Veterinaria Italiana, Volume 49 (2), April-June 2013

ISSN 0505-401X

RIVISTA DI SANITÀ PUBBLICA VETERINARIA

VOLUME 49 (2) - APRILE-GIUGNO / APRIL-JUNE 2013

Rivista trimestrale di Sanità Pubblica Veterinaria, edita dall’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” A quarterly journal devoted to veterinary public health, veterinary science and medicine, published by the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ in Teramo, Italy

Volume 49 (2), 2013

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 TERAMO, Italia telefono +39 0861 3321 fax +39 0861 332251 www.izs.it

Questa rivista è nata nel 1950 con il nome di Croce Azzurra.

Dal 1954 si chiamerà Veterinaria Italiana.

Direttore Editor-in-Chief Giovanni Savini

Comitato direttivo Managing Scientific Board Romano Marabelli Fernando Arnolfo

Membri onorari Honorary Members Louis Blajan - France James H. Steele - United States of America

Comitato di redazione Editorial Board Hassan Abdel Aziz Aidaros – Egypt Ayayi Justin Akakpo – Senegal Nicola T. Belev – Bulgaria Stuart C. MacDiarmid – New Zealand J. Gardner Murray – Australia Yoshihiro Ozawa – Japan Alexander N. Panin – Russia

Victor E. Saraiva – Brazil Aristarhos M. Seimenis – Greece Arnon Shimshony – Israel Samba Sidibé – Mali Gavin R. Thomson – South Africa Carlo Turilli – Italy Norman G. Willis – Canada

Comitato scientifico Scientific Advisory Board L. Garry Adams – United States of America Menachem Banai – Israel Elie K. Barbour – Lebanon A.C. David Bayvel – New Zealand Giorgio Battelli – Italy Roy G. Bengis – South Africa Ingrid E. Bergmann – Argentina Peter F. Billingsley – United States of America Silvio Borrello – Italy Canio Buonavoglia – Italy Mike Brown – United Kingdom Gideon Brücknerr – South Africa Giovanni Cattoli – Italy Bernadette Connolly – United Kingdom Julio De Freitas – Brazil Piergiuseppe Facelli – Italy Gianluca Fiore – Italy Cesidio Flammini – Italy Riccardo Forletta – Italy Bruno Garin-Bastuji – France Giorgio Giorgetti – Italy Rob Gregory – New Zealand Anwar Hassan – Malaysia

Barry J. Hill – United Kingdom Katsuyuki Kadoi – Japan Bruce Kaplan – United States of America R. Paul Kitching – Canada Corinne I. Lasmézas – France N. James MacLachlan – United States of America Salvatore Magazzù – Italy Franco Mutinelli – Italy Klaus Nielsen – Canada Lisa Oakley – New Zealand Massimo Palmarini – United Kingdom Attilio Pini – Italy Santino Prosperi – Italy Franco M. Ruggeri – Italy Domenico Rutili – Italy Paul Sutmoller – The Netherlands Peter M. Thornber – Australia Silvio Arruda Vasconcellos – Brazil Patrick Wall – Ireland Alexander I. Wandeler – Canada Kazuya Yamanouchi – Japan Cristóbal Zepeda – United States of America Stéphan Zientara – France

Segreteria di redazione Associate Editors Monica Bucciarelli, Guido Mosca, Mariarosaria Taddeo, Carlo Turilli Recensioni Book reviews Manuel Graziani Progetto grafico e web Graphic and web design Paola Di Giuseppe Amministrazione Administration Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 Teramo, Italia veterinariaitaliana@izs.it Stampa Printer Giservice srl, Teramo, Italia http://www.izs.it/vet_italiana/index.html © 2013 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 Teramo, Italia

ISSN 0505-401X Formato elettronico Electronic format ISSN 1828-1427 Stampato su carta ecologica TCF Printed on 50% recycled, 100% chlorine- and acid-free environmentally friendly paper Aut. Trib. Teramo n. 299 del 16/05/1990 Sped. in Abb. Post. Art. 2 comma 20/c L. 66/96 DCB/DC Abruzzo Pescara

Volume 49 (2), 2013

Thomson Reuters Science Journal Citation Reports® database (JCR/Science Edition®) Journal impact factor 2011: 0.667 • National Library of Medicine’s MEDLINE/ PubMed system • Thomson Reuters Science Citation Index Expanded™ (SciSearch®) • CABI’s Full-Text Repository • Directory of Open Access Journals (DOAJ) • Elsevier’s SciVerse Scopus

Vahid Noaman, Edris Shirvani, Seyed Mohammad Hosseini, Amir Hossein Shahmoradi, Mohammad Reza Heidari, Hamid Raiszadeh, Morteza Kamalzadeh & Masoume Bahreyari Serological surveillance of bluetongue virus in cattle in central Iran................................................................................141

Sorveglianza sierologica del virus della Bluetongue (BTV) in bovine Holstein nell’Iran Centrale (riassunto)............................................................................ 141

Chintu Ravishankar, Sukdeb Nandi, Vishal Chander & Tapas Kumar Mohapatra Concurrent testing of breeding bulls for bovine herpesvirus 1 infection (BHV-1) in India.......................................145

Infezione da Herpesvirus bovino-1 (BHV-1) in tori da riproduzione in India (riassunto).......................................................................................... 145 Le pubblicazioni dell’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” (IZSAM) sono protette dalla legge internazionale sul copyright. Gli estratti possono essere letti, scaricati, copiati, distribuiti, stampati, recuperati; è consentito inoltre il collegamento ai file pdf di Veterinaria Italiana.

Informazioni per fini commerciali devono essere richieste all’IZSAM. Le traduzioni a stampa e gli adattamenti sono consentiti previa autorizzazione scritta da parte dell’IZSAM. Le opinioni espresse negli articoli pubblicati sono esclusivamente sotto la responsabilità degli autori. L’eventuale citazione di specifiche Ditte o prodotti, siano essi brevettati o meno, non implica che essi siano stati consigliati dall’IZSAM e vengano preferiti ad altri di simile natura non menzionati nei testi.

Rudi Cassini, Manuela Signorini, Antonio Frangipane di Regalbono, Alda Natale, Fabrizio Montarsi, Mauro Zanaica, Michele Brichese, Giulia Simonato, Serena Borgato, Amira Babiker & Mario Pietrobelli Influenza delle misure preventive sulla prevalenza di leishmaniosi canina in un focolaio identificato in Nord Italia nel 2006 ............................................................151

Preliminary study of the effects of preventive measures on the prevalence of Canine Leishmaniosis in a recently established focus in northern Italy................................................. 157

Javad Asadi, Mojtaba Kafi & Mohammad Khalili Seroprevalence of Q fever in sheep and goat flocks with a history of abortion in Iran between 2011 and 2012......................163

Si ringrazia Fabrizio Piccari per la gentile concessione dell’immagine di copertina.

Sieroprevalenza di Febbre Q in greggi di pecore e capre con anamnesi di aborto in Iran tra il 2011 e il 2012 (riassunto)................................................. 163

Publications of the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ (IZSAM) are protected by international copyright law. Users are permitted to read, download, copy, distribute, print, search abstracts; besides they can link to Veterinaria Italiana full pdf files. Should information be required for commercial purposes, prior written permission must be sought from the IZSAM. Published translations and adaptations also require prior written approval from the IZSAM. The views expressed in signed articles are solely the responsibility of the authors. The mention of specific companies or products of manufacturers, whether or not patented, does not imply that these have been endorsed or recommended by the IZSAM in preference to others of a similar nature that are not mentioned.

Elisabetta Di Giannatale, Alessandra Alessiani, Francesca Sauro, Francesco Sbraccia, Giuseppe Croce, Antonella Nissim, Alessandra Carnevale & Giacomo Migliorati Studio epidemiologico di un focolaio da Norovirus rilevato nel 2009 in una residenza assistita per anziani in Italia Centrale............169

Acknowledgement is made to Fabrizio Piccari for the cover image.

Epidemiological study of an outbreak of Norovirus in a rest home in Italy........................... 175

Irshad Ahmed Hajam, Pervaiz Ahmed Dar, Shanmugam Chandra Sekar, Rajakishore Nanda, Subodh Kishore, Veerakyathappa Bhanuprakash & Kondabattula Ganesh Expression, purification, and functional characterisation of Flagellin, a TLR5-ligand...............................................................................181

Espressione, purificazione e caratteristiche funzionali della Flagellina, un TLR5-legante (riassunto)................................................................................. 181

Volume 49 (2), 2013 Velca Botti, Francine Valérie Navillod, Lorenzo Domenis, Riccardo Orusa, Erika Pepe, Serena Robetto & Cristina Guidetti Salmonella spp. e antibiotico-resistenza in Mammiferi e Uccelli selvatici in Italia nord-occidentale dal 2002 al 2010.................187

Salmonella spp. and antibiotic resistant strains in wild mammals and birds in north-western Italy from 2002 to 2010........................................................................................ 195

Paola Scocco, Francesca Mercati, Andrea Brusaferro, Piero Ceccarelli, Carlo Belardinelli & Alessandro Malfatti Grado di cheratinizzazione dell’epitelio ruminale e valutazione dello stato corporeo in ovini tenuti su pascoli di Brachypodium rupestre...........................................................................203

Keratinisation degree of rumen epithelium and body condition score in sheep grazing on Brachypodium rupestre................................................................................................ 211

Paolo Dalla Villa, Shanis Barnard, Elisa Di Fede, Michele Podaliri, Luca Candeloro, Antonio Di Nardo, Carlo Siracusa & James A. Serpell Risposte comportamentali e fisiologiche al confinamento del cane lungodegente in canile....................................219 Behavioural and physiological responses of shelter dogs to long-term confinement......... 231

SHORT COMMUNICATION Mostafa Halimi, Abasalt Hosseinzadeh Colagar & Mohammad Reza Youssefi Immune response in spirlins (Alburnoides bipunctatus, Bloch 1782) infested by Ligula intestinalis parasite.......................................................243

Risposta immunitaria in alborelle bipuntate infestate da Ligula intestinalis (riassunto) .................................................................................... 243

LIBRI/Book reviews Maria Caramelli Per non scoprirlo mangiando… .................................................247 Eric Chaline 50 Animali che hanno cambiato il corso della Storia ...............249

Serological surveillance of bluetongue virus in cattle in central Iran Vahid Noaman1, Edris Shirvani2, Seyed Mohammad Hosseini3, Amir Hossein Shahmoradi1, Mohammad Reza Heidari1, Hamid Raiszadeh1, Morteza Kamalzadeh2 & Masoume Bahreyari2 1

Department of Veterinary Research, Isfahan Research Centre for Agriculture and Natural Resources, Amirieh Town, Postal Box 81785-199, Isfahan, Iran vnoaman@gmail.com 2 Razi Vaccine and Serum Research Institute, Postal Box 31975-148, Karaj, Iran 3 Isfahan Veterinary Head Office, Amirieh Town, Isfahan, Iran

Keywords Bluetongue virus, Cattle, Competitive ELISA, Iran, Seroprevalence.

Summary The aim of this study was to evaluate the seroprevalence and distribution of antibodies to the bluetongue virus (BTV) among dairy Holstein cattle of central Iran. From September 2010 to August 2011, 892 blood samples from Holstein dairy cattle were collected from healthy animals. Blood samples were divided according to type of farm (industrial and non-industrial), season (warm and cold), location (North, South, East, and West), cattle production groups (calf, heifer, dairy and dry) and age groups (under 6 months, 6 months-2 years and over 2 years). The sera were screened using a commercially competitive enzyme-linked immunosorbent assay (c-ELISA) kit. Twenty-four sera (2.69 %) were found to be positive for BTV. Bluetongue virus seroprevalence was significantly higher (χ2 = 8.29, df = 3, p < 0.05) in cattle in southern locations as compared to those in other locations. Older animals (> 2 years) showed a relatively higher seroprevalence, but the difference was not statistically significant (p = 0.06). No statistically significant difference in BTV seroprevalence was noted between farming systems, seasons and cattle production groups (p > 0.05). The results demonstrate that the seroprevalence of BTV is low in cattle from the Isfahan province, central Iran. Further studies are needed to determine the serotypes and vectors of BTV in the central region of Iran.

Sorveglianza sierologica del virus della Bluetongue (BTV) in bovine Holstein nell’Iran Centrale Parole chiave Bovino, ELISA competitiva, Iran, Sieroprevalenza, Virus della Bluetongue.

Riassunto Il presente studio è stato effettuato con l’obiettivo di valutare la sieroprevalenza e la distribuzione di anticorpi per il virus della Bluetongue (BTV) in bovine da latte Holstein nella provincia di Esfahan, situata nella zona centrale dell’Iran. Tra settembre 2010 e agosto 2011 sono stati prelevati campioni di sangue da 892 animali sani. I campioni sono stati suddivisi in base alla tipologia di allevamento, alla stagione, alla zona di provenienza, al periodo produttivo e all’età dell’animale. Lo screening dei sieri è stato effettuato con kit commerciale c-ELISA. Ventiquattro sieri (2,69%) sono risultati positivi per BTV. La sieroprevalenza è risultata molto più elevata negli animali testati nelle zone meridionali (χ2 = 8,29, p<0,05). Negli animali di età superiore ai 2 anni la sieroprevalenza è risultata più alta ma la differenza non è stata statisticamente significativa (p=0,06). I diversi tipi di allevamento, le stagioni e i diversi stadi del periodo produttivo non hanno permesso di rilevare differenze statisticamente significative (p>0,05). In conclusione i risultati hanno dimostrato bassi valori di sieroprevalanza nei bovini testati. Gli autori indicano la necessità di ulteriori studi per determinare sierotipi e vettori di BTV nella regione centrale dell’Iran.

Veterinaria Italiana 2013, 49 (2), 141-144. doi: 10.12834/VetIt.2013.492.141.144

141

Noaman et al.

Bluetongue virus in cattle of Central Iran

Introduction Bluetongue (BT) is a non-contagious, infectious viral disease of ruminants. Bluetongue viruses (BTV) are arthropod-borne and comprise the type species of the genus Orbivirus, family Reoviridae.

To date, a total of 26 BTV serotypes have been recognised worldwide (8, 11, 23, 17, 21). Bluetongue is responsible for substantial economic losses in ruminants and, because of this economic impact, it has been included in a list of notifiable diseases by the World Organisation for Animal Health (Office International des Épizooties: OIE) (23). The infection occurs throughout tropical and subtropical regions as well as in some temperate regions of the world (between latitudes 34°S and 53°N) (5, 6, 12, 18), where many populations of the adult Culicoides vectors reproduce and can affect domestic and wild ruminants (17, 21).

Based on virological and serological studies, BTV is widely present in sheep and goats in Iran (1, 3, 9, 13, 16). However, only limited information is available on BTV in cattle in Iran (14).

The clinical signs of BT disease in cattle range from a mild febrile illness to extensive erosions of the oral mucosa, at times such symptoms are confused with the symptoms of foot and mouth disease (FMD) (19).

To our knowledge, there is no confirmed report of BT in Iran, although some field veterinarians have previously reported suspected BT-like disease in cattle. Similarly, there have been reports of FMD-like disease in cattle from central Iran that had previously been immunised against FMD. Therefore, the aim of this study was to evaluate the seroprevalence and distribution of antibodies to BTV among dairy Holstein cattle in central Iran.

Material and methods The study was carried out on industrial and non‑industrial Holstein dairy cattle farm around Isfahan (latitude 30° 43’-34° 27’ N, longitude 49° 36’55° 31’ E), central Iran.

From 26 September 2010 to 25 August 2011, a total of 892 blood samples were collected via the jugular vein from healthy cattle from 24 randomly selected Holstein dairy farms in the North, South, East and West of Isfahan. According to the farm records, clinical symptoms related to BTV had not been observed in the animals. Cattle were grouped according to the type of farm (industrial: 621 and non-industrial: 271), season when the samples were collected (warm: 512 and cold: 380), location (North: 199; South: 211; East: 226; and West: 256), production (calf: 123; heifer: 122; in milk production: 514; and during the dry period: 133), and age (under 6 months: 124; 6 months-2 years: 128; and over 2

142

years: 640). The samples were transported to the laboratory in iceboxes. After proper clotting, the blood samples were centrifuged at 5,000 rpm for 10 min and the serum samples were stored at –20°C until analysis.

The sera were screened using a commercially c-ELISA kit (IDEXX/Institut Pourquier, Montpellier, France) following the manufacturer’s instructions.

This test is based on the detection of antibodies specific to the VP7 protein of BTV, and is designed to detect antibodies against any serotype of BTV. One positive and two negative controls provided by the manufacturer were included in each test. Results were expressed as a percentage of the S/N ratio, calculated as % S/N = 100 × sample absorbance/ negative control mean absorbance. According to the manufacturer’s specifications, a sample is considered to be positive if its S/N% value is less than or equal to 70%.

Chi square (χ2) test (SAS software, version 8.2) was used to assess the association between the seroprevalence of BTV and farming systems, seasons, locations, cattle production groups and age groups (20). Results were considered statistically significant for p < 0.05.

Results The overall seroprevalence was 2.69% (95% confidence interval [CI], 1.82-3.97). Bluetongue virus seroprevalence was significantly higher (χ2 = 8.29, p < 0.05) in cattle from southern locations as compared to those in other locations (Table I).

Older animals (> 2 years) showed a relatively higher seroprevalence as compared to other age groups, but the difference was not statistically significant (p = 0.06). Similarly, no statistically significant difference in BTV seroprevalence was noted between farming systems (p = 0.44), seasons (p = 0.45) and cattle production groups (p = 0.11).

Discussion Iran is considered a favourable country for presence and abundance of BTV vectors, because of its latitude and climate (15). Several studies have been performed in different parts of the country for BTV and seropositive sheep and goats have been extensively reported in the West, South-West, NorthWest and Central provinces of Iran (1, 3, 9, 13, 16).

This study reports for the first time the presence of BTV antibodies in cattle from Isfahan province, central Iran. Interestingly, the value of the seroprevalence was similar to the one found in cattle in South-East Iran (14), but it was much lower

Veterinaria Italiana 2013, 49 (2), 141-144. doi: 10.12834/VetIt.2013.492.141.144

Noaman et al.

Bluetongue virus in cattle of Central Iran

Table I. Distribution of bluetongue virus seroprevalence according to farming system, season, location, cattle production groups and age.

Level

Number tested

Positive

All animals

All animals

892

24

Seroprevalence (%) (95% confidence interval) 2.69 (1.82-3.97)

Farming system

Industrial

621

15

2.42 (1.48-3.95)

Non-industrial

271

9

3.32 (1.76-6.19)

Warm

512

12

2.34 (1.34-4.05)

Cold

380

12

3.16 (1.82-5.44)

North

199

4

2.01 (0.78-5.05)

South

211

11

5.21 (2.93-9.09)

East

226

2

0.88 (0.24-3.16)

West

256

7

2.73 (1.33-5.53)

Calf

123

0

0

Heifer

122

2

1.64 (0.45-5.78)

Category

Season Location

Cattle production group

Age group

Dry

133

3

2.26 (0.77-6.43)

Dairy

514

19

3.7 (2.38-5.71)

Under 6 months

124

0

0

6 months-2 years

128

2

1.56 (0.43-5.51)

Over 2 years

640

22

3.44 (2.28-5.15)

than the values recorded in sheep (53%) and goats (49%) from the same province (16). The value of the seroprevalence was also different from the one reported in neighboring countries where high BTV seroprevalences were detected both in cattle and in sheep and goats (7, 10). Since the test used in this study (c-ELISA) had 100% sensitivity and 98.0% specificity, and the sample size was sufficient for the study purpose, the apparent low seroprevalence in cattle in our study might reflect that either the vector does not bite cattle or that cattle only rarely come into contact with infected vectors.

Species of Culicoides from Iran have been previously reported (15), but there is no information on the Culicoides vectors of BTV in Iran (9). BTV seroprevalence was significantly (p < 0.05) higher in cattle in southern locations as compared to those in other locations. This can probably be due to their proximity to the Zayandeh-Rood River (16); this river plays an effective role on the climatic conditions and the humidity of the region, and provides excellent opportunity for reproduction, proliferation and propagation of vectors (15).

As expected, older animals were found to have a higher seroprevalence than younger animals. As described by Singer et al. 1998 (22), the higher seroprevalence in older animals is probably due to a longer time of exposure to the vector.

Although cattle-housing hygiene level (manure, pond, and stagnant water management) in

Veterinaria Italiana 2013, 49 (2), 141-144. doi: 10.12834/VetIt.2013.492.141.144

nonâ&#x20AC;&#x2018;industrial farms is lower than in industrial farms and the environmental conditions in non-industrial farms is suitable for vectors activity, contrary to expectations, no significant difference in BTV seroprevalence was shown between cattle kept in industrial and non-industrial farms.

BTV is highly seasonal and antibody levels can be more easily detected after the vector season (4).

However, no statistically significant difference in BTV seroprevalence was found between cold and warm seasons. This observation is in contrast with the results reported by Noaman et al. (16), who observed higher BTV seroprevalence in sheep and goats during the warm season. This finding might indicate the absence of new infection.

The results of this study suggest that the clinical symptoms observed by some field veterinarians in cattle in this region were probably not related to BTV infection. However, further investigations on BTV epidemiology, including studies on BTV serotypes and vectors, should be planned in Iran.

Acknowledgements The authors are thankful to Razi Vaccine and Serum Research Institute of Iran and Isfahan Research Centre for Agriculture and Natural Resources for funding the research and technical support.

143

Bluetongue virus in cattle of Central Iran

Noaman et al.

References 1. Afshar A. & Kayvanfar H. 1974. Occurrence of precipitating antibodies to bluetongue virus in sera of farm animals in Iran. Vet Rec, 94, 233-235.

12. Maclachlan N.J., Drew C.P., Darpel K.E. & Worwa G. 2009. The pathology and pathogenesis of bluetongue.

J Comp Pathol, 141, 1-16.

2. Afshar A., Thomas F.C., Wright P.F., Shapiro J.L. & Anderson J. 1989. Comparison of competitive ELISA, indirect ELISA and standard AGID tests for detecting bluetongue virus antibodies in cattle and sheep. Vet Rec, 124, 136-141.

13. Momtaz H., Nejat Sh., Souod N., Momeni M. & Safari S. 2011. Comparisons of competitive enzyme-linked immunosorbent assay and one step RT-PCR tests for the detection of bluetongue virus in south west of Iran. Afr J Biotechnol, 10 (36), 6857-6862.

3. Azimi S.M., Keyvanfar H., Pourbakhsh S.A. & Razmaraii N. 2008. S7 gene Characterization of bluetongue viruses in Iran. Arch Razi Inst, 63, 15-21.

14. Mozaffari A.A., Khalili M. & Yahyazadeh F. 2012. A serological investigation of bluetongue virus in cattle of south-east Iran. Vet Ital, 48 (1), 41-44.

4. Capela R., Purse B.V., Pena I., Wittman E.J., Margarita Y., Capela M., Romao L., Mellor P.S. & Baylis, M. 2003.

Spatial distribution of Culicoides species in Portugal in relation to the transmission of African horse sickness and bluetongue viruses. Med Vet Entomol, 17, 165-177.

5. European Food Safety Authority (EFSA). 2007. Scientific Opinion of the Scientific Panel on Animal Health and Welfare on request from the European Commission on bluetongue vectors and vaccines. EFSA J, 479, 1-29.

6. Gould E.A. & Higgs S. 2009. Impact of climate change and other factors on emerging arbovirus diseases.

Trans R Soc Trop Med Hyg, 103, 109-121.

7. Gür S.A. 2008. Serologic investigation of blue tongue virus (BTV) in cattle, sheep and Gazella subgutturosa subgutturosa in south-eastern Turkey. Trop Anim Health Prod, 40, 217-221.

8. Hoffman M.A., Renzullo S., Mader M., Chaignat V., Worwa G. & Thuer B. 2008. Genetic characterization of toggenberg orbivirus, a new bluetongue virus, from goats, Switzerland. Emerg Infect Dis, 14, 1855-1861.

9. Jafari-Shoorijeh S., Ramin A.G., Maclachlan N.J., Osburn B.I., Tamadon A., Behzadi M.A., Mahdavi M., Araskhani A., Samani D., Rezajou N. & Amin-Pour A. 2010. High seroprevalence of bluetongue virus infection in sheep flocks in West Azerbaijan, Iran. Comp Immunol Microbiol Infec Dis, 33, 243-247.

10. Lundervold M., Milner-Gulland E.J., O’Callaghan C.J. & Hamblin C. 2003. First evidence of bluetongue virus in Kazakhstan. Vet Microbiol, 92, 281-287.

11. Maclachlan N.J. 2010. Global implications of the recent emergence of bluetongue virus in Europe. Vet Clin North Am Food Anim Pract, 26, 163-71.

144

15. Navai Sh. & Mesghali A. 1968. Ceratopogonidae (Diptera) of Iran. J Nat Hist, 2, 241-246.

16. Noaman V., Kargar-Moakhar R., Shahmoradi A.H., Heidari M.R., Tabatabaei J. & Nabinejad A.R. 2008. Use of competitive ELISA for serological detection of bluetongue virus antibody in sheep and goats of Isfahan Province, Iran [in Persian, with English abstract].

Pajouhesh Sazandegi Anim Fish Sci, 21 (3), 39-48.

17. Pastoret P.-P. 2009. Emerging diseases, zoonoses and vaccines to control them. Vaccine, 27, 6435-6438.

18. Purse B.V., Mellor P.S., Rogers D.J., Samuel A.R., Mertens P.P. & Baylis M. 2005. Climate change and the recent emergence of bluetongue in Europe. Nat Rev Microbiol, 3, 171-81.

19. Radostits O.M., Gay C.C., Hinchcliff K.W. & Constable P.D. 2007. Veterinary medicine: a textbook of the diseases of cattle, sheep, pigs, goats and horses, 10 ed.

WB Saunders Company, London, 1299-1304.

20. SAS 2001. SAS user’s guide: Statistics, SAS Inst. Inc., Carry, NC. 21. Schwartz-Cornil I., Mertens P.P., Contreras V., Hemati B., Pascale F., Breard E., Mellor P.S., MacLachlan N.J. & Zientara S. 2008. Bluetongue virus: virology, pathogenesis and immunity. Vet Res, 39, 46-61.

22. Singer R.S., Boyce W.M., Gardner I.A., Johnson W.O. & Fisher A.S. 1998. Evaluation of bluetongue virus diagnostic tests in free-ranging bighorn sheep. Prev Vet Med, 35, 265-282.

23. Weaver S.C. & Reisen W.K. 2010. Present and future arboviral threats. Antiviral Res, 85, 328-345.

Veterinaria Italiana 2013, 49 (2), 141-144. doi: 10.12834/VetIt.2013.492.141.144

Concurrent testing of breeding bulls for bovine herpesvirus 1 infection (BHV-1) in India Chintu Ravishankar, Sukdeb Nandi, Vishal Chander & Tapas Kumar Mohapatra Virus Laboratory, Centre for Animal Disease Research and Diagnosis, Indian Veterinary Research Institute, Izatnagar, Uttar Pradesh, PIN 243 122 India chinturavi@rediffmail.com

Keywords Bovine herpesvirus 1 (BHV-1), Breeding bulls, ELISA, Real time PCR, Virus isolation, Virus neutralisation test (VNT).

Summary In this study, sera from 65 breeding and 19 training bulls from Uttar Pradesh State in north India were tested for bovine herpesvirus 1 (BHV-1) antibodies by enzyme linked immunosorbent assay (ELISA) and virus neutralization test (VNT). The VNT test could detect 56 (86.15%) and 9 (47.37%) of the samples from breeding and training bulls as positive for BHV-1 antibodies whereas in ELISA 63 (96.92%) and 10 (52.63%) were found positive, respectively. Semen samples from the breeding bulls were simultaneously tested by the Taqman based real time PCR (qPCR). Of the 65 samples screened, only 40 (61.54%) were found to contain BHV-1 DNA indicating that all the seropositive bulls are not shedding the virus in semen. When the RT-PCR positive samples were subjected to virus isolation on Madin-Darby bovine kidney (MDBK) cells, no virus isolates could be obtained. The advantages of concomitant testing of serum and semen of breeding bulls and measures for control of BHV-1 infections in bull farms are discussed.

Infezione da Herpesvirus bovino-1 (BHV-1) in tori da riproduzione in India Parole chiave ELISA, Herpesvirus bovino 1 (BHV-1), Isolamento virale, Real time PCR, Test di neutralizzazione virale (VNT), Toro da riproduzione.

Riassunto L’articolo riporta i risultati ottenuti analizzando i sieri prelevati da 65 tori da riproduzione e 19 tori in prova nello stato indiano dell’Uttar Pradesh per il rilevamento di anticorpi nei confronti dell’Herpesvirus bovino-1 (BHV-1). Il saggio di sieroneutralizzazione (VNT) ha evidenziato la positività per anticorpi anti BHV-1 in 56 (86,15%) tori da riproduzione e 9 (47,37%) in prova.

L’ELISA ha permesso di riscontrare la positività in 63 (96,92%) esemplari da riproduzione e in 10 (52,63%) dei soggetti in prova. Contemporaneamente, con TaqMan real time PCR (qPCR), sono stati analizzati campioni di seme prelevati dai tori da riproduzione. Solo 40 (61,54%) dei 65 campioni hanno evidenziato la presenza di BHV-1, mentre i restanti 25 sono risultati negativi. L’isolamento del virus dai campioni risultati positivi con qPCR, tramite cellule Madin‑Darby bovine kidney (MDBK), non ha avuto esito favorevole. L’articolo descrive i vantaggi dell’analisi contemporanea di siero e seme e propone misure atte al controllo delle infezioni da BHV-1 in allevamenti di tori da riproduzione.

Veterinaria Italiana 2013, 49 (2), 145-150. doi: 10.12834/VetIt.2013.492.145.150

145

Ravishankar et al.

BHV-1 infection in breeding bulls in India

Introduction Bovine herpesvirus 1 (BHV‑1) is the etiologic agent of a variety of disease conditions in bovines, like infectious bovine rhinotracheitis (IBR), infectious pustular vulvovaginitis (IPV), infectious pustular balanoposthitis (IPB), conjunctivitis, abortion, enteritis, and a generalized disease of newborn calves. Bovine herpesvirus 1 belongs to the genus Varicellovirus, subfamily Alphaherpesvirinae, family Herpesviridae (14). The virus can be differentiated into subtypes 1.1, 1.2a and 1.2b on the basis of restriction enzyme profiling of genomic DNA (18). Subtype 1.1 is mainly responsible for the respiratory form of the disease whereas 1.2a and 1.2b are associated with the reproductive system.

However, BHV‑1 subtype 1.1 may also be associated with the reproductive form of the disease and vice versa. Bovine herpesvirus 1.2 subtypes may be less virulent than subtype 1.1. Bovine herpesvirus subtype 1.2a is abortigenic whereas 1.2b is not (9). The virus is distributed worldwide with the exception of few BHV‑1 free countries. It has been eradicated from some European countries and parts of Germany. Control programs are being implemented in several other countries such as Germany and Italy (36). Though an infection with BHV‑1 does not cause high mortality among the affected animals, the economic loss due to reduced production, impaired work ability, abortion and so on, is enormous.

Bovine herpesvirus 1 replicates to high titres in mucous membranes of the upper respiratory tract and, after genital infection, replication occurs in the mucous membranes of the vagina or prepuce. After initial replication in respiratory, prepuce or vaginal mucosal epithelium, the virus can enter neural cells and remain latent in the trigeminal (respiratory form) or sacral ganglia (reproductive form) probably for the entire life of the host (10, 19). Natural stress such as transportation, pregnancy, inclement weather and artificial stress, such as application of corticosteroids, can induce reactivation of the latent infection and potentially shed the virus intermittently in semen, respiratory or vaginal secretion (6). The virus can be transmitted through infected semen by natural mating and artificial insemination to susceptible cows (8, 23). The achievement and maintenance of BHV-1-free status is the best way to prevent the diseases caused by BHV-1. The World Organisation for Animal Health (Office International des Épizooties: OIE) prescribes that, for international trade, sera of animals should be tested for freedom from BHV‑1 antibodies by enzyme-linked immunosorbent assay (ELISA) or virus neutralisation test (VNT) and semen for absence of BHV‑1 by virus isolation or by real time PCR (qPCR).

