Wine & Viticulture Journal - May/June 2015 by Provincial Press Group

MAY/JUNE · Volume 30 Number 3

VINEYARD INNOVATIONS & TECHNOLOGY • A new robot for vineyard monitoring • Whole bunch fermentation: a wild card inclusion in red winemaking • Micro-oxygenation and its impact on Pinot Noir • Early results of the Free Trade Agreement with Japan • Tasting: Lesser-known Italian whites

New twist on QR codes Orora’s dedication to the wine and spirit industry is building a closer connection between producers and consumers. QR codes are a popular way to increase consumer interaction. Use your smart phone to scan the QR code, and you’ll notice a whole new twist on

1300 2 ORORA www.ororagroup.com stelvin.sales@ororagroup.com

engaging consumers - unveiling additional product and brand information. Recognising this, Lark Hill Wines partnered with Orora to develop Australia’s first QR code on a wine screw-cap. Contact us to discuss Orora’s innovative approach to supporting your business.

Publisher: Hartley Higgins General Manager: Elizabeth Bouzoudis Editor Sonya Logan Ph (08) 8369 9502 Fax (08) 8369 9501 Email s.logan@winetitles.com.au Editorial Advisory Panel Gary Baldwin Peter Dry Mark Krstic Armando Corsi Markus Herderich EDITORIAL ASSISTANCE Lauren Jones, Write Lane CONTRIBUTING WRITERS

Graeme Allinson Stuart Barclay Tony Battaglene Johan Bruwer Paul Chambers Armando Corsi Michael Dal Zotto Peter Dry Colin Gaetjens Markus Herderich Cathy Howard Geoff Kew Paul Lewis Mardi Longbottom Patrick Nickolaus Chester Osborn Helen Palermo Mark Rowley Richard Smart Peter Sternes Javier Tardaguila Luke Warner

Peter Bailey Eveline Bartowsky Anthony Borneman Kim Chalmers Justin Cohen Peter Costello Maria Diago Dominic Durner Nuredin Habili Tony Hoare Dan Johnson Tony Keys Larry Lockshin David Mills Geoff O’Keefe Linda Ovington Mark Palermo Anthony Saliba Mark Sosnowski Michael Swadener Hai-Linh Trieu

Advertising Manager: Dan Brannan Ph (08) 8369 9515 Fax (08) 8369 9529 Email d.brannan@winetitles.com.au Production and Design: Luke Westle Subscriptions One-year subscription (6 issues) Australia $77.00 (AUD) Two-year subscription (12 issues) Australia $144.00 (AUD) To subscribe and for overseas prices, visit: www.winebiz.com.au The Wine & Viticulture Journal is published bi-monthly. Correspondence and enquiries should be directed to Sonya Logan. The views expressed in the Journal are those of the authors and do not necessarily reflect the opinions of the Journal or its staff.

Sonya Logan, Editor

he coming months look set to be particularly interesting for the Australian wine industry when the outcomes of several reviews, inquiries and meetings in the works into its various challenges will be revealed. First, we’ve got the inquiry by the Senate Rural and Regional Affairs and Transport References Committee which will report in November. Then there’s Treasury’s discussion paper into the operation of the Wine Equalisation Tax rebate to be released in July. And now there’s an industry leaders’ meeting due to be held in Adelaide in August to come up with two or three key solutions to accelerate the industry’s return to profitability and reach a consensus on the best structure to represent the industry on key issues. I’m sure there’s an inquiry or two I’ve forgotten too but these would have to be the big ones and if you’re not up to speed with what they’re all about then you can catch up in our news pages in this issue. On the grapegrowing front in this issue, we’ve got an interesting piece from Richard Smart who outlines his concerns about the Australian Grapevine Propagation Material Standard in not addressing the spread of grapevine trunk diseases (page 43). We invited parties with a particular interest in the vine planting industry and trunk diseases in Australia to respond to his concerns and they can be found on the pages that follow Richard’s article. The focus of this issue is ‘Vineyard Innovations & Technology’ and to this end we present an article on a project under way in the EU to develop an unmanned robot to monitor various vine and grape aspects such as yield, vegetative growth, and grape composition (page 38). A prototype has

been developed and if you ask me it looks a little bit like the earlier versions of K-9, the robotic dog from the Dr Who series (actually, from a marketing perspective, it might be worth the designers making the similarity between their robot and dogs even more obvious given how much vineyard and winery owners and workers love to have their canines by their side as they tend their vines – perhaps I should forward my suggestion…). And, be sure to head on over to Soil Horizon - the first of a semi-regular column in which Geoff Kew will draw on his many years of experience looking at soil profiles in vineyards and other horticultural and agricultural enterprises to describe how soil affects vine growth, fruit production and quality (page 59). Readers of Australian Viticulture may recall Ken Wetherby writing a similar column on soil profiles for several years. Well, Geoff is Ken’s son-in-law and feels many growers have forgotten just how much their soils influence how their vines grow, so hopes his columns will be a timely reminder. Over in winemaking is one of the highlights of this issue - Cathy Howard’s look at the use of whole bunches in winemaking (page 16). And if Pinot Noir is in your production mix, be sure to take a look at the results of some research out of Germany on the effect of microoxygenation on the polyphenols and sensory characteristics of this variety. Over to you to enjoy these articles and the many others that lie within the following pages. But if you don’t or you’d like to make a suggestion please don’t hesitate to forward your thoughts via email, Twitter, Facebook or carrier pigeon: s.logan@winetitles.com.au

Like us on Facebook or follow us on Twitter! www.facebook.com/WineAndVitiJournal Address 630 Regency Road, Broadview, South Australia 5083

Telephone and Fax Ph (08) 8369 9500 Fax (08) 8369 9501

General info@winetitles.com.au Editorial s.logan@winetitles.com.au Subscriptions subs@winetitles.com.au Advertising widsales@winetitles.com.au

@WineVitiJournal Cover: Autumn descends on a vineyard near Kuitpo in South Australia's Adelaide Hills Photo: Ben Heide REGULAR FEATURES

News 6 ASVO 10 AGWA 11 WFA 12 Tony Keys 13

www. w inebiz.com.au

AWRI Report 34 Alternative Varieties 61 Varietal Report 76 Tasting 79

WIN E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

V30N3

IN THIS ISSUE

T E N UT R S E V ICT OI N C U LT

V I T I C U LT U R E

R E G U L A R F E AT U R E S

10 ASVO (Mardi Longbottom): Mildura seminar just round the corner while Adelaide seminar planning under way to identify this year’s ‘hot topic’ 11 AGWA (Stuart Barclay): Market development update: Working together to build demand for Australian Wine

38 A new robot for vineyard monitoring 43 RICHARD SMART: A sub-standard standard 51 Highlights from the 9th International Workshop on Grapevine Trunk Diseases

12 WFA (Tony Battaglene): Further cuts to the costs of shipping wine samples overseas on the cards 13 KEY FILES (TONY KEYS): Little and large – what is the future of the cask and half bottles?

W I N E M A K I N G

16 CATHY HOWARD: Whole bunch fermentation: a wild card inclusion in red winemaking 52 Grapevine Pinot Gris virus – a tricky virus around the corner? 56 TONY HOARE: Current trends and future predictions for Australian viticulture Part 2: The Golden Era – Potential opportunities and barriers to future success for Australian viticulture 59 SOIL HORIZON (GEOFF KEW): Potential rootzones – where are your roots? 61 ALTERNATIVE VARIETIES: Teroldego 26 Micro-oxygentation and its impact on polyphenols and sensory characteristics of Pinot Noir 32 A new look at an old practice: how sulfur dioxide additions influence microbial diversity during fermentation 34 AWRI REPORT: Unravelling the capricious nature of Oenococcus oeni

BUSINESS & MARKETING

64 The year in review for vineyard and winery real estate sales 66 Proficiency testing for peace of mind

W I N E TA S T I N G

75 Lesser-known Italian whites

68 Optimising the impact of wine education on Asian consumers: training with Western or Chinese terminology 70 Early results of the Free Trade Agreement with Japan 72 Wine avoiders in five countries: potential for adopting wine as an alcoholic beverage of choice V3 0N 3

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.winebiz. com . au

N E W S

S N I P S

WET REBATE REFORMS ON HOLD The Federal Government has asked the Treasury to prepare a discussion paper on the operation of the Wine Equalisation Tax (WET) rebate despite lobbying by the wine industry to have reforms to the rbate included in its May Budget. The discussion paper will be released in July and will form part of the Government’s Tax White Paper process which will incorporate a range of reforms designed to achieve a simpler and streamlined tax system for the nation. Assistant Treasurer Josh Frydenberg announced the discussion paper on 5 May ahead of the Budget release on 12 May. It followed lobbying of the Government by the Winemakers’ Federation of Australia (WFA) to have the WET rebate reformed by abolishing the separate New Zealand producers’ rebate and phasing out the rebate on bulk and unbranded wine. WFA has asked that the savings brought about by these reforms be offset by $25m for marketing Australian wine exports. WFA says these reforms have the backing of Wine Grape Growers Australia, Wines of Western Australia, South Australian Wine Industry Association, Wine Tasmania, Wine Victoria, the New South Wales Wine Association and Queensland Wine Industry Association, as well as wine regions including Riverland, Riverina and Murray Valley. WFA chief executive Paul Evans said while the industry would have been disappointed that its WET rebate reforms were not be part of the Budget, it had highlighted a “compelling case” for structural reform and Government was listening. He said constructive discussions with Government on WET rebate reform would continue. “We need one-off supplementary marketing funds from Government to boost the promotion of Australian wine. With the Australian dollar softening, global consumer sentiment improving – especially in the key North American market – and the opportunities free trade agreements present us with, a window of opportunity has been created. “We now need adequate resources to re-introduce the quality and diversity of our offering to wine buyers and consumers and shift demand to recover share and margin. We can offset this expenditure by making some limited reforms to the wine equalization tax (WET) rebate including the abolition of the separate and unfair New Zealand producers’ rebate and the phasing-out of the rebate on bulk and unbranded wine."

www.win eb i z .c om.au

Meanwhile, Pernod Ricard and Treasury Wine Estates have engaged the services of Newgate Communications to lobby for changes to the tax system on wine, including replacing it with a category-based volumetric tax. A spokesperson for Pernod Ricard told the Wine & Viticulture Journal the signing of Newgate was prompted by the Government’s decision to reform Australia’s tax system. The two wine companies were due to launch their joint campaign in early June which would focus on industry stakeholders more so than the general public, the spokesperson said. Pernod Ricard and TWE have previously lobbied the Federal Government for a category based volumetric tax to be placed on wine in submissions they each made to the tax forum in 2011. “Newgate will help us to communicate our message,” the spokesperson said, adding that both companies still supported WFA’s proposed WET rebate reforms. INDUSTRY AWAITS OUTCOME OF SENATE INQUIRY The closing date for submissions to the inquiry into the Australian grape and wine industry by the Senate Standing Committee on Rural and Regional Affairs and Transport has now ended with the group due to report in November. Senators Anne Ruston, Nick Xenophon, Bridget McKenzie, Peter Whish-Wilson and John Madigan moved to establish the inquiry on 24 March which is examining: • the extent and nature of any market failure in the Australian grape and wine industry supply chain • the extent to which federal and state legislative and regulatory regimes inhibit and support the production, processing, supply chain logistics and marketing of Australian wine • the profitability of wine grape growers, and the steps industry participants have taken to enhance profitability • the impact and application of the wine equalisation tax rebate on grape and wine industry supply chains • the extent to which grape and wine industry representation at regional, state and national level effectively represents growers and winemakers with respect to equity in the collection and distribution of levies • the work being undertaken by the Australian Grape and Wine Authority pertaining to levy collection information W I N E & V I T I CULTUR E JO UR N A L MAY/JUNE 2015

• the power and influence of retailers of Australian wine in domestic and export markets • the adequacy and effectiveness of market intelligence and pricing signals in assisting industry and business planning • the extent to which the Australian grape and wine industry benefits regional communities both directly and indirectly through employment, tourism and other means any related matters. This is the second inquiry into the grape and wine industry by the committee in a decade. Lawrie Stanford, executive director of Wine Grape Growers Australia, said senate inquiries had a bad reputation for making things happen “and even some of the Senators involved in this exercise will admit to this”. “Moreover, another inquiry at this time may be considered excessive where there seems to be a surplus of industry ‘reviews’ happening at the moment. Nevertheless, I feel the Senate Inquiry will serve a purpose from several points of view. It will provide a perspective from a ‘third party’ (goodness knows after about 10 years in the doldrums, industry introspection has not done the job of finding solutions to fix things), it can and will complement the other activities in terms of topics or perspectives, it will identify the appropriate agents for change on the issues it deals with (industry or government or investment community etc.) and it can give these agents added impetus, or even moral authority, to act,” Stanford told the Wine & Viticulture Journal’s sister publication, the e-newsletter Daily Wine News. Paul Evans, chief executive of the Winemakers’ Federation of Australia, said initiatives that highlighted the wine industry and areas where action was needed were welcome. “The inquiry into the wine industry does exactly that and the Winemakers’ Federation of Australia looks forward to making a submission. However, WFA has analysed the challenges in front of the industry and is now implementing a comprehensive action plan that has been developed over the past two years to support industry’s recovery. We do not intend to wait for the inquiry to act,” Evans told Daily Wine News. CHALLENGES AND OPPORTUNITIES TO BE ADDRESSED AT WINE INDUSTRY LEADERS MEETING IN AUGUST A wine industry leaders’ meeting, titled ‘Grape and Wine 2015 - A Focus for Action’, will be held in Adelaide on 6 August to agree on two to three issues V30N3

N E W S

that will accelerate return to profitability for growers and winemakers and reach a consensus on the best structure to represent the industry on key issues. The meeting will be held in Adelaide at the National Wine Centre and attended by around 40 nominees of national, state and regional industry organisations. Tony D’Aloisio, president of WFA, said a small group of national and state industry leaders had been working on the concept and details of the leaders’ meeting since late 2014 following agreement that a more united approach was required to effectively work through the industry’s challenges and opportunities. D’Aloisio said to ensure engagement with the whole industry, an industry survey would be conducted prior to the meeting as well as engagement with regional associations and their members via state wine associations. An independent consultant will help facilitate the meeting and identify the key issues facing industry and what can be done to improve alignment and collaboration between the industry bodies on behalf of levy payers and members. “An expected outcome from the meeting will be agreement on what organisation reform is required to achieve a more united and effective industry voice and what interim arrangements can be put in place to progress the key issues in front of industry,” D’Aloisio said. He said the need for the meeting was supported by the peak state wine associations including the South Australian Wine Industry Association, NSW Wine Industry Association, Wines

of WA, Wine Victoria and grapegrower organisations including Wine Grape Growers Australia, Murray Valley Winegrowers, the Wine Grapes Marketing Board, the Riverland Wine Industry Development Council, the Wine Grape Council of South Australia, and the Winemakers’ Federation of Australia. EXTRA MOTIVATION TO ATTEND WINETECH2015 The recently announced tax breaks for small businesses in the Federal Budget are expected to attract more interaction and investment at WineTech2015. Hosted by the Wine Industry Suppliers Association (WISA), WineTech 2015, the wine industry’s flagship trade show, will be held in Adelaide from 1416 July. Matthew Moate, executive officer of WISA, said the tax incentive could be “a major new driver of investment in plant and equipment supporting the wine sector and it is a very welcome development in the lead-up to WineTech2015”. Businesses with a turnover of less than $2 million can now claim a tax deduction on capital purchases for business assets of up to $20,000. “It will certainly encourage grapegrowers and winemakers – indeed participants along the entire supply chain – to attend the event to consider purchases of latest products and technologies,” Moate said. “The $20,000 tax incentive is just the boost we needed to raise confidence in the industry and it will translate

S N I P S

into new investment and turnover that will benefit business owners and the economy in general. “WineTech2015 will be a timely opportunity for participants in the wine sector to keep abreast of innovation, and to discuss latest products and developments with industry leaders,” Moate said. “There has not been a better opportunity to look, learn and buy from a floor show with a direct operational focus.” The event will be held at the Adelaide Showground, and will be supported by the Australian Grape and Wine Authority (AGWA), Winemakers’ Federation of Australia (WFA), Wine Grape Growers Australia (WGGA) and Wine Communicators of Australia (WCA). In addition to supplier presentations, WineTech2015 will also offer a seminar program to tackle a range of topics, including: • What can we learn from our allies in industry – food, beverage and agriculture? Are there solutions and inspiration in their stories and experiences not yet considered? • Why it pays to create a memorable cellar door experience and how to achieve it • Wine Retail – The digital space • Influencing purchasing intent through social media and storytelling • Future generation providing insights into how the industry can assess its needs now and into the future • Support for export and investment with Korea and Japan through free trade agreements. For more information on WineTech 2015, visit www. winetechaustralia.com. au. WVJ

Also manufacturers of

• S G Spur Pruners • Single Side Pruners • Vine Cane Sweepers • Hydraulic Power Packs • Double Acting Cutter Bars

AUSTRALIAN MADE PRUNERS

For further information visit our website S G Pruner Vineyard & Orchard Sweepers • Single and double sided • Full electric over hydraulic controls at www.spagnolo.com.au or contact: • Spring-loaded head enables it to from your tractor seat glide around posts and vine trunks. • Totally adjustable for different cordon spacings Ph (03) 5021 1933 Fax (03) 5021 5233 • Spur prunes between vine cordons • Optional hydraulic lift, tilt and side shift cylinders. • Prunes single cordon in VSP trellis Email sales@spagnolo.com.au • Ideal for cleaning up uneven terrain • SG Pruner patent app no. • Durable powdercoated finish AUS 780431 U.S.A 6,523,337 Mildura Victoria Australia V3 0N 3

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.winebiz. com . au

O P I N I O N

Phase out WET rebate and redirect funds to boost export efforts By Chester Osborn, d’Arenberg, McLaren Vale, South Australia

Editor of the Wine & Viticulture Journal Sonya Logan recently teamed up with her colleague Nathan Gogoll, editor of our sister publication Grapegrower & Winemaker, to put some questions to several grapegrowers and wine producers and national representative and regional bodies to glean their thoughts on the state of play in the Australian wine industry. As well as answering our questions, Chester Osborn offered the following additional commentary which we thought we’d republish here for those who may have missed it. To read this and the rest of our online ‘state of play’ Q&A with the industry, visit the Daily Wine News blog (https://dailywinenews.wordpress.com/)

would like to paint a picture and ,propose my solutions to the industry’s problems. I believe Paul Evans, from the Winemakers’ Federation of Australia (WFA), is between a rock and a hard place as lots of tiny new wineries, labels and growers are totally relying on the WET exemption for their business model to work and this has totally distorted the marketplace. Quite a rift has occurred within the industry, with many larger wine producers unhappy with their representation by the WFA. So much so that many are pulling out their funding. I am speaking out here for the many medium and larger producers not getting a hearing. First, I would like to say we have all benefited to varying degrees from the assistance the WET exemption has brought us. Overall, however, all it has done is make wine cheaper (mainly middle or upper range wines), make the trade more profitable to some degree and introduce masses of new labels to the marketplace. The latter are mainly coming from new, inexperienced growers and their friends and relatives, ‘quasi’ wine companies, retailers and New Zealand wine growers/ makers/trade. In addition there are similar cider selling companies. The WET exemption has not sold one extra bottle of wine. Effectively, it has acted like a hand out to the final consumer by making wine cheaper. Paul Evans has worked on rewriting the details of WET exemption eligibility relatively nicely; however the core problems going forward are not addressed. I will address these shortly after I have pointed out some of the distorted occurrences we have observed that are relatively legal. People have been able to make multiple claims on a single parcel of wine by selling it to a so-called ‘extra party’ and then again on-selling multiple times, and each time a WET exemption claim is made.

www.win eb i z .c om.au

Effectively, this leaves the wine owing nothing to the original owner. Obviously this is not intentionally illegal, but easily orchestrated legally. Even New Zealanders have got in on the act. I have heard of wine being sold from Australia to New Zealand and then back to Australia. Each time WET exemption is paid, while the wine itself has not left Australian shores. While on the subject of New Zealand, seven years ago very little New Zealand wine was imported into Australia. Now it accounts for about 15% of all wine sold. We have been paying the New Zealanders tens of millions of dollars to come and take over our industry. I have also heard of Chinese setting up companies in Australia to claim WET exemption on cider that is sold somewhere else in the world. Paul’s model has addressed these issues to the best he can, however while the WET exemption still exists, there are multiple ways of claiming it. The main problem I envisage in the future is that all companies up to $1.5 million wholesale sales have a huge price advantage. Once sales reach $1.5 million, every bottle sold over and above the threshold dilutes the average return per bottle. Eventually we will end up with thousands of companies all claiming WET exemption and, in turn, the Government will not be collecting much WET tax at all. Many of these companies would be basing their finances on getting the 29% rebate to be profitable and their wine being cheaper. Not one extra bottle of Australian wine would be sold. Not one over-supplied grape would be crushed. In effect, the WET exemption would be rewarding small, inefficient wine producers while making it harder for the larger wine companies to compete, causing them to cut costs (and potentially staff) to the bone. In both cases that would leave few dollars to build a brand and market it both domestically and internationally. Wines made by small

W I N E & V I T I CULTUR E JO UR N A L MAY/JUNE 2015

companies pricing for export would be higher than the same locally sold wine and well-informed overseas based retailers and customers would not want to stock those products. Effectively, Australia’s huge advantage of having the strongest brands in the world would be diluted. The canvas would be more like Europe where there are masses of small wineries adding to the confusion about wine that the consumer already has. As we all know, the major problem with the wine industry centres around supply and demand. There is just not enough demand for the amount of supply. So, as we all strongly compete, the WET exemption enables inefficient small companies to compete also but doesn’t make anyone more profit as while we are in oversupply, undercutting to lower margins will always bring profits down to the bones, as people are desperate to keep selling their grapes and wine. This is where I say the WET exemption only makes wine cheaper and doesn’t help producers or growers. What would be best for everyone is to bring supply and demand back to even or, ideally, demand over supply. The $260 million handed to wineries in 2013-14 could be given in a different way. I see two types of assistance packages that would achieve amazing results. The $260 million could be spread among all wineries only on the condition it be spent on visits to export markets and ancillary costs of doing events. During the heyday of Aussie wine exports a huge number of winemakers toured overseas markets with amazing success. Now, very few travel largely due to their selfimposed cost cutting brought about by the imbalance of supply and the WET tax rebate. You can imagine the headlines around the world: ‘Cashed up Aussie winemakers invading our shores’. The results would be astronomical.

V30N3

O P I N I O N

The second benefit would be spreading the rest of the $260 million for publications, specifically for advertorials and the establishment or continuation of publications on Australian wine; both published magazines and e-commerce. Part of the problem with Aussie wine export sales is the lack of international press written about Australian wine, which is inextricably bound to the lack of Aussie wine advertising in their publications. Countries in Europe are heavily subsidised by governments to promote their wine industry internationally. There is also the issue of parochial prejudice which is more difficult a mindset to overcome. This may sound a lot like the Export Market Development Grants (EMDG) scheme but I think that is too easily rorted. With the EMDG, companies can get invoices from overseas distributors claiming ‘market development costs’ for huge amounts. The overseas company can justify the expenses as wages of employees, on the road and the like. Meanwhile, the wine export price is elevated so as to match the original intended price, effectively achieving very little that wouldn’t already be done, and getting a nice cash injection from the Government. It’s just too easy to rort. I envisage that the money would be

allocated as assistance (remuneration for 60-70% of costs) set up as a tendered grant, and applied for before spending. Before long, Australia would be considered the capital of the wine world taking up volumes of the world’s wine lists. Some people in the industry have put forward a concept where you must have a bricks and mortar winery to get the WET exemption. This has major flaws and negative consequences. The definition of ‘bricks and mortar’ is a difficult one as one wine barrel could potentially be enough to qualify. Conversely, if only grapes processed and stored onsite are considered eligible this may result in decreased quality and many inefficient wine labels. Places like Tasmania have wineries that process dozens of small wine label products. Each of these wines would then need to be made in inefficient small wineries prone to problems arising from incompetence, naivety and all the associated problems of semi microvinification. It would be too painful to many businesses to remove the WET exemption in one fell swoop. I would see it being phased out over a three-year period. Each of those three years of gradual WET exemption reduction would be offset

by the increase in promotional support I’ve outlined. We could continue with Paul Evans’ slightly cleaned up WET tax exemptions, or we could be putting the assistance to much greater use. If we take the first route, one day in the future when we have a very different, multi small wine company geography and the Government is removing the WET exemptions as little money is being collected, it will be much more painful and difficult to adapt. It isn’t that long ago that Australian wine was on everyone’s minds internationally. The longer we leave it to make a change, Australian wine becomes a lost memory. Finally, I leave you with a recent quote by Neil McGuigan, the fourth Australian president of the International Wine & Spirit Competition, who when asked to comment on rumours about the recent sale of Peter Lehman Wines, declined other than to say, “Let’s face it, almost every Australian winery is on the market.” How long should unprofitable wine labels/companies be subsidised by the Government? The money could be put to better use to achieve great export volumes and achieve enormous benefits for the wine industry and the Australian economy, instead of causing a lot of distortions and WVJ pain.

By all means, take off our tops. By effectively promoting your brands & products we encourage consumers to take the tops off your wines. As the only Australian manufacturer of Hoods, Polylaminate and PVC Capsules, we achieve these results through innovative R&D and global backing. Being seasoned wine industry suppliers means we understand your requirements, making it easier to help you sell your wine

ENO144393-B/WVJ2015

& build your brands.

V3 0N 3

08 8347 0455 | www.enoplastic.com.au

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.winebiz. com . au

A S V O

Mildura Seminar just around the corner while Adelaide seminar planning under way to identify this year's 'hot topic' By Mardi Longbottom President, Australian Society of Viticulture and Oenology

egistrations are now open for this year’s ASVO Mildura seminar. The two international speakers - Dr Kendra Baumgartner, from the US, and Dr Vaughn Bell, from New Zealand - are expected to attract a strong audience of wine industry professionals from across Australia on 22-23 July. To maximise the opportunity provided by having such a group together, we have included more chances for networking by hosting a welcome reception, dinner and breakfast. Everyone attending is encouraged to take full advantage of these opportunities to meet the speakers in person and reconnect with friends and colleagues. For more information about the program, speakers and online booking visit https://asvomildura.wordpress.com/

ADELAIDE SEMINAR The ASVO board has started planning for the Adelaide seminar to be held at the Plant Research Centre, at Urrbrae, on Thursday 19 November 2015. The Adelaide seminar traditionally brings together the research and practical learnings from a ‘hot topic’ from the recent season. The seminar sub-committee, led by David Wollan, from Victoria, is currently surveying ASVO members to identify this year’s theme. The Adelaide seminar will be immediately followed by the annual Awards for Excellence dinner. A call for applications for the viticulturist and winemaker of the year will be announced in July. If you know someone who has made a significant contribution to the Australian wine industry in recent years,

tap them on the shoulder and encourage them to apply. 2016 TECHNICAL CONFERENCE AND TRADE EXHIBITION The 16th Australian Wine Industry Technical Conference and Trade Exhibition is returning to Adelaide in July 2016. The program will include esteemed local and international speakers, workshops, technical posters, an expansive trade exhibition and networking events. A call for workshop submissions and poster abstracts will take place in the coming months, and registrations will open in February 2016. Contact information and further details are available at http://www.awitc.com.au/

Incline Drainers

Four models -300, 500, 800, 1000mm

Additionally we tailor-make • Marc removal systems • Receiving bins • Stalk elevators • Belt conveyors • Whole bunch pressing conveyors • Storage tanks

Membrane Presses

4,500 ltr to 66,000 ltr tank capaciy Both closed and slotted shell presses

Destemmers/Crushers There are six models in our MC Series: · MC100 · MC250 · MC400 · MC600 · MC800 · MC1000

10–15 tonne/hr 25–30 tonne/hr 40–50 tonne/hr 50–60 tonne/hr 60–80 tonne/hr 80–100 tonne/hr

28-34 Neptune Terrace • Ottoway • South Australia 5013 Phone (08) 8447 3911 • Fax (08) 8447 1088 • Email fmc@fmiller.com.au For more information on our wide range of products visit www.fmiller.com.au

www.w i n eb i z .c om.au

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

Australian Products for Australian Wineries

Spotlight on Innovative Efficient Products for the Wine Industry

WVJ

V30N3

A G W A

Market development update: working together to build demand for Australian wine By Stuart Barclay, General Manager Market Development, Australian Grape and Wine Authority

ine Australia is inviting knowledge, insights and assistance to meet the needs of the wine community Australian wine companies, Australian wine companies wishing to as we partner with wine companies, regions and states to partner develop new markets for their wine and regions and states to deliver targeted with us to help grow demand for build existing markets. programs to engage with trade, media Australian wine through our market We have established networks and consumers. development activities. across the world’s trade channels, Our Market Program Guide for Launched in April, our Market media, wine educators and influencers, events from July 2015 was released Program Guide has an exciting and we work closely within these in April and includes 50 events and program of consumer activities where wine and trade events, retail companies, regions and From large-scale commercial activities for our global promotions, tastings and states can partner with masterclasses, trade us. From large-scale brands to specific activities for smaller regional events, educational commercial activities brands, the opportunities for investment are initiatives, advertorial for our global brands opportunities and to specific activities for intentionally varied to suit the diverse needs of our sommelier and trade smaller regional brands, sector. immersion activities. the opportunities for We are looking investment are intentionally to build on recent varied to suit the diverse improvements in Australian wine networks to deliver core events and needs of our sector. exports. In the 12 months to the end activities that reflect our market Our user-pays activities form an of March 2015, exports increased in strategy and benefit Australian wine essential component of our market volume to 711 million litres and in value producers. activities. They help to create to an average of A$2.60 per litre. These core events and activities opportunities for our wine sector Pleasingly, the increase in value include developing the insights partners to achieve greater reach reversed a seven-year decline while and knowledge base of the world’s with their marketing efforts, provide the volume was the highest since 2011. wine trade, media and consumers an equitable cost-effective approach Volumes increased in most price points through education and masterclasses; for our wine producers and state and and the strong growth in the higher communicating about the people, regional partners, and they remove price points contributed to the average places and stories about Australian barriers to entry for small producers. value of bottled exports increasing to wines; aligning Australian wine with a We have also introduced a structured $4.87 per litre, the highest since 2005. modern epicurean lifestyle; displaying and formal ‘market entry program’ These export results, together with and promoting a diverse portfolio of of activities that provide dedicated improving sentiment from trade and Australian wine at major trade and assistance to Australian wine brands consumers at recent international consumer events globally. wanting to enter new markets. events, provide an indication of We also build collaborative We design our user-pays activities changing sentiment in the international partnerships with like-minded to meet the needs of the wine markets that we are looking to harness organisations to develop joint community. Naturally, we are flexible and grow. business plans and build awareness, with the activities offered and we create understanding and demand for new activities to capture emerging CORE ACTIVITIES Australian wine. We work closely with opportunities and meet demand from Tourism Australia and state tourist the sector. We will be updating our Wine Australia’s role is to promote commissions to build international guide with new opportunities every the sale and consumption of Australian awareness of Australia’s fine food and quarter. wine internationally and domestically. wine culture. We also work closely To see how you can get involved in We support winemakers’ strategies and with Austrade to help the wine sector our activities and programs and be part underpin their efforts by promoting the capture export opportunities. of a collective effort to help maximise diversity of Australian wine through demand for Australian wine, view MARKET PROGRAM GUIDE market development initiatives in the Wine Australia Market Program Australia and overseas. Guide at www.wineaustralia.com/ Wine levies fund our in-market Two years ago, we introduced marketprograms presence in the US, Canada, UK, China user-pays activities to supplement our To sign up for more information and Australia and approximately 70 core activities and provide a vehicle to on the key market development core market development activities. amplify our in-market messages. Our activities, contact market.programs@ WVJ Our in-market staff provide local user-pays activities are designed to wineaustralia.com

V3 0N 3

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

NWE FWAS

Further cuts to the costs of shipping wine samples overseas on the cards By Tony Battaglene General Manager, Strategy and International Affairs, Winemakers’ Federation of Australia

Tony Battaglene recently returned from Europe where he represented the Australian wine sector at various international meetings, including the International Organisation of Wine and the Vine (OIV), World Wine Trade Group (WWTG) and the International Federation of Wine and Spirits - FIVS. In this article, he outlines some recent developments and future activities in the international wine trade including a major new initiative to enhance the movement of samples. WORK TO REMOVE BARRIERS AND IMPROVE TRADE OUTCOMES FOR AUSTRALIAN WINES The World Wine Trade Group (WWTG) is a group of industry and government representatives who share a mutual interest in facilitating the international trade in wine and overcoming obstacles. Along with Australia, members are Argentina, Canada, Chile, Georgia, New Zealand, South Africa and the United States of America. In recent years several countries have also attended the group’s meetings as observers, including (in alphabetical order) Brazil, China, Chinese Taipei, India, Japan (at industry level), Mexico, Moldova, the Philippines, Thailand, Uruguay, and Vietnam. Representation by the government sector is led by the Department of Foreign Affairs and Trade (DFAT) with support from the Department of Agriculture and the Australian Grape and Wine Authority. Australia's industry sector is represented by WFA. Industry sets the agenda and the government group negotiates the treaty-level agreements. Among key medium-term issues before us are: •

consideration of bilateral arrangements between the group and a particular market, such as China, as a means of encouraging deeper engagement on regulatory issues

•

reviewing and adopting common principles of good regulatory practice including methods of analysis

•

a maximum residue limit (MRL) working group to feed into work by the Asia-Pacific Economic Cooperation (APEC) on harmonising agri-chemical MRLs in the APEC region

www.w i n eb i z .c om.au

•

a watching brief and collective action on EU regulations

•

preparing material to contribute to the debate on ingredient and energy labelling

•

coordination of positions in the Codex Alimentarius Commission.

The World Wine Trade Group met in in Brussels from 30 April-1 May 2015 to make progress. In a joint session of government and industry representatives, updates were shared by members on regulations, trade barrier issues and trade negotiations. We also had a robust discussion about specific issues, particularly concerning European Union rules on traditional terms and standards for organic wine. The WWTG working group on pesticide MRLs provided a report on findings and recommendations. The European Commission’s Environment Directorate General provided an update on the Product Environmental Footprint pilot program. He explained the Commission was considering the applications for agricultural and food-related pilot projects. The motivation for this project was the large number of methodologies in the European Union across commodities and between sectors. Consumer surveys undertaken in Europe showed that 50% of consumers did not trust environmental claims. The European Union has issued ‘soft’ regulation requiring member states and private enterprises (e.g., retailers) to use the tool rather than other methodologies. In the future, the protocol will be integrated into different policy instruments including the Eco-labelling scheme, which is currently based on arbitrary factors.

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

FUTURE WORK The chair of the WWTG is appointed on a rotating basis and Australia has now assumed this role. Australia will also now host a meeting in Adelaide from 9-11 November 2015, followed by an APEC Wine Regulatory Forum meeting including a joint session. These meetings will include regulators and industry from more than 20 countries, giving the meeting an important opportunity to resolve international market access issues and facilitate wine trade. Key items for work are the development of an MOU between regulatory authorities to enhance future cooperation and combat counterfeiting and trade in fraudulent wine. We will also progress an agreement to facilitate the exchange of samples. This is especially prudent because of the heavy cost burden it places on exporters, leading to WWTG governments and industry coming together to try and find a way forward that will reduce this burden. It’s a standard practice within international trade in wine to ship small volumes not intended for sale to consumers (commercial samples) but rather for pouring at competitions, exhibitions or marketing activities in relation to product introductions, or even for destructive analytical testing purposes ahead of market entry. Although the recently signed WWTG Memorandum of Understanding on Certification has reduced some of the costs for shipping commercial wine samples, particularly among signatories, there’s still an unnecessary impost which can generate upwards of 790,000 days of delay time and US$41 million in document costs annually for wine traded into and from WWTG WVJ countries alone.

V30N3

K E Y

F I L E S

Little and large – what is the future of the cask and half bottles? By Tony Keys

he wine cask has reached its half century. It’s a notable milestone and its history has been well documented over the years in articles detailing the story of the late Thomas Angove, of Angove Family Winemakers, and his wine box invention. The figures for the amount of wine consumed via cask vary, but around one-third of all wine in Australia is poured from a cask. The wine cask is fascinating; many consider it ‘bogan thinking’, only the uneducated, poor or old drink wine from cask. Time for self-analysis. Do I buy cask wine? No. Why not? Because I get many samples of bottled wine but rarely samples of cask wine. Last year I did receive samples of the Winesmiths cask wines and they showed very well in tasting. I did drink them after tasting and shared many with friends, all of whom were impressed but confused why somebody such as I with access to so many good bottled wines would provide a cask. The casks were shared so I could observe the reaction, which turned out to be predictable. Friends were surprised I would drink cask and then surprised again the wine in cask was of such good quality. This is a story that several who scribe about wine have written about before. Cask wine has got better and consumer perception towards it is slowly changing.

…the limited research I have carried out shows size is important, as is the varietal. It appears there is a 'no-way' reaction to drinking a five-litre dry white, red or fruity Gordo. That is considered very down market, but it’s a 'yes' to a two-litre Sauvignon Blanc, Cabernet, Merlot or Pinot Grigio. My own limited research has found some friends are happy to have a good two-litre cask of white in the fridge and a red in the kitchen cupboard, but only for private home consumption. When guests arrive bottled wine is brought out. Taking a segue, the slow acceptance of cask wine that is taking place amongst the middle class is the same as those middle classes now boasting about the $5 bottle of Spanish wine they buy from Aldi. All that is needed is for the cask to bridge the invisible gap between soberness and acceptance. It is the modern way to boast how the fantastic wine bargain was found, making the finder a hero amongst their social circle. Again, the limited research I have carried out shows size is important, as is the varietal. It appears there is a 'no-way' reaction to drinking a five-litre dry white, red or fruity Gordo. That is considered very down market, but it’s a 'yes' to a twolitre Sauvignon Blanc, Cabernet, Merlot or Pinot Grigio. Presentation is important and Australia has been slow with innovation and design. Looking at a selection of casks available at Dan Murphy’s, several five-litre casks are not only cheap in price, they also look cheap (personal opinion). The two-litre offerings look smarter, although they remain the standard brick shape. Only Brown Brothers has a bag inside a

V3 0N 3

box that is crafted to look like a designer handbag. The Americans came later to boxed wine but have taken to it with gusto in the past five years. It’s said to now represent around 17.5% of US consumption. In the 52 weeks to 22 February 2015, premium boxed wines increased 11% in volume and 14% in value, according to market research company IRI. It appears the US has a preference for three-litre boxes. In April this year Gallo entered the market with Pinot Noir and Chardonnay in three-litre casks under the Vin Vault brand. Unfortunately, it looks as if the more interesting three-litre wines in the US originate from France. Accolade Wines has released a selection of cask wines under the collective name of Magnum. It’s a clever idea. The cask is equivalent to two 750mL bottles (hence the name) and fits within current brands such as Houghton, Brookland Valley or Riddoch. Not only is the packaging smart, so is the retail approach as the plan is for the cask to sit on the shelf next to the bottles. It’s another stepping stone to full cask acceptance further up the social scale. At the other end of the scale Accolade Wines says little is happening with 18.75cl (187.5mL) bottles other than for airline business. Accolade reported sales of its wines in small bottles ▶ in the UK, both in glass and PET, is in decline.

Manage Brettanomyces bruxellensis in-house

Proactively test for and manage BRETT, using Veriflow technology - bringing same-day analysis to your vineyard “Game Changer In The Vineyard: Streamline The Process With Molecular Diagnostics” - Forbes magazine

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

Results in

HOURS

Talk to AMSL Scientific today about BRETT risk management. P 02 9882 3666

W www.amsl.com.au

www.wine biz. com . au

K E Y

F I L E S

Based on our own internal research, we’ve found that the traditional 750mL offering can act as a barrier to consumption; only one-third of wine drinkers consume a full bottle on a typical occasion and twothirds do not finish the whole bottle. - Treasury Wine Estates Treasury Wine Estates (TWE) has a similar story domestically; sales volumes have been steady year on year across several brands which use one or more of these smaller formats,e.g., Lindemans, Matua, Wolf Blass Red Label and Yellow Label, and Yellowglen. A spokesperson for TWE said: “We pack the 18.75cl mainly for customers such as airlines, and the piccolos (20cl sparkling) are popular off-premise. Sales of 37.5cl (375mL half bottles) have also been steady over recent years. “Based on our own internal research, we’ve found that the traditional 750mL offering can act as a barrier to consumption; only one-third of wine drinkers consume a full bottle on a typical occasion and two-thirds do not finish the whole bottle. “Therefore, smaller pack formats open up wine to more occasions as it removes a potential barrier to consumption; we see growth potential in smaller formats and we’re continuing to research alternative packaging options." Yet, reports from the UK say sales for small bottles of wine are on the increase. In an article by The Guardian consumer affairs correspondent Rebecca Smithers, dated 16 March 2015: “Sales of mini bottles of wine containing single servings have soared as health-conscious consumers seek to rein in the amount of alcohol they drink, supermarkets are reporting.” Smithers reports UK supermarket Tesco has sold almost one million more

units of 18.75cl in the past year (up 10%) and Sainsbury’s have increased sales by 21%. Although health is put forward as a major reason and portion control as another, sales of smaller bottles in the UK are really being driven by piccolos sales of Prosecco. Pernod Ricard Winemakers produces a number of small format wines from various brands including the Australian Jacobs’ Creek and Wyndham Estate brands. The range also includes Brancott Estate, from New Zealand, and the Spanish Campo Viejo brand. These are available across a number of different markets and formats, including 18.75cl, 20cl, 25cl and 37.5cl, with 18.75cl seeing the most shipments globally. The domestic and UK markets are the largest with the UK seeing strong growth via the 18.75cl Campo Viejo Tempranillo, which recorded growth of 135.6% according to Nielsen UK Grocery Multiples in the 52 weeks to 3 January 2015. The UK is also the hot spot for 18.75cl, with Brancott Estate Sauvignon Blanc showing growth of 67.6% in the Nielsen figures. Jacob’s Creek Sparkling Rosé 18.75cl is the bestselling New World sparkling wine in the UK, growing at 15% in that market. As TWE said, its research shows two-thirds of wine drinkers do not finish the full bottle but is that enough reason to invest in smaller bottles? Opened bottles of red or white wines will survive well in a fridge for two or three days, so it appears there is little reason to buy quarter bottles unless it’s

some form of consumption self-control. Further from Rebecca Smithers: “A 25cl bottle of Marks & Spencer Petit Chablis, for example, will set shoppers back £5, compared with the standard 75cl bottle for £10. But retailers say that a wider range of good quality wines in smaller sizes has given consumers more choice while allowing them to exercise restraint.” Tesco wine buyer Ami Harmer also comes up with health as being a reason for increased sales, saying people are putting more thought into the amount of consumption. As yet, research hasn’t been produced or I have not found any showing that smaller bottles are a positive for reducing consumption. What I have found is people like to drink piccolos in bars, and bars like to sell them. For the consumer it means fresh bubbly wine, and for the bar it means full bottles of sparkling wine are not going flat once opened, resulting in customer complaint. It’s estimated there are around 10 million 1.85cl units of Australian wine produced annually for the domestic market. A lot goes to domestic airlines. The next bracket up includes piccolos and is much larger, estimated around 34.6 million units. The leading brands on the domestic market are produced by Jacob’s Creek but Yellow Tail is up there, as is Brancott Estate Classic Marlborough Sauvignon Blanc. Wine packed in either casks or small bottles have a future but, as yet, it’s not clearly defined.

Wine industry commentator Tony Keys has spent more than 30 years in the wine industry including the retail sector in the UK and roles with the Australian Wine Export Council and the Australian Wine Bureau in London. He is author of The Key Report, a weekly report containing news, views, analysis and opinions on the wine industry: WVJ www.thekeyreport.com.au

2015 Edition OUT NOW PRINT & ONLINE Acess via www.winebiz.com.au/widonline

New 2015! Wine Bloggers

To order your copy - Phone: + 618 8369 9516 Email: orders@winetitles.com.au Visit: www.winebiz.com.au

www.w i n eb i z .c om.au

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

PROVEN CRUSHING AND PRESSING TECHNOLOGY.

Della Toffola has over 50 years of experience in winemaking technology and equipment. With an emphasis on innovation, our extensive range includes crushers-destemmers, pumps, presses, flotation systems, filters, storage, stabilisation, refrigeration and fermentation equipment. Our NDC range of crusher-destemmers ensure a delicate separation of the berry from the stems, combined with a gentle crushing action. Wineries enjoying superior and efficient throughput include Barossa Valleyâ&#x20AC;&#x2122;s Wine Wise facility and Marlboroughâ&#x20AC;&#x2122;s modern large-scale VinLink winery. Or just ask the team at NZ Wineries who upgraded their old pressing regime, and managed to process half of Vintage 2014 through three new Della Toffola presses.

www.dtpacific.com | info@dtpacific.com | + 61 3 9924-4040 | @DellaToffolaPac

WINEMAKING

GRAPE/JUICE HANDLING

Whole bunch fermentation: a wild card inclusion in red winemaking By Cathy Howard

The inclusion of whole bunches in red wine ferments has become a fashionable winemaking tool for those seeking elegance over power. But the various techniques for carrying out whole bunch fermentations, the variability of stem ripeness, vintage-to-vintage variations, and vineyard-to-vineyard differences create a complex matrix of factors liable to result in different flavours in the final wine.

t seems that the circle has turned again with another winemaking practice. Winemakers across the globe are seeking out ‘new’ techniques to improve the quality and complexity of their wines to enhance varietal and site-specific characteristics and, ultimately, to create an edge, a point of difference for their wine over others in the marketplace, or quite simply, they are passionate about making the best wine that they possibly can each year. There are many winemaking techniques being practised now that were once regarded as outmoded practices, and including stems in red wine ferments is one that is being more talked about now than it was 10 or even five years ago. Whole bunch (or whole cluster) inclusion into red wine ferments is now becoming a fashionable winemaking tool for those seeking elegance over power. WHAT IS WHOLE BUNCH INCLUSION FOR FERMENTATION? Whole bunch fermentation is the inclusion of the entire grape cluster into the fermentation vessel, bypassing the destemmer/crusher. Since mechanical harvesters and destemmer/crushers have only existed for about 50 years, historically speaking all red wines prior to the introduction of these pieces of vineyard and winery equipment would have been fermented as whole bunches. The technique has its origins in traditional French wines of Burgundy and the Rhone Valley. The northernmost Rhone area, Côte- Rôtie, is defined by powerful Shiraz made using whole bunch fermentations of varying percentages, which are

www.w i n eb i z .c om.au

Whole bunches of Shiraz are loaded into an open fermenter at Clonakilla, in the Canberra region.

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

ARDS AW

WISA SU P

OF THE YE AR IER PL

WINNER 2014

WINEMAKING

GRAPE/JUICE HANDLING

... many of the most complex, fascinating and charming Australian Pinots include a well-judged (read subtle) quantity of stalks in the ferment. - Huon Hooke also sometimes co-fermented with Viognier. Further south are the AOCs of Hermitage, Cornas, and St. Joseph, all producing Shiraz. Stem inclusion depends more on the producer’s style rather than on tradition. On average, Côte-Rôtie wines have around 30% whole cluster, although some wines reach as much as 100%, which is the case for the La Landonne wine from E. Guigal. In regions like Cornas and Hermitage, stem inclusion is not as commonplace. In the Southern Rhone, there are more producers using whole cluster fermentation, and it seems that there are those that are converting to it after years of de-stemming their grapes. Burgundy has an interesting history with using whole bunch fermentation, and has been centred around the influence of one person, Henri Jayer, of premier cru Cros Parantoux, who said, “Stems, stems! Why would you ever use stems? We never have ripe stems in Burgundy!” Pinot Noir is a relatively low-tannin grape variety and, therefore, can lack the broader, silky mouthfeel and additional length that tannins provide in other red varieties. Stem inclusion will bring additional tannin to the ferment, but they can introduce herbaceous, green-vegetative characteristics and create astringency on the palate. Jayer influenced many to move away from using whole

[]

2 1 Presses In

bunch inclusion and the popularity of destemming across the region was linked with a corresponding reduction in sappy, green characters in many red Burgundies, so there was a good reason for doing it. In Burgundy now, there is a tendency to move back towards including stems. This is partly attributed to the passing of Henri Jayer, and partly attributed to global warming, with the stems now more often riper than they used to be. Whole bunch inclusion in ferments is quite controversial, and can divide winemakers and wine writers. In an article by Huon Hooke in the Sydney Morning Herald in 2011, 'The stalk delivers', Hooke refers to an article by stalk-hater Richard Jennings in which Jennings says (see www.cellartracker.com/ event.asp?iEvent=15061): ‘’What possesses [winemakers] to take a beautiful ingredient and obscure its deliciousness with extraneous flavours taken from much lesser material?’’ "In the winemakers defence," says Hooke, "I would reply that many of the most complex, fascinating and charming Australian Pinots include a well-judged (read subtle) quantity of stalks in the ferment.” Hooke continues: “When specialist Burgundy scribe Allen Meadows asked famous winemaker Henri Jayer (a stalk man) if he’d ever enjoyed chewing on a grape stalk, Jayer replied no. But had Meadows ever enjoyed chewing on a piece of oak barrel? It doesn’t mean it can’t add something interesting to the wine and, anyway, neither stalks nor oak become a part of the wine, they simply have contact with it for a time. In a sense, stalks are like oak: too much is bad and neither should dominate but, if sensitively used, both can add something”. It seems then that the use of whole bunches in fermentation can be a bit of a wild card depending on site and vintage. When it works well, it delivers incredibly complex aromatics and flavours. Aromas and flavours have been described as clean

It quickly converts from an If you’re looking open press to a closed press for a new press, offering complete versatility the smart choice in varietal and stylistic winemaking is the new Europress S It has unique detachable drains on the style press outside that turns the closed press into an open press, in just 20 minutes. The external drains allow faster press cycles and makes cleaning very quick, thorough, and safe. Take a look at the benefits and features offered by the smart Europress range. Call Grapeworks for further information.

National 03 9555 5500 SA & WA Sales 0401 560 550 Email info@grapeworks.com.au

Scharfenberger

www.grapeworks.com.au

Maschinenbau

WVJ

www.w i n eb i z .c om.au

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

Transforming every bottle...

...into exceptional design Innovative design. Premium disposition. Cutting edge and unique. The Vinolok glass closure adds sophistication and elegance to any wine. With a range of ďŹ nishes, from clear, frosted and coloured glass to metal coatings, crystals and ornaments, Vinolok will ensure your packaging stands out from the rest!

...with quality and reliability Smallest of Volumes. Greater Flexibility. Colcap can meet your needs by oďŹ&#x20AC;ering printed screw caps of exceptional quality and fast turnaround. Minimum order quantities of 1,200 or multiples thereof.

AUS: +61 2 9700 7666 | sales@columbit.com.au | www.columbit.com.au NZ: +64 9 274 5278 | sales@columbit.co.nz | www.columbit.co.nz

Complex

Technically perfect sparkling wine cork.... Just ask the winemakers and even the critics.... As you know, I have been writing on the science of closures actively for more than a decade, and most recently in my focus on sparkling wines. I’m currently in the midst of reviewing wines for the Halliday Companion (James has appointed me his exclusive sparkling reviewer) and my (large) bin of corks currently contains more DIAMs than natural corks! In my instructions to winemakers sending samples for the Halliday Companion or The Champagne Guide, I request them to include: •

Two bottles of each cuvée (natural cork seals)

•

One bottle of each cuvée (crown seal or DIAM)

This is a statement of my faith in the reliability of crown seals and DIAM closures. Tyson Stelzer,

Black BG

Multi Award Winning Wine Writer, annual readership of 4,000,000 globally Author & Publisher of 13 wine books and a universally respected Wine Closure Scientist Author of The Champagne Guide 2014-2015 Winner Best Wine Book of the Year

“At Grant Burge Wines we use DIAM exclusively in our Icon and Sparkling wines and could not be happier with the faultless results. DIAM gives me the opportunity to present my wines knowing they will be in pristine condition, consistent and without any closure derived modification. “DIAM offers winemakers and marketers a fantastic closure option, and I have no hesitation in recommending this product.” Craig Stansborough, Chief Winemaker, Grant Burge Wines

Reverse Colour

“Producers spend billions globally trying to recruit new customers, and it’s no big secret that keeping a customer is cheaper than recruiting a new one. Consumers rarely understand that a wine is faulty and frequently just put it down to the wine being just ‘not as good as it used to be.’ The difficulty is that the producer will never hear that, and therefore can’t do anything about it. They just lose the customer. Bottle variation is a hidden cost.” James Gabbani Wines & Vines

“At Wines by Geoff Hardy we have been using DIAM cork in our premium red and sparkling wines since 2005. Through continued innovation and development DIAM have now released the new DIAM 30 which is guaranteed for long term cellar maturation of 30+ years. A guarantee that removes the stress surrounding cork selection for our premium wines. This long term view adds significant value to our relationship and confidence with DIAM as our premium closure of choice. It’s a beautiful thing knowing I can open a bottle of our wine at anytime, anywhere around the world and be guaranteed of a sensorially neutral closure that provides consistency in seal and respects the aromatic profile of each wine from bottle to bottle”

“The experience of one bad bottle can cancel out several good ones in a consumer’s mind, and the winery almost never gets feedback about it”. Jim Gordon Editor W&V USA "DIAM closures have undergone the most rigorous technical trials in the industry. The results have been nothing but positive and we remain committed to the DIAM closure." Andrew Gale, Technical Category Manager (Tesco)

“DIAM is the perfect closure for Sparkling!”

“In 2003 we swapped from natural cork to DIAM. Before then, we had a real issue with spoilage due to cork taint. Since then we have used over 700,000 DIAM closures – for table wine and sparkling wine - with not one complaint or recorded case of spoilage. Our endorsement of the product is unqualified.”

Lucy Cléments, Winemaker, Sainsbury’s Supermarkets (England)

John Ellis, Winemaker/Owner/experienced Show Judge, Hanging Rock Wines, Macedon

Shane Harris, Winemaker & Brand Ambassador Wines by Geoff Hardy.

by Vinocor =

NO TAINT NO FLAT WINE NO BOTTLE VARIATION NO COMPLAINTS NO LOSS OF CUSTOMERS NO PROBLEMS.

Anything else is a compromise. For more details - Phone. +61 8 8392 9999 | Fax. +61 8 8392 9990 | Email. info@vinocor.com.au | Visit. www.vinocor.com.au

GRAPE/JUICE HANDLING

WINEMAKING

the carbonic maceration aroma character. This is generally most obvious at pressing when it is mostly released into the surrounding wine. “The second aspect is thought to be minor, even insignificant from a sensory point of view. While stems can have higher tannin concentrations than berries, there is little evidence that it is actually extracted under winemaking conditions. In fermentations with dry, woody stems, there can be a herbaceous aroma contributed, even a black tea or cedar character. The trials of stem additions that resulted in the tea and cedar character were when stems which had been removed from the berries were added back and not whole cluster fermentations as such.” I also came across a multitude of comments and opinions from winemakers across the winemaking world, many in the US, France and Australia, and I have included some of the more notable, thought-provoking ones:

The contributions of whole cluster fermentation are at least due to two aspects: the intact berry aspect of the whole cluster, and the extraction and adsorption properties of the stems. - Roger Boulton, UC Davis earth, green tobacco, unlit cigar tobacco, spicy, heady florals ‘like lilac and rose petal’, black or white pepper and snap peas. Sometimes even cologne or agave. The unpredictability of whole cluster fermentation can yield a negative result, with the wine being herbaceous vegetate and green. It is a technique not used with every red variety. It is most commonly associated with Pinot Noir and Shiraz. Cabernet Sauvignon, Cabernet Franc and Merlot all share a degree of greenness in their varietal flavour signature, something that most winemakers will seek to minimise and won’t want to risk exaggerating by including stems. In researching for this article, I came across a quote from Roger Boulton, Professor of Enology and Chemical Engineering, University of California, Davis: “The contributions of whole cluster fermentation are at least due to two aspects: the intact berry aspect of the whole cluster, and the extraction and adsorption properties of the stems. The first would be similar to that of whole berry effects, which make small contributions normally seen in carbonic maceration. The berry cells undergo a biochemical modification internally, partly fermentation-like, but with significant modification of monomeric phenols that results in

• [In a warm climate], the wines are going to be robust. That’s the terroir speaking, but you can still aim for freshness, a bit of brightness of fruit, more elegance on the palate. This is one of the reasons why there is so much interest in whole bunch fermentation at the moment. • Stem inclusion is seen as a way to achieve freshness in a wine • The state of ripeness of the stems is important. This is determined primarily by the vineyard site, with vintage variation playing a role • The riper the stems, the spicier the flavours. The greener ▶ the stems, the more herbaceous the wine can become

Fla vy FX

Cross Flow Filtration of Wine AND Juice Lees

The solution “2 in 1” to filter all year around

BEFORE

AFTER

The FX filter is able to filter wine and juice lees efficiently with a range of sizes to suit small and large wineries. The operation is simple and reliable. The FX filters and washes automatically with minimal supervision. The quality of the filtered juice lees is excellent with no oxidation nor dilution in the process. A network of regional Bucher Vaslin Dealership provides reliable local technical support for advice and maintenance.

Our regional dealership WA SWAT - Tel. 08 9755 5766

VIC / TAS Vinvicta - Tel. 1300 360 353

SA / NSW / QLD Wine Energy - Tel. 0407 400 728

NZ Viniquip - Tel. 06 879 7799 Tradetech - Tel. 03 577 9849

www.buchervaslin.com Your success is our priority

WINEMAKING

GRAPE/JUICE HANDLING

• When our fruit is starting to ripen, I taste the stems on a regular basis. I find that they hit a point where the tannic harshness disappears and is replaced by a pleasant smooth flavour • In some warmer regions with a shorter ripening time, the stems may still be very green at harvest and, thus, unsuitable for inclusion at all • Whole bunch inclusion does not work well from younger vineyards with bigger clusters • There is a difference between just adding stems back, and doing a percentage of whole cluster. The whole cluster brings a dimension of carbonic fermentation to the resulting wine • An element of carbonic maceration is an important part of whole bunch ferments, and is likely to contribute significantly to the enhanced texture and aromatics often seen in wines made by whole bunch fermentation • If using large red fermentation tanks, it is impossible to keep the stems. Whole bunch ferments are harder to punch down • Whole cluster fermentation affects the tannin structure. It can be a subtle effect or quite grippy. When used as a blending component it can work well concerning texture • When you add stems to a wine, you increase the pH and decrease the TA compared with a completely de-stemmed wine • Region and vintage are the deciding factors. There are some regions where stems do seem to retain an aggressive green character and, therefore, it is difficult to do much whole cluster. By the same token, there are regions that seem to benefit dramatically from a percentage of whole cluster as the added complexity really changes the wine • A high stalk content in the ferment results in a wine that smells peppery, dusty and vegetal. At a low level, say 25%, stems contribute extra aroma and flavour complexity without dominating • High stalk-inclusion wines tend to quickly change after a year or two’s age, morphing from green-herbal to a more foresty, undergrowth or sweet-tobacco scent that can be very appealing. TECHNIQUES INVOLVED IN WHOLE BUNCH FERMENTATION

For further information, please contact Kauri NZ Tel: 0800 KAURIWINE NZ Fax: 04 910 7415 Email: winery@kauri.co.nz

www.w i n eb i z .c om.au

AUS Tel: 1800 127 611 AUS Fax: 1800 127 609 Website: www.kauriwine.com

There are many different ways of doing whole bunch fermentations. Combine these different techniques with the variability in the state of ripeness of the stems, the vintageto-vintage variations, and vineyard-to-vineyard differences, and it creates a complex matrix of factors liable to result in different flavours in the final wine. Percentages of whole bunches included in ferments vary widely around the globe, from 0.5% up to 100%, and in one instance that I came across, even 110%. In his blog, ‘A whole bunch of action at the Yarra Valley Wine Program in September 2011’, Jeremy Pringle stated: “De Bortoli’s Reserve Syrah 2010 (a damn good wine)

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

GRAPE/JUICE HANDLING

presented as the most obviously stemmy wine in the line up at around 70% whole bunches used, yet the Jamsheed Silvan Syrah 2010 and the Punt Road Chemin Syrah 2010 used 100% whole bunches.” Pringle continues later in his blog: “For the record Gary Mills spoke about adapting the percentage of whole bunches depending on the vineyard in question – thus you’ve got 60% in the 2010 Healesville Syrah, 100% in the ’10 Silvan and 50% in the ’10 Garden Gully. Timo Mayer (Mayer Wines) talked about stem inclusion in reference to Pinot. He uses it to add savouriness if the fruit from a vineyard is a little too rich or sweet”. Huon Hooke (Sydney Morning Herald 2011, ‘The stalk delivers’) states: “The Farr family …. Pinots range from 100% stalks with the flagship Tout Pres to 40% with Farr Rising. The Shiraz has been reduced to 25%. "The main purpose is to keep the berries as whole as possible for as long as possible, to release their sugar slowly into the fermentation,' says winemaker Nick Farr. 'This gives more gamey, earthy, foresty characters and creates structure, length and savouriness. The wines are always tighter, less fruit-forward and never as open as 100% destemmed wines." "He agrees they can sometimes taste too vegetal when young but even a year or two in the bottle transforms this into more attractive complexities." There are several ways that whole bunches are added to fermentation vessels if you don’t use all stems. •

added first to the empty tank, then the destemmed grapes on top

WINEMAKING

•

added last, so the stems are punched down through the fermenting juice

•

or added in layers, lasagne-like, with a layer of whole bunches, followed by a layer of destemmed, then another layer of whole bunches, and so on.

There are several notable Australian winemakers who have been using whole bunch inclusion to varying degrees in their red ferments for a number of years with great success, such as Tim Kirk, at Clonakilla, who started using whole bunch inclusion in his Shiraz and Pinot Noir ferments in 1993. The practice has found a home in the cooler parts of Victoria with winemakers such as Dave Bicknell, of Oakridge; William Downie, Luke Lambert, Gary Mills, of Jamsheed; Rory Lane, of The Story; and Steve Webber, of De Bortoli. It was Gary Farr of Wines By Farr, in Bannockburn, Victoria, who pioneered extensive stalk usage in this country. He and his son Nick, whose labels include Farr Rising, still wander the limits with stalks to produce Pinot Noir. There are others who have been trialling the technique for the past few years with mixed results, such as Tom Carson, at Yabby Lake. TIM KIRK, CHIEF WINEMAKER AND CHIEF EXECUTIVE, CLONAKILLA WINES In 1993, Tim Kirk started using whole bunch fermentation at Clonakilla. He drew his inspiration for initially using the technique from his passionate interest in the Shiraz and Pinot Noir wines of the Rhone Valley and Burgundy. He had read and tasted widely, and had became quite passionate about making

The Pacifix Muselet • Plain plaque • Printed plaque • Plaqueless • Plain or coloured wire • Fast delivery • Precision component • Australian made Proudly made in Australia by D.J. Young Pty Ltd 710 High Street Kew East VIC 3102 Telephone: +61 3 9859 4468 Fax +61 3 9819 7357 e-mail: production@pacifix.com.au

www.pacifix.com.au V3 0N 3

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

WINEMAKING

GRAPE/JUICE HANDLING

his wines, following many of their traditional techniques which included whole bunch fermentation, as well as co-fermenting his Shiraz with Viognier. “In 1993, we used 30% whole bunch inclusion, and followed up in 1994, a frost-affected year with a much lighter crop level, with 100% whole bunch. In contrast, in 2011, a cool and wet year, we did not use any whole bunch inclusion as I did not want to risk the wines having any form of greenness, and instead wanted to highlight genuine grape ripeness. The stalks were also the neon green in colour too, presenting a much higher likelihood of green herbaceous characters dominating in the final wines which was undesirable”. The percentage of whole bunch used varies from year to year, from vineyard batch to vineyard batch, and is usually between 20-35% (the average is 30%). Kirk continued: “This is fairly consistent from year to year. We make around 20 fermentation batches each vintage. All are fermented in open-topped two to four-tonne fermenters, and we keep the various clones and vineyard sections separate from vineyard through to blending for bottling”. Kirk added that he does do the odd 100% whole bunch ferment, which happened this vintage, and this gives him valuable blending options down the track. The extent of stalk lignification is not as important to Kirk as vintage and vineyard site effects. He harvests when the grapes are at their best, and doesn’t wait for the stalks to lignify. Clonakilla’s Shiraz, Shiraz Viognier and Pinot Noir wines all have a portion of whole bunch inclusion on ferment. Kirk adds the whole bunch portion first into the open fermenter, then lays the destemmed (not crushed) portion on top. Standard time on skins is three weeks, with manual plunging of caps carried out daily. Plunging is reasonably easy to do throughout ferment. He sees very little carbonic maceration character in his wines, although come pressing time, there are some whole intact berries remaining on the stalks, so there would be some cellular fermentation happening within these berries. It is definitely not an obvious, overt carbonic maceration aroma or flavour. It would nonetheless be adding to the overall complexity of the wine. Kirk sees the main benefit of using whole bunch inclusion as a means of fully capturing the essence of the vineyard. Stem inclusion adds a subtle complexity to the resulting wines, and the character is not dominant. After using the technique for more than 20 years, he finds it suits his grapes beautifully, and is consistently in balance with his wines. The stem inclusion characters (tannins and flavours) are woven into the tapestry of each of his wines, and sit comfortably in the background, lifting the pure, fruit character of a particular block and enhancing the quality of the final blended wine. Kirk concluded: “Whole bunch adds something, it enhances the beauty and site-specific characters of my grapes, and is a counterpoint to the wine. I also think that whole bunch inclusion is better suited to cooler climates.” TOM CARSON, WINEMAKER AND GENERAL MANAGER, YABBY LAKE VINEYARD Carson’s first experiences with whole bunch inclusion were in 1991, during his last year at Roseworthy, undertaking his vintage experience with Tim Knappstein. They were experimenting with the Lenswood Pinot Noir, using different levels of whole bunches on ferment. The trials had come about as it was a widely used technique in Burgundy and with other top Pinot Noir makers at that time. Carson uses whole bunch inclusion on, “Pinot Noir mainly, we use a tiny bit with Shiraz but limit it to under 10%. I find with Shiraz that it tends to highlight the green vegetative stalk

www.w i n eb i z .c om.au

Plunging whole bunch ferments at Clonakilla. characters and can easily dominate the flavour profile. It can also strip some of the richness of Shiraz and reduce the palate to a leaner profile”. Yabby Lake hand picks all of its blocks and, as Carson says, the decision as to how much whole bunch will be included comes down to: “We use it as we see fit with particular clones and sections of the vineyard. It is highly vintage dependant as to how much we use”. Carson continued: “We use whole bunch inclusion mostly with Pinot Noir, up to 30%. The percentage we use is highly dependant on the vintage, then clone, then block. For example, in 2011 we used it sparingly, less than 5%. In 2012, 2013 and 2015, up to 25%, and in 2014 it was less than 15%. It is a combination of fruit condition, i.e., set and stalk condition, and the potential quality of the vintage. The higher the quality of the vintage, the more we use, so we look to assess potential early in the vintage by examining colour, structure, and density of the early batches. If we like what we see, we go higher on

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

GRAPE/JUICE HANDLING

the percentage of whole bunch inclusion. If the vintage seems lighter, cooler and stalk condition and fruit density is lower, we hold back.” With partial whole bunch inclusion, Carson places whole bunches in the fermenters first, then crushes over the top. “Some batches we use 100% whole bunch and we crush a small amount on the bottom, to assist with the commencement of the fermentation, and then place the whole bunches on top.” For Carson, the main benefits of using whole bunch inclusion is perfume and fragrance, then added savoury tannins and palate length. The influence of carbonic maceration is also very important as this adds the fragrance and perfume characters to the wine. Carson uses an intuitive approach to when and how much whole bunch to use, based on his own experiences. “For us there is a no-recipe approach to whole bunch usage.” MARK HAISMA, MICRONEGOCIANT IN BURGUNDY AND NORTHERN RHONE Mark Haisma was at Yarra Yering for 10 years from 1999 to 2009, and is now a micronegociant in Burgundy, and is also making a wine in Cornas. While at Yarra Yering working with Dr Bailey Carrodus, he was introduced to the whole bunch inclusion concept for red ferments. Carrodus was the one who first introduced Haisma to the basket method. Haisma continued: “We were using a few different methods, but never whole bunch. We were just adding stalks back to the ferment after the destemmer. The basket method enabled us to remove the stalks when we felt we had the desired effect. We often trialled the same batch as three separate ferments: no stalks, stalks added back, and stalks added back in baskets. Normally the last method (using the basket) was used for the ferment we wanted to have longer macerations.” Haisma’s whole bunch experiences started once he commenced making his own wines in Burgundy and Cornas. Haisma said: “In Cornas, especially, I am using a lot of whole bunch. However, it is very much dependant on the year, as well as the fruit, the specific site and, more importantly, my mood! I will use whole bunch in different proportions. Too often I hear people saying 'we are a whole bunch people’, but in years where it doesn’t merit it, the results I find are unbalanced. For me, it’s a useful technique and an aid for vinification to best suit my wines. I like what it does to the texture of the wine and I like that it helps me control the speed of fermentation. (The cap doesn’t tend to get as hot as with destemmed grapes as the gaps within the bunches in the cap allow for heat to escape)." Haisma continued: “It is a great way to build loads of complexity and savoury characters, and still keep a lush, creamy feel to the palate. I think of velvet. This is especially noticeable with my Cornas. As for Burgundy, it’s all about the complexity and finesse.” Haisma concluded by saying: “Carbonic maceration for me implies a more prolonged soak on skins before fermentation starts. I don’t really get that, as my ferments start cool, but get started within 48 to 60 hours”.

WINEMAKING

vintage and vineyard variations. A quote I came across summed it up beautifully: “One winemaker’s whole bunch triumph is another winemaker’s green garden atrocity”. The benefits of whole bunch inclusion are summed up by Jamie Goode in his Wine Anorak blog: ‘Whole bunches and stems in red winemaking: “Frequently cited as a benefit of whole bunch is the enhanced aromatic expression of the wine, and it’s common to find an elevated, sappy green, floral edge to the pronounced fruity aromas which is really attractive. Freshness is another positive attribute associated with whole bunch. Done well, whole cluster can help make wines that are more elegant than their totally destemmed counterparts. I would add that whole bunch wines sometimes start out with distinctive flavours and aromas that can be a little surprising, but these often resolve nicely with time in bottle”. Then there are the negatives. Stem inclusion can be quite unpleasant for many tasters if it is a dominant character in a wine, unbalanced with overriding herbal, stemmy and vegetative characters. Getting the balance right, and using the whole bunch inclusion technique to achieve the best results comes from a carefully planned and trialled practice with your own fruit, getting to know what suits and doesn’t suit your vineyard sections, and adapting the amounts of whole bunch included from vintage to vintage. In conclusion, the end result of whole bunch fermentation when done well are wide ranging, dynamic and reflective of the region, vintage and percentage of whole bunch used.

Cathy Howard is winemaker and, together with husband Neil, proprietor of Whicher Ridge Wines, near Busselton Western Australia, and has been making wine for more than 20 years. She also consults part time to some wineries in the WVJ Geographe region.

Your Vineyard Your Voice

Do you care about the future of winegrape growing? With your support we: • Improve market conditions for winegrapes • Provide a national grower voice in industry debates • Lobby the commonwealth government • Facilitate industry biosecurity arrangements • Provide services to help run your vineyard more effectively.

Join now!

CONCLUSIONS To include whole bunches in a ferment or not is a controversial topic for many, and there are wide and varying opinions on the technique. The use of whole clusters in fermentation can be a bit of a wild card depending on site and vintage, if not used wisely and judiciously taking into account

Visit www.wgga.com.au or phone 08 8133 4400

WINEMAKING

M I C R O - O X Y G E N AT I O N

Micro-oxygenation and its impact on polyphenols and sensory characteristics of Pinot Noir By Dominik Durner1, 2, Patrick Nickolaus1 and Hai-Linh Trieu1 1 Dienstleistungszentrum Ländlicher Raum Rheinpfalz, Competence Center for Wine Research, Breitenweg 71, 67435 Neustadt/ Weinstrasse, Germany 2 University of Applied Sciences Kaiserslautern, Department of Applied Logistics and Polymer Sciences, Carl-Schurz-Str. 10, 66953 Pirmasens, Germany

Researchers investigated how phenolic and other oxygen-induced compounds in a 2013 Pinot Noir evolved during micro-oxygenation and examined the sensory impact of different oxygen dosages. INTRODUCTION The continuous addition of measured amounts of oxygen, referred to as micro-oxygenation (MOX), is a widely applied technique to promote greater colour and balanced tannicity of red wines. This study focussed on the evolution of phenolic and other oxygen-induced compounds during MOX of a 2013 Pinot Noir and examined the sensory impact of different oxygen dosages. EVOLUTION OF COLOUR AND ANTHOCYANINS DURING WINEMAKING AND MATURATION The evolution of red wine colour is subject to dramatic changes throughout the vinification process. During alcoholic fermentation (AF) a high proportion of anthocyanins gets lost due to adsorption by yeast cells (Morataet et al. 2005, Mazauric and Salmon 2006), ß-Glucosidase-catalysed cleavage (Wenzel 1989), or polymerisation/derivatisation reactions (Fulcrand et al. 2004). This loss in anthocyanins is usually accompanied by a colour decrease. The phenomenon becomes particularly obvious during AF of a thermo-vinified wine (Figure 1) when the extraction process of anthocyanins is completed before AF. After AF, the decrease in colour density slows down. However, colour evolution is still well correlated to the loss in anthocyanins until the end of MLF. During the three-month MOX period, colour and anthocyanin curves developed differently. While the wine colour increased, the anthocyanin concentration decreased nearly 30% within this period, indicating the formation of deeply-coloured polymeric pigments. BENEFICIAL AND DETRIMENTAL MOX EFFECTS As shown in Figure 1, MOX improves the colour of wine. Oxygen-induced polymeric pigments, particularly the ethylidenebridged anthocyanin-flavanol oligomers (Timberlake and Bridle 1976, Escribano-Bailon et al. 1996, Es-Safi et al. 1999), are thought to be responsible for the higher colour stability in MOX wines. At the same time, the formation of polymeric pigments seems to soften astringency perception of red wines (Weber et al. 2013). This effect has been shown in MOX trials before claiming that small amounts of oxygen promote balanced tannicity (Del Carmen Llaudy et al. 2006, De Beer et al. 2008, Durner et al. 2010). Alongside these advantages, however, other repercussions of MOX have to be considered. Acetaldehyde, a compound that causes off-flavours at high concentrations, is produced in the course of oxygen-triggered reactions of polyphenols (Wildenradt and Singleton 1974). An accumulation of acetaldehyde could, therefore, be detrimental for wine. Another issue is the occurrence of dry tannins due to excessive oxygen addition (Lemaire 1995, Durner et al. 2010). Accordingly, there is a need to monitor the beneficial

www.w i n eb i z .c om.au

and detrimental effects of MOX in order to identify optimum oxygen dosages for different phenolic pre-conditions. WINEMAKING PROTOCOL AND MOX EXPERIMENT Our MOX experiment was carried out on a Pinot Noir, clone Mariafeld, which was grown in Oberderdingen (Württemberg) and harvested on 12 October 2013. Must analysis revealed 20.9°Bx, pH3.2, 240mg/L YAN, and negligible volatile acidity and gluconic acid concentrations. Prior to alcoholic fermentation, de-stemmed and crushed grapes were heated to 82°C for two minutes and cooled down to 40°C for depectinisation using 30µL/L pectinase (Trenolin Frio DF, Erbsloeh, Geisenheim, Germany). After 13.5 hours, grapes were pressed and the juice was clarified using a separator. An aliquot of the clarified juice was supplemented with 200mg/L condensed tannins (UVATANN ST, Ever Intec, Pramaggiore, Italy). Both fortified and regular juice were inoculated with 200mg/L of the hydrated Mycoferm Cru 05 yeast strain according to the manufacturer’s instructions (Ever Intec, Pramaggiore, Italy). After two days, the two batches were inoculated with the Extremo IT14 strain (Ever Intec, Pramaggiore, Italy) to initiate malolactic fermentation (MLF). During alcoholic fermentation and simultaneous MLF both wines were kept at 20°C. After completion of MLF (36 days), the wines were racked, divided into six equal portions per fortified and regular wine, and transferred to 100L stainless steel tanks with a diameter of 200mm and a height of 3200mm. The wine analysis at this point revealed an anthocyanin concentration of 102mg/L. Depending on the grape tannin supplementation before AF, the tannin concentrations after MLF were 131mg/L and 174mg/L, respectively. These measures

Figure 1. Evolution of colour during winemaking and maturation of a thermo-vinified 2012 Pinot Noir; thermoextraction at 85°C for two minutes; 3hL juice fermentation at 20°C for 10 days; MLF at 18°C for 35 days; MOX with 10mg O2/L/month at 15°C for 12 weeks; 90/35mg/L total/free SO2; bottle storage at 15°C for nine months.

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

LIVING TECHNOLOGY FOR WINES WITH PERSONALITY

INOXPA AUSTRALIA PTY, LTD Unit 1/4 Fuji Crescent MORNINGTON - AUSTRALIA Tel. +61 (3) 5976 8881 - Fax +61 (3) 5976 8882 Mobile: 0458 770 170 inoxpa.au@inoxpa.com

www.inoxpa.com

INOXPA Group specializes in wine and food equipment, providing you with a high level of accountability and a strict adherence to standards. At INOXPA, we control all of the manufacturing processes and guarantee the fabrication and efficiency of all of our products. Welcome to our dynamic world of solutions.

WINEMAKING

M I C R O - O X Y G E N AT I O N

resulted in two different molar tannin-toanthocyanin ratios: 2.2 for the regular wine and 2.9 for the tannin-supplemented Pinot Noir. After racking, two different MOX treatments with oxygen dosages of 10mg or 20mg O2/L/month were started for a period of 12 weeks at a constant temperature of 15°C in duplicate. Oxygen delivery was conducted using food-grade oxygen (BIOGON O E948, Linde Gas, Pullach, Germany), a VinO2 MOX system (Ever Intec, Pramaggiore, Italy), and ceramic diffusers with a pore size of 0.4µm (Thonhauser, Perchtolsdorf, Austria). The diffusers were suspended 50mm above the bottom of the tanks. Control batches of the same two wines were stored without oxygen addition for the same time period and at the same temperature in duplicate. Upon completion of MOX, the wines were sulfured by consecutive additions of SO2 in order to achieve a stable level of 35mg/L free SO2. After bottling, wines were stored horizontally at room temperature for two months until sensory sessions started. EVOLUTION OF COLOUR AND ACETALDEHYDE DURING MOX As stated by many other authors, oxygen triggers the formation of stable pigments with higher colour intensity and a purple colour hue (Cano-Lopez et al. 2006, Del Carmen Llaudy et al. 2006, De Beer et al. 2008, Cano-Lopez et al. 2008). Monitoring the colour intensity revealed a steady rate of increase throughout the 12-weeks MOX process for both treated wines (Figure 2). While the colour intensity in the control wine remained unchanged during the first six weeks, both MOX wines immediately increased in colour. At completion of MOX, the colour intensity was increased by 10% in the control wine, by 23% in the wine treated with 10mg O2/L/month, and by 36% in the wine that received twice the

amount of oxygen. Accordingly, the colour gain was 13% per 10mg O2/L/month for three months. The increase in colour of the control wine resulted probably from polymeric pigments triggered by residual oxygen in the wine. The increase in colour continued for two weeks after completion of MOX, suggesting a time delay in the process of forming polymeric pigments. Considering the reaction paths of oxygen in red wine, three consecutive and interdependent steps take place: First, the oxidation of catechol-containing phenolics yielding highly reactive hydrogen peroxide (Wildenradt and Singleton 1974), secondly, the hydrogen peroxide-induced oxidation of ethanol to acetaldehyde (Fenton 1894), and thirdly, the formation of anthocyanin derivatives, polymeric pigments, and other polymerised polyphenols utilising the formed acetaldehyde (Cheynier et al. 2002, Vernhet et al. 2011). As an intermediate product, acetaldehyde plays a major role during MOX and was suggested as a control parameter for the MOX process (Carlton et al. 2007). On average, red wines contain 30mg/L acetaldehyde (Liuand Pilone 2000). It can contribute fruity aromas to red wine at low levels. At higher concentrations the wine aroma is considered a defect and is reminiscent of rotten apples. The threshold of acetaldehyde in wine ranges between 100-125mg/L (Liuand Pilone 2000). An accumulation of acetaldehyde is supposed to determine the endpoint of MOX (Carlton et al. 2007). Monitoring the acetaldehyde by means of HS-GC/ FID revealed fast-rising concentrations during 12 weeks MOX for the wine treated with 20mg O2/L/month (Figure 3). After 10 weeks, the concentration levelled off at 75mg/L suggesting a state of equilibrium between the formation and consumption of acetaldehyde. The low MOX dosage showed a slower and later increase in acetaldehyde, finally reaching a

Figure 2. Evolution of colour during 12 weeks MOX with different oxygen dosages in Pinot Noir (error bars indicate 2SD).

www.w i n eb i z .c om.au

concentration of 45mg/L. The control wine remained at stable acetaldehyde levels during the 12 weeks. The acetaldehyde curves (Figure 3) show good correlation with the evolution of wine colour (Figure 2). However, adverse effects of acetaldehyde may also appear when its concentrations are too high. These could be either a deterioration of organoleptic characteristics or a higher demand in SO2. In order to assess the negative impact of the acetaldehyde, the concentration of total SO2 necessary to obtain 35mg/L free SO2 was determined (Figure 3). Despite its higher acetaldehyde level, the wine treated with 10mg O2/L/month retained the same total SO2 as the control, but with a considerable portion (57%) in the bound form. In contrast, significant elevation of total SO2 was observable in the wine treated with 20mg O2/L/month which could be attributed to the high concentration of acetaldehyde. Since too high levels in SO2 should be avoided with regard to legal limits, inhibition of lactic acid bacteria, and negative sensory aspects, such as an increase of SO2 demand, should be regarded as over-oxygenation. MOX-INDUCED FORMATION OF POLYMERIC PIGMENTS As mentioned earlier, MOX-induced polymeric pigments are thought to be responsible for the observed colour intensification. Vitisin B, four isomers of the ethylidene-bridged malvidin3-glucoside-flavanol dimer, and 16 isomers of the double ethylidene-bridged flavanol-malvidin-3-glucoside-flavanol trimer were analysed using LC-Q-ToFMS analyses. Exact masses of molecular ions and fragmentation patterns of the molecules were used for identification. Vitisin B was quantified using malvidin3-glucoside as an external standard. The ethylidene-bridged dimer was quantified

Figure 3. Acetaldehyde during 12 weeks MOX with different oxygen dosages in Pinot Noir (error bars indicate 2SD; Total SO2 data with different letters indicate significant differences for p ≤ 0.05).

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

M I C R O - O X Y G E N AT I O N

Figure 4. Concentrations of vitisin B and ethylidene-bridged anthocyaninflavanol dimers and trimers after completion of MOX with different oxygen dosages in regular and tannin-supplemented Pinot Noir (Abbreviations: Cat: Catechin; Mv: Malvidin-3 glucoside). using the ethylidene-bridged dimer cyanidin-3-glucoside-catechin. The ethylidene-bridged trimer was quantified using the double ethylidene-bridged trimer catechin-cyanidin-3-glucoside-catechin. The standards were synthesised by and obtained from Weber and Winterhalter (2014). Figure 4 shows the concentrations of vitisin B and ethylidene-bridged anthocyanin-flavanol dimers and trimers after completion of MOX with different oxygen dosages in regular and tanninsupplemented Pinot Noir. As expected, the highest concentrations were found in wines treated with 20mg O2/L/month. Regarding the different oxygen dosages, the red/ purple-coloured anthocyanin-flavanol oligomers showed a faster increase in concentration than the orange-coloured vitisin B. In relation to the progressive colour intensification shown in Figure 2, the disproportionately low increase in vitisin B concentration seems to be sensorially irrelevant. Considering the fast increase in anthocyanin-flavanol oligomers, the anthocyanin-flavanol dimer was predominantly formed upon 10mg, and the trimer upon 20mg O2/L/month, suggesting that not only the concentration but also the size of MOX-induced polymeric pigments is dependent on the oxygen dosage applied. The comparison of regular and tannin-supplemented Pinot Noir in Figure 4 revealed that higher tannin-toanthocyanin ratio favoured the formation of anthocyanin-flavanol oligomers. At the same time, the MOX-induced production of orange-coloured vitisin B was not dependent on the tannin-to-anthocyanin ratio of the wine. This observation confirms that tannins are responsible for the initiation of polymerisation reactions of anthocyanins and tannins. SENSORY IMPACT OF MOX The descriptive sensory analysis was conducted with18 trained judges according

V3 0N 3

Figure 5. Sensory impact of MOX with different oxygen dosages in Pinot Noir three months after bottling (n=18×2; Scale: 0-10; Significance levels: * p ≤0.05; ** p ≤ 0.01; *** p ≤ 0.001).

A U S T R A L I A

W I NNE E MA WKSI N G

A U S T R A L I A

to the method described by Durner et al. (2010). According to statistically processed sensory data, MOX treatment yielded significant changes in colour intensity, colour hue, strawberry aroma, and dry tannin impression (Figure 5). The wine benefited from low dosage MOX as colour increased and fruit intensity improved, confirming the hypothesis that a moderate acetaldehyde concentration can contribute fruity aromas to red wine (Liuand Pilone 2000). With a purple tint reminiscent of Cabernet Sauvignon, the 20mg O2/L/ month dosage did not result in a visual colour improvement of the Pinot Noir. Furthermore, there was an unpleasant increase in dry tannin perception which may be also regarded as an indicator for over-oxygenation (Lemaire 1995). Examining the sensory profile for the tannin-supplemented Pinot Noir, the addition of 200mg/L grape tannins before AF had little impact on the descriptors (Figure 6). However, the MOXinduced colour intensification was more pronounced in the tannin-supplemented wine, confirming that a higher tannin-toanthocyanin ratio accelerates the formation of red-coloured polymeric pigments. On the other hand, the strawberry aroma, which was increased upon the 10mg O2/L/ month dosage, remained unchanged when tannins were added to the wine. The dry tannin intensity was significantly increased in the tannin-supplemented Pinot Noir at 10mg O2/L/month dosage. Compared with the regular wine (Figure 5), the unpleasant increase in dry tannin perception was only observed at the 20mg O2/L/month dosage, suggesting that MOX-induced effects are reached faster with a higher tannin-toanthocyanin ratio. CONCLUSIONS The experiment demonstrated that MOX is a useful tool to intensify and stabilise the colour of a red wine with medium anthocyanin concentration. To achieve the desired results it is necessary that laccase ▶ and other PPOs are completely inactive.

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015 mep_wine_1312_59x272.indd 1

www.wine biz. com . au

14/05/2014 16:08

WINEMAKING

M I C R O - O X Y G E N AT I O N

providing the ethylidene-bridged standards for quantification and for his support in developing the LC-MS method. The authors thank the Württembergische Weingärtner-Zentralgenossenschaft e. G. for donating the wine for this study. Ever s.r.l. is acknowledged for providing oenological supplies and the MOX equipment. REFERENCES

Figure 6. Sensory impact of grape tannin addition with and without MOX in Pinot Noir three months after bottling (n=18×2; Scale: 0-10; Significance levels: * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001). The MOX-induced colour increase is always accompanied with an accumulation of acetaldehyde. Higher oxygen dosages are linked to a higher rise in acetaldehyde concentration and, accordingly, to a larger increase in colour. However, acetaldehyde concentrations of more than 50mg/L cause higher SO2 demand and concentrations of more than 100mg/L are considered an off-flavour. Acetaldehyde is necessary for the formation of the red/purplecoloured ethylidene-bridged anthocyanin-flavanol oligomers. These oligomers are most likely responsible for the MOX-induced colour intensification. They increase in concentration as the oxygen dosage increases. Besides these compounds, the orange-coloured vitisin B also increased in concentration with a higher oxygen dosage. Due to the disproportionately low increase in vitisin B concentration, it can be assumed that vitisin B is irrelevant for wine colour at this stage. Tannin addition before AF favoured the MOX-induced formation of anthocyanin-flavanol oligomers. Vitisin B concentration was not dependent on the tannin-to-anthocyanin ratio of the wines. These observations suggest that tannins are essential for the initiation of polymerisation reactions responsible for higher colour stability. Sensory analysis confirmed higher colour intensity due to 10mg O2 /L/month treatment and revealed an increase in strawberry aroma which is attributed to the moderate acetaldehyde concentrations in the wine. A high oxygen dosage of 20mg O2/L/ month resulted in an atypical purple hue and an unpleasant increase in dry tannin perception. These descriptions indicate over-oxygenation. The supplementation of grape tannins without MOX showed only minor changes in the sensory profile. However, the increase in colour intensity was even larger in association with MOX treatment, confirming the hypothesis of an accelerated formation of red coloured polymeric pigments at a higher tanninto-anthocyanin ratio. Besides colour, the tannin-fortified and MOX treated wine has been described with higher dry tannin intensity already after low oxygen dosage. These results suggest that the oxygen demand of a red wine decreases with an increasing tanninto-anthocyanin ratio. ACKNOWLEDGEMENTS This research project is supported by the German Ministry of Economics and Energy (via AiF) and the FEI (Forschungskreis der Ernährungsindustriee. V., Bonn) in cooperation with the German Winegrowers’ Association (DWV), project AiF 17719 N. The authors express gratitude to Fabian Weber, from the University Bonn, for

www.w i n eb i z .c om.au

Cano-Lopez, M., Pardo-Minguez, F., Lopez-Roca, J.M. and Gomez-Plaza, E. (2006) Effect of micro-oxygenation on anthocyanin and derived pigment content and chromatic characteristics of red wines. Am. J. Enol. Vitic. 57:325-331. Cano-Lopez, M., Pardo-Mínguez, F., Schmauch, G., Saucier, C., Teissedre, P.-L., Lopez-Roca, J. M. and Gomez-Plaza, E. (2008) Effect of micro-oxygenation on colour and anthocyanin-related compounds of wines with different phenolic contents. J. Agric. Food Chem. 56:5932-5941. Carlton, W.K., Gump, B., Fugelsang, K. and Hasson, A.S. (2007) Monitoring acetaldehyde concentrations during micro-oxygenation of red wine by headspace solid-phase microextraction with on-fiberderivatisation. J. Agric. Food Chem. 55:56205625. Cheynier, V., Atanasova, V., Fulcrand, H., Mazauric, J.-P. and Moutounet, M. (2002) Oxygen in wine and its role in phenolic reactions during aging. In Proceedings of the Uses of Gases in Winemaking Conference. M. Allen et al. (Eds.), pp. 23-27. ASVO, Adelaide. De Beer, D., Joubert, E., Marais, J. and Manley, M. (2008) Effect of oxygenation during maturation on phenolic composition, total antioxidant capacity, colour and sensory quality of Pinotage wine. S. Afr. J. Enol. Vitic. 29:13-25. Del Carmen Llaudy, M., Canals, R., Gonzalez-Manzano, S., Canals, J.M., SantosBuelga, C. and Zamora, F. (2006) Influence of micro-oxygenation treatment before oak ageing on phenolic compounds composition, astringency, and colour of red wine. J. Agric. Food Chem. 54:4246-4252. Durner, D., Weber, F., Neddermeyer, J., Koopmann, K., Winterhalter, P. and Fischer, U. (2010) Sensory and colour changes induced by micro-oxygenation treatments of Pinot Noir before and after malolactic fermentation. Am. J. Enol. Vitic. 61:474-485. Es-Safi, N.E., Fulcrand, H., Cheynier, V. and Moutounet, M. (1999) Studies on the acetaldehyde-induced condensation of (-)-epicatechin and malvidin 3-O-glucoside in a model solution system. J. Agric. Food Chem. 47:2096-2102. Escribano-Bailon, T., Dangles, O. and Brouillard, R. (1996) Coupling reactions between flavylium ions and catechin. Phytochem. 41:1583-1592. Fenton, H.J.H. (1894) Oxidation of tartaric acid in presence of iron. Journal of the Chemical Society, Transactions 65:899-910. Fulcrand, H., Atanasova, V., Salas, E. and Cheynier, V. (2004) The fate of anthocyanins in wine: Are there determining factors? In ACS symposium series Vol. 886: pp. 68-88. American Chemical Society. Lemaire, T. (1995) La micro-oxygénation des vins. Thesis, Ecole Nationale Superieure Agronomique Montpellier, France. Liu, S.Q. and Pilone, G.J. (2000) An overview of formation and roles of acetaldehyde in winemaking with emphasis on microbiological implications. Int. J. of Food Sci. and Tech. 35:49-61 Mazauric, J.P. and Salmon, J.M. (2006) Interactions between yeast lees and wine polyphenols during simulation of wine ageing II: Analysis of desorbed polyphenol compounds from yeast lees. J. Agric. Food Chem. 54:3876-3881. Morata, A., Gómez-Cordovés, M.C., Colomo, B. and Suárez, J.A. (2005) Cell wall anthocyanin adsorption by different Saccharomyces strains during the fermentation of Vitis vinifera L. cv Graciano grapes. Eur. Food Res. Technol. 220:341–346. Timberlake, C.F. and Bridle, P. (1976) Interactions between anthocyanins, phenolic compounds, and acetaldehyde and their significance in red wines. Am. J. Enol. Vitic. 27:97-105. Vernhet, A., Dubascoux, S., Cabane, B., Fulcrand, H., Dubreucq, E. and Poncet-Legrand, C. (2011) Characterisation of oxidised tannins: comparison of depolymerisation methods, asymmetric flow field-flow fractionation and small-angle X-ray scattering. Anal. Bioanal. Chem. 401:1559-1569. Weber, F., Greve, K., Durner, D., Fischer, U. and Winterhalter, P. (2013) Sensory and chemical characterisation of phenolic polymers from red wine obtained by gel permeation chromatography. Am. J. Enol. Vitic. 64:15-25. Weber, F. and Winterhalter, P. (2014) Synthesis and structure elucidation of ethyliden-linked anthocyanin-flavan-3-ol oligomers. Food Res. Int. 65:69-76. Wenzel, K. (1989) Selektion einer Hefemutante zur Verminderung der Farbstoffverluste während der Rotweingärung. Vitis 28:111-120. Wildenradt, H.L. and Singleton, V.L. (1974) The production of aldehydes as a result of oxidation of polyphenolic compounds and its relation to wine ageing. Am. J. Enol. Vitic. 25:119-126.

This article is based on a presentation delivered at a seminar held in Adelaide late last year which was organised by the Australian Society of Viticulture & Oenology and titled ‘Inputs to Outputs: Is Less More?’ WVJ

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

WINE ENG 2015

NATIONAL

CONFERENCE &

EXHIBITION

Finding a better way. Excellence in Winery operation and asset management.

August 26th & 27th Chateau Tanunda Winery Barossa Valley

For further information visit www.wea.org.au or contact Trevor Leighton 0417 597 956 tleighto@bigpond.net.au

W I N E&MMARKETING AKING BUSINESS

SULFUR

A new look at an old practice: how sulfur dioxide additions influence microbial diversity during fermentation By Michael L. Swadener1 and David A. Mills1,2 1Department of Viticulture and Enology, University of California, Davis, CA 95616 2Department of Food Science and Technology, University of California, Davis, CA 95616

How does SO2 added early in the winemaking process shape the microbial diversity of a fermentation?

he use of sulfur dioxide (sulfites or SO2) in winemaking is hardly a new technology – it has been used since the Romans started burning sulfur candles in emptied barrels to keep them from turning sour. The general antimicrobial and antioxidant effects of SO2 in wine have also been well known for several decades and many modern winemakers find it to be a key additive for producing (and preserving) premium quality wine. At crushing/pressing the addition of sulfites are considered to inhibit growth of certain non-Saccharomyces yeasts and lactic acid bacteria (LAB), which can contribute to spoilage and problematic fermentations. At adequate levels, SO2 also reduces the activity of the oxidative enzyme polyphenol oxidase which can rapidly deplete oxygen in juice/must at the expense of the growing yeast population during the early stages of fermentation.

www.w i n eb i z .c om.au

What is not well established is precisely how SO2 added early on shapes the microbial diversity of a wine fermentation. Bokulich et al. (2015) recently addressed this issue using some of the latest methods in microbial ecology. Traditional culturebased methods for examining microbial profiles of wines, while powerful and useful for many investigations, are limited in both their sensitivity and scope. These techniques are slow, laborious, and not sensitive to the presence of very small or difficult-to-cultivate populations. For the Bokulich et al. (2015) investigation high-throughput marker-gene sequencing was used to examine the changes in both bacterial and fungal communities throughout the fermentation of a Chardonnay wine. The method begins with environmental samples—in this case fermenting must—whereby total DNA was extracted and two separate sets of primers (one bacterial and one fungal) were used in separate PCR reactions to amplify the target regions of all microbes present. For bacteria this region was the V4 domain of the 16S rRNA genes and for fungi the internal transcribed spacer (ITS) 1 loci were amplified. These two ‘amplicons’ were then sequenced by modern techniques (in this case an Illumina Miseq device) resulting in hundreds of thousands of short DNA sequences which are then quality filtered and classified into operational taxonomical units (OTUs) prior to identification and cataloging of the various microbial taxa by comparison with existing databases. What this yields, in the end, is the relative frequencies of dozens of different types of microbes in each sample – a model of the microbial communities. Further statistical analyses allowed comparison of samples and the significant differences that exist among them to be found. It is important to note that this process is based on DNA and does not differentiate between live or dead cells, nor those that might lie somewhere in between in a viable but nonculturable (VBNC) state. However, its great strength lies in its sensitivity to even small and otherwise difficult to detect populations. Even more important, it is a rapid and affordable way to obtain a much more complete description of the microbial communities of hundreds (or thousands) of samples at once. The actual Chardonnay fermentations were conducted in triplicate five gallon fermentations, uninoculated at 0, 15, 20, 25, 35, 50, 75, 100, and 150mg/L SO2, as well as 0 and 50mg/L SO2 inoculated with commercial Saccharomyces cerevisiae EC1118. The fermentations were conducted rather conventionally and sampled after 1, 2, 3, 5, 7, 10, 14, and 21 days. That’s 11 treatments, in triplicate, at eight sampling times, for a total of 264 unique samples. Simply put, no other current method would allow for such rapid and in-depth analysis of so many treatments or time points as was possible here with marker gene sequencing. What did all this sequencing reveal? For one, SO2 mainly impacted bacterial diversity, as fungal populations across the

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

SULFUR

range of sulfite additions did not appear to differ significantly from one another throughout the course of the fermentations. This lack of significant differences may have been partly due to high variation within replicate fermentations. Bacterial diversity, on the other hand, was found to be significantly impacted by different doses of SO2. For uninoculated fermentations, 25mg/L or more of SO2 seemed to stabilise bacterial populations. When SO2 was less than 25mg/L, however, bacterial populations shifted in ways that were somewhat surprising. In no-sulfite added musts the average number of bacterial species decreased rapidly after 10 days and remained lower than the sulfited musts. This was likely caused by the growth of a few species, especially those in the genus Lactobacillus and the larger family, Lactobacillaceae, which dominated the bacterial communities and caused the less-abundant taxa to fall below detectable levels. In the low sulfite musts (15 and 20mg/L) there were significant increases in the populations of acetic acid bacteria of the genus Gluconobacter that were not observed elsewhere. These low and no-sulfite musts were also slower to begin active fermentation, and had higher Brix values (2.2, 0.6, and -0.3º Brix) after 21 days than the greater than 25mg/L sulfite treatments (-1.0 to -1.5ºBrix). This suggests that the growth of these bacteria may have impacted fermentation completion or, conversely, the conditions that restricted fermentation led to their population increases. A stabilising effect similar to adding more than 25mg/L SO2 was achieved by inoculation with a strong S. cerevisiae starter culture, even with zero sulfites added. Fermentation also proceeded more rapidly and to a slightly greater degree of completion when inoculated with yeast. Thus, inoculation alone may provide a reasonable level of protection and contribute to microbial stability during fermentation of non-sulfited wines. Emphasis should be placed on the fact that this observation applies to the period of active fermentation and such a protective effect may not persist into later stages of winemaking. Some additional results of the study, the significance of which might be less obvious to most winemakers, include the abundant presence of the bacterial genus Erwinia and other members of the same Enterorbacteriaceae family, regardless of sulfite levels. Traditionally, these bacteria have not been considered to be participatory members of wine fermentation, as they have not been isolated from wine by culture-based methods. The high relative abundance of Erwinia from the very beginning of fermentation supports the thought that they are environmental microbes, coming from the surface of the grapes at pressing, and are not necessarily active during the fermentation. Their apparent persisting presence through fermentation, and repeated detection in this and similar studies, however, suggests that they might warrant further study as to what sort of metabolic state they are in – live, dead, or VBNC. If they are not merely dead and floating around, then there is a question of what role they might play in fermentation.

V3 0N 3

Although this specific work may generate more questions than it answers with regard to SO2, it clearly demonstrates that modern marker gene sequencing creates a far fuller and higher definition picture of the constellation of microbes present in wine fermentations and how they respond to different treatments. Indeed, as these techniques are increasingly used in combination with other ‘omics’ approaches, such as metabolomics, we will begin to draw connections between particular microbial taxa and key positive or negative sensory attributes that define wines. If the regional microbial taxa are considered truly part of the ‘terroir’ of the ensuing wine as suggested previously (Bokulich et al. 2014), perhaps these new tools will help researchers define which specific taxa play a key role in that terroir and how winemaking decisions , including SO2 usage, influences that expression. REFERENCES Bokulich, N.A.; Swadener, M.; Sakamoto, K.; Mills, D.A. and Bisson, L.F. (2015) Sulfur dioxide treatment alters wine microbial diversity and fermentation progression in a dose-dependent fashion. American Journal of Enology and Viticulture 66(1):73–79. Bokulich, N.A.; Thorngate, J.H.; Richardson, P.M. and Mills, D.A. (2014) Microbial biogeography of winegrapes is conditioned by cultivar, vintage, and climate. Proceedings of the National Academy of Sciences of the United States of America 111(1):E139–48.

ACKNOWLEDGMENTS MLS was supported by an Adolf L. and Richie C. Heck Research Fellowship, Horace O. Lanza Scholarship, Mario P. Tribuno Memorial Research Scholarship, and Wine Spectator WVJ Scholarship.

3.9% HORTICULTURE FINANCE OFFER* LIMITED TIME ONLY

*Terms and conditions apply.

QUANTUM MIST – THE ULTIMATE PERFORMER IN GRAPES » Outstanding spray application and improved efficiencies » Superior Australian designed SARDI fans » High volume, turbulent, directional air » A range of tank sizes and row options to suit all vineyards Freecall 1800 999 162 Freefax 1800 623 778

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

ALGO/CLE3739

…SO2 mainly impacted bacterial diversity, as fungal populations across the range of sulfite additions did not appear to differ significantly from one another throughout the course of the fermentations… Bacterial diversity, on the other hand, was found to be significantly impacted by different doses of SO2.

W I NNE E MA WKSI N G

Email sales@croplands.com.au www.croplands.com.au

www.wine biz. com . au

AWRI

Unravelling the capricious nature of Oenococcus oeni By Anthony Borneman, Eveline Bartowsky, Peter Costello, Peter Sternes, Paul Chambers, Markus Herderich and Dan Johnson The Australian Wine Research Institute, PO Box 197, Glen Osmond, South Australia 5064

Managing director Dan Johnson

Exciting times lie ahead for malolactic fermentation (MLF) research and this will bring substantial benefits to winemakers. New genetic sequencing techniques are revealing the incredible diversity amongst strains of Oenococcus oeni, the bacterium primarily responsible for MLF. This new knowledge should provide extensive opportunities for Australian winemakers to choose MLF strains tailored to suit their individual conditions – optimising both fermentation efficiency and flavour release. MLF – A KEY WINEMAKING PROCESS MLF is critical in red wine production, where it is used to convert malic acid from grapes into lactic acid. This ‘softens’ the palate of a wine and decreases the likelihood of spoilage by undesirable microbes that can use malic acid as an energy source. In addition, MLF can influence wine style by changing the flavour profile; this has been one of the drivers for many winemakers adopting MLF in white wine production. Winemakers primarily rely on the bacterium Oenococcus oeni to conduct MLF in the winery; one or two other species

BUYERS’ GUIDE For experienced wine & grape industry suppliers

of bacteria (e.g., some strains of Lactobacillus plantarum) are able to perform MLF, but are not commonly used. O. oeni is an interesting bacterium. It is one of a few micro-organisms that can grow in the hostile environment of wine, where low pH, the presence of alcohol and a scarcity of nutrients prove far too great a challenge for most microbes. In fact, far from simply surviving in wine, O. oeni has only ever been isolated from winery environments, suggesting that this is its natural home. Nonetheless, while O. oeni is at home in wine, it can be rather capricious; sometimes it is very slow or even fails to complete MLF. This is perhaps the biggest bugbear winemakers have with MLF; efficiency and reliability are far from guaranteed. The availability of more robust and efficient MLF strains would take some of the stress out of vintage. If such isolates could be used to shape wine style in a targeted way, so much the better. Strains of O. oeni that can be accessed by winemakers vary considerably in their tolerances to stresses and, therefore, in their MLF performance. They also differ in their capacity to influence wine style. However the genetic determinants of these differences remain unknown, making it difficult to screen for new strains with properties that will benefit the ▶ winemaker.

AT A GLANCE • Malolactic fermentation is an important winemaking process for most red and some white wines, improving both sensory properties and microbial stability • Oenococcus oeni is the bacterium most commonly used to conduct MLF in winemaking • Many different strains of O. oeni are available, with differences in fermentation efficiency and flavour generation • Until recently it has been difficult to conduct genetic analysis on this species; however, new techniques are making it possible to sequence its genome and start to tie winemaking-relevant properties to particular genes • These developments are opening the door for winemakers to tailor their choice of MLF strain to specific fermentation characteristics or desired flavour outcomes

www.winebiz.com.au/guide 34

www.w i n eb i z .c om.au

• As more O. oeni strains are sequenced, MLF options for winemakers will increase.

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

26TH EDITION INTERNATIONAL ENOLOGICAL AND BOTTLING EQUIPMENT EXHIBITION

ORGANIZED BY

WORLD LEADER IN WINE TECHNOLOGY 3 rd —6 th NOVEMBER 2015 Fiera Milano (Rho) Italy info@simei.it / simei.it

AWRI

O. OENI - A DIFFICULT BACTERIUM TO STUDY While there have been many decades of research into MLF, it has proven to be a difficult field of study for microbiologists, largely due to the intractable nature of O. oeni. Most microbes that are studied in the laboratory (including wine yeast) are amenable to genetic analysis. It is possible, for example, in a research setting to get yeast to exchange genes by natural means (such as mating) or through the application of genetic engineering techniques. This enables the identification and characterisation of genes that drive important processes. Knowledge of these genes then makes it easier to isolate novel non-genetically modified strains with desirable traits. However, O. oeni does not lend itself to traditional genetics or genetic engineering techniques. Apart from one or two reports in the scientific literature, this species of bacterium has proven to be recalcitrant when it comes to genetic engineering techniques. Fortunately, developments over recent years in gene analysis technologies are providing a way forward. It’s no longer necessary to rely on gene transfer techniques to begin to identify and characterise the genetic determinants of traits, it’s now possible to go straight to the stuff that genes are made of: DNA. Genes are essentially recipes for making proteins, which are, in turn, responsible for building, maintaining and reproducing cells. Proteins include enzymes, transporters for delivering nutrients into cells and regulators of metabolism – in fact, just about everything that a cell does is controlled and executed by proteins. In this context genes might be regarded as a cell’s instructions for life. Genes are made from DNA and the full complement of DNA carrying the full set of genes of an organism is called its genome (see breakout box on facing page).

All the information you need in one place PRINT & ONLINE • 7,000 Industry listings • 9,000 Personnel • 3,000 Wineries • 5,600 Wine brands • 1,750 Grapegrowers • 2,000 Buyers’ guide listings • 300 Distributors & retailers • 210 Writers & media PLUS + Statistics + 2014 Overview + Calendar of events + Wineshows + Courses + Organisations

NEW 2015! - WINE BLOGGERS To order your copy: Ph: +618 8369 9509 E: orders@winetitles.com.au

Visit: www.winebiz.com.au

www.w i n eb i z .c om.au

While a considerable amount has already been learned about many aspects of O. oeni genetics, the sequencing completed so far has really only scratched the surface. What is required now is an intensive effort to sequence an even larger number of strains... and determine the variations in traits that are relevant to MLF performance. Using the latest DNA sequencing technologies it is now possible to sequence the entire genome of an organism, and because bacterial genomes are relatively small, the task can be achieved in a reasonable timeframe. This has afforded scientists at AWRI and in other laboratories around the world the opportunity to sequence a number of O. oeni strains, and what we are learning about this bacterium is amazing. DIVERSITY REVEALED Genomic sequencing of bacteria in general has revealed that there is often enormous genetic diversity within a species; massively more than is found in plants and animals. This has led to the introduction of the terms ‘pan genome’ and ‘core genome’. A core genome is the collection of genes that all members of a species have. These might be regarded as indispensible to the bacterium in question. Then there are genes that are found within a species but are dispensable; they are found only in some strains. The pan genome is the full collection of genes (dispensable and indispensable) in a species. O. oeni has been shown to have a high level of genetic diversity (AWRI publication #1512). It has a core genome of approximately 1165 genes, but more than 2800 genes in its pan genome. Typically, for any strain of O. oeni, the core genome constitutes about 60-70% of its DNA, the rest carries dispensable genes, providing an enormous potential for genetic variation between strains. Presumably, while we use the word dispensable for this highly variable part of the genome, these genes will provide an advantage in some environments and not others. This might explain why, for example, some strains perform well in red wine but are less reliable in white. How did O. oeni come to have this huge level of genetic diversity across strains? The answer, at least in part, appears to be due to a phenomenon that is common in the bacterial world known as horizontal gene transfer (HGT). In contrast to vertical transfer of genes, which happens during normal reproduction when parents pass on their genes to offspring, in HGT genes are transferred from one organism to another outside of a normal reproductive process, often between totally unrelated species. In nature, it seems bacteria have been using HGT for millennia, enabling cross-species genetic engineering to improve their genetic potential. O. oeni has acquired genes from, for example, species of Lactobacillus and Pediococcus, both of which are found in food and beverage production. In fact, the level of transfer from Lactobacillus species has led to the suggestion that these bacteria provide a potential reservoir of genes for O. oeni. It is humbling to recognise that biotechnologists are a few billion years behind nature in their genetic engineering skills and require sophisticated laboratory tools to achieve similar, although considerably more modest, ends. HGT can occur via any one of several mechanisms but we still don’t know how O. oeni does it. Genomic sequencing has shown that there are clear signs of virus infection in the O.oeni genome. These viruses

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

AWRI

CRACKING THE CODE: GENES AND GENOMES Genes are recipes for making proteins. For example, your cells carry a gene/recipe for making the protein insulin, which is a hormone that regulates blood sugar level. You also have genes/recipes that instruct your cells how to make proteins that control how tall you can grow, the colour of your eyes, the general shape of your body, etc. It is these recipes of life that dictate whether you will have athletic potential or not, and, because you inherited them from your parents, you end up looking like them. If genes are recipes, then genomes are recipe books. The human genome carries all of the recipes required for making

proteins to build a human body from conception to adulthood, and repair and defend that body during its life. All of our physiology and anatomy is shaped by a collection of 20,000–25,000 genes that comprise the human genome. And, unless you have an identical twin, your recipe book differs a little from everyone else’s. The language of the genes is different to the languages we use to communicate with each other. It is based on an alphabet of only four letters (A, T, G and C) and its lexicon is limited to three-letter words, which means there are only 64 words in the genetic dictionary. However, this is more than enough to string

may have brought with them genes from hosts that they had previously infected. However, it is likely that other processes are also at work and if these were better understood, it would be easier to perform genetics experiments on O. oeni. SPECIFIC GENES RELEVANT TO WINEMAKING Homing in on specific aspects of the O. oeni genome, considerable variation has been found in genes responsible for exopolysaccharide (EPS) production. EPSs are critical components of the shield that surrounds O. oeni cells, known as the cell wall, which protects against environmental assaults. EPSs, therefore, contribute to the robustness of the bacterium, which, in turn, would be expected to impact on the performance and reliability of strains in MLF. EPSs may also affect the mouthfeel of wine. EPS genes are housed in three regions of the genome and it seems that they differ between strains. The nature of the variation of these genes is consistent with reported differences in both the amount and type of EPS produced by at least three of the strains that have been sequenced. This provides some validation of genomic sequencing as a means of predicting traits in O. oeni. In a nutrient deficient environment such as wine, a bacterium needs to be able to synthesise many of the molecules needed for building cellular components. Thus, the synthesis of amino acids (the building blocks of proteins) might be regarded as fundamental for survival. Interestingly, there is considerable inter-strain variation in the presence of genes for amino acid synthesis. For example, some strains lack the genes necessary for synthesis of the amino acid leucine. Others lack genes for the synthesis of threonine and/or glutamine and/or methionine. Whether these differences correlate with the ability to efficiently finish MLF has yet to be determined. Another important observation from comparing O. oeni genomes concerns the genes required for sugar utilisation. It has been known for decades that different strains of O. oeni utilise different sugars, but the underlying reasons for this variation were not understood. From genomic sequencing we now know that strains vary in the genes that they carry for sugar uptake from the environment and for sugar metabolism. For example, only some strains have the genes necessary to utilise L-arabinose, a sugar that is found in grape juice and is not metabolised by yeast.

V3 0N 3

together sets of instructions for building all of the proteins (enzymes, hormones, muscles, antibodies, cartilage, etc.) we require for life. The ‘paper’ on which the words that make up the recipes of life is written is known as DNA, and when we read an entire recipe book of an organism, decoding what is recorded in its DNA, we say we are sequencing its genome. What we end up with in this process is a long sequence of millions of A, T, G, and Cs, with no spaces or obvious punctuation marks that we have to decipher. Thankfully, sophisticated computational aids can do most of this for us. Reproduced from AWRI publication #1100.

MORE SEQUENCING NEEDED While a considerable amount has already been learned about many aspects of O. oeni genetics, the sequencing completed so far has really only scratched the surface. What is required now is an intensive effort to sequence an even larger number of strains (sequence data for about 50 O. oeni genomes is currently available in the public domain) and determine the variations in traits that are relevant to MLF performance. From this it will be possible to determine which genes are essential for the ability to efficiently complete MLF at low pH, in high alcohol, at low temperature and under numerous other wine-relevant conditions. Armed with the above, it will be possible to advise on which commercially available strains of O. oeni are best suited to conditions that are typical of particular wine varieties, styles and regions. Large collections of O. oeni isolates could be screened to identify new strains with combinations of traits that are better-suited to Australian winemaking conditions than currently available commercial products. The AWRI culture collection, for example, houses approximately 900 MLF bacteria, some of which were isolated as early as the 1970s, prior to the practice of inoculating with commercially-available MLF strains. Who knows what gems we might find? ACKNOWLEDGEMENTS This work was supported by Australia’s grapegrowers and winemakers through their investment body the Australian Grape and Wine Authority, with matching funds from the Australian Government. The AWRI is a member of the Wine Innovation Cluster. Ella Robinson is thanked for her editorial assistance. REFERENCES AWRI publication #1512 Borneman, A.R.; McCarthy, J.M.; Chambers, P.J. and Bartowsky, E.J. (2012) Comparative analysis of the Oenococcus oeni pan genome reveals genetic diversity in industrially-relevant pathways. BMC Genomics 13:373. AWRI publication #1100 Borneman, A.R.; Forgan, A.H.; Chambers, P.J. and Pretorius, I.S. (2008) Unravelling the genetic blueprint of wine yeast. Aust. N.Z. Wine Ind. J. 23(5):23–25. WVJ

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

V I T I C U LT U R E

VINEYARD INNOVATIONS

A new robot for vineyard monitoring By Maria P. Diago and Javier Tardaguila, University of La Rioja, Spain

A project is under way in the EU to design, develop and deploy an unmanned robot equipped with various non-invasive sensing technologies to monitor grape yield, vegetative growth, vineyard water status and grape composition.

raditionally, European vineyards have not been technology driven. The human eye has been the only ‘sensor’ steering vineyard management decisions, providing subjective evaluations on yield, vegetative growth and plant status regarding water stress, pests and diseases. Sustainable viticulture requires objective and continuous key parameter monitoring for rational decision-making with advanced technologies and sensors in the field. These would allow for observing crops and quantifying important factors in vineyards such as grape yield, leaf development, disease incidence and detection of various stress issues (water, nutrition, etc). This information can also be globally referenced with GPS tags, enabling the assessment of spatial variability for key agronomical parameters in the vineyard, which may facilitate precision viticulture strategies aimed at differentiated and optimised vineyard management. Nowadays, there is no practical system in agriculture that integrates multiple sensors capable of acquiring information on agronomical, physiological and fruit composition simultaneously and on the go. Only some remote sensing solutions from aerial platforms or satellites have included the simultaneous acquisition of spectral information in the visible

SE AR

and infrared ranges, allowing for the assessment of grapevine vigour and water status. However, the small spatial resolution of multispectral devices together with the architecture of grapevine cultivation in rows rather than a continuous crop, the limited weather flexibility and the elevated cost of aerial monitoring are important drawbacks, which have practically led to remote sensing techniques for most of the small- and medium-size vineyards being discarded. An alternative to long-distance remote sensing from airplanes and satellites has been the use of unmanned aerial vehicles (UAVs) or drones, but these present serious limitations: payload, severe restrictions in terms of flight autonomy, flight control and safety, and ambiguous official regulations for these aerial vehicles, among other issues. A promising and solid option to remote sensing for vineyard monitoring is proximal sensing, through which all the inconveniences mentioned above are certainly expected to be tackled by the outcome of the VineRobot project (www.vinerobot.eu). Proximal sensing includes all detecting technologies that retrieve information from an object when the distance between the sensor and the object is less than, or comparable to, some of the dimensions of the sensor. In agriculture, these sensors have been widely used, either individually or in combination, for evaluating and characterising various soil properties such as water content, salinity and nutrients (Zerger et al. 2010). However, the characterisation of biophysical and physiological parameters of plants by these sensors has been less explored. The main sensors used for monitoring the cultivation or composition of fruits in the field are the following: RGB cameras, thermal cameras, multi and hyperspectral cameras, fluorescencebased sensors, LIDAR (light detection and ranging) sensors, ▶ and NIR spectroscopy.

• Wine industry personnel ONLINE PHONEBOOK • Up-to-date winery information by region, tonnes crushed and more! • Wine Distributors, retailers and writers

Access your Wine Industry Directory ONLINE by purchasing the 2015 Directory ORDER TODAY:

Visit: www.winebiz.com.au Call: +618 8369 9500 Email: orders@winetitles.com.au

First prototype of the VineRobot.

www.w i n eb i z .c om.au

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

MILES AHEAD

THE RESULTS SPEAK FOR THEMSELVES

Over 20 years of proven hands free growth straight to the wire, with quick and easy assembly using our Zip-Safe seal. It’s no wonder GroGuard is Australia’s biggest name in vine establishment technology. Designed and manufactured locally for Australian conditions, our legendary strength and reliability is backed by a 3-year guarantee. Contact your local rural store or

freecall 1800 644 259 www.groguard.com.au

TIRED OF BROKEN POSTS? Broken vineyard posts after harvest, awaiting disposal – you have a real problem!!!

With millions of intermediary vineyard posts damaged in Australia and New Zealand each year, ECO TRELLIS® has a solution that will save you both time and money.

Pre-punched hole positions: simple to adjust the tucking /fruiting wires Patented clip range: colour coded for ease of use No tyre punctures: nails/staples Rolled top: no cap required for netting protection

INTRODUCING ECO TRELLIS INTERMEDIARY POSTS ®

BENEFITS

Viticulturists and vineyard managers using ECO TRELLIS® intermediary posts report that they replace significantly less than timber alternatives each year.

Structural strength: high tensile galvanised steel which means fewer breakages Bulge: provides structural strength with a ground retention flange and patented footing if required Ease of installation and handling: saves on labour costs Recyclable: no stock piling of damage posts Longer product life cycle: more durable than wooden vineyard posts Environmentally friendly: no chemical leaching

See the light with ECO TRELLIS®. Photo courtesy Felton Road, NZ

NZ TUBE MILLS | 2–14 Port Road, Seaview, Lower Hutt, Wellington PO Box 36-036, Lower Hutt 5045, Wellington, New Zealand

ecotrellis.com

AUSTRALIA Lukas Mojzisek, Sales Engineer | PH +614 0857 3874 | EMAIL lukas.mojzisek@nztubemills.co.nz NEW ZEALAND Gareth Gardiner, Sales Engineer | PH 0508 NZ TUBE + 64 4 576 1800 | EMAIL ecotrellis@nztubemills.co.nz

VINEYARD INNOVATIONS

The scientific and technological impact of the VineRobot is mainly driven by the innovative nature of the vine scouting robot, as no other similar product exists in the market, in spite of the need for technology in the highly competitive world of winemaking. The aim of this project is the design, development and deployment of a novel use-case agricultural robot under the scope of unmanned ground vehicles (UGV), and equipped with several non-invasive sensing technologies to monitor grape yield, grapevines’ vegetative growth, water stress and grape composition in order to optimise the vineyard management and improve grape composition and wine quality. The scope covers the integral monitoring of vineyards over the entire season by placing a ground robot along the vineyards, endowed with artificial intelligence and machine learning techniques to plan how to operate in a changing environment. The final users will receive updated information in mobile applications (app). The proposed use-case agricultural robots (where key proximal sensing technologies are implemented) are intended to allow revolutionary and conclusive decision making to optimise vineyard management and to drive fundamental agronomical decisions according to grape yield estimation, plant growth monitoring, water status, and berry composition assessment. The successful deployment of a robot like this requires solutions for specific challenges and objectives, such as: • physical constraints for mobility in off-road environments • navigation planning and safeguarding • design of multiple engines’ system for perception, mapping and communication • global localisation system

V3 0N 3

• validation of the sensing solutions and agronomical parameters • prototype construction and demo agenda. The main capability expected from the VineRobot is the possibility of working (retrieving agronomical and physiological data from the grapevines) autonomously and safely over long periods of time under uncertain environmental conditions of vineyards. In addition to navigation, the VineRobot will gather key information from the vines and will convey it through compatible maps. For practical purposes, the activity within this project focusses on two big areas: first, robot design and construction and, secondly, development of crop sensing units. In general terms, the first prototype of the VineRobot has been designed, built, and tested in Les Vignerons de Buzet (France). The requirements for the robot design in terms of ‘what the robot has to do’ have also been defined. The first prototype is capable of moving in the field at ease and, at this point, can be manually operated with a joystick or remotely steered through a tablet. The first version of the security network comprising five emergency stops has been implemented and evaluated. The following stages will endow the robot with autonomous motion, which will be demonstrated in the vineyards of Les Vignerons de Buzet (France) in summer 2015. The work on the bio-sensing capabilities of the robot has progressed so far in three directions:

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

V V II T T II C C U U L LT T U U R R E E

1. A vision system based on RGB and IR perception is being developed to identify and track grape berries on the go 2. Fundamental research on NIR spectrometry has been conducted to measure water stress alternatively to thermography and some aspects of grape composition 3. The FAsense, a new chlorophyll fluorescence-based sensor to detect the level of anthocyanins in grapes as well as other canopy properties of vines, such as the leaf nitrogen status, is being developed. Many field tests have been performed so far on the premises of the different partners across Europe, Logroño (Spain), Buzet (France), Geisenheim (Germany), Macon (France), and Valencia (Spain) where practically all partners have collaborated. The scientific and technological impact of the VineRobot is mainly driven by the innovative nature of the vine scouting robot, as no other similar product exists in the market, in spite of the need for technology in the highly competitive world of winemaking. The two main novelties are that the robot will be able to navigate any standard vineyard for at least four hours without human intervention (at present there are no commercial robots that can be left alone in outdoor fields for a timeframe longer than a demo duration of several minutes), and at the end of the monitoring mission, the robot will provide a set of crop maps of agronomical parameters in a compatible format to be easily displayed in regular computers and smartphone-like devices. The VineRobot is generally targeted at the people who make crucial decisions about the vineyard’s management or provide consultancy to grapegrowers and winery managers. The main potential impact for end-users involves several ▶ aspects:

www.wine biz. com . au

V I T I C U LT U R E

VINEYARD INNOVATIONS

• end-users will draw clear economic and environmental advantages from using the scouting robot, as they will optimise vineyard inputs and management costs • the fast and versatile display of the crop maps makes the robot a flexible and powerful decision-support tool for making educated decisions based on measurable data. The use of the scouting robot and the immediate display of valuable information on the robot or, alternatively, on smartphone-like devices will promote advanced business operations. In general, the robot is intended to provide final users with the following benefits: • reasonably accurate yield forecast and consistent grape yield estimations on one hand, and quality improvements on the other hand, thanks to optimised crop monitoring and advanced vineyard management • continuous and accurate vineyard agronomical, physiological, and grape quality information to better cope with the impact of climate change and global warming on grapegrowing

• optimisation of the labour demand and costs for vineyard management • more sustainable vineyard management with optimisation of chemical inputs (i.e., fertilisers, fungicides and pesticides for disease and pest control) and improved use of natural resources (water) • meet industry and community expectations, as well as government regulations on environmental vineyard management and long-term sustainability. The project consortium involves eight partners: five SMEs, located in three European countries (Italy, Spain, and France), and three research and technology development providers in two countries (Germany and Spain). Also involved in the project is The University of La Rioja (Spain) which is coordinating the project and the University Geisenheim Hochschule (Germany), the Polytechnic University of Valencia (Spain), the French company FORCE-A—dedicated to the production of non-invasive sensors, Les Vignerons de Buzet—a major wine production and winemaking corporation located just to the south-east of the Bordeaux region of France, Wall-Ye (France) which has developed one of the first

robots in agriculture, the Italian firm SIVIS—leader in machine vision and surveillance and reconnaissance systems, and the Spanish SME Avanzare—dedicated to the creation of advanced sensors. The project deals with the fields of precision viticulture and robotics and is also a novel technological challenge, since it represents a large step forward in agricultural robotics and the application of advanced noninvasive proximal sensing to provide reliable, fast, objective information that is state-of-the-art from vineyards to grapegrowers. Therefore, the robot will help viticulturists and winemakers in making management decisions concerning vineyards and wine quality. ACKNOWLEDGEMENT The work leading to these results has received funding from the European Union under grant agreement WVJ nº610953.

The wine industry’s leading online job site

Are you looking for staff? Don’t waste time wading through hundreds of job applications that have no relevance to the role you are seeking to fill. List your next employment ad with the service that is used by thousands in the wine industry. Contact Andrew Dawson on +618 8369 9523 or email jobs@winebiz.com.au Post your ad online at winejobs.com.au

Ph +618 8369 9500 Fax +618 8369 9501

www.w i n eb i z .c om.au

Email info@winetitles.com.au www.winebiz.com.au

created and managed by

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

TRUNK DISEASES

V V II T T II C C U U L LT T U U R R E E

A sub-standard standard By Richard Smart Smart Viticulture. Email: richard@smartvit.com.au

Richard Smart says the recently-developed national standard for grapevine propagation material does little to address the spread of grapevine trunk diseases. In the pages that immediately follow, we then present a series of responses from various organisation and people with a specific interest in vine planting material and trunk diseases in Australia who we invited to comment on Richard’s observations. INTRODUCTION There is no doubt that the world’s vineyards are facing a potential crisis from trunk diseases, as they are said to occur in every grapegrowing country. At the moment there is no agreed control, and these fungal diseases are spreading in mature vineyards, sometimes making them unprofitable at early ages of less than 20 years. There is a marked varietal susceptibility and Sauvignon Blanc is especially sensitive. Worse still, it appears man is the principal vector spreading the grapevine trunk diseases (GTD) vineyard to vineyard, in particular the ‘nursery man’. It is hard now to find a young grafted vine free of grapevine trunk disease symptoms of one form or another, wherever I look. Over the last few years I have seen trunk disease infestation of young and mature plantings, and symptomatic young grafted vines, in the UK, Italy, France, Japan, China, Myanmar, Norway, Belgium, Thailand, Philippines, Australia and New Zealand. I am completing the writing of this article while in Rioja, Spain. Yesterday I demonstrated GTD symptoms in both rootstock and scion of young, grafted vines to a grower just about to plant. He said, “This cannot be disease. They are from the second largest nursery in the world. They are certified. I hope this is not disease in my new babies”. Worse still, in most regions, the growers are unaware of the problem and do nothing as the vines continue to die. In early stages, GTD are quite insidious, some without foliar symptoms. In terms of dealing with the problem, the most proactive region I have visited is the Barossa Valley, where as a result of the SARDI Eutypa and now Botryosphaeria awareness, trunk renewal is being employed. This also applies to a few New Zealand vineyards. In my opinion, a combination of trunk renewal along with pruning wound protection offers the best hope of controlling trunk diseases in mature vineyards. But what of the equally widespread problem in grapevine nurseries which are producing infected planting material? While some of these young vines may perform well in early years, they are very susceptible to stress. In any event, they are the principal source of infection for new vineyards, as has been demonstrated in Australia (Whitelaw-Weckert et al. 2013). Many studies around the world have indicated that mother vine source blocks, especially for rootstock cuttings, are the principal sources of trunk diseases in the grafting process (see Gramaje and Armegnol 2011). Soaking in the nursery has been found to be an important source of cross contamination. Hot water treatment of 50°C for 30 minutes has been shown effective against some trunk disease pathogens. While this is best done before grafting, I have seen evidence of further trunk disease infection during trimming after lifting the dormant plants from the field nursery. Imagine my relief when I discovered that Australia was to publish a national standard for grapevine propagation material. I thought that this problem would be solved, at least ▶ for Australia. V3 0N 3

Figure 1. Sauvignon Blanc vines killed by trunk disease in the grapevine collection at Nuriootpa, in South Australia’s Barossa Valley. It is a susceptible variety to grapevine trunk diseases.

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

V I T I C U LT U R E

TRUNK DISEASES

DISEASE-FREE CUTTINGS FOR PROPAGATION

AUSTRALIAN GRAPEVINE COLLECTIONS, THEIR SORRY STATE

A likely important factor in the global problem with infected planting material is the fact that many source vine blocks are now a couple of decades old. This coincides with the previous availability of virus-tested planting material. Rootstock mother vines are invariably spur pruned, and in Europe are often trained low to the ground with shoots/canes sprawled on the soil. In Australia some mother vines are trellised. As I understand it, wound protection of the mother vines against trunk diseases is very uncommon at winter pruning, so these ‘middle aged’ rootstock mother vines are most likely infected with GTD, and are the major source of the infected cuttings. It has been shown that rootstock shoots are infected during the growing season and, further, that dormant cuttings taken in wet weather allow further infection to occur. It seems to me that the problems of avoiding diseased cuttings will not be resolved until there are successful protocols for mother vine management. If the mother vine source blocks are to be replanted, where might the disease-free planting material come from? This is an important question, especially in Australia, and has been the subject of considerable recent review. This issue concerns the management of grapevine germplasm collections in Australia, and their disease status, among other attributes.

Back in the 1960s, ‘70s and ‘80s there were a range of state viticultural research stations, all of which had variety collections (I recall harvesting the first Chardonnay vines at Griffith in the mid 1960s for experimental winemaking by Glen McWilliam). There were extensive collections at CSIRO Merbein to support Alan Antcliff’s breeding program, and at Nuriootpa because of the interest of Richard Cirami. Now some of these stations are closed, and others have severe funding restraints. The various vine improvement groups have also established ‘source blocks’ to support their activities, but they are reliant on cutting sales, and so are currently strapped for funds. There is no national register of grapevines in Australia; I did one for New Zealand in 1989 or so, but do not know if it has been kept up. The status of Australia’s grapevine collections was reviewed by McMichael, Hamilton and Tassie in GWR 1112, (then GWRDC funding, February 2013), and significantly it compared the Australian grapevine situation with other perennial crops, and with international grapevine collections. The Australian grapevine situation performed poorly in this comparison. More recently a report chaired by WGGA (GWR 1401, September 2014) made out a case for a strategic oversight of Australia’s grapevine foundation assets, proposing the

Figure 1. Delegates to the International Grapevine Trunk Disease Workshop held in Adelaide late last year observing symptoms of grapevine trunk diseases in one of two of Australia’s important grapevine variety collections – the first is located at Nuriootpa, South Australia, and is owned by the South Australian Research and Development Institute (pictured), while the other belongs to CSIRO and is based at Koorlong, in Victoria.

www.w i n eb i z .c om.au

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

Australian Grape and Wine Authority assume national oversight. Australia has two major grapevine collections, one belonging to CSIRO at Koorlong (1100 entries of varieties/ clones), the other to SARDI at Nuriootpa (750 varieties/clones). Both, sadly, are now closed to the public; the CSIRO one for fear of litigation over misnaming (remember the Albarino/Savagnin debacle?), and the SARDI one for reasons unknown, but I can guess. Please read on. During the November 2014 International Council for Grapevine Trunk Disease (ICGTD) workshop, there was a field trip to the Barossa Valley, with the first stop at the Nuriootpa Viticultural Research Station, in Nuriootpa. We were there to visit the grapevine collection, not to admire its diversity, but unbelievably, and sadly, to observe the way that the collection was being ravaged by GTD, eutypa and, I assume, botryosphaeria. In fact, this collection is used as a study site of variety susceptibility to GTD. How paradoxical! A vine collection nominally of ‘disease-free’ plants, being used to study GTD! By the way, I saw no virus symptoms, but there were many vines killed by GTD, see Figures 1 and 2. Virus is a much overstated problem now in Australia. There is no mention of this sorry state of affairs in the GWRDC studies mentioned above (and why not? did they visit?), and one can only wonder about the situation at the CSIRO collection. AUSTRALIAN GRAPEVINE PROPAGATION MATERIAL STANDARD In a somewhat parallel move, Peter Hayes was funded by GWRDC (GWR 1002, September 2013) to develop an Australian Grapevine Propagation Material Standard. For unexplained reasons, the proposed standard was incorporated in the Standards Australia portfolio. One important implication is that the standard is not freely available. It costs $165 for three copies from the website www.standards.org.au. This was a strange decision by GWRDC (now AGWA), and I cannot imagine what might be the benefit of not making the standard freely available on its website. The standard preparation follows the Standards Australia procedure and format, which seems bureaucratic. The standard claims to provide requirements on: • establishing and maintaining the variety, provenance (origin and selection history) and health of grapevine propagation material • classification of material according to fitness for the purpose of propagation and/or vineyard establishment V30N3

TRUNK DISEASES

• documentation, including traceability, classification and labelling of propagation or material. The plan in itself did not allow for accreditation but suggests it is suitable for third-party accreditation, or for selfassessment. The document is 13 pages long plus nine pages of appendices. Of these, all but one part in five of the first, and all of the remaining six appendices are already in the public domain. One wonders why it is necessary to pay for them? The one part of the first not in the public domain is another Standards Australia document on sampling procedures, costing $220 for three copies. Ouch. Since the document is concerned with grapevine health and fitness for purpose for vineyard establishment, there may be a solution to the Australian problem of grapevine trunk disease-infected propagation with grafted grapevines. This is not so. There is an incomplete list of grapevine trunk disease fungi listed in ‘Definitions’ under ‘wood decay’ on page 6. Also, on page 24, in Appendix E, grapevine propagation material specifications for dormant cuttings, at E.2.3.d, says… ”No evidence of brown or black discolouration due to healing damage or fungal/bacterial contamination.” This would include the staining typical of GTD found at the base of rootstocks, and below and above the graft union. On this basis, I am yet to see any one-year-old grafted vine in Australia that passes this test. But I do not see them all, obviously. The test is destructive. This grapevine propagation material standard is overly obsessed with the problems of correct nomenclature, by DNA testing, and virus infection. The major present problems in the Australian grapevine nursery sector are trunk diseases, yet they are effectively ignored. The GWRDC paid substantially for this report, and maybe for Standards Australia involvement, of that I do not know. So far as I can see it has been a waste of money. The authors claim a need for a two-year review to incorporate new methods of virus testing. Sounds like a good income stream for consultants. Let us hope that GTD will be appropriately addressed as well. What I do know is that this standard does not help Australian grapegrowers purchase disease-free vines for planting. It seems clear that reviving Australia’s wine fortunes will require planting new varieties in hot regions, or plant new cool regions. New plantings will be required, and they should be of high health. This standard will not help that. How well are other countries meeting this challenge? Here I can only speak of New Zealand. NEW ZEALAND GRAFTED GRAPEVINE STANDARD This standard was first introduced in 2006, and has been amended four times since. It is freely available on the New Zealand Winegrowers (NZW) website (http://www.nzwine.com/ info-centre/grafted-grapevine-standard-3/). This document also emphasises correct identity, as well as virus disease. The latter focusses on GLRaV-3, as this mealy bug-vectored virus has caused major problems. To New Zealand’s great credit, this virus appears to now be under control in the Gimblett Gravels region, an effort involving scientists, NZW funding, good education and grower cooperation to remove infected vines and replant. The standard is also strong on sampling procedures. Regrettably, the standard is also weak on GTD, but that is due to change with the new version, to be released in 2015. As well as revising the standard, there is a GTD protocol being developed, based on a scientific literature review. Good on the Kiwis. Will they be the first to produce asymptomatic

V3 0N 3

V I T I C U LT U R E

grafted vines commercially? Maybe. Their nurserymen were well represented at the Adelaide meeting of the International Trunk Disease Workshop, in November 2014. CONCLUSION This is a sorry state of affairs for Australia. Let us hope that AGWA responds appropriately to Wine Grape Growers Australia, and that someone with knowledge of the issues, and some funding, takes control. For now, it is a debacle that reflects poorly on the national grape and wine sector and its organisation. Let us hope that AGWA can do better than GWRDC before it. I realise that most nurserymen are taking every care to produce healthy plants. However, many are choosing to ignore trunk disease symptoms. I cannot imagine a more important research topic worldwide than to develop protocols for nursery mother vine management, which will eliminate the production of diseased grafted plants. Australia could and should be part of such an international effort. LITERATURE CITED Whitelaw-Weckert, M.A.; Rahman, L.; Appleby, L.M.; Hall, A.; Clark, A.C.; Waite, H. and Hardie, W.J. (2013) Co-infection by Botryosphaeriaceae and Ilyonectria spp. fungi during propagation causes decline of young grafted Grapevines. Plant Pathology 1-12. Gramaje, D. and Armegnol, J. (2011) Fungal trunk pathogens in the grapevine propagation process: potential inoculum sources, detection, identification and management strategies. Plant Disease 95:1041-1055. WVJ

Strainer Posts & Trellis Lines Build and maintain with the most ideal combinations

Spend minimal time, effort & money Highly acclaimed by large and small growers for the last 20 years Twitcher™ Wire Strainer

Screw Anchor Patent No. 54447/01

Greatly Improved

Now in High Tensile

TM 801886

Build & Strain with the Twitcher Vineyard, Orchard, Netting etc. (So simple!)

Build and positively secure End Posts and Assemblies (Where all else fails!) Anchors now all High Tensile rod and Plate. Plate sizes: 6” 8” and 10”

Freecall Today 1800 501 657

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.krieslco.com.au krieslco@tpg.com.au

www.wine biz. com . au

V I T I C U LT U R E

TRUNK DISEASES

Over the next five pages we present a series of responses from various individuals and organisations with a particular interest in the vine planting industry and trunk diseases in Australia who took up our invitation to comment on Richard Smart’s article that appears on pages 43-45 in this issue.

Supportive of raising awareness of trunk diseases and adoption of protocols for mother vine management By Vine Industry Nursery Association

runk diseases are present in grapevine plantings around the world. The extent of the presence of trunk diseases in grapevine plantings, however, is not known. Whether the infection/expression rate has reached the economic threshold requiring amelioration and/or replanting has not been determined. Anecdotes about certified vines in vineyards overseas raises the matter of planting material ‘certification’ in Australia and what this means in practice. In Australia, there is no national certified standard for grapevines. The Australian Grapevine Propagation Material Standard does set minimum health status for compliance with the standard, but does not imply certification of material that has met the standard. The supply chain for planting material has at least two stages and sometimes more than two. The first stage is with the source areas that supply nurseries with propagation material. Nurseries utilise the material from source areas to propagate planting material. Nurseries work with the material they are supplied with and do so in the belief that source area managers have ‘rouged out’ off types and diseased material. In general, source area managers have done a good job identifying off types and virus-affected planting material. ELISA and PCR testing have been utilised to achieve source areas that are largely virus free and true to type, save human error and the odd mix-up at supply level that does happen from time to time. There is no such non-destructive molecular test available for trunk diseases. Trunk diseases can be asymptomatic and not possible to detect from visual, non-destructive testing. Herein lies the problem for source area managers and their clients, the nurseries. The Vine Industry Nursery Association (VINA) recognises that there is a need to tackle the incidence of trunk diseases in planting material and has taken a proactive approach in minimising the possibility of infected material being supplied to members’ clients. VINA represents the interests of member vine nurseries, some of which are VINA accredited and audited annually, and some of which are not accredited. There is often confusion about ‘accreditation of nurseries’ and ‘certification of planting material’. Accreditation provides an audit trail of material used in grapevine propagation. All material used in propagation is traceable back to source. VINA accreditation is also based on an audit of operating procedures of source areas and nurseries verifying procedures have been followed. Accreditation does not give certified status to the

www.w i n eb i z .c om.au

material produced by accredited nurseries. This is a common misconception. VINA makes the following recommendations in dealing with the incidence of trunk diseases in planting material: • development of a non-destructive diagnostic test for trunk diseases • development of protocols for the management of trunk diseases in source areas that minimise the chances of infected spores accessing untreated entry point wounds • development of protocols to minimise the opportunity for trunk disease spores to gain entry to vines in established vineyards • adoption of hot water treatment for 30 minutes at 50°C for all propagation material pre-processing (grafted or own rooted material) • adoption of hot water treatment for 30 minutes at 50°C for all bare-rooted dormant propagation material pre-delivery • establishment of a national register of commercial source areas, whether vine improvement group or privately operated • licensing of commercial source areas incorporating testing and inspection. Buyers of propagation material should identify suppliers that are VINA accredited in the first instance. Secondly, it would seem prudent for buyers to specify hot water treatment of material before propagation and pre-delivery of dormant bare-rooted material. Buyers should be aware that nurseries cannot guarantee the health status of the material they supply. Nurseries are reliant on source area managers providing clean, true-to-type material and are offered no guarantees of this from their suppliers. A trunk diseases working group was formed at the Technical Conference in Sydney, 2014. This group is looking at ways and means of reducing the incidence of trunk diseases in planting material and ameliorating the effects in established vineyards. VINA supports the move to raise awareness of the impact of trunk diseases and to encourage the adoption of the protocols suggested above. VINA is in the process of developing a ‘nursery and source area best practice’ publication to give some direction to the grapevine propagation sector in ways to limit the incidence of problems such as trunk diseases.

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

TRUNK DISEASES

V I T I C U LT U R E

AGWA committed to grapevine trunk disease research By Andreas Clark, Chief Executive Officer, Australian Grape & Wine Authority

he Australian Grape and Wine Authority (AGWA) is the single statutory service body for the Australian grape and wine community. Our priorities are directed by the Australian wine community. We coordinate and fund grape and wine research and development and facilitate the dissemination, adoption and commercialisation of the results. One of our priority research areas is investigating grapevine trunk diseases. GRAPEVINE TRUNK DISEASES Over the last 10 years, we have provided $1.8 million in funding to six research projects investigating the various types of grapevine trunk diseases that can affect vineyards across Australia. As a result of this research, new forms of treatment for grapevine trunk diseases – such as eutypa dieback – have been developed and results have helped to create awareness and drive further research. We support the dissemination of critical information about grapevine trunk disease management through various approaches, including vineyard walks and workshops held across Australia. We also sponsored the 9th International Workshop on Grapevine Trunk Diseases that was held in Australia last year, which brought Australian and international researchers together to share the latest research and development outcomes.

AUSTRALIAN STANDARD FOR GRAPEVINE PROPAGATION MATERIAL The Australian Standard for Grapevine Propagation Material was developed with funding from the Grape & Wine Research & Development Corporation and substantial in-kind input from members of the wine community. The standard was initially designed to ensure varietal authenticity, and phytosanitary status was added to the project as vine health was recognised as an important issue with evolving diagnostics and treatments. Providing a ‘best practice’ model through the standard helps to ensure that vines purchased from nurseries meet set expectations. However, it is now up to nurseries to adopt and for customers to require planting material that meets the standard. The standard is, of necessity, a consensus-framed document involving all key interests and with proposed mechanism to update it, as informed by R&D and experience. It is our intention to revisit and update the standard in future. As the standard is administered by Standards Australia, we cannot make it freely available through our website. However, we will continue to provide funding to grapevine trunk disease projects and other aspects of grapevine germplasm and disseminate this information to Australian grapegrowers. Naturally, our priority areas remain critically important to us and we welcome continuing public discussions in these areas.

Keeping it all in perspective By Nuredin Habili, Waite Diagnostics. Email: nuredin.habili@adelaide.edu.au

oth eutypa dieback and botryosphaeria cane dieback (and a number of similar fungi) are wood-inhabiting fungal diseases and, in the grapevine, these are collectively named grapevine trunk diseases (GTD). GTDs cause a steady decline in vine vigour until the vines are no longer economical. Vineyard hygiene, especially at the nursery level, is important to reduce the damaging effect of these fungi. Treating dormant cuttings by dipping into hot water at 50°C for 30 minutes has given great rewards. This protocol is being practised by qualified nurserymen, especially around the Barossa Valley. The trick is that those cuttings that are hidden within a bunch must receive the uniform temperature of 50°C. This therapy will either eliminate or reduce the infection level of not only the GTD agents but also of Australian grapevine yellows phytoplasma and agrobacterium which cause crown gall (see figure). Hot water treatment can increase the average life of a vineyard by decades. Based on my experience, I know that eutypa in Shiraz is very bad in blocks with shallow soils in a number of viticultural regions in South Australia where water logging in winter or spring is a problem. We would need to do a lot more survey work on how widespread these trunk diseases are in Australia. I remember Richard’s strong views on Australian grapevine yellows phytoplasmas back in the ‘90s. As in the past, he has no real hard evidence for most of his claims. He visited a vineyard in the Barossa Valley back in November 2014 accompanied by a number of delegates from the International GTD Workshop in Adelaide. V3 0N 3

The culprits of these grapevine diseases can be fully or partially eliminated from dormant cuttings by hot water treatment: A & B, Grapevine Trunk Diseases (e.g., Eutypa); C, Crown Gall caused by Agrobacterium vitis; D & E, Australian grapevine yellows caused by ca Phytoplasmas australiense. It is important to know that this treatment cannot get rid of viruses. In his current article he wrote that he did not see any virus symptoms. It is important to emphasise that most grapevine viruses express symptoms late in autumn rather than in spring (November), the time he visited the eutypa-affected vineyards. Last, but not least, while GTD can spread by contaminated pruning tools, including mechanical harvesters and pruners, ▶ viruses cannot spread via this route.

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

V I T I C U LT U R E

TRUNK DISEASES

Trunk disease risk management: current practices By Nick Dry, Manager, Yalumba Nursery

n our experience there is no ‘silver bullet’ for controlling grapevine trunk diseases (GTD) in planting material; instead, control of GTDs are achieved through a cumulative reduction in risk. Our practices are built around limiting the three points of entry for trunk disease: in the rootstock and scion (from the mother vines), through contact with infected soil in the field nursery and through infection through the wounds (i.e., graft union) during the propagation process. Outlined below is a summary of our current practices. MOTHER-BLOCK MANAGEMENT We grow our rootstock mother blocks in a dry, low rainfall climate (Riverland). They are trained on a high trellis (approximately 800mm from the ground) to help limit soil surface pathogen contamination. The vines are head trained and spur pruned. As a rule large pruning cuts are avoided and taking cuttings during rain events is rare. As a standard practice Phos-acid is applied as a foliar application and through fertigation at least once a season, which helps to stimulate the plants’ natural defence mechanisms. NURSERY HYGIENE • cuttings are soaked in Sterimax (didecyldimethylammonium chloride-active is 180ppm) prior to cool storage • all water is chlorinated including hot-water treatment tanks at 10ppm • hot water tanks emptied at least weekly • Sterimax hydration tanks emptied daily • cutting hydration tanks emptied after every cage (used to leach out Sterimax pre-grafting) • rootling hydration tanks emptied daily • limit water in process i.e., scion not cut into water • grafting occurs indoors in a dust and contaminant limiting environment.

• pre-grafting: 50°C for 30 minutes for both scion and rootstock • rootlings: 52°C for five minutes. FIELD NURSERY MANAGEMENT • 3-year rotation • use of Phos-acid (foliar applications x 2 and fertigation x 2) which helps to stimulate the plants’ natural defence mechanisms TRUNK DISEASE RISK MANAGEMENT: OPPORTUNITIES Yalumba Nursery is continually looking at ways of reducing the potential of spreading trunk disease pathogens through our planting material. The recent trunk disease conference held in Adelaide highlighted a number of practices that we are now looking to employ to further reduce risk to our customers. These include: • treating established mother vines and dipping of cuttings in fungicides known to be effective against botrysphearia • establishing new rootstock mother vine plantings using ‘clean’ planting material • trialling increased hot water treatment temperatures for cuttings and rootlings • dipping of grafted vines in fungicide pre-callusing to reduce the potential for infected graft unions • trialling methods in the field nursery to reduce soil pathogen levels. There are currently no non-destructive tests for GTDs and, so, we have found it difficult to establish an effective protocol for sampling and observing potential GTD symptoms in our planting material. The proof that Yalumba Nursery is supplying ‘healthy’ vines is based on their performance in the field and the positive feedback we receive from our customers.

HOT-WATER TREATMENT Hot water treatment is proven to be the most effective control for all three GTD pathogens. Currently, Yalumba Nursery uses the following regime:

Trunk diseases: back to basics with plant pathology By Sandra Savocchia and Regina Billones-Baaijens, National Wine and Grape Industry Centre, Charles Sturt University, School of Agricultural and Wine Sciences, Wagga Wagga, New South Wales 2650

n response to Dr Smart’s article, while we tend to agree with many of the points highlighted, we take this opportunity to highlight some of the gaps we believe are present in the area of grapevine trunk diseases (GTD) and that would assist in informing the Australian Grapevine Propagation Material Standard. Botryosphaeria dieback (BD) and eutypa dieback (ED) are serious diseases of grapevines worldwide, causing cankers, dieback and eventually death of vines. These GTDs rank in the top five priority diseases of the Australian winegrape industry (Scholefield and Morison 2010). Over the last 15 years or so, investigations of GTD pathogens in nursery plant materials focussed mainly on Petri disease (formerly known as black

www.w i n eb i z .c om.au

goo) and black foot disease causing young vine decline (YVD) in nurseries and young vineyards. The studies by Edwards et al. (2004) and Whitelaw-Weckert et al. (2013) reported a number of GTD pathogens including YVD pathogens in young grafted vines and propagation materials. However, to our knowledge there have been no detailed studies to investigate their role in vineyard infections in Australia. Information on the prevalence and distribution of BD pathogens in Australian nurseries is also lacking. Therefore, there is an urgent need to investigate the presence of these and other pathogens in Australian nurseries and to understand their potential spread within the nursery system and, eventually, vineyard.

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

TRUNK DISEASES

A grapevine nurseries study conducted in New Zealand (NZ) from 2008-2011 is, to our knowledge, the first comprehensive study into infection by BD pathogens in propagation materials and young grafted plants. The study assessed samples from nine commercial nurseries and showed that 23% of symptomatic and non-symptomatic young grafted plants and propagation cuttings were infected by the same Botryosphaeriaceae species commonly found in NZ vineyards (Billones-Baaijens et al. 2013a). The sources of BD infections were also investigated in three commercial nurseries by analysing one-year-old dormant canes, nursery wash water, callusing media and tools using conventional methods and molecular tools (Billones-Baaijens et al. 2013b). Dormant canes from the mother vine blocks without visible symptoms tested positive to BD pathogens and were externally contaminated with spores of BD pathogens. However, these spores were only detected in minimal quantities in the propagation system suggesting that current sanitation practices in these NZ nurseries are effective in reducing the spread of BD pathogens during the grafting process, possibly through cuttings being washed/disinfested prior to cold storage. Furthermore, genetic studies using DNA fingerprinting also showed that while some Botryosphaeriaceae species may be introduced to vineyards through infected plant materials, other species may originate from existing vine infections within the vineyards or from other hosts surrounding the vineyards (Billones-Baaijens et al. 2014). GTD pathogens have been isolated from extensive surveys of established vines across South Australia and New South Wales and, in many cases, the infection had clearly originated from large mechanical or pruning wounds and not from infected nursery material (Qiu et al. 2011, Pitt et al. 2010). The studies conducted in Australia by Qiu et al. (2015) and Wunderlich et al. (2012) corroborate the findings conducted in NZ as they also showed that BD pathogens isolated from established vines are also genetically variable suggesting that the entry point of infections is more complex than possible entry only from nursery material. This area still requires further research. Further experiments in NZ investigated the processes of disease development by assessing the presence of BD pathogens in the shoots of mother vines, which provided the cuttings for propagation. Multiple species and individual strains within a species in any shoot and randomly distributed along individual shoots were found (Billones-Baaijens et al., 2015) indicating multiple sources of infection, probably from externally dispersed spores, rather than endophytic spread of an infection from the mother vine. However, most of the infections were sited within the bark and had not progressed into the adjacent wood, suggesting that they were latent or dormant in surface tissues, possibly waiting until they could infect the wood through wounds. Plants and cuttings with latent infections, but no obvious symptoms, are likely to pass through the nursery grading process undetected and be sold unwittingly to growers. However, there is still a need to investigate whether these latent infections will actually result in infected plants within a vineyard. Edwards (2006) reported that newly-planted vines have the potential to recover from Petri disease if management practices that reduce stress are implemented. Delaying water stress regimes and avoiding heavy crop loads for the first three to four years following establishment could assist in these vines becoming well-established and symptomless if other management strategies such as the protection of pruning wounds for GTD pathogens are also implemented. In addition, water stress and nutrient deficiencies are reported to increase infections by BD pathogens (Amponsah et al. 2014, Qiu 2015). It is therefore possible that when planted into vineyards, asymptomatic young vines may encounter stresses that can lead to manifestation of the damaging symptoms. However, the stress factors that can trigger a latent infection to become actively pathogenic and

V3 0N 3

V I T I C U LT U R E

the mechanisms of pathogen colonisation also require further investigation. An understanding of how latency becomes active and the development of control strategies that target external pathogen propagules (bark infections) is therefore necessary for the improvement of nursery practices that will minimise the spread of disease. SUMMARY The studies conducted in both NZ and Australia have contributed to the global understanding of the pathways of infection of BD pathogens and other GTD pathogens. However, these studies also raised further questions including how these nursery infections relate to current vineyard infections. While in many cases, vines become diseased in the presence of a pathogen, favourable environmental factors must also occur for the disease to develop. Understanding the biology of these pathogens, particularly the latent-to-active stages of their lifecycle, will enable us to develop integrated control strategies for use at the nursery level. If we can minimise factors that trigger active infections we will have a greater chance of resolving the problems of GTDs before they reach the vineyard. As with any standard, the Australian Grapevine Propagation Material Standard requires continued improvement that is informed by appropriate scientific evidence. While the Fit Vine app developed at the NWGIC for mobile devices is a step in the right direction for assessing the quality of vines prior to planting, continued scientific input is required for its maintenance. Currently we believe there are significant gaps in our scientific knowledge of the role of GTDs in nursery systems which require a concerted effort to address. Researchers at the NWGIC have been studying GTDs for more than 12 years and we believe we have the experience and are well ▶ placed to lead any future research in this area.

The most up-to-date, relevant information to support decision-making for SA grapegrowers Global economic outlook and trends Expected demand by variety Analysis of grape prices, wine sales figures and vineyard land values Seasonal conditions forecast for 2016 Issues and opportunities for sustainable vineyards PLUS showcase of local vineyard innovations and presentation of inaugural WGCSA “Vinnovation Award” Standard

Earlybird

WGCSA members

Prices

$125

$110

Others

$190

$165

More information: wgcsa.com.au or phone 8351 4378

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

@winegrapessa

www.wine biz. com . au

V II T T II C C U U L LT T U U R R E E V

TRUNK DISEASES

REFERENCES

Plant Pathology 135:175-185.

Amponsah, N.T.; Jones, E.E.; Ridgway, H.J. and Jaspers, M. (2014) Factors affecting Neofusicoccum luteum infection and disease progression in grapevines. Australasian Plant Pathology 43:547-556.

Billones-Baaijens, R.; Ridgway, H.J.; Jones, E.E. and Jaspers, M.V. (2013b) Inoculum sources of Botryosphaeriaceae species in New Zealand grapevine nurseries. European Journal of Plant Pathology 135:159-174.

Billones-Baaijens, R.; Ridgway, H.; Jones, E.E. and Jaspers, M.V. (2015) Spatial distribution of Neofusicoccum species within a rootstock mother vine indicates potential infection pathways. European Journal of Plant Pathology 141:267-279. Billones-Baaijens, R.; Baskarathevan, J.; Jones, E.E.; Jaspers, M.V.; Cruickshank, R.H. and Ridgway, H.J. (2014) Genetic analysis of Neofusicoccum parvum and N. luteum isolates from nurseries and vineyards indicates different infection sources. Paper presented at the 9th International Workshop on Grapevine Trunk Diseases, Adelaide, Australia. Billones-Baaijens, R.; Ridgway, H.J.; Jones, E.E.; Cruickshank, R.H. and Jaspers, M.V. (2013a) Prevalence and distribution of Botryosphaeriaceae species in New Zealand grapevine nurseries. European Journal of

Edwards, J. and Pascoe, I.G. (2004) Occurrence of Phaeomoniella chlamydospora and Phaeoacremonium aleophilum associated with Petri disease and esca in Australian grapevines. Australasian Plant Pathology 33:273-279. Edwards, J. (2006) Managing grapevine trunk diseases (Petri disease, Esca, and others) that threaten the sustainability of Australian viticulture. Final Report to the Grape and Wine Research and Development Corporation, Project CRCV 2.2.1. Pitt, W.M.; Huang, R.; Steel, C.C. and Savocchia, S. (2010) Identification and distribution of Botryosphaeriaceae species associated with grapevine decline and dieback in New South Wales and South Australia. Australian Journal of Grape and Wine Research 16:258-271.

Qiu, Y.; Steel, C.C.; Ash, G.J. and Savocchia, S. (2011) Survey of Botryosphaeriaceae associated with grapevine decline in the Hunter Valley and Mudgee grape growing regions of New South Wales. Australasian Plant Pathology 40:1-11. Qiu, Y. (2015) The biology and epidemiology of the grapevine trunk disease pathogen Botryosphaeriaceae spp. PhD Thesis, Charles Sturt University. Scholefield, P. and Morison, J. (2010) Assessment of Economic Cost of Endemic Pests & Diseases on the Australian Grape & Wine Industry. Final Report to the Grape and Wine Research and Development Corporation, Project GWR 08/04. Whitelaw-Weckert, M.A.; Rahman, L.; Appleby, L.M.; Hall, A.; Clark, A.C.; Waite, H. and Hardie, W.J. (2013) Co-infection by Botryosphaeriaceae and Ilyonectria spp. fungi during propagation causes decline of young grafted grapevines. Plant Pathology 62:1226-1237. Wunderlich, N. (2012) Association and pathogenicity of Botryosphaeriaceae fungi on different Vitis vinifera tissue. PhD Thesis, Charles Sturt University.

An accurate summary of the issues By Helen Waite, Charles Sturt University, Wagga Wagga, New South Wales

ichard Smart’s article presents an accurate summary of the issues surrounding trunk diseases and the problems associated with their transmission in planting material. As he so rightly points out, the issues associated with germplasm and mother vine collections and management are fundamental to the production of high quality planting material. However, as he also points out funding and management of germplasm and source blocks is problematic, and for this reason cuttings that are supplied to nurseries frequently have latent trunk disease infections. Unfortunately these latent infections are asymptomatic and their capacity to act as a source of cross contamination in the nursery is largely unrecognised. Furthermore, nursery practices such as soaking cuttings in water favour cross contamination and whole batches of cuttings can become infected as they move through successive processes in the nursery. The recently published standard seeks to address these issues,

but as Smart notes, it is not comprehensive and is difficult and expensive to access and based on out-of-date research. The comment in Appendix G section C regarding soaking baths is of particular concern. There is no reason to soak grapevine material and good evidence to show that it is a source of contamination, even if the water is treated with a biocide. However, Australia is one of the few jurisdictions that have a standard. If the scope is widened and it is brought up to date and made more accessible it has the potential to be a very useful tool in the quest to improve the quality of planting material available to Australian growers. In the meantime, growers and nurseries wanting to evaluate the quality of planting material can download the free Fit Vine mobile app I have developed. Fit Vine guides the user through an assessment of dormant or green potted planting material that enables growers to determine if the vines in question are fit for purpose.

Discussions with industry around possible formation of an Australian national vine collection ongoing

As well as inviting the CSIRO to comment on Richard’s article, we also sought comment on the current inability of industry to access its grapevine germplasm collection in Sunraysia. By Rob Walker, Group Leader, Winegrapes & Horticulture, CSIRO Agriculture

hanks for the opportunity to address issues raised by Richard Smart’s article. As his article deals largely with the issue of the industry’s response, management and protocols related to trunk diseases we will leave it to more appropriate organisations to respond to the general issues raised. With regard to variety collections, CSIRO has previously contributed to industry discussions on the subject, including the following articles: • Thomas, M.R. and Walker,R. (2009) Evolution of grapevine variety collections in Australia. The Australian and New Zealand Grapegrower and Winemaker 545:78–80. • Arbuckle, K. (2012) Fresh calls for national clean plant network. The Australian and New Zealand Grapegrower and Winemaker 579:44.

Regarding your question about CSIRO’s vine collection, this was established in the 1960s as a research collection and remains a valuable source of material for research. This follows significant effort to relocate the collection to maintain its availability following the closure of our Merbein laboratory. The collection has provided a valuable resource for the work of many scientists at both the Merbein and Adelaide CSIRO laboratories. Numerous research projects undertaken with support from CSIRO, GWRDC and now AGWA have sourced material from the collection. Such projects will continue to deliver new varieties such as the winegrape Tyrian, new rootstocks such as Merbein 5489, and new information, for example, on variety and rootstock performance to industry. CSIRO continues to be engaged in discussions with industry relating to the possibility of formation of an Australian national collection. WVJ

www.w i n eb i z .c om.au

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

TRUNK DISEASES

V I T I C U LT U R E

Highlights from the 9th International Workshop on Grapevine Trunk Diseases By Mark Sosnowski, Convenor 9IWGTD, South Australian Research and Development Institute, PO Box 397, Adelaide, South Australia 5001. Email: mark.sosnowski@sa.gov.au

Mark highlights some of the more relevant presentations on trunk disease management presented at the 9trh International Workshop on Grapevine Trunk Diseases, held in Adelaide late last year.

he 9th International Workshop on Grapevine Trunk Diseases (9IWGTD) was hosted by the South Australian Research and Development Institute (SARDI) and the University of Adelaide (UA) at the National Wine Centre, in Adelaide, from 18-20 November 2014. Held in Australia for the first time, it showcased the Australian wine industryâ&#x20AC;&#x2122;s proactive methods for trunk disease management and provided the industry with an opportunity to learn the latest information and practical management strategies from around the world. The workshop, with support from the Australian Grape and Wine Authority (AGWA) and wine industry associated companies, attracted 111 delegates from 13 countries, with 48 industry delegates and 11 researchers representing the Australian wine industry. Seventy-one papers were presented on the latest knowledge from research around the world with sessions focussing on the fundamental and applied science underpinning research to develop practical management strategies. A field tour to the Barossa Valley provided delegates with insight into the proactive management of trunk diseases in Australia through research at SARDIâ&#x20AC;&#x2122;s Nuriootpa Research Centre, in a commercial vineyard and in the Yalumba nursery. Following are some of the highlights most relevant to trunk disease management for the Australian wine industry. IDENTITY AND DISTRIBUTION OF GRAPEVINE TRUNK DISEASES This session concentrated on new information from wine regions of New Zealand, Canada and Hungary. It highlighted the diversity of pathogens that exist in these regions and the differences between regions around the world in differing environments and climates. A macro-array technique is being developed in Canada to efficiently detect and quantify the large suite of pathogens responsible for grapevine trunk diseases around the world. Discussions between researchers in Australia

V3 0N 3

Delegates of the 9th International Workshop on Grapevine Trunk Diseases. and Canada have led to collaboration fast-tracking the development of the molecular detection techniques that will be applied in Australian research to assist in determining inoculum dispersal in different climatic regions. Presentations on inoculum dispersal in regions of California, Chile and South Africa revealed the prevalence of inoculum in young vineyards and rootstock and scion nursery mother vines, stressing the importance of early detection to encourage adoption of preventative practices. The timing of spore release tends to follow rainfall in most regions but seasonal patterns differ based on local climatic factors. This highlighted the importance of localised research to ensure appropriate recommendations are provided to Australian grapegrowers. Unmanned aerial vehicles are being evaluated for remote sensing as a predictive tool for the early stages of leaf stripe foliar symptoms of esca disease in Italy. This approach has correlated foliar symptoms from ground surveys with Normalised Difference Vegetation Index from aerial remote sensing, and

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

provides a research tool for analysing symptom spread and may provide a predictive tool for disease monitoring. The use of aerial remote sensing is being successfully applied for phylloxera monitoring in Australia and, together with other ground-based imagery analysis tools such as Greenseeker, there is potential for developing tools for monitoring dieback diseases to improve management strategies. CULTURAL MANAGEMENT Spanish research has shown that global recommendations for late pruning to reduce risk of infection do not apply in the Catalonia region. When comparing pruning in early autumn and late winter, followed by inoculation with botryosphaeria dieback and esca pathogens, it was concluded that the wound susceptibility period was significantly less for the early pruning than for the late pruning. Current AGWA research in Australia is examining the effect of pruning time on wound susceptibility to pathogens that cause eutypa and botryosphaeria dieback and

www.wine biz. com . au

V I T I C U LT U R E

TRUNK DISEASES

future research aims to expand this to climatically diverse regions around the country. Wounds caused by shoot thinning and watershoot removal have potential to become infected by trunk disease pathogens. According to South African research, many trunk disease pathogens, including those causing botryosphaeria dieback, were isolated from naturally infected grapevine sucker wounds, although eutypa dieback pathogens were not found. Artificial inoculation with the pathogens on potted vines in the greenhouse led to successful infection by all pathogens. This research confirms results previously reported from France, where the eutypa dieback pathogen was isolated from 2% of wounds resulting from shoot removal in spring. The risk of infection is much less than during winter pruning due to smaller wound surface area and decreased susceptibility, but avoiding shoot removal during rain periods is recommended to further reduce the risk. The potential role of secateurs or loppers in spreading trunk disease has been considered in recent Spanish research. The eutypa dieback fungus was not found on washings from blades used to cut infected wood, but other pathogens were present. Pruning wounds made with artificially inoculated blades led to infection by all pathogens tested, including those that cause eutypa and botryosphaeria dieback. Although there may be a small risk of spreading disease through pruning equipment, the use of a wound protection fungicide following pruning will counteract any risk of spreading pathogens. French research on the summer susceptibility of vines to botryosphaeria dieback pathogens showed the greatest infection at flowering, possibly related to the high metabolic activity in the inflorescences. These results arose from artificial inoculations so more research is

Seminar session at the National Wine Centre, in Adelaide. required to draw conclusions about natural infection in vineyards. Australian research is developing protective treatments for winter wound infection by trunk disease pathogens, some of which are fungicides also applied during summer for protection against foliar diseases. Therefore, it is possible that protection may be afforded for summer infection, although further research would be required to confirm this. PRUNING WOUND PROTECTION Australian research has confirmed the efficacy of a number of fungicides for the prevention of eutypa dieback, with Emblem® (fluazinam) recently registered in Australia for eutypa dieback control based on this research, and others in the process of registration. In addition the research has demonstrated the ability to apply fungicides to pruning wounds using commercial spray equipment, as long as they are applied with high water volumes and targeted to the pruning wound zone to ensure maximum coverage. This novel research, funded by AGWA, has gained much interest from researchers and industries around the world.

Visit to a commercial vineyard in the Barossa Valley.

www.w i n eb i z .c om.au

Furthermore, evaluation of Gelseal (tebuconazole) has shown its efficacy for control of eutypa dieback in both Australia and New Zealand and is in the process of registration. Fungicide evaluation for the control of botryosphaeria dieback and phomopsis in Portugal showed that following three years of application of Bion® (acibenzolar-S-methyl) + Cuprocol® (copper oxychloride) after pruning and then Bion® + Score® (difenoconazole) at growth stage C/D (leaf tip visible/first leaf separated from shoot tip) incidence and severity of disease were reduced compared with the untreated control. Spanish research showed that the greater the distance of the pruning cut above the node, the less chance that botryosphaeria dieback and esca pathogens successfully colonise below the node. Pruning wound protection by Trichoderma spp. was the subject of a number of presentations. In Hungary, Trichoderma was shown to colonise wounds effectively and reduce trunk disease symptoms. In South Africa, methods of application were compared, with hand application by paint brush

Mark Sosnowski demonstrating trunk disease symptoms.

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

TRUNK DISEASES

V I T I C U LT U R E

or backpack sprayer providing greater incidence of Trichoderma colonisation compared with a Gator sprayer. In Italy, application of Trichoderma to pruning wounds with a sprayer over several years led to reduced esca symptoms. In France, a registered Trichoderma product, Esquive®, was reported to provide control of a number of trunk diseases in several laboratory and field experiments. NURSERY PROPAGATION New Zealand researchers reported on the distribution of species that cause botryosphaeria dieback in rootstock mother vines. They concluded that vines were subjected to multiple infections from various sources and that most infection was found to be latent in the bark, with some fungi possibly moving into the wood. The link between latent infection in cuttings, thresholds and disease in established vines is yet to be determined and has been the basis of discussions at the workshop between Australian and international researchers for future collaboration. Two presentations on the use of hot water treatment (HWT) for controlling botryosphaeria dieback pathogens in propagation material provided contrasting results. In Spain, HWT (51°C for 30 minutes) significantly reduced survival of the artificially inoculated pathogen in plant material, with some species more susceptible than others. In New Zealand, HWT (50°C for 30 minutes) was ineffective at reducing infection of artificially infected vines, but performed better with naturally infected vines (57-100% control). Higher temperatures were more effective at reducing infection but also caused bud mortality. The Spanish study did not evaluate bud mortality. These studies reflect the potential issues experienced with HWT for controlling botryosphaeria dieback. It also highlights the importance of managing trunk diseases in mother vines to reduce the likelihood of infection in propagation material. The New Zealand study further evaluated the efficacy of soaking cuttings in carbendazim and tebuconazole fungicides for 30 minutes; this was shown to eliminate infection by botryosphaeria dieback pathogens in artificially and naturally infected cuttings. DISEASE RESISTANCE Germplasm collections in both California and Australia have revealed significant variation in symptoms of eutypa and botryosphaeria dieback. Furthermore, rooted and detached cane assays have confirmed a reduced rate of disease progress for some V. vinifera

V3 0N 3

Nick Dry describing propagation processes at Yalumba Nursery. varieties in both countries and less susceptible varieties are currently being evaluated in potted and mature vines in South Australia. Further work in Australia is also showing variation in rootstock genotypes and clonal material of Shiraz, Chardonnay and Cabernet Sauvignon, where future research efforts will be focussed. Research in California and France has revealed anatomical and gene expression differences between varieties with differing susceptibility to trunk disease symptoms. Current research by UA and SARDI researchers is investigating biochemical and anatomical differences between varieties of differing susceptibility to eutypa dieback. ECONOMICS An economic study of Californian vineyards has provided a strong case for early adoption of preventative practices for managing grapevine trunk diseases. It revealed that adopting practices such as delayed pruning, fungicide protection of wounds by hand and double pruning within the first three years of planting increased productivity to levels similar to a healthy vineyard over a 25-year lifespan. Spray application strategies developed in Australia would reduce costs of wound protection significantly compared with hand application and, therefore, lead to even greater economic return of the vineyard. Discussions between Californian and Australian researchers at the workshop may lead to collaboration to expand the Californian model with inputs from Australian production figures and research data. This would most likely provide an economic case for Australian growers to adopt recommendations early. Dr Kendra Baumgartner, of the US Department of Agriculture, will present more on the

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

Californian research at the upcoming ASVO seminar on vineyard longevity, in Mildura in July 2015. FINAL WRAP-UP In the final presentation of the workshop, the scene was set for the ensuing discussion forum, with a comparison between the worldwide experiences of phylloxera and trunk disease. It was suggested that lessons learnt from the phylloxera epidemic of the 19th century could assist in preventing an epidemic of similar proportions with trunk diseases. This message strengthened the importance of the worldwide research that was showcased at the 9IWGTD and that the International Council on Grapevine Trunk Diseases (ICGTD) continues to support it. In an Australian context, it highlights the advances that have resulted from over a decade of research in this country, providing practical and effective management strategies for trunk diseases. The workshop culminated in a forum which provided open discussion between industry participants and researchers. It highlighted the need for more research to address nursery propagation standards and provide industry with more confidence about planting material. It also recognised the advancements in grapevine trunk disease management strategies since the last workshop, and the great benefit of international collaboration through the ICGTD in addressing the diverse range of trunk pathogens and their associated diseases. For more information, abstracts from the 9IWGTD proceedings have been published in the international scientific journal Phytopathologia Meditteranea and are available as a downloadable PDF WVJ at www.icgtd.org

www.wine biz. com . au

V I T I C& U MARKETING LT U R E BUSINESS

PESTS & DISEASES

Grapevine Pinot Gris virus a tricky virus around the corner? By Nuredin Habili, Waite Diagnostics, University of Adelaide, Australia. Email: nuredin.habili@adelaide.edu.au

ynonyms Vitis vinifera cv. Pinot Gris and Pinot Grigio refer to the same variety of white winegrape (Figure 1). These may differ in their wine style, but both are the mutant of Pinot Noir. Pinot Gris originally comes from the north-eastern region of France (Alsace) and northern Italy. Its production in Australia started in the 1980s, but only in 2000 did it really gain prevalence. Cooler climate regions like the Mornington Peninsula, the Yarra Valley and the Adelaide Hills are the major Pinot Gris growing areas in Australia. According to the Australian Bureau of Statistics the production of Pinot Gris in 2012, compared with 2010, increased 28% and reached a total of 50,000 tonnes. The most popular clone of Pinot Gris in Australia is D1V7 which was imported from UC Davis. Since 2003 symptoms of stunting, chlorotic mottling and leaf deformation on Pinot Gris (Figure 2A) have been concerning winegrape growers in Italy. Since these symptoms were similar to those caused by the fanleaf group of viruses, Italian researchers initiated a program to test symptomatic vines for fanleaf and its related viruses but all the tests turned out negative. Tests for leafroll viruses and vitiviruses were also negative. With the advent of Next Generation Sequencing (NGS) techniques the virus was detected in Pinot Gris in 2012 by Giampetruzzi et al. by the deep sequencing of the virus-associated small RNAs present in plant samples. NGS can detect any pathogen whether it belongs to plant, fungi, bacteria, virus or viroids present in a complex diseased sample. This means that by performing a single test we can virtually identify the culprit of an unknown disease. The name of the virus described here comes from Pinot Gris, the variety in which the virus was first identified. Grapevine Pinot Gris virus (GPGV) is a trichovirus (tricho means hair; referring to the morphology of the virus particle) and is related to grapevine berry inner necrosis virus (GINV), which was reported from Japan by Yoshikawa et al. back in 1997. GPGV is not confined to Pinot Gris (Figure 2A). This virus has also

www.w i n eb i z .c om.au

been detected in a number of other varieties in Italy including Traminer (Figure 2B), Chardonnay, Pinot Noir and also in tablegrapes. In France, it has been reported from Merlot grafted on Gravesac rootstock in the Bordeaux region (Beuve et al. 2015). In a French vineyard collection the red variety Carignan, showing fanleaf-like symptoms, tested negative for fanleaf and other nepoviruses, but was positive for GPGV (Beuve et al. 2015). In Slovenia the virus was identified in the cultivars Pinot Gris, Sauvignonasse and Muscat Blanc. It appears that symptoms like those of GPGV are widely spread in Slovenia, as in one survey alone 40 out of 42 symptomatic vines contained this virus. Outside Europe, GPGV was found in South Korea (Cho et al. 2013) in the tablegrape cv. Tamnara, which showed berry necrosis symptoms similar to those caused by the related virus GINV. GPGV was also detected in the Czech and Slovak Republics, where the complete genome of three isolates of this virus has been determined (Glasa et al. 2014). Still not much research has been done on GPGV; even the mode of its transmission in vineyards is not known. Beuve et al. (2015) suspected the eryophid mite Colomerus vitis,

which is the vector of the related virus GINV. In Australia, Colomerus vitis can cause bud-axis necrosis and restricted spring growth when its numbers per bud reach more than 100 (Bernard et al. 2005). However, the foliar symptoms were not described by Bernard et al. (2005). GPGV has two distinct genetic groups. One group produces symptoms, while the other group is symptomless. One can claim that the symptomless group might be harmless to the grapevine. However, the consequences of its combined infections with other viruses are hard to predict. In molecular or proteomics terms, the symptomless group has a stretch of six extra amino acids in their movement protein. The significance of this feature is not known. We can differentiate between the symptomless and symptomatic isolates in PCR by using the following pair of primers in a molecular test currently in use by Waite Diagnostic: DetF (5’TGGTCTGCAGCCAGGGGACA3’) and DetR (5’TCACGACCGGCAGGGAAGGA3’) (Saldarelli et al. 2015).The primers were selected from the 3’ end of movement protein and the 5’ end of the viral coat protein (MP/CP) gene sequences. The size of the PCR product is 588 base

Figure 1. Bunches of Pinot Gris (clone D1V7) at the time of harvest. W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

PESTS & DISEASES

V U L BUSINESS V II T T II C C& U MARKETING LT T U U R R E E

Figure 2. Symptoms of Grapevine Pinot Gris virus on grapevine leaves: (A) cv. Pinot Gris and (B) cv. Traminer. Photos courtesy Dr Pasquale Salderelli, Bari University, Italy. pairs. All imported grapevine varieties undergo strict biosecurity assessment, including testing for GPGV. So far it has not been found in Australia. If this virus is detected in any imported variety it would be considered a biosecurity risk and be destroyed before being released to the environment. It is advisable that prior to sending propagating material to Australia, the importer asks for a PCR test done for GPGV and other exotic viruses using the diagnostic procedure described above. If you come across the symptoms like those in Figure 2, we highly recommend sending samples to Waite Diagnostics. If you live outside of South Australia, you would need to contact Nuredin Habili in the first instance: nuredin.habili@ adelaide.edu.au

REFERENCES Beuve, M.; Candresse, T.; Tannières M. and Lemaire, O. (2015) First report of Grapevine Pinot Gris virus (GPGV) in grapevine in France. Plant Disease 99:293. Bernard, M.B.; Horne, P.A.; Cho, I.S.; Jung, S.M.; Cho, J.D.; Choi, G.S. and Lim, H.S. (2013) First report of Grapevine Pinot Gris virus infecting grapevine in Korea. New Dis. Rep. 27:10. Giampetruzzi, A.; Roumi, V.; Roberto, R.; Malossini, U.; Yoshikawa, N.; La Notte, P.; Terlizzi, F.; Credi, R. and Saldarelli, P. (2012) A new grapevine virus discovered by deep sequencing of virus- and viroid-derived small RNAs in cv. Pinot Gris. Virus Res. 163:262-268. Glasa, M.; Lukas, P.; Komınek, P.; Nagyova, A.; Candresse, T. and Olmos, A. (2014) Molecular characterisation of divergent grapevine Pinot Gris virus isolates and their detection in Slovak and Czech grapevines. Arch. Virol. 159:2103-2107. Hoffmann, A.A. (2005) Eriophyoid mite damage in Vitis vinifera (grapevine) in Australia: Calepitrimerus

vitis and Colomerus vitis (Acari: Eriophyidae) as the common cause of the widespread ‘restricted spring growth’ syndrome. Experimental and Applied Acarology 35:83-109. Saldarelli, P.; Giampetruzzi, A.; Morelli, M.; Malossini, U.; Pirolo, C.; Bianchedi, P. and Gualandri, V. (2015) Genetic variability of Grapevine Pinot Gris virus and its association with grapevine leaf mottling and deformation. Phytopathology (in press). Yoshikawa, N.; Iida, H.; Goto, S.; Magome, H.; Takahashi, T. and Terai, Y. (1997) Grapevine berry inner necrosis, a new trichovirus: comparative studies with several known trichoviruses. Arch Virol 142:1351–1363.

ACKNOWLEDGEMENTS I would like to thank Dr Ian Dundas for critically reading the manuscript. I am grateful to Dr John Possingham for the sample of Pinot Gris (Figure 1) and WVJ for his technical comment.

Providing all your wine industry information needs in print and online See us at stand 171 at WineTech 2015.

Visit www.winebiz.com.au or call 08 8369 9522 to subscribe today!

V3 0N 3

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

V I T I C& U MARKETING LT U R E BUSINESS

TONY HOARE

Current trends and future predictions for Australian viticulture Part 2: The Golden Era – Potential opportunities and barriers to future success for Australian viticulture By Tony Hoare Hoare Consulting, PO Box 1106, McLaren Flat 5171 South Australia. Email: tony@hoareconsulting.com.au

Following Part 1 of this article in the March/April issue, Tony Hoare continues his look into the future of the Australian viticulture industry, this time delving into the future hurdles that growers will need to overcome to enjoy success in the golden era that some are predicting for the nation’s winegrape growers.

he golden era for Australian viticulture is about to begin according to some industry pundits. After seeing the cycle go full circle in my short involvement, I am trying to imagine how the golden era will look for Australian winegrape growers. What will be the drivers of this future prosperity and what are the obstacles that may impede or derail this potential golden era? There are people with bigger crystal balls than mine who will be able to identify where the opportunities for our future prosperity lie and I will leave those predictions to them. I discussed Shiraz in Part 1 of this article which I believe will be the lynch pin for this future period of growth. In this article, I will focus on viticultural hurdles that growers need to overcome to underwrite wineries and their future success in the golden era.

bulk wine as a bottle ready product and, therefore, don’t need grower contracts. This lack of security has a massive flowon effect for other growers, their suppliers and the regional communities where they live. Current pricing for winegrapes is based on a combination of subjective, quality measures and objective winery specifications for levels of ripeness and colour. These parameters are also influenced by a relative scale that fluctuates based on seasonal climate conditions that affect yield and quality outcomes in conjunction with market

PROFITABILITY Many winegrape growers will view the catchphrase ‘golden era’ with some irony. For many of them a return to consistent profitability would be a welcome first step. Most are realistic that a boom is unlikely to happen as in the 1990s. The current viticultural industry in Australia is changing quickly. This is largely due to changing fortunes for growers’ profitability. Whilst wineries are forced to adapt to a fast-changing local and international market for varieties, wine styles, price points and volumes, growers are forced to follow suit. At the high quality end of the cool climate market for fruit the demand seems to be consistent from wineries, sometimes exceeding supply. This situation is likely to remain with the main beneficiaries being those growers currently at that level who will be rewarded for their fruit quality with financial security into the future. The hangover from the boom planting period of the ‘90s remains and the ‘clean out’ of surplus winegrapes is being compounded by the availability of uncontracted, cheap fruit and bulk wine - much of it sold below the cost of production. The WET tax has contributed to a changing landscape in Australian viticulture. It continues to place downward pressure on winegrape prices. Currently, WET is providing incentive for surplus winegrapes to be processed which would most likely have been left to rot or removed permanently from production. The incentive for growers to pick unwanted fruit and take the risk of processing for the bulk wine market is underwritten largely by the WET rebate where a maximum of $500K can be claimed. The flow-on effect of this action by the grower is that wineries that previously purchased fruit are then able to purchase

www.w i n eb i z .c om.au

Cool, windy conditions and extreme heat in spring can disrupt flowering and reduce fruitset.

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

CT EO LNLYA H R ODAOROER

demand. As a result of the current systems, grower profitability can fluctuate significantly between seasons. The main cause of uncertainty is weather. Unseasonal and extreme weather conditions can dramatically alter the yield for the current and even following season. Cool, windy conditions and extreme heat in spring can disrupt flowering and reduce fruitset. The catastrophic effects of frost have been experienced by many growers in recent years in vineyards that have not been previously damaged. The frustration for growers is deciding what management practices to implement as weather is unpredictable. Expensive frost control is a major capital investment and the return on this investment needs to be justified. The influence of weather on profitability can be as cruel as one single day of heat or frost which can result in complete yield loss. On top of unpredictable weather there are increasing operational costs of water, power, chemicals, fertilisers and labour which are also eating into winegrape profitability. Based on current winegrape market conditions, there is little incentive for future investment in some sectors and regions. The concern for Brand Australia is the effects of over investment and excess winegrapes that remain on the market. This situation is reducing the viability of generational and professional winegrape growers who will be needed to help drive future growth. How growers are currently paid by some wineries is being debated at a number of levels at present and there are constant calls from industry bodies to have price determination mechanisms to rid the industry of unwanted, unviable fruit and reward those growers who deserve to be rewarded.

BUSINESS & MARKETING VV II TT II CC U L BUSINESS & U MARKETING L TT UU RR EE

exit grants lessened the area of vineyard plantings in some regions and seasonal water restrictions due to cost and supply further reduced yield. The correction of a winegrape supply and demand imbalance would ideally happen in a more controlled way influenced by industry leaders, policy makers and free market forces. Unfortunately, extreme heat events in particular have had a significant effect on the yield and quality of Australian winegrapes in recent years, especially from veraison to harvest. Consecutive days of extreme heat has caused issues in a number of ways. Water resources from veraison to harvest have been stretched and many of the private irrigation schemes were not designed to cope with demand during these periods, resulting in some growers missing out on water at critical times and suffering financially as a result. Growers also suffer from a requirement for extra water usage which at current prices in some regions has reached more than $3400 per megalitre. I have seen extreme heat reduce 30% of yield in a single day on an irrigated, balanced canopy/cropped vineyard due to the effects of berry shrivel and desiccation. The other issue associated with extreme weather is the ability of wineries, their service providers, roads, etc to cope with compressed vintages caused by rapid ripening as a result of hot weather. An increased monoculture of varieties ripening at the same time in some regions has further added to this issue. An escalation in the frequency and length of irrigations increases pumping and therefore power costs, and can also increase the effects of soil salinity if water quality is saline, especially ▶ during drought periods.

Future predictions • a winegrape price determination payment scheme based on objective measures and the return to winery/grower contracts as demand for quality fruit increases • an adjustment of the WET tax rebate to exclude bulk wine • reduced total vineyard area • emphasis on regionality – right variety, right place • refinement of sub-regional significance – increasing the value of champion regional varieties and their vineyards. Overall, the opportunities for Australian winegrape growers rely on being able to grow to winery specifications consistently and do so efficiently to align with market segments and consumer preferences. VITICULTURAL IMPEDIMENTS AND OPPORTUNITIES TO FUTURE GROWTH There are a number of key areas that need to be addressed for the future prosperity of Australian viticulture. Extreme weather and water Dry seasons, heatwaves and frosts have all been having a negative influence on yield across many regions in recent seasons. These factors are largely due to ‘unseasonal’ or ‘extreme’ weather. Unfortunately, the seasonal averages are not as consistent as they once may have been. A major challenge for winegrape growers will be mitigating the effects of unpredictable and extreme weather to maintain viable yield and fruit quality to winery specifications. In one way, extreme weather has been an asset to Australian winegrape growers. The potential blowout in oversupply of winegrapes has been reduced by the direct and indirect effects of extreme weather events reducing yields and vineyard area. The cost of water and government

V3 0N 3

YOUR FORK TRUCK SOLUTION • •

Short term hire for vintage Long term hire to suit your needs

We are a South Australian family owned and operated business with over 55 years experience in the forktruck industry We offer a variety of services including:• Fully equipped workshop for repairs and service • Fully equipped service vans for onsite repairs and maintenance • Spare parts for all makes and models - new and secondhand • Quality advice and technical support • A range of secondhand fork trucks for sale • New Hyundai fork trucks available for sale and fully maintained lease options

SALES • HIRE • REPAIRS • SPARE PARTS • SERVICE

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

V I T I C& U MARKETING LT U R E BUSINESS

TONY HOARE

Eutypa, together with the other trunk diseases esca and botryphariea, comprise a triple threat to short-term viability and long-term prosperity by lowering yield. In response to extreme heat events, Australian growers and, with some assistance from government, have been already taking action to mitigate financial losses by: • converting open irrigation channels to piped and pressurised systems to reduce loss through evaporation and on-farm pumping costs • updating irrigation systems to maximise water use efficiency; conversion to drip from overhead irrigation and more scheduling using electronic controllers in place of manual • developing and applying soil moisture monitoring technology to maximise water use efficiency, manage soil salinity and maximise crop yield and quality • mid and undervine management responses to conserve soil moisture • managing yields and canopies to achieve balanced, more resilient vines • applying vine 'sunscreen' sprays to protect foliage and fruit • using precision viticulture tools, such as PCD maps and infra-red, for vineyard micro management for irrigation system design and vineyard management decisions, achieved using retrofitting to increase uniformity despite soil, aspect and topographical variation • harvesting at lower levels of sugar ripeness • using selective harvesters for fruit sorting to improve fruit uniformity prior to the weighbridge. Future predictions • changing varieties to suit climate changes in regions; y=greater adoption of Mediterranean varieties and potential new cultivars • clonal selection for more heat/ drought resilient mainstream varieties • undercover viticulture - use of seasonal or permanent covers for winegrape vineyards, particularly in high value wine producing regions • use of technology for fruit maturity sampling to field sample and predict harvest dates to ensure optimal levels of ripeness

www.w i n eb i z .c om.au

• use of a new generation of droughtresistant rootstocks to further reduce vine water requirements, increase canopy resilience and enhance yield • water authorities to partner growers to realise a sustainable level of water pricing especially during peak supply • use of technology e.g., frost fans, to cool vineyards on hot days as well as provide frost protection. THE MAIN PEST AND DISEASE ISSUES INFLUENCING FUTURE PROSPERITY Eutypa lata (Deadarm) This slow moving trunk disease is considered by many Australian winegrape growers as the number one pest and disease issue facing them currently. Eutypa, together with the other trunk diseases esca and botryphariea, comprise a triple threat to short-term viability and long-term prosperity by lowering yield. While some varieties appear more susceptible, most varieties are at risk to the effects of trunk diseases mainly due to the requirement for seasonal pruning. At present there are management guidelines for minimising the introduction of these diseases, however, there is no silver bullet to halt its spread. The impact of trunk diseases in the long term is costly due to reworking of vineyards and lost production in the meantime. The Australian Wine Research Institute recognises the issue and its magnitude and is directing funds and resources to research in the hope of being better able to deal with trunk diseases in the future. In the short term, postpruning spray options will be more widely available to provide more plant protection to the introduction of infection; future developments may include the identification of resistant cultivars or clones of varieties. The spread of eutypa eventually forces many vineyards into yields below viable levels. Whilst the eradication of trunk diseases is unlikely in the short term, these trunk diseases will need to be managed to compensate for their damaging effects on vineyard profitability.

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

Phylloxera This little aphid-like insect is always lurking as a potential biosecurity threat to Australian vineyards. South Australia, Western Australia, Queensland and Tasmania are phylloxera free. While phylloxera is only in small areas of central and north eastern Victoria and south east of New South Wales it can be spread relatively easily and is an ever-present threat to Australian viticulture. The outbreak in the Yarra Valley in Victoria shows that phylloxera can appear at any time. Whilst this pest needs a soil or Vitis sp. plant material vector to be transported, it is not beyond comprehension that this could happen through either negligence or even sabotage. Protection using resistant and tolerant rootstock are the best forms of defence, however, there is only a low percentage of total plantings in nonphylloxera regions to rootstock. The risk to these regions of the effects of a phylloxera infection are relatively low at present, however, it takes up to three years to detect an infection and then it can spread at 100 metres per year. This is one pest not to become complacent about and risk management needs to be improved to safeguard any future risks. Birds The damage caused by birds to winegrapes each year appears to be increasing. Urban sprawl is joining the links between winegrowing regions and urban areas, allowing birds an easier passage into and out of vineyards. Noise restrictions on bird control measures such as gas guns and shooting make it more difficult to use these ‘cheaper’ control methods. While the effectiveness of netting is unquestionable, the costs of its usage are placing further pressure on grower profitability. Previously I have forecast the use of drones or automated devices which will patrol airspace around vineyards to deter birds. Currently there are a number of researchers and companies looking into this possibility. Hopefully some of the licensing and privacy issues of using these devices will be overcome so that winegrape growers can utilise what seems to be an affordable and potentially effective bird control strategy in the future. The Australian viticultural landscape has undergone some major changes in the last two decades. Its evolution from the first vines of James Busby to today has been driven by hard work and innovation. The golden era beckons and if we are to share in this future prosperity we need to deal with the issues limiting us at present. WVJ

V30N3

AR SCOEILLL H O RDI OZ O R N

BUSINESS MARKETING V T V II T T II C C U U& L L T U U R R E E

Potential rootzones where are your roots? By Geoff Kew Kew Wetherby Soil Survey Pty Ltd, South Australia. Email: kewwetherby3@bigpond.com

Welcome to Soil Horizon, the first of a semi-regular column in which Geoff Kew will draw on his 20 years of experience looking at soil profiles in vineyards and other horticultural and agricultural enterprises – covering the wine industry boom times of the 1990s to now when redevelopment of vineyards is being considered – to discuss how soil effects vine growth, fruit production and quality. Such discussions are particularly timely given that 2015 is the International Year of Soils.

he most time efficient way to observe vine root growth in the field is to excavate backhoe pits near the base of a vine or vines. Observing vine root growth in different soil materials in the field provides information that is not available from spatially-derived computer imagery and analysis. After the backhoe has finished you will need to clean the face of the soil pit to remove the smear marks from the backhoe bucket, and this will expose vine roots and the soil structure and horizons. The exposed vertical face will allow not only observation of where vine roots are growing, but will also show the different soil materials. Make a note of the depth of soil changes and in which soil materials the roots are growing. In most cases the sandy and or loamy topsoil materials above clay, soil carbonate or weathered rock will have most of the finer (1-2mm thick) roots and there should be too many to count. The larger medium-size roots (2-5mm thick) will be found in the subsoil materials. In general, some of the guidelines below can be used to determine how far vine roots will grow in a new vineyard soil. The topsoil materials will be colonised by vine roots. Topsoil in the context of this article refers to the ‘A’ horizon sandy and loamy soil textures (sand, loamy sand, sandy loam, sandy clay loam, clay loam) that overlie a ‘B’ horizon which may be clay, soil carbonate or weathered rock. If the clay is well structured and friable, vine roots will go about 50cm but if it is poorly structured and not permeable root growth is restricted to about 20cm. If the ‘B’ horizon contains soil carbonate that is sandy and loamy, then up to 50cm of that material would be colonised but only about 30cm if it is clay. The depth of vine root growth in weathered rock will depend on the angle of the rock fractures and the amount of soil material between the fractures, but vine roots will usually colonise 70cm of weathered rock. Other factors that may restrict vine root growth include soil chemical problems such as soil salinity, dispersion and sodicity. I have included three common soil types seen in vineyards across Australia, as obviously we could not include all soil types in this article. Have a look at the soil profiles and the information I have provided and determine what depth you think vine roots will reach in these soils, assuming there are no soil chemical problems. I work on where the bulk of the roots will be and do not include odd roots scattered here or there.

into the clay loam soil carbonate. The vine roots will not go 50cm into the soil carbonate as they have already travelled through the structured clay above. The potential rootzone in this undeveloped site would then be 60cm. The moderately deep Sodosol (Figure 2, see page 60) has two topsoil layers. The first is sandy clay loam to 20cm and the second is 25cm of loamy sand to a depth of 45cm above clay. The second layer has been leached resulting in a

• 10cm of clay loam, over • Permeable red sub-angular blocky clay to 30cm, over • Clay loam soil carbonate with 70% siltstone gravel to 80cm, over

THE ANSWERS

• Clay loam soil carbonate with 75% siltstone gravel to 150cm. The shallow calcareous Chromosol (Figure 1) has 10cm of clay loam topsoil over well-structured friable sub-angular blocky clay that is 20cm thick. The roots should colonise all the topsoil and 20cm of the clay and then go another 30cm

V3 0N 3

Figure 1. Shallow calcareous Chromosol soil, similar to Terra Rossa. Photo courtesy Tait Wines

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

V I T I C U LT U R E

SOIL HORIZON

bleached colour due to ponded water on the clay below this layer. It is now mainly composed of quartz grains. The clay below the topsoil is poorly structured (prismatic) and will limit water movement and vine root growth. It may also be sodic and dispersive and would probably benefit from ripping and deep gypsum placement (a topic for another article). Vine roots will struggle in the clay and may only reach another 20cm. The potential rootzone for this soil profile is then 65cm and is, in fact, greater than Figure 1 due to the deep topsoil of 45cm. The Chromosol or duplex soil (Figure 3) has a permeable, friable structure and 25cm of topsoil comprising 10cm of sandy clay loam, and a second sandy clay loam horizon with 25% gravel and pebbles of weathered rock. The clay below is friable and permeable with an angular blocky structure; vine roots should go 50cm into this material, giving a rootzone of 75cm. The discussion above shows that vine rootzone depth will vary with the soil materials while topsoil depth is critical in determining how far roots will grow. This data is important for determining readily available waterholding capacity WVJ across the vineyard.

• Sandy clay loam to 20cm, over • Loamy sand to 45cm, over • Prismatic (rectangular columns) structured light medium clay to 80cm, over • Prismatic medium clay to 115cm, over • Angular blocky (house brick-shaped) medium clay with some soil carbonate to 150cm. Figure 2. Moderately deep Sodosol soil. Photo courtesy Advanced Viticulture & Management

NEED MORE

TRAFFIC to your website/business? Australia’s LARGEST circulating wine industry e-newsletter

• Sandy clay loam to 10cm, over • Sandy clay loam with 25% siltstone gravel to 25cm, over • Angular blocky (house brick-shaped) medium clay to 65cm, over • Light medium clay soil carbonate to 100cm, over

Over 11,000 subscribers Contact Dan Brannan on 08 8369 9515 or d.brannan@winetitles.com.au

www.w i n eb i z .c om.au

• 80% weathered siltstone and sandy clay loam in fractures to 150cm. Figure 3. A Chromosol soil – a duplex or texture contrast soil with permeable and friable structure. Photo courtesy Barossa Valley Estate

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

ALTERNATIVE VARIETIES

V I T I C U LT U R E

Teroldego – “You never get better than this one” By Greg O’Keefe, Winemaker, Michelini Wines, Alpine Valleys, Victoria

TEROLDEGO By Peter Dry Emeritus Fellow, The Australian Wine Research Institute BACKGROUND

Dino (left) and Ilario Michelini with winemaker Greg O’Keefe. HISTORY Known as the Royal Wine of Trentino, Teroldego is an indigenous variety of the Trentino-Alto Adige region in northern Italy. It is planted almost exclusively in Campo Rotaliano, in the Adige Valley north of Trento, and its sole appellation of origin is Teroldigo Rotaliano DOC, which was declared on 18 February 1971. Currently it is planted on 390.5 hectares and is cultivated by more than 300 producers in the region. The name Teroldego is thought to arise from its traditional method of cultivation, trained on a system of ‘tirelle’ or wire harnesses. In 1851 the Michelini family began growing grapes and making wine in the Trentino-Alto Adige region of the Italian Alps. Arriving in Sydney in 1949 at the age of 25, Emo Michelini commenced planting the Michelini Vineyard in 1982 in the cool Buckland Valley near Bright, in north-east Victoria. Whilst the initial vineyard was planted by Emo and his sons Ilario and Dino to sparkling wine varietals Chardonnay and Pinot Noir, the vineyard was expanded to 40ha in 1992 and included around 0.4ha of Marzemino (another northern Italian varietal related to Teroldego which was primarily grown south of Trentino) which has been made into wine and sold under the Michelini label since the first release of wines from the 1997 season. Emo remembered the wine produced from Teroldego, grown in his home town of Rovereto. “This is the wine,” he would insist. “You never get better than this one!” It later emerged that a great uncle had brought some Teroldego over from Italy many years ago and an experimental wine was made in 2004 from around 100kg of fruit at 24.5 Brix, harvested on 14 April in a large open top fermenter to allow optimum extraction of body and colour before pressing and maturation in a small stainless steel barrel. Showing amazing depth of colour, the wine was bottled under cork and entered into the 2004 Australian Alternative Variety Wine Show, in Mildura, where it received a bronze medal ▶ equivalent for experimental wines.

V3 0N 3

Teroldego (teh-ROHLL-deh-goh) has been known in Trentino, in northern Italy, for many centuries. It has an interesting family tree because it is a full sibling of Dureza (a parent of Shiraz) and a parent of both Marzemino and Lagrein (the other parent is unknown). Synonyms include Merlina, Teroldega, Teroldeghe, Teroldico, Teroldigo, Tirodola and Tiroldegho. It has had its own DOC in Trentino-Alto Adige since 1971: Teroldego Rotaliano for both red and rosé wines. It is also used as minor component in other DOCs in Trentino-Alto Adige and grown in Veneto and Valtellina to a small extent. There were 839 hectares in Italy in 2010. There are also small areas in the US (California) and Brazil. In Australia, there are currently at least five wine producers in Margaret River, Langhorne Creek, McLaren Vale and Alpine Valleys. VITICULTURE Budburst is mid-season and maturity is mid to late. Vigour is moderate with an erect growth habit. Bunches are small and compact with small to medium tough-skinned berries. Yield is usually moderate. Cane pruning is used in Italy but spur pruning has also been used in Australia. Teroldego has low susceptibility to downy and powdery mildews, but high susceptibility to bunch stem necrosis. WINE Teroldego wines are deeply coloured, fresh and fruity. When yield is restricted and full maturity is achieved, wines have ripe tannin with good acid balance. Descriptors include dark fruits (particularly black cherry), spicy, herbal and bitter almond. Moderate tannin levels suit early drinking styles. The natural acidity of Teroldego is high and reports suggest that it was in danger of decline in Italy due to this characteristic; however, this could have been a consequence of inappropriate site selection. Such a tendency to high acid is unlikely to be a negative attribute in warm to hot regions in Australia.

For further information on this and other emerging varieties, contact Marcel Essling (marcel.essling@ awri.com.au or 08 8313 6600) at The Australian Wine Research Institute to arrange the presentation of the Alternative Varieties Research to Practice program in your region.

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

V I T I C U LT U R E

ALTERNATIVE VARIETIES

Following the success of this initial trial, cuttings were taken to provide planting material for around 0.4ha on 101-14 Mgt rootstock in the spring of 2005.

The second commercial Teroldego was harvested on 8 April 2009 at 24.1 Brix, 7.7g/L acidity and pH3.55. This wine was made in a similar manner to that above and was tasted together with the 2008 wine at a tasting in January 2010. The 2009 wine was bright in colour but had much softer tannins. The group came to the conclusion that although the 2008 was the better wine, the 2009 would develop more quickly and, so, a decision was taken to release the 2009 wine in the standard Michelini range and the 2008 in the premium Emo Selection reserve range. Both wines were filtered through sterile sheets and finally a sterile membrane on the way to filling into glass, sealing under screwcap and packed into 12 bottle cartons. The 2008 Emo Selection Teroldego went on to win the gold medal and trophy for ‘Chairman’s Wine to Watch’ at the 2010 Australian Alternative Varieties Wine (AAVWS) show and the 2009 wine was awarded a silver medal. Since then we have released a single varietal Teroldego from the 2010, 2011 and 2012 vintages which have been awarded a further silver and gold medal at subsequent AAVWS events.

VITICULTURE From the limited amount of literature available, Teroldego is reported to be a hardy, vigorous and potentially prolific cool-climate vine, best suited to permeable, well-drained soils. It is recognisable by large, pentagonal, three-lobed leaves and the compact, elongated, pyramidal bunches support medium to small, round, blue black berries with thick, resistant skins. The fruit is low in tannin but high in aroma, colour, extract, acidity, sugar and potential alcohol. We have observed that in our vineyard, Teroldego grows in a fairly similar manner to its northern Italian relative, Marzemino. It has moderate vigour on a single wire VSP trellis with upright growing habit, late budburst around mid-October and earlier harvest than Marzemino in early April with moderate yield around 8 tonnes per hectare. The variety is moderately thick skinned and, so, more resistant to disease than Sangiovese and with higher natural acidity similar to Barbera.

MARKETING

WINEMAKING Our first commercial Teroldego harvest was on 28 March 2008 with maturity figures 24.5 Brix, pH3.74 and 7.5g/L TA. The fruit was machine harvested and transferred to the winery in Myrtleford to be crushed into twotonne stainless steel open fermenting tanks. The fruit was allowed to soak for two days with moderate SO2 addition of around 50ppm prior to addition of ICV-D254 yeast. Fermentation started almost immediately and proceeded for about five to seven days on skins with regular pump overs at moderate temperature (25-28°C) prior to pressing in a modern airbag press. The wine was then transferred to oak in a heated room to complete primary and malolactic fermentation. Following the fermentation process, the wine was racked to tank, pH adjusted to around 3.50, 100ppm SO2 added and then transferred to one-year-old French oak barriques for maturation with a view to bottling around mid-2009. Minimum SO2 levels around 40ppm free and 80ppm total were maintained throughout the maturation period. Typically we would bottle our red

www.w i n eb i z .c om.au

wines after just 12 months in oak, but it was becoming clear the wine was just not ready as the tannins were still quite fresh and strong, typical of Teroldego from a low cropping or warmer year such as 2008. During a tasting with other local winemakers in January 2009 at the cellar door in Myrtleford, it was agreed that this wine needed more time to come together, and that it should be reviewed in another year’s time.

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

In September 2006 Michelini Wines released the first of our premium wines under the Emo Selection range, a 2004 Merlot which has been very well received. Unfortunately, Emo passed away just a few weeks short of bottling and this wine was released in his memory. The 2008 Emo Selection Teroldego was released at a Long Pasta Lunch held at the winery in conjunction with the 2010 La Fiera festival held in Myrtleford in May to coincide with the Italian Connection Rally from Sydney to Melbourne. Around 100 people were treated to a four course lunch produced by local chef Frank Martinez, of Sole e Luna in nearby Bright, and the wine was matched to beef lasagna. Both wines are packaged in premium antique green claret glass. The Emo Selection wine is subtly different in that it has a brown screwcap and Emo Selection appears on the front label, whilst the standard wine has a black screwcap. The wine works well with our other Italian varietals including Pinot Grigio, Barbera, Sangiovese, Marzemino and Fragolino to provide a real alternative to the mainstream offering at other locations, and visitors to cellar door are enjoying the difference. WVJ

V30N3

IS YOUR RIESLING UP TO THE CHALLENGE? 16

THE HYATT HOTEL CANBERRA AND ALBERT HALL CANBERRA

12-17 OCTOBER 2015 A COMPETITION DEDICATED TO RIESLING WINES TO SHOWCASE THE WONDERS OF THE RIESLING VARIETY

CALENDAR OF EVENTS

The Canberra International Riesling Challenge is a unique opportunity for Riesling producers to showcase their product. The Challenge has become an internationallyâ&#x20AC;&#x201C;recognised wine show, and is the largest event of its kind in the Southern Hemisphere.

HOSTED BY CHARLES STURT UNIVERSITY

The 16th Canberra International Riesling Challenge, attracts wines from Riesling producing countries around the world. Judging is conducted on a regional basis which highlights the individual characteristics unique to the wine's location in the world. Ken Helm, AM Chairman Canberra International Riesling Challenge

SO IF YOU THINK IT IS, THEN ENTER. KEY DATES

SEMINAR ON RIESLING EXCELLENCE Friday 16 October 2015 Hyatt Hotel Canberra

RIESLING MASTER CLASS Friday 16 October 2015 Hyatt Hotel Canberra

EXHIBITORS AND COMSUMER TASTING Saturday 17 October 2015 Albert Hall Canberra

Bookings for the Seminar and Master Class are essential as spaces are limited. For more information, visit www.rieslingchallenge.com or email info@rieslingchallenge.com

ENTRIES OPEN 1 JUNE www.rieslingchallenge.com ENTRIES CLOSE 31 JULY | JUDGING 13 -15 OCTOBER WINNERS ANNOUNCED AT THE AWARDS PRESENTATION ON 16 OCTOBER 2015

BUSINESS & MARKETING

VINEYARD/WINERY SALES

The year in review for vineyard and winery real estate sales By Colin Gaetjens Partner, Gaetjens Pickett Valuers, Adelaide, South Australia

Colin Gaetjens provides his annual review of vineyard and winery real estate sales during 2014-15.

here was quite a bit of activity in Chardonnay, which probably no longer over many years since the late 1980s to the market in 2014 and early 2015 have a place in what should be a largely build Grant Burge Wines and have truly with a range of assets selling dominant red region. earned a bit of a break whilst continuing at quite reasonable prices and, in a This gives an indication of the sort to run the vineyard properties. number of cases, simply selling! of adjustment that must be ongoing, as The recently concluded sale, again There still remains a reasonable all vineyard areas slowly assess their by Gaetjens Langley, of the Ashton Hills degree of difference between the strengths and adjust plantings to match. wine business for Stephen George was expectations of vendors and purchasers. Progress on this front has been very highly successful, with Wirra Wirra now In many cases, it is a continuing slow despite the economic imperative the new owner. It was interesting to see a reflection of a market where what might to get it right, and I must say that it is certain amount of commentary assumed be considered normal value is difficult something we ponder frequently and the sale was due to necessity, when to achieve, given the reluctance of wonder why adjustment comes so nothing could have been further from the purchasers or investors to pay for assets slowly. truth. Stephen George simply wanted to when profits and returns retire and would not have are so hard to achieve. sold unless he knew the In general there is quite good demand from various business was going into the This is particularly the case with many vineyards hands of an approved new companies to acquire active or dormant brands, where market value is well owner who would continue and our currency depreciation will certainly help below replacement cost with his ideals. and the only sales that There are many small exporters. occur are generally under and successful winery distressed circumstances. operations and strong The shining light for demand and There have been no major changes in brands where the owners are similarly healthy prices is the Barossa Valley. value or shift in demand in most other wanting to retire, and we would expect Fruit prices are increasing, reflecting regions from last year, or indeed the this segment of the market to develop higher demand, and there has been a past few years. over the next few years as owners who firming of interest in the acquisition of The biggest transaction of the year set up in the 1970s and '80s look at vineyard and winery assets. was the sale of the majority ownership stepping back to enjoy life. The vineyard sale referred to in our of Peter Lehmann Wines by Hess Group, A number of properties and wineries last report (Wine & Viticulture Journal, which saw off the attack by Allied were sold in various circumstances, May /June 2014 issue), the Marananga Domecq in 2003. The Hess family wanted often after being on the market for property supplying Shiraz for the to make adjustments to its investment lengthy periods. Scotchmanâ&#x20AC;&#x2122;s Hill, Torbreck Laird wine, was confirmed portfolio and asked Gaetjens Langley to near Geelong, sold for a total of around in July with an analysis of anywhere act for them in valuing and ultimately $10,600,000, but general activity is still between $450,000 and $700,000 per selling their 86% shareholding. relatively low. hectare, depending on how one does the There were several strong bidders In general there is quite good sums. It is a small (2ha or so) mainly with the successful new owner being the demand from various companies to Shiraz vineyard where the fruit had Casella Group, for which it is generally acquire active or dormant brands, and been selling for upwards of $12,000 per agreed will be a good fit. our currency depreciation will certainly tonne. The sale price equated to an help exporters. It looks like vintage 2015 Gaetjens Langley sold the wellenterprise value of around $80,000,000, may be reasonably normal and industry known Chateau Yaldara to Chinese obviously significantly lower than the adjustment is still ongoing. interests which had already invested acquisition value back in 2003. Treasury Wine Estates has announced strongly in another Barossa winery. At the time of the Lehmann sale there another round of changes to its various The sale took place quickly for a total were rumours abroad that Accolade was holdings which will see some interesting consideration of around $15,000,000, in serious discussions with Grant Burge asset sales again. Non-core regions which we thought was excellent value Wines, and so that turned out to be with will continue to struggle in light of little for a 10,000t winery, brand, limited the confirmation of the sale occurring in demand, and the market overall is inventory and part of the vineyards. January 2015. patchy with pockets of optimism along Several other Barossa vineyards Full details are not known but Grant with paddocks of despair. of various sizes realised from around Burge essentially keeps the vineyard There is plenty of activity in the $60,000 to $85,000 per hectare for good properties and the Illaparra winery, with pipeline and, as usual, people wanting to red varieties depending on location Accolade taking on the Krondorf winery, sell outnumber people wanting to buy. and condition, but much less for all of the brands and the inventory. The prospects of selling at good value for white varieties such as Semillon and Grant and Helen Burge worked very hard the vendor are limited and specific. WVJ

www.w i n eb i z .c om.au

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

The National Wine Industry Supplier Trade Show July Tues 14 to Thurs 16

presents

Open 9am to 5pm

Adelaide Showground, SA

WineTech Australia will be presented in South Australia by the Wine Industry Suppliers Association from July 14 to 16. The expansive WineTech Exhibition showcases the full spectrum of products & services in grape growing, winemaking, packaging, distribution, marketing, sales, plant & equipment, e-business, commercial services and more. It provides a one-stop-shop to see, hear, touch, feel, and learn about the innovative and proven products and services that can help our industry prosper. A content program, complementing the exhibition, will provide useful take home messages about products, services and strategies that can be implemented to drive sustainable profitability and growth for your business. FREE at the WineTech Seminar Stage Tuesday July 14 10am Bring Significant Efficiency to the Process of MLF Using Viniflora® NoVA™ – Presented by Chr. Hansen 11am Setting Up a Sales Process for Your Winery – Presented by Australia Trade Tasting Midday Put a Barrel in Your Wine – Presented by Flexcube 1pm It’s All About the Taste – Wine Evaluations with Lallemand – Presented by Lallemand (IMCD/Winequip) 2pm Advanced Enzymatic Wine Analysis – Presented by Deltagen 3pm Take Control of Your Wine Costing – Presented by Jx2 4pm Discount Demand: Ways for the Wine Industry to Survive and Prosper – Presented by WCA Wednesday July 15 10am Clemens Technologies Australia – Presented by Thomas Clemens 11am A New Tool To Detect And Manage Brettanomyces – Presented by AMSL Scientific Midday Innovation in Solar Energy and Energy Storage for the Australian Wine Industry – Presented by The Solar Project 1pm Closing the Loop from Cellar Door to Online Sales and the Digital Channel – Presented by cru.io 2pm Take Control of your Wine Costing – Presented by Jx2 Frost Protection: Managing Cold Air Flows 3pm & Cold Air Accumulation in the Vineyard – Presented by SHuR FARMS 4pm Doing Things Differently – Practical Success in the Vineyard – Presented by Grapegrower & Winemaker Magazine Thursday July 16 10am Fundamentals of Wine Filtration – Presented by 3M Purification 11am It’s All About The Taste – Wine Evaluations with Lallemand – Presented by Lallemand (IMCD/Winequip) Midday Prothec: An Effective Degradable Tie for your Vineyard – Presented by Adepta 2pm Crossing the Bridge from Manual to Automated Titrations – Presented by Hanna Instruments 4pm Water: More Than Just an Input – Presented by Water Industry Alliance

On the Mezzanine Floor Tuesday July 14 Collaboration & Communication: “What Can We Learn from our Allies in Industry Food, Beverage and Agriculture?” – Speakers: Rob Kerin (Primary Producers SA), Alex Knoll (Barossa Fine Foods), Catherine Barnett (Food SA) – Presented & Supported by Wine Communicators of Australia 2pm Wine Tourism: “Why it Pays to Create a Memorable Cellar Door Experience and How to Achieve it” – Speakers: Robin Shaw (Adelaide Hills Wine), Kym Brown (Tour Barossa) Wednesday July 15 11am Wine Retail: “The Retail Digital Space - Trends, Insights & Innovation” – Speaker: Sam Willard (The Wine Quarter- Woolworths Liquor Group) 2pm Social Media: “Influencing Purchase Intent through Social Media and Storytelling” – Speaker: Nick Bowditch (Social Media Thought Leader) – Presented & Supported by Cru-io Thursday July 16 11am Future Generation: “Opportunities to Attract and Nurture the Industries Next Generation” – Speakers: Ross Ord (AgriFood Skills Australia), Harry Moate (Trade Schools for the Future), Anne Duncan (AGWA), Nicole Underwood (nicoleunderwood pty ltd) 2pm Emerging Markets “Support for Export and Investment with Korea & Japan FTA’s” – Speakers: Nicola Kelly (Dept. State Development), Linda Marchesan (Austrade), Hiro Tejima (AGWA), Tim Siebert (Moore Stephens Accounting) 11am

Each of the above sessions are

$90 each, or buy 6 for $400 Wine Industry Functions

Proudly Supported by

Tuesday July 14 7.45 – 9am WineTech Opening Industry Breakfast 8.30pm – 12am The Yeastie Boys Thursday July 16 11.30am – 2.30pm WineTech Luncheon

Tickets and further details www.winetechaustralia.com.au

Free Visitor Registration at www.winetechaustralia.com.au Show Manager Kym Jones Exhibitions P: 08 8297 1688 E: info@kjex.com.au

Further Details

www.winetechaustralia.com.au

BUSINESS & & MARKETING MARKETING BUSINESS

WINE TESTING

Proficiency testing for peace of mind By Luke Warner, Chair, Interwinery Analysis Group. Email: chairperson@interwinery.com.au

Comparing the results out of your winery laboratory with others enables more than just the opportunity to detect errors and biases. BENEFITS TO PARTICIPATION IN PROFICIENCY TESTING Participation in a proficiency testing (PT) program should be thought of as an opportunity for continuous improvement of wine testing laboratories. It should be an integral part of any wine testing laboratory’s quality system, regardless of whether a lab is accredited to ISO/ IEC 17025. At the very least, a wine laboratory’s quality system should comprise two distinct levels of PT: inter-winery testing (or between-winery testing, as discussed in greater detail in this article) which gives an indication of a lab’s overall performance, and intra-laboratory testing (or within-lab testing) which provides information on how individual technicians perform compared with each other. Most wine laboratories operate in isolation and do not have the opportunity to compare their data with other laboratories. This could potentially allow for the introduction of errors and biases which may not be detected during everyday operation. It could be argued that the primary purpose of a laboratory participating in a PT program is to assess performance against other laboratories to detect erroneous or biased results. However, there are other benefits to participating in a PT program, some of which are discussed below. Proving technician competence to management Results of PT should always be reported to management. The results of intra-laboratory PT can help management identify under performance and allow it to take appropriate action (for example, re-training). Conversely, it allows management to appropriately reward and encourage technicians who perform satisfactorily. Furthermore, within-lab PT can supplement training records as it proves technicians can adequately and accurately perform measurements/ analyses. It is important to note that intra-laboratory testing will not identify a bias that has become established within a laboratory, which is where between-winery testing is most useful.

www.w i n eb i z .c om.au

Proving laboratory competence to internal and external customers The results of inter-winery and intralaboratory testing can be used to prove a laboratory’s competence to internal and external customers. Results, with explanation, should be disseminated to as many internal customers as possible – regardless of the outcome of the round of PT. External customers should not ordinarily be privy to results of individual rounds of testing (unless they ask). Always let customers know that your laboratory regularly participates in testing. Identifying of issues in testing methodologies or scientific equipment used Results from a round of PT may indicate an issue with a particular method, instrument, or scientific equipment used. When these issues arise, ensure all root cause analysis is documented and include all corrective action taken when disseminating results to internal customers. This shows the laboratory is proactive in identifying and correcting problems as they arise.

Allows for the comparison of methodologies within labs or between wineries With the introduction of FTIR and other advanced technologies in the wine industry, many wine laboratories have the ability to test analytes via a number of different methods. Analysing a sample using more than one methodology can help to identify systematic or random errors. Other benefits • results from a round of testing may indicate some further technician training may be required • demonstrates to customers, both internal and external, that your laboratory is serious about the quality of data produced • good performance in PT means increased morale of all staff

Method evaluation Ongoing participation in a PT program can assist participants in determining method precision (repeatability and reproducibility) and method accuracy (comparison with other techniques). In addition to evaluating a method for use, PT participation can also allow a laboratory to estimate an uncertainty of measurement for a method. Monitoring long-term performance Laboratories are able to monitor the long-term performance of their tests. If the Z-score (a score's relationship to the mean in the group) for a test shifts suddenly where previously it had been stable, then something may have occurred to cause the shift. For example, a shifting Z-score may indicate that a piece of scientific equipment is beginning to fail due to age, therefore giving laboratory management the justification needed to purchase a replacement.

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

The results of intra-laboratory proficiency testing can help winery management identify under performance and allow it to take appropriate action, such as retraining. It also allows management to reward and encourage technicians who perform satisfactorily. V30N3

WINE TESTING

• continuous good performance in PT increases confidence with relevant parties such as customers and accreditation bodies.

Median

BUSINESS & MARKETING V I T I C U LT U R E

Upper Whisker

Lower Whisker

Outside value

UNDERSTANDING STATISTICAL REPORTS Typically, following participation in a round of PT, a report is made available to participants. Though reports between PT providers are likely to vary, they should have some common elements between them. In this section, we will discuss how technicians and managers can interpret statistics reports and what some of the jargon means (please note that the following is specific to a round of Interwinery Analysis Group proficiency testing). The graph Results may be displayed graphically as a Youden Plot which is an ideal tool for analysing inter-laboratory data where two duplicate samples have been analysed. A Youden Plot will have results for one sample on the x-axis and results for the other sample on the y-axis. A linear line of best fit is applied and represents the general trend of the data and an ellipse indicates the 95% confidence interval of the mean. Some questions you can answer by looking at the Youden Plot include: • Are our results similar to results by other laboratories? • Do we have errors and if so, are they systematic or random errors? • Do we have outlying results? Obviously, you want your results to be as close to the mean as possible. Ideally, your results should aggregate within (or very close to) the ellipse representing the 95% confidence interval. If your results are not within the ellipse, there is a good chance there is an error associated with them. Errors due to random factors will mean that results are scattered randomly about the mean values. These errors are indicative of either poor reproducibility between analysts or perhaps faulty scientific equipment. Systematic errors are harder to deal with because their effects are generally only observable if they can be removed. This is where participating in a PT program can be beneficial as errors due to systematic factors will generate results close to the linear line of best fit but will be situated in either the upper right or lower left corner of the graph but away from the central ellipse. Systematic errors can arise from sources such as incorrectly zeroed instruments, instrument drift or change in environment.

V3 0N 3

Lower Hinge

Upper Hinge

Far outside value

Figure 1. A Youden Plot could also include box-and-whisker plots which look something like Figure 1. This additional information provides a visual summary of the distribution of data used to generate the Youden Plot. The length of the central box (from the lower to upper hinge in Figure 1) shows the interquartile range (IQR) which is the range within which the middle 50% of results fall. The lower hinge and upper hinge are the 25th percentile (or lower quartile) and 75th percentile (or upper quartile), respectively. A vertical line in the box indicates the median of the data. The lower whisker indicates the range of values which are within 1.5 IQR of the lower quartile whereas the upper whisker represents the range of values within 1.5 IQR of the upper quartile. Any values that fall within either of the whiskers should be investigated further and any values outside are unacceptable. The statistics Ideally, a summary table of the statistics should be present in the report. Statistics reported in a round of Interwinery Analysis Group PT includes the following: • Number of cases: the number of results submitted by member laboratories • Minimum: the smallest result submitted • Maximum: the largest result submitted • Range: maximum value subtract minimum value • Median: the middle value of results submitted. In cases where distributed results are skewed heavily, the median value may be more indicative of the true value than the mean as it is less affected by extreme outliers • Mean: the arithmetic mean and the value used for further statistical calculations. Where distribution is normal, the mean and median should be the same • 95% CI Upper and Lower: if results for sample A or sample B fall within this range, then there is a 95% probability that they are the same as the mean W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

• Standard deviation: any results which are more than two standard deviations from the mean need further investigation by the submitting laboratory • C.V.: coefficient of variation, which is standard deviation divided by the mean, and gives an indication of variance in relation to the mean. Z-Score Ideally, some sort of standardised score should be provided in the report. The Z-score is such a value and provides participants with information about the location of their results within a distribution of data and is calculated using the mean and standard deviation values. Z-scores are signed as either positive or negative indicating a result is above or below the mean. The number is the distance between the Z-score and mean in terms of the number of standard deviations and interpretation of the Z-score should typically be as follows: • |Z| ≤ 2.0: results are satisfactory

• |Z| ≥ 2.1 and ≤ 3.0: results are questionable and further investigation could be warranted • |Z| ≥ 3.0: results are unacceptable and further investigation is necessary. Finally, some food for thought: even though you may have achieved a satisfactory Z-score for a particular test, consideration should be given to your uncertainty of measurement for that test. Never assume that a Z-score of ≤ 2.0 automatically means good performance. It could still be that the difference between your result and group mean is greater than the uncertainty of measurement you established during method validation, and therefore corrective action may be warranted.

The Interwinery Analysis Group is a NATA-accredited proficiency program provider and global support system for wine analysis laboratories in Australia and throughout the world, run by wine industry people for the wine industry. For further information about the group visit: WVJ www.interwinery.com.au. www.wine biz. com . au

BUSINESS & MARKETING

ASIAN MARKETS

Optimising the impact of wine education on Asian consumers: training with Western or Chinese terminology By Dr Armando Corsi, Dr Justin Cohen and Professor Larry Lockshin Ehrenberg-Bass Institute for Marketing Science, University of South Australia

This article is the third in a series of reports appearing in the Journal that provide commentary on an AGWA-funded research project that seeks to understand Asian market demand for Australian wine, and how to best educate novice Asian wine drinkers. INTRODUCTION In the September/October 2013 issue of the Wine & Viticulture Journal we discussed the methods and the different wine education techniques we used to educate novice Asian wine drinkers. In the March/April 2014 issue of the Wine & Viticulture Journal we looked deeper at the impact of selfreported wine reviews as a component of the wine education process. In this article we provide commentary on a later stage of this Australian Grape and Wine Authority (AGWA) funded research project, ‘Understanding Asian market demand using Asian consumers in Australia’, where we replicate and extend our understanding of how best to educate novice Asian wine drinkers. The results of the first wave of data collection proved that education based on region of origin is more effective than education by grape variety in terms of improving the likeability, willingness to pay and perceived price point of the wines tasted by novice Asian wine consumers. We also demonstrated that education dramatically improves a novice wine drinkers’ ability to communicate about wine both in the quantity and quality of the descriptors used. Another way to influence the way a wine drinker perceives a wine is by the language used to describe it. We now have further refined our educational techniques to investigate the impact of Western versus culture-specific (Asian) tasting terminology and food matching amongst our targeted cohort. METHODOLOGY AND SAMPLE This wave of data collection tested if the impact of wine education on increasing the likeability, willingness to purchase and perceived price points of Australian wines differs using education based on traditional Western descriptors or their Chinese equivalent terms. For a detailed description of the research protocol and methodology we refer readers to Corsi et al. (2013). The only change to the protocol used originally was that all respondents were trained using education by region of origin. However, while one group was trained using Western terms and Western food matching suggestions, the other course used Chinese terms and Asian food matching suggestions. The taste descriptors adopted for the experiment were generated from the outcome of another China-focussed, AGWA-funded project, the aim of which was to understand Chinese sensory preferences for different wine styles and the language used to describe them. The full report for that project is available at http://bit.ly/USA-1201. The food matching suggestions were derived from an exhaustive review of both expert and wine/culinary themed trade publications. To qualify for the research program held in Adelaide,

www.w i n eb i z .c om.au

participants had to be between 18 and 30 years of age, be born in an Asian country and lived there for at least 10 years. Attendance at all scheduled sessions was a pre-requisite for the participants to receive a gift card as compensation. This was necessary to guarantee the comparability of samples across the different conditions. As in prior waves, participants were asked to nominate a preference for a two-session or five-session wine program. Those who selected the twosession program only attended two blind tastings 20 days apart, but didn’t receive any training and were classified as the control group. Those who selected the five-session course attended three wine education training classes between the two blind tastings. The five-session participants were randomly allocated into two sub-groups, where they were educated using Western or Chinese terms. The classes were run on different days to avoid information transfer between sub-groups, but all sessions were run in exactly the same conditions and time frame to guarantee comparability. The experiment took place in October 2013 with a total of 96 participants, almost equally spread across the three groups. The majority of the sample was aged 20-24 years (69%), Chinese (45%) or Malaysian (25%) and female (57%). No significant socio-demographic differences were found between groups, apart from a slightly higher presence of females in the control group (71%) compared with the other two treated groups. RESULTS Figure 1 to Figure 3 present the results on average overall likeability, willingness to purchase, and perceived price points of the six wines tasted blind before and after the course.

Figure 1. Likeability – before versus after wine education.

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

ASIAN MARKETS

An education by Western descriptors generated a significant positive change in overall likeability, willingness to purchase and perceived price point. In particular, the average likeability value across the six wines increased 10% from 5.3/9.0 to 5.8/9.0 (p=0.01), the willingness to purchase rose 8% from 3.0/5.0 to 3.3/5.0 (p=0.02), and the perceived price point increased 35% from 2.6 to 3.5 (p= 0.00), which is interpreted as moving from an average of approximately $16 a bottle to about $21 a bottle. For all three variables, both the final average score and the percentage increase between the first and the last blind session were the highest recorded across the three groups. The group educated by Chinese terms generated increases of 9% (likeability), 7% (willingness to purchase) and 27% (perceived price point), but only the changes in likeability and perceived price point were statistically significant. Finally, the values recorded for the three dependent variables for the control groups are all statistically not significant and the changes are all lower than 2%, which clearly demonstrates the effect of training. CONCLUSIONS This research program continues to prove at a holistic level that education of any type is effective in increasing a novice wine drinker’s likeability, willingness to purchase and perceived price point of a wine. Different experiments we have reported explained that education by region of origin, having students generate self-reported wine reviews and using Western terminology and food matching are optimal for wine

BUSINESS &MARKETING MARKETING BUSINESS V I T I C& U LT U R E

education of novice Asian wine drinkers in Australia. The slightly higher effectiveness of education based on Western terminology is not surprising. Despite the respondents being novice Asian wine drinkers, they have lived in Australia for a period of time, been exposed to the culture and come across media and information that discuss wine in a Western context, even if only in very small amounts. We cannot negate its impact. In addition, an educator with a Western background delivered the course in English. The respondents could possibly experience some incongruence with the Chinese terminology and food matching due to the mode of delivery. We are seeking further funding to replicate this research in China using a Chinese educator and ascertain optimal wine education models for Australian wine in China. It is important to note that we are not suggesting to ‘mothball’ wine education using Chinese terms and food matching, but rather that there is more work to be done in creating culturally congruent education formats. In China, where there is less exposure to Western culture and language and more familiarity with wine in a Chinese context, it is suggested that Australia work to define its engagement with Chinese wine drinkers through its continued culturespecific market development. There is more work to be done in this field and our team at the Ehrenberg-Bass Institute for Marketing Science continues to work on AGWA-supported China initiatives to provide a competitive advantage to the Australian wine industry. REFERENCE Corsi, A.M.; Cohen, J. and Lockshin, L. (2013) Optimising the impact of wine education on Asian international students. Wine & Viticulture Journal 28(5):83-85. WVJ

Figure 2. Willingness to purchase – before versus after wine education.

Figure 3. Perceived price point – before versus after wine education. V3 0N 3

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

WVJ

www.wine biz. com . au

BUSINESS & & MARKETING MARKETING BUSINESS

JAPAN

Early results of the Free Trade Agreement with Japan By Mark Rowley, Industry Analyst, Wine Australia

n 15 January 2015 the JapanAustralia Economic Partnership Agreement (JAEPA) came into force. The changes immediately eliminated the ÂĽ45 (A$0.49) per litre excise on bulk wine shipments, while the tariff on bottled wine was reduced by 1.875% to 13.125%. The second scheduled tariff reduction on bottled wine came into effect on 1 April with a schedule to further reduce tariffs by 1.875% per annum until the tariff reaches zero in 2021. The importance of the Japanese wine market should not be understated. Japan is the second biggest wine market by value in Asia behind China and ninth largest in the world. According to Euromonitor International, 312 million litres of wine valued at US$8 billion was sold in Japan in 2013. After a period of stagnation, the volume of wine sold in Japan has grown at an average rate of seven per cent per annum over the last five years. Japan is Australiaâ&#x20AC;&#x2122;s ninth biggest export market at 11.0 million litres valued at $43 million (total exports of 711ML valued at $1.85) in the year to March 2015. Japan accounts for 2% of total value and 1% of total volume. During the year, Australian exports increased by 11% reaching an all-time record (see Figure 1). Table 1 illustrates the very early Australian export results post-FTA commencement by comparing the first quarter of 2015 with the first quarter of 2014. In the first quarter of 2015, total exports were up by 63%. The growth

was firmly driven by an increase in the lowest price segment, which bulk wine with zero tariffs generally falls into. The under $2.49 per litre segment increased by 80% to 5.5 million litres. However, there was also strong growth in the higher priced segments which are still subject to relatively

higher tariffs. The above A$10.00 per litre segment increased by 12% to 405,000 litres. Regionally identified wines have been the real driver in this segment. For example, McLaren Vale wines increased by 52% to 8400 litres, Eden Valley exports increased by 627% to 7200 litres and Cowra grew 471%

Figure 1. Australian wine exports to Japan for the year to March 2015.

The importance of the Japanese wine market should not be understated. Japan is the second biggest wine market by value in Asia behind China and ninth largest in the world. Figure 2. Japan wine imports by source. Source: Global Trade Atlas

www.w i n eb i z .c om.au

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

JAPAN

BUSINESS & MARKETING V I T I C U LT U R E

Table 1. Volume change by price segment (March quarter 2015 vs March quarter 2014) Price segment

Segment share in year ending March 2015

Segment share in latest quarter

Quarterly comparison (% change)

$2.49 and under

30%

34%

80%

$2.50 to $4.99

49%

46%

$5.00 to $7.49

13%

12%

$7.50 to $9.99

5.1%

4.1%

-25%

$10.00 and over

3.5%

3.4%

12%

All exports

100%

63%

Source: AGWA wine export approval database

to 7200 litres. The A$2.50 to A$4.99 segment (up 7% to 5.4 million litres) and $5.00 to $7.49 per litre segment (up 4% to 1.5 million litres) also increased, albeit at slower rates. In contrast the $7.50 to $9.99 declined by 25% to 485,000 litres (Table 1). The reduction in the bulk tariff enables Australia to effectively compete where the majority of wine sales are priced. Still wine sales in Japan are heavily weighted to the lower-end of the market, with 81% of the total volume sold at below ¥1500 (A$16) per bottle and 88% of Australian sales. Australia is under-represented in the middle price segments of ¥2000-5000 (A$22-$A55) per bottle, as 8% of total wine is sold in this segment compared with 4% of Australian sales. The agreement provides some relief to Australian exporters as Australia had been trading at a significant disadvantage compared with Chile. When the Chilean-Japan FTA came into force in early 2007, Chile’s market share was just 7.0%. However by 2014, Chilean market share had risen threefold to a 24.9% share of wine imports. In volume terms, Chilean wine imports increased by 478% to 67 million litres, while the broader market for imports increased by 63% to 270 million litres. Figure 2 illustrates that post-Chilean FTA, Chile’s exports grew rapidly shortly surpassing the US within two years. The growth has continued without any other competitor on an even playing field. In very few Asian markets in which Australia competes in an ‘even playing field’ with respect to import tariffs, the US and Chile outperform Australia. Chile exports larger volumes than Australia to Taiwan, South Korea and China (where it has a trade advantage in the former two markets) but ships lower volumes elsewhere in Asia. Chile has significant first mover advantage and it will take effort to convince buyers to switch from existing suppliers. With Australia now on a level

playing field with Chile and with an advantage against other key competitors, opportunities are present for Australia to regain lost market share. Wine Australia will be capitalising on the changes through an active market program, such as the annual Wine Australia tasting in September in Tokyo, and various promotional and educational activities in partnership with Australian Wine Ambassadors and allies such as Austrade, Tourism Australian and Meat and Livestock WVJ Australia.

With Australia now on a level playing field with Chile and with an advantage against other key competitors, opportunities are present for Australia to regain lost market share.

V3 0N 3

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

BUSINESS & MARKETING

WINE AVOIDERS

Wine avoiders in five countries: potential for adopting wine as an alcoholic beverage of choice By Linda Ovington1, Anthony Saliba1* and Johan Bruwer2 1 School of Psychology and NWGIC, Charles Sturt University, Australia 2 School of Marketing, University of South Australia, Australia *Corresponding author: Anthony Saliba, email: asaliba@csu.edu.au

Researchers deliver the final results of their study into wine avoiders across Australia, US, UK, Canada and India, including some interesting findings on the number of avoiders within each country.

harles Sturt University has been conducting a study in five countries on more than 4000 ‘wine avoiders’; that is, people who consume alcohol but choose not to drink wine. There are varied reasons why consumers choose to avoid wine and these will be reported in detail in various forums as data is analysed further. The purpose of this article is straightforward: to report on the percentage of people who are classified as ‘wine avoiders’ across a spectrum of wine countries. This is important, since an avoider of wine in this context potentially represents a new customer to the wine industry, rather than a customer who has been taken from a competitor, or worse, another brand (i.e., commonly termed product cannibalisation). If the percentage of avoiders is considerable, then this represents a platform to potentially substantially increase wine sales in a sustainable way, and to expose more consumers to the joys of experiencing wine. STUDY METHOD Participants of legal drinking age were recruited for completion of an online questionnaire in Australia, the United States, Canada and the United Kingdom as established markets, and India as an emerging market. The total sample, mean age (and standard deviation) are reported in Table 1, while the frequency of alcohol (as distinct from wine) consumption is reported in Figure 1. As expected, the established markets had a fairly similar distribution for frequency of consumption, with a large proportion of consumers reporting drinking several times a week, thus reflecting the well-known 20:80 phenomenon in

www.w i n eb i z .c om.au

Figure 1. marketing (20% of consumers account for 80%, or thereabouts, of a product’s consumption). In India, on the other hand, distribution was more balanced across ‘several times a week’ and ‘once a week’. The figure is standardised in order to show a fair comparison across countries where sample sizes differed.

RESULTS For research purposes, wine avoiders were defined as those who consume wine at 0-5% of their total alcoholic beverage consumption. The 5% ‘rule’ takes into consideration any wine avoiders who may drink a

Table 1. Sample size for each country with mean age (standard deviation). Country

Mean age in years (SD)

1171

45.62 (13.30)

Australia

994

44.17 (13.37)

854

43.56 (13.03)

Canada

978

42.90 (12.61)

India

440

33.73 (8.99)

Total

4437

43.13 (13.15)

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

WINE AVOIDERS

BUSINESS V A R I E T A&LMARKETING REPORT

Results indicate that approximately 18-25% of alcohol consumers avoid wine across all the countries. glass on a special occasion, such as sparkling wine at a wedding or if offered a glass of wine declines the offer. This definition was also informed by focus groups that were conducted in all of the countries. Wine consumers were defined as consuming wine at 6-100% of their total alcoholic beverage consumption. To validate the 5% ‘rule’ we measured the average number of standard wine drinks on a single occasion, comparing wine avoiders with wine consumers. The results are shown in Figure 2. For the Western countries the average for wine avoiders was less than half a standard drink. The results differed for India where 1.5 standard drinks of wine on average were consumed for those who consumed 5% or less wine of their total alcohol consumption. At first glance the results are surprising, however, when considering the responses from a previous focus group study conducted on wine avoiders in India (see Ovington, McIntyre, Saliba and Bruwer 2014) this result is less surprising. Indian participants in general enjoy wine and reported wine avoidance for different reasons. Overall the reasons included accessibility and not knowing how to purchase a genuine wine product (fake wines are common in India). With this in mind, Indians who consume little wine may still report consuming a couple of standard drinks on one occasion if having access to the product is possible. When these Indians consume wine, it is likely to be occasion-driven, i.e., birthday celebration, etc. The percentage of wine avoiders was fairly similar for each country (see Figure 3). Results indicate that approximately 18-25% of alcohol consumers avoid wine across all the countries, averaging out to 21.3% of alcohol consumers who avoid wine. First, it was surprising to find that the percentage of wine consumers was similar across all the countries, including India. When examining the data closely, we can see that the overall consumption levels in India remain low compared with other countries. The consumption figures are based on alcohol consumers and it should not be forgotten that in some countries, the percentage of alcohol avoiders is relatively high, but that fact is not

V3 0N 3

Figure 2.

Figure 3. reflected in the data reported here, since data is based on those who actually consume alcohol. In order to give an estimate of the potential market size of ‘new’ wine consumers for each country, the percentage of adult alcohol consumers was obtained from relevant studies

(i.e., World Health Organisation). An estmation of the total numbers of wine avoiders was calculated from this figure. Results are reported in Table 2. Since the percentage of wine avoiders was relatively constant throughout the different countries (though the US was slightly higher

Table 2. Number of wine avoiders calculated by total number of alcohol consumers. No. of alcohol consumers

Wine avoiders %

Total number of wine avoiders

Australia

14,872,923

21.0

3,123,314

Canada

22,964,555

18.4

4,225,478

192,579,111

24.9

47,952,198

45,934,567

21.4

9,829,997

India

265,283,861

21.8

57,831,877

Total

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

122,962,864

www.wine biz. com . au

BUSINESS & & MARKETING MARKETING BUSINESS

WINE AVOIDERS

All countries tested contain a substantial proportion of wine avoiders, while some countries, due to their population size, represent enormous market potential for new wine consumers. and Canada the lowest), the biggest impact on the total number of wine avoiders was the base population size. In India, this is somewhat misleading as there are studies that claim marked socioeconomic differences. That is, the more than 50 million potential new wine consumers reported in Table 2 for India may be inflated, as some alcohol consumers may not be able to afford wine as it tends to be higher in price than some other alcoholic beverages in that country. However, based on the current figures and given that Australia in 2014 exported 1 million litres of wine to India at A$3.7 million (Daily Wine News 2015), if the wine avoiders segment of 57 million people can be penetrated by, say, just 5% it could mean an increase of 215,000 litres exported to India at A$796,000. In the case of the developed wine markets, a total of 64 million potential

new wine consumers exists, with the US and the UK the largest contributors. Even in Australia, where an excellent framework to encourage new wine consumers exists, there remains more than three million people who could be introduced to the joys of experiencing wine as their chosen alcoholic beverage. CONCLUSION

currently consumed beverages such as beer or spirits. Our premise is socially responsible consumption levels of wine on a per country basis. The results of this study show that all countries tested contain a substantial proportion of wine avoiders, while some countries, due to their population size, represent enormous market potential for new wine consumers. Why people avoid wine and, therefore, what the wine industry can do to address these consumersâ&#x20AC;&#x2122; requirements will be the topic of future reports from this study. REFERENCES Daily Wine News (2015) Australia Business Week in India identifies emerging opportunities

It is important to note that in this study we only polled consumers of alcohol. By doing this, all potential new wine consumers that we have identified are those who already choose to consume alcohol. We are not advocating that people start drinking wine where they currently avoid alcohol. Moreover, we are not advocating that consumers introduce wine into their diet at unsafe levels; instead, we suggest that the joys of experiencing wine could replace

for wine. Retrieved 21 January 2015, from http:// www.winebiz.com.au/dwn/details.asp?ID=16170 Ovington, L.; McIntyre, E.; Saliba, A. and Bruwer, J. (2014) Why do people avoid wine? Wine & Viticulture Journal 29(4):63-65.

WVJ

Wine Industry Calendar Australiaâ&#x20AC;&#x2122;s wine industry portal by Winetitles

JAN MAY

JUN

Visit

JUL OCT

Comprehensive list of local and international events and courses. Search for wine shows, conferences, trade shows, and more!

www.winebiz.com.au/calendar DEC

for more information!

Created and managed by

www.w i n eb i z .c om.au

Got an event to promote? Email wid@winetitles.com.au W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

VA R I E TA L R E P O R T

Bringing to light Australia’s lesser-known Italian whites The producers behind an Australian-grown Malvasia, Greco and Garganega – the three wines regarded by our panellists as the stars of our recent tasting of lesser-known Italian whites – reveal how they are crafting their respective varietals. Mark and Helen Palermo and Paul Lewis Directors Cocozza Single Estate Central Victoria Wine: Green Man 2012 Malvasia Istriana (RRP$36.00/BOTTLE) VITICULTURE The vineyard was established in 2002 on a greenfield site on the western foothills of Mount Samaria, which overlooks the large Lake Nillahcootie, midway between Mansfield and Benalla, and 130km from Melbourne. The vineyard has an elevation of between 260mm and 290mm above sea level and has a 12 degree slope from east to west. Both the elevation and slope minimise any potential frost problems. The sedimentary profile of the site provides the vines with a stony, gravely loam over permeable clay above the fractured bedrock. Major influences on the micro-climate are the south-westerly breezes across the lake, the northerly breezes through the wide north/south valley, and good rainfall. The surrounding state forest immediately adjoining the east and southern boundaries, and the 2002-planted indigenous vegetation corridors also contribute to a more benign influence. The increase and abundance of activity of beneficial insects is evident. All land on our property adjoining the vineyard remains fallow as no cattle are held. As an aside, we are also the proud protectors of several trees that are a rare sub-species of Eucalypt discovered just a few years ago. The only known specimens in the world grow within a 10km radius of our property. Prior to planning and establishing the vineyard, four 1.5 metre deep (approx.) soil pits were dug to assess soil profile, permeability and fertility on two separate sites. Soil was assessed as Class 3 (good for agriculture and some horticulture) bordering on Class 4 (fair for a limited range of agriculture). The soil profiles showed a pH of 6.1-6.7 at 0-10cm and 5.5-5.6 at 10cm-50cm. As a result of the pit soil tests, we had prepared a soil therapy report covering every facet (Albrecht Category) and remedial improvement needed. The recommended fertilisers, based on a blend of composted manure at 5 tonnes per hectare, colloidal soft rock phosphate at 0.3t/ha and all other nutrient elements were spread across the vineyard prior to any planting. The decision had been made in 1998 to plant a vineyard exclusively to Italian varietals; for personal reasons most of the vines selected were southern Italian. The seven varieties chosen were (whites) Fiano, Malvasia and Vermentino, and (reds) Aglianico, Negro Amaro, Sagrantino and Sangiovese. We attended a seminar on Italian varieties held in 1998 by Dr Richard Smart in order to gain a wider perspective on the most suitable Australian geographic areas, facets of climate needs, and the many varying vine training systems. Simplicity, minimising structure costs and the apparent clear benefits of the most suitable training system for our site dictated we use VSP with one fruiting wire and two foliage wires.Dr

V3 0N 3

Mark and Helen Palermo, who together with Paul Lewis, are directors of Green Man Wines. Smart’s formula for the width of the row to equal the height of the trellis to maximise dappled shade, especially north of the Great Divide, made sense. However, we did compromise to provide more tractor clearance and settled for 2m posts and rows of 2.5m wide. Vines with five vines to a bay are at 1.2m spacing. The vineyard was planted in 2004. A second, small vineyard of more intense planting of about 1900 vines, as a support for the existing vineyard, was planted in 2011. All the vines are planted on drought-resistant rootstocks. To increase the survival rate of vines planted in a severe and prolonged drought, the decision was made that the seven chosen varietals would each, wherever possible, include as many as five ▶ different clones and four rootstocks.

Malvasia bunches in the Green Man vineyard located on the western foothills of Mount Samaria, between Mansfield and Benalla in Central Victoria.

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

VA R I E TA L R E P O R T

We were aware that such a mix of clones and rootstocks would considerably increase labour in a very small (7 acres) vineyard involving a majority of hand work. As an example, although not extreme, ripening varied not only between grape varieties but also between rows having different clones and rootstocks. The hope of creating sophisticated and complex finished wines was tempting enough to tolerate the increased work. The vines are all dry grown. For the first five years, during a savage drought and to ensure their survival in the stony soil, the 8500 young vines were individually hand watered several times each year - a mammoth job! There is no irrigation and no plan to install any. Water from a dam onsite is pumped up to a recently installed 165,000 litre holding tank for use for hand watering if necessary during the months of December, January and February, and for new tree planting. Rainfall averages between 850 and 1000mm. The elevation, surrounding mountain ranges, and consistent breezes all exert a modifying influence on the climate during summer months. As soon as the sun sets, temperatures drop quickly and nights, more often than not, are quite cold. Rain storms emanating from the north with tropical influence sometimes produce heavy rainfall and light hail in February. We have been members of Biodynamic Agriculture Australia (BAA) for about 12 years. We intend to make application for a transition period to become accredited. Biodynamic 500 is sprayed two or three times a year, preferably on specific days when moisture is evident. Liquid manure from a mixture of kangaroo and cow manure (from an adjacent property) and seaweed is used. Every three to four years a helping hand of blood and bone is applied to each vine. This year we shall again have soil analysis reports together with suggested organic-based remedial fertilisers needed with biodynamic sprays to improve nutrient balance. The canopy is sometimes sprayed with Casuarina tea and to minimise downy and powdery mildew, only organic products and copper are used as preventatives. Sulfur is rarely used. Shoot thinning is carried out and fruit removal undertaken to keep yields as closely as possible to approximately 2.5kg per vine. Baume readings are recorded regularly together with tasting the juice of half a cup of single berries picked from the separate rootstocks. If a very warm period occurs we are especially alert to the potential of our white varieties to bolt towards 14 Baume. One of the major benefits of Malvasiaâ&#x20AC;&#x2122;s thick-skinned grapes, as in most of our varietals, is the potential for slow, long, bottle ageing. This provides guidelines for assessing sugar levels, seed ripeness, skin state, acid and aromatics, in concert with the Baume reading, in deciding the optimum picking time. Hand pruning and especially fruit picking, provided no extreme weather event occurs, take place on specific biodynamic days according to moon phases. We attempt to delay pruning as late as possible, mainly to extend the ripening period, especially for the reds. The vineyard is mostly spur pruned to a total of eight spurs on the standard two-cordon wires. Pre-pruning for the 2015 season is being considered. The Malvasia is the single Istriana clone although it was planted on two rootstocks - Paulsen 1103 and Ruggeri 140. The vines are quite vigorous although we notice that budburst is always two weeks behind all vines, including some of the very late maturing reds. The vines are quite vertical and comparatively free from serious problems although the past two seasons have shown an even later budburst due possibly to spider mite intrusion. We may have to spray these with sulfur in the dormancy period. The Malvasia fruit grown in southern Italy and Sicily is mostly used to produce Passito wine or is mixed as a blend with

www.w i n eb i z .c om.au

Trebbiano or other whites. There are producers of outstanding Malvasia wine as a single entity but they are in the minority. The reason for the dearth of non-blended Malvasia may be due to several factors including modest cropping and the need to barrel age the wine from six to 15 months to achieve a complex, fine quality. Other white varieties, especially Vermentino, are heavier croppers and seem to need less time before being put into bottles. WINEMAKING Green Man wines are made at Medhurst Wines in the Yarra Valley. Our winemaker, Simon Steele, and our consultant, Robert Paul, consider that although early days, the Malvasia 2015 is shaping up with good promise. The Malvasia fruit for the 2012 vintage was picked on biodynamic fruit day 26 March at 13.5 Baume. The fruit was pressed and cold settled and the juice was acid adjusted. Fermentation was conducted in stainless steel with natural yeast to preserve fruit and natural fermentation. Malolactic fermentation is not performed to preserve acidity and fruit freshness. The wine was aged in old oak for about six months. The 2015 Green Man vintage will provide about 800 cases comprising between 65 and 200 cases for each of the seven varietals. As the second vineyard develops, the total will increase to around 1300 cases. MARKETING All our wines are marketed under the name Green Man Wines. The Green Man is an ancient European, archetypal protector of woodlands and wild places, symbolises fertility, the rebirth of spring, and the spirit of nature. We are alert to the difficult task of gaining a foothold in a tough market and social economic uncertainty. Our objectives are to promote the Green Man image and the protection of the total environment as an integral facet of our viticulture; specialise solely in authentic Italian varietal wines; and maintain a small client base to ensure continuity of supply. The 2012 Malvasia, as a cleanskin, has been released to a few selected outlets as a trial test; the feedback was extremely enthusiastic. We have a very small quantity of the 2014 Malvasia. The 2015 Malvasia, although early days, promises to be an excellent wine so we wait patiently until December when this is bottled. Our 2010 Malvasia won a gold medal and the chairmanâ&#x20AC;&#x2122;s

Chalmersâ&#x20AC;&#x2122; Heathcote Vineyard has two distinct vineyard blocks, one at 120-170m elevation and the other at 200-240m. The Greco grows in the lower block comprising the famous deep friable red Cambrian earth of the region.

W I N E & V I T ICULTUR E JO UR N A L MAY/JUNE 2015

V30N3

VA R I E TA L R E P O R T

trophy for ‘Wine to Watch’ at the 2011 Alternative Varieties Wine Show. While there is no cellar door at the vineyard, our wines are available online, comprising small quantities of the 2010, 2012 and 2014 Malvasia and our 2013 Sangiovese. The 2015 vintage Fiano and Vermentino will be available in September 2015 and the 2015 Malvasia in January 2016. Kim Chalmers Director Chalmers Wines Australia Heathcote, Victoria Wine: Chalmers 2014 Greco (RRP$29.00/bottle) VITICULTURE There are many winegrape varieties cultivated in southern Italy that bear the name Greco or Greco ‘something’ but they are not all related. Their designation, as such, was based on the hypothesis that the vines were introduced to Italy by the Greeks. This particular Greco, a white variety introduced to Australia by Chalmers in 2001, is Greco di Tufo, from Campania. Tuff or Tufo is a type of calcareous rock comprised of fallen volcanic ash, as well as the name of the small town at the centre of the Greco di Tufo DOCG area. On arrival in Australia ,Chalmers first grew Greco on limestone in the Murray Darling and have now planted the variety in ancient soil of volcanic origin in Heathcote. Chalmers Greco is estate-grown at the Chalmers Heathcote Vineyard, in the northern part of the Heathcote GI on the Mt Camel ridge. The site has an east-facing slope home that is home to two distinct vineyard blocks, one at 120-170m elevation and the other at 200-240m. Greco grows in the lower block comprising the famous deep friable red Cambrian earth of the region. Although Chalmers’ first Greco wine was produced in 2005 from the original vineyard in Euston, the Greco plantings at Heathcote were only established in 2010. They are planted in east-west oriented rows running up and down the hill. This orientation ensures even exposure of the fruit on both sides of the row due to the passage of the sun directly over the row during the course of the day. It also enables excellent air drainage as the prevailing winds are almost constantly whipping across the ridge from the west, all the way down the rows and out the bottom where there is lower lying country beyond our bottom vineyard block. The Greco vines are grown on single-cordon VSP with two pairs of foliage wires, initially in a unilateral cane pruning system

Greco harvested from Chalmers’ Heathcote Vineyard in 2014. V3 0N 3

Chalmers Wines director Kim Chalmers. but currently in transition to spur pruning to help restrict yields. The density of the planting is 4545 vines per hectare with vine spacing of 1m and row spacing of 2.2m. The vineyard is set up with drip irrigation fed from a dam filled with water delivered from the Murray Goulburn system. However, due to the average annual rainfall of around 550mm, irrigation is utilised infrequently to supplement natural rainfall as required in drier periods. The bulk of the vineyard nutrients are delivered annually by liberal application of certified organic composted cow manure. An annual cover crop of rye grass is grown in the mid-rows to soak up excess spring moisture and periodically slashed onto the under vine area as a mulch during the growing season. Greco is very hardy in hot/semi-dry environments with incredible high natural acidity, a characteristic we seek in warm climate viticulture to give structure and ageing potential to the wine. Greco also has extremely compact bunches and thin skins rendering it susceptible to botrytis in damp conditions so it is important to manage the canopy in such a way to encourage airflow. The average yield with cane pruning is around 10 tonnes to the hectare (2.2kg per vine) but with the move to spur pruning we hope to reduce that to around 7-8 t/ha (closer to 1.5kg per vine). Greco has generous fruit flavours but with a super high natural acidity frequent flavour tasting is essential in determining harvest date as the acidity can give a false sense of under-ripeness in the field. See page 78 for maturity data from the 2015 vintage for the▶ acid vs sugar ripening profile.

An example of the striking orange juice solids of Greco after racking pre-ferment in 2015 at Chalmers Wines.

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

VA R I E TA L R E P O R T

16/2/2015 24/2/2015

28/2/15 HARVEST

Greco 2015

9/2/2015

Baume

10.4

11.1

11.8

12.0

2.82

2.94

3.04

3.23

25.0

11.7

10.7

7.0

WINEMAKING Grapes for the Chalmers 2014 Greco were hand harvested at 12.5 Baume with 3.34pH and 9.3TA on 27 February. The fruit stayed overnight in a cool room at 4°C and was whole bunch pressed into stainless steel tanks the next morning with no acid adjustment necessary. Fermentation occurs without yeast addition and is limited to 14°C and can take up to two months or more. Greco oxidises readily during the pressing process so the juice is quite brown during ferment. This brown colour drops out after ferment with the wine eventually showing a bright, deep golden colour. The wine was cold stabilised and bottled after six months to retain freshness. We have trialled a few different winemaking methods with Greco through our Bucket Wine project (www.bucketwine. com) including whole berry ferments, two-day cold soaks and maximum oxidation which all produced interesting and unique wines. However, as Greco naturally has strong character with aromas of white peach, marzipan and aromatic spice, a chalky and mineral palate of poached quince with pleasant phenolic grip. We have utilised a fairly simple winemaking process for our commercial release to let the variety speak for itself. MARKETING Chalmers wines are all made from Italian varieties. The core of the range consists of three whites, a rosato and three reds. We also make two sparkling wines and a dessert wine. The Greco sits in the middle of the range of whites in terms of style and price-point. Chalmers wines are only sold within Australia, mostly in Melbourne and Sydney. The market for this wine is primarily on-premise, as is most of the Chalmers portfolio. It’s a savoury, food-friendly style but also has been popular in wine bar settings. A small amount is sold through independent retail outlets, again, mainly in Melbourne. The 2014 Greco was our first from Heathcote and sold out quite quickly as there was a lot of interest around the variety and the wine style. We have been able to significantly increase our production in 2015 which is an exciting prospect for a wine so new in the range. I think Greco has a strong future as the wine has a great balance of intensity, generosity of fruit, chalky texture and mouth-watering acidity. Michael Dal Zotto Winemaker Dal Zotto Wines King Valley, Victoria Wine: 2014 Dal Zotto Garganega (RRP$25.00/bottle) VITICULTURE This 100% Garganega is estate-grown on a block with a northeast-facing slope located in Whitfield, Victoria. The block is on the second tier of the valley at an elevation of 350m and experiences relatively cool growing conditions with maximum temperatures of approximately 33°C and nights that cool to below 10°C throughout the growing season. The vines are grown in a volcanic loam soil. Budburst occurs in late September which can at times put the vines at risk of frost

www.w i n eb i z .c om.au

damage, but frosts are generally more likely to occur at the start of the growing season as opposed the end. However, being up off the valley floor does help given there are good early morning breezes to help minimise this risk. The Garganega is grafted onto old Sauvignon Blanc vines. Two clones are planted: 69 and 84 The trellis system used to grow the grapes is a T-trellis which is used because in the home of Garganega the best system for growing it regardless of site is the pergola method which allows fruit to hang below the canopy in dappled shade. Being a very giving variety the vine has to be shoot thinned early and once fruit is going through veraison it is bunch thinned to help manage the crop load. It is a balancing act as we want the fruit to hang below the vine under the canopy without bunches being too close to the ground. At this point the vine is spur pruned to one-bud spurs. The plant spacing is 1.8m and the rows are 3m apart. The canopy is managed through the growing season to ensure bunches get sufficient light without being completely exposed. The vines are watered via drip irrigation with the amount dependent on the levels of moisture in the soil. The water is sourced from the King River. As mentioned earlier the vines are spur pruned by hand to one bud with four spurs per arm. Due to the nature of the vine and the size of the bunches, which can be up to 400g, there is a constant need to monitor cropping levels and carry out shoot and bunch thinning. In the two years we have been growing the Garganega we have had no trouble with disease or pests. Having such open bunches helps to prevent this and make it a great variety to manage in the vineyard. Being our second year we are still finding our way and experiment with things like managing crop load and also the use of an additional foliage wire. At harvest we are looking for a yellow-orange tinge in the skin with flavours of mandarin and citrus lemony notes as well as some herby characters. We would hope to have it crop at around 4 tonnes to the acre. WINEMAKING The fruit is handpicked and whole bunch pressed. Free run is achieved at 600L/t and pressing at 150L/t. The juice is settled for 12 hours and then racked off lees and inoculated. Initial fermentation temperature is maintained at around 16-18°C and as it starts to move the temperature is lowered to 14°C. Fermentation tends to last around 21 days and in the last third of the ferment it is circulated. Once the ferment is complete the wine is left to settle then racked off lees with a third going to barrel for a period of three months. From this point the wine is stabilised and bottled for a November release. The fruit for the 2014 Garganega was harvested in late March with an analysis of: Baume pH TA

12.5-13.0 3.31 6.07g/L

MARKETING As with all our wines they first get trialled at cellar door before moving into the broader market. Currently, the Garganega is available exclusively at cellar door and sold to local north-east Victorian outlets. As we gain a stronger understanding of the product we will move it out into the national market. WVJ

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

V30N3

TA S T I N G N O T E S

Victorians star in lesser known Italian whites tasting Our latest tasting featured a small collection of alternative Italian white wines made by Australian producers from the following varieties: Garganega, Greco, Verduzzo, Malvasia, and Bianco d’Alessano.

n the last six years, the Wine & Viticulture Journal has held tastings of Australian-made Arneis, Vermentino, Fiano and Pinot Grigio. Today, each of these Italian whites are being produced by at least 50 local wineries. Although this hardly makes them mainstream (although, Pinot Grigio could probably be described as such given it represented 3.63% of last year’s national crush compared with the other whites in Chardonnay, 20.9%, Sauvignon Blanc, 5.62%, and Semillon, 4.2%), we decided it was time to throw our spotlight on some of these varieties’ lesser-known Italian cousins. On their own these whites aren’t yet produced in sufficient number in Australia to warrant stand-alone tastings, so we invited producers to present the following wines for one super-sized tasting: Garganega, Greco, Verduzzo, Malvasia, and Bianco d’Alessano. The panellists for our lesser known Italian whites tasting comprised Andrew Cottell, owner, winemaker and viticulturist for Parish Hill in the Adelaide Hills; Daniel Zuzolo, winemaker and production manager at Primo Estate in McLaren Vale; Sue Bastian, AssociateProfessor in Oenology and Sensory Studies at The University of Adelaide; Peter Dry, Emeritus Fellow with the Australian Wine Research Institute, and Bachelor of Viticulture and Oenology students from The University of Adelaide Sam Milne and Alex Croker.

The panellists for this issue’s tasting were (from left) Andrew Cottell, of Parish Hill, in the Adelaide Hills; Bachelor of Viticulture and Oenology students from The University of Adelaide Sam Milne and Alex Croker; Sue Bastian, of the School of Agriculture, Food and Wine at The University of Adelaide; Peter Dry, Emeritus Fellow, the Australian Wine Research Institute; and Daniel Zuzolo, from Primo Estate, in McLaren Vale. The tasting featured a mix of varietals, including a blend, with Pizzini from the King Valley demonstrating its name for being one of Australia’s most prolific producers of Italian-style wines representing three of the 12 wines. Given this mix, it would have been somewhat unfair to ask our panellists to nominate their best wines of the tasting with only a couple or, as in most cases, no comparisons with similar varietals in

the line-up. Instead, we ask the panel to identify the wines they thought were the stars of the tasting with the following wines receiving the most nominations: Chalmers 2014 Greco, Dal Zotto 2014 Garganega and Green Man 2012 Malvasia. For some interesting insights into the background of these wines and how they’re being produced in the vineyard and winery by their makers, turn to our varietal report on page 75.

CHALMERS 2014 GRECO

DAL ZOTTO 2014 GARGANEGA

GREEN MAN 2012 MALVASIA

Heathcote, Victoria 13.0% v/v - screwcap RRP$29.00/bottle

King Valley, Victoria 13.2% v/v – screwcap RRP$27.00/bottle

Upper Goulburn, Victoria 13.5% v/v - screwcap RRP$36.00/bottle

Star of tasting: Bright pale to medium straw in colour with gold/green tints. Moderately intense nose with some complexity and spice; aromas of pear and lemon rind with hints of stone and tropical fruit. Rich and smooth palate with a soft mouthfeel featuring lemon, melon, and tropical fruit; somewhat warming; good length, weight and texture.

Star of tasting: Mid-yellow straw hues with green tints. Moderately intense nose featuring pome fruit, honey, wild fennel/aniseed and slight floral character. One taster thought the nose was reminiscent of a Mosel Riesling. Floral characters follow onto the full-bodied, well-balanced complex palate which also reveals honey, kerosene, grapefruit, mango and lime cordial characters. Soft acid with good acidity, mouthfeel and length. An attractive, aromatic wine, said one taster.

Star of tasting: Mid-yellow gold in colour with bright green tints. Intense, bright and lifted nose of apricot, peach, pear, orange, marmalade, honey, slight tropicals and florals, water cress and subtle oak; some development evident. Low to medium-bodied palate with soft oak, slightly tart acid and notes of citrus, apricot, orange rind, marmalade and honey. Tight structure and great length of flavour.

V3 0N 3

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

TA S T I N G N O T E S

SALENA ESTATE 2013 BIANCO D’ALESSANO

CALABRIA WINES 2013 PRIVATE BIN PINOT BIANCO

CALABRIA WINES 2012 PRIVATE BIN PINOT BIANCO

Riverland, South Australia 12.0% v/v - screwcap RRP$15.95/bottle

Riverina, New South Wales 12.5% v/v - screwcap RRP$14.95/bottle

Riverina, New South Wales 13.0% v/v - screwcap RRP$14.95/bottle

Clear and bright colour of pale to medium yellowgold with gold/green flashes. Quite a complex nose featuring pear and yellow peach, tropical fruits and characters of asparagus, beans, barley sugar, white pepper and spice; florals also evident. Full flavoured, rich, creamy, persistant palate which is mouthfilling and features grapefruit, apricot and a little savouriness. Good acid finish, albeit a little phenolic. A good food wine; very textural, said one taster. Lacks fruit and freshness, said another.

Bright mid-straw in colour with slight yellow and green tints. Intense, fruit-forward nose of citrus fruit, white nectarine, peach, lime juice, and slight tropical fruit as well as lanolin and musk characters. A couple of tasters detected a character reminiscent of aged Riesling. Fresh and lively acid on the palate which has crunchy apple and stonefruit characteristics. Simplistic but refreshing with lovely fruit, said one taster. Lacks complexity and texture, said another.

Clean and clear colour of mid-straw with green and gold tints. Medium-intensity, moderately-complex nose of apple, peach, pear, cream, rose petal and musk with hints of herbs. Elegant, full-flavoured palate that has good weight and texture balanced with acidity and freshness; good length with some nuttiness and a slightly phenolic finish. A pretty wine with a lovely creamy palate but lacking in freshness and structure. Quite representative of Pinot Bianco, said one taster.

SCOTT WINES 2014 LA PROVA GARGANEGA

GREEN MAN 2014 MALVASIA

PIZZINI 2014 VERDUZZO

Upper Goulburn, Victoria 13.0% v/v - screwcap RRP$36.00/bottle

King Valley, Victoria 12.5% v/v – screwcap RRP$24.00/bottle

Mid yellow gold in colour with a golden rim. Intense, creamy nose of honey, butter, butterscotch, oak, smokiness, marmalade, nutmeg, musk and spice with some slight florals. Well-balanced, persistent palate that has good mouthfeel. Soft acid with some citrus, spice and musk but oak still dominates. One of the most interesting wines in the line-up that offers something that none of the other wines in the line-up do, said one taster. Typical of the variety, said another

Pale straw in colour. Subdued fruits of green apple, lychee, pome fruit, and white stonefruit on the nose, which has a low to moderate intensity; slight spiciness and white blossom also evident. Well-balanced, good-textured, good-weighted and persistent palate with nice flavour and good, bright acid but somewhat simple; stonefruit characters apparent. Probably appeal to the average Sauvignon Blanc drinker. Would appeal to Sauvignon Blanc drinkers, said one taster.

PIZZINI 2013 VERDICCHIO

PIZZINI 2014 FRIULANO

VINEA MARSON 2012 GRAZIA

King Valley, Victoria 12.5% v/v - screwcap RRP$24.00/bottle

King Valley, Victoria 11.6% v/v - screwcap RRP$18.00/bottle

Pale straw hue with green tints. Delicate and fresh nose of medium complexity featuring white blossom, pear, apple, cloves and spiciness. One taster felt the nose was sulfide dominant. Medium-bodied palate of medium length with some stonefruit, pear and lychee but is oak dominant. Good mouthfeel with a clean acid finish. Easy-drinking, good food wine, noted one taster.

Steely pale yellow in colour with yellow-green and silver tints. Medium-intensity, delicate nose featuring kiwifruit, lemon rind, pear, white peach, florals and honey. Very light bodied wine with some lemon and lime and chalky, drying acid. A clean wine but fairly neutral, noted one taster.

(37% Pinot Bianco, 37% Malvasia, 26% Friulano) Alpine Valleys, Victoria 13.0 v/v – screwcap RRP$25-30.00/bottle

Barossa Valley, South Australia 12.0% v/v – screwcap RRP$23.00/bottle Pale straw in colour with green tints. Intense but simple nose with a tinned corn/hot ferment character overlying green apple, pear, white nectarine, buttery and honey characters. Palate has good balance, nice fruit, particularly green apple, and moderate acidity, but is fairly simple.

www.w i n eb i z .c om.au

W I N E & V I T ICULTUR E JO UR N A L MAY/JUNE 2015

Deep, rich yellow in colour with orange/buttery tints. Intense, complex nose of cheese, vinegar, oak and spice; lacks freshness; hydrogen sulfide evident. Palate is textural, balanced, mouthfilling and slightly course. A curious, interesting wine, noted one taster.

V30N3

PRODUCTS & SERVICES

Quantum Mist – a quantum leap in horticultural application

roplands began working with the South Australian Research and Development Institute (SARDI) in 2002 to develop the Quantum Mist™ fan for horticulture. Today, more than 14,000 Quantum Mist fan heads have been sold worldwide. More growers are discovering the financial and timesaving benefits gained from the Quantum Mist’s ability to spray large areas precisely, at faster travel speeds, all while using less energy. The Quantum Mist technology is ideal for a variety of applications and the system can easily match grower needs across all growing conditions. It is widely used in vineyards in single, two and three row combinations. Fluro dye tests have proven that the Quantum Mist penetrates deeper within the canopy and spray actually reaches its intended target. The lightweight axial Quantum Mist fans are easily set to the angle, size and height of the crop, minimising chemical drift and chemical waste. “The advantage with this technology is we can adjust fan speeds down low to reduce drift, match the spray heads to the height of the bushes and get chemical spray straight to the leaf area,” said George Jessett, horticultural manager for BerryExchange, who introduced the Single Row Quantum Mist Sprayer to Australia’s largest commercial blueberry farm. Offering flexibility with fan speed and spray application rates, the Quantum Mist fan heads deliver high volume, turbulent, directional air that provides up to 30 percent more coverage than traditional sprayers, resulting in optimum plant protection and disease control. Jessett says flexibility with spray volume and improved efficacy are the major advantages in using Quantum

The Croplands Quantum Mist sprayer Mist as part of his plant protection program. The Quantum Mist technology has revolutionised the way vineyards are now sprayed and won the Innovation Award at the Wine Industry Suppliers Australia 2009 Supplier of the Year Awards. It continues to advance with a new cable-drive system for increased savings in power requirements and fuel use.

For further information contact Croplands on freecall: 1800 ▶ 999 162 or email: sales@croplands.com.au

Don't rely on what you hear on the grapevine NEW 2015! - WINE BLOGGERS

2015 OUT NOW!

Comprehensive and up-to-date grape and wine industry resource Includes report of the industry - thorough annual statistical overview Trusted resource for over 30 years. Now available in PRINT and ONLINE!

If you’re involved with any facet of the industry, The Directory is an essential reference for sourcing information

To order your copy - Ph: +618 8369 9509 Email: orders@winetitles.com.au Visit: www.winebiz.com.au V3 0N 3

W I N E & V ITICULTUR E JO UR NA L MAY/JUNE 2015

www.wine biz. com . au

PRODUCTS & SERVICES

The ultimate wine transfer pump

noxpa has released a new positive displacement pump for the gentle transfer of whole or destemmed grapes. The compact and robust design of the Kiber NTE progressive cavity pump makes it an essential piece of equipment for any winery. Its mobile design allows it to be installed quickly and easily right underneath any destemer unit. It can also be used for devatting. Friction between the rotor and stator creates a vacuum in the inlet area that aids the entry of grapes into the pump. The turning motion of the rotor makes the cavities between the rotor and the

stator move forward, thus transferring the product to the outlet. Together with its highly versatile, easy-to-clean design, coupled with a three-phase IP55 helical bevel geared motor mounted on rotary wheels with brakes, electric panel with ON/OFF switch, inverter and emergency stop push button, the NTE is the ultimate wine transfer pump. The Kiber NTE starts with the NTE60 with a capacity of 11,000 litres per hour and goes all the way up to our king of cavity pumps, the NTE120 at 90,000 litres per hour.

Visit www.inoxpa.com to download a technical sheet on the Kiber NTE, view our 3D animation of the pump in action at https://youtu.be/QbVUf6j52Cs or phone Inoxpa Australia on +61 3 5976 8881 to discuss all your wine transfer needs.

Belvidere back in full swing

t was a busy vintage at Belvidere Winery in Langhorne Creek, South Australia, with grapes coming in from all over in 2015. The contract processing facility welcomed many new and returning clients, crushing everything from Petit Verdot to Vermentino and anywhere from four tonnes to 1000. Head winemaker Andrew Hercock was busy sourcing fruit both locally and throughout the Riverland to fill a wide range of bottling requests, with

a focus on big reds. The micro winery saw a constant stream of wine destined for barrels and some excellent small batch parcels have started appearing in tastings. Belvidere’s Crystal Xie (international sales) and Hugh Baldwin (client liaison officer/bulk wine sales) recently returned from a successful trip to China to Chengdu (for the 92nd China Food and Drinks Fair) and Qingdao. Here they spent a hectic few weeks promoting packaged and bulk wine

solutions, meeting everybody they could and eating every oddity they could find. There was a strong Australian presence at the fair and it was clear that the reputation of Australian wine is only growing stronger. The Belvidere team welcomes any enquiries on packaged wine, bulk wine and contract processing. It’s never too early to start thinking about vintage 2016! For further information visit www. belviderewinery.com.au

Future proof your vineyard with Eco Trellis

co Trellis offers a complete vineyard trellising solution using posts, clips and strainers suitable for any vineyard site. Since 2009, product development engineers from NZ Tube Mills have worked closely with the Australasian wine industry to develop Eco Trellis steel posts and wire clips. Research and new product development is on-going and in the last 12 months has included: • intensive testing of steel posts in vineyards exposed to high wind and extreme weather conditions. • launch of a patented colour-coded clip range to make viticulturists and vineyard workers more efficient in the field • introduction of a brand new Eco Trellis plug designed specifically to fill any un-used, pre-punched holes in Eco Trellis posts (they are easily removed if irrigation or cordon wire positions need to be changed and do not

www.w i n eb i z .c om.au

protrude or interfere with mechanical pruning or harvesting equipment). With millions of intermediary vineyard posts damaged in Australia and New Zealand each year, Eco Trellis is also ideal for replacing broken wooden posts. Viticulturists and vineyard managers using Eco Trellis intermediary posts report that they replace significantly less than timber alternatives each year. Eco Trellis has sales engineers in New Zealand and Australia. It works with leaders in the Australasian wine industry including Accolade Wines, Treasury Wine Estates, Pernod Ricard, Yalumba, Henschke, Villa Maria Estate Wines and Ara Wines as well as many boutique producers. This revolutionary new trellising system continues to be popular with organic winegrowers and those practising sustainable viticulture methods. For further information visit us at Wine Tech 2015 in Adelaide from 14-16 July or visit www.ecotrellis.com

W I N E & V I T I CULTUR E JO UR NA L MAY/JUNE 2015

Eco Trellis in action at New Zealand’s Felton Road wine company. V30N3

»Spa & Wellness for Your Pipettes« Look after your pipettes before and after vintage > Eppendorf offers pipette maintenance, calibration and adjustment services for all brands of pipettes > Trade-in or Trade-up your old pipettes for new models with the Eppendorf Trade-in program > Receive a 20% discount off your next pipette calibration or maintenance by quoting LQH2014 on your next decontamination form* * Valid till March 31st , 2015, visit www.eppendorf.com.au for forms

Melbourne

Adelaide

New Zealand

FOR ALL YOUR

FILTRATION NEEDS

SUPER PREMIUM WINES

NEW MMF AUTOMATIC CARTRIDGE FILTRATION •

Microﬁltration of still and sparkling wines.

•

Automatic control of ﬂow rate, pressure and regeneration cycles.

•

Utilising high surface area/ﬂow rate for longevity of ﬁlter media

•

Can be used with coarse, polishing or sterile cartridges

•

1000 – 10,000L/hr

BOUTIQUE TO HIGH VOLUME

NEW MFTC HOLLOW FIBRE CROSS FLOW •

Excellent value, available in Semi Auto and Automatic versions.

•

Ease of operation via touch screen display.

•

Wide bore 1.8mm Capillaries for turbid wines

•

9.5 – 95m² systems

OUTSTANDING PERFORMANCE FOR STILL OR SPARKLING WINES

MFTS SPIRAL WOUND CROSS FLOW •

• Microﬁltration Tangential System delivering the highest ﬁltration quality.

“No backﬂush” system allowing constant ﬁlterability.

•

Membrane manufactured in PVDF.

•

Fully automated system.

•

Surface area of 23m2 per membrane.

•

69 – 830m² systems

•

Extremely low operating pressure.

•

Pressurised system for sparkling ﬁltration.

JUCLAS FILTERS ARE BUILT FOR YOUR NEEDS TODAY WITH THE FLEXIBILITY TO ADD EXTRA MEMBRANES LATER TO ACCOMMODATE FUTURE GROWTH

I N N O V A T I V E

W I N E

For further details, contact us on: Melbourne 59 Banbury Rd, Reservoir Ph. 1300 882 850 Adelaide 12 Hamilton Tce, Newton Ph. 08 8365 0044 New Zealand 4C Titoki Place, Albany, Auckland Ph. 0800 699 599 E. sales@winequip.com.au www.winequip.com.au www.winequip.co.nz

T E C H N O L O G I E S