson), Department of Veterans Affairs, New Jersey Health Care System, East Orange, NJ (Dr. Lange, Ms. FitzGibbons and Ms. Fobler), Beth Israel Medical Center, Department of Neurosurgery, New York, NY (Dr Maniker), Beth Israel Medical Center, Department of Pain Medicine & Palliative Care (Dr Natelson), New York University, College of Dentistry, Department of Epidemiology and Health Promotion, New York, NY (Dr Janal), William S. Middleton Memorial Veterans Hospital and the Department of Kinesiology, University of Wisconsin, Madison, WI (Dr Cook)

Abstract Objective—We performed an open label Phase I/II trial to evaluate the safety and tolerability of vagus nerve stimulation (VNS) in patients with treatment-resistant fibromyalgia (FM) as well as to determine preliminary measures of efficacy in these patients. Methods—Of 14 patients implanted with the VNS stimulator, 12 completed the initial 3 month study of VNS; 11 returned for follow-up visits 5, 8 and 11 months after start of stimulation. Therapeutic efficacy was assessed with a composite measure requiring improvement in pain, overall wellness, and physical function. Loss of both pain and tenderness criteria for the diagnosis of FM was added as a secondary outcome measure because of results found at the end of 3 months of stimulation.

NIH-PA Author Manuscript

Results—Side effects were similar to those reported in patients treated with VNS for epilepsy or depression and, in addition, dry mouth and fatigue were reported. Two patients did not tolerate stimulation. At 3 months, five participants had attained efficacy criteria; of these, two no longer met widespread pain or tenderness criteria for the diagnosis of FM. The therapeutic effect seemed to increase over time in that additional participants attained both criteria at 11 months. Conclusions—Side effects and tolerability were similar to those found in disorders currently treated with VNS. Preliminary outcome measures suggested that VNS may be a useful adjunct treatment for FM patients resistant to conventional therapeutic management but further research is required to better understand its actual role in the treatment of FM. Fibromyalgia (FM) affects 3.4% of women and 0.5% men in North America (1). Despite this prevalence, only three medications are currently approved for its use. Anecdotal data among FM practitioners suggest that many patients, however, continue to suffer pain which interferes substantially with their physical function and quality of life. We evaluated the possibility that periodic stimulation of the left vagus nerve by Vagus Nerve Stimulation [VNS] throughout the 24 hr day might be a safe, tolerable, and useful adjunct treatment for patients reporting continued severe pain despite receiving current best

Corresponding Author: Benjamin H. Natelson, MD, Pain and Fatigue Study Center, Department of Pain Medicine and Palliative Care, Beth Israel Medical Center, 10 Union Square East, New York, NY 10003. bnatelson@bethisraelny.org; 212-844-6768.

Lange et al.

Page 2

NIH-PA Author Manuscript

medical management. Three observations guided the reasoning for undertaking this trial: first, experimental studies suggested that afferent vagal stimulation may modulate descending serotonergic and noradrenergic neurons to reduce pain (2); second, VNS has FDA approval for treatment resistant epilepsy and depression – disorders which have been treated by similar medicines as those used to treat FM (3;4) and third, VNS appeared to decrease pain perception in patients with treatment-resistant depression (5). To test our hypothesis, we initiated a Phase I/II safety and tolerability trial of VNS in a cohort of FM persons with continued substantial pain complaints despite medical treatment. While the primary purpose of this “proof of concept” trial was to assess the safety and tolerability of VNS in FM, we also collected preliminary data assessing potential treatment efficacy.

METHODS Study participants

NIH-PA Author Manuscript

This was an open label, longitudinal, single-center study using VNS in a group of FM patients refractory to conventional pharmacological treatment. To be eligible, patients had to have FM, diagnosed by a physician, for at least two years, be between 18 to 60 years of age, and attain at least average scores on the vocabulary subscale of the Wechsler Adult Intelligence Scale–III (WAIS-III (6)). In addition, FM patients had to provide physiciandocumented evidence that the following medications had been tried to treat FM pain but either did not provide sufficient relief or were tolerated poorly: non-steroidal antiinflammatory drugs, tricyclic antidepressants or duloxetine (an SNRI), any one anticonvulsant drug, and tramadol. Patients had to be on a stable medication regimen for at least six weeks prior to study entry and were asked to maintain this regimen throughout the initial or acute phase of the study. While reductions in dosage did not affect continuing eligibility, dosage increases or the introduction of additional drugs were not allowed during the acute phase of the study; thereafter, there were no restrictions. Exclusions included other medical illness that could cause widespread body pain; use of antipsychotic drugs or any non-pharmacological treatment for FM within three months of enrollment; vagotomy; being in litigation at time of enrollment; reporting the onset of FM following physical trauma; positive history of psychotic depression, bipolar disorder, psychotic disorders, substance abuse/dependence within 10 years prior to study intake on diagnostic psychiatric interview [MINI (7)]; patients with non-psychotic depression were not excluded.

NIH-PA Author Manuscript

One hundred and twelve individuals were recruited and screened between November 2006 and May 2008. Of these, 14 women fulfilled entry criteria and provided informed consent to undergo VNS implantation, activation, current intensity ramp up, and fixed stimulation for three months. Eleven of the 14 implanted patients participated in a longitudinal study lasting an additional 8 months. Study procedures Timeline—After signing an IRB approved screening consent, participants visited the Pain & Fatigue Study Center on two occasions to be evaluated for study eligibility. The evaluation included a careful medical history, physical examination, and blood tests (CBC with differential, sedimentation rate, SMA-18, TSH/T4/T3 uptake, CPK, ANA, Rheumatoid factor, C6-Lyme Elisa) to rule out other possible causes of widespread pain and to allow collection of baseline data. On each of these visits, eligibility was ascertained by confirming the diagnosis of FM using ACR criteria (8). Those criteria required (a) the presence of chronic widespread pain defined as ≥ three months of pain in at least three bodily quadrants plus pain in the axial skeletal area and (b) the report of pain upon pressure of at least 11 of

Pain Med. Author manuscript; available in PMC 2012 September 1.

Lange et al.

Page 3

NIH-PA Author Manuscript

18 points with a pressure of 4 kg. To determine whether a point was tender or not, we used a standardized and validated examination (9) in which a “positive” tender point was defined as a patient rating of 2 or more on a 0 to 10 pain scale (0 was none, 5 moderate and 10 worst pain imaginable) upon palpitation with 4 kg pressure. At baseline, participants were required to wear a watch-type electronic diary (Actiwatch, Respironics, Inc, Portland, OR) that polled pain intensity five times a day over 9 days (at least 37 readings required for inclusion). Eligible participants had to have a median pain intensity score of at least 5 (where 0 indicated No Pain and 10 Worst Pain Imaginable). Once eligibility was confirmed, patients signed an implantation enrollment consent approved by the IRB of UMDNJ-NJMS. Baseline data collected on the screening visits included the SF-36 (10), the Margolis Pain Drawing (11), and reports of usual FM pain intensity during the past week, scaled the same as the electronic diary. Quantitative sensory testing (QST) assessing heat pain was conducted using the TSA 2001 apparatus (Medoc, Ltd, Ramat Yishai, Israel). Participants rated the pain intensity and unpleasantness of seven stimulus intensities ranging from 43° C to 49° C in 1° increments, each presented twice and ordered at random, on a 10 point magnitude rating scale.

NIH-PA Author Manuscript

After a median of 60 days following enrollment, study participants were implanted with the VNS device. After two weeks for surgical recovery, participants began a two-week stimulation adjustment period during which VNS intensity was increased to deliver as high a current as could be comfortably tolerated [target range: 1 to 2 mA] while holding all other stimulation parameters constant [pulse width = 250 µsec; frequency = 20 Hz; duty cycle = 30 sec on, 5 min off – i.e., the parameters used by Cyberonics Inc, the device manufacturer, for previous trials of VNS]. Stimulus parameters were then held constant over the next 12 weeks, referred to as the “Acute Study,” although reductions in VNS current intensity due to side effects were allowed. During this phase of the study, participants could decrease medications but could neither increase dose or frequency of existing medications nor add new medications. During their 9 return visits, study participants provided data on side effects of VNS, FM and medication status, as well as usual pain ratings since their last visit; they also completed QST and self-report questionnaires. Participants who continued in the follow up study after 5, 8 and 11 months of stimulation provided these same data; they could now also request upward adjustment of current intensity due to lessening of side effects over time or diminishing pain relief after the acute study. Assessment of safety and tolerability

NIH-PA Author Manuscript

Primary safety endpoints included (a) the number of participants who tolerated implantation of the VNS device, its activation and ramp up through the end of the acute study and (b) the range of VNS output current tolerated at the end of the acute study and at the 5, 8, and 11 month follow-up visits. We aimed to determine whether: a) types of adverse events were similar to those reported in patients with refractory epilepsy and treatment resistant depression and b) rates of occurrence of adverse events were similar. Efficacy outcomes We assessed participants for clinical improvement at each of the planned study visits. Our primary outcome measure was whether participants attained a minimal clinically important difference (MCID+) following VNS; this criterion has been previously employed in a 3month drug trial in FM (12). To become MCID+, participants had to show improvement on three separate measures: a 30% improvement from baseline ‘usual pain ratings in the last week’ AND a Patient Global Impression of Change score rated as markedly or moderately improved [1–2 on a 7 point scale] AND an improvement of at least 6 points [0.6 SD] on the Physical Function subscale of the SF-36.

Pain Med. Author manuscript; available in PMC 2012 September 1.

Lange et al.

Page 4

NIH-PA Author Manuscript

The secondary outcome measure presented in this paper – i.e., loss of FM caseness – was not an a priori hypothesis since no data exist to support the notion that this variable might change with treatment. However, we added FM caseness as a post hoc outcome measure, because of the unexpected results seen at the end of the acute study period. We defined loss of FM caseness as a patient’s no longer fulfilling both 1990 ACR FM criteria -- widespread pain and at least 11 tender points on palpation. We operationalized the definition of widespread pain by considering it present if patients had pain in at least 3 bodily quadrants plus having axial pain (score of ≥ 4). Thus scores ≤ 3 no longer fulfilled the widespread pain criterion. Patients having less than 11 tender points no longer fulfilled the tender point criterion. We report safety and tolerability data for all 14 implanted participants; outcome is reported using an intent to treat analysis.

RESULTS Participants were all women with ages ranging from 35 to 54. Four had major depressive disorder [MDD] on entry; three were disabled. Of the remaining 10 without MDD, four were disabled. Safety and Tolerability

NIH-PA Author Manuscript

All 14 study participants tolerated implantation of the VNS device, its activation and the subsequent ramp up of VNS output current. Ultimately, 100% of the study sample tolerated implantation well, while 93% tolerated ramp up and fixed stimulation during the acute study (see below).

NIH-PA Author Manuscript

There were 4 unanticipated/serious adverse events occurring in 3 patients. The first was not device related: participant #118 was non-compliant with the protocol requirement for not changing medication during the 16-week acute study and was hospitalized for opiate overdose. The second was device related: Participant #115 experienced a device failure necessitating surgical revision. The third, also occurring in participant #115, was not device related: Following device re-activation and ramp up of stimulus intensity, she reported such marked dyspepsia that she asked that the stimulator be turned off. Dyspepsia continued despite cessation of VNS. Data from these two participants – both of whom came into the study positive for current MDD – are not included in the preliminary efficacy analysis of the acute study. The last adverse event was classified as possibly stimulation related: Participant #121 reported stimulus-bound electric-like sensations across her chest and into her left arm that were reduced by lowering VNS intensity; this side effect of stimulation is persisting but has been well tolerated. At the end of the acute study, current intensity ranged from 0.75 to 2 mA [median = 1.5 mA]. Thereafter, participants were free to adjust their output current, but median output current remained stable at 1.5 mA: ranges of output current at 5, 8 and 11 month stimulation follow-up visits respectively were 1.0–2.5 mA; 0.5–2.25 mA, and 1.0–2.5 mA. Despite objective evidence of improvement at the end of the acute study, one patient [#105] with MDD perceived VNS as not beneficial for her widespread pain and felt it exacerbated her pre-existing headache disorder; she requested that the stimulator be turned off and elected to have it explanted subsequent to completing the acute study. Frequencies of observed adverse events (AEs) related to surgery, the device, or stimulation for all 14 implanted participants are listed in Table 1. Most adverse events were similar to those reported in patients with refractory epilepsy and treatment resistant depression (13); they were self limited and decreased in severity over time.

Pain Med. Author manuscript; available in PMC 2012 September 1.

Lange et al.

Page 5

NIH-PA Author Manuscript

Surgery and stimulation related adverse events not reported previously, but observed here included mild (n=1) to moderate (n=2) dry mouth and moderate (n=1) to severe (n=2) increases in fatigue. While rates of occurrence for voice alteration for FM patients were similar to those of patients with treatment resistant MDD and epilepsy (64% versus 58 and 54%, respectively), rates of neck/facial pain, headaches, and dyspnea were greater in the FM sample (50%, 21%, and 50%, respectively versus 13–16%, less than 5%, and 14–16%, respectively). These observations in this small sample suggest that individuals with treatment resistant FM, a chronic pain disorder, may be more sensitive to pain related to vagus nerve stimulation. However, this increased sensitivity did not result in termination of stimulation. Efficacy

NIH-PA Author Manuscript

A priori outcome measure—Table 2 indicates the time points when individual participants became MCID+ [light grey shading]. At the end of the acute study, five [36%] of the 14 implanted participants had become MCID+, and in the follow up study, two, eight, and seven of the 14 implanted participants [14%, 57%, and 50% respectively] had become MCID+ at the 5, 8 and 11 month stimulation visits. Two participants were MCID+ across all 4 assessment times; one study patient was MCID+ at the end of the acute study and then again at the 8 and 11 month stimulation follow up visits; three patients became MCID+ at the 8 month and 11 month time points – suggestive of progressive improvement over time. Less successful outcomes included one participant who was MCID+ only at the end of the acute study and a second one who was MCID+ only at the end of the acute study and at the 8 month assessment. A posteriori outcome measure—At baseline, each of the 14 women had tenderness in 4 bodily quadrants as well as in axial skeletal areas [noted in Table 2 as 5 within parentheses], and tender point counts ranged from 12 to 18 [median = 17.5]. Table 2 also shows the points in time when individual participants ceased fulfilling both criteria for FM caseness – that is, when participants had three or fewer quadrants of pain and had fewer than 11 tender points [thick outlined boxes]. These numbers increased over the course of the study from two at the end of the acute study to five at the end of the follow-up study. There was an association between MCID status and FM status: participants no longer fulfilled criteria for FM at 14 of the 22 time points [63.6%] where participants were MCID+, while only one no longer fulfilled criteria for FM at the 23 time points [4.3%] where participants were MCID- [Fisher’s test = 0.001, 2-tailed]. Concordance between the two outcome measures seemed to improve over time. While only two of the five MCID+ participants no longer fulfilled the two criteria for FM at the end of the acute study, five of the seven MCID + participants no longer fulfilled both criteria for FM at the end of the follow-up study.

NIH-PA Author Manuscript

The overall decrease in pain sensitivity is supported by the QST results obtained prior to device activation and at each of the subsequent study visits for the 11 patients completing the follow up trial [see Figure 1]. As expected, reported pain intensity increased as the actual temperature of the probe increased, ANOVA for repeated measures F2,26 = 14.1, p = 0.001. Results also showed that there was a significant and progressive decrease in pain intensity reported to each of the three temperatures over the course of the study, ANOVA for repeated measures F5,77 = 9.3, p = 0.001.

DISCUSSION In general, FM patients had the same types of side effects to VNS as those reported in patients with treatment-resistant epilepsy and depression – most often stimulus-bound voice alteration, neck pain, nausea, and dyspnea; these side effects tended to dissipate with time.

Pain Med. Author manuscript; available in PMC 2012 September 1.

Lange et al.

Page 6

NIH-PA Author Manuscript

Dry mouth and increased fatigue were two AEs not previously reported and present in this study population. While implantation surgery was tolerated well, two patients did not complete the acute study [one due to problems tolerating stimulation and the other due to study violations]; a third patient requested device explantation due to treatment inefficacy. This non-completion rate does not differ from that reported at the end of the one year trial of VNS for major depression [270 completers of 295 implanted (14); fishers test NS]. Eleven women completed the follow up study. No late emerging AEs were observed. While the primary purpose of this study was to assess the safety and tolerability of VNS in FM, a secondary goal was to do a preliminary evaluation of its efficacy. We assessed the MCID and another measure added at the end of the acute study phase – the existence of the diagnosis of FM consistent with 1990 ACR FM criteria (2), i.e., FM caseness. We had not considered loss of FM caseness (2) as a possible outcome measure when we designed the study because no published treatment had been efficacious enough to affect diagnosis, but since we found this to occur in certain VNS-treated patients, we realized that using loss of FM caseness as an outcome variable might be useful for clinicians in judging the potential efficacy of VNS.

NIH-PA Author Manuscript

Both outcome measures showed substantial improvement over time. At the end of the acute study, five of the 14 participants became MCID+ and two no longer fulfilled both diagnostic criteria for the 1990 ACR FM case definition (2). In contrast to studies using reduction in pain alone to indicate the therapeutic efficacy of a drug in treating FM, only this and one other published trial used the more demanding MCID to determine a positive therapeutic effect (12). Importantly, no study has ever reported sufficient improvement in pain that treated patients no longer fulfill criteria for the diagnosis of FM (2). This therapeutic effect seemed to increase beyond the acute trial. At the end of the 11 month study, seven patients were MCID+ and parallel improvement was seen in terms of FM caseness (2): five patients no longer fulfilled either the widespread pain criterion or the tender point criterion for the diagnosis of FM (2), and a sixth patient continued to have wide spread pain but had fewer than 11 tender points (dark grey shading in Table 2). We were surprised by the robustness and ubiquity of response to the VNS treatment. While it is true that “improvement in tender point threshold appears to be a difficult outcome to achieve” (4), our results suggest that an FM treatment can reduce tender point threshold to the degree that the point tested is no longer tender.

NIH-PA Author Manuscript

However, tender point count was not a reliable predictor of continued therapeutic success over time as can be seen with #102 as an example (see Table 2). She had widespread pain throughout the trial and had as few as five tender points at one visit; but, then, number of tender points increased thereafter. The best predictor of outcome seemed to be reduction in painful quadrants to three or lower. For every patient except #121 at her 8 month visit, this reduction in bodily pain boded well for continued clinical improvement. The reduction in QST/psychophysical response to heat pain stimuli suggests that VNS had an effect on the sensitivity of the nociceptive system. Patients reported large decreases in pain ratings from the pre-stimulation baseline to the end of the acute study phase, and these changes persisted throughout the remaining study visits. These data suggest that VNS may tune down the pathophysiological processes responsible for central sensitization, thus providing a potential mechanism as to how VNS can reduce widespread musculoskeletal pain in FM. The results of the entire QST battery are currently being prepared as a separate manuscript. Since this is an uncontrolled pilot study, an obvious question is whether this positive therapeutic effect is specific to VNS itself or is a placebo effect secondary to extraneous Pain Med. Author manuscript; available in PMC 2012 September 1.

Lange et al.

Page 7

NIH-PA Author Manuscript

factors related to being in a treatment trial necessitating surgery, feeling a sensory stimulus throughout the day, and having high hopes for a good therapeutic outcome. Some data do exist to show that non-specific [i.e., placebo] effects can last for many months in trials requiring surgery. But studies reporting that outcome were for episodic events – syncope (15) or angina (16) – very different conditions from one with chronic pain. One trial on Parkinsonian patients has been cited as showing a long-lived placebo effect, but not one which improved patients’ neurological impairment or their objective function (17); another with sham surgery for knee pain did produce a 10% reduction in pain over one year (18). Thus, published data indicating a prolonged effect of nonspecific factors in reducing chronic symptoms are sparse. Some evidence for an initial non-specific effect may be seen from the data of one participant, subject #124, who became MCID+ at the end of the acute study but at no time point thereafter. However, the continued improvement over time shown by some patients and the fact that more patients attained outcome criteria over time argues against a nonspecific or placebo explanation for the therapeutic benefit; such an incrementing response has been reported for VNS treatment of refractory epilepsy (19). Nevertheless, a controlled trial is needed to determine the specificity of these effects.

Acknowledgments NIH-PA Author Manuscript

This work was supported by NIH # AR-053732. A patent application for the use of VNS in FM is pending for GL under US Patent Application No. 12/322,741. We thank Dr. Daniel Clauw, a physician expert in FM and FM treatment trials, and Dr. Sandra Helmers, an expert in the use of VNS in epilepsy, for their help in various aspects of this study. We acknowledge the help of Dr. Adam Perlman in patient recruitment and medical decision making and the help of Ms. Kristin Thorsen, editor of the Fibromyalgia Network News, for publicizing the existence of this clinical “proof of concept” trial to the FM community at large and thus aiding in recruitment of participants.

Reference List

NIH-PA Author Manuscript

1. Wolfe F, Ross K, Anderson J, Russell IJ, Hebert L. The prevalence and characteristics of fibromyalgia in the general population. Arthritis Rheum. 1995; 38:19–28. [PubMed: 7818567] 2. Randich A, Gebhart GF. Vagal afferent modulation of nociception. Brain Res Brain Res Rev. 1992; 17:77–99. [PubMed: 1327371] 3. Arnold LM, Goldenberg DL, Stanford SB, Lalonde JK, Sandhu HS, Keck PE Jr. et al. Gabapentin in the treatment of fibromyalgia: a randomized, double-blind, placebo-controlled, multicenter trial. Arthritis Rheum. 2007; 56:1336–1344. [PubMed: 17393438] 4. Russell IJ, Mease PJ, Smith TR, Kajdasz DK, Wohlreich MM, Detke MJ, et al. Efficacy and safety of duloxetine for treatment of fibromyalgia in patients with or without major depressive disorder: Results from a 6-month, randomized, double-blind, placebo-controlled, fixed-dose trial. Pain. 2008; 136:432–444. [PubMed: 18395345] 5. Borckardt JJ, Kozel FA, Anderson B, Walker A, George MS. Vagus nerve stimulation affects pain perception in depressed adults. Pain Res Manag. 2005; 10:9–14. [PubMed: 15782242] 6. Wechsler, D. Wechsler Adult Intelligence Scale - Revised, Manual. New York: Psychological Corporation; 1981. 7. Sheehan DV, Lecrubier Y, Sheehan KH, Amorim P, Janavs J, Weiller E, et al. The MiniInternational Neuropsychiatric Interview (M.I.N.I.): the development and validation of a structured diagnostic psychiatric interview for DSM-IV and ICD-10. J Clin Psychiatry. 1998; 59 Suppl 20:22– 33. [PubMed: 9881538] 8. Wolfe F, Smythe HA, Yunus MB, Bennett RM, Bombardier C, Goldenberg DL, et al. The American College of Rheumatology 1990 criteria for the classification of fibromyalgia: Report of the Multicenter Criteria Committee. Arthritis Rheum. 1990; 33:160–172. [PubMed: 2306288] 9. Okifuji A, Turk DC, Sinclair JD, Starz TW, Marcus DA. A standardized manual tender point survey .I. development and determination of a threshold point for the identification of positive tender points in fibromyalgia syndrome. J Rheumatol. 1997; 24:377–383. [PubMed: 9035000]

Pain Med. Author manuscript; available in PMC 2012 September 1.

Lange et al.

Page 8

NIH-PA Author Manuscript NIH-PA Author Manuscript

10. McHorney CA, Ware JE, Raczek AE. The MOS 36-item short form health survey (SF-36): II. Psychometric and clinical tests of validity in measuring physical and mental health constructs. Med Care. 1993; 31:247–263. [PubMed: 8450681] 11. Margolis RB, Tait RC, Krause SJ. A rating system for use with patient pain drawings. Pain. 1986; 24:57–65. [PubMed: 2937007] 12. Clauw DJ, Mease P, Palmer RH, Gendreau RM, Wang Y. Milnacipran for the treatment of fibromyalgia in adults: a 15-week, multicenter, randomized, double-blind, placebo-controlled, multiple-dose clinical trial. Clin Ther. 2008; 30:1988–2004. [PubMed: 19108787] 13. Cyberonics Inc. Epilepsy Physicians' Manual, Neuro Cybernetic Prosthesis System NCP Pulse Generator, Models 100 and 101. 2002 http://us.cyberonics.com/en/vns-therapy-for-epilepsy/ healthcare-professionals/vns-therapy/manuals-page. 14. Cyberonics Inc.. For Health Care Professionals. Houston TX: 2008. Depression Information. VNS Therapy™ Pulse Generators; p. 23 15. Connolly SJ, Sheldon R, Thorpe KE, Roberts RS, Ellenbogen KA, Wilkoff BL, et al. Pacemaker therapy for prevention of syncope in patients with recurrent severe vasovagal syncope: Second Vasovagal Pacemaker Study (VPS II): a randomized trial. JAMA. 2003; 289:2224–2229. [PubMed: 12734133] 16. Cobb LA, Thomas GI, Dillard DH, Merendno KA, Bruce RA. An evaluation of internalmammary-artery ligation by a double-blind technic. N Engl J Med. 1959; 260:1115–1118. [PubMed: 13657350] 17. McRae C, Cherin E, Yamazaki TG, Diem G, Vo AH, Russell D, et al. Effects of perceived treatment on quality of life and medical outcomes in a double-blind placebo surgery trial. Arch Gen Psychiatry. 2004; 61:412–420. [PubMed: 15066900] 18. Moseley JB, O'Malley K, Petersen NJ, Menke TJ, Brody BA, Kuykendall DH, et al. A controlled trial of arthroscopic surgery for osteoarthritis of the knee. N Engl J Med. 2002; 347:81–88. [PubMed: 12110735] 19. Morris GL III, Mueller WM. Long-term treatment with vagus nerve stimulation in patients with refractory epilepsy. The Vagus Nerve Stimulation Study Group E01-E05. Neurology. 1999; 53:1731–1735. [PubMed: 10563620]

NIH-PA Author Manuscript Pain Med. Author manuscript; available in PMC 2012 September 1.

Lange et al.

Page 9

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

Figure 1.

Mean pain intensity ratings (Âą SEM) across the duration of the study. Data are plotted in months following surgical implantation of VNS.

Pain Med. Author manuscript; available in PMC 2012 September 1.

Lange et al.

Page 10

Table 1

Study participant adverse event profile

NIH-PA Author Manuscript

Observed Surgery Related AEs (N=14)

Mild

Dyspnea

Moderate

Severe

Voice Alteration

Incision pain

Skin irritation

Infection/Fever

Nausea

Neck pain

Sleep difficulties/Insomnia

Surgery-related complications such as upper respiratory infection

Observed Device or Stimulation Related AEs (N=14)

Mild

Agitation/anxiety/panic

Moderate

Severe

Chest pain

NIH-PA Author Manuscript

Device migration

Decreased appetite/weight loss

Dyspepsia

Dysphagia

Dyspnea

Ear pain

Facial pain

Gastritis

Headache

Increased coughing

Mania, hypomania, and related symptoms

Nausea and vomiting

Neck/throat pain

Sleep disturbances/difficulties, including worsening of pre-existing obstructive sleep apnea, insomnia

Tinnitus

NIH-PA Author Manuscript

Tooth pain

Voice alteration

AEs potentially specifically related to Fibromyalgia (N=14)

Mild

Moderate

Surgery related Dry mouth

Fatigue

Headache

Neck numbness

Device and stimulation related Abdominal pain

Pain Med. Author manuscript; available in PMC 2012 September 1.

Severe

Lange et al.

Page 11

Observed Surgery Related AEs (N=14)

Mild

Moderate

Severe

Dry mouth

Excessive production of saliva

Depression worsening

NIH-PA Author Manuscript

Fatigue

Nasal congestion

Neck numbness

Photophobia

NIH-PA Author Manuscript NIH-PA Author Manuscript Pain Med. Author manuscript; available in PMC 2012 September 1.

NIH-PA Author Manuscript

Pain Med. Author manuscript; available in PMC 2012 September 1.

16 (5)

17 (5)

15.5 (5)

18 (5)

13.5 (5)

18 (5)

15 (5)

107

108

111

114

115

117

118

119

121

124

16 (5)

8 (5)

4 (3)

8 (5)

8 (0)

STOP

4 (5)

5 (4)

After 5 Months of Stim.

8 (4)

9 (5)

7 (0)

6 (3)

5 (2)

STOP

1 (1)

10 (5)

After 8 Months of Stim.

13 (5)

9 (4)

6 (0)

3 (3)

7 (3)

EXPLANT

8 (2)

14 (5)

After 11 Months of Stim.

15 (4)

18 (4)

18 (5)

2 (2)

5 (2)

14 (4)

18 (5)

11 (4)

18 (3)

18 (5)

15 (4)

18 (5)

STUDY VIOLATION; EXCLUDED

5 (0)

DEVICE PROBLEM THEN SIDE EFFECTSâ&#x2020;&#x2019; STOP

16 (5)

0 (1)

4 (1)

12 (5)

11 (5)

6 (4)

2 (4)

9 (5)

Acute Study End

Light grey filled cell indicates MCID+ Thick black outlined cell indicates no longer fulfilling EITHER widespread pain OR tenderness criteria for FM Dark grey filled cell indicates patient who at last visit did not fulfill tenderness criterion for FM

18 (5)

106

18 (5)

104

14.5 (5)

12 (5)

102

105

Baseline Average

Efficacy outcome measures: Tender points (# quadrants of Pain) Across the Study

NIH-PA Author Manuscript

Table 2 Lange et al. Page 12

Acta Oto-Laryngologica

ISSN: 0001-6489 (Print) 1651-2251 (Online) Journal homepage: http://www.tandfonline.com/loi/ioto20

Effectiveness of transcutaneous electrical stimulation for chronic tinnitus Sun Kyu Lee, Hoon Chung, Ji Hyun Chung, Seung Gun Yeo, Mun Suh Park & Jae Yong Byun To cite this article: Sun Kyu Lee, Hoon Chung, Ji Hyun Chung, Seung Gun Yeo, Mun Suh Park & Jae Yong Byun (2014) Effectiveness of transcutaneous electrical stimulation for chronic tinnitus, Acta Oto-Laryngologica, 134:2, 159-167 To link to this article: http://dx.doi.org/10.3109/00016489.2013.844854

Published online: 11 Nov 2013.

Submit your article to this journal

Article views: 190

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=ioto20 Download by: [Thomas Lobstein]

Date: 06 November 2015, At: 04:50

Acta Oto-Laryngologica. 2014; 134: 159–167

ORIGINAL ARTICLE

Effectiveness of transcutaneous electrical stimulation for chronic tinnitus

SUN KYU LEE, HOON CHUNG, JI HYUN CHUNG, SEUNG GUN YEO, MUN SUH PARK & JAE YONG BYUN

Downloaded by [Thomas Lobstein] at 04:50 06 November 2015

Department of Otolaryngology – Head and Neck Surgery, College of Medicine, Kyung Hee University, Seoul, Korea

Abstract Conclusion: Based on the Tinnitus Handicap Inventory (THI) and visual analog scale (VAS) scores, transcutaneous electrical stimulation (TENS) can provide relief from tinnitus. Response to electrical stimulation was best seen in patients with lowfrequency tinnitus and with mild hearing loss. Objective: TENS is known to alleviate symptoms of tinnitus. However, study of the effectiveness of TENS for tinnitus has produced variable results, and it is still unclear what kind of patients with tinnitus would respond best to TENS. Here, we assessed the effects of TENS on the perception of tinnitus using the THI and VAS questionnaires. Methods: A total of 65 patients with tinnitus were divided into two groups: 45 patients received TENS and 20 patients received placebo (sham stimulation) twice a week over 4 weeks. THI and VAS scores were assessed before and after electrical stimulation. We also evaluated the effects of TENS on the degree of initial hearing loss and tinnitus frequency. Results: Twenty-eight of 45 patients (62.2%) revealed subjective improvement in tinnitus with TENS. TENS was more effective in patients with low-frequency tinnitus or with mild hearing loss. Symptomatic improvement in the electrical stimulation group was achieved for 1 month in most patients.

Keywords: Hearing loss, Tinnitus Handicap Inventory, THI

Introduction Tinnitus, characterized by the sensation of sound with no apparent source, accompanies a variety of diseases and involves all portions of the auditory pathway ranging from the external ear to the cerebral cortex [1]. Treatment of tinnitus remains challenging as the underlying causes are unknown. As the mechanism for tinnitus continues to undergo study, many treatments such as pharmacotherapy, biofeedback, acoustic masking, and psychotherapy have all been attempted. However, to date, there is no established treatment protocol [2]. Of the various treatments for tinnitus, electrical stimulation represents a unique form of sound therapy first used at least 120 years ago. Volta first attempted electrical stimulation of the inner ear [3], and House et al. reported tinnitus suppression as a beneficial side effect

of cochlear implantation in patients with profound hearing impairment [4]. Suppression of tinnitus by electrical stimulation of the preauricular skin, mastoid, eardrum, promontory, round window, and within the cochlea has been employed since the 1960s and 1970s [3,5,6]. Early results demonstrated that positive polarity was able to suppress tinnitus, and negative polarity produced the sensation of sound. It has been purported that this therapy leads to hyperpolarization of neural fibrils and thus inhibits or reduces the spontaneous firing rate by changing basal membrane potential, presumably due to increased microcirculation of the auditory pathways [7]. The efficacy of transcutaneous electrical stimulation (TENS) has been reported at up to 80%, although rates fluctuate depending on experimental design. Longterm improvements in tinnitus also vary from hours to weeks. TENS represents a noninvasive and simple

Correspondence: Jae Yong Byun MD, Department of Otolaryngology – Head and Neck Surgery, Kyung Hee University Hospital at Gangdong, Sangil-dong, Gangdong-gu, Seoul, Korea, 134-727. E-mail: otorhino512@naver.com

(Received 1 July 2013; accepted 8 September 2013) ISSN 0001-6489 print/ISSN 1651-2251 online 2014 Informa Healthcare DOI: 10.3109/00016489.2013.844854

160

S.K. Lee et al.

method but has limitations given that underlying mechanisms remain uncertain and treatment efﬁcacy is not consistent [8]. The aim of this study was to evaluate the efﬁcacy of TENS on the external pinna in patients with chronic tinnitus and to investigate the features of tinnitus that may impact treatment. Material and methods

Downloaded by [Thomas Lobstein] at 04:50 06 November 2015

Subjects Patients diagnosed with subjective, unilateral tinnitus and followed up for longer than 6 months in KyungHee University Hospital, Gangdong from February 2007 to March 2008 were included in this study. Each patient provided an otologic history and underwent physical examination. Subjects with chronic otitis media, neurological or hormonal disturbances, cerebrovascular disease, treatable forms of tinnitus, or receiving medications or other treatments for tinnitus were excluded. Due to the nature of the proposed treatment, we also excluded patients with any internal electrical device (for example, cardiac pacemakers and metal plates). All subjects had suffered from perceived tinnitus for a minimum of 6 months. Informed consent was obtained from each patient before initiating treatment. In total, 65 patients with chronic, subjective tinnitus were randomized to the treatment arm (electrical stimulation) or to the control arm (sham stimulation), allowing for a prospective, single-blind, randomized control (RCT) study to be conducted. The electrical stimulation group consisted of 45 patients subjected to TENS twice a week for 4 weeks. The sham stimulation group consisted of 20 patients who underwent electrical stimulus attachment but did not receive any stimulus during the same time-frame. During the

electrical stimulation period, no other treatments for tinnitus including medications or psychotherapy were administered. Otologic and audiologic evaluations Patients underwent an otologic history and audiologic evaluation. Tests included audiometry for pure-tone average (PTA), speech reception threshold, and impedance battery. Brainstem audiometry was performed in all patients to exclude retrocochlear lesions. Analysis of tinnitus was accomplished using stimulated sounds from a Norwest SG-1 Tinnitus Synthesizer (GN otometrics, copenhagen, Denmark), with the experimenter adjusting the synthesized frequency and intensity level according to the manufacturer’s instructions. To evaluate the effects of percutaneous electrical stimulation according to hearing levels, patients were divided into five groups (normal, mild, moderate, moderate-severe, and severe) based on average pure-tone threshold (average of responses at 500, 1000, and 2000 Hz) and according to ANSI classification (1969). In addition, to investigate the relationship between tinnitus features and treatment efficacy, patients were divided into a low-frequency tinnitus group (0.25– 2 kHz) and a high-frequency tinnitus group (4–8 kHz) based on the tinnitogram. Electrical stimulation After auricles were cleaned with alcohol, probes were placed at 5 of 13 possible points where electrical resistance was low and conductance of the electrical current was high relative to the surrounding area (Figure 1) [9].

Figure 1. (A) Physiotense device (Physiomed Inc., Germany). (B) Illustration of sites used for transcutaneous electrical stimulation (TENS). In total, 13 points were located by characteristics of low electrical resistance with resulting high electrical current conductance relative to the surrounding area. The stimulus was applied to ﬁve sites that we chose on the auricle of the ear with tinnitus.

Downloaded by [Thomas Lobstein] at 04:50 06 November 2015

TENS for tinnitus Stimulation was performed using the Physiotense (Physiomed Inc., Schnaittach/Laipersdorf, Germany), which generates alternating currents with a frequency of 50 Hz (Figure 1). Current intensity was 15 mA. The device has on/off, pulse-square, frequency, and current intensity buttons. An alternating, pulsed current at low frequency (50 Hz) was used for tinnitus suppression. Hand-held electrodes were placed on the external pinna and stimulation duration was 30 s for each point. In total, therapy sessions for each patient were instituted twice a week for a total of eight therapy sessions over 4 weeks. For the sham stimulation group, the treatment paradigm was identical to the electrical stimulation group except that the power supply was turned off and current was not delivered from the probe. Of note, even in the electrical stimulation group, patients are not able to feel sound vibrations or sense current delivery. Patients were unaware of the treatment group to which they were assigned. Assessment of the severity of tinnitus Patients completed questionnaires including the visual analog scale (VAS) and the Korean adaptation of the Tinnitus Handicap Inventory (THI) [10] both before electrical stimulation and after treatment. Tinnitus severity was assessed via VAS scores for four subgroups: duration, loudness, annoyance, and difficulty in activities of daily life. Patients were asked to rate each item within the subgroup on a scale of 0 to 10 points, with 0 indicating no symptoms and 10 denoting greatest discomfort. THI represents a validated and widely used questionnaire for assessing the impact of tinnitus in daily life. It consists of a 25-item survey that provides a total score and 3 subscale scores (functional, emotional, and catastrophic subscale scores). Each of the 25 items has 3 potential answers with ‘yes’ assigned four points, ‘sometimes’ two points, and ‘no’ zero points. Total scores range from 0 to 100, with 0 being asymptomatic and 100 representing the worst possible symptoms. When pretreatment and post-treatment total THI scores differed by more than 10 points, we defined such interventions as helpful. When pretreatment and post-treatment total THI scores differed by less than 10 points, such interventions were defined as not helpful.

calculation of the sample size. The mean and standard deviation of each arm from key references were used, and we planned this study as an unequal RCT (the ratio of sample Arm2:Arm1 was 2:1) to avoid ethical problems and save time. Statistical analysis was performed with the Statistical Package for Social Science 18.0 (SPSS Inc., Chicago, IL, USA). Because VAS and THI scores are nonparametric values, Wilcoxon signed rank test was performed to analyze the difference between pretreatment and post-treatment. The effect of electrical stimulation, frequency of tinnitus, and coexisting hearing loss was analyzed by multi-way analysis of variance (ANOVA). For all analyses, p values < 0.05 were considered statistically significant. Results In total, 65 patients with chronic tinnitus (39 males and 26 females; average age 46.2 ± 13.9 years) participated in the study. The duration of tinnitus ranged from 3 months to 8 years (median duration 24.44 ± 19.79 months). Demographic and clinical characteristics of both the electrical stimulation and sham stimulation groups are shown in Table I. Based on pretreatment and post-treatment changes in THI scores, 28 patients (62.2%) from the electrical stimulation group received helpful benefits, whereas only two patients (10%) from the sham stimulation group were satisfied (Table II). Comparison of VAS scores and THI scores in electrical stimulation and sham stimulation groups In the electrical stimulation group, VAS scores demonstrated statistically significant improvements in all subscales. VAS scores for duration declined from 6.9 (pretreatment) to 5.6 (post-treatment). VAS scores for loudness were 6.7 (pretreatment) and 5.8 (post-treatment), and for annoyance were reduced from 6.7 (pretreatment) to 5.4 (post-

Table I. Clinical characteristics of the study patients. Electrical stimulation group

Sham stimulation group

Sex (M:F)

26:19

13:7

Age (years)

46.6 ± 13.9

45.6 ± 11.5

20:25

8:12

38.1 ± 6.4

36.4 ± 5.2

Characteristic

Statistical analysis When we designed this study, we obtained an appropriate sample size by using the SAS 9.3 program. We applied an alpha value of 0.05, power of 0.80, and a two-sided condition as an analytic parameter for

161

Side of tinnitus (right:left) Hearing level of the side with tinnitus (dB)

162

S.K. Lee et al.

Table II. Performance rating of electrical stimulation for tinnitus according to the Tinnitus Handicap Inventory (THI) score. Group

Helpful, n (%)

Not helpful, n (%)

Transcutaneous electrical stimulation (n = 45)

28 (62.2)

17 (37.8)

Sham stimulation (n = 20)

2 (10.0)

18 (90.0)

Downloaded by [Thomas Lobstein] at 04:50 06 November 2015

Helpful: THI beneﬁt (pretreatment – post-treatment) score is more than 10 points. Not helpful: THI beneﬁt (pretreatment – posttreatment) score is less than 10 points.

treatment). Pretreatment and post-treatment VAS scores for difficulty in activities of daily life were 6.8 and 5.4, respectively. In the sham stimulation group, pretreatment VAS scores for duration, loudness, annoyance, and difficulty in activities of daily life were 6.5, 6.2, 6.5, and 6.6, respectively. Following sham electrical stimulation, VAS scores decreased to 6.1, 5.6, 5.7, and 6.5, respectively. There were no significant differences between pretreatment and post-treatment VAS scores (Table III). Baseline mean THI scores were 49.4 for the electrical stimulation group and 44.5 for the sham stimulation group. Man–Whitney U test determined that baseline means were not significantly different (p > 0.05). Following treatment, the mean THI score significantly decreased to 42.8 in the electrical

stimulation group. In the sham stimulation group, the mean THI score increased to 45.2, but no significant difference was identified. After electrical stimulation, emotional and catastrophic subscales of THI significantly improved. In the sham stimulation group, functional subscale scores significantly increased and there was no significant change of score for other subscales (Table III).

Relationship between frequency of tinnitus, degree of hearing disturbance, and treatment effect of electrical stimulation In the electrical stimulation group, patients were divided into two subgroups based on the distribution of tinnitus frequency, with 25 patients having lowfrequency tinnitus (0.25–2 kHz) and 20 patients having high-frequency tinnitus (4–8 kHz). To analyze the relationship between tinnitus frequency and electrical stimulation efﬁcacy, changes in THI and VAS scores were assessed. In the electrical stimulation group with lowfrequency tinnitus, the pretreatment VAS score for duration was 7.4 and the post-treatment score was 3.8. VAS scores for loudness reduced from 6.7 to 5.1 following treatment, and VAS scores for annoyance reduced from 6.5 to 5.0 with treatment. VAS scores for difﬁculty in activities of daily living decreased from

Table III. Comparison of changes in visual analog scale (VAS) score and tinnitus handicap inventory (THI) score between electrical stimulation and sham stimulation. Assessment VAS

THI

Subscale

Group

Prestimulation

Post-stimulation

p value

Duration

TENS

6.9 ± 1.6

5.6 ± 2.1

< 0.05*

Sham

6.5 ± 1.2

6.1 ± 1.5

> 0.05

Loudness

TENS

6.7 ± 1.7

5.8 ± 1.9

< 0.05*

Sham

6.2 ± 1.9

5.6 ± 1.6

> 0.05

Annoyance

TENS

6.7 ± 1.5

5.4 ± 2.2

< 0.05*

Sham

6.5 ± 1.7

5.7 ± 2.2

> 0.05

Difﬁculty in activities of daily life

TENS

6.8 ± 1.9

5.4 ± 1.9

< 0.05*

Sham

6.6 ± 1.7

6.5 ± 1.3

> 0.05

Functional

TENS

46.3 ± 20.7

45.4 ± 15.9

> 0.05

Sham

43.8 ± 13.1

49.5 ± 11.7

< 0.05*

Emotional

TENS

50.2 ± 21.5

31.9 ± 17.3

< 0.05*

Sham

42.1 ± 15.6

40.5 ± 15.5

> 0.05

Catastrophic

TENS

51.6 ± 21.7

37.4 ± 16.1

< 0.05*

Sham

47.7 ± 13.9

46.2 ± 13.3

> 0.05

TENS

49.4 ± 9.9

42.8 ± 8.7

< 0.05*

Sham

44.5 ± 6.5

45.2 ± 7.9

> 0.05

Total

Results are given as mean ± standard deviation. TENS, transcutaneous electrical stimulation. *p < 0.05.

TENS for tinnitus

163

Table IV. Treatment results according to tinnitus frequency. Low-frequency tinnitus Assessment

Subscale

Visual analog scale Duration

Loudness

Annoyance

Group Prestimulation Post-stimulation p value

Downloaded by [Thomas Lobstein] at 04:50 06 November 2015

Prestimulation Post-stimulation p value

TENS

7.4 ± 1.7

3.8 ± 1.5

< 0.05*

6.5 ±1.2

6.0 ± 1.3

> 0.05

Sham

5.7 ± 1.2

5.4 ± 1.7

> 0.05

7.0 ± 1.0

6.5 ± 1.3

> 0.05

TENS

6.7 ± 1.5

5.1 ± 1.9

< 0.05*

7.2 ± 1.4

7.0 ± 1.1

> 0.05

Sham

6.3 ± 2.2

5.4 ± 1.7

> 0.05

7.1 ± 1.8

6.7 ± 1.7

> 0.05

TENS

6.5 ± 1.5

5.0 ± 2.2

< 0.05*

7.1 ± 1.7

5.8 ± 1.5

< 0.05*

Sham

6.4 ± 2.1

6.5 ± 1.2

> 0.05

6.5 ± 1.6

6.2 ± 2.5

> 0.05

6.6 ± 1.9

5.3 ± 1.9

< 0.05*

7.1 ± 1.1

5.7 ± 1.7

< 0.05*

Difﬁculty in activities TENS of daily life Sham Tinnitus Handicap Functional Inventory

High-frequency tinnitus

TENS

7.2 ± 2.0

7.0 ± 1.1

> 0.05

7.2 ± 1.5

6.2 ± 1.4

> 0.05

49.4 ± 20.7

47.0 ± 17.4

< 0.05*

47.9 ± 13.0

45.0 ± 12.1

> 0.05

Sham

42.0 ± 17.0

43.8 ± 13.8

> 0.05

44.8 ± 11.1

51.8 ± 9.9

< 0.05*

Emotional

TENS

54.4 ± 21.7

28.7 ± 15.2

< 0.05*

45.9 ± 14.7

32.2 ± 12.3

< 0.05*

Sham

51.5 ± 17.6

48.4 ± 15.5

> 0.05

42.4 ± 15.2

41.6 ± 16.1

> 0.05

Catastrophic

TENS

53.5 ± 20.5

38.0 ± 17.3

< 0.05*

49.5 ± 17.5

35.5 ± 13.2

< 0.05*

Sham

53.7 ± 16.7

48.7 ± 16.7

> 0.05

49.8 ± 12.4

44.8 ± 11.6

> 0.05

Total

TENS

51.8 ± 10.1

39.9 ± 9.1

< 0.05*

47.7 ± 11.4

37.1 ± 9.8

> 0.05

Sham

52.4 ± 16.7

53.6 ± 10.4

> 0.05

45.7 ± 5.8

46.1 ± 6.5

> 0.05

Results are given as mean ± standard deviation. TENS, transcutaneous electrical stimulation. *p < 0.05.

6.6 to 5.3 after treatment. All changes in VAS scores were statistically significant (p < 0.05). For THI scores, whole subscales showed significant improvement after treatment and total THI scores also decreased significantly after treatment (Table IV). In the electrical stimulation group with highfrequency tinnitus, VAS scores for all subscales improved following electrical stimulation, but only two items – annoyance and difficulty in activities of daily life – exhibited statistically significant decreases. Mean total THI score changed from 47.7 to 37.1 with treatment. Functional subscale score decreased from 47.9 to 45.0, emotional stress score changed from 45.9 to 32.2, and catastrophic subscale score decreased from 49.5 to 35.5. All THI scores decreased, but only improvements in emotional stress and catastrophic subscales were statistically significant (Table IV). To analyze the association between degree of hearing disturbance and effect of electrical stimulation, patients in the electrical stimulation group were divided into five subgroups of hearing disturbance: normal, mild, moderate, moderately severe, and severe, according to ISO classification. VAS and THI scores before and after electrical stimulation were calculated. Clinical improvement following treatment for all five hearing level subgroups was compared. In the normal-hearing level group, all VAS subscales and THI scores showed significant improvements. The mild hearing disturbance

group also showed statistically significant improvements inallsubscalesexceptVASscorefordifficultyinactivities of daily life. However, in the severe hearing disturbance group, only the VAS score for difficulty in activities of daily life decreased significantly (Figures 2 and 3). The degree of hearing disturbance and frequency of tinnitus were analyzed simultaneously with multi-way ANOVA, and the statistical value of the difference in the VAS and THI scores according to treatment was compared. The actual therapeutic effect of electrical stimulation on the frequency of tinnitus and degree of hearing disturbance was analyzed with multi-way ANOVA. The interactions among the three variables (treatment arm, frequency of tinnitus, and degree of hearing disturbance) with the changes in the VAS and THI scores were not significant (treatment arm – frequency of tinnitus: p = 0.770, p = 0.070; treatment arm – degree of hearing disturbance: p = 0.395, p = 0.822; frequency of tinnitus – degree of hearing disturbance: p = 0.542, p = 0.860). With multi-way ANOVA, changes in the VAS and THI scores were significantly different between electrical stimulation and sham stimulation (p = 0.046, p = 0.017), and changes in the THI scores between patients with lowand high-frequency tinnitus were significantly different (p = 0.048). Moreover, the change in the THI score was significant according to the degree of hearing disturbance (p = 0.048) (Table V).

164

S.K. Lee et al. 10 10 *

Pre Post

4 2

ML Mod MS Change of awareness

ML Mod MS Change of loudness

10 * *

Pre Post

VAS score

Pre Post

0 NL

Downloaded by [Thomas Lobstein] at 04:50 06 November 2015

VAS score

Pre Post

4 2

0 NL

ML Mod MS Change of annoyance

ML Mod MS Change of effect on life

Figure 2. Change in visual analog scale (VAS) score according to degree of hearing disturbance following electrical stimulation. ML, mild; Mod, moderate; MS, moderate-severe; NL, normal; Pre, pretreatment; Post, after treatment; Se, severe. *p < 0.05.

Considering the results of the study, actual TENS, low-frequency tinnitus, and normal hearing/mild hearing disturbance were associated with signiﬁcant changes in the THI score.

Improvement in duration of tinnitus after electrical stimulation Duration of tinnitus suppression varied from a few hours to several months. To summarize, 14 patients (31%) received symptomatic relief for less than 1 week and 16 patients (36%) had beneﬁts lasting less than 1 month. Only two patients (4%) had effects lasting longer than 3 months – of note, these two patients had low-frequency tinnitus and mild hearing loss.

Side effects of TENS Mild side effects were seen in eight patients including four patients with dizziness, three patients with headache, and one patient with facial numbness. However, side effects dissipated after cessation of treatment.

Discussion The use of electrical currents to alter physiologic responses has been recognized since the 1800s, and electrical stimulation has been used to treat inflammation, pain, edema, joint dysfunction, and spinal disorders [11,12]. Electrical stimulation for the treatment of tinnitus remains an intriguing therapeutic option. Interestingly, reduction in tinnitus symptoms has been reported as a beneficial side effect following cochlear implantation [4]. In 1977, Graham and Hazell [5] demonstrated tinnitus suppression in two of nine patients via transtympanic stimulation of the promontory with alternating currents. In 1979, Portmann et al. [13] reported an 87% success rate of temporary suppression of tinnitus by electrical stimulation. TENS for tinnitus was reported by Chouard et al. [14] in 1981, with greater than onethird of patients experiencing significant reduction in tinnitus symptoms. Engelberg and Bauer [9] in 1985 reported an 82% improvement in tinnitus symptoms with TENS in a sample of 20 patients. Recent evidence demonstrated a success rate of roughly 50% in 500 patients with tinnitus of varying etiology using electrical stimulation [8]. However, given the

165

TENS for tinnitus 100

100

* Pre Post

THI score

ML Mod MS Functional subscale

Pre Post

100

ML Mod MS Se Emotional subscale

100

80 *

Pre Post

40 20

THI score

* THI score

0 NL

Downloaded by [Thomas Lobstein] at 04:50 06 November 2015

* 60

* Pre Post

* 40 20

0 NL

ML Mod MS Se Catastrophic subscale

Mod Total THI

Figure 3. Change in Tinnitus Handicap Inventory (THI) score according to degree of hearing disturbance following electrical stimulation. ML, mild; Mod, moderate; MS, moderate-severe; NL, normal; Pre, pretreatment; Post, after treatment; Se, severe. *p < 0.05.

subjective nature of tinnitus, evaluation of treatment efficacy remains difficult. In this study, we evaluated the efficacy of TENS in the management of tinnitus through the use of VAS and THI questionnaires – validated and widely used methods for assessing the impact of tinnitus on daily life. Not surprisingly, conflicting results of electrical therapy for tinnitus have been reported, as many Table V. Statistical value of change in visual analog scale (VAS) score and Tinnitus Handicap Inventory (THI) score analyzed by multi-way ANOVA. p value Change in VAS score

Change in THI score

TENS vs sham procedure

0.046*

0.017*

Low-frequency tinnitus vs high-frequency tinnitus

0.219

0.048*

Degree of hearing disturbance

0.492

0.049*

Factor

*p < 0.05.

factors can inﬂuence treatment efﬁcacy including currency of the electrical stimulation and location of stimulation [15]. Currency of the electrical stimulation may be important; however, no clear superiority between direct and alternating currents on tinnitus suppression has emerged. While direct current seems more effective in cochlear stimulation, this method of electrical stimulation should only be employed in patients with severe hearing loss due to the possibility of cochlear damage. Hazell et al. [16] demonstrated that electrical suppression of tinnitus is frequency dependent, with low-frequency stimuli being more effective. The authors concluded that frequency characteristics of tinnitus suppression and auditory discomfort are divergent phenomena at low frequencies, and frequencies higher than 100 Hz should be avoided. The application site of electrical stimulation remains a topic for continued study. Some evidence indicates that electrical stimulation should be administered close to cochlear neurons. Kuk et al. [17]

Downloaded by [Thomas Lobstein] at 04:50 06 November 2015

166

S.K. Lee et al.

reported a reduction in tinnitus in 50% of patients using alternating current via the eardrum. Vernon and Fenwick [18] used preauricular and postauricular electrical suppression of tinnitus in 50 patients and found decreases in tinnitus intensity in 28% of patients as compared with only 2% of patients receiving placebo stimulation. Similarly, in a large caseseries, Steenerson and Cronin [8] used preauricular stimulation and reported a 53% success rate in tinnitus reduction. Based on the aforementioned results, we used a stimulator that generates an alternating current with a frequency of 50 Hz, a level that has previously been reported as most effective for tinnitus suppression. Current intensity was 15 mA, and there were no complications. The placebo effect is often difficult to assess; however, in the present study, electrical stimulation was inaudible and produced no sensation, allowing for blind testing. In addition, we analyzed several variables between the electrical stimulation group and the sham stimulation group. There were no significant differences between the two groups; therefore, we believe that sham stimulation played a role as a true control. As expected, the number of patients who benefited from therapy was higher in the electrical stimulation group than in the sham testing group. We also evaluated the relationships among treatment efficacy, hearing level, and tinnitus frequency. Here, patients with low-frequency tinnitus were more susceptible to electrical stimulation. It has been demonstrated previously that outer hair cell motility increases in response to electrical stimulation. Electrically stimulated outer hair cells can provide inputs to the basilar membrane that, in turn, can excite inner hair cells and elicit synaptically mediated long-latency responses of the auditory nerve and main superior olivary nuclei [19]. According to the tonotopicity of the superior olivary complex, hair cells that respond to low frequency are located ventrolaterally, and hair cells that respond to high frequency are found dorsomedially [20]. Following transcutaneous stimulation, hair cells located more laterally could react faster than at other sites. Therefore, patients with lowfrequency tinnitus may experience better therapeutic effects. Our results suggest that TENS can be effective for tinnitus of various hearing levels as the degree of tinnitus suppression was not significantly different between hearing levels. The site of and mechanism by which electrical stimulation produces tinnitus relief remain unclear. Further research is necessary to determine optimal conditions for electrical stimulation in treating tinnitus.

Conclusions Approximately 62% of patients suffering from tinnitus experience considerable symptomatic relief following TENS. While tinnitus does not completely dissipate, distressing features of tinnitus often disappear with electrical stimulation. Electrical stimulation appears more effective in patients with low-frequency tinnitus or mild hearing loss. Electrotherapy can be repeated without notable risks. Large-scale application of this treatment modality may be helpful to better characterize the underlying mechanisms of tinnitus. Declaration of interest: The authors report no conﬂicts of interest. The authors alone are responsible for the content and writing of the paper.

References [1] Kaada B, Hognestad S, Havstad J. Transcutaneous nerve stimulation (TNS) in tinnitus. Scand Audiol 1989;18:211– 17. [2] Goodey R. Tinnitus treatment: state of the art. Prog Brain Res 2007;166:237–46. [3] Cazals Y, Negrevergne M, Aran JM. Electrical stimulation of the cochlea in man: hearing induction and tinnitus suppression. J Am Audiol Soc 1978;3:209–13. [4] House WF, Berliner KI, Crary WG. Cochlear implants. Ann Otol Rhinol Laryngol 1976;85:1–93. [5] Graham JM, Hazell JWP. Electrical stimulation of the human cochlea using a transtympanic electrode. Br J Audiol 1977; 11:59–62. [6] Aran JM, Wu ZY, Charle de Sauvage R, Cazals Y, Portmann M. Electrical stimulation of the ear: experimental studies. Ann Otol Rhinol Laryngol 1983;92:614–20. [7] Konopka W, Zalewski P, Olszewski J, Olszewska-Ziaber A, Pietkiewicz P. Tinnitus suppression by electrical promontory stimulation in patients with sensorineural hearing loss. Auris Nasus Larynx 2001;28:35–40. [8] Steenerson RL, Cronin GW. Treatment of tinnitus with electrical stimulation. Otolaryngol Head Neck Surg 1999; 121:511–13. [9] Engelberg M, Bauer W. Transcutaneous electrical stimulation for tinnitus. Laryngoscope 1985;95:1167–73. [10] Kim JH, Lee SY, Kim CH, Lim SL, Shin JN, Chung WH, et al. Reliability and validity of a Korean adaptation of the Tinnitus Handicap Inventory. Korean J Otolaryngol-Head Neck Surg 2002;45:328–34. [11] Gault WR, Gatens PF. Use of low intensity direct current in management of ischemic skin ulcers. Phys Ther 1976;56: 265–7. [12] Bowman BR, Baker LL, Waters RL. Positional feedback and electrical stimulation: an automated treatment for the hemiplegic wrist. Arch Phys Med Rehab 1979;60:497–9. [13] Portmann M, Cazals Y, Negrevergne M, Aran JM. Temporary tinnitus suppression in man through electrical stimulation of the cochlea. Acta Otolaryngol 1979;87:294–9. [14] Chouard CH, Meyer B, Maridat D. Transcutaneous electrotherapy for severe tinnitus. Acta Otolaryngol 1981;91: 415–22.

TENS for tinnitus

Downloaded by [Thomas Lobstein] at 04:50 06 November 2015

[15] Rubinstein JT, Tyler RS. 2004. Electrical suppression of tinnitus. In Snow JB Jr, editor. Tinnitus: theory and management. Lewiston, NY: BC Decker. p 326–35. [16] Hazell JW, Jastreboff PJ, Meerton LE, Conway MJ. Electrical tinnitus suppression: frequency dependence of effects. Audiology 1993;32:68–77. [17] Kuk FK, Tyler RS, Rustand N, Harker LA, Tye-Murray N. Alternating current at the eardrum for tinnitus reduction. J Speech Hear Res 1989;32:393–400.

167

[18] Vernon JA, Fenwick JA. Attempts to suppress tinnitus with transcutaneous electrical stimulation. Otolaryngol Head Neck Surg 1985;93:385–9. [19] Cevette MJ, Cocco D, Pradhan GN, Galea AM, Wagner LS, Oakley SR, et al. The effect of galvanic vestibular stimulation on distortion product otoacoustic emissions. J Vestib Res 2012;22:17–25. [20] Cooper NP, Rhode WS. Basilar membrane tonotopicity in the hook region of the cat cochlea. Hear Res 1992;63:191–6.

International Tinnitus Journal, Vol. 15, No. 1, 100–106 (2009)

Transtympanic Electrical Stimulation for Immediate and Long-Term Tinnitus Suppression Walter Di Nardo, Francesca Cianfrone, Alessandro Scorpecci, Italo Cantore, Sara Giannantonio, and Gaetano Paludetti Institute of Otorhinolaryngology, Catholic University of the Sacred Heart, A. Gemelli University Hospital, Rome, Italy

Abstract: Tinnitus is a common symptom which often becomes disabling, affecting the emotional and psychosocial dimensions of life. There are many reports describing tinnitus suppression or attenuation through electrical stimulation of the ear, provided either by cochlear implants or by transtympanic stimulation. Our study project aims to assess the effects of electrical promontory stimulation (EPS) on persistent disabling tinnitus.We enrolled 11 patients affected by postlingual monoaural or binaural profound hearing loss and disabling tinnitus in the worse ear. EPS was performed with direct continuous positive current delivered by an active platinum-iridium needle electrode connected to a promontory stimulator device. The short-term effect on tinnitus was assessed during and immediately after the stimulation. Longterm effects were estimated after one month by comparing pre- and post-EPS Tinnitus Handicap Inventory (THI) scores. Immediately after EPS, five patients (45.4%) reported complete suppression and four (36.4%) reported attenuation of tinnitus. Two patients (18.2%) said it was unchanged. After one month, the THI score was reduced in five patients (45.4%) and remained unchanged in the other six patients (54.6%). The beneficial effects of EPS on tinnitus might be explained by interference with tinnitus generating circuits such as the dorsal cochlear nucleus and the inferior colliculus and by modification of cortical activity. EPS is to be considered a worthwhile attempt at tinnitus suppression, and could help select candidates for the positioning of an implantable electrical stimulator that might provide longer-term beneficial effect on tinnitus. Key Words: electrical stimulation; promontory; tinnitus; treatment

innitus is a quite common symptom, not infrequently reported by patients as a bothersome and upsetting experience severely affecting the emotional and psychosocial dimensions of life and sometimes impairing the patients’ ability to perform daily life activities. Etiological factors and neural mechanisms for tinnitus remain challenging topics. As reported by basic and clinical research, lesions are more often localized within the auditory periphery and concern hairy cells. The subsequent change in the acoustic nerve ﬁber excitation pattern triggers an immediately

Reprint requests: Alessandro Scorpecci, MD, Institute of Otorhinolaryngology, Catholic University of the Sacred Heart, A. Gemelli University Hospital, Largo F.Vito 1, 00168, Rome, Italy. E-mail: alessandroscorpecci@ virgilio.it

100

successive elaboration by neural centers and then, after some time, the priming of neural plasticity phenomena. Therefore, tinnitus could be due to central nervous system reorganization as a long-term consequence of a peripheral alteration [1,2]. To date, only a few effective tinnitus treatments are available. Many studies have described attempts at suppressing tinnitus by means of electrical stimulation, delivered both transcutaneously [3–9] and transtympanically [10–12]. Recently, attempts have been made at relieving chronic intractable tinnitus by delivering electrical stimuli directly to the auditory cortex [13,14]. Nonetheless, given the invasiveness of cortical stimulation and the uncertainty of its beneﬁcial effect on tinnitus, and also considering the as-yet-undeﬁned criteria of patient selection for such a treatment option, we believe that electrical promontory stimulation (EPS) still

Transtympanic Electrical Stimulation for Tinnitus Suppression

deserves attention on account of its good rate of success and of its low invasiveness. Furthermore, the assumption that peripheral stimulation can effectively achieve tinnitus suppression is strengthened by the common observation that sensorineurally deaf patients undergoing cochlear implantation often experience reduction or even utter suppression of their tinnitus [15–18]. Our study project aims to assess the effectiveness of EPS as a treatment of persistent tinnitus induced by cochlear lesions and to try to deﬁne the most effective electrostimulation type.

MATERIALS AND PATIENTS Our methods for patient enrollment, informed consent, psychoacoustic testing, placement of a transtympanic electrode, electrical stimulation, data analysis, and follow-up were reviewed and approved by our institutional review board and are in accordance with the Helsinki Declaration. In our clinic, we enrolled 11 patients (7 women and 4 men) affected by postlingual monaural or binaural profound hearing loss and with severe and disabling tinnitus in the worse ear. Each of the patients had been suffering from tinnitus for at least 1 year. The patients’ ages ranged between 34 and 64. We obtained from each patient a complete history and ear, nose, and throat physical examination. In particular, we focused on tinnitus features, such as day, month, and year in which it started; type and characteristics of sound; loudness as represented on a visual analog scale; and the way it affected common daily life activities, sleep, and emotions. Eventually, each patient was asked about tinnitus or hearing loss (or both) in his or her family. We performed a complete audiological assessment (pure-tone audiometry, speech audiometry, and transitory evoked otoacoustic emissions) and a study of tinnitus pitch, loudness, and minimum masking level (MML) on the day of the EPS session. When the hearing loss was gradual in onset, patients underwent auditory brainstem response (ABR) recordings before their deafness became profound, and results were consistent with a peripheral origin of their disease. In other cases, we used ABR to exclude anomalies of the contralateral ear and malingering. Furthermore, to exclude the most common central causes of tinnitus (acoustic neuroma, vascular lesion, neurovascular conﬂict), all patients underwent brain magnetic resonance imaging with gadolinium. Overall, the test battery suggested a cochlear origin of tinnitus in all patients. Finally, immediately before EPS and 1 month afterward, we had the study subjects complete the Tinnitus Handicap Inventory (THI), a 25-question test dealing with the social and neuro-

International Tinnitus Journal, Vol. 15, No. 1, 2009

psychological consequences of tinnitus (e.g., disabilities, emotional reactions to the symptom, difficulty in concentrating). The questionnaire was introduced into the tinnitus assessment battery in order to give the clinician a quick and effective tool for evaluating tinnitus and for classifying patients clinically [19]. THI has been validated worldwide and can be completed by patients in a very short time. The stimulation system we used is a Cochlear Promontory Stimulator Z10012 (Cochlear Ltd., Lane Cove, NSW, Australia), an active platinum-iridium needle electrode and a silver surface electrode located on the ipsilateral mastoid region. The anesthetic procedures consisted in careful cleansing of the external auditory canal and local administration of lidocaine to anesthetize the tympanic membrane for 5 minutes. We performed transtympanic electrical stimulation with direct continuous positive current at levels ranging from 0 to 500 A. Pulse rates available were 50, 100, 200, 400, 800, and 1,600 Hz. We started by delivering current at the lowest pulse rate (50 Hz) and proceeded to increase the pulse rate. For each presented frequency of stimulation, current intensity was slowly increased to find threshold first and then the discomfort level, and we asked patients about the effect of stimulation on tinnitus. Having learned from the patients the frequency causing the best tinnitus suppression, we delivered continuous stimulation at that frequency for at least 60 seconds. At the end of the procedure, we asked patients whether tinnitus was still present or had abated or disappeared.

RESULTS Characteristics of the study population, including age, cause of hearing loss, and duration of tinnitus, are shown in Table 1; tinnitus pitch, loudness, and MML as measured immediately before the electrical stimulation Table 1. Characteristics of the Study Population Age (yr)

Cause of Hearing Loss

Duration of Tinnitus (yr)

1 2 3 4 5 6 7 8 9 10

73 34 44 50 57 60 62 48 32 52

2 16 2 4 1 3 17 20 12 2

Idiopathic Genetic Sudden hearing loss Sudden hearing loss Sudden hearing loss Sudden hearing loss Idiopathic Idiopathic Idiopathic Iatrogenic (stapedotomy complication) Autoimmune

Patient

101

International Tinnitus Journal, Vol. 15, No. 1, 2009

Di Nardo et al.

Table 2. Tinnitus Pitch, Loudness, and MML in the Study Patients Immediately Preceding Electrical Stimulation Pitch (Hz)

Loudness (dB HL)

MML (dB HL)

4,000 1,000 8,000 and 1,000 250 and 3,000 125 1,000 and 3,000 250 250 250 250 4,000

50 60 60 70 and 90 75 65 60 80 80 70 60

60 70 60 90 80 75 70 NM 90 90 65

Patient 1 2 3 4 5 6 7 8 9 10 11

MML minimum masking level; NM not masked by any intensity of sound stimulus.

session are shown in Table 2. Table 3 lists data concerning the modalities and the effects of EPS, such as pulse rate of the delivered stimulus, threshold, discomfort level, and best tinnitus-suppressing frequencies for each patient. Overall tinnitus evaluation immediately after EPS showed that ďŹ ve patients (45.4%) reported complete suppression of tinnitus, four (36.4%) reported tinnitus attenuation, and two (18.2%) said it was unchanged; no one reported tinnitus worsening. On the whole, 9 of the 11 patients (81.8%) had immediate beneďŹ t from EPS relative to their tinnitus. The most effective frequencies of electrical stimulation for tinnitus suppression or reduction were 50 Hz and 100 Hz. For lower frequencies of stimulation, electrical intensity for tinnitus suppression or attenuation was just above auditory threshold, whereas for high frequencies of stimulation, it was quite near maximum acceptable

Table 3. Effects of Electrical Promontory Stimulation on Tinnitus Pulse Rate Discomfort of Stimulus Threshold Level Patient (Hz) ( A) ( A) 1

50 100

Effective Pulse Rates and Intensities*

150 200

250 250

50 and 100 Hz at threshold

50 100 200 400 800 1,600

40 40 60 No sound No sound No sound

70 80 80 130 70 70

Tinnitus unchanged

50 100 200 400 800 1,600

70 300 No sound No sound No sound No sound

350 350 500 500 500 500

50 and 100 Hz; 300 A, 200, 400, 800 Hz; 400 A (for both tinnitus components)

50 100 200 400 800 1,600

80 220 90 No sound No sound No sound

80 300 500 500 500 500

50 Hz, 80 A (250 Hz component of tinnitus) 3,000 Hz component unchanged

50 100 200 400 800 1,600

70 400 No sound No sound No sound No sound

250 500 500 500 500 500

Tinnitus unchanged

50 100 200 400 800 1,600

36 20 15 No sound No sound No sound

75 68 80 80 80 80

50, 100, 200 Hz; 60 A

Pulse Rate Discomfort of Stimulus Threshold Level Patient (Hz) ( A) ( A)

Effective Pulse Rates and Intensities*

50 100 200 400 800 1,600

225 150 200 No sound No sound No sound

380 250 250 250 250 250

50 Hz, 300 A 100 Hz, 200 A 200 Hz, 200 A

50 100 200 400 800 1,600

370 No sound No sound No sound No sound No sound

500 500 500 500 500 500

50 Hz, 440 A (3,000 Hz component of tinnitus) 1,000 Hz component unchanged

50 100 200 400 800 1,600

80 230 No sound No sound No sound No sound

270 390 700 850 900 900

50, 100 Hz, 230 A 200 Hz, 400 A

50 100 200 400 800 1,600

215 250 250 250 250 No sound

400 400 500 500 500 500

800 Hz, 300 A

50 100 200 400 800 1,600

30 70 220 No sound No sound No sound

120 140 220 220 220 220

50, 100 Hz; 100 A

* Describes the most effective tinnitus-suppressing pulse rates, with the respective intensity of stimulation. Patient 1 could be stimulated only with 50-Hz and 100-Hz pulse rates, because other pulse rates gave him painful sensations.

102

Transtympanic Electrical Stimulation for Tinnitus Suppression

International Tinnitus Journal, Vol. 15, No. 1, 2009

DISCUSSION

level in the majority of patients. Remarkably, three patients reported tinnitus attenuation with subthreshold stimulation (i.e., stimulation with a pulse rate that did not elicit any sounds). Three patients (patients 3, 4, and 8) had a double tinnitus. In these cases, the effect of EPS was considered separately for the two components. Patient 3 reported suppression of both tinnitus components, whereas patients 4 and 8 said that only one of the components had been reduced or suppressed, the other one remaining unchanged (see Table 3). After 1 month, among the eight patients who had benefited from EPS, five (45.4%) said their tinnitus was still present but that its intensity was much lower than before. The remaining six patients (54.6%) reported that tinnitus was unchanged or had progressively returned to its former loudness. No patient reported tinnitus worsening. Evaluation of the emotional, affective, and psychosocial impact of tinnitus performed through the THI showed the following: THI reduction in five patients (45.4%) and THI unchanged in the remaining six patients (54.6%). THI scores obtained immediately before and 1 month after EPS are shown in Table 4, which also provides information about pre- and poststimulation partial scores relative to the three categories (emotional, functional, and catastrophic) comprising the THI. No association was found among tinnitus pitch and loudness, MML, and effect of electrical stimulation. Conversely, factors such as tinnitus duration and patient’s age appear to be associated with the THI outcome: Four of the six patients having had tinnitus for less than 5 years had a complete or partial benefit from the procedure, whereas only one of five patients with more than 5 years of tinnitus showed a THI score reduction after 1 month. As for patients’ age, four of the five subjects reporting longer-lasting benefit from the procedure were younger than 50 years. Finally, there seemed to be no association between the cause of hearing loss and the benefits derived from EPS.

The effectiveness of electrical stimulation on tinnitus is well-known, thanks to studies on groups of patients affected by bilateral profound sensorineural hearing loss and undergoing cochlear implantation, the majority of whom report suppression or attenuation of tinnitus after device hookup [15–18]. Our short-term and long-term results are consistent both with the evidence provided by such studies on cochlear implants and with recent works on transtympanic electrical stimulation [20–22].

Mechanisms Underlying the Immediate Effects of EPS on Tinnitus Despite the remarkable amount of evidence pointing to a beneficial and lasting effect of EPS on tinnitus, studies generally describe the clinical effects of the procedure rather than focusing on the mechanisms underlying tinnitus suppression, so that at present there are many questions—and no certainty—as to how EPS should work. The “masking” hypothesis, which was among the earliest proposed [23], has long been considered too simplistic and insufficient, because in some cases tinnitus reduction can be obtained by means of subliminal electrical pulse rates. Consistent with reports by Rubinstein et al. [20] and Okusa et al. [22], our results indicate that in two patients (patients 3 and 9), suppression of tinnitus occurred at a pulse rate and at an intensity of stimulation that did not elicit any sound sensations (see Table 3). So, even if a role for masking cannot be completely ruled out, it appears that other mechanisms play a role. One of the theories about peripheral tinnitus suggests that its origin lies in an alteration of spontaneous firing by acoustic nerve fibers. In a number of animal studies, this abnormal activity was brought back to a spontaneous-type nerve firing by application of an electrical stimulus [24,25].

Table 4. Tinnitus Handicap Inventory (THI) Scores Before and After Electrical Promontory Stimulation (EPS) Pre-EPS THI

THI One Month After EPS

Patient

Functional

Emotional

Catastrophic

Total

Functional

Emotional

Catastrophic

Total

1 2 3 4 5 6 7 8 9 10 11

28 34 18 36 34 14 8 10 28 22 12

10 28 14 32 16 20 6 4 32 16 8

8 6 6 20 14 12 6 4 12 18 4

46 68 38 88 64 46 20 18 72 56 24

6 34 10 18 34 14 4 10 28 0 4

4 28 6 16 16 20 6 4 32 0 4

0 6 0 8 14 12 8 4 12 4 0

10 68 16 46 64 46 18 18 72 4 8

103

International Tinnitus Journal, Vol. 15, No. 1, 2009

Whether EPS can restore some degree of normal firing in the cochlear nerve of humans affected by tinnitus is at present unknown. Very few reports are currently available about a real-time monitoring of nerve fiber activity during and immediately after peripheral electrical stimulation. Watanabe et al. [26] registered compound action potentials (CAP) through electrocochleography during promontory stimulation: Patients reporting tinnitus suppression during the procedure were also found to have greater CAP amplitudes as compared to patients whose tinnitus remained unchanged, but whether this is a neural correlate of tinnitus suppression is still a matter of debate. Alternatively, suggested mechanisms through which a positive current delivered to the promontory or to the cochlea may work on nerve fibers include hyperpolarization of axons, with subsequent inhibition of spontaneous discharge rates [27], and even a reflex increase in microcirculation in the auditory pathway [21].

Di Nardo et al.

cal stimulation on tinnitus in humans, though other noninvasive, promising techniques, such as quantitative electroencephalography, could well serve the purpose of a precise monitoring of EPS brain effects as long as they become more reliable in deﬁning central correlates of tinnitus [37]. As for the tinnitus-associated psychosocial impairment, THI administration allowed us to appreciate a reduction of the THI score in ﬁve patients 1 month after transtympanic stimulation, which means most of the negative emotional, affective, and psychosocial impacts of tinnitus abated. This outcome seems to suggest that electrical stimulation also affects the activity of association areas (limbic system) that are notoriously closely intertwined with the neural pathways involved in tinnitus pathogenesis and play a very important role in producing negative emotional correlates of tinnitus, such as anxiety and annoyance.

Toward Optimization of EPS Mechanisms Underlying Long-Term Effects of EPS on Tinnitus A temporary alteration of acoustic nerve ﬁring cannot account for the long-term effect (at least 1 month) of a 60-second promontory stimulation such as the one we administered to our study patients. In fact, the lasting residual inhibition we observed in some of them implies that central stations along the auditory pathway are likely to be involved as well. The dorsal cochlear nucleus (DCN) and the inferior colliculus (IC) could be plausible candidates, given the amount of evidence pointing to them as tinnitus generators [28,29], although there is currently a paucity of direct evidence of their role in humans [30]. In vivo monitoring of electrical activity in these centers during and after electrical stimulation delivered to the promontory or to the cochlea would be an optimal method to ascertain whether changes occur in the DCN and IC in response to EPS. Finally, a possible effect of EPS on the cortical reorganization [31–34] underlying tinnitus must be assumed, as a positron emission tomography (PET) study has shown that electrical stimulation delivered to the promontory and round-window region causes activation of the primary auditory cortex and some of the surrounding association areas [35]. Other PET studies report that the electrical stimulation produced by a cochlear implant can reduce the signs of abnormal activity supposed to be associated with tinnitus in the primary auditory and associated cortices and in brain areas of the limbic system [36]. To conﬁrm this, functional brain imaging should be improved so as to reliably identify central areas of tinnitus-related activity. No other reports address the central effects of electri-

104

Considering our preliminary results, we think more expansive series are necessary to precisely define the features that the electrical stimulation should possess to suppress tinnitus. However, even the results on our small series seem to indicate that tinnitus suppression occurs mostly at lower pulse rates (50 and 100 Hz) and at an intensity of stimulation between threshold and minimum discomfort level, although in two of our patients, tinnitus suppression was achieved through subthreshold stimuli. In particular, the issue of using subthreshold or suprathreshold electrical stimulation should be addressed with special attention in future studies: Subthreshold stimulation would be better, avoiding replacement of tinnitus with an unpleasant and intrusive sound, just as often happens with maskers. Aside from the optimal parameters of stimulation, clinical features that predict EPS success should be outlined more precisely for a correct selection of candidates who could derive the utmost benefit from the procedure. Our results suggest that recent onset of tinnitus and a patient’s age can be predictive of tinnitus suppression, although selection criteria deserve deeper investigations in larger series. In conclusion, we assume that EPS is to be considered per se a worthwhile attempt at tinnitus suppression, being quite easy to administer and successful in the majority of cases. Certain parameters of EPS (e.g., lower frequencies of stimulation) seem more effective and should be taken into account for future use of this procedure. Specific features, such as recent onset of tinnitus and patients’ young age, appear to be associated with a better outcome and should therefore be considered as major factors for patient selection.

Transtympanic Electrical Stimulation for Tinnitus Suppression

EPS results could help predict tinnitus response to the positioning of an implantable electrical stimulator: Patients for whom EPS proves to be effective could beneﬁt from the implantation of an intratympanic stimulator that could be controlled by radiofrequencies from the outside. Considering the recent achievements of cochlear implant “soft surgery,” which allows preservation of residual hearing, cochlear implants could deﬁnitely be used to suppress intractable tinnitus in patients with unilateral profound hearing loss [38].

REFERENCES 1. Eggermont JJ, Roberts LE. The neuroscience of tinnitus. Trends Neurosci 27:676–682, 2004. 2. Cacace AT. Expanding the biological basis of tinnitus: Cross-modal origins and the role of neuroplasticity. Hear Res 175:112–132, 2003. 3. Vernon JA, Fenwick JA. Attempts to suppress tinnitus with transcutaneous electrical stimulation. Otolaryngol Head Neck Surg 93:385–389, 1985. 4. Shulman A. External electrical stimulation in tinnitus control. Am J Otol 6:110–115, 1985. 5. Dobie RA, Hoberg KE, Rees TS. Electrical tinnitus suppression: A double-blind crossover study. Otolaryngol Head Neck Surg 95:319–323, 1986. 6. Thedinger BS, Karlsen E, Schack SH. Treatment of tinnitus with electrical stimulation: An evaluation of the Audimax Theraband. Laryngoscope 97:33–37, 1987. 7. Steenerson RL, Cronin GW. Tinnitus reduction using transcutaneous electrical stimulation. Otolaryngol Clin North Am 36:337–344, 2003. 8. Aydemir G, Tezer MS, Borman P, et al. Treatment of tinnitus with transcutaneous electrical nerve stimulation improves patients’ quality of life. J Laryngol Otol 120:442– 445, 2006. 9. Kapkin O, Satar B, Yetiser S. Transcutaneous electrical stimulation of subjective tinnitus. ORL J Otorhinolaryngol Relat Spec 70:156–161, 2008. 10. Balkany T, Bantii H, Vernon J. Workshop: Direct electrical stimulation of the inner ear for the relief of tinnitus. Am J Otol 8:207–212, 1987. 11. Kuk FK, Tyler RS, Rustad N, et al. Alternating current at the eardrum for tinnitus reduction. J Speech Hear Res 32:393–400, 1989. 12. Matsushima JI, Sakai N, Uemi N, et al. Evaluation of implanted tinnitus suppressor based on tinnitus stress test. Int Tinnitus J 3:123–131, 1997. 13. De Ridder D, De Mulder G, Verstraeten E, et al. Primary and secondary auditory cortex stimulation for intractable tinnitus. ORL J Otorhinolaryngol Relat Spec 68:48–55, 2006. 14. Seidman MD, De Ridder D, Elisevich K, et al. Direct electrical stimulation of Heschl’s gyrus for tinnitus treatment. Laryngoscope 118:491–500, 2008.

International Tinnitus Journal, Vol. 15, No. 1, 2009

15. Di Nardo W, Cantore I, Cianfrone F, et al. Tinnitus modiﬁcations after cochlear implantation. Eur Arch Otorhinolaryngol 264:1145–1149, 2007. 16. Baguley DM, Atlas MD. Cochlear implants and tinnitus. Prog Brain Res 166:347–355, 2007. 17. Yonehara E, Mezzalira R, Porto PR, et al. Can cochlear implants decrease tinnitus? Int Tinnitus J 12:172–174, 2006. 18. Ruckenstein MJ, Hedgepeth C, Rafter KO, et al. Tinnitus suppression in patients with cochlear implants. Otol Neurotol 22:200–204, 2001. 19. Newman CW, Jacobson GP, Spitzer JB. Development of the Tinnitus Handicap Inventory. Arch Otolaryngol Head and Neck Surg 122:143–148, 1996. 20. Rubinstein JT, Tyler RS, Johnson A, et al. Electrical suppression of tinnitus with high-rate pulse trains. Otol Neurotol 24(3):478–485, 2003. 21. Konopka W, Zalewski P, Olszewski J, et al. Tinnitus suppression by electrical promontory stimulation (EPS) in patients with sensorineural hearing loss. Auris Nasus Larynx 28:35–40, 2001. 22. Okusa M, Shiraishi T, Kubo T, et al. Tinnitus suppression by electrical promontory stimulation in sensorineural deaf patients. Acta Otolaryngol Suppl 501:54–58, 1993. 23. Battmer RD, Heermann R, Laszig R. Suppression of tinnitus by electric stimulation in cochlear implant patients. HNO 37(4):148–152, 1989. 24. Runge-Samuelson CL, Abbas PJ, Rubinstein JT, et al. Response of the auditory nerve to sinusoidal electrical stimulation: Effects of high-rate pulse trains. Hear Res 194:1– 13, 2004. 25. Litvak LM, Delqutte B, Eddington DK. Improved temporal coding of sinusoids in electric stimulation of the auditory nerve using desynchronizing pulse trains. J Acoust Soc Am 114:2099–2111, 2003. 26. Watanabe K, Okawara D, Baba S, et al. Electrocochleographic analysis of the suppression of tinnitus by electrical promontory stimulation. Audiology 36:147–154, 1997. 27. Aran JM, Sauvage RC, Erre JP. Perspectives in electrical stimulation of the ear (experimental studies). J Laryngol Otol 9(suppl):132–136, 1984. 28. Kaltenbach JA. Summary of evidence pointing to a role of the dorsal cochlear nucleus in the etiology of tinnitus. Acta Otolaryngol 126:20–26, 2006. 29. Melcher JR, Sigalovsky IS, Guinar JJ Jr, et al. Lateralized tinnitus studied with functional magnetic resonance imaging: Abnormal inferior colliculus activation. J Neurophysiol 83:1058–1072, 2000. 30. Lanting CP, De Kleine E, Bartels H, et al. Functional imaging of unilateral tinnitus using fMRI. Acta Otolaryngol 128:415–421, 2008. 31. Hoke M, Pantev C, Lütkenhöner B, et al. Auditory cortical basis of tinnitus. Acta Otolaryngol Suppl 491:176–181, 1991. 32. Weisz N, Wienbruch C, Dohrmann K, et al. Neuromagnetic indicators of auditory cortical reorganization of tinnitus. Brain 128:2722–2731, 2005. 33. Mühlnickel W, Elbert T, Taub E, et al. Reorganization of auditory cortex in tinnitus. Proc Natl Acad Sci U S A 95:10340–10343, 1998.

105

International Tinnitus Journal, Vol. 15, No. 1, 2009

34. Schmidt AM, Weber BP, Vahid M, et al. Functional MR imaging of the auditory cortex with electrical stimulation of the promontory in 35 deaf patients before cochlea implantation. AJNR Am J Neuroradiol 24:201– 207, 2003. 35. Mirz F, Mortensen MV, Jedde A, et al. Positron Emission Tomography of Tinnitus Suppression by Cochlear Implantation. In R Patuzzi (ed), Proceedings of the Seventh International Tinnitus Seminar, 2nd ed. Perth: University of Western Australia, 2002:136–140.

106

Di Nardo et al.

36. Jastreboff PJ, Gray WC, Gold SL. Neurophysiological approach to tinnitus patients. Am J Otol 17:236–240, 1996. 37. Shulman A, Avitable MJ, Goldstein B. Quantitative electroencephalography power analysis in subjective idiopathic tinnitus patients: A clinical paradigm shift in the understanding of tinnitus, an electrophysiological correlate. Int Tinnitus J 12:121–131, 2006. 38. Di Nardo W, Cantore I, Melillo P, et al. Residual hearing in cochlear implant patients. Eur Arch Otorhinolaryngol 264:855–860, 2007.

CLINICAL TRIAL ARTICLE

PSYCHIATRY

published: 07 August 2012 doi: 10.3389/fpsyt.2012.00070

Transcutaneous vagus nerve stimulation: retrospective assessment of cardiac safety in a pilot study Peter M. Kreuzer 1 *, Michael Landgrebe 1 , Oliver Husser 2 , Markus Resch 2 , Martin Schecklmann 1 , Florian Geisreiter 1 , Timm B. Poeppl 1 , Sarah Julia Prasser 1 , Goeran Hajak 1,3 and Berthold Langguth 1 1 2 3

Department of Psychiatry and Psychotherapy, University of Regensburg, Regensburg, Germany Klinik und Poliklinik für Innere Medizin II, University of Regensburg Medical Center, Regensburg, Germany Department of Psychiatry, Psychosomatic Medicine and Psychotherapy, Social Foundation Bamberg, Bamberg, Germany

Edited by: Darin D. Dougherty, Massachusetts General Hospital, USA Reviewed by: Darin D. Dougherty, Massachusetts General Hospital, USA Charles R. Conway, Washington University School of Medicine in St. Louis, USA *Correspondence: Peter M. Kreuzer , Department of Psychiatry and Psychotherapy, University of Regensburg, Universitaetsstr. 84, 93053 Regensburg, Germany. e-mail: peter.kreuzer@medbo.de

Background: Vagus nerve stimulation has been successfully used as a treatment strategy for epilepsy and affective disorders for years. Transcutaneous vagus nerve stimulation (tVNS) is a new non-invasive method to stimulate the vagus nerve, which has been shown to modulate neuronal activity in distinct brain areas. Objectives: Here we report effects of tVNS on cardiac function from a pilot study, which was conducted to evaluate the feasibility and safety of tVNS for the treatment of chronic tinnitus. Methods:Twenty-four patients with chronic tinnitus underwent treatment with tVNS over 3–10 weeks in an open single-armed pilot study. Safety criteria and practical usability of the neurostimulating device were to investigate by clinical examination and electrocardiography at baseline and at several visits during and after tVNS treatment (week 2, 4, 8, 16, and 24). Results: Two adverse cardiac events (one classified as a severe adverse event) were registered but considered very unlikely to have been caused by the tVNS device. Retrospective analyses of electrocardiographic parameters revealed a trend toward shortening of the QRS complex after tVNS. Conclusion: To our knowledge this is one of the first studies investigating feasibility and safety of tVNS in a clinical sample. In those subjects with no known pre-existing cardiac pathology, preliminary data do not indicate arrhythmic effects of tVNS. Keywords: vagus nerve, neuromodulation, tinnitus, ECG, electrocardiography, cardiac arrhythmia

INTRODUCTION Electrical stimulation of the vagus nerve (VNS) is an FDAapproved therapy tool for both refractory depression and epilepsy (Schachter and Saper, 1998; Ben-Menachem, 2002; Grimm and Bajbouj, 2010). Furthermore, it has recently emerged as a promising therapeutic approach for cardiac diseases (Schwartz et al., 2008; De Ferrari et al., 2009, 2011). It broadly affects various parts of the brain including the thalamus, cerebellum, orbitofrontal cortex, limbic system, hypothalamus, and medulla (Chae et al., 2003; Pardo et al., 2008; Vonck et al., 2008; Kosel et al., 2011). Recently vagus nerve stimulation paired with auditory stimuli has been shown to reverse pathological and behavioral changes in an animal model of tinnitus (Engineer et al., 2011). Traditionally, vagus nerve stimulation has been performed by the implantation of a neurostimulating device connected to an electrode located along the cervical branch of the vagus nerve. In order to minimize adverse effects of this procedure such as coughing during stimulation, croakiness, general operational and anesthesiological risks, and high costs, a new non-invasive neurostimulating device has been developed for transcutaneous stimulation of the afferent auricular branch of the vagus nerve (ABVN) located medial of the tragus Abbreviations: AV, atrioventricular; ECG, electrocardiography/ electrocardiographic; LBBB, left bundle branch block; NTS, nucleus of the solitary tract/nucleus tractus solitarii; tVNS, transcutaneous vagus nerve stimulation; VNS, conventional vagus nerve stimulation.

www.frontiersin.org

at the entry of the acoustic meatus (tVNS®). The tVNS® device received CE approval in 2010 (CE1275). CE marking is an indication that a medical device complies with essential health and safety requirements. Transcutaneous vagus nerve stimulation (tVNS) targets the cutaneous receptive field of the ABVN at the outer ear (Ellrich, 2011). The human outer ear is supplied by three sensory nerves, namely the auriculotemporal nerve, the great auricular nerve, and the ABVN (Peuker and Filler, 2002). On 14 human ears the complete course of nerve supply was exposed and each branch was defined by identifying its origin. In all specimens the ABVN was found to significantly supply the cavity of conchae and exclusively supply the cymba conchae, which served as stimulation site in the present study (Peuker and Filler, 2002). In respect to neuroimaging techniques two functional magnetic resonance imaging (fMRI) studies have been done investigating the effect of tVNS applied to the left tragus area in a sample of four healthy male adults (Dietrich et al., 2008) and to the left outer ear canal in a sample of 22 healthy volunteers (Kraus et al., 2007). Stimulation of the earlobe served as control condition. Both fMRI studies showed blood oxygen level-dependent (BOLD) signal changes. Earlobe stimulation as a sham control intervention did not exert similar effects (Kraus et al., 2007). No significant effects on heart rate, blood pressure, or peripheral microcirculation could be detected during the stimulation procedure (Kraus et al., 2007). The brain activation pattern under tVNS clearly shares

August 2012 | Volume 3 | Article 70 | 1

Kreuzer et al.

features with changes observed during invasive VNS (Chae et al., 2003; Kraus et al., 2007). In a pilot study we aimed to assess feasibility and safety of tVNS in a clinical sample of patients suffering from subjective and chronic tinnitus. Since efferent fibers of the vagus nerve modulate cardiac function, cardiac safety has always been a concern in the therapeutic use of vagus nerve stimulation (Cristancho et al., 2011). Efferent vagal fibers to the heart are supposed to be located on the right side (Nemeroff et al., 2006). In order to avoid cardiac side effects, electrode placement is performed on the left side in treatment of central nervous diseases (Nemeroff et al., 2006). Even if tVNS stimulates selectively afferent vagus nerve fibers, a potential reflectory effect on efferent vagus nerve function cannot be excluded. Therefore we performed electrocardiography (ECG) in all patients at baseline and during tVNS treatment.

MATERIALS AND METHODS STUDY DESIGN AND SUBJECTS

The present study was conducted as a feasibility and safety study with an open, single-armed pilot study design. Clinical visits were planned according to the study protocol at screening, baseline, week 2, week 4, week 8, week 16, and week 24 (end of treatment) with a further follow-up 4 weeks after termination of the stimulation in week 28. The study was approved by the Ethics Committee of the University of Regensburg. All study procedures were conducted in accordance with the last revision of the Declaration of Helsinki. All participants gave written informed consent after a comprehensive explanation of the procedures. After occurrence of two cardiologic events [one newly diagnosed left bundle branch block (LBBB) and one sinusarrhythmic episode], these two cases were analyzed in detail. Moreover, ECG data from all patients in the whole sample were retrospectively analyzed at that time point. PATIENTS AND RECRUITMENT

The present study included 24 patients [10 male, 14 female; 59.0 ± 10.7 years (38.4–72.8)] with chronic tinnitus [167.0 ± 134.7 months duration (8.1–479.0)]. The trial was registered in an international database (ClinicalTrials.gov. identifier: NCT01176734). Patients with moderate to severe tinnitus defined by a Tinnitus Questionnaire (TQ) score >30 were recruited between May and August 2010 at the Interdisciplinary Tinnitus Center of the University of Regensburg. The mean TQ in the study sample was 49.7 ± 11.1 (32–75). Patients with severe internal, neurological, or psychiatric comorbidities were excluded from the study. Exclusion criteria were checked by taking a detailed medical history by experienced psychiatrists. Asthma was considered a contraindication (because of theoretical risk of impairment due to a parasympathetic enhancement by VNS) as well as the permanent use of left-sided hearing aids and/or tinnitus masking devices. tVNS NEUROSTIMULATING DEVICE

A tVNS instrument consisting of two titan electrodes mounted on a gel frame and connected to a wired neurostimulating device (CM02, Cerbomed, Erlangen, Germany) was used.

Frontiers in Psychiatry | Neuropsychiatric Imaging and Stimulation

Electrocardiography in transcutaneous vagus nerve stimulation

The clinical efficacy of VNS requires activation of thick myelinated afferent fibers of the vagus nerve (Vonck et al., 2007). The fibers of a sensory peripheral nerve such as the ABVN mediate touch sensation. Consequently, the stimulus intensity of tVNS was individually adjusted to a level above the individual’s detection threshold and clearly below the individual’s pain threshold. The tVNS® device offered a stimulus intensity between 0.1 and 10 mA with a stimulation frequency of 25 Hz. Stimulation was active for 30 s, followed by a break of 180 s. In addition, stimulation intensity was applied in an adjustable way by the patients according to the situational circumstances. Patients were instructed individually in the usage of the tVNS device and were recommended to use the stimulator only during daytime for safety reasons. They were instructed to adjust the stimulation intensity in order to achieve a tingling sensation that should be perceived with no painful percept at all. Every change in stimulation parameters was logged by the stimulation device. In 22 of the 24 stimulators, we could compile a detailed history of stimulation, in the remaining two cases this was not possible due to technical problems. During the study, patients used the stimulation device 24.0 ± 19.3 days with an average of 5.15 ± 1.80 h a day. The mean intensity of stimulation in the whole sample was 3.2 ± 2.5 mA. ELECTROCARDIOGRAPHY

Twelve-electrode ECGs were recorded with a standard ECG device (Corina, GE Medical Systems Information Technology Inc., Milwaukee, USA) using GE Cardiosoft Software of General Electric Company, New York, USA. During ECG all patients were laying in supine position with the tVNS stimulator turned off. STATISTICAL ANALYSES

All continuous data were displayed as the mean with the standard deviation and were compared using the paired Student’s t -test or the two sample Student’s t -test when appropriate. In addition we reported the effect sizes d for these contrasts to estimate the clinical significance according to Cohen (d = 0.2 small, 0.5 medium, 0.8 high; Cohen, 1988). Statistical analyses were done in a two-stepsapproach for the whole sample and for the sample without the two patients with adverse events. Statistical significance was assumed for a p-value < 0.05.

RESULTS After occurrence of two cardiac events (one newly diagnosed LBBB and one sinusarrhythmic episode) the two cases were analyzed in detail. In addition, we conducted an analysis of all ECG recordings performed during the course of the study up to this time point as an interim analysis, in order to address safety issues. For the whole sample missing values for visit 2 (55%) and 3 (82%) were high; thus, we concentrated on contrasts between screening/baseline (5% = 1 value missing for QRS), visit 1 (14% missing), and last available visit (32% missing). In two patients cardiac adverse events during tVNS had occurred. A 62 years old female (patient 1) developed a palpitation episode that was monitored and treated in an intensive care unit. This event was therefore classified as a severe adverse event and reported immediately to the sponsor and the local ethics committee. The patient had noticed palpitation on a hot Saturday in

August 2012 | Volume 3 | Article 70 | 2

Kreuzer et al.

Electrocardiography in transcutaneous vagus nerve stimulation

FIGURE 1 | ECG of patient 2 at baseline, week 2 and week 4 visit.

www.frontiersin.org

August 2012 | Volume 3 | Article 70 | 3

Kreuzer et al.

Electrocardiography in transcutaneous vagus nerve stimulation

FIGURE 2 | ECG displaying LBBB at week 8 visit (patient 2).

the summer of 2010 that worsened in the course of the day and led to consultation of a physician in the evening. She was initially supplied with Calcium and Magnesium formula but when the complaints persisted even on the following day she sought help in a hospital and was initially observed in an intensive care unit after administration of nitroglycerine inhaler. After normal results were obtained at echocardiography, duplex sonography of the carotids, 24 h ECG monitoring, and thoracal X-ray she was dismissed from hospital without complaints 1 day later. Elevation of the dosage of her beta-blocking antiarrhythmic drug from 2.5 mg b.i.d. to 5 mg b.i.d. was recommended. Further exploration revealed that the patient had suffered comparable events earlier in the past but in-patient-treatment had not been necessary so far. tVNS treatment had been stopped immediately in this patient and she was retracted from the study. A 67 year-old male patient (patient 2) displayed a LBBB with atrioventricular conduction time of 160 ms in a routine echocardiographic control performed after 8 weeks of tVNS, which had not been there at baseline and at the prior visits (screening/baseline, week 2, week 4). Prior echocardiography had not revealed any pathological results as shown in Figure 1. The patient himself did not experience any symptoms, the LBBB was detected in a routine control ECG according to the study protocol (see

Frontiers in Psychiatry | Neuropsychiatric Imaging and Stimulation

Figure 2). For improvement of mood and sleep he was on medication with mirtazapine (15 mg/day) and pre-existing arterial hypertension was treated with metoprolol 200 mg/day. Additional cardiac risk factors included smoking (10–15 cigarettes/day for almost 50 years), obesity (180 cm, 100 kg; BMI = 30.9 kg/m2 ), and hyperlipidemia. Extensive internal check-up including several ECG and sonographic examinations revealed a concentric hypertrophy of the left ventricle without regional cardiac movement disorders. Heart catheter examinations were recommended but refused by the patient. The LBBB was completely reversible, further ECG controls did not show similar episodes so far (see Figure 3). tVNS stimulation was immediately stopped after detecting the LBBB at week 8 study visit. This event was not classified as a severe adverse event as it did not lead to hospitalization of the patient or other grave impairment. Further reported adverse events included headache (3×), breathing difficulties (3×), chest sensation (3×), dizziness (2×), subjective hearing impairment (2×), worsening of tinnitus, neck pain, croakiness, and sleeping disorder. Notably, all these complaints were reported to have been perceived transiently, they could not be objectified and no specific actions were taken. For none of these side effects there was a clear hint for a causal relationship to the intervention itself.

August 2012 | Volume 3 | Article 70 | 4

Kreuzer et al.

Electrocardiography in transcutaneous vagus nerve stimulation

FIGURE 3 | ECG at follow-up 6 weeks after LBBB (patient 2).

Side effects clearly related to the intervention were technical problems [contact problems (4×)] and local problems [local electrode pressure (11×); pain at stimulation with high intensity (3×)]. Statistical analyses were performed on various ECG parameters [heart beats per minute, PQ interval (ms), QRS complex (ms), and QTc (ms)] both for the whole sample (n = 24) and the sample without the two patients with adverse events (n = 22; see Figure 4). For the whole sample none of the analyzed parameters showed significant differences between the three time points, effect sizes were small (all ps > 0.246; all ds < 0.312). When the two patients with cardiac averse events were excluded from analysis, a significant reduction of the QRS complex with a medium effect size (p = 0.047; d = 0.541) from screening to the termination emerged; all other contrasts were not significant with small effect sizes (all ps > 0.382; all ds < 0.206). All results are displayed in detail in Figure 4.

DISCUSSION The purpose of this pilot study was to evaluate the feasibility and safety of tVNS in the treatment of chronic tinnitus. This is one of the first studies investigating feasibility and safety of

www.frontiersin.org

tVNS in a clinical sample (Stefan et al., 2012). The main findings of our study were that (1) tVNS is feasible in tinnitus patients without any signs of long-term worsening of tinnitus complaints and that (2) in those patients without a history of known cardiac disease, these data suggest that tVNS cannot be considered unsafe. It was well tolerated in the majority of patients of this study sample. (3) With respect to the measured cardiac parameters, the study showed that tVNS of the left ABVN is unlikely to cause adverse cardiac reactions. In both of the reported cardiac adverse events other explanations for the symptoms were existing in the patients. Patient 1 had experienced sinusarrhythmic episodes already in the past, in patient 2 the comorbid condition of hypertension had caused concentric cardiac hypertrophy which might have contributed to the described temporary LBBB. In the statistical analysis of the whole sample no effects on ECG parameters were observed, after exclusion of the patients with side effects there was a significant reduction of the QRS time. However, this effect is small, and significance would not have survived correction for multiple testing. Thus it remains to be elucidated by further studies whether tVNS reduces the QRS time or whether the QRS time remains unaffected by tVNS. Definitively our data do not provide a hint for a prolongation of the QRS complex which is

August 2012 | Volume 3 | Article 70 | 5

Kreuzer et al.

Electrocardiography in transcutaneous vagus nerve stimulation

FIGURE 4 | Cardiac parameters during tVNS stimulation for both the whole sample and the sample without the 2 patients experiencing adverse cardiac events.

a known predictor of cardiac morbidity and mortality (Shamim et al., 1999; Kashani and Barold, 2005; Brenyo and Zareba, 2011). The authors are well aware of the preliminary character of the presented data as the study was originally not designed for the

Frontiers in Psychiatry | Neuropsychiatric Imaging and Stimulation

assessment of cardiac effects of left-sided tVNS, but was rather conducted to examine feasibility and efficacy of tVNS in a sample of tinnitus patients. Therefore, the analyzed ECG recordings were performed based on standard safety considerations. Stable somatic

August 2012 | Volume 3 | Article 70 | 6

Kreuzer et al.

Electrocardiography in transcutaneous vagus nerve stimulation

comorbidities including cardiac diseases were not considered as a contraindication for participation in the study, unfortunately complicating the interpretation of the presented data ex post. Nonetheless, we would recommend a more conservative selection of patients in future clinical studies. This is in line with the low incidence of adverse cardiac reactions during the long-term experience in more than 50,000 patients with implanted left VNS for treatment of epilepsy and depression (Ben-Menachem, 2002; Cristancho et al., 2011). After intensive workup the two described cardiac adverse events during the study are more probably due to individual pre-existing cardiac risk factors such as known sinus-arrhythmias (patient 1), hypertensive state, and the attributable dilatative cardiomyopathy (patient 2). Taking into consideration the relatively high age of our sample, the risk of internal somatic comorbidities is much higher than in general population samples and one should not prematurely judge

REFERENCES Ben-Menachem, E. (2002). Vagus-nerve stimulation for the treatment of epilepsy. Lancet Neurol. 1, 477–482. Brenyo, A., and Zareba, W. (2011). Prognostic significance of QRS duration and morphology. Cardiol. J. 18, 8–17. Chae, J. H., Nahas, Z., Lomarev, M., Denslow, S., Lorberbaum, J. P., Bohning, D. E., and George, M. S. (2003). A review of functional neuroimaging studies of vagus nerve stimulation (VNS). J. Psychiatr. Res. 37, 443–455. Cohen, J. (1988). Statistical Power for the Behavioral Sciences. Hillsdale, NJ: Erlbaum. Cristancho, P., Cristancho, M. A., Baltuch, G. H., Thase, M. E., and O’Reardon, J. P. (2011). Effectiveness and safety of vagus nerve stimulation for severe treatment-resistant major depression in clinical practice after FDA approval: outcomes at 1 year. J. Clin. Psychiatry 72, 1376–1382. De Ferrari, G. M., Crijns, H. J., Borggrefe, M., Milasinovic, G., Smid, J., and Zabel, M., Gavazzi, A., Sanzo, A., Dennert, R., Kuschyk, J., Raspopovic, S., Klein, H., Swedberg, K., and Schwartz, P. J. (2011). Chronic vagus nerve stimulation: a new and promising therapeutic approach for chronic heart failure. Eur. Heart J. 32, 847–855. De Ferrari, G. M., Sanzo, A., and Schwartz, P. J. (2009). Chronic vagal stimulation in patients with congestive heart failure. Conf. Proc. IEEE Eng. Med. Biol. Soc. 2009, 2037–2039.

www.frontiersin.org

Dietrich, S., Smith, J., Scherzinger, C., Hofmann-Preiss, K., Freitag, T., Eisenkolb, A., and Ringler, R. (2008). A novel transcutaneous vagus nerve stimulation leads to brainstem and cerebral activations measured by functional MRI. Biomed. Tech. (Berl.) 53, 104–111. Ellrich, J. (2011). Transcutaneous vagus nerve stimulation. Eur. Neurol. Rev. 6, 262–264. Engineer, N. D., Riley, J. R., Seale, J. D., Vrana, W. A., Shetake, J. A., Sudanagunta, S. P., Borland, M. S., and Kilgard, M. P. (2011). Reversing pathological neural activity using targeted plasticity. Nature 470, 101–104. Grimm, S., and Bajbouj, M. (2010). Efficacy of vagus nerve stimulation in the treatment of depression. Expert Rev. Neurother. 10, 87–92. Kashani, A., and Barold, S. S. (2005). Significance of QRS complex duration in patients with heart failure. J. Am. Coll. Cardiol. 46, 2183–2192. Kosel, M., Brockmann, H., Frick, C., Zobel, A., and Schlaepfer, T. E. (2011). Chronic vagus nerve stimulation for treatment-resistant depression increases regional cerebral blood flow in the dorsolateral prefrontal cortex. Psychiatry Res. 191, 153–159. Kraus, T., Hosl, K., Kiess, O., Schanze, A., Kornhuber, J., and Forster, C. (2007). BOLD fMRI deactivation of limbic and temporal brain structures and mood enhancing effect by transcutaneous vagus nerve stimulation. J. Neural Transm. 114, 1485–1493. Nemeroff, C. B., Mayberg, H. S., Krahl, S. E., Mcnamara, J., Frazer, A., Henry, T. R., George, M. S., Charney, D. S., and Brannan, S. K.

the tVNS to be causally related to the adverse cardiac reactions described above. Thus, our preliminary data do not provide concrete hints for relevant influences of tVNS on cardiac rhythm. In our opinion tVNS as approved by CE marking represents an innovative and promising new approach in non-invasive modulation of brain activity that might exert benefits in a variety of neuropsychiatric disorders and merits further research. Nevertheless, in light of the potential of tVNS to modulate conduction system of the heart, ECG recordings are recommended in every study of tVNS in order to obtain further safety data.

ACKNOWLEDGMENTS We want to thank Susanne Staudinger, Sylvia Dorner-Mitschke, Helene Niebling, and Sandra Pfluegl for their assistance in appointment management and data handling.

(2006). VNS therapy in treatmentresistant depression: clinical evidence and putative neurobiological mechanisms. Neuropsychopharmacology 31, 1345–1355. Pardo, J. V., Sheikh, S. A., Schwindt, G. C., Lee, J. T., Kuskowski, M. A., Surerus, C., Lewis, S. M., Abuzzahab, F. S., Adson, D. E., and Rittberg, B. R. (2008). Chronic vagus nerve stimulation for treatmentresistant depression decreases resting ventromedial prefrontal glucose metabolism. Neuroimage 42, 879–889. Peuker, E. T., and Filler, T. J. (2002). The nerve supply of the human auricle. Clin. Anat. 15, 35–37. Schachter, S. C., and Saper, C. B. (1998). Vagus nerve stimulation. Epilepsia 39, 677–686. Schwartz, P. J., De Ferrari, G. M., Sanzo, A., Landolina, M., Rordorf, R., Raineri, C., Campana, C., Revera, M., Ajmone-Marsan, N., Tavazzi, L., and Odero, A. (2008). Long term vagal stimulation in patients with advanced heart failure: first experience in man. Eur. J. Heart Fail. 10, 884–891. Shamim, W., Francis, D. P., Yousufuddin, M., Varney, S., Pieopli, M. F., Anker, S. D., and Coats, A. J. (1999). Intraventricular conduction delay: a prognostic marker in chronic heart failure. Int. J. Cardiol. 70, 171–178. Stefan, H., Kreiselmeyer, G., Kerling, F., Kurzbuch, K., Rauch, C., Heers, M., Kasper, B., Hammen, T., Rzonsa, M., Pauli, E., Ellrich, J., Graf, W., and Hopfengaertner, R. (2012). Transcutaneous vagus nerve stimulation (t-VNS) in pharmacoresistant

epilepsies: a proof of concept trial. Epilepsia 53, e115–e118. Vonck, K., Boon, P., and Van Roost, D. (2007). Anatomical and physiological basis and mechanism of action of neurostimulation for epilepsy. Acta Neurochir. Suppl. 97, 321–328. Vonck, K., De Herdt, V., Bosman, T., Dedeurwaerdere, S., Van Laere, K., and Boon, P. (2008). Thalamic and limbic involvement in the mechanism of action of vagus nerve stimulation, a SPECT study. Seizure 17, 699–706. Conflict of Interest Statement: The study was sponsored by CerboMed GmbH, Erlangen, Germany. Received: 16 April 2012; accepted: 08 July 2012; published online: 07 August 2012. Citation: Kreuzer PM, Landgrebe M, Husser O, Resch M, Schecklmann M, Geisreiter F, Poeppl TB, Prasser SJ, Hajak G and Langguth B (2012) Transcutaneous vagus nerve stimulation: retrospective assessment of cardiac safety in a pilot study. Front. Psychiatry 3:70. doi: 10.3389/fpsyt.2012.00070 This article was submitted to Frontiers in Neuropsychiatric Imaging and Stimulation, a specialty of Frontiers in Psychiatry. Copyright © 2012 Kreuzer, Landgrebe, Husser, Resch, Schecklmann, Geisreiter, Poeppl, Prasser, Hajak and Langguth. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in other forums, provided the original authors and source are credited and subject to any copyright notices concerning any third-party graphics etc.

August 2012 | Volume 3 | Article 70 | 7

DOI: 10.1590/0004-282X20140061

VIEWS AND REVIEWS

Transcutaneous vagus and trigeminal nerve stimulation for neuropsychiatric disorders: a systematic review Estimulação transcutânea do nervo vago e do nervo trigêmeo para o tratamento de distúrbios neuropsiquiátricos: revisão sistemática Pedro Shiozawa1, Mailu Enokibara da Silva1, Thais Cristina de Carvalho1, Quirino Cordeiro1, André R. Brunoni2, Felipe Fregni3,4

ABSTRACT We reviewed trigeminal nerve stimulation (TNS) and transcutaneous vagus nerve stimulation (tVNS). All techniques have shown preliminary promising results, although the results are mixed. Method: We performed a systematic review of the Medline and Embase databases, with no constraint to dates, through June 2013. The keywords were [(1) trigeminal nerve stimulation OR (2) cranial nerve OR (3) trigemin* OR (4) transcutaneous VNS OR (5) transcutaneous cranial nerve stimulation] and (6) mental disorders. Results: We included four preclinical and clinical five studies on TNS. All clinical data were based on open-label studies with small samples, which diminished the external validity of the results, thus reflecting the modest impact of TNS in current clinical practice. Of the tVNS clinical trials, three assessed physiological features in healthy volunteers, and one examined patients with epilepsy. Conclusion: TNS and tVNS improve treatment of particular neuropsychiatric disorders such as depression. Keywords: transcutaneous nerve stimulation, trigeminal stimulation, neuropsychiatric disorders. RESUMO O uso de estimulação de nervos cranianos de maneira transcutânea tem sido uma estratégia em desenvolvimento recente. Diferentes estudos apontam para resultados clínicos favoráveis no tratamento de diferentes quadros neuropsiquiátricos. Método: Revisão sistemática da literatura com base nas bibliotecas eletrônicas Medline e Embase, sem restrição de data inicial, até agosto de 2013. Os termos de busca utilizados foram [(1) trigeminal nerve stimulation OR (2) cranial nerve OR (3) trigemin* OR (4) transcutaneous VNS OR (5) transcutaneous cranial nerve stimulation] and (6) mental disorders. Resultados: Incluímos quatro estudos pré-clinicos e cinco estudos clínicos abordando estimulação do nervo trigêmeo. Todos os estudos foram abertos, com pequenas amostras, o que reduz a validade externa dos dados, refletindo a ainda incipiente atuação da técnica, apesar de promissora. Considerando-se a estimulação do nervo vago, três artigos avaliaram aspectos fisiológicos em voluntários saudáveis e um artigo estudou pacientes com epilepsia. Conclusão: As estratégias de estimulação transcutânea de nervos cranianos, apesar de incipiente, tem demonstrado resultados clínicos favoráveis no tratamento de distúrbios neuropsiquiátricos. Palavras-chave: estimulação transcutânea de nervos cranianos, estimulação do nervo trigêmeo, distúrbios neuropsiquiátricos.

Different nonpharmacological brain stimulation techniques have been used in clinical neurology and psychiatry, such as electroconvulsive therapy (ECT), repetitive transcranial magnetic stimulation (rTMS), vagus nerve stimulation (VNS), transcranial direct current stimulation (tDCS), deep brain stimulation (DBS), stereotactic surgery and trigeminal

nerve stimulation (TNS)1,2,3,4,5. Theoretically, such techniques present different mechanisms of action. For instance, ECT nonspecifically increases brain activity and excitability through controlled, electrically induced seizures; rTMS through an electromagnetic field induces intracortical eletric currents which may madulate neuronal activity focally; and

Departamento de Psiquiatria, Faculdade de Ciências Médicas da Santa Casa de São Paulo, Sao Paulo SP, Brazil;

Centro de Pesquisa Clínica, Hospital Universitário, Universidade de São Paulo, Sao Paulo SP, Brazil;

Laboratory of Neuromodulation, Harvard Medical School, Harvard University, United States;

Center of Clinical Research Training, Harvard University, United States.

Correspondence: Pedro Shiozawa; Departamento de Psiquiatria, Faculdade de Ciências Médicas da Santa Casa de São Paulo; Rua Major Maragliano, 241 Vila Mariana; 04600-010 São Paulo SP, Brasil; E-mail: pshiozawa@yahoo.com.br Conflict of interest: The authors declare no conflict of interest. Received 10 September 2013; Received in final form 26 March 2014; Accepted 15 April 2014.

542

tDCS modifies brain excitability through weak, direct electric currents. It is assumed that such techniques are top-down – i.e., they indirectly modulate subcortical activity through primary network changes in cortical activity. Conversely, both trigeminal and vagus nerve stimulation modulate brain activity through bottom-up mechanisms – that is, by stimulating cranial nerves whose nuclei lie in the brain stem, which, in turn, make extensive connections to the limbic cortex and monoaminergic nuclei. The vagus nerve, for instance, innervates the nucleus tractus solitarius bilaterally, which is connected to regions of the brain that are associated with the regulation of mood, emotion, and seizure activity6. Similarly, the trigeminal nerve has extensive connections to the brainstem and other brain structures. The trigeminal nerve has 3 major sensory branches over the face, all of which are bilateral. The trigeminal ganglion, located in the Meckel cave (cavum trigeminale), projects to the trigeminal nucleus which makes reciprocal projections to the nucleus tractus solitarius, locus coeruleus, and reticular formation7. The aim of this review was to systematically review all clinical and preclinical studies on both transcutaneous trigeminal (TNS) and vagus (tVNS) nerve stimulation as to understand the therapeutic and mechanistic aspects of these interventional techniques in the treatment of neuropsychiatric disorders. This is important because these techniques might modulate brain structures through transcutaneous electric nerve stimulation, although this has not been systematically assessed yet. We performed a systematic review following the PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analyses) Statement8. The methodological details are discussed below.

LITERATURE REVIEW We searched the Medline and Embase databases for the keywords: [(1) trigeminal nerve stimulation OR (2) cranial nerve OR (3) trigemin* OR (4) transcutaneous VNS OR (5) transcutaneous cranial nerve stimulation] and (6) mental disorders. These terms were selected even in the absence of specific Mesh terms (items 1, 3, 4 and 5) as to increase sensitivity. The date limits were from the first date available to June 2013. We also looked for potential relevant articles in the study references and contacted experts in the field.

Therefore, other types of articles, such as case reports and editorial letters, studies that assessed conditions other than neuropsychiatric disorders and studies that assessed interventions other than tVNS and TNS were excluded.

DATA EXTRACTION The following variables were extracted per a structured checklist that we developed: (a) Overview – study design, authors, year of publication, technique summary, other relevant data; (b) Demographics – total sample (number), age (years), gender (percentage females); (c) Assessment of mental disorder – method of diagnosis (clinical interview, structured checklist); and (d) Outcomes – description of each study’s principal results.

QUALITY ASSESSMENT To assess the methodological heterogeneity between studies, each report was evaluated with regard to quality, focusing on 2 critical methodological issues: (a) Internal validity – for clinical studies, we followed the Cochrane guidelines to determine the risk of bias in randomization/allocation (selection bias), blinding and control comparison (performance bias), and outcome assessment and reporting (attrition, measurement, and reporting biases). (b) Construct validity – we determined whether the operational criteria for mental disorder, vagus nerve stimulation, and trigeminal nerve stimulation were appropriate – i.e., whether each study fulfilled the following criteria: (i) clinical or preclinical studies that focused on transcutaneous cranial nerve stimulation; (ii) articles on mental disorders.

QUANTITATIVE ANALYSIS Anticipating that there would be few studies and that between-study heterogeneity would be important, our initial aim was not to perform a quantitative analysis, such as meta-analysis and meta-regression. Instead, we reviewed the main findings of the studies and addressed their limitations.

STUDIES OVERVIEW ELIGIBILITY CRITERIA We adopted the following inclusion criteria: (a) manuscript written in English, Spanish, or Portuguese; and (b) clinical trials; interventional studies; preclinical studies.

Our initial search yielded 389 references, 288 of which were initially excluded, based on eligibility criteria, leaving 101 articles. In a subsequent analysis 71 references were excluded after the abstracts were reviewed. Ultimately, 13

Pedro Shiozawa et al. Vagus and trigeminal stimulation

543

studies were included: 9 on TNS (5 clinical trials, n=41 subjects and 4 preclinical studies, i.e, studies evaluating the effects of TNS over animal models) and 4 clinical studies (n=84 subjects) on tVNS.

TRIGEMINAL NERVE STIMULATION The initial animal studies of TNS focused on epilepsy. First, experimental models were based on pentylenetetrazole-induced seizure in conscious adult rats. This chemical causes a generalized tonic-clonic seizure with a 4-second period at a frequency of 4 per minute for approximately 2 hours. After the drug was administered, TNS was performed, reducing seizure activity in the thalamus and neocortex. The clinical response of TNS depends on the stimulus frequency and intensity [9]. In humans, TNS is performed through electric stimulation at 120 Hz with a pulse wave duration of 250 microseconds and cycle of 30 seconds. Electrical stimuli creates an asymmetrical biphasic pulse wave, adjustable from 0 to 100 mAs. In an open-label study (n=07), DeGiorgio et al. evaluated the efficacy of TNS in epilepsy. Fifty-seven percent of the sham experienced a $50% reduction in seizures after TNS. This pilot exploratory study indicated that transcutaneous stimulation of the supraorbital and infraorbital divisions of the trigeminal nerve was safe and well tolerated for the 3and 6-month treatment periods10. In a 12-month follow-up open-label trial (n=14), the authors reported a satisfactory result of TNS for epilepsy, which effected a mean reduction in seizure frequency of 66% after 3 months, 66% at 6 months, and 56% at 12 months11. Some years later, this group published another open-label exploratory study on external TNS in 14 subjects, focusing on its side effects. Supraorbital and infraorbital TNS was well tolerated, and there were no significant acute or long-term adverse effects on heart rate or systolic or diastolic blood pressure and no major clinical side effects12. There are few publications on the use of TNS for psychiatric disorders. In a recent analysis, TNS was concluded to be a valuable and promising adjuvant to the current therapeutic management of depressive disorders7. In a recent study, Shraeder et al. described 5 patients (60% female; mean age 49.6 years) with treatment-resistant depression who received TNS over an 8-week follow-up7. Subjects had electrodes (Superior Silver 1.25-in. diameter, Tyco) placed on their foreheads to stimulate the V1 branches of the trigeminal nerve bilaterally for approximately 8 hours each night (8 weeks; ~55 nights). Current was adjusted to maintain comfortable but perceptible levels of stimulation (EMS7500 Stimulator, TENS Products, Inc. Granby, CO, USA). As a result, remission rates of depressive symptoms reached 70% in the 2-month follow-up.

544

Arq Neuropsiquiatr 2014;72(7):542-547

TNS has been generally well tolerated in research protocol studies13. Side effects are infrequent, transient, and mild and include skin irritation, tingling, forehead pressure, and headache. DeGiorgio et al. reported no effects by electrocardiograph with regard to heart rate or systolic or diastolic blood pressure and conclude that it was safe hemodynamically11.

TRANSCUTANEOUS VAGUS NERVE STIMULATION (TVNS) Stefan and colleagues verified the efficacy of tVNS in resistant epilepsy in 10 patients. In this open-label trial, 5 of 7 patients experienced a decrease in seizure frequency after a 9-month follow-up14. The safety of tVNS has been reported in phase I trials15,16,17,18,19. A recent randomized controlled pilot study15 showed for the first time an antidepressant effect of a non-invasive auricular electrical nerve stimulation. A total of 37 patients suffering from major depression were included in two randomized sham controlled add-on studies, and the patients were stimulated five times a week on a daily basis for the duration of 2 weeks. The antidepressant effect measured by the beck depression inventory (BDI) was very significant: Patients treated with tVNS gained 12.6 (standard deviation (SD) 6.0) points, compared to 4.4 (SD 9.9) points of the sham-stimulated patients (Tables 1 and 2).

STUDY ANALYSIS Our literature review comprised 9 clinical and preclinical studies on TNS and 4 clinical studies on tVNS per the study design. The relative lack of data reflects the recent development of these interventions and the need for consistent interventional studies to determine their clinical value and limitations. We retrieved 4 preclinical and 5 clinical studies on TNS. All clinical data were based on open-label studies with small samples (total of 44 patients in the clinical studies), which precluded the use of TNS as a tool for clinical practice. There were 4 clinical studies on tVNS (total of 84 patients – 3 assessed physiological features in healthy volunteers and 1 examined epilepsy patients. One study was a crossover design, and the remaining trials were open-label studies, which also compromised their conclusions and analysis.

ANATOMICAL CONSIDERATIONS The basis for using cranial nerve stimulation as an “add-on” therapy for psychatric disorders underscore the

Table 1. Overview of data extraction and quality assessment - Clinical Studies trigeminal enrve stimulation. Study Diagnosis / Subjects Intervention design assessment

Authors DeGiorgio, 2006 Pop, 2011

DeGiorgio, 2009 Schraeder, 2011 DeGiorgio, 2003

Open Label Study Open Label Study Open Label Study Open Label Study Open Label Study

Epilepsy; Clinical assessment Epilepsy; Clinical assessment Epilepsy; Clinical assessment TRD / IDC-10; HDRS; BDI

Epilepsy; Clinical assessment

TNS

Main Outcome

Biases Sumary

57% of the sample experienced a $50% reduction in seizures after TNS intervention. No signicant acute or long-term major adverse effects.

Small sample size, poor demographical sample description, low impact of results generalizability. Small sample size, poor demographical sample description, low impact of results generalizability. Mean seizure frequency Small sample size, poor demographical reduction: 66% (3 m); sample description, low impact of 56% (6 m) and 59% (12 m). results generalizability. Significant decreases in symptom Small sample size, low impact of severity were observed over results generalizability. 8 weeks. TNS was well tolerated and patients Small sample size, low impact of reported reductions in seizures results generalizability. during stimulation.

importance of clearly understanding neuroanatomic pathways related to the stimulated nerve. The trigeminal nerve is 1 of the 12 pairs of cranial nerves and has motor and sensory function. It originates from a motor nucleus and 3 sensory nuclei that extend throughout most of the length of the brain stem. The vagus nerve comprises motor and sensory fibers. The filaments of this nerve unite and form a flat cord that passes beneath the flocculus to the jugular foramen, through which it leaves the cranium. The vagus and trigeminal nerves project directly to serotoninergic and noradrenergic neurons in the brain, which generate specific neurotransmitters (serotonin and noradrenaline) that are linked to many neuropsychiatric disorders, such as mood and anxiety disorders. Other vagal and trigeminal neuronal projections are directed toward central brain stem structures, such as the nucleus solitarius, locus

coeruleus, and reticular formation, and to other limbic, sensory, cortical, and subcortical areas, such as the locus coeruleus, orbitofrontal cortex, insula, hippocampus, and amygdala. The propagation of electric stimuli through these neuronal projections from peripheral sites to the central nervous system has been proposed to constitute the neurobiological basis of central nervous system (CNS).

THE â&#x20AC;&#x153;BOTTOM-UPâ&#x20AC;?MECHANISM In current neuromodulation scenario, clinical results have been working as trully hypothesis driven forces, i.e., empirical observation and data analysis from different studies have been highlighting possible mechanisms related to the neurobiological functioning of neuromodulation

Table 2. Overview of data extraction and quality assessment - Clinical Studies trigeminal vagus nerve stimulation. Study design

Subjects

Busch, 2012

Crossover

Health volunteers; study on pain physiology

tVNS

Stefan, 2012

Open Label Study

Pharmacoresistant Epilepsy; Clinical assessment

tVNS

Dietrich, 2008

Open Label Study

tVNS

Kraus, 2007

Open Label Study

Hein, 2013

Doubleblinded sham controled trial

Health volunteers; neuroimaging study on brain activation patterns Health volunteers; neuroimaging study on brain activation patterns Patients with depressive disorder

Authors

Diagnosis / assessment

Intervention

tVNS

Main Outcome

Biases Sumary

tVNS was related to an increase Small sample size, poor in mechanical and pressure demographical sample pain threshold and a reduction description, low impact of of mechanical pain sensitivity. results generalizability. 7 patients concluded the trial and Small sample size, poor presented an overall reduction demographical sample of 71.4% of seizure frequency description, low impact of after a 9-month follow up. results generalizability. A positive fMRI BOLD response Small sample size, poor was detected during stimulation demographical sample in different brain areas. description, low impact of results generalizability. fMRI BOLD-signal decreases in Small sample size, low impact of results limbic brain areas. Increased activation was seen in the insula, generalizability. precentral gyrus and the thalamus. Small sample size, low In contrast to sham-treated impact of results patients, electrically stimulated persons showed a significantly generalizability. better outcome in the BDI.

Pedro Shiozawa et al. Vagus and trigeminal stimulation

545

strategies. The precise mechanisms by which CNS exerts its effects remain unknown. Empirical evidence has been reported, suggesting that CNS causes long-term neuroplasticity in the brain. Two chief explanations have been hypothesized for the effects of TNS, primarily from preclinical research. First, neuronal firing is suppressed during TNS in rats as soon as nerve stimulation begins20. Further, in humans, tVNS and TNS are typically provided on a continuous fixed-duty cycle, and in animal studies, there is a period during which the seizure threshold increases after each “on” cycle terminates8. There might also be effects of cranial nerve stimulation that last from tens of seconds to minutes and outlast the period of nerve stimulation. In addition, there appear to be long-term effects of cranial nerve stimulation that tend to decrease in over months to years15,16,17. Electric stimulation provides direct modulatory effects in subcortical sites, i.e, there are changes in cortical excitability. Neuroimaging studies corroborate these effects, showing neuronal activity changes in certain sites of brain, such as the amygdala, insula, precentral gyrus, hippocampus, and thalamus4,5,16,21. These neuroanatomical connections have been linked to the “bottom-up” mechanism of modulation by CNS9. According to this hypothesis, the propagation of electric stimuli follows an inverse path from peripheral nerves toward the brain stem and central structures, as discussed. The centrifuges electric propagation throughout neurons contrasts with the well-known “top-down” mechanism of other modulation strategies, such as electroconvulsive therapy and transcranial magnetic stimulation, in which the stimulus acts first on central brain structures, with propagation later to peripheral sites.

SUMMARY OF CURRENT CLINICAL USE OF TVNS AND TNS Both TNS and tVNS are performed by the placement of a bipolar electrode transcutaneously over superficial branches of either trigeminal or vagus nerve, which results in further dissemination of a low-frequency electric pulse from the nerve toward the central nervous system. Electric stimulation of the nerve has direct modulatory effects in subcortical sites. The use of cranial nerve stimulation in current psychiatric practice is sparse and still limited to a few research protocols. TNS an tVNS are recent interventions that causes minor adverse effects. A relevant feature is their transcutaneous-based stimuli, which stands for a non invasive procedure.

FINAL REMARKS TNS and tVNS are techniques that, despite their recent development, have ellected satisfactory outcomes in the past decade, which have engendered further research in many clinical situations. Additional controlled studies are needed to overcome the difficulties of standardizing and disseminating the technique. Long-term clinical outcomes and new applications for these techniques in other neuropsychiatric disorders will be invaluable in clinical practice. TNS and tVNS improve treatment of particular neuropsychiatric disorders such as depression, and their development will allow clinicians to intervene in neuroplasticity and neuromodulation.

References 1.

Krishnamoorthy ES. Treatment of depression in patients with epilepsy: problems, pitfalls, and some solutions. Epilep Behavn 2003;4(Suppl):S46-S54.

Schrader LM, Cook IA, Miller PR, Maremont ER, DeGiorgio CM, Trigeminal nerve stimulation in major depressive disorder: first proof of concept in an open pilot trial. Epilep Behav 2011;22:475-478.

Howland RH, Shutt LS, Berman SR, Spotts CR, Denko T. The emerging use of technology for the treatment of depression and other neuropsychiatric disorders. Ann Clin Psychiatry 2011;23:48-62.

Moher D, Liberati A, Tetzlaff J, Altman DG. Preferred reporting items for systemtic reviews and meta-analyses: the PRISMA statement. PLos Med 2009;6:10000097.

Loo C, Katalinic N, Mitchell PB, Greenberg B. Physical treatments for bipolar disorder: a review of electroconvulsive therapy, stereotactic surgery and other brain stimulation techniques. J Affect Disord 2011;132:1-13.

Fanselow EE, Reid A, Nicolelis AL. Reduction of pentylenetetrazole induced seizure activity in awake rats by seizure-triggered trigeminal nerve stimulation. J Neurosci 2000;20:8160-8168.

10.

Mohr P, Rodriguez M, Slavoveçkov A, Hanka J. The application of vagus nerve stimulation and deep brain stimulation indepression. Neuropsychobiology 2011;64:170-181.

DeGiorgio CM, Shewmon DA, Whitehurst T. Trigeminal nerve stimulation for epilepsy. Neurology 2003;61:421-422.

11.

DeGiorgio C, Murray D, Markovic D Whitehurst T. Trigeminal nerve stimulation for epilepsy: long-term feasibility and efficacy. Neurology 2009;72:936-938.

12.

Pop J, Murray D, Markivic D, DeGiorgio CM. Acute and long-term safety of external trigeminal nerve stimulation for drug-resistant epilepsy. Epilep Behav 2011;22:574-576.

13.

DeGiorgio CM, Shewmon DA, Murray D, Whitehurst T. Pilot study of trigeminal nerve stimulation (TNS) for epilepsy: a proof-of-concept trial. Eplepsia 2006;47:1213–1215.

546

Brunoni AR, Teng CT, Correa C, et al. Neuromodulation approaches for the treatment of major depression: challenges and recommendations from a working group meeting. Arq Neuropsiquiatr 2010;68:433-451. Daban C, Martinez-Aran A, Cruz N, Vieta E. Safety and efficacy of vagus nerve stimulation in treatment-resistant depression. A systematic review. J Aff Disord 2008;110:1-15

Arq Neuropsiquiatr 2014;72(7):542-547

14.

Stefan H, Kreiselmeyer G, Kerling F, et al. Transcutaneous vagus nerve stimulation (t-VNS) in pharmacoresistant epilepsies: a proof of concept trial. Epilepsia 2012;53:115-118.

18.

Andrade P, Noblesse LH, Temel Y, et al. Neurostimulatory and ablative treatment options in major depressive disorder: a systematic review. Acta Neurochir (Wien) 2010;152:565-577.

15.

Kraus T, Hรถsl K, Kiess O, Schanze A, Kornhuber J, Forster C. BOLD fMRI deactivation of limbic and temporal brain structures and mood enhancing effect by transcutaneous vagus nerve stimulation. J Neural Transm 2007;114:1485-1493.

19.

Busch V, Zeman F, Heckel A, Menne F, Ellrich J, Eichhammer P. The effect of transcutaneous vagus nerve stimulation on pain perception: an experimental study. Brain Stimul 2013;6:202-209.

20.

16.

Dietrich S, Smith J, Scherzinger C, et al. A novel transcutaneous vagus nerve stimulation leads to brainstem and cerebral activations measured by functional MRI. Biomed Tech (Berl) 2008;53:104-111.

Morris GL 3rd, Mueller WM. Long-term treatment with vagus nerve stimulation in patients with refractory epilepsy. The Vagus Nerve Stimulation Study Group E01-E05. Neurology 1999;53:1731-1735.

17.

Revesz D, Tjernstrom M, Ben-Menachem E, et al. Effects of vagus nerve stimulation on rat hippocampal progenitor proliferation. Exp Neurol 2008;214:259-265.

21.

Schlaepfer TE, George MS, Mayberg H. WFSBP Guidelines on brain stimulation treatments in psychiatry. WFSBP task force on brain stimulation. World J Biol Psychiatry 2010;11:2-18.

Pedro Shiozawa et al. Vagus and trigeminal stimulation

547

REVIEW ARTICLE

Surgically implanted and non-invasive vagus nerve stimulation: a review of efficacy, safety and tolerability E. Ben-Menachema, D. Revesza, B. J. Simonb and S. Silbersteinc a

Institution of Clinical Neuroscience and Physiology, Sahlgrenska Academy, G€ oteborgs University, G€ oteborg, Sweden; belectroCore LLC, c Basking Ridge, NJ; and Jeﬀerson Headache Center, Thomas Jeﬀerson University, Philadelphia, PA, USA

EUROPEAN JOURNAL OF NEUROLOGY

Keywords:

depression, epilepsy, headache, implantable, migraine, safety, transcutaneous, vagus nerve stimulation Received 16 June 2014 Accepted 27 October 2014 European Journal of Neurology 2015, 22: 1260–1268 doi:10.1111/ene.12629

Vagus nerve stimulation (VNS) is effective in refractory epilepsy and depression and is being investigated in heart failure, headache, gastric motility disorders and asthma. The first VNS device required surgical implantation of electrodes and a stimulator. Adverse events (AEs) are generally associated with implantation or continuous on off stimulation. Infection is the most serious implantation-associated AE. Bradycardia and asystole have also been described during implantation, as has vocal cord paresis, which can last up to 6 months and depends on surgical skill and experience. The most frequent stimulation-associated AEs include voice alteration, paresthesia, cough, headache, dyspnea, pharyngitis and pain, which may require a decrease in stimulation strength or intermittent or permanent device deactivation. Newer noninvasive VNS delivery systems do not require surgery and permit patientadministered stimulation on demand. These non-invasive VNS systems improve the safety and tolerability of VNS, making it more accessible and facilitating further investigations across a wider range of uses.

Introduction Vagus nerve stimulation (VNS) is a viable treatment option in refractory epilepsy and depression [1]. Until recently, all VNS therapy required surgical implantation of electrodes (around the cervical vagus nerve) connected to a stimulating device implanted under the anterior chest wall [1,2]. Implantable VNS is safe and well tolerated [1], but adverse events (AEs) are associated with both the surgical procedure and the electrical stimulation itself [1,3]. Subsequently, noninvasive VNS (nVNS) delivery options that eliminate the need for surgical implantation were developed. These alternative VNS delivery systems avoid surgery-related AEs (e.g. infection, cardiac events) and may limit AEs related to the continuous on oﬀ stimulation cycle of implantable devices, since nVNS devices can be adjusted to balance eﬃcacy and tolerability [4,5]. Correspondence: Elinor Ben-Menachem, MD, PhD, Institution of Clinical Neuroscience and Physiology, Sahlgrenska Academy, G€ oteborgs University, 413 45 G€ oteborg, Sweden (tel.: +46 31 342 1456; fax: +46 31 8214 524; e-mail: ebm@neuro.gu.se; elinor.benmenachem@neuro.gu.se).

This review provides a summary of the eﬃcacy, safety and tolerability of VNS delivery systems including both surgically implantable VNS and newer devices in development that deliver VNS non-invasively.

Vagus nerve function and anatomic connections The vagus (tenth cranial) nerve is a mixed parasympathetic nerve, containing both afferent and efferent sensory fibers. An estimated 80% of vagus nerve fibers are afferent and convey visceral, somatic and taste sensations (Fig. 1) [6–9]. The vagus nerve is subdivided into five groups: (1) special visceral afferents, (2) general visceral afferents, (3) general somatic afferents, (4) special visceral efferents and (5) general visceral efferents [10]. Thorough reviews of vagus nerve anatomy and function have been discussed previously [11,12]. The vagus nerve connections allow it to modulate the function of higher brain centers, forming the basis for its potential use in many disorders.

© 2015 The Authors. European Journal of Neurology published by John Wiley & Sons Ltd on behalf of European Academy of Neurology. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

1260

EFFICACY AND SAFETY OF VNS MODALITIES

1261

Figure 1 Vagus nerve innervation. (Reprinted with permission from Massey [9]).

Effectiveness of implantable VNS VNS Therapy system

Early animal studies supported VNS effectiveness in human epilepsy [13–16]. Clinical studies of the implantable VNS Therapy system (Fig. 2a; Cyberonics, Inc., Houston, TX, USA) in refractory epilepsy demonstrated 50% seizure reduction in 24.5%–46.6% of patients [2,17,18]. The VNS Therapy system was approved for the treatment of medically refractory epilepsy in Europe in 1994 and in the USA and Canada in 1997. As of August 2014, over 100 000 VNS devices were implanted in more than 75 000 patients worldwide [19]. Mood improvements observed in patients who received implantable VNS for refractory epilepsy [20,21] led to investigations of treatment-resistant depression. A large sham-controlled, 10-week trial in treatment-resistant depression failed to find a statistical difference between the two treatments in terms of the 24-item Hamilton Depression Rating Scale (HRSD24) response [22]. However, a 1-year open-label extension (n = 205) found that the HRSD24 score improved significantly by 0.45 (standard error = 0.05) points per

month (repeated measures t = 8.25, degrees of freedom 654, P < 0.001) [23]. This led to US Food and Drug Administration (FDA) approval of implantable VNS for the adjunctive, long-term treatment of chronic or recurrent depression in patients at least 18 years of age who are experiencing an episode of major depression and have not had an adequate response to four or more antidepressant treatments [24]. Implantable VNS provided efficacy benefits in small studies in refractory migraine and cluster headache (CH) [25,26], heart failure [27], Alzheimer’s disease [28,29], treatment-resistant anxiety disorders [30] and obesity [31]. The exact mechanism by which VNS provides benefit across these widely different conditions is unknown. The diverse therapeutic potential of VNS, along with the AEs, cost and limited accessibility associated with implantable VNS, led to the development of new nVNS modulators that do not require surgery. Safety and tolerability associated with the surgically implanted VNS Therapy system can be divided into two classes: device implantation related and VNS stimulation related [1,3]. The most frequent surgical AEs include infection (3%–6% of patients), vocal cord paresis, lower facial

1262

E. BEN-MENACHEM ET AL.

weakness and, infrequently, bradycardia and asystole [32]. Infection rarely prompts device removal [33]. Vocal cord paresis and lower facial weakness have occurred in about 1% of patients each [32,33]. With surgical technique improvements, permanent voice alterations and lower facial weakness have become rare. Depending on the duration of use, replacement of the stimulus generator battery will be required, necessitating additional surgery. Stimulation-related AEs in refractory epilepsy and depression were similar and most frequently included voice alteration, cough, dyspnea, paresthesia, headache and pain (Table 1) [3]. The frequency of these AEs declines with continued treatment [34]. For example, voice alteration was present in 62% of patients (a)

with epilepsy receiving VNS at 3 months but in only 18.7% of patients at 5 years [3]. Cardiac AEs associated with implantable VNS devices mainly occur in the operating room during initial device testing. These include bradycardia, ventricular asystole and complete heart block [35–38]. Only rarely have these emerged years after VNS initiation. One patient developed bradyarrhythmia characterized by sudden falls, pallor and unconsciousness lasting <10 s that occurred for the ﬁrst time 2 years after VNS initiation. The attacks occurred during stimulation and stopped when the VNS device was turned oﬀ [39]. Another report described intermittent self-terminating complete heart block occurring every 15– 25 min and lasting 20–40 s that occurred 6.5 years after the implantation of a VNS device for the treatment of epilepsy [40]. A third case reported periodic asystole 9 years after implantation [41]. VNS is not associated with central nervous system AEs such as fatigue, psychomotor retardation, cognitive dysfunction or suicidal ideation in patients with epilepsy. One suicide and seven suicide attempts in six patients occurred in the pivotal implantable VNS trial [23] in treatment-resistant depression. No teratogenicity has been observed [42,43]. Patients treated with implantable VNS have noted improvements in feelings of well-being, alertness, memory and thinking skills, as well as mood. CardioFit

(b)

Figure 2 Implantable VNS systems: (a) VNS Therapy system and (b) CardioFit. (Reprinted with permission from (a) Cyberonics, Houston, TX, USA, and (b) BioControl Medical, Yehud, Israel).

CardioFit (BioControl Medical Ltd., Yehud, Israel) (Fig. 2b) is an implantable VNS device being investigated in heart failure acting by preferential activation of vagal efferent fibers [44]. The rationale of this approach has been reviewed elsewhere [45,46]. The stimulation is designed to correct the autonomic imbalance (sustained sympathetic overdrive and parasympathetic withdrawal) that is maladaptive in heart failure [27,45]. An initial feasibility study evaluated the safety of CardioFit in eight patients with New York Heart Association (NYHA) class II–III heart failure over 6 months [27]. CardioFit stimulation provided statistically significant improvements in NYHA II–III heart failure, especially at months 1 and 3 (P < 0.01), reduced left ventricular end systolic volume (P = 0.03) and improved 6-min walking test (P = 0.04) and Minnesota quality of life measure (P = 0.001). Mild, transient voice alteration was the only implantation-associated event [27]. Stimulation-associated AEs included cough (n = 4), pain at stimulation site (n = 4), mandibular pain (n = 3) and voice alteration (n = 2). No AEs were severe; all resolved with continued treatment [27].

EFFICACY AND SAFETY OF VNS MODALITIES

Table 1 Adverse events (%) reported in clinical trials of the VNS Therapy system in patients with epilepsy or depression (reprinted with permission from Ben Menachem [3]) 3 months Adverse event Cough Voice alteration Dyspnea Pain Paresthesia Headache Pharyngitis Depression Infection Deaths

Epilepsy

Depression

12 months Epilepsy

21 62

15 55

16 17 25 20 9 3 4

23 27 30

13 15 15 16 10 5 6 2 patients (1 SUDEP, 1 pneumonia)

5-year follow-up Epilepsy 1.5 18.7 2.3 4.7 1.5 – – – – 4 patients (1 SUDEP, 3 status epilepticus)

SUDEP, sudden, unexpected, unexplained death in epilepsy.

Subsequently, a phase 2 open-label, 6-month study (n = 32) in patients with NYHA II–IV heart failure had similar findings. Statistically significant effects were found between baseline and 6-month follow-up for NYHA class improvement (P < 0.001), 6-min walking (P = 0.0014), quality of life (P = 0.0001), left ventricular ejection fraction (P = 0.0003) and left ventricular end systolic volume index (P = 0.02). In total, 26 serious AEs (SAEs) occurred in 13 patients. Two SAEs (acute pulmonary edema; surgical revision necessitated by a loose electrode connector on the stimulus generator) were implantation related [47]. A third SAE, an episode of syncope associated with new onset atrial fibrillation and hypotension, was felt to be possibly related to the system. Other SAEs possibly related to the procedure or the system included syncope facilitated by dehydration (two episodes) or new onset atrial fibrillation and hypotension (one episode), and atrial fibrillation (two episodes in the same patient; one episode recurred after cardioversion) [47].

Effectiveness of non-invasive VNS devices NEMOS

NEMOS (Cerbomed, Erlangen, Germany) is an external device that provides transcutaneous VNS (tVNS) by using a dedicated intra-auricular electrode (like an earphone) which stimulates the auricular branch of the vagus nerve (Fig. 3a) [48]. In 2010, the device received the European clearance (CE mark) for epilepsy and is available in Germany, Austria, Switzerland and Italy. The patient controls VNS stimulation intensity within a deﬁned range and self-treatment sessions lasting

1263

1–4 h three to four times daily and as necessary (e.g. before a seizure) are recommended. Users adjust the current until they feel a slight discomfort or tingling sensation at the stimulation site [48]. A proof-of-concept study of NEMOS tVNS enrolled 10 patients with pharmacoresistant epilepsy who received treatment three times daily (1 h each) for 9 months [49]. Three patients discontinued [49]. Five of the seven patients who continued reported reductions in seizure frequency, but none reached the 50% reduction threshold for response. Two patients reported increased seizure frequency that remained constant over the entire study duration [49]. In another study in healthy volunteers (n = 48), tVNS increased mechanical and pressure pain threshold, reduced mechanical pain sensitivity and lowered pain ratings during sustained application of painful heat compared with sham treatment [50]. There were no clinically relevant AEs. Napadow et al. [51] compared the effect of NEMOS stimulation to non-vagal auricular stimulation in patients (n = 18) with chronic pelvic pain. Although a numerical reduction in evoked pain intensity and temporal summation of mechanical pain was observed with NEMOS, the differences were not significant between the two methods. Anxiety was significantly reduced with NEMOS stimulation vs. non-vagal auricular stimulation. No significant effect of stimulation, time or interaction on heart rate or heart rate variability (P > 0.7) or on respiratory rate (P > 0.8) was observed. gammaCore

gammaCore (electroCore LLC, Basking Ridge, NJ, USA) is a handheld, self-contained nVNS device under investigation for headache, epilepsy and gastrointestinal disorders. It consists of a portable stimulator with a battery, signal-generating and -amplifying electronics and a digital control user interface that controls signal amplitude (Fig. 3b). Two stainless steel round discs function as skin contact surfaces that deliver a proprietary, low-voltage electrical signal to the cervical vagus nerve. The device delivers a programmable number of stimulation cycles, each lasting 120 s [52]. Evidence for gammaCore nVNS eﬃcacy comes from small studies in intractable CH [53], episodic migraine [54] and chronic migraine [55]. In CH, gammaCore nVNS delivered both acutely for CH attacks and as a twice-daily preventive treatment (median 12 weeks) was tested over a median of 12 weeks in 31 evaluable adults (12 with chronic CH, 10 as medically intractable CH, and nine with episodic CH). Overall, 18 of 21 patients reported improvement (51% mean improvement from baseline) and three reported no

1264

E. BEN-MENACHEM ET AL.

An open-label pilot study [4] of gammaCore nVNS in episodic migraine (n = 30) investigated applying two 90-s stimulations administered 15 min apart during migraine. Overall, 27 patients treated 80 migraines. Of 19 patients with moderate or severe pain at the time of treatment of their first attack, nine (47%) reported pain relief and four (21%) reported being pain free 2 h after treatment. In 54 migraine attacks that were moderate to severe at the time of treatment, 2-h pain relief was achieved in 23 (43%) attacks and 2-h pain-free status was achieved in 12 (22%). Treatment-related AEs, all mild or moderate, included transient muscle stiffness/pain (n = 7) and dizziness (n = 2); all AEs except one (neck stiffness treated with a nonsteroidal anti-inflammatory drug) resolved without treatment [4]. Moscato and Moscato [55] evaluated 73 patients with chronic migraine, 19 of whom had moderate to severe migraine pain with nausea, phonophobia and photophobia at the time of evaluation and received gammaCore nVNS in two 90-s treatments administered 15 min apart. At 2 h, mean visual analog scale pain scores were significantly reduced from baseline (P < 0.05); nine of 19 patients were pain free, six had reduced pain and four remained unchanged. AEs included two reports of brief paresthesia, which resolved within a few minutes [55]. gammaCore is now being evaluated in four multicenter, randomized, controlled trials in the EU and North America in primary headache disorders; to date, no significant serious device-related AEs have been reported. Table 2 summarizes the clinical studies of new implantable and non-implantable VNS devices covered in this review [4,27,47,49,50,52,53,55–58].

(a)

(b)

Discussion

Figure 3 Non-implantable VNS systems: (a) NEMOS (tVNS) and (b) gammaCore (nVNS). (Reprinted with permission from (a) Cerbomed, Erlangen, Germany, and (b) electroCore, Basking Ridge, NJ, USA).

change. Seventeen were able to stop, reduce or signiﬁcantly reduce their prior abortive treatment use [53]. AEs included local discomfort, a mild skin irritation secondary to the conductive gel and worsening of pain in one subject [52].

safety and tolerability

VNS is well tolerated in the treatment of refractory epilepsy and depression [1]. Most AEs resolve after 1– 2 years of continued treatment [3]. Implantable VNS is associated with surgically related AEs, such as infection and dysrhythmias; stimulation-associated AEs include cough, paresthesia, pain and voice alteration, which generally decrease in prevalence over time. Voice alteration, a common and particularly disturbing AE that may continue in nearly 20% of patients at 5 years, may be a consequence of the continuous on oﬀ stimulation cycle seen with implantable VNS and is stimulus dose dependent. nVNS devices could be expected to provide an improved safety proﬁle because they do not require surgical implantation and provide shorter durations of stimulation compared with the constantly cycling stimulation with implantable VNS.

Indication studied

Severe congestive heart failure

Chronic heart failure

Refractory focal epilepsy

Pharmacoresistant epilepsy

Healthy volunteers

Major depression

Reference

Schwartz et al. [27]

De Ferrari et al. [47]

Ben-Menachem et al. [57]

Stefan et al. [49]

Busch et al. [50]

Hein et al. [58]

32 (8 from feasibility phase [27] and 24 from multicenter international phase [47])

15 min once or twice daily, 5 day/week for 2 weeks; bilateral transauricular vagus nerve

Stable stimulation duration of ~1 h; left auricular branch of vagus nerve

12–15 months after implantation: amplitude was 1.5–2.0 mA, frequency was 20 Hz, duty cyclea was 30 s on, 1.8–3 min oﬀ (14.3%–20.3%) with a pulse width of 0.3 ms and a quasi-trapezoidal pulse shape; left cervical vagus nerve 3 times daily (1 h each) for 9 months; left auricular branch of vagus nerve

Duty cyclea ≤25% (e.g. maximum 10 s on, 30 s oﬀ) for 6 months; right cervical vagus nerve

2–10 s on, 6–30 s oﬀ for 6 months; right cervical vagus nerve

Stimulation schedule; location

Signiﬁcant reduction (P < 0.0001) in Beck Depression Inventory (self-report) but not in clinician-rated Hamilton Depression Rating Scale between active and sham treatments

50% reduction threshold not reached; seizure frequency was reduced by 45% and 48% in 2 patients and increased in 2 patients tVNS increased pain threshold and lowered pain sensitivity and pain ratings

(continued)

3 patients discontinued; AEs included hoarseness, headache and constipation No discontinuations or SAEs; AEs included stimulation site sensations of slight pain, pressure, prickling, itching or tickling in 39 patients with active stimulation No vital sign changes; no unpleasant sensations or irritations

Implantation-related AE: voice alteration (hoarseness) Stimulation-related AEs: cough; pain at stimulation site, mandible and ear; voice alteration Implantation-related SAEs: acute pulmonary edema (1 event), surgical revision (1 event) Other possibly related SAEs: dehydration-related syncope (2 events); syncope resulting from new-onset atrial fibrillation and hypotension; atrial fibrillation (2 events; 1 was a return to atrial fibrillation after cardioversion) AEs: pain at site of stimulation (n = 6), cough (n = 5), dysphonia (n = 4), mandibular pain (n = 3) and ECG stimulus artifact (n = 1) Cough and/or hoarseness not noted until stimulation of 2 mA reached

Signiﬁcant improvements in NYHA class (P < 0.01), QOL on Minnesota Living With Heart Failure questionnaire (P = 0.001), and left ventricular end systolic volume (P = 0.03) At 3 and 6 months: 56% and 59% of patients improved by ≥1 NYHA class (P ≤ 0.001) At 6 months: signiﬁcant improvements in 6-min walk test (P = 0.0014), QOL on Minnesota Living with Heart Failure questionnaire (P = 0.0001), LVEF (P ≤ 0.0003) and LVESVI (P = 0.02)

Seizure frequency reduction of 50% in 2 patients and 25% in 2 patients; rate unchanged in 1 patient

Safety/tolerability

Eﬃcacy

Table 2 Summary of clinical studies utilizing implantable or non-invasive VNS delivery cited in this review

EFFICACY AND SAFETY OF VNS MODALITIES

1265

AE, adverse event; CH, cluster headache; ECG, electrocardiogram; LVEF, left ventricular ejection fraction; LVESVI, left ventricular end systolic volume index; NYHA, New York Heart Association; QOL, quality of life; SAE, serious adverse event; tVNS, transcutaneous VNS; VNS, vagus nerve stimulation. a Duty cycle is the percentage of time that stimulation is on.

19 Chronic migraine Moscato and Moscato [55]

Two 90-s stimulations 15 min apart; location not reported

30 Episodic migraine Goadsby et al. [4]

Two 90-s stimulations 15 min apart; right cervical vagus nerve

AEs included worsening of pain in 1 patient; skin irritation, local skin reaction to conductive gel

Overall improvement: estimated subjective improvement of 51% in 18 patients; no change in 3 patients Abortive treatment: 47% of acute attacks were terminated and 27% substantially improved in 15 min Preventive treatment: reduction in 24-h attack frequency (4.68 2.36 to 2.54 2.12; P < 0.0005) Pain relief noted at 2 h for 46 of 79 migraines (58%) treated by 26 patients; 2-h pain free rate was 28% Reduction (P < 0.05) in mean pain scores in overall group at 2 h; 9 patients were pain free, 6 had reduced pain and 4 were unchanged at 2 h 21 Intractable CH Nesbitt et al. [52,53]

Acute stimulation of 2–4 cycles (90 s each) to abort CH attacks and twice daily as preventive; cervical vagus nerve, ipsilateral to pain

Safety/tolerability Eﬃcacy n Indication studied Reference

Table 2 (Continued)

AEs included transient muscle or local skin irritation and 2 reports of light-headedness 2 brief episodes of paresthesia

E. BEN-MENACHEM ET AL.

Stimulation schedule; location

1266

Efficacy could not be compared between these modalities at the time of this review because of the different stages of development of the various delivery systems. One consistent observation, however, is that efficacy and possible AEs, at least for epilepsy and depression, improve with time over a period of about 18 months [23,32,34,59–61]. Implanted VNS devices are currently approved for the treatment of refractory epilepsy and depression; past and ongoing investigations in other indications have provided signals of the therapeutic potential in a wide variety of conditions. AEs, amongst other factors stemming from the surgical procedure, are negative aspects of implantable VNS and could be eliminated entirely through the use of nVNS delivery devices. The less frequent stimulation schedules used with nVNS may reduce the overall incidence of stimulation-associated AEs. Without a requirement for an expensive and potentially risky surgical procedure, nVNS may facilitate the earlier use of therapeutic VNS without the prerequisite of achieving a ‘treatment-refractory’ status in the condition of interest. Results from ongoing clinical studies are awaited to help inform appropriate use.

Acknowledgements Medical writing support was provided by John H. Simmons, MD, of Peloton Advantage, LLC, and funded by electroCore LLC.

Disclosure of conflicts of interest Dr Ben-Menachem reports serving on an advisory board for electroCore and as a consultant for Bial, BioControl, Esai, UCB Pharma; she also serves as an editor of Acta Neurologica Scandinavica. Dr Revesz has no conﬂict of interest related to the content of this article. Dr Silberstein reports serving on an advisory board for electroCore. Dr Simon reports being an employee of electroCore and has numerous issued patents and pending patent applications related to the gammaCore device.

References 1. Beekwilder JP, Beems T. Overview of the clinical applications of vagus nerve stimulation. J Clin Neurophysiol 2010; 27: 130–138. 2. Ben-Menachem E, Manon-Espaillat R, Ristanovic R, et al. Vagus nerve stimulation for treatment of partial seizures: 1. A controlled study of eﬀect on seizures. First International Vagus Nerve Stimulation Study Group. Epilepsia 1994; 35: 616–626. 3. Ben-Menachem E. Vagus nerve stimulation, side eﬀects, and long-term safety. J Clin Neurophysiol 2001; 18: 415–418.

EFFICACY AND SAFETY OF VNS MODALITIES

4. Goadsby P, Lipton R, Cady R, Mauskop A, Grosberg B. Non-invasive vagus nerve stimulation (nVNS) for acute treatment of migraine: an open-label pilot study [abstract S40.004]. Presented at Annual Meeting of the American Academy of Neurology, 16 23 March 2013, San Diego, CA. 5. Jurgens TP, Leone M. Pearls and pitfalls: neurostimulation in headache. Cephalalgia 2013; 33: 512–525. 6. Hatton KW, McLarney JT, Pittman T, Fahy BG. Vagal nerve stimulation: overview and implications for anesthesiologists. Anesth Analg 2006; 103: 1241–1249. 7. Krahl SE. Vagus nerve stimulation for epilepsy: a review of the peripheral mechanisms. Surg Neurol Int 2012; 3: S47–S52. 8. Foley JO, Dubois F. Quantitative studies of the vagus nerve in the cat, I: The ratio of sensory and motor studies. J Comp Neurol 1937; 67: 49–67. 9. Massey BT. Physiology of oral cavity, pharynx and upper esophageal sphincter. GI Motility Online 2006. http://www.nature.com/gimo/contents/pt1/full/ gimo2.html (accessed 09/26/2014). 10. Tewfik TL, Meyers AD. Vagus nerve anatomy. http:// emedicine.medscape.com/article/1875813-overview (accessed 01/29/2014). 11. Ruffoli R, Giorgi FS, Pizzanelli C, Murri L, Paparelli A, Fornai F. The chemical neuroanatomy of vagus nerve stimulation. J Chem Neuroanat 2011; 42: 288–296. 12. Berthoud HR, Neuhuber WL. Functional and chemical anatomy of the afferent vagal system. Auton Neurosci 2000; 85: 1–17. 13. Lockard JS, Congdon WC, DuCharme LL. Feasibility and safety of vagal stimulation in monkey model. Epilepsia 1990; 31 (Suppl. 2): S20–S26. 14. Woodbury DM, Woodbury JW. Effects of vagal stimulation on experimentally induced seizures in rats. Epilepsia 1990; 31 (Suppl. 2): S7–S19. 15. Woodbury JW, Woodbury DM. Vagal stimulation reduces the severity of maximal electroshock seizures in intact rats: use of a cuff electrode for stimulating and recording. Pacing Clin Electrophysiol 1991; 14: 94–107. 16. Zabara J. Inhibition of experimental seizures in canines by repetitive vagal-stimulation. Epilepsia 1992; 33: 1005–1012. 17. Vagus Nerve Stimulation Study Group. A randomized controlled trial of chronic vagus nerve stimulation for treatment of medically intractable seizures. Neurology 1995; 45: 224–230. 18. Uthman BM, Wilder BJ, Penry JK, et al. Treatment of epilepsy by stimulation of the vagus nerve. Neurology 1993; 43: 1338–1345. 19. Cyberonics Inc. 2013 Annual Report. http://ir.cyberonics.com/annuals.cfm (accessed 03/05/2014). 20. Elger G, Hoppe C, Falkai P, Rush AJ, Elger CE. Vagus nerve stimulation is associated with mood improvements in epilepsy patients. Epilepsy Res 2000; 42: 203–210. 21. Harden CL, Pulver MC, Ravdin LD, Nikolov B, Halper JP, Labar DR. A pilot study of mood in epilepsy patients treated with vagus nerve stimulation. Epilepsy Behav 2000; 1: 93–99. 22. Rush AJ, Marangell LB, Sackeim HA, et al. Vagus nerve stimulation for treatment-resistant depression: a randomized, controlled acute phase trial. Biol Psychiatry 2005; 58: 347–354. 23. Rush AJ, Sackeim HA, Marangell LB, et al. Effects of 12 months of vagus nerve stimulation in treatment-resis-

24.

25.

26.

27.

28.

29.

30.

31.

32. 33.

34.

35.

36.

37.

38.

39.

40.

41.

1267

tant depression: a naturalistic study. Biol Psychiatry 2005; 58: 355–363. VNS Therapy System Physician’s Manual. Houston, TX: Cyberonics Inc., 2013. http://dynamic.cyberonics.com/ manuals/ (accessed 01/05/2015). Sadler RM, Purdy RA, Rahey S. Vagal nerve stimulation aborts migraine in patient with intractable epilepsy. Cephalalgia 2002; 22: 482–484. Mauskop A. Vagus nerve stimulation relieves chronic refractory migraine and cluster headaches. Cephalalgia 2005; 25: 82–86. Schwartz PJ, De Ferrari GM, Sanzo A, et al. Long term vagal stimulation in patients with advanced heart failure: ﬁrst experience in man. Eur J Heart Fail 2008; 10: 884– 891. Merrill CA, Jonsson MA, Minthon L, et al. Vagus nerve stimulation in patients with Alzheimer’s disease: additional follow-up results of a pilot study through 1 year. J Clin Psychiatry 2006; 67: 1171–1178. Sjogren MJ, Hellstrom PT, Jonsson MA, Runnerstam M, Silander HC, Ben-Menachem E. Cognition-enhancing eﬀect of vagus nerve stimulation in patients with Alzheimer’s disease: a pilot study. J Clin Psychiatry 2002; 63: 972–980. George MS, Ward HE Jr, Ninan PT, et al. A pilot study of vagus nerve stimulation (VNS) for treatment-resistant anxiety disorders. Brain Stimul 2008; 1: 112–121. Roslin M, Kurian M. VNS in the treatment of morbid obesity. In: Schacter SC, Schmidt D, eds. VNS. MartinDunitz: London, 2012: 113–121. Ben-Menachem E. Vagus-nerve stimulation for the treatment of epilepsy. Lancet Neurol 2002; 1: 477–482. Handforth A, DeGiorgio CM, Schachter SC, et al. Vagus nerve stimulation therapy for partial-onset seizures: a randomized active-control trial. Neurology 1998; 51: 48–55. Morris GL III, Mueller WM, the Vagus Nerve Stimulation Study Group E01-E05. Long-term treatment with vagus nerve stimulation in patients with refractory epilepsy. Neurology 1999; 53: 1731–1735. Tatum WO, Moore DB, Stecker MM, et al. Ventricular asystole during vagus nerve stimulation for epilepsy in humans. Neurology 1999; 52: 1267–1269. Ali II, Pirzada NA, Kanjwal Y, et al. Complete heart block with ventricular asystole during left vagus nerve stimulation for epilepsy. Epilepsy Behav 2004; 5: 768– 771. Ardesch JJ, Buschman HP, van der Burgh PH, Wagener-Schimmel LJ, van der Aa HE, Hageman G. Cardiac responses of vagus nerve stimulation: intraoperative bradycardia and subsequent chronic stimulation. Clin Neurol Neurosurg 2007; 109: 849–852. Schuurman PR, Beukers RJ. Ventricular asystole during vagal nerve stimulation. Epilepsia 2009; 50: 967– 968. Amark P, Stodberg T, Wallstedt L. Late onset bradyarrhythmia during vagus nerve stimulation. Epilepsia 2007; 48: 1023–1024. Borusiak P, Zilbauer M, Cagnoli S, Heldmann M, Jenke A. Late-onset cardiac arrhythmia associated with vagus nerve stimulation. J Neurol 2009; 256: 1578–1580. Iriarte J, Urrestarazu E, Alegre M, et al. Late-onset periodic asystolia during vagus nerve stimulation. Epilepsia 2009; 50: 928–932.

1268

E. BEN-MENACHEM ET AL.

42. Ben-Menachem E, Hellstrom K, Waldton C, Augustinsson LE. Evaluation of refractory epilepsy treated with vagus nerve stimulation for up to 5 years. Neurology 1999; 52: 1265–1267. 43. Husain MM, Stegman D, Trevino K. Pregnancy and delivery while receiving vagus nerve stimulation for the treatment of major depression: a case report. Ann Gen Psychiatry 2005; 4: 16. 44. CardioFit Pilot Study. Promising results from the CardioFit pilot study. http://www.biocontrol-medical.com/ health_pros.php?ID=23 (accessed 02/10/2014). 45. Sabbah HN. Electrical vagus nerve stimulation for the treatment of chronic heart failure. Clevel Clin J Med 2011; 78 (Suppl. 1): S24–S29. 46. Abraham WT, De Ferrari GM. Novel non-pharmacological approaches to heart failure. J Cardiovasc Transl Res 2014; 7: 263–265. 47. De Ferrari GM, Crijns HJ, Borggrefe M, et al. Chronic vagus nerve stimulation: a new and promising therapeutic approach for chronic heart failure. Eur Heart J 2011; 32: 847–855. 48. NEMOS t-VNS for treatment of drug-resistant epilepsy. http://cerbomed.com/upload/Brochure_Epilepsy_Patients_EN.pdf (accessed 01/29/2014). 49. Stefan H, Kreiselmeyer G, Kerling F, et al. Transcutaneous vagus nerve stimulation (t-VNS) in pharmacoresistant epilepsies: a proof of concept trial. Epilepsia 2012; 53: e115–e118. 50. Busch V, Zeman F, Heckel A, Menne F, Ellrich J, Eichhammer P. The eﬀect of transcutaneous vagus nerve stimulation on pain perception – an experimental study. Brain Stimul 2013; 6: 202–209. 51. Napadow V, Edwards RR, Cahalan CM, et al. Evoked pain analgesia in chronic pelvic pain patients using respiratory-gated auricular vagal aﬀerent nerve stimulation. Pain Med 2012; 13: 777–789. 52. Nesbitt AD, Marin JCA, Tomkins E, Ruttledge MH, Goadsby PJ. Non-invasive vagus nerve stimulation for the treatment of cluster headache: a cohort series with

53.

54.

55.

56.

57.

58.

59.

60.

61.

extended follow-up [abstract; oral presentation]. Presented at Biennial World Congress of the International Neuromodulation Society, 8 13 June 2013, Berlin, Germany. Nesbitt AD, Marin JCA, Tomkins E, Ruttledge MH, Goadsby PJ. Non-invasive vagus nerve stimulation for the treatment of cluster headache: a cohort study [abstract P141]. Cephalalgia 2013; 33: 107. Goadsby P, Grosberg B, Mauskop A, Cady R, Simmons K. Eﬀect of noninvasive vagus nerve stimulation on acute migraine: an open-label pilot study. Cephalalgia 2014; 34: 986–993. Moscato D, Moscato FR. Treatment of chronic migraine by means of vagal stimulator [abstract]. J Headache Pain 2013; 14 (Suppl): 56–57. El Tahry R, Raedt R, Mollet L, et al. A novel implantable vagus nerve stimulation system (ADNS-300) for combined stimulation and recording of the vagus nerve: pilot trial at Ghent University Hospital. Epilepsy Res 2010; 92: 231–239. Ben-Menachem E, Rydenhag B, Silander H. Preliminary experience with a new system for vagus nerve stimulation for the treatment of refractory focal onset seizures. Epilepsy Behav 2013; 29: 416–419. Hein E, Nowak M, Kiess O, et al. Auricular transcutaneous electrical nerve stimulation in depressed patients: a randomized controlled pilot study. J Neural Transm 2013; 120: 821–827. Nahas Z, Marangell LB, Husain MM, et al. Two-year outcome of vagus nerve stimulation (VNS) for treatment of major depressive episodes. J Clin Psychiatry 2005; 66: 1097–1104. Siddiqui F, Herial NA, Ali II. Cumulative eﬀect of vagus nerve stimulators on intractable seizures observed over a period of 3 years. Epilepsy Behav 2010; 18: 299– 302. Ryzi M, Brazdil M, Novak Z, et al. Long-term vagus nerve stimulation in children with focal epilepsy. Acta Neurol Scand 2013; 127: 316–322.

Ellrich_v1_A4_2011 22/12/2011 14:29 Page 254

Epilepsy

Transcutaneous Vagus Nerve Stimulation Jens Ellrich Professor of Medical Physiology, Department of Health Science and Technology, Medical Faculty, Aalborg University and Chief Medical Officer, Medical Department, cerbomed GmbH

Abstract Invasive vagus nerve stimulation (VNS) is an approved treatment for drug-resistant epilepsy. Besides its recognised clinical efficacy, there are major drawbacks, such as invasiveness and a great many side effects. Therefore there is a medical demand for transcutaneous VNS (t-VNS®), which combines selective, non-invasive access to vagus nerve afferents with a low risk profile. Both treatments excite thick myelinated fibres of vagus nerve branches that project to the nucleus of the solitary tract in the brainstem. Preclinical data emphasise the equivalent anticonvulsive effects of both methods. Based upon the common mode of action and the first clinical data, the t-VNS device received Conformité Européenne (CE) approval. Besides the approved intended use for drug-resistant epilepsy and depression, a future clinical trial will address the efficacy of t-VNS in chronic pain.

Keywords Anticonvulsive, brainstem, concha, depression, drug-resistant, ear, epilepsy, neuromodulation, non-invasive, pain, vagus nerve Disclosure: Jens Ellrich is Chief Medical Officer at cerbomed GmbH. Received: 10 August 2011 Accepted: 23 September 2011 Citation: European Neurological Review, 2011;6(4):254–6 DOI:10.17925/ENR.2011.06.04.254 Correspondence: Jens Ellrich, Chief Medical Officer, Medical Department, cerbomed GmbH, Medical Valley Centre, Henkestrasse 91, D-91052 Erlangen, Germany. E: jens.ellrich@cerbomed.com

Support: The publication of this article was funded by cerbomed GmbH.

Drug-resistant epilepsy accounts for more than 30 % of epileptic patients.1 Alternative treatment options are resective neurosurgery, deep brain stimulation and invasive vagus nerve stimulation (VNS).2 Invasive stimulation of the cervical branch of the vagus nerve has been shown to be highly effective in clinical trials, with a responder rate of approximately 60 %.3,4 Surgically and technically induced complications include electrode fractures, deep wound infections, transient vocal cord palsy, cardiac arrhythmia under test stimulation, electrode malfunction and post-traumatic dysfunction of the stimulator. 5 Frequent side effects of chronic invasive VNS, such as hoarseness, cough, dyspnoea and pain, are mainly due to bidirectional stimulation of efferent and afferent fibres within the mixed cervical branch of the vagus nerve. Besides the recognised clinical efficacy of invasive VNS, there are major drawbacks, such as invasiveness, and a great many side effects, due to electrical stimulation of a mixed peripheral nerve. Therefore there is a medical demand for an alternative medical device that combines selective, non-invasive access to vagus nerve afferents with a low risk profile.6 This article assesses the new neuromodulatory technique of transcutaneous VNS (t-VNS ®) on the basis of the following requirements for effective VNS therapy inferred from recent concepts of the mechanisms of action:3,4,7

• access to the nucleus of the solitary tract (NTS) in the brainstem; and • elicitation of a typical cerebral activation pattern.

Site of Transcutaneous Vagus Nerve Stimulation t-VNS targets the cutaneous receptive field of the auricular branch of the vagus nerve (ABVN) at the outer ear. Several lines of evidence from anatomical and clinical studies reveal the topographical anatomy and the functional impact of the ABVN on the autonomic nervous system.

Nerve Supply of the Outer Ear The human outer ear (see Figure 1A) is supplied by three sensory nerves, namely the auriculotemporal nerve, the great auricular nerve and the ABVN. 8 On 14 human ears the complete course of nerve supply was exposed and each branch was defined by identifying its origin. In 73 % of cases the ABVN, and in 18 % the great auricular nerve, were found on the antihelix solely and 9 % showed a double innervation. In 9 % of specimens the ABVN provided ramification for the crura antihelices, in 45 % for the cavity of conchae and in 100 % for the cymba conchae. In 55 % the ABVN and the great auricular nerve were found on the cavity of conchae. No region with triple innervation was found. Thus, in all specimens the ABVN was found to significantly supply the cavity of conchae and exclusively supply the cymba conchae.

Intracranial Section of the Vagus Nerve • unidirectional stimulation of thick myelinated afferent vagus nerve fibres;

254

A patient with tongue cancer suffered from severe pain in the outer ear. This refractory pain was treated by intracranial section

Ellrich_v1_A4_2011 21/12/2011 16:41 Page 255

Transcutaneous Vagus Nerve Stimulation

of the vagus nerve (see Figure 1B). 9 During the sectioning of the vagus on the left side, the anaesthetist noted that the heart rate dropped to 40 beats per minute. Following section of the vagus root, the cutaneous area of complete anaesthesia covered the posterior wall of the external auditory canal, the concha and, with only a slight degree of pain, the antihelix and antitragus. The authors concluded that there is no doubt that the major supply to the anaesthetised area is by means of the vagus nerve. 9

Figure 1: Brainstem Mechanisms of Transcutaneous Vagus Nerve Stimulation

NTS X

DN NA

Superior ganglion VZV

Isolated Vagus Nerve Palsy with Herpes Zoster A 31-year-old woman was admitted to hospital due to difficulty swallowing fluid, hoarseness and painful vesicles on the right ear. Neurological examination revealed poor elevation of the soft palate on the right side. Herpetic vesicles were present on the right concha and the posterior wall of the external auditory canal. No facial palsy, loss of hearing or mucosal lesions in the mouth or pharynx were present. The authors diagnosed an isolated vagus nerve palsy due to varicella zoster infection (see Figure 1C), highlighting the distribution of the cutaneous receptive field of the ABVN. 10

Auricular Syncope A 13-year-old girl had been receiving drug treatment for presumed absence epilepsy without any anticonvulsive effect. The medical history indicated that recurrent syncopal attacks were precipitated by external auditory canal stimulation. Targeted autonomic function tests confirmed a hyperactive vagal response with bradycardia and light-headedness provoked by tactile stimulation of the left external auditory canal. Abstinence from ear-scratching led to complete alleviation of symptoms without any drug treatment. The authors proposed reflex syncope (see Figure 1D), due to stimulation of the ABVN, as the pathophysiological mechanism. 11

Lung

F Cough Heart

ABVN

D Syncope

A Cymba conchae

Sensory fibres of the auricular branch of the vagus nerve (ABVN) (red) supply the skin of the concha (yellow). The cymba conchae is exclusively supplied by the ABVN. Sensory vagus nerve fibres from different organs project via the superior ganglion to the nucleus of the solitary tract (NTS). NTS neurons (dark blue) project to visceral efferent neurons located in the dorsal nucleus of the vagus nerve (DN) and the nucleus ambiguus (NA). Visceral efferent nerve fibres (green) supply, e.g., the heart and the lung. For the sake of clarity, afferent pathways and efferent pathways of the vagus nerve are separately illustrated on the right and left sides of the figure, respectively. A to F refer to the text. VZV = varicella zoster virus causing herpes zoster; X = vagus nerve.

Referred Otalgia Referred otalgia arises from non-otological, remote diseases and occurs in up to 50 % of adult patients who consult a general physician for ear pain. 12 Head and neck malignancy is the most important pathology associated with referred otalgia. Twenty-six patients with non-metastatic lung cancer primarily suffered from auricular pain localised ipsilaterally to the lung mass. 13 Lung masses which abut or infiltrate visceral vagus nerve afferents can refer pain to the ear by convergence of visceral fibres from the lung and somatic afferents of the ABVN onto common secondary sensory neurons in the NTS (see Figure 1E).

Ear-cough Reflex A young boy complained about a chronic dry cough. On examination, an accumulation of epidermal cerumen surrounding a skin ulceration in a narrowed external auditory canal was found. Stimulation of the wall of the ear canal with a cotton bud triggered a marked cough reflex (see Figure 1F). After removal of the accumulated cerumen the cough disappeared.14 The ear-cough reflex was elicited in 12 patients. It was bilaterally induced in three patients. Lacrimation was additionally observed in one patient (auriculo-lacrimal reflex). 15,16,17 Twenty-one out of 500 patients studied had a clinically positive ear-cough reflex. Gagging and lacrimation were seen in nine and 10 patients, respectively. While vomiting was present in one case (ear-vomiting reflex), severe cardiac inhibition with syncopal attack was seen in three patients (auriculo-cardiac reflex).15 Similar reflex phenomena documenting

EUROPEAN NEUROLOGICAL REVIEW

the functional connection between the ABVN and the autonomic nervous system are the gastro-auricular phenomenon, the auriculo-genital reflex and the auriculo-uterine reflex.18

Preferential Excitation of Thick Myelinated Nerve Fibres by Transcutaneous Vagus Nerve Stimulation The clinical efficacy of VNS requires activation of thick myelinated afferent fibres of the vagus nerve. 4,7 The fibres of a sensory peripheral nerve such as the ABVN mediate touch sensation. Consequently, the stimulus intensity of electrical t-VNS is adjusted to a level above the individual’s detection threshold and clearly below the individual’s pain threshold. The detection threshold is defined as the lowest stimulus intensity that evokes the first perceptible sensation that reliably corresponds to a tingling sensation. The pain threshold is defined as the lowest stimulation intensity that elicits the first pricking or unpleasant sensation. Both psychophysical thresholds are determined by the method of limits, with several runs of electrical stimuli applying ramps of decreasing and increasing intensity. In 18 healthy volunteers (36 ears) the electrical detection threshold with a single-pulse stimulation (200 μs duration) averages out at 0.8 ± 0.3 mA in the cymba conchae. 19 This intensity conforms to published thresholds as measured in the face or the forearm. 20–22 Touch sensation is clinically assessed by the mechanical detection threshold via application of von Frey filaments. The mechanical detection

255

Ellrich_v1_A4_2011 21/12/2011 16:41 Page 256

Epilepsy threshold in the area of the cymba conchae in 14 ears corresponds to 0.5 ± 0.7 mN which is very similar to thresholds in the face and the forearm. 19,21,23 Electrical and mechanical detection thresholds and evoked tingling sensation in patients and volunteers clearly demonstrate preferential activation of thick myelinated Aβ fibres of the ABVN by t-VNS.

Projection of Auricular Branch of the Vagus Nerve Fibres to the Nucleus of the Solitary Tract The NTS is the main target of VNS (see Figure 1). Central projections of the ABVN of the cat were examined by the transganglionic horseradish peroxidase (HRP) transport technique. After topical application of HRP to the central cut end of the ABVN, neuronal somata in the superior ganglion of the vagus nerve were labelled. Main terminal labelling was seen ipsilaterally in the NTS. Within the NTS, labelled terminals were detected in the interstitial, dorsal, dorsolateral and commissural subnuclei.24 In rats, HRP was injected into the middle of the ear for anterograde tracing in order to identify ABVN fibre endings in the brainstem. HRP immunohistochemistry showed positive fibre endings in the NTS.25

Cerebral Activation Pattern under Vagus Nerve Stimulation t-VNS was applied to 22 healthy volunteers in a functional magnetic resonance imaging (fMRI) study. 26 Stimulation of the earlobe served as a sham control. fMRI showed robust blood oxygen level-dependent (BOLD) signal decreases in limbic brain areas, including the amygdala, hippocampus, parahippocampal gyrus and the middle and superior temporal gyrus under t-VNS. Increased activation was detected in the insula, precentral gyrus and the thalamus. Earlobe stimulation as a sham control intervention did not show similar effects. The brain activation pattern under t-VNS clearly shares features with changes observed during invasive VNS. 27

Kwan P, Arzimanoglou A, Berg AT, et al., Definition of drug resistant epilepsy: consensus proposal by the ad hoc Task Force of the ILAE Commission on Therapeutic Strategies, Epilepsia, 2010;51:1069–77. 2. Al-Otaibi FA, Hamani C, Lozano AM, Neuromodulation in Epilepsy, Neurosurgery, 2011;69:957–79. 3. Beekwilder JP, Beems T, Overview of the clinical applications of vagus nerve stimulation, J Clin Neurophysiol, 2010;27:130–8. 4. Amar AP, Levy ML, Liu CY, Apuzzo MLJ, Vagus Nerve Stimulation. In: Krames ES, Peckham PH, Rezai AR (eds), Neuromodulation, first edition, London: Academic Press, 2009;625–37. 5. Spuck S, Tronnier V, Orosz I, et al., Operative and technical complications of vagus nerve stimulator implantation, Neurosurgery, 2010;67:489–94. 6. Ventureyra EC, Transcutaneous vagus nerve stimulation for partial onset seizure therapy. A new concept, Childs Nerv Syst, 2000;16:101–2. 7. Vonck K, Boon P, Van Roost D, Anatomical and physiological basis and mechanism of action of neurostimulation for epilepsy, Acta Neurochir Suppl, 2007;97:321–8. 8. Peuker ET, Filler TJ, The nerve supply of the human auricle, Clin Anat, 2002;15:35–7. 9. Fay T, Observations and results from intracranial section of glossopharyngeus and vagus nerves in man, J Neurol Psychopathol, 1927;8:110–23. 10. Ohashi T, Fujimoto M, Shimizu H, Atsumi T, [A case of isolated vagus nerve palsy with herpes zoster], Rinsho Shinkeigaku, 1994;34:928–9. 11. Thakar A, Deepak KK, Kumar SS, Auricular syncope,

256

Anticonvulsive Effect of Transcutaneous Vagus Nerve Stimulation in Rodents The anticonvulsive effect of t-VNS was addressed in an experimental rat seizure model.28 Epileptic seizures were induced by intraperitoneal injection of the proconvulsant compound pentylenetetrazole (PTZ). Seizures were documented by epidural electroencephalogram (EEG) recording. Invasive VNS was applied to the left cervical branch of the vagus nerve and t-VNS was administered to the left ear. PTZ injection without any VNS evoked highly synchronous, large-amplitude activity in epidural EEG traces. Invasive VNS and t-VNS both substantially reduced PTZ-induced seizure activity in epidural EEG compared with that of control periods. There was no significant difference between invasive VNS and t-VNS in the average duration of the anti-seizure effect.28

Reduced Seizure Frequency in a Case Series of Drug-resistant Epilepsy t-VNS was applied to seven patients with drug-resistant epilepsy for a period of nine months. Patients applied t-VNS three times per day for a time period of one hour each. The primary outcome of the study was based upon the number of seizures as documented by the patient´s seizure diary. After nine months, an overall reduction in seizure frequency was observed in five out of seven patients. The authors concluded that non-invasive t-VNS is a safe and well-tolerated method for longer time periods and might be an alternative treatment option for epilepsy patients.29

Summary and Conclusions Invasive VNS and t-VNS both excite thick myelinated fibres of vagus nerve branches that project to the NTS in the brainstem. Preclinical data emphasise the equivalent anticonvulsive effects of both neuromodulatory methods. Based upon the common mode of action and the first clinical data, the t-VNS device received Conformité Européenne (CE) approval. Besides the approved intended use for drug-resistant epilepsy and depression, a future clinical trial will address the efficacy of t-VNS in chronic pain.30 n

J Laryngol Otol, 2008;122:1115–7. 12. Charlett SD, Coatesworth AP, Referred otalgia: a structured approach to diagnosis and treatment, Int J Clin Pract, 2007;61:1015–21. 13. Eross EJ, Dodick DW, Swanson JW, Capobianco DJ, A review of intractable facial pain secondary to underlying lung neoplasms, Cephalalgia, 2003;23:2–5. 14. Jegoux F, Legent F, Beauvillain de Montreuil C, Chronic cough and ear wax, Lancet, 2002;360:618. 15. Gupta D, Verma S, Vishwakarma SK, Anatomic basis of Arnold’s ear-cough reflex, Surg Radiol Anat, 1986;8:217–20. 16. Tekdemir I, Aslan A, Elhan A, A clinico-anatomic study of the auricular branch of the vagus nerve and Arnold’s ear-cough reflex, Surg Radiol Anat, 1998;20:253–7. 17. Fernandez-Fernandez FJ, Iglesias-Olleros MA, Chronic cough in adults, Thorax, 2004;59:451. 18. Engel D, The gastroauricular phenomenon and related vagus reflexes, Arch Psychiatr Nervenkr, 1979;227:271–7. 19. Ellrich J, Transcutaneous vagus nerve stimulation: feasibility, safety and clinical application, Neuromodulation, 2011;14:in press. 20. Ellrich J, Lamp S, Peripheral Nerve Stimulation Inhibits Nociceptive Processing: An Electrophysiological Study in Healthy Volunteers, Neuromodulation, 2005;8:225–35. 21. Ristic D, Spangenberg P, Ellrich J, Analgesic and antinociceptive effects of peripheral nerve neurostimulation in an advanced human experimental model, Eur J Pain, 2008;12:480–90. 22. Aymanns M, Yekta SS, Ellrich J, Homotopic long-term depression of trigeminal pain and blink reflex within one side of the human face, Clin Neurophysiol, 2009;120:2093–9.

23. Yekta SS, Smeets R, Stein JM, Ellrich J, Assessment of trigeminal nerve functions by quantitative sensory testing in patients and healthy volunteers, J Oral Maxillofac Surg, 2010;68:2437–51. 24. Nomura S, Mizuno N, Central distribution of primary afferent fibers in the Arnold’s nerve (the auricular branch of the vagus nerve): a transganglionic HRP study in the cat, Brain Res, 1984;292:199–205. 25. Gao XY, Rong P, Ben H, et al., Morphological and electrophysiological characterization of auricular branch of vagus nerve: Projections to the NTS in mediating cardiovascular inhibition evoked by the acupuncture-like stimulation, Abstr Soc Neurosci, 2010;694:22. 26. Kraus T, Hosl K, Kiess O, et al., BOLD fMRI deactivation of limbic and temporal brain structures and mood enhancing effect by transcutaneous vagus nerve stimulation, J Neural Transm, 2007;114:1485–93. 27. Chae JH, Nahas Z, Lomarev M, et al., A review of functional neuroimaging studies of vagus nerve stimulation (VNS), J Psychiatr Res, 2003;37:443–55. 28. He W, Zhu B, Rong P, A new concept of transcutaneous vagus nerve stimulation for epileptic seizure, Abstr Soc Neurosci, 2009;539:4. 29. Stefan H, Kreiselmeyer G, Kerling F, et al., Transcutaneous vagus nerve stimulation (t-VNS) in pharmacoresistant epilepsies: a proof of concept trial, Epilepsia, 2011 (under revision). 30. Ellrich J, Busch V, Eichhammer P, Inhibition of pain processing by transcutaneous vagus nerve stimulation, Neuromodulation, 2011;14:383.

EUROPEAN NEUROLOGICAL REVIEW

Neurobiology of Disease 60 (2013) 80–88

Contents lists available at ScienceDirect

Neurobiology of Disease journal homepage: www.elsevier.com/locate/ynbdi

Vagus nerve stimulation during rehabilitative training improves forelimb strength following ischemic stroke N. Khodaparast ⁎, S.A. Hays, A.M. Sloan, D.R. Hulsey, A. Ruiz, M. Pantoja, R.L. Rennaker II, M.P. Kilgard The University of Texas at Dallas, School of Behavioral Brain Sciences, 800 West Campbell Road, GR41, Richardson, TX 75080-3021, USA

a r t i c l e

i n f o

Article history: Received 3 July 2013 Revised 31 July 2013 Accepted 7 August 2013 Available online 15 August 2013 Keywords: Vagus nerve stimulation Plasticity Neurorehabilitation Motor cortex Stroke Ischemia

a b s t r a c t Upper limb impairment is a common debilitating consequence of ischemic stroke. Physical rehabilitation after stroke enhances neuroplasticity and improves limb function, but does not typically restore normal movement. We have recently developed a novel method that uses vagus nerve stimulation (VNS) paired with forelimb movements to drive speciﬁc, long-lasting map plasticity in rat primary motor cortex. Here we report that VNS paired with rehabilitative training can enhance recovery of forelimb force generation following infarction of primary motor cortex in rats. Quantitative measures of forelimb function returned to pre-lesion levels when VNS was delivered during rehab training. Intensive rehab training without VNS failed to restore function back to pre-lesion levels. Animals that received VNS during rehab improved twice as much as rats that received the same rehabilitation without VNS. VNS delivered during physical rehabilitation represents a novel method that may provide long-lasting beneﬁts towards stroke recovery. © 2013 Elsevier Inc. All rights reserved.

Introduction Stroke is the second most common cause of disability worldwide (Leary and Saver, 2003). Ischemic stroke causes neural death due to inadequate blood flow, often resulting in movement impairments on the opposite side of the body (Deb et al., 2010; Lo et al., 2003). Seventy-five percent of patients who survive an ischemic stroke continue to have significant weakness in the upper extremities even after extensive rehabilitative therapy (Harvey and Nudo, 2007; Kwakkel, 2009; Levine and Greenwald, 2009). Impaired limb function reduces the ability to perform activities of daily living, reduces the quality of life, and increases medical costs (King, 1996; Whyte et al., 2004). The development of an effective therapy to restore motor function would fulfill a large unmet clinical need. Physical rehabilitation after stroke drives plasticity in the form of reorganization of cortical circuitry in the motor system (Johansson, 2000; Nudo, 2003; Rossini and Forno, 2004; Schaechter, 2004; Ward and Cohen, 2004). One common rehabilitative intervention, constraint induced movement therapy (CIMT) causes reorganization of the motor cortex map of arm movement (Sawaki et al., 2008; Schaechter et al., 2002). Additionally, new methods using virtual reality and electrical stimulation of motor cortex may also promote increased synaptic plasticity and cortical reorganization within the motor cortex (AdkinsMuir and Jones, 2003; Lindenberg et al., 2012; You et al., 2005). The development of additional methods to increase neural plasticity ⁎ Corresponding author. Fax: +1 972 883 2491. E-mail address: navid.khodaparast@gmail.com (N. Khodaparast). Available online on ScienceDirect (www.sciencedirect.com). 0969-9961/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.nbd.2013.08.002

may lead to improved recovery of motor function (Hallett, 2001; Nudo, 2003). We have recently developed a method to induce specific and long-lasting cortical map plasticity by pairing vagus nerve stimulation (VNS) with movements or sensory stimuli in intact rats (Engineer et al., 2011; Porter et al., 2011). Repeatedly delivering VNS with forelimb movements resulted in movement-specific map plasticity within the primary motor cortex beyond training without VNS (Porter et al., 2011). We hypothesized that this enhancement in reorganization within the motor cortex may improve recovery of function after stroke. Upper limb strength is one of the best prognostic indicators for arm function and chronic disability following stroke (Harris and Eng, 2007; Mercier and Bourbonnais, 2004; Sunderland et al., 1989). Here, we evaluated whether the delivery of VNS during rehabilitative training can enhance recovery of forelimb strength in a model of ischemic stroke. Rats were trained to perform an isometric force task that quantitatively measures forelimb force generation (Hays et al., 2012). This task is fully automated, allowing the experimenter to test several animals simultaneously and avoid the possibility of experimenter bias. Unilateral injections of a peptide vasoconstrictor, endothelin-1, into primary motor cortex caused an ischemic infarct and impaired function of the trained forelimb (Fang et al., 2010; Gilmour et al., 2004; Hays et al., 2012). Rats underwent rehabilitative training for five weeks with or without the delivery of VNS. No VNS was delivered on week six to allow evaluation of persistent effects. VNS delivered during rehabilitative training restored pull force generation back to pre-lesion levels, whereas extensive rehabilitative training without VNS failed to restore function. These findings suggest that VNS paired with physical rehabilitation may hold promise for enhancing recovery of upper extremity function after stroke.

N. Khodaparast et al. / Neurobiology of Disease 60 (2013) 80–88

Materials and methods Subjects Nineteen adult female Sprague–Dawley rats, approximately 4 months old and weighing approximately 250 g when the experiment began, were used in this experiment. The rats were housed in a 12:12 h reversed light cycle environment so that behavioral testing took place during the dark cycle in order to increase daytime activity levels. Rats were food deprived to no less than 85% of their normal body weight during training as motivation for the food pellet rewards. This study was designed to take into consideration the rapid hormonal cycle of female rats. To ensure that the data for each rat was collected during every stage of the estrus cycle all analyses were based on the average of a week's worth of behavioral data. All handling, housing, surgical procedures, and behavioral training of the rats were approved by the University of Texas at Dallas Institutional Animal Care and Use Committee. Behavioral apparatus and software The behavioral chamber consisted of an acrylic box (10 × 12 × 4.75 in.) with a slot (2.5 × 0.4 in.) located in the front right corner of the box through which the rats could access the pull handle. The slot location restricted access such that only the right forelimb could be used to perform the task. The aluminum pull handle was centered in the slot at a height of 2.5 in. from the cage floor and at lateral distances varying from 0.75 in. inside to 0.75 in. outside relative to the inner wall surface of the cage, depending on the training stage. The handle was affixed to a custom designed force transducer (Motor Pull Device, Vulintus LLC, Sachse, TX) located outside the cage. The maximum load capacity of the transducer was 2 kg, and the typical forces generated by the rats fell within the linear range of measurement. Forces readings were sampled at 20Hz and measured with ± 1 g accuracy. Force measurements were calibrated with a force meter at least once per week. Custom software was used to control the task and collect data. A motor controller board (Motor Controller, Vulintus LLC, Sachse, TX) sampled the force transducer every 50 ms and relayed information to a custom MATLAB software which analyzed, displayed, and stored the data. Force values and corresponding timestamps were collected as continuous traces for each trial to allow for the analysis of force profiles over the course of a session. If a trial was successful, the software triggered an automated pellet dispenser (Vulintus LLC, Sachse, TX) to deliver a sucrose pellet (45 mg dustless precision pellet, BioServ, Frenchtown, NJ) to a receptacle located in the front left corner of the cage. Isometric force task training The isometric force task was performed as previously described. Training sessions lasted 30 min and were conducted twice daily, five days a week, with sessions on the same day separated by at least 2 h. During early phases of training, experimenters manually shaped animals by using ground sucrose pellets to encourage interaction with the handle. Rats pulled the handle initially located 0.75 in. inside the training cage to receive a sucrose reward pellet. A trial was initiated when the rat generated a force of at least 10 g on the handle. After trial initiation, the force was sampled for 4 s. If the force threshold was broken within a 2 second window following the initial contact, the trial was recorded as a success and a reward pellet was delivered. If the force did not exceed threshold within the 2 second window, the trial was recorded as a failure and no reward was given. Hit rate was calculated based on the number of successful trials over the total number of initiated trials: Hit rate = [(total successful trials / total trials) ∗ 100]. Force on the pull handle was sampled for 2 additional seconds following the 2 second trial window, regardless of the trial outcome, to capture any late attempts which were unrewarded. Following the 4 s of data collection there was

a 50 millisecond pause before rats could initiate another trial. If rats did not receive 50 pellets in a single day, they were given 10 g of pellets after daily training sessions were complete. The task was made progressively more difﬁcult as rats met the criterion for number of successful trials within a session and progressed to the next stage. As the training stages increased, the handle was gradually retracted to 0.75 in. outside the cage and the force threshold progressively increased up to 120 g. If an animal exceeded criteria for a proceeding stage, they were automatically advanced to the stage that matched their performance. The prescribed position and threshold values were strictly adhered to for pre- and post-lesion measurements. Rats were held at the pre-lesion stage until they had 10 successive sessions averaging over 85% success rate. The pre-lesion data reported in this study is compiled from these 10 sessions. After this point, the rats were given an ischemic lesion followed by seven days of recovery, after which they returned for post-lesion behavioral testing with the same parameters as pre-lesion allowing for a direct comparison of performance. All rats were tested until they had 4 sessions with greater than 10 trials each during the post-lesion assessment. Rats then proceeded to the therapy stage where VNS was delivered on each successful trial for 25 days (Fig. S1). Following the therapy stage, all rats underwent an additional two days (week 6) of rehabilitative training only, to allow assessment of the persistent effects of VNS pairing.

Unilateral motor cortex ischemic lesion Unilateral ischemic lesions of primary motor cortex were performed similar to a previously described method (Fang et al., 2010; Gilmour et al., 2004; Hays et al., 2012, 2013). See Supplementary Methods section for details.

Vagus nerve cuff implantation Following ischemic lesion, all rats were implanted with a skullmounted two-channel connector (headcap) and a bipolar stimulating nerve cuff constructed with platinum-iridium leads (5–6 kΩ impedance). Implantations were performed as previously described (Engineer et al., 2011; Porter et al., 2011). See Supplementary Methods sections for details.

Application of VNS Behavioral training was identical for all rats. The VNS during Rehab group received approximately 9000 total stimulations over 25 days (i.e., fifty 30 min sessions). VNS was delivered within 50 ms of a successful pull attempt. VNS was delivered as a 500 ms train of 15 pulses at 30 Hz (Fig. S1). Each biphasic pulse was 0.8 mA in amplitude and 100 μs in phase duration. These parameters are identical to our earlier studies (Engineer et al., 2011; Porter et al., 2011). Previous studies using the same parameters employed in this study have demonstrated changes in electroencephalographic measures and neuronal spiking synchrony during VNS, indicating that the nerve is successfully stimulated (Engineer et al., 2011; Nichols et al., 2011). No stimulation was delivered during the post-lesion assessment stage. During the first day of post-lesion assessment, no rats had a stimulator cable connected to the headcap. For both the Rehab rats and the VNS + Rehab rats, the stimulator cable was first connected during the second day of post-lesion assessment and was connected every day until the end of the fifth week of therapy. The stimulation cable for the Rehab rats was not connected to a stimulator. During the sixth week, the stimulator cable was not utilized for either group. Rats were perfused and brains removed following the sixth week of training to quantify lesion size (see Supplementary Methods for details).

N. Khodaparast et al. / Neurobiology of Disease 60 (2013) 80–88

Statistics All data are reported as the mean ± SEM. All comparisons were planned in the experimental design a priori, and significant differences were determined using one-way ANOVA, two-way ANOVA, and t-tests where appropriate. Statistical tests for each comparison are noted in the text. One tailed t-tests comparing individual subject performance after therapy (week 6) to baseline performance (PRE) were used to determine which rats exhibited a significant impairment after therapy. All other t-tests were two-tailed. Paired t-tests were used to compare repeated measures over time within groups. Alpha level was set at 0.05 for all comparisons. Significant differences between the Rehab and VNS + Rehab groups are noted in the figures with an asterisk. See Table S1 for statistical values for t-test comparisons.

force transducer and apply 120 g of force to receive a food reward (Fig. 1). Rats became highly proﬁcient at the task in 10.1 ± 0.6 days. Early in training, rats were able to generate forces up to 400 g. Highly trained rats did not generate higher forces (Fig. 1D). The majority of trials in highly trained were over 120 g. Early in training, pull force was often less than 80 g and varied substantially from trial to trial. A signiﬁcant decrease in the variance was observed in highly trained rats compared to newly trained rats (F test for equal variance, P b 0.001). This demonstrates that the increase in task performance with training is unlikely to be due to strengthening of forelimb muscles, but rather is due to the acquisition of skilled forelimb use. Daily observations did not reveal any obvious differences in the reach or grasp strategy used to perform the pull task. Unilateral ischemic lesion impairs task performance

Results Rats acquire skilled performance of the isometric force task To assess forelimb function in the context of stroke, rats were trained to perform the isometric force task, a behavioral test that quantitatively assesses multiple parameters of forelimb function (Hays et al., 2012). The task requires rats to reach out and grasp a handle attached to a

Prior to the induction of ischemic damage, subjects were held until they achieved a pre-lesion baseline of ﬁve consecutive days exceeding 85% hit rate performance. Performance during the baseline did not differ signiﬁcantly across days (Day 1: 84.6 ± 2.1%, Day 5: 87.2 ± 1.6%, n = 15, P = 0.36, paired t-test). Single trial examples matched to the bottom quartile of force show that pull force exceeded the 120 g threshold on the vast majority of trials (Figs. 2A,B, left panel). Both groups were

Fig. 1. Acquisition of skilled performance on the isometric force task. (A) Depiction of a rat performing the task. The sequential images show the extension of the forelimb, followed by a grasp and pull. Frames are separated by 150 ms. Previously shown in Hays et al. (2012). (B) Example of force data collected from a single successful trial. The gray dashed line denotes the 120 g hit threshold. Open arrowheads mark separate pulls. The black horizontal dashed line marks the maximal force of the trial. The arrow marks the threshold crossing, when a reward pellet and VNS, when appropriate, were delivered. (C) Example data from a single unsuccessful trial. Symbols are the same as in B. Note that the force never exceeds the hit threshold, so no reward or VNS was delivered. (D) Distribution of peak forces in newly trained and highly trained rats. Highly trained rats tend to generate peak forces centered about 120 g, while newly trained rats generate a wide range of forces. Maximal peak forces in newly trained rats are comparable to those observed in highly trained rats, suggesting that the improvement in performance is not due to muscle strengthening, but rather reﬁnement of task performance.

N. Khodaparast et al. / Neurobiology of Disease 60 (2013) 80–88

Fig. 2. VNS paired with Rehab improves hit rate after ischemic lesion. (A, B) Single trial force profiles matched to the bottom quartile of force for each experimental group throughout the course of the experiment. The gray dashed line indicates the 120 g hit threshold. (C) Hit rate performance over the course of the experiment. VNS paired with Rehab improves recovery compared to Rehab on most weeks. The increase in hit rate is still present at week 6, after the cessation of VNS therapy. N refers to number of rats in each group. * indicates significant difference between Rehab and VNS + Rehab. (D) Correlation of individual subject performance prior to lesion and after the completion of therapy. Empty symbols denote a significant reduction after therapy compared to pre-lesion performance. Symbols on or above the line suggest recovery, while those below the line indicate impairment. Note the consistent recovery in the VNS + Rehab group and the wide variability in recovery in the Rehab group.

highly successful at the task, with no difference observed in hit rate between groups (Fig. 2C, PRE, Rehab: 87.0 ± 0.7%; VNS + Rehab: 87.7 ± 1.5%, n = 9,6, unpaired t-test, P = 0.63, also see Movie S1). Induction of unilateral ischemic damage significantly worsened performance in both groups compared to pre-lesion (Fig. 2C, POST, Rehab: 37.8 ± 4.1%, paired t-test, P b 0.001; VNS + Rehab: 38.8 ± 7.5%, P b 0.001, also see Movie S2). No difference was observed between groups (unpaired t-test, P = 0.89). Single trial examples matched to the bottom quartile of force after lesion illustrate the reduction in peak force and increase in number of pulls per trial (Figs. 2A,B, center panel). Physical rehabilitation is the most common intervention to restore motor function after stroke (Piernik-Yoder and Ketchum, 2013), so we sought to evaluate the effectiveness of rehabilitative training without VNS to improve motor outcomes. ANOVA of hit rate in this group revealed a significant effect (F[6,56] = 2.64, P = 0.025). Rehabilitative training without VNS (Rehab) resulted in a modest recovery of forelimb function, but was unable to return performance to pre-lesion levels. Average hit rate was significantly reduced compared to pre-lesion levels throughout the course of therapy (Fig. 2C, PRE vs. weeks 1–6, all P b 0.01, also see Table S1 and Movie S3). By week 6, the impairment of hit rate had recovered 47.5 ± 15.4%. Performance of individual rats varied widely after therapy, ranging from a substantial impairment to full recovery (Fig. 2D, also see Fig. S2A). 6 of 9 rats (67%) were significantly worse compared to pre-lesion performance after the therapy, suggesting that rehabilitative training without VNS is typically insufficient to restore forelimb performance to pre-lesion levels. We sought to evaluate if the addition of VNS paired with rehabilitative training enhanced recovery of forelimb function. ANOVA of hit rate

revealed a significant effect (F[6,35] = 11.83, P b 0.001). VNS paired with rehabilitative training (VNS + Rehab) fully restored forelimb performance to pre-lesion levels. No significant difference from pre-lesion was observed between weeks 2 and 6 (all P N 0.05). The benefits of VNS paired with physical rehabilitation were evident during week six after the cessation of VNS, suggesting a long-lasting benefit (week 5 vs. week 6, within, P = 0.89). After the completion of therapy, hit rate was indistinguishable from pre-lesion performance (99.2 ± 9.6% recovery, also see Movie S4). Only 1 of 6 rats (17%) demonstrated a statistically significant impairment compared to pre-lesion performance after the therapy, suggesting that VNS paired with physical rehabilitation improves recovery of forelimb function. To determine if VNS paired with rehabilitative training confers an advantage beyond rehabilitative training without VNS, we compared performance across groups at each week of therapy. ANOVA of hit rate revealed a significant effect of treatment (F[1,83] = 33.21, P b 0.001) and time (F[5,83] = 3.14, P = 0.012). Post hoc comparisons demonstrated that VNS + Rehab displayed an increased hit rate compared to Rehab on most weeks (Fig. 2C). The increase in hit rate persisted throughout the remainder of therapy (unpaired t-test, P b 0.05 for weeks 2, 3, 5, 6). These results demonstrate that VNS paired with rehabilitative training results in a significant increase in recovery compared to rehabilitative training without VNS. Unilateral ischemic lesion reduces forelimb strength In addition to assessing hit rate performance, we sought to evaluate forelimb strength. Before ischemic lesion, peak force generated by the

N. Khodaparast et al. / Neurobiology of Disease 60 (2013) 80–88

forelimb was similar in both groups. On the majority of trials, peak force exceeded 120 g (Figs. 3A,B, left panel). Averaged pre-lesion peak force was slightly, but significantly, higher in the VNS + Rehab group (Fig. 3C, PRE, Rehab: 144.1 ± 2.0 g; VNS + Rehab: 152.0 ± 2.2 g, unpaired t-test, P = 0.017). After ischemic lesion, peak force generation was significantly reduced in both groups compared to prelesion (Fig. 3C, POST, Rehab: 103.6 ± 4.2 g, paired t-test, P b 0.001; VNS + Rehab: 99.0 ± 7.9 g, P b 0.001). No difference in peak force was observed between groups (unpaired t-test, P = 0.57). The distribution of peak forces demonstrated a notable leftward shift with significantly fewer trials with peak forces above the 120 g threshold (Figs. 3A,B, center panel). Rehabilitative training without VNS was insufficient to fully restore forelimb strength. The distribution of peak forces after therapy reveals substantial deficiencies compared to pre-lesion (Fig. 3B). Significant increases are observed in bins 80–120 g (paired t-test, P b 0.05 for each bin) and significant decreases are observed in bin 140–160 g (P b 0.05) after therapy. This increase in low force pulls and decrease in high force pulls is consistent with a deficit in forelimb strength. ANOVA on peak force revealed a significant effect of therapy for the Rehab group (F[6,56] = 2.98, P = 0.014). Rehab resulted in a small but significant improvement in peak force by week 2 (Fig. 3C, POST v.

week 2, paired t-test, P b 0.05). However, peak force remained significantly reduced compared to pre-lesion levels throughout the course of therapy (Fig. 3C, PRE vs. weeks 1–6, paired t-test, all P b 0.05). On week 6, peak force had recovered 56.8 ± 16.6% of the deficit relative to pre-lesion levels. 7 of 9 rats (78%) demonstrated significant impairment of force generation after the completion of therapy (Fig. 3D, also see Fig. S2B). VNS paired with physical rehabilitation resulted in notable recovery of forelimb strength. After five weeks of therapy, the distribution of peak forces is highly similar to that observed pre-lesion, with no differences observed between any bins (Fig. 3A, paired t-test, all P N 0.15). This indicates a complete restoration of forelimb strength. ANOVA on peak force revealed a significant effect of therapy for the VNS group (F[6,35] = 8.88, P b 0.001). Examination of group averages over the course of therapy demonstrates that peak force increased significantly compared to the post-lesion baseline during the first week of therapy (Fig. 3C, POST vs. week 1, paired t-test, P b 0.05). No significant difference from pre-lesion was observed between weeks 1 and 6 (all P N 0.05). At the completion of therapy, peak force had recovered 104.3 ± 15.3% relative to the deficit and was indistinguishable from pre-lesion levels. The restoration of peak force remained after the cessation of VNS therapy at week 6, indicating that the recovery of forelimb

Fig. 3. VNS paired with Rehab improves recovery of forelimb strength. (A, B) Peak force distributions for both groups at each time point. The gray dashed box indicates trials which exceed the 120 g threshold. The numerical value indicates the cumulative percentage (± SE) of trials exceeding the 120 g threshold. (C) Maximal force over the course of the experiment. VNS paired with rehabilitative training significantly improves maximal force compared to rehabilitative training alone by the second week of therapy. The increase in force is still present at week 6 after the cessation of VNS. N refers to number of rats in each group. * indicates significant difference between Rehab and VNS + Rehab. (D) Correlation of individual subject maximal force prior to lesion and after the completion of therapy. Empty symbols denote a significant reduction after therapy compared to pre-lesion performance. All subjects (6 of 6) in the VNS + Rehab group demonstrate complete recovery, while only 2 of 9 subjects in the Rehab group recover.

N. Khodaparast et al. / Neurobiology of Disease 60 (2013) 80–88

function was long-lasting. None of the subjects (0 of 6) that received VNS + Rehab demonstrated an impairment of force generation at the completion of therapy (Fig. 3D). These findings demonstrate that VNS + Rehab fully restores forelimb force generation. Consistent with the recovery observed in single subjects, average peak force in the VNS + Rehab group is significantly greater than the Rehab group (Fig. 3C). ANOVA of peak force revealed a significant effect of treatment (F[1,83] = 47.92, P b 0.001) and time (F[5,83] = 3.74, P = 0.004). By week 2, maximal force was significantly higher in the VNS + Rehab group. The improvement in maximal force was evident throughout the remainder of therapy (unpaired t-test, P b 0.05 for weeks 2–6). These results demonstrate that VNS paired with rehabilitative training results in a significant increase in forelimb strength compared to rehabilitative training without VNS. Intensity of training cannot account for the differences in recovery Insufficient training intensity or motivation can limit the gains from rehabilitation (Kwakkel et al., 1999; Sivenius et al., 1985). To confirm that the Rehab group did not perform less intensive training, we compared the total number of pull attempts performed over the course of therapy. The total number of pulls during therapy is significantly higher in the Rehab group compared to the VNS + Rehab group (Fig. 4A, Rehab: 67,653 ± 7379 total attempts, VNS + Rehab: 47,656 ± 4535 total attempts, unpaired t-test, P = 0.050). Because the Rehab group performs more repetitions but displays worse functional outcomes, the intensity of the training cannot account for the difference between the groups. These findings highlight the marked benefit of VNS paired with rehabilitative training beyond rehabilitative training without VNS. Lesion size cannot account for the differences in recovery We sought to determine if our stimulation parameters would confer neuroprotective effects that could reduce lesion size, and if any changes could account for differences in functional recovery. Lesion size spanned the left caudal forelimb area through all layers of cortex (Fig. 4B, also see Fig. S5). The resulting infarct was primarily restricted to cortex, but minor white matter damage was observed in one subject in the Rehab group and one subject in the VNS + Rehab group. There was no difference in lesion volume observed between groups (Fig. 4C, VNS + Rehab: 9.64 ± 2.55 mm3, Rehab: 10.03 ± 2.41 mm3, n = 6,8, unpaired t-test, P = 0.78, also see Fig. S3). These findings demonstrate that the stimulation parameters used in this study did not confer any observable neuroprotective effects on lesion size (see Supplementary materials). Discussion This study tested whether delivering VNS during rehabilitative training could improve recovery of forelimb motor function following cortical ischemic damage compared to rehabilitative training alone. Forelimb function was assessed using the automated isometric pull task with approximately 50,000 pull attempts collected per rat, resulting in unbiased data collection and high statistical power (Hays et al., 2012). Rats received rehabilitative training on an isometric force task (Hays et al., 2012) for five weeks with or without the delivery of VNS. Weeks of daily intensive rehabilitative training without VNS failed to restore pre-lesion function. Forelimb function recovered completely when brief bursts of VNS were delivered during rehabilitative training. VNS paired with rehabilitative training doubled recovery of hit rate performance and forelimb strength compared to rehabilitative training without VNS. VNS did not alter the size of the lesion or increase the intensity of rehabilitative training. The enhanced recovery facilitated by the delivery of VNS during rehabilitative training may present an opportunity for reducing motor impairments in stroke patients. Stroke often results in deficits of skilled movement which persist in spite of extensive rehabilitation (Segura et al., 2006; Van Peppen et al.,

2004). Rehabilitative training is focused on improving motor function after stroke, which is thought to be supported by reorganization of the motor cortex (Hallett, 2001; Kleim, 2011; Nudo, 2003). Rehabilitationinduced cortical plasticity is associated with the degree of recovery in animal models (Castro-Alamancos and Borrell, 1995; Dijkhuizen et al., 2001; Frost et al., 2003; Ramanathan et al., 2006) and in stroke patients (Calautti and Baron, 2003; Lindenberg et al., 2012). A variety of factors that limit neural plasticity reduce recovery following brain damage (Boyeson et al., 1992; Conner et al., 2005; Goldstein et al., 1991; McHughen et al., 2010; Siironen et al., 2007; Sweetnam et al., 2012). Because of the association of plasticity and recovery, it was reasonable to expect that enhancement of plasticity would lead to gains in functional recovery after stroke. Vagus nerve stimulation paired with motor training in unlesioned animals induced robust plasticity in the motor cortex, while similar amounts of motor training without VNS did not drive observable plasticity (Porter et al., 2011). The improvement of recovery observed in this study in subjects that received VNS during rehabilitative training is likely due to the VNS-dependent enhancement of plasticity within motor cortex. However, the cellular and molecular mechanisms that underlie VNS-dependent recovery remain unclear. Stimulation of the vagus nerve engages multiple neuromodulatory systems and results in the release of acetylcholine, norepinephrine, and brain-derived neurotrophic factor (Dorr and Debonnel, 2006; Follesa et al., 2007; Groves and Brown, 2005; Hassert et al., 2004; Nichols et al., 2011; Roosevelt et al., 2006). Individually, each of these neuromodulators is known to enhance cortical plasticity and facilitate recovery after brain damage (Boyeson et al., 1992; Conner et al., 2005; Goldstein et al., 1991; Ramanathan et al., 2009; Schäbitz et al., 2004, 2007). There is considerable evidence that these neuromodulators, particularly acetylcholine and norepinephrine, operate synergistically to promote plasticity (Bear and Singer, 1986; Salgado et al., 2012; Seol et al., 2007). The ability of vagus nerve stimulation to engage these neuromodulatory systems arises from its unique anatomy. Eighty percent of the vagus nerve is comprised of afferent sensory fibers that project into the medulla (Foley and DuBois, 1937; George et al., 2000). These fibers synapse bilaterally on neurons within the nucleus of the tractus solitarius, which then project to the noradrenergic locus coeruleus (LC) and the cholinergic basal forebrain (BF) (Berntson et al., 1998; George et al., 2000; Henry, 2002; Semba et al., 1988). Stimulation of the vagus nerve drives activity within both the LC and BF regions and consequently induces release of acetylcholine and norepinephrine throughout the cortex (Follesa et al., 2007; Nichols et al., 2011; Roosevelt et al., 2006). Both of these regions are required for the effects of VNS in the central nervous system (Krahl et al., 1998; Nichols et al., 2011). It is not yet known whether the release of these neuromodulators is required for the robust enhancement of recovery driven by VNS. Our results provides a proof of concept demonstration that VNS during rehabilitative training holds promise for improving recovery of motor function after stroke. However, translating pre-clinical stroke research into effective therapies for patient has proven to be difficult (Lyden and Lapchak, 2012; O'Collins et al., 2006). Many therapies require delivery soon after the onset of ischemic damage, either to inhibit neuronal death or to bolster the innate transient increase in plasticity after damage (Adams et al., 1994; Savitz, 2007). As a result, many strategies are less effective once chronic deficits are in place. The discrepancy between the timing of delivery of a treatment in animal studies and human trials is thought to be a contributing factor the failure of many promising preclinical therapies (Cheng et al., 2004; Gladstone et al., 2002; Kahle and Bix, 2012). In this study, VNS paired with rehabilitative training was effective when initiated nine days after the stroke. The ability of VNS to confer a beneficial outcome when delivered at this time scale is an improvement over interventions that must be delivered shortly after (i.e., typically within six hours of) stroke to be effective (Ay et al., 2009; Hiraki et al., 2012; Yenari and Hemmen, 2010; Zivin, 1998).

N. Khodaparast et al. / Neurobiology of Disease 60 (2013) 80–88

Fig. 4. VNS does not increase intensity of rehabilitative training or decrease lesion size. (A) Rehab rats perform slightly, but signiﬁcantly, more pull attempts over the course of therapy that VNS + Rehab rats. (B) Reconstructions demonstrating the extent of the smallest, representative, and largest lesions. Ischemic damage is primarily conﬁned to the forelimb area. Numbers refer to mm from bregma. (C) No difference in lesion size was observed between the Rehab and VNS + Rehab groups.

However, it is possible that VNS paired with rehabilitative training may not be ineffective when delivered long after stroke. Later delivery of rehabilitation is associated with worse functional outcomes in animal models and patients (Biernaskie et al., 2004; Cifu and Stewart, 1999), potentially because the rehabilitation occurs after the transient upregulation of plasticity and growth-promoting factors induced by brain damage (Carmichael et al., 2005; Murphy and Corbett, 2009; Wieloch and Nikolich, 2006). In spite of this, two factors suggest that a delay of weeks or months might not occlude the beneﬁcial effects of VNS paired with rehabilitative training. First, VNS paired with physical training can generate motor cortical plasticity independent of brain damage (Porter et al., 2011). This suggests that VNS-dependent plasticity does not rely on the transient period of enhanced growth and plasticity after injury; therefore VNS may be successful when delivered later. Second, VNS drives a precisely-timed release of neuromodulators that are normally increased during natural motor learning (Izaki et al., 1998; Orsetti et al., 1996). It has been predicted that the ability to achieve supranormal levels of these neuromodulators during rehabilitative training may improve functional gains (Nadeau et al., 2004). Pharmacological interventions that alter the levels of acetylcholine and norepinephrine during rehabilitative training improve motor outcomes in some studies (Adkins and Jones, 2005; Gilmour et al., 2005; Kessler et al., 2000; Nadeau et al., 2004; Walker-Batson et al., 1995). If VNS improves rehabilitation by triggering a consistent trial-by-trial burst of neuromodulators, then it is reasonable to expect that VNS might continue to improve rehabilitation that begins long after stroke onset. However, since the current experiments do not test this possibility, the potential utility of VNS during the chronic stage is speculative and needs to be tested.

There is considerable preclinical and clinical evidence that VNS could be safely delivered in stroke patients. VNS has been used to treat of a wide range of conditions, including refractory epilepsy (BenMenachem, 2002; Morris and Mueller, 1999), treatment-resistant depression (Rush et al., 2005; Sackeim et al., 2001), Alzheimer's disease (Sjogren et al., 2002), fibromyalgia (Lange et al., 2011), and bipolar disorder (Marangell et al., 2008). Over 60,000 patients have received VNS over the past twenty-five years (Englot et al., 2011). The clinically approved therapy, which is typically delivers 100 times more daily current than our therapy, is well-tolerated and usually continues for many years (Morris and Mueller, 1999). Few patients report side effects, the most common of which are cough and hoarseness (Sackeim et al., 2001). Even at these high currents, no significant changes in heart rate or oxygen saturation are observed (Binks et al., 2001; Handforth et al., 1998). Additional studies will be needed to determine whether delivery of VNS during physical therapy would be safe in stroke patients. This is the first study to show that VNS paired with rehabilitative training promotes recovery of strength in a model of stroke. However, the ability for VNS to enhance event-specific plasticity applies in other brain regions and may have therapeutic implications for other diseases (Kilgard, 2012; Lozano, 2011). VNS paired with tones drives tone-specific plasticity within auditory cortex (Engineer et al., 2011). A therapy based on specifically targeting plasticity employed VNS pairing with tones and successfully reversed pathological plasticity and eliminated the behavioral correlate of tinnitus in a rat model (Engineer et al., 2011). This same therapy is now undergoing clinical trials in chronic tinnitus patients, with promising preliminary results (Arns and De Ridder, 2011). The benefits of therapy for tinnitus appear to be long-lasting and seem to be blocked by medications that interfere

N. Khodaparast et al. / Neurobiology of Disease 60 (2013) 80–88

with acetylcholine and norepinephrine, providing further mechanistic support of a neuromodulatory basis of VNS-directed plasticity. In addition to tinnitus and stroke, targeted plasticity represents a potential tool for other neurological disorders, including aphasia, apraxia, dystonia, and pain (Lozano, 2011). Conclusion/implications This study provides a proof of concept demonstration that stimulation of the vagus nerve paired with rehabilitative training can improve recovery of forelimb function in a rat model of stroke. VNS delivered during rehabilitative training fully restored forelimb force generation to pre-lesion levels. A similar amount of rehabilitative training without VNS was insufﬁcient to restore performance. These results suggest that VNS paired with physical rehabilitation is a potentially viable new therapy for enhancing recovery of motor function after stroke. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.nbd.2013.08.002. Funding This work was supported by MicroTransponder, Inc. Author contributions N.K., S.A.H., and M.P.K. wrote the manuscript. N.K., M.P.K., R.L.R., and A.M.S. designed the study. N.K., S.A.H., D.R.H., A.R., and M.P. performed behavioral testing. N.K., S.A.H., and A.M.S. analyzed the data. A.M.S. and R.L.R. provided software and hardware support. All authors discussed the results and provided comments on the manuscript. Acknowledgments We would like to T. Fayyaz, N. Alam, F. Naqvi, D. Cao, R. Babu, R. Gattamaraju, V. Konduru, S. Burghul, and R. Joseph for help with behavioral training. References Adams, H.P., Brott, T.G., Crowell, R.M., Furlan, A.J., Gomez, C.R., Grotta, J., Helgason, C.M., Marler, J.R., Woolson, R.F., Zivin, J.A., 1994. Guidelines for the management of patients with acute ischemic stroke. A statement for healthcare professionals from a special writing group of the Stroke Council, American Heart Association. Stroke 25, 1901–1914. Adkins, D.L., Jones, T.A., 2005. D-Amphetamine enhances skilled reaching after ischemic cortical lesions in rats. Neurosci. Lett. 380, 214–218. Adkins-Muir, D., Jones, T., 2003. Cortical electrical stimulation combined with rehabilitative training: enhanced functional recovery and dendritic plasticity following focal cortical ischemia in rats. Neurol. Res. 25 (8), 780–788. Arns, M., De Ridder, D., 2011. Neurofeedback 2.0? J. Neurother. 15, 91–93. Ay, I., Lu, J., Ay, H., Gregory Sorensen, A., 2009. Vagus nerve stimulation reduces infarct size in rat focal cerebral ischemia. Neurosci. Lett. 459, 147–151. Bear, M.F., Singer, W., 1986. Modulation of Visual Cortical Plasticity by Acetylcholine and Noradrenaline. Ben-Menachem, E., 2002. Vagus-nerve stimulation for the treatment of epilepsy. Lancet Neurol. 1, 477–482. Berntson, G.G., Sarter, M., Cacioppo, J.T., 1998. Anxiety and cardiovascular reactivity: the basal forebrain cholinergic link. Behav. Brain Res. 94, 225–248. Biernaskie, J., Chernenko, G., Corbett, D., 2004. Efﬁcacy of rehabilitative experience declines with time after focal ischemic brain injury. J. Neurosci. 24, 1245–1254. Binks, A., Paydarfar, D., Schachter, S., Guz, A., Banzett, R., 2001. High strength stimulation of the vagus nerve in awake humans: a lack of cardiorespiratory effects. Respir. Physiol. 127, 125–133. Boyeson, M.G., Callister, T.R., Cavazos, J.E., 1992. Biochemical and behavioral effects of a sensorimotor cortex injury in rats pretreated with the noradrenergic neurotoxin DSP-4. Behav. Neurosci. 106, 964. Calautti, C., Baron, J., 2003. Functional neuroimaging studies of motor recovery after stroke in adults a review. Stroke 34, 1553–1566. Carmichael, S.T., Archibeque, I., Luke, L., Nolan, T., Momiy, J., Li, S., 2005. Growth-associated gene expression after stroke: evidence for a growth-promoting region in peri-infarct cortex. Exp. Neurol. 193, 291–311. Castro-Alamancos, M., Borrell, J., 1995. Functional recovery of forelimb response capacity after forelimb primary motor cortex damage in the rat is due to the reorganization of adjacent areas of cortex. Neuroscience 68, 793–805.

Cheng, Y.D., Al-Khoury, L., Zivin, J.A., 2004. Neuroprotection for ischemic stroke: two decades of success and failure. NeuroRx 1, 36–45. Cifu, D.X., Stewart, D.G., 1999. Factors affecting functional outcome after stroke: a critical review of rehabilitation interventions. Arch. Phys. Med. Rehabil. 80, S35–S39. Conner, J.M., Chiba, A.A., Tuszynski, M.H., 2005. The basal forebrain cholinergic system is essential for cortical plasticity and functional recovery following brain injury. Neuron 46, 173–179. Deb, P., Sharma, S., Hassan, K., 2010. Pathophysiologic mechanisms of acute ischemic stroke: an overview with emphasis on therapeutic significance beyond thrombolysis. Pathophysiology 17, 197–218. Dijkhuizen, R.M., Ren, J., Mandeville, J.B., Wu, O., Ozdag, F.M., Moskowitz, M.A., Rosen, B.R., Finklestein, S.P., 2001. Functional magnetic resonance imaging of reorganization in rat brain after stroke. Proc. Natl. Acad. Sci. 98, 12766–12771. Dorr, A.E., Debonnel, G., 2006. Effect of vagus nerve stimulation on serotonergic and noradrenergic transmission. J. Pharmacol. Exp. Ther. 318, 890–898. Engineer, N.D., Riley, J.R., Seale, J.D., Vrana, W.A., Shetake, J.A., Sudanagunta, S.P., Borland, M.S., Kilgard, M.P., 2011. Reversing pathological neural activity using targeted plasticity. Nature 470, 101–104. Englot, D.J., Chang, E.F., Auguste, K.I., 2011. Vagus nerve stimulation for epilepsy: a metaanalysis of efficacy and predictors of response: a review. J. Neurosurg. 115, 1248–1255. Fang, P., Barbay, S., Plautz, E.J., Hoover, E., Strittmatter, S.M., Nudo, R.J., 2010. Combination of NEP 1–40 treatment and motor training enhances behavioral recovery after a focal cortical infarct in rats. Stroke 41, 544–549. Foley, J.O., DuBois, F.S., 1937. Quantitative studies of the vagus nerve in the cat. I. The ratio of sensory to motor fibers. J. Comp. Neurol. 67, 49–67. Follesa, P., Biggio, F., Gorini, G., Caria, S., Talani, G., Dazzi, L., Puligheddu, M., Marrosu, F., Biggio, G., 2007. Vagus nerve stimulation increases norepinephrine concentration and the gene expression of BDNF and bFGF in the rat brain. Brain Res. 1179, 28–34. Frost, S., Barbay, S., Friel, K., Plautz, E., Nudo, R., 2003. Reorganization of remote cortical regions after ischemic brain injury: a potential substrate for stroke recovery. J. Neurophysiol. 89, 3205–3214. George, M.S., Sackeim, H.A., Rush, A.J., Marangell, L.B., Nahas, Z., Husain, M.M., Lisanby, S., Burt, T., Goldman, J., Ballenger, J.C., 2000. Vagus nerve stimulation: a new tool for brain research and therapy. Biol. Psychiatry 47, 287–295. Gilmour, G., Iversen, S.D., O'Neill, M.F., Bannerman, D.M., 2004. The effects of intracortical endothelin-1 injections on skilled forelimb use: implications for modelling recovery of function after stroke. Behav. Brain Res. 150, 171–183. Gilmour, G., Iversen, S.D., O'Neill, M.F., O'Neill, M.J., Ward, M.A., Bannerman, D.M., 2005. Amphetamine promotes task-dependent recovery following focal cortical ischaemic lesions in the rat. Behav. Brain Res. 165, 98–109. Gladstone, D.J., Black, S.E., Hakim, A.M., 2002. Toward wisdom from failure lessons from neuroprotective stroke trials and new therapeutic directions. Stroke 33, 2123–2136. Goldstein, L.B., Coviello, A., Miller, G.D., Davis, J.N., 1991. Norepinephrine depletion impairs motor recovery following sensorimotor cortex injury in the rat. Restor. Neurol. Neurosci. 3, 41–47. Groves, D.A., Brown, V.J., 2005. Vagal nerve stimulation: a review of its applications and potential mechanisms that mediate its clinical effects. Neurosci. Biobehav. Rev. 29, 493–500. Hallett, M., 2001. Plasticity of the human motor cortex and recovery from stroke. Brain Res. Rev. 36, 169–174. Handforth, A., DeGiorgio, C., Schachter, S., Uthman, B., Naritoku, D., Tecoma, E., Henry, T., Collins, S., Vaughn, B., Gilmartin, R., 1998. Vagus nerve stimulation therapy for partialonset seizures: a randomized active-control trial. Neurology 51, 48–55. Harris, J.E., Eng, J.J., 2007. Paretic upper-limb strength best explains arm activity in people with stroke. Phys. Ther. 87, 88–97. Harvey, R.L., Nudo, R.J., 2007. Cortical brain stimulation: a potential therapeutic agent for upper limb motor recovery following stroke. Top. Stroke Rehabil. 14, 54–67. Hassert, D., Miyashita, T., Williams, C., 2004. The effects of peripheral vagal nerve stimulation at a memory-modulating intensity on norepinephrine output in the basolateral amygdala. Behav. Neurosci. 118, 79. Hays, S.A., Khodaparast, N., Sloan, A.M., Hulsey, D.R., Pantoja, M., Ruiz, A.D., Kilgard, M.P., Rennaker II, R.L., 2012. The isometric pull task: a novel automated method for quantifying forelimb force generation in rats. J. Neurosci. Methods 212, 329–337. Hays, S.A., Khodaparast, N., Sloan, A.M., Fayyaz, T., Hulsey, D.R., Ruiz, A.D., Pantoja, M., Kilgard, M.P., Rennaker II, R.L., 2013. The bradykinesia assessment task: an automated method to measure forelimb speed in rodents. J. Neurosci. Methods 214, 52–61. Henry, T.R., 2002. Therapeutic mechanisms of vagus nerve stimulation. Neurology 59, S3–S14. Hiraki, T., Baker, W., Greenberg, J.H., 2012. Effect of vagus nerve stimulation during transient focal cerebral ischemia on chronic outcome in rats. J. Neurosci. Res. 90, 887–894. Izaki, Y., Hori, K., Nomura, M., 1998. Dopamine and acetylcholine elevation on lever-press acquisition in rat prefrontal cortex. Neurosci. Lett. 258, 33–36. Johansson, B.B., 2000. Brain plasticity and stroke rehabilitation. The Willis lecture. Stroke 31, 223–230. Kahle, M.P., Bix, G.J., 2012. Successfully climbing the “STAIRs”: surmounting failed translation of experimental ischemic stroke treatments. Stroke Res. Treat. 2012. Kessler, J., Thiel, A., Karbe, H., Heiss, W., 2000. Piracetam improves activated blood flow and facilitates rehabilitation of poststroke aphasic patients. Stroke 31, 2112–2116. Kilgard, M.P., 2012. Harnessing plasticity to understand learning and treat disease. Trends Neurosci. 35, 715–722. King, R.B., 1996. Quality of life after stroke. Stroke 27, 1467–1472. Kleim, J.A., 2011. Neural plasticity and neurorehabilitation: teaching the new brain old tricks. J. Commun. Disord. 44, 521–528.

N. Khodaparast et al. / Neurobiology of Disease 60 (2013) 80–88

Krahl, S.E., Clark, K.B., Smith, D.C., Browning, R.A., 1998. Locus coeruleus lesions suppress the seizure‐attenuating effects of vagus nerve stimulation. Epilepsia 39, 709–714. Kwakkel, G., 2009. Towards integrative neurorehabilitation science. Physiother. Res. Int. 14, 137–146. Kwakkel, G., Wagenaar, R.C., Twisk, J.W., Lankhorst, G.J., Koetsier, J.C., 1999. Intensity of leg and arm training after primary middle-cerebral-artery stroke: a randomised trial. Lancet 354, 191–196. Lange, G., Janal, M.N., Maniker, A., FitzGibbons, J., Fobler, M., Cook, D., Natelson, B.H., 2011. Safety and efficacy of vagus nerve stimulation in fibromyalgia: a phase I/II proof of concept trial. Pain Med. 12, 1406–1413. Leary, M.C., Saver, J.L., 2003. Annual incidence of first silent stroke in the United States: a preliminary estimate. Cerebrovasc. Dis. 16, 280–285. Levine, J., Greenwald, B.D., 2009. Fatigue in Parkinson disease, stroke, and traumatic brain injury. Phys. Med. Rehabil. Clin. N. Am. 20, 347–361. Lindenberg, R., Zhu, L.L., Schlaug, G., 2012. Combined central and peripheral stimulation to facilitate motor recovery after stroke: the effect of number of sessions on outcome. Neurorehabil. Neural Repair 26, 479–483. Lo, E.H., Dalkara, T., Moskowitz, M.A., 2003. Mechanisms, challenges and opportunities in stroke. Nat. Rev. Neurosci. 4, 399–414. Lozano, A.M., 2011. Harnessing plasticity to reset dysfunctional neurons. N. Engl. J. Med. 364, 1367–1368. Lyden, P., Lapchak, P., 2012. Sisyphus and translational stroke research. Sci. Transl. Med. 4 (156ps20-156ps20). Marangell, L.B., Suppes, T., Zboyan, H.A., Prashad, S.J., Fischer, G., Snow, D., Sureddi, S., ALLEN, J.C., 2008. A 1-year pilot study of vagus nerve stimulation in treatmentresistant rapid-cycling bipolar disorder. J. Clin. Psychiatry 69, 183–189. McHughen, S.A., Rodriguez, P.F., Kleim, J.A., Kleim, E.D., Crespo, L.M., Procaccio, V., Cramer, S.C., 2010. BDNF val66met polymorphism influences motor system function in the human brain. Cereb. Cortex 20, 1254–1262. Mercier, C., Bourbonnais, D., 2004. Relative shoulder flexor and handgrip strength is related to upper limb function after stroke. Clin. Rehabil. 18, 215–221. Morris, G.L., Mueller, W.M., 1999. Long-term treatment with vagus nerve stimulation in patients with refractory epilepsy. Neurology 53, 1731–1735. Murphy, T.H., Corbett, D., 2009. Plasticity during stroke recovery: from synapse to behaviour. Nat. Rev. Neurosci. 10, 861–872. Nadeau, S.E., Behrman, A.L., Davis, S.E., Reid, K., Wu, S., Stidham, B., Helms, K., Rothi, L.G., 2004. Donepezil as an adjuvant to constraint-induced therapy for upper-limb dysfunction after stroke: an exploratory randomized clinical trial. J. Rehabil. Res. Dev. 41, 525–534. Nichols, J., Nichols, A., Smirnakis, S., Engineer, N., Kilgard, M., Atzori, M., 2011. Vagus nerve stimulation modulates cortical synchrony and excitability through the activation of muscarinic receptors. Neuroscience 189, 207–214. Nudo, R.J., 2003. Functional and structural plasticity in motor cortex: implications for stroke recovery. Phys. Med. Rehabil. Clin. N. Am. 14, S57. O'Collins, V.E., Macleod, M.R., Donnan, G.A., Horky, L.L., van der Worp, Bart H., Howells, D.W., 2006. 1,026 experimental treatments in acute stroke. Ann. Neurol. 59, 467–477. Orsetti, M., Casamenti, F., Pepeu, G., 1996. Enhanced acetylcholine release in the hippocampus and cortex during acquisition of an operant behavior. Brain Res. 724, 89–96. Piernik-Yoder, B., Ketchum, N., 2013. Rehabilitation Outcomes of Stroke Patients With and Without Diabetes. Archives of physical medicine and rehabilitation. Porter, B.A., Khodaparast, N., Fayyaz, T., Cheung, R.J., Ahmed, S.S., Vrana, W.A., Rennaker II, R.L., Kilgard, M.P., 2011. Repeatedly pairing vagus nerve stimulation with a movement reorganizes primary motor cortex. Cereb. Cortex 22, 2365–2374. Ramanathan, D., Conner, J.M., Tuszynski, M.H., 2006. A form of motor cortical plasticity that correlates with recovery of function after brain injury. Proc. Natl. Acad. Sci. 103, 11370–11375. Ramanathan, D., Tuszynski, M.H., Conner, J.M., 2009. The basal forebrain cholinergic system is required specifically for behaviorally mediated cortical map plasticity. J. Neurosci. 29, 5992–6000. Roosevelt, R.W., Smith, D.C., Clough, R.W., Jensen, R.A., Browning, R.A., 2006. Increased extracellular concentrations of norepinephrine in cortex and hippocampus following vagus nerve stimulation in the rat. Brain Res. 1119, 124–132. Rossini, P.M., Forno, G.D., 2004. Neuronal post-stroke plasticity in the adult. Restor. Neurol. Neurosci. 22, 193–206. Rush, A.J., Sackeim, H.A., Marangell, L.B., George, M.S., Brannan, S.K., Davis, S.M., Lavori, P., Howland, R., Kling, M.A., Rittberg, B., 2005. Effects of 12 months of Vagus Nerve Stimulation in Treatment-resistant Depression: A Naturalistic Study.

Sackeim, H.A., Rush, A.J., George, M.S., Marangell, L.B., Husain, M.M., Nahas, Z., Johnson, C.R., Seidman, S., Giller, C., Haines, S., 2001. Vagus nerve stimulation (VNS™) for treatment-resistant depression: efﬁcacy, side effects, and predictors of outcome. Neuropsychopharmacology 25, 713–728. Salgado, H., Köhr, G., Treviño, M., 2012. Noradrenergic ‘tone’ determines dichotomous control of cortical spike-timing-dependent plasticity. Sci. Rep. 2. Savitz, S.I., 2007. A critical appraisal of the NXY-059 neuroprotection studies for acute stroke: a need for more rigorous testing of neuroprotective agents in animal models of stroke. Exp. Neurol. 205, 20–25. Sawaki, L., Butler, A.J., Leng, X., Wassenaar, P.A., Mohammad, Y.M., Blanton, S., Sathian, K., Nichols-Larsen, D.S., Wolf, S.L., Good, D.C., 2008. Constraint-induced movement therapy results in increased motor map area in subjects 3 to 9 months after stroke. Neurorehabil. Neural Repair 22, 505–513. Schäbitz, W., Berger, C., Kollmar, R., Seitz, M., Tanay, E., Kiessling, M., Schwab, S., Sommer, C., 2004. Effect of brain-derived neurotrophic factor treatment and forced arm use on functional motor recovery after small cortical ischemia. Stroke 35, 992–997. Schäbitz, W., Steigleder, T., Cooper-Kuhn, C.M., Schwab, S., Sommer, C., Schneider, A., Kuhn, H.G., 2007. Intravenous brain-derived neurotrophic factor enhances poststroke sensorimotor recovery and stimulates neurogenesis. Stroke 38, 2165–2172. Schaechter, J.D., 2004. Motor rehabilitation and brain plasticity after hemiparetic stroke. Prog. Neurobiol. 73, 61. Schaechter, J.D., Kraft, E., Hilliard, T.S., Dijkhuizen, R.M., Benner, T., Finklestein, S.P., Rosen, B.R., Cramer, S.C., 2002. Motor recovery and cortical reorganization after constraintinduced movement therapy in stroke patients: a preliminary study. Neurorehabil. Neural Repair 16, 326–338. Segura, A.P.C., Fontes, S.V., Fukujima, M.M., de Andrade Matas, S.L., 2006. The impact evaluation of physical therapy on the quality of life of cerebrovascular stroke patients. Int. J. Rehabil. Res. 29, 243–246. Semba, K., Reiner, P., McGeer, E., Fibiger, H., 1988. Brainstem afferents to the magnocellular basal forebrain studied by axonal transport, immunohistochemistry, and electrophysiology in the rat. J. Comp. Neurol. 267, 433–453. Seol, G.H., Ziburkus, J., Huang, S.Y., Song, L., Kim, I.T., Takamiya, K., Huganir, R.L., Lee, H.K., Kirkwood, A., 2007. Neuromodulators control the polarity of spike-timing-dependent synaptic plasticity. Neuron 55, 919–929. Siironen, J., Juvela, S., Kanarek, K., Vilkki, J., Hernesniemi, J., Lappalainen, J., 2007. The Met allele of the BDNF Val66Met polymorphism predicts poor outcome among survivors of aneurysmal subarachnoid hemorrhage. Stroke 38, 2858–2860. Sivenius, J., Pyörälä, K., Heinonen, O., Salonen, J., Riekkinen, P., 1985. The signiﬁcance of intensity of rehabilitation of stroke—a controlled trial. Stroke 16, 928–931. Sjogren, M.J.C., Hellstrom, P.T.O., Jonsson, M.A.G., Runnerstam, M., Silander, H.C., Ben-Menachem, E., 2002. Cognition-enhancing effect of vagus nerve stimulation in patients with Alzheimer's disease: a pilot study. J. Clin. Psychiatry 63, 972–980. Sunderland, A., Tinson, D., Bradley, L., Hewer, R.L., 1989. Arm function after stroke. An evaluation of grip strength as a measure of recovery and a prognostic indicator. J. Neurol. Neurosurg. Psychiatry 52, 1267–1272. Sweetnam, D., Holmes, A., Tennant, K.A., Zamani, A., Walle, M., Jones, P., Wong, C., Brown, C.E., 2012. Diabetes impairs cortical plasticity and functional recovery following ischemic stroke. J. Neurosci. 32, 5132–5143. Van Peppen, R.P., Kwakkel, G., Wood-Dauphinee, S., Hendriks, H.J., Van der Wees, Ph.J., Dekker, J., 2004. The impact of physical therapy on functional outcomes after stroke: what's the evidence? Clin. Rehabil. 18, 833–862. Walker-Batson, D., Smith, P., Curtis, S., Unwin, H., Greenlee, R., 1995. Amphetamine paired with physical therapy accelerates motor recovery after stroke: further evidence. Stroke 26, 2254–2259. Ward, N.S., Cohen, L.G., 2004. Mechanisms underlying recovery of motor function after stroke. Arch. Neurol. 61, 1844. Whyte, E.M., Mulsant, B.H., Vanderbilt, J., Dodge, H.H., Ganguli, M., 2004. Depression after stroke: a prospective epidemiological study. J. Am. Geriatr. Soc. 52, 774–778. Wieloch, T., Nikolich, K., 2006. Mechanisms of neural plasticity following brain injury. Curr. Opin. Neurobiol. 16, 258–264. Yenari, M.A., Hemmen, T.M., 2010. Therapeutic hypothermia for brain ischemia: where have we come and where do we go? Stroke 41, S72–S74. You, S.H., Jang, S.H., Kim, Y., Hallett, M., Ahn, S.H., Kwon, Y., Kim, J.H., Lee, M.Y., 2005. Virtual reality-induced cortical reorganization and associated locomotor recovery in chronic stroke an experimenter-blind randomized study. Stroke 36, 1166–1171. Zivin, J.A., 1998. Factors determining the therapeutic window for stroke. Neurology 50, 599–603.

Annales Françaises d’Anesthésie et de Réanimation 33S (2014) A162–A167

24 h) mesurée par une échelle numérique au repos par un investigateur en aveugle des données pré et per-opératoires. L’analyse statistique a consisté en l’analyse multivariée des facteurs en rapport avec la DPO 24 h d’une part et la DPO 24 h ≥ 5/10 par la suite. Ces analyses ont été ajustées sur la consommation cumulée de morphine et la classification du caractère douloureux de la chirurgie d’après le référentiel de la SFAR. Résultats Cinq cent quinze patients âgés de 59 ± 16 ans dont 50 % de femmes ont été inclus dans les secteurs orthopédique 36 %, digestif 21 %, vasculaire 11 %, urologique 11 %, gynécologique 8 %, cardiothoracique 8 % et ORL 5 %. L’anxiété générale était de 28 ± 27 mm et l’anxiété liée à la chirurgie de 40 ± 31 mm. L’anticipation du niveau de douleur était de 42 ± 27 mm et la consommation anticipée d’antalgique était égale à la moyenne dans 58 % des cas, 19 % des patients pensant avoir une consommation plus élevée que la moyenne. La DPO 24 h au repos était de 3,4 ± 2,6 et ≥ 5/10 dans 35 % des cas. L’analyse multivariée de la DPO retrouvait comme variables indépendantes l’anxiété générale (p = 0,03), la douleur pressentie (p = 0,007), ainsi que la consommation préopératoire d’antalgique (p = 0,003). Les variables permettant de prédire une douleur ≥ 5/10 étaient l’anxiété générale (p = 0,004), une anticipation du besoin en antalgiques supérieurs à la moyenne (p = 0,001) et l’existence de douleurs fréquentes dans la vie quotidienne (p = 0,02). L’aire sous la courbe de ce modèle est de 0,67. Discussion L’anticipation de la douleur post-opératoire et l’anxiété sont des facteurs connus de majoration de la DPO. Notre étude confirme, sur une large population, les résultats d’une étude récente menée en obstétrique sur l’intérêt d’utiliser des mesures simplifiées de ces paramètres en pré-opératoire. Elle ajoute le gain de rechercher l’existence de douleur dans la vie quotidienne. Déclaration d’intérêts Les auteurs n’ont pas transmis de déclaration de conflits d’intérêts. Pour en savoir plus Anesthesiology 2013;118:1170–9.

A163

Pour l’analyse, les valeurs moyennées de l’ANI et la Ce-R à t + 5 min ont été utilisées. Les données ont été comparées par un test de Mann Whitney avec p < 0,05 considéré comme significatif. Résultats Parmi les 62 patients consécutifs opérés de TAPC, 50 (28 hommes, 22 femmes, ASA 1-3, âge moyenne 53 ± 14 ans, BMI 24 ± 4 kg/m2 ) ont été inclus. La durée moyenne de l’intervention est 5,53 ± 1,23 h avec une consommation de propofol (3,3 ± 1,0 g) et de rémifentanil (3,6 ± 1,5 mg). Le Ce-R a était modifié 145 fois pendant les différents temps chirurgicaux. Les réponses de l’ANI aux modifications de la Ce-R sont présentées en Fig. 1. Discussion Dans cette étude, l’augmentation significative de la Ce-R est suivie d’une augmentation significative de l’ANI alors que la diminution de la Ce-R n’a pas eu d’impact significativement sur l’ANI. Serait-il à cause d’une analgésie déjà suffisante ou d’une absence de corrélation de l’ANI avec le niveau d’analgésie ? D’autres études sont nécessaires pour répondre à ces questions.

Fig. 1

Réponses de l’ANI au changements de Ce-R.

Déclaration d’intérêts Les auteurs n’ont pas transmis de déclaration de conﬂits d’intérêts. Références [1] Br J Anaesth 2013;111:1024–30. [2] Br J Anaesth 2013;111:627–9. http://dx.doi.org/10.1016/j.annfar.2014.07.274

http://dx.doi.org/10.1016/j.annfar.2014.07.273 R247 R246

Réponses de l’analgésia-nociception index (ANI) aux modiﬁcations de la concentration cible de rémifentanil lors de chirurgie de tumeurs de l’angle ponto cérébelleux

M. Sesay ∗ , M. Bias , A. Chehab , B. Maachi , M. Penna , M. Stockle , K. Nouette-Gaulain SAR3, CHU Pellegrin, Bordeaux, France ∗ Auteur correspondant. Introduction L’analgésia-nociception index (ANI) est un index de caractérisation de la balance analgésie/nociception par le monitorage continu du tonus parasympathique [1,2]. En raison de sa nouveauté, cet index nécessite une validation dans les contextes cliniques différents. L’objectif de cette étude a été d’évaluer la réponse de l’ANI à la modification de concentration cible de rémifentanil (Ce-R) lors de chirurgie de tumeurs de l’angle ponto cérébelleux (TAPC). Patients et méthodes Après consentement éclairé, les patients bénéficiant d’une chirurgie de TAPC ont été inclus dans cette étude observationnelle. Les patients sous bétabloquants, parasympatholytiques et ceux porteurs de pacemakers ont été exclus. L’anesthésie générale à objectif de concentration était standardisée: propofol (cible site-effet : 4–6 ug/mL) guidée par un BIS (20–40) et rémifentanil (cible site-effet 4–6 ng/mL), avec surveillance cardiorespiratoire et enregistrement continu de l’ANI (écran caché). La Ce-R était modifiée selon l’appréciation de l’anesthésiste et l’IADE en charge du patient qui ne tenaient donc pas en compte des données de l’ANI. Les principaux événements chirurgicaux et l’horaire du changement de Ce-R (t) ont été notés dans la feuille d’anesthésie.

Stimulation nerveuse transcutanée du parasympathique au niveau de l’oreille A.-M. Largeron 1,∗ , D. Charier 1 , R. Manet 2 , F. Vassal 2 , V. Pichot 3 , J.-C. Barthelemy 4 , S. Molliex 1 1 Département d’anesthésie-réanimation 2 Service de neurochirurgie 3 Service de physiologie de l’exercice - EA 4607 4 Physiologie de l’exercice - EA 4607, CHU, Saint-Étienne, France ∗ Auteur correspondant. Introduction L’origine de la réflexologie auriculaire est ancienne: 4 siècles avant Jésus-Christ, les égyptiens calmaient déjà certaines douleurs par la stimulation de points spécifiques sur l’oreille. Dans la médecine traditionnelle chinoise, les oreilles comptent également plus de 120 points d’acupuncture ou de shiatsu, associés à différentes parties du corps. L’auriculothérapie contemporaine a été fondée en 1957 par un médecin lyonnais, Paul Nogier. Elle associe à chaque zone corporelle une correspondance précise sur l’oreille. La stimulation d’un point se fait à l’aide de petites billes, d’aiguille semi-permanentes, ou par stimulation électrique permanente, micro-courants ou champs magnétiques. Elle est utilisée pour traiter les troubles du système nerveux (insomnies, stress, dépression, troubles digestifs), la douleur aiguë, la prise de poids et les dépendances [1]. Un travail récent a proposé d’utiliser la stimulation de la conque auriculaire, innervée par la branche auriculaire du nerf vague, pour stimuler le noyau du tractus solitaire au niveau du tronc cérébral, avec un effet comparable à celui de la stimulation directe du nerf vague au niveau cervical sur l’épilepsie réfractaire [2]. Le but de notre étude était de vérifier si la stimulation de la conque entraîne une réponse parasympathique (p ), mesurée sur la fréquence cardiaque (FC), la variabilité de la fréquence cardiaque

A164

Annales Françaises d’Anesthésie et de Réanimation 33S (2014) A162–A167

(VFC) évaluée à l’aide de l’ANI® (Metrodoloris, Lille) et le diamètre pupillaire (DP) mesuré à l’aide du vidéopupillomètre NeuroLight® (iDMed, Marseille). Sujets et méthodes Après accord du Comité d’éthique et consentement, 10 volontaires sains ASA 1–2, âgées de 18 à 45 ans, ont participé à ce travail. La stimulation du nerf vague a été réalisée au niveau de la conque de l’oreille gauche par 2 électrodes au contact de la peau. L’intensité a été montée par pallier de 0,25 mA jusqu’à obtenir un picotement constant, sans atteindre le seuil douloureux, à la fréquence de 25 Hz. Pour chaque sujet un enregistrement de 5 minutes a été réalisé en condition de stimulation, et un enregistrement hors stimulation (placebo), de façon randomisée et à 10 minutes d’intervalle. Vingt mesures simultanées de la FC, de l’ANI® , et du DP ont ainsi été réalisées, dans des conditions standardisées d’éclairage, œil controlatéral ouvert: 10 avec et 10 sans stimulation (Fig. 1). Résultats La Tableau 1 présente les variations de la FC, de la VFC obtenue avec l’ANI® et du DP. La stimulation transcutanée de la conque auriculaire stimule le p comme le montrent les variations de l’ANI® . Discussion La VFC obtenue à l’aide de l’ANI® confirme l’activation du p par la stimulation transcutanée de la conque auriculaire. Ce résultat ouvre la voie à une possibilité de traitement de la douleur par stimulation transcutanée au niveau de l’oreille, ce qui devra être confirmé par des travaux à venir.

Fig. 1

Tableau 1

R248

Réactivité pupillaire en réanimation : corrélation entre une analyse automatisée et une analyse clinique J. Marin 1,∗ , R. Chabanne 1 , S. Kauffmann 1 , C. Fernandez Canal 1 , B. Pereira 2 , T. Gillart 3 , P. Schoeffler 4 1 Neuroréanimation 2 Délégation recherche clinique et innovation 3 Réanimation médico chirurgicale 4 Département anesthésie réanimation, CHU de Clermont-Ferrand, Clermont-Ferrand, France ∗ Auteur correspondant. Introduction L’analyse de la réactivité pupillaire est fondamentale dans l’évaluation des patients cérébrolésés. La disparition de ce réflexe du tronc cérébral est associée à des lésions cérébrales graves et à un mauvais pronostic. Cependant, cette donnée clinique reste subjective et délicate en raison des conditions d’examen et des facteurs physiopathologiques et médicamenteux interagissant avec la taille pupillaire et la qualité du réflexe. La vidéopupillométrie automatisée permet désormais une analyse précise et reproductible. Nous avons étudié la concordance de la réactivité pupillaire évaluée par pupillométrie et par l’examen clinique infirmier et médical. Patients et méthodes L’étude a été réalisée dans un service de réanimation polyvalente à orientation neurologique après accord du CPP et consentement des patients ou de leur représentant. La réactivité pupillaire de tous les patients a été évaluée chaque jour à l’aide d’un pupillomètre Neurolight Algiscan (IDMed) par des étudiants hospitaliers. Les données ont été comparées à l’examen clinique réalisé à la même heure et dans les mêmes conditions par l’infirmière en charge du patient et par un médecin réanimateur unique. L’analyse statistique a consisté en une étude de la concordance à l’aide du test Kappa. Résultats Trente-trois patients ont été évalués avec 324 mesures au total. L’âge moyen était 59 ± 20 ans, l’IGS2 moyen 47 ± 18. Soixante-sept pour cent étaient neurolésés (7 traumatisés craniens, 7 hématomes intraparenchymateux spontanés, 4 hémorragies méningées anévrysmales et 3 encéphalopathies postanoxiques). Cinquante-quatre pour cent n’étaient pas sédatés et 52 % sevrés des catécholamines. Cinq pour cent des examens retrouvaient une aréactivité avec le pupillomètre contre 12 % pour les IDE et 16 % pour le médecin. Dans 52 cas, la réactivité pupillométrique était présente mais très faible (< 15 %). La corrélation était faible, au mieux Kappa 0,71 entre pupillométrie et infirmiers. Les discordances d’évaluation étaient associées à une réactivité pupillométrique < 15 %, au phénotype « yeux marrons », aux patients neurolésés. Aucune discordance n’était retrouvée en cas d’aréactivité pupillométrique (Fig. 1). Discussion Il existe des discordances d’évaluation du réflexe pupillaire selon la technique et les examinateurs. La pupillométrie automatisée semble plus sensible que l’analyse clinique médicale et paramédicale, mettant en évidence des faux négatifs. Compte tenu de l’importance de cette évaluation, notamment concernant la prise de décision chez ce type de patient, il pourrait être intéressant d’utiliser la pupillométrie automatisée afin de valider une aréactivité clinique en pratique courante. Cependant, le collectif de notre étude et la faible fréquence d’aréactivité dans notre population ne permettent pas d’analyser précisément les facteurs associés aux discordances.

Déclaration d’intérêts Les auteurs n’ont pas transmis de déclaration de conﬂits d’intérêts. Références [1] Encycl Med Nat Acupunct Med 1989;12:16–22 [tradit. chinoise]. [2] Epilepsy Behav 2013;28:343–6. http://dx.doi.org/10.1016/j.annfar.2014.07.275

Fig. 1

Straube et al. The Journal of Headache and Pain (2015) 16:63 DOI 10.1186/s10194-015-0543-3

RESEARCH ARTICLE

Open Access

Treatment of chronic migraine with transcutaneous stimulation of the auricular branch of the vagal nerve (auricular t-VNS): a randomized, monocentric clinical trial Andreas Straube1*, J. Ellrich2,3, O. Eren1, B. Blum1 and R. Ruscheweyh1

Abstract Background: Aim of the study was assessment of efficacy and safety of transcutaneous stimulation of the auricular branch of the vagal nerve (t-VNS) in the treatment of chronic migraine. Methods: A monocentric, randomized, controlled, double-blind study was conducted. After one month of baseline, chronic migraine patients were randomized to receive 25 Hz or 1 Hz stimulation of the sensory vagal area at the left ear by a handhold battery driven stimulator for 4 h/day during 3 months. Headache days per 28 days were compared between baseline and the last month of treatment and the number of days with acute medication was recorded The Headache Impact Test (HIT-6) and the Migraine Disability Assessment (MIDAS) questionnaires were used to assess headache-related disability. Results: Of 46 randomized patients, 40 finished the study (per protocol). In the per protocol analysis, patients in the 1 Hz group had a significantly larger reduction in headache days per 28 days than patients in the 25 Hz group (−7.0 ± 4.6 vs. −3.3 ± 5.4 days, p = 0.035). 29.4 % of the patients in the 1 Hz group had a ≥50 % reduction in headache days vs. 13.3 % in the 25 Hz group. HIT-6 and MIDAS scores were significantly improved in both groups, without group differences. There were no serious treatment-related adverse events. Conclusion: Treatment of chronic migraine by t-VNS at 1 Hz was safe and effective. The mean reduction of headache days after 12 weeks of treatment exceeded that reported for other nerve stimulating procedures. Keywords: Sensory nerve; Neuromodulation; Clinical study; Chronic headache; Electrical pulses

Background Migraine is a frequent neurological disorder. In some patients, episodic migraine (with < 15 headache days per month) evolves towards chronic migraine, which is characterized by ≥15 headache days per month of which ≥ 8 have migraine-like features [1], see also: http://ihs-classification.org/de/0_downloads/. Chronic migraine affects approximately 1.3 to 2.4 % of the general population [2]. It is associated with significant disability and reduced health-related quality of life and often complicated by * Correspondence: Andreas.Straube@med.uni-muenchen.de 1 Klinik und Poliklinik für Neurologie, Oberbayerisches Kopfschmerzzentrum, Klinikum Großhadern, Ludwig-Maximilians-Universität München, Marchioninistr. 15, 81377 Munich, Germany Full list of author information is available at the end of the article

overuse of acute pain medications [3, 4]. Up to now, randomized controlled trials showing a significant effect in the treatment specifically of chronic migraine have been published only for topiramate and onabotulinumtoxin A [5, 6]. Treatment of chronic migraine is often difficult, with significant numbers of patients not responding to pharmacological management. In recent years, neuromodulation was introduced in the treatment of headache [7]. Invasive occipital nerve stimulation (ONS) has been investigated for the treatment of chronic migraine, with inconsistent results [8–10]. Significant reduction in headache days was demonstrated in only one of the three studies, which however did not meet its primary endpoint (a 50 % reduction of mean daily pain ratings) [10]. A major disadvantage of ONS is the safety

© 2015 Straube et al. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited.

Straube et al. The Journal of Headache and Pain (2015) 16:63

profile with frequent adverse events such as infections, lead migration or lead disconnection [8, 10]. This is also the reason why in some health markets the reimbursement of ONS was stopped by the regulatory administration. Thus, less invasive forms of neuromodulation such as transcutaneous electrical nerve stimulation are under investigation. For example, supraorbital transcutaneous stimulation for 3 months has been shown to be effective for the preventive treatment of episodic migraine (active treatment: 38 % responders, sham: 12 % responders, p < 0.05) [11]. Vagal nerve stimulation using implanted electrodes is used as a treatment option in otherwise therapyrefractory epilepsy and depression [12]. Case reports and small series of patients who received an implanted vagal nerve stimulator for treatment of epilepsy and had comorbid migraine suggest that VNS may have a preventive effect in migraine [13–16]. A recently developed medical device (NEMOS®, cerbomed, Erlangen, Germany) allows for non-invasive, transcutaneous stimulation of the auricular branch of the vagus nerve (auricular t-VNS) using a special ear electrode. Auricular t-VNS excites thick myelinated sensory Aβ-fiber afferents in the vagal nerve, activating the nucleus of the solitary tract [17, 18]. Effects on autonomous activity have been demonstrated in healthy subjects where auricular t-VNS increases heart rate variability [19]. Anticonvulsive effects in rodents are similar to those achieved with invasive VNS [18]. Functional imaging during auricular t-VNS has shown a pattern consistent with afferent vagal stimulation [20, 21]. Both invasive VNS and auricular t-VNS reduce pinprick and pressure pain in humans [22, 23]. In addition, a recent observational study has suggested that t-VNS to the right cervical branch of the vagus nerve (cervical t-VNS) may be effective for acute migraine treatment [24]. In the present study, we investigated the effect of auricular t-VNS on chronic migraine.

Methods This was a monocentric, prospective, double-blind, randomized, parallel-group, controlled trial analyzed both

Fig. 1 Study design

Page 2 of 9

on intention-to-treat basis (ITT), and on per protocol basis (PP). The trial was conducted in a German tertiary headache outpatient clinic (Department of Neurology, University of Munich). The study was approved by the ethics committee of the medical faculty of the University of Munich and written informed consent was obtained from all participants. The study is registered in the German Clinical Trials Register (DRKS00003681). Study participants

Men or women between 18 and 70 years with a diagnosis of chronic migraine according to the ICHD-IIR (code A1.5.1.) (http://ihs-classification.org/de/0_downloads/), duration of ≥ 6 months, no migraine-prophylactic medication or stable migraine-prophylactic medication for ≥1 month, and stable acute medication were eligible, medication overuse was not an exclusion criterion. Patients were excluded if they suffered from other primary or secondary headaches, severe neurologic or psychiatric disorders including opioid- or tranquilizer-dependency, cranio-mandibulary dysfunction, fibromyalgia, had a Beck’s Depression Inventory (BDI [25]) score >25 at the screening visit, anatomic or pathologic changes at the left outer ear, currently participated in another clinical trial, or were unable to keep a headache diary. Pregnant or breast-feeding women were also excluded. A pregnancy test was performed at the screening visit in women of childbearing potential and they were required to use a reliable means of contraception. In addition, patients who had less than 15 headache days per 28 days during the 4-week baseline period were excluded. Study design (Fig. 1)

The study consisted of a 4-week screening period (“baseline”) followed by a 12-week randomized, doubleblind, parallel-group treatment period with either 1 Hz or 25 Hz tVNS with the NEMOS® device (Fig. 2). Adverse events were recorded at visits 2 to 6. Compliance with stimulation was checked at visits 3 to 6 by reading out the NEMOS® device and quantified in percent of the

Straube et al. The Journal of Headache and Pain (2015) 16:63

Fig. 2 NEMOS® device and positioning of the electrode for stimulation of the vagus afferents at the concha

Page 3 of 9

contact with the skin of the concha. Impedance is measured automatically and insufficient electrode contact with the skin evokes an alarm. During stimulation, series of electrical pulses (pulse width: 250 μs, frequency: 1 Hz or 25 Hz, duty cycle: 30s on, 30 s off, to avoid habituation) are applied to the skin of the concha. Stimulus intensity was individually fitted during visit 2 to elicit a tingling but not painful sensation, and could later be adjusted by the patient as needed. Patients were asked to stimulate for a total of 4 h per day (in sessions of 1 to 4 h, a specific distribution over the day or interval between sessions was not required), and were free to stimulate for an additional hour if they thought this was useful, e.g. for treatment of acute headache. The effect of such acute treatment was not recorded. Stimulation parameters of the 25 Hz group were chosen so that with 4 h of daily stimulation, the number of electrical stimuli per day would be similar to those normally used for invasive vagal nerve stimulation in patients with epilepsy. The 1 Hz stimulation was intended as an active control. The active control was chosen in order to avoid un-blinding of the subjects. Primary and secondary outcome parameters

intended daily stimulation time (4 h). Re-training was administered during visits 3 to 6 as necessary. The Migraine Disability Assessment (MIDAS [26]) and the Headache Impact Test (HIT-6 [27]) were filled in by the patient as indicated in Fig. 1. Patients kept a paper-and-pencil headache diary during the entire period, handing in their diaries and receiving a fresh sheet at each visit. In the diary, patients indicated for every day (1) headache duration in hours, (2) headache intensity (on a 0 to 10 numerical rating scale: 0, no pain; 10, strongest pain imaginable), and (3) intake of acute headache medication (analgesics, triptans). Sample size calculations were based on published studies on successful pharmacological treatment of chronic migraine (mean effect size: −4,68 headache days/month after removal of the placebo effect) [5, 6, 28, 29]. To detect an effect of this size with an α error of 0.05 and a power of 0.80, a group size of 49 patients per treatment group was estimated, including 10 % drop-out. An interims analysis after 46 patients was planned. Since patient recruitment was slower than expected, the sponsor decided to terminate the study at the interims analysis, and no further patients were enrolled. Neurostimulation

The NEMOS® t-VNS device (Cerbomed, Erlangen, Germany) is a transcutaneous vagus nerve stimulator designed for electrical stimulation at the concha of the outer ear, which receives sensory innervation from the auricular branch of the vagal nerve (Fig. 2). The NEMOS® device has received the CE mark for treatment of pain (CE0408) and is registered in the European Databank on Medical Devices (EUDAMED, CIV-11-09-002381). It consists of a handheld, battery driven electrical stimulator connected to an ear electrode placed in

All outcome measures refer to change from baseline (the 4-week period between visits 1 and 2) to the evaluation period (the 4-week period between visits 5 and 6, Fig. 1). The primary outcome measure was mean change in headache days per 28 days. A headache day was defined as a calendar day with headache of ≥ 4 h duration or headache successfully aborted by acute headache medication or any other treatment known to be typically effective in the specific patient (e.g. sleep, progressive relaxation exercises). Secondary outcome parameters were: (1) percentage of “responders” (subjects having at least 50 % reduction of headache days per 28 days from baseline to evaluation); (2) change in mean headache intensity on days with headache; (3) change in days with acute headache medication intake per 28 days; (4) change in headache-related disability, as assessed by the MIDAS and HIT-6 questionnaires; (5) number and type of adverse events. Statistical analysis

Mean ± standard deviation (SD) is reported unless stated otherwise. The threshold for significance of statistical comparisons was set at p < 0.05. Statistical analysis was performed both on ITT and on per protocol basis (PP). For the ITT analysis, a last observation carried forward approach was used for patients who dropped out during the course of the study. Group comparisons at baseline, of duration of the treatment period, compliance or number of patients affected by adverse events were done using Mann–Whitney U-Test or Fisher’s exact test as appropriate. Analysis of the primary endpoint was done using an analysis of covariance (ANCOVA) model with the factors treatment group (1 Hz vs. 25 Hz) and sex as categorical variables and baseline

Straube et al. The Journal of Headache and Pain (2015) 16:63

values as covariate. The same type of ANCOVA was used for the analysis of the following secondary outcome parameters: change in mean headache intensity, change in days with acute headache medication intake per 28 days and change in MIDAS and HIT-6 scores. The number of responders was compared between groups using a logistic regression model that included treatment group and sex as factor and the number of headache days per 28 days at baseline as covariate. An estimate of the treatment odds ratio (Wald method) was derived from this model.

Results The study was conducted between March 2012 and July 2014. A total of 46 patients were randomized to the 1 Hz group (n = 22) or the 25 Hz group (n = 24, ITT). 6 patients dropped out during the study. Reasons for dropouts were: adverse events in 4 patients (treatment-related stimulation site ulcer in 3 patients, gastrectomy not related to treatment in 1 patient), insufficient compliance in 1 patient, patient’s request in 1 patient. One additional patient was excluded from the per protocol (PP) analysis after the end of the study because of violation of inclusion criteria (<15 headache days per 28 days in the screening period). This left 17 patients in the 1 Hz group and 22 patients in the 25 Hz group for the PP analysis (Fig. 3) Demographic and headache characteristics of the population are shown in Table 1. There were no significant differences between both groups. Primary outcome measure

PP-analysis indicated a significant decrease in headache days per 28 days from baseline to evaluation, which was

Fig. 3 Patient disposition

Page 4 of 9

significantly larger in the 1 Hz group than in the 25 Hz group (F[35] = 4.82, p = 0.035, Table 2). In the 1 Hz group, the reduction amounted to −7.0 days per 28 days (36.4 % reduction from baseline), while the 25 Hz group reached only −3.3 days (17.4 % reduction from baseline). In the ITT analysis, there also was a significant decrease in headache days per 28 days in both groups, but no significant group difference (F[42] = 2.94, p = 0.094, Table 2). Visual inspection of headache days per 28 days over the treatment period revealed a continuous decrease in the 1 Hz group, while a steady state was reached after 14 days in the 25 Hz group (Fig. 4). Secondary outcome measures

Results of secondary outcome measures and the corresponding statistics are summarized in Table 2. The number of responders (>50 % improvement in headache days) was in the 1 Hz group (PP) 29.4 % and in the 25 Hz group (PP) 13.6 %. Headache intensity was not significantly changed by t-VNS in either treatment group, and there were no group differences. The number of days with intake of acute headache medication as well as the MIDAS and HIT-6 scores were significantly reduced in both treatment groups, there were no group differences. Treatment duration and compliance

Results and statistics are listed in Table 3. Duration of the treatment period was similar between groups. The average number of stimulated hours per day during the treatment period was around 3.4 in all groups, corresponding to around 85 % of the requested 4 h of daily

Straube et al. The Journal of Headache and Pain (2015) 16:63

Page 5 of 9

Table 1 Baseline characteristics of the cohort Intention-to-treat analysis

Per protocol analysis

1 Hz (n = 22) 25 Hz (n = 24) Group comparison 1 Hz (n = 17) 25 Hz (n = 22) Group comparison Age

43.8 ± 11.5

39.3 ± 12.4

p = 0.21

44.1 ± 11.4

39.0 ± 12.5

p = 0.21

Females

p = 0.69

p = 0.68

Headache days/28 days

19.4 ± 4.0

18.9 ± 5.1

p = 0.47

19.1 ± 3.7

19.2 ± 4.7

p = 0.66

Headache intensity (NRS: 0–10)

5.2 ± 1.5

5.0 ± 1.5

p = 0.73

5.0 ± 1.5

p = 0.98

Migraine history (years)

27.1 ± 13.0

20.4 ± 12.1

p = 0.08

27.8 ± 11.5

21.4 ± 12.1

p = 0.11

Days with acute headache medication/28 days 10.3 ± 6.4

8.2 ± 4.9

p = 0.24

11.1 ± 6.6

8.6 ± 4.8

p = 0.17

MIDAS score

83.6 ± 56.0

p = 0.55

77.2 ± 70.1

82.1 ± 58.0

p = 0.71

76.8 ± 64.8

HIT-6 score

64.3 ± 4.7

66.0 ± 4.1

p = 0.25

64.8 ± 5.0

66.0 ± 4.2

p = 0.55

BDI

6.9 ± 5.7

7.9 ± 5.6

p = 0.59

6.9 ± 5.9

7.2 ± 5.0

p = 0.95

Demographic and headache characteristics assessed at the first visit or during the baseline period (4 weeks) are given. Values are mean ± SD or numbers of subjects. Results of Mann–Whitney U test or Fisher’s Exact test are given. Headache intensity (NRS: numerical rating scale 0–10) MIDAS migraine disability assessment, HIT headache impact test, BDI beck’s depression inventory

stimulation, indicating good compliance with treatment. There were no significant group differences. Safety and tolerability

Adverse events (AEs) were analysed in the full analysis set (safety set) and summarized in Table 4. The number of treatment emergent AEs (AEs occurring after initiation of treatment) was higher in the 25 Hz group (112 events, 76 treatment-related events) as compared to the 1 Hz group (67 events, 39 treatment-related events, Table 4),. Most AEs were mild or moderate in severity and resolved without sequelae. The most frequent treatment-related AE were local problems at the stimulation site, such as mild or moderate pain, paresthesia, or pruritus during or after stimulation, and erythema, ulcer or scab (31 events in 10 patients in the 1 Hz group, 70 events in 17 patients in the

25 Hz group, p = 0.14). Treatment-related AEs leading to discontinuation of the study were stimulation site ulcer (accompanied by pain, paresthesia, or pruritus) in 2 patients of the 1 Hz group and in 1 patient of the 25 Hz group. These three cases of application site ulcer occurred early during the study. After that, patients were asked to specially care for the skin of their ear after each use of the NEMOS® device, using a custom rich skin cream, and no more cases of application site ulcer occurred. There were no treatmentrelated SAEs. Three SAEs, leading to hospitalization of the patient, were recorded during the whole study (infectious mononucleosis, gastrectomy, intervertebral disc protrusion).

Discussion The present monocentric, randomized, controlled, doubleblind, parallel-group clinical trial provides evidence that

Table 2 Results of primary and secondary treatment outcome measures Intention-t-treat analysis 1 Hz (n = 22)

Per protocol analysis

25 Hz (n = 24) Group comparison 1 Hz (n = 17)

25 Hz (n = 22) Group comparison

−5.6 ± 5.0

−3.0 ± 5.3

F[42] = 2.94

−7.0 ± 4.6

−3.3 ± 5.4

F[35] = 4.82

(−5.9; −0.5)

(−8.5; −3.2)

p = 0.094

(−9.6; −4.1)

(−5.9; −0.4)

p = 0.035

Responder (50 % reduction in headache days)

5 (22.7 %)

3 (12.5 %)

OR = 2.44

5 (29.4 %)

3 (13.6 %)

OR = 3.21

Change in headache intensity (NRS 0 – 10)

−0.1 ± 1.1 (n = 20) 0.2 ± 1.0

F[40] = 0.30

0.02 ± 1.2 (n = 15) 0.2 ± 1.0

F[33] = 0.28

(−0.2; 0.9)

p = 0.58

(−0.4; 0.8)

p = 0.60

Change in headache days/28 days

p = 0.29

Change in days with acute headache −2.0 ± 4.2 medication in 28 days (−4.2; −0.3) Change in MIDAS score

Change in HIT-6 score

(−0.4; 0.7)

p = 0.18 (−0.2; 0.9)

−1.3 ± 4.4

F[42] = 0.01

−2.7 ± 4.5

−1.6 ± 4.1

F[35] < 0.01

(−4.4; −0.3)

p = 0.91

(−4.7; −0.4)

(−4.7; −0.3)

p = 0.96

−18.7 ± 28.0

−21.8 ± 54.5

F[42] < 0.01

−24.2 ± 29.8

−26.5 ± 53.9

F[35] < 0.01

(−38.6; −0.9)

(−39.2; −0.8)

p = 0.98

(−43.2; −4.0)

(−42.1; −3.7)

p = 0.96

−2.5 ± 6.8

−3.8 ± 5.5

F[42] = 0.12

−3.8 ± 7.1

−3.9 ± 5.69

F[35] = 0.01

(−6.7; −0.7)

(−7.3; −1.2)

p = 0.73

(−7.8; −1.1)

(−7.6; −1.0)

p = 0.93

Change refers to change from the 4-week baseline period to the last 4 weeks of the 12-week treatment period. Means, SDs and 95 % confidence intervals are given. For the responder analysis, numbers of subjects and percent of the total group are given. Significant differences are marked in bold. Number of subjects is given in parentheses, where different from the total group. Primary outcome parameter: change in headache days/28 days MIDAS migraine disability assessment, HIT headache impact test, NRS numerical rating scale 0–10

Straube et al. The Journal of Headache and Pain (2015) 16:63

Fig. 4 Mean course of number of headache days per 28 days during t-VNS treatment. Results of the per protocol set are shown (1 Hz: n = 17, 25 Hz: n = 22). Values are mean ± SEM. Mean values are also given in the figure

daily treatment with auricular t-VNS is effective in chronic migraine. Both in the 1 Hz and the 25 Hz group the number of headache days per 28 days decreased significantly by 7.0 and 3.3 days, respectively (PP-analysis, Table 2), with a significantly larger reduction in the 1 Hz compared to the 25 Hz group (p = 0.035). 29.4 % of the patients in the 1 Hz group and 13.6 % of the patients in the 25 Hz group achieved a reduction of more than 50 % in headache days (“responder”). With an absolute reduction in headache days per 28 days by 7.0 in the 1 Hz group and a mean group difference of 2.7 headache days, the effect of auricular t-VNS was comparable to the effects of topiramate and onabotulinumtoxin A versus placebo. Previous trials in chronic migraine with topiramate for 4 months have shown a reduction in headache days per month of 3.5 and 6.4 days in the verum group, which exceeded the effect in the placebo group by 3.7 and 1.7 days, respectively [6, 30]. In the large PREEMPT trials onabotulinumtoxin A was able to reduce the number of headache days per month in chronic migraine patients by 9.0 and 7.8 days after 6 months, which exceeded the placebo effect by 2.3 and 1.4 days, respectively [5, 31]. Compared to previous trials investigating neurostimulation devices the results are

Page 6 of 9

favorable. In the ONS trials for chronic migraine, reduction of headache days after 3 months was by 6.7, 5.5 and 6.1 days in the verum group, which exceeded the sham group by 5.2, 1.6 and 3.1 days, respectively [8–10]. However, none of these studies reached significance for its primary end point. Transcutaneous supraorbital neurostimulation has so far only been tested in episodic migraine, achieving a reduction by 2.5 headache days from a baseline of 7.8 headache days, which was 2.3 days more than placebo [11]. It has to be mentioned that the study was planned as a trial with an active comparator in order to be sure that the patients were blinded and that we expected that the 25 Hz stimulation would be more effective than the 1 Hz stimulation, corresponding to the results from the use of invasive VNS in epilepsy [32, 33]. This means that it is very unlikely that partial unblinding may have affected the results, as the local sensation is more intense with 25 Hz stimulation, and the study physicians expected the 25 Hz stimulation to be more effective. However, it is not clear why the 1 Hz stimulation was more effective than the 25 Hz stimulation. The mechanisms by which VNS influences chronic migraine may be different from those in epilepsy. In addition, activation of central nervous system structures by stimulation of thickly myelinated sensory fibers in the auricular branch of the vagus nerve may require different stimulation patterns than the cervical branch, which is a mixed nerve with myelinated and non-myelinated efferent as well as afferent fibers. As no dose–response or frequency-response data are available for any neurostimulation method in migraine treatment, the question whether frequency or total number of stimuli influence the result remains open. Analgesic effects of electrical low-frequency stimulation (LFS) in various pain models have been demonstrated in man and rodents [34]. Electrical pulse series with optimum frequency of 1 Hz for 20 min significantly suppressed nociceptive signaling and pain perception by approximately 40 % for hours [35, 36]. This phenomenon of long-term depression (LTD) has been shown in the spinal system [37–41] and in the craniofacial area [42–44]. Stimulation parameter of t-VNS in the present study resemble electrical LFS and could have provoked LTD of nociceptive processing in the spinal trigeminal nucleus that plays a critical role in migraine pain [45]. Actually, the auriculotemporal nerve, a branch of the trigeminal nerve, supplies the outer ear and could, therefore, mediate access of electrically evoked neural

Table 3 Duration of treatment period and compliance with stimulation during the treatment period Intention-to-treat analysis

Per protocol analysis

1 Hz (n = 22) 25 Hz (n = 24) Group comparison 1 Hz (n = 17) 25 Hz (n = 23) Group comparison 77.9 ± 25.8

85.7 ± 11.4

p = 0.22

89.0 ± 8.4

87.5 ± 7.5

p = 0.67

Average number of stimulated hours per day 3.42 ± 0.59

3.44 ± 0.61

p = 0.69

3.34 ± 0.62

3.44 ± 0.62

p = 0.51

Treatment period (days)

Mean ± SD values are given. Treatment period indicates the number of days between visits 2 and 6. The average number of stimulated hours per day of the treatment period is given. Patients were requested to stimulate 4 h per day during the treatment period. The real average stimulation time per day was slightly lower

Straube et al. The Journal of Headache and Pain (2015) 16:63

Page 7 of 9

Table 4 Overview of adverse events (safety set) 1 Hz (n = 22)

25 Hz (n = 24)

Number of events Number of patients (%) Number of events Number of patients (%) Treatment emergent AEs

17 (77.3 %)

112

19 (79.2 %)

Treatment-related AEs

11 (50.0 %)

17 (70.8 %)

Stimulation site treatment-related TEAEs

10 (45.5 %)

17 (70.8 %)

All serious AEs (including pre-treatment SAEs)

2 (9.1 %)

Serious treatment emergent AEs

2 (9.1 %)

Serious treatment-related AEs

Treatment-related AEs leading to discontinuation of study 8

4 (18.2 %)

1 (4.2 %)

Death

signals to brainstem nuclei of the trigeminal nerve [46]. Thus, LTD could be a mechanism that might, at least, contribute to the analgesic effect of t-VNS in the present study. In fact, other stimulation parameters might be even more effective than the 1 Hz stimulation, and the 25 Hz stimulation might have been partially active in the present study, possibly reducing the effect in the group comparison. Indeed, 25â&#x20AC;&#x201C;30 Hz stimulation has been shown to significantly reduce experimental pain in humans [23] and seizures in rodents [18]. In addition, in the present study both groups significantly improved in headache-related disability measures (MIDAS and HIT-6), and reduced their intake of acute headache medication, although it cannot be determined if this is due to the placebo effect or due to stimulation effects in both groups. The missing significant difference in the reduction of the MIDAS and HIT6 between the 1Hz and the 25Hz group is probably due to the too small sensitivity of these tests in detecting differences in quality of life. Furthermore, it is unclear if 25 Hz stimulation also have a mood stabilizing effect which influences the ratings in the used tests. Furthermore, it is still not clear how vagus nerve stimulation interferes with migraine generation. One possibility is a direct or indirect inhibition of nociceptive trigeminal neurons by vagal activation. Indeed, animal data show that afferent vagal stimulation can reduce the activation of nociceptive neurons in the caudal trigeminal nucleus in response to noxious stimulation of the face or dura [47â&#x20AC;&#x201C;49]. This might be due to the existence of dense reciprocal connections between the spinal trigeminal nucleus and the nucleus tractus solitarii (NTS) which is the major target of vagal afferents [50]. Responses of spinal trigeminal neurons might also be reduced by activation of the descending pain inhibitory systems. Although this has not been shown directly for the trigeminal area, animal studies showed that vagal nerve stimulation can activate descending pain inhibitory systems, probably involving projections from the NTS to the nucleus raphe magnus and the locus coeruleus, which are at the origin of serotonergic and noradrenergic

descending pain inhibitory pathways [51]. Alternatively, VNS might exert migraine prophylactic actions by modifying cortical excitability. Altered cortical excitability in chronic migraine has been demonstrated in various electrophysiological measurements is thought to contribute to its pathogenesis [52]. Several lines of evidence indicate that the cortical excitability is increased in chronic migraine patients: 1) There is a reduced habituation of the blink reflex interictally [53]. 2) The magnetic suppression of perceptual accuracy was decreased in patients with chronic migraine compared to episodic migraine and controls which may indicate also a higher cortical excitability [54]. 3) Analysis of the high frequency somatosensory evoked potentials showed early response sensitization and late habituation, most probably due an increased coupling between thalamus and cortex in chronic migraine [55]. Afferent vagal information is relayed via the NTS and the parabrachial nucleus to several subcortical and cortical regions, including thalamus, insula and lateral prefrontal cortex. In addition, the NTS has strong projections to the locus coeruleus and the nucleus raphe magnus which provide widespread noradrenergic and serotonergic innervation of the cortex [56]. Modulation of cortical excitability via these pathways is thought to be important for the anticonvulsant effects of VNS [33]. Increased GABA levels have been found in the cerebrospinal fluid of epilepsy patients treated with VNS, suggesting an increase in inhibitory neurotransmission [57]. Auricular t-VNS increases parasympathetic activity and/or reduces sympathetic activity [19], which might also affect cortical excitability, maybe by mechanisms similar to those assumed for the migraine preventive effects of beta-blocking agents [58]. In summary, VNS is well positioned to alter cortical excitability, especially to reduce cortical hyperexcitability. Direct evidence that this interferes with pain processing or migraine generation is currently lacking. It would be interesting to repeat the above described experiments which showed an increased cortical excitability in chronic migraine under t-VNS stimulation. A third possibility is that the antimigraine action of VNS relies on modification of transmitter release from efferent parasympathetic fibers innervating

Straube et al. The Journal of Headache and Pain (2015) 16:63

dural vessels, e.g. fibers stemming from the spheno-palatine ganglion. The release of neurotransmitters, especially calcitonin-gene related peptide (CGRP), at dural vessels with subsequent neurogenic inflammation and sensitization of primary afferents is thought to play an important role in migraine pathophysiology [59]. Parasympathetic fibres innervating the dura mater release vasoactive intestinal polypeptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP), which are potent vasodilatators and thought to contribute to sensitization of nociceptive trigeminal primary afferents. Increased peripheral blood VIP levels have been detected in chronic migraine [60], and intravenous administration of PACAP has been shown to induce migrainous headache in migraine patients [61], suggesting that both transmitters are related to migraine pathophysiology. Although auricular t-VNS stimulates only vagal afferents, there are close connections between afferent and efferent parasympathetic brainstem centers, making an influence of VNS on dural efferents likely. A major practical advantage of auricular t-VNS is good tolerability and safety. For comparison, in the pooled topiramate trial analysis, 1 out of 4 patients (25 %) dropped out because of intolerable adverse effects [62]. In our study only 3 of 46 patients (7 %) dropped out due to side effects of t-VNS. All three cases occurred early in the study and were due to stimulation site ulcer which later in the study could be prevented by appropriate skin care. Another advantage of t-VNS therapy is that it can be combined with any other drug treatment without risking cumulative adverse effects or pharmacodynamic interactions. In addition, auricular t-VNS allows patients to continue routine activities, leading to a high compliance with stimulation times (around 85 % on average). However, long-term effects and sustainability of efficacy of t-VNS are still unknown and need to be demonstrated in appropriate open-label trials.

Conclusions In conclusion, the present parallel-group randomized controlled trial, provides evidence that auricular t-VNS at 1 Hz for 4 h daily is effective for chronic migraine prevention over 3 months. The absolute reduction in headache days (7.0) and the difference between groups (2.7 headache days) is comparable to the effects of topiramate and onabotulinum toxin A in chronic migraine prevention. The t-VNS treatment also results in a meaningful improvement in the quality of life as assessed by MIDAS and HIT 6. The safety profile was favourable and compliance with daily stimulation was high. Competing interests Cerbomed funded the study. A. Straube has received honoraries by Pharm Allergan, Boehringer Ingelheim, Hormosan, electroCore, CerboMed. Grants from the German Science foundation, German Minister of Research and Education and the Kröner-Fresenius foundation.

Page 8 of 9

J. Ellrich was employed as Chief Medical Officer by the company cerbomed GmbH. O. Eren has nothing to disclose B. Blum has nothing to disclose R. Ruscheweyh has received honaries by Pharm Allergan, MSD, Mundipharma, Pfizer and grants from the Else Kröner Fresenius Stiftung. Authors’ contributions The study was planned by JE and AS. AS, RR, OE, BB recruited the patients and collected the data. Statistical analysis was performed by Metronomia Clinical Research GmbH (Munich, Germany). Cerbomed supported the preparation of the figures and the layout. The paper was written by the authors and all authors participated in the decision to publish the paper and had full access to all study data. All authors read and approved the final manuscript. Acknowledgement The authors thank Nadine Wolf, PhD for her contribution to the clinical investigation plan and A. Hartlep, PhD and V. Koepke for their help in the preparation of the manuscript. Author details 1 Klinik und Poliklinik für Neurologie, Oberbayerisches Kopfschmerzzentrum, Klinikum Großhadern, Ludwig-Maximilians-Universität München, Marchioninistr. 15, 81377 Munich, Germany. 2Department of Health Science and Technology, Professor Dr. med. Jens Ellrich, Aalborg University, Fredrik Bajers Vej 7D2, DK-9220 Aalborg, Denmark. 3Cerbomed GmbH, Medical Valley Center, Henkestr. 91, 91052 Erlangen, Germany. Received: 5 May 2015 Accepted: 16 June 2015

References 1. Headache Classification Subcommittee of the International Headache Society (2013) The International Classification of Headache Disorders, 3rd edition (beta version). Cephalalgia 33:629–808 2. Bigal ME, Serrano D, Reed M, Lipton RB (2008) Chronic migraine in the population: burden, diagnosis, and satisfaction with treatment. Neurology 71:559–566 3. Dodick DW (2006) Clinical practice. Chronic daily headache. N Engl J Med 354:158–165 4. Lipton RB, Bigal ME (2003) Chronic daily headache: is analgesic overuse a cause or a consequence? Neurology 61:154–155 5. Diener HC, Dodick DW, Aurora SK, Turkel CC, DeGryse RE, Lipton RB, Silberstein SD, Brin MF (2010) OnabotulinumtoxinA for treatment of chronic migraine: results from the double-blind, randomized, placebo-controlled phase of the PREEMPT 2 trial. Cephalalgia 30:804–814 6. Silberstein SD, Lipton RB, Dodick DW, Freitag FG, Ramadan N, Mathew N, Brandes JL, Bigal M, Saper J, Ascher S, Jordan DM, Greenberg SJ, Hulihan J (2007) Efficacy and safety of topiramate for the treatment of chronic migraine: a randomized, double-blind, placebo-controlled trial. Headache 47:170–180 7. Martelletti P, Jensen RH, Antal A, Arcioni R, Brighina F, de Tommaso M, Franzini A, Fontaine D, Heiland M, Jurgens TP, Leone M, Magis D, Paemeleire K, Palmisani S, Paulus W, May A (2013) Neuromodulation of chronic headaches: position statement from the European Headache Federation. J Headache Pain 14:86 8. Saper JR, Dodick DW, Silberstein SD, McCarville S, Sun M, Goadsby PJ (2011) Occipital nerve stimulation for the treatment of intractable chronic migraine headache: ONSTIM feasibility study. Cephalalgia 31:271–285 9. Lipton RB, Goadsby PJ, Cady RK, Aurora SK, Grosberg BM, Freitag FG, Silberstein SD, Whiten DM, Jaax KN (2009) PRISM study: occipital nerve stimulation for treatment-refractory migraine. Cephalalgia 29:30 10. Silberstein SD, Dodick DW, Saper J, Huh B, Slavin KV, Sharan A, Reed K, Narouze S, Mogilner A, Goldstein J, Trentman T, Vaisman J, Ordia J, Weber P, Deer T, Levy R, Diaz RL, Washburn SN, Mekhail N (2012) Safety and efficacy of peripheral nerve stimulation of the occipital nerves for the management of chronic migraine: results from a randomized, multicenter, double-blinded, controlled study. Cephalalgia 32:1165–1179 11. Schoenen J, Vandersmissen B, Jeangette S, Herroelen L, Vandenheede M, Gerard P, Magis D (2013) Migraine prevention with a supraorbital

Straube et al. The Journal of Headache and Pain (2015) 16:63

12. 13. 14. 15. 16. 17. 18.

19.

20.

21.

22. 23.

24.

25. 26.

27.

28.

29. 30.

31.

32.

33. 34. 35.

36. 37. 38.

transcutaneous stimulator: a randomized controlled trial. Neurology 80:697–704 Beekwilder JP, Beems T (2010) Overview of the clinical applications of vagus nerve stimulation. J Clin Neurophysiol 27:130–138 Hord ED, Evans MS, Mueed S, Adamolekun B, Naritoku DK (2003) The effect of vagus nerve stimulation on migraines. J Pain 4:530–534 Sadler RM, Purdy RA, Rahey S (2002) Vagal nerve stimulation aborts migraine in patient with intractable epilepsy. Cephalalgia 22:482–484 Mauskop A (2005) Vagus nerve stimulation relieves chronic refractory migraine and cluster headaches. Cephalalgia 25:82–86 Lenaerts ME, Oommen KJ, Couch JR, Skaggs V (2008) Can vagus nerve stimulation help migraine? Cephalalgia 28:392–395 Ellrich J (2011) Transcutaneous vagus nerve stimulation. Eur Neurol Rev 6:254–256 He W, Jing XH, Zhu B, Zhu XL, Li L, Bai WZ, Ben H (2013) The auriculo-vagal afferent pathway and its role in seizure suppression in rats. BMC Neurosci 14:85 Clancy JA, Mary DA, Witte KK, Greenwood JP, Deuchars SA, Deuchars J (2014) Non-invasive vagus nerve stimulation in healthy humans reduces sympathetic nerve activity. Brain Stimul 7:871–877 Kraus T, Kiess O, Hosl K, Terekhin P, Kornhuber J, Forster C (2013) CNS BOLD fMRI effects of sham-controlled transcutaneous electrical nerve stimulation in the left outer auditory canal - a pilot study. Brain Stimul 6:798–804 Frangos E, Ellrich J, Komisaruk BR (2015) Non-invasive access to the vagus nerve central projections via electrical stimulation of the external Ear: fMRI evidence in humans. Brain Stimul 8:624–636 Kirchner A, Birklein F, Stefan H, Handwerker HO (2000) Left vagus nerve stimulation suppresses experimentally induced pain. Neurology 55:1167–1171 Busch V, Zeman F, Heckel A, Menne F, Ellrich J, Eichhammer P (2013) The effect of transcutaneous vagus nerve stimulation on pain perception–an experimental study. Brain Stimul 6:202–209 Goadsby PJ, Grosberg BM, Mauskop A, Cady R, Simmons KA (2014) Effect of noninvasive vagus nerve stimulation on acute migraine: an open-label pilot study. Cephalalgia 34:986–993 Beck AT, Erbaugh J, Ward CH, Mock J, Mendelsohn M (1961) An inventory for measuring depression. Arch Gen Psychiatry 4:561–571 Stewart WF, Lipton RB, Dowson AJ, Sawyer J (2001) Development and testing of the Migraine Disability Assessment (MIDAS) questionnaire to assess headache-related disability. Neurology 56:S20–S28 Kosinski M, Bayliss MS, Bjorner JB, Ware JE Jr, Garber WH, Batenhorst A, Cady R, Dahlof CG, Dowson A, Tepper S (2003) A six-item short-form survey for measuring headache impact: the HIT-6. Qual Life Res 12:963–974 Freitag FG, Diamond S, Diamond M, Urban G (2008) Botulinum toxin type A in the treatment of chronic migraine without medication overuse. Headache 48:201–209 Silvestrini M, Bartolini M, Coccia M, Baruffaldi R, Taffi R, Provinciali L (2003) Topiramate in the treatment of chronic migraine. Cephalalgia 23:820–824 Diener HC, Bussone G, Van Oene JC, Lahaye M, Schwalen S, Goadsby PJ (2007) Topiramate reduces headache days in chronic migraine: a randomized, double-blind, placebo-controlled study. Cephalalgia 27:814–823 Aurora SK, Dodick DW, Turkel CC, DeGryse RE, Silberstein SD, Lipton RB, Diener HC, Brin MF (2010) OnabotulinumtoxinA for treatment of chronic migraine: results from the double-blind, randomized, placebo-controlled phase of the PREEMPT 1 trial. Cephalalgia 30:793–803 The Vagus Nerve Stimulation Study Group (1995) A randomized controlled trial of chronic vagus nerve stimulation for treatment of medically intractable seizures. Neurology 45:224–230 Milby AH, Halpern CH, Baltuch GH (2008) Vagus nerve stimulation for epilepsy and depression. Neurotherapeutics 5:75–85 Ellrich J (2006) Long-term depression of orofacial somatosensory processing. Suppl Clin Neurophysiol 58:195–208 Ellrich J (2004) Electric low-frequency stimulation of the tongue induces long-term depression of the jaw-opening reflex in anesthetized mice. J Neurophysiol 92:3332–3337 Jung K, Rottmann S, Ellrich J (2009) Long-term depression of spinal nociception and pain in man: influence of varying stimulation parameters. Eur J Pain 13:161–170 Rottmann S, Jung K, Vohn R, Ellrich J (2010) Long-term depression of pain-related cerebral activation in healthy man: an fMRI study. Eur J Pain 14:615–624 Rottmann S, Jung K, Ellrich J (2010) Electrical low-frequency stimulation induces long-term depression of sensory and affective components of pain in healthy man. Eur J Pain 14:359–365

Page 9 of 9

39. Jung K, Larsen LE, Rottmann S, Ellrich J (2011) Heterotopic low-frequency stimulation induces nociceptive LTD within the same central receptive field in man. Exp Brain Res 212:189–198 40. Jung K, Lelic D, Rottmann S, Drewes AM, Petrini L, Ellrich J (2012) Electrical low-frequency stimulation induces central neuroplastic changes of pain processing in man. Eur J Pain 16:509–521 41. Rottmann S, Jung K, Ellrich J (2008) Electrical low-frequency stimulation induces homotopic long-term depression of nociception and pain from hand in man. Clin Neurophysiol 119:1895–1904 42. Aymanns M, Yekta SS, Ellrich J (2009) Homotopic long-term depression of trigeminal pain and blink reflex within one side of the human face. Clin Neurophysiol 120:2093–2099 43. Yekta SS, Lamp S, Ellrich J (2006) Heterosynaptic long-term depression of craniofacial nociception: divergent effects on pain perception and blink reflex in man. Exp Brain Res 170:414–422 44. Ellrich J, Schorr A (2004) Low-frequency stimulation of trigeminal afferents induces long-term depression of human sensory processing. Brain Res 996:255–258 45. Noseda R, Burstein R (2013) Migraine pathophysiology: anatomy of the trigeminovascular pathway and associated neurological symptoms, CSD, sensitization and modulation of pain. Pain. 154 Suppl 1. 46. Peuker ET, Filler TJ (2002) The nerve supply of the human auricle. Clin Anat 15:35–37 47. Lyubashina OA, Sokolov AY, Panteleev SS (2012) Vagal afferent modulation of spinal trigeminal neuronal responses to dural electrical stimulation in rats. Neuroscience 222:29–37 48. Multon S, Schoenen J (2005) Pain control by vagus nerve stimulation: from animal to man…and back. Acta Neurol Belg 105:62–67 49. Bossut DF, Maixner W (1996) Effects of cardiac vagal afferent electrostimulation on the responses of trigeminal and trigeminothalamic neurons to noxious orofacial stimulation. Pain 65:101–109 50. Zerari-Mailly F, Buisseret P, Buisseret-Delmas C, Nosjean A (2005) Trigeminosolitarii-facial pathway in rats. J Comp Neurol 487:176–189 51. Randich A, Gebhart GF (1992) Vagal afferent modulation of nociception. Brain Res Brain Res Rev 17:77–99 52. Coppola G, Pierelli F, Schoenen J (2009) Habituation and migraine. Neurobiol Learn Mem 92:249–259 53. De Marinis M, Pujia A, Colaizzo E, Accornero N (2007) The blink reflex in “chronic migraine”. Clin Neurophysiol 118:457–463 54. Aurora SK, Barrodale PM, Tipton RL, Khodavirdi A (2007) Brainstem dysfunction in chronic migraine as evidenced by neurophysiological and positron emission tomography studies. Headache 47:996–1003 55. Coppola G, Iacovelli E, Bracaglia M, Serrao M, Di LC, Pierelli F (2013) Electrophysiological correlates of episodic migraine chronification: evidence for thalamic involvement. J Headache Pain 14:76 56. Henry TR (2002) Therapeutic mechanisms of vagus nerve stimulation. Neurology 59:S3–S14 57. Ben-Menachem E, Hamberger A, Hedner T, Hammond EJ, Uthman BM, Slater J, Treig T, Stefan H, Ramsay RE, Wernicke JF (1995) Effects of vagus nerve stimulation on amino acids and other metabolites in the CSF of patients with partial seizures. Epilepsy Res 20:221–227 58. Richter F, Mikulik O, Ebersberger A, Schaible HG (2005) Noradrenergic agonists and antagonists influence migration of cortical spreading depression in rat-a possible mechanism of migraine prophylaxis and prevention of postischemic neuronal damage. J Cereb Blood Flow Metab 25:1225–1235 59. Pietrobon D, Striessnig J (2003) Neurobiology of migraine. Nat Rev Neurosci 4:386–398 60. Cernuda-Morollon E, Martinez-Camblor P, Alvarez R, Larrosa D, Ramon C, Pascual J (2015) Increased VIP levels in peripheral blood outside migraine attacks as a potential biomarker of cranial parasympathetic activation in chronic migraine. Cephalalgia 35:310–316 61. Schytz HW, Birk S, Wienecke T, Kruuse C, Olesen J, Ashina M (2009) PACAP38 induces migraine-like attacks in patients with migraine without aura. Brain 132:16–25 62. Bussone G, Diener HC, Pfeil J, Schwalen S (2005) Topiramate 100 mg/day in migraine prevention: a pooled analysis of double-blind randomised controlled trials. Int J Clin Pract 59:961–968

Li et al. Trials (2015) 16:101 DOI 10.1186/s13063-015-0630-4

TRIALS

STUDY PROTOCOL

Open Access

Transcutaneous electrical stimulation at auricular acupoints innervated by auricular branch of vagus nerve pairing tone for tinnitus: study protocol for a randomized controlled clinical trial Tian-Tian Li1†, Zhao-Jun Wang1†, Song-Bai Yang2*, Jun-Hong Zhu2, Shi-Zhong Zhang1, San-Jin Cai1,2, Wen-Han Ma1, Ding-Qi Zhang1 and Zhi-Gang Mei1,2*

Abstract Background: Subjective tinnitus is a phantom sensation experienced in the absence of any source of sound. Its mechanism remains unclear, and no approved drugs are available. Vagus nerve stimulation (VNS) is an exciting new method to treat tinnitus, but direct electrical stimulation of the cervical vagus has disadvantages. This randomized controlled clinical trial aims to overcome these limitations by stimulating the auricular branch of vagus nerve (ABVN) on the outer ear. Since the ABVN is the only peripheral branch of the vagus nerve distributed on the ear’s surface, it should be possible to achieve analogous efficacy to VNS by activating the central vagal pathways. However, researches have indicated that the curative effect lies in a combination of auditory and vagal nerve stimulation. Moreover, from traditional Chinese theory, auricular acupoints used to treat tinnitus are mainly in the regions supplied by the ABVN. Whether stimulation at the auricular acupoints is due to unintentional stimulation of vagal afferent fibers also needs evidence. Methods/design: A total of 120 subjects with subjective tinnitus are randomized equally into four groups: (1) electrical stimulation at auricular acupoints (CO10, CO11, CO12, and TF4) innervated by the ABVN; (2) electrical stimulation at auricular acupoints (CO10, CO11, CO12, and TF4) innervated by ABVN pairing tones; (3) electrical stimulation at auricular acupoints innervated by non-ABVN pairing tones; (4) electrical acupuncture. Patients will be treated for 30 minutes every other day for 8 weeks. The primary outcome measure is the Tinnitus Handicap Inventory. The secondary outcome measure combines a visual analogue scale to measure tinnitus disturbance and loudness with the Hospital Anxiety and Depression Scale. Assessment is planned at baseline (before treatment) and in the 4th and 8th week, with further follow-up visits after termination of the treatment at the 12th week. Any adverse events will be promptly documented. Discussion: Completion of this trial will help to confirm whether ABVN or the combination of ABVN and sound stimulus plays a more important role in treating tinnitus. Moreover, the result of this clinical trial will enhance our understanding of specific auricular acupoints. Trial registration: Chinese Clinical Trials Register ChiCTR-TRC-14004940. Keywords: auricular acupoints, auricular branch of vagus nerve (ABVN), randomized controlled trial, subjective tinnitus, tones * Correspondence: maypaul@163.com; zhigangmei@139.com † Equal contributors 1 Medical College of China Three Gorges University, No. 8, University Avenue, Yichang, Hubei, China 2 Yichang Hospital of Traditional Chinese Medicine, Clinical Medical College of Traditional Chinese Medicine, China Three Gorges University, Yichang, Hubei 443003, China © 2015 Li et al.; licensee BioMed Central. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Li et al. Trials (2015) 16:101

Background Subjective tinnitus is considered as a phantom sensation experienced in the absence of any internal or external acoustic stimulus. It can be perceived as a hissing, buzzing, humming, roaring, whistling, or ringing sound in one or both ears, or somewhere in the head. At present, tinnitus has becoming the most common otology problem, affecting 10% to 30% of the general population and an estimated prevalence of 24.2% in the older population [1]. Meanwhile, with the growing popularity of electronic music, young people experience transient or permanent tinnitus at a ratio of 89.5% and 14.8%, respectively, after exposure to loud music [2]. Among severe tinnitus sufferers, tinnitus-related sensations, such as anxiety, annoyance, frustration, and depression lead to a negative impact on quality of life in 70% of those affected [3], and they are usually told that they must learn to live with it. Yet the pathological mechanisms that underlie tinnitus perception remain largely hypothetical and are still not well understood. Currently, the universally accepted hypothesis is that interactions between altered cochlear inputs and distorted central auditory processing provoke tinnitus. Studies have supported that subjective tinnitus may be a result of the expression of neural plasticity and that anomalies may develop because of decreased input from the ear, deprivation and sound stimulation, overstimulation or other factors as yet unknown. For the buried pathological mechanisms, treatment options are limited. No physiotherapy treatments can yet be considered sufficient in providing long-term reduction of tinnitus impact and there is no drug approved by the European Medicines Agency or the Food and Drug Administration on the market [4,5]. Therefore, an effective and safe therapy for tinnitus is of considerable importance to meet this significant unmet clinical need. Vagus nerve stimulation (VNS) is approved by the Food and Drug Administration for both refractory epilepsy and resistant depression [6,7]. VNS offers an exciting new perspective for the treatment of tinnitus and it has recently been demonstrated that VNS is a promising method [8]. In this method, an electrode surgically implanted around the left cervical vagus nerve is connected to a pulse generator placed subcutaneously in the upper chest. However, considering the disadvantages of the implantation, including lesions of the vagus nerve, infection, shortness of breath, possible mechanical failure of electronic equipment, and battery replacement, a relatively safe and well tolerated improved method is desired. To minimize side effects, stimulation of the auricular branch of vagus nerve (ABVN) has been suggested [9]. The ABVN is the only peripheral branch of the vagus nerve distributed on the surface of ear, and studies using the transganglionic horseradish peroxidase method [10,11] have shown that it mainly projects to the nucleus

Page 2 of 9

of the solitary tract in the brainstem. Functional magnetic resonance imaging and vagus sensory evoked potentials revealed that ABVN stimulation shows considerable similarity to implanted VNS, with both acting through the central auditory pathway of the vagus nerve [12,13]. Thus, it would be safer simply to deliver mild electric shocks to the skin of the outer ear instead of resorting to VNS with surgery. However, some researchers reported that ABVN stimulation alone seems to have no relevant improvement of tinnitus complaints [8,14], and it is suggested that the combination with other interventions, such as sound stimuli, which would reduce the cortical response to mid-frequency tones, increase frequency selectivity, and decrease cortical synchronization [15] should be considered. But there is not currently enough evidence in clinical practice of the effect of the method of pairing tones with stimulation at ABVN. Moreover, auricular acupuncture, the underlying mechanism of which is unclear, has been used to treat tinnitus for thousands of years [16]. Auricular acupoints applied to treat tinnitus such as Kidney (CO10), Yidan (CO11), Liver (CO12) and Shenmen (TF4) are distributed in the regions supplied by ABVN [17]. So whether auricular acupoints are due to an unintentional stimulation of the vagal afferent fibers also needs more clinical and experimental evidence. Therefore, we have designed a randomized, four-arm, controlled clinical study to provide a conclusive answer. In this trial, our aim is to attempt to confirm whether ABVN or the combination of ABVN and sound stimulus plays a more important role in the treatment of tinnitus. Moreover, the result of this clinical trial will enhance our understanding of specific auricular acupoints.

Methods/design Design

This is a randomized, single-blind, four-armed, controlled clinical trial conducted in Yichang Hospital of Traditional Chinese Medicine, Clinical Medical College of Traditional Chinese Medicine, China Three Gorges University. Study patients will be screened based on specific inclusion and exclusion criteria. Before beginning the treatment, all candidates will undergo a standard neuro-otological examination and a baseline audiometric assessment, including measurement of hearing thresholds, minimal masking levels, loudness discomfort levels, and stapedial reflexes, performed by professional audiologists. Then they will be equally randomized into four groups: (1) electrical stimulation at auricular acupoints (CO10, CO11, CO12, and TF4) innervated by ABVN (the ABVN group); (2) electrical stimulation at auricular acupoints (CO10, CO11, CO12, and TF4) innervated by ABVN pairing tones (the ABVN plus tone group); (3) electrical stimulation at auricular acupoints innervated by non-ABVN pairing tones (the non-ABVN

Li et al. Trials (2015) 16:101

Page 3 of 9

plus tone group); (4) an electrical acupuncture group. Detailed information regarding the clinical procedures is presented in Figure 1. The clinical endpoints are assessed by blinded independent statisticians. Any adverse effects during the course will be reported. This trial was registered on the Chinese Clinical Trial Register (ChiCTR-TRC-14004940). The trial will be performed according to the principles of the Declaration of Helsinki (Edinburgh version, 2000). In addition, written informed consent will be obtained from all participants. Ethical permission was obtained from the Research Ethical Committee of Yichang Hospital of Traditional Chinese Medicine, Clinical Medical College of Traditional Chinese Medicine, China Three Gorges University. The ethics committee approval number is 201407041.

Recruitment period and methods

Patients will be enrolled in Yichang Hospital of Traditional Chinese Medicine, Clinical Medical College of Traditional Chinese Medicine, China Three Gorges University with a target sample size of 120 subjects. We will recruit the participants by advertising in the hospitals, in public newspapers and on the internet homepages of hospitals. The trial will be executed from July 2014 to July 2015. Types of participant Inclusion criteria

Qualified participants meeting all of the following conditions will be recruited [18,19]: 1. Single-tone subjective tinnitus, typical conditions of unilateral or bilateral;

Patients with subjective tinnitus

Screening for eligibility

Exclude: •Not meeting inclusion criteria •Refused to participate •Other reasons

Randomized (n = 120) 1:1:1:1

ABVN group (n = 30)

ABVN plus tone group (n = 30)

Non-ABVN plus tone group (n = 30)

Electrical acupuncture group (n = 30)

•Treatment period over 8 weeks •Every other day •30 minutes per session

•Outcome measures at baseline, 4th, and 8th week •Follow-up at 12th week •THI, VAS, HADS

Figure 1 Flow chart. ABVN, auricular branch of vagus nerve; HADS, Hospital Anxiety and Depression Scale; THI, Tinnitus Handicap Inventory; VAS, visual analogue scale.

Li et al. Trials (2015) 16:101

2. Age 15 to 65 years, either sex; 3. Recurrent attacks for more than 1 month or persist attacks for more than 5 days; 4. Must be able to hear stimulation tones presented by the device at all frequencies; 5. Must be able to complete the forms and use the rating scales; 6. Not be taking part in any other clinical trial during the period; 7. Voluntarily signed informed consent forms. Exclusion criteria

Participants who experience or have one or more of the following conditions will be excluded: 1. Objective tinnitus or Ménière’s disease; 2. Tinnitus induced by otitis media, otitis interna or cerebellopontine angle tumors; 3. Postcochlear lesion; 4. Patients with severe diabetes, hypertension or cardiovascular disease, or mental disease; 5. Patients unable to read, understand and complete the forms or use the rating scales; 6. Pregnant or preparing for pregnancy. Randomization and blinding

One researcher screens and enrolls participants at the clinic. Patients are numbered according to registration order. After participants have completed a baseline evaluation, another researcher who is uninvolved with data collection randomly assigns them to one of four treatment groups in a 1:1:1:1 ratio using a computer-generated, blocked randomization sequence generated using SPSS 15.0 software (SPSS Inc., Chicago, IL, USA). This researcher informs the therapist of the treatment assignment. We applied a single-blind design in which the study patients, data collocation staff, and data analysts are blinded during the study protocol. The therapists are not blinded to the treatments they deliver because treatment manipulation makes it impossible. During the intervention, therapists and data collection staff are instructed not to exchange information with each other nor communicate with the study patients. Interventions

Specific interventions of each group are as follows (Figure 2). ABVN group

All participants will receive transcutaneous electrical stimulation at auricular acupoints innervated by the ABVN. The points are located at the cymba conchae and the triangular fossa, where there is rich ABVN

Page 4 of 9

distribution [17]. Main stimulation points according to standard practice include Kidney (CO10), Yidan (CO11), Liver (CO12), and Shenmen (TF4). A transcutaneous electrical nerve stimulator (Suzhou Medical Appliance Co. Ltd., Suzhou, China) will be used in this group. Two carbon-impregnated silicone electrode tips are connected to the transcutaneous electrical nerve stimulator by metal wire; one tip contacts the skin surface points and the other acts as a terminal end in the ear. The stimulation frequency is 20 Hz, the stimulation current is 1 to 5 mA, with stimulus pulses shorter than 1 ms in duration. Each session will last 30 minutes; sessions are performed every other day for 8 weeks. ABVN plus tone group

The format will be exactly the same as for the ABVN group. Multiple tones will be delivered by Tinnitus Measurer software (Neonix, USA) at a comfortable listening level during the transcutaneous electrical nerve stimulation. Randomly interleaved pure tones that span the hearing range but exclude the tinnitus tone will be selected. Each session will last 30 minutes; sessions are performed every other day for 8 weeks. Non-ABVN plus tone group

The format of this group will be the same as for the ABVN plus tone group, except that the subjects receiving stimulation will be stimulated at auricular acupoints supplied by the great auricular nerve [17]. Each session will last 30 minutes; sessions are performed every other day for 8 weeks. Electrical acupuncture group

The subjects of this group will be treated with electrical acupuncture at local and distal points. Acupuncture points are selected as follows. 1. local acupoints: Yifeng (TE17), Tinghui (GB2); 2. distal acupoints: Xiaxi (GB43), Zhongzhu (TE3). Patients will be in a comfortable and relaxed position and asked to concentrate on the treatment task. After the needles are inserted into the acupoints, they will be connected to an electrical point stimulation device (G6805-2A, Shanghai Huayi Medical Instrument CO., Ltd, Shanghai, China) operating at a frequency of 20 Hz and current of 1 to 5 mA, with pulses shorter than 1 ms in duration. The intensity will be adjusted individually based on the tolerance of the patient. All parameters of the electrical stimulation inducing twitching of the muscles indicate effective stimulus. After retaining the needles for 30 min, all needles are taken out using alcohol-soaked cotton balls to avoid infection and bleeding. The needles (Suzhou Medical Supplies Factory Co., Ltd. Suzhou, China) used in this group are 25 mm in length and 0.3 mm in diameter. Electrical acupuncture is performed by a therapist with rich clinical experience

Li et al. Trials (2015) 16:101

Page 5 of 9

Figure 2 Locations and stimulation devices. (A) Points used in the ABVN group and the ABVN plus tone group for transcutaneous electrical nerve stimulation. (B) Points used in the non-ABVN plus tone group for transcutaneous electrical nerve stimulation. (C) Acupoints used in the electrical acupuncture group. (D) Locations of acupoints in the acupuncture group. local acupoints: Tinghui (GB2) and Yifeng (TF17); distal acupoints: Zhongzhu (TE3) and Xiaxi (GB43). (E) Innervation of the human auricle, including ABVN (blue grid), great auricular nerve (green grid) and auriculotemporal nerve (red grid) [17]; the black areas show the specific auricular acupoints. TF4, CO10-12, and HX1 are used in the ABVN group and the ABVN plus tone group; HX9 and LO5 are used in the non-ABVN plus tone group. (F) Ideograph of sound (tones) stimulus: each speakers is equidistant from the head of the subject.

and acupuncture licenses for Chinese medicine practitioners from the Ministry of Health of China. Treatment will be conducted over a period of 8 weeks, at a frequency of every other day.

(58 to 76 points), or ‘catastrophic’ (78 to 100 points). The assessment is at baseline (before randomization), and in the 4th and 8th week, with further follow-up visits after termination of the treatment at the 12th week.

Primary outcome measures

Secondary outcome measures

The primary outcome is evaluated using the Tinnitus Handicap Inventory, which evaluates 25 items grouped into a functional subscale (11 factors), an emotional subscale (9 factors), and a catastrophic subscale (5 factors). Each question of the Tinnitus Handicap Inventory can be answered by either ‘often’ (4 points), ‘sometimes’ (2 points), or ‘never’ (0 points). The total score allows the tinnitus to be categorized as: ‘slight’ (0 to 16 points), ‘mild’ (18 to 36 points), ‘moderate’ (38 to 56 points), ‘severe’

A visual analogue scale, measuring the disturbance and the loudness of the tinnitus will be used. This consists of 100 mm lines with ‘0 = total absence’ and ‘100 = maximum’ of tinnitus disturbance and loudness, respectively. The severity of both anxiety and depression is evaluated using the Hospital Anxiety and Depression Scale, in which seven items for anxiety and another seven items for depression are assessed. Each item is answered by the patients on a four point (0 to 3) response category.

Li et al. Trials (2015) 16:101

Page 6 of 9

A score of 0 to 7 for either subscale could be regarded as being in the normal range, a score of 8 to 10 is just suggestive of the presence of the respective state and a score of 11 or higher indicates the probable presence of the mood disorder [20]. Both of these assessments will be used at baseline (before randomization), and in the 4th and 8th week, with further follow-up visits after termination of the treatment at the 12th week. Statistical methods

The trial aims to detect a difference between the four study groups. We present here our power analysis for the primary outcome only. This is deemed a clinically significant difference of a 20-point or greater reduction in score on the Tinnitus Handicap Inventory following treatments. Since this is a novel therapy, we used data from a previous proof-of-concept feasibility study [21], the mean decrease rate is 28% in the VNS group and 0.97% in the control group. The following formula was used for a four-group trial [22]: n1 ¼ n2 ¼

μα þ μβ

2Pð1−PÞ

ðP1 −P2 Þ2

Calculations are performed using 80% power and a 5% significance level (two-side). The required sample size is approximately 27 participants for each group. Assuming a 10% dropout rate, we plan to enroll a total of 120 participants with four groups of equal size (30 participants per group).

Statistical analysis will be performed by the Medical College of China Three Gorges University, No.8, University Avenue, Yichang, Hubei, China. The statistician is blinded from the allocation of groups. The SPSS 15.0 software package (SPSS Inc., Chicago, IL, USA) will be used to analyze the data. Participant protections and ethics

The protocol adheres to the latest revision of the Helsinki Declaration and the Chinese law of human study and has been approved by the Research Ethical Committee of Yichang Hospital of Traditional Chinese Medicine, Clinical Medical College of Traditional Chinese Medicine, China Three Gorges University. The participants are informed of the potential benefits, risks, alternatives, and responsibilities during the study before they are asked to provide consent. Potential mild adverse events, reported to be related to electro-acupuncture treatment, are pain, bleeding, tiredness, and a feeling of faintness in the acupuncture group [23], and skin redness and pressure marks in the other groups, but these mild symptoms will generally resolve spontaneously after treatment. Additionally, ABVN is thought to be involved in some peculiar somatovisceral reflexes. For instance, an ear-cough reflex (Arnold’s reflex) is estimated to be present in approximately 4% [24] of the general population, while there is rare occurrence of eargag reflex, ear-lacrimal reflex and auricular syncope [24,25]. So there is a rare possibility that patients in the two groups receiving ABVN stimulation might have these reflexes. Participants who show any adverse effects during the course of the therapy will receive appropriate treatment immediately. All adverse effects will be documented, and patients with persistent worsening symptoms will be withdrawn from the study.

Statistical analysis

In this trial, our primary outcome measure is the Tinnitus Handicap Inventory. We define the treatment response as a reduction in score on the Tinnitus Handicap Inventory following treatments of 20 points or more. First, baseline characteristics will be analyzed using descriptive statistics for each group. Then repeated measures analysis is performed to make comparisons among the treatment groups and the control group (ABVN plus tone versus electrical acupuncture, non-ABVN plus tone versus electrical acupuncture, and ABVN versus electrical acupuncture) at different time points (4th, 8th, and 12th week). If a significant difference is found, the next step is to make comparisons among the three treatment groups in effectiveness. Multiple comparisons will be adjusted according to the Bonferroni correction method. The Kruskal-Wallis test will be employed in the analysis of skewed distribution data. Analysis of variance will be used for numerical variables, and the χ2 test for categorical variables.

Discussion We have presented the design and protocol for the randomized controlled clinical study for tinnitus patients. If it proves successful, this new treatment method could offer hope to millions of patients who are affected by tinnitus. Although the exact pathophysiology of tinnitus still remains elusive, it is believed that an abnormal balance between inhibition and excitation causing map reorganization of central auditory circuits underlies many forms of tinnitus [26]. Moreover, signs of abnormal activity were not only revealed in the central auditory system but also in non-auditory areas, including the limbic system [27-29]. The annoyance of tinnitus is not correlated with its acoustic characteristics, but there is a significant correlation with psychological symptoms [30]. The autonomic nervous system is a major factor in the difference between simply perceiving tinnitus and being distressed by it [31]. Studies

Li et al. Trials (2015) 16:101

have reported that tinnitus distress correlated positively with sympathetic markers and negatively with parasympathetic markers [32,33]. Accumulating evidence illustrates that tinnitus is correlated with symptoms of distress, such as emotional stress and depression for the important role of the limbic system in the pathophysiology of tinnitus, which is based on the further understanding of auditory-limbic interactions [34-36]. Vagal nerve stimulation was developed based on this growing understanding of tinnitus. It may work by activating the nucleus of the solitary tract, which, in turn, may activate the locus coeruleus and nucleus basalis, which release neuromodulators that have significant effects on learning and memory and in plasticity regulation by modulating neurons in the cortex, hippocampus, and amygdala [26]. Engineer and colleagues [8] have indicated that cervical VNS paired with specific auditory stimuli completely eliminated the physiological and behavioral correlates of the phantom sound. They observed that pairing tones with VNS significantly acutely increased excitability and suppressed spontaneous multi-unit activity in rat auditory cortex [37]. Indeed, beneficial effects in relieving psychological symptoms have been confirmed in patients with tinnitus using invasive VNS pairing tones [21] or transcutaneous VNS paired with tones [19,38] in recent small sample pilot studies. However, another experiment also demonstrated that VNS-directed long-lasting reversal of pathological neural plasticity is driven by the repeated association of VNS with tones, and not by VNS alone [8]. German researchers [14] claimed that no clinically relevant improvement of tinnitus complaints was observed after transcutaneous VNS alone. To some extent, this may confirm the suggestion that stimulation at ABVN might prove less effective than VNS because fibers from the auricular branch do not primarily target the nucleus of the solitary tract and so only target it partly. Otherwise, as these researchers themselves suggested [14], the most probable explanation is that VNS alone is not effective in reducing tinnitus, which is supported by the work of Engineer et al. [8]. While sound stimulus alone, as a common sensory exposure treatment strategy, has been applied to treat tinnitus for many years [39,40], studies have indicated that it has only provided some temporary relief [41,42]. Therefore, to identify whether ABVN or the combination of ABVN and sound stimulus plays a more important role in relieving tinnitus, we designed this four-armed novel trial to determine their specific effect on tinnitus. Acupuncture is an important part of traditional Chinese medicine. It has been accepted in China for thousands of years and is now used as an alternative and complementary medical therapy in Western countries.

Page 7 of 9

Meta-analysis results have indicated that acupuncture or acupuncture combined with other therapies is superior to medication alone or non-acupuncture treatments in treating subjective tinnitus [43]. However, in another systematic review, acupuncture for the treatment of tinnitus has not been demonstrated to be efficacious [44]. Whether acupuncture is effective or not in the treatment of tinnitus is a question worthy of discussion. According to the theory of traditional Chinese medicine, the shaoyang meridians of the hand and foot travel to the ear region, so acupoints of the shaoyang meridians located both in local and distant areas of the ear are used to treat tinnitus in this protocol. In addition, the specific acupoints Yifeng (TE17), Tinghui (GB2), Xiaxi (GB43), and Zhongzhu (TE3) are usually chosen in treating tinnitus. Auricular acupuncture, as an important branch of acupuncture, has also been utilized in the treatment of diseases for years. In ancient Chinaâ&#x20AC;&#x2122;s earliest medical text Huang Di Nei Jing, which was compiled in the 5th century BC, the correlation between the external ear and the body or viscera is described. In 1957, Dr. Paul Nogier, a physician in France, first originated the concept of an inverted fetus map on the external ear [45]. He proposed a theory that there is a somatotopic and viscerotopic representation on the auricle [46]. According to these theories, disorders from a particular part of the body or viscera can be treated by the corresponding points in the ear [46,47]. Therefore, related auricular acupoints such as Kidney (CO10), Yidan (CO11), or Liver (CO12) are usually selected to treat tinnitus, which, according to the organ-viscera theory of traditional Chinese medicine, results from insufficient Kidney qi or dampness-heat of the Liver and Gallbladder. The Shenmen point (TF4) has the effect of tranquilizing the mind [48,49]. It is often utilized to remedy mental illnesses or psychiatric disorders, such as insomnia [50], anxiety [51,52], or tinnitus [53]. However, the physiological mechanisms associated with these auricular acupoints remain unclear. In this study, it is proposed that the autonomic and the central nervous system could be modified by auricular vagal stimulation via projection from the ABVN to the nucleus of the solitary tract [54], which might work through the neuromodulator system, thus directing plasticity to treat tinnitus. However, our study has several potential limitations. First, all the outcome measures are self-assessments instead of objective measures. To some extent, objective measures carry out relatively convincing evidence. However, the Tinnitus Handicap Inventory [55,56], visual analogue scale [56], and Hospital Anxiety and Depression Scale [57] have been much used in most of the randomized controlled trials on tinnitus and they are proved to be efficient in reflecting the subjective emotional changes related to tinnitus. Second, this trial is

Li et al. Trials (2015) 16:101

Page 8 of 9

single-blind, therefore, the subjective factors from therapists might bias the outcome assessments. However, it is hard to blind the therapists, who are required to be familiar with treatments for the specific grouping assignment. Another limitation concerns the fact that this is a single center study. It does not lend results to great generalizability to more diverse sets of patients in more diverse regions. In addition, the sample size in this study is relatively small. A large sample, multicenter, and objective measures to assess the effectiveness of treatment should be included in a future study.

Trial status This trial is currently recruiting participants.

12.

Consent

13.

Written informed consent was obtained from the participants for publication of this manuscript and accompanying images. A copy of the written consent is available for review by the editor-in-chief of this journal.

7. 8.

9. 10.

11.

14.

15. Abbreviations ABVN: Auricular branch of vagus nerve; VNS: Vagus nerve stimulation.

16.

Competing interests The authors declare that they have no competing interests.

17.

Authors’ contributions ZGM conceived and designed the study. SBY participated in designing the study and is in charge of treatment of patients in the ABVN plus tone group. TTL drafted the manuscript and was responsible for obtaining approval from the Research Ethical Committee of Yichang Hospital of Traditional Chinese Medicine, Clinical Medical College of Traditional Chinese Medicine, China Three Gorges University and registering the trial with the Chinese Clinical Trial Registry. ZJW contributed to drafting the manuscript and prepared the figures. JHZ is in charge of treatment of patients in the ABVN group. DQZ is in charge of treatment of patients in the non-ABVN plus tone group. SJC is in charge of treatment of patients in the electrical acupuncture group. SZZ is responsible for central randomization and statistical analysis and made amendments to the manuscript. WHM is in charge of recruitment, collects date and provides pictures. All authors read and approved the final version of the manuscript.

19.

18.

20. 21.

22. 23. 24. 25.

Acknowledgements The study was supported by the general scientific research project of traditional Chinese medicine approved by the Health and Family Planning Commission of Hubei Province, P.R. China.

26. 27.

Received: 11 October 2014 Accepted: 4 March 2015 28. References 1. Negrila-Mezei A, Enache R, Sarafoleanu C. Tinnitus in elderly population: clinic correlations and impact upon QoL. J Med Life. 2011;4:412–6. 2. Gilles A, De Ridder D, Van Hal G, Wouters K, Kleine Punte A, Van de Heyning P. Prevalence of leisure noise-induced tinnitus and the attitude toward noise in university students. Otol Neurotol. 2012;33:899–906. 3. Tyler RS, Baker LJ. Difficulties experienced by tinnitus sufferers. J Speech Hear Disord. 1983;48:150–4. 4. Dobie RA. A review of randomized clinical trials in tinnitus. Laryngoscope. 1999;109:1202–11. 5. Langguth B, Elgoyhen AB. Current pharmacological treatments for tinnitus. Expert Opin Pharmacother. 2012;13:2495–509.

29.

30. 31. 32.

Shiozawa P, da Silva ME, de Carvalho TC, Cordeiro Q, Brunoni AR, Fregni F. Vagus nerve stimulation in the treatment of epilepsy. Arq Neuropsiquiatr. 2014;72:542–7. Grimm S, Bajbouj M. Efficacy of vagus nerve stimulation in the treatment of depression. Expert Rev Neurother. 2010;10:87–92. Engineer ND, Riley JR, Seale JD, Vrana WA, Shetake JA, Sudanagunta SP, et al. Reversing pathological neural activity using targeted plasticity. Nature. 2011;470:101–4. Schnupp J. Auditory neuroscience: how to stop tinnitus by buzzing the vagus. Curr Biol. 2011;21:263–5. Nomura S, Mizuno N. Central distribution of primary afferent fibers in the Arnold’s nerve (the auricular branch of the vagus nerve): a transganglionic HRP study in the cat. Brain Res. 1984;292:199–205. Mei ZG, Zhu B, He W, Gao XY. Morphological basis of auricular acupuncture effects: evidences from neural tracer method of HRP. Lishizhen Med Mater Med Res. 2009;20:2675–7. Kraus T, Hösl K, Kiess O, Schanze A, Kornhuber J, Forster C. BOLD fMRI deactivation of limbic and temporal brain structures and mood enhancing effect by transcutaneous vagus nerve stimulation. J Neural Transm. 2007;114:1485–93. Polak T, Markulin F, Ehlis AC, Langer JB, Ringel TM, Fallgatter AJ. Far field potentials from the brain stem after transcutaneous vagus nerve stimulation. J Neural Transm. 2009;116:1237–42. Kreuzer PM, Landgrebe M, Resch M, Husser O, Schecklmann M, Geisreiter F, et al. Feasibility, safety and efficacy of transcutaneous vagus nerve stimulation in chronic tinnitus: an open pilot study. Brain Stimul. 2014;14:173–9. Kilgard MP, Vazquez JL, Engineer ND, Pandya PK. Experience dependent plasticity alters cortical synchronization. Hear Res. 2007;229:191–9. Cheng XN. Chinese acupuncture and moxibustion. Beijing: Foreign Language Press; 2010. Peuker ET, Filler TJ. The nerve supply of the human auricle. Clin Anat. 2002;15:35–7. Zheng XY. Guiding principles of clinical study on new drugs of traditional Chinese medicine. Beijing: China Medical Science Press; 2002. Mei ZG, Yang SB, Cai SJ, Lei HP, Zhuo C, Guo YH, et al. Treatment of tinnitus with electrical stimulation on acupoint in the distribution area of ear vagus nerve combining with sound masking: randomized controlled trial. World J Acupunct-Moxibustion. 2014;24:30–5. Zigmond AS, Snaith RP. The hospital anxiety and depression scale. Acta Psychiatr Scand. 1983;67:361–70. De Ridder D, Vanneste S, Engineer ND, Kilgard MP. Safety and efficacy of vagus nerve stimulation paired with tones for the treatment of tinnitus: a case series. Neuromodulation. 2014;17:170–9. Liu JP. Sample size calculation in clinical research. Zhongguo Zhong Xi Yi Jie He Za Zhi. 2003;23:536–8. Ernst E, White AR. Prospective studies of the safety of acupuncture: a systematic review. Am J Med. 2001;110:481–5. Gupta D, Verma S, Vishwakarma SK. Anatomic basis of Arnold’s ear-cough reflex. Surg Radiol Anat. 1986;8:217–20. Thakar A, Deepak KK, Kumar SS. Auricular syncope. J Laryngol Otol. 2008;122:1115–7. Engineer ND, Møller AR, Kilgard MP. Directing neural plasticity to understand and treat tinnitus. Hear Res. 2013;295:58–66. Langguth B, Eichhammer P, Kreutzer A, Maenner P, Marienhagen J, Kleinjung T, et al. The impact of auditory cortex activity on characterizing and treating patients with chronic tinnitus-first results from a PET study. Acta Otolaryngol Suppl. 2006; 84–8. Leaver AM, Renier L, Chevillet MA, Morgan S, Kim HJ, Rauschecker JP. Dysregulation of limbic and auditory networks in tinnitus. Neuron. 2011;69:33–43. Langguth B, Schecklmann M, Lehner A, Landgrebe M, Poeppl TB, Kreuzer PM, et al. Neuroimaging and neuromodulation: complementary approaches for identifying the neuronal correlates of tinnitus. Front Syst Neurosci. 2012;6:15. Luxon LM. Tinnitus: its causes, diagnosis, and treatment. BMJ. 1993;306:1490–1. Jastreboff PJ, Hazell JW. Tinnitus retraining therapy: implementing the neurophysiological model. Cambridge: Cambridge University Press; 2004. Datzov E, Danev S, Haralanov H, Naidenova V, Sachanska T, Savov A. Tinnitus, heart rate variability, and some biochemical indicators. Int Tinnitus J. 1999;5:20–3.

Li et al. Trials (2015) 16:101

33. van der Loo E, Congedo M, Vanneste S, Van De Heyning P, De Ridder D. Insular lateralization in tinnitus distress. Auton Neurosci. 2011;165:191–4. 34. Kraus KS, Canlon B. Neuronal connectivity and interactions between the auditory and limbic systems: effects of noise and tinnitus. Hear Res. 2012;288:34–46. 35. Rauschecker JP, Leaver AM, Mühlau M. Tuning out the noise: limbic-auditory interactions in tinnitus. Neuron. 2010;66:819–26. 36. Landgrebe M, Langguth B, Rosengarth K, Braun S, Koch A, Kleinjung T, et al. Structural brain changes in tinnitus: grey matter decrease in auditory and non-auditory brain areas. Neuroimage. 2009;46:213–8. 37. Nichols JA, Nichols AR, Smirnakis SM, Engineer ND, Kilgard MP, Atzori M. Vagus nerve stimulation modulates cortical synchrony and excitability through the activation of muscarinic receptors. Neuroscience. 2011;189:207–14. 38. Lehtimäki J, Hyvärinen P, Ylikoski M, Bergholm M, Mäkelä JP, Aarnisalo A, et al. Transcutaneous vagus nerve stimulation in tinnitus: a pilot study. Acta Otolaryngol. 2013;133:378–82. 39. Vernon JA. Attempts to relieve tinnitus. J Am Audiol Soc. 1977;2:124–31. 40. Hobson J, Chisholm E, El Refaie A. Sound therapy (masking) in the management of tinnitus in adults. Cochrane Database Syst Rev. 2012;11, CD006371. doi:10.1002/14651858. 41. Okamoto H, Stracke H, Stoll W, Pantev C. Listening to tailor-made notched music reduces tinnitus loudness and tinnitus-related auditory cortex activity. Proc Natl Acad Sci U S A. 2010;107:1207–10. 42. Reavis KM, Rothholtz VS, Tang Q, Carroll JA, Djalilian H, Zeng FG. Temporary suppression of tinnitus by modulate sounds. J Assoc Res Otolaryngol. 2012;13:561–71. 43. Ma WH, Zhang DQ, Wang ZJ, Mei ZG. Meta-analysis on domestic and overseas acupuncture treatment for nervous tinnitus. Chin J Inf Tradit Chin Med. 2014;2:17–22. 44. Park J, White AR, Ernst E. Efficacy of acupuncture as a treatment for tinnitus: a systematic review. Arch Otolaryngol Head Neck Surg. 2000;126:489–92. 45. Nogier P. From acuriculotherapy to auriculomedicine. Sainte-Ruffine: Maisonneuve, France; 1981. 46. Nogier P. Points reflexes auriculares. Maisonneuve, France: Moulins-les-Metz; 1987. 47. Oleson TD, Kroening RJ, Bresler DE. An experimental evaluation of auricular diagnosis: the somatotopic mapping or musculoskeletal pain at ear acupuncture points. Pain. 1980;8:217–29. 48. O’Connor J, Benksy D. (translator, editor). Acupuncture: a comprehensive text - Shanghai College of Traditional Medicine. Chicago: Eastland; 1981. 49. Oleson T, Kroening RA. A comparison of Chinese and Nogier acupuncture points. Am J Acupunct. 1983;11:205–23. 50. Jiang B, Ma ZH, Zuo F. Auricular acupuncture for insomnia: a randomized controlled trial. Zhonghua Liu Xing Bing Xsue Za Zhi. 2010;31:1400–2. 51. Wang SM, Kain ZN. Auricular acupuncture: a potential treatment for anxiety. Anesth Analg. 2001;92:548–53. 52. Wang SM, Peloquin C, Kain ZN. The use of auricular acupuncture to reduce preoperative anxiety. Anesth Analg. 2001;93:1178–80. 53. Tao L. Auricular acupuncture combined with body acupuncture for 30 cases of tinnitus. Hunan J Tradit Chin Med. 2012;2:70. 54. He W, Wang X, Shi H, Shang H, Li L, Jing X, et al. Auricular acupuncture and vagal regulation. Evid Based Complement Alternat Med. 2012. doi:10.1155/2012/786839. 55. Zeman F, Koller M, Langguth B, Landgrebe M. Tinnitus Research Initiative database study group. Which tinnitus-related aspects are relevant for quality of life and depression: results from a large international multicentre sample. Health Qual Life Outcomes. 2014;12:7. 56. Figueiredo RR, Azevedo AA, Oliveira PM. Correlation analysis of the visual-analogue scale and the Tinnitus Handicap Inventory in tinnitus patients. Braz J Otorhinolaryngol. 2009;75:76–9. 57. Zöger S, Svedlund J, Holgers KM. The Hospital Anxiety and Depression Scale (HAD) as a screening instrument in tinnitus evaluation. Int J Audiol. 2004;43:458–64.

Page 9 of 9

Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color ﬁgure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit

Stimulation du nerf vague pour le traitement des crises épileptiques partielles Privitera MD, Welty TT E, Ficker DD M, Welge J. Vagus nerve stimulation for partial seizures. Cochrane Database of Systematic Reviews 2010, Issue 7. Art. No.: CD002896. DOI: 10.1002/14651858.CD002896

TRADUCTION

ORIGINAL

Date de traduction : 1-4-2013

Published : 2010-7-7

Responsable traduction : Centre Cochrane Français

Statut :UPDATED

Financeurs pour le Canada : Instituts de Recherche en Santé du Canada, Ministère de la Santé et des Services Sociaux du Québec, Fonds de recherche du Québec-Santé et Institut National d'Excellence en Santé et en Services Sociaux; pour la France : Ministère en charge de la Santé

Stimulation du nerf vague pour le traitement des crises épileptiques partielles

Vagus nerve stimulation for partial seizures

Résumé en langue simplifiée

Plain language summary

Stimulation du nerf vague pour le traitement des crises

Vagus nerve stimulation for partial seizures

épileptiques partielles

Vagus nerve stimulator is a device that is

Le stimulateur du nerf vague est un appareil efficace en

effective as add-on treatment for drug-resistant

traitement d'appoint de l'épilepsie partielle résistante aux

partial epilepsy.

médicaments.

Epilepsy is a disorder where recurrent seizures

L'épilepsie est un trouble qui se caractérise par des

are caused by abnormal electrical discharges

convulsions récurrentes causées par des décharges

from the brain. Most seizures can be controlled

électriques anormales dans le cerveau. La plupart des

by a single antiepileptic drug but sometimes

crises épileptiques sont contrôlées à l'aide d'un seul

seizures are drug-resistant. The review of trials

médicament antiépileptique, mais certaines crises sont

found that vagus nerve stimulation is effective

résistantes aux médicaments. La revue des essais a

when used with one or more antiepileptic

observé que la stimulation du nerf vague combinée à un ou

drugs to reduce the number of seizures for

plusieurs antiépileptiques était efficace pour réduire le

people with drug-resistant partial epilepsy.

nombre de crises chez les patients atteints d'épilepsie

Adverse effects were hoarseness, cough, and

partielle résistante aux médicaments. Les effets

neck pain. More research is needed to

indésirables étaient un enrouement, de la toux et des

compare this treatment to antiepileptic drugs

douleurs cervicales. Des recherches supplémentaires sont

currently available.

nécessaires afin de comparer ce traitement aux antiépileptiques actuellement disponibles.

Résumé

Abstract

Contexte

Background

Ceci est une version mise à jour de la revue Cochrane

This is an updated version of the original

originale publiée dans le numéro 1 en 2002.

Cochrane review published in Issue 1, 2002.

La stimulation du nerf vague (SNV) a été introduite en tant

Vagus nerve stimulation (VNS) has been

que traitement complémentaire chez les patients

introduced as an adjunct for treating people

présentant des crises épileptiques. L'objectif de cette revue

with seizures. The aim of this systematic

systématique était d'examiner les preuves actuellement

review was to overview the current evidence

disponibles concernant les effets de la stimulation du nerf

for the effects of vagus nerve stimulation when

vague en tant que traitement complémentaire chez les

used as an adjunctive treatment for people

patients atteints d'épilepsie partielle résistante aux

with drug-resistant partial epilepsy.

médicaments.

Objectifs

Objectives

Déterminer les effets d'une stimulation SNV d'intensité

To determine the effects of VNS high-level

élevée versus faible (dose sous-thérapeutique présumée).

stimulation compared to low-level (presumed subtherapeutic dose) stimulation.

Stratégie de recherche

Search methods

Nous avons consulté le registre spécialisé du groupe

We searched the Cochrane Epilepsy Group's

Cochrane sur l'épilepsie (janvier 2010), le registre

Specialized Register (January 2010), the

Cochrane des essais contrôlés (CENTRAL) (Bibliothèque

Cochrane Central Register of Controlled Trials

Cochrane, numéro 1, 2010) et MEDLINE (1950 à janvier

(CENTRAL) (The Cochrane Library Issue 1,

2010). Aucune restriction de langue n'a été imposée.

2010), and MEDLINE (1950 to January 2010). No language restrictions were imposed.

Critères de sélection

Selection criteria

Les essais contrôlés randomisés en double aveugle

Randomized, double-blind controlled trials of

portant sur la SNV et comparant une stimulation d'intensité

VNS comparing high and low stimulation

élevée à une stimulation de faible intensité. Les études

paradigms. Studies in adults or children with

portant sur des adultes ou des enfants présentant des

drug-resistant partial seizures.

crises épileptiques partielles résistantes aux médicaments.

Recueil des données et analyse

Data collection and analysis

Deux auteurs de la revue ont sélectionné les essais à

Two review authors independently selected

inclure et extrait des données de façon indépendante. Les

trials for inclusion and extracted data. The

critères de jugement suivants ont été évalués: (a)

following outcomes were assessed: (a) 50% or

réduction d'au moins 50 % de la fréquence totale des

greater reduction in total seizure frequency; (b)

crises épileptiques ; (b) arrêt prématuré du traitement

treatment withdrawal (any reason); (c) adverse

(n'importe quelle raison) ; (c) effets indésirables. Les

effects. Primary analyses were intention-to-

analyses primaires ont été effectuées en intention de

treat. Sensitivity best and worst case analyses

traiter. Des analyses de sensibilité basées sur la méthode

were also undertaken. Summary odds ratios

du cas le plus défavorable/favorable ont également été

(ORs) were estimated for each outcome.

effectuées. Les rapports des cotes résumés ont été estimés pour chaque critère de jugement.

Résultats principaux

Main results

Les résultats de l'analyse d'efficacité globale montrent que

Results of the overall efficacy analysis show

la stimulation SNV d'intensité élevée est significativement

that VNS stimulation using the high stimulation

plus efficace que la stimulation de faible intensité. Le

paradigm was significantly better than low

rapport des cotes global (intervalle de confiance (IC) à

stimulation. The overall OR (95% confidence

95 %) pour un taux de réponse de 50 % dans toutes les

interval (CI)) for 50% responders across all

études est de 1,93 (IC à 95 %, entre 1,1 et 3,4). Cet effet

studies is 1.93 (95% CI 1.1 to 3.4). This effect

ne présentait pas de variation substantielle et demeurait

did not vary substantially and remained

statistiquement significatif dans l'analyse du cas le plus

statistically significant for both the best and

défavorable et le plus favorable. Les résultats pour le

worst case scenarios. Results for the outcome

critère de jugement de l'arrêt prématuré du traitement

withdrawal of allocated treatment suggest that

assigné suggèrent que la SNV est bien tolérée, car aucune

VNS is well tolerated as no significant

différence significative n'était observée entre les groupes

difference was found between the high and low

de la stimulation d'intensité élevée et faible, et que les

stimulation groups, and withdrawals were rare.

arrêts prématurés étaient rares. Les effets indésirables

Statistically significant adverse effects

statistiquement significatifs associés à l'implantation (faible

associated with implantation (low versus

intensité versus conditions à l'inclusion) étaient un

baseline) were hoarseness, cough, pain, and

enrouement, de la toux, des douleurs et une paresthésie.

paresthesia. Statistically significant adverse

Les effets indésirables statistiquement significatifs

effects associated with stimulation (high versus

associés à la stimulation (élevée versus faible) étaient un

low) were hoarseness and dyspnea,

enrouement et une dyspnée, ce qui suggérait que

suggesting the implantation is associated with

l'implantation était associée à un enrouement, mais que la

hoarseness, but the stimulation produces

stimulation entraînait une aggravation de cet effet

additional hoarseness.

indésirable.

Conclusions des auteurs

Authors'conclusion

La SNV semble être un traitement efficace et bien toléré

VNS for partial seizures appears to be an

dans les crises épileptiques partielles. Des effets

effective and well tolerated treatment. Adverse

indésirables (enrouement, toux, douleurs, paresthésie et

effects of hoarseness, cough, pain,

dyspnée) sont associés au traitement, mais semblent

paresthesias, and dyspnea are associated with

raisonnablement bien tolérés car les sorties d’étude étaient

the treatment but appear to be reasonably well

rares. Les effets indésirables des antiépileptiques affectant

tolerated as dropouts were rare. Typical

typiquement le système nerveux central, tels que l'ataxie,

central nervous system adverse effects of

les étourdissements, la fatigue, les nausées et la

antiepileptic drugs such as ataxia, dizziness,

somnolence, ne présentaient pas d'association

fatigue, nausea, and somnolence were not

statistiquement significative avec le traitement SNV.

statistically significantly associated with VNS treatment.

Groupe d'appartenance : Epilepsie Sujet(s) associé(s) : Santé des enfants, Neurologie

Rong et al. BMC Complementary and Alternative Medicine 2012, 12:255 http://www.biomedcentral.com/1472-6882/12/255

STUDY PROTOCOL

Open Access

Transcutaneous vagus nerve stimulation for the treatment of depression: a study protocol for a double blinded randomized clinical trial Pei-Jing Rong1*, Ji-Liang Fang1,3, Li-Ping Wang4, Hong Meng1, Jun Liu3, Ying-ge Ma5, Hui Ben1, Liang Li1, Ru-Peng Liu1, Zhan-Xia Huang5, Yu-Feng Zhao6, Xia Li5, Bing Zhu1* and Jian Kong2

Abstract Background: Depressive disorders are the most common form of mental disorders in community and health care settings. Unfortunately, the treatment of Major Depressive Disorder (MDD) is far from satisfactory. Vagus nerve stimulation (VNS) is a relatively new and promising physical treatment for depressive disorders. One particularly appealing element of VNS is the long-term benefit in mood regulation. However, because this intervention involves surgery, perioperative risks, and potentially significant side effects, this treatment has been limited to those patients with treatment-resistant depression who have failed medication trials and exhausted established somatic treatments for major depression, due to intolerance or lack of response. This double-blinded randomized clinical trial aims to overcome these limitations by introducing a novel method of stimulating superficial branches of the vagus nerve on the ear to treat MDD. The rationale is that direct stimulation of the afferent nerve fibers on the ear area with afferent vagus nerve distribution should produce a similar effect as classic VNS in reducing depressive symptoms without the burden of surgical intervention. Design: One hundred twenty cases (60 males) of volunteer patients with mild and moderate depression will be randomly divided into transcutaneous vagus nerve stimulation group (tVNS) and sham tVNS group. The treatment period lasts 4 months and all clinical and physiological measurements are acquired at the beginning and the end of the treatment period. Discussion: This study has the potential to significantly extend the application of VNS treatment for MDD and other disorders (including epilepsy, bipolar disorder, and morbid obesity), resulting in direct benefit to the patients suffering from these highly prevalent disorders. In addition, the results of this double-blinded clinical trial will shed new light on our understanding of acupuncture point specificity, and development of methodologies in clinical trials of acupuncture treatment. Trials registration: Clinical Trials. ChiCTR-TRC-11001201 http://www.chictr.org/cn/ Keywords: Major depression disorder, Vagus nerve stimulation, Transcutanecous vagus nerve stimulation

* Correspondence: rongpj@hotmail.com; zhubing@mail.cintcm.ac.cn 1 Institute of Acupuncture and Moxibustion, China Academy of Chinese Medical Sciences, Beijing 100700, China Full list of author information is available at the end of the article ÂŠ Rong et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Rong et al. BMC Complementary and Alternative Medicine 2012, 12:255 http://www.biomedcentral.com/1472-6882/12/255

Background Major depressive disorder (MDD) is the fourth leading cause of disability worldwide [1], and is projected to become the second leading cause of disability worldwide by the year 2020 [2,3]. Despite the critical need, current treatments for these disorders are far from satisfactory [1,3] due to high non-response rate to treatments, high relapse rates, and frequent intolerable side effects. The etiology and pathogenesis of depression in MDD is not clear; however, it is generally believed that the cause of major depressive disorder is a combination of brain chemistry, family history, and psychosocial environment. Vagus nerve stimulation (VNS) is a relatively new FDA-approved somatic treatment for treatment-resistant depression (TRD) that can produce significant and clinically meaningful antidepressant effects [1,4-6]. Studies also indicate that VNS may provide long-term sustained benefits [1,5,7], which is particularly compelling given the highly recurrent nature of MDD [3]. However, the involvement of surgery, perioperative risks, and potentially significant side effects have limited this treatment only to those patients who have been treated for depression in the past but have failed to respond to at least 4 prescribed medications and/or established somatic treatment options such as electroconvulsive therapy (ECT) for MDD [8]. This double-blinded randomized clinical trial aims to overcome these limitations of VNS by testing the efficacy of a novel method of transcutaneous vagus nerve stimulation (tVNS) to treat MDD. The rationale for using tVNS is that anatomical studies have shown that the ear is the only place on the surface of the human body where there is afferent vagus nerve distribution [9,10]. Thus, direct stimulation of the afferent nerve fibers on the ear should produce an effect similar to classic VNS in reducing depressive symptoms without the burden of surgical intervention [11]. Additionally, as an important branch of acupuncture, auricular acupuncture has been widely used to treat various disorders including MDD by stimulating points on the ear. Thus, we believe the results of this study will also enhance our understanding of acupuncture mechanisms, shedding new light on acupoint specificity. Methods and design Trial design

This study is a randomized, multicenter, double blind clinical trial with two treatment groups (tVNS and sham tVNS). Please see flow chart (Figure 1) for more details regarding the clinical procedures. The clinical endpoints are assessed by blinded independent observers. The central randomization system is used to assign patients to the tVNS or sham tVNS treatment groups. All procedures are performed by the Clinical Evaluation Center at

Page 2 of 6

Recruitment, screening and consent form

Pre-treatment psychiatric and physiological measurements

Randomization

tVNS treatment

Sham tVNS treatment

Post-treatment psychiatric and physiological measurements Figure 1 Flow chart of the clinical trial.

the China Academy of Chinese Medical Sciences (CACMS) in Beijing. The Ethics committee of Institute of Acupuncture and Moxibustion, CACMS approved the experiment procedure. Setting

Investigators are conducting the trial in four hospitals in Beijing, China. These four hospitals are: Guang An Men Hospital, China Academy of Chinese Medical Sciences; Huguosi TCM Hospital, Beijing University of TCM; Acupuncture Hospital, China Academy of Chinese Medical Sciences. Blinding

As a double-blinded trial, both study physicians/ investigators and patients are blinded to treatment group (tVNS versus sham tVNS). To ensure that both investigators and patients remain blinded, two carbonimpregnated silicone electrodes are fixed to one ear clamp (Figure 2). Only one of the electrodes; however, is connected to the electrical lead (wire) imbedded in the clamp in order to keep the operation of the study double blind. In the tVNS group, the upper electrode was wired to the transcutaneous electrical nerve stimulator (TENS) while in the sham tVNS group the lower electrode is inactively wired to the TENS. Both the physician’s and the patient’s blindness to the mode of treatment are assessed after completion of all post-treatment measurements by asking each individual to guess the treatment modality they received given three options, “real tVNS”, “sham tVNS” or “uncertain”.

Rong et al. BMC Complementary and Alternative Medicine 2012, 12:255 http://www.biomedcentral.com/1472-6882/12/255

Page 3 of 6

Figure 2 Locations and the stimulation electrodes on the auricular surface. Red spots indicate the locations for transcutaneous auricular vagus nerve stimulation (tVNS) and blue spots indicate the locations for sham tVNS. The left figure shows the two tVNS points being in the innervation area of the auricular branch of vagus nerve (green). The right figure indicates the clip/electrode used in the study. To achieve the design of double-blind, two paired electrodes were fixed to one ear clamp. But only one of them was connected with the wire that was imbedded in the clamp in order to keep the operation of double-blind. In the tVNS group, the upper electrodes are wired to the machine while in the sham tVNS group the lower electrodes are wired.

provide informed consent in the presence of a study physician.

Patients Study population

Patients with mild or moderate MDD are recruited for the trial. ICD-10 Classification of Mental and Behavioral Disorders are used for diagnosis of MDD. Patients who voluntarily provide informed consent and meet inclusion/exclusion criteria are enrolled in this study. Inclusion and exclusion criteria include: Inclusion criteria

1. Patient meets ICD-10 diagnosis standard: mild (2 typical + 2 other core symptoms), moderate (2 typical+3 other core symptoms). 2. Patient is 16â&#x20AC;&#x201C;70 years of age 3. Patient stopped taking anti-depressive medication or other psychiatric medications 2 weeks before the intervention started. 4. Patient is educated beyond junior high school, in order to understand the scales. 5. Patient has exhibited symptoms for at least 2 months, and no longer than 2 years. Exclusion criteria

1. Patients 2. Patients 3. Patients 4. Patients

with with with with

current addiction to drugs severe depression or suicidal thoughts severe medical disorders poor compliance

Recruitment procedures

The investigators recruit patients with mild or moderate depressive symptoms using advertising and by sending flyers to the four hospitals involved in the study. After passing a pre-screening, potentially eligible patients

Intervention and comparison tVNS treatment

Location The points for tVNS are located in the auricular concha area where there is rich vagus nerve branch distribution (Figure 2). Intervention procedure Patients take a seated position or they lay on their side. After the stimulation points are disinfected according to standard practice, ear clips are attached to the ear area (auricular concha) that will be stimulated. Stimulation parameters include: 1) density wave adjusted to 20Hz, with less than 1ms wave width; and 2) 1mA current turned on. The intensity is adjusted based on the tolerance of the patient. Each treatment lasts for 30 minutes and is carried on twice a day, 5 days per week for the duration of the treatment period (12 weeks). Sham tVNS treatment

Location The stimulation points for sham tVNS are located at the superior scapha (outer ear margin midpoint), where there is no vagus nerve distribution (Figure 2). Intervention procedure All procedures performed in the sham tVNS treatment group are identical to the procedures for the verum tVNS group. Choice of endpoints

All endpoints are measured at week 0 and week 10. The endpoints include the 24-item Hamilton Depression

Rong et al. BMC Complementary and Alternative Medicine 2012, 12:255 http://www.biomedcentral.com/1472-6882/12/255

Rating Scale (HAM-D-24), the 17-item Hamilton Depression Rating Scale (HAM-D-17), Self-rating Anxiety Scale (SAS), Self-rating Depression Scale (SDS), electrocardiogram rate, breathing rate, and skin conduction response. Similar to previous studies [12,13], the primary outcome is the categorical classification of treatment response. We are interested in comparing the difference in treatment response rate between the two groups as measured by HAM-D-24, where treatment response is defined as a 50% or greater reduction in HAM-D-24 scores following a 10-week treatment. In addition, previous studies [14-17] suggest that expectations for symptom relief can significantly influence the response to medications, acupuncture, and placebo. Thus, before the first treatment, patients are asked to rate on a scale how much they expect the treatment will relieve their symptoms, from “complete relief” to “do not work at all”.

Sample size calculation and statistical analysis Sample size

We present here our power analysis for the primary outcome only. Since this is a novel therapy, we used the data from a previous non-controlled pilot study on treatment-resistant MDD in senior patients [18] to calculate the power. The primary outcome measure is the categorical classification of response; we define the treatment response as a 50% or greater reduction in HAMD-24 scores following treatments. From a previous proof of concept study [18], the response rate in the tVNS group is 39%; assuming a 20% dropout rate, with 60 patient in each group, we will have 80% power to detect a difference of 25% or greater in response rate between the tVNS and the sham tVNS group based on a chi square test at a 0.05 significance level.

Statistical analysis

In this study, the primary outcome measure is the categorical classification of treatment response. We define the treatment response as a 50% or greater reduction in HAM-D-24 scores following treatments. Response rates across the two groups will be compared with the chi square (x2) test. Additionally, we will also use the HAM-D-24 score as continuous variable and apply a regression model to compare the different between two treatment groups. More specifically, in the model, the dependent variable is post-treatment HAM-D-24 score, the independent variable is treatment mode (tVNS versus sham tVNS), and covariances will include pre-treatment HAM score, age and gender. Similar analyses will also be performed in other clinical and physiological outcome measurements.

Page 4 of 6

Data safety monitoring

Independent data safety monitoring board members will meet every 6 months or as needed. Participants who show persistent worsening symptoms during the course of a clinical trial or develop unstable psychiatric symptoms (e.g., suicidality, homicidality, psychosis) will be withdrawn from the study and will be referred for appropriate treatment immediately. According to the following classifications, a safety monitoring board will review and rate adverse events to determine whether to suspend the test condition. Level 1: Security, without any adverse reactions. Level 2: Safe, and have mild adverse reaction, do not need any treatment can continue to treatment. Level 3: There are security issues; there is a moderate adverse reaction, after treatment may continue to treatment. Level 4: Because of adverse reactions, terminate this research. All adverse events will be reported to the Human Research Committee promptly in accordance with guidelines.

Discussions Depression, with serious medical, social and economic consequences, represents a significant burden to both patients and society. Unfortunately, reports suggest that despite the progress that has been made in pharmacologic and psychological treatments, many MDD patients only partially benefit or do not benefit at all [1,3]. Additionally, pharmacologic treatments often have a high rate of relapse and intolerable side effects, which further the call for new treatment of MDD. VNS is a relatively new FDA-approved somatic treatment for depressive disorders [1,4-6] and may provide long-term sustained benefits [1,5,7]. The limitations and adverse events related to VNS are quite obvious, including the involvement of surgery, perioperative risks, and potentially significant side effects such as hoarseness, throat pain, coughing, dyspnea, paresthesia, and muscle. Thus, VNS treatment is limited only to those patients who have exhausted the standard somatic treatments for MDD due to intolerance or lack of response [8]. The underlying mechanism of antidepressant action using VNS is not fully understood. Hypotheses are based on the anatomy and function of the vagus nerve, which is implicated in mood control [19]. It is known that the vagus nerve is a mixed nerve composed of about 80% afferent fibers. It is speculated that antidepressant effects of VNS are attributed partially to the projection of afferent fibers to the nucleus tractus solitaries, which is further connected directly and indirectly with brain

Rong et al. BMC Complementary and Alternative Medicine 2012, 12:255 http://www.biomedcentral.com/1472-6882/12/255

Page 5 of 6

structures including reticular formation in the medulla, parabrachial nucleus, the locus coeruleus, the amygdala, hypothalamus, insula, thalamus, orbitofrontal cortex, and other limbic regions responsible for mood and anxiety regulation [5,9]. This clinical trial aims to overcome these limitations by introducing a novel method of stimulating superficial branches of the vagus nerve to treat MDD. The evidence supporting the feasibility of this trial includes: 1) two proofs of concept, non-controlled, clinical trials demonstrated that tVNS can be used as an effective treatment for treatment-resistant MDD in both senior patients [18] and in epilepsy patients [20], another important indication of the VNS; 2) An fMRI study [21] showed that tVNS at specific ear regions can produce significant fMRI signal decreases, which is similar to the brain activity changes produced by VNS [22-24]. It is important to note that the same stimulation at ear regions without vagal supply could not evoke similar fMRI signal changes. In addition, only after tVNS, psychometric assessment of research subjects revealed significant improvement in well-being; and 3) two animal studies [25,26] demonstrated that stimulation of the certain areas of the ear with vagus nerve supplies can evoke firing of the vagus nerve and produce relatively specific physiological changes (e.g. decreased arterial pressure, heart rate, and intragastric pressure). Thus, results from both human and animal studies have endorsed the rational of the treatments. In a previous study in senior patients with resistant MDD, Xu and colleagues [18] found that compared with the drug only group, drug plus electroacupuncture stimulation at a point in the ear where the vagus nerve is distributed can produce greater HAM-D score reduction and more good responders. However, the lack of an accepted control group significantly limited the interpretation of the study. In this protocol, we have included an active control group (sham tVNS), and used a double-blinded design, which could significantly enhance the quality of the clinical trial. Compared with traditional VNS, tVNS has the advantage of being low cost, safe and non-invasive. Thus, it can be used on patients with mild to moderate MDD. If this study is successful, the results will significantly extend the application of VNS treatment to MDD and other disorders (including epilepsy, bipolar disorder, and morbid obesity) and will result in direct benefit to the patients suffering from these highly prevalent disorders. Additionally, we believe that this study will also enhance our understanding of acupuncture mechanisms. As an important branch of acupuncture treatment and with extensive application in past decades, auricular acupuncture, with specific indication of different ear acupoints, remains a mystery. The tVNS treatment for

MDD provides a unique angle as well as a model to investigate the biological basis underlying acupoint specificity. Finally, to blind both the investigator and patient, we applied two pairs of carbon-impregnated silicone electrodes, only one of which was wired to give electrical output; thus, neither patients nor physicians know whether they received real or sham tVNS. This double-blinded design can significantly improve the quality of the trial and will shed new light on the development of methodologies in clinical trials of acupuncture treatment. In summary, in this clinical trial, we are evaluating the efficacy of tVNS in mild and moderate MDD patients using a randomized and double-blinded design. The success of the trial will significantly improve the application of this promising new method. Trial status

The first participants were included on May 18, 2011. There are 49 participants recruited until the point when this paper was submitted on September, 2012. Competing interests All authors claim no conflict of interest. Authors’ contributions PjR,BZ designed the trail and was responsible for obtaining approval by the Institutional Ethics Committee of the China Academy of Chinese Medical Sciences. PjR ,JL Fang and JK contributed to data analysis plan and manuscript preparation; JlF, LpW, HM, JL, YgM HB, LL RpL, contribute to the design of the trial and are in charge of recruitment and treatment of patients in each center, they also do data collection, LL, RjR, XL prepared the figures and RjR present his ear on Figure 2. and YfZ did central randomization and the protocol of statistical analysis. All authors read the manuscript, and approved the contributions. Acknowledgements This scientific work was supported byNational twelfth five-year science and technology support program (2012BAF14B10) and a Natural Science Foundation of Beijing China (No. 711117) Grant to PJ. Rong. We thank for, Rupeng Liu who providing the consent for his ear on the publication. Author details 1 Institute of Acupuncture and Moxibustion, China Academy of Chinese Medical Sciences, Beijing 100700, China. 2Department of Psychiatry, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02115, USA. 3Guang An Men Hospital, China Academy of Chinese Medical Sciences, Beijing 100053, China. 4Huguosi TCM Hospital, Beijing University of TCM, Beijing, China. 5Beijing University of Chinese Medicine, Beijing 100029, China. 6 Clinical Evaluation Center, China Academy of Chinese Medical Sciences, Beijing 100700, China. Received: 16 September 2012 Accepted: 23 November 2012 Published: 14 December 2012 References 1. Sackeim HA, Lisanby SH: physical treatments in psychiatry. In Treatment of depression: bridging the 21 st century. Edited by Weissman MM. Washington, DC: American psychiatric press; 2001:151–172. 2. Michaud CM, Murray CJ, Bloom BR: Burden of disease–implications for future research. JAMA 2001, 285:535–539. 3. Rush AJ: Vagus nerve stimulation: clinical results in depression. In Vagus nerve stimulaiton. Edited by Schachter SC, Schmidt D. London: Martin Dunitz; 2003:85–112.

Rong et al. BMC Complementary and Alternative Medicine 2012, 12:255 http://www.biomedcentral.com/1472-6882/12/255

8. 9. 10. 11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

George MS, Nahas Z, Bohning DE, Kozel FA, Anderson B, Chae JH, Li XB, Mu QW: Potential mechanisms of action of vagus nerve stimulaiton for depression. In Vagus nerve stimulaiton. Edited by Schachter SC, Schmidt D. London: Martin Dunitz; 2003:68–83. Nemeroff CB, Mayberg HS, Krahl SE, McNamara J, Frazer A, Henry TR, George MS, Charney DS, Brannan SK: VNS therapy in treatment-resistant depression: clinical evidence and putative neurobiological mechanisms. Neuropsychopharmacology 2006, 31:1345–1355. Daban C, Martinez-Aran A, Cruz N, Vieta E: Safety and efficacy of Vagus Nerve Stimulation in treatment-resistant depression. A systematic review. J Affect Disord 2008, 110:1–15. Sperling W, Reulbach U, Kornhuber J: Clinical benefits and cost effectiveness of vagus nerve stimulation in a long-term treatment of patients with major depression. Pharmacopsychiatry 2009, 42:85–88. Ventureyra EC: Transcutaneous vagus nerve stimulation for partial onset seizure therapy. A new concept. Childs Nerv Syst 2000, 16:101–102. Henry TR: Therapeutic mechanisms of vagus nerve stimulation. Neurology 2002, 59:S3–S14. Peuker ET, Filler TJ: The nerve supply of the human auricle. Clin Anat 2002, 15:35–37. Yang AC, Zhang JG, Rong PJ, Liu HG, Chen N, Zhu B: A new choice for the treatment of epilepsy: electrical auricula-vagus-stimulation. Med Hypotheses 2011, 77:244–245. Rush AJ, Marangell LB, Sackeim HA, George MS, Brannan SK, Davis SM, Howland R, Kling MA, Rittberg BR, Burke WJ, et al: Vagus nerve stimulation for treatment-resistant depression: a randomized, controlled acute phase trial. Biol Psychiatry 2005, 58:347–354. Rush AJ, Sackeim HA, Marangell LB, George MS, Brannan SK, Davis SM, Lavori P, Howland R, Kling MA, Rittberg B, et al: Effects of 12 months of vagus nerve stimulation in treatment-resistant depression: a naturalistic study. Biol Psychiatry 2005, 58:355–363. Jensen MP, Karoly P: Motivation and expectancy factor in symptom perception: a laboratory study of the placebo effect. Psychosom Med 1991, 53:144–152. Fillmore M, Vogel-Sprott M: Expected effect of caffeine on motor performance predicts the type of response to placebo. Pharmacol 1992, 106:209–214. Kalauokalani D, Cherkin DC, Sherman KJ, Koepsell TD, Deyo RA: Lessons from a trial of acupuncture and massage for low back pain: patient expectations and treatment effects. Spine 2001, 26:1418–1424. Kaptchuk TJ: The placebo effect in alternative medicine: can the performance of a healing ritual have clinical significance? Ann Intern Med 2002, 136:817–825. Xu WW, Li JX, Cai Y, Wang QS: Study of vagus nerve in ear electronic acupunc ture stimulation for senior patients w ith treatmentresistantmajor depressive. J C lin Psych iatry 2009, 19:189–200. Mohr P, Rodriguez M, Slavickova A, Hanka J: The application of vagus nerve stimulation and deep brain stimulation in depression. Neuropsychobiology 2011, 64:170–181. Stefan H, Kreiselmeyer G, Kerling F, Kurzbuch K, Rauch C, Heers M, Kasper BS, Hammen T, Rzonsa M, Pauli E, et al: Transcutaneous vagus nerve stimulation (t-VNS) in pharmacoresistant epilepsies: a proof of concept trial. Epilepsia 2012, 53:e115–e118. Kraus T, Hosl K, Kiess O, Schanze A, Kornhuber J, Forster C: BOLD fMRI deactivation of limbic and temporal brain structures and mood enhancing effect by transcutaneous vagus nerve stimulation. J Neural Transm 2007, 114:1485–1493. Henry TR, Bakay RA, Votaw JR, Pennell PB, Epstein CM, Faber TL, Grafton ST, Hoffman JM: Brain blood flow alterations induced by therapeutic vagus nerve stimulation in partial epilepsy: I. Acute effects at high and low levels of stimulation. Epilepsia 1998, 39:983–990. Henry TR, Bakay RA, Pennell PB, Epstein CM, Votaw JR: Brain blood-flow alterations induced by therapeutic vagus nerve stimulation in partial epilepsy: II. prolonged effects at high and low levels of stimulation. Epilepsia 2004, 45:1064–1070. Zobel A, Joe A, Freymann N, Clusmann H, Schramm J, Reinhardt M, Biersack HJ, Maier W, Broich K: Changes in regional cerebral blood flow by therapeutic vagus nerve stimulation in depression: an exploratory approach. Psychiatry Res 2005, 139:165–179.

Page 6 of 6

25. Gao XY, Li YH, Zhu B, Ben H, Rong PJ: Effect of acupuncture of auricular concha area on blood pressure in spontaneous hyertension and norma rats and its underlying mechanim. Chinese Acupuncture 2006, 31:90–95. 26. Gao XY, Zhang SP, Zhu B, Zhang HQ: Investigation of specificity of auricular acupuncture points in regulation of autonomic function in anesthetized rats. Auton Neurosci 2008, 138:50–56. doi:10.1186/1472-6882-12-255 Cite this article as: Rong et al.: Transcutaneous vagus nerve stimulation for the treatment of depression: a study protocol for a double blinded randomized clinical trial. BMC Complementary and Alternative Medicine 2012 12:255.

Ref.: North American Neuromodulation Society; 15th Annual Meeting, December 8–11, 2011 , Las Vegas, USA Poster Sessions

Analgesic Effects of Transcutaneous Vagus Nerve Stimulation (136) Jens Ellrich, MD PhD, Aalborg University, Department of Health Science and Technology, Aalborg, Denmark; Peter Eichhammer, MD PhD, University of Regensburg, Department of Psychiatry, Regensburg, Germany; Volker Busch, MD PhD, University of Regensburg. Department of Psychiatry, Regensburg, Germany

Introduction: Vagus nerve stimulation modulates nociception and pain processing in animal and human experimental studies. Due to the invasive procedure of vagus nerve stimulation, studies mainly involve patients suffering from both drug‐resistant epilepsy and pain. The present study addressed the hypothesis that noninvasive, transcutaneous electrical stimulation of the auricular branch of the vagus nerve (t‐VNS) alters pain processing. Methods: Somatosensory processing was assessed by the quantitative sensory testing (QST) protocol with mechanical and thermal stimulation in 48 healthy volunteers in a randomized, controlled study. Each volunteer participated in two experimental sessions with or without (control) active t‐VNS on different days in randomized order. In one session QST was performed before and during t‐VNS on both hands. After baseline QST, t‐VNS at the left ear was started with a nonpainful stimulus intensity using rectangular pulses. Results: Statistical analysis revealed significant interactions between stimulation and side for the parameters mechanical pain sensitivity (MPS) and pressure pain threshold (PPT). MPS of the left hand was lower under t‐VNS as compared to control session and the right side (P < .05). PPT was higher under t‐VNS as compared to control condition and the right side (P < .05). Sustained application of painful heat for 5 min induced increased perception ratings under baseline conditions. Under t‐VNS pain rating increase was significantly reduced as compared to control (P < .001). All other QST parameters remained statistically unchanged. Conclusion: Sensitivity to mechanically evoked pain on the ipsilateral hand was reduced. Besides flattening of the stimulus‐response‐function for superficial mechanical pain (MPS), increased PPT reveals suppression of deep muscle pain under t‐VNS. Furthermore, temporal summation of noxious heat seems to be inhibited with t‐VNS. The study shows alteration of mechanical and thermal pain processing in healthy volunteers. Future studies in chronic pain patients will address the potential analgesic effects of t‐VNS. Disclosures: J. Ellrich: Bauerfeind AG, Bayer Vital GmbH, Cerbomed GmbH. P. Eichhammer: Cerbomed GmbH. V. Busch: None.

Analgesic effects of transcutaneous vagus nerve stimulation Jens Ellrich1,2, Nadine Wolf1, Volker Busch3, Peter Eichhammer3 (1) Medical Department, Cerbomed GmbH, Henkestrasse 91, D-91052 Erlangen, Germany (2) Department of Health Science and Technology, Aalborg University, Fredrik Bajers Vej 7D2, DK-9220 Aalborg, Denmark (3) Center for Pain and affective Disorders, Department of Psychiatry, University of Regensburg, Universitätsstrasse 84, D-93059 Regensburg, Germany

Introduction

Stimulation of vagus nerve afferents has been shown to modulate nociception and pain processing in animal and human experimental studies (1,2). Due to the invasive procedure of vagus nerve stimulation (VNS), the vast majority of clinical studies investigated patients who primarily suffered from epilepsy or depression with concomitant pain diseases (3-5). However, in one case series VNS was implanted in order to treat chronic headache showing significant improvement in four out of six patients (6). A recently developed medical device allows for transcutaneous electrical stimulation of the auricular branch of the vagus nerve (t-VNS). The present study addresses the hypothesis that t-VNS alters pain processing. (1) Bohotin et al., Pain 101: 3-12, 2003 (3) Broggi et al., Neurol Sci 31: S87-92, 2010 (5) Hord et al., J Pain 4: 530-4, 2003

? Test stimulation: Quantitative Sensory Testing, QST

on left and right hand dorsum

Results

Ipsilateral PPT increased under active t-VNS.

CDT, WDT: Cold, Warm Detection Threshold TSL: Thermal Sensory Limen PHS: Paradoxical Heat Sensations CPT, HPT: Cold, Heat Pain Threshold

Non-painful QST parameters remained unchanged. Parameter

Stimulation

Interaction Stimulation*Side

CDT

F=0.01, n.s.

F=0.05, n.s.

WDT

F=0.05, n.s.

F=0.10, n.s.

TSL

F=1.71, n.s.

F=0.03, n.s.

MDT

F=1.96, n.s.

F=0.75, n.s. 2-way RM ANOVA, n.s.: not significant

Rolke et al., European Journal of Pain 10: 77–88, 2006

MDT: Mechanical Detection Threshold MPT: Mechanical Pain Threshold MPS: Mechanical Pain Sensitivity ALL: Allodynia

Invasive VNS in rats inhibits sensory neurons in the brainstem and pain-related behavior. Fos-immuno-reactivity in the brainstem decreased on the ipsilateral side.

Invasive VNS in epilepsy patients inhibits wind-up and tonic pressure pain. Spinal or even supraspinal mechanisms are suggested to be involved.

t-VNS inhibits deep muscle pain processing on the ipsilateral side (PPT).

t-VNS reduces mechanical pain sensitivity (MPS).

t-VNS reduces temporal summation of noxious heat (THP).

t-VNS affects pain processing but does not interfere with innocuous somatosensory processing.

t-VNS is suggested to activate CNS mechanisms of pain modulation.

Future studies will address potential analgesic effects in patients.

Ipsilateral MPS decreased under active t-VNS.

(2) Kirchner et al., Neurology 55: 1167-71, 2000 (4) Multon & Schoenen, Acta Neurol Belg 105: 62-7, 2005 (6) Mauskop, Cephalalgia 25: 82-6, 2005

Methods

? Randomized, controlled, crossover study ? 48 healthy volunteers: 24 ♀, 24 ♂, 23.3 ± 2.1 years ? 2 randomized sessions with active or sham t-VNS

on different days ? Conditioning stimulation: Transcutaneous vagus nerve stimulation, t-VNS - applied to skin afferents of the auricular branch of the vagus nerve in left ear‘s concha - electrical, rectangular pulses (250 µs duration) - 25 Hz stimulation frequency - intensity above detection threshold and below pain threshold evoking tingling sensations

Rolke et al., European Journal of Pain 10: 77–88, 2006

WUR: Windup Ratio VDT: Vibration Detection Threshold PPT: Pressure Pain Threshold

Rolke et al., European Journal of Pain 10: 77–88, 2006

Tonic Heat Pain (THP): Contact heat pulse with a saw tooth shape started from 0.5°C below individual HPT and increased to 0.5°C above HPT with 25 pulses per min. During the stimulation period of 5 min volunteers rated pain perception on a numerical rating scale (0 to 10) every 20 seconds.

? Study design

Reduced THP under t-VNS.

Summary & Conclusions

Corresponding author: Professor Dr. med. Jens Ellrich, MD Medical Department, Cerbomed GmbH, Henkestr. 91, D-91052 Erlangen e-mail: jens.ellrich@cerbomed.com Department of Health Science and Technology, Medical Faculty, Aalborg University, Fredrik Bajers Vej 7D2, DK-9220 Aalborg e-mail: jellrich@hst.aau.dk

ARTICLE ORIGINAL

ORIGINAL ARTICLE

J Pharm Clin 2009 ; 28 (1) : 13-20

Inte´reˆt de la the´rapie par stimulation du nerf vague dans les e´pilepsies re´fractaires - e´tude au centre hospitalier universitaire de Nancy Vagus nerve stimulation relevance in refractory epilepsy L. ALBERTINI, A. BONNEVILLE, S. GEORGET, M. LABRUDE Pharmacie centrale, Hôpital central, 29, avenue du Maréchal de Lattre de Tassigny, CO 60034, 54035 Nancy Cedex, France <l.albertini@chu-nancy.fr>

Re´sume´. Pre`s d’un tiers des patients e´pileptiques pre´sentent une e´pilepsie re´fractaire aux traitements me´dicamenteux. Dans 80 % des cas environ, l’ablation chirurgicale du foyer e´pileptoge`ne est impossible. Pour ces patients, la the´rapie par stimulation du nerf vague (SNV) apparaıˆt comme une alternative. Il s’agit d’un dispositif me´dical constitue´ d’un geńe´rateur d’impulsions e´lectriques implante´ en sous-cutane´ sous la clavicule gauche et d’e´lectrodes enrouleés autour du nerf vague gauche. Notre objectif e´tait d’e´valuer l’efficacite´ de la the´rapie par SNV sur la fre´quence, l’intensite´ et la dureé des crises d’e´pilepsie et d’e´tudier son effet sur la qualite´ de vie des patients. La population e´tudieé et suivie dans le service de neurologie du CHU de Nancy e´tait composeé de 27 patients chez lesquels avait e´te´ implante´ un stimulateur du nerf vague. Nous avons reálise´ d’une part, une e´tude re´trospective des dossiers de ces patients et, d’autre part, une enqueˆte de qualite´ de vie a` l’aide d’un questionnaire adapte´ a` partir de questionnaires normalise´s. La population comprenait ˆ ge e´tait de 27,5 ans [12-52] et la moyenne d’a ˆge a` l’implantation e´tait de 21 adultes et 6 enfants. La moyenne d’a 26 ans [10-48]. Un an apre`s l’implantation, une re´duction de la fre´quence des crises supe´rieure a` 50 % a e´te´ observeé chez 18,5 % des patients. Apre`s plusieurs anneés de traitement, l’efficacite´ a e´te´ maintenue chez 21 % des patients et ame´lioreé chez 4 %. Nous avons e´galement observe´ une ame´lioration de la qualite´ de vie chez un patient sur deux (augmentation de 3 points en moyenne sur une ećhelle de 1 a` 10), avec une ame´lioration de leur e´tat psychologique et de leurs capacite´s de concentration intellectuelle. En revanche, 40 % des patients se sont dećlare´s plus fatigue´s. La the´rapie par SNV semblerait eˆtre inte´ressante puisque, meˆme si son efficacite´ sur la fre´quence des crises n’est pas syste´matique, elle posse´derait un effet beńe´fique sur la qualite´ de vie de certains patients et notamment sur leur e´tat psychologique. Mots cle´s : e´pilepsie re´fractaire, pharmacore´sistance, nerf vague, stimulation Abstract. About 30% of epileptic patients present with refractory epilepsy. In 80% of the case, surgical resection is not indicated. Vagus Nerve Stimulation (VNS) therapy seems to be an alternative for these patients. The generator which delivers electrical impulse was implanted under the skin in the upper chest and was connected with wires which were attached around the left vagus nerve. The objectives of this study were to evaluate VNS therapy efficacy on seizures frequency, intensity and duration and to assess quality-of-life. Our population included 27 patients with VNS therapy that were monitored in the University Hospital of Nancy. We carried out a retrospective study using medical histories and a quality-of-life survey. The population was composed of 21 adults and 6 children. Mean age was 27,5 years [range: 12-52]. Mean age at implantation time was 26 years [range: 10-48]. One year after implantation, the seizure frequency decreased by among 18,5% of the patients. After several years, the efficacy was preserved in 21% and improved in 4% of the patients. The quality-of-life improved in one patient out of two (increase of 3 graduations on a 10 graduations scale) especially regarding their psychological and intellectual reactions. However, 40% of the patients felt more tired. Even though the efficacy of VNS therapy is unpredictable, it seems to be interesting as long as it would improve the quality-of-life, namely psychological.

doi: 10.1684/jpc.2009.0110

Key words: refractory epilepsy, pharmacoresistance, vagus nerve, stimulation

L’

épilepsie est l’affection neurologique la plus fréquente après la migraine. Près de 50 millions de personnes sont atteintes d’épilepsie dans le monde dont environ 450 000 en France. Son incidence moyenne

´s a ` part : L. Albertini * Correspondance et tire J Pharm Clin, vol. 28, n o 1, janvier-fe´vrier-mars 2009

est d’environ 50/100 000 habitants par an (données OMS). Étant donné la fréquence et la gravité de cette affection, son traitement présente donc un intérêt majeur pour la santé publique. Aujourd’hui, il existe de nombreux traitements et on dénombre plus de 20 médicaments antiépileptiques sur le marché français. Cependant, malgré l’existence de cet

L. Albertini, et al.

arsenal thérapeutique, seuls deux tiers des patients sont équilibrés par un traitement médicamenteux, alors que pour un tiers d’entre eux les crises persistent en dépit d’une bonne observance. On parle alors d’épilepsie pharmacorésistante. Ces épilepsies sévères et réfractaires débutent en majorité pendant l’enfance ou l’adolescence. Elles ont alors un effet délétère sur le développement psychomoteur et neuropsychologique et entraînent des difficultés sociales (scolaires, professionnelles et familiales). Parmi ces patients présentant une épilepsie réfractaire, 10 000 seraient candidats à une intervention chirurgicale (cortectomie, hémisphérotomie, callosotomie), alors que seuls 300 d’entre eux sont opérés chaque année en France (données OMS). Dans les autres cas, la chirurgie est impossible (épilepsie multifocale, foyer épileptogène dans une zone fonctionnelle par exemple du langage). Pour ces patients, la thérapie par stimulation du nerf vague (Vagus Nerve Stimulation = VNS) apparaît comme une alternative possible. Cette thérapie est utilisée depuis 1988 aux États-Unis et depuis 1996 en France. Il s’agit d’un dispositif médical implantable stérile doté d’un marquage CE. Son utilisation a été approuvée aux États-Unis en 1997 par la FDA (Federal Drug Administration) comme traitement adjuvant des épilepsies partielles pharmacorésistantes chez l’adulte et l’enfant de plus de 12 ans. Le mécanisme d’action est encore mal élucidé. Toutefois, quelques hypothèses proposent qu’une stimulation à haute fréquence permette de désynchroniser l’activité cérébrale par activation des fibres à vitesse de conduction lente. Lors de manifestations inaugurales des crises, la stimulation des afférences vagales sur le cortex pourrait inhiber ou raccourcir les décharges. L’effet à long terme de la SNV serait dû à des modifications des activités noradrénergiques et sérotoninergiques et résulterait en une élévation du seuil épileptogène. Les principaux effets indésirables sont une toux, une rugosité de la voix et une gêne locale, ils sont en général transitoires. L’implantation se fait sous anesthésie générale. L’intervention dure environ 1 heure. Deux incisions sont faites : l’une au niveau de l’épaule, près de l’aisselle gauche, l’autre dans le cou. L’intensité du courant peut être réglée entre 0 et 3,5 mA. L’intensité optimale est différente pour chaque patient. Le courant est délivré de façon cyclique et intermittente : le plus couramment pendant 30 secondes toutes les 5 minutes ou en cycle court : pendant 30 secondes toutes les 3 minutes. L’objectif de notre étude réalisée au Centre hospitalier et universitaire (CHU) de Nancy était d’évaluer l’efficacité et la tolérance de la thérapie par stimulation du nerf vague, tant au niveau clinique qu’au niveau du ressenti du patient et à sa qualité de vie.

Population La population étudiée était composée des patients chez lesquels avait été implanté un stimulateur du nerf vague pour une épilepsie sévère réfractaire entre 2001 et 2007 et qui sont suivis dans le service de neurologie du CHU de Nancy ou au centre spécialisé de Flavigny. La population étudiée était composée de 27 patients dont 6 enfants (moins de 18 ans) (5 garçons, 1 fille) et 21 adultes (7 femmes et 14 hommes), dits pharmacorésistants et pour qui la chirurgie n’était pas envisageable (épilepsie multifocale, pas de foyer épileptogène identifié, foyer épileptogène dans une zone fonctionnelle, par exemple du langage). La moyenne d’âge était de 27,5 ans [1252]. L’âge moyen de début des crises était de 6,04 ans. La moyenne d’âge à la pose était de 26 ans [10-48]. En moyenne le nombre d’années d’épilepsie avant l’implantation du SNV était de 18,3 ans. Parmi ces patients, 12 étaient atteints d’épilepsies symptomatiques liées aux circonstances suivantes : – post-traumatiques (2 cas) ; – malformations cérébrales (2 cas) ; – méningoencéphalites virales (2 cas) ; – encéphalopathie post-anoxique (1 cas) ; – génétique (chromosome 20 en anneau) (1 cas) ; – syndrome de Lennox-Gastaut (3 cas) ; – sclérose tubéreuse de Bourneville (1 cas). Les 15 autres patients étaient atteints d’épilepsie cryptogénique (c’est-à-dire dont la cause est inconnue).

Etude re´trospective du dossier des patients Pour une étude rétrospective documentée du dossier des patients, une fiche de recueil a été conçue afin de cibler les différentes informations à recueillir dans les dossiers. Ces informations concernaient les caractéristiques de l’épilepsie (type de crises, âge de début des crises, fréquence des crises), l’historique des traitements médicamenteux antiépileptiques, les caractéristiques du traitement par SNV (âge à la pose, paramètres de stimulation, évolution de la fréquence des crises, de leur intensité et de leur durée, effets indésirables).

Mate´riel et me´thodes Le stimulateur est commercialisé actuellement par un seul fournisseur : Cyberonics® (Cyberonics Europe SA/NV Belgicastraat 9, 1930 Zaventem, Belgique). Il est composé d’un générateur placé en sous-cutané sous la clavicule gauche, d’électrodes bipolaires entourées autour du nerf vague gauche et d’un tunnélisateur qui relie le générateur aux électrodes (figure 1).

Figure 1. Position du stimulateur du nerf vague. J Pharm Clin, vol. 28, n o 1, janvier-fe´vrier-mars 2009

Stimulation du nerf vague et e´pilepsies re´fractaires

Une enquête a également été réalisée auprès des patients et/ou de leur entourage (patient, personnel soignant) à l’aide d’un questionnaire. Ce dernier a été adapté à partir de questionnaires normalisés sur la qualité de vie (tels que les QOLIE-31 (Quality Of Life In Epilepsy à 31 items [1], QOLIE-89 Quality Of Life In Epilepsy à 89 items [2], questionnaire généraliste SF36 [3]). Il a été validé par les médecins, et soumis à 19 patients lors d’entretiens avec un interne en pharmacie. Les huit autres patients n’ont pas souhaité se soumettre au questionnaire.

Re´sultats Nous avons tout d’abord évalué l’efficacité du traitement c’est-à-dire sa capacité de réduction de la fréquence des crises. Nous avons utilisé dans ce but des critères d’efficacité couramment retrouvés dans les publications scientifiques [4] qui considèrent que, lorsque la fréquence des crises est réduite de 0 à 25 %, les patients sont non répondeurs (et le traitement inefficace) et que lorsqu’elle est comprise entre 26 et 50 % l’efficacité est dite modérée. Les patients sont considérés comme répondeurs si la réduction de la fréquence des crises est supérieure à 50 %. Entre 51 et 75 %, le traitement est efficace, entre 76 et 100 % il est très efficace.

Efficacite´ apre`s un an de traitement par stimulation neurovagale Un an après la mise en place du dispositif, cinq patients étaient répondeurs (soit 18 %). Les autres ont été considérés comme non répondeurs puisque le pourcentage de réduction des crises était inférieur ou égal à 50 % (figure 2). Chez trois patients, l’efficacité n’a pas pu être évaluée (N) soit parce que le patient ne se souvenait pas des crises, soit parce qu’il existait une déficience mentale qui rendait la communication avec le patient difficile (figure 2).

Efficacite´ a` long terme Nous avons étudié les patients chez lesquels un stimulateur du nerf vague avait été implanté depuis 2001, ce qui nous a permis d’évaluer l’efficacité de ce traitement à long terme (figure 3). Plusieurs cas étaient possibles : – la thérapie par SNV était efficace à un an et le restait par la suite, l’efficacité étant alors considérée comme maintenue, ceci concernait 6 patients (soit 22 % des patients) ; – la thérapie par SNV était efficace à un an, mais pas audelà, l’efficacité étant alors considérée comme transitoire, ceci était le cas de 5 patients (soit 18,5 % des patients) ; J Pharm Clin, vol. 28, n o 1, janvier-fe´vrier-mars 2009

Nombre de patients

Enqueˆte d’e´valuation de la qualite´ de vie

– la thérapie par SNV n’était pas efficace à un an mais le devenait à long terme, l’efficacité étant alors considérée comme améliorée, ce fut le cas pour 1 patient ; – la thérapie par SNV n’était pas efficace, ni à un an ni à long terme, ce fut le cas pour 8 patients (soit près de 30 %). La figure 3 présente le nombre de patients se trouvant dans chacun de ces cas. L’efficacité n’a pu être évaluée chez sept patients en raison de difficultés de communication avec ces patients ou parce qu’ils avaient été implantés il y a moins d’un an. Parmi les cinq patients répondeurs à un an de traitement : – l’efficacité s’est maintenue chez deux patients à trois ans de traitement ; – chez deux autres patients, l’efficacité a été transitoire (perte d’efficacité après deux et cinq ans de traitement) ; – l’évolution pour le cinquième patient est restée inconnue, puisque l’implantation a eu lieu en 2007. Deux patients sont devenus répondeurs après deux et quatre ans de traitement : l’efficacité a été améliorée avec le temps. Une ablation du dispositif a été réalisée chez deux patients en raison de son inefficacité (après un et quatre ans de traitement). Un patient est décédé, mais sa mort ne serait pas liée au stimulateur. Un seul patient a montré une amélioration de l’efficacité avec le temps. Il est donc difficile de conclure quant à une efficacité de la thérapie par SNV sur la fréquence des crises d’épilepsie au cours du temps. Les résultats sont très variables en fonction des patients. On retrouve également dans les publications scientifiques des notions d’efficacité variable selon le syndrome épileptique [4, 5].

16 14 12 10 8 6 4 2 0

0-25

26-50

51-75

76-100

Pourcentage de réduction des crises

Figure 2. Efficacité après un an de traitement exprimée en pourcentage de réduction des crises. N = non évaluable.

9 8

Nombre de patients

Cette fiche de recueil a été validée par deux neurologues du CHU de Nancy. Les patients interrogés sont suivis par ces deux neurologues dans différents services : le service de neurologie de l’hôpital central du CHU de Nancy et deux structures spécialisées localisées à Flavignysur-Moselle (à 15 km de Nancy) dans lesquelles certains patients séjournent : – le Centre d’observation et de cure pour enfants épileptiques (COCEE) ; – l’Institut médico-éducatif (IME).

7 6 5 4 3 2 1 0 Améliorée

Maintenue

Transitoire

Aucune

Efficacité

Figure 3. Évolution de l’efficacité à long terme (au-delà de un an). N = non évaluable.

L. Albertini, et al. Tableau 1. Caractéristiques de la maladie épileptique des patients répondeurs. Patient

Aˆge

Sexe

Aˆge de de´but des crises

Type d’e´pilepsie

Aˆge a` la pose

Nombre d’anne´es d’e´pilepsie avant la pose

R2 R3 R4 R5 R6 R7

52 37 34 18 16 12

M M M M F M

1,5 N 8 6 6 5

Partielle bitemporale Focale temporale bilate´rale Partielle bifrontale cryptoge´nique Absence frontale cryptoge´nique Ence´phalopathie post anoxique Post traumatique

48 34 33 15 14 10

46 N 25 9 8 5

N = non évaluable ou non retrouvé dans les dossiers.

Tableau 2. Paramètres de stimulation des patients répondeurs. Patient R1 R2 R3 R4 R5 R6 R7

Intensite´ de stimulation stabilise´e (mA) 1,75 2 2 2 1,5 2,5 2,5

Intervalles entre les stimulations en minutes 5 5

5 1,8

Nous avons étudié le profil des patients dits « répondeurs » (tableau 1) c’est-à-dire chez lesquels la fréquence des crises a été réduite de plus de 50 %. Il s’agissait de sept patients (cinq répondeurs à un an de traitement et deux répondeurs tardifs) dont six de sexe masculin et un de sexe féminin, deux d’entre eux étant âgés de moins de 18 ans. Nous n’avons remarqué aucune relation entre l’efficacité du traitement et le type d’épilepsie traitée, puisqu’il s’agissait aussi bien d’épilepsies cryptogéniques que symptomatiques. Nous n’avons pas mis en évidence de relation entre l’efficacité du traitement et l’âge du patient, ni entre cette efficacité et l’âge du patient au début du traitement ou au début des crises. Nous n’avons remarqué aucune relation avec l’intensité de stimulation (tableau 2). Tous ces résultats sont à interpréter avec prudence, étant donné le petit nombre de patients observés et le fait que nous n’avions pas de recul pour quatre patients chez lesquels l’implantation avait eu lieu en 2007.

Autres effets du traitement par stimulation du nerf vague Si, en terme de fréquence de crises, l’efficacité du traitement par SNV ne s’avère que partielle, il existe d’autres effets bénéfiques non négligeables. En effet, s’il ne diminue pas la fréquence des crises, ce traitement peut permettre une diminution d’autres paramètres de l’épilepsie tels que l’intensité, la durée des crises. Une réduction de l’intensité et de la durée des crises a été observée chez sept (soit 26 %) des patients d’après les données médicales retrouvées dans les dossiers de ces patients. Cette

réduction de l’intensité et de la durée des crises apparaît concomitante chez cinq patients. Trois patients qui ne présentaient pas de réduction de fréquence des crises, les ont cependant ressenties avec moins d’intensité (tableau 3). Pour certains patients, malgré une inefficacité en termes de fréquence des crises, il existerait donc bien un effet bénéfique du traitement par SNV, qui se traduit par une diminution de l’intensité et/ou de leur durée.

Effets inde´sirables Une toux sèche a été observée chez quatre patients et une modification de la voix chez huit d’entre eux. La toux sèche et la modification de la voix sont survenues pendant la stimulation (tableau 4). La plupart du temps ces effets étaient transitoires. S’ils persistent, l’intensité de stimulation devra donc être diminuée par paliers de 0,25 mA, jusqu’à atteindre une bonne tolérance du patient. Deux patients ont souffert d’essoufflement. Ce dernier est dû au ralentissement du rythme cardiaque causé par la stimulation du nerf vague. Il survient lors d’un effort. Six patients ont ressenti une gêne au niveau du point d’implantation du stimulateur(tableau 4). Ces effets indésirables sont plutôt mineurs et transitoires, ils peuvent être facilement maîtrisés en diminuant l’intensité de stimulation. Dans notre étude, aucun stimulateur n’a dû être retiré du fait d’effets indésirables.

Traitements me´dicamenteux associe´s Le traitement médicamenteux a pu être réduit après l’implantation du stimulateur chez cinq patients : – chez un patient âgé de 37 ans bénéficiant d’une trithérapie par Tegretol® (carbamazépine), Neurontin® (gabapentine) et Trileptal® (oxcarbazépine), la posologie du Trileptal® (oxcarbazépine) a été diminuée de 450 mg/jour à 300 mg/jour ; – chez une patiente âgée de 16 ans traitée avant la pose de l’implant par une trithérapie associant Lamictal® (lamotrigine) 250 mg/jour, Keppra® (levetiracetam) 1 250 mg/jour et Sabril® (vigabatrin) 1 500 mg/jour, le traitement par Sabril® (vigabatrin) a été arrêté ; – chez une patiente âgée de 22 ans initialement traitée par quadrithérapie, le traitement par Tegretol® (carbamazépine) a pu être arrêté. Elle est désormais traitée par une trithérapie : Keppra® (levetiracetam) 1 500 mg/jour, Lamictal® (lamotrigine) 200 mg/jour et Rivotril® (clonazepam) 1/4 de comprimé matin et soir ; – chez un patient âgé de 12 ans traité par une trithérapie par Lamictal® (lamotrigine) 200 mg/jour, Trileptal® (oxJ Pharm Clin, vol. 28, n o 1, janvier-fe´vrier-mars 2009

Stimulation du nerf vague et e´pilepsies re´fractaires Tableau 3. Effet de la thérapie par SNV sur les crises d’épilepsie (fréquence, durée, intensité SNV chez les patients répondeurs). Patient Re´duction Re´duction Nombre Re´duction de traitement de la fre´quence d’anne´es de SNV de la fre´quence me´dicamenteux des crises a` 1 an (%) en 2007 des crises en 2007/ pose (%) R1 R2 R3 R4 R5 R6 R7

0 0 1 0 0 1 1

90 0 90 75 90 90 25

5 4 3 1 3 2 2

0 50 a` 80 50 a` 90 75 90 10 95

Re´duction des hospitalisations

Re´duction de l’intensite´ des crises

Re´duction Efficacite´ de la dure´e de l’aimant des crises

0 N 1 N N N

0 0 N 1 0 0 1

0 1 N 1 0 0 1

N 1 N N N N 1

N = non évaluable ou non retrouvé dans les dossiers ; 0 = non ; 1 = oui.

Tableau 4. Effets indésirables de la thérapie par SNV chez les patients répondeurs. Effets inde´sirables

Patient Toux R1 R2 R3 R4 R5 R6 R7

0 1 0 0 0 0 0

Modification de la voix 0 1 1 0 0 0 1

Essoufflement

Geˆne

0 0 0 0 0 0 0

0 1 0 0 0 0 1

0 = non ; 1 = oui.

carbazépine) 300 mg/jour et Urbanyl® (clonazepam) 20 mg/jour, l’utilisation des benzodiazépines a pu être arrêtée. Plusieurs modifications de traitement ont été réalisées après la mise en place du stimulateur. Aujourd’hui, l’enfant est traité par Trileptal® (oxcarbazépine) 300 mg/ jour, Lamictal® (lamotrigine) 100 mg/jour et Keppra® (levetiracetam) 1 000 mg/jour. Urbanyl® (clonazepam) est remplacé par Keppra® (levetiracetam) ce qui permet d’éviter l’utilisation de benzodiazépine aux effets indésirables délétères au quotidien (somnolence) pour les patients ; – chez un patient âgé de 52 ans traité par une quadrithérapie : Keppra® (levetiracetam) 3 g/jour, Lamictal® (lamotrigine) 500 mg/jour, Alepsal® (phénobarbital, caféine) 100 mg/jour et Urbanyl® (clonazepam) 20 mg/jour, le traitement par Urbanyl® (clonazepam) a été arrêté et la dose de Lamictal® (lamotrigine) a été réduite à 400 mg/ jour après 4 ans de thérapie par SNV. Chez les autres patients, la thérapie par SNV n’a pas permis d’alléger le traitement médicamenteux.

Re´sultats de l’enqueˆte aupre`s des patients et du personnel Un questionnaire a été soumis à 19 patients suite à leurs consultations de contrôle avec le neurologue. Le questionnaire était rempli lors d’un entretien avec un interne en pharmacie, l’objectif principal étant d’apprécier la qualité de vie des patients depuis l’implantation du dispositif. J Pharm Clin, vol. 28, n o 1, janvier-fe´vrier-mars 2009

La qualité de vie a été évaluée grâce à une échelle composée de 10 graduations extraite de questionnaire standard (QOLIE-89) [2]. Nous avons demandé aux patients d’évaluer leur qualité de vie sur cette échelle avant puis après la mise en place du stimulateur. Nous avons pu alors déterminer une évolution de la qualité de vie des patients selon trois niveaux : – amélioration : la différence est positive, ce fut le cas pour 10 patients ; – dégradation : la différence est négative, ce fut le cas pour 2 patients ; – aucun changement : la différence est nulle, ce fut le cas pour 4 patients. Les résultats sont présentés sur la figure 4. Nous avons observé une amélioration de la qualité de vie chez dix patients (différence positive), une dégradation de celle-ci chez deux patients (différence négative), aucune évolution chez quatre patients (différence nulle) et chez trois patients cette évolution n’a pu être évaluée (figure 4). Nous avons également recherché un éventuel effet de la SNV sur différents paramètres tels que le dynamisme, la confiance, la nervosité, le moral, la fatigue, l’humeur, le comportement, la concentration, la mémoire et le sommeil. Selon les critères, une amélioration a pu être notée chez certains patients, notamment celle du moral chez 7 patients. Par contre, six patients se sont sentis plus fatigués qu’avant la mise en place du stimulateur. Notons aussi l’amélioration de la concentration (6 patients) et de la nervosité (5 patients). Pour les autres critères (dynamisme, confiance, humeur, comportement, mémoire, sommeil), l’évolution est fluctuante selon les patients (améliorée pour certains et dégradés pour d’autres) (figure 5).

Discussion Efficacite´ de la stimulation du nerf vague Dans notre étude, nous avons noté une efficacité aléatoire et non systématique du traitement par SNV sur le nombre de crises. En effet, seuls 18 % des patients ont été considérés comme répondeurs après un an de traitement, c’està-dire qu’ils présentaient une diminution de la fréquence des crises supérieure à 50 %. Un quart des patients étaient répondeurs après plusieurs années de traitement. Plusieurs hypothèses peuvent expliquer cette efficacité non systématique :

L. Albertini, et al.

– d’une part, la thérapie par stimulation du nerf vague est un traitement de dernière intention, réservé aux patients présentant des épilepsies très sévères et réfractaires aux autres traitements. On aurait donc pu penser avoir de meilleurs résultats si les patients traités avaient présenté des épilepsies moins sévères et moins rebelles. D’ailleurs cette hypothèse est supportée par Majoie et al. [5] qui ont montré que les patients qui présentaient un électroencéphalogramme moins perturbé, présentaient une plus grande réduction des crises lors d’un traitement par SNV ; – d’autre part, étant donné que la thérapie par SNV est utilisée en dernier recours, le traitement n’est pas précoce. Or certains auteurs ont comparé des patients traités précocement par SNV avec des patients traités tardivement. Ils ont ainsi montré que l’utilisation précoce de la SNV améliorait significativement le contrôle des crises. En effet, les crises ont disparu chez 15 % des patients traités précocement trois mois après l’instauration de la SNV, contre 4,4 % du groupe traité plus tardivement [6, 14].

6 5 4 3

Différence 2 1 de qualité 0 de vie

-1

Stimulation du nerf vague et traitements antie´pileptiques associe´s

-2 N 0

Contrairement à Uthman et al. [7], nous n’avons pas pu démontrer d’efficacité de la thérapie par SNV à long terme, alors que ces auteurs avaient mis en évidence un effet cumulatif de la thérapie par SNV lors d’une étude rétrospective sur 48 patients portant sur une période de 12 ans. Nous n’avons pas retrouvé cet effet cumulatif. Mais il est à rappeler que l’épilepsie est une maladie évolutive. L’effet de son traitement à long terme est donc très difficile à démontrer puisqu’il peut exister une confusion entre l’effet thérapeutique et l’évolution de la maladie épileptique. La conclusion est d’autant plus difficile que nous avions un petit effectif. Nous n’avons pas observé de meilleure efficacité chez l’enfant dans notre étude, contrairement à certains auteurs [8] qui, à l’occasion de quelques études portant sur de faibles effectifs, ont fait état d’une plus grande efficacité chez l’enfant par rapport à l’adulte. Leurs résultats restent cependant controversés et peu d’études ont été menées uniquement chez l’enfant. Néanmoins, nous considérons que nos propres résultats sont également à interpréter avec prudence puisque notre effectif n’était que de six enfants. Nous avons montré que le traitement par SNV était efficace pour certains patients mais rien ne nous permet de prédire quel type de patient sera répondeur ou pas. En effet, dans notre étude, l’efficacité du traitement par SNV ne dépendait ni du type de crise ni de la cause de l’épilepsie. Il semblerait exister une susceptibilité individuelle dans la réponse à la thérapie par SNV.

Nombre de patients

Figure 4. Évolution de la qualité de vie chez chaque patient (avant et après SNV). N = non évaluable en raison d’une déficience mentale du patient qui rend la communication difficile avec ce patient.

Nous avons constaté que 5 patients sur 27 ont pu bénéficier d’une réduction de leur traitement antiépileptique. Dans notre étude les médicaments concernés étaient le Trileptal® (oxcarbazépine), le Sabril® (vigabatrin), le Tegretol® (carbamazépine) et le Lamictal® (lamotrigine). Dans une étude réalisée en 2002 aux États-Unis, Labar et al. [9] ont étudié les médicaments antiépileptiques utilisés

Nombre de patients

7 6 5 Amélioration Dégradation

4 3 2 1

l ei

re oi ém

So m m

n tio ra nt

r eu H um

te po r om C

C on ce

tig

m en t

al Fa

si vo

té

e er N

fia on C

m e

Figure 5. Évolution des paramètres étudiés depuis l’implantation du stimulateur.

J Pharm Clin, vol. 28, n o 1, janvier-fe´vrier-mars 2009

Stimulation du nerf vague et e´pilepsies re´fractaires

pendant les 12 premiers mois de la thérapie par SNV. Dans la population étudiée, composée de 1 407 patients, 228 patients ont pris moins de médicaments antiépileptiques. Les traitements le plus souvent suspendus étaient à base de topiramate (Epitomax®), de tiagabine (Gabitril®), de carbamazépine (Tegretol®), de lamotrigine (Lamictal®) et de gabapentine (Neurontin®). Toutefois cette étude n’a porté que sur les 12 premiers mois de thérapie par SNV, et il serait donc intéressant de réaliser cette même étude à plus long terme. Les effets indésirables engendrés par ces traitements ne sont pas négligeables. En effet, le Trileptal® (oxcarbazépine) peut entraîner des troubles neuropsychiques, une hyponatrémie, une diplopie, des troubles hématologiques, des manifestations cutanées et des troubles digestifs. Le Tegretol® (carbamazépine) peut induire les mêmes effets indésirables que le Trileptal® et des effets atropiniques. Le Sabril® (vigabatrin) peut provoquer un rétrécissement parfois irréversible du champ visuel, une sédation, une fatigue ou au contraire une agitation chez l’enfant, une prise de poids et des céphalées. Le Lamictal® (lamotrigine) peut être associé à une ataxie, une diplopie, des vertiges, des vomissements et des manifestations cutanées. Les effets indésirables de ces traitements contribuent donc à la dégradation de la qualité de vie des patients. La thérapie par SNV peut, dans certains cas, permettre de diminuer la posologie de ces produits, ou même de suspendre leur utilisation. Étant donné le peu d’effets indésirables induits par la SNV, le gain en qualité de vie est réel et peut permettre aux patients d’améliorer leurs relations sociales (pas d’effets neuropsychiques) et leur bien-être (pas de prise de poids, de céphalées ou de troubles hématologiques). Dans leur étude, Labar et al. [9] ont recherché un éventuel effet synergique entre les médicaments antiépileptiques et la thérapie par SNV. Aucun antiépileptique en particulier n’a montré d’effet additif avec la thérapie par SNV. Par ailleurs, chez deux des patients que nous avons observés, l’utilisation de benzodiazépines telles que l’Urbanyl® (clobazam) a pu être arrêtée. Les benzodiazépines ne constituent qu’un traitement symptomatique d’appoint des épilepsies, mais leur utilisation n’est pas sans conséquence puisqu’elles provoquent notamment des troubles neuropsychiques (troubles du comportement, irritabilité, somnolence, confusion, amnésie antérograde) et une dépendance physique et psychique. Dans certains cas, la thérapie par SNV permet d’éviter le recours aux benzodiazépines, notamment chez l’enfant. Là encore, cela permettrait une amélioration de la qualité de vie avec une « normalisation » du comportement et une socialisation plus facile.

Ame´lioration de l’humeur par stimulation du nerf vague : vers d’autres indications Dans notre étude, nous montrons qu’il existerait en évidence une amélioration de la nervosité, de la concentration et du moral lors du traitement par SNV, ainsi que de l’humeur et du comportement pour certains patients. Ceci va dans le sens de récentes études qui s’intéressent à l’utilisation de la thérapie par SNV dans le traitement de la dépression. L’idée de l’utilisation de la SNV dans le traitement de la dépression résulte de différentes observations : – tout d’abord des observations cliniques directes : notre étude a démontré une amélioration de l’humeur et de l’apprentissage chez les patients épileptiques traités par J Pharm Clin, vol. 28, n o 1, janvier-fe´vrier-mars 2009

SNV. Cette amélioration a également été observée par d’autres auteurs [10] ; – de plus, certains médicaments antiépileptiques tels que la lamotrigine (Lamictal®), et la carbamazépine (Tegretol®) sont déjà connus pour stabiliser l’humeur et les troubles bipolaires ; – notons par ailleurs que la SNV agit au niveau du thalamus et du cortex et que ces régions du système nerveux sont impliquées dans la régulation de l’humeur ; – enfin, la SNV modifie les concentrations de certaines monoamines au niveau du système nerveux central telles que la sérotonine, la noradrénaline, le GABA. Or, ces neurotransmetteurs sont impliqués dans la physiopathologie de la dépression. Marangell et al. [11] ont étudié l’effet de la thérapie par SNV sur les troubles bipolaires résistant aux traitements médicamenteux. Neuf patients ont été suivis pendant un an et leur trouble a été évalué grâce à différentes échelles (Hamilton Rating Scale for Depression (HAM-D-28) ou Young Mania Rating Scale (YMRS)). Une amélioration moyenne de 38,1 % a été observée après 12 mois de traitement avec une diminution significative des symptômes observés. Cette étude suggère que la thérapie par SNV est efficace et bien tolérée chez les patients atteints de troubles bipolaires. Une étude sur deux ans incluant 59 patients atteints de dépression majeure a montré que 31 % des patients étaient répondeurs (c’est-à-dire une diminution du score HAM-D-28 d’au moins 50 %) après trois mois de traitement par SNV, 44 % après un an et 42 % après deux ans avec un taux de rémission (c’est-à-dire un score HAM-D-28 ≤ 10) de 15 % à trois mois, 27 % à un an et 22 % à deux ans. Cette thérapie ajoutée aux traitements médicamenteux permet d’obtenir des réponses chez des patients résistant aux médicaments [12]. D’ailleurs George et al. ont montré que, chez les patients répondeurs à la thérapie par SNV, il était possible de réduire les doses ou le nombre de médicaments utilisés contrairement au cas des patients non répondeurs [13].

Conclusion Notre étude a porté sur un dispositif médical innovant : le stimulateur du nerf vague. Il s’agit d’une alternative non pharmacologique au traitement des épilepsies réfractaires. Nous avons évalué l’efficacité de cette thérapie d’une part, sur la maladie épileptique et, d’autre part, sur la qualité de vie. Nous avons observé une efficacité aléatoire sur le nombre de crises d’épilepsie, et pu montrer une diminution de la sévérité de ces crises et du temps de récupération dans certains cas. Cette thérapie par stimulation du nerf vague permet une amélioration de la qualité de vie pour une partie des patients (meilleur comportement, meilleur moral). L’importance de cet effet bénéfique était d’ailleurs perceptible lors de nos entretiens avec ces patients. Comme nous, d’autres auteurs ont observé cette amélioration du moral lors d’un traitement par stimulation du nerf vague. Cette thérapie est désormais à l’essai aux ÉtatsUnis dans le traitement de la dépression, et deviendra peut-être une nouvelle indication de ce dispositif médical. Ainsi, la thérapie par stimulation du nerf vague dans le traitement des épilepsies réfractaires ne représente pas la

L. Albertini, et al.

panacée. Toutefois, il s’agit d’une alternative intéressante de dernière ligne pour des patients réfractaires aux médicaments. Elle peut permettre, dans certains cas, de réduire les crises d’épilepsie en terme de fréquence, de durée ou d’intensité et/ou d’augmenter la qualité de vie des patients en améliorant le moral, l’humeur et la concentration. ■ Remerciements Nous tenons à remercier les médecins neurologues et neurochirurgiens : Messieurs Vignal, Schaff, et Klein ainsi que Madame Coulbois, qui nous ont permis de réaliser cette étude et nous ont accompagnés pendant ce travail.

Re´fe´rences 1. Cramer JA, Perrine K, Devinsky O, Bryant-Comstock L, Meador K, Hermann B. Development and cross-cultural translations of a 31-item quality of life in epilepsy inventory. Epilepsia 1998 ; 39 : 81-8. 2. Devinsky O, Vickrey BG, Cramer J, Perrine K, Hermann B, Meador K, et al. Development of the quality of life in epilepsy inventory. Epilepsia 1995 ; 36 : 1089-104. 3. Wade JE, Scherbourne CD. The MOS 36-item short-form health survey (SF-36). Medical Care 1992 ; 30 : 73-483. 4. Abubakr A, Wambacq I. Long-term outcome of vagus nerve stimulation therapy in patients with refractory epilepsy. J Clin Neurosci 2008 ; 15 : 127-9.

5. Majoie HJ, Berfelo MW, Aldenkamp AP, Renier WO, Kessels AG. Vagus nerve stimulation in patients with catastrophic childhood epilepsy, a 2-year follow-up study. Seizure 2005 ; 14 : 10-8. 6. Renfroe JB, Wheless JW. Earlier use of adjunctive vagus nerve stimulation therapy for refractory epilepsy. Neurology 2002 ; 59 (Suppl. 4) : 26-30. 7. Uthman BM, Reichl AM, Dean JC, Eisenschenk S, Gilmore R, Reid S, et al. Effectiveness of vagus nerve stimulation in epilepsy patients : a 12-year observation. Neurology 2004 ; 63 : 1124-6. 8. Wheless JW. Nonpharmacologic treatment of the catastrophic epilepsies of childhood. Epilepsia 2004 ; 45 (Suppl. 5) : 17-228. 9. Labar D, Nikolov B, Tarver B, Fraser R. Vagus nerve stimulation for symptomatic generalized epilepsy : a pilot study. Epilepsia 1998 ; 39 : 201-5. 10. Harden CL, Pulver MC, Ravdin LD, Nikolov B, Halper JP, Labar DR. A pilot study of mood in epilepsy patients treated with vagus nerve stimulation. Epilepsy Behav 2000 ; 1 : 93-9. 11. Marangell LB, Rush AJ, George MS, Sackeim HA, Johnson CR, Husain MM, et al. Vagus nerve stimulation (VNS) for major depressive episodes : one year outcomes. Biol Psychiatry 2002 ; 51 : 280-7. 12. Nahas Z, Marangell LB, Husain MM, Rush AJ, Sackeim HA, Lisanby SH, et al. Two-year outcome of vagus nerve stimulation (VNS) for treatment of major depressive episodes. J Clin Psychiatry 2005 ; 66 : 1097-104. 13. Daban C, Martinez-Aran A, Cruz N, Vieta E. Safety and efficacy of Vagus Nerve Stimulation in treatment-resistant depression. A systematic review. J Affect Disord 2008 ; 110 : 1-15. 14. Helmers SL, Griesemer DA, Dean JC, Sanchez JD, Labar D, Murphy JV, et al. Observations on the use of vagus nerve stimulation earlier in the course of pharmacoresistant epilepsy : patients with seizures for six years or less. Neurologist 2003 ; 9 : 160-4.

J Pharm Clin, vol. 28, n o 1, janvier-fe´vrier-mars 2009

Traitement des épilepsies réfractaires : rôle de la stimulation électrique Rev Med Suisse 2012;8:930-934

Résumé Les médicaments antiépileptiques contrôlent les crises chez 70% des malades ; pour les autres, un bilan préchirurgical est indiqué, surtout lorsqu’une origine focale est suspectée. Cependant, seulement une partie de ces malades vont être amenés à subir une chirurgie de résection du foyer épileptique (curative). Plusieurs thérapies palliatives, utilisant une stimulation électrique extra ou intracrânienne, ont été développées depuis quinze ans. Cet article présente les stimulations du nerf vague, cérébrale profonde (mésiotemporale ou thalamique) ainsi que corticale «à la demande». Ces approches ont en commun un taux de réponse de 30-50%, mais moins de 5% de patients libres de crises à long terme. Il reste à espérer que la meilleure compréhension des mécanismes épileptogènes et des réseaux neuronaux impliqués puisse améliorer ces données.

Introduction Les épilepsies touchent près de 1% de la population générale, et leur diagnostic syndromique, nécessaire pour poser l’indication à un traitement spécifique avec des médicaments antiépileptiques, implique la survenue d’au moins une crise épileptique prouvée, associée à une prédisposition constante à en générer d’autres.1 Par ailleurs, des crises comitiales en dehors de cette constellation particulière (par exemple, lors de sevrage d’alcool, de somnifères, ou de troubles métaboliques réversibles) ne justifient pas la mise en route d’une thérapie spécifique : une fois la cause sous-jacente

résolue, le risque de récidive retombe à des valeurs comparables à celles de la population générale. Les principes de prescription et les options concernant les médicaments antiépileptiques avaient été revus en détail il y a deux ans dans ce journal.2 Dans ce contexte, il est important de rappeler à nouveau que les crises épileptiques non prolongées (qui durent donc moins de cinq minutes) ne doivent pas justifier l’administration indiscriminée de benzodiazépines : cette approche, en effet, perturbe l’évaluation clinique du malade, prolongeant la phase postcritique avec de possibles complications cardiorespiratoires et de la conscience, et doit donc être réservée aux menaces d’état de mal, situation où les benzodiazépines représentent la première ligne de traitement.3 Le choix de la médication antiépileptique doit être fondé sur trois axes : le contexte spécifique du patient (syndrome épileptique, âge, comorbidités médicales), les propriétés pharmacologiques des substances envisagées et l’expérience du soignant avec ces dernières.2 Un premier médicament antiépileptique aura une chance d’environ 50% de contrôler les crises chez une personne avec une épilepsie, un deuxième pourra améliorer la situation chez 15% de malades en plus, puis les essais ultérieurs vont obtenir un taux de réussite encore plus faible.4,5 Finalement, environ un tiers des personnes vivant avec une épilepsie deviennent pharmacorésistantes ; cela signifie qu’en dépit de l’utilisation d’au moins deux substances appropriées (en considération du syndrome épileptique) seules ou en combinaison, administrées à un dosage et pour une durée adéquats, le patient continue à présenter des crises épileptiques.6 Seule une partie d’entre eux seront candidats à une chirurgie de l’épilepsie ; pour les autres, heureusement, une palette grandissante d’approches curatives ou palliatives s’offre à cette population pharmacorésistante. Comme revers de la médaille, il est utile de mentionner que chaque malade n’est généralement pas éligible pour chacune de ces options, et que ces dernières présentent toutes des taux de réussite variables, et des effets indésirables spécifiques.

Bilan préchirurgical de l’épilepsie Toute personne souffrant d’épilepsie pharmacorésistante devrait être référée à un centre spécialisé dans la prise en charge des épilepsies difficiles à traiter. Le but de cette évaluation est premièrement de clarifier le diagnostic grâce à un enregistrement vidéo-EEG (électroencéphalogramme) prolongé pour capturer les épisodes en question : s’agit-il vraiment de manifestations épileptiques ou de crises non épileptiques psychogènes, qui constituent la cause des symptômes chez au moins 20% des patients dont le diagnostic initial était celui d’épilepsie ?7 S’agit-il de manifestations cardiovasculaires ou de mouvements anormaux dans le spectre des maladies extrapyramidales ? Si l’origine épileptique est confirmée, la distinction entre épilepsie généralisée et épilepsie focale (dont les crises se présentent parfois avec des généralisations secondaires mimant des crises généralisées d’emblée) permet de mieux choisir le traitement médicamenteux. Enfin, dans les épilepsies focales pharmacorésistantes, un bilan d’imagerie approfondi (détaillé il y a deux ans dans ce journal)8 vise à localiser le foyer épileptique et sa proximité avec le cortex éloquent (langage, motricité, sensibilité, vision, etc.) que la chirurgie doit préserver. Dans certains cas, un enregistrement EEG avec électrodes intracrâniennes profondes (stéréotactiques) ou sous-durales, est nécessaire pour préciser la localisation du foyer et du cortex éloquent. Lorsqu’elle est possible, la chirurgie de l’épilepsie permet de supprimer les crises chez environ deux tiers des patients souffrant d’épilepsie temporale et chez plus de la moitié des patients avec épilepsie extratemporale.9 Les techniques de chirurgie palliative par chirurgie fonctionnelle et stimulation cérébrale chronique ne devraient donc être proposées que chez des patients chez lesquels un bilan préchirurgical a conclu que la chirurgie n’était pas une option raisonnable. Il est important de se souvenir que l’absence de lésion cérébrale sur l’IRM cérébrale ne contre-indique en aucun cas la chirurgie et surtout pas le bilan préchirurgical. Stimulation du nerf vague (Vagal Nerve Stimulation)

Suite à plusieurs études randomisées en double aveugle, cette approche a été admise depuis 1997 aux Etats-Unis et en Europe (y compris en Suisse) comme traitement palliatif pour l’épilepsie ; plus de 65 000 personnes de tout âge en ont bénéficié dans le monde. De plus, depuis 2005, la stimulation du nerf vague (VNS) est reconnue aussi dans le traitement des dépressions pharmacorésistantes. Il s’agit d’un stimulateur électrique dont la batterie est implantée en position sous-cutanée devant le muscle grand pectoral gauche, avec une électrode qui «remonte» dans la région cervicale ipsilatérale pour aller entourer le nerf vague ; il paraît en effet que le choix du côté gauche permette de réduire au maximum les éventuelles interférences avec le rythme cardiaque. L’intervention se déroule en anesthésie générale sur un mode semi-ambulatoire et dure environ une heure. Le boîtier délivre des pulses électriques typiquement de 30 secondes toutes les cinq minutes, 24 heures sur 24. Le mécanisme d’action est inconnu à ce stade, le rôle de l’action neuromodulatrice, au niveau du tronc cérébral (en particulier le noyau du tractus solitaire) et, indirectement, sur les projections plus rostrales, est discuté.10 Ces bases anatomiques expliquent peut-être les effets bénéfiques sur la cognition et la vigilance,11,12 ce qui représente en pratique des «effets secondaires» souhaités et très fréquemment obtenus (indépendamment de l’action sur les crises épileptiques), particulièrement chez des malades souffrant d’encéphalopathies épileptiques ou d’effets secondaires médicamenteux. L’efficacité sur la réduction de la fréquence des crises est progressive pendant les deux premières années : à long terme, environ 50% des patients rapportent une réduction d’au moins 50% des manifestations épileptiques, mais seulement 0-5% sont complètement libres de crises.13,14 Probablement aussi grâce à l’impact sur la vigilance, la qualité de vie se trouve améliorée.15 La possibilité d’activer la stimulation lors d’une crise épileptique, par le biais d’un passage d’aimant sur le boîtier, offre une indépendance thérapeutique supplémentaire aux patients et aux soignants, et peut s’avérer efficace (raccourcissement des crises, de

la phase postcritique) chez environ un tiers des malades. La tolérance est généralement bonne, avec comme effets indé sirables les plus fréquents, des dysesthésies du pharynx et une dysphonie lors de la stimulation, symptômes qui sont assez aisément gérables en adaptant les paramètres de stimulation et qui s’estompent avec le temps. Le profil de sécurité très favorable aux niveaux cardiovasculaire et gastro-intestinal est corroboré par le grand nombre de malades ayant reçu une VNS ; une aggravation des crises (qui peut survenir avec les médicaments antiépileptiques) reste à ce jour un risque d’une exceptionnelle rareté. Par contre, chez les sujets souffrant en parallèle d’un syndrome des apnées du sommeil, la VNS devrait être envisagée seulement si leur trouble respiratoire est correctement soigné, au vu d’un risque d’aggravation clairement lié au stimulateur.16 Stimulation cérébrale profonde (Deep Brain Stimulation) La stimulation cérébrale profonde (DBS) est une technique prometteuse, mais a été appliquée sur un nombre beaucoup plus restreint de patients que la VNS. Différentes approches existent, visant soit directement le foyer épileptique, soit un nœud important du réseau épileptique. Différentes cibles cérébrales ont été testées pour contrôler l’activité épileptique dans le cerveau à l’aide de stimulations électriques chroniques. Une électrode est implantée dans le cerveau ou à la surface du cortex et l’enregistrement de l’activité cérébrale, durant les premiers jours d’implantation, permet de définir les paramètres de stimulation avant l’internalisation du système, qui comprend un câble souscutané reliant la sortie de l’électrode sur le crâne au boîtier de stimulation situé sous la clavicule. Nous présentons ci-dessous les sites de stimulation les plus fréquents, mais la liste n’est pas exhaustive. Stimulation amygdalo-hippocampique La stimulation amygdalo-hippocampique dans l’épilepsie du lobe temporal est décrite depuis plus de dix ans. Cette stratégie est

utilisée chez des patients avec un foyer épileptique temporal bilatéral, ou un foyer unilatéral (dominant) avec un risque élevé de troubles mnésiques en cas de résection de l’hippocampe «épileptique». Il s’agit ici de stimuler directement le foyer épileptique avec un effet probablement inhibiteur de la stimulation à haute fréquence (130 Hz). Dans une des premières études, sept patients sur dix ont bénéficié d’une réduction d’au moins 50% des crises, et aucun effet neurologique ou cognitif indésirable n’a été rapporté.17 Comme pour la VNS, le mécanisme d’action de la DBS est encore mal compris et ses paramètres de stimulation n’étaient pas optimisés pour le contrôle de l’activité épileptique, mais empiriquement empruntés à la DBS dans la maladie de Parkinson. Dans ce contexte, une étude genevoise a récemment analysé l’effet des différents paramètres de stimulation : la stimulation à haute fréquence (130 Hz) est supérieure à celle à basse fréquence (5 Hz), du moment que ces derniers avaient plutôt tendance à augmenter l’activité épileptique.18 Une étude romande ultérieure a montré l’importance de la précision millimétrique du placement de l’électrode de stimulation et la nécessité d’une stimulation plus intense chez les patients avec sclérose hippocampique comparée à l’épilepsie temporale non lésionnelle.19 Il existe probablement un effet microlésionnel de l’implantation de l’électrode, car certains patients sont nettement améliorés sans même enclencher la stimulation. Toutefois, cet effet, lorsqu’il est présent, tend à s’estomper après quelques semaines ou mois. Stimulation du noyau antérieur du thalamus En 2010, une étude multicentrique randomisée en double aveugle (stimulation ON versus OFF) a montré que la DBS, par stimulation bilatérale du noyau antérieur du thalamus, était efficace sur un groupe de 110 patients avec épilepsie focale (foyer mésiotemporal ou néocortical).20 Comme pour la DBS amygdalo-hippocampique, les électrodes sont reliées à un boîtier de stimulation sousclaviculaire. L’effet était progressif avec la durée de stimulation et

après deux ans, la réduction médiane des crises était de 56%, avec six patients libres de crises. L’effet était plus favorable encore chez les malades avec épilepsie temporale, probablement du fait que le noyau antérieur du thalamus fait partie du circuit limbique dont font également partie l’amygdale et l’hippocampe, deux structuresclés dans l’épilepsie temporale. Les cas d’épilepsie mal localisée ou de foyers multiples représentent également des indications, car l’effet découle de la modulation de centres sous-corticaux qui semblent constituer des relais communs de propagation des crises. Aucun effet significatif sur la cognition ou la qualité de vie n’a été rapporté, même si l’impact négatif sur l’humeur présente une prévalence qui paraît accrue par rapport au placebo (interférence avec les réseaux limbiques ?). Suite à cette étude, la DBS du noyau antérieur du thalamus a obtenu la certification aux Etats-Unis et en Europe comme traitement de l’épilepsie focale pharmacorésistante. En Suisse, le remboursement doit être préalablement demandé à la caisse maladie au cas par cas. Stimulation à la demande Afin de minimiser les potentiels effets secondaires et maximiser la durée de vie de la batterie, une stimulation à la demande, déclenchée par la détection d’une crise serait hautement souhaitable. Une étude randomisée en double aveugle multicentrique est en cours sur un groupe de 191 patients avec épilepsie focale mésiotemporale ou néocorticale. L’électrode intracérébrale ou sous-durale est reliée à un boîtier de stimulation plat, inséré en épicrânien. Les résultats préliminaires montrent un bénéfice significatif mais modéré de la stimulation (-38% versus 17% de crises, p=0,012), avec une amélioration rapportée de la qualité de vie et pas d’effet cognitif significatif.21 Conclusion La chirurgie résective, lorsqu’elle est possible, reste le meilleur traitement de l’épilepsie pharmacorésistante focale. Chez les patients qui ne peuvent pas bénéficier d’une telle chirurgie, il

existe désormais plusieurs possibilités de chirurgie palliative par stimulation électrique chronique intra ou extracrânienne. Une meilleure connaissance des mé canismes sous-jacents permettra à l’avenir d’optimiser les paramètres de stimulation et de mieux choisir les candidats à la stimulation pour améliorer le contrôle des crises chez les patients stimulés. Implications pratiques > Tout patient avec épilepsie difficile à traiter devrait faire l’objet d’une évaluation par un centre spécialisé pour clarification du diagnostic et propositions thérapeutiques > Les patients avec une épilepsie pharmacorésistante peuvent bénéficier de plusieurs approches curatives ou palliatives impliquant une neurostimulation > La neurostimulation ne doit être considérée qu’après démonstration que le patient n’est pas un bon candidat pour une chirurgie résective, car cette dernière a, pour l’instant, un taux de succès nettement plus élevé > Les choix des indications, la discussion interdisciplinaire et le suivi des patients doivent être coordonnés dans des centres de compétences Bibliographie 1. [**] Fisher RS, van Emde Boas W, Blume W, et al. Epileptic seizures and epilepsy : Definitions proposed by the International League Against Epilepsy (ILAE) and the International Bureau for Epilepsy (IBE). Epilepsia 2005;46:470-2. [Medline] 2. Rossetti AO, Seeck M. Le traitement médicamenteux actuel de l’épilepsie. Rev Med Suisse 2010;6:901-6. [Medline] 3. Rossetti AO, Lowenstein DH. Management of refractory status epilepticus in adults : Still more questions than answers. Lancet Neurol 2011;10:922-30. [Medline] 4. Kwan P, Brodie MJ. Early identification of refractory epilepsy. N Engl J Med 2000;342:314-9. [Medline] 5. Luciano AL, Shorvon SD. Results of treatment changes in patients with apparently drug-resistant chronic epilepsy. Ann Neurol 2007;62:375-81. [Medline]

6. [*] Kwan P, Arzimanoglou A, Berg AT, et al. Definition of drug resistant epilepsy : Consensus proposal by the ad hoc Task Force of the ILAE Commission on Therapeutic Strategies. Epilepsia 2010;51:1069-77. [Medline] 7. Benbadis SR, Allen Hauser W. An estimate of the prevalence of psychogenic non-epileptic seizures. Seizure 2000;9:280-1. [Medline] 8. Vulliémoz S, Pollo C, Schaller K, Novy J. Chirurgie de l’épilepsie : un traitement curatif ? Rev Med Suisse 2010;6:9125. [Medline] 9. [**] Spencer S, Huh L. Outcomes of epilepsy surgery in adults and children. Lancet Neurol 2008;7:525-37. [Medline] 10. Ben Menachem E. Vagus-nerve stimulation for the treatment of epilepsy. Lancet Neurol 2002;1:477-82. [Medline] 11. Malow BA, Edwards J, Marzec M, et al. Vagus nerve stimulation reduces daytime sleepiness in epilepsy patients. Neurology 2001;57:879-84. [Medline] 12. Boon P, Moors I, De Herdt V, Vonck K. Vagus nerve stimulation and cognition. Seizure 2006;15:259-63. [Medline] 13. Labar D. Vagus nerve stimulation for 1 year in 269 patients on unchanged antiepileptic drugs. Seizure 2004; 13:392-8. [Medline] 14. [*] Englot DJ, Chang EF, Auguste KI. Vagus nerve stimulation for epilepsy : A meta-analysis of efficacy and predictors of response. J Neurosurg 2011;115:1248-55. [Medline] 15. Dodrill CB, Morris GL. Effects of vagal nerve stimulation on cognition and quality of life in epilepsy. Epilepsy Behav 2001;2:46-53. [Medline] 16. Parhizgar F, Nugent K, Raj R. Obstructive sleep apnea and respiratory complications associated with vagus nerve stimulators. J Clin Sleep Med 2011;7:401-7. [Medline] 17. [*] Vonck K, Boon P, Achten E, De Reuck J, Caemaert J. Long-term amygdalohippocampal stimulation for refractory temporal lobe epilepsy. Ann Neurol 2002;52: 556-65. 18. Boëx C, Vulliémoz S, Spinelli L, Pollo C, Seeck M. High and low frequency electrical stimulation in non-lesional temporal lobe epilepsy. Seizure 2007;16:664-9. [Medline] 19. Boëx C, Seeck M, Vulliémoz S, et al. Chronic deep brain stimulation in mesial temporal lobe epilepsy. Seizure 2011;20:485-90. [Medline]

20. [*] Fisher R, Salanova V, Witt T, et al. Electrical stimulation of the anterior nucleus of thalamus for treatment of refractory epilepsy. Epilepsia 2010;51:899-908. [Medline] 21. Morrell MJ. Responsive cortical stimulation for the treatment of medically intractable partial epilepsy. Neurology 2011;77:1295-304. [Medline] [*] à lire [**] à lire absolument Abstract Antiepileptic drugs allow controlling seizures in 70% of patients. For the others, a presurgical work-up should be undertaken, especially if a focal seizure origin is suspected ; however, only a fraction of pharmacoresistant patients will be offered resective (curative) surgery. In the last 15 years, several palliative therapies using extra- or intracranial electrical stimulations have been developed. This article presents the vagal nerve stimulation, the deep brain stimulation (targeting the mesiotemporal region or the thalamus), and the cortical stimulation «on demand». All show an overall long-term responder rate between 30-50%, but less than 5% of patients becoming seizure free. It is to hope that a better understanding of epileptogenic mechanisms and of the implicated neuronal networks will lead to an improvement of these proportions.

Contact auteur(s) Andrea Rossetti, PD Service de neurologie CHUV, 1011 Lausanne andrea.rossetti@chuv.ch Serge Vulliémoz, Service de neurologie HUG, 1211 Genève 14 serge.vulliemoz@hcuge.ch

Epilepsy Behav. 2013 Sep;28(3):343-6. doi: 10.1016/j.yebeh.2013.02.001. Epub 2013 Jun 29.

Transcutaneous auricular vagus nerve stimulation as a complementary therapy for pediatric epilepsy: a pilot trial. He W 1, Jing X, Wang X, Rong P, Li L, Shi H, Shang H, Wang Y, Zhang J, Zhu B.

Author information â&#x20AC;˘

Institute of Acupuncture and Moxibustion, China Academy of Chinese Medical Sciences, China.

Abstract OBJECTIVE: We investigated the safety and efficacy of transcutaneous auricular vagus nerve stimulation (ta-VNS) for the treatment of pediatric epilepsy. METHODS: Fourteen pediatric patients with intractable epilepsy were treated by ta-VNS of the bilateral auricular concha using an ear vagus nerve stimulator. The baseline seizure frequency was compared with that after 8weeks, from week 9 to 16 and from week 17 to the end of week 24, according to the seizure diaries of the patients. RESULTS: One patient dropped out after 8weeks of treatment due to lack of efficacy, while the remaining 13 patients completed the 24-week study without any change in medication regimen. The mean reduction in seizure frequency relative to baseline was 31.83% after week 8, 54.13% from week 9 to 16 and 54.21% from week 17 to the end of week 24. The responder rate was 28.57% after 8weeks, 53.85% from week 9 to 16 and 53.85% from week 17 to the end of week 24. No severe adverse events were reported during treatment. CONCLUSION: Transcutaneous auricular VNS may be a complementary treatment option for reducing seizure frequency in pediatric patients with intractable epilepsy and should be further studied. Copyright ÂŠ 2013 Elsevier Inc. All rights reserved. KEYWORDS: Auricular branch of the vagus nerve; Pediatric epilepsy; Transcutaneous auricular vagus nerve stimulation

Hegel Vol. 5 N° 3 - 2015

173

Doi : 10.4267/2042/56896

Propriétés anti-inflammatoires du nerf vague : implications thérapeutiques en gastroentérologie Anti-inflammatory properties of the vagus nerve: therapeutic implications in gastroenterology 1. Clinique Universitaire d’Hépato-Gastroentérologie, CHU de Grenoble, CS-10217, 38043 Grenoble Cedex 09 2. Stress et Interactions Neuro-Digestives, Grenoble Institut des Neurosciences (GIN), Inserm U836, Grenoble BBonaz@chu-grenoble.fr

Résumé Le nerf vague assure la liaison entre le système nerveux central et le tube digestif. C’est un nerf mixte comprenant 80 % de fibres afférentes et 20 % de fibres efférentes. Il a des propriétés anti-inflammatoires à la fois via ses fibres afférentes capables d’activer l’axe corticotrope en réponse à un stress immunitaire et, de découverte plus récente, via ses fibres efférentes. En effet, la libération d’acétylcholine à l’extrémité de ses fibres efférentes est capable d’inhiber la libération de TNF par les macrophages. Cette propriété anti-TNF du nerf vague peut être utilisée dans le traitement des maladies inflammatoires chroniques de l’intestin mais également dans la polyarthrite rhumatoïde. La neurostimulation vagale peut avoir un intérêt dans cette approche thérapeutique non médicamenteuse en alternative aux anti-TNF conventionnels ou en alternative aux thérapies médicamenteuses.

Mots-clés Balance sympatho-vagale ; Maladies inflammatoires chroniques de l’intestin ; Nerf vague ; Neurostimulation vagale ; Voie cholinergique anti-inflammatoire

Abbréviations ACh : acétylcholine ; ACTH : hormone adrénocorticotrope ; CRF : corticotrophin-releasing factor ; HRV : «heart rate variability» ; IL : interleukine ; MC : maladie de Crohn ; MICI : maladies inflammatoires chroniques de l’intestin ; NV : nerf vague ; NSV : neurostimulation vagale ; NTS : noyau du tractus solitaire ; SNC : système nerveux central ; TD : tube digestif ; TNF : tumor necrosis factor ; VCA : voie cholinergique anti-inflammatoire.

Abstract The vagus nerve is the link between the central nervous system and the digestive tract. It is a mixed nerve composed of 80% and 20% of afferent and efferent fibers respectively. The vagus nerve has anti-inflammatory properties both through its afferents, through the hypothalamicpituitary adrenal axis, and more recently described, through its efferents. Indeed, the release of acetylcholine at the distal end of the vagus nerve is able to inhibit the release of TNF by macrophages. This anti-TNF effect could be used in the treatment of inflammatory bowel diseases but also rheumatoid arthritis. Vagus nerve stimulation may be of interest as a non-drug therapy in alternative to conventional anti-TNF or to drug therapies.

Keywords Cholinergic anti-inflammatory pathway; Inflammatory bowel diseases; Sympatho-vagal balance; Vagus nerve; Vagus nerve stimulation.

Neurosciences

Bruno Bonaz1, 2

Hegel Vol. 5 N° 3 - 2015

174

Introduction Le nerf vague (NV) ou nerf pneumogastrique ou Xe nerf crânien est le nerf le plus long de l’organisme. C’est un nerf mixte, à la fois sensitif et moteur, somatique et végétatif. Il participe à l’innervation du pharynx, du larynx, de l’œsophage, et de tous les viscères thoraciques et abdominaux. Le NV fait partie du système nerveux parasympathique qui constitue, avec le système nerveux sympathique dont il est classiquement antagoniste, le système nerveux autonome. Le NV assure notamment la liaison bidirectionnelle entre le système nerveux central (SNC) et le tube digestif (TD) au sein du système nerveux autonome. C’est donc un acteur majeur des relations neuro-digestives ou « brain-gut interactions » des Anglo-saxons. Cette communication réciproque assure un fonctionnement intégré pour assurer le contrôle des fonctions digestives telles que la motricité, la sensibilité, l’immunité, la satiété ; ces fonctions peuvent devenir, dans certaines conditions, pathologiques [1, 2]. Le NV est un nerf mixte comprenant 80 % de fibres afférentes et 20 % de fibres efférentes véhiculant respectivement les informations en provenance du TD vers le SNC et inversement. Le contingent efférent du NV ou premier neurone vagal prend son origine au niveau du bulbe, dans le noyau moteur dorsal du vague, et s’articule avec un deuxième neurone, dit post-ganglionnaire, situé dans la paroi digestive au sein même du système nerveux entérique (ou intrinsèque), véritable « deuxième cerveau » du TD assurant une autonomie motrice et sécrétoire au TD. Classiquement, le NV innerve tout le TD jusqu’au colon transverse encore que, pour certains anatomistes, il innerverait tout le TD chez l’Homme. En complément de cette innervation efférente vagale, on trouve le contingent efférent parasympathique pelvien (S2-S4) qui constitue les nerfs pelviens, équivalents du NV, qui vont s’articuler avec des neurones situés dans le TD (neurones post-ganglionnaires). Le parasympathique pelvien innerve la fin du TD, classiquement le colon gauche et le rectum, et la vessie. Le neurotransmetteur du système parasympathique vagal et pelvien est l’acétylcholine (ACh) qui agit sur des récepteurs muscariniques ou nicotiniques. Les fibres afférentes vagales véhiculent les informations en provenance du TD vers le SNC et permettent au SNC d’être informé, de façon consciente ou inconsciente, par notre TD. Il s’agit de fibres prenant naissance dans les différentes parois du TD pour se terminer au niveau du bulbe et plus particulièrement dans le noyau du tractus solitaire (NTS) selon une viscérotopie bien déterminée. Le NTS est situé audessus du noyau moteur dorsal du vague, à l’origine des efférences vagales, avec lequel il fait des boucles réflexes à l’origine du classique réflexe vago-vagal. Les corps cellulaires des afférences vagales sont situés dans les ganglions plexiformes, au niveau cervical. Le NTS est un noyau sensitif important qui va ensuite projeter les informations en provenance du TD via les afférences vagales vers l’hypothalamus, le système limbique, le noyau parabrachial pontique (gros noyau sensitif de relai), le thalamus… pour donner lieu à des réactions autonomiques, comportementales, endocriniennes. Les afférences vagales sont sensibles aux nutriments contenus dans la lumière digestive, elles contiennent des chémorécepteurs, thermorécepteurs, osmorécepteurs, mécanorécepteurs par opposition aux afférences sympathiques qui véhiculent essentiellement les voies de la douleur viscérale digestive vers la moelle épinière. A l’exception de la douleur, la plupart des informations nerveuses provenant des viscères ne sont pas conscientes, excepté dans des conditions pathologiques.

Propriétés anti-inflammatoires du nerf vague Le NV est un nerf « doublement » anti-inflammatoire via ses afférences mais également ses efférences [1, 2].

Propriétés anti-inflammatoires des afférences vagales La libération dans les tissus périphériques de médiateurs de l’inflammation tels que les cytokines proinflammatoires interleukine (IL)-1beta, IL-6 et tumor necrosis factor (TNF) est capable d’activer les afférences vagales via leur interaction avec des récepteurs sur les para-ganglions des afférences du NV. C’est ainsi que, chez l’animal, la réalisation d’un choc septique par injection systémique ou intrapéritonéale de lipopolysaccharide, composant essentiel de la paroi des bactéries à Gram négatif, qui est une endotoxine pyrogène, entraîne une activation des afférences vagales. L’information périphérique va être intégrée au niveau du NTS puis de là, véhiculée sur l’hypothalamus via des projections du NTS sur le noyau paraventriculaire de l’hypothalamus et plus particulièrement sur des neurones qui contiennent le corticotrophin-releasing factor (CRF), principal neuromédiateur du stress. Ces neurones à CRF projettent sur l’anté-hypophyse pour favoriser la libération d’hormone adrénocorticotrope (ACTH) qui va stimuler

Hegel Vol. 5 N° 3 - 2015

175

la libération de glucocorticoïdes (cortisol) aux propriétés anti-inflammatoires bien connues. La finalité étant d’atténuer/annuler la réaction inflammatoire à point de départ périphérique. C’est le classique axe hypothalamo-hypophysaire-surrénalien ou axe corticotrope, axe de réponse au stress qui participe à l’axe neuro-endocrinien-immunitaire qui assure l’homéostasie de l’organisme. Le concept de stress a été décrit initialement par Hans Selye en 1936 [3] défini comme la réponse non spécifique de l’organisme à une demande, en l’occurrence un « stresseur » qui peut être soit intéroceptif (venant de l’intérieur de l’organisme), par exemple une inflammation digestive, ou extéroceptif (venant de l’extérieur de l’organisme), par exemple un stress psychologique. En 1950, Geoffrey Harris a fait un grand pas en avant dans la cartographie du circuit du stress neuroendocrine en démontrant que les facteurs de stress induisent une activation de l’axe corticotrope. Guillemin, un étudiant en thèse de Selye, et Schally ont par la suite rapporté de façon indépendante l’existence d’un facteur hypothalamique capable de stimuler la libération d’ACTH par l’hypophyse [4]. Cette activation de l’axe corticotrope à partir d’un stimulus périphérique peut être mise en évidence en utilisant l’expression du proto-oncogène c-fos, classique marqueur d’activation neuronale, qui est exprimé par des neurones « activés » par divers stimuli douloureux, inflammatoires, psychologiques, hormonaux… et qui vont exprimer la protéine Fos que l’on peut détecter par immunohistochimie ou par hybridation in situ (ARNm du c-fos). Il est ainsi possible de cartographier les voies neuronales centrales activées par un stimulus périphérique, notamment une colite expérimentale [5].

Propriétés anti-inflammatoires des efférences vagales Elles ont été décrites beaucoup plus récemment par l’équipe de Kevin Tracey aux USA [6]. Cette équipe a montré, en 2000, que l’induction d’un choc septique chez le rat par injection IV de lipopolysaccharide était prévenue en stimulant les efférences vagales. Ces auteurs ont montré que, chez ces animaux dont le NV était sectionné (vagotomie) au niveau cervical et dont on stimulait le bout périphérique, c’est-à-dire les efférences, le choc septique était prévenu. Ce même groupe a montré que cet effet antiinflammatoire était médié par la libération d’ACh agissant non pas sur des récepteurs muscariniques mais sur des récepteurs alpha 7 nicotiniques des macrophages [7]. En effet, la libération par les macrophages de TNF était inhibée après neurostimulation vagale (NSV) chez des animaux invalidés pour les récepteurs alpha7 nicotiniques. Le NV a donc un effet anti-TNF via la libération d’ACh à ses extrémités, cet ACh se liant sur des récepteurs alpha7 nicotiniques des macrophages pour inhiber la libération de TNF, cet effet étant activé par la NSV. Tracey a décrit cette voie anti-inflammatoire comme « la voie cholinergique antiinflammatoire (VCA) » (« cholinergic anti-inflammatory pathway ») [8]. Le NV est le siège, pour Tracey, d’un « réflexe inflammatoire » c’est-à-dire que l’activation des afférences vagales par un processus inflammatoire périphérique va stimuler, en retour, les efférences vagales pour entrainer un effet antiinflammatoire anti-TNF via un réflexe vago-vagal afférent-efférent. La vagotomie tronculaire cervicale ou abdominale prévient cet effet car elle interrompt ce réflexe. On imagine, bien entendu, les implications thérapeutiques de la stimulation vagale selon différentes voies d’activations que nous détaillerons plus loin. Le rôle de la rate a également été discuté dans cet effet anti-TNF de la NSV. Pour l’équipe de Tracey, la NSV entrainerait une inhibition de la libération de TNF par la rate, source importante de TNF dans l’organisme, par les macrophages spléniques. Il y aurait une interaction entre le NV et le nerf sympathique splénique qui innerve la rate [9]. Si le système sympathique et parasympathique sont classiquement antagonistes, dans ce cas, au niveau splénique, ils seraient agonistes. La libération de noradrénaline par le nerf splénique, sous l’effet de l’activation cholinergique du NV, se fixerait sur des récepteurs béta2 des lymphocytes spléniques qui libéreraient de l’ACh qui va se fixer sur des récepteurs alpha7 nicotiniques des macrophages de la rate pour inhiber la libération de TNF par ces macrophages. Toutefois ce concept est contredit par certains. En effet, l’innervation cholinergique de la rate est discuté par certains et l’ACh libéré par le nerf vague n’interréagirait pas directement avec le nerf sympathique splénique mais indirectement par l’intermédiaire de lymphocytes T circulants qui libéreraient de l’ACh (source non neuronale d’ACh) favorisant la libération de noradrénaline par les terminaisons spléniques qui agiraient sur des récepteurs béta2 des macrophages pour inhiber la libération de TNF par ces macrophages [10]. Il est à noter que le stress, qui est impliqué dans la physiopathogénie des maladies inflammatoires chroniques de l’intestin (MICI : maladie de Crohn, rectocolite hémorragique) [1] entraîne une inhibition vagale et une activation du système sympathique favorisant ainsi la réaction pro-inflammatoire (11]. Toute hypotonie vagale avec ou sans hypertonie sympathique peut donc favoriser un processus inflammatoire. Toute anomalie de la balance sympatho-vagale, reflet de l’équilibre entre les systèmes sympathique et parasympathique, dans le sens d’un dysfonctionnement du NV notamment, peut avoir un effet pro-inflammatoire. L’étude de la variabilité cardiaque (HRV : « heart rate variability » des Anglo-saxons) permet d’étudier cette balance sympatho-vagale à la recherche d’une hypotonie vagale et/ou d’une hypertonie sympathique [12]. Nous avons montré qu’il y avait des anomalies de cette balance sympatho-vagale dans le syndrome de l’intestin irritable mais également dans les MICI et que

Hegel Vol. 5 N° 3 - 2015

176

ces anomalies pouvaient être corrélées à l’ajustement psychologique des patients [12]. Nous avons également montré qu’une hypotonie vagale était corrélée au taux de TNF circulant chez des patients avec MC [13]. Donc, tout rétablissement de cette balance sympatho-vagale est donc susceptible de contrebalancer un processus pro-inflammatoire.

Implications thérapeutiques de la voie cholinergique antiinflammatoire De par ses propriétés anti-TNF, le NV peut être un outil thérapeutique dans le traitement des maladies où la voie du TNF est prédominante telles que les MICI, la polyarthrite rhumatoïde, le psoriasis…. Par ailleurs, des données montrent qu’au cours de l’iléus post-opératoire il y a une activation des macrophages péritonéaux lors de la mobilisation des viscères qui entraine un ileus via une libération de TNF par ces macrophages. La stimulation du NV qu’elle soit pharmacologique, par des agonistes alpha7 nicotiniques notamment, ou par neurostimulation, s’accompagne d’une inhibition de l’ileus post-opératoire [14]. Différentes approches sont possibles pour stimuler la VCA [1, 2]. Tout d’abord la voie pharmacologique des agonistes alpha 7 nicotiniques tels que le GTS-21, le AR-R17779 qui ont montré leur intérêt dans des modèles d’ileus post-opératoire, de pancréatite aigüe. L’autre possibilité est la voie nutritionnelle telle que l’ingestion d’aliment riche en graisses qui vont stimuler, au niveau duodénal, la libération de cholecystokinine par les cellules I qui va agir sur des récepteurs des afférences vagales pour, par voie réflexe vago-vagale excitatrice, entrainer une activation de la VCA. A l’inverse, on connait l’effet antiinflammatoire du jeune. Cet effet pourrait être médié par la libération de ghréline par le fundus qui activerait ensuite la VCA [15]. En effet, des souris invalidées pour la grhéline ont une suppression de la VCA comme démontré par une réduction de l’activité du NV et une augmentation des taux plasmatiques d’IL-1beta et d’IL-6. Cet effet est réversé par l’administration de ghréline ou de nicotine qui entrainent une activation de la VCA. Une activation du système cholinergique central entrainant une activation de la VCA a été décrite chez le rat après injection centrale (intra-cérébroventriculaire) de CNI 1493 (semapimod), un guanylhydrazone tétravalent, inhibiteur des P38MAPkinase, qui active le noyau moteur dorsal du vague et donc la VCA. Il a été montré que l’injection de CNI 1493 stimulait l’activité électrique du NV. Cet effet est aboli par la vagotomie prouvant bien l’imputabilité du NV [16]. De même, l’administration périphérique d’un anti-cholinestérasique capable de franchir la barrière hémato-encéphalique et de stimuler le système cholinergique central, comme la galantamine, utilisé dans le traitement de la maladie d’Alzheimer, est capable d’activer la VCA et d’inhiber la libération périphérique de TNF au cours d’un choc endotoxinique chez l’animal. Cet effet disparait après administration d’un antagoniste muscarinique à action centrale ou chez l’animal invalidé pour les récepteurs alpha 7 nicotiniques [17]. Chez l’animal, la galantamine est capable d’améliorer une colite expérimentale [18]. L’hypnose a un effet antiinflammatoire probablement en partie en augmentant l’activité vagale comme cela a été démontré par l’étude de la variabilité cardiaque [19]. Il est probable également que d’autres techniques comme la pleine conscience (« mindfulness ») qui est capable d’activer la VCA a des propriétés anti-inflammatoires via une augmentation de la variabilité cardiaque [20]. Il en est de même pour la méditation [21]. L’activité physique est connue pour réduire l’activité inflammatoire systémique et elle est reconnue comme intervention à visée anti-inflammatoire. Par ailleurs, les individus avec activité physique régulière ont un risque moindre de développer des maladies chroniques. Si son mécanisme d’action n’est pas très bien connu, il pourrait impliquer la VCA dans la mesure où des niveaux d’activité physique élevés sont associés avec une augmentation du tonus vagal et des niveaux bas de CRP, un marqueur inflammatoire classique [22]. L’activité physique a donc un effet anti-inflammatoire potentiel dans les pathologies inflammatoires qu’elle soit utilisée de façon isolée ou associée à un traitement. Enfin, la NSV est une voie thérapeutique nouvelle, non médicamenteuse, des maladies inflammatoires chroniques à médiation TNF [1, 2].

La neurostimulation vagale dans le traitement des MICI La NSV est classiquement utilisée dans le traitement de l’épilepsie réfractaire aux traitements [2]. Dans ce cas le principe est d’implanter une électrode spiralée autour du NV gauche relié à un neurostimulateur implanté en position sous-claviculaire gauche ou axillaire gauche après tunnelisation de l’électrode sous la peau au cours d’une intervention chirurgicale d’une durée d’environ 1 heure classiquement réalisée par un neurochirurgien. C’est le NV gauche qui est choisi pour être stimulé, tant chez l’Homme que chez l’animal, car le NV droit innerve le nœud sino-auriculaire et sa stimulation entraine une réduction importante du

Hegel Vol. 5 N° 3 - 2015

177

rythme cardiaque, ce qui n’est pas le cas du NV gauche. C’est la société Cyberonics (Houston, Texas, USA ; http://us.cyberonics.com/en/) qui commercialise les électrodes et les neurostimulateurs. La NSV a été approuvée pour le traitement de l’épilepsie par la FDA aux USA en 1997 et en 2001 en Europe. Elle est aussi approuvée pour le traitement de la dépression réfractaire au traitement. Dans ces deux indications, la stimulation se fait à haute fréquence (20-30 Hz) sensée activer les afférences vagales et donc avoir un effet central. Si son effet mécanistique est mal connu dans l’épilepsie et la dépression, il serait susceptible de passer par un effet sur certaines structures nerveuses centrales dont le locus coeruleus, principal noyau noradrénergique central situé au niveau du pont et dont les projections se font sur l’hippocampe, le cortex frontal. Le thalamus serait également impliqué de par ses projections sur le cortex, ainsi que des modifications du système limbique (amygdale et hippocampe). Classiquement, les paramètres utilisés dans la NSV à visée anti-épileptique/dépressive sont : intensité 0,5–3,5 mA, fréquence 20–30 Hz, largeur d’impulsion 500 microsecondes, stimulation ON 30–90 s et stimulation OFF 5 min. Par contre, pour stimuler la VCA, la NSV est utilisée à basse fréquence (5-10 Hz), sensée activer les efférences vagales, les autres paramètres étant identiques. Dans le cadre des MICI, la première étude expérimentale ayant démontré un effet anti-inflammatoire de la VCA repose sur les travaux de Miceli & Jacobson [23] qui montraient que l’administration préalable d’anticholinestérasiques tels que la néostigmine ou la physostigmine entrainaient une amélioration d’une colite expérimentale chez le rat. Cet effet était plus marqué pour la physostigmine, qui franchit la barrière hémato-encéphalique, en faveur d’un mécanisme central prédominant. Ghia et al. [24] ont montré qu’une vagotomie entraînait une aggravation d’une colite expérimentale chez la souris, démontrant ainsi le rôle protecteur du NV. Nous avons démontré, pour la première fois, chez un animal vigil non vagotomisé, que la NSV à basse fréquence (5 Hz) entrainait une amélioration d’une colite expérimentale au TNBS, classiquement utilisée comme modèle de MC [25]. Nous avons aussi montré que, la stimulation à basse fréquence supposée stimuler les efférences vagales, stimule également les afférences vagales comme le démontre une étude d’IRM cérébrale chez l’animal ou la NSV à basse fréquence entraîne une désactivation dans le NTS, porte d’entrée des afférences vagales, ainsi que dans ses sites de projection [26]. Donc la NSV à basse fréquence stimule à la fois les efférences et les afférences vagales ce qui suppose qu’elle stimule les deux voies anti-inflammatoires du NV : la VCA et l’axe corticotrope. Cela confirme d’ailleurs des données IRMf chez l’Homme qui montre qu’une NSV à basse fréquence entraine des modifications d’activité cérébrale. Dans le cadre d’une approche translationnelle pour passer de l’animal à l’Homme avec MC, nous menons une étude pilote de NSV chez des patients avec MC modérée à sévère en alternative aux anti-TNF ou chez des patients naïfs de traitement (ClinicalTrials.gov Identifier: NCT01569503). Nous avons implanté 7 patients dont 2 étaient en échec d’Imurel au moment de l’implantation et 5 naïfs de tout traitement. Deux patients ont été un échec : le premier patient a été opéré d’une résection iléocaecale pour MC fistulisante naïve de tout traitement. Ce patient a choisi de poursuivre la NSV car il avait observé un effet bénéfique initialement de la NSV et qu’il ne voulait pas de traitement médicamenteux dont il craignait les effets secondaires. La deuxième patiente a été mise sous une association Rémicade + Imurel et elle est actuellement en rémission profonde (clinique, biologique, endoscopique). Les 5 autres patients sont en rémission uniquement sous NSV avec un recul de 6 à 38 mois. En particulier, le premier patient que nous avons implanté l’a été en avril 2012, alors qu’il était en poussée sous Imurel pour une MC iléale aux antécédents de résection iléo-caecale. Ce patient est actuellement en rémission profonde et nous avons pu arrêter l’Imurel depuis 24 mois, soit 14 mois après l’implantation de la NSV. Il s’agit du premier cas de NSV dans la MC que nous avons rapporté dans la littérature [27]. La NSV apparait donc comme un traitement non médicamenteux intéressant dans la MC, soit comme alternative aux anti-TNF, du fait de ses propriétés anti-TNF, voire comme alternative aux traitements médicamenteux (cela a été le cas chez 5 de nos 7 patients). L’avantage est d’utiliser une voie antiinflammatoire intrinsèque non médicamenteuse, de se prémunir des effets iatrogènes potentiels des traitements et des problèmes d’observance rapportés chez 30 à 50 % des patients avec MICI. Par ailleurs, la NSV permet une économie financière dans la mesure où l’ensemble électrode + neurostimulateur coûte environ 9000 euros. La batterie d’un neurostimulateur dure 5 à 10 ans. Une alternative à la NSV dite invasive neurochirurgicale pourrait être la NSV non invasive par voie transauriculaire (ta-NSV) dont le but est de stimuler la conche de l’oreille (concha auriculae), partie de l’oreille innervée par la branche auriculaire du nerf vague, dont la stimulation activerait le « réflexe inflammatoire ». Une étude d’imagerie cérébrale fonctionnelle a récemment montré que la neurostimulation de cette région s’accompagnait d’une activation cérébrale dans la zone du NTS et de ses projections [28]. D’ailleurs, la ta-NSV est déjà utilisée dans l’épilepsie dans le cadre d’essais cliniques (ClinicalTrials. gov Identifier: NCT02004340) et on dispose de quelques données publiées [29]. L’appareillage est commercialisé sous le nom de Nemos par la société Cerbomed (Erlangen, Allemagne). La NSV peut aussi être utilisée dans le traitement d’autres pathologies à médiation TNF telles que la polyarthrite rhumatoïde. Des données expérimentales ont montré son intérêt [30] et un essai clinique

Hegel Vol. 5 N° 3 - 2015

178

est terminé depuis mai 2014 (ClinicalTrials.gov Identifier: NCT01552941) et les résultats sont en attente, mais également dans le psoriasis bien qu’aucun essai ne soit enregistré sur ClinicalTrial.gov à ce jour. Le syndrome de l’intestin irritable, classiquement décrit comme une anomalie des relations neurodigestives et qui est caractérisé, comme les MICI, par des anomalies de la balance sympatho-vagale avec notamment une hypotonie vagale et inversement une hypertonie sympathique [12], et classiquement décrit par certains comme une MICI à minima, est potentiellement une cible thérapeutique de la NSV. D’ailleurs, dans le cadre d’une collaboration avec des collègues de Lyon et de St-Etienne, nous menons une étude pilote dans ce sens (ClinicalTrials.gov Identifier: NCT02420158). Une étude est également en cours dans le cadre de la NSV per-opératoire pour prévenir l’ileus post-opératoire (ClinicalTrials.gov Identifier: NCT01572155).

Conclusion Le NV a des propriétés intrinsèques liées à ses fibres afférentes, par activation de l’axe corticotrope, et à ses fibres efférentes, par activation de la VCA à effet anti-TNF. Une activation de cette dernière voie a un intérêt potentiel dans le traitement des MICI mais également de la polyarthrite rhumatoïde et d’autres pathologies (psoriasis, ileus post-opératoire, syndrome de l’intestin irritable…). Dans ce contexte, la NSV qu’elle soit invasive (neurochirurgicale) ou non invasive (trans-auriculaire) a un intérêt potentiel.

Références 1. Bonaz BL, Bernstein CN. Brain-gut interactions in inflammatory bowel disease. Gastroenterology 2013 Jan;144(1):3649. 2. Bonaz B, Picq C, Sinniger V, Mayol JF, Clarençon D. Vagus nerve stimulation: from epilepsy to the cholinergic antiinflammatory pathway. Neurogastroenterol Motil 2013 Mar;25(3):208-21. 3. Selye H. A syndrome produced by diverse nocuous agents. 1936. J Neuropsychiatry Clin Neurosci 1998 Spring;10(2):230-1. 4. Taché Y, Brunnhuber S. From Hans Selye’s discovery of biological stress to the identification of corticotropinreleasing factor signaling pathways: implication in stress-related functional bowel diseases. Ann N Y Acad Sci. 2008 Dec;1148:29-41. 5. Porcher C, Sinniger V, Juhem A, Mouchet P, Bonaz B. Neuronal activity and CRF receptor gene transcription in the brains of rats with colitis. Am J Physiol Gastrointest Liver Physiol 2004 Oct;287(4):G803-14. 6. Borovikova LV, Ivanova S, Zhang M, Yang H, Botchkina GI, Watkins LR, Wang H, Abumrad N, Eaton JW, Tracey KJ. Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin. Nature 2000 May 25;405(6785):458-62. 7. Wang H, Yu M, Ochani M, Amella CA, Tanovic M, Susarla S, Li JH, Wang H, Yang H, Ulloa L, Al-Abed Y, Czura CJ, Tracey KJ. Nicotinic acetylcholine receptor alpha7 subunit is an essential regulator of inflammation. Nature 2003 Jan 23;421(6921):384-8. 8. Pavlov VA, Wang H, Czura CJ, Friedman SG, Tracey KJ. The cholinergic anti-inflammatory pathway: a missing link in neuroimmunomodulation. Mol Med 2003 May-Aug;9(5-8):125-34. 9. Rosas-Ballina M, Ochani M, Parrish WR, Ochani K, Harris YT, Huston JM, Chavan S, Tracey KJ. Splenic nerve is required for cholinergic antiinflammatory pathway control of TNF in endotoxemia. Proc Natl Acad Sci U S A 2008 Aug 5;105(31):11008-13. 10. Martelli D, McKinley MJ, McAllen RM. The cholinergic anti-inflammatory pathway: a critical review. Auton Neurosci 2014 May;182:65-9. 11. Taché Y, Bonaz B. Corticotropin-releasing factor receptors and stress-related alterations of gut motor function. J Clin Invest 2007 Jan;117(1):33-40. 12. Pellissier S, Dantzer C, Canini F, Mathieu N, Bonaz B. Psychological adjustment and autonomic disturbances in inflammatory bowel diseases and irritable bowel syndrome. Psychoneuroendocrinology 2010 Jun;35(5):653-62. 13. Pellissier S, Dantzer C, Mondillon L, Trocme C, Gauchez AS, Ducros V, Mathieu N, Toussaint B, Fournier A, Canini F, Bonaz B. Relationship between vagal tone, cortisol, TNF-alpha, epinephrine and negative affects in Crohn’s disease and irritable bowel syndrome. PLoS One 2014 Sep 10;9(9):e105328. 14. de Jonge WJ, van den Wijngaard RM, The FO, ter Beek ML, Bennink RJ, Tytgat GN, Buijs RM, Reitsma PH, van Deventer SJ, Boeckxstaens GE. Postoperative ileus is maintained by intestinal immune infiltrates that activate inhibitory neural pathways in mice. Gastroenterology 2003 Oct;125(4):1137-47. 15. Mao Y, Tokudome T, Kishimoto I, Otani K, Nishimura H, Yamaguchi O, Otsu K, Miyazato M, Kangawa K. Endogenous ghrelin attenuates pressure overload-induced cardiac hypertrophy via a cholinergic anti-inflammatory pathway. Hypertension 2015 Jun;65(6):1238-44. 16. Bernik TR, Friedman SG, Ochani M, DiRaimo R, Ulloa L, Yang H, Sudan S, Czura CJ, Ivanova SM, Tracey KJ. Pharmacological stimulation of the cholinergic antiinflammatory pathway. J Exp Med 2002 Mar 18;195(6):781-8. 17. Pavlov VA, Parrish WR, Rosas-Ballina M, Ochani M, Puerta M, Ochani K, Chavan S, Al-Abed Y, Tracey KJ. Brain acetylcholinesterase activity controls systemic cytokine levels through the cholinergic anti-inflammatory pathway. Brain Behav Immun 2009 Jan;23(1):41-5. doi: 10.1016/j.bbi.2008.06.011. Epub 2008 Jun 27.

Hegel Vol. 5 N° 3 - 2015

179

18. Ji H, Rabbi MF, Labis B, Pavlov VA, Tracey KJ2, Ghia JE. Central cholinergic activation of a vagus nerve-to-spleen circuit alleviates experimental colitis. Mucosal Immunol 2014 Mar;7(2):335-47. 19. Yüksel R, Ozcan O, Dane S. The effects of hypnosis on heart rate variability. Int J Clin Exp Hypn 2013;61(2):16271. 20. Azam MA, Katz J, Fashler SR, Changoor T, Azargive S, Ritvo P. Heart rate variability is enhanced in controls but not maladaptive perfectionists during brief mindfulness meditation following stress-induction: A stratified-randomized trial. Int J Psychophysiol 2015 Jun 25. pii: S0167-8760(15)00215-9. 21. Lumma AL, Kok BE, Singer T. Is meditation always relaxing? Investigating heart rate, heart rate variability, experienced effort and likeability during training of three types of meditation. Int J Psychophysiol 2015 Jul;97(1):3845. 22. Lujan HL, DiCarlo SE. Physical activity, by enhancing parasympathetic tone and activating the cholinergic antiinflammatory pathway, is a therapeutic strategy to restrain chronic inflammation and prevent many chronic diseases. Med Hypotheses 2013 May;80(5):548-52. 23. Miceli PC, Jacobson K. Cholinergic pathways modulate experimental dinitrobenzene sulfonic acid colitis in rats. Auton Neurosci 2003 Apr 30;105(1):16-24. 24. Ghia JE, Blennerhassett P, El-Sharkawy RT, Collins SM.The protective effect of the vagus nerve in a murine model of chronic relapsing colitis. Am J Physiol Gastrointest Liver Physiol 2007 Oct;293(4):G711-8. 25. Meregnani J, Clarençon D, Vivier M, Peinnequin A, Mouret C, Sinniger V, Picq C, Job A, Canini F, Jacquier-Sarlin M, Bonaz B. Anti-inflammatory effect of vagus nerve stimulation in a rat model of inflammatory bowel disease. Auton Neurosci 2011 Feb 24;160(1-2):82-9. 26. Reyt S, Picq C, Sinniger V, Clarençon D, Bonaz B, David O. Dynamic Causal Modelling and physiological confounds: a functional MRI study of vagus nerve stimulation. Neuroimage. 2010 Oct 1;52(4):1456-64. 27. Clarençon D, Pellissier S, Sinniger V, Kibleur A, Hoffman D, Vercueil L, David O, Bonaz B. Long term effects of low frequency (10 hz) vagus nerve stimulation on EEG and heart rate variability in Crohn’s disease: a case report. Brain Stimul 2014 Nov-Dec;7(6):914-6. 28. Frangos E, Ellrich J, Komisaruk BR. Non-invasive Access to the Vagus Nerve Central Projections via Electrical Stimulation of the External Ear: fMRI Evidence in Humans. Brain Stimul 2015; 8: 624-36. 29. Aihua L, Lu S, Liping L, Xiuru W, Hua L, Yuping W. A controlled trial of transcutaneous vagus nerve stimulation for the treatment of pharmacoresistant epilepsy. Epilepsy Behav 2014 Oct;39:105-10. 30. Koopman FA, Schuurman PR, Vervoordeldonk MJ, Tak PP. Vagus nerve stimulation: a new bioelectronics approach to treat rheumatoid arthritis? Best Pract Res Clin Rheumatol 2014 Aug;28(4):625-35.

Liens d’intérêt : aucun

NIH Public Access Author Manuscript Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

NIH-PA Author Manuscript

Published in final edited form as: Curr Behav Neurosci Rep. 2014 June ; 1(2): 64–73. doi:10.1007/s40473-014-0010-5.

Vagus Nerve Stimulation Robert H. Howland, M.D.(1) (1)Department

of Psychiatry; Western Psychiatric Institute and Clinic, University of Pittsburgh Medical Center; Pittsburgh, PA

Abstract

NIH-PA Author Manuscript

The vagus nerve is a major component of the autonomic nervous system, has an important role in the regulation of metabolic homeostasis, and plays a key role in the neuroendocrine-immune axis to maintain homeostasis through its afferent and efferent pathways. Vagus nerve stimulation (VNS) refers to any technique that stimulates the vagus nerve, including manual or electrical stimulation. Left cervical VNS is an approved therapy for refractory epilepsy and for treatment resistant depression. Right cervical VNS is effective for treating heart failure in preclinical studies and a phase II clinical trial. The effectiveness of various forms of non-invasive transcutaneous VNS for epilepsy, depression, primary headaches, and other conditions has not been investigated beyond small pilot studies. The relationship between depression, inflammation, metabolic syndrome, and heart disease might be mediated by the vagus nerve. VNS deserves further study for its potentially favorable effects on cardiovascular, cerebrovascular, metabolic, and other physiological biomarkers associated with depression morbidity and mortality.

Keywords Vagus nerve; vagus nerve stimulation; transcutaneous vagus nerve stimulation; depression; treatment resistant depression; epilepsy; heart failure; metabolic syndrome; inflammation; cytokines; immune system

NIH-PA Author Manuscript

Introduction The sympathetic and parasympathetic components of the autonomic nervous system (ANS) control and regulate the function of various organs, glands, and involuntary muscles throughout the body (e.g., vocalization, swallowing, heart rate, respiration, gastric secretion, and intestinal motility). The vagus nerve (cranial nerve X) is a mixed nerve composed of 20% “efferent” fibers (sending signals from the brain to the body) and 80% “afferent” (sensory) fibers (carrying information from the body to the brain). The efferent cholinergic fibers are the main parasympathetic component of the ANS [1], but an important function of the vagus nerve is transmitting and/or mediating sensory information from throughout the

Corresponding Author: Robert H. Howland, M.D. Associate Professor of Psychiatry University of Pittsburgh School of Medicine Western Psychiatric Institute and Clinic 3811 O’Hara Street Pittsburgh PA 15213 Tel: 412-246-5749 Fax: 412-246-5750 HowlandRH@upmc.edu. Conflict of interest Robert H. Howland received a grant from Cyberonics, NeoSync and Medtronic. Human and animal rights and informed consent This article does not contain any studies with human or animal subjects performed by any of the authors.

Howland

Page 2

NIH-PA Author Manuscript

body to the brain [2]. The right and left vagus nerves exit from the brainstem, and they course through the neck (in the carotid sheath between the carotid artery and jugular vein), upper chest (along the trachea), lower chest and diaphragm (along the esophagus), and into the abdominal cavity [3]. During this course, branches enervate various structures such as the larynx, pharynx, heart, lungs, and gastrointestinal tract. In the brainstem, the sensory afferent fibers terminate in the nucleus tractus solitarius, which then sends fibers that connect directly or indirectly to different brain regions. These regions include the dorsal raphe nuclei, locus ceruleus, amygdala, hypothalamus, thalamus, and orbitofrontal cortex.

NIH-PA Author Manuscript

The term â&#x20AC;&#x153;vagus nerve stimulationâ&#x20AC;? (VNS) can be used generally to describe any technique that stimulates the vagus nerve. An observation first made in the 1880s was that manual massage and compression of the carotid artery in the cervical region of the neck could suppress seizures, an effect attributable to crude stimulation of the vagus [4]. Electrical VNS studies were conducted during the 1930s and 1940s to understand the influence of the ANS on modulating brain activity. Studies in cats and monkeys demonstrated that VNS influenced brain electrical activity. Subsequent studies determined that VNS had anticonvulsant effects on experimentally-induced seizures in dogs [5]. Various forms of paced breathing can also influence brain electrical activity, which might be mediated by VNS arising from the diaphragm [6,7]. Cardio-respiratory stimulation of the vagus nerve may explain some of the positive emotional and cognitive benefits of deep breathing, yoga, or aerobic exercise activities. Dedicated clinical trials eventually led to approval by the United States Food and Drug Administration (FDA) of an implanted VNS device indicated for the treatment of refractory epilepsy in 1997 [8]. The same device was later given an FDA-approved indication for the treatment of chronic treatment resistant depression (chronic TRD) in 2005. Small open-label studies and case series reports have described the use of VNS for rapid cycling bipolar disorder, treatment-resistant anxiety disorders, Alzheimerâ&#x20AC;&#x2122;s disease, chronic refractory headaches, and obesity, although none of these uses has been given FDA approval [9].

Methods of vagus nerve stimulation Left cervical VNS

NIH-PA Author Manuscript

The most common clinical use of VNS involves the surgical implantation of a commercially available programmable pulse generator device (NCP System; Cyberonics, Inc.; Houston, TX) [10]. The implant surgery is performed under general anesthesia, typically as an outpatient procedure. The generator is implanted subcutaneously in the left upper chest or left axillary border. The electrode lead wire is attached to the left mid-cervical vagus nerve through a second incision in the left neck area. The lead wire is passed through a subcutaneous tunnel and attached to the pulse generator. Possible surgical complications include wound infection and hoarseness (due to temporary or permanent left vocal cord paralysis), which occurs in about 1% of patients. A handheld computer programs the pulse generator stimulation parameters via a programming wand placed on the skin over the device. The programmable parameters are the current charge (electrical stimulus intensity, measured in milliamperes (mA)), the pulse width (electrical pulse duration, measured in microseconds), the pulse frequency (measured Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 3

NIH-PA Author Manuscript

in Herz (Hz)), and the on/off duty cycle (the stimulus on-time and off-time, measured in seconds or minutes). Initial settings for the four parameters can each be adjusted to optimize efficacy (for seizure control or for other symptom control depending on the indication) and tolerability. The generator runs continuously, but patients can turn off VNS temporarily by holding a magnet over the device and VNS can be turned on and off by the programmer. The pulse generator battery life depends on the stimulus parameters, and it can be replaced or permanently removed in a simple surgical procedure.

NIH-PA Author Manuscript

The adverse effects of VNS are mostly stimulation-related and therefore experienced for very short intermittent periods of time. Possible adverse effects could be related to the stimulation of any body structure enervated by the vagus nerve, but 80% of fibers are afferent and these electrical pulses are propagated from the point of attachment toward the brain rather than the body. Stimulation from the left mid-cervical vagus nerve most commonly causes voice alteration, cough, dyspnea, dysphagia, and neck pain or paresthesias. Left cervical VNS is believed to minimize potential cardiac effects such as bradycardia or asystole (primarily mediated by the right vagus nerve). Stimulation parameters can be adjusted to make adverse effects more tolerable, but tolerance often occurs with chronic stimulation. Experience in epilepsy populations has shown that VNS is effective, safe, and well tolerated in pediatric patients. There are no identified risks when VNS has been used during pregnancy. VNS is safe and compatible to use together with psychotropic drugs and with electroconvulsive therapy (ECT). Whole body MRI scans cannot be done with VNS implants, but MRI scans of the head are possible using a transmit/ receive head coil [11]. Shortwave, microwave, or therapeutic ultrasound diathermy should not be used, but diagnostic ultrasound is safe. Metal detectors, microwave ovens, cellular telephones, and other electrical or electronic devices will not affect VNS. Right cervical VNS

NIH-PA Author Manuscript

Right cervical VNS reduces seizure activity in animal models, and there is some evidence that this is true in humans [3], but it is not known whether right cervical VNS would effectively treat depressive symptoms. A VNS device system (CardioFit System; BioControl Medical Ltd; Yehud, Israel) has been developed for the treatment of heart failure [12]. This programmable device is implanted in the right chest wall. It is connected to the right cervical vagus using a cuff designed to preferentially activate vagal efferent fibers (intended to affect cardiac function). The stimulator senses heart rate and shuts off at a predetermined threshold of bradycardia. Preclinical studies and one phase II human study suggest that chronic right cervical VNS is safe and effective for treating heart failure [12,13]. A similar VNS system (FitNeS System; BioControl Medical Ltd; Yehud, Israel) has been designed with a cuff electrode that preferentially activates afferent fibers, which is intended to minimize typical VNS side effects related to efferent fiber stimulation. Left cervical VNS using this device has been described in five patients with epilepsy, who showed some benefit and no typical VNS side effects [14]. Transcutaneous forms of VNS The outer ear is supplied by three sensory nerves: the auriculotemporal nerve, the great auricular nerve, and the auricular branch of the vagus nerve (ABVN) [15]. The external

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 4

NIH-PA Author Manuscript

auditory meatus and concha (cymba conchae and cavum conchae) of the ear are supplied mainly by the ABVN, and the cymba conchae is supplied exclusively by the ABVN. A transcutaneous method of VNS (t-VNS) targets the cutaneous receptive field of the ABVN. Applying an electrical stimulus to the left cymba conchae (using a stimulus intensity above the sensory detection threshold, but below the pain threshold) results in a brain activation pattern not dissimilar to that of left cervical VNS [16-18]. The use of t-VNS for treating epilepsy was first proposed in 2000 [19]. A t-VNS device (NEMOS; Cerbomed GmbH; Erlangen, Germany) received European clearance for the treatment of epilepsy and depression in 2010 and for the treatment of pain in 2012. These approvals were based primarily on preclinical studies of t-VNS as well as extrapolating the findings from preclinical and human studies of left cervical VNS.

NIH-PA Author Manuscript

Transcutaneous Electrical Nerve Stimulator (TENS) devices can also be employed to administer t-VNS, by situating contact electrodes in the region of the cymba conchae. Patients can self-administer t-VNS, which can be applied unilaterally or bilaterally (depending on the device system used), but there is no established clinical paradigm for how t-VNS should be administered (i.e., stimulation parameters; duration and frequency of each stimulation session; length of treatment; etc.). The NEMOS manufacturer suggests that each session should last at least one hour and should be used 3-4 times per day, but the basis for this recommendation is unclear. There is some published clinical data (mostly pilot studies) on the use of t-VNS for epilepsy, depression, pain, and other clinical indications, suggesting that it is safe and well tolerated [20-25].

NIH-PA Author Manuscript

Another type of t-VNS device (gammaCore; electroCore LLC; Basking Ridge, NJ, USA) has European clearance for the prophylactic and acute treatment of cluster headache, migraine, hemicrania continua, and medication overuse headache. Therapy using gammaCore is delivered through a hand-held portable device with two flat stimulation contact surfaces that transmits a proprietary electrical signal in the vicinity of the vagus nerve. The device is placed on the neck over the vagus nerve, at a location where the pulse is found. The stimulation intensity is controlled by the patient and the application stimulation lasts for 90 seconds. Patients may experience headache relief when used as needed, but the device can be used several times per day to prevent headaches. Pilot studies and case series reports using the gammaCore device for primary headache syndromes have been described in abstract form and larger controlled trials are underway [26], but this device has not been investigated in epilepsy or depression.

Studies of VNS for Depression Rationale for VNS in depression The rationale for investigating VNS as a treatment for depression is based on various preclinical and clinical studies [27]. In animal models of depression, VNS has antidepressant-like effects [28,29]. VNS has positive effects on mood symptoms in epilepsy, even among those patients whose seizures do not improve. The vagus nerve has direct and indirect connections to the cortical-limbic-thalamic-striatal neural circuit pertinent to emotional and cognitive functions relevant in depression [1]. Functional brain imaging studies in humans demonstrate that VNS influences physiological activity in these areas

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 5

NIH-PA Author Manuscript

[30,31]. Animal and human studies have shown that VNS influences the activity of norepinephrine, serotonin, and other neurotransmitters implicated in mood disorders [1]. Like other antidepressant therapies, VNS increases the expression of the neurotrophin brainderived neurotrophic factor (BDNF) and activates its receptor [32], and also stimulates hippocampal neurogenesis [33]. Clinical trials of left cervical VNS for depression

NIH-PA Author Manuscript

An open-label pilot study first investigated left cervical VNS in 60 patients with chronic TRD [34,35]. These patients had unipolar or bipolar depression, were depressed for an average of nearly 10 years, and had not responded to an average of 16 different antidepressant therapies. After implant, two weeks of post-surgery recovery without stimulation was followed by 10 weeks of active VNS. Approximately 30% responded and 15% achieved remission. Patients who had not responded previously to ECT were less likely to respond. Among 13 patients who had not responded to more than seven different drug treatments previously, none responded to VNS. Of the remaining patients (less than seven prior treatment failures), 39% responded to VNS. During follow-up of 59 patients, 44% were responders (27% remitters) at one year [36] and 42% were responders (22% remitters) at two years [37]. These outcomes demonstrated that the effectiveness of VNS increased with time and was maintained, which is contrary to typical experience with pharmacotherapy in chronic TRD [38]. Patients with fewer previous unsuccessful treatments were more likely to respond or remit during long-term VNS therapy. By two years, two patients had died (unrelated to VNS), four had dropped out, and 48 (81%) were still receiving VNS. The 81% retention rate suggested that VNS was an acceptable treatment and that patients may have derived non-specific therapeutic benefits from the treatment even if they had not achieved a response or remission based on depression rating scale assessments.

NIH-PA Author Manuscript

A multi-center randomized double-blind controlled acute treatment study comparing active (device turned on) and sham (device turned off) left cervical VNS in 235 patients with chronic TRD was subsequently conducted [39]. These patients had unipolar or bipolar disorder, and had not responded to between two and six different antidepressant therapies. After implant, two weeks of post-surgery recovery without stimulation was followed by 10 weeks of active or sham VNS. Response rates (15% active versus 10% sham) based on the primary efficacy outcome measure (Hamilton Rating Scale for Depression (HRSD)) were not significantly different, but there was a significant difference in response rates (17% active versus 7% sham) based on a secondary measure, the Inventory of Depressive Symptomatology Self Report (IDSSR). Only three patients (1%) dropped out because of adverse events. At the end of the acute study, VNS was activated in all patients and 205 were followed in a long-term naturalistic treatment study [40]. A cohort of 124 patients having chronic TRD and receiving treatment as usual (TAU) was enrolled as a naturalistic comparison group [41]. After one year, VNS patients were significantly more likely to be improved (27% response; 16% remission) compared to TAU patients (13% response; 7% remission). This study confirmed that the antidepressant response to VNS tends to increase over time and the majority of patients maintain their response. Only 3% of VNS patients dropped out due to

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 6

adverse events; 90% continued treatment. There was no difference in treatment outcomes for patients with bipolar versus unipolar depression [42].

NIH-PA Author Manuscript

Schlaepfer and colleagues [43] reported the results of an open-label uncontrolled European multicenter study of left cervical VNS in 74 patients with chronic unipolar or bipolar TRD (non-response to 2-6 antidepressant therapies). Half the patients had previously received ECT, including 38% who had received ECT in their current episode. During the first three months post-implant, medication doses and VNS stimulation parameters were kept stable. For the next nine months, medications and VNS stimulation parameters were changed if necessary. After three months, the response rate (based on the HRSD) was 37% and the remission rate was 17%. The one-year and two-year response rates were 53% and 53%, respectively, and the respective remission rates were 33% and 40% [44]. Two patients exited the study because of adverse events, two had VNS explanted, and two committed suicide. Dosing studies of VNS for depression

NIH-PA Author Manuscript NIH-PA Author Manuscript

The safety and effectiveness of three different stimulation levels of left cervical VNS was investigated in a randomized double-blind multicenter study of 331 patients with unipolar or bipolar TRD (non-response to four or more previous antidepressant therapies) [45]. 57% of the patients had previously received ECT, 81% had not responded to six or more antidepressants in their current depressive episode, and nearly half had previously attempted suicide. Patients were randomized to one of three VNS dose-parameter groups: Low (0.25 mA current; 130 microsec pulse width), Medium (0.5-1.0 mA; 250 microsec), or High (1.25-1.5 mA; 250 microsec). Stimulation parameters were stable within each group for the first 22 weeks (acute phase), after which the output current could be increased if necessary until week 50 (end of study). During the acute phase, all groups showed statistically significant improvement on the primary efficacy measure (change from baseline on the IDSClinician Rated scale), but there were no differences between groups. Mean change in these scores showed continued improvement by week 50. A composite measure of total charge delivered per day was significantly correlated with depressive symptom improvement (i.e., a greater total charge was associated with decreasing depressive symptoms). Response and remission rates (for each group) were numerically higher at week 50 than at week 22, but there were no significant differences of response or remission rates among the groups at week 22 or at week 50. The proportion of responders at week 22 who were also responders at week 50 were substantially higher for the Medium and High groups than for the Low group. Six patients died (two by suicide; four unrelated to the study); 94% remained in the study until week 50. The antidepressant effects of two different VNS stimulation parameters also were evaluated by Muller and colleagues [46] in a retrospective analysis of data derived from two parallel groups of ten patients: Low strength/high frequency (<1.5 mA; 20 Hz) versus high strength/low frequency (>1.5 mA; 15 Hz). At follow-up (duration of VNS treatment was not specified), there was a significant decrease in the HRDS for the low strength/high frequency group, but not the other group.

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 7

Meta-analysis of VNS studies for depression

NIH-PA Author Manuscript

Berry and colleagues [47] recently published a meta-analysis of patient-level data from six multicenter studies of left cervical VNS for TRD. This analysis included patient data from five of the published studies reviewed above and data from an ongoing nonrandomized registry study [48]. The registry compares VNS plus TAU (VNS+TAU; 335 patients) versus TAU (301 patients). The objective of the meta-analysis was to compare response and remission rates (based on the Montgomery-Asberg Depression Rating Scale (MADRS) and the Clinical Global Impressions Improvement (CGI-I) subscale) over time for VNS+TAU (1035 subjects) and TAU (425 subjects) from patient-level data, rather than treatment effect sizes, derived from the six studies. The MADRS response rate for VNS+TAU at 12, 24, 48, and 96 weeks were 12%, 18%, 28%, and 32% versus 4%,7%, 12%, and 14% for TAU. The MADRS remission rates were 3%, 5%, 10%, and 14% for VNS+TAU versus 1%, 1%, 2%, and 4% for TAU. When data were analyzed by odds ratios, VNS+TAU was associated with a significantly greater likelihood of response and remission compared with TAU. For patients who had responded to VNS+TAU at 24 weeks, sustained response was more likely at 48 weeks and at 96 weeks. The analysis of response and remission rates based on the CGI-I similarly distinguished the VNS+TAU and TAU groups.

NIH-PA Author Manuscript

Safety and tolerability of VNS for depression The relative safety, tolerability, and acceptability of VNS in the depression studies are comparable to that seen in epilepsy [8]. The most common adverse effects were voice alteration, cough, dyspnea, dysphagia, and neck pain or paresthesias; were typically mildmoderate in severity; and often improved with time or by adjusting VNS. Insomnia, sedation, sexual dysfunction, weight gain, and cognitive impairment were not associated with VNS. The risk of developing hypomania or mania is low [49]. VNS was not associated with an increased risk of suicidal thoughts, suicide attempts, or completed suicide in the depression studies. Depression-related suicidal symptoms often improved over time.

NIH-PA Author Manuscript

Additional data from the VNS registry found that VNS-treated patients had lower rates of all-cause mortality, completed suicide, suicide thoughts, and suicide attempts compared to TAU patients, although not all of the findings were statistically significant [48]. In a retrospective analysis of Medicare administrative claims data, Feldman and colleagues [50] compared the experience of four groups of Medicare beneficiaries: those receiving left cervical VNS; those defined as having TRD; those defined as having non-TRD; and those defined as general Medicare beneficiaries. Patients receiving VNS had lower annual mortality rates compared to the three other groups. The medical costs per patient-year were found to be similar for the VNS and non-TRD groups, both of which were substantially lower than for the TRD group. Transcutaneous VNS for depression As described previously, auricular t-VNS is an alternative form of stimulating the vagus nerve. Hein and colleagues [25] conducted a randomized sham-controlled pilot study of auricular t-VNS in 37 patients with major depression (not TRD). The t-VNS was administered bilaterally using a TENS microstimulator unit (manufactured by Auri-Stim Medical Inc.; Denver, CO, USA). The stimulation was used for 15 minutes once or twice a Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 8

NIH-PA Author Manuscript

day, five days per week, for two weeks. Active stimulation was set just below the threshold of perception; sham stimulation involved no current. Active-stimulation was associated with a significantly greater improvement on a self-report measure of depression (the Beck Depression Inventory) compared to sham-stimulation after two weeks, but there was no change within or difference between groups on the HRSD. The treatment was well tolerated. Another study of auricular t-VNS for non-chronic depression is currently being conducted [51].

Depression, inflammation, metabolic syndrome, infectious disease, heart disease, and VNS Inflammatory biomarkers, depression, and the heart

NIH-PA Author Manuscript

Studies have shown that depression is an independent risk factor for the development of cardiovascular disease, and that comorbid depression increases the morbidity and mortality of patients with pre-existing heart disease [52,53]. Depression also contributes to the risk of developing cardiac arrhythmias [54]. Heart failure resulting from cardiac ischemia or tachycardia is accompanied by changes in autonomic tone resulting in increased heart rate and decreased heart rate variability. Autonomic dysfunction in heart failure is often associated with neurohormonal activation (e.g., increased plasma norepinephrine, angiotensin II, and endothelin-1), inflammatory biomarkers and cytokines (e.g., tumor necrosis factor alpha and C-reactive protein), metabolic changes, and increased systemic and cardiac oxidant stress [55]. Similarly, autonomic dysregulation, inflammatory/immune system activation, and dysregulated neuro-immune system interactions are implicated in hypertension and cardiovascular disease [56]. There is extensive experience using measures of heart rate variability in diverse disease syndromes, and these studies indicate that decreased heart rate variability and decreased vagus nerve activity is associated with increased morbidity and mortality [57].

NIH-PA Author Manuscript

Complex bidirectional relationships among depression, immune system function, and infectious disease have been described [58,59]. There is considerable evidence from preclinical and clinical studies that acute or chronic infectious disease can increase the risk of developing depression, and this causal effect is mediated by the induction of proinflammatory cytokines [60-62]. Cytokine receptors have been identified in the brain, and cytokines have been shown to activate the hypothalamic-pituitary-adrenal (HPA) axis and to alter neurotransmitter function, both of which are relevant to the pathogenesis of depression. Gut microbiota has a role in priming and regulating whole-body immunoregulatory activity and can influence brain function and behavior [63,64]. The state of depression itself does not cause elevated levels of inflammatory cytokines [65]. The vagus nerve and the neuro-endocrine-immune axis The vagus nerve is a major component of the ANS, has an important role in the regulation of metabolic homeostasis, and plays a key role in the neuro-endocrine-immune axis to maintain homeostasis through its afferent and efferent pathways [66,67]. Stimulation of receptors expressed on immune cells by pathogen-associated molecular patterns or disease-associated molecular patterns induces an increase of pro-inflammatory cytokines that communicate

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 9

NIH-PA Author Manuscript

with the brain through neural and humoral pathways. The vagus nerve mediates an antiinflammatory effect through its afferent pathways involved in the activation/regulation of the HPA axis and adrenal gland corticosteroid release. By contrast, vagus nerve efferents mediate anti-inflammatory processes via direct effects on immune cells or through the splenic sympathetic nerve. This pathway is referred to as the cholinergic anti-inflammatory pathway (CAP). Activation of vagal afferents by inflammatory mediators (such as cytokines) in peripheral tissues results in an inflammatory reflex in which vagal efferents inhibit inflammation by suppressing cytokine production via the CAP.

NIH-PA Author Manuscript

Experimental studies (e.g., animal models of endotoxemia, sepsis, shock, and colitis) have demonstrated that invasive VNS significantly alters pro-inflammatory cytokines and other measures of inflammation. Right and left VNS also has favorable effects on focal cerebral ischemia in animal studies and this does not appear to be related to alterations in cerebral blood flow [68,69]. Transcutaneous VNS was shown to reduce pro-inflammatory biomarkers and improve survival in a murine sepsis model [70]. Clinical studies of inflammatory markers in VNS-treated epilepsy patients are limited. Some of these studies, but not all, have demonstrated alterations associated with VNS [71-74]. It should be noted that these patients had epilepsy and were not studied under conditions of inflammation. Corcoran and colleagues [75] measured various peripheral cytokines before and three months after left cervical VNS implantation in ten patients with TRD. They found increases in certain pro-inflammatory and anti-inflammatory peripheral cytokines. Levels of inflammatory cytokines and nitric oxide synthase (NOS; an enzyme that catalyzes nitric oxide (NO), which is a highly reactive free radical oxygen species that functions as a gaseous signaling molecule) are elevated in heart failure. In experimental animal studies of heart failure, VNS modulates the inflammatory response and NOS production [55]. In humans, stress and depression have been associated with changes in NO [76,77]. Interferonalpha has been shown to induce NOS and NO release [78]. Interferon-alpha is an innate immune cytokine that has anti-viral and anti-proliferative activities, is a potent stimulator of pro-inflammatory cytokines in the periphery and central nervous system, and induces depression. Whether VNS influences NOS or NO in humans with heart disease or depression is unknown.

NIH-PA Author Manuscript

Various antidepressant therapies can suppress or attenuate pro-inflammatory processes [79], although the presence of inflammatory biomarkers is associated with a less than optimal response to standard antidepressant drugs [80,81]. As a result, novel pharmacologic agents that target inflammatory processes, either directly or indirectly, are of interest as potential antidepressant therapies and are now being investigated [80,81]. The central role of the vagus nerve in the regulation of the neuro-endocrine-immune axis might be a potential mechanism of action for VNS in the treatment of depression. Moreover, the known associations between depression, cardiovascular disease, cerebrovascular disease, metabolic syndrome, infectious disease, and other health conditions suggests that using VNS as a treatment for depression might have primary, secondary, and/or tertiary prevention benefits for many or all of these associated conditions [67,82]. If so, overall morbidity and mortality might be favorably influenced by long-term VNS therapy and might be safer than antidepressant drugs [83].

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 10

Conclusions NIH-PA Author Manuscript

The relative antidepressant effectiveness of VNS Left cervical VNS is an approved therapy for epilepsy and for TRD, but its antidepressant efficacy is modest. In a critical review, Martin and Martin-Sanchez [84] concluded that insufficient data are available to even describe VNS as effective in the treatment of depression. They suggest that its positive effects may be mediated by the placebo effect, regression toward the mean, spontaneous remission, or the Hawthorne effect; that it is not clear that its potential benefit is outweighed by possible harm; and that solid evidence of an antidepressant effect should be based exclusively on long-term clinical trials with a control group.

NIH-PA Author Manuscript

In their analysis, however, the authors mix epilepsy studies and depression studies. They also fail to discuss the unique nature of the patient population enrolled in the VNS depression studies [85]. These depressed patients are distinguished by the chronicity of their depressive disorder (average length of illness more than 25 years and average length of current episode nearly seven years), their extensive history of treatment non-response (average of seven drug failures and more than 50% having received ECT), and their rates of lifetime hospitalizations and suicide attempts. Such patients are invariably excluded from most clinical treatment trials, except perhaps for studies of deep brain stimulation [9]. A placebo effect, spontaneous remission, or simply observing these patients (the Hawthorne effect) are unlikely to explain even modest improvements (compared to TAU) among patients with these clinical characteristics. The tolerability and safety of implanted VNS systems has been well established based on world-wide experience with epilepsy and depression patients, including children and adolescents [8]. Conducting a long-term controlled trial in TRD would be scientifically ideal, but technically challenging and ethically problematic.

NIH-PA Author Manuscript

In the Sequenced Treatment Alternatives to Relieve Depression (STAR*D) trial [86], the majority of patients had chronic or recurrent depression, but they were not considered treatment-resistant and they were less severely and chronically ill than patients enrolled in the VNS studies. Treatment was rendered sequentially through four levels (each lasting up to 12 weeks) of various antidepressant therapies. Patients with an unsatisfactory treatment response at any level moved to the next level. Rates of intolerance, defined as the proportion of patients exiting a level because of adverse events, ranged from 16-35% at each of the four levels. Altogether, the cumulative remission rate after up to four levels of treatment was 67%. About 33% of patients therefore did not achieve remission after up to four levels of treatment, and a substantial minority was treatment intolerant. Relapse was assessed during a 1-year naturalistic follow-up of patients who had a satisfactory treatment response. Patients who required more treatment steps had higher relapse rates during the naturalistic follow-up phase: 40%, 55%, 65%, and 71% after each of the four sequential levels, respectively. At any level, lower relapse rates were found among patients who were in remission at follow-up entry than for those who were not in remission. The efficacy, tolerability, and relapse rates after one year of VNS treatment in a group of chronic and highly treatment-resistant patients compares favorably with pharmacotherapy outcomes

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 11

NIH-PA Author Manuscript

demonstrated in STAR*D among a group of less severely ill patients. Indeed, VNS would be indicated for the type of patients that remain depressed after four treatment trials, such as those patients who completed treatment in STAR*D and were still depressed. Future directions for studying VNS

NIH-PA Author Manuscript

Left cervical VNS was investigated and approved for the treatment of epilepsy and TRD, and right cervical VNS was avoided to minimize potential adverse cardiac effects. Animal and human studies, however, suggest that right cervical VNS is safe and effective for treating heart failure and arrhythmias [13]. Left cervical VNS also has been shown to suppress atrial tachyarrhythmias in dogs [87], although VNS might be proarrhythmic under certain conditions [87]. Whether right, left, and bilateral cervical VNS have comparable efficacy, tolerability, and safety in the treatment of epilepsy or depression in humans is unknown. Krahl [3] has suggested that there might be a lateralization of VNS effects (at least for seizure control). If so, would the modest antidepressant effects of left cervical VNS improve with the use of right or bilateral VNS? In depressed patients, it also is not known whether the potential benefits of VNS on cardiovascular, cerebrovascular, and metabolic risk factors would differ for right, left, or bilateral VNS. Addressing these clinically relevant issues in a clinical trial(s) is unlikely to occur. The design of such a study using a surgically implanted device with long-term assessments of relevant outcomes would be technically challenging and prohibitively expensive.

NIH-PA Author Manuscript

Transcutaneous VNS is a potentially viable option for conducting these types of studies, although its antidepressant efficacy has not been well studied and is not yet established. Right auricular t-VNS was found to inhibit atrial fibrillation in anesthetized dogs [89] and tVNS altered pro-inflammatory biomarkers in a murine sepsis study [70]. Kreuzer and colleagues [90] reported that auricular t-VNS had a trend effect to shorten the QRS complex in patients treated for tinnitus, but the effect of t-VNS on inflammatory, metabolic, and/or cardiovascular biomarkers has not been extensively investigated in humans. Transcutaneous forms of VNS therefore deserve further study not only as a treatment for depression and other neuropsychiatric disorders, but also for its potentially favorable effects on cardiovascular, cerebrovascular, metabolic, and other physiological biomarkers that are associated with morbidity and mortality [68]. Using t-VNS would also permit an investigation of the relative clinical and neurobiological effects of right, left, and bilateral VNS. Compliance with ethics guidelines

References 1. **Ruffoli R, Giorgi FS, Pizzanelli C, et al. The chemical neuroanatomy of vagus nerve stimulation. J Chem Neuroanatomy. 2011; 42:288–296. This paper provides an overview of the neuroanatomy and neurochemistry relevant to the therapeutic uses of vagus nerve stimulation. 2. Zagon A. Does the vagus nerve mediate the sixth sense? Trends Neurosc. 2001; 24(11):671–673. 3. *Krahl SE. Vagus nerve stimulation for epilepsy: A review of the peripheral mechanisms. Surg Neurol Int. 2012; 3(Suppl S1):47–52. [PubMed: 22629484] This paper reviews the peripheral neuroanatomy and physiology of the vagus nerve that is relevant to the antiseizure effects of vagus nerve stimulation.

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 12

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

4. Lanska DJ. Corning and vagal nerve stimulation for seizures in the 1880s. Neurology. 2002; 58:452–459. [PubMed: 11839848] 5. Zabara J. Inhibition of experimental seizures in canines by repetitive vagal stimulation. Epilepsia. 1992; 33(6):1005–1012. [PubMed: 1464256] 6. Stancak A, Kuna M, Srinivasan, et al. Kapalabhati—yogic cleansing exercise. II. EEG topography analysis. Homeost Health Dis. 1991; 3(4):182–189. [PubMed: 1818698] 7. Stancak A, Pfeffer D, Hrudova L, et al. Electroencephalographic correlates of paced breathing. Neuroreport. 1993; 4(6):723–726. [PubMed: 8347815] 8. *Morris GL, Gloss D, Buchhalter J, et al. Evidence-based guideline update: Vagus nerve stimulation for the treatement of epilepsy. Neurology. 2013; 81:1453–1459. [PubMed: 23986299] This is the most recent critical evaluation of evidence regarding the efficacy and safety of vagus nerve stimulation for epilepsy in children, adolescents, and adults. 9. Howland RH, Shutt LS, Berman SR, et al. The emerging use of technology for the treatment of depression and other neuropsychiatric disorders. Ann Clin Psychiatry. 2011; 23:48–62. [PubMed: 21318196] 10. Terry RS, Tarver WB, Zabara J. The implantable neurocybernetic prosthesis system. Pacing Clinical Electrophysiol. 1991; 14(1):86–93. 11. Gorny KR, Bernstein MA, Watson RE. 3 Tesla MRI of patients with vagus nerve stimulator: Initial experience using a T/R head coil under controlled conditions. J Magnetic Resonance Imaging. 2010; 31:475–481. 12. **De Ferrari GM, Schwartz PJ. Vagus nerve stimulation: from pre-clinical to clinical application: challenges and future directions. Heart Fail Rev. 2011; 16:195–203. [PubMed: 21165697] This paper describes the preclinical and clinical background relevant to the therapeutic use of right cervical vagus nerve stimulation for heart failure. 13. **De Ferrari GM, Crijns HJGM, Borggrefe M, et al. Chronic vagus nerve stimulation: A new and promising therapeutic approach for chronic heart failure. Eur Heart J. 2011; 32:847–855. [PubMed: 21030409] This paper describes the results from the first phase II clinical trial of right cervical vagus nerve stimulation for heart failure. 14. Ben-Menachem E, Rydenhag B, Silander H. Preliminary experience with a new system for vagus nerve stimulation for the treatment of refractory focal onset seizures. Epilepsy Behavior. 2013; 29:416–419. [PubMed: 24070879] 15. **Ellrich J. Transcutaneous vagus nerve stimulation. Eur Neurological Rev. 2011; 6(4):254–256. This paper briefly describes the neuroanatomy of the auricular branch of the vagus nerve and the rationale for a transcutaneous form of vagus nerve stimulation. 16. Dietrich S, Smith J, Scherzinger C, et al. A novel transcutaneous vagus nerve stimulation leads to brainstem and cerebral activations measured by functional MRI. Biomed Tech (Berl). 2008; 53:104–111. [PubMed: 18601618] 17. Kraus T, Hosl K, Kiess O, et al. BOLD fMRI deactivation of limbic and temporal brain structures and mood enhancing effect by transcutaneous vagus nerve stimulation. J Neural Transm. 2007; 114:1485–1493. [PubMed: 17564758] 18. **Kraus T, Kiess O, Hosl K, et al. CNS BOLD fMRI effects of sham-controlled transcutaneous electrical nerve stimulation in the left outer auditory canal—A pilot study. Brain Stimulation. 2013; 6:798–804. [PubMed: 23453934] This paper describes the findings from an fMRI imaging study of the effects of transcutaneous stimulation of the outer auditory canal, demonstrating changes in limbic areas. 19. Ventureyra EC. Transcutaneous vagus nerve stimulation for partial onset seizure therapy. A new concept. Childs Nerv Syst. 2000; 16:101–102. [PubMed: 10663816] 20. Busch V, Zeman F, Heckel A, et al. The effect of transcutaneous vagus nerve stimulation on pain perception—An experimental study. Brain Stimulation. 2013; 6:202–209. [PubMed: 22621941] 21. Lehtimaki J, Hyvarinen P, Ylikoski M, et al. Transcutaneous vagus nerve stimulation in tinnitus: A pilot study. Acta Oto Laryngologica. 2013; 133:378–382. [PubMed: 23237096] 22. **Stefan H, Kreiselmeyer G, Kerling F, et al. Transcutaneous vagus nerve stimulation (t-VNS) in pharmacoresistant epilepsies: A proof of concept trial. Epilepsia. 2012; 53(7):e115–e118.

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 13

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

[PubMed: 22554199] This paper describes the findings from a pilot study of transcutaneous auricular vagus nerve stimulation in adults with refractory epilepsy. 23. *He W, Jing X, Wang X, et al. Transcutaneous auricular vagus nerve stimulation as a complementary therapy for pediatric epilepsy: A pilot trial. Epilepsy Behavior. 2013; 28:343–346. [PubMed: 23820114] This paper describes the results of a pilot study of transcutaneous auricular vagus nerve stimulation for epilepsy in children. 24. Peijing R, Aihua L, Jianguo Z, et al. An alternative therapy for drug-resistant epilepsy: Transcutaneous auricular vagus nerve stimulation. Chin Med J. 2014; 127(2):300–304. [PubMed: 24438620] 25. **Hein E, Nowak M, Kiess O, et al. Auricular transcutaneous electrical nerve stimulation in depressed patients: A randomized controlled pilot study. J Neural Transm. 2013; 120:821–827. [PubMed: 23117749] This paper describes the findings from a pilot study of transcutaneous vagus nerve stimulation for non-chronic non-refractory major depression. 26. Hassanzadeh R, Jone JC, Ross EL. Neuromodulation for intractable headaches. Curr Pain Headache Rep. 2014; 18:392. Doi: 10.1007/s11916-013-0392-1. [PubMed: 24488653] 27. George MS, Rush AJ, Sackeim HA, Marangell LB. Vagus nerve stimulation (VNS): Utility in neuropsychiatric disorders. Int J Neuropsychopharmacol. 2003; 6:73–83. [PubMed: 12899738] 28. Krahl SE, Senanayake SS, Pekary AE, Sattin A. Vagus nerve stimulation (VNS) is effective in a rat model of antidepressant action. J Psychiatr Res. 2004; 38:237–240. [PubMed: 15003428] 29. Furmaga H, Shah A, Frazer A. Serotonergic and noradrenergic pathways are required for the anxiolytic-like and antidepressant-like behavioral effects of repeated vagal nerve stimulation in rats. Biol Psychiatry. 2011; 70:937–945. [PubMed: 21907323] 30. *Kosel M, Brockmann H, Frick C, et al. Chronic vagus nerve stimulation for treatment-resistant depression increases regional cerebral blood flow in the dorsolateral prefrontal cortex. Psychiatry Res Neuroimaging. 2011; 191:153–159. A recent brain imaging study of the effects of invasive left cervical vagus nerve stimulation in patients with treatment resistant depression. 31. *Conway CR, Chibnall JT, Gebarea MA, et al. Association of cerebral metabolic activity changes with vagus nerve stimulation antidepressant response in treatment-resistant depression. Brain Stimulation. 2013; 6:788–797. [PubMed: 23485649] A recent brain imaging study investigating correlations between cerebral metabolic activity and the treatment response to left cervical vagus nerve stimulation. 32. Furmaga H, Carreno FR, Frazer A. Vagal nerve stimulation rapidly activates brain-derived neurotrophic factor receptor TrkB in rat brain. PLoS ONE. 2012; 7(5):e34844. Doi:10.1371/ journal.pone.0034884. [PubMed: 22563458] 33. Gebhardt N, Bar KJ, Boettger MK, et al. Vagus nerve stimulation ameliorated deficits in one-way active avoidance learning and stimulated hippocampal neurogenesis in bulbectomized rats. Brain Stimulation. 2013; 6:78–83. [PubMed: 22405742] 34. Rush AJ, George MS, Sackeim HA, et al. Vagus nerve stimulation (VNS) for treatment-resistant depressions: A multicenter study. Biol Psychiatry. 2000; 47:276–286. [PubMed: 10686262] 35. Sackeim HA, Rush AJ, George MS, et al. Vagus Nerve Stimulation (VNS) for treatment-resistant depression: Efficacy, side effects, and predictors of outcome. Neuropsychopharmacology. 2001; 25:713–728. [PubMed: 11682255] 36. Marangell LB, Rush AJ, George MS, et al. Vagus Nerve Stimulation (VNS) for major depressive episodes: One year outcomes. Biol Psychiatry. 2002; 51:280–287. [PubMed: 11958778] 37. Nahas Z, Marangell LB, Husain MM, et al. Two-year outcome of Vagus Nerve Stimulation (VNS) for treatment of major depressive episodes. J Clin Psychiatry. 2005; 66:1097–1104. [PubMed: 16187765] 38. Dunner DL, Rush AJ, Russell JM, et al. Prospective long-term multicenter study of the naturalistic outcomes of patients with treatment-resistant depression. J Clin Psychiatry. 2006; 67:688–695. [PubMed: 16841617] 39. Rush AJ, Marangell LB, Sackeim HA, et al. Vagus Nerve Stimulation for treatment-resistant depression: A randomized controlled acute phase trial. Biol Psychiatry. 2005; 58:347–354. [PubMed: 16139580]

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 14

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

40. Rush AJ, Sackeim HA, Marangell LB, et al. Effects of 12 months of Vagus Nerve Stimulation in treatment-resistant depression: A naturalistic study. Biol Psychiatry. 2005; 58:355–363. [PubMed: 16139581] 41. George MS, Rush AJ, Marangell LB, et al. A one-year comparison of Vagus Nerve Stimulation with treatment as usual for treatment-resistant depression. Biol Psychiatry. 2005; 58:364–373. [PubMed: 16139582] 42. Nierenberg AA, Alpert JE, Gardner-Schuster EE, et al. Vagus nerve stimulation: 2-year outcomes for bipolar versus unipolar treatment-resistant depression. Biol Psychiatry. 2008; 64(6):455–460. [PubMed: 18571625] 43. Schlaepfer TE, Frick C, Zobel A, et al. Vagus nerve stimulation for depression: Efficacy and safety in a European study. Psychological Med. 2008; 38:651–661. 44. Bajbouj M, Merkl A, Schlaepfer TE, et al. Two-year outcome of vagus nerve stimulation in treatment-resistant depression. J Clin Psychopharmacol. 2010; 30:273–281. [PubMed: 20473062] 45. *Aaronson ST, Carpenter LL, Conway CR, et al. Vagus nerve stimulation therapy randomized to different amounts of electrical charge for treatment-resistant depression: Acute and chronic effects. Brain Stimulation. 2013; 6:631–640. [PubMed: 23122916] This paper describes the results of a recent large randomized clinical trial comparing outcomes for three different stimulation doses of left cervical vagus nerve stimulation in patients with treatment resistant depression. 46. Muller HH, Kornhuber J, Maler JM, Sperling W. The effects of stimulation parameters on clinical outcomes in patients with vagus nerve stimulation implants with major depression. J ECT. 2013; 29:e40–e42. [PubMed: 23728236] 47. **Berry SM, Broglio K, Bunker M, et al. A patient-level meta-analysis of studies evaluating vagus nerve stimulation therapy for treatment-resistant depression. Medical Devices Evidence Research. 2013; 6:17–35. This paper describes the findings from an analysis of patient-level data from six large prospective studies of left cervical vagus nerve stimulation compared to treatment-as-usual for treatment resistant depression. 48. *Olin B, Jayewardene AK, Bunker M, Moreno F. Mortality and suicide risk in treatment-resistant depression: An observational study of the long-term impact of intervention. PLoS ONE. 2012; 7(10):e48002. Doi:10.1371/journal.pone.0048002. [PubMed: 23133537] This paper describes the initial findings from a vagus nerve stimulation therapy registry of patients with treatment resistant depression. 49. *Gerson R, Murray E, Price B, et al. Mania following vagus nerve stimulation: A case report and review of the literature. Epilepsy Behavior. 2011; 20:138–140. [PubMed: 21167787] This paper provides a brief literature review of the risk of mania associated with vagus nerve stimulation. 50. Feldman RL, Dunner DL, Muller JS, Stone DA. Medicare patient experience with vagus nerve stimulation for treatment-resistant depression. J Med Econ. 2012:1–13. Doi: 10.3111/136969987.2012.724745. 51. Rong PJ, Fang JL, Wang LP, et al. Transcutaneous vagus nerve stimulation for the treatment of depression: A study protocol for a double blinded randomized clinical trial. BMC Complementary Alternative Med. 2012; 12:255. Doi:10.1186/1472-6882-12-255. 52. Rugulies R. Depression as a predictor for coronary heart disease: A review and meta-analysis. Am J Prev Med. 2002; 23:51–61. [PubMed: 12093424] 53. Carney RM, Freedland KE, Miller GE, Jaffe AS. Depression as a risk factor for cardiac mortality and morbidity: A review of potential mechanisms. J Psychosomatic Res. 2002; 53:897–902. 54. Brown AD, Barton DA, Lambert GW. Cardiovascular abnormalities in patients with major depressive disorder: Autonomic mechanisms and implications for treatment. CNS Drugs. 2009; 23(7):583–602. [PubMed: 19552486] 55. Li W, Olshansky B. Inflammatory cytokines and nitric oxide in heart failure and potential modulation by vagus nerve stimulation. Heart Fail Rev. 2011; 16:137–145. [PubMed: 20658318] 56. Abboud FM, Harwani SC, Chapleau MW. Autonomic neural regulation of the immune system— Implications for hypertension and cardiovascular disease. Hypertension. 2012; 59:755–762. [PubMed: 22331383]

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 15

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

57. Huston JM, Tracey KJ. The pulse of inflammation: heart rate variability, the cholinergic antiinflammatory pathway and implications for therapy. J Intern Med. 2011; 269:45–53. [PubMed: 21158977] 58. Anders S, Tanaka M, Kinney DK. Depression as an evolutionary strategy for defense against infection. Brain Behavior Immunity. 2013; 31:9–22. 59. Tanaka, M.; Anders, S.; Kinney, DK. Immunotoxicity, Immune Dysfunction, and Chronic Disease. Humana Press; 2012. Environment, the immune system, and depression: An integrative review and discussion of the infection-defense hypothesis; p. 345-385. 60. Benros ME, Waltoft BL, Nordentoft M, et al. Autoimmune diseases and severe infections as risk factors for mood disorders: A nationwide study. JAMA Psychiatry. 2013; 70:812–820. [PubMed: 23760347] 61. Capuron L, Miller AH. Immune system to brain signaling: Neuropsychopharmacological implications. Pharmacology Therapeutics. 2011; 130:226–238. [PubMed: 21334376] 62. Hornig M. The role of microbes and autoimmunity in the pathogenesis of neuropschiatric illness. Current Opinion Rheumatology. 2013; 25(4):488–495. 63. Cryan JF, Dinan TG. Mind-altering microorganisms: The impact of the gut microbiota on brain and behavior. Nature Reviews Neuroscience. 2012; 13:701–712. 64. Raison CL, Lowry CA, Rook GAW. Inflammation, sanitation, and consternation: Loss of contact with coevolved, tolerogenic microorganisms and the pathophysiology and treatment of major depression. Arch Gen Psychiatry. 2010; 67:1211–1224. [PubMed: 21135322] 65. Hannestad J, DellaGioia N, Bloch M. The effect of antidepressant medication treatment on serum levels of inflammatory cytokines: A meta-analysis. Neuropsychopharmacology. 2011; 36:2452– 2459. [PubMed: 21796103] 66. **Bonaz B, Picq C, Sinniger V, et al. Vagus nerve stimulation: from epilepsy to the cholinergic anti-inflammatory pathway. Neurogastroenterol Motil. 2013; 25:208–221. [PubMed: 23360102] This paper reviews the involvement of the vagus nerve in the cholinergic anti-inflammatory pathway and the known and potential anti-inflammatory effects of vagus nerve stimulation. 67. **Pavlov VA, Tracey KJ. The vagus nerve and the inflammatory reflex—linking immunity and metabolism. Nat Rev Endocrinol. 2012; 8:743–754. [PubMed: 23169440] This paper reviews the involvement of the vagus nerve in regulation of metabolic homeostasis, and the efferent vagus nerve-mediated control of immune function and proinflammatory response via the cholinergic inflammatory reflex. 68. Sun Z, Baker W, Hiraki T, Greenberg JH. The effect of right vagus nerve stimulation on focal cerebral ischemia. Brain Stimulation. 2012; 5:1–10. [PubMed: 22037134] 69. Ay I, Sorensen AG, Ay H. Vagus nerve stimulation reduces infarct size in rat focal cerebral ischemia: An unlikely role for cerebral blood flow. Brain Research. 2011; 1392:110–115. [PubMed: 21458427] 70. Huston JM, Gallowitsche-Puerta M, Ochani M, et al. Transcutaneous vagus nerve stimulation reduces serum high mobility group box 1 levels and improves survival in murine sepsis. Crit Care Med. 2007; 35:2762–2768. [PubMed: 17901837] 71. Aalbers MW, Klinkenberg S, Rijkers K, et al. The effects of vagus nerve stimulation on pro- and anti-inflammatory cytokines in children with refractory epilepsy: An exploratory study. Neuroimmunomodulation. 2012; 19:352–358. [PubMed: 23038102] 72. Barone L, Colicchio G, Policicchio D, et al. Effect of vagal nerve stimulation on systemic inflammation and cardiac autonomic function in patients with refractory epilepsy. Neuroimmunomodulation. 2007; 14:331–336. [PubMed: 18418007] 73. Majoie HJ, Rijkers K, Berfelo MW, et al. Vagus nerve stimulation in refractory epilepsy: effects on pro- and anti-inflammatory cytokines in peripheral blood. Neuroimmunomodulation. 2011; 18:52–56. [PubMed: 20639683] 74. De Herdt V, Bogaert S, Bracke KR, et al. Effects of vagus nerve stimulation on pro- and antiinflammatory cytokine induction in patients with refractory epilepsy. J Neuroimmunology. 2009; 214:104–108. [PubMed: 19608283]

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Howland

Page 16

NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript

75. Corcoran C, Connor TJ, O’Keane V, Garland MR. The effects of vagus nerve stimulation on proand anti-inflammatory cytokines in humans: A preliminary report. Neuroimmunomodulation. 2005; 12:307–309. [PubMed: 16166810] 76. Moreno J, Gaspar E, Lopez-Bello G, et al. Increase in nitric oxide levels and mitochondrial membrane potential in platelets of untreated patients with major depression. Psychiatry Res. 2013; 209:447–452. [PubMed: 23357685] 77. Trueba AF, Smith NB, Auchus RJ, Ritz T. Academic exam stress and depressive mood are associated with reductions in exhaled nitric oxide in healthy individuals. Biol Psychology. 2013; 93:206–212. 78. Lu DY, Leung YM, Su KP. Interferon-alpha induces nitric oxide synthase expression and haem oxygenase-1 down-regulation in microglia: Implications of cellular mechanism of IFN-alphainduced depression. Int J Neuropsychopharmacol. 2013; 16:433–44. [PubMed: 22717332] 79. **Leonard BE. Impact of inflammation on neurotransmitter changes in major depression: An insight into the action of antidepressants. Prog Neuro Psychopharmacol Biol Psychiatry. 2014; 48:261–267. This review summarizes evidence that chronic low-grade inflammation plays an important role in the pathology of depression. 80. Lotrich F. Inflammatory cytokines, growth factors, and depression. Current Pharmaceutical Design. 2012; 18:5920–5935. [PubMed: 22681170] 81. Raison CL, Rutherford RE, Woolwine BJ, et al. A randomized controlled trial of the tumor necrosis factor antagonist infliximab for treatment-resistant depression: The role of baseline inflammatory biomarkers. JAMA Psychiatry. 2013; 70:31–41. [PubMed: 22945416] 82. Celano CM, Huffman JC. Depression and cardiac disease: A review. Cardiology Review. 2011; 19:130–142. [PubMed: 21464641] 83. Rustad JK, Stern TA, Hebert KA, Musselman DL. Diagnosis and treatment of depression in patients with congestive heart failure: A review of the literature. Prim Care Companion CNS Disord. 2013; 15 PCC.13r01511. doi:10.4088/PCC.13r01511. 84. Martin JLR, Martin-Sanchez E. Systematic review and meta-analysis of vagus nerve stimulation in the treatment of depression: Variable results based on study design. Eur Psychiatry. 2012; 27:147– 155. [PubMed: 22137776] 85. Olanchanski N, McInnis Myers M, Halseth M, et al. The economic burden of treatment-resistant depression. Clin Ther. 2013; 35:512–522. [PubMed: 23490291] 86. Rush AJ, Trivedi MH, Wisniewski SR, et al. Acute and longer-term outcomes in depressed outpatients requiring one or several treatment steps: A STAR*D report. Am J Psychiatry. 2006; 163:1905–1917. [PubMed: 17074942] 87. Shen MJ, Shinohara T, Park HW, et al. Continuous low-level vagus nerve stimulation reduces stellate ganglion nerve activity and paroxysmal atrial tachyarrhymias in ambulatory canines. Circulation. 2011; 123:2204–2212. [PubMed: 21555706] 88. Zhang Y, Mazgalev TN. Arrhythmias and vagus nerve stimulation. Heart Fail Rev. 2011; 16:147– 161. [PubMed: 20559719] 89. Yu L, Scherlag BJ, Li S, et al. Low-level transcutaneous electrical stimulation of the auricular branch of the vagus nerve: A noninvasive approach to treat the initial phase of atrial fibrillation. Heart Rhythm. 2013; 10:428–435. [PubMed: 23183191] 90. Kreuzer PM, Landgrebe J, Husser O, et al. Transcutaneous vagus nerve stimulation: Retrospective assessment of cardiac safety in a pilot study. Frontiers Psychiatry. Aug 7.2012 3:70. Doi:10.3389/ fpsyt.2012.00070.

Curr Behav Neurosci Rep. Author manuscript; available in PMC 2015 June 01.

Journal of Cancer Therapy, 2013, 4, 1116-1131 http://dx.doi.org/10.4236/jct.2013.46128 Published Online August 2013 (http://www.scirp.org/journal/jct)

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation? Marjolaine Pelissier-Rota1,2, Michèle Lainé1,2, Benjamin Ducarouge1,2, Bruno Bonaz1,2,3, Muriel Jacquier-Sarlin1,2* 1

Centre de Recherche Inserm U836, Institute of Neurosciences, Grenoble, France; 2University of Grenoble, Grenoble, France; Hospitalo-Universitary Center, CHU of Grenoble, Grenoble, France. Email: *jacquier-sarlin@ujf-grenoble.frt 3

Received May 28th, 2013; revised June 30th, 2013; accepted July 8th, 2013 Copyright © 2013 Marjolaine Pelissier-Rota et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

ABSTRACT Inflammatory Bowel Disease (IBD) patients, such as Crohn’s disease or ulcerative colitis suffer from chronic and relapsing intestinal inflammation that favours the development of colitis associated cancer (CAC). This inflammation is initiated by aberrant activations of the innate immune responses associated to intestinal barrier defects. The conventional medical therapies consist to decrease the inflammatory response, which also decrease the risk of colon carcinoma but lead to severe side-effects. Recently, a number of animal studies have demonstrated that innate immune responses are attenuated by stimulation of the efferent arm of vagus nerve (VN) through its neurotransmitter acetylcholine (ACh), that acts on resident macrophages α7 nicotinic receptor (α7 nAChR). ACh also acts as a signalling molecule in epithetlial cells through cholinergic receptors such as nAChR or muscarinic (mAChR) receptors. In the current study, we aimed to extend these findings to CAC prevention by treating human adenocarcinoma cell lines through targeting cholinergic receptors with nicotine (which binds nAChR) and ACh (which binds both cholinergic receptors). Using HT-29 and Caco-2 cell lines, we demonstrated that ACh-induced activation of mAChR results in cell dissociation together with changes in expression and localization of intestinal tight and adherens junction proteins. ACh-induced modulation of cell adhesion proprieties correlates with the acquisition of invasive potential. By contrast, nicotine-mediated activation of nAChR maintains epithelial cell organisation. ACh-released by VN stimulation (VNS) could effectively preserve epithelium integrity thus limiting inflammatory response and tumor development. However, attention should be paid on the nature of the cholinergic receptor solicited. Indeed, regarding to the protective effects of nAChR signalling on epithelial cells, activation of mAChR would worsen the disease and led to increase inflammation. These data have important repercussions on the therapeutic potential of VNS in IBD and CAC, which may represent “the yin and yang” of the intestinal homeostasis. Keywords: Cell Adhesion; Colorectal Cancer; Tumor Progression; Cholinergic Receptors; Inflammation; Vagus Nerve

1. Introduction Inflammatory Bowel Diseases (IBD), such as Crohn’s disease (CD) or ulcerative colitis (UC), are multifactorial chronic inflammatory diseases of the gastrointestinal tract for which the exact causative mechanism is still unclear. According to a current hypothesis, an increased intestinal permeability due to an epithelial barrier defect, coupled with a dysfunctional immune response participate to the development of chronic intestinal inflammation [1]. *

Corresponding author.

In the long-term, IBD can induce further complication and patients have an increased risk developing other pathologies such as colorectal cancer (CRC). About 20% of CRC cases can be genetically attributed to a family history. Involvement and mechanisms by which environmental factors contribute to the disease are still unclear. Colitis associated cancer (CAC) is a type of colon cancer which is preceded by clinically detectable IBD. CAC develops from dysplasia, which is stimulated by chronic inflammation, rather than polyps. Even though CRC does not always develop after IBD, its high frequency in patients with IBD represents a paradigm for the connection JCT

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation

between inflammation and cancer in terms of epidemicology and mechanistic studies in preclinical models (for review [2]). UC increases cumulative risk of CRC by up to 18% - 20%, while CD by up to 8% after 30 years of active disease. The increase in prevalence of CAC in IBD patients seems to correlate with the chronic inflamematory conditions of the intestinal mucosa, in particular with the degree [3], duration [4,5] and anatomical extent of colonic inflammation [6], as well as the presence of primary sclerosing cholangitis, and IBD management such as efficacy of anti-inflammatory therapies [7]. In animal models, intraperitoneal injection of the carcinogen azoxymethane (AOM) followed by repeated cycles of dextran sulfate sodium (DSS) or mice lacking the gene for the IL-10 cytokine, chronic inflammation also results in an increased frequency of intestinal tumors [8,9]. Epidemiological studies report that the long-term administration of anti-inflammatory drugs decreases the risk of colon carcinoma [10]. The conventional medical therapy for IBD consists to reduce the inflammatory response using 5-aminosalicylates, corticosteroids, immunosuppressives (azathioprine/mercaptopurine), and biological therapies (anti-TNFα, but these treatments have severe side-effects [11,12]. Vagus nerve (VN) is the main nerve of the parasympathic division of the autonomic nervous system for the thoracic and abdomino-pelvic viscera that controls heart rate, hormone secretion and gastrointestinal motility/secretion [13]. Recent studies indicate that VN is also an immunomodulator [14]. In experimental models of inflammatory disease, vagus nerve stimulation (VNS) attenuates the production of pro-inflammatory cytokines and inhibits the inflammatory process [15,16]. The inflammatory reflex is a centrally neuro-endocrine-immune integrated physiological mechanism that maintains homeostasis through: 1) the activation of the hypothalamic pituitary adrenal axis by VN afferent fibers and 2) the cholinergic anti-inflammatory pathway (CAP) by VN efferent fibers [17,18]. At the molecular level, the CAP relies on the effects of acethylcholine (ACh), the VN principal neurotransmitter, on macrophages [18]. ACh signals through either muscarinic (G-protein-coupled) receptors (mAChR) or nicotinic (ligand-gated ion channels receptors (nAChR) [19]. There are five subtypes of mAChR (M1-M3) which are products of distinct genes [20]. They present similar structure constituted of seven transmembrane helice (TM1-TM7) and three extracellular and three intracellular loops [21]. nAChRs are transmembrane proteins composed of five subunits arranged around an axis perpendicular to the membrane. Therefore, nAChR is a homo-(α7 or α9) or a hetero-pentamer composed from various subunits (α2 - α10; β2 - β4, , , ). These cholinergic receptors are present in the central and peripheral nervous systems, in immunocompetent cells (monocyte, lymphocyte, and macrophage). Activation of Copyright © 2013 SciRes.

1117

α7 nAChR, either directly through interaction with selective nicotinic agonist (such as nicotine) or indirectly through the activation of the autonomic nervous systems (e.g. VN), inhibits adaptive and innate immune responses [22-24]. The affinity of nicotine for this receptor is greater than its physiological agonist, ACh [25]. nAChR signaling also reduces macrophage cytokine production and inflammation in animal models of pancreatitis [26], DSS-induced colitis [27], 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis [28] and intestinal ileus [29]. Thus, VNS appears as an alternative therapy to conventional treatment, for digestive disorders such as IBD. Currently, VNS is used in treatment of patient with seizure disorders and depression through the stimulation of VN afferent fibers [30] or metabolism disorders such as obesity (for review [31]). Inflammation could contribute to carcinogenesis by increasing the level of reactive oxygen species that have a mutagenic effect on DNA (tumor initiation) [32] or by generating an environment in favour of sustained growth, angiogenesis, migration and invasion of tumor cells (tumor progression and metastasis). Various components of the inflammatory environment in IBD are key elements in the different steps of cancer [33]. Recent works have elucidated the role of various immune cells and mediators in all the steps of colon carcinogenesis with the dissection of some molecular pathways [2,34,35]. In this paper, we will focus on the therapeutic potential of VNS in CAC, not only by regulating inflammatory response at the immune level but also by preventing or limiting intestinal barrier breakdown associated to the inflammation process. Indeed, epithelial cells also express cholinergic receptors [36]. While the role of α7 nAChR in intestinal cells is less understood, cholinergic receptors regulate ion transport across cell membrane and thereby affect intestinal water movement [37]. The main subtype of mAChR in rat and human intestinal epithelial cells is the M3 and to a lesser extends the M1 receptor [38-40]. Epithelia form a barrier constituted of specialized cells characterized by structural features including polarized morphology and cell-cell contacts. They lie on a basement membrane, which is organized into a complex structure containing collagen type IV (COIV), various laminin isoforms, and proteoglycans [41-43]. Interactions between cells and this specialized extracellular matrix (ECM) are crucial for essential biological processes such as migration, proliferation, differentiation, and cell survival. The cell-cell or cell-ECM interactions are mediated through various transmembrane receptors, which are linked intracellularly to cytoskeleton components and signal transduction molecules [44,45]. Tight junctions (TJ) are composed of transmembrane proteins (claudins, occludins and junctional adhesion molecules), scaffold proteins like zona occludens (ZOs) that link the actin cytoskeleton, and intracellular regulatory molecules inJCT

1118

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation

cluding kinases [46]. Directly beneath TJ are the adherens junctions (AJ) with E-cadherin connected to the actin cytoskeleton via α/β catenins and regulated by p120ctn [47]. Disorganization of these cellular junctions could participate in the infection process but also in the cellular dedifferentiation preceding carcinogenesis and cell migration [48]. These epithelial alterations are more pronounced in UC tissues in which the development of malignancies is apparently more frequent than in CD tissues, suggesting that disturbances of junction-associated molecules are likely to be involved in carcinogenesis from IBD patients. Using HT-29 and Caco-2 cells, two human colonic adenocarcimoma cell lines, we demonstrated that VNS could preserve epithelium integrity thus limiting inflammatory response and tumor development. However, attention should be paid on the nature of the cholinergic receptor solicited. Indeed, regarding to the protective effects of nicotine-induced activation of nAChR on epithelial cells, mAChR activation by ACh favours the acquisition of invasive potential with a modulation of cell adhesion proprieties. These data have important repercussions on the therapeutic potential of VNS in IBD and CAC.

anti-β catenin (Cat. N˚. C2206) polyclonal antibodies and

7 nAChR (clone 306) monoclonal antibody were ob-

tained from Sigma Aldrich (L’Isle d’Abeau, France). Polyclonal antibody directed against Src-PTyr418 (AT7135) was purchased from MBL Calbiochem (VWR International, Fontenay-sous-Bois, France), monoclonal anti-Src (Clone GD11) was from Millipore (Molsheim, France). Occludine clone (OC-3F10) and ZO-1(clone ZO1-1412) monoclonal antibodies were from Invitrogen (Cergy Pontoise, France). Alexa-conjugated goat antimouse secondary antibody was obtained from Molecular Probes (Eugene, OR). Horse Radish Peroxydase-conjugated goat anti-mouse was from Bio-Rad (Marnes-la-Coquette, France), donkey anti-rabbit antibodies were from Jackson Immunoresearch (Immunotech, Marseille, France).

2.3. RT-PCR Total RNA extractions were performed using TrizolTM reagent and 1 µg of total RNA was denaturized and subsequently processed for reverse transcription using MMLV (Invitrogen) according to manufacturer’s instructions and run on thermocycler (Eppendorf). Primer sequences and probes are:

2. Materials and Methods 2.1. Cell Culture The human colon adenocarcinoma cell lines HT-29 and Caco-2/TC7 were cultured at 37˚C in a 5% CO2 atmosphere in DMEM containing 25 mM glucose (Invitrogen, Cergy Pontoise, France) and supplemented with 10% FCS, 5% penicillin and streptomycin. The medium was changed every day to avoid glucose exhaustion, which leads to differentiation. The differentiation of HT-29 cells was initiated by replacing standard medium by glucose free DMEM (Invitrogen) supplemented with 10% dialyzed foetal calf serum, 5 mM galactose, 15 mM HEPES, selenous acid (10−2 g/ml), penicillin, and streptomycin [49]. This medium (Gal-medium or differentiating medium) was changed every day. The differentiation of Caco-2 occurs after 15 days of culture postconfluence. The cells were harvested in phosphate-buffered saline (PBS) supplemented with 1 mM EDTA and 0.05% trypsin (w/v).

2.2. Chemical Reagents and Antibodies Polyclonal antibodies directed against M3 mAChR (Cat. N˚. AB41169) provided from Abcam (12964, Abcam, Paris, France). Anti-human E-cadherin (Clone HECD1) monoclonal antibody was obtained from Takara Biochemicals (Cambrex Bio Science, Paris, France). Monoclonal antibody against p120ctn (clone 98) was purchased from BD Biosciences/Transduction Laboratories (Pont de Claix, France). Anti-actin (Cat. N˚. A2066), and Copyright © 2013 SciRes.

7 nAChR

M3AChR

GAPDH

5’CAGGGGTGAAGACTGTTCGT 3’CACTGTGAAGGTGACATCCG 5’CCTTCAAGGAAGCCACTCTG 3’GTCTGTGGGTTGATGTGTGC 5’GAACATCATCCCTGGCTCTACTGG 3’AATGCCAGCCCCAGCGTCTACTGG

PCR conditions are: 5 min at 92˚C followed by 35 cycles (40 sec at 92˚C, 40 sec at 60˚C and 1 min at 72˚C) and 10 min at 72˚C. PCR were analyzed on 1.5% agarose gel. Quantification was performed using Image J (NIH software). GAPDH were used as housekeeping gene.

2.4. Immunoblot Cells were grown to confluence and lysed with a buffer made of 1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, and supplemented with 1 mM PMSF, 2 g/mL aprotinin, 10 g/mL leupeptin, 10 M pepstatin, 2 mM CaCl2 and MgCl2, for 15 min on ice. Protein concentrations in lysates were determined using the copper reduction/bicinchoninic acid (BCA) assay (Pierce Chemical Co) according to the manufacturer’s instructions. Proteins (30 g in SDS- mercaptoethanol sample buffer) were resolved on 10% polyacrylamide gels, transferred into PVDF membranes (Hybond-C super; Amersham), and blocked in 5% bovine serum albumin in 0.1% Tween 20 in TBS for 1 hr at room temperaJCT

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation

ture. After overnight incubation at 4˚C with primary antibodies diluted in the blocking solution, blots were washed in TBS, 0.1% Tween 20 and then incubated with appropriate horseradish peroxidase-conjugated secondary antibodies (dilution of 1:10000) for 1 hr at room temperature before extensive washes. The blots were revealed by chemiluminescence (Amersham ECL reagents) and quantified with Image J software from NIH. Primary antibodies were used at the following dilutions: antihuman 7 nAChR and M3 mAChR, E-cadherin, p120ctn and -catenin (1:1000), ZO-1 (1:2000), and anti-actin (1:2000).

2.5. Immunofluorescent Staining Cells were grown on glass coverslips and were treated as described previously [50]. After fixation with PFA-4% sucrose, non-specific sites were blocked for 1 hr at 37˚C with 3% BSA-0.5% Tween20. Then cells were incubated for 1 hr at 37˚C with specific antibodies which were diluted in the blocking solution at 1:100 for primary and 1:500 for secondary antibodies. Fluorescence photomicrographs were taken with a confocal microscope at the x100 objective (Leica TCS SPE) or an epifluorescence microscope at the x100 objective (ZEISS, Avio Vert 200 M).

2.6. Extracellular Matrix Preparation and Cell Adhesion Tissue culture dishes were coated with LM-332 using the following methods: A431 epidermoid cells were cultured to confluence on various surfaces at 37˚C to allow for the deposit of LM-332, then cells were removed as previously described [51,52]. Briefly, confluent monolayers were sequentially extracted with 1% (v/v) Triton X-100 in PBS, followed by 2M urea in 1M NaCl. All extraction buffers contained protease inhibitors (1mM phenyl-methylsulfonyl fluoride and 2 mM N-ethylmaleimide). Plates were washed in PBS, incubated with 1%BSA, and stored at −20˚C. Human collagen type IV from placenta was obtained from Sigma Aldrich. Coating of plastic Petri dishes (Microtiter plates 96-well, Nunclone; Nunc, Roskilde, Denmark) was performed by overnight incubation with extracellular matrix proteins (10 µg/mL) at 4˚C. Plates were saturated with 3% (w/v) BSA in PBS for 2 hrs at 37˚C to block nonspecific adhesion. HT-29 cells were harvested and pre-treated or not with 100 nM nicotine or ACh for 30 min before to be plated (5  104 cells/ well) in triplicate in coated 96-well microtiter plates and incubated from 0 to 60 min at 37˚C. Non adherent cells were removed by washing three times with PBS, and cell adhesion was estimated by a colorimetric cell proliferation assay (CellTiter 96 AQueous Non-Radioactive Cell Proliferation Assay; Promega). Copyright © 2013 SciRes.

1119

2.7. Cell Invasion Assay Total HT-29 cells (2.5  10−5/mL) were placed in the top compartment of a 24-multiwell insert plate (BD Falcon), which was separated from the bottom compartment by BD-Matrigel Matrix membrane, with 0.4-µm pore size. Serum-free RPMI with or without nicotine or ACh (100 nM) were added into the top compartment and 10% FCS into the bottom compartment. After 48 hrs at 37˚C in a 5% CO2 atmosphere, cells that had invaded through the Matrigel were analyzed: cotton swabs were used to remove cells on the upper surface of inserts. After fixation with PFA 4%, migratory cells were stained with Hematoxylin Gill’s formula (Vector Laboratories) and manually counted under the microscope. The mean values of the readings and their SEM were calculated, and statistical differences were analyzed using Student’s t-test for non-paired samples.

2.8. Assay for Cell Proliferation Cell were plated in 96-well plates (2000 cells/well) at day 0 and cultured in complete DMEM medium without or with nicotine and ACh (100 nM). Cell proliferation was evaluated from day 1 to 3 using the CellTiter 96 Kit (Promega) according to the manufacturer’s instructions.

2.9. Densitometric Analysis and Statistics Immunoblots shown are representative of at least three independent experiments. All graphs represent the mean value ± SD of protein expression levels measured by densitometric analysis in “Image J” software (NIH). Statistics were performed with unpaired t-test and statistical significance was given by the number of asterisks (*P < 0.05; **P < 0.01; ***P < 0.001).

3. Results 3.1. Expression and Regulation of Cholinergic Receptors Expression in Human Colon Cancer Cell Lines It has been described that human colon cancer cell lines expressed mainly M3AChR and α4, α5, α7 and β1 nAChR subunits but only α7 subunits form a functional receptor [53]. First, we analyzed whether α7 nAChR and M3AChR, the two major cholinergic receptors susceptible to be activated by ACh released by VNS are present tors was visualized by staining HT-29 cells and then imaging under confocal microscopy (Figure 1(a)). Without treatment, immunofluorescence staining demonstrated that these receptors produced varying intensities of labelling in the cells, seemingly localized at the membrane. Some cytoplasmic dots are observed probably matching with cholinergic receptor neosynthesis or endocytosis. There is also an accumulation of vesicles enriched in α7 JCT

1120

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation

Day of differentiation

2.5 2 1.5 1 0.5 0

2×105

5×105

1×106 2×106

Figure 1. Functional cholinergic receptors: expression, distribution and regulation. (a) Expression and distribution of functional cholinergic receptors in HT-29 cells. Confocal immunofluoresence analysis of α7 nAChR (green) and M3AChR (red) in HT-29 cells incubated (or not) with nicotine or ACh (100 nM, 5 hrs). Co-localization is illustrated by yellow staining. Scale bar, 20 µm. (b) Cholinergic recaptor expression during cell differentiation. HT-29 cells are differentiated during 10 days by glucose starvation. Caco-2 cells are differentiated during 15 days after these cells formed a monolayer. Expressions of α7 nAChR and M3AChR in HT-29 cells and Caco-2 TC7 cell lines are quantified from immunoblot. Actin is used as loading control. C: Influence of cell density on cholinergic receptor expression. HT-29 cells are seeded at different concentration. Expression of cholinergic receptors are analysed by RT-PCR with specific primers. GAPDH are used as keeping house gene.

nAChR at the extern edge of cells not engaged in cellcell contacts. In presence of cholinergic ligands (nicotine or ACh, 100 nM, 5 hrs) we observed cell dissociation (black spaces appeared between adjacent cells) associated with a modification of the cell shape (more spreading cells) in presence of ACh. Cholinergic treatment induces a hypercholinergic response (desensitization process) which is illustrated by a decrease of cholinergic receptor density at the membrane of epithelial cells with a concomitant increase of cytoplasmic labelling which indicate that they receptors are functional. Then their expression was analyzed at the protein level and according to the status of differentiation of epithelial cell lines (Figure 1(b)). For this purpose we chose two adenocarcinomas cell lines (HT-29 and Caco-2) able to differentiate in vitro under specific culture conditions. The differentiated state of HT-29 cells is obtained by substitution Copyright © 2013 SciRes.

of glucose for galactose (Gal medium) in culture medium [54]. A variety of changes in the adhesive properties of HT-29 cells is observed during the first ten days of culture in the Gal medium which corresponds to the initial step of their differentiation [55,56]. Enterocyte differentiation of Caco-2 cells occurs after they reached confluence. They must be grown in confluent monolayer at least for 15 days [57]. Western blot also confirmed the presence of α7 nAChR and M3AChR in both cell lines. According to the differentiation status of cells, it appeared thatα7 nAChR increases during the differentiation of HT-29 cells and stays constant in Caco-2 cells. In contrast M3AChR expression decreases in HT-29 cells while it increases in Caco-2 cells. AChR expression according to the cell density was analyzed by RT-PCR (Figure 1(c). α7nAChR are present at low cell density and their expression decreases at higher cell concentration. In contrast the expression of M3AChR slightly increases with the cell density. These observations could explain the discrepancy noticed during the differentiation of the two cell lines. Indeed during the differentiation process, the substitution of glucose by galactose leads to cell death and thus lost of HT-29 cells. In contrast Caco2 cells are still confluent.

3.2. Only mAChR Induces a Loss and Redistribution of TJ and AJ Proteins Disruption of epithelial barrier integrity is identified as one of the pathologic mechanisms in IBD and cancer development. Adequate intestinal TJ protein function determines intestinal barrier integrity. We measured changes in expression and localization of occluding and ZO-1 to determine whether modulation of these TJ proteins correlates with changes observed with cholinergic treatment [58,59]. For this purpose, we use differentiated Caco-2 cells which established “mature” TJ compared to HT-29 cells. Confluent monolayers of Caco-2 cells differentiated for 15 days were harvested and immunoblotted (Figure 2(a)). Western blots indicated that while nicotine didn’t modify the expression of ZO-1 and occludin, ACh induces a time dependent loss of expression of these two TJ proteins. Fluorescence microscopy analysis confirmed the changes observed in western blots (Figure 2(b)). Membrane polarity was estimated by the actin cytoskeletal organization in microvilli at the apical side and actomyosin ring behind. In contrast to nicotine which preserves the actin cytoskeleton structures, ACh induces a reorganization of actin cytoskeleton with a loss of actomyosin ring and microvilli. At the same time, there is a redistribution of ZO-1 and to a lesser extend occludin from the intercellular junctions. Effect of cholinergic treatment was then evaluated on subjacent AJ proteins (Figure 3). Similar results were obtained with HT-29 and Caco-2 cells. In HT-29 cells, ACh also induces a loss of E-cadherin and catenins protein expres JCT

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation

1121

(a) (a)

(b) (b)

Figure 2. Cholinergic signaling modifies TJ protein expression and distribution. (a) Differentiated Caco-2 cells, which express TJ, are treated (or not) with nicotine or ACh (100 nM) during 0 to 48 hrs. Expressions of ZO-1 and occludin are analyzed by immunoblotting. Actin is used as a loading control. B: Immunofluorescence images of actin cytoskeleton organization at the apical pole and TJ protein distribution in Caco-2 incubated (or not) with nicotine or ACh (100 nM, 5 hrs). Scale bar: 20 µm.

sion determined by western blots (Figure 3(a)). Confocal microscopy analysis showed that nicotine induces slight cell dissociation but E-cadherin was still at the membrane together with p120ctn/β-ctn. Both catenins were co-localized (Figure 3(b)). In presence of ACh, cells completely dissociated and E-cadherin staining was cytoplasmic. Membrane labelling of catenins also disappeared and less co-localization between the two proteins was observed. Localization and stability of AJ proteins were controlled by phosphorylation/dephosphorylation events. The kinase Src is one of the kinases involved in this process and it can be activated by cholinergic ligands. We then compared the ability of nicotine and ACh to activate Src by measuring its phosphorylation on tyr418 (Figure 4). Exposure of HT-29 cells to nicotine doesn’t induce any Src activation during the time course experiment. By contrast Ach treatment leads to a time-dependent activation of Src with a maximum at 5 hrs. Altogether these data indicate that ACh but not nicotine induces an alteration of epithelial cell integrity characterized by a loss of TJ and AJ proteins subsequently to cell dissociation and protein endocytosis and degradation. This phenomenon could be address by the activation of Copyright © 2013 SciRes.

Figure 3. Cholinergic signaling modifies AJ protein expression and distribution. (a) HT-29 cells are treated (or not) with nicotine or ACh (100 nM) during 0 to 48 hrs. Expressions of E-cadherin, -catenin and p120ctn are analyzed by immunoblotting. Actin is used as a loading control. (b) Confocal immunofluorescence images of AJ proteins. HT29 cells which express AJ are incubated (or not) with nicotine or ACh (100 nM, 5 hrs. Upper panel: E-cadherin (green), lower panel: p120ctn (green), β-ctn (red). Co-localization of p120ctn and β-catenin is illustrated by yellow staining. Scale bar: 20 µm.

Figure 4. Src-phosphorylation following AChR activation. Westernblots showing Src-pTyr418 and Src total expression following nicotine and ACh treatment (100 nM) during 0 to 24 hrs in HT-29 cells.

the Src kinase.

3.3. ACh Modifies Cell-ECM Adhesion and Stimulates Human Cancer Cell Invasion The AJ’s disassembly correlates with a loss of cell-cell adhesion and an acquisition of migratory potential [60]. This event is associated to a modification of cell-ECM adhesive properties. We then compared the adhesive potential of HT-29 cells treated or not with cholinergic reJCT

1122

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation

ceptors on collagen IV (COIV) and laminin-332 (LN332), two major proteins of the basal membrane (Figure 5(a)). Nicotinic treatment enhances cell adhesion to COIV and had no effect on LN-332. By contrast, exposure of HT-29 cells to ACh diminishes adhesion to both ECM proteins. These modifications of ACh-induced cellECM interactions were correlated to an enhanced capacity of HT-29 cell invasion (Figure 5(b)). Using Matrigel chamber assays, we found that ACh induced a 3-fold increase in HT-29 cell invasion. Nicotine had no effect on HT-29 cell invasion. These results indicate that activation of mAChR by ACh modifies cell adhesive proprieties in favour of invasion.

3.4. Ach Enhances Cell Proliferation ACh is an autocrine/paracrine factor in various non neuronal cells. Consistent with previous observations, we found that ACh reproducibly induced a 1.7-fold increase in HT-29 cell proliferation at 48 hrs and 72 hrs after seeding (Figure 6). Nicotine also significantly stimulated HT-29 cell proliferation (1.3-fold increase). In this present work, data indicate that ACh-induced mAChR signaling plays a key role in colon cancer cell polarity and adhesion, proliferation and invasion compared to nAChR.

inflammation is initiated by aberrant activations of the innate immune responses associated to intestinal barrier defects. Recently, a number of animal studies have demonstrated that innate immune responses are attenuated by stimulation of the efferent arm of VN through its neurontransmitter ACh, that acts on resident macrophages 7 nAChR, [15,16]. It appeared that ACh is not only a neurotransmitter but it also acts as a signaling molecule in non-neuronal tissues. In the current study, we aimed to extend these findings to CAC prevention by treating human adenocarcinoma cell lines through targeting cholinergic receptors with nicotine and ACh. nAChRs and mAChRs might affect the inflammatory response in an opposite manner and may represent “the yin and yang” of the intestinal homeostasis [61]. Our data suggest that nAChR and mAChR might also affect differently cancer progression (Figure 7).

4. Discussion IBD patients suffer from chronic and relapsing intestinal inflammation that favours the development of CAC. This

(a)

(b)

Figure 5. Cholinergic signaling modulates migration and invasion potential in HT-29 cells. (a) Contrary to mAChR signaling, nAChR activation promotes cell adhesion. HT-29 cells are treated (or not) with nicotine or ACh (100 nM, 5 hrs) 30 min before adhesion and then plated on either type IV collagen (COIV) or laminin-332 (LN-332) at 10 µg/mL. Cell adhesion is evaluated using a Cell Titer Aqueous MTT reagent kit. Results are expressed relative to the untreated cells which are fixed at 1. Data represent the mean +/- SEM of 4 experiments. (b) Contrary to nAChR signaling, mAChR activation favors cell migration. Effect of nicotine and ACh (100 nM, 48 hrs) on HT-29 cell transmigration is determined using a transwell assay. Cells which migrated through the matrigel are stained with hematoxylin and visualized and counted by phase contrast microscopy. Results are expressed according to the control which is fixed at 1. Data (n > 3) represent the mean +/− SEM.p Copyright © 2013 SciRes.

Figure 6. Cholinergic signaling modulates HT-29 cell proliferation. To determine proliferation potential, HT-29 cells are incubated (or not) with nicotine or ACh (100 nM) during 24, 48 and 72 hrs. Cell proliferation is determined by MTT assays. Results are expressed relative to the proliferation of untreated cells, which is fixed at 1. Data represent the mean +/− SEM of 3 experiments.

Figure 7. “The ying and the yang” effect of VNS. In IBD patients, VNS would have protective effects on epithelial barrier integrity via nAChR. This effect relies on a positive modulation of intercellular junction proteins in term of expression and localization. In an opposite manner, VNSmediated activation of mAChR leads to cell-cell contact disruption with intercellular junction proteins degradation and delocalization together with a decrease of cell-ECM adhesion. Altogether these effects favor cell migration and invasion as observed in tumor progression. JCT

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation

4.1. Acetylcholine, Neurotransmitter and Autocrine/Paracrine Mediator Emerging evidences indicate that normal and neoplastic non-neuronal cells can produce and release ACh in sufficient quantity to modulate cell function [62]. Neuronal and non-neuronal (epithelial, endothelial and immune cells) ACh is synthesized by the enzyme choline acetyltransferase (ChAT) using acetyl-CoA and choline as substrates. The later is taken up from the extracellular site by a specific high affinity choline transport-system (CHT1) [62,63]. In contrast to the situation in nerves where ACh is stored in specific vesicles, there is no storage compartment in non-neuronal cells and ACh appeared to be released directly after synthesis. In both conditions, ACh is rapidly hydrolysed by acetylcholinesterase (AChE), thereby limiting its action to immediately neighbouring cells. ACh targets mAChR and nACR with a greater affinity for the former. Both receptors are widely expressed in different non-neuronal cell types (for review [64,65]. Different mAChRs couple differentially to multiple G proteins that are describe to mediate distinct cytoplasmic signaling pathways implicated in various cellular functions. Activation of nAChR leads to Ca2+ influx that directly modulates these signaling pathways.

4.2. Regulation of the Cholinergic System in Cancer All components of the cholinergic system such as synthesis, storage, release, inactivation as well as the expression and function of various cholinergic receptors can be affected in pathophysiological conditions. Some substantial alterations of the non-neuronal cholinergic system have already described in human colon cancers. The cholinergic system for ACh synthesis and degradation is modified in human colon cancer cell lines compared to normal tissues. The activity of AChE was measured in 55 human samples of healthy and malignant colon, sigmoid colon and rectum. It appeared that cancer decreases the average of AChE activity value, such increasing the rate of ACh [66]. Moreover, Cheng and colleagues demonstrated that ChAT staining is undetectable to weak in normal enterocytes but is moderate to strong in 50% of colon cancer examined and colon cancer cell lines [67]. This data show that colon cancer cells possess the ability to produce and release ACh, which could act as an autocrine/paracrine factor. While there is few data on the regulation of ACh release during inflammation, it has been shown that corticoids negatively modulate the non-neuronal cholinergic system by regulating transport and synthesis of ACh in particular at the surface epithetlium of trachea and intestine [68]. In gastrointestinal tissue, the primary mAChR subunits Copyright © 2013 SciRes.

1123

are M1AChR, M2AChR and M3AChR, but colon epithelial cells mainly express M1AChR and M3AChR [38-40,69]. Frutcht et al. reported that human colon cancer cell lines and colon cancer tissues express M3AChR. Their expression is increased up to 8-fold in cancer compared to normal tissue [70]. This over-expression is observed in 60% of colon cancer examined [71]. The over-expression of M3AChR is associated to a drop of degradation and an increasing of ACh synthesis. Corticoids also modulate the expression of mAChR, in a cell specific manner: glucocorticoids decrease M2AChR and M3AChR density in airway smooth muscles [72] while they up-regulated M2AChR in parasympathic nerves [73]. Since the discovery of ubiquitous presence of nAChR in mammalian cells, studies from many laboratories have linked nAChR with various pathological conditions including cancer [74]. These studies were performed with nicotine and concern tobacco-related carcinogenesis such as lung cancer. However it is clear that various nAChR subtypes are expressed in non-neuronal cells but their pattern of expression and their functional roles is under debate [65,75]. nAChRs are expressed in various human cancers with subunit expression altered except the 7-subunit, which is constantly expressed and functional (reviewed in cardinale et al., 2012). It has been proposed that looking at the differentiation status of the tumor, there is a tendency of a major expression of α7 nAChR protein levels in more differentiated human lung tumors [76]. We found that the M3AChR and α7 nAChR are expressed in HT-29 and Caco-2. Their expression is not correlated to the differentiation status of these cell lines but rather to the cellular density. This result was confirmed using various human colonic cell lines characterized by different stage of differentiation (data not shown).

4.3. How mAChR May Participate in CAC? Muscarinic receptor activation stimulates proliferation, migration and invasion of human colon cancer cells [77-79]. These effects have been attributed to M3AChRinduced secretion of matrix metalloprteinases (MMPs) such as MMP7 that releases EGF ligands or MMP1. Most of M3AChR effects seem to be mediated by transactivation of the EGFR. Co-expression of M3AChR and EGFR in many colon cancer cell lines associated with over expression of these receptors in the majority of colon cancer suggests that the functional interaction between M3AChR and EGFR is important for colon cancer regulation. In human colon cancer cell lines, we found that ACh alters the assembly of intercellular junctions (AJ and TJ), a process associated to epithelial barrier failure. This correlates with the observation that mAChR JCT

1124

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation

(in particular M3) increases epithelial cell permeability [80]. This ACh–induced alteration of cellular contacts, decreases cell-ECM adhesion and stimulates invasion of HT-29 cells. Recent research demonstrated that the molecular mechanism of cholinergic control of keratinocyte adhesion involves an ACh receptor-dependant changes in the phosphorylation status of adhesion [81,82]. The phosphorylation of adhesion molecules plays an important role in assembly/disassembly of intercellular junctions controlling their structural integrity and the adhesive capacity [83-86]. Tyrosine phosphorylation of p120ctn or serine phosphorylation of α-ctn correlate with a decrease of cell adhesion and represent the initial event for their degradation [87,88]. The phosphorylation status of a given adhesion molecule is determined by both protein kinase and phosphatase activities. Various kinases have been described to phosphorylate proteins among which the Src kinase [89,90]. We found that ACh but not nicotine induces Src phosphorylation on Tyr 418. Strong evidences for non-neuronal ACh production are reported in human keratinocytes and small lung cancer cells where this transmitter acts as an autocrine/paracrine growth factor stimulating cell proliferation [91,92]. Similarly, ACh produced and released by H508 colon cancer cells interacts with M3AChR and acts as an autocrine growth factor [93]. In HT-29 cells, we found that ACh also stimulates cell proliferation. An increasing number of evidences suggests that cyclooxygenase-2 (Cox-2) expression is associated with colon cancer induction and progression by stimulating cell proliferation, suppressing apoptosis, inducing tumor angiogenesis and promoting invasiveness [93]. However, M3AChR and Cox-2 share the same signaling cascade. M3AChR activation is coupled to the phospholipase C (PLC) signaling cascade and PLC-activated protein PKC is an inducer of Cox-2. In HT-29 cells, Yang and Frucht showed that stimulation of M3AChR by carbachol up-regulates COX-2 protein expression in a concentration and time- dependent manner [71]. So, Cox-2 could constitute the molecular bridge between inflammation and cancer, and mediate in part the effect of M3AChR. Together, these finding indicate that M3AChR expression plays a strong role in intestinal tumor promotion by modulating key process of carcinogenesis. Using different in vivo models, Raufman et al., showed that M3AChR gene ablation decreases both colon tumor number and size and the degree of dysplasia [94]. Indeed, only lowgrade adenomas are detected from Apcmin/+ M3AChR−/− mice while in Apcmin/+ M3AChR+/+ mice both low and high grade adenomas are observed [95]. Furthermore, M3AChR selective inhibitors have been proven to reduced the size of small cell lung cancer xenografts in nude mice [96] suggesting that M3AChR are key promoters of tumor growth. Copyright © 2013 SciRes.

4.4. Protective Effects of nAChR As mAChR, nAChR have been described to modulate epithelial cell-cell contacts, adhesion and motility of respiratory epithelial cells, lung cancer and in a variety of human cancer cell lines [97-99]. Nicotine can induce the transition from a well-differentiated epithelial cell to a highly invasive carcinoma cell involving different signal transduction cascades. Long-term treatment of lung cancer and breast cancer cells is required for these effects. In these models it has been proposed that nicotine, acting via α7 nAChR, stimulates mRNA and protein expression of fibronectin with a concomitant down regulation of junctional protein expression and/or localisation [98,100, 101]. Evidence of nAChR mediated activation of integrin-dependent signaling pathway has also been obtained in colon and gastric cancer [102]. Regarding the gastrointestinal tract, Cho’s laboratory showed that nicotine induced activation of α7 nAChR and stimulated the growth and angiogenesis of gastric and colon cancer by systemic as well as cellular increase in stress neurotransmitters (adrenaline, noradrenaline) leading to β-adrenergic signaling, transactivation of the EGFR and release of EGF [103-105].These finding strengthen the hypothesis that modulation of nAChR upon chronic exposition to tobacco may contribute to the development and progression of cancer. However in some cases, nicotine and tobacco could exert protective effects. UC patients with a history of smocking usually developed their disease after they had stopped smocking [106-108]. Smoking has been found to reduce development and severity of UC and to worsen the disease in CD patients [106,109,110]. Similarly, nicotine administration ameliorates disease in DSS experimental colitis [111]; while worsened the course in TNBS colitis [112]. In patients, [113] treatment with transdermal nicotine was effective at inducing disease remission in UC patients but patients suffered from adverse effects [114]. Thus the effects of nicotine and 7 nAChR agonists may depend on many factors such as disease model and severity, the expression and the subtype of nAChRs. According to these data and our observations, it appeared that cholinergic receptor expression must be determined before VNS therapy. Using a concentration similar to those observed in the blood of smokers (0.01 - 1 M), we found that nicotine-mediated activation of α7 nAChR exert protective effect on epithelial morphology that can preserve from failure of barrier function. Nicotine increased or maintained the expression of various intercellular proteins such as p120ctn, Z0-1, Occludin. This mechanism may contribute to maintain barrier integrity. McGilligan has described similar results, showing that nicotine decrease Caco-2 permeability by regulating the expression of TJ proteins [115]. This process is important to reduce inJCT

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation

flammation but also cancer progression. In a rodent model of intestinal inflammation after severe burn injury, Costantini and collaborators showed that nicotine administration prevent burn-induced intestinal permeability and limited histological injury by controlling intercellular protein expression and localisation [116]. These effects could also be mediated by VNS of enteric nervous system [117]. Many mechanisms are responsible for the up-regulation of junction proteins by nicotine. One possibility is the activation of extracellular signal related kinase (ERK) or mitogen activated kinase (MAPK). Nicotine is described to increase the expression of these kinases [118, 119]. Another possibility is a nicotine-mediated decrease of the nuclear factor kappa B (NFkB). This factor has been described to regulate TJ permeability [120,121] and Cox-2 expression [122,123], a CRC tumor promoting factor [93]. Finally, α7 nAChR activation can regulate the stability of the junction proteins by controlling their phosphorylation status. Indeed, in keratinocytes, Chernyavsky et al., showed that α7 nAChR activates adhesion molecules by both inhibiting Src family kinases and activating protein tyrosine phosphatases (PTP) [124]. nAChRs can be associated with both Src and PTP in large multimeric complexes controlling their activation [125]. Recently, nAChR has been implicated in regulating the release of the neurotransmitter -aminobuturic acid (GABA), which may act as a tumor suppressor in particular, in colon carcinoma and lung adenocarcinoma cells [126,127]. The heterotrimeric α42 nAChR, which binds ACh and nicotine with higher affinity than α7 nAChR, stimulates the release of GABA. This higher affinity for nicotine is thought to cause the long-term inactivation (or desensitization) of the heteromeric nAChR that has been observed after chronic exposition to nicotine such as smokers. By contrast the sensibility of α7 nAChr remains unchanged, its expression is up-regulated by nicotine and its biological effect is increased [128]. The effect induced by nicotine may be different in various cell types, differentiated or “totipotent”, and having diverse metabolic properties to convert nicotine in its metabolite such as cotinine which is more toxic. Moreover, these effects may be related to different factors such as: 1) length of exposure (short versus chronic); 2) concentration (high or low); 3) anatomical distribution and expression of receptor subtypes. Finally, the α7 nAChR effects could be modulated by the secreted mammalian LY-6/urokinase plasminogen activator receptor-related protein-1 (SLURP-1) that has been recently identified by an endogenous ligand for α7 nAChR which exerts protective effect [59].

1125

nAChR in cancer therapy in particular tobacco-related carcinogenesis. In this case, the challenge is to develop compound capable of inhibiting α7 nAChR or potentiating α42 nAChR to counterbalance the deleterious effects of chronic nicotine (for review [129]. Most promising compounds have side-effects in particular on the central nervous system since they can cross the blood-brain barrier. In improving the strategy for treating IBD patients, VNS could represent an attractive therapeutic approach to prevent CAC. VNS (afferent fibers) at high frequency (30 Hz) is already successfully used in humans in the treatment of depression, seizure and more recently metabolism troubles [30,31]. Now this technique could be extended to gastrointestinal disorders such as IBD using a low frequency stimulation (5 - 10 Hz) which is known to activate efferent fibers (for review [12]). In this condition, VNS uses a physiological anti-inflammatory pathway and represents a safe technique with even less side-effects. A reduction of inflammation is a key step for decrease the risk of CAC. However we should keep in mind that the nature and the subtype of cholinergic receptors on target cells should be carefully investigated before evaluating the effectiveness of nAChR as a drug target in these patients. Indeed, stimulation of mAChR play key role in colon cancer cell invasion.

5. Acknowledgements The authors gratefully acknowledge grant support from Association pour la Recherche sur le Cancer, Ligue Nationale contre le Cancer, GEFLUC and ESPOIR. B. Ducarouge and M. Pelissier-Rota are the recipient of a fellowship from the Ministère de la Recherche et de l’Enseignement Supérieur. We thank Pierre-Emmanuel Buyse for his technical support.

REFERENCES [1]

M. Scharl and G. Rogler, “Inflammatory Bowel Disease: Dysfunc- tion of Autophagy?” Digestive Disease, Vol. 30, No. 3, 2012, pp. 12-19. doi:10.1159/000342588

[2]

S. Danese and A. Mantovani, “Inflammatory Bowel Disease and Intestinal Cancer: A Paradigm of the Yin-Yang Interplay between Inflammation and Cancer,” Oncogene, Vol. 29, No. 23, 2010, pp. 3313-3323. doi:10.1038/onc.2010.109

[3]

M. Rutter, B. Saunders, K. Wilkinson, S. Rumbles, G. Schofield, M. Kamm, C. Williams, A. Price, I. Talbot and A. Forbes, “Severity of Inflammation Is a Risk Factor for Colorectal Neoplasia in Ulcerative Colitis,” Gastroenterology, Vol. 126, No. 2, 2004, pp. 451-460. doi:10.1053/j.gastro.2003.11.010

[4]

J. A. Eaden, K. R. Abrams and J. F. Mayberry, “The Risk of Colorectal Cancer in Ulcerative Colitis: A Meta-Analysis,” Gut, Vol. 48, No. 4, 2001, pp. 536-535. doi:10.1136/gut.48.4.526

JCT

1126 [5]

[6]

[7]

[8]

[9]

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation M. D. Rutter, B. P. Saunders, K. H. Wilkinson, S. Rumbles, G. Schofield, M. A. Kamm, C. B. Williams, A. B. Price, I. C. Talbot and A. Forbes, “Thirty-Year Analysis of a Colonoscopic Surveillance Program for Neoplasia in Ulcerative Colitis,” Gastroenterology, Vol. 130, No. 4, 2006, pp. 1030-1038. doi:10.1053/j.gastro.2005.12.035 A. Ekbom, M. Zack and H. O. Adami, “The Epidemiology of Inflammatory Bowel Disease: A Large, PopulationBased Study in Sweden,” Gastroenterology, Vol. 100, No. 2, 1991, pp. 350-358. S. I. Grivennikov, “Inflammation and Colorectal Cancer: Colitis-Associated Neoplasia,” Seminars in Immunopathology, Vol. 35, No. 2, 2013, pp. 229-244. doi:10.1007/s00281-012-0352-6 H. S. Cooper, S. Murthy, K. Kido, H. Yoshitake and A. Flanigan, “Dysplasia and Cancer in the Dextran Sulfate Sodium Mouse Colitis Model. Relevance to Colitis-Associated Neoplasia in the Human: A Study of Histopathology, B-Catenin and p53 Expression and the Role of Inflammation,” Carcinogenesis, Vol. 21, No. 4, 2000, pp. 757-768. doi:10.1093/carcin/21.4.757 R. L. Shattuck-Brandt, G. W. Varilek, A. Radhika, F. Yang, M. K. Washington and R. N. DuBois, “Cyclooxygenase 2 Expression Is Increased in the Stroma of Colon Carcinomas from IL-10(-/-) Mice,” Gastroenterology, Vol. 118, No. 2, 2000, pp. 337-345. doi:10.1016/S0016-5085(00)70216-2

Abed, C. J. Czura and K. J. Tracey, “Nicotinic Acetylcholine Receptor Alpha7 Subunit Is an Essential Regulator of Inflammation,” Nature, Vol. 421, No. 6921, 2003, pp. 384388. doi:10.1038/nature01339 [17] K. J. Tracey, “The Inflammatory Reflex,” Nature, Vol. 420, No. 6917, 2002, pp. 853-859. doi:10.1038/nature01321 [18] K. J. Tracey, “Physiology and Immunology of the Cholinergic Antiinflammatory Pathway,” Journal of Clinical Investigation, Vol. 117, No. 2, 2007, pp. 289-296. doi:10.1172/JCI30555 [19] A. Miyazawa and N. Unwin, “Structure and Gating Mechanism of the Acetylcholine Receptor Pore,” Nature, Vol. 423, No. 6943, 2003, pp. 949-955. doi:10.1038/nature01748 [20] J. Wess, “Molecular Biology of Muscarinic Acetylcholine Receptors,” Critical Reviews in Neurobiology, Vol. 10, No. 1, 1996, pp. 69-99. doi:10.1615/CritRevNeurobiol.v10.i1.40 [21] L. G. Paleari, A. Cesario and P. Russo, “The Cholinergic System and Cancer,” Seminars in Cancer Biology, Vol. 18, No. 3, 2008, pp. 211-217. doi:10.1016/j.semcancer.2007.12.009 [22] M. Sopori, “Effects of Cigarette Smoke on the Immune System,” Nature Reviews Immunology, Vol. 2, No. 5, 2002, pp. 372-377. doi:10.1038/nri803

[10] P. Sansone, G. Piazzi, P. Paterini, A. Strillacci, C. Ceccarelli, F. Minni, G. Biasco, P. Chieco and M. Bonafè, “Cyclooxygenase-2/Carbonic Anhydrase-IX Up-Regulation Promotes Invasive Potential and Hypoxia Survival in Colorectal Cancer Cells,” Journal of Cellular and Molecular Medicine, Vol. 13, No. 9, 2009, pp. 3876-3887. doi:10.1111/j.1582-4934.2008.00580.x

[23] C. J. Czura, S. G. Friedman and K. J. Tracey, “Neural Inhibition of Inflammation: The Cholinergic Anti-Inflammatory Pathway,” Journal of Endotoxin Research, Vol. 9, No. 6, 2003, pp. 409-413.

[11] K. Nys and S. Vermeire, “Autophagy: A New Target or an Old Strategy for the Treatment of Crohn’s Disease?” Nature Reviews Gastroenterology & Hepatology, 2013, in Press.

[25] H. M. Schuller, “Nitrosamines as Nicotinic Receptor Ligands,” Life Sciences, Vol. 80, No. 24-25, 2007, pp. 2274-2280. doi:10.1016/j.lfs.2007.03.006

[12] B. Bonaz, C. Picq, V. Sinniger, J. F. Mayol and D. Clarençon, “Vagus Nerve Stimulation: From Epilepsy to the Cholinergic Anti-Inflammatory Pathway,” Neurogastroenterology & Motility, Vol. 25, No. 3, 2013, pp. 208-221. doi:10.1111/nmo.12076 [13] C. Cheyuo, A. Jacob, R. Wu, M. Zhou, G. F. Coppa and P. Wang, “The Parasympathetic Nervous System in the Quest for Stroke Therapeutics,” Journal of Cerebral Blood Flow & Metabolism, Vol. 31, 2011, pp. 1187-1195. doi:10.1038/jcbfm.2011.24 [14] V. A. Pavlov and K. J. Tracey, “The Cholinergic AntiInflammatory Pathway,” Brain, Behavior, and Immunity, Vol. 19, No. 6, 2005, pp. 493-499. [15] L. V. Borovikova, M. Zhang, H. Yang, G. I. Botchkina, L. R. Watkins, H. Wang, N. Abumrad, J. W. Eaton and K. J. Tracey, “Vagus Nerve Stimulation Attenuates the Systemic Inflammatory Response to Endotoxin,” Nature, Vol. 405, No. 6785, 2000, pp. 458-462. doi:10.1038/35013070 [16] H. Wang, M. Yu, M. Ochani, C. A. Amella, M. Tanovic, S. Susarla, J. H. Li, H. Wang, H. Yang, L. Ulloa, Y. AlCopyright © 2013 SciRes.

[24] L. Ulloa, “The Vagus Nerve and the Nicotinic Anti-Inflammatory Pathway,” Nature Reviews Drug Discovery, Vol. 4, No. 8, 2005, pp. 673-684. doi:10.1038/nrd1797

[26] D. J. van Westerloo, I. A. Giebelen, S. Florquin, M. J. Bruno, G. J. Larosa, L. Ulloa, K. J. Tracey and T. van der Poll, “The Vagus Nerve and Nicotinic Receptors Modulate Experimental Pancreatitis Severity in Mice,” Gastroenterology, Vol. 130, No. 6, 2006, pp. 1822-1830. doi:10.1053/j.gastro.2006.02.022 [27] J. E. Ghia, P. Blennerhassett, H. Kumar-Ondiveeran, E. F. Verdu and S. M. Collins, “The Vagus Nerve: A Tonic Inhibitory Influence Associated with Inflammatory Bowel Disease in a Murine Model,” Gastroenterology, Vol. 131, No. 4, 2006, pp. 1122-1130. doi:10.1053/j.gastro.2006.08.016 [28] J. Meregnani, D. C, M. Vivier, A. Peinnequin, C. Mouret, V. Sinniger, C. Picq, A. Job, F. Canini, M. Jacquier-Sarlin and B. Bonaz, “Anti-Inflammatory Effect of Vagus Nerve Stimulation in a Rat Model of Inflammatory Bowel Disease,” Autonomic Neuroscience: Basic and Clinical, Vol. 160, No. 1, 2011, pp. 82-89. doi:10.1016/j.autneu.2010.10.007 [29] F. The, C. Cailotto, J. van der Vliet, W. J. de Jonge, R. J. Bennink, R. M. Buijs and G. E. Boeckxstaens, “Central Activation of the Cholinergic Anti-Inflammatory Pathway JCT

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation

1127

Reduces Surgical Inflammation in Experimental PostOperative Ileus,” British Journal of Pharmacology, Vol. 163, No. 5, 2011, pp. 1007-1016. doi:10.1111/j.1476-5381.2011.01296.x

verse Multifunctional Molecules of Basement Membranes,” Journal of Investigative Dermatology, Vol. 106, No. 2, 1996, pp. 209-214. doi:10.1111/1523-1747.ep12340471

[30] A. H. Milby, C. H. Halpern and G. H. Baltuch, “Vagus Nerve Stimulation for Epilepsy and Depression,” Neurotherapeutics, Vol. 5, No. 1, 2008, pp. 75-85. doi:10.1016/j.nurt.2007.10.071

[43] J.-F. Beaulieu, “Extracellular Matrix Components and Integrins in Relationship to Human Intestinal Epithelial Cell Differentiation,” Progress in Histochemistry and Cytochemistry, Vol. 31, No. 4, 1997, pp. 1-76. doi:10.1016/S0079-6336(97)80001-0

[31] V. A. Pavlov and K. J. Tracey, “The Vagus Nerve and the Inflammatory Reflex—Linking Immunity and Metabolism,” Nature Reviews Endocrinology, Vol. 8, 2012, pp. 743-754. doi:10.1038/nrendo.2012.189 [32] S. P. Hussain, L. J. Hofseth and C. C. Harris, “Radical Causes of Cancer,” Nature Reviews Cancer, Vol. 3, No. 6, 2003, pp. 267-285. doi:10.1038/nrc1046 [33] G. K. Zupanc, I. Horschke and D. A. Lovejoy, “Corticotropin Releasing Factor in the BRain of the Gymnotiform Fish, Apteronotus leptorhynchus: Immunohistochemical Studies Combined with Neuronal Tract Tracing,” General and Comparative Endocrinology, Vol. 114, No. 3, 1999, pp. 349-364.doi:10.1006/gcen.1999.7273 [34] P. M. O’Connor, T. K. Lapointe, P. L. Beck and A. G. Buret, “Mechanisms by Which Inflammation May Increase Intestinal Cancer Risk in Inflammatory Bowel Disease,” Inflammatory Bowel Diseases, Vol. 16, No. 8, 2010, pp. 1411-1420. doi:10.1002/ibd.21217 [35] J. Terzić, S. Grivennikov, E. Karin and M. Karin, “Inflammation and Colon Cancer,” Gastroenterology, Vol. 138, No. 6, 2010, pp. 2101-2114. [36] O. M. Kalashnyk, G. L. Gergalova, S. V. Komisarenko and M. V. Skok, “Intracellular Localization of Nicotinic Acetylcholine Receptors in Human Cell Lines,” Life Sciences, Vol. 91, No. 21-22, 2012, pp. 1033-1037. doi:10.1016/j.lfs.2012.02.005 [37] C. L. Hirota and D. M. McKay, “Cholinergic Regulation of Epithelial Ion Transport in the Mammalian Intestine,” British Journal of Pharmacology, Vol. 149, No. 5, 2006, pp. 463-479. doi:10.1038/sj.bjp.0706889 [38] R. Kopp, G. Lambrecht, E. Mutschler, U. Moser, R. Tacke and A. Pfeiffer, “Human HT-29 Colon Carcinoma Cells Contain Muscarinic M3 Receptors Coupled to Phosphoinositide Metabolism,” European Journal of Pharmacology: Molecular Pharmacology, Vol. 172, No. 4-5, 1989, pp. 397-405. doi:10.1016/0922-4106(89)90021-7 [39] K. E. J. Dickinsona, R. A. Frizzellb and M. C. Sekar, “Activation of T84 Cell Chloride Channels by Carbachol Involves a Phosphoinositide-Coupled Muscarinic M3 Receptor,” European Journal of Pharmacology: Molecular Pharmacology, Vol. 225, No. 4, 1992, pp. 291-298. doi:10.1016/0922-4106(92)90102-2 [40] K. E. O’Malley, C. B. Farrell, K. M. O’Boyle and A. W. Baird, “Cholinergic Activation of Cl-Secretion in Rat Colonic Epithelia,” European Journal of Pharmacology, Vol. 275, No. 1, 1995, pp. 83-89. [41] P. Simon-Assmann, M. Kedinger, A. De Arcangelis, V. Rousseau and P. Simo, “Extracellular Matrix Components in Intestinal Development,” Experientia, Vol. 51, No. 9-10, 1995, pp. 883-900. doi:10.1007/BF01921739 [42] M. Aumailley and T. Krieg, “Laminins: A Family of DiCopyright © 2013 SciRes.

[44] S. Miyamoto, S. K. Akiyama and K. M. Yamada, “Synergistic Roles for Receptor Occupancy and Aggregation in Integrin Transmembrane Function,” Science, Vol. 267, No. 5199, 1995, pp. 883-885. doi:10.1126/science.7846531 [45] M. A. Schwartz, M. D. Schaller and M. H. Ginsberg, “Integrins: Emerging Paradigms of Signal Transduction,” Annual Review of Cell and Developmental Biology, Vol. 11, No. 1, 1995, pp. 549-599. doi:10.1146/annurev.cb.11.110195.003001 [46] Z. Hossain and T. Hirata, “Molecular Mechanism of Intestinal Permeability: Interaction at Tight Junctions,” Molecular BioSystems, Vol. 4, No. 12, 2008, pp. 1181-1185. doi:10.1039/b800402a [47] C. M. Niessen, “Tight Junctions/Adherens Junctions: Basic Structure and Function,” Journal of Investigative Dermatology, Vol. 127, 2007, pp. 2535-2532. doi:10.1038/sj.jid.5700865 [48] J. A. Jankowski, F. K. Bedford and Y. S. Kim, “Changes in Gene Structure and Regulation of E-Cadherin during Epithelial Development, Differentiation, and Disease,” Progress in Nucleic Acid Research and Molecular Biology, Vol. 57, 1997, pp. 187-215. doi:10.1016/S0079-6603(08)60281-0 [49] A. Zweibaum, M. Pinto, G. Chevalier, E. Dussaulx, N. Triadou, B. Lacroix, K. Haffen, J.-L. Brun and M. Rousset, “Enterocytic Differentiation of a Subpopulation of the Human Colon Tumor Cell Line HT-29 Selected for Growth in Sugar-Free Medium and Its Inhibition by Glucose,” Journal of Cellular Physiology, Vol. 122, No. 1, 1985, pp. 27-29. doi:10.1002/jcp.1041220105 [50] N. T. Chartier, M. Laine, S. Gout, G. Pawlak, C. A. Marie, P. Matos, et al., “Laminin-5-Integrin Interaction Signals through PI 3-Kinase and Rac1b to Promote Assembly of Adherens Junctions in HT-29 Cells,” Journal of Cell Science, Vol. 119, 2006, pp. 31-46. doi:10.1242/jcs.02698 [51] E. A. Wayner, S. G. Gil, G. F. Murphy, M. S. Wilke and W. G. Carter, “Epiligrin, a Component of Epithelial Basement Membranes, Is an Adhesive Ligand for Alpha 3 Beta 1 Positive T Lymphocytes,” The Journal of Cell Biology, Vol. 121, No. 5, 1993, pp. 1141-1152. doi:10.1083/jcb.121.5.1141 [52] J. B. Weitzman, R. Pasqualini, Y. Takada and M. E. Hemler, “The Function and Distinctive Regulation of the Integrin VLA-3 in Cell Adhesion, Spreading, and Homotypic Cell Aggregation,” The Journal of Biological Chemistry, Vol. 268, No. 12, 1993, pp. 8651-8657. [53] A. E. Summers, C. J. Whelan and M. E. Parsons, “Nicotinic Acetylcholine Receptor Subunits and Receptor Activity in the Epithelial Cell Line HT29,” Life Sciences, JCT

1128

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation Vol. 72, No. 18-19, 2003, pp. 2091-2094. doi:10.1016/S0024-3205(03)00089-4

[54] C. Huet, C. Sahuquillo-Merino, E. Coudrier and D. Louvard, “Absorptive and Mucus-Secreting Subclones Isolated from a Multipotent Intestinal Cell Line (HT-29) Provide New Models for Cell Polarity and Terminal Differentiation,” The Journal of Cell Biology, Vol. 105, No. 1, 1987, pp. 345-357. doi:10.1083/jcb.105.1.345 [55] S. P. Gout, M. R. Jacquier-Sarlin, L. Rouard-Talbot, P. Rousselle and M. R. Block, “RhoA-Dependent Switch between Alpha2Beta1 and Alpha3Beta1 Integrins Is Induced by Laminin-5 during Early Stage of HT-29 Cell Differentiation,” Molecular Biology of the Cell, Vol. 12, No. 10, 2001, pp. 3268-3281. [56] S. Gout, C. Marie, M. Lainé, G. Tavernier, M. R. Block and M. Jacquier-Sarlin, “Early Enterocytic Differentiation of HT-29 Cells: Biochemical Changes and Strength Increases of Adherens Junctions,” Experimental Cell Research, Vol. 299, No. 2, 2004, pp. 498-510. doi:10.1016/j.yexcr.2004.06.008 [57] J. Fogh, “Human Tumor Cells in Vitro,” Plenum Press, New York, 1975, pp. 115-141. [58] H. P. S. Wong, L. Yu, E. K. Y. Lam, E. K. K. Tai, W. K. K. Wu and C. H. Cho, “Nicotine Promotes Cell Proliferation via Alpha7-Nicotinic Acetylcholine Receptor and Catecholamine-Synthesizing Enzymes-Mediated Pathway in Human Colon Adenocarcinoma HT-29 Cells,” Toxicology and Applied Pharmacology, Vol. 221, No. 3, 2007, pp. 261-267. doi:10.1016/j.taap.2007.04.002 [59] A. Pettersson, L. Nilsson, G. Nylund, A. KhorramManesh, S. Nordgren and D. S. Delbro, “Is Acetylcholine an Autocrine/Paracrine Growth Factor via the Nicotinic Alpha7-Receptor Subtype in the Human Colon Cancer Cell Line HT-29?” European Journal of Pharmacology, Vol. 609, No. 1-3, 2009, pp. 27-33. doi:10.1016/j.ejphar.2009.03.002 [60] C. D’Souza-Schorey, “Disassembling Adherens Junctions: Breaking Up Is Hard to Do,” Trends in Cell Biology, Vol. 15, No. 1, 2005, pp. 19-26. doi:10.1016/j.tcb.2004.11.002 [61] S. Razani-Boroujerdi, M. Behl, F. F. Hahn, J. C. PenaPhilippides, J. Hutt and M. L. Sopori, “Role of Muscarinic Receptors in the Regulation of Immune and Inflammatory Responses,” Journal of Neuroimmunology, Vol. 194, No. 1, 2008, pp. 83-88. doi:10.1016/j.jneuroim.2007.11.019 [62] I. Wessler, C. J. Kirkpatrick and K. Racké, “Non-Neuronal Acetylcholine, a Locally Acting Molecule, Widely Distributed in Biological Systems: Expression and Function in Humans,” Pharmacology & Therapeutics, Vol. 77, No. 1, 1998, pp. 59-79. doi:10.1016/S0163-7258(97)00085-5 [63] T. Okuda and T. Haga, “High-Affinity Choline Transporter,” Neurochemical Research, Vol. 28, No. 3-4, 2003, pp. 483-488. doi:10.1023/A:1022809003997 [64] K. Racké, U. R. Juergens and S. Matthiesen, “Control by Cholinergic Mechanisms,” European Journal of Pharmacology, Vol. 533, No. 1-3, 2006, pp. 57-68. doi:10.1016/j.ejphar.2005.12.050 [65] I. Wessler and C. J. Kirkpatrick, “Acetylcholine beyond Copyright © 2013 SciRes.

Neurons: The Non-Neuronal Cholinergic System in Humans,” British Journal of Pharmacology, Vol. 154, No. 8, 2008, pp. 1558-1571. doi:10.1038/bjp.2008.185 [66] M. F. Montenegro, F. Ruiz-Espejo, F. J. Campoy, E. Muñoz-Delgado, M. Páez de la Cadena, F. J. RodríguezBerrocal and C. J. Vidal, “Cholinesterases Are DownExpressed in Human Colorectal Carcinoma,” Cellular and Molecular Life Sciences, Vol. 63, No. 18, 2006, pp. 2175-2182. doi:10.1007/s00018-006-6231-3 [67] K. R. Cheng, R. Samimi, G. F. Xie, J. Shant, C. Drachenberg, M. Wade, R. J. Davis, G. Nomikos and J.-P. Raufman, “Acetylcholine Release by Human Colon Cancer Cells Mediates Autocrine Stimulation of Cell Proliferation,” American Journal of Physiology-Gastrointestinal and Liver Physiology, Vol. 295, No. 3, 2008, pp. G591-G597. doi:10.1152/ajpgi.00055.2008 [68] I. Wessler, T. Reinheimer, H. Klapproth, F.-J. Schneider, K. Racké and R. Hammer, “Mammalian Glial Cells in Culture Synthesize Acetylcholine,” Naunyn-Schmiedeberg’s Archives of Pharmacology, Vol. 356, No. 5, 1997, pp. 694-697. doi:10.1007/PL00005107 [69] J.-P. Raufman, R. Samimi, N. Shah, S. Khurana, J. Shant, C. Drachenberg, G. F. Xie, J. Wess and K. R. Cheng, “Genetic Ablation of M3 Muscarinic Receptors Attenuates Murine Colon Epithelial Cell Proliferation and Neoplasia,” Cancer Research, Vol. 68, 2008, pp. 3573-3578. doi:10.1158/0008-5472.CAN-07-6810 [70] H. Frucht, R. T. Jensen, D. Dexter, W. L. Yang and Y. Xiao, “Human Colon Cancer Cell Proliferation Mediated by the M3 Muscarinic Cholinergic Receptor,” Clinical Cancer Research, Vol. 5, No. 9, 1999, pp. 2532-2539. [71] W.-L. Yang and H. Frucht, “Cholinergic Receptor UpRegulates COX-2 Expression and Prostaglandin E(2) Production in Colon Cancer cells,” Carcinogenesis, Vol. 21, No. 10, 2000, pp. 1789-1793. doi:10.1093/carcin/21.10.1789 [72] C. W. Emala, J. Clancy and C. A. Hirshman, “Glucocorticoid Treatment Decreases Muscarinic Receptor Expression in Canine Airway Smooth Muscle,” American Journal of Physiology, Vol. 272, No. 4, 1997, pp. L745-L751. [73] D. B. Jacoby, B. L. Yost, B. Kumaravel, Y. Chan-Li, H.-Q. Xiao, K. Kawashima and A. D. Fryer, “Glucocorticoid Treatment Increases Inhibitory M(2) Muscarinic Receptor Expression and Function in the Airways,” American Journal of Respiratory Cell and Molecular Biology, Vol. 24, No. 4, 2001, pp. 485-91. doi:10.1165/ajrcmb.24.4.4379 [74] H. M. Schuller, “Cell Type Specific, Receptor-Mediated Modulation of Growth Kinetics in Human Lung Cancer Cell Lines by Nicotine and Tobacco-Related Nitrosamines,” Biochemical Pharmacology, Vol. 38, No. 20, 1989, pp. 3439-3442. doi:10.1016/0006-2952(89)90112-3 [75] C. Gotti and F. Clementi, “Neuronal Nicotinic Receptors: From Structure to Pathology,” Progress in Neurobiology, Vol. 74, No. 6, 2004, pp. 363-396. doi:10.1016/j.pneurobio.2004.09.006 [76] Russo P CA, Cardinale A., “Presentation to the Special Issue: ‘α7-Nicotinic Receptor (α7-nAChR): One Target Different Diseases’,” Current Drug Targets, Vol. 13, No. , JCT

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation 2012, 573. [77] J.-P. Raufman, J. Shant, G. F. Xie, K. R. Cheng, X.-M. Gao, B. Shiu, N. Shah, C. B. Drachenberg, J. Heath, J. Wess and S. Khurana, “Muscarinic Receptor Subtype-3 Gene Ablation and Scopolamine Butylbromide Treatment Attenuate Small Intestinal Neoplasia in Apcmin/+ Mice,” Carcinogenesis, Vol. 32, No. 9, 2011, pp. 1396-1402. doi:10.1093/carcin/bgr118 [78] A. Belo, K. R. Cheng, A. Chahdi, J. Shant, G. F. Xie, S. Khurana and J.-P. Raufman, “Muscarinic Receptor Agonists Stimulate Human Colon Cancer Cell Migration and Invasion,” American Journal of Physiology-Gastrointestinal and Liver Physiology, Vol. 300, No. 5, 2011, pp. G749-G760. doi:10.1152/ajpgi.00306.2010 [79] K. Cheng, P. Zimniak and J. P. Raufman, “Transactivation of the Epidermal Growth Factor Receptor Mediates Cholinergic Agonist-Induced Proliferation of H508 Human Colon Cancer Cells,” Cancer Research, Vol. 63, No. 20, 2003, pp. 6744-6750. [80] H. L. Cameron and M. H. Perdue, “Muscarinic Acetylcholine Receptor Activation Increases Transcellular Transport of Macromolecules across Mouse and Human Intestinal Epithelium in Vitro,” Neurogastroenterology & Motility, Vol. 19, No. 1, 2007, pp. 47-56. doi:10.1111/j.1365-2982.2006.00845.x [81] V. T. Nguyena, J. Arredondoa, A. I. Chernyavskya, Y. Kitajimab and S. A. Grando, “Keratinocyte Acetylcholine Receptors Regulate Cell Adhesion,” Life Sciences, Vol. 72, No. 18-19, 2003, pp. 2081-2085. doi:10.1016/S0024-3205(03)00087-0 [82] Nguyen VT AJ, Chernyavsky AI, Kitajima Y, Pittelkow M, Grando SA., “Pemphigus Vulgaris IgG and Methylprednisolone Exhibit Reciprocal Effects on Keratinocytes,” The Journal of Biological Chemistry, Vol. 279, 2004, pp. 2135-2146. doi:10.1074/jbc.M309000200 [83] S. Alemà and A. M. Salvatore, “p120 Catenin and Phosphorylation: Mechanisms and Traits of an Unresolved Issue,” Biochimica et Biophysica Acta (BBA)-Molecular Cell Research, Vol. 1773, No. 1, 2007, pp. 47-58. doi:10.1016/j.bbamcr.2006.06.001 [84] E. Calautti, M. Grossi, C. Mammucari, Y. Aoyama, M. Pirro, Y. Ono, J. Li and G. P. Dotto, “Fyn Tyrosine Kinase Is a Downstream Mediator of Rho/PRK2 Function in Keratinocyte Cell-Cell Adhesion,” The Journal of Cell Biology, Vol. 156, No. 1, 2002, pp. 137-148. doi:10.1083/jcb.200105140 [85] J. Lilien, J. Balsamo, C. Arregui and G. Xu, “Turn-Off, Drop-Out: Functional State Switching of Cadherins,” Developmental Dynamics, Vol. 224, No. 1, 2002, pp. 1829. doi:10.1002/dvdy.10087 [86] M. Serresa, O. Filholb, H. Lickertc, C. Grangeassed, E. M. Chambazb, J. Stappertc, C. Vincenta and D. Schmitt, “The Disruption of Adherens Junctions Is Associated with a Decrease of E-Cadherin Phosphorylation by Protein Kinase CK2,” Experimental Cell Research, Vol. 15, No. 2, 2000, pp. 255-264. doi:10.1006/excr.2000.4895 [87] S. Dupre-Crochet, A. Figueroa, C. Hogan, E. C. Ferber, C. U. Bialucha, J. Adams, E. C. N. Richardson and Y. Fujita, Copyright © 2013 SciRes.

1129

“Casein Kinase 1 Is a Novel Negative Regulator of ECadherin-Based Cell-Cell Contacts,” Molecular and Cellular Biology, Vol. 27, No. 10, 2007, pp. 3804-3816. doi:10.1128/MCB.01590-06 [88] H. Aberle, A. Bauer, J. Stappert, A. Kispert and R. Kemler, “Beta-Catenin Is a Target for the Ubiquitin-Proteasome Pathway,” The EMBO Journal, Vol. 16, 1997, pp. 3797-3804. doi:10.1093/emboj/16.13.3797 [89] B. C. Elias, T. Suzuki, A. Seth, F. Giorgianni, G. Kale, L. Shen, J. R. Turner, A. Naren, Dominic M. Desiderio and Radhakrishna Rao, “Phosphorylation of Tyr-398 and Tyr-402 in Occludin Prevents Its Interaction with ZO-1 and Destabi-Lizes Its Assembly at the Tight Junctions,” The Journal of Biological Chemistry, Vol. 284, 2009, pp. 1559-1569. doi:10.1074/jbc.M804783200 [90] A. Kourtidis, S. P. Ngok and P. Z. Anastasiadis, “p120 Catenin: An Essential Regulator of Cadherin Stability, Adhe-Sion-Induced Signaling, and Cancer Progression,” Progress in Molecular Biology and Translational Science, Vol. 116, 2013, pp. 409-432. doi:10.1016/B978-0-12-394311-8.00018-2 [91] P. F. Song, H. S. Sekhon, Y. B. Jia, J. A. Keller, J. K. Blusztajn, G. P. Mark and E. R. Spindel, “Acetylcholine Is Synthesized by and Acts as an Autocrine Growth Factor for Small Cell Lung Carcinoma,” Cancer Research, Vol. 63, No. 1, 2003, pp. 214-221. [92] T. Schlereth., F. Birklein, K. an Haack, S. Schiffmann, H. Kilbinger, C. J. Kirkpatrick and I. Wessler, “In Vivo Release of Non-Neuronal Acetylcholine from the Human Skin as Measured by Dermal Microdialysis: Effect of Botulinum Toxin,” British Journal of Pharmacology, Vol. 147, No. 2, 2006, pp. 183-187. doi:10.1038/sj.bjp.0706451 [93] R. Y. Huang and G. G. Chen, “Cigarette Smoking, Cyclooxygenase-2 Pathway and Cancer,” Biochimica et Biophysica Acta, Vol. 1815, No. 2, 2011, pp. 158-169. [94] J. P. Raufman, R. Samimi, N. Shah, S. Khurana, J. Shant, C. Drachenberg, G. Xie, J. Wess and K. Cheng, “Genetic Ablation of M3 Muscarinic Receptors Attenuates Murine Colon Epithelial Cell Proliferation and Neoplasia,” Cancer Research, Vol. 68, No. 10, 2008, pp. 3573-3578. doi:10.1158/0008-5472.CAN-07-6810 [95] G. P. Boivin, K. Washington, K. Yang, J. M. Ward, T. P. Pretlow, R. Russell, D. G. Besselsen, V. L. Godfrey, T. Doetschman, W. F. Dove, H. C. Pitot, R. B. Halberg, S. H. Itzkowitz, J. Groden and R. J. Coffey, “Pathology of Mouse Models of Intestinal Cancer: Consensus Report and Recommendations,” Gastroenterology, Vol. 124, No. 3, 2003, pp. 762-77. doi:10.1053/gast.2003.50094 [96] P. Song, H. S. Sekhon, A. Lu, J. Arredondo, D. Sauer, C. Gravett, G. P. Mark, S. A. Grando and E. R. Spindel, “M3 Muscarinic Receptor Antagonists Inhibit Small Cell Lung Carcinoma Growth and Mitogen-Activated Protein Kinase Phosphorylation Induced by Acetylcholine Secretion,” Cancer Research, Vol. 67, No. 8, 2007, pp. 39363944. doi:10.1158/0008-5472.CAN-06-2484 [97] S. Zia, A. Ndoye, V. T. Nguyen and S. A. Grando, “Nicotine Enhances Expression of the Alpha 3, Alpha 4, Alpha 5, and Alpha 7 Nicotinic Receptors Modulating Calcium JCT

1130

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation Metabolism and Regulating Adhesion and Motility of Respiratory Epithelial Cells,” Research Communications in Molecular Pathology and Pharmacology, Vol. 97, No. 3, 1997, pp. 243-262.

[98] P. Dasgupta, W. Rizwani, S. Pillai, Kinkade R, Kovacs M, Rastogi S, Banerjee S, Carless M, Kim E, Coppola D, Haura E, Chellappan S., “Nicotine induces Cell Proliferation, Invasion and Epithelial-Mesenchymal Transition in a Variety of Human Cancer Cell Lines,” International Journal of Cancer, Vol. 124, No. 1, 2009, pp. 35-36. doi:10.1002/ijc.23894 [99] R. Davis, W. Rizwani, S. Banerjee, M. Kovacs, E. Haura, D. Coppola and S. Chellappan, “Nicotine Promotes Tumor Growth and Metastasis in Mouse Models of Lung Cancer,” PLoS One, Vol. 4, No. 10, 2009, Article ID: e7524. doi:10.1371/journal.pone.0007524 [100] J. E. Michaelson, J. R. Ritzenthaler and J. Roman, “Regulation of Serum-Induced Fibronectin Expression by Pro- tein Kinases, Cytoskeletal Integrity, and CREB,” Ameri- can Journal of Physiology-Lung Cellular and Molecular Physiology, Vol. 282, 2002, pp. L291-L301.

C. Buss, B. K. Evans, et al., “Nicotine Enemas for Treatment of Ulcerative Colitis: A Study of the Pharmacokinetics and Adverse Events Associated with Three Doses of Nicotine,” Alimentary Pharmacology & Therapeutics, Vol. 20, No. 8, 2004, pp. 859-865. doi:10.1111/j.1365-2036.2004.02199.x [109] B. Tanja and B. Ulrich, “Inflammatory Bowel Disease and Smoking: A Review of Epidemiology, Pathophysiology, and Therapeutic Implications,” Inflammatory Bowel Diseases, Vol. 10, No. 6, 2004, pp. 848-859. doi:10.1097/00054725-200411000-00019 [110] W. J. Sandborn, “Severe Ulcerative Colitis,” Current Treatment Options in Gastroenterology, Vol. 2, No. 2, 1999, pp. 113-118. doi:10.1007/s11938-999-0038-x [111] J. E. Ghia, P. Blennerhassett, H. Kumar-Ondiveeran, E. F. Verdu and S. M. Collins, “The Vagus Nerve: A Tonic Inhibitory Influence Associated with Inflammatory Bowel Disease in a Murine Model,” Gastroenterology, Vol. 131, No. 4, 2006, pp. 1122-1130. doi:10.1053/j.gastro.2006.08.016

[101] Y. Zheng, J. D. Ritzenthaler, J. Roman and S. W. Han, “Nicotine Stimulates Human Lung Cancer Cell Growth by Inducing Fibronectin Expression,” American Journal of Respiratory Cell and Molecular Biology, Vol. 37, No. 6, 2007, pp. 681-690. doi:10.1165/rcmb.2007-0051OC

[112] S. A. Snoek, M. I. Verstege, E. P. van der Zanden, N. Deeks, D. C. Bulmer, M. Skynner, et al., “Selective Alpha7 Nicotinic Acetylcholine Receptor Agonists Worsen Disease in Experimental Colitis,” British Journal of Pharmacology, Vol. 160, No. 2, 2010, pp. 322-333. doi:10.1111/j.1476-5381.2010.00699.x

[102] P. L. Wei, L. J. Kuo, M. T. Huang, W. C. Ting, Y. S. Ho, W. Wang, J. An and Y. J. Chang, “Nicotine Enhances Colon Cancer Cell Migration by Induction of Fibronectin,” Annals of Surgical Oncology, Vol. 18, No. 6, 2011, pp. 1782-1790. doi:10.1245/s10434-010-1504-3

[113] A. P. Sykes, C. Brampton, S. Klee, C. L. Chander, C. Whelan and M. E. Parsons, “An Investigation into the Effect and Mechanisms of Action of Nicotine in Inflammatory Bowel Disease,” Inflammation Research, Vol. 49, No. 7, 2000, pp. 311-319. doi:10.1007/s000110050597

[103] H. P. S. Wong, L. Yu, E. K. Y. Lam, E. K. K. Tai, W. K. K. Wu and C. H Cho, “Nicotine Promotes Colon Tumor Growth and Angiogenesis through Beta-Adrenergic Activation,” Toxicological Sciences, Vol. 97, No. 2, 2007, pp. 279-287. doi:10.1093/toxsci/kfm060

[114] J. McGrath, J. W. Mcdonald and J. K. Macdonald, “Transdermal Nicotine for Induction of Remission in Ulcerative Colitis,” The Cochrane Database of Systematic Reviews, Vol. 18, No. 4, 2004, Article ID: CD004722.

[104] V. Y. Shin, W. K. K. Wu, Y. N. Ye, W. H. L. So, M. W. L. Koo, E. S. L. Liu, et al., “Nicotine Promotes Gastric Tumor Growth and Neovascularization by Activating Extracellular Signal-Regulated Kinase and Cyclooxygenase-2,” Carcinogenesis, Vol. 25, No. 12, 2004, pp. 2487-2495. doi:10.1093/carcin/bgh266 [105] V. Y. Shin, W. K. K. Wu, K. M. Chu, H. P. S. Wong, E. K. Y. Lam, E. K. K. Tai, et al., “Nicotine Induces Cyclooxygenase-2 and Vascular Endothelial Growth Factor Receptor-2 in Association with Tumor-Associated Invasion and Angiogenesis in Gastric Cancer,” Molecular Cancer Research, Vol. 3, 2005, pp. 607-615. doi:10.1158/1541-7786.MCR-05-0106 [106] R. D. Pullan, J. Rhodes, S. Ganesh, V. Mani, J. S. Morris, G. T. Williams, R. G. Newcombe, M. Russell, C. Feyerabend, G. Thomas, et al., “Transdermal Nicotine for Active Ulcerative Colitis,” The New England Journal of Medicine, Vol. 330, 1994, pp. 811-815. doi:10.1056/NEJM199403243301202 [107] J. Rhodes and G. Thomas, “Nicotine Treatment in Ulcerative Colitis,” Drugs, Vol. 49, No. 2, 1995, pp. 157160. doi:10.2165/00003495-199549020-00001 [108] J. R. Ingram, P. Routledge, J. Rhodes, R. W. Marshall, D. Copyright © 2013 SciRes.

[115] V. E. McGilligan, J. M. W. Wallace, P. M. Heavey, D. L. Ridley and I. R. Rowland, “The Effect of Nicotine in Vitro on the Integrity of Tight Junctions in Caco-2 Cell Monolayers,” Food and Chemical Toxicology, Vol. 45, No. 9, 2007, pp. 1593-1598. doi:10.1016/j.fct.2007.02.021 [116] T. W. Costantini, M. Krzyzaniak, G. A. Cheadle, J. G. Putnam, A. M. Hageny, N. Lopez, et al., “Targeting α-7 Nicotinic Acetylcholine Receptor in the Enteric Nervous System: A Cholinergic Agonist Prevents Gut Barrier Failure after Severe Burn Injury,” The American Journal of Pathology, Vol. 181, No. 2, 2012, pp. 478-486. doi:10.1016/j.ajpath.2012.04.005 [117] T. W. Costantini, V. Bansal, M. Krzyzaniak, J. G. Putnam, C. Y. Peterson, W. H. Loomis, et al., “Vagal Nerve Stimulation Protects against Burn-Induced Intestinal Injury through Activation of Enteric Glia Cells,” American Journal of Physiology, Gastrointestinal and Liver Physiology, Vol. 299, No. 6, 2010, pp. G1308-G1318. doi:10.1152/ajpgi.00156.2010 [118] C. Bose, H. Zhang, K. B. Udupa and P. Chowdhury, “Activation of p-ERK1/2 by Nicotine in Pancreatic Tumor Cell Line AR42J: Effects on Proliferation and Secretion,” American Journal of Physiology, Gastrointestinal and JCT

Role of Cholinergic Receptors in Colorectal Cancer: Potential Therapeutic Implications of Vagus Nerve Stimulation Liver Physiology, Vol. 289, No. 5, 2005, pp. G926-G934. doi:10.1152/ajpgi.00138.2005 [119] H. Nakayama, S. Ueno, T. Ikeuchi and H. Hatanaka, “Regulation of Alpha3 Nicotinic Acetylcholine Receptor Subunit mRNA Levels by Nerve Growth Factor and Cyclic AMP in PC12 Cells,” Journal of Neurochemistry, Vol. 74, No. 4, 2000, pp. 1346-1354. doi:10.1046/j.1471-4159.2000.0741346.x [120] T. Y. Ma, G. K. Iwamoto, N. T. Hoa, V. Akotia, A. Pedram, M. A. Boivin, et al., “TNF-Alpha-Induced Increase in Intestinal Epithelial Tight Junction Permeability Requires NF-Kappa B Activation,” American Journal of Physiology, Gastrointestinal and Liver Physiology, Vol. 286, No. 3, 2004, pp. G367-G376. doi:10.1152/ajpgi.00173.2003 [121] E. Hollenbach, M. Neumann, M. Vieth, A. Roessner, P. Malfertheiner and M. Naumann, “Inhibition of p38 MAP Kinase- and RICK/NF-kappab-Signaling Suppresses Inflammatory Bowel Disease,” FASEB Journal, Vol. 18, No. 13, 2004, pp. 1550-1552. [122] C. C. Hsu, J. C. Lien, C. W. Chang, C. H. Chang, S. C. Kuo and T. F. Huang, “Yuwen02f1 Suppresses LPS-Induced Endotoxemia and Adjuvant-Induced Arthritis Primarily through Blockade of ROS Formation, NFkB and MAPK Activation,” Biochemical Pharmacology, Vol. 85, No. 3, 2013, pp. 385-395. doi:10.1016/j.bcp.2012.11.002 [123] S. A. Benitah, P. F. Valerón and J. C. Lacal, “ROCK and Nuclear factor-KappaB-Dependent Activation of Cyclooxygenase-2 by Rho GTPases: Effects on Tumor Growth and Therapeutic Consequences,” Molecular Biology of the Cell, Vol. 14, No. 7, 2003, pp. 3041-3054.

1131

doi:10.1091/mbc.E03-01-0016 [124] A. I. Chernyavsky, J. Arredondo, T. Piser, E. Karlsson and S. A. Grando, “Differential Coupling of M1 Muscarinic and Alpha7 Nicotinic Receptors to Inhibition of Pemphigus Acantholysis,” The Journal of Biological Chemistry, Vol. 283, 2008, pp. 3401-3408. doi:10.1074/jbc.M704956200 [125] M. L. van Hoek, C. S. Allen and S. J. Parsons, “Phosphotyrosine Phosphatase Activity Associated with c-Src in Large Multimeric Complexes Isolated from Adrenal Medullary Chromaffin Cells,” The Biochemical Journal, Vol. 326, Pt. 1, 1997, pp. 271-277. [126] J. Joseph, B. Niggemann, K. S. Zaenker and F. Entschladen, “The Neurotransmitter Gamma-Aminobutyric Acid Is an Inhibitory Regulator for the Migration of SW 480 Colon Carcinoma Cells,” Cancer Research, Vol. 62, No. 22, 2002, pp. 6467-6469. [127] H. M. Schuller, H. A. N. Al-Wadei and M. Majidi, “GABAB Receptor Is a Novel Drug Target for Pancreatic Cancer,” Cancer, Vol. 112, No. 4, 2008, pp. 767-778. doi:10.1002/cncr.23231 [128] H. Kawai and D. K. Berg, “Nicotinic Acetylcholine Receptors Containing Alpha 7 Subunits on Rat Cortical Neurons Do Not Undergo Long-Lasting Inactivation Even When Up-Regulated by Chronic Nicotine Exposure,” Journal of Neurochemistry, Vol. 78, No. 6, 2001, pp. 1367-1378. doi:10.1046/j.1471-4159.2001.00526.x [129] P. Ambrosi and A. Becchetti, “Targeting Neuronal Nicotinic Receptors in Cancer: New Ligands and Potential Side-Effects,” Recent Patents on Anti-Cancer Drug Discovery, Vol. 8, No. 1, 2013, pp. 38-52.

JCT

Chapter 14

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis Bruno Bonaz, Sonia Pellissier, Valérie Sinniger, Didier Clarençon,André Peinnequin and Frédéric Canini Additional information is available at the end of the chapter http://dx.doi.org/10.5772/52066

1. Introduction Irritable bowel syndrome (IBS) is a functional digestive disorder characterized by abdominal pain, bloating and altered bowel habits without any organic cause (Drossman 1999b; Mulak and Bonaz 2004). Patients with IBS exhibit enhanced perception of visceral sensation to colonic distension which is associated with hypervigilance at the origin of visceral hypersensitivity (VHS) (Ritchie 1973; Bradette, et al. 1994; Elsenbruch, et al. 2010). VHS is a clinical marker of IBS considered to play a major role in its pathophysiology. The exact cause of VHS is unknown but a number of mechanisms are evoked as represented by neuroplastic changes in primary afferent terminals (peripheral sensitization) due to peripheral inflammation or infection of the gut (i.e. post-infectious IBS) but also in the spinal cord (central sensitization) and in the brain (supraspinal pain modulation) or in descending pathways that modulate spinal nociceptive transmission (Bonaz 2003; Mulak and Bonaz 2004). In addition, stress is able to increase visceral sensitivity either at the central and/or peripheral level (Mulak and Bonaz 2004; Larauche, et al. 2011). There is a bidirectional communication between the central nervous system (CNS) and the gastrointestinal (GI) tract, i.e. the brain-gut axis, such as signals from the brain can modify the motor, sensory, secretory, and immune functions of the GI tract and, conversely, visceral messages from the GI tract can influence brain functions in a top-down and bottom-up relation. Numerous data argue for a dysfunction of this brain-gut axis in the pathophysiology of IBS (Mulak and Bonaz 2004; Bonaz and Sabate 2009; Tillisch, et al. 2011). Stress, through the corticotrophin-releasing factor (CRF) system (CRF, urocortins and their receptors CRF1,2), is a key factor involved in the pathophysiology of IBS. Indeed, stress is © 2012 Bonaz et al., licensee InTech. This is an open access chapter distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

340 The Amygdala – A Discrete Multitasking Manager

able to modify visceral sensitivity as well as GI motility, permeability, intestinal microbiota, and immunity of the GI tract, all mechanisms that are involved in the pathophysiology of IBS. In addition, stress is able to modulate the hypothalamic pituitary adrenal (HPA) axis and the autonomic nervous system (ANS) which is the link between the gut and the CNS and an imbalance of the ANS is observed in IBS patients (Pellissier, et al. 2010a; Mazurak, et al. 2012). The main brain areas involved in stress are the prefrontal cortex, the limbic system (e.g. the hippocampus and the amygdala) and the hypothalamus. Relations between the prefrontal cortex and the limbic system are important in the management of stress response. The amygdala is a key structure involved in the stress effect on the GI tract. Indeed, the amygdala is involved in brain-gut and gut-brain interactions. i) The amygdala receives informations from the gut through the parabrachial (PB) nucleus, a sensitive nucleus, and the dorsal vagal complex. The latter, composed of the nucleus tractus solitaries (NTS), is the main entrance of the vagus nerve (vagal afferents) and sends projections to the amygdala. The amygdala is therefore a relay of somatic and visceral nociceptive and non-nociceptive afferents through ascending inputs from the spinal cord and the NTS to the insula which is the main cortical area involved in sensitive information processing. ii) The amygdala controls the ANS which is a key element in the neuro-endocrine and autonomic responses to stress of the organism to maintain homeostasis. On the one hand, the amygdala projects to the dorsal motor nucleus of the vagus nerve (DMNV) at the origin of the parasympathetic branch of the vagus nerve (vagal efferents); this makes the amygdala able to modulate the functioning of the parasympathetic system through the vagus nerve. On the other hand, the amygdala projects to the intermediolateral column cells of the spinal cord, at the origin of the sympathetic nerves, and locus coeruleus (LC) in the pons. It makes the amygdala able to modulate the sympathetic nervous system, the other branch of the ANS, and thus to modulate the sympatho-vagal balance, a marker of brain-gut interactions (Mazurak, et al. 2012). iii) The amygdala controls the HPA axis activation either directly or indirectly via the hippocampus (i.e. inhibition), known to inhibit the HPA axis, and thus to decrease stress response. iv) The amygdala is also involved in childhood psycho-traumatic experiences which are key elements in the pathophysiology of IBS. Indeed, early life stress, as represented by sexual abuse in infancy or adolescence, is present in 30 to 50% of IBS patients (Chitkara, et al. 2008; Bradford, et al. 2012). The amygdala is particularly vulnerable to stressors in early life. The amygdala contains all the elements of the CRFergic system (e.g. CRF, Ucns, CRF1,2) and early life stress induces persistent changes of the CRFergic system in the amygdala leading to an increased stress sensitivity in adulthood. This has been well modelled in the maternally separated (MS) rat model where morphological modifications of the amygdala (e.g. enlarged amygdala volumes and increases in CRF-containing neurons) are induced. v) The amygdala (central nucleus; CeA) and the bed nucleus of the stria terminalis (BNST) are highly interconnected with limbic regions (Bienkowski and Rinaman 2012). These two regions are frequently referred as a “central extended amygdala”, which shares similar connectivity with other brain regions (e.g. hypothalamus and brainstem) that coordinate behavioural and physiological responses to interoceptive and exteroceptive

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 341

stressors. It makes the amygdala able to link pain and emotional processings. Furthermore, the amygdala is sensitive to stress-induced increase in glucocorticoids since the existence of elevated glucocorticoid level in the amygdala is associated with anxiety-like behavior and visceral hypersensitivity (Myers and Greenwood-Van Meerveld 2007b; 2010). The amygdala is therefore at the cross-road of anxiety, stress, and visceral sensitivity. The role of the amygdala in IBS is therefore crucial since IBS patients reported higher score of state and trait anxiety than healthy volunteers or in inflammatory bowel disease (IBD) patients in remission with IBS symptoms (Drossman 1999b; Pellissier, et al. 2010a). vi) The prefrontal cortex (PFC), and particularly its medial part (mPFC), is able to modulate the functioning of the amygdala. Indeed, the mPFC involvement in fear extinction process (Sotres-Bayon, et al. 2004; Quirk, et al. 2006a) has been shown to be indirectly mediated by its inhibitory action on the amygdala output (Vidal-Gonzalez, et al. 2006). vii) Brain imaging techniques (fMRI, PET) have contributed to a better understanding of the pathophysiology of IBS. During rectal distention, an activation of most of the brain structures referenced above, and in particular the amygdala, have been observed in healthy volunteers (Baciu, et al. 1999) while an abnormal brain processing (i.e. abnormal loci of cerebral activation) of pain was observed in IBS patients (Bonaz, et al. 2002; Agostini, et al. 2011). In addition, brain structural changes of the HPA axis and limbic structures have been recently reported in IBS patients (Blankstein, et al. 2010; Seminowicz, et al. 2010). At the present time, the only medical treatment of IBS is directed at GI motor/sensory or CNS processing. Unfortunately, this treatment is poorly effective and often associated with high placebo effects, thus revealing the importance of the overlap between pain and placebo neurobiological pathways. The therapeutic approach is essentially focused on the symptoms as represented by anti-spasmodics for pain, laxatives or bulking agents, 5-HT4 agonists and guanylate cyclase-C agonist for intestinal transit regulation and anti-depressives/anxiolytics drugs. Placebo has a ď&#x201A;ť 40% efficacy in IBS patients (Patel, et al. 2005) and pronounced placebo analgesia is coupled with prominent changes of brain activity in visceral pain matrix, as represented by the amygdala (Lu, et al. 2010). Non-pharmacological therapies are of special interest. Cognitive behavioral therapy is associated with reduced limbic activity (e.g. reduced neural activity in the amygdala), GI symptoms, and anxiety (Lackner, et al. 2006). Hypnosis has shown efficacy in IBS (Whorwell, et al. 1984) and is known to modify the activity of the amygdala (Drossman 1999b). All methods focused on stress reduction such as mindfulness-based stress reduction should reduce pain perception (Drossman 1999a). Repetitive transcranial magnetic stimulation of the PFC that decreases the activity of the amygdala (Baeken, et al. 2010) would also be of interest in IBS patients. In this context, vagal nerve stimulation, used for the treatment of refractory epilepsy and depression, should be of interest in the treatment of IBS by modulating the amygdala. Indeed, an inhibitory action of vagal nerve stimulation on amygdala-mPFC neurotransmission, probably due to the deactivation of the amygdala, has been described under VNS (Kraus, et al. 2007). Consequently, new methods aimed at modifying the activity of the amygdala represent a therapeutic challenge in the management of IBS patients.

342 The Amygdala – A Discrete Multitasking Manager

2. Irritable bowel syndrome 2.1. Definition-background The irritable bowel syndrome (IBS) is the most common disorder encountered by gastroenterologists. IBS is defined as “a functional bowel disorder in which abdominal pain is associated with defecation or a change in bowel habit with features of disordered defecation and distension”(Drossman 1999b). Classically the syndrome is considered as functional since biological as well as morphological (e.g. colonoscopy) investigations are not able to evidence any detectable organic lesions or anatomical abnormalities (colonic polyps or diverticulosis…) relative to symptomatology of the affected patients. The syndrome has been defined according to Rome III criteria (Longstreth, et al. 2006). There is a female predominance in a ratio of 2:1 (Drossman, et al. 1993). IBS affects up to 10–15% of the population with an estimated 1.7 billion dollars in annual direct cost (Talley, et al. 1991). Generally patients suffer from the absence of a real diagnostic and from the consideration that they have a psychosomatic disease. Pain is perceived by patients as the most distressing symptom and constitutes their major reason for consulting a physician (Sandler, et al. 1984). Extra-intestinal manifestations are also frequently described by the patients (e.g. headache, low back pain, chronic fatigue, interstitial cystitis…) (Whitehead, et al. 2002).

2.2. Pathophysiology The pathophysiology of IBS is multifactorial. Altered bowel motility, sensory disorders, psychosocial factors are evoked (Drossman, et al. 1999c; Gaynes and Drossman 1999; Bonaz and Sabate 2009). Local features have also been considered as important. The role of food is often evoked by patients and a number of them are intolerant to lactose, fructose, gluten, polyols (Dapoigny, et al. 2004; Morcos, et al. 2009) with an enhancement of their symptoms following an eviction of such foods from diet. There is also good evidence for a role of the GI microbiota in its pathogenesis (Parkes, et al. 2008). Neuroimmune interactions are also involved, based on the development of IBS after infectious gastroenteritis (i.e. postinfectious IBS) (Gwee 2001) or in patients with IBD in clinical remission (i.e. postinflammatory IBS) (Long and Drossman 2010). A low grade inflammation has been observed in IBS patients with a predominance of mastocytes in close contact with neural fibers explaining why IBS is assimilated to an IBD by some authors (Ford and Talley 2011). Sensory disorders, and especially VHS, have also been evoked in the pathophysiology of IBS. VHS, represented by the increased sensation of pain when the pelvic colon is distended with an inflated rectal balloon, is a clinical marker of IBS which is observed in most of IBS patients. The exact location of the abnormal processing of visceral pain is unknown, and can have a peripheral origin, i.e. in the digestive tract by altered peripheral functioning of visceral afferents (i.e. bottom-up model), a spinal origin, e.g. spinal hyperalgesia by a defect of the gate control, or a defect of descending inhibitory controls or an altered central processing of afferent information from the gut, i.e. top-down model or a combination of all these hypotheses. IBS patients have an alteration in the spinal modulation of nociceptive

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 343

process by the inhibitory descending pain modulation systems (Wilder-Smith, et al. 2004) in which the amygdala could be involved. Psychosocial factors are often found in IBS patients. Among 20 to 50% of IBS patients have psychiatric disorders, such as major depression, anxiety, and somatoform disorders (Garakani, et al. 2003). Low dose of tricyclic antidepressants have shown efficacy in ameliorating the symptoms in patients (Rahimi, et al. 2009). IBS is also frequently associated with fibromyalgia in 30% to 70% of the cases. This syndrome is characterized by somatic hyperalgesia, the physiopathology of which is close to IBS (Mathieu 2009). IBS and fibromyalgia are classified by some authors as central sensitization syndromes (Woolf 2011). A majority of IBS patients associate stressful life events with initiation or exacerbation of their symptoms (Whitehead, et al. 1992) and stress is able to act at all levels of the physiopathology of IBS (see below). Globally, a concept has emerged that IBS is the result of a dysfunction of the brain-gut interplay, as conceptualized in the brain-gut axis. The ANS is, with the HPA axis, the link between the CNS and the gut and an autonomic dysfunction is observed in IBS patients which could be of top-down or bottom-up origin, as observed for VHS.

3. The brain-gut axis 3.1. Definition The brain talks to the gut and conversely through a bidirectional communication under normal conditions and especially during perturbations of homeostasis. The CNS and the gut communicate through the ANS and the circumventricular organs and the gut contains a “little brain” as represented by the enteric nervous system which is a target of the ANS.

3.2. The enteric nervous system The enteric nervous system can control functions of the intestine even when it is completely separated from the CNS (Bayliss and Starling 1899). The enteric nervous system contains three categories of neurons, identified as sensory, associative, and motor neurons (both excitatory and inhibitory) which are the final common pathways for the control of signals to the musculature, submucosa, mucosa, and vasculature, both blood and lymphatic. The enteric nervous system contains as many neurons as in the spinal cord (400–600 million) and confers an autonomy to the digestive tract such as the enteric nervous system can function independently of the CNS for the programming of motility and secretion (Furness 2012). Some neuropeptides and receptors are present in both the enteric nervous system and the CNS. The function of the GI tract is modulated by both the enteric nervous system and the ANS.

3.3. The autonomic nervous system (The afferent system) The ANS is composed of the sympathetic (i.e. the splanchnic nerves) and parasympathetic nervous system (i.e. the vagus nerves and the sacral parasympathetic nucleus represented by the pelvic nerves) which are mixed systems.

344 The Amygdala – A Discrete Multitasking Manager

The vagus nerve contains essentially 80-90% of afferent fibers vehiculating informations from the abdominal organs to the brain (Altschuler, et al. 1989) with the exception of the pelvic viscera for which informations are vehiculated to S2-S4 levels of the spinal cord by the pelvic nerves with central projections similar to other spinal visceral afferents. The vagus nerve carries mainly mechanoreceptor and chemosensory informations from the gut. If classically vagal afferents do not encode painful stimuli, they are able to modulate nociceptive processing in the spinal cord and the brain (Randich and Gebhart 1992). The sympathetic nerves contain 50% afferent fibers. Visceral afferents that enter via spinal nerves (i.e; splanchnic and pelvic nerves), at thoracic 5 - lumbar 2 segments of the spinal cord, carry information concerning temperature as well as nociceptive visceral inputs related to mechanical, chemical, or thermal stimulation through C and Aδ fibers, which will reach conscious perception. The afferent informations of the ANS reach the CNS at the spinal cord level, for the splanchnic nerves, the nucleus tractus solitarius (NTS) level in the dorsal medulla for the vagus nerve, and the sacral parasympathetic (S2-S4) level for the pelvic nerves. At the level of the spinal cord, sympathetic afferents are integrated at the level of laminae I, II outer, V, VII (indirectly) and X. Then the information is sent to the upper level through the spinothalamic and spino-reticular tracts, the dorsal column with projection to the thalamus (ventral posterolateral nucleus, intralaminar nucleus) and the cerebral cortex (insular, anterior-cingulate, dorsolateral PFC…). Neurons from laminae I, IV, and V responding to visceral stimuli also receive nociceptive cutaneous inputs (Foreman 1999). At the level of the NTS, vagal afferents are integrated in subnuclei according to visceral somatotopy (e.g. medial, commissural, gelatinosus) (Altschuler, et al. 1993) and then projections to the PB nucleus, in the pons, according to a viscerotopic organization, which in turn projects to numerous structures in the brainstem, hypothalamus, basal forebrain, thalamus, and cerebral cortex (Fulwiler and Saper 1984). In the cerebral cortex, the insular cortex acts as a visceral (e.g. GI) cortex through a NTS-PB-thalamo-cortical pathway according to a viscerotopic map. The insular cortex is connected with the limbic system (bed nucleus of the stria terminalis and CeA) and with the lateral frontal cortical system (Saper 1982). The NTS also sends projections to the ventrolateral medulla, the hypothalamus, and the amygdala/bed nucleus of the stria terminalis contributing to visceral perception. The NTS receives convergent afferents from both the spinal cord (i.e. laminae I, V, VII, and X) and the vagus nerve; some of these afferents probably being at the origin of autonomic reflex responses. This convergence is also observed at the level of the PB and ventrolateral medulla (Saper 2002) thus arguing for a relationship of pain with visceral sensations. At the forebrain level, the spinal visceral sensory system constitutes a postero-lateral continuation of the cranial nerve to the visceral sensory thalamus and cortex (Saper 2000). There is also a spino-PB pathway since about 80% of lamina I spinothalamic axons send collaterals to the PB (Hylden, et al. 1989) and a spino–parabrachio–amygdaloid pain pathway which implicates the transmission of nociceptive information to the amygdala. Spinal nociceptive neurons in laminae I, IV, V, VII, and X directly innervate the

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 345

hypothalamus and medial prefrontal cortex (Cliffer, et al. 1991; Burstein 1996). The messages coming from the gut are integrated in the central autonomic network (see below), which, in turn, adapts the response of the digestive tract through the efferent ANS through reflex loops which are essentially unconscious or become conscious in pathological conditions such as VHS observed in IBS. There is also descending pathways that control somatic as well as visceral pain by modulating visceral informations at the spinal cord level. These pathways are both inhibitory, thus producing analgesia as represented by projections from the periaqueductal gray to the rostroventral medulla, and LC descending fibers to the spinal cord as well as facilitatory producing hyperalgesia (rostroventral medulla and OFF and ON cells) (Tsuruoka, et al. 2010).

3.4. The circumventricular organs The circumventricular organs are highly vascularized structures with fenestrated capillaries located around the 3rd and 4th ventricles. They are characterized by the lack of a bloodâ&#x20AC;&#x201C;brain barrier and represent points of communication between the blood, the brain, and the cerebrospinal fluid (Benarroch 2011). They are represented by the subfornical organ, median eminence, pineal gland, area postrema, organum vasculosum of the lamina terminalis. The circumventricular organs are sensitive to the vascular content (e.g. circulating interleukins, electrolytes). They activate dendritic cells releasing prostaglandins acting on PGE2 receptor of neurons located closely to these circumventricular organs. These neurons send projections to the hypothalamus, activating the HPA axis, and to the central autonomic network represented by the DMNV and the sympathetic pre-ganglionar neurons of the intermediolateralis column. The circumventricular organs are consequently involved in the central integration of a peripheral message to maintain homeosthasis. For example, they are involved in sodium and water balance, cardiovascular regulation, metabolic and energetic balance, immune function, regulation of body temperature, vomiting, reproduction. During an immune challenge represented by systemic inflammation, cytokines released in the circulation talk to the brain through two routes i.e. neural (vagal afferents) and humoral (circumventricular organs) to activate the HPA axis.

3.5. The central autonomic nervous system The central autonomic nervous system integrates and modulates afferent informations from the gut and sends reversible inputs to the gut. In the CNS, visceral informations are integrated in the central autonomic nervous system via brain regions involved in the autonomic, endocrine, motor, and behavioral responses (Saper 2002). The brain network can be roughly divided into executive structures, mainly hypothalamic, coordinating structures, mainly included in the limbic system, and high level control structures, mainly the frontal cortex. The hypothalamus e.g. paraventricular nucleus (PVN), lateral hypothalamus, arcuate nucleus and adjacent retrochiasmatic area innervate the parasympathetic and sympathetic preganglionic neurons. The principal neuromediators are oxytocin and vasopressin

346 The Amygdala – A Discrete Multitasking Manager

(Hallbeck, et al. 2001). Through the release of CRF, the neuromediator of stress, the PVN is involved in the HPA axis response to stress. The limbic system is represented by the amygdala and its nuclei, the bed nucleus of the stria terminalis, considered as the extended amygdala, the septum and the hippocampus. The limbic system modulates the endocrine system and the ANS, two major components of the brain-gut axis. Classically, the amygdala is involved in the integration of emotions and the emotional conditioning which is represented by the association of a conditioned stimulus (i.e. a sound) with an unconditioned stimulus (the reinforcement) (Henke, et al. 1991; Benarroch 2006; LeDoux 2007). The amygdala receives afferents from the NTS, PB nucleus, frontal cortex, and LC and sends projection to the ANS, the frontal cortex and the hippocampus. The amygdala inhibits the DMNV, stimulates the sympathetic nervous system and the stress response through the HPA axis. The amygdala is a CRF-containing nucleus. The prefrontal, insular, and anterior cingulate cortices are involved in the integration of visceral informations, attention, emotions and in the regulation of humor. The anterior cingulate cortex is divided in a cognitive dorsal part and an affective ventral part i.e. the perigenual part which has been frequently activated in brain imaging by numerous emotional stimuli. Most of these structures (ANS, HPA axis, limbic system, endogenous pathways that modulate pain and discomfort…) are part of the emotional motor system that mediates the effect of emotional states on the GI function, modulates gut functions and communicates emotional changes via the ANS to the gut. The threshold for visceral perception is dependent on the individual’s emotional and cognitive state (Mayer 2000; Mayer 2011). Visceral as well as stressful informations activate the LC, a nucleus belonging to central noradrenergic system localized in the pons. The LC is the largest group of noradrenergic neurones. It is involved in emotional arousal, autonomic, and behavioural responses to stress and attention-related processes through its dense projections to most areas of the cerebral cortex and alertness-modulating nuclei (e.g. majority of the cerebral cortex, cholinergic neurones of the basal forebrain, cortically-projecting neurones of the thalamus, serotoninergic neurones of the dorsal raphe and cholinergic neurones of the pedunculopontine and laterodorsal tegmental nucleus). The LC also exerts an indirect action on autonomic activity via projections to the PVN and to the cerebral cortex and amygdala, structures which are known to influence the activity of premotor sympathetic neurones in the PVN. LC activation leads to anxiety through an activation of the amygdala (Tasan, et al. 2010).

4. Stress and the gut 4.1. Background Stress is defined as the response of the organism to a solicitation of the challenging environment. The body engages a “fight or flight” response when exposed to an acute challenge with a sympathetic activation leading to an increase of heart rate and respiration, increased arousal, alertness, and inhibition of acutely non adaptive vegetative functions (feeding, digestion, growth and reproduction). The time course of the reaction corresponds

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 347

to the general syndrome of adaptation defined by Hans Selye in 1950 (Selye 1950). The reaction of stress is physiological but may become pathological following an unbalance between the capacities of adaptation and the requirement of the environment, thus leading to functional, metabolic, and even lesional disorders.

4.2. The CRFergic system CRF is a 41-amino acid peptide derived from a 191-amino acid preprohormone. CRF is secreted by the paraventricular nucleus (PVN) of the hypothalamus in response to stress (Vale et al. in 1981) as well as its related peptides the urocortines (Ucn) i.e. Ucn 1, Ucn 2 (also known as stresscopin-related peptide), and Ucn 3 (also known as stresscopin). CRF and the Ucns exert their biological actions on target cells through activation of two 7â&#x20AC;&#x201C; transmembrane-domain G proteinâ&#x20AC;&#x201C;coupled receptors, known as CRF receptor type 1 (CRF1) and CRF receptor type 2 (CRF2) which are encoded by 2 distinct genes [for review (Gravanis and Margioris 2005)]. CRF and Ucn 1 have equal affinity for the CRF1 receptor, although Ucn 1 is 40 times more potent than CRF in binding CRF2. In contrast, Ucns 2 and 3 bind selectively to CRF2. The population of CRF synthetizing neurons is predominantly expressed in the parvocellular part of the PVN of the hypothalamus and projects via the external zone of the median eminence to the anterior pituitary. In addition to its role as a hypothalamic hypophysiotropic hormone, CRF acts as a neurotransmitter in several brain areas. CRF has predominantly excitatory actions on neurons in the hippocampus, cortex, LC, and hypothalamic nuclei (Siggins, et al. 1985). CRF1 mediates anxiety-like behaviors whereas CRF2 mediates anxiolytic effects in the defensive withdrawal test (Heinrichs, et al. 1997). Competitive CRF receptor antagonists have been developed to determine the functions of CRF receptors under basal and stress conditions (Bonaz and Tache 1994b). The CRF system plays a critical role in coordinating the autonomic, endocrine, and behavioural responses to stress (Dunn and Berridge 1990). The effect of stress on the GI tract is now well characterized. Stress induces modifications of motility, secretion, visceral sensitivity, local inflammatory responses (Delvaux 1999; Mawdsley and Rampton 2006; Tache and Bonaz 2007) through a central and/or peripheral action through CRF1,2 related receptors. Alterations of this complex system in humans are linked to a variety of anxiety-related psychiatric disorders and stress-sensitive pain syndromes, including IBS. Dysfunction in the HPA axis regulation attributable to overactivation of CRF/CRF1 signaling in response to chronic stress has been implicated in the pathophysiology of IBS symptoms (Chang, et al. 2009).

4.3. Stress effect on GI functions 4.3.1. Motility and secretion Stress is known to decrease gastric emptying, lengthen small bowel motility and increase colonic motility (Tache and Bonaz 2007). The effects of stress on gut function are mediated by the ANS represented by the sympathetic, vagal and pelvic parasympathetic innervation of the

348 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

enteric nervous system (Grundy 2006). At the central level, stress inhibits the parasympathetic nervous system and activates the sympathetic nervous system through the effect of PVN projections on the DMNV and intermediolateral column cells of the spinal cord. CRF signaling is a key component in the alterations of gut motor function in response to stress in both the brain and the gut. The CRF/CRF1 signalling pathway is involved in stressinduced anxiety/depression (Holsboer and Ising 2008) and alterations of colonic motor and visceral pain while both central and peripheral CRF2 receptor activation may exert a counteracting influence (Tache, et al. 2005; Million, et al. 2006). At the level of the GI tract, stress delays gastric emptying through CRF2 while increasing colonic motility and secretion through CRF1 (Tache and Bonaz 2007). In the small bowel, CRF-like peptides stimulate the contractile activity of the duodenum through CRF1 receptor while inhibiting phasic contractions of the ileum through CRF2 receptor (Porcher, et al. 2005). Stress also induces an activation of the sacral parasympathetic nucleus through the projections of the Barrington nucleus through CRF activation thus stimulating recto-colonic motility (Tache and Bonaz 2007). Numerous data have established the involvement of peripheral CRF signalling in the modulation of secretory function under stress conditions via activation of both CRF1 and CRF2 receptors, activation of cholinergic enteric neurons, mast cells and possibly serotonergic pathways (Larauche, et al. 2009).

4.3.2. Intestinal permeability An increase of intestinal permeability is observed in the colon of IBS patients, associated with visceral or somatic hypersensitivity (Zhou and Verne 2011). Stress is able to disrupt the intestinal epithelial barrier thus increasing the penetration of luminal antigens into the lamina propria, leading to nociceptors sensitization and favoring the development of visceral hypersensitivity (Ait-Belgnaoui, et al. 2005). This increase of intestinal permeability is due to an activation of peripheral CRF signaling involving both CRF2 and CRF1 (Buckinx, et al. 2011) as well as mast cell activation (Santos, et al. 2001).

4.4. Stress effect on intestinal inflammation Stress is able to increase intestinal inflammation by increasing intestinal permeability (see above) thus activating mast cells and visceral afferents in a local loop. Stress favours intestinal inflammation by stimulating the sympathetic nervous system and inhibiting the vagus nerve thus decreasing the cholinergic anti-inflammatory pathway. Stress, through its immune-suppressive function also favours inflammation (Ghia, et al. 2006; Mawdsley, et al. 2006; Bonaz 2010).

4.5. Stress effect on the microbiota Bacteria in the gut (400â&#x20AC;&#x201C;1,000 different bacterial species) have an important role in the immune response, including inflammation (Lee and Mazmanian 2010). Stress is able to

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 349

modify the intestinal microbiota (Bailey, et al. 2010). Alteration of the microbiota favors translocation of bacteria from the intestinal lumen to the interior of the body where they can stimulate the immune system (Clarke, et al. 2010). This can in turn have significant impact on the host and affect behavior, visceral sensitivity and inflammatory susceptibility (Collins and Bercik 2009).

4.6. Stress effect on visceral sensitivity Stress is known to increase visceral sensitivity [(Larauche, et al. 2012) for review]. Either acting at the central and/or peripheral (e.g. digestive) level, stress is able to increase visceral perception and emotional response to visceral events by a disturbance of the brain-gut axis at its different levels, central, gut and the ANS. Genetic model of depression or anxiety, such as the high-anxiety Wistar-Kyoto (WKY) rats or Flinders Sensitive Line rats have shown increased sensitivity to colorectal distension (Overstreet and Djuric 2001). In the same way genetic models deleting CRF1 exhibit a decrease in colonic sensitivity to colonic distension (Trimble, et al. 2007) while models overexpressing CRF1 exhibit enhanced response to colonic distension (Million, et al. 2007). These data argue for the filiation stress-anxietyinflammation and visceral hypersensitivity. Again, the CRF signalling, at both the central and peripheral level, is a key element involved in stress-induced visceral hypersensitivity. Recent data argue for an equally important contribution of the peripheral CRF/CRF1 signalling pathway locally expressed in the gut to the GI stress response (Larauche, et al. 2009). At the peripheral level, mast cells degranulation observed in the colon following stress and peripheral administration of CRF (Wallon, et al. 2008) induces visceral hypersensitivity via the release of mediators (histamine, tryptase, prostaglandin E2, nerve growth factor) that can stimulate or sensitize sensory afferents (van den Wijngaard, et al. 2009; 2010). Intravenous administration of CRF increases GI motility and visceral pain sensitivity in IBS patients compared with healthy controls, whereas administration of a non-selective CRF receptor antagonist improved these responses (Million, et al. 2005; Tache, et al. 2005; Tsukamoto, et al. 2006).

4.7. Gut pathologies are engineered by stress The GI tract is a sensitive target to stress. Numerous data argue for a role of stress in the pathophysiology of IBS. Patients with IBS report more stressful life events than medical comparison groups or healthy subjects (Drossman, et al. 1996; 2000; Drossman 2011). Stress is strongly associated with symptom onset and symptom severity in IBS patients. Illness experience, health care-seeking behavior, and treatment outcome are adversely affected by stressful life events, chronic social stress, anxiety disorders, maladaptive coping style. A history of emotional, sexual, or physical abuse is often found in IBS patients [(Chitkara, et al. 2008) for review]. For example, there is a significantly higher prevalence (i.e. 44%) of sexual or physical abuse in patients with functional GI disorders than in controls with organic GI disorders (Drossman, et al. 1990). Psychiatric comorbidity, especially major depression, anxiety, and somatoform disorders, occur in 20 to 50% of IBS patients (Garakani, et al. 2003)

350 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

and more likely precede the onset of the GI symptoms, thus suggesting a role for psychiatric disorders in functional GI disorder development (Sykes, et al. 2003). Functional brain imaging studies have shown that there is a major influence of cognitiveaffective processes on GI sensations and its CNS correlates in health and functional digestive disorders as IBS (Mayer, et al. 2006; Van Oudenhove, et al. 2007). Cognitive-affective processes including arousal, attention and negative emotions strongly influence visceral pain perception through modulation of its neural correlates (Mayer 2011). Feeling emotions requires the participation of brain regions, such as the somatosensory cortices and the upper brainstem nuclei that are involved in the mapping and/or regulation of internal organism states (Damasio, et al. 2000). This has led to the biopsychosocial concept of IBS (Drossman 1996b). These data are in agreement with the role of hypervigilance in the visceral hypersensitivity observed in IBS patients (Naliboff, et al. 2008). Spence et al. (Spence and Moss-Morris 2007) have characterized predictors of post-infectious IBS such as perceived stress, anxiety, somatisation and negative illness beliefs at the time of infection in favor of a cognitive-behavioural model of IBS. The importance of psychosocial factors and somatisation compared to gastric sensorimotor function is most pronounced in hypersensitive patients with functional dyspepsia, another functional GI disorder (Van Oudenhove, et al. 2008).

5. Gut and emotional memories Early life trauma (neglect, abuse, loss of caregiver or life threatening situation) increases susceptibility to develop later affective disorders such as depression, anxiety, and is a key factor in the development of IBS (Bradford, et al. 2012). Traumatic events, such as war, environmental disasters, physical abuse or a bad accident in adulthood can induce posttraumatic stress disorder (PTSD) with increased prevalence of GI symptoms, such as IBS (Cohen, et al. 2006). The role of stress sensitization is also reproduced in preclinical studies. Adults rats previously subjected to neonatal maternal separation (MS) exhibit visceral hypersensitivity to colorectal distension in basal conditions (Ren, et al. 2007). This visceral hypersensitivity is exacerbated in acute stress (e.g. water avoidance stress: WAS; Avoidance to water for 1 h by standing on a small platform; Bonaz & TachĂŠ 1994b) conditions (Coutinho, et al. 2002). Chronic exposure to repeated WAS is used to study visceral hypersensitivity and is very close to clinical conditions. However, habituation of the CRFergic system is observed in chronic conditions (Bonaz and Rivest 1998) and may induce analgesia. It seems that these conflicting data are influenced by the basal state conditions of the animals before applying the repeated stressor (surgery and single housing) (Larauche, et al. 2010).

6. The amygdala in IBS pathophysiology The amygadala is a key element in the pathogeny of IBS.

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 351

6.1. Anatomical and functional basis 6.1.1. Amygdala structures The amygdala is divided into a primitive group of nuclei associated with the olfactory system (central, medial and cortical nuclei, and nucleus of the lateral olfactory tract), and a phylogenetically new group of nuclei (lateral and basal) (Knapska, et al. 2007). The lateral (LA), basolateral (BLA), and central nuclei (CeA) are important for sensory processing (Neugebauer 2006; LeDoux 2007). The amygdala is part of the central autonomic nervous system that is involved in the brain-gut axis. The amygdala is a key element in emotional/affective behavior (LeDoux 2007), including the emotional responses to pain such as anxiety and fear of pain (Gauriau and Bernard 2002; Neugebauer, et al. 2004; Neugebauer 2006) as well as in the reciprocal relationship between pain and affective state (Meagher, et al. 2001; Rhudy and Meagher 2003). Affective content is attached to sensory information through associative processing in the LAâ&#x20AC;&#x201C;BLA circuitry and is then transmitted to the CeA which is the output nucleus for major amygdala functions (Maren 2005; Phelps and LeDoux 2005). The CeA serves to attach emotional significance to afferent nociceptive transmission and coordinates appropriate autonomic, affective and motor behavioral responses through its outputs to the hypothalamus, cortex and brainstem (Neugebauer, et al. 2004).

6.1.2. Amygdala inputs The CeA receives numerous sensory informations from descending cortical, thalamic (perigeniculate, paraventricular) and brainstem inputs (Whalen and Kapp 1991), as well as from the olfactory system, medial PFC, insula, brainstem viscerosensory and nociceptive centers (NTS, PB), and from all parts of the amygdala. The amygdala increases the excitability of CNS sites regulating behavioral, neuroendocrine, and autonomic responses to stress (LeDoux, et al. 1988) and thus is able to modify GI functions. The amygdala is involved in the affective processing of sensory information and in the generation of anxiety and fear (Davis 1997), elements which are involved in the pathogeny of IBS.

6.1.3. CRF as a key mediator in amygdala The amygdala, and particularly the CeA, is a major site of extrahypothalamic CRF, in cell bodies and terminals as well as CRF1 and, to a lesser extent, CRF2 receptors. The amygdala is a key element of the extrahypothalamic circuits through which CRF contributes to anxiety-like behavior and affective disorders (Aguilera, et al. 1987; Sajdyk, et al. 1999; Reul and Holsboer 2002; Fu and Neugebauer 2008). Excepting the hypothalamus, the amygdala is the major site of urocortin III (the endogenous ligands for CRF2 receptors) expression (Li, et al. 2002). In particular, activation of CRF neurons in the CeA that project to the LC increase its firing thus resulting in a noradrenaline release in the structures it is projecting to (Bouret, et al. 2003). LC activation leads to anxiety through the activation of the amygdala and, conversely, anxiety producing stimuli (stressful and fear-inducing stimuli) that increase the activity of the amygdala lead to LC activation (Samuels and Szabadi 2008).

352 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

6.1.4. Amygdala output to gut The CEA is involved in the modulation of the ANS because of its brainstem projections to the DMNV, NTS, PB and the periaqueductal gray (Rizvi, et al. 1991), known to modulate the spinal cord processing of noxious information through descending inhibitory controls (Le Bars, et al. 1992). The CEA innervates hypothalamic nuclei, modulating the HPA axis (Rodrigues, et al. 2009). The CeA also projects to the medial peri-LC dendritic region, resulting in increased norepinephrine release and other monoamine systems in the brainstem and forebrain (Gray 1993; Fudge and Emiliano 2003; Pare 2003) which are involved in arousal and hypervigilance.

6.1.5. Modulators of amygdala The LC has an inhibitory effect on the BLA and the activation of this pathway leads to a disinhibition of the CeA, since the BLA has a predominantly inhibitory influence over the CeA (Rosenkranz, et al. 2006). The LC is involved in the stress response through CRF1 receptors as well as CRF afferent fibers from the Barrington nucleus which is ventrolaterally located to the LC. The Barrington nucleus projects to the sacral parasympathetic nucleus to increase the motility of the distal recto-colon (Valentino, et al. 1993). Colorectal distension increases the firing of the LC through CRF1 through a LC-Barrington nucleus pathway (Rouzade-Dominguez, et al. 2001). In addition, the LC is involved in the brain noradrenergic modulation of the GI tract motility (Bonaz, et al. 1992a; 1992b; 1995). Consequently, the Barrington-LC-amygdalo complex is ideally positioned to bidirectionally coordinate brain-gut interactions.

6.2. Amygdala and the pathophysiology of IBS 6.2.1. Amygdala and visceral hyperalgesia The use of C-Fos expression as a marker of neuronal activation has shown that somatovisceral (Bonaz and Fournet 2000; Sinniger, et al. 2004; 2005), and visceral (Wang, et al. 2009) pain as well as stress- or abdominal surgery-induced GI disturbances (Bonaz and Tache 1994a; 1994b; 1997; Bonaz and Rivest 1998) and colitis (Porcher, et al. 2004) induced the activation of the amygdala. In addition, the amygdala is one of the central areas from where digestive sensations are elicited in epileptic patients (Mulak, et al. 2008) during intracerebral electrical stimulations. In a model of visceral pain induction such as inflating a balloon into the rectum, an activation of the amygdala is observed in healthy volunteers (Baciu, et al. 1999) while aberrant functional responses (e.g. deactivation of the amygdala) to noxious rectal stimulation was observed in areas of the brain involved in emotional sensory processing, particularly the amygdala, insula, and prefrontal cortex in IBS patients (Bonaz, et al. 2002; Elsenbruch, et al. 2010; Tillisch, et al. 2011) thus arguing for an abnormal brain processing of visceral pain following rectal distension.

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 353

Activation of corticosteroid receptor (both glucocorticoid and mineralocorticoid receptors) in the CeA is involved in the induction of anxiety and visceral hypersensitivity (Myers and Greenwood-Van Meerveld 2007b). High levels of glucocorticoids result in CRF mRNA level increases in the amygdala (Makino, et al. 1994). The group of Greenwood-Van Meerveld ) have shown that implants of corticosterone micropellets in the CeA increase anxiety-like behavior as well as visceral hypersensitivity to colonic distension and increased responsiveness of viscera-sensitive lumbosacral spinal neurons that mediate visceromotor reflexes to colo-rectal distension (Greenwood-Van Meerveld, et al. 2001; Myers, et al. 2005; Greenwood-van Meerveld, et al. 2006; Myers and Greenwood-Van Meerveld 2007a). Indeed, exposure of the amygdala to corticosterone-releasing micropellets caused an increase in action potential frequency in the dorsal horn neurons in the L6-S1 spinal segments suggesting that a descending neuronal pathway, originating in the amygdala, could be triggered by continuous activation by corticosterone. The neurons responding with excitation to colorectal distension were short-lasting and long-lasting excitatory neurons based on the duration of the reponse (Venkova et al. 2009). Mineralocorticoid receptors but not glucocorticoid receptors in the amygdala trigger descending pathways facilitating viscero-nociceptive processing in the spinal cord (Venkova, et al. 2009). In addition, a WAS known to activate the amygdala (Bonaz and Tache 1994b), performed during 7 consecutive days induced VHS that was abolished by glucocorticoid receptor and mineralocorticoid receptor antagonists in the amygdala. These results argue for a role of amygdaloid glucocorticoid receptor and mineralocorticoid receptor in IBS. The CRF signaling is also involved in pain processing. WKY is a rat strain for studying anxiety and IBS. WKY express a greater amount of CRF and CRF1 mRNA in the CeA and the PVN (Bravo, et al. 2011). In this model, it has been shown that colonic hypersensitivity to luminal distension is reversed by peripheral administration of a CRF1 antagonist (O'Malley, et al. 2011). Infusion of CRF1 antagonist into the CeA attenuates the hypersensitivity to colonic distension in the WKY rats, thus confirming the role of CRF1 receptor in the amygdala in VHS mechanism (Johnson, et al. 2012). The basal expression of CRF in the LC is increased in WKY rats and a selective CRF1 receptor antagonist abolished the activation of LC neurons by colorectal distension and intracisternal CRF in rats (Kosoyan, et al. 2005). These data strengthen the role of the CeA and LC in VHS through CRF1 which is in agreement with the interactions between both nuclei involved in emotional-arousal circuit. Indeed, CRF neurons in the CeA project directly to the LC and increase the firing rate of LC neurons thus increasing noradrenaline release in the vast terminal fields of this ascending noradrenergic system. In humans, oral administration of a selective CRF1 antagonist (GW876008) is followed by a significant BOLD signal reductions within the amygdala during pain expectation in IBS patients (Hubbard, et al. 2011). CRF1 receptors in the amygdala contribute to pain-related sensitization, whereas the normally inhibitory function of CRF2 receptors is suppressed in the arthritis pain model. Thus, due to the opposing effect of CRF1 and CRF2 receptors, CRF can induce a dual effect in the amygdala. The differential effects of CRF1 and CRF2 receptor antagonists on pain-related processing in the amygdala have reciprocal opposing influences on anxiety-like behaviors. CRF1 and CRF2 receptors in the amygdala mediate opposing effects on nociceptive processing (Ji and Neugebauer 2007).

354 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

Numerous data argue for a role of CRF1 and CRF2 to mediate pro- and anti-nociceptive effects of CRF respectively. It has been shown that low concentrations of CRF facilitate nociceptive processing in the CeA neurons through CRF1 while higher concentrations of CRF have inhibitory effects through CRF2 receptors. This is in agreement with the concept that CRF2 receptors serve to dampen or reverse CRF1-initiated responses (Tache and Bonaz 2007). These results clarify the controversial role of CRF in pain modulation and show that the CRFergic system in the amygdala may be a key link between pain and affective states and disorders.

6.3. Amygdala and stress conditioning 6.3.1. The synchronic stress engineering Systemic cortisol is a classical marker of the HPA axis activation. The amygdala and hippocampus have numerous receptors for cortisol and are consequently highly susceptible to the products of the HPA axis. Glucocorticoid occupation of hippocampal receptors has a suppressive effect on the HPA axis (van Haarst, et al. 1997) whereas glucocorticoid occupation of amygdala receptors have a facilitating effect on the HPA axis, often increasing CRF expression within the amygdala (Makino, et al. 1994). CRF receptors are greatly expressed in the amygdala and hippocampus early in development (Baram and Hatalski 1998), thus explaining why young animals are especially vulnerable to threat. In agreement, early-life stress induces a decrease of hippocampal volume and functional alterations when measured in adulthood (Nemeroff, et al. 2006). Structural changes have also been observed in IBS patients using brain imaging (Blankstein, et al. 2010; Seminowicz, et al. 2010). Also, circulating glucocorticoids can have contrasting effects in the amygdala and hippocampus, and these two structures can play contrasting roles in the activity of the HPA axis. In the context of an overactivity of the HPA axis due to an enhanced stress responsiveness, greater basal levels of systemic cortisol have been reported in IBS patients (Chang, et al. 2009). Circulating cortisol regulates the HPA axis and is also able to act within the amygdala by binding to selective glucocorticoid and mineralocorticoid receptors, highly expressed in the amygdala (Sapolsky, et al. 1983) to facilitate behavioral and psychological stress responses including GI motility.

6.3.2. Amygdala and stress memorisation Functional imaging studies indicate that the mPFC is engaged in fear extinction process in relation with the amygdala (Phelps, et al. 2004). The amygdala is an important region involved in the acquisition of fear conditioning, a learning that corresponds to the association between a conditioned stimulus andan unconditioned stimulus. The infralimbic region of the mPFC participates in the mechanism of fear extinction (Rosenkranz, et al. 2003; Quirk and Vidal-Gonzalez 2006b) and also in the recall of fear extinction with an active inhibition of the previous fear condition responses. This is mediated by a down regulation of amygdala outputs with mPFC neurons exciting (glutamate) inhibitory neurons (GABA) within the BLA or in the intercalated region inhibiting in turn amygdala outputs from the

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 355

CeA (Vidal-Gonzalez, et al. 2006). The activity of intentional regulation of treat related-cues by the PFC is decreased in anxious patients and the conditioned fear extinction is also less active, in PTSD-anxious patients and this is associated with symptoms provocations (Bradette, et al. 1994). The amygdala is also activated by uncertainty and the capacity of the PFC to regulate attention, (re) interpretation of the situation will modulate the level of the response of amygdala to uncertainty. In IBS, uncertainty plays an important role in the perception of pain. Therefore it seems important to study the fronto-amygdalar relations in IBS patients. The inhibitory control of the mPFC on CeA would maintain an homeostatic state with an equilibrated sympatho-vagal balance and low glucocorticoids circulating levels. In the case of a deficit in PFC activity with a lack of inhibitory regulatory communications with the amygdala, a chronic imbalance of the ANS with an increase sympathetic activity should appear as we have observed in IBS patients exhibiting a low heart rate variability and a high score of anxiety (Pellissier, et al. 2010a). Moreover, there is a strong relation between the activity of the ANS and the immune system as recently shown by the cholinergic anti-inflammatory pathway (Huston and Tracey 2011). Hence, when the parasympathetic system is hypoactive as a consequence of anxiety for instance, it could facilitate inflammation which could be deleterious for health and well-being (Bonaz 2003). The hypoactivity of the PFC and the enhancement of amygdala (re)-activity are strongly influenced by stress as demonstrated by a number of studies. It has recently been shown an increase in the dendritic arborization, and synaptic connectivity in the LA/B neurons under chronic stress conditions (Vyas, et al. 2002; Vyas, et al. 2006). LA/B neurons from stressed animals display increased firing rates and greater responsiveness (Kavushansky and Richter-Levin 2006) since the mediators of stress i.e. norepinephrine, and glucocorticoids decrease GABA inhibition (Rodriguez Manzanares, et al. 2005), thereby allowing for increased excitability in LA/B. In the meantime, an atrophy and spine loss of neurons in the mPFC following stress and glucocorticoid exposition is observed (Czeh, et al. 2008) allowing an over-activation of amygdala under chronic stress exposition.

6.3.3. Amygdala and early stress Environmental events during early postnatal life can influence the formation of neural circuits that provide limbic and cortical control over autonomic emotional motor output since a differential timing of hypothalamic and limbic forebrain synaptic inputs to autonomic neurons has been observed during the first 1â&#x20AC;&#x201C;2 weeks postnatal (Rinaman, et al. 2011). This provides a potential structural correlate for early experience-dependent effects on later responsiveness to emotionally evocative stimuli and an enhanced risk for the development of psychopathologies such as mood and aggressive disorders. MS is classically used as a model of brain-gut axis dysfunction (O'Mahony, et al. 2011) and early life trauma are often observed in IBS patients (Bradford, et al. 2012). The amygdala is functionally active early in life and demonstrates continued refinement, through increased cortical connections, throughout childhood and adolescence. The amygdala is particularly vulnerable to stressors early in life. Reduced hippocampal volumes (Woon, et al. 2010) and increased amygdala volumes (Tottenham, et al. 2010) have been associated with early life stress.

356 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

6.3.4. The maternal separation model (MS) Numerous studies have shown that the HPA axis of MS rodents shows hyperactivity in the PVN and amygdala (Plotsky and Meaney 1993; Coutinho, et al. 2002; Plotsky, et al. 2005; Schwetz, et al. 2005). Offspring of mothers that exhibit more licking and grooming of pups show reduced plasma ACTH and corticosterone responses to acute stress and decreased levels of hypothalamic CRF mRNA in correlation with the frequency of maternal licking and grooming during the first 10 days of life (Plotsky, et al. 2005). Thus, it is likely that a major part of the alterations associated with early life stress are related to CRF hyperproduction that account for amygdala hyperactivity. Maternal care during the first week of life is associated with increased GABAergic inhibition of amygdala activity (Diorio and Meaney 2007). These data reflect the importance of early environmental factors in regulating the development of the hypothalamic CRF system in relation with amygdala activity and the vulnerability to stress. Moreover, there is a sex-specific difference in the effects of early life stress on HPA axis activity consistent with the higher prevalence of major depression with hypercortisolism in women than in men. Moreover, women who experienced early life stress are more likely to develop depression as well as IBS (Bradford, et al. 2012). Sexhormones influence amygdala development in human populations (Rose, et al. 2004). An alteration in the central CRF system has been evidenced in two different rat models of comorbid depression and functional GI disorders (e.g. IBS) represented by neonatal MS and the WKY rat, a genetically stress-sensitive rat strain, that display increased visceral hypersensitivity and alterations in the HPA axis. These rat strains express a greater amount of CRF and CRF1 mRNA in the amygdala (CeA) as well as in the PVN (Bravo, et al. 2011). They also present a positive correlation between increased central CRF and CRF1 receptor expression, with elevated anxiety-like behavior and colonic hypersensitivity (Gunter, et al. 2000; Shepard and Myers 2008). An increase of CRF1 mRNA was observed in the PVN and amygdala while CRF2 mRNA, classically counteracting CRF1 in the CNS, was lower in the amygdala of MS rats. Such modifications, by affecting the HPA axis regulation, may contribute to behavioral changes associated with stress-related disorders, and alter the affective component of visceral pain modulation, which is enhanced in IBS patients (Bravo, et al. 2011).

6.4. The alteration of amygdala control in IBS The amygdala has interconnections with the anterior cingulate cortex, the PFC, the hippocampus, the hypothalamus (e.g. PVN), the bed nucleus of the stria terminalis, the lateral septum, the thalamus, the periacqueductal gray, the PB, the LC, the raphe nuclei, and the dorsal vagal complex (area postrema, nucleus tractus solitarius and DMNV) (Knapska, et al. 2007). All these regions have been shown to be activated in experimental models of stress, inflammation, and pain as represented by c-fos expression and/or CRF receptor mRNA induction (Bonaz and Tache 1994a; Bonaz and Rivest 1998; Bonaz, et al. 2000; Porcher, et al. 2004; Sinniger, et al. 2004; 2005) or electrical stimulations (Mulak, et al. 2008).

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 357

In addition, brain imaging techniques (fMRI, PET), have contributed to the better understanding of IBS. An activation of most of the brain structures referenced above, and particularly the amygdala, has been observed in healthy volunteers following rectal pain while an abnormal brain processing of pain was observed in IBS and IBD patients (Baciu, et al. 1999; Bonaz, et al. 2002; Agostini, et al. 2011). In addition, brain structural changes of the HPA axis and limbic structures have been recently reported in IBS patients (Blankstein, et al. 2010; Seminowicz, et al. 2010). Because psycho- or pharmacotherapy tends to result in normalization of activity of key structures such as the PFC including anterior cingulate cortex, hippocampus, or amygdala, either through a top-down or bottom-up effect (Quide, et al. 2012), the determination of psycho-physiological vulnerability in IBS patients should be a flag to consider the psychological needs in the follow-up of such patients in the prevention of relapses of such diseases (Pellissier, et al. 2010b).

7. Therapeutic implications-treatment targeting amygdala activity reduction in IBS The effect of stress on amygdala functioning has therapeutic implications both with nonpharmacological and pharmacological treatment to reduce stress perception. Psychological mind-body interventions including psychotherapy, cognitive behavioral therapy, hypnotherapy, relaxation exercises or mindfulness mediation have been shown to improve symptoms of IBS patients (Kearney and Brown-Chang 2008; Ford 2009; Whorwell 2009). Repetitive transcranial magnetic stimulation of the PFC, based on the central role of the mPFC in cognitive theory of mind, can cause changes in acute pain perception and has been used in a model of central sensitization syndrome such as fibromyalgia (Mhalla, et al. 2011; Short, et al. 2011) but no data have been currently published in IBS patients. Modulation of the ANS by restoring the sympatho-vagal balance (DeBenedittis, et al. 1994; Nishith, et al. 2003; Gemignani, et al. 2006) as well as modifying coping strategies vigilance state and globally the restoration of a functional brain-gut axis, are at the origin of the efficacy of these treatments. Brain imaging techniques have shown modulation of brain activation, as for example in the amygdala, by such treatments (Goldin and Gross 2010; Lawrence, et al. 2011). Conventional treatment as represented by anti-depressives, anxiolytics, drug targeting the central sensitization syndrome α2δ ligand (pregabalin, gabapentin); tachykinin receptor antagonists either directly and/or indirectly are supposed to target the hyperfunctioning of the amygdala (Ghaith, et al. 2010; Gale and Houghton 2011; Trinkley and Nahata 2011; Larauche, et al. 2012). In the context of the microbiota-brain-gut axis, probiotics, prebiotics, antibiotics such as rifaximin, an antibacterial agent that is virtually unabsorbed after oral administration and is devoid of systemic side effects, are of interest (Bercik, et al. 2011; Fukudo, et al. 2011; Fukudo and Kanazawa 2011). If targeting CRF signaling with CRF1 receptor antagonists, based on pre-clinical and/or clinical data (brain imaging) has been used successfully in humans to treat depression and anxiety (Kunzel, et al. 2003) their efficacy is still matter of debate in the treatment of IBS patients (Sweetser, et al. 2009).

358 The Amygdala – A Discrete Multitasking Manager

8. Conclusion A growing body of evidence argues for an important role of stress, through the HPA axis, limbic system activity (e.g. the amygdala), and the ANS, i.e. the sympathetic and the parasympathetic (e.g. the vagus nerve) nervous system, in the initiation and perpetuation of IBS. Stress, pain, and immune activation are common risk factors involved in the pathogenesis of IBS which are able to act through this neuro-endocrine-immune axis. The amygdala, through its connections with the PFC, LC, hippocampus, HPA axis, and ANS is a key structure involved in the pathogeny of IBS. Animal models of activation of the CRFergic system in the amygdala, as represented by maternal separation stress or WKY rats, developed VHS as observed in most of IBS patients. Thereofore, a therapeutic targeting of the amygdala either through pharmacological or non-pharmacological approach should be of interest for the treatment of IBS.

Author details Bruno Bonaz* Clinique Universitaire d’Hépato-Gastroentérologie, CHU de Grenoble, BP217, France Stress et Interactions Neuro-Digestives, Grenoble Institut des Neurosciences (GIN), Centre de Recherche INSERM U836-UJF-CEA-CHU, CHU de Grenoble, BP217, France Sonia Pellissier Stress et Interactions Neuro-Digestives, Grenoble Institut des Neurosciences (GIN), Centre de Recherche INSERM U836-UJF-CEA-CHU, CHU de Grenoble, BP217, France Département de Psychologie, Université de Savoie, France Valérie Sinniger Stress et Interactions Neuro-Digestives, Grenoble Institut des Neurosciences (GIN), Centre de Recherche INSERM U836-UJF-CEA-CHU, CHU de Grenoble, BP217, France Didier Clarençon, André Peinnequin and Frédéric Canini Stress et Interactions Neuro-Digestives, Grenoble Institut des Neurosciences (GIN), Centre de Recherche INSERM U836-UJF-CEA-CHU, CHU de Grenoble, BP217, France Institut de Recherche Biomédicale des Armées – CRSSA-Antenne La Tronche, BP 87, France

9. References Agostini, A., N. Filippini, D. Cevolani, R. Agati, C. Leoni, R. Tambasco, C. Calabrese, F. Rizzello, P. Gionchetti, M. Ercolani, M. Leonardi and M. Campieri (2011). "Brain functional changes in patients with ulcerative colitis: a functional magnetic resonance imaging study on emotional processing." Inflammatory bowel diseases 17(8): 1769-1777.

Corresponding Author

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 359

Aguilera, G., M.A. Millan, R.L. Hauger and K.J. Catt (1987). "Corticotropin-releasing factor receptors: distribution and regulation in brain, pituitary, and peripheral tissues." Annals of the New York Academy of Sciences 512: 48-66. Ait-Belgnaoui, A., S. Bradesi, J. Fioramonti, V. Theodorou and L. Bueno (2005). "Acute stress-induced hypersensitivity to colonic distension depends upon increase in paracellular permeability: role of myosin light chain kinase." Pain 113(1-2): 141-147. Altschuler, S.M., X.M. Bao, D. Bieger, D.A. Hopkins and R.R. Miselis (1989). "Viscerotopic representation of the upper alimentary tract in the rat: sensory ganglia and nuclei of the solitary and spinal trigeminal tracts." The Journal of comparative neurology 283(2): 248268. Altschuler, S.M., J. Escardo, R.B. Lynn and R.R. Miselis (1993). "The central organization of the vagus nerve innervating the colon of the rat." Gastroenterology 104(2): 502-509. Baciu, M.V., B.L. Bonaz, E. Papillon, R.A. Bost, J.-F. Le Bas, J. Fournet and C.M. Segebarth (1999). "Central processing of rectal pain: A functional MR imaging study." AJNR Am J Neuroradiol. 20(10):1920-1924. Baeken, C., R. De Raedt, P. Van Schuerbeek, M.A. Vanderhasselt, J. De Mey, A. Bossuyt and R. Luypaert (2010). "Right prefrontal HF-rTMS attenuates right amygdala processing of negatively valenced emotional stimuli in healthy females." Behav Brain Res 214(2): 450455. Bailey, M.T., S.E. Dowd, N.M. Parry, J.D. Galley, D.B. Schauer and M. Lyte (2010). "Stressor exposure disrupts commensal microbial populations in the intestines and leads to increased colonization by Citrobacter rodentium." Infection and immunity 78(4): 15091519. Baram, T.Z. and C.G. Hatalski (1998). "Neuropeptide-mediated excitability: a key triggering mechanism for seizure generation in the developing brain." Trends in neurosciences 21(11): 471-476. Bayliss, W.M. and E.H. Starling (1899). "The movements and innervation of the small intestine." The Journal of physiology 24(2): 99-143. Benarroch, E.E. (2006). "Pain-autonomic interactions." Neurological Science 27: S130-S133. Benarroch, E.E. (2011). "Circumventricular organs: receptive and homeostatic functions and clinical implications." Neurology 77(12): 1198-1204. Bercik, P., A.J. Park, D.A. Sinclair, A. Khoshdel, J. Lu, X. Huang, Y. Deng, P.A. Blennerhasset, M. Fahnestock, D. Moine, B. Berger, J.D. Huizinga, W. Kunze, P.G. McLean, G.E. Bergonzelli, S.M. Collins and E.F. Verdu (2011). "The anxiolytic effect of Bifidobacterium longum NCC3001 involves vagal pathways for gut-brain communication." Neurogastroenterology Motility 23: 1132-e1544. Bienkowski, M.S. and L. Rinaman (2012). "Common and distinct neural inputs to the medial central nucleus of the amygdala and anterior ventrolateral bed nucleus of stria terminalis in rats." Brain structure & function. Blankstein, U., J. Chen, N.E. Diamant and K.D. Davis (2010). "Altered brain structure in irritable bowel syndrome: potential contributions of pre-existing and disease-driven factors." Gastroenterology 138(5): 1783-1789.

360 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

Bonaz, B., L. Martin, E. Beurriand, J. Hostein and C. Feuerstein (1992a). "Involvement of hypothalamic noradrenergic systems in the modulation of intestinal motility in rats." Brain Res 583(1-2): 332-335. Bonaz, B., L. Martin, E. Beurriand, M. Manier, J. Hostein and C. Feuerstein (1992b). "Locus ceruleus modulates migrating myoelectric complex in rats." Am J Physiol 262(6 Pt 1): G1121-1126. Bonaz, B. and Y. Tache (1994a). "Induction of Fos immunoreactivity in the rat brain after cold-restraint induced gastric lesions and fecal excretion." Brain Res 652(1): 56-64. Bonaz, B. and Y. Tache (1994b). "Water-avoidance stress-induced c-fos expression in the rat brain and stimulation of fecal output: role of corticotropin-releasing factor." Brain Res 641(1): 21-28. Bonaz, B., L. Martin, E. Beurriand, J. Hostein and C. Feuerstein (1995). "Brain noradrenergic systems modulate the ceco-colonic myoelectric activity in rats." Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society 7(2): 101-110. Bonaz, B. and Y. Tache (1997). "Corticotropin-releasing factor and systemic capsaicinsensitive afferents are involved in abdominal surgery-induced Fos expression in the paraventricular nucleus of the hypothalamus." Brain Res 748(1-2): 12-20. Bonaz, B. and S. Rivest (1998). "Effect of a chronic stress on CRF neuronal activity and expression of its type 1 receptor in the rat brain." Am J Physiol 275(5 Pt 2): R1438-1449. Bonaz, B. and J. Fournet (2000). "[Acid-sensitive esophagus: a model of abnormal visceroception]." Gastroenterologie clinique et biologique 24(10): 903-905. Bonaz, B., P.J. Riviere, V. Sinniger, X. Pascaud, J.L. Junien, J. Fournet and C. Feuerstein (2000). "Fedotozine, a kappa-opioid agonist, prevents spinal and supra-spinal Fos expression induced by a noxious visceral stimulus in the rat." Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society 12(2): 135-147. Bonaz, B., M. Baciu, E. Papillon, R. Bost, N. Gueddah, J.F. Le Bas, J. Fournet and C. Segebarth (2002). "Central processing of rectal pain in patients with irritable bowel syndrome: an fMRI study." Am J Gastroenterol 97(3): 654-661. Bonaz, B. (2003). "Visceral sensitivity perturbation integration in the brain-gut axis in functional digestive disorders." Journal of physiology and pharmacology : an official journal of the Polish Physiological Society 54 Suppl 4: 27-42. Bonaz, B. and J.M. Sabate (2009). "[Brain-gut axis dysfunction]." Gastroenterologie clinique et biologique 33 Suppl 1: S48-58. Bonaz, B. (2010). "[Brain-gut interactions]." La Revue de medecine interne / fondee ... par la Societe nationale francaise de medecine interne 31(8): 581-585. Bouret, S., A. Duvel, S. Onat and S.J. Sara (2003). "Phasic activation of locus ceruleus neurons by the central nucleus of the amygdala." The Journal of neuroscience : the official journal of the Society for Neuroscience 23(8): 3491-3497. Bradette, M., M. Delvaux, G. Staumont, J. Fioramonti, L. Bueno and J. Frexinos (1994). "Evaluation of colonic sensory thresholds in IBS patients using a barostat. Definition of optimal conditions and comparison with healthy subjects." Dig Dis Sci 39(3): 449-457.

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 361

Bradford, K., W. Shih, E.J. Videlock, A.P. Presson, B.D. Naliboff, E.A. Mayer and L. Chang (2012). "Association between early adverse life events and irritable bowel syndrome." Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association 10(4): 385-390 e383. Bravo, J.A., T.G. Dinan and J.F. Cryan (2011). "Alterations in the central CRF system of two different rat models of comorbid depression and functional gastrointestinal disorders." Int J Neuropsychopharmacol 14(5): 666-683. Buckinx, R., D. Adriaensen, L.V. Nassauw and J.P. Timmermans (2011). "Corticotrophinreleasing factor, related peptides, and receptors in the normal and inflamed gastrointestinal tract." Frontiers in neuroscience 5: 54. Burstein, R. (1996). "Somatosensory and visceral input to the hypothalamus and limbic system." Progress in brain research 107: 257-267. Chang, L., S. Sundaresh, J. Elliott, P.A. Anton, P. Baldi, A. Licudine, M. Mayer, T. Vuong, M. Hirano, B.D. Naliboff, V.Z. Ameen and E.A. Mayer (2009). "Dysregulation of the hypothalamic-pituitary-adrenal (HPA) axis in irritable bowel syndrome." Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society 21(2): 149-159. Chitkara, D.K., M.A.L. van Tilburg, N. Blois-Martin and W.E. Whitehead (2008). "Early life risk factors that contribute to irritable bowel syndrome in adults: a systematic review." The American Journal of Gastroenterology 103: 765-774. Clarke, T.B., K.M. Davis, E.S. Lysenko, A.Y. Zhou, Y. Yu and J.N. Weiser (2010). "Recognition of peptidoglycan from the microbiota by Nod1 enhances systemic innate immunity." Nature medicine 16(2): 228-231. Cliffer, K.D., R. Burstein and G.J. Giesler, Jr. (1991). "Distributions of spinothalamic, spinohypothalamic, and spinotelencephalic fibers revealed by anterograde transport of PHA-L in rats." The Journal of neuroscience : the official journal of the Society for Neuroscience 11(3): 852-868. Cohen, H., A. Jotkowitz, D. Buskila, S. Pelles-Avraham, Z. Kaplan, L. Neumann and A.D. Sperber (2006). "Post-traumatic stress disorder and other co-morbidities in a sample population of patients with irritable bowel syndrome." European journal of internal medicine 17(8): 567-571. Collins, S.M. (2001). "Stress and the gastrointestinal tract. IV. Modulation of intestinal inflammation by stress: basic mechanisms and clinical relevance." The American Journal of Physiology 280: G315-G318. Collins, S.M. and P. Bercik (2009). "The relationship between intestinal microbiota and the central nervous system in normal gastrointestinal function and disease." Gastroenterology 136(6): 2003-2014. Coutinho, S.V., P.M. Plotsky, M. Sablad, J.C. Miller, H. Zhou, A.I. Bayati, J.A. McRoberts and E.A. Mayer (2002). "Neonatal maternal separation alters stress-induced responses to viscerosomatic nociceptive stimuli in rat." American journal of physiology. Gastrointestinal and liver physiology 282(2): G307-316.

362 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

Czeh, B., C. Perez-Cruz, E. Fuchs and G. Flugge (2008). "Chronic stress-induced cellular changes in the medial prefrontal cortex and their potential clinical implications: does hemisphere location matter?" Behav Brain Res 190(1): 1-13. Damasio, A.R., T.J. Grabowski, A. Bechara, H. Damasio, L.L. Ponto, J. Parvizi and R.D. Hichwa (2000). "Subcortical and cortical brain activity during the feeling of selfgenerated emotions." Nat Neurosci 3(10): 1049-1056. Dapoigny, M., J. Bellanger, B. Bonaz, S. Bruley des Varannes, L. Bueno, B. Coffin, P. Ducrotte, B. Flourie, M. Lemann, A. Lepicard and O. Reigneau (2004). "Irritable bowel syndrome in France: a common, debilitating and costly disorder." Eur J Gastroenterol Hepatol 16(10): 995-1001. Davis, M. (1997). "Neurobiology of fear responses: the role of the amygdala." The Journal of neuropsychiatry and clinical neurosciences 9(3): 382-402. DeBenedittis, G., M. Cigada, A. Bianchi, M.G. Signorini and S. Cerutti (1994). "Autonomic changes during hypnosis: a heart rate variability power spectrum analysis as a marker of sympatho-vagal balance." The International journal of clinical and experimental hypnosis 42(2): 140-152. Delvaux, M.M. (1999). "Stress and visceral perception." Canadian journal of gastroenterology = Journal canadien de gastroenterologie 13 Suppl A: 32A-36A. Diorio, J. and M.J. Meaney (2007). "Maternal programming of defensive responses through sustained effects on gene expression." Journal of psychiatry & neuroscience : JPN 32(4): 275-284. Drossman, D.A., J. Leserman, G. Nachman, Z.M. Li, H. Gluck, T.C. Toomey and C.M. Mitchell (1990). "Sexual and physical abuse in women with functional or organic gastrointestinal disorders." Annals of internal medicine 113(11): 828-833. Drossman, D.A., Z. Li, E. Andruzzi, R.D. Temple, N.J. Talley, W.G. Thompson, W.E. Whitehead, J. Janssens, P. Funch-Jensen, E. Corazziari and et al. (1993). "U.S. householder survey of functional gastrointestinal disorders. Prevalence, sociodemography, and health impact." Dig Dis Sci 38(9): 1569-1580. Drossman, D.A., Z. Li, J. Leserman, T.C. Toomey and Y.J. Hu (1996a). "Health status by gastrointestinal diagnosis and abuse history." Gastroenterology 110(4): 999-1007. Drossman, D.A. (1996b). "Gastrointestinal illness and the biopsychosocial model." Journal of clinical gastroenterology 22(4): 252-254. Drossman, D.A. (1999a). "Do psychosocial factors define symptom severity and patient status in irritable bowel syndrome?" The American journal of medicine 107(5A): 41S50S. Drossman, D.A. (1999b). "The Rome criteria process: diagnosis and legitimization of irritable bowel syndrome." Am J Gastroenterol 94(10): 2803-2807. Drossman, D.A., F.H. Creed, K.W. Olden, J. Svedlund, B.B. Toner and W.E. Whitehead (1999c). "Psychosocial aspects of the functional gastrointestinal disorders." Gut 45 Suppl 2: II25-30. Drossman, D.A., W.E. Whitehead, B.B. Toner, N. Diamant, Y.J. Hu, S.I. Bangdiwala and H. Jia (2000). "What determines severity among patients with painful functional bowel disorders?" Am J Gastroenterol 95(4): 974-980.

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 363

Drossman, D.A. (2011). "Abuse, trauma, and GI illness: is there a link ?" The American Journal of Gastroenterology 106: 14â&#x20AC;&#x201C;25. Dunn, A.J. and C.W. Berridge (1990). "Physiological and behavioral responses to corticotropin-releasing factor administration: is CRF a mediator of anxiety or stress responses?" Brain research. Brain research reviews 15(2): 71-100. Elsenbruch, S., C. Rosenberger, P. Enck, M. Forsting, M. Schedlowski and E.R. Gizewski (2010). "Affective disturbances modulate the neural processing of visceral pain stimuli in irritable bowel syndrome: an fMRI study." Gut 59(489e495): 10.1136/gut.2008.175000. Ford, A.C. (2009). "Management of irritable bowel syndrome." Minerva gastroenterologica e dietologica 55(3): 273-287. Ford, A.C. and N.J. Talley (2011). "Mucosal inflammation as a potential etiological factor in irritable bowel syndrome: a systematic review." Journal of gastroenterology 46(4): 421431. Foreman, R.D. (1999). "Mechanisms of cardiac pain." Annu Rev Physiol 61: 143-167. Fu, Y. and V. Neugebauer (2008). "Differential mechanisms of CRF1 and CRF2 receptor functions in the amygdala in pain-related synaptic facilitation and behavior." The Journal of neuroscience : the official journal of the Society for Neuroscience 28(15): 38613876. Fudge, J.L. and A.B. Emiliano (2003). "The extended amygdala and the dopamine system: another piece of the dopamine puzzle." The Journal of neuropsychiatry and clinical neurosciences 15(3): 306-316. Fukudo, S., M. Hongo, H. Kaneko and R. Ueno (2011). "Efficacy and safety of oral lubiprostone in constipated patients with or without irritable bowel syndrome: a randomized, placebo-controlled and dose-finding study." Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society 23(6): 544e205. Fukudo, S. and M. Kanazawa (2011). "Gene, environment, and brain-gut interactions in irritable bowel syndrome." J Gastroenterol Hepatol 26 Suppl 3: 110-115. Fulwiler, C.E. and C.B. Saper (1984). "Subnuclear organization of the efferent connections of the parabrachial nucleus in the rat." Brain Res 319(3): 229-259. Furness, J.B. (2012). "The enteric nervous system and neurogastroenterology." Nature reviews. Gastroenterology & hepatology. Gale, J.D. and L.A. Houghton (2011). "Alpha 2 Delta (alpha(2)delta) Ligands, Gabapentin and Pregabalin: What is the Evidence for Potential Use of These Ligands in Irritable Bowel Syndrome." Frontiers in pharmacology 2: 28. Garakani, A., T. Win, S. Virk, S. Gupta, D. Kaplan and P.S. Masand (2003). "Comorbidity of irritable bowel syndrome in psychiatric patients: a review." American journal of therapeutics 10(1): 61-67. Gauriau, C. and J.F. Bernard (2002). "Pain pathways and parabrachial circuits in the rat." Experimental physiology 87(2): 251-258. Gaynes, B.N. and D.A. Drossman (1999). "The role of psychosocial factors in irritable bowel syndrome." Bailliere's best practice & research. Clinical gastroenterology 13(3): 437-452.

364 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

Gemignani, A., L. Sebastiani, A. Simoni, E.L. Santarcangelo and B. Ghelarducci (2006). "Hypnotic trait and specific phobia: EEG and autonomic output during phobic stimulation." Brain Res Bull 69(2): 197-203. Ghaith, O., M. El-Halabi, J.G. Hashash and A.I. Sharara (2010). "Investigational agents for the irritable bowel syndrome." Expert opinion on investigational drugs 19(10): 11611178. Ghia, J.-E., P. Blennerhassett, H. Kumar-Ondiveeran, E.F. Verdu and S.M. Collins (2006). "The vagus nerve: a tonic inhibitory influence associated with inflammatory bowel disease in a murine model." Gastroenterology 131: 1122-1130. Goldin, P.R. and J.J. Gross (2010). "Effects of mindfulness-based stress reduction (MBSR) on emotion regulation in social anxiety disorder." Emotion 10(1): 83-91. Gravanis, A. and A.N. Margioris (2005). "The corticotropin-releasing factor (CRF) family of neuropeptides in inflammation: potential therapeutic applications." Current medicinal chemistry 12(13): 1503-1512. Gray, T.S. (1993). "Amygdaloid CRF pathways. Role in autonomic, neuroendocrine, and behavioral responses to stress." Annals of the New York Academy of Sciences 697: 5360. Greenwood-Van Meerveld, B., M. Gibson, W. Gunter, J. Shepard, R. Foreman and D. Myers (2001). "Stereotaxic delivery of corticosterone to the amygdala modulates colonic sensitivity in rats." Brain Res 893(1-2): 135-142. Greenwood-van Meerveld, B., A.C. Johnson, J. Schulkin and D.A. Myers (2006). "Long-term expression of corticotropin-releasing factor (CRF) in the paraventricular nucleus of the hypothalamus in response to an acute colonic inflammation." Brain Research 1071: 9196. Grundy, D. (2006). "Signalling the state of the digestive tract." Autonomic Neuroscience: Basic and Clinical 125: 76-80. Gunter, W.D., J.D. Shepard, R.D. Foreman, D.A. Myers and B. Greenwood-Van Meerveld (2000). "Evidence for visceral hypersensitivity in high-anxiety rats." Physiol Behav 69(3): 379-382. Gwee, K.A. (2001). "Postinfectious Irritable Bowel Syndrome." Current treatment options in gastroenterology 4(4): 287-291. Hallbeck, M., D. Larhammar and A. Blomqvist (2001). "Neuropeptide expression in rat paraventricular hypothalamic neurons that project to the spinal cord." The Journal of comparative neurology 433(2): 222-238. Heinrichs, S.C., J. Lapsansky, T.W. Lovenberg, E.B. De Souza and D.T. Chalmers (1997). "Corticotropin-releasing factor CRF1, but not CRF2, receptors mediate anxiogenic-like behavior." Regulatory peptides 71(1): 15-21. Henke, P.G., A. Ray and R.M. Sullivan (1991). "The amygdala. Emotions and gut functions." Digestive Diseases and Sciences 36(11): 1633-1643. Holsboer, F. and M. Ising (2008). "Central CRH system in depression and anxiety--evidence from clinical studies with CRH1 receptor antagonists." Eur J Pharmacol 583(2-3): 350357.

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 365

Hubbard, C.S., J.S. Labus, J. Bueller, J. Stains, B. Suyenobu, G.E. Dukes, D.L. Kelleher, K. Tillisch, B.D. Naliboff and E.A. Mayer (2011). "Corticotropin-releasing factor receptor 1 antagonist alters regional activation and effective connectivity in an emotional-arousal circuit during expectation of abdominal pain." The Journal of neuroscience : the official journal of the Society for Neuroscience 31(35): 12491-12500. Huston, J.M. and K.J. Tracey (2011). "The pulse of inflammation: heart rate variability, the cholinergic anti-inflammatory pathway and implications for therapy." Journal of internal medicine 269(1): 45-53. Hylden, J.L., F. Anton and R.L. Nahin (1989). "Spinal lamina I projection neurons in the rat: collateral innervation of parabrachial area and thalamus." Neuroscience 28(1): 27-37. Ji, G. and V. Neugebauer (2007). "Differential effects of CRF1 and CRF2 receptor antagonists on pain-related sensitization of neurons in the central nucleus of the amygdala." Journal of neurophysiology 97(6): 3893-3904. Johnson, A.C., L. Tran, J. Schulkin and B.G. Meerveld (2012). "Importance of stress receptormediated mechanisms in the amygdala on visceral pain perception in an intrinsically anxious rat." Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society. Kavushansky, A. and G. Richter-Levin (2006). "Effects of stress and corticosterone on activity and plasticity in the amygdala." Journal of neuroscience research 84(7): 15801587. Kearney, D.J. and J. Brown-Chang (2008). "Complementary and alternative medicine for IBS in adults: mind-body interventions." Nature clinical practice. Gastroenterology & hepatology 5(11): 624-636. Knapska, E., K. Radwanska, T. Werka and L. Kaczmarek (2007). "Functional internal complexity of amygdala: focus on gene activity mapping after behavioral training and drugs of abuse." Physiological reviews 87(4): 1113-1173. Kosoyan, H.P., D.E. Grigoriadis and Y. Tache (2005). "The CRF(1) receptor antagonist, NBI35965, abolished the activation of locus coeruleus neurons induced by colorectal distension and intracisternal CRF in rats." Brain Res 1056(1): 85-96. Kraus, T., K. Hosl, O. Kiess, A. Schanze, J. Kornhuber and C. Forster (2007). "BOLD fMRI deactivation of limbic and temporal brain structures and mood enhancing effect by transcutaneous vagus nerve stimulation." J Neural Transm 114(11): 1485-1493. Kunzel, H.E., A.W. Zobel, T. Nickel, N. Ackl, M. Uhr, A. Sonntag, M. Ising and F. Holsboer (2003). "Treatment of depression with the CRH-1-receptor antagonist R121919: endocrine changes and side effects." Journal of psychiatric research 37(6): 525-533. Lackner, J.M., M. Lou Coad, H.R. Mertz, D.S. Wack, L.A. Katz, S.S. Krasner, R. Firth, T.C. Mahl and A.H. Lockwood (2006). "Cognitive therapy for irritable bowel syndrome is associated with reduced limbic activity, GI symptoms, and anxiety." Behav Res Ther 44(5): 621-638. Larauche, M., C. Kiank and Y. Tache (2009). "Corticotropin releasing factor signaling in colon and ileum: regulation by stress and pathophysiological implications." Journal of physiology and pharmacology : an official journal of the Polish Physiological Society 60 Suppl 7: 33-46.

366 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

Larauche, M., G. Gourcerol, M. Million, D.W. Adelson and Y. Tache (2010). "Repeated psychological stress-induced alterations of visceral sensitivity and colonic motor functions in mice: influence of surgery and postoperative single housing on visceromotor responses." Stress 13(4): 343-354. Larauche, M., A. Mulak and Y. Tache (2011). "Stress-related alterations of visceral sensation: animal models for irritable bowel syndrome study." Journal of neurogastroenterology and motility 17(3): 213-234. Larauche, M., A. Mulak and Y. Tache (2012). "Stress and visceral pain: from animal models to clinical therapies." Experimental neurology 233(1): 49-67. Lawrence, J.M., F. Hoeft, K.E. Sheau and S.C. Mackey (2011). "Strategy-dependent dissociation of the neural correlates involved in pain modulation." Anesthesiology 115(4): 844-851. Le Bars, D., L. Villanueva, D. Bouhassira and J.C. Willer (1992). "Diffuse noxious inhibitory controls (DNIC) in animals and in man." Patologicheskaia fiziologiia i eksperimental'naia terapiia(4): 55-65. LeDoux, J.E., J. Iwata, P. Cicchetti and D.J. Reis (1988). "Different projections of the central amygdaloid nucleus mediate autonomic and behavioral correlates of conditioned fear." The Journal of neuroscience : the official journal of the Society for Neuroscience 8(7): 2517-2529. LeDoux, J. (2007). "The amygdala." Current Biology 17(20): R868-R874. Lee, Y.K. and S.K. Mazmanian (2010). "Has the microbiota played a critical role in the evolution of the adaptive immune system?" Science 330(6012): 1768-1773. Li, C., J. Vaughan, P.E. Sawchenko and W.W. Vale (2002). "Urocortin III-immunoreactive projections in rat brain: partial overlap with sites of type 2 corticotrophin-releasing factor receptor expression." The Journal of neuroscience : the official journal of the Society for Neuroscience 22(3): 991-1001. Long, M.D. and D.A. Drossman (2010). "Inflammatory bowel disease, irritable bowel syndrome, or what?: A challenge to the functional-organic dichotomy." Am J Gastroenterol 105(8): 1796-1798. Longstreth, G.F., W.G. Thompson, W.D. Chey, L.A. Houghton, F. Mearin and R.C. Spiller (2006). "Functional bowel disorders." Gastroenterology 130(5): 1480-1491. Lu, H.C., J.C. Hsieh, C.L. Lu, D.M. Niddam, Y.T. Wu, T.C. Yeh, C.M. Cheng, F.Y. Chang and S.D. Lee (2010). "Neuronal correlates in the modulation of placebo analgesia in experimentally-induced esophageal pain: a 3T-fMRI study." Pain 148(1): 75-83. Makino, S., P.W. Gold and J. Schulkin (1994). "Corticosterone effects on corticotropinreleasing hormone mRNA in the central nucleus of the amygdala and the parvocellular region of the paraventricular nucleus of the hypothalamus." Brain Res 640(1-2): 105-112. Maren, S. (2005). "Synaptic mechanisms of associative memory in the amygdala." Neuron 47(6): 783-786. Mathieu, N. (2009). "[Somatic comorbidities in irritable bowel syndrome: fibromyalgia, chronic fatigue syndrome, and interstitial cystitis]." Gastroenterologie clinique et biologique 33 Suppl 1: S17-25.

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 367

Mawdsley, J.E., M.G. Macey, R.M. Feakins, L. Langmead and D.S. Rampton (2006). "The effect of acute psychologic stress on systemic and rectal mucosal measures of inflammation in ulcerative colitis." Gastroenterology 131: 410â&#x20AC;&#x201C;419. Mawdsley, J.E. and D.S. Rampton (2006). "The role of psychological stress in inflammatory bowel disease." Neuroimmunomodulation 13(5-6): 327-336. Mayer, E.A. (2000). "The neurobiology of stress and gastrointestinal disease." Gut 47: 861869. Mayer, E.A., B.D. Naliboff and A.D.B. Craig (2006). "Neuroimaging of the brain-gut axis: from basic understanding to treatment of functional GI disorders." Gastroenterology 131: 1925-1942. Mayer, E.A. (2011). "Gut feelings: the emerging biology of gutâ&#x20AC;&#x201C;brain communication." Nature Neuroscience 12: 453-466. Mazurak, N., N. Seredyuk, H. Sauer, M. Teufel and P. Enck (2012). "Heart rate variability in the irritable bowel syndrome: a review of the literature." Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society 24(3): 206216. Meagher, M.W., R.C. Arnau and J.L. Rhudy (2001). "Pain and emotion: effects of affective picture modulation." Psychosom Med 63(1): 79-90. Mhalla, A., S. Baudic, D. Ciampi de Andrade, M. Gautron, S. Perrot, M.J. Teixeira, N. Attal and D. Bouhassira (2011). "Long-term maintenance of the analgesic effects of transcranial magnetic stimulation in fibromyalgia." Pain 152(7): 1478-1485. Million, M., C. Maillot, D.A. Adelson, T. Nozu, A. Gauthier, J. Rivier, G.P. Chrousos, A. Bayati, H. Mattsson and Y. Tache (2005). "Peripheral injection of sauvagine prevents repeated colorectal distension-induced visceral pain in female rats." Peptides 26(7): 1188-1195. Million, M., L. Wang, Y. Wang, D.W. Adelson, P.Q. Yuan, C. Maillot, S.V. Coutinho, J.A. McRoberts, A. Bayati, H. Mattsson, V. Wu, J.Y. Wei, J. Rivier, W. Vale, E.A. Mayer and Y. Tache (2006). "CRF2 receptor activation prevents colorectal distension induced visceral pain and spinal ERK1/2 phosphorylation in rats." Gut 55(2): 172-181. Million, M., L. Wang, M.P. Stenzel-Poore, S.C. Coste, P.Q. Yuan, C. Lamy, J. Rivier, T. Buffington and Y. Tache (2007). "Enhanced pelvic responses to stressors in female CRFoverexpressing mice." American journal of physiology. Regulatory, integrative and comparative physiology 292(4): R1429-1438. Morcos, A., T. Dinan and E.M. Quigley (2009). "Irritable bowel syndrome: role of food in pathogenesis and management." Journal of digestive diseases 10(4): 237-246. Mulak, A. and B. Bonaz (2004). "Irritable bowel syndrome: a model of the brain-gut interactions." Medical science monitor : international medical journal of experimental and clinical research 10(4): RA55-62. Mulak, A., P. Kahane, D. Hoffmann, L. Minotti and B. Bonaz (2008). "Brain mapping of digestive sensations elicited by cortical electrical stimulations." Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society 20(6): 588-596.

368 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

Myers, D.A., M. Gibson, J. Schulkin and B. Greenwood Van-Meerveld (2005). "Corticosterone implants to the amygdala and type 1 CRH receptor regulation: effects on behavior and colonic sensitivity." Behav Brain Res 161(1): 39-44. Myers, B. and B. Greenwood-Van Meerveld (2007a). "Corticosteroid receptor-mediated mechanisms in the amygdala regulate anxiety and colonic sensitivity." American journal of physiology. Gastrointestinal and liver physiology 292(6): G1622-1629. Myers, B. and B. Greenwood-Van Meerveld (2007b). "Corticosteroid receptor-mediated mechanisms in the amygdala regulate anxiety and colonic sensitivity." The American Journal of Physiology 292: G1622-G1629. Myers, B. and B. Greenwood-Van Meerveld (2010). "Elevated corticosterone in the amygdala leads to persistant increases in anxiety-like behavior and pain sensitivity." Behavioural Brain Research. Naliboff, B.D., A.M. Waters, J. Labus, L. Kilpatrick, M.G. Craske, L. Chang, H. Negoro, H. Ibrahimovic, E.A. Mayer and E. Ornitz (2008). "Increased acoustic startle responses in IBS patients during abdominal and nonabdominal threat." Psychosomatic Medicine 70: 920-927. Nemeroff, C.B., J.D. Bremner, E.B. Foa, H.S. Mayberg, C.S. North and M.B. Stein (2006). "Posttraumatic stress disorder: a state-of-the-science review." Journal of psychiatric research 40(1): 1-21. Neugebauer, V., W. Li, G.C. Bird and J.S. Han (2004). "The amygdala and persistent pain." The Neuroscientist : a review journal bringing neurobiology, neurology and psychiatry 10(3): 221-234. Neugebauer, V. (2006). "Chapter 11 Subcortical processing of nociceptive information: basal ganglia and amygdala." Handbook of clinical neurology / edited by P.J. Vinken and G.W. Bruyn 81: 141-158. Nishith, P., S.P. Duntley, P.P. Domitrovich, M.L. Uhles, B.J. Cook and P.K. Stein (2003). "Effect of cognitive behavioral therapy on heart rate variability during REM sleep in female rape victims with PTSD." Journal of traumatic stress 16(3): 247-250. O'Mahony, S.M., N.P. Hyland, T.G. Dinan and J.F. Cryan (2011). "Maternal separation as a model of brain-gut axis dysfunction." Psychopharmacology 214(1): 71-88. O'Malley, D., T.G. Dinan and J.F. Cryan (2011). "Neonatal maternal separation in the rat impacts on the stress responsivity of central corticotropin-releasing factor receptors in adulthood." Psychopharmacology 214(1): 221-229. Overstreet, D.H. and V. Djuric (2001). "A genetic rat model of cholinergic hypersensitivity: implications for chemical intolerance, chronic fatigue, and asthma." Annals of the New York Academy of Sciences 933: 92-102. Pare, D. (2003). "Role of the basolateral amygdala in memory consolidation." Progress in neurobiology 70(5): 409-420. Parkes, G.C., J. Brostoff, K. Whelan and J.D. Sanderson (2008). "Gastrointestinal microbiota in irritable bowel syndrome: their role in its pathogenesis and treatment." Am J Gastroenterol 103(6): 1557-1567. Patel, S.M., W.B. Stason, A. Legedza, S.M. Ock, T.J. Kaptchuk, L. Conboy, K. Canenguez, J.K. Park, E. Kelly, E. Jacobson, C.E. Kerr and A.J. Lembo (2005). "The placebo effect in

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 369

irritable bowel syndrome trials: a meta-analysis." Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society 17(3): 332-340. Pellissier, S., C. Dantzer, F. Canini, N. Mathieu and B. Bonaz (2010a). "Psychological adjustment and autonomic disturbances in inflammatory bowel diseases and irritable bowel syndrome." Psychoneuroendocrinology 35(5): 653-662. Pellissier, S., C. Dantzer, F. Canini, N. Mathieu and B. Bonaz (2010b). "Toward a definition of a global psycho-physiological criterion of vulnerability to relapse in inflammatory bowel diseases." The American Journal of Gastroenterology 105: 1446-1447. Phelps, E.A., M.R. Delgado, K.I. Nearing and J.E. LeDoux (2004). "Extinction learning in humans: role of the amygdala and vmPFC." Neuron 43(6): 897-905. Phelps, E.A. and J.E. LeDoux (2005). "Contributions of the amygdala to emotion processing: from animal models to human behavior." Neuron 48(2): 175-187. Plotsky, P.M. and M.J. Meaney (1993). "Early, postnatal experience alters hypothalamic corticotropin-releasing factor (CRF) mRNA, median eminence CRF content and stressinduced release in adult rats." Brain research. Molecular brain research 18(3): 195-200. Plotsky, P.M., K.V. Thrivikraman, C.B. Nemeroff, C. Caldji, S. Sharma and M.J. Meaney (2005). "Long-term consequences of neonatal rearing on central corticotropin-releasing factor systems in adult male rat offspring." Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology 30(12): 2192-2204. Porcher, C., V. Sinniger, A. Juhem, P. Mouchet and B. Bonaz (2004). "Neuronal activity and CRF receptor gene transcription in the brains of rats with colitis." American journal of physiology. Gastrointestinal and liver physiology 287(4): G803-814. Porcher, C., A. Juhem, A. Peinnequin, V. Sinniger and B. Bonaz (2005). "Expression and effects of metabotropic CRF1 and CRF2 receptors in rat small intestine." American journal of physiology. Gastrointestinal and liver physiology 288(5): G1091-1103. Quide, Y., A.B. Witteveen, W. El-Hage, D.J. Veltman and M. Olff (2012). "Differences between effects of psychological versus pharmacological treatments on functional and morphological brain alterations in anxiety disorders and major depressive disorder: a systematic review." Neurosci Biobehav Rev 36(1): 626-644. Quirk, G.J., R. Garcia and F. Gonzalez-Lima (2006a). "Prefrontal mechanisms in extinction of conditioned fear." Biol Psychiatry 60(4): 337-343. Quirk, G.J. and I. Vidal-Gonzalez (2006b). "Keeping the memories flowing." Nat Neurosci 9(10): 1199-1200. Rahimi, R., S. Nikfar, A. Rezaie and M. Abdollahi (2009). "Efficacy of tricyclic antidepressants in irritable bowel syndrome: a meta-analysis." World journal of gastroenterology : WJG 15(13): 1548-1553. Randich, A. and G.F. Gebhart (1992). "Vagal afferent modulation of nociception." Brain research. Brain research reviews 17(2): 77-99. Ren, T.-H., J. Wu, D. Yew, E. Ziea, L. Lao, W.-k. Leung, B. Berman, P.-j. Hu and J.J.Y. Sung (2007). "Effects of neonatal maternal separation on neurochemical and sensory response to colonic distension in a rat model of irritable bowel syndrome." The American Journal of Physiology 292: G849-G856.

370 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

Reul, J.M. and F. Holsboer (2002). "On the role of corticotropin-releasing hormone receptors in anxiety and depression." Dialogues in clinical neuroscience 4(1): 31-46. Rhudy, J.L. and M.W. Meagher (2003). "Negative affect: effects on an evaluative measure of human pain." Pain 104(3): 617-626. Rinaman, L., L. Banihashemi and T.J. Koehnle (2011). "Early life experience shapes the functional organization of stress-responsive visceral circuits." Physiology & Behavior 104: 632-640. Ritchie, J. (1973). "Pain from distension of the pelvic colon by inflating a balloon in the irritable colon syndrome." Gut 14(2): 125-132. Rizvi, T.A., M. Ennis, M.M. Behbehani and M.T. Shipley (1991). "Connections between the central nucleus of the amygdala and the midbrain periaqueductal gray: topography and reciprocity." The Journal of comparative neurology 303(1): 121-131. Rodrigues, S.M., J.E. LeDoux and R.M. Sapolsky (2009). "The influence of stress hormones on fear circuitry." Annual review of neuroscience 32: 289-313. Rodriguez Manzanares, P.A., N.A. Isoardi, H.F. Carrer and V.A. Molina (2005). "Previous stress facilitates fear memory, attenuates GABAergic inhibition, and increases synaptic plasticity in the rat basolateral amygdala." The Journal of neuroscience : the official journal of the Society for Neuroscience 25(38): 8725-8734. Rose, A.B., D.P. Merke, L.S. Clasen, M.A. Rosenthal, G.L. Wallace, A.C. Vaituzis, J.D. Fields and J.N. Giedd (2004). "Effects of hormones and sex chromosomes on stress-influenced regions of the developing pediatric brain." Annals of the New York Academy of Sciences 1032: 231-233. Rosenkranz, J.A., H. Moore and A.A. Grace (2003). "The prefrontal cortex regulates lateral amygdala neuronal plasticity and responses to previously conditioned stimuli." The Journal of neuroscience : the official journal of the Society for Neuroscience 23(35): 11054-11064. Rosenkranz, J.A., D.M. Buffalari and A.A. Grace (2006). "Opposing influence of basolateral amygdala and footshock stimulation on neurons of the central amygdala." Biol Psychiatry 59(9): 801-811. Rouzade-Dominguez, M.L., A.L. Curtis and R.J. Valentino (2001). "Role of Barrington's nucleus in the activation of rat locus coeruleus neurons by colonic distension." Brain Res 917(2): 206-218. Sajdyk, T.J., D.A. Schober, D.R. Gehlert and A. Shekhar (1999). "Role of corticotropinreleasing factor and urocortin within the basolateral amygdala of rats in anxiety and panic responses." Behav Brain Res 100(1-2): 207-215. Samuels, E.R. and E. Szabadi (2008). "Functional neuroanatomy of the noradrenergic locus coeruleus: its roles in the regulation of arousal and autonomic function part I: principles of functional organisation." Current neuropharmacology 6(3): 235-253. Sandler, R.S., D.A. Drossman, H.P. Nathan and D.C. McKee (1984). "Symptom complaints and health care seeking behavior in subjects with bowel dysfunction." Gastroenterology 87(2): 314-318.

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 371

Santos, J., P.C. Yang, J.D. Soderholm, M. Benjamin and M.H. Perdue (2001). "Role of mast cells in chronic stress induced colonic epithelial barrier dysfunction in the rat." Gut 48(5): 630-636. Saper, C.B. (1982). "Convergence of autonomic and limbic connections in the insular cortex of the rat." The Journal of comparative neurology 210(2): 163-173. Saper, C.B. (2000). "Hypothalamic connections with the cerebral cortex." Progress in brain research 126: 39-48. Saper, C.B. (2002). "The central autonomic nervous system: conscious visceral perception and autonomic pattern generation." Annual review of neuroscience 25: 433-469. Sapolsky, R.M., B.S. McEwen and T.C. Rainbow (1983). "Quantitative autoradiography of [3H]corticosterone receptors in rat brain." Brain Res 271(2): 331-334. Schwetz, I., J.A. McRoberts, S.V. Coutinho, S. Bradesi, G. Gale, M. Fanselow, M. Million, G. Ohning, Y. Tache, P.M. Plotsky and E.A. Mayer (2005). "Corticotropin-releasing factor receptor 1 mediates acute and delayed stress-induced visceral hyperalgesia in maternally separated Long-Evans rats." American journal of physiology. Gastrointestinal and liver physiology 289(4): G704-712. Selye, H. (1950). "Stress and the general adaptation syndrome." British medical journal 1(4667): 1383-1392. Seminowicz, D.A., J.S. Labus, J.A. Bueller, K. Tillisch, B.D. Naliboff, M.C. Bushnell and E.A. Mayer (2010). "Regional gray matter density changes in brains of patients with irritable bowel syndrome." Gastroenterology 139(1): 48-57 e42. Shepard, J.D. and D.A. Myers (2008). "Strain differences in anxiety-like behavior: association with corticotropin-releasing factor." Behav Brain Res 186(2): 239-245. Short, E.B., J.J. Borckardt, B.S. Anderson, H. Frohman, W. Beam, S.T. Reeves and M.S. George (2011). "Ten sessions of adjunctive left prefrontal rTMS significantly reduces fibromyalgia pain: a randomized, controlled pilot study." Pain 152(11): 2477-2484. Siggins, G.R., D. Gruol, J. Aldenhoff and Q. Pittman (1985). "Electrophysiological actions of corticotropin-releasing factor in the central nervous system." Federation proceedings 44(1 Pt 2): 237-242. Sinniger, V., C. Porcher, P. Mouchet, A. Juhem and B. Bonaz (2004). "c-fos and CRF receptor gene transcription in the brain of acetic acid-induced somato-visceral pain in rats." Pain 110(3): 738-750. Sinniger, V., P. Mouchet and B. Bonaz (2005). "Effect of nor-trimebutine on neuronal activation induced by a noxious stimulus or an acute colonic inflammation in the rat." Life sciences 77(23): 2927-2941. Sotres-Bayon, F., D.E. Bush and J.E. LeDoux (2004). "Emotional perseveration: an update on prefrontal-amygdala interactions in fear extinction." Learn Mem 11(5): 525-535. Spence, M.J. and R. Moss-Morris (2007). "The cognitive behavioural model of irritable bowel syndrome: a prospective investigation of patients with gastroenteritis." Gut 56(8): 10661071. Sweetser, S., M. Camilleri, S.J. Linker Nord, D.D. Burton, L. Castenada, R. Croop, G. Tong, R. Dockens and A.R. Zinsmeister (2009). "Do corticotropin releasing factor-1 receptors influence colonic transit and bowel function in women with irritable bowel syndrome?"

372 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

American journal of physiology. Gastrointestinal and liver physiology 296(6): G12991306. Sykes, M.A., E.B. Blanchard, J. Lackner, L. Keefer and S. Krasner (2003). "Psychopathology in irritable bowel syndrome: support for a psychophysiological model." Journal of behavioral medicine 26(4): 361-372. Tache, Y., M. Million, A.G. Nelson, C. Lamy and L. Wang (2005). "Role of corticotropinreleasing factor pathways in stress-related alterations of colonic motor function and viscerosensibility in female rodents." Gend Med 2(3): 146-154. Tache, Y. and B. Bonaz (2007). "Corticotropin-releasing factor receptors and stress-related alterations of gut motor function." The Journal of clinical investigation 117(1): 33-40. Talley, N.J., A.R. Zinsmeister, C. Van Dyke and L.J. Melton, 3rd (1991). "Epidemiology of colonic symptoms and the irritable bowel syndrome." Gastroenterology 101(4): 927-934. Tasan, R.O., N.K. Nguyen, S. Weger, S.B. Sartori, N. Singewald, R. Heilbronn, H. Herzog and G. Sperk (2010). "The central and basolateral amygdala are critical sites of neuropeptide Y/Y2 receptor-mediated regulation of anxiety and depression." The Journal of neuroscience : the official journal of the Society for Neuroscience 30(18): 62826290. Tillisch, K., E.A. Mayer and J.S. Labus (2011). "Quantitative meta-analysis identifies brain regions activated during rectal distension in irritable bowel syndrome." Gastroenterology 140: 91-100. Tottenham, N., T.A. Hare, B.T. Quinn, T.W. McCarry, M. Nurse, T. Gilhooly, A. Millner, A. Galvan, M.C. Davidson, I.M. Eigsti, K.M. Thomas, P.J. Freed, E.S. Booma, M.R. Gunnar, M. Altemus, J. Aronson and B.J. Casey (2010). "Prolonged institutional rearing is associated with atypically large amygdala volume and difficulties in emotion regulation." Developmental science 13(1): 46-61. Trimble, N., A.C. Johnson, A. Foster and B. Greenwood-van Meerveld (2007). "Corticotropin-releasing factor receptor 1-deficient mice show decreased anxiety and colonic sensitivity." Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society 19(9): 754-760. Trinkley, K.E. and M.C. Nahata (2011). "Treatment of irritable bowel syndrome." Journal of clinical pharmacy and therapeutics 36(3): 275-282. Tsukamoto, K., Y. Nakade, C. Mantyh, K. Ludwig, T.N. Pappas and T. Takahashi (2006). "Peripherally administered CRF stimulates colonic motility via central CRF receptors and vagal pathways in conscious rats." The American Journal of Physiology 290: R1537R1541. Tsuruoka, M., D. Wang, J. Tamaki and T. Inoue (2010). "Descending influence from the nucleus locus coeruleus/subcoeruleus on visceral nociceptive transmission in the rat spinal cord." Neuroscience 165(4): 1019-1024. Vale, W., J. Spiess, C. Rivier, and J. Rivier (1981). Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and beta-endorphin. Science 213(4514): 1394-1397.

The Irritable Bowel Syndrome: How Stress Can Affect the Amygdala Activity and the Brain-Gut Axis 373

Valentino, R.J., S.L. Foote and M.E. Page (1993). "The locus coeruleus as a site for integrating corticotropin-releasing factor and noradrenergic mediation of stress responses." Annals of the New York Academy of Sciences 697: 173-188. van den Wijngaard, R.M., T.K. Klooker, O. Welting, O.I. Stanisor, M.M. Wouters, D. van der Coelen, D.C. Bulmer, P.J. Peeters, J. Aerssens, R. de Hoogt, K. Lee, W.J. de Jonge and G.E. Boeckxstaens (2009). "Essential role for TRPV1 in stress-induced (mast celldependent) colonic hypersensitivity in maternally separated rats." Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society 21(10): 1107-e1194. van den Wijngaard, R.M., T.K. Klooker, W.J. de Jonge and G.E. Boeckxstaens (2010). "Peripheral relays in stress-induced activation of visceral afferents in the gut." Autonomic neuroscience : basic & clinical 153(1-2): 99-105. van Haarst, A.D., M.S. Oitzl and E.R. de Kloet (1997). "Facilitation of feedback inhibition through blockade of glucocorticoid receptors in the hippocampus." Neurochemical research 22(11): 1323-1328. Van Oudenhove, L., S.J. Coen and Q. Aziz (2007). "Functional brain imaging of gastrointestinal sensation in health and disease." World journal of gastroenterology : WJG 13(25): 3438-3445. Van Oudenhove, L., J. Vandenberghe, B. Geeraerts, R. Vos, P. Persoons, B. Fischler, K. Demyttenaere and J. Tack (2008). "Determinants of symptoms in functional dyspepsia: gastric sensorimotor function, psychosocial factors or somatisation?" Gut 57(12): 16661673. Venkova, K., R.D. Foreman and B. Greenwood-Van Meerveld (2009). "Mineralocorticoid and glucocorticoid receptors in the amygdala regulate distinct responses to colorectal distension." Neuropharmacology 56(2): 514-521. Vidal-Gonzalez, I., B. Vidal-Gonzalez, S.L. Rauch and G.J. Quirk (2006). "Microstimulation reveals opposing influences of prelimbic and infralimbic cortex on the expression of conditioned fear." Learn Mem 13(6): 728-733. Vyas, A., R. Mitra, B.S. Shankaranarayana Rao and S. Chattarji (2002). "Chronic stress induces contrasting patterns of dendritic remodeling in hippocampal and amygdaloid neurons." The Journal of neuroscience: the official journal of the Society for Neuroscience 22(15): 6810-6818. Vyas, A., S. Jadhav and S. Chattarji (2006). "Prolonged behavioral stress enhances synaptic connectivity in the basolateral amygdala." Neuroscience 143(2): 387-393. Wallon, C., P.C. Yang, A.V. Keita, A.C. Ericson, D.M. McKay, P.M. Sherman, M.H. Perdue and J.D. Soderholm (2008). "Corticotropin-releasing hormone (CRH) regulates macromolecular permeability via mast cells in normal human colonic biopsies in vitro." Gut 57(1): 50-58. Wang, L., V. Martinez, M. Larauche and Y. Tache (2009). "Proximal colon distension induces Fos expression in oxytocin-, vasopressin-, CRF- and catecholamines-containing neurons in rat brain." Brain Res 1247: 79-91.

374 The Amygdala â&#x20AC;&#x201C; A Discrete Multitasking Manager

Whalen, P.J. and B.S. Kapp (1991). "Contributions of the amygdaloid central nucleus to the modulation of the nictitating membrane reflex in the rabbit." Behavioral neuroscience 105(1): 141-153. Whitehead, W.E., M.D. Crowell and J.C. Robinson (1992). "Effects of stressful life events on bowel symptoms: subjects with irritable bowel syndrome compared with subjects without bowel dysfunction." Gut 33: 825-830. Whitehead, W.E., O. Palsson and K.R. Jones (2002). "Systematic review of the comorbidity of irritable bowel syndrome with other disorders: what are the causes and implications?" Gastroenterology 122(4): 1140-1156. Whorwell, P.J., A. Prior and E.B. Faragher (1984). "Controlled trial of hypnotherapy in the treatment of severe refractory irritable-bowel syndrome." Lancet 2(8414): 1232-1234. Whorwell, P.J. (2009). "Behavioral therapy for IBS." Nature clinical practice. Gastroenterology & hepatology 6(3): 148-149. Wilder-Smith, C.H., D. Schindler, K. Lovblad, S.M. Redmond and A. Nirkko (2004). "Brain functional magnetic resonance imaging of rectal pain and activation of endogenous inhibitory mechanisms in irritable bowel syndrome patient subgroups and healthy controls." Gut 53: 1595â&#x20AC;&#x201C;1601. Woolf, C.J. (2011). "Central sensitization: implications for the diagnosis and treatment of pain." Pain 152(3 Suppl): S2-15. Woon, F.L., S. Sood and D.W. Hedges (2010). "Hippocampal volume deficits associated with exposure to psychological trauma and posttraumatic stress disorder in adults: a metaanalysis." Progress in neuro-psychopharmacology & biological psychiatry 34(7): 11811188. Zhou, Q. and G.N. Verne (2011). "New insights into visceral hypersensitivity - clinical implications in IBS." Nature Reviews Gastroenterology & Hepatology 8: 349-355.