In India, IBR was first reported in 1976 from Uttar

146

Pradesh State in north India (17). At present the disease is endemic in the country and the seroprevalence of BHV‑1 infections has been reported from cattle and buffalos from different parts of the country (15, 20, 21, 22, 25, 28). The Government of India has decided to screen breeding bulls for the infection before using semen for artificial insemination purposes. However, reports on simultaneous screening of serum and semen of breeding bulls for BHV‑1 status are scarce. This article reports the evaluation of serum and semen of breeding bulls from Uttar Pradesh State for the presence of BHV‑1 antibodies using VNT and ELISA, virus shedding using a Taqman probe based qPCR, and virus isolation. It also communicates the results obtained by testing training bulls for seropositivity.

Materials and methods The samples of the study were from Uttar Pradesh state, North India, which is situated between 23°52´N and 31°28’N latitude and 77°3´E and 84°39´E longitude.

The climate of the state is of tropical monsoon type, but variations exist because of differences in altitudes.

The average temperature varies in the plains from 3°C to 4°C in January to 43°C to 45°C in May and June.

Blood samples from 65 breeding bulls were collected in sterile vacutainers, allowed to clot and transported under chilling conditions to the Virus Laboratory, Centre for Animal Disease Research and Diagnosis (CADRAD), Indian Veterinary Research Institute, Izatnagar, for testing. Serum was separated from the clotted blood by centrifugation; heat inactivated at 56°C for 30 min and stored at –20°C until testing was done. Semen samples were also collected from the animals on the same day and transported to the laboratory under the conditions mentioned above.

All the animals were apparently healthy and were not vaccinated against BHV‑1 as this vaccination is not practiced in India.

The virus neutralisation test was used to determine the titre of BHV‑1 antibodies and was performed following the standard protocol of the OIE (36) with some modifications. Two fold serial dilutions of all the test serum samples, including control positive and control negative serum samples, were made up to 1:32 in Dulbecco modified Eagle’s medium (DMEM) containing 2% foetal bovine serum (FBS) and 50 µg/ml gentamicin. A total of 50 µl of each dilution was put in duplicate wells in a 96 well tissue culture microtitre plate. Undiluted serum samples were put in one well to test the toxicity of the serum to the Madin‑Darby bovine kidney (MDBK) cells.

A volume of 50 µl of BHV‑1 containing 100 TCID50 was added to each well excluding the cell control wells, and the plate was incubated at 37°C for 24 h in a CO2 incubator. A volume of 100 µl of MDBK cell suspension containing 3 × 104 cells was added to all

Veterinaria Italiana 2013, 49 (2), 145-150. doi: 10.12834/VetIt.2013.492.145.150

Ravishankar et al.

the wells. The plate was further incubated at 37°C for 48 h in a CO2 incubator and read for presence or absence of cytopathic effect (CPE). The end point titre was determined on the basis of the highest dilution of the test serum neutralising 100 TCID50 of virus in 50% of cell culture wells. Any neutralisation by undiluted serum was considered as positive.

Serum samples were also tested for antibodies to BHV‑1 by using an indirect ELISA (i-ELISA) kit (Svanovir® IBR-Ab, Svanova Biotech Ab, Uppsala, Sweden) following the protocol supplied by the manufacturer. After the test, the plate was read at 450 nm in ELISA reader. The percentage positivity (PP) was calculated using the formula PP = (OD of test sample/OD of positive control) × 100. Serum samples with a percentage positivity <25 were considered negative and those with a percentage ≥25 were positive. The relative sensitivity and specificity of VNT with respect to ELISA were calculated following the method of MacDiarmid and Hellstrom (13).

A Taqman probe based qPCR was used to detect BHV‑1 genomic DNA in the semen samples. The assay detects a 97 bp portion of the highly conserved glycoprotein B gene of BHV-1. The extraction of DNA from the samples and qPCR were carried out as described previously (36). For extraction of DNA from the semen samples, 10 µl of the sample was added to 100 µl of Chelex 100 (Sigma-Aldrich, St. Louis, MO, USA) (10%, w/v, in sterile distilled water), 11.5 µl of 10 mg/ml proteinase K (Sigma), 7.5 µl of 1M DTT (Sigma) and 90 µl sterile distilled water. The sample mixture was mixed gently and incubated at 56°C for 30 min. Following brief vortexing, the sample tube was placed in a boiling water bath for 8 min. The vortexing was repeated and the samples were centrifuged at 10,000 × g for 3 min. The supernatant containing DNA was used directly or stored at -20°C for future use. For use as positive control, DNA from BHV‑1 isolate was extracted using SDS-Proteinase K method protocol as described by Sambrook and Russell (27).

A 25 µl qPCR reaction mixture consisted of 12.5 µl of 2X Platinum Quantitative PCR SuperMix-UDG master mixture (Invitrogen, California, USA), 1 µl of each primer (4.5 mM), Taqman probe (3 mM), 4 µl of nuclease free water, 0.5 µl of 1:10 diluted ROX dye and 5 µl of template DNA. Positive control and no template control (NTC) were also included with each run. The cycling was carried out in a Stratagene Mx3005P RT-PCR machine and the cycling parameters were 50°C for 2 min, 95°C for 2 min followed by 45 cycles of 95°C for 15 sec and 60°C for 45 sec. Any sample with a cycle threshold (Ct) value equal or less than 45 was regarded as positive.

Virus isolation from semen was carried out as per the procedure described by the OIE (36) with slight

Veterinaria Italiana 2013, 49 (2), 145-150. doi: 10.12834/VetIt.2013.492.145.150

BHV-1 infection in breeding bulls in India

modifications. Briefly, 200 μl of each fresh semen sample was diluted in 2 ml FBS and gentamicin was added to it at 500 µg/ml. The suspension was mixed vigorously and left at room temperature for 30 min. The mixture was inoculated into confluent MDBK cell monolayer in a six-well tissue culture plate and the plates were incubated for 1 h at 37°C. The mixture was removed and the monolayer washed twice with 5 ml maintenance medium (DMEM with 2% FBS and 50 µg/ml gentamicin) and 5 ml maintenance medium was added to each well.

Known positive control and cell control (without sample) wells were also kept. The plates were observed daily for the appearance of a CPE. If no CPE was present after 7 days, the cultures were frozen and thawed three times, clarified by centrifugation, and the supernatant used to inoculate fresh MDBK monolayers. The samples were considered to be negative, if there was no evidence of a CPE after three passages.

Results Fifty-six (86.15%) and 9 (47.37%) samples out of the 65 bull and 19 training bull sera tested by VNT were found to have BHV‑1 antibodies. The VNT titre of the positive samples ranged from 1:2 to 1:16. In the ELISA test, 63 (96.92%) out of the 65 samples tested were found to be positive for BHV‑1 antibodies.

Percentage positivity values ranged from 40.83 to 95.96%. Ten (52.63%) of the sera of the 19 training bulls tested were found to be positive and the PP values ranged from 55.70 to 95.19%. The samples that were positive in ELISA were positive also in VNT. The two ELISA negative sera were negative also in VNT. When the relative sensitivity of ELISA with respect to VNT for detection of BHV‑1 antibodies was calculated, it was found to be 100%. The relative specificity of detection of ELISA was calculated to be 100% for breeding bulls and 90% for training bulls (Table I). A total of 40 (61.64%) of the 65 semen samples tested were found to be positive for BHV‑1 as evidenced by Ct values ranging from 33.74 to 38.58. All the qPCR positive semen samples were tested as positive in ELISA; however, five samples were detected as negative in the VNT. Virus isolation trials could not recover any BHV‑1 isolate from the qPCR positive semen samples.

Discussion Bovine herpesvirus 1 causes conditions in bovines that are important from the economic point of view.

Some of the characteristics of the virus which make it an important pathogen are: • its capacity to spread quickly in a herd with a basic reproduction number (R0) of more than 3,

147

Ravishankar et al.

BHV-1 infection in breeding bulls in India

Table I. Results of virus neutralisation test and enzyme-linked immunosorbent assay for bovine herpesvirus 1 antibodies performed on sera of breeding and training bulls.

Breeding bulls

Training bulls

Test ELISA

Positive Negative Total

Positive 56 0 56

VNT Negative 7 2 9

Total 63 2 65

Test ELISA

Positive Negative Total

Positive 9 0 9

VNT Negative 1 9 10

Total 10 9 19

VNT = Virus neutralisation test; ELISA = Enzyme-linked immunosorbent assay.

• its capacity to remain latent in the nervous system, • to be reactivate intermittently, • to shed in semen, and • be transmitted by natural mating and artificial insemination (34).

Artificial insemination with BHV‑1 contaminated semen can result in reduction of conception rates, shortened oestrus cycles and endometritis that leads to huge economic losses as well as reduction in production (31). Abortion caused by BHV‑1 infection is observed at 4 - 8 months of gestation (19).

In the present study, it was observed that a very high percentage of breeding bulls (96.92%) were positive for BHV‑1 antibodies indicating that they have been exposed to BHV-1. In breeding bulls, 95% seropositivity from Tamil Nadu, 41% from Karnataka, and 32.34% from Punjab have been reported from India (25, 29). Another important finding is that 52.63% of the training bulls were also found to be seropositive and this should be taken seriously as semen will be collected from these bulls in the future. Among the serological tests conducted, VNT could detect a lesser percentage of animals in both groups as positive.

The greater sensitivity of ELISA is due to the fact that ELISA detects both neutralising and non-neutralising antibodies whereas VNT detects only the former (20).

There are many reports of the use of conventional PCR assays for the detection of BHV‑1 DNA in bovine semen samples (5, 11, 16, 30, 33, 35, 37). However, qPCR has the advantage to be more sensitive and specific than conventional PCR; besides, results can be visualised in real time as and when the reaction is progressing without the need for post PCR processing. Real time PCRs for the detection of BHV‑1 in samples have been reported (1, 7). In the present study, the Taqman based qPCR could detect only 40 (61.54%) out of the 65 semen samples as positive. However, the percentage of seropositive animals was much higher (96.92%). This indicates that not all the seropositive bulls shed virus in the semen at that time. The percentage of positivity is

148

similar to that obtained by Deka et al. (5) in India wherein 14 (58.33%) of 24 semen samples were tested positive by conventional PCR. In another study conducted in India, Rana et al. (24) used qPCR to detect BHV‑1 in frozen semen batches and reported that 86 (19.5%) of the 439 bull samples tested were positive. This positivity percentage is lower compared to the one obtained in this study and it may be due to a lower number of animals shedding the virus or to the fact that frozen (extended) semen in which virus load becomes diluted was used for testing.

In the present study no isolate could be recovered from any of the semen samples tested. There are contrasting reports on the sensitivity of virus isolation from semen employing cell cultures.

Brunner et al. (3) and Drew et al. (8) could detect as little as 5TCID50 in 0.5 ml and 1TCID50 in 0.1 ml of artificially contaminated semen, respectively. Some reports, on the contrary, suggest that virus isolation in cell culture is not sensitive enough to detect BHV‑1 that is still infectious for bovines (2, 12). However, many authors have reported the isolation of BHV‑1 from semen samples with varying success rates (4, 5, 32, 33). The failure to get any isolates in the present study may be due to the very low concentration of virus in the samples which was further reduced by dilution (1:10) prior to inoculation, inactivation of virus during transport of semen samples to the laboratory, and to the inherent toxicity of bovine semen to cell cultures.

The establishment of a BHV‑1 free herd/bull station can be effected by strict quarantine and periodic testing of animals for BHV‑1 antibodies. Testing random serum samples (20%) collected one month apart are a safe surveillance system to monitor BHV‑1 infection in bull farms (34). In a country like India, where BHV-1 is endemic, it is difficult, although not impossible, to maintain a BHV‑1 free herd. However, it should also be borne in mind that seronegative animals have also been shown to excrete the virus in semen (5, 26). Bulls shed BHV‑1 virus in the semen intermittently and following natural and artificially induced stress.

Veterinaria Italiana 2013, 49 (2), 145-150. doi: 10.12834/VetIt.2013.492.145.150

Ravishankar et al.

BHV-1 infection in breeding bulls in India

Real time PCR has several limitations such as need for sophisticated and expensive laboratory instruments, costly chemicals and reagents, and skilled manpower for carrying out of the test and interpretation of results. However, these drawbacks are negligible as compared to the huge economic losses brought about by the release of batches of infected semen into the susceptible population.

Further, the adoption of programs to vaccinate the animals with a suitable potent and efficacious vaccine would definitely reduce the incidence of disease and associated economic losses.

detect BHV-1, though ELISA was superior to VNT in this regard. The presence of the virus in semen samples could be detected by a highly sensitive qPCR. However, the virus could not be isolated from the positive samples. Since serological results do not always correlate well with the presence of virus in the semen, and since virus isolation from semen is a laborious process, the only prudent approach to check the spread of BHV‑1 through semen would be to test each batch of semen by a sensitive test like qPCR and release batches of semen found negative.

Conclusions

Acknowledgments

In the present study breeding bulls were tested for the presence of BHV‑1 infection by VNT, ELISA, qPCR and virus isolation. Both the serological tests could

The authors wish to thank the Director of the Indian Veterinary Research Institute for providing the facilities in which this study was conducted.

References 1. Abril C., Engels M., Liman A., Hilbe M., Albini S., Franchini M., Suter M. & Ackermann M. 2004. Both viral and host factors contribute to neurovirulence of bovine herpesviruses 1 and 5 in interferon receptordeficient mice. J Virol, 78, 3644-3653.

2. Bielanski A., Loewen K.G. & Hare W.C. 1988. Inactivation of bovine herpesvirus 1 (BHV-1) from in vitro infected bovine semen. Theriogenology, 30, 649-657.

3. Brunner D., Engels M., Schwyzer M. & Wyler R. 1988. A comparison of three techniques for detecting bovine herpesvirus 1 (BHV-1) in naturally and experimentally contaminated semen. Reprod Domest Anim, 23, 1-9.

4. Chandranaik B.M., Chethana, Shivaraj, Kumar S. & Renukaprasad C. 2010. Isolation of BHV-1 from bovine semen and application of real-time PCR for diagnosis of IBR/IPV from clinical samples. Vet Arhiv, 80, 467-475.

10. Engels M. & Ackermann M. 1996. Pathogenesis of ruminant herpesvirus infections. Vet Microbiol, 53, 3-15.

11. Grom J., Hostnik P., Toplak I. & Barlic-Maganja D. 2006.

Molecular detection of BHV 1 in artificially inoculated semen and in the semen of a latently infected bull treated with dexamethasone. Vet J, 171, 539-544.

12. Kupferschmied H.U., Kihm U., Bachmann P., Muller K.H. & Ackermann M. 1986. Transmission of IBR/IPV virus in bovine semen: a case report. Theriogenology, 25, 439-443.

13. MacDiarmid S.C. & Hellstrom J.S. 1987. An intradermal test for the diagnosis of brucellosis in extensively managed cattle herds. Prev Vet Med, 4, 361-369.

14. MacLachlan N.J. & Dubovi E.J. 2011. Fenner’s veterinary virology. Academic Press, Amsterdam, 507 pp.

5. Deka D., Ramneek, Maiti N.K. & Oberoi M.S. 2005.

Detection of bovine herpesvirus-1 infection in breeding bull semen by virus isolation and polymerase chain reaction. Rev Sci Tech Off int Epiz, 24, 1085-1094.

15. Malmurugan S., Raja A., Saravanabava K. & Dorairajan N. 2004. Seroprevalence of infectious bovine rhinotracheitis in cattle and buffaloes using AvidinBiotin ELISA. Tamilnadu J Vet Anim Sci, 33, 146-149.

6. Dennet D.P., Barasa J.Q. & Johnson J.H. 1976. Infectious bovine rhinotracheitis virus: studies on the venereal carrier status range of cattle. Res Vet Sci, 20, 77-83.

16. Masri S.A., Olson W., Nguyen P.T., Prins S. & Deregt D. 1996. Rapid detection of bovine herpesvirus 1 in the semen of infected bulls by a nested polymerase chain reaction assay. Can J Vet Res, 60, 100-107.

7. Diallo I.S., Corney B.G. & Rodwell B.J. 2011. Detection and differentiation of bovine herpesvirus 1 and 5 using a multiplex real-time polymerase chain reaction.

J Virol, 175, 46-52.

17. Mehrotra M.L., Rajya B.S. & Kumar S. 1976. Infectious bovine rhinotracheitis (IBR) / keratoconjunctivitis in calves. Indian J Vet Path, 1, 70-73.

8. Drew T.W., Hewitt-Taylor C., Watson L. & Edwards S. 1987. Effect of storage conditions and culture technique on the isolation of infectious bovine rhinotracheitis virus from bovine semen. Vet Rec, 121, 547-548.

18. Metzler A.E., Matile H., Gassmann U., Engels M. & Wyler R. 1985. European isolates of bovine herpesvirus 1: a comparison of restriction endonuclease sites, polypeptides, and reactivity with monoclonal antibodies. Arch Virol, 85, 57-69.

9. Edwards S., White H. & Nixon P. 1990. A study of the predominant genotypes of bovid herpesvirus 1 found in U.K. Vet Microbiol, 22, 213-223.

19. Muylkens B., Thiry J., Kirten P., Schynts F. & Thiry E. 2007. Bovine herpesvirus 1 infection and infectious bovine rhinotracheitis. Vet Res, 38, 181-209.

Veterinaria Italiana 2013, 49 (2), 145-150. doi: 10.12834/VetIt.2013.492.145.150

149

BHV-1 infection in breeding bulls in India

20. Nandi S. & Kumar M. 2011. Comparison of ELISA and virus neutralization test in assaying serum antibodies to bovine herpesvirus 1. Acta Virol, 55, 175-177.

aborted materials of dairy cattle. Indian J Ani Sci, 56, 823-826.

21. Nandi S., Pandey A.B., Sharma K., Audarya S.D. & Chauhan R.S. 2007. Seroprevalence of infectious bovine rhinotracheitis in cattle of an organized farm by indirect ELISA. The Indian Cow, 7, 50-53.

30. Van Engelenburg F.A., Maes R.K., van Oirschot J.T. & Rijsewijk F.A. 1993. Development of a rapid and sensitive polymerase chain reaction assay for detection of bovine herpesvirus type 1 in bovine semen. J Clin Microbiol, 31, 3129-3135.

22. Pandita N. & Srivastava R. N. 1993. A study on seroepidemiology of bovine herpes virus in Haryana.

Indian J Virol, 9, 31-38.

31. Van Oirschot J.T. 1995. Bovine herpesvirus 1 in semen of bulls and the risk of transmission: A brief review. Vet Quart, 17, 29-33.

23. Parsonson I.M. & Snowdon W.A. 1975. The effect of natural and artificial breeding using bulls infected with, or semen contaminated with, infectious bovine rhinotracheitis virus. Aust Vet J, 51, 365-369.

32. Van Oirschot J.T., Straver P.J., van Lieshout J.A.H., Quak J., Westenbrink F. & van Exsel A.C. 1993. A subclinical infection of bulls with bovine herpesvirus type 1 at an artificial insemination centre. Vet Rec, 132, 32-35

24. Rana S.K., Kota S.N., Samayam P.N., Rajan S. & Srinivasan V.A. 2011. Use of real-time polymerase chain reaction to detect bovine herpesvirus 1 in frozen cattle and buffalo semen in India. Vet Ital, 47, 313-322.

33. Weiblen R., Kreutz L.C., Canaborro T.F., Schuch L.F. & Rebelatto M.C. 1992. Isolation of bovine herpesvirus 1 from preputial swabs and semen of bulls with balanoposthitis. J Vet Diagn Invest, 4, 341-343.

25. Renukaradhya G.J., Rajasekhar M. & Raghavan R. 1996.

Prevalence of infectious bovine rhinotracheitis in southern India. Rev Sci Tech Off int Epiz, 15, 1021-1028.

34. Wentink G.H., Frankena K., Bosch J.C., Vandehoek J.E.D. & Van den Berg Th. 2000. Prevention of disease transmission by semen in cattle. Livest Prod Sci, 62, 207-220.

26. Rocha M.A., Barbosa E.F., Guimaraes S.E., Dias Neto E. & Gouveia A.M. 1998. A high sensitivity-nested PCR assay for BHV-1 detection in semen of naturally infected bulls. Vet Microbiol, 63, 1-11.

27. Sambrook J. & Russell D.W. 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York.

28. Singh B., Ramakhant K. & Tongaonakar S.S. 1983.

Adaptation of infectious bovine rhinotracheitis virus in MDBK cell line and testing of buffalo sera for neutralizing antibodies. Indian J Comp Microbiol Immunol Infect Dis, 4, 6-10.

29. Singh B.K., Sreenivasan M.A., Tongaonkar S.S., Ramakant K. & Roychoudhary P.N. 1986. Isolation of infectious bovine rhinotracheitis from semen and

150

Ravishankar et al.

35. Wiedmann M., Brandon R., Wagner P., Dubovi E.J. & Batt C.A. 1993. Detection of bovine herpesvirus-1 in bovine semen by a nested PCR assay. J Virol Methods, 44, 129-139.

36. World Organization for Animal Health (Office International des Ă&#x2030;pizooties: OIE) 2010. Infectious bovine rhinotracheitis / infectious pustular vulvovaginitis. OIE, Paris, p. 1-17 (oie.int/fileadmin/ Home/eng/Health_standards/tahm/2.04.13_IBR_IPV. pdf accessed on 9 July 2012).

37. Xia J.Q., Yason C.V. & Kibenge F.S. 1995. Comparison of dot blot hybridization, polymerase chain reaction, and virus isolation for detection of bovine herpesvirus-1 (BHV-1) in artificially infected bovine semen. Can J Vet Res, 59, 102-109.

Veterinaria Italiana 2013, 49 (2), 145-150. doi: 10.12834/VetIt.2013.492.145.150

Influenza delle misure preventive sulla prevalenza di leishmaniosi canina in un focolaio identificato in Nord Italia nel 2006 Rudi Cassini1, Manuela Signorini2, Antonio Frangipane di Regalbono2, Alda Natale3, Fabrizio Montarsi3, Mauro Zanaica4, Michele Brichese5, Giulia Simonato2, Serena Borgato6, Amira Babiker3, Mario Pietrobelli2 Dipartimento di Biomedicina Comparata e Alimentazione (BCA), Università degli Studi di Padova, Viale dell’Università 16, 35020 Legnaro (PD), Italia rudi.cassini@unipd.it 2 Dipartimento di Medicina Animale, Produzioni e Salute (MAPS), Università degli Studi di Padova, Viale dell’Università 16, 35020 Legnaro (PD), Italia 3 Istituto Zooprofilattico Sperimentale delle Venezie, Viale dell’Università 10, 35020 Legnaro (PD), Italia 4 Unità Sanitaria Locale, ULSS 17, Regione Veneto, via G. Marconi 19, 35043 Monselice (PD), Italia 5 Unità Complessa Sanità Animale e Igiene Alimentare, Dorsoduro 3493, 30123 Venezia, Italia 6 Medico Veterinario, Cavalcavia Stati Uniti 14, 35127 Padova, Italia 1

Parole chiave Cane, Italia, Leishmania infantum, Leishmaniosi canina, Prevenzione, Sieroprevalenza.

Riassunto La leishmaniosi canina è un’infezione endemica nel bacino del Mediterraneo con una documentata tendenza a diffondersi verso nord. L’uso massiccio di misure di protezione contro i rischi del contatto con i flebotomi (collari e formulazioni spot-on) è stato studiato in un focolaio registrato in una zona collinare dei Colli Euganei in Italia nord-orientale nel 2006.

Nel 2006 e 2007 sono stati testati i sieri di 449 cani provenienti dalla stessa zona. Trentuno animali (6,9%) sono risultati positivi al test di immunofluorescenza indiretta (IFI). L’analisi dei fattori di rischio ha chiaramente dimostrato come il focolaio fosse limitato alla località di Calaone, situata nel comune di Baone (PD). Per verificare l’efficacia delle misure preventive adottate, nel 2010, 63 cani di Calaone sono stati campionati e i loro proprietari intervistati.

In base alle informazioni rilasciate dai proprietari, la protezione dei cani nei confronti della leishmaniosi ha avuto inizio nel 2006 (66,7% dei cani protetti) crescendo negli anni seguenti (90% dei cani protetti). Il valore di sieroprevalenza (4,2%) della classe di cani di età più giovane (<5 anni) è risultato significativamente minore di quello delle altre classi, dimostrando che gli animali nati dopo il 2006 hanno avuto meno probabilità di infettarsi. Inoltre, i valori di sieroprevalenza riferiti esclusivamente ai cani di Calaone sono risultati del 32,4% (23/71) nel 2006-2007 e 20,6% (13/63) nel 2010, mostrando una tendenza decrescente. I risultati ottenuti mostrano un alto livello di sensibilizzazione dei proprietari dei cani e sembrano evidenziare come l’uso pervasivo di collari e spot-on agisca positivamente nel ridurre l’intensità di circolazione di Leishmania infantum.

Veterinaria Italiana 2013, 49 (2), 151-156. doi: 10.12834/VetIt.2013.492.151.156

Introduzione Leishmania infantum è un importante ed emergente agente patogeno responsabile di zoonosi (17). Il protozoo è l’agente eziologico della leishmaniosi canina e delle forme cutanea e viscerale della leishmaniosi umana nell’area del bacino del Mediterraneo.

La leishmaniosi canina è endemica in molte zone delle coste del Mediterraneo con notevoli variazioni di prevalenza (1, 8, 18).

In Italia è stata dimostrata la tendenza della malattia a diffondersi verso nord (11) con il forte rischio che focolai emergano in altre parti più settentrionali

d’Europa (17). L’uso pervasivo di misure di prevenzione della puntura dei flebotomi (es. collari impregnati con deltametrina o con imidacloprid-10%/ flumethrin-4,5%, formulazioni spot-on contenenti imidacloprid-10%/permethrin-50%) ha dimostrato di essere un efficace mezzo di prevenzione della leishmaniosi canina e di riduzione della sua incidenza nelle aree endemiche e iperendemiche (6, 10, 14, 16). Nonostante questo tipo di approccio sia da tempo ampiamente utilizzato e promosso nei focolai di recente instaurazione al fine di controllare il diffondersi del parassita, non ci sono studi di campo che ne abbiano dimostrato l’efficacia.

151

Cassini et al.

Influenza dell’uso di misure preventive sulla prevalenza di leishmaniosi canina

Molti focolai di leishmaniosi canina sono stati descritti in Nord Italia a partire dagli anni ‘90 (15). Tra questi, un piccolo focolaio è stato prima sospettato e poi confermato in una piccola località della zona dei Colli Euganei nell’Italia nord-orientale. Questo studio riassume i risultati di cinque anni di attività di sorveglianza del focolaio e presenta i risultati preliminari dell’uso massiccio di misure di prevenzione della puntura dei flebotomi per controllare e, possibilmente, eradicare la leishmaniosi canina nella zona.

Materiali e metodi Area di studio Nella prima parte dello studio è stato indagato il livello di diffusione di Leishmania infantum nella zona collinare a sud dei Colli Euganei, posta nella parte centrale della regione Veneto, nell’Italia nord-orientale (Figura 1). Questa zona presenta caratteristiche climatiche e ambientali peculiari, sostanzialmente differenti da quelle dell’area pianeggiante che la circonda. In particolare, i versanti esposti a sud sono caratterizzati da un clima tipicamente mediterraneo.

Nella seconda parte lo studio si è ristretto nella località di Calaone, Comune di Baone, sempre nella zona a sud dei Colli Euganei (45°14’58’’N-11°39’54’’E). Calaone è l’unica frazione del comune che si trova sopra i 100 m sul livello del mare (s.l.m.), con altitudine media di 223 m s.l.m. (intervallo 74-377 m s.l.m.) e predominante esposizione verso sud. Secondo i dati forniti dai servizi veterinari locali (ULSS 17), la popolazione canina, registrata all’anagrafe nel 2010, è risultata costituita da 119 cani con una percentuale di animali non registrati stimata intorno al 5%.

A completamento dello studio, una specifica indagine epidemiologica è stata predisposta nel 2010 per verificare l’efficacia dell’intervento promosso nella località di Calaone, intervistando i proprietari sull’utilizzo delle misure di prevenzione della puntura del flebotomo durante gli anni precedenti. In totale sono stati prelevati campioni da 63 cani e intervistati i rispettivi proprietari.

Analisi di laboratorio

La segnalazione di un caso autoctono di leishmaniosi canina e la presenza di Phlebotomus perniciosus, do-

I campioni di sangue sono stati analizzati utilizzando un test di immunofluorescenza indiretta (IFI) eseguito secondo le indicazioni OIE riportate nel Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (13). I titoli ≥1:40 sono stati considerati positivi e indicativi di esposizione al parassita, rivelatori del contatto tra soggetto e flebotomo infetto durante la precedente stagione estiva. Quando possibile, è stato eseguito un esame citologico su aspirato linfonodale dei cani risultati positivi all’analisi sierologica, la colorazione è stata eseguita con kit Diff-Quick® (MedionDiagnostics International Inc., Miami, FL, USA).

Figura 1. Area di studio. Confini dei comuni coinvolti nello studio (linea bianca spessa) e confini dell’area dei Colli Euganei (linea bianca sottile).

Figura 2. Amastigoti in un aspirato linfonodale risultato positivo e prelevato da un cane residente nella località di Calaone, comune di Baone (PD).

Campionamento

152

cumentate nel 2005 (3), hanno contribuito a far sospettare che la leishmaniosi stesse circolando nel comune di Baone. Il livello di diffusione della parassitosi è stato indagato nel 2006 e nel 2007, quando sono stati analizzati i campioni di sangue prelevati, rispettivamente, da 245 e 229 cani (25 soggetti sono stati testati entrambi gli anni). I proprietari di cani del comune di Baone e dei comuni collinari limitrofi sono stati invitati a far controllare i propri animali, partecipando alle giornate di campionamento gratuito organizzate a maggio 2006 e giugno 2007. Sin dalla prima giornata i proprietari dei cani sono stati invitati a usare misure preventive (collari o spot-on) da giugno a ottobre di ogni anno. Inoltre è stato organizzato un incontro informativo nell’ottobre del 2006 per aumentare la consapevolezza della popolazione locale nei confronti della malattia e delle misure di controllo attuabili.

Veterinaria Italiana 2013, 49 (2), 151-156. doi: 10.12834/VetIt.2013.492.151.156

Cassini et al.

Influenza dell’uso di misure preventive sulla prevalenza di leishmaniosi canina

Analisi statistica

o 1:160). Le analisi statistiche sono state eseguite usando PASW Statistic 18 (SPSS Inc.).

L’analisi ha coinvolto 449 cani controllati nel 2006 e nel 2007 (i soggetti prelevati entrambi gli anni sono stati considerati una sola volta). Si è proceduto con un’analisi dei fattori di rischio per valutare le eventuali differenze di sieroprevalenza tra animali di diverso sesso, con diverso stile di vita (cani da compagnia e da caccia/guardia), appartenenti a diverse classi d’età (<5; 5-7; >7 anni), provenienti da diversi comuni (Arquà Petrarca, Baone, Cinto Euganeo) o residenti in zone a diversa altitudine (pianura: sotto i 100 m s.l.m.; collina: sopra i 100 m s.l.m.). Sono stati anche indagati quali possibili fattori di rischio: l’abitudine a pernottare nell’ambiente esterno, la convivenza con altri cani e lo spostamento in aree endemiche. Le differenze di sieroprevalenza sono state valutate inizialmente utilizzando una statistica di tipo univariato con il test del Chi-quadrato di Pearson o con il test esatto di Fisher, se maggiormente appropriato. Le analisi statistiche sono state eseguite sia considerando tutti i positivi (soglia ≥1:40), sia considerando positivi solo gli animali con titoli ≥1:160, valori normalmente considerati indicativi di infezione (5). Inoltre, il dataset è stato analizzato anche con statistica multivariata, mediante un modello di regressione logistica (9), in modo da verificare quali fossero i potenziali fattori di rischio associati alla sieropositività per Leishmania infantum nei due diversi valori di cut-off (1:40

Per quanto riguarda i cani monitorati nel 2010 a Calaone (n=63), le differenze di sieroprevalenza tra classi di età (<5; 5-7; >7anni) sono state valutate usando il test del Chi-quadrato di Pearson. La sieroprevalenza ottenuta nel 2010 è stata confrontata con il valore ottenuto dal dataset del 2006-2007, ma riferito esclusivamente ai cani provenienti da Calaone.

Risultati Indagine preliminare (anni 2006-2007) Su 449 cani controllati, 31 (6,9%) sono risultati sieropositivi (≥1:40). Dei soggetti positivi 29 cani sono risultati provenire dal Comune di Baone, in particolare, 24 dalla località di Calaone. Solo per un soggetto l’anamnesi ha riportato lo spostamento in area endemica.

La maggior parte dei proprietari si è mostrata riluttante al prelievo di materiale biologico dal proprio cane mediante aspirato linfonodale. In totale sono stati campionati solo 4 cani, di questi 2 sono risultati positivi (Figura 2). I titoli anticorpali dei due cani positivi erano di 1:320 e 1:160.

I risultati delle analisi univariate sono riportati in Tabella I e quelli del modello di regressione logistica

Tabella I. Valori di sieroprevalenza per Leishmania infantum in relazione ad alcuni dati epidemiologici della popolazione canina (anni 2006-2007).

Numero animali

Fattori di rischio Comune

Altitudine Pernottamento in ambiente esterno Classi di età (anni)

Sesso Stile di vita Convivenza con altri cani Spostamento in area endemica

Esposizione (1:40 cut-off) Positivi Prevalenza (%) 0 0,0 29 12,0** 1 0,9 6 2,2 25 14,4** 6 4,6

Infezione (1:160 cut-off) Positivi Prevalenza (%) 0 0,0 20 8,3** 0 0,0 2 0,7 18 10,3** 1 0,8

Arquà Petrarca Baone Cinto Euganeo Pianura Collina No

48 242 111 273 174 131

Si

316

25

7,9

19

6,0*

<5 5-7 >7 Maschi Femmine Cani da compagnia Cani da caccia/guardia No Si No Si

185 123 133 246 199 278 94 208 238 413 32

12 10 9 16 15 17 9 11 20 30 1

6,5 8,1 6,8 6,5 7,5 6,1 9,6 5,3 8,4 7,3 3,1

9 5 6 10 10 10 6 9 11 20 0

4,9 4,1 4,5 4,1 5,0 3,6 6,4 4,3 4,6 4,8 0,0

** p<0,01; * p<0,05.

Veterinaria Italiana 2013, 49 (2), 151-156. doi: 10.12834/VetIt.2013.492.151.156

153

Cassini et al.

Influenza dell’uso di misure preventive sulla prevalenza di leishmaniosi canina

Tabella II. Risultati dell’analisi multivariata dei fattori di rischio (anni 2006-2007).

a

Fattore di rischio

p value

Odds Ratio

Comune di Baone Area collinare Pernottamento ambiente esternoa

<0,001 <0,001

8,718 4,225

0,026

3,332

95% C.I. per O.R. Inferiore Superiore 3,181 23,890 2,468 7,232 1,158

9,592

Considerando solo cani positivi con titolo ≥1:160.

Sieroprevalenza (%)

35

1/24 (4,2%)

8/25 (32,0%)

4/14 (28,6%)

30 25 20 15 10 5 0 <5

5-7

>7

Classi di età (anni)

Figura 3. Valori di sieroprevalenza per Leishmania infantum nella popolazione canina in relazione alle classi di età (anno 2010). in Tabella II. I cani residenti in area collinare, quelli provenienti dal comune di Baone e quelli tenuti a pernottare nell’ambiente esterno hanno mostrato una maggiore probabilità di entrare in contatto con i flebotomi infetti.

Indagine epidemiologica a Calaone (anno 2010) I proprietari dei cani intervistati nell’indagine del 2010 hanno riferito che l’utilizzo di collari e di spot‑on efficaci contro i flebotomi aveva avuto inizio nel 2006. Nel primo anno il 66,7% (30/45) dei cani è risultato dotato di misure preventive.

Tale percentuale è aumentata negli anni seguenti: 90,0% (45/50) nel 2007, 91,1% (51/56) nel 2008 e 88,9% (56/63) nel 2009.

Nel 2010, su 63 cani campionati, 13 (20,6%) sono risultati positivi. La Figura 3 mostra la differenza dei valori di sieroprevalenza tra le classi d’età. La classe <5 anni presenta un valore (4,2%) significativamente minore (p<0,05) delle altre due classi. Nel 2006‑2007, dei 449 soggetti campionati, 71 sono risultati provenienti dalla località di Calaone, di questi 23 (32,4%) sono risultati positivi al test IFI, almeno ad uno dei due campionamenti. La ridu-

154

zione di sieroprevalenza tra il 2006-2007 e il 2010 è stata dell’11,8%.

Discussione L’indagine condotta sulla popolazione canina nel 2006-2007 ha dimostrato la presenza di un focolaio di leishmaniosi canina in quest’area meridionale dei Colli Euganei. La residenza in un’area collinare e la provenienza dal comune di Baone sono stati identificati come i due più importanti fattori di rischio, confermando la località di Calaone come centro del focolaio. La mancanza di differenze di sieroprevalenza tra le classi d’età è indicativa di un’infezione di nuova introduzione, quando i soggetti più anziani hanno le stesse probabilità di quelli più giovani di entrare in contatto con il parassita e diventare infetti. Il focolaio è stato dunque descritto come limitato all’area di Calaone e di recente instaurazione (2006).

Utilizzando il cut-off 1:160, i cani abituati a pernottare all’esterno sono risultati a maggior rischio.

Questo risultato suggerisce che anche i cani tenuti in ambienti interni durante la notte possono avere occasionali contatti con i flebotomi infetti, ma la permanenza all’esterno viene confermata come importante fattore di rischio per lo sviluppo dell’infezione e, conseguentemente, della malattia (4, 12).

I risultati dello studio epidemiologico condotto nel 2010 per valutare la progressione del focolaio sembrano essere incoraggianti anche se risentono della ridotta numerosità del campione.

I dati sull’impiego delle misure di prevenzione della puntura del flebotomo dimostrano come i proprietari dei cani siano stati fortemente sensibilizzati sulla malattia e come gli stessi siano a conoscenza delle corrette misure di controllo dell’infezione.

L’uso diffuso di collari e di spot-on sembra agire in modo positivo, come dimostrano la tendenza decrescente della sieroprevalenza e il limitato numero di cani sieropositivi tra i soggetti giovani. Infatti, in tre anni, il valore di sieroprevalenza nella località di Calaone si è ridotto di circa un terzo. Inoltre, considerando gli animali campionati nel 2010, il valore di sieroprevalenza della classe di età più giovane (fino a 4 anni di età) è risultato significativamente più basso di quello delle altre classi, dimostrando che gli animali nati dopo il 2006 (quando è iniziato l’utilizzo di massa delle misure preventive) hanno avuto meno probabilità di essere esposti al parassita rispetto agli animali più anziani (Figura 3).

Questo focolaio, insieme con i numerosi nuovi focolai di leishmaniosi canina segnalati nel Nord Italia (11, 14), conferma l’espansione dell’infezione da Leishmania infantum in questa parte del paese, che a ragione deve essere considerata endemica, almeno in buona parte delle proprie aree collinari a clima

Veterinaria Italiana 2013, 49 (2), 151-156. doi: 10.12834/VetIt.2013.492.151.156

Cassini et al.

Mediterraneo. In letteratura, solo un caso di leishmaniosi umana è stato documentato in Italia nordorientale (7), ma la presenza di casi sub-clinici e la sottostima di casi di leishmaniosi umana nei report ufficiali potrebbero contribuire a non far emergere una più rilevante circolazione del parassita all’interno della popolazione umana, come riscontrato in Italia nord-occidentale (2). La presenza di aree con elevata prevalenza del parassita all’interno della popolazione canina e la sempre maggiore diffusione geografica suggeriscono un aumento del rischio per la popolazione umana nel prossimo futuro.

Conclusioni Lo studio descrive l’identificazione di un focolaio di leishmaniosi canina in una piccola località di una zona collinare del Nord Italia, in precedenza considerata indenne dal parassita. Un tempestivo intervento, finalizzato a promuovere l’utilizzo di misure di prevenzione nei confronti della puntura del fleboto-

Influenza dell’uso di misure preventive sulla prevalenza di leishmaniosi canina

mo, è stato messo in atto con successo per arrestare la diffusione del parassita, riducendo la sieroprevalenza nei cani dell’area. I risultati ottenuti confermano che il monitoraggio attivo della leishmaniosi canina è un utile mezzo per allertare i servizi di sanità pubblica e che ogni azione finalizzata a prevenire il diffondersi della malattia nel cane contribuisce a diminuire il rischio per la popolazione umana.

Ringraziamenti Si ringraziano per la collaborazione il personale del comune di Baone e i medici veterinari liberi professionisti del territorio.

Finanziamenti Questo studio è stato supportato da un Progetto di Ateneo dell’Università degli Studi di Padova (Codice progetto CPDA083110) e dalla Regione Veneto.

Bibliografia 1. Baneth G., Koutinas A.F., Solano-Gallego L., Bourdeau P. & Ferrer L. 2008. Canine leishmaniosis – new concepts and insights on an expanding zoonosis: part one.

Trends Parasitol, 24, 324-30.

2. Biglino A., Bolla C., Concialdi E., Trisciuoglio A., Romano A. & Ferroglio E. 2011. Asymptomatic Leishmania infantum infection in an area of Northwestern Italy (Piedmont Region) where such infections are traditionally nonendemic. J Clin Microbiol, 48, 131-136.

3. Cassini R. 2008. Aspetti epidemiologici e rischi zoonosici delle malattie trasmesse da vettori: Babesiosi e Leishmaniosi in Italia Nord-Orientale. PhD thesis, University of Padova. (http://paduaresearch. cab.unipd.it/794/1/Tesi_Dottorato_Cassini.pdf ultimo accesso 20/5/2013).

4. Cortes S., Vazc Y., Nevesd R., Maia C., Cardoso L. & Campino L. 2012. Risk factors for canine leishmaniasis in an endemic Mediterranean region. Vet Parasitol, 189, 189-196.

5. Ferroglio E., Trisciuoglio A., Gastaldo S., Mignone W. & Delle Piane M. 2002. Comparison of ELISA IFAT and Western blot for the serological diagnosis of Leishmania infantum infection in dog. Parassitologia, 44, 64.

6. Ferroglio E., Poggi M. & Trisciuoglio A. 2008.

Evaluation of 65% permethrin spot-on and deltamethrin-impregnated collars for canine Leishmania infantum infection prevention. Zoonoses Public Health, 55, 145-148.

7. Gabrielli G.B., Zaia B., Stanzial A.M. & Corrocher R. 2001. Leishmaniosi viscerale: una malattia raramente diagnosticata nel nord Italia. Descrizione di un caso.

Annali Italiani di Medicina Interna, 16, 185-191.

Veterinaria Italiana 2013, 49 (2), 151-156. doi: 10.12834/VetIt.2013.492.151.156

8. Gramiccia M. 2011. Recent advances in leishmaniosis in pet animals: Epidemiology, diagnostics and antivectorial prophylaxis. Vet Parasitol, 181, 23-30.

9. Hosmer D.W. & Lemeshow S. 2000. Applied logistic regression, 2nd ed. Wiley, New York.

10. Maroli M., Mizzoni V., Siragusa C., D’Orazi A. & Gradoni L. 2001. Evidence for an impact on the incidence of canine leishmaniasis by the mass use of deltamethrinimpregnated dog collars in Southern Italy. Med Vet Entomol, 15, 358-363.

11. Maroli M., Rossi L., Baldelli R., Capelli G., Ferroglio E., Genchi C., Gramiccia M., Mortarino M., Pietrobelli M. & Gradoni L. 2008. The northward spread of leishmaniasis in Italy: evidence from retrospective and ongoing studies on the canine reservoir and phlebotomine vectors. Trop Med Int Health, 13, 256-264.

12. Martín-Sánchez J., Morales-Yuste M., Acedo-Sanchez C., Baron S., Diaz V. & Morillas-Marquez F. 2009. Canine Leishmaniasis in southeastern Spain. Emerg Infect Dis, 15, 795-798.

13. Office International des Épizooties: OIE (World Organisation for Animal Health). Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2008. Chapter 2.1.8. Leishmaniosis. (http://www.oie.int/fileadmin/ Ho m e/ eng/ Healt h_st andards/ t ahm / 2.01 .0 8 _ LEISHMANIOSIS.pdf accessed on 20/05/2013).

14. Otranto D., Paradies P., Lia R.P., Latrofa M.S., Testini G., Cantacessi C., Mencke N., Galli G., Capelli G. & Stanneck D. 2007. Efficacy of a combination of 10% imidacloprid/50% permethrin for the prevention of leishmaniasis in kenneled dogs in an endemic area.

Vet Parasitol, 144, 270-278.

155

Influenza dellâ&#x20AC;&#x2122;uso di misure preventive sulla prevalenza di leishmaniosi canina

156

Cassini et al.

15. Otranto D., Capelli G. & Genchi C. 2008. Changing distribution patterns of canine vector borne diseases in Italy: leishmaniosis vs. dirofilariosis. Parasite Vector, 2, S2. doi:10.1186/1756-3305-2-S1-S2.

17. Ready P.D. 2010. Leishmaniasis emergence in Europe. Euro Surveill, 15, pii=19505. (http:// w w w.eurosur veillance.org/ViewAr ticle. aspx?ArticleId=19505).

16. Otranto D., Dantas-Torres F., de Caprariis D., Di Paola G., Tarallo V.D., Latrofa M.S., Lia R.P., Annoscia G., Breitshwerdt E.B., Cantacessi C., Capelli G. & Stanneck D. 2013. Prevention of Canine Leishmaniosis in a Hyper-Endemic Area Using a Combination of 10% Imidacloprid/4.5% Flumethrin. PLos One, 8. doi: 10.1371/journal.pone.0056374.

18. Solano-Gallego L., Koutinas A., Mirò G., Cardoso L., Pennisi M.G., Ferrer L., Bourdeau P., Oliva G. & Baneth G. 2009. Directions for the diagnosis, clinical staging, treatment and prevention of canine leishmaniosis. Vet Parasitol, 165, 1-18.

Veterinaria Italiana 2013, 49 (2), 151-156. doi: 10.12834/VetIt.2013.492.151.156

Preliminary study of the effects of preventive measures on the prevalence of Canine Leishmaniosis in a recently established focus in northern Italy Rudi Cassini1, Manuela Signorini2, Antonio Frangipane di Regalbono2, Alda Natale3, Fabrizio Montarsi3, Mauro Zanaica4, Michele Brichese5, Giulia Simonato2, Serena Borgato6, Amira Babiker3 & Mario Pietrobelli2 Department of Comparative Biomedicine and Food Science, University of Padova, Viale dell’Università 16, 35020 Legnaro (PD), Italy rudi.cassini@unipd.it 2 Department of Animal Medicine, Production and Health, University of Padova, Viale dell’Università 16, 35020 Legnaro (PD), Italy 3 Istituto Zooprofilattico Sperimentale delle Venezie, Viale dell’Università 10, 35020 Legnaro (PD), Italy 4 Local Health Unit, ULSS 17, Veneto Region, via G. Marconi 19, 35043 Monselice (PD), Italy 5 Veneto Region, Animal Health Unit, Dorsoduro 3493, 30123 Venezia, Italy 6 Veterinary practitioner, Cavalcavia Stati Uniti 14, 35127 Padova, Italy 1

Keywords Canine Leishmaniosis, Dog, Italy, Leishmania infantum, Preventive measures, Seroprevalence.

Summary Canine Leishmaniosis is endemic in Mediterranean areas, with a well-documented northward spread. The mass use of preventive measures against sandfly bites (collar and spot-on formulations) was tested in a small focus recently established in an isolated hilly area of north‑eastern Italy (Colli Euganei). In 2006 and 2007, a total of 449 dogs living in the southern part of Colli Euganei were screened against Leishmania infantum using an immunofluorescence antibody test (IFAT), and 31 (6.9%) were seropositive. A risk factor analysis clearly described the focus as limited to a small village named Calaone. In 2010, 63 animals from Calaone were sampled and their owners interviewed to verify the effectiveness of the preventive measures.

According to what reported by owners, dogs started to be protected in 2006 (66.7% dogs protected), and protection rate incremented (around 90%) during the subsequent years. The seroprevalence value (4.2%) of the youngest age class (<5 years) was significantly lower than other classes, demonstrating that animals born after 2006 had low probabilities of getting infected. Besides, seroprevalence value referred only to dogs living in Calaone was 32.4% (23/71) in 2006-2007 and 20.6% (13/63) in 2010, showing a decreasing trend. Although still preliminary, the results show high sensitization of dog owners and suggest that the mass use of collars and spot-on acts positively in reducing the circulation of L. infantum.

Veterinaria Italiana 2013, 49 (2), 157-161. doi: 10.12834/VetIt.2013.492.157.161

Introduction Leishmania infantum is considered an important and emerging zoonotic pathogen (17). It is the etiologic agent of Canine Leishmaniosis (CanL) and of cutaneous and visceral zoonotic Human Leishmaniasis (HumL) in Mediterranean areas. Canine Leishmaniosis is endemic along the Mediterranean coast, where its prevalence varies widely (1, 8, 18).

A northward spread of CanL in Italy is well documented (11) and there is a high risk of emergence in other parts of Europe further north (17).

The massive use of sandfly bite preventive measures (e.g. deltamethrin- and imidacloprid 10%/flumethrin 4.5%-impregnated collars, and imidacloprid 10%/ permethrin 50% in spot-on formulation) has been

shown to be one of the most effective systems in preventing CanL in dogs and reducing its incidence in endemic and hyper-endemic areas (6, 10, 14, 16). Although this approach has been extensively promoted also in newly established foci to control the spread of the parasite, no field studies have documented its effectiveness so far.

Many new autochthonous foci of CanL in northern Italy have been described since the 90s (15). Among these, a small focus was first suspected and then confirmed in a small village in the southern part of Colli Euganei, an isolated hilly area in the central part of the Veneto Region, north-eastern Italy. This study summarizes a 5-year surveillance activity and presents the preliminary results of a mass use of

157

Cassini et al.

Effects of preventive measures on canine leishmaniosis

sandfly bite preventive measures in controlling, and possibly eradicating, CanL from the area.

Material and methods Study area The first part of the study investigated the diffusion of L. infantum in southern Colli Euganei (Figure 1).

The area presents unique climatic and environmental characteristics, which substantially differ from the surrounding plain. In particular, southern slopes are characterized by a Mediterranean climate.

The second part of the study was limited to Calaone, which is a small village located in Baone municipality, southern part of Colli Euganei (45°14’58’’N-11°39’54’’E). Calaone is the only village of the municipality located mostly 100 m above sea level (a.s.l.), with an average altitude of 223 m a.s.l. (range 74-377 m a.s.l.), and a predominant southern exposition. According to the local veterinary service office (ULSS 17) the registered Calaone dog population in 2010 consisted of 119 animals, with an estimated 5% of unregistered dogs.

Field sampling The first suspicion of the presence of L. infantum in the area was based on the report of one autochthonous case of CanL and on the presence of Phlebotomus perniciosus in Calaone village, documented in 2005 (3). The spread of CanL in the southern area of Colli Euganei was assessed in 2006 and 2007, when 245 and 229 dogs, respectively, were screened by serological tests (25 dogs were tested both years). Dog owners in Baone and surrounding hilly municipalities were invited to test their animals during a one-day sampling campaign organized on a free basis in the late May 2006 and in June 2007. Since the first

Figure 1. Study area. Boundaries of municipalities involved in the study (thick white lines) and of Colli Euganei area (thin white lines).

158

2006 campaign, dog owners had been invited to use preventive measures (collars or spot‑on formulation) during the June-October period. Furthermore, an informative meeting was organized in October 2006 in Baone, aimed at increasing the public awareness of the disease and its prevention.

A new specific epidemiological survey, including queries about dog owners’ use of preventive measures, was designed in 2010 to verify the effectiveness of the intervention promoted in Calaone village. A total of 63 animals were sampled and their owners interviewed on the use of preventive measures against sandfly bites during the previous years.

Laboratory analyses Blood samples were analysed using an immunofluorescence antibody test (IFAT) according to OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals (13). Immunofluorescence antibody test serum titres ≥1:40 were considered positive and indicative of CanL exposure, i.e. a contact with an infected vector in the previous summer season. Whenever possible, aspirates from lymph nodes were collected from dogs positive at serological analysis, and cytological smears were stained using Diff-Quick® kit (Medion Diagnostics International Inc., Miami, FL, USA).

Statistical analyses Considering all dogs sampled in 2006 and 2007 (n = 449; dogs tested both years were considered only once), a risk-factor analysis was performed to evaluate seroprevalence differences among sex, life style (companion animals; hunting dogs/ watchdogs), age class (<5; 5-7; >7 years), municipality of origin (Arquà Petrarca; Baone; Cinto Euganeo), and altitude (plain: under 100 m a.s.l.; hill: above

Figure 2. Amastigotes in a positive lymph node aspirate collected from a dog living in Calaone stained using Diff-Quick® kit.

Veterinaria Italiana 2013, 49 (2), 157-161. doi: 10.12834/VetIt.2013.492.157.161

Cassini et al.

Effects of preventive measures on canine leishmaniosis

100 m a.s.l.). Sleeping outside at night, living with other dogs, and travelling to endemic areas were also investigated as possible risk factors. Differences in seroprevalence were first evaluated using univariate statistic, specifically Pearson’s Chi-squared test or, when appropriate, Fisher’s exact test. Statistical analyses were also performed considering positive animals with titres ≥1:160, which is indicative of CanL infection (5). Moreover, the dataset of dogs was analysed by means of multivariate logistic regression model (9) to evaluate potential risk factors associated with L. infantum seroprevalence at different cut-off (1:40 or 1:160). Statistical analysis was performed using PASW Statistic 18 (SPSS Inc.).

in Calaone village. Only one animal had history of travelling to an endemic area.

Most of the dog owners were not willing to let their dogs being checked by means of lymph nodes aspirates. Thus, only 4 dogs were sampled and 2 resulted positive, respectively with 1:320 and 1:160 titres at IFAT (Figure 2).

The results of univariate analysis are presented in Table I, whereas logistic regression model results are shown in Table II. Dogs living in hilly areas and particularly in Baone municipality and kept outside at night showed higher probability to be exposed to an infected sandfly bite.

Differences in seroprevalence among age classes (<5; 5-7; >7 years) of the dogs sampled in 2010 in Calaone village (n = 63) were evaluated using Pearson’s Chi-squared test. Seroprevalence obtained in 2010 was compared to the values referred only to Calaone dogs and obtained from the dataset of 2006-2007 samples.

Epidemiological investigation in Calaone (year 2010) Dog owners interviewed during the 2010 campaign reported that they had started using collars or spot‑on formulations or both since 2006. At the beginning 66.7% (30/45) dogs resulted to be protected from sandfly bites. The percentage increased in subsequent years: 90.0% (45/50) in 2007, 91.1% (51/56) in 2008, and 88.9% (56/63) in 2009.

Results Preliminary survey (years 2006-2007)

In 2010, 13 (20.6%) dogs, out of 63 investigated, resulted positive. Figure 3 shows the differences in age class seroprevalence values in 2010. The <5 age class presents a value (4.2%) significantly lower

A total of 31 (6.9%) out of the 449 dogs tested were seropositive (≥1:40). Nearly all positive dogs (n = 29) were from Baone municipality, and 24 lived

Table I. L. infantum seroprevalence based on epidemiological data and significant statistical differences (years 2006-2007).

Factor Municipality

Altitude Night outdoor Age class (years)

Sex Life style Living with other dogs Travels to endemic areas

N Arquà Petrarca Baone Cinto Euganeo Plain Hill No Yes <5 5-7 >7 Male Female Companion animals Hunting dogs/watchdogs No Yes No Yes

48 242 111 273 174 131 316 185 123 133 246 199 278 94 208 238 413 32

Exposure (1:40 cut-off) Pos Prev (%) 0 0.0 29 12.0** 1 0.9 6 2.2 25 14.4** 6 4.6 25 7.9 12 6.5 10 8.1 9 6.8 16 6.5 15 7.5 17 6.1 9 9.6 11 5.3 20 8.4 30 7.3 1 3.1

Infection (1:160 cut-off) Pos Prev (%) 0 0.0 20 8.3** 0 0.0 2 0.7 18 10.3** 1 0.8 19 6.0* 9 4.9 5 4.1 6 4.5 10 4.1 10 5.0 10 3.6 6 6.4 9 4.3 11 4.6 20 4.8 0 0.0

** p<0.01; * p<0.05.

Veterinaria Italiana 2013, 49 (2), 157-161. doi: 10.12834/VetIt.2013.492.157.161

159

Cassini et al.

Effects of preventive measures on canine leishmaniosis

Table II. Results of multivariate risk-factor analysis (years 2006-2007).

a

Factor

P value

Odds Ratio

Baone municipality Hilly area Night outdoora

<0.001 <0.001 0.026

8.718 4.225 3.332

95% C.I. for O.R. Lower Upper 3.181 23.890 2.468 7.232 1.158 9.592

Only dogs positive at IFAT >1:160.

35

1/24 (4.2%)

8/25 (32.0%)

4/14 (28.6%)

Seroprevalence (%)

30 25 20 15 10 5 0 <5

5-7

>7

Age classes (years)

Figure 3. Seroprevalence for L. infantum in different age classes (year 2010). (p < 0.05) than other classes. In 2006-2007, 71 dogs out of the 449 sampled were from Calaone village, and 23 (32.4%) of these resulted positive at IFAT, at least at one sampling. The reduction of prevalence between 2006-2007 and 2010 was 11.8%.

Discussion The screening of dogs in 2006-2007 clearly demonstrated that a CanL focus has established in the southern part of Colli Euganei area. Provenances from a hilly area and from Baone municipality were identified as the two major risk factors, so confirming Calaone village as the centre of the focus. The lack of differences in seroprevalence values among age classes is indicative of a newly established infection in which old dogs have the same probability of getting infected as young animals. The CanL focus was therefore described as limited to Calaone village and recently established.

Dogs spending the night outdoor resulted at higher risk when using the 1:160 cut-off. This result suggests that also dogs kept inside during the night may have occasional contacts with infected sandflies, but sleeping outside is confirmed to be an important risk factor for the development of the infection and consequently of the disease (4, 12).

Although the results of the epidemiological study

160

conducted in 2010 to evaluate focus progression are still preliminary and affected by the limited size of the dog population sampled, they are encouraging.

Data on the use of sandfly bite preventive measures suggest that dog owners have been highly sensitized to the disease and are aware of the appropriate measures to control the infection.

The mass use of collars and spot-on products seems to act positively, considering the decreasing trend of the seroprevalence and the reduced number of seropositive dogs among young animals. In fact, seroprevalence in Calaone was reduced by one third in about three years. Furthermore, considering only animals sampled in 2010, the seroprevalence value of the youngest age class (up to 4 years old) is significantly lower than other classes, demonstrating that animals born after 2006, when the mass use of preventive measures started in the village, had clearly lower probabilities of being exposed to the parasite than older animals (Figure 3).

This focus, along with the numerous new foci of CanL detected in northern Italy (11, 14), confirm the expansion of L. infantum infection in this part of the country, which must now be considered endemic, at least in most of its hilly areas with Mediterranean climate. At present, only one autochthonous case of HumL has been documented in north-eastern Italy (7), but subclinical cases and the underestimation of HumL cases in official reports can conceal a higher circulation of the parasite in the human population, as it has been found in north-western Italy (2).

The presence of areas with high prevalence and the geographic spread of the parasite among dog populations suggest that the risk to the human population may increase in the near future.

Conclusions The study describes the identification of a new autochthonous focus of CanL in a small village of a hilly area of northern Italy, previously considered free from the parasite. A prompt intervention to promote the use of sandfly bite preventive measures was implemented to stop the spread of the parasite and showed to be able to reduce the seroprevalence among dogs in the area. The results confirm that active CanL monitoring is a useful tool in alerting and preparing public health services, and that any action aimed at preventing the spread of CanL also contributes to lowering the risk for the human population.

Acknowledgments We thank Baone municipality personnel and private veterinary practitioners of the area for the collaboration.

Veterinaria Italiana 2013, 49 (2), 157-161. doi: 10.12834/VetIt.2013.492.157.161

Cassini et al.

Effects of preventive measures on canine leishmaniosis

Grant support This study was supported by a grant from the University of Padua (Project code CPDA083110) and by the Veneto Region.

References 1. Baneth G., Koutinas A.F., Solano-Gallego L., Bourdeau P. & Ferrer L. 2008. Canine leishmaniosis – new concepts and insights on an expanding zoonosis: part one.

Trends Parasitol, 24, 324-30.

2. Biglino A., Bolla C., Concialdi E., Trisciuoglio A., Romano A. & Ferroglio E. 2011. Asymptomatic Leishmania infantum infection in an area of Northwestern Italy (Piedmont Region) where such infections are traditionally nonendemic. J Clin Microbiol, 48, 131-136.

3. Cassini R. 2008. Aspetti epidemiologici e rischi zoonosici delle malattie trasmesse da vettori: Babesiosi e Leishmaniosi in Italia Nord-Orientale. PhD thesis, University of Padova. (http://paduaresearch.cab. unipd.it/794/1/Tesi_Dottorato_Cassini.pdf accessed on 20/5/2013).

4. Cortes S., Vazc Y., Nevesd R., Maia C., Cardoso L. & Campino L. 2012. Risk factors for canine leishmaniasis in an endemic Mediterranean region. Vet Parasitol, 189, 189-196.

5. Ferroglio E., Trisciuoglio A., Gastaldo S., Mignone W. & Delle Piane M. 2002. Comparison of ELISA IFAT and Western blot for the serological diagnosis of Leishmania infantum infection in dog. Parassitologia, 44, 64.

6. Ferroglio E., Poggi M. & Trisciuoglio A. 2008.

Evaluation of 65% permethrin spot-on and deltamethrin-impregnated collars for canine Leishmania infantum infection prevention. Zoonoses Public Health, 55, 145-148.

7. Gabrielli G.B., Zaia B., Stanzial A.M. & Corrocher R. 2001. Leishmaniosi viscerale: una malattia raramente diagnosticata nel nord Italia. Descrizione di un caso.

Annali Italiani di Medicina Interna, 16, 185-191.

8. Gramiccia M. 2011. Recent advances in leishmaniosis in pet animals: Epidemiology, diagnostics and antivectorial prophylaxis. Vet Parasitol, 181, 23-30.

11. Maroli M., Rossi L., Baldelli R., Capelli G., Ferroglio E., Genchi C., Gramiccia M., Mortarino M., Pietrobelli M. & Gradoni L. 2008. The northward spread of leishmaniasis in Italy: evidence from retrospective and ongoing studies on the canine reservoir and phlebotomine vectors. Trop Med Int Health, 13, 256-264.

12. Martín-Sánchez J., Morales-Yuste M., Acedo-Sanchez C., Baron S., Diaz V. & Morillas-Marquez F. 2009. Canine Leishmaniasis in southeastern Spain. Emerg Infect Dis, 15, 795-798.

13. Office International des Épizooties: OIE (World Organisation for Animal Health). Manual of Diagnostic Tests and Vaccines for Terrestrial Animals 2008. Chapter 2.1.8. Leishmaniosis. (http://www.oie.int/fileadmin/ Ho m e/ eng/ Healt h_st andards/ t ahm / 2.01 .0 8 _ LEISHMANIOSIS.pdf accessed on 20/05/2013).

14. Otranto D., Paradies P., Lia R.P., Latrofa M.S., Testini G., Cantacessi C., Mencke N., Galli G., Capelli G. & Stanneck D. 2007. Efficacy of a combination of 10% imidacloprid/50% permethrin for the prevention of leishmaniasis in kenneled dogs in an endemic area.

Vet Parasitol, 144, 270-278.

15. Otranto D., Capelli G. & Genchi C. 2008. Changing distribution patterns of canine vector borne diseases in Italy: leishmaniosis vs. dirofilariosis. Parasite Vector, 2, S2. doi:10.1186/1756-3305-2-S1-S2.

16. Otranto D., Dantas-Torres F., de Caprariis D., Di Paola G., Tarallo V.D., Latrofa M.S., Lia R.P., Annoscia G., Breitshwerdt E.B., Cantacessi C., Capelli G. & Stanneck D. 2013. Prevention of Canine Leishmaniosis in a Hyper-Endemic Area Using a Combination of 10% Imidacloprid/4.5% Flumethrin. PLos One, 8. doi: 10.1371/journal.pone.0056374.

9. Hosmer D.W. & Lemeshow S. 2000. Applied logistic regression, 2nd ed. Wiley, New York.

17. Ready P.D. 2010. Leishmaniasis emergence in Europe. Euro Surveill, 15, pii=19505. (http:// w w w.eurosur veillance.org/ViewAr ticle. aspx?ArticleId=19505).

10. Maroli M., Mizzoni V., Siragusa C., D’Orazi A. & Gradoni L. 2001. Evidence for an impact on the incidence of canine leishmaniasis by the mass use of deltamethrinimpregnated dog collars in Southern Italy. Med Vet Entomol, 15, 358-363.

18. Solano-Gallego L., Koutinas A., Mirò G., Cardoso L., Pennisi M.G., Ferrer L., Bourdeau P., Oliva G. & Baneth G. 2009. Directions for the diagnosis, clinical staging, treatment and prevention of canine leishmaniosis. Vet Parasitol, 165, 1-18.

Veterinaria Italiana 2013, 49 (2), 157-161. doi: 10.12834/VetIt.2013.492.157.161

161

Seroprevalence of Q fever in sheep and goat flocks with a history of abortion in Iran between 2011 and 2012 Javad Asadi1, Mojtaba Kafi1 & Mohammad Khalili2 1

Department of Clinical Sciences, School of Veterinary Medicine, Shiraz University, Shiraz, 71345, Iran 2 Department of Pathobiology, School of Veterinary Medicine, Shahid Bahonar University of Kerman, Kerman, 7616914111, Iran mdkhalili1@yahoo.com, mdkhalily@mail.uk.ac.ir

Keywords Abortion, Coxiella burnetii, Goat, Iran, Seroprevalence, Sheep, Q fever.

Summary The purpose of this study was to estimate the seroprevalence of Coxiella burnetii infection in sheep and goat flocks with a history of abortion in different areas of Iran. One thousand and one hundred ovine and 180 caprine samples from 43 sheep and goat flocks in four counties located in the Northeast (Mashhad), Central (Isfahan), Western (Arak), and Southwest (Shiraz) Iran were collected randomly between March 2011 and April 2012. The CHEKIT Q fever ELISA kit was used to identify specific antibodies against C. burnetii in sheep and goats. The results showed that the overall seroprevalence of C. burnetii in sheep and goats was 19.5% and 27.2%, respectively. There was a significant difference in seropositivity between sheep and goats (P<0.05). Central Iran significantly had the highest prevalence among the studied areas, especially in goat coxiellosis (23.8% and 40.8% in sheep and goats, respectively). The lowest prevalence in sheep was 12.8% in Northeast Iran while in Western Iran C. burnetii antibodies were absent in goats. The higher prevalence of Q fever in Central Iran may be partly due to persistent favourable conditions to spread C. burnetii in this area including drought and dust storms that originated from neighbouring Iraq and Kuwait. In conclusion, the present study demonstrated the relatively high prevalence of Q fever in sheep and goat flocks with a history of abortion. Therefore, Q fever could be responsible for considerable numbers of ovine and caprine abortions in Iran.

Sieroprevalenza di Febbre Q in greggi di pecore e capre con anamnesi di aborto in Iran tra il 2011 e il 2012 Parole chiave Aborto, Capra, Coxiella burnetii, Febbre Q, Iran, Pecora, Sieroprevalenza.

Riassunto L’articolo descrive i risultati di uno studio condotto in Iran tra Marzo 2011 e Aprile 2012 per valutare la sieroprevalenza di infezioni da Coxiella burnetii in pecore e capre con anamnesi di aborto. Lo studio si è basato su un campionamento casuale effettuato su 43 greggi di pecore e capre in quattro province dell’Iran: Mashhad (zona nordorientale), Esfahan (zona centrale), Arak (zona occidentale) e Shiraz (zona sudorientale). Sono stati utilizzati 1.100 campioni prelevati da pecore e 180 prelevati da capre. Per identificare gli anticorpi specifici per Coxiella burnetii è stato impiegato il test CHEKIT Q Fever ELISA. I risultati hanno mostrato la sieroprevalenza totale del microrganismo nel 19,5% delle pecore e nel 27,2% delle capre, differenza che è risultata statisticamente significativa (P<0,05). Nella zona centrale dell’Iran sono stati rilevati valori di sieroprevalenza più elevati nelle capre (40,8%), nella zona nordorientale valori più bassi nelle pecore (12,8%) e nella zona occidentale non sono stati evidenziati anticorpi Coxiella burnetii nelle capre. La presenza di un maggior numero di animali affetti da febbre Q nella zona centrale dell’Iran può essere ricondotta al persistere nell’area di condizioni favorevoli alla diffusione del microrganismo come siccità e tempeste di polvere, queste ultime provenienti da Iraq e Kuwait (paesi confinanti). I risultati dello studio hanno mostrato che in greggi di pecore e capre con anamnesi di aborto esiste una prevalenza relativamente alta di febbre Q, il cui agente eziologico potrebbe essere responsabile del considerevole numero di aborti riscontrati.

Veterinaria Italiana 2013, 49 (2), 163-168. doi: 10.12834/VetIt.2013.492.163.168

163

Asadi et al.

Q fever in sheep and goats in Iran

Introduction Q fever is a zoonotic disease caused by Coxiella burnetii, an obligate intracellular bacterium (23).

The infection has a worldwide distribution with the exception of New Zealand (10). A wide range of hosts is susceptible to infection with C. burnetii including farm animals, pets, wild mammals, arthropods (mainly ticks), birds, as well as humans.

C. burnetii coud be maintained in nature following two different cycles: the wild cycle, in which ticks and wild animals are involved, and the domestic cycle, where ruminant and other animal species such as dogs and cats are the main reservoirs (3, 23).

However, the link between both proposed cycles is currently poorly understood, especially because the domestic cycle has been considered the main source for human infection (18). The main reservoirs of C. burnetii are domesticated ruminants such as cattle, goats and sheep which are also considered the major source of infection for human beings (2).

Transmission of infection to humans occurs mainly through inhalation of contaminated aerosols and, less commonly, ingestion of infected milk and/or raw dairy products (3, 30).

The bacterium has a small gram-negative pleomorphic coccobacilli shape and produces two morphologically distinct cell types that comprise a bi-phasic developmental cycle. A small cell variant (SCV), with its characteristic condensed chromatin, is thought to be an extracellular survival form with enhanced resistance to environmental stressors such as desiccation and heat. When the small cell variant invades the host, it develops into a large cell variant (LCV) that is metabolically and divisionally active. Differentiation of LCV to SCV occurs during the stationary phase of the organism’s growth cycle.

It involves changes in surface proteins, but changes in lipopolysaccharide (LPS) have not been studied so far. Originally LCV was thought to produce an endospore that served as a progenitor of the SCV, but this developmental form has since been discounted (23).

C. burnetii is very resistant to heat, drought and disinfectants. Therefore, the organism can survive for long periods in the environment and be transmitted through contaminated aerosols (2). It has been shown that dry and windy conditions play a role in C. burnetii transmission and are epidemiologic factors in Q fever outbreaks occurring near sheep‑rearing areas (6, 33, 40).

The infection is mainly asymptomatic in humans.

However, acute forms of the disease can cause clinical signs including a flulike illness, pneumonia, and hepatitis. Endocarditis is the major clinical presentation of chronic Q fever (23, 32). Q fever is often subclinical in animals, however it can lead to abortion, fetal death, delivery of weak newborn

164

animals, and reproductive disorders (1, 18, 39, 41).

C. burnetii is commonly shed in the amniotic fluid and placenta of infected animals during parturition, but shedding of the bacterium can also occur via milk, urine, and feces. The only clinical finding in sheep and goats is abortion, particularly in late gestation (11, 31). Abortions during coxiellosis epizootics have been described in goats and sheep (4, 22, 28).

In Iran, the incidence of ovine and caprine abortion is very high, mainly in late gestation without specific clinical signs. Although Brucella species and other causal agents are responsible for a considerable percentage of abortions in Iran, there have also been a significant number of abortions each year with unknown etiology. So far, C. burnetii has not been investigated as plausible agent of these cases in Iran, in addition, recent serological studies have reported the evidence of C. burnetii infection in animals and humans in Kerman, Southeast Iran (16, 17, 36). However, these studies have been conducted with low sample size and limited to this area of the country.

Serological tests are usually used for detection of antibodies against C. burnetii. The most commonly used techniques include ELISA and immunofluorescence assay (IFA). ELISA is preferable to IFA because it is more sensitive (23, 34).

Due to lack of information on the epidemiology and biology of C. burnettii infection, outbreaks of Q fever may occur unnoticeably in humans and animals. Despite the prevalence of Q fever in Iran, only few studies have been conducted on abortions in relation to this disease. Therefore, the present study was undertaken to estimate the prevalence of Q fever in sheep and goat sera of flocks with a history of abortion in different regions of Iran.

Materials and methods Sample collection A total of 1,280 serum samples (1,100 ovine and 180 caprine) was collected from 43 sheep and goat flocks in four counties located in the Northeast (Mashhad), Central (Isfahan), Western (Arak), and Southwest (Shiraz) Iran from April 2011 to March 2012. These four counties were selected on the basis of geographical distribution and local reports of a high occurrence of abortion in both sheep and goats. For each area, information on flock reproductive status (including abortion, fetal death, and newborn animals’ viability) was obtained from the Province Veterinary Department. In all counties except Mashhad, farms with a history of high abortion rate (≥10%) were selected. In the selected farms, about 10–12% of the population of each flock

Veterinaria Italiana 2013, 49 (2), 163-168. doi: 10.12834/VetIt.2013.492.163.168

Asadi et al.

was randomly tested. The number of sampled flocks was 15, 15, and 13 farms in Southwest, Central, and Western Iran, respectively. The flock size ranged from 30 to 500 in Southwest, 50 to 1,120 in Central, and 23 to 400 animals in Western Iran.

In Mashhad, blood samples were randomly obtained immediately before slaughter of sheep and goats at the abattoir of the county. The catchment area of this abattoir includes all counties of Razavi Khorasan province, Northeast Iran.

Animals older than 6 months were included in this study. Blood samples were taken aseptically from the jugular vein using a sterile 10-ml anticoagulant‑free vacutainer. Samples were transported to the laboratory in containers with ice and sera were separated immediately by centrifugation of blood at 1,500×g for 10 min at room temperature and were stored at −20 °C until the day of analysis.

ELISA assay Serum samples were tested for Q fever antibodies using the indirect ELISA kit (CHEKIT, IDEXX Laboratories, Switzerland), which was carried out following the protocol recommended by the manufacturer using phase I + II purified antigens of C. burnetii. Sera were prepared at 1:400 dilution, and specific antibodies were measured using a peroxidase-labeled anti ruminant immunoglobulin G conjugate. Results were expressed as a percentage of the optical density reading of the test sample (value), calculated as value = 100× (S−N)/(P−N), where S, N, and P are the OD of the test sample, the negative control, and the positive control, respectively. Sera were considered to be ELISA positive if they had a value of 40% or more, suspect if the value was between 30% and 40%, and negative if the value was <30%. A farm was considered positive if at least one animal on the farm was classified as positive.

Statistical analysis Statistical analyses were performed using SPSS software version 16 (SPSS Inc., Chicago, Ill, USA). A Chi-square test was used to determine the association between prevalence of Q fever antibodies and species of animals. P value < 0.05 was considered statistically significant.

Q fever in sheep and goats in Iran

seropositivity between sheep and goats (p=0.02).

The highest prevalence in sheep and goats was 23.8% and 40.8% in Central Iran, respectively. The lowest prevalence in sheep was 12.8% in Northeast Iran while in Western Iran, C. burnetii antibodies were absent in goats (Table I).

All flocks had at least one positive animal. Therefore, the flock-level prevalence of Q fever was 100%.

Within-herd seroprevalence ranged from 6.1% to 55.30% in the studied flocks.

Discussion The present study demonstrated that the overall seroprevalence of C. burnetii in sheep and goats was 19.5% and 27.2%, respectively. With the exception of Northeast Iran - where farm data were not available, all farms had at least one seropositive animal (farm prevalence 100%). This study demonstrated substantial transmission of C. burnetii within and between sheep and goat flocks in the studied regions.

The prevalence of seropositive animals (sheep or goats) per farm varied between 6.1 and 55.3%. The difference between farms may be partly related to differences in management and hygienic measures.

All studies performed in rural areas have shown that poor hygiene could be an exacerbating factor in the spread of C. burnetii (20, 21). The overall high prevalence of C. burnetii infection detected in this study can also be associated with poor sanitary practices in most flocks in Iran including inappropriate disposal of fetal fluids and membranes, aborted fetuses, and use of placentas to feed dogs.

The seroprevalence estimates, however, are lower than those found in sheep (29.42%) and goats (65.78%) in Southeast Iran (16, 36).

In this study the Q fever seroprevalence in sheep is comparable to those found in neighbouring countries of Iran. In Turkey serosurveys have demonstrated that seropositivity of C. burnetii infection is 20% in the southern Marmara region (15) and 13.5% in the West Black Sea region (9).

Table I. Seroprevalence of C. burnetii infection in sheep and goats in Southwest, Central, West and Northeast Iran.

Area

Results A total of 1,280 animals from 43 flocks in four different areas in Iran were sampled and tested for the presence of antibodies against C. burnetii. A total of 215 sheep (19.5%; 95% CI: 17-22%) and 49 goats (27.2%; 95% CI: 21-34%) had antibodies specific to C. burnetii. There was a significant difference in

Veterinaria Italiana 2013, 49 (2), 163-168. doi: 10.12834/VetIt.2013.492.163.168

Southwest Central West Northeast Total

Sheep Positive Negative 48 (20.4) 187 (79.6) 80 (23.8) 256 (76.2) 49 (21.1) 183 (78.9) 38 (12.8) 259 (87.2) 215 (19.5) 885 (80.5)

Goat Positive Negative 16 (21.1) 60 (78.9) 31 (40.8) 45 (59.2) 0 (0) 15 (100) 2 (15.4) 11 (84.6) 49 (27.2) 131 (72.8)

Numbers in parentheses show the percentage of prevalence in sheep and goat in each area.

165

Asadi et al.

Q fever in sheep and goats in Iran

The seroprevalence of C. burnetii infection in sheep populations has been estimated in several other countries such as USA (10%), Spain (21%), Cyprus (18.9%) and Germany (1.3%) (13, 25, 29, 35).

Seroprevalence of C. burnetii has been studied worldwide also in goats. The goat seroprevalence has been reported to be 8.8% in Albania (5) and 6.5% in Northern Greece (27). In Spain, the goat and farm prevalence was 8.7% and 45%, respectively (35), similar to the results for animals tested in Northern Ireland (24). Goat and farm prevalence has been determined to be respectively 21.4% and 43.1% in the Netherland(37) and 13% and 47% in Sardinia (22). A highly different goat prevalence has been observed in Poland, where no C. burnetii IgG phase 2 antibodies were found in 918 goats from 48 herds (7). The results of the present study show a 27.2% overall goat prevalence of C. burnetii, which is relatively high compared to most seroprevalence studies performed in Europe, while it is low compared to the seroprevalence in Southeast Iran (65.7%). However, the data collected show the highest prevalence in goats (40.8%) in Central Iran, which is more comparable to the one found in Southeast Iran. Absence of C. burnetii antibodies in Western Iran could be ascribed to the presence of fewer populations of goats in this area.

The results of the study, as the ones of studies performed in Southeast Iran (16, 36) and the USA (25), show a significantly higher seroprevalence in goats than in sheep. Thus, goats represent a higher risk for environmental contamination and, consequently, for transmission within flocks and between different areas. Goats share a predisposition with dairy cows to be chronically infected (18). Therefore, transmission of C. burnetii to humans from infected goats may be significant in areas where they replace cows as a source of milk.

Central Iran had the highest prevalence (P<0.05) among the studied areas especially in goats (40.8%) followed by Southwest, Western, and Northeast Iran.

In recent years, the Central and Southwest regions of Iran have experienced drought associated with lower rainfall and drier lambing season, which predisposes the aerosol transmission of C. burnetii. Concurrently, and especially since 2004, these regions have been experiencing major dust storm events originating from neighbouring Iraq and Kuwait. This event, which is termed â&#x20AC;&#x2DC;the Middle Eastern Dust (MED) eventâ&#x20AC;&#x2122;, can potentially carry different infective agents and transport them over long distances (38).

Interestingly Leski et al. (19) have indicated a high prevalence of C. burnetii in breathable dusts from arid regions of Iraq and Kuwait. The role of dry and

166

windy conditions in the aerosol transmission of C. burnetii has been suggested in several outbreaks (6, 12, 14, 33, 40, 42). Furthermore, an outbreak of Q fever occurred in US soldiers deployed to Iraq in 2005 (8). The disease has recently been reported in countries neighbouring Iran, including Oman (2000), Iraq (2003), Afghanistan (2006), United Arab Emirates (2008), Turkey (2010), and Saudi Arabia (2011) (26).

The higher prevalence of Q fever in Central Iran can be due to climatic conditions favourable to the transmission of the bacterium in this area. In contrast, the lower prevalence in Northeast Iran can be attributed, at least partly, to different conditions including the higher rainfall and lack of the dusts mentioned above. Besides, the most likely way in which animals acquire infection seems to be by inhalation of organisms from infected dusts especially in Central and Southwest Iran.

The samples of this study were taken from flocks with a history of fetal death, delivery of weak offspring and high abortion rate of unknown etiology. The high prevalence of Q fever detected in the samples collected from different regions of Iran suggests a possible important role of C. burnetii as a causal agent of the reproductive failures reported in the flocks of this country. However, further studies, including molecular investigations, are required to determine the precise etiological factor of the abortions.

According to the present status of C. burnetii infection in Iran and persistent favourable conditions to the spreading of the bacterium, more attention is needed to control and prevent Q fever in terms of public health and ovine and caprine abortions.

Conclusions The present study demonstrated the relatively high prevalence of Q fever in sheep and goat flocks with a history of abortion in Iran. The results show that goats might play an important role in contaminating the environment and spreading the infection within and between the flocks. Furthermore, the prevalence values found in this study were influenced by geographical location and, possibly, climatic conditions.

Grant support This research was funded by Shiraz University, Shahid Bahonar University of Kerman, and The Research Center for Developing New Technologies.

Veterinaria Italiana 2013, 49 (2), 163-168. doi: 10.12834/VetIt.2013.492.163.168

Asadi et al.

Q fever in sheep and goats in Iran

References 1. Aitken I.D., Bogel K., Cracea E., Edlinger E., Houwers D., Krauss H., Rady M., Rehacek J., Schiefer H.G. & Schmeer N. 1987. Q fever in Europe: Current Aspects in Aetiology, Epidemiology, Human Infection, Diagnosis and Therapy. Infect, 15, 323-327.

15. Kennerman E., Rousset E., Gölcü E. & Dufour P. 2010.

Seroprevalence of Q fever (coxiellosis) in sheep from the southern Marmara Region, Turkey. Comp Immun Microbiol Infect Dis, 33, 37-45.

2. Angelakis E. & Raoult D. 2010. Q fever. Vet Microbiol, 140, 297-309.

16. Khalili M. & Sakhaee E. 2009. An update on a serologic survey of Q fever in domestic animals in Iran. Am J Trop Med Hyg, 80, 1031-1032.

3. Arricau Bouvery N., Souriau A., Lechopier P. & Rodolakis A. 2003. Experimental Coxiella burnetii infection in pregnant goats: excretion routes. Vet Res, 34, 423-433.

17. Khalili M., Shahabi-Nejad N. & Golchin M. 2010. Q fever serology in febrile patients in southeast Iran. Trans R Soc Trop Med Hyg, 104, 623-624.

4. Cantas H., Muwonge A., Sareyyupoglu B., Yardimci H. & Skjerve E. 2011. Q fever abortions in ruminants and associated on-farm risk factors in northern Cyprus.

BMC Vet Res, 7, 13.

18. Lang, G.H. 1990. Coxiellosis (Q fever) in animals. In Q Fever: The Disease, vol 1. (T.J. Marrie, ed). CRC Press, Boca Raton, 23-48.

5. Cekani M., Papa A., Kota M., Velo E. & Berxholi K. 2008.

Report of a serological study of Coxiella burnetii in domestic animals in Albania. Vet J, 175, 276-278.

6. Clark W.H., Lennette E.H., Railsback O.C. & Romer M.S. 1951. Q fever in California. VII Clinical features in 180 cases. Arch Intern Med, 88, 155-167.

7. Czopowicz M., Kaba J., Szalus-Jordanow O., Nowicki M., Witkowski L., Nowicka D. & Frymus T. 2010. Prevalence of antibodies against Chlamydophila abortus and Coxiella burnetii in goat herds in Poland. Pol J Vet Sci, 13, 175-179.

8. Faix D.J., Harrison D.J., Riddle M.S., Vaughn A.F., Yingst S.L., Earhart K. & Thibault G. 2008. Outbreak of Q fever among US military in Western Iraq, June–July 2005.

Clin Infect Dis, 46, 65-68.

9. Gozalan A., Rolain J.M., Ertek M., Angelakis E., Coplu N., Basbulut E.A., Korhasan B.B. & Esen B. 2010.

Seroprevalence of Q fever in a district located in the west Black Sea region of Turkey. Eur J Clin Microbiol Infect Dis, 29, 465-469.

10. Greenslade E., Beasley R., Jennings L., Woodward A. & Weinstein P. 2003. Has Coxiella burnetii (Q fever) been introduced into New Zealand? Emerg Infect Dis, 9, 138-140.

11. Hatchette T.F., Hudson R.C., Schlech W.F., Campbell N.A., Hatchette J.E., Ratnam S., Raoult D., Donovan C. & Marrie T.J. 2001. Goat-associated Q fever: a new disease in Newfoundland. Emerg Infect Dis, 7, 413-419.

12. Hawker J.I., Ayres J.G., Blair I., Evans M.R., Smith D.L., Smith E.G., Burge P.S., Carpenter M.J., Caul E.O., Coupland B., Desselberger U., Farrell I.D., Saunders P.J. & Wood M.J. 1998. A large outbreak of Q fever in the West Midlands: windborne spread into a metropolitan area? Communicable Disease and Public Health, 1, 180-187.

13. Hellenbrand W., Breuer T. & Petersen L. 2001. Changing epidemiology of Q fever in Germany, 1947–1999.

Emerg Infect Dis, 7, 789-796.

14. Kazar J., Hornicek J., Valihrach J., Krunert Z., Pavlik J., Petrik P. & others. 1982. [An epidemic of Q-fever in a cotton-processing plant (author’s translation)]. Cesk Epidemiol Mikrobiol Imunol, 28, 144-151.

Veterinaria Italiana 2013, 49 (2), 163-168. doi: 10.12834/VetIt.2013.492.163.168

19. Leski T.A., Malanoski A.P., Gregory M.J., Lin B. & Stenger D.A. 2011. Application of a broad-range resequencing array for detection of pathogens in desert dust samples from Kuwait and Iraq. Appl Environ Microbiol, 77, 4285-4292.

20. Luoto L. 1960. Report on the nationwide occurrence of Q fever infections in cattle. Pub Health Rep, 75, 135-140.

21. Lyytikäinen O., Ziese T., Schwartländer B., Matzdorff P., Kuhnhen C., Jäger C. & Petersen L. 1998. An outbreak of sheep-associated Q fever in a rural community in Germany. Eur J Epidemiol, 14, 193-199.

22. Masala G., Porcu R., Sanna G., Chessa G., Cillara G., Chisu V. & Tola S. 2004. Occurrence, distribution, and role in abortion of Coxiella burnetii in sheep and goats in Sardinia, Italy. Vet Microbiol, 99, 301-305.

23. Maurin M. & Raoult D. 1999. Q fever. Clin Microbiol Rev, 12, 518-553.

24. McCaughey C., Murray L.J., McKenna J.P., Menzies F.D., McCullough S.J., O’Neill H.J., Wyatt D.E., Cardwell C.R. & Coyle P.V. 2010. Coxiella burnetii (Q fever) seroprevalence in cattle. Epidemiol Infect, 138, 21-27.

25. McQuiston J.H. & Childs J.E. 2002. Q fever in humans and animals in the United States. Vect Borne Zoo Dis, 2, 179-191.

26. Mostafavi E., Rastad H.& Khalili M. 2012. Q Fever: An Emerging Public Health Concern in Iran. Asian Journal of Epidemiology, 5, 66-74 27. Pape M., Bouzalas E.G., Koptopoulos G.S., Mandraveli K., Arvanitidou-Vagiona M., Nikolaidis P. & AlexiouDaniel S. 2009. The serological prevalence of Coxiella burnetii antibodies in sheep and goats in northern Greece. Clin Microbiol Infect, 15(Suppl 2), 146-147.

28. Parisi A., Fraccalvieri R., Cafiero M., Miccolupo A., Padalino I., Montagna C., Capuano F. & Sottili R. 2006.

Diagnosis of Coxiella burnetii-related abortion in Italian domestic ruminants using single-tube nested PCR. Vet Microbiol, 118, 101-106.

29. Psaroulaki A., Hadjichristodoulou C., Loukaides F., Soteriades E., Konstantinidis A., Papastergiou P., Ioannidou M.C. & Tselentis Y. 2006. Epidemiological study of Q fever in humans, ruminant animals, and ticks in Cyprus using a geographical information system. Eur J Clin Microbiol Infect Dis, 25, 576-586.

167

Q fever in sheep and goats in Iran

30. Raoult D. 1996. Q fever: still a query after all these years. J Med Microbiol, 44, 77-78.

31. Raoult D., Tissot D.H., Foucault C., Gouvernet J., Fournier P.E., Bernit E., Stein A., Nesri M., Harli J.R. & Weiller P.J. 2000. Q fever 1985–1998. Clinical and epidemiologic features of 1,383 infections. Medicine (Baltimore), 79, 109-123.

32. Raoult D., Marrie T.J. & Mege J.L. 2005. Natural history and pathophysiology of Q fever. Lancet Infect Dis, 5, 219-226.

33. Rehacek J. & Tarasevich I.V. 1988. Rickettsia akari.

In Acari-Borne Rickettsiae and Rickettsioses in Eurasia, Bratislava. (J. Rehacek & I.V. Tarasevich, eds).

Veda Publishing House of the Slovak Academy of Sciences, 128-145 pp.

34. Rousset E., Durand B., Berri M., Dufour P., Prigent M., Russo P., Delcroix T., Touratier A., Rodolakis A. & Aubert M. 2007. Comparative diagnostic potential of three serological tests for abortive Q fever in goat herds. Vet Microbiol, 124, 286-297.

35. Ruiz-Fons F., Astobiza I., Barandika J.F., Hurtado A., Atxaerandio R., Juste R.A. & García-Pérez A.L. 2010.

Seroepidemiological study of Q fever in domestic ruminants in semi-extensive grazing systems. BMC Vet Res, 6, 3.

36. Sakhaee E. & Khalili M. 2010. The first serologic study of Q fever in sheep in Iran. Trop Anim Health Prod, 42, 1561-1564.

168

Asadi et al.

37. Schimmer B., Luttikholt S., Hautvast J.L.A., Graat E.A.M., Vellema P. & van Duynhoven Y.T.H.P. 2011.

Seroprevalence and risk factors of Q fever in goats on commercial dairy goat farms in the Netherlands, 20092010. BMC Vet Res, 7, 81.

38. Shahsavani A., Naddafi K., Jafarzade Haghighifard N., Mesdaghinia A., Yunesian M., Nabizadeh R., Arahami M., Sowlat M.H., Yarahmadi M., Saki H., Alimohamadi M., Nazmara S., Motevalian S.A. & Goudarzi G. 2012. The evaluation of PM10, PM2.5, and PM1 concentrations during the Middle Eastern Dust (MED) events in Ahvaz, Iran, from april through september 2010. J Arid Environ, 77, 72-83.

39. Spicer A.J., Crowther R.W., Vella E.E., Bengtsson E., Miles R. & Pitzolis G. 1977. Q fever and animal abortion in Cyprus. Trans Roy Soc Trop Med Hyg, 71, 16-20.

40. Tissot-Dupont H., Amadei M.A., Nezri M. & Raoult D. 2004. Wind in November, Q fever in December. Emerg Infect Dis, 10, 1264-1269.

41. To H., Htwe K.K., Kako N., Kim H.J., Yamaguchi T.H., Fukushi S. & Hirai K. 1998. Prevalence of Coxiella burnetii infection in dairy cattle with reproductive disorders. J Vet Med Sci, 60, 859-861.

42. Wallensten A., Moore P., Webster H., Johnson C., van der Burgt G., Pritchard G., Ellis-Iversen J. & Oliver I. 2010. Q fever outbreak in Cheltenham, United Kingdom, in 2007 and the use of dispersion modelling to investigate the possibility of airborne spread. Euro Surveill, 25, 15(12),19521.

Veterinaria Italiana 2013, 49 (2), 163-168. doi: 10.12834/VetIt.2013.492.163.168

Studio epidemiologico di un focolaio da Norovirus rilevato nel 2009 in una residenza assistita per anziani in Italia Centrale Elisabetta Di Giannatale1, Alessandra Alessiani1, Francesca Sauro1, Francesco Sbraccia2, Giuseppe Croce2, Antonella Nissim2, Alessandra Carnevale2, Giacomo Migliorati1 1

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale”, Campo Boario, 64100 Teramo, Italia e.digiannatale@izs.it 2 Casa di riposo “G. De Benedictis”, Viale F. Crispi 245, 64100 Teramo, Italia

Parole chiave Italia, Gastroenterite, Norovirus, Residenza assistita per anziani.

Riassunto In una residenza assistita per anziani, nella regione Abruzzo, in Italia Centrale, tra gennaio e marzo 2009, è stato riscontrato un focolaio da Norovirus genotipo GII.4 (variante 2006). Le indagini condotte nella residenza, tipologicamente esposta a infezioni da Norovirus, come riportato con frequenza in letteratura, si sono concentrate sull’individuazione della fonte d’infezione e della via di propagazione del virus. Sono stati effettuati controlli igienico‑sanitari e analisi microbiologiche e chimiche sul sistema idrico della struttura, su ospiti e operatori della residenza. Per conoscere le condizioni relative all’insorgenza dell’infezione e alla diffusione dell’agente patogeno è stato realizzato ed erogato un questionario finalizzato a individuare le abitudini di vita dei soggetti presenti nella residenza.

Veterinaria Italiana 2013, 49 (2), 169-174. doi: 10.12834/VetIt.2013.492.175.180

Introduzione I Norovirus appartengono alla famiglia Caliciviridae, microrganismi responsabili di gastroenterite nell’uomo. Dotati di spiccata variabilità genetica, questo genere di virus comprende 5 genogruppi (GI-GV) e 31 cluster genetici. In particolare, i genogruppi I, II e IV sono patogeni per l’uomo (4, 11).

La trasmissione può avvenire attraverso il contatto interumano, ma anche per ingestione di acqua o alimenti contaminati o per contatto diretto con superfici contaminate (2, 3, 10, 12, 17). I sintomi più comuni sono: nausea, vomito, diarrea, talvolta febbre, mal di testa e dolori articolari. In genere, la sintomatologia compare 12-48 ore dopo l’infezione permanendo fino a un massimo di 60 ore. In bambini e adulti si riscontra un elevato tasso di attacco (25), favorito dalla bassa dose infettante e dall’incapacità delle comuni pratiche di pulizia di abbattere la carica virale (8).

La diffusione di Norovirus è talmente elevata da dar luogo alla creazione di modelli matematici specifici per il loro controllo, soprattutto nelle strutture nosocomiali (30). In Italia non esiste un sistema nazionale di sorveglianza per le infezioni da Norovirus. Le esigue segnalazioni hanno permesso di evidenziare come il genogruppo più diffuso sia GII con il relativo genotipo GII.4, e le varianti GII.4 2006 a e GII4.

2006 b, come nel resto d’Europa (1, 9, 10, 13, 15, 24).

Le strutture più comunemente coinvolte sono quelle deputate all’alloggio di persone per lunghi periodi come quelle sanitarie e di assistenza per gli anziani, soprattutto nei mesi invernali (14, 17, 26, 27).

Il presente studio prende in esame una residenza assistita per anziani nella regione Abruzzo, in Italia Centrale, in cui è stato registrato, nel periodo gennaio-marzo 2009, un focolaio di gastroenterite da Norovirus. Sono stati effettuati controlli igienico-sanitari e analisi chimiche e microbiologiche sul sistema idrico della struttura, su ospiti e operatori della residenza. Per conoscere le condizioni relative all’insorgenza dell’infezione e alla diffusione dell’agente patogeno è stato realizzato ed erogato un questionario finalizzato a individuare le abitudini di vita dei soggetti presenti nella residenza.

Materiali e metodi Struttura della residenza assistita per anziani La residenza assistita per anziani è risultata costituita da due stabili separati (A e B) con funzioni diversificate e proprio personale medico e paramedico. L’epidemia ha interessato solo lo stabile B. Nello stabile A (disposto su due piani, ognuno do-

169

Focolaio da Norovirus in una residenza assistita per anziani

tato di refettorio, infermeria, salotto con televisore, telefoni comuni nel corridoio) costituito da 42 camere, doppie e triple, dotate di bagno, sono risultati presenti anziani con gravi problemi di salute e patologie senili, alcuni di essi con difficoltà di movimento e necessità di assistenza continua.

Nello stabile B (disposto su due piani, ognuno dotato di soggiorno con televisore) costituito da 76 camere singole e 12 camere doppie, tutte con bagno e telefono, sono risultati presenti anziani parzialmente o del tutto autosufficienti, spesso con lievi problemi di salute, alcuni in grado di uscire autonomamente dalla residenza. Dei due piani, il primo, dotato di refettorio, è risultato riservato agli anziani parzialmente autosufficienti, il secondo a quelli autosufficienti.

Al piano terra sono risultati ubicati: refettorio, salone ricreativo, ambulatorio, cappella e, con entrata indipendente, la sede dell’associazione di volontariato incaricata del trasporto gratuito degli anziani in ospedale. I servizi medici, paramedici, di catering e pulizia sono risultati assicurati da 29 operatori. In particolare, il lavaggio della biancheria comune è stato realizzato dalla lavanderia interna, quello degli indumenti personali sia dagli anziani stessi che da lavanderie esterne. La pulizia dello stabile è stata assicurata da una cooperativa di servizi esterna alla struttura che ha provveduto alla pulizia quotidiana degli ambienti. La ristorazione è stata demandata, in entrambe le strutture, ad uno stesso servizio catering che ha consegnato i pasti tre volte al giorno. Lo stabile B, nel periodo interessato dall’epidemia, ha fatto registrare 62 ospiti.

Indagine epidemiologica L’indagine epidemiologica è stata condotta con uno studio di coorte coinvolgendo tutti gli ospiti residenti e il personale operante nello stabile B. Un apposito questionario è stato realizzato e distribuito per la raccolta organizzata delle informazioni riguardanti: dati personali, mansioni, tempo di permanenza nella struttura, sintomatologia, alimenti consumati e visite ricevute. Soggetti interessati da almeno 3 episodi di diarrea o vomito nelle 24 ore sono stati definito come “casi”.

Per l’indagine epidemiologica, i soggetti afferenti alla residenza sono stati divisi in due gruppi: uno costituito da 62 ospiti e l’altro da 29 operatori. Al termine, i soggetti intervistati sono stati 54, di cui 46 ospiti e 8 operatori.

Analisi microbiologica delle feci Sono stati esaminati 13 campioni di feci di altrettanti soggetti con sintomatologia gastroenterica recente o in atto al momento dell’intervista. I campioni sono stati analizzati per ricerca di: Campylobacter spp.,

170

Di Giannatale et al.

Tabella I. Sequenze oligonucleotidiche e sonda TaqMan per la regione di giunzione ORF1-ORF2 dei Norovirus GI e GII. Norovirus GI NV1LCpr-probe: 6-FAM–5’-TGG ACA GGA GAY CGC RAT CT–3’-TAMRA ON1F4: 5’-CGC TGG ATG CGN TTC CAT-3’ NV1LCR: 5’-CCT TAG ACG CCA TCA TCA TTT CC -3’ Norovirus GII QN1FS- probe: VIC-5’-AGC ACG TGG GAG GGC GAT CG -3’-TAMRA QN1F2d: 5’- ATG TTC AGR TGG ATG GAG RTT CTC WGA -3’ COG2R: 5’- TCG ACG CCA TCT TCA TTC ACA -3’

Salmonella spp., Escherichia coli O157, Shigella spp., Listeria monocytogenes, Yersinia enterocolitica, Norovirus e Rotavirus.

La ricerca di Campylobacter è stata effettuata mediante semina diretta su agar m-CCDA (Biolife, Milano, Italia) e agar Karmali (Biolife), incubazione a 42°C in microaerofilia. La ricerca di Salmonella spp. è stata condotta secondo la norma ISO 6872:2002, quella di Escherichia coli O157, Shigella spp., Yersinia enterocolitica e Listeria monocytogenes per semina diretta, rispettivamente, su agar MacConkey Mugsorbitolo (Oxoid, Basingstoke, Union Kingdom), agar Salmonella-Shigella (Biolife), agar CIN (Biolife), agar sangue (BioMerieux, Craponne, Francia). Tutte le colture sono state incubate a 37°C per 24 ore.

La ricerca di Rotavirus è stata effettuata mediante metodo ELISA utilizzando il kit commerciale ProSpect (Oxoid). Quella di Norovirus con RT-PCR impiegando il kit commerciale IDEIA Norovirus (IDEIA, Dallas, USA). L’RNA per l’RT-PCR è stato estratto utilizzando il kit commerciale High Pure Viral Nucleic Acid Kit (Roche, Milano, Italia). L’amplificazione è stata eseguita con il kit SuperScript™ III Platinum® One-Step Quantitative RT-PCR System (Invitrogen, Carlsbad, CA, USA).

Gli oligonucleotidi e la sonda TaqMan utilizzati per la regione di giunzione ORF1-ORF2 sono riportati nella Tabella 1.

Il profilo termico per la reazione di RT-PCR è stato il seguente: 50°C x 15’ e 94°C x 2’ (retroscrizione), 45 cicli costituiti da 15’ a 95°C (amplificazione) e 30’’ a 60°C (annealing).

L’analisi PCR Real Time è stata eseguita con ABI Prism® 7900 HT Fast RT-PCR. Un’aliquota dei campioni è stata inviata all’Istituto Superiore di Sanità per la conferma del risultato.

Analisi microbiologiche e chimiche delle acque Complessivamente sono stati prelevati 5 campioni di acqua: 3 campioni di acqua potabile (prelevati dalla cisterna dell’acqua di riserva, dal rubinetto della cu-

Veterinaria Italiana 2013, 49 (2), 169-174. doi: 10.12834/VetIt.2013.492.175.180

Di Giannatale et al.

Focolaio da Norovirus in una residenza assistita per anziani

cina in uso all’associazione di volontariato e dal distributore automatico presente nella sala ricreativa) e 2 campioni di acqua non potabile (prelevati dall’impianto antincendio e dall’impianto frigorifero).

I campioni sono stati analizzati per la ricerca di Escherichia coli e Coliformi (ISO 308-1:2000), Pseudomonas aeruginosa (ISO 16266:2006), Enterococchi (ISO 7899-2:2000), Carica batterica totale a 37°C e 21°C (ISO 8199:2005), Clostridium perfringens (6).

Per la ricerca di virus, i campioni di acqua sono stati concentrati utilizzando filtri PrepScaleTM TFF Cardrige (Millipore, Milano, Italia). In seguito, i campioni sono stati decontaminati e ulteriormente concentrati per ultrafiltrazione con Centricon plus 20 (Millipore). Ai concentrati ottenuti sono stati applicati gli stessi metodi utilizzati per la ricerca dei virus nelle feci.

Il cloro residuo è stato determinato con metodo cromogeno utilizzando il kit Aquaquant® Cloruro (Merck, Milano, Italia). I solidi sospesi sono stati rilevati filtrando un litro d’acqua con sistema a membrana da 0,45 µm e determinati per via gravimetrica dopo essiccamento a 103-105°C.

Misure sanitarie È stata effettuata un’accurata disinfezione di tutti gli ambienti comuni e riservati, comprese le suppellettili.

La disinfezione delle superfici è stata effettuata per contatto con soluzione di Virkon® all’1% (DuPont, Subdory, UK), quella di utensili e oggetti per immersione nella stessa soluzione per almeno 10 minuti.

Stoviglie e biancheria sono state lavate con ipoclorito 1.000 ppm a temperature superiori a 60°C,

come indicato dalle linee guida internazionali per la prevenzione delle gastroenteriti virali negli ospedali (2, 3). È stato organizzato un incontro con gli operatori della struttura in cui sono state ribadite le norme igieniche e richiamato il corretto utilizzo dei mezzi di protezione individuale. I soggetti coinvolti nell’epidemia sono stati invitati a una più accurata igiene personale, a rimanere nelle proprie camere e, nel caso degli operatori, ad astenersi dal lavoro per almeno 48 ore dopo la scomparsa dei sintomi.

Risultati Al questionario hanno risposto 62 ospiti e 8 operatori. In realtà è stato possibile raccogliere informazioni utili solo da 54 intervistati (59% dei soggetti afferenti alla residenza), fra cui 46 ospiti e 8 operatori.

L’indagine ha permesso di evidenziare tra gli intervistati quelli che hanno dichiarato di aver manifestato la sintomatologia gastroenterica nel periodo 1 gennaio-17 marzo 2009 (Figura 1). Degli intervistati 8 soggetti, 6 ospiti e 2 operatori della residenza, sono rientrati nella classificazione di “caso”. In particolare, 4 ospiti e 2 operatori hanno riferito episodi febbrili.

Dei soggetti intervistati, indipendentemente dalla definizione di “caso”, 7 individui sono risultati positivi a Norovirus. Fra questi, 4 soggetti hanno riferito di aver avuto episodi di vomito nel locale adibito a refettorio.

L’esame batteriologico per la ricerca di batteri enterici è risultata negativa per tutti i 13 campioni esaminati.

La ricerca virologica ha interessato 12 campioni di feci, un campione non è stato esaminato poiché quantitativamente insufficiente. Per Norovirus sono

6 Operatori Ospiti

Numero di persone

5

4

3

2

1

0 1/1

26/1

19/2

20/2

23/2

25/2

28/2

1/3

2/3

3/3

4/3

5/3

6/3

8/3

9/3

12/3

17/3

Data dell’infezione

Figura 1. Numero di soggetti intervistati con sintomatologia gastroenterica nel periodo 1 gennaio - 17 marzo 2009.

Veterinaria Italiana 2013, 49 (2), 169-174. doi: 10.12834/VetIt.2013.492.175.180

171

Focolaio da Norovirus in una residenza assistita per anziani

Di Giannatale et al.

Punto di prelievo

Tipo di acqua

Carica batterica 30°C (CFU/ml)

Carica batterica 21°C (CFU/ml)

Coliformi totali (CFU/100ml)

Coliformi fecali (CFU/100 ml)

Streptococchi (CFU/100 ml)

P. aeruginosa (CFU/100 ml)

C. perfringens (CFU/100 ml)

Salmonella

Campylobacter

Solidi sospesi (mg/l)

Cloro residuo (mg/l)

Tabella II. Risultati degli esami batteriologici e chimici delle acque analizzate.

Impianto frigorifero Impianto antincendio Cisterna dell’acqua di riserva Cucina Distributore di acqua

NP NP P P P

160 0 >300 0 120

160 0 >300 0 >300

20 0 20 0 0

0 0 0 0 0

3 0 2 0 0

28 0 50 0 40

6 0 8 0 0

A A A A A

A A A A A

1,1 NE 25,1 NE NE

NR (<0,1) 0,1 NR (<0,1) 0,1 NE

NP = acqua non potabile; P = acqua potabile; NR = non rilevabile; NE = non eseguito; A = assente.

risultati positivi 5 campioni (41,7%) con metodo ELISA e 8 (66,6%) con metodo RT-PCR. I campioni positivi alla RT-PCR sono risultati del genotipo GII4 variante 2006. Un campione è risultato positivo per Rotavirus.

Per quanto riguarda le analisi delle acque, quelle prelevate dall’impianto frigorifero, dalla cisterna e dal distributore posto nella sala ricreativa hanno fatto riscontrare una carica batterica elevata. Non è stata rilevata la contaminazione da Norovirus.

La presenza di solidi sospesi è stata rilevata nell’acqua dell’impianto frigorifero e della cisterna, il cloro residuo in quella dell’impianto antincendio e in quella erogata in cucina.

I risultati degli esami microbiologici e chimici effettuati sulle acque sono riportati nella Tabella 2.

Discussione In base ai primi rilievi effettuati, la natura virale del focolaio gastroenterico è stata sospettata in antecedenza alla conferma ottenuta con i test microbiologici, in quanto la sintomatologia è risultata coerente con la descrizione di focolai da Norovirus effettuata da Kaplan: periodo di incubazione di 24-48 ore, episodi di vomito superiori al 50% dei casi, durata della malattia tra 12 e 60 ore, esami colturali negativi per batteri patogeni (8). L’indagine epidemiologica è stata eseguita basandosi sulla fonte d’infezione e sulla sua diffusione, sono state studiate le condizioni strutturali della residenza, le relazioni interpersonali sia tra ospiti sia con soggetti esterni alla residenza. In questo tipo di infezione, infatti, il contatto interumano ha incidenza molto elevata (7). Il numero di dati ottenuti con il questionario è stato inferiore rispetto a quanto atteso. Contemporaneamente all’erogazione del questionario si è deciso di verificare lo stato della rete idrica e la sua possibile correlazione con l’infezione. L’esito negativo delle ricerche batteriologiche, virologiche e chimiche ha dimostrato l’estraneità dell’acqua all’episodio epi-

172

demico osservato. L’acqua del distributore e l’acqua di riserva hanno mostrato un’alta carica batterica, ma non batteri o virus enterici.

Il servizio di catering comune ai pazienti dei due stabili e il coinvolgimento solo di persone dello stabile B hanno evidenziato l’estraneità degli alimenti all’episodio epidemico.

Il ridotto numero di campioni di feci su cui è stato possibile effettuare le ricerche microbiologiche, purtroppo, ha limitato i dati oggettivi a disposizione dell’indagine. Infatti, rispetto al numero di individui apparentemente coinvolti, i campioni sono stati numericamente esigui per l’incapacità dei soggetti e la scarsa collaborazione del personale, preposto al loro sostegno, a effettuare il prelievo. La relativa non comparabilità dei risultati ottenuti con ELISA e RT-PCR è da associare alla differente sensibilità delle due metodiche (5, 28, 29).

La presenza del menù stabilito dal servizio catering, con cadenza quindicinale, ha permesso di valutare e conseguentemente scartare anche il possibile coinvolgimento di alimenti nell’epidemia, favorendo l’ipotesi dell’esclusiva diffusione del virus per contagio interumano. Ipotesi avvalorata da quanto riportato nel questionario dal primo ospite ad aver accusato la sintomatologia, il quale ha riferito l’abitudine di non uscire dalla residenza.

La condivisione delle aree comuni da parte dei soggetti autosufficienti ha assunto, di conseguenza, rilevanza fondamentale nella diffusione epidemica della gastroenterite.

In seguito ai casi di gastroenterite registrati nella residenza, a scopo profilattico, sono state adottate norme igieniche più rigorose che hanno permesso l’interruzione della trasmissione virale. Questa evenienza suggerisce come l’isolamento dei soggetti malati fino a 48 ore dopo la scomparsa di sintomi e il contemporaneo uso di disinfettanti adeguati siano l’unica soluzione per arginare questo tipo di focolaio (3, 4).

Veterinaria Italiana 2013, 49 (2), 169-174. doi: 10.12834/VetIt.2013.492.175.180

Di Giannatale et al.

Conclusioni I Norovirus rappresentano un importante problema di Sanità Pubblica a causa della loro capacità di produrre infezioni umane clinicamente rilevanti in tutti i gruppi di età, a causa dell’alta infettività associata alle diverse vie di trasmissione e all’incapacità di sviluppare nell’uomo un’immunità duratura.

In Italia, a causa della mancanza di un idoneo sistema di sorveglianza e di protocolli diagnostici applicati di routine nei laboratori di analisi, unitamente alla breve durata della sintomatologia e dell’immunità acquisita, si registra una sottostima dell’effettiva incidenza dell’infezione da Norovirus nella popolazione.

Il presente studio, tramite i rilievi effettuati da psichiatra e psicologo, ha evidenziato come la presenza

Focolaio da Norovirus in una residenza assistita per anziani

e la persistenza della gastroenterite nella residenza abbiano determinato negli ospiti uno stato ansioso depressivo-reattivo, tale da determinare un decadimento della qualità di vita.

L’indagine ha permesso di ravvisare la necessità di potenziare la diagnosi differenziale delle forme gastroenteriche per attuare misure preventive specifiche nei confronti dei differenti agenti eziologici.

A riguardo, di notevole ausilio è l’attuazione di un piano d’informazione della popolazione in modo da sensibilizzarla e renderla parte attiva nella limitazione della diffusione dell’infezione. Purtroppo nella residenza indagata, dove l’età media degli ospiti è risultata di circa 80 anni, l’attuazione di un piano di informazione, con la conseguente modifica dei comportamenti a riguardo, è difficilmente attuabile se non per i soli operatori.

Bibliografia 1. Boccia D., Tozzi A.E., Cotter B., Rizzo C., Russo T., Buttinelli G., Caprioli A., Marziano M.L. & Ruggeri F.M. 2002. Waterborne outbreak of Norwalk-like virus gastroenteritis at a tourist resort, Italy. Emerg Infect Dis, 8 (6), 563-568.

2. Centers for Disease Control and Prevention (CDC).

2012. Norovirus in healthcare setting. (http://www. cdc.gov/HAI/organisms/norovirus.html ultimo accesso gennaio 2013).

3. Centro Nazionale di Epidemiologia, Sorveglianza e Promozione della Salute EpiCentro. 2011. Norovirus (http://www.epicentro.iss.it/problemi/norovirus/ epid.asp).

4. Chadwick P.R., Beards G., Brown D., Caul E.O., Cheesbrough J., Clarke I., Curry A., O’Brien S., Quigley K., Sellwood J. & Westmoreland D. 2000. Management of hospital outbreaks of gastro-enteritis due to small round structured viruses. J Hosp Infect, 45 (1), 1-10.

The Food-borne viruses in Europe. Eurosurveillance, 11 (50), article1 (http://www.eurosurveillance.org/ ViewArticle.aspx?PublicationType=W&Volume=11&Is sue=50&OrderNumber=1).

10. Kroneman A., Verhoef L., Harris J., Duinzer E., van Duynhoven Y., Gray J., Iturriza M., Bottiger B., Falkenhorst G., Johnsen C., von Bonsdorff C.H., Maunula L., Kuusi M., Pothier P., Galley A., Schreier E., Hohne M., Hohne M., Koch J., Szucs G., Reuter G., Krisztalovics K, Lynch M., McKeown P., Foley B., Coughlan S., Ruggeri F.M., Di Bartolo I., Vainio K., Isakbaeva E., Poljsak-Prjatelj M., Grow A.H., Mijovski J.Z., Bosch A., Buesa J., Fauquier A.S., Hernandez-Pezzi G., Hedlund K.O. & Koopmans M. 2008. Analysis of integrated virological and Epidemiological Reports of norovirus outbreaks collected within the foodborne viruses in Europe Network from 1 July 2001 to 30 June 2006. J Clin Microbiol, 46 (9), 2959-65.

5. de Bruin E., Duizer E., Veannema H. & Koopmans M.P.G. 2006. Diagnosis of Norovirus outbreaks by commercial ELISA or RT-PCR. J Virol Meth, 137 (2), 259-264.

11. Kroneman A., Vennema H., Deforche K.,. van der Avoort H., Penaranda S., Oberste M.S., Vinjé J., M. Koopmans.

2011. An automated genotyping tool for enteroviruses and noroviruses. J Clin Vir, 51, 121-125

6. Decreto Legislativo n. 31/2001. Attuazione della direttiva 98/83/CE relativa alla qualità delle acque destinate al consumo umano. Gazz Uff, 52, 3.03.2001 - Suppl Ordinario, 41.

12. Lee S.H, Levy D.A., Craun G.F., Beach M.J. & Calderon R.L. 2002. Surveillance for waterborne disease outbreaks, United States 1999-2000. CDC Surveillance Summaries, 22 Nov 2002. MMVR, 51 (08), 1-28.

7. Greig J.D. & Lee M.B. 2008. Enteric outbreaks in long-term care facilities and recommendation for prevention: a review. Epidemiol Infect, 137 (2), 145-155.

13. Logann C., O’Leary J.J. & O’Sullivan N. 2007. Real-time reverse transcription PCR detection of norovirus, sapovirus and astrovirus as causative agents of acute viral gastroenteritis. J Virol Meth, 146 (1-2), 36-44.

8. Kaplan J.E., Feldman R., Campbell D.S., Lookabaugh C. & Gary G.W. 1982. The frequency of a Norwalk-like pattern of illness on outbreaks of acute gastroenteritis.

Am J Public Health, 72 (12), 1329-1332.

9. Kroneman A., Vennema H., Harris J., Reuter G., von Bonsdorff H., Hedlund O., Vainio K., Jackson V., Pothier P., Koch J., Schreier E., Böttiger B. & Koopmans M., 2006.

Veterinaria Italiana 2013, 49 (2), 169-174. doi: 10.12834/VetIt.2013.492.175.180

14. Lopman B. 2004. Viral gastroenteritis epidemic of 2002 associated with new norovirus variant.

Eurosurveillance, 8 (11). (http://www.eurosurveillance. org/ViewArticle.aspx?ArticleId=2410).

15. Lopman B., Reacher M., Gallimore C. & Adak G.K., Gray J.J. & Brown D.W. 2003. A summer time peak of

173

Focolaio da Norovirus in una residenza assistita per anziani

‘winter vomiting disease’: surveillance of noroviruses in England and Wales. BMC Public Health, 3, 1-4 (http:// www.biomedcentral.com/1471-2458/3/13 ultimo accesso 21/01/13).

G., Semprini P. & Ruggeri F.M. 2008. An outbreak of gastroenteritis in a holiday resort in Italy. Epidemiological survey, implementation and application of preventive measures. Vet Ital, 44 (3), 469-481.

16. Lopman B., Vennema H., Kohli E., Pothgier P., Sanchez A., Negredo A., Buesa J., Schreier E., Reacher M., Brown D., Gray G., Iturriza M., Gallimore C., Bottiger B., Hedlund K.-O., Torvèn M., von Bonsdorff C-H., Maunula L., Pljsak-Prijatelj M., Zimsek J., Rauter G., Szùrgy G., Melegh B, Svennson L., van Duijnhoven Y. & Koopmans M . 2004. Increase in viral gastroenteritis outbreaks in Europe and epidemic spread of new norovirus variant.

Lancet, 363 (9414), 682-688.

23. Nordgren J., Lindgren P-R, Matussek A. & Svensson L. 2010. Norovirus gastroenteritis outbreak with a secretor-independent susceptibility pattern, Sweden.

Emerg Infect Dis, 16 (1), 81-87.

17. Martinelli D., Prato R., Chironna M., Sallustio A., Caputi G., Conversano M., Ciofi Degli Atti M., D’Ancona F.P., Germinario C.A. & Quarto M. 2007. Large outbreak of viral gastroenteritis caused by contaminated drinking water in Apulia, Italy, May-October 2006.

Eurosurveillance, 12 (16), 3176.

18. Mattei R., Severoni C., Neri L., Donati E. & Savarino A. 2008. Local epidemiological surveillance of norovirus infections in children hospitalised for gastroenteritis.

Microbiol Med, 23 (4), 203-207.

19. Maunula L. & Von Bonsdorff C.H. 2005. Norovirus genotypes causing gastroenteritis outbreaks in Finland 1998-2002. J Clin Virol, 34 (3), 186-194.

20. Medici M.C., Morelli A., Arcangeletti M.C., Calderaio A., De Conto F., Martinelli M., Abelli L.A., Dettori G. & Chezzi C. 2009. An outbreak of norovirus infection in an Italian residential-care facility for the elderly. Clin Microbiol Infect, 15 (1), 97-100.

21. Medici M.C., Martinelli M., Abelli L., Ruggeri MF., Di Bartolo I., Arcangeletti M.C., Pinardi F., De Conto F., Izzi G., Bernasconi S., Chezzi C. & Dettori G. 2006. Molecular epidemiology of norovirus infections in sporadic cases of viral gastroenteritis among children in northern Italy. J Med Virol, 78 (11), 1486-1492.

22. Migliorati G., Prencipe V., Ripani A., Di Francesco C., Casaccia C., Crudeli S., Ferri N., Giovannini A., Marconi M.M., Marfoglia C., Melai V., Savini G., Scortichini

174

Di Giannatale et al.

24. Ottaviani M. & Bonadonna L. 2007. Metodi analitici per le acque destinate al consumo umano. Parte 2.

Metodi microbiologici. Rapporti ISTISAN 00/14 Pt.2ISS.1123-3117 (http://www.iss.it/binary/aqua/cont/ RappIstisan%2007%205.1204715346.pdf ).

25. Petersen L.R., Ammon A., Hamouda O., Breuer T., Kiessling S., Bellach B., Niemer U., Bindert F.J., Ostroff S., and Kurth R. 2000. Developing national epidemiologic capacity to meet the challenges of emerging infections in Germany. Emerg Infect Dis, 6 (6), 576–584.

26. Rimoldi S.G., Pagani C., Lombardi A., Molteni E., Bossi C., Tonielli C. & Gismondi M. 2009. Epidemiological evaluation of sporadic cases of norovirus infection in communitary and hospitalized patients. Microbiol Med, 24 (1), 47-49.

27. Said M.A., Perl T. M. & Sears C.L. 2008. Gastrointestinal flu: norovirus in health care and long-term care facilities. Clin Infect Dis, 47 (9), 1202-1208.

28. Tsang O.T.Y., Wong A.T.Y., Chown C.B., Yung R.W.H., Lim W.W.L. & Liu S.H. 2008. Clinical characteristics of nosocomial outbreaks in Hong Kong. J Hosp Infect, 69 (2), 135-140.

29. Vainio K. & Myrmel M. 2006. Molecular epidemiology of norovirus outbreaks in Norway during 2000 to 2005 and comparison of four norovirus real-time reverse transcriptase PCR assay. J Clin Microbiol, 44 (10), 3695-3702.

30. Vanderpas J., Louis J., Reynders M., Mascart G. & Vandenberg O. 2009. Mathematical model for the control of nosocomial norovirus. J Hosp Infect, 71 (3), 214-222.

Veterinaria Italiana 2013, 49 (2), 169-174. doi: 10.12834/VetIt.2013.492.175.180

Epidemiological study of an outbreak of Norovirus in a rest home in Italy Elisabetta Di Giannatale1, Alessandra Alessiani1, Francesca Sauro1, Francesco Sbraccia2, Giuseppe Croce2, Antonella Nissim2, Alessandra Carnevale2 & Giacomo Migliorati1 1

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy e.digiannatale@izs.it 2 Casa di riposo ‘G. De Benedictis’, Viale F. Crispi 245, 64100 Teramo, Italy

Keywords Nursing home (hospice), Gastroenteritis, Italy, Norovirus.

Summary A Norovirus GII.4 (variant 2006) epidemic occurred in a rest home in the Abruzzo region of Italy between January and March 2009. Rest homes are typologically exposed to Norovirus infections as often reported in the literature. The investigation proposed in this article focused on identifying the source of infection and the route of propagation of the virus in the infected rest home. Microbiological, chemical and hygiene/health investigations were conducted on residents and employees of the home and on its water supply. A questionnaire was designed and distributed to identify the habits of the subjects who promoted the spread of the virus, in order to obtain a retrospective view of the event.

Veterinaria Italiana 2013, 49 (2), 175-180. doi: 10.12834/VetIt.2013.492.181.186

Introduction Noroviruses are micro‑organisms of the Caliciviridae family which might be responsible for human gastroenteritis. They feature marked genetic variability, comprising 5 genogroups (GI-GV) and 31 gene clusters. Genogroups I, II and IV are pathogenic for humans (4, 11). Transmission may occur through person‑to‑person contact, but also following the ingestion of contaminated water or food or by direct contact with contaminated surfaces (2, 3, 10, 12, 17). The most common symptoms are nausea, vomiting and diarrhoea and, sometimes, fever, headache, and joint pains. The symptoms generally appear 12-48 hours after infection, and persist for up to 60 hours. There is a high rate of infection in both children and adults (25), due to the low infecting dose and the inability of common cleaning practices to eliminate the viral load (8).

The incidence of Norovirus is so high that specific mathematical models have been created for its control, especially in hospitals (30). There is no national Norovirus surveillance system in Italy, but the few available reports indicate that the most widespread genogroup in Italy as well as in other European countries is GII, with the related genotypes GII.4, variants GII.4 2006a and GII.4 2006b (1, 9, 10, 13, 15, 24). The main sources of contagion are human‑to‑human contact and occasional food contamination. The most commonly

affected facilities are those providing long-term accommodation such as hospitals and care homes for the elderly, especially in winter (14, 17, 26, 27).

A Norovirus outbreak was recorded in a care home in the Abruzzo region of Italy from January to March 2009. Microbiological and chemical tests were conducted on stool and water samples to investigate the source of infection. A questionnaire was designed to identify the habits of the subjects who promoted the spread of the virus in order to obtain a retrospective view of the event.

Materials and methods Structure of the care home The care home consisted of two separate buildings (A and B) with diversified functions and their own medical and paramedical personnel. The epidemic affected only building B. Building A housed elderly people with serious health problems and geriatric disorders, some of whom had impaired movement ability and required continuous care. The two-storey building consisted of 42 double and triple rooms with en suite bathroom. Each storey was provided with a dining room, infirmary, lounge with television and telephones in the corridor.

Building B mainly housed partly and wholly

175

Norovirus outbreak in a rest home

self‑sufficient elderly people, often with minor geriatric problems, some of whom could go out of the home autonomously. The two-storey building, each floor having a lounge with television, consisted of 76 single and 12 double rooms, all with en suite bathroom and telephone. The first of the 2 storeys, equipped with a dining room, was reserved for partly self-sufficient residents, and the second for wholly self-sufficient residents. On the ground floor were the dining room, recreation room, clinic, chapel, and the offices of the voluntary association (with an independent entrance) responsible for free transport of residents to hospital. Medical, paramedical, catering and cleaning services were provided by 29 people. In particular, common laundry was washed in the internal laundry, while personal clothing was washed by the residents themselves and external laundries. The building was cleaned by an external service cooperative, which cleaned the premises daily. Catering for both buildings was outsourced to a catering service, which delivered meals three times a day. Sixty-two residents were housed in building B during the period of the epidemic.

Epidemiological investigation The epidemiological investigation was conducted by means of a cohort study involving all the residents of building B and the personnel working there. A questionnaire was devised to gather information relating to personal data, duties, time spent in the home, symptoms, food eaten and visits received.

Each person who had suffered at least three episodes of diarrhoea or vomiting in the last 24 h was classified as a ‘case’.

For the epidemiological investigation, the subjects were divided into two groups: one consisting of 62 residents and one of 29 employees. By the end of the study, there were 54 respondents, comprising 46 residents and 8 employees.

Microbiological analysis of stool samples A total of 13 stool samples from 13 people that had exhibited recent symptoms of gastroenteritis or gastroenteritis ongoing at the time of the interview were examined. The samples were analysed for Campylobacter spp., Salmonella spp., Escherichia coli O157, Shigella spp., Listeria monocytogenes, Yersinia enterocolitica, Norovirus, and Rotavirus.

The Campylobacter test was conducted by direct seeding on m-CCDA agar (Biolife, Milan) and Karmali agar (Biolife), incubated at 42°C in microaerophilia.

The Salmonella spp. test was conducted in accordance with standard ISO 6872:2002, and the Escherichia coli O157, Shigella spp., Yersinia enterocolitica and Listeria monocytogenes tests

176

Di Giannatale et al.

Table I. Oligonucleotide sequences and TaqMan probe for the ORF1‑ORF2 junction region of Norovirus GI and GII. Norovirus GI NV1LCpr-probe: 6-FAM–5’-TGG ACA GGA GAY CGC RAT CT–3’-TAMRA ON1F4: 5’-CGC TGG ATG CGN TTC CAT-3’ NV1LCR: 5’-CCT TAG ACG CCA TCA TCA TTT CC -3’ Norovirus GII QN1FS- probe: VIC-5’-AGC ACG TGG GAG GGC GAT CG -3’-TAMRA QN1F2d: 5’- ATG TTC AGR TGG ATG GAG RTT CTC WGA -3’ COG2R: 5’- TCG ACG CCA TCT TCA TTC ACA -3’

were conducted by direct seeding on MacConkey Mug-sorbitol agar (Oxoid, Cambridge), SalmonellaShigella agar (Biolife), CIN agar (Biolife), and blood agar (BioMérieux, Marcy L’Étoile), respectively. All the cultures were incubated at 37°C for 24 h.

The Rotavirus test was conducted by ELISA method using the commercial ProSpect kit (Oxoid). The Norovirus test was conducted in RT-PCR with the commercial IDEIA kit Norovirus (IDEIA, Dallas, USA). The RNA for RT-PCR was extracted with the commercial High Pure Viral Nucleic Acid Kit (Roche, Milano, Italia). The amplification was conducted with the SuperScript™ III Platinum® One‑Step Quantitative RT‑PCR system kit (Invitrogen, Carlsband, California). The manufacturer’s instructions were followed in all cases.

The oligonucleotides used and the TaqMan probe for the ORF1-ORF2 junction region are listed in Table 1.

The thermal profile for the RT-PCR reaction was as follows: 50°C × 15 min and 94°C × 2 min (reverse transcription); 45 cycles consisting of 15 min at 95°C (amplification) and 60°C for 30 sec (annealing).

The analysis was conducted with the PCR Real Time instrument ABI Prism® 7900 HT Fast RT-PCR. An aliquot of the samples was sent to the Istituto Superiore della Sanità, Roma, for confirmation of the result.

Microbiological and chemical tests on water Five water samples were taken. Three samples of drinking water were taken at different points of the supply: the water storage tank, the kitchen tap used by the voluntary association, and the automatic distributor in the recreation room. The 2 samples of non-drinking water were taken from the fire‑fighting and refrigerating installations.

The samples were analysed for Escherichia coli and Coliform bacteria (ISO 308-1:2000), Pseudomonas aeruginosa (ISO 16266:2006), Enterococchi (ISO 7899-2:2000), total bacteria count at 37°C and 21°C (ISO 8199:2005) and Clostridium perfringens (6).

Veterinaria Italiana 2013, 49 (2), 175-180. doi: 10.12834/VetIt.2013.492.181.186

Di Giannatale et al.

Norovirus outbreak in a rest home

For virus analyses, the water samples were concentrated with PrepScaleTM TFF cartridge filters (Millipore, Milan). The samples were then decontaminated and further concentrated by ultrafiltration with Centricon plus 20 (Millipore).

Finally, the same virological methods used for testing the presence of the virus in the stool samples were applied to the concentrated sample of water.

The residual chlorine was determined with the chromogenic method using the Aquaquant® Chloride kit (Merck, Darmstadt, GE) in accordance with the instructions of the manufacturer. Solids in suspension were detected by filtering one litre of water with a 0.45 µm membrane system, and determined by gravimetry after drying at 103°C-105°C.

Health measures All the common and private areas of the building were thoroughly disinfected, including furnishing.

Surfaces were disinfected by contact with a 1% Virkon® solution (DuPont, Subdory,UK) and utensils and objects were disinfected by immersion in the same solution for at least 10 min. Kitchenware and laundry were washed with hypochlorite at 1,000 ppm, at temperatures exceeding 60°C, as indicated in the international guidelines for prevention of viral gastroenteritis in hospitals (2,3). A meeting was held with the employees of the home, during which the rules of hygiene were reiterated and the correct use of individual protection systems was urged. Those involved in the epidemic were asked to perform more thorough personal hygiene,

to stay in their rooms and, in the case of employees, not to go to work for 48 h after the symptoms had disappeared.

Results A total of 62 residents and 8 employees answered the questionnaire. Useful information, however, was only obtained from 54 (59%) respondents, comprising 46 residents and 8 employees. The survey identified the respondents who said they had had symptoms of gastroenteritis from 1 January to 17 March 2009 (Figure 1). Eight respondents were classified as ‘cases’: 6 residents and 2 members of the care home’s staff. In particular, 4 residents and 2 employees also reported episodes of fever.

Seven respondents tested positive for Norovirus, regardless of whether they were classified as ‘cases’.

Four of them reported that they had had episodes of vomiting in the dining room.

The bacteriological test for enteric bacteria was negative for all 13 samples examined. The virological research included 12 stool samples; one sample was not examined because the quantity was insufficient.

Five samples (41.7%) tested positive for Norovirus by ELISA and 8 (66.6%) by RT-PCR. The RT-PCR positive samples were genogroup GII4 variant 2006. One sample tested positive for Rotavirus.

As regards water analysis, the samples taken from the refrigerating installation, the tank and the distributor in the recreation room showed a high bacteria count.

Norovirus contamination was not found.

Solids in suspension were found in the water of the refrigerating installation and residual chlorine in

6 Employees Residents

Number of people

5

4

3

2

1

0 1/1

26/1

19/2

20/2

23/2

25/2

28/2

1/3

2/3

3/3

4/3

5/3

6/3

8/3

9/3

12/3

17/3

Date of infection

Figure 1. Number of respondents presenting symptoms of gastroenteritis from 1 January to 17 March 2009.

Veterinaria Italiana 2013, 49 (2), 175-180. doi: 10.12834/VetIt.2013.492.181.186

177

Norovirus outbreak in a rest home

Di Giannatale et al.

Sampling point

Type of water

Bacteria count 30°C (CFU/ml)

Bacteria count 21°C (CFU/ml)

Total coliform bacteria (CFU/100ml)

Faecal coliform bacteria (CFU/100 ml)

Streptococci (CFU/100 ml)

P. aeruginosa (CFU/100 ml)

C. perfringens (CFU/100 ml)

Salmonella

Campylobacter

Solids in suspension (mg/l)

Residual chlorine (mg/l)

Table II. Results of bacteriological and chemical tests on water.

Refrigerating installation Fire-fighting installation Reserve water tank Kitchen Water distributor

NP NP P P P

160 0 >300 0 120

160 0 >300 0 >300

20 0 20 0 0

0 0 0 0 0

3 0 2 0 0

28 0 50 0 40

6 0 8 0 0

A A A A A

A A A A A

1.1 NE 25.1 NE NE

NR (<0.1) 0.1 NR (<0.1) 0.1 NE

NP = non-drinking water; P = drinking water; NR = not detectable; NE = not performed; A = absent.

that of the fire-fighting installation and the kitchen.

The results of the microbiological and chemical tests on the water are shown in Table II.

Discussion On the basis of the initial investigations, the viral nature of the outbreak of gastroenteritis was suspected even before being confirmed by the microbiological tests, because the symptoms were consistent with Kaplan’s description of Norovirus outbreaks: incubation period 24-48 h, episodes of vomiting in over 50% of cases, duration of illness between 12 h and 60 h (8).

The epidemiological investigation was conducted on the basis of the source of infection and its spread, and the structural conditions of the home were studied, together with the personal relations between residents and persons from outside the home, as human-to-human contact has a very high incidence in this type of infection (7).

The amount of data obtained with the questionnaire was less than expected. Simultaneously with the distribution of the questionnaire, it was decided to check on the state of the water supply and its possible correlation with the infection. The negative result of the bacteriological, virological and chemical tests demonstrated that the epidemic was unrelated to the water supply. Drinking water in the distributor and reserve water showed high bacteria count but enteric bacteria or virus were never isolated. The same catering service for both buildings, and only the involvement of people in building B, showed the non-involment of food epidemic. Unfortunately, the small number of stool samples on which microbiological tests could be conducted limited the objective data available for the study. Compared with the number of persons apparently involved, the samples were numerically small due to the incapacity of the patients and

178

poor cooperation by care personnel in obtaining the samples. The relative non-comparability of the results obtained with ELISA and RT-PCR method is associated with the different sensitivities of the two methods (5, 28, 29).

The menu drawn up fortnightly by the catering service allowed us to evaluate, and rule out, the possible involvement of food in the epidemic, supporting the hypothesis that the virus spread only by human-to-human contact. This hypothesis was supported by the questionnaire completed by the first resident to suffer from symptoms, who reported that he never left the home. Sharing of common areas by self-sufficient residents consequently acquired crucial importance in the epidemic spread of gastroenteritis.

Following the cases of gastroenteritis recorded in the home, more stringent hygiene measures were introduced for preventive purposes, and this interrupted the transmission of the virus. This event suggests that isolation of the patient for up to 48 h after the disappearance of the symptoms, and simultaneous use of suitable disinfectants, is the only solution enabling this kind of epidemic to be terminated (3, 4).

Conclusions Norovirus represents a major public health problem, because of its ability to produce clinically significant human infections in all age groups due to the high level of infectivity associated with the different transmission routes, and the inability of humans to develop lasting immunity.

In Italy, due to the lack of a suitable surveillance system and diagnostic protocols on a routine basis, together with the short duration of the symptoms and the immunity acquired, the actual incidence of Norovirus infection among the population is undoubtedly underestimated.

Veterinaria Italiana 2013, 49 (2), 175-180. doi: 10.12834/VetIt.2013.492.181.186

Di Giannatale et al.

According to the psychiatrist and psychologist working at the home, the presence and persistence of gastroenteritis led to a state of reactive depression and anxiety in residents, which deteriorated their perceived quality of life. The study demonstrates the need to strengthen the differential diagnosis of forms of gastroenteritis so that specific preventive measures can be taken against the etiological

Norovirus outbreak in a rest home

agents involved. It is very helpful to implement an information plan for the population, to make them aware of the situation and encourage them to participate actively in limiting the spread of the infection. In our care home, where the average age of residents is about 80, providing information and modifying behaviour is difficult to implement, except for employees working in the facility.

References 1. Boccia D., Tozzi A.E., Cotter B., Rizzo C., Russo T., Buttinelli G., Caprioli A., Marziano M.L. & Ruggeri F.M. 2002. Waterborne outbreak of Norwalk-like virus gastroenteritis at a tourist resort, Italy. Emerg Infect Dis, 8 (6), 563-568.

2. Centers for Disease Control and Prevention (CDC).

2012. Norovirus in healthcare setting. (http://www. cdc.gov/HAI/organisms/norovirus.html accessed on January 2013).

3. Centro Nazionale di Epidemiologia, Sorveglianza e Promozione della Salute EpiCentro. 2011. Norovirus (http://www.epicentro.iss.it/problemi/norovirus/ epid.asp).

4. Chadwick P.R., Beards G., Brown D., Caul E.O., Cheesbrough J., Clarke I., Curry A., O’Brien S., Quigley K., Sellwood J. & Westmoreland D. 2000. Management of hospital outbreaks of gastro-enteritis due to small round structured viruses. J Hosp Infect, 45 (1), 1-10.

5. de Bruin E., Duizer E., Veannema H. & Koopmans M.P.G. 2006. Diagnosis of Norovirus outbreaks by commercial ELISA or RT-PCR. J Virol Meth, 137 (2), 259-264.

6. Decreto Legislativo n. 31/2001. Attuazione della direttiva 98/83/CE relativa alla qualità delle acque destinate al consumo umano. Gazz Uff, 52, 3.03.2001 - Suppl Ordinario, 41.

7. Greig J.D. & Lee M.B. 2008. Enteric outbreaks in long-term care facilities and recommendation for prevention: a review. Epidemiol Infect, 137 (2), 145-155.

8. Kaplan J.E., Feldman R., Campbell D.S., Lookabaugh C. & Gary G.W. 1982. The frequency of a Norwalk-like pattern of illness on outbreaks of acute gastroenteritis.

Am J Public Health, 72 (12), 1329-1332.

9. Kroneman A., Vennema H., Harris J., Reuter G., von Bonsdorff H., Hedlund O., Vainio K., Jackson V., Pothier P., Koch J., Schreier E., Böttiger B. & Koopmans M., 2006.

The Food-borne viruses in Europe. Eurosurveillance, 11 (50), article1 (http://www.eurosurveillance.org/ ViewArticle.aspx?PublicationType=W&Volume=11&Is sue=50&OrderNumber=1).

10. Kroneman A., Verhoef L., Harris J., Duinzer E., van Duynhoven Y., Gray J., Iturriza M., Bottiger B., Falkenhorst G., Johnsen C., von Bonsdorff C.H., Maunula L., Kuusi M., Pothier P., Galley A., Schreier E., Hohne M., Hohne M., Koch J., Szucs G., Reuter G., Krisztalovics K, Lynch M., McKeown P., Foley B., Coughlan S., Ruggeri F.M., Di Bartolo I., Vainio K.,

Veterinaria Italiana 2013, 49 (2), 175-180. doi: 10.12834/VetIt.2013.492.181.186

Isakbaeva E., Poljsak-Prjatelj M., Grow A.H., Mijovski J.Z., Bosch A., Buesa J., Fauquier A.S., Hernandez-Pezzi G., Hedlund K.O. & Koopmans M. 2008. Analysis of integrated virological and Epidemiological Reports of norovirus outbreaks collected within the foodborne viruses in Europe Network from 1 July 2001 to 30 June 2006. J Clin Microbiol, 46 (9), 2959-65.

11. Kroneman A., Vennema H., Deforche K.,. van der Avoort H., Penaranda S., Oberste M.S., Vinjé J., M. Koopmans.

2011. An automated genotyping tool for enteroviruses and noroviruses. J Clin Vir, 51, 121-125 12. Lee S.H, Levy D.A., Craun G.F., Beach M.J. & Calderon R.L. 2002. Surveillance for waterborne disease outbreaks, United States 1999-2000. CDC Surveillance Summaries, 22 Nov 2002. MMVR, 51 (08), 1-28.

13. Logann C., O’Leary J.J. & O’Sullivan N. 2007. Real-time reverse transcription PCR detection of norovirus, sapovirus and astrovirus as causative agents of acute viral gastroenteritis. J Virol Meth, 146 (1-2), 36-44.

14. Lopman B. 2004. Viral gastroenteritis epidemic of 2002 associated with new norovirus variant.

Eurosurveillance, 8 (11). (http://www.eurosurveillance. org/ViewArticle.aspx?ArticleId=2410).

15. Lopman B., Reacher M., Gallimore C. & Adak G.K., Gray J.J. & Brown D.W. 2003. A summer time peak of ‘winter vomiting disease’: surveillance of noroviruses in England and Wales. BMC Public Health, 3, 1-4 (http:// www.biomedcentral.com/1471-2458/3/13 accessed on 21/01/13).

16. Lopman B., Vennema H., Kohli E., Pothgier P., Sanchez A., Negredo A., Buesa J., Schreier E., Reacher M., Brown D., Gray G., Iturriza M., Gallimore C., Bottiger B., Hedlund K.-O., Torvèn M., von Bonsdorff C-H., Maunula L., Pljsak-Prijatelj M., Zimsek J., Rauter G., Szùrgy G., Melegh B, Svennson L., van Duijnhoven Y. & Koopmans M . 2004. Increase in viral gastroenteritis outbreaks in Europe and epidemic spread of new norovirus variant.

Lancet, 363 (9414), 682-688.

17. Martinelli D., Prato R., Chironna M., Sallustio A., Caputi G., Conversano M., Ciofi Degli Atti M., D’Ancona F.P., Germinario C.A. & Quarto M. 2007. Large outbreak of viral gastroenteritis caused by contaminated drinking water in Apulia, Italy, May-October 2006.

Eurosurveillance, 12 (16), 3176.

18. Mattei R., Severoni C., Neri L., Donati E. & Savarino A. 2008. Local epidemiological surveillance of norovirus

179

Norovirus outbreak in a rest home

infections in children hospitalised for gastroenteritis.

Microbiol Med, 23 (4), 203-207.

19. Maunula L. & Von Bonsdorff C.H. 2005. Norovirus genotypes causing gastroenteritis outbreaks in Finland 1998-2002. J Clin Virol, 34 (3), 186-194.

20. Medici M.C., Morelli A., Arcangeletti M.C., Calderaio A., De Conto F., Martinelli M., Abelli L.A., Dettori G. & Chezzi C. 2009. An outbreak of norovirus infection in an Italian residential-care facility for the elderly. Clin Microbiol Infect, 15 (1), 97-100.

21. Medici M.C., Martinelli M., Abelli L., Ruggeri MF., Di Bartolo I., Arcangeletti M.C., Pinardi F., De Conto F., Izzi G., Bernasconi S., Chezzi C. & Dettori G. 2006. Molecular epidemiology of norovirus infections in sporadic cases of viral gastroenteritis among children in northern Italy. J Med Virol, 78 (11), 1486-1492.

22. Migliorati G., Prencipe V., Ripani A., Di Francesco C., Casaccia C., Crudeli S., Ferri N., Giovannini A., Marconi M.M., Marfoglia C., Melai V., Savini G., Scortichini G., Semprini P. & Ruggeri F.M. 2008. An outbreak of gastroenteritis in a holiday resort in Italy. Epidemiological survey, implementation and application of preventive measures. Vet Ital, 44 (3), 469-481.

23. Nordgren J., Lindgren P-R, Matussek A. & Svensson L. 2010. Norovirus gastroenteritis outbreak with a secretor-independent susceptibility pattern, Sweden.

Emerg Infect Dis, 16 (1), 81-87.

24. Ottaviani M. & Bonadonna L. 2007. Metodi analitici per le acque destinate al consumo umano. Parte 2.

180

Di Giannatale et al.

Metodi microbiologici. Rapporti ISTISAN 00/14 Pt.2ISS.1123-3117 (http://www.iss.it/binary/aqua/cont/ RappIstisan%2007%205.1204715346.pdf ).

25. Petersen L.R., Ammon A., Hamouda O., Breuer T., Kiessling S., Bellach B., Niemer U., Bindert F.J., Ostroff S., and Kurth R. 2000. Developing national epidemiologic capacity to meet the challenges of emerging infections in Germany. Emerg Infect Dis, 6 (6), 576â&#x20AC;&#x201C;584.

26. Rimoldi S.G., Pagani C., Lombardi A., Molteni E., Bossi C., Tonielli C. & Gismondi M. 2009. Epidemiological evaluation of sporadic cases of norovirus infection in communitary and hospitalized patients. Microbiol Med, 24 (1), 47-49.

27. Said M.A., Perl T. M. & Sears C.L. 2008. Gastrointestinal flu: norovirus in health care and long-term care facilities. Clin Infect Dis, 47 (9), 1202-1208.

28. Tsang O.T.Y., Wong A.T.Y., Chown C.B., Yung R.W.H., Lim W.W.L. & Liu S.H. 2008. Clinical characteristics of nosocomial outbreaks in Hong Kong. J Hosp Infect, 69 (2), 135-140.

29. Vainio K. & Myrmel M. 2006. Molecular epidemiology of norovirus outbreaks in Norway during 2000 to 2005 and comparison of four norovirus real-time reverse transcriptase PCR assay. J Clin Microbiol, 44 (10), 3695-3702.

30. Vanderpas J., Louis J., Reynders M., Mascart G. & Vandenberg O. 2009. Mathematical model for the control of nosocomial norovirus. J Hosp Infect, 71 (3), 214-222.

Veterinaria Italiana 2013, 49 (2), 175-180. doi: 10.12834/VetIt.2013.492.181.186

Expression, purification, and functional characterisation of Flagellin, a TLR5-ligand Irshad Ahmed Hajam, Pervaiz Ahmed Dar, Shanmugam Chandra Sekar, Rajakishore Nanda, Subodh Kishore, Veerakyathappa Bhanuprakash & Kondabattula Ganesh Foot and Mouth Disease Vaccine Quality Control and Assurance Laboratory, Indian Veterinary Research Institute, Bangalore, 560 024 Karnataka, India ganesh_k60@yahoo.co.in Keywords Cytochines, Flagellin, Immunogenicity, Salmonella Typhimurium.

Summary Flagellin, a Toll-like receptor 5 (TLR5)-ligand, is known for its activities like adjuvant, induction of pro-inflammatory cytokines and innate immunity. In this context, fliC gene of Salmonella Typhimurium was cloned into pET32a expression plasmid using in-house designed gene specific primers. The frame and orientation of the inserted fliC gene was confirmed upon colony PCR, restriction enzyme analysis and sequencing. Sequence analysis of fliC revealed proper orientation of the gene and had 1,485 nucleotides. Following transformation of pET‑fliC plasmid into Escherichia coli BL21 (DE3) cells, the gene was expressed after inducing with IPTG (Isopropylβ-D-1-thiogalactopyranoside). The polyHis-tag-fliC was ~70kDa as confirmed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE).

The identity/authenticity of the recombinant-fliC was confirmed by its specific reactivity with commercial anti-fliC MAb of S. Typhimurium. Further, the antigenic and functional properties of recombinant-fliC were determined espousing its ability to induce antigen specific antibodies in G pigs and increased m-RNA expression of certain pro-inflammatory mediators like TNF-α and GM-CSF in vitro.

Espressione, purificazione e caratteristiche funzionali della Flagellina, un TLR5-legante Parole chiave Citochine, Flagellina, Immunogenicità, Salmonella Typhimurium.

Riassunto La flagellina, legante il Toll-like receptor 5 (TLR5), è nota per le sue proprietà adiuvanti e per l’induzione di citochine pro-infiammatorie e immunità innata. L’articolo descrive i risultati della clonazione del gene fliC di Salmonella Typhimurium effettuata in un plasmide con espressione pET‑32a, utilizzando primer specifici per il gene messi a punto nel Foot and Mouth Disease Vaccine Quality Control and Assurance Laboratory. La struttura e l’orientamento del gene fliC sono stati confermati tramite colony PCR e analisi con enzimi di restrizione e sequenziamento.

L’analisi della sequenza di fliC ha evidenziato il corretto orientamento del gene e la presenza di 1.485 nucleotidi. Il plasmide pET-fliC è stato impiegato per la trasformazione genetica in cellule di Escherichia coli BL21 (DE3) e il gene è stato espresso tramite induzione con IPTG. La massa del poly His-tag-fliC pari a circa 70 kDa è stata confermata con elettroforesi su gel di poliacrilammide in presenza di sodio dodecil solfato (SDS-PAGE). L’identità/autenticità del fliC ricombinante è stata confermata dalla reattività specifica evidenziata con MAb anti-fliC di S. Typhimurium. Le proprietà antigeniche e funzionali del fliC ricombinante sono state determinate tramite l’induzione di anticorpi antigene-specifici nelle cavie e l’aumento in vitro dell’espressione dell’m-RNA di alcuni mediatori come TNF-α e GM-CSF. Veterinaria Italiana 2013, 49 (2), 181-186. doi: 10.12834/VetIt.2013.492.187.192

181

Hajam et al.

Functional characterisation of Flagellin

Introduction Bacterial flagellin (fliC) serves many functions like mobility, pathogenicity, adjuvanticity and toll like receptor (TLR)-ligand activity (1, 9, 19). TLRs, a group of conserved receptors play a crucial role in activating antigen presenting cells (APCs) and the adaptive response (2). The binding of fliC with TLR5 leads to a cascade of reactions that results in the production of pro-inflammatory cytokines like TNF-α, IL-6 and IL‑12, thereby up-regulate the antigen presenting cell surface molecules (8). TLR5 is present on the surface of epithelial and immune system cells like dendritic cells (DC), monocytes, natural killer cells (NK), and T-lymphocytes (25). fliC activates the epithelial cells, well-known for their ability to encounter the pathogen and defend the body against it. Moreover, in vivo administration of fliC is much safer than the lipopolysaccharide (LPS) inducing shock (26). These properties make fliC an ideal and potent molecular adjuvant (6, 12, 17, 23).

In addition, immunisation with fliC has been found to protect the host from a wide range of pathogens, chemicals and radiations (22, 26). Therefore, the present study was conceptualised to clone and express the fliC from S. Typhimurium in prokaryotic expression system, characterise the recombinant protein by Western blot and in vitro analysis of mRNA expression levels of various pro-inflammatory mediators.

Materials and methods Bacterial strain Stab-culture of Salmonella enterica serovar Typhimurium (S. Typhimurium) of bovine origin available at FMD vaccine quality control unit, Indian Veterinary Research Institute (IVRI), Bangalore, was used as source for fliC gene.

Amplification of fliC gene A colony of S. Typhimurium was grown in Luria‑Bertani broth (LB broth) overnight at 37°C with constant agitation (220 rpm). Genomic DNA was extracted (21) and the fliC gene was amplified using in-house designed gene specific primers (fliC F; cgcggatccatggcacaagtcattaatacaaac and fliC R; gcgctcgagacgcagtaaagagaggacgtt) based on the known DNA sequence. For amplification of the fliC gene, the polymerase chain reaction (PCR) was standardised using 10 ng of genomic DNA, 20 pM of each gene specific primers, 10 mM of each dNTPs, 5 µl of 10× enzyme buffer and 0.5 U of Accu Taq LA DNA polymerase (Sigma-Aldrich, St. Louis, MO, USA) in a 50 µl final reaction volume. The amplification

182

was carried out with initial denaturation of DNA at 94°C (10 min) followed by 35 cycles of 94°C for 45 sec, annealing at 56°C for 90 sec, extension at 72°C (100 sec), and final extension at 72°C for 10 min. The amplified product was analysed by electrophoresis using 0.5% agarose gel and ethidium bromide as tracking dye.

Cloning and expression of flagellin The amplified PCR product was cloned into prokaryotic expression vector pET-32a (Novagen, San Diego, California, USA) at NcoI-XhoI site. For ligation, the fliC gene PCR product and vector plasmid were used in the ratio of 2:1. The ligated product was initially propagated in Top 10 Escherichia coli competent cells (Invitrogen, Carlsbad, California, USA) (21). Transformed colonies were screened by colony PCR, restriction enzyme analysis and sequencing. The recombinant pET‑fliC plasmid extracted from Top 10 E. coli cells was purified and transformed to E. coli BL21 (DE3) strain (Novagen, San Diego, California, USA) for expression of flagellin. The expression was induced by adding 1 mM Isopropylβ‑D-1-thiogalactopyranoside (IPTG) to transformed BL21 (DE3) bacteria (OD600=0.6) at 30°C. Zero-time aliquot (uninduced culture) was used as control. The samples collected after 4 h and 6 h were analysed for expressed protein by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (15). The recombinant protein was further confirmed by Western blot analysis using anti-fliC monoclonal antibody (MAb) of S. Typhimurium (Clone: X5A12, Invivogen, San Diego, California, USA).

Solubility and purification of the recombinant flagellin The solubility of the expressed protein was determined by re-suspending the bacterial pellet (6 h post IPTG induction) in lysis buffer. After sonication, the lysate was centrifuged at 12,000 × g (15 min) and supernatant representing soluble fraction was collected. The pellet was again resuspended in the lysis buffer, which represented the suspension of the insoluble matter. Both extracts were analysed after running on 10% SDS-PAGE. Purification of the recombinant flagellin containing poly-His tag was done by using Ni-NTA Spin Columns (Qiagen, Hilden, Germany) under denaturation conditions as per the manufacturer’s instructions. The positive elutes confirmed by SDS-PAGE were pooled and extensively dialysed (six washings) against phosphate buffered saline (pH 8.0) at 4°C. Purified protein was quantified by a Bradford assay (5), filtered, and stored in the same buffer at –20°C until use.

Veterinaria Italiana 2013, 49 (2), 181-186. doi: 10.12834/VetIt.2013.492.187.192

Hajam et al.

Functional characterisation of Flagellin

Antigenic and functional characterisation of recombinant flagellin To determine the antigenic nature of recombinantfliC three guinea pigs were immunised with the purified protein (6 µg/animal). Guinea pigs were maintained under standard conditions following the recommendations of the Institute Animal Ethics Committee (IAEC) under the guidelines set forth by the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA).

Three animals were kept as controls. Blood samples were collected from all the animals directly from the heart on day 14 post immunisation and serum was separated, inactivated and stored at –20°C until use.

The functional characterisation of the protein was studied under in vitro conditions by determining the effect of recombinant-fliC on m-RNA expression levels of various inflammatory mediators and quantified semi-quantitatively by reverse transcriptase polymerase chain reaction (RT-PCR) using established primers (11) (Table 1). Peripheral blood mononuclear cells (PBMC) were isolated from the blood of normal healthy G pigs by density gradient (4) using Histopaque (M/s Sigma‑Aldrich, Cat. No. 1083) and were cultured in RPMI-1640 medium (M/s Sigma‑Aldrich, Cat. No. R1383) supplemented with 10% fetal calf serum and penicillin and streptomycin at 50 µg and 100 IU/ ml, respectively. Harvested cells were counted and distributed (2x106/well) in 24-well culture plate and incubated with or without purified recombinant-fliC (5µg/ml) at 37˚C, 5% CO2 for 8 h. RNA was extracted

by RNeasy Mini kit (Qiagen, Hilden, Germany) and cDNA was prepared using SuperScript™ ІІІ Reverse Transcriptase kit (Invitrogen, San Diego, California, USA) as per the manufacturer’s instructions.

Amplification of the cytokine genes was carried out as described previously (11). The density of electrophoretic bands of amplified PCR products was done using band leader 3.0.

Results Construction of the expression vector pET32a-fliC The fliC gene (~1.5 kb) sequence of S. Typhimurium was successfully cloned into expression vector, pET-32a using NcoI and XhoI restriction enzymes.

The colony PCR product of recombinant clones has shown amplification of ~2 kb product using vector specific T7 forward and gene specific reverse primers and thus indicated that the gene was in proper orientation. The release of ~1.5 kb insert upon restriction enzyme digestion and gene sequence analysis of 1,986 bases of recombinant plasmid including 501 bp of vector and 1,485 bp of fliC gene, further confirmed the proper orientation of the insert (Figure 1). The sequence was published in GenBank with accession number HM 920247.1.

Table I. Sequence of primers used for the detection and quantification of the inflammatory mediators by reverse transcriptase-polymerase chain reaction.

Primer name GAPDH (F-RT) GAPDH (R-RT) GM-CSF (F-RT) GM-CSF (R-RT) TNF-α (F-RT) TNF-α (R-RT) iNOS (F-RT) iNOS (R-RT)

5´-3´ sequence Product length ACC ACA GTC CAT GCC ATC AC 343 bp TGT CGC TGT TGA AGT CA CTG TGG TTT GCA GCA TCT GT 171 bp GGG GCT CAA ACT GGT CAT AG ATC TAC CTG GGA GGC GTC TT 184 bp GAG TGG CAC AAG GAA CTG GT GCA CAC GTT GGC TTC CCT CT 456 bp TGG GCC AGT GCT TCT GAT TTT CC

Veterinaria Italiana 2013, 49 (2), 181-186. doi: 10.12834/VetIt.2013.492.187.192

Figure 1. Amplification of fliC gene and confirmation of recombinant clone. (a) PCR amplification of fliC gene. (b) Confirmation of recombinant clones by colony PCR using vector specific T7 primer and gene specific reverse primer. (c) Recombinant plasmid (r) showing less mobility than neat pET32a vector plasmid (s) in agarose gel. (d) Insert release (1,485 bp) by using NcoI and XhoI restriction enzymes.

183

Hajam et al.

Functional characterisation of Flagellin

Expression and characterisation of flagellin protein The confirmed pET-fliC plasmid was transformed into E. coli BL21 (DE3) host cells for expression of flagellin.

As shown in Figure 2c, the Coomassive brilliant blue stained gel indicated the polyHis6-tagged flagellin protein to be ~70kDa. For characterisation of the recombinant-fliC, the IPTG-induced cell lysate was fractionated on SDS-gel, transferred to a nitrocellulose membrane and probed with specific anti-fliC MAb. The protein reacted specifically giving a characteristic single band (Figure 2d), thus confirming the authenticity of the protein.

Solubility and purification of the recombinant flagellin The expressed recombinant-fliC was roughly about two third as soluble and one-third as insoluble as determined by the band intensity of the coomassive stained SDS-PAGE gels by loading equal volumes of supernatant and re-suspended pellet samples of

lysed bacteria (Figure 2b). The protein was produced in bulk and purified under denatured conditions using Ni-NTA spin columns. The protein was re‑natured by dialysis against PBS (pH 7.4) and the purity of the Ni-NTA purified recombinant protein was >95% as analysed by SDS-PAGE (Figure 2c). The amount of the recombinant-fliC was 2 mg/100 ml of bacterial culture.

Antigenic and functional characterisation of recombinant flagellin The recombinant-fliC was found to be immunogenic as the sera collected from all the three animals that received expressed protein showed specific immunoreactivity on Western blotting analysis.

Furthermore, in vitro studies of flagellin indicated that it was functional and increased the m-RNA expression levels in the stimulated PBMC. The results indicated that recombinant-fliC induced higher levels of pro-inflammatory mediators TNF-α and GM-CSF when compared to the un-stimulated control wells (Figures 3 and 4).

Discussion Pathogen associated molecular patterns (PAMPS) like lipopolysaccharides (LPS), flagellin, capsule and other molecules are conserved evolutionarily. They

Figure 2. Expression of poly His6-tagged flagellin protein in Escherichia coli BL21(DE3) cells using pET32a vector. (a) Protein expression at 4 h (lane 2), 6 h (lane 3) post IPTG induction, and uninduced control (lane 1). (b) Expressed protein as soluble (lane 2) and insoluble (lane 1). (c) Purified poly His tagged protein isolated using Ni-NTA spin columns. (d) Immunoblot of the expressed protein using anti-fliC monoclonal antibody of Salmonella Typhimurium.

184

Figure 3. Semi-quantitative RT-PCR of cytokine genes. PBMCs from healthy guinea pigs were cultured with or without flagellin. Total RNA was isolated and RT-PCR of various cytokines was done. The bands obtained in flagellin stimulated and control cells were used for determining the relative mRNA levels of TNF-α, GM-CSF and iNOS semi‑quantitatively as shown in Figure 4

Veterinaria Italiana 2013, 49 (2), 181-186. doi: 10.12834/VetIt.2013.492.187.192

Hajam et al.

Functional characterisation of Flagellin

2.0 Flagellin treated wells Control wells

1.8

Relative mRNA expression levels

1.6 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0 TNF-α

GM-CSF

iNOS

Cytokines

Figure 4. Relative gene expression analysis of TNF-α and GM-CSF based on the density of various electrophoretic bands for Figure 3 by using band leader 3.0. The expression levels were evaluated by taking the data of GAPDH bands as the background. TNF-α showed highest mRNA levels.’ are structurally or functionally crucial for survival, growth and/or development of the microorganisms (13, 16). In general, flagellin is mostly associated with Gram-negative bacteria and is required for motility, attachment to host cells, pathogenesis and virulence of bacteria. In particular, the flagellin of Salmonella is associated with virulence and immune responses. Flagellin, either in its native or truncated recombinant forms has been successfully used for the diagnosis of Salmonellosis in human beings and also production of monoclonal antibodies (20, 24).

Besides, flagellin is a potent and safe adjuvant in inducing early, robust and broad-spectrum immune responses. Owing to its immune augment activity, the present investigation was conceptualised to produce purified form of recombinant whole flagellin of S. Typhimurium in prokaryotic system and characterise for its functionality. This will be useful in exploring its diagnostic, ligand and adjuvant activities in the near future in our laboratory.

In the present study, full length fliC gene was expressed in E. coli. Expression of such exogenous proteins in E. coli have aplenty of deleterious effects on the host cell due to over expressed recombinant

Veterinaria Italiana 2013, 49 (2), 181-186. doi: 10.12834/VetIt.2013.492.187.192

protein or its inclusion bodies. This in turn, inhibits the growth of bacteria (7). In order to overcome these problems in this study, the host cell, E. coli were grown at 30°C. Upon studying the expression kinetics, it was found that the maximum fliC was expressed 6 h post IPTG induction. Furthermore, most of the expressed protein was in the soluble form even after purification, a requirement in eliciting immune response. The authenticity of the recombinant-fliC protein was confirmed by immune‑blotting with anti-fliC MAb of S. Typhimurium and anti-sera raised against it.

Flagellin is known for its innate immune agonist activity and it binds to TLR5 receptor (3, 10, 16).

Flagellin stimulates the secretion of inflammatory cytokines like TNF-α and GM-CSF. The other additional advantage of fliC is that, contrary to LPS, it does not induce shock (26). This unique feature makes fliC a better adjuvant for vaccines than other adjuvants. Because of this property, fliC has been used with many vaccine preparations to augment the immune responses delivered through different routes (6, 12, 17, 23). Further, the recombinant‑fliC was tested for its increased pro-inflammatory activity in terms of expression of TNF-α and GM‑CSF genes in PBMCs in vitro. The relative expression levels of these mediators were quantified semi‑quantitatively by RT-PCR, which revealed that the most prominent change was on TNF-α. GM-CSF and that TNF-α have pleiotropic effects and induce general immune stimulation in vivo. TNF-α is a key molecule in coordinating the inflammatory response and activation of cytokine cascade while GM‑CSF is responsible for proliferation and maturation of neutrophils, macrophages and dendritic cells (14, 18). In conclusion, the recombinant-fliC is immunogenic in guinea pig and known to induce pro-inflammatory cytokines. In the near future the expressed fliC will be explored for its various adjuvant and TLR ligand activities, particularly with FMD vaccine preparations, at the authors’ laboratory.

Acknowledgments The authors are very thankful to the Joint Director, IVRI in Bangalore, for providing necessary facilities and also Dr. V. Balamurugan, Senior Scientist, Project Directorate on Animal Disease Monitoring and Surveillance, H A Farm, Hebbal, Bangalore for providing E. coli BL21 cells.

185

Functional characterisation of Flagellin

Hajam et al.

References 1. Allen-Vercoe E. & Woodward M.J. 1999. Adherence of Salmonella enterica serovar Enteritidis to chick gut explant: the role of flagella but not fimbriae. J Med Microbiol, 48, 771-780.

2. Banchereau J., Briere F., Caux C., Davoust J., Lebecque S., Liu Y., Pulendran B. & Palucka K. 2000. Immunobiology of dendritic cells. Ann Rev Immunol, 18, 767-811.

3. Barton G.M. & Medzhitov R. 2002. Control of adaptive immune responses by Toll-like receptors. Curr Opin Immunol, 14, 380-383.

4. Boyum A. 1968. Separation of leukocytes from blood and bone marrow with special reference to factors which influence and modify sedimentation properties of haematopoietic cells. Scand J Clin Lab Invest Suppl, 97, 77-89.

5. Bradford M.M. 1976. Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem, 72, 248-254.

6. Cuadros C., Lopez-Hernandez F.J., Dominguez A.L., McClelland M. & Lustgarten J. 2004. Flagellin fusion proteins as adjuvants or vaccines induce specific immune responses. Infect Immun, 72, 2810-2816.

7. Dabrowski S. & Kur J. 1998. Cloning and expression in Escherichia coli of the recombinant His-tagged dna polymerases from Pyrococcus furiosus and Pyrococcus woesei. Protein Expr Purif, 4, 131-138.

8. Didierlaurent A., Ferrero I., Otten L.A., Dubois B., Reinhardt M., Carlsen H., Blomhoff R., Akira S., Kraehenbuhl J.P. & Sirard J.C. 2004. Flagellin promotes myeloid differentiation factor 88-dependent development of Th2-type response. J Immunol, 172, 6922-6930.

9. Eaves-Pyles T.D., Wong H.R., Odoms K. & Pyles R.B. 2001.

Salmonella flagellin dependent proinflammatory responses are localized to the conserved amino and carboxyl regions of the protein. J Immunol, 167, 7009-7016.

15. Laemmli U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophages T4. Nature, 227, 680-685.

16. Medzhitov R. & Janeway C.A. Jr. 2000. Innate immune recognition: mechanisms and pathways. Immunol Rev, 173, 89-97.

17. Moigne V.L., Robreau G. & Mahana W. 2008. Flagellin as a good carrier and potent adjuvant for Th1 reponse: Study of mice immune response to the p27 (Rv2108) Mycobacterium tuberculosis antigen. Mol Immunol, 45, 2499-2507.

18. Pulendran B., Smith J.L. & Caspary G. 1999. Distinct dendritic cell subsets differentially regulate the class of immune response in vivo. Proc Natl Acad Sci USA, 96, 1036-1041.

19. Reichhart J.M. 2003. TLR5 takes aim at bacterial propeller. Nat Immunol, 4, 1159-1160.

20. Sadallah F., Brighouse G., Del-Giudice G., Drager-Dayal R. & Hodne M. 1990. Production of specific monoclonal antibodies to Salmonella typhi flagellin and possible application to immunodiagnosis of typhoid fever. J Infect Dis, 161, 59-64.

21. Sambrook J. & Russell D.W. 2001. Molecular cloning: a laboratory manual, Third ed. Cold Spring Harbor laboratory Press, Cold Spring Harbor, New York, pp.

116-118.

22. Sanders C.J., Yu Y., Moore D.A., Williams III I.R. & Gewirtz A.T. 2006. Humoral immune response to flagellin requires T cells and activation of innate immunity. J Immunol, 177, 2810-2818.

10. Hayashi F., Smith K.D., Ozinsky A., Hawn T.R., Yi E.C., Goodlett D.R., Eng J.K., Akira S., Underhill D.M. & Aderem A. 2001. The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5.

Nature, 410, 1099-1103.

23. Skountzou I., Mdel P., Martin B., Wang L., Koutsonanos Y.D., Weldon W., Jacob J. & Compans R.W. 2010.

Salmonella flagellins are potent adjuvants for intranasally administered whole inactivated influenza vaccine. Vaccine, 28, 4103-4112.

11. Hiroyuki Y., Tadashi U., Satoru M., Kumiko H. & Isamu S. 2005. Newly designed primer sets available for evaluating various cytokines and iNOS Mrna expression in guinea pig lung tissues by RT-PCR. Exp Anim, 54, 163-172.

24. Sukosol T., Sarasombath S., Songsivilai S., Ekpo P., Rungpitarangsi B. & Pang T. 1994. Fusion protein of Salmonella typhi flagellin as antigen for diagnosis of typhoid fever. Asian Pacific J Allergy Immunol, 12, 21-25.

12. Hong S.H., Byun Y., Nguyen C.T., Kim S.Y., Seong B.L., Park S., Woo G., Yoon Y., Koh J.T., Fujihashi K. & Rhee J.H. 2011. Intranasal administration of a flagellinadjuvanted inactivated influenza vaccine enhances mucosal immune responses to protect mice against lethal infection. Vaccine, 30, 466-474.

13. Janeway C.A. Jr. 1989. Approaching the asymptote?

Evolution and revolution in immunology. Cold Spring Harbor Symp Quant Biol, 54, 1-13.

186

14. Kielian T., Nagai E., Ikubo A., Rasmussen C.A. & Suzuki T. 1999. Granulocyte/macrophage-colony-stimulating factor released by adenovirally transduced CT26 cells leads to the local expression of macrophage inflammatory protein 1alpha and accumulation of dendritic cells at vaccination sites in vivo. Cancer Immunol Immunother, 48, 123-131.

25. Tallant T., Deb A., Kar N., Lupica J., Veer M.J.D. & DiDonato J.A. 2004. Flagellin acting via TLR5 is the major activator of key signaling pathways leading to NF-ÎşB and proinflammatory gene program activation in intestinal epithelial cells. BMC Microbiol, 4, 33. doi:10.1186/1471-2180-4-33.

26. Vijay-Kumar M., Aitken J.D., Sanders C.J., Frias A., Sloane V.M., Xu J., Neish A.S., Rojas M. & Gewirtz A.T. 2008.

Flagellin treatment protects against chemicals, bacteria, viruses, and radiation. J Immunol, 180, 8280-8285.

Veterinaria Italiana 2013, 49 (2), 181-186. doi: 10.12834/VetIt.2013.492.187.192

Salmonella spp. e antibiotico-resistenza in Mammiferi e Uccelli selvatici in Italia nord-occidentale dal 2002 al 2010 Velca Botti, Francine Valérie Navillod, Lorenzo Domenis, Riccardo Orusa, Erika Pepe, Serena Robetto, Cristina Guidetti Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d’Aosta, Struttura Complessa Valle d’Aosta, Centro di Referenza Nazionale per le Malattie degli Animali Selvatici (Ce.R.M.A.S.), Regione Amérique 7/G, 11020 Quart, Italia cristina.guidetti@izsto.it

Parole chiave Antibiotico-resistenza, Fauna selvatica, Italia nord-occidentale, Salmonella, Tetraciclina.

Riassunto La Salmonella è un importante agente patogeno responsabile di zoonosi di notevole rilevanza economica. In Europa la salmonellosi è la seconda infezione trasmessa per via alimentare, in Italia il microrganismo continua ad essere la causa più frequente di infezione alimentare. In Europa sono in atto molti piani di sorveglianza di Salmonella in animali da allevamento, tuttavia il monitoraggio del microrganismo in animali selvatici è effettuato solo occasionalmente. Lo studio ha avuto l’obiettivo di indagare la presenza di Salmonella in animali selvatici e i ceppi antibiotico-resistenti. Nel periodo 2002-2010, 2.713 animali selvatici (Canidi, Mustelidi, Uccelli, Roditori e Ungulati), provenienti da aree dell’Italia nordoccidentale, sono stati testati per Salmonella mediante metodo microbiologico colturale seguito da tipizzazione sierologica e biochimica. Di questi, 117 (63 Canidi, 25 Mustelidi, 24 Uccelli, 5 Ungulati) sono risultati positivi per Salmonella (4,3%). Sono stati isolati 130 ceppi appartenenti a diversi sierotipi e Salmonella Typhimurium è risultato quello più rappresentato.

La sensibilità agli antibiotici è stata testata su 88 ceppi con test di disco-diffusione. La maggior parte dei ceppi analizzati (97,7%) si sono mostrati intermedi (I) o resistenti (R) ad almeno una classe di antibiotici. I più alti valori sono stati osservati per la classe delle tetracicline.

La presenza di sierotipi di Salmonella antibiotico-resistenti e responsabili di zoonosi è stata riscontrata in diverse specie di animali selvatici.

Veterinaria Italiana 2013, 49 (2), 187-194. doi: 10.12834/VetIt.2013.492.193.200

Introduzione Salmonella è un batterio responsabile di zoonosi di notevole rilevanza per la salute pubblica poiché ha un considerevole impatto economico (19). La salmonellosi è una delle malattie alimentari più comuni e maggiormente diffuse. In Europa è la seconda infezione alimentare dopo la campilobatteriosi.

Nel 2010, l’European Food Safety Authority (EFSA) ha riportato 99.020 casi di salmonellosi umana nei 27 Stati Membri dell’Unione Europea, inclusi 2.730 casi in Italia, paese in cui Salmonella è ancora la principale causa di focolai di infezione alimentare (10).

Il genere Salmonella comprende due specie: S. enterica e S. bongori (22). La prima include sei sottospecie (subsp.): enterica, salamae, arizonae, diarizonae, houtenae e indica. Esistono oltre 2.500 sierotipi di Salmonella responsabili di zoonosi, la maggior parte dei quali appartiene alla sottospecie enterica. Salmonella risiede in un’ampia varietà di ospiti:

animali da allevamento e domestici, fauna selvatica ed esotica, rettili.

Nelle nazioni dell’Unione Europea sono in atto molti piani di sorveglianza per Salmonella su animali allevati. Il controllo della filiera è, infatti, l’approccio più efficace per garantire la sicurezza alimentare. Nel 2009, la maggior parte dei ceppi è stata isolata da polli (45,7%), suini (16,02%) e tacchini (4,14%) (3).

Al contrario, la ricerca di Salmonella nella fauna selvatica non è regolata da piani di monitoraggio nazionali ma è effettuata, occasionalmente, a scopo di studio.

Diverse indagini sono state svolte sugli Uccelli selvatici (17, 27) ma i dati disponibili sulla presenza di Salmonella nei Mammiferi selvatici sono pochi.

Lo studio ha avuto l’obiettivo di indagare la presenza di Salmonella e i ceppi antibiotico-resistenti negli animali selvatici (Canidi, Mustelidi, Uccelli, Roditori e Ungulati) dell’Italia nord-occidentale.

187

Salmonella spp. e ceppi antibiotico-resistenti nei selvatici

Tabella I. Animali campionati.

Canidi Mustelidi

Uccelli

Famiglia Canidae Mustelidae

Accipitridae

Ardeidae Columbidae Corvidae

Cuculidae Falconidae

Fringillidae Laridae Passeridae Picidae Scolopacidae Strigidae

Sturnidae Tetraonidae Turdidae Tytonidae Roditori

Ungulati

Cricetidae Myocastoridae Muridae Soricidae Cervidae Suidae

Genere/specie (nome comune) Vulpes vulpes (volpe rossa) Meles meles (tasso) Martes martes (martora) Martes foina (faina) Mustela putorius (puzzola) Accipiter gentilis (astore) Accipiter nisus (sparviere) Aquila chrysaetos (aquila reale) Buteo buteo (poiana) Circaetus gallicus (biancone) Nycticorax nycticorax (nitticora) Columba livia (piccione) Garrulus glandarius (ghiandaia) Corvus corone (cornacchia) Pica pica (gazza) Cuculus canorus (cuculo) Falco peregrinus (falco pellegrino) Falco spp. (falco) Falco tinnunculus (gheppio) Pernis apivorus (falco pecchiaiolo) Fringilla coelebs (fringuello) Larus spp. (gabbiano) Passer domesticus (passero domestico) Picus viridis (picchio verde) Scolopax rusticola (beccaccia) Asio otus (gufo comune) Bubo bubo (gufo reale) Otus scops (assiolo) Strix aluco (allocco) Sturnus vulgaris (storno) Tetrao tetrix (gallo forcello) Turdus merula (merlo) Tyto alba (barbagianni) Clethrionomys glareolus (arvicola rossastra) Myocastor coypus (nutria) Apodemus spp. (topo) Sorex spp. (toporagno) Cervus elaphus (cervo) Sus scrofa (cinghiale)

Materiali e metodi Raccolta dei campioni In Italia nord-occidentale (Valle d’Aosta, Piemonte e Liguria), tra gennaio 2002 e dicembre 2010, sono stati prelevati ed esaminati per Salmonella spp. 2.713 animali selvatici (1.222 Canidi, 221 Mustelidi, 1.101

188

Botti et al.

Uccelli, 100 Roditori, 69 Ungulati) (Tabella I). Gli animali, generalmente, sono stati prelevati morti a causa di incidenti in strada e attività venatoria nell’ambito dei piani di controllo provinciali o regionali. In alcuni casi, i soggetti sono risultati provenienti dai centri di recupero della fauna selvatica.

Gli animali morti sono stati sottoposti ad un esame necroscopico completo con la raccolta di campioni di linfonodo meseraico, feci e visceri per un totale di 3.862 campioni biologici. In particolare, a 927 volpi rosse (Vulpes vulpes) e 146 Mustelidi sono stati prelevati feci e linfonodo meseraico. Ai 3 animali catturati vivi è stato effettuato un tampone cloacale.

Isolamento e identificazione di Salmonella Tutti i campioni sono stati omogeneizzati con apparecchio tipo Stomacher. Dopo incubazione di 18 ore in Buffered Peptone Water, sono stati inoculati in tre brodi di arricchimento (Selenite Cystine, Rappaport-Vassiliadis e Mueller Kauffman Tetrathionate) per 24 ore. Dieci µl di ciascun brodo sono stati inoculati in piastre di terreni selettivi (Brilliant Green Agar e Xylose Lysine Deoxycholate Agar). Le piastre sono state incubate per 24 ore a 37°C. Le colonie sospette sono state trasferite su Triple Sugar Iron per l’identificazione presuntiva di Enterobacteriaceae, basata sulla fermentazione degli zuccheri e produzione di H2S. Le presunte salmonelle sono state confermate con test biochimico (API 20E®) e sierologico. L’identificazione del sierotipo è stata effettuata tramite sieri monovalenti.

Salmonella Typhimurium e Salmonella Enteritidis sono state fagotipizzate con metodo standard dal Centro di Referenza Nazionale per le Salmonellosi.

Valutazione della sensibilità agli antibiotici L’antibiotico-resistenza è stata verificata con il test di disco-diffusione (metodo Kirby-Bauer), effettuato su Mueller-Hinton Agar a partire da una sospensione batterica con torbidità pari a 0,5 McFarland. L’interpretazione è stata eseguita in base ai criteri forniti dal Clinical Laboratory Standard Institute (CLSI) (4).

Gli antibiotici saggiati in questo studio sono rappresentativi delle diverse classi: β-lattamici, tetracicline, chinoloni, aminoglicosidi, sulfonamidi, polipeptidi e fenicoli. Le molecole sono state selezionate sulla base della loro rilevanza per la salute pubblica e tenendo conto delle indicazioni dell’EFSA (11), della rete Enter-net Italia (5) e della letteratura disponibile. Gli antibiotici testati e le loro concentrazioni sono riportati nella Tabella II.

Veterinaria Italiana 2013, 49 (2), 187-194. doi: 10.12834/VetIt.2013.492.193.200

Botti et al.

Salmonella spp. e ceppi antibiotico-resistenti nei selvatici

Tabella II. Sensibilità agli antibiotici (Metodo Kirby-Bauer), numero e percentuale di ceppi intermedi e resistenti.

Classe antimicrobica Aminoglicosidi

β-lattamici

Fenicoli Polipeptidi Chinoloni

Sulfonamidi Tetracicline

Molecola attiva Amikacina Streptomicina Neomicina Gentamicina Kanamicina Ampicillina Amoxicillina + acido clavulanico Cefotaxima Cefalotina Cloramfenicolo Colistina Acido nalidixico Enrofloxacina Ciprofloxacina Trimetoprim + sulfametoxazolo Oxitetraciclina Tetraciclina

Simbolo AK S N CN K AM AMC CTX KF C CT NA ENR CIP SXT T TE

Dose (μg) 30 10 30 10 30 10 30 (20 e 10) 30 30 30 10 30 5 5 25 (23,75 e 1,25) 30 30

Ceppi I/R Fr % (No) 0% (n=0) 46,6% (n=41) 7,9% (n=7) 0% (n=0) 4,5% (n=4) 13,6% (n=12) 7,9% (n=7) 0% (n=0) 1,0% (n=1) 1,0% (n=1) 1,0% (n=1) 3,4% (n=3) 3,4% (n=3) 0% (n=0) 1,0% (n=1) 72,3% (n=68) 81,8% (n=72)

Fr = frequenza; I = ceppo intermedio; R = ceppo resistente.

Tabella III. Salmonella in Canidi, Mustelidi, Uccelli, Roditori e Ungulati dal 2002 al 2010: animali analizzati e positivi (numero e percentuale).

Anno 2002 2003 2004 2005 2006 2007 2008 2009 2010 Total

Canidi Mustelidi Uccelli Roditori Ungulati Animali Analizzati Positivi Analizzati Positivi Analizzati Positivi Analizzati Positivi Analizzati Positivi Analizzati Positivi (No) Fr (No) (No) Fr (No) (No) Fr (No) (No) Fr (No) (No) Fr (No) (No) Fr (No) 6,3% 15,8% 6,4% 48 19 25 2 94 (n=3) (n=3) (n=6) 7,1% 22,2% 1,6% 5,6% 56 27 126 4 213 (n=4) (n=6) (n=2) (n=12) 9,9% 7,0% 0,6% 2,6% 142 57 545 65 2 811 (n=14) (n=4) (n=3) (n=21) 6,8% 5,7% 3,5% 3,8% 5,5% 263 35 84 30 26 438 (n=18) (n=2) (n=3) (n=1) (n=24) 6,2% 21,2% 4,4% 7,0% 178 33 135 8 354 (n=12) (n=7) (n=6) (n=25) 5,1% 5,9% 3,1% 4,3% 175 17 131 1 324 (n=9) (n=1) (n=4) (n=14) 0,7% 14,3% 1,7% 296 19 14 2 28 359 (n=2) (n=4) (n=6) 20,0% 13,9% 6,8% 46 5 36 1 88 (n=1) (n=5) (n=6) 5,6% 11,1% 20,0% 9,4% 18 9 5 32 (n=1) (n=1) (n=1) (n=3) 5,2% 11,3% 2,2% 7,2% 4,3% 1.222 221 1.101 100 69 2.713 (n=63) (n=25) (n=24) (n=5) (n=117)

Fr = frequenza.

Risultati

ha mostrato segni clinici o lesioni patologiche riconducibili a salmonellosi.

Ceppi di Salmonella

Le frequenze di positività sono risultate pari a: 5,2% (63/1222) nei Canidi, 11,3% (25/221) nei Mustelidi, 2,2% (24/1101) negli Uccelli e 7,2% (5/69) negli Ungulati. Nessun roditore è risultato positivo per Salmonella (Tabella III).

Durante il periodo di studio, 117 animali selvatici (63 Canidi, 25 Mustelidi, 24 Uccelli, 5 Ungulati) sono risultati positivi per Salmonella (4,3%). Nessuno di essi

Veterinaria Italiana 2013, 49 (2), 187-194. doi: 10.12834/VetIt.2013.492.193.200

189

Salmonella spp. e ceppi antibiotico-resistenti nei selvatici

Sono stati isolati 130 ceppi di Salmonella: 2 animali hanno permesso di evidenziare due differenti sottospecie di Salmonella nella stessa matrice e 11 animali, campionati sia per feci sia per linfonodo [una faina (Martes foina), 2 tassi (Meles meles) e 8 volpi], sono risultati positivi per entrambe le matrici (Tabelle IV e V).

Le sottospecie di Salmonella identificate sono risultate le seguenti: S. enterica subsp. enterica (n=91), S. enterica subsp. houtenae (n=13), S. enterica subsp. diarizonae (n=15), S. enterica subsp. arizonae (n=5), S. enterica subsp. salamae (n=3).

Inoltre, salmonelle non specifiche sono state indicate dal laboratorio che ha identificato i sierotipi, rispettivamente, come “nuovo sierotipo” (n=2) e “sierotipo non tipizzabile” (n=1).

Salmonella Typhimurium è risultato il sierotipo più comunemente identificato, riscontrato in 7 volpi rosse, 4 tassi, 2 piccioni (Columba livia), una ghiandaia (Garrulus glandarius), un passero (Passer domesticus), una poiana (Buteo buteo), un gufo comune (Asio otus) e un barbagianni (Tyto alba).

La fagotipizzazione è stata effettuata per 10 salmonelle appartenenti al sierotipo Typhimurium e i fagotipi individuati sono stati: DT 104, DT 12, DT 193, DT 302 e solo un “non tipizzabile”.

Tabella IV. Coinfezione da parte di ceppi o fagotipi differenti di Salmonella in uno stesso animale (4 casi individuati).

Specie animale Caso 1 Volpe rossa Caso 2 Volpe rossa

Feci

S. Typhimurium DT12 S. Veneziana S. enterica subsp. salamae Caso 3 Volpe rossa E S. Kimuenza S. enterica subsp. arizonae gr. Z:50:z4,z23:-: E Caso 4 Biancone S. Enteritidis gr. D11,9,12:g,m:-: PT4

Linfonodo meseraico S. Typhimurium DT104 S. Kottbus Non analizzato Non analizzato

Tabella V. Presenza di Salmonella in feci e linfonodi di Canidi e Mustelidi.

Anno 2002 2003 2004 2005 2006 2007 2008 2009 2010 Totale

190

Salmonella in Salmonella in Salmonella nelle linfonodo e feci linfonodo feci Mustelidi Canidi Mustelidi Canidi Mustelidi Canidi 3 2 2 2 1 1 1 1 1 6 5 2 1 12 1 1 1 5 8 1 2 2 4 1 1 1 1 1 5 6 12 32 1 14

Botti et al.

Salmonella Enteritidis è stata rilevata in cinque animali: 2 volpi rosse, un biancone (Circaetus gallicus), un allocco (Strix aluco), un gabbiano (Larus spp.). In tre casi il fagotipo è risultato PT4.

Gli altri sierotipi di Salmonella enterica subsp. enterica sono riportati in Tabella VI.

Resistenza agli antibiotici Ottantotto ceppi sono stati testati per verificare la sensibilità agli antibiotici. Quasi tutti i ceppi (97,7%) si sono mostrati intermedi (I) o resistenti (R) ad almeno una classe di antibiotici. I valori maggiori sono stati osservati per la classe delle tetracicline.

Le percentuali di resistenza alle singole molecole è riportata in Tabella II. Soltanto due ceppi di Tabella VI. Sierotipi di Salmonella enterica subsp. enterica.

Sierotipo Alfort Bonariensis Bredeney Braenderup Brancaster Coeln Corvallis Djugu Farsta Galiema Heidelberg Hessarek Hiduddify Infantis Kibi Kimuenza Kottbus Livingstone Loanda Massenya Mikavasima Muenchen Napoli Nordufer Ohio Strourbridge Suberu Thompson Tsevie Tshiongwe Veneziana Wil

No 1 3 1 1 1 5 1 1 1 1 3 1 1 4 2 1 5 2 1 1 1 3 2 2 1 1 1 2 1 2 8 1

Specie Volpe rossa Volpe rossa, faina Volpe rossa Volpe rossa Gheppio Volpe rossa, tasso, faina Tasso Volpe rossa Piccione Cinghiale Volpe rossa Volpe rossa Volpe rossa Volpe rossa, faina, cornacchia, cervo Volpe rossa, faina Volpe rossa Volpe rossa, cinghiale Volpe rossa, assiolo Assiolo Tasso Volpe rossa Volpe rossa, tasso Tasso Tasso Aquila reale Gallo forcello Allocco Cinghiale Piccione Volpe rossa Volpe rossa, biancone, falco pellegrino Volpe rossa

Veterinaria Italiana 2013, 49 (2), 187-194. doi: 10.12834/VetIt.2013.492.193.200

Botti et al.

Salmonella spp. e ceppi antibiotico-resistenti nei selvatici

Table VII. Schema dei ceppi di Salmonella multi-resistenti (MDR).

Sierotipo

Specie animale

Schema di MDR

S. Typhimurium DT 104 S. Typhimurium DT 193 S. Typhimurium

Volpe rossa Gufo comune Poiana Volpe rossa Volpe rossa Volpe rossa Gheppio Volpe rossa Volpe rossa Aquila reale Volpe rossa Faina

AM-C-S-T-TE AM-AMC-N-S-T-TE AM-AMC-S-T-TE AM-NA-ENR-S-TE AM-NA-ENR-S-T-TE S-T-TE AM-AMC-NA-N-S-K-T-TE-SXT AM-AMC-T-TE N-S-T-TE AM-AMC-S-T-TE AM-S-T-TE AM-AMC-KF-ENR-T-TE

S.Brancaster S. Heidelberg S. Bredeney S. Ohio Nuovo sierotipo Non tipizzabile

Salmonella Enteritidis sono risultati sensibili agli antibiotici (S).

Trentatrè ceppi, definiti multi-resistenti (MDR), sono risultati intermedi o resistenti a due o più classi di antibiotici (Tabella VII).

Discussione Lo studio ha analizzato la presenza di Salmonella nella fauna selvatica dell’Italia nord-occidentale (Canidi, Mustelidi, Ungulati e Uccelli).

Una ricerca simile, effettuata nei Paesi Baschi (20), per un breve periodo (2001-2002) e su un basso numero di animali, ha evidenziato come la prevalenza di Salmonella nei Mammiferi selvatici sia comparabile a quella degli Uccelli selvatici. Nella ricerca citata, in linea con quanto rilevato nel presente studio, gli animali positivi non hanno mostrato sintomi di salmonellosi. Tuttavia, le frequenze di positività rilevate nel presente studio su Mammiferi e Uccelli sono entrambe inferiori a quelle riportate da Millán et al. (rispettivamente, 5,8% vs 7,2% e 2,2% vs 8,5%) (20).

Per quanto riguarda i Canidi e l’infezione da Salmonella si riporta uno studio sulle volpi in Norvegia risultate infettate dallo stesso sierotipo Salmonella Typhimurium responsabile di focolai nei Passeriformi (14). Diversamente, nello studio effettuato non è rilevabile una correlazione tra ceppi di Salmonella Typhimurium isolati da specie animali differenti e non si riportano focolai di salmonellosi negli Uccelli. Tuttavia, alcuni sierotipi di Salmonella (S. Infantis, S. Kottbus, S. Livingstone, S. Veneziana) sono stati riscontrati in animali connessi tra loro nella catena alimentare {volpe rossa, faina, rapaci [biancone, assiolo (Otus scops), falco pellegrino (Falco peregrinus)] e cinghiale (Sus scrofa)} (Tabella VI).

Il comportamento e le abitudini alimentari degli animali selvatici influenzano la probabilità di essere infettati da Salmonella (9). In particolare, tassi, volpi,

Veterinaria Italiana 2013, 49 (2), 187-194. doi: 10.12834/VetIt.2013.492.193.200

uccelli rapaci e cinghiali potrebbero acquisire Salmonella attraverso lo scavenging su carcasse contaminate o cercando tra i rifiuti (20).

Un’indagine su salmonelle non tifoidee è stata realizzata su gruppi sociali di tassi nel Regno Unito, rivelando un’elevata prevalenza del batterio (72%) (29).

Tali risultati, anche se in apparenza differenti, sono comparabili ai dati del presente studio che mostrano un’elevata positività nonostante la bassa dimensione campionaria. Questa frequenza può essere spiegata da alcuni aspetti biologici dei tassi: animali che condividono tane e latrine con dieta onnivora che include Insetti, piccoli Mammiferi e Uccelli.

Uno studio è stato condotto su cinghiale, capriolo (Capreolus capreolus), cervo (Cervus elaphus) e volpe rossa, nel periodo 2005-2009, nelle aree delle regioni Lombardia ed Emilia Romagna: Salmonella è stata isolata da cinghiali in una percentuale variabile dal 3,9% al 26%, in relazione all’area geografica di campionamento (18). Solo occasionalmente il batterio è stato ritrovato in capriolo, cervo o volpi rosse. La sierotipizzazione ha rivelato la presenza di S. Typhimurium, S. Napoli, S. Veneziana, S. Mishmarhaeme e, in particolare, di S. Thompson nei cinghiali, similmente ai risultati del presente studio.

Esistono innumerevoli ricerche sulla presenza di Salmonella negli Uccelli selvatici. In Spagna, Reche et al. (24) hanno riportato la prevalenza del 4% nei rapaci, principalmente di S. Typhimurium DT 104.

In un altro studio, sempre su rapaci, è stata riportata una percentuale ancora maggiore di Salmonella (10%) (19). La positività rilevata nel presente studio, nel complesso delle specie di Uccelli indagati, è stata inferiore (2,2%), tuttavia, metà degli isolamenti sono risultati riferibili a Uccelli rapaci (n=12/24).

Come riportato da Vieira-Pinto et al. (28) e Hilbert et al. (16), la selvaggina [nel presente studio: cinghiali, cervo e gallo forcello (Tetrao tetrix)] potrebbe costituire una fonte di infezione per l’uomo quando gli spari nell’addome o una scorretta eviscerazione causino contaminazione fecale delle carni destinate al consumo.

Un’ulteriore fonte di infezione per l’uomo potrebbe essere la scorretta manipolazione degli animali vivi presso i centri di recupero della fauna selvatica, specialmente degli Uccelli selvatici [nel presente studio: aquila reale (Aquila chrysaetos), assiolo, gheppio (Falco tinnunculus), allocco, colombo, gufo comune (Asio otis) e passero].

Tutti gli animali campionati nel presente studio possono essere considerati portatori sani di Salmonella per l’assenza di lesioni patologiche riconducibili a salmonellosi (enterite emorragica, epatite glaucomatosa, ecc.).

Tra le volpi e i Mustelidi positivi, analizzati per due matrici, la maggior parte sono risultati positivi solo

191

Salmonella spp. e ceppi antibiotico-resistenti nei selvatici

per il linfonodo meseraico, non per le feci (n=44).

Questo aspetto indica che gli stessi animali al momento del campionamento, pur essendo portatori di Salmonella, non sono escretori. È probabile che fattori stressanti (avverse condizioni climatiche, carenze nutrizionali, altre malattie infettive) favoriscano il trasferimento di Salmonella nelle feci rendendo l’animale escretore.

La fauna selvatica può essere un ricco serbatoio di una grande varietà di sierotipi, la maggior parte dei quali da considerare non patogeni. Tuttavia, alcuni geni che codificano per fattori di virulenza, localizzati su plasmidi, possono essere trasferiti da un ceppo all’altro causando un incremento della patogenicità di alcuni sierotipi (1). Questi ultimi, inoltre, possono preferire specie animali differenti: alcuni sono considerati specie-specifici, altri ubiquitari (13). La presenza di plasmidi di virulenza in sierotipi adattati all’ospite suggerisce che l’acquisizione orizzontale della virulenza può aver espanso l’assortimento di ospiti di Salmonella (25).

Tra i ceppi del microrganismo isolati nel presente studio, il 32% (n=41/130), menzionato nei rapporti Enter-net Italia 2002-2009 come responsabile di infezioni umane, è risultato costituito da: S. Enteritidis, S. Typhimurium, S. Heidelberg, S. Muenchen, S. Thompson, S. Bredeney, S. Napoli e S. Infantis (7, 8).

In particolare, S. Napoli è un sierotipo emergente in Italia. Uno studio recente suggerisce che il principale serbatoio del microrganismo possa essere l’ambiente (12), anche se Graziani et al. non hanno identificato una specifica fonte di esposizione per l’uomo. La presente indagine indica che il tasso possa rappresentare una fonte sostanziale di S. Napoli.

Il sierotipo S. Thompson è stato associato a un focolaio di salmonellosi causato da rucola contaminata da acque di irrigazione non potabili (21). La fauna selvatica, in particolare gli Uccelli, potrebbero causare la contaminazione delle colture vegetali, direttamente con materiale fecale o indirettamente con la contaminazione delle acque di irrigazione (15).

In uno studio precedente (6), effettuato nella regione Valle d’Aosta, è stato osservato come le distribuzioni spaziali stimate di carnivori ed esseri umani infettati da Salmonella fossero parzialmente sovrapposte, considerando che S. Typhimurium, S. Heidelberg e S. Infantis sono state isolate in entrambi. Questo aspetto può essere spiegato dal comportamento sinantropico delle specie selvatiche che vivono in prossimità di aree residenziali, zone agricole e discariche di rifiuti. La dieta estremamente diversificata di cinghiali, tassi e volpi aumenta il rischio di acquisire Salmonella e spiega l’ampia diversità di sierotipi (9).

L’analisi dei dati ha rivelato la presenza di una diffusa antibiotico-resistenza di Salmonella in Italia nordoccidentale. La diffusione di batteri responsabili di

192

Botti et al.

zoonosi resistenti agli antibiotici è un aspetto rilevante per il trattamento delle infezioni umane per la capacità di compromettere l’efficacia delle terapie.

Gli Stati Membri dell’Unione Europea raccolgono e analizzano un’ampia varietà di campioni animali e alimentari per monitorare la presenza di batteri antibiotico-resistenti responsabili di zoonosi, generalmente Salmonella, Campylobacter, Escherichia ed Enterococcus. Non esistono dati sulla resistenza agli antibiotici nella fauna selvatica da confrontare con i risultati del presente studio. I soli dati disponibili sono quelli riportati dall’EFSA riguardanti il bestiame (da 0,2% a 75%) (11). Il tasso di resistenza agli antibiotici nella fauna selvatica, emerso nel presente studio (97,7%), risulta maggiore di quello indicato dal rapporto EFSA, tuttavia i dati devono essere correlati alla numerosità campionaria.

I valori di resistenza più elevati sono stati registrati nei confronti delle tetracicline, verosimilmente per l’impiego frequente in medicina veterinaria, in circa i due terzi dei regimi terapeutici (26). In aggiunta, diversamente dai dati europei, i risultati hanno mostrato una totale sensibilità dei ceppi a cefotaxime e ciprofloxacina.

Tra le Salmonelle MDR, un caso significativo è rappresentato da Salmonella Brancaster isolata da un gheppio, che ha rivelato di essere un sierotipo intermedio o resistente verso ampicillina, amoxicillina + acido clavulanico, acido nalidixico, neomicina, streptomicina, kanamicina, oxitetraciclina, tetraciclina e trimetoprim + sulfametoxazolo. Le informazioni epidemiologiche relative a questo sierotipo sono piuttosto limitate. La letteratura indica isolamenti sporadici: Salmonella Brancaster è stata riportata in Toscana nel 1985 e nel 1991 da campioni umani (23) ma senza fornire dati sulla sensibilità antimicrobica.

Salmonella Typhimurium DT 104, considerata un agente patogeno emergente, ha mostrato un elevato numero di resistenze rispetto agli altri fagotipi.

Non è noto se gli isolati di DT 104 possiedano virulenza maggiore oppure se essa stessa sia associata a geni di resistenza multipla. Se i geni relativi alla virulenza fossero associati a quelli dell’antibioticoresistenza, essa potrebbe essere selezionata dall’uso di antibiotici (2).

Cause probabili che promuovono la selezione di ceppi antibiotico-resistenti sono: i trattamenti massivi effettuati negli allevamenti per la terapia e la profilassi delle infezioni batteriche, una posologia inaccurata e tempi di trattamento inadeguati. Anche l’uso di mangimi addizionati con antibiotici, a dosaggi sub-terapeutici, come promotori della crescita, possono produrre resistenza verso le molecole in uso e verso quelle strutturalmente e farmacologicamente correlate (cross-resistenza) (13).

Veterinaria Italiana 2013, 49 (2), 187-194. doi: 10.12834/VetIt.2013.492.193.200

Botti et al.

Conclusioni È necessaria una costante vigilanza su Salmonella nella fauna selvatica e sulla sua sensibilità agli antibiotici per identificare precocemente i ceppi responsabili di zoonosi, individuare nuovi profili di resistenza e valutare le misure di controllo. I risultati ottenuti in questo studio sottolineano la necessità di coordinare al meglio organizzazioni e reti che si occupano di sicurezza alimentare, salute animale e umana.

Ringraziamenti Gli autori ringraziano: la dott.ssa Lucia Decastelli della S.C. Controllo alimenti e igiene delle produzioni, IZS Piemonte, Liguria e Valle D’Aosta, per l’identificazione dei sierotipi; la dott.ssa Antonia Ricci del Centro di Referenza Nazionale per le Salmonellosi, IZS delle Venezie, per la fagotipizzazione; il dott. Roberto Pellizzaro del Centro di Recupero della Valle d’Aosta e la dott ssa Elena Ghelfi del Parco Fluviale del Po e dell’Orba, il

Salmonella spp. e ceppi antibiotico-resistenti nei selvatici

Corpo Forestale dello Stato e l’Ufficio Fauna della Regione Autonoma Valle d’Aosta per il campionamento; la dott.ssa Cristina Banchi e la dott.ssa Raffaella Spedicato per il supporto tecnico e analitico.

Finanziamenti Questo studio è stato in parte finanziato dal Ministero della Salute attraverso il Progetto di ricerca PLV 25/07 RC “Epidemiosorveglianza in CRAS e CRASE: monitoraggio sanitario di rapaci e passeriformi per la messa a punto di un sistema di prevenzione verso alcune zoonosi (infezione da Chlamydia e Salmonella, influenza aviaria, Newcastle disease e West Nile disease) e parassitosi della avifauna selvatica” e il Progetto di ricerca IZS PLV 009/00 “Valutazione sulla presenza di alcune patologie nella volpe e nei mustelidi con possibili ripercussioni sulla salute dell’uomo e degli animali domestici”.

Bibliografia 1. Boyd E.F. & Hartl D.L. 1997. Recent horizontal transmission of plasmids between natural populations of E. coli and Salmonella enterica. J Bacteriol, 179, 1622-1627.

2. Briggs C.E. & Fratamico P.M. 1999. Molecular characterization of an antibiotic resistance gene cluster of Salmonella typhimurium DT104. Antimicrob Agents Chemother, 43, 846-849.

3. Centro di Referenza Nazionale per le Salmonellosi.

2011.

Enter-Vet Report 2009. (http://www. izsvenezie.it/images/stories/Pdf/Salmonelle/report_ entervet_2009new.pdf ultimo accesso 24 ottobre 2012).

4. Clinical Laboratory Standard Institute. 2008.

Performance Standards for Antimicrobial Disk and Dilution Susceptibility Test for Bacteria Isolated From Animals, Approved Standard. 3rd Ed. CLSI document M31-A3. Wayne, PA, 99 p.

5. Dionisi A.M., Filetici E., Ocwzarek S., Arena S., Benedetti I., Lucarelli C., Luzzi I., Scavia G., Minelli F., Ciaravino G., Marziano M.L., Caprioli A. & Italy Enter-net Laboratories. 2011. ENTER-NET: Sorveglianza delle infezioni trasmesse da alimenti e acqua. Rapporto dell’attività 2007-2009. Not Ist Super Sanità, 24, 3-10.

6. Domenis L., Orusa R., Lo Valvo T., Balestrieri A., Ferrari A. & Robetto S. 2004. Wild carnivores as bioindicators of Salmonella sp. infections in Aosta Valley-preliminary results. Abstract Book of The Sixth Conference of the European Wildlife Disease Association TSE and CWD Workshop, 68 p.

7. Enter-net Italia a. Sorveglianza delle infezioni da Salmonella. Dati storici dal 2000 al 2006. (http:// www.iss.it/binary/salm/cont/4.e%20%20Dati%20 SALMONELLA%202000-2006.1206455668.pdf ultimo accesso 24 ottobre 2012).

Veterinaria Italiana 2013, 49 (2), 187-194. doi: 10.12834/VetIt.2013.492.193.200

8. Enter-net Italia b. Sorveglianza delle infezioni da Salmonella. Dati storici dal 2007 al 2009. (http://w w w.iss.it/binar y/ente/cont/4f_Dati_ SALMONELLA_2007_2009.pdf ultimo accesso 24 ottobre 2012).

9. Euden P.R. 1990. Salmonella isolates from wild animals in Cornwall. Br vet J, 146, 228-232.

10. European Food Safety Authority, European Centre for Disease Prevention and Control; The European Union. 2012. Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2010. EFSA Journal, 10, 2597.

11. European Food Safety Authority and European Centre for Disease Prevention and Control. 2012. The European Union Summary Report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2010. EFSA Journal, 10, 2598.

12. Graziani C., Busani L., Dionisi A.M., Caprioli A. Ivarsson S., Hedenström I. & Luzzi I. 2011. Virulotyping of Salmonella enterica Serovar Napoli strains isolated in Italy from human and nonhuman sources. Foodborne Pathog Dis, 8, 997-1003.

13. Graziani C., Galetta P., Busani L., Dionisi A.M., Filetici E., Ricci A., Caprioli A. & Luzzi I. 2005. Infezioni da Salmonella: diagnostica, epidemiologia e sorveglianza.

Rapporti ISTISAN, 05/27, 1-49.

14. Handeland K., Nesse L.L., Lillehaug A., Vikøren T., Djønne B. & Bergsjø B. 2008. Natural and experimental Salmonella Typhimurium infections in foxes (Vulpes vulpes). Vet Microbiol, 132, 129-134.

15. Hanning I.B., Nutt J.D. & Ricke S.C. 2009. Salmonellosis outbreaks in the United States due to fresh produce:

193

Salmonella spp. e ceppi antibiotico-resistenti nei selvatici

Botti et al.

measures.

Salmonella Thompson infections linked to imported rucola lettuce. Foodborne Pathog Dis, 5, 165-173.

16. Hilbert F., Smulders F.J.M., Chopra-Dewasthaly R. & Paulsen P. 2011. Salmonella in the wildlife-human interface. Food Res Int, 45, 603-608.

22. Office International des Épizooties: OIE (World Organisation for Animal Health). 2010. Salmonellosis.

OIE Terrestrial Manual, Chapter 2.9.9.

17. Hughes L.A., Shopland S., Wigley P., Bradon H., Leatherbarrow A.H., Williams N.J., Bennet M., de Pinna E., Lawson B., Cunningham A.A. & Chantrey J. 2008.

Characterisation of Salmonella enterica serotype Typhimurium isolates from wild birds in northern England from 2005-2006. BMC Vet Res, 4, 4-13.

23. Pacini R., Quagli E., Galassi R., Tozzi E. & Malloggi L. 1994. Dieci anni di sorveglianza epidemiologica a Livorno (I parte). Studio epidemiologico sulle salmonelle isolate da portatori sani, nell’area livornese, dal 1984 al 1993. Bollettino di Microbiologia e Indagini di Laboratorio, 14, 9-14.

18. Magnino S., Frasnelli M., Fabbi M., Bianchi A., Zanoni M.G., Merialdi G., Pacciarini M.L. & Gaffuri A. 2011.

The monitoring of selected zoonotic diseases of wildlife in Lombardy and Emilia-Romagna, northern Italy. In Game meat hygiene in focus: Microbiology, epidemiology, risk analysis and quality assurance, (P. Paulsen, A. Bauer, M. Vodnansky, R. Winkelmayer & F.J.M. Smulders, eds.). Wageningen, Wageningen Academic Publishers, 223-244.

24. Reche M.P., Jiménez P.A., Alvarez F., García de los Ríos J.E., Rojas A.M. & de Pedro P. 2003. Incidence of Salmonellae in captive and wild free-living raptorial birds in central Spain. J Vet Med B, 50, 42-44.

sources and potential intervention Foodborne Pathog Dis, 6, 635-648.

19. Molina-Lopez R.A., Valverdú N., Martin M., Mateu E., Obon E., Cerdà-Cuéllar M. & Darwich L. 2011. Wild raptors as carriers of antimicrobial-resistant Salmonella and Campylobacter strains. Vet Rec, 168, 565b-567b.

20. Millán J., Aduriz G., Moreno B., Juste R.A. & Barral M. 2004. Salmonella isolates from wild birds and mammals in the Basque Country (Spain). Rev sci tech Off int Epiz, 23, 905-911.

21. Nygård K., Lassen J., Vold L., Adersson Y., Fisher I., Löfdahl S., Threlfall J., Luzzi I., Peters T., Hampton M., Torpdahl M., Kapperud G. & Aavitsland P. 2008. Outbreak of

194

25. Rotger R. & Casadesús J. 1999. The virulence plasmids of Salmonella. Internatl Microbiol, 2, 177-184.

26. Schwarz S., Kehrenberg C. & Walsh T.R. 2001. Use of antimicrobial agents in veterinary medicine and food animal production. Int J Antimicrob Agents, 17, 431-437.

27. Tizard I. 2004. Salmonellosis in Wild Birds. Semin Avian Exot Pet, 13, 50-66.

28. Vieira-Pinto M., Morais L., Caleja C., Themudo P., Torres C., Igrejas G., Poeta P. & Martins C. 2011. Salmonella sp. in game (Sus scrofa and Oryctolagus cuniculus).

Foodborne Pathog Dis, 8, 739-740.

29. Wilson J.S., Hazel S.M., Williams N.J., Phiri A., French N.P. & Hart C.A. 2003. Nontyphoidal Salmonellae in United Kingdom badgers: prevalence and spatial distribution.

Appl Environ Microbiol, 69, 4312-4315.

Veterinaria Italiana 2013, 49 (2), 187-194. doi: 10.12834/VetIt.2013.492.193.200

Salmonella spp. and antibiotic-resistant strains in wild mammals and birds in north-western Italy from 2002 to 2010 Velca Botti, Francine Valérie Navillod, Lorenzo Domenis, Riccardo Orusa, Erika Pepe, Serena Robetto & Cristina Guidetti Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d’Aosta, National Reference Center for Wild Animal Diseases (Ce.R.M.A.S.), Regione Amérique 7/G, 11020 Quart, Italy cristina.guidetti@izsto.it

Keywords Antibiotic-resistance, North-western Italy, Salmonella, Tetracycline, Wildlife.

Summary Salmonella is an important zoonotic pathogen of economic importance. In Europe, salmonellosis is the second food-borne infection, in Italy, Salmonella is still the major cause of food-borne outbreaks. In Europe, there are many Salmonella surveillance plans on farmed animals, while Salmonella survey of wild animals is occasionally performed. The aim of this study was to investigate the presence of Salmonella including the antibiotic-resistant strains in wild animals. Between 2002 and 2010, 2,713 wild animals (canids, mustelids, birds, rodents, ungulates), were collected in north-western Italy and tested for Salmonella by classical microbiological culture method followed by serological and biochemical typing.

One hundred and seventeen wild animals (63 canids, 25 mustelids, 24 birds, 5 ungulates) were found positive for Salmonella (4.3%). One hundred and thirty strains, belonging to several serotypes were isolated, and S. Typhimurium was the most common serotype found.

Antibiotic susceptibility was tested by disk-diffusion test on 88 strains. Almost all the analyzed strains (97.7%) showed resistance/intermediate resistance to at least one class of antibiotics and the highest resistance values were observed for the tetracycline class. In conclusion, zoonotic and antibiotic-resistant serotypes were found in many species of wildlife.

Veterinaria Italiana 2013, 49 (2), 195-202. doi: 10.12834/VetIt.2013.492.201.208

Introduction Salmonella is a zoonotic bacterium of public health significance, with considerable economic impact (19). Salmonellosis is one of the most common and widely distributed food-borne diseases. It is noteworthy that in Europe, Salmonellosis is the second food-borne disease after campylobacteriosis.

In 2010, the European Food Safety Authority (EFSA) reported 99,020 cases of human salmonellosis from 27 EU Members States including 2,730 cases in Italy. In our country Salmonella is still the major cause of food-borne outbreaks (10). The genus Salmonella consists of two species: S. enterica and S. bongori (22). The first one includes 6 subspecies (subsp.): enterica, salamae, arizonae, diarizonae, houtenae, and indica. There are over 2,500 serotypes of zoonotic Salmonella, most belonging to the subspecies enterica.

Salmonella resides in a variety of different hosts: in farmed and domestic animals but also in wild and exotic fauna, including reptiles. Several European Countries endorse Salmonella surveillance plans on

farmed animals. In this respect it is noteworthy that in 2009 the great majority of strains was collected from poultry (45.7%), swine (16.02%), and turkey (4.14%) (3). Conversely, Salmonella survey in wild animals is not regulated by national monitoring plans and it is only occasionally performed for research purpose.

Several studies have been performed on wild birds (17, 27), however few reports are available on the presence of Salmonella in wild mammals.

This study aimed to investigate the presence of Salmonella including antibiotic-resistant strains in wild animals (canids, mustelids, wild birds, rodents, and ungulates) in north-western Italy.

Material and methods Sample collection Between January 2002 and December 2010, 2,713 wild animals (1,222 canids, 221 mustelids, 1,101 wild birds, 100 rodents, 69 ungulates) were collected in north-western Italy (Valle d’Aosta,

195

Salmonella spp. and antibiotic-resistant strains in wildlife

Table I. List of sampled animals.

Canids Mustelids

Family Canidae Mustelidae

Wild birds

Accipitridae

Ardeidae Columbidae Corvidae

Cuculidae Falconidae

Fringillidae Laridae Passeridae Picidae Scolopacidae Strigidae

Rodents

Ungulates

Sturnidae Tetraonidae Turdidae Tytonidae Cricetidae Myocastoridae Muridae Soricidae Cervidae Suidae

Genus/species (common name) Vulpes vulpes (red fox) Meles meles (badger) Martes martes (stone marten) Martes foina (marten) Mustela putorius (polecat) Accipiter gentilis (goshawk) Accipiter nisus (sparrowhawk) Aquila chrysaetos (golden eagle) Buteo buteo (common buzzard) Circaetus gallicus (short-toed snake-eagle) Nycticorax nycticorax (black-crowned night heron) Columba livia (common pigeon) Garrulus glandarius (eurasian jay) Corvus corone (carrion crow) Pica pica (magpie) Cuculus canorus (cuckoo) Falco peregrinus (peregrine falcon) Falco spp. (hawk) Falco tinnunculus (common kestrel) Pernis apivorus (honey buzzard) Fringilla coelebs (chaffinch) Larus spp. (seagull) Passer domesticus (house sparrow) Picus viridis (green woodpecker) Scolopax rusticola (woodcock) Asio otus (long-eared owl) Bubo bubo (eagle-owl) Otus scops (scops owl) Strix aluco (tawny owl) Sturnus vulgaris (european starling) Tetrao tetrix (black grouse) Turdus merula (blackbird) Tyto alba (barn owl) Clethrionomys glareolus (bank vole) Myocastor coypus (nutria) Apodemus spp. (field mouse) Sorex spp. (shrew) Cervus elaphus (red deer) Sus scrofa (wild boar)

Piemonte and Liguria regions) and tested for Salmonella spp. (Table I). The animals were mostly found dead (usually for a trauma or following a car accident); some of them were hunted for provincial or regional control plans; in fewer cases, the animals were admitted to wildlife rehabilitation centres.

Dead animals, delivered to our laboratory, were submitted to a complete necropsy and the sampling

196

Botti et al.

of mesenteric lymph nodes, faeces and viscera was performed for a total of 3,862 biological samples.

In particular 927 red foxes (Vulpes vulpes) and 146 mustelids were sampled both for faeces and lymph nodes. A cloacal swab was generally collected from live animals.

Isolation and identification of Salmonella All samples were homogenized in a Stomacher blender. After incubation in Buffered Peptone Water for 18 hours, three enrichment broths Selenite Cystine, Rappaport-Vassiliadis, and Mueller Kauffman Tetrathionate - were inoculated and incubated for 24 hours; 10 µl of each broth were inoculated onto 2 plates of selective media, Brilliant Green Agar and Xylose Lysine Deoxycholate agar.

The plates were incubated for 24 hours at 37°C. Suspected colonies were transferred on Triple Sugar Iron for a first identification of Enterobacteriaceae, based on sugar fermentation and H2S production.

The presumptive Salmonellae were confirmed with biochemical (API 20E®) and serological tests.

Monovalent antisera have been deployed for the identification of the serotypes. S. Typhimurium and S. Enteritidis were phage typed by the Centro di Referenza Nazionale per le Salmonellosi, Italy, according to standard methods.

Antimicrobial susceptibility testing The antibiotic susceptibility was tested using disk‑diffusion test (Kirby-Bauer Method), performed on Mueller-Hinton agar from a bacterial suspension of turbidity equal to McFarland 0.5. The interpretation was made according to the criteria provided by the Clinical Laboratory Standard Institute (4).

Antibiotics tested in this study are representative of different classes: β-lactams, tetracyclines, quinolones, aminoglycosides, sulphonamides, polypeptides, and phenicols. These molecules were selected for their relevance to public health and taking into account the EFSA guidance (11), the network Enter-net Italy (5), and the available literature. The antibiotics tested and their concentrations are shown in Table II.

Results Strains of Salmonella One hundred and seventeen wild animals (63 canids, 25 mustelids, 24 wild birds, 5 ungulates) were found positive for Salmonella (4.3%). None of them showed clinical symptoms or pathological lesions related to salmonellosis. The positivity frequency was: 5.2%

Veterinaria Italiana 2013, 49 (2), 195-202. doi: 10.12834/VetIt.2013.492.201.208

Botti et al.

Salmonella spp. and antibiotic-resistant strains in wildlife

Table II. Antibiotic susceptibility (Kirby-Bauer Method), number and percentage of resistant/intermediate resistant strains.

Antimicrobial class Aminoglycosides

β-lactams

Phenicols Polypeptides Quinolones

Sulphonamides Tetracyclines

Active molecule Amikacin Streptomycin Neomycin Gentamicin Kanamycin Ampicillin Amoxicillin + clavulanic acid Cefotaxim Cefalotin Chloramphenicol Colistin Nalidixic acid Enrofloxacin Ciprofloxacin Trimethoprim + sulfamethoxazole Oxytetracycline Tetracycline

Symbol AK S N CN K AM AMC CTX KF C CT NA ENR CIP SXT T TE

Dose (μg) 30 10 30 10 30 10 30 (20&10) 30 30 30 10 30 5 5 25 (23.75&1.25) 30 30

Antibiotic R/IR Strains Fr % (no) 0% (n=0) 46.6% (n=41) 7.9% (n=7) 0% (n=0) 4.5% (n=4) 13.6% (n=12) 7.9% (n=7) 0% (n=0) 1.0% (n=1) 1.0% (n=1) 1.0% (n=1) 3.4% (n=3) 3.4% (n=3) 0% (n=0) 1.0% (n=1) 72.3% (n=68) 81.8% (n=72)

Fr = frequency; R = resistant strain; IR = intermediate resistant strain.

Table III. Antibiotic susceptibility (Kirby-Bauer Method), number and percentage of resistant/intermediate resistant strains.

Canids Mustelids Wild birds Rodents Ungulates Animals Year Analyzed Positive Analyzed Positive Analyzed Positive Analyzed Positive Analyzed Positive Analyzed Positive (no) Fr (no) (no) Fr (no) (no) Fr (no) (no) Fr (no) (no) Fr (no) (no) Fr (no) 6.3% 15.8% 6.4% 2002 48 19 25 2 94 (n=3) (n=3) (n=6) 7.1% 22.2% 1.6% 5.6% 2003 56 27 126 4 213 (n=4) (n=6) (n=2) (n=12) 9.9% 7.0% 0.6% 2.6% 2004 142 57 545 65 2 811 (n=14) (n=4) (n=3) (n=21) 6.8% 5.7% 3.5% 3.8% 5.5% 2005 263 35 84 30 26 438 (n=18) (n=2) (n=3) (n=1) (n=24) 6.2% 21.2% 4.4% 7.0% 2006 178 33 135 8 354 (n=12) (n=7) (n=6) (n=25) 5.1% 5.9% 3.1% 4.3% 2007 175 17 131 1 324 (n=9) (n=1) (n=4) (n=14) 0.7% 14.3% 1.7% 2008 296 19 14 2 28 359 (n=2) (n=4) (n=6) 20.0% 13.9% 6.8% 2009 46 5 36 1 88 (n=1) (n=5) (n=6) 5.6% 11.1% 20.0% 9.4% 2010 18 9 5 32 (n=1) (n=1) (n=1) (n=3) 5.2% 11.3% 2.2% 7.2% 4.3% Total 1,222 221 1,101 100 69 2,713 (n=63) (n=25) (n=24) (n=5) (n=117) Fr = frequency.

(63/1,222) in canids, 11.3% (25/221) in mustelids, 2.2% (24/1,101) in wild birds, and 7.2% (5/69) in ungulates. No rodent was positive for Salmonella (Table III).

A total of 130 Salmonella strains was isolated:

Veterinaria Italiana 2013, 49 (2), 195-202. doi: 10.12834/VetIt.2013.492.201.208

2 animals showed 2 subspecies of Salmonellae in the same matrix and 11 animals, sampled both for faeces and for lymph nodes [1 marten (Martes foina), 2 badgers (Meles meles), and 8 red foxes], were positive for both matrixes (Tables IV and V).

197

Salmonella spp. and antibiotic-resistant strains in wildlife

Botti et al.

The identified Salmonella subspecies were as follows: S. enterica subsp. enterica (n=91), S. enterica subsp. houtenae (n=13), S. enterica subsp. diarizonae (n=15), S. enterica subsp. arizonae (n=5), S. enterica subsp. salamae (n=3). We also found Salmonella spp. indicated as ‘new serotype’ (n=2) and ‘untypifiable serotype’ (n=1) by the Food Safety Department (Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d’Aosta, Italy).

S. Typhimurium was the most common identified serotype and it was documented in 7 red foxes, 4 badgers, 2 common pigeons (Columba livia), 1 eurasian jay (Garrulus glandarius), 1 house sparrow (Passer domesticus), 1 common buzzard (Buteo buteo), 1 long‑eared owl (Asio otus), and 1 barn owl (Tyto alba).

The phage typing was made for 10 S. Typhimurium and the definitive bacteriophage types (DT) were DT 104, DT 12, DT 193, DT 302 and only 1 ‘untypifiable phage’. S. Enteritidis was found in 5 animals [2 red foxes, 1 short-toed snake-eagle (Circaetus gallicus), 1 tawny owl (Strix aluco), 1 seagull (Larus spp.)] from all sampling areas; in 3 cases the phage type was Table IV. Coinfection by different Salmonella strains or phage types in the same animals (4 cases).

Animal species

Faeces

Red fox Red fox

S. Typhimurium DT12 S. Veneziana S. enterica subsp. salamae AND S. Kimuenza S. enterica subsp. arizonae gr. Z:50:z4,z23:-: AND S. Enteritidis gr. D11,9,12:g,m:-: PT4

Red fox Short-toed snake-eagle

Mesenteric lymph node S. Typhimurium DT104 S. Kottbus Not tested Not tested

Table V. Salmonella presence in faeces and lymph nodes of canids and mustelids sampled for both matrixes.

Year 2002 2003 2004 2005 2006 2007 2008 2009 2010 Total

198

Salmonella in Salmonella in Salmonella in lymph node and lymph node faeces faeces Mustelids Canids Mustelids Canids Mustelids Canids 3 2 2 2 1 1 1 1 1 6 5 2 1 12 1 1 1 5 8 1 2 2 4 1 1 1 1 1 5 6 12 32 1 14

PT4. The other serotypes of S. enterica subspecies enterica are described in Table VI.

Antimicrobial resistance Eighty-eight strains were tested for antibiotic susceptibility. Almost all the analyzed strains (97.7%) showed resistance (R) / intermediate resistance (IR) to at least one class of antibiotics, with the highest resistance values observed for the tetracycline class. The percentage of resistance to individual active molecules is shown in Table II. Only 2 S. Enteritidis strains were fully antimicrobial susceptible (S). Thirty three strains were Multi Drug Resistant (MDR) showing R/IR towards 2 or more classes of antibiotics (Table VII).

Table VI. Serotypes of Salmonella enterica subspecies enterica.

Salmonella serotype Alfort Bonariensis Bredeney Braenderup Brancaster Coeln Corvallis Djugu Farsta Galiema Heidelberg Hessarek Hiduddify Infantis Kibi Kimuenza Kottbus Livingstone Loanda Massenya Mikavasima Muenchen Napoli Nordufer Ohio Strourbridge Suberu Thompson Tsevie Tshiongwe

No

Species

1 3 1 1 1 5 1 1 1 1 3 1 1 4 2 1 5 2 1 1 1 3 2 2 1 1 1 2 1 2

Veneziana

8

Wil

1

Red fox Red fox, marten Red fox Red fox Common kestrel Red fox, badger, marten Badger Red fox Common pigeon Wild boar Red fox Red fox Red fox Red fox, marten, carrion crow, red deer Red fox, marten Red fox Red fox, wild boar Red fox, scops owl Scops owl Badger Red fox Red fox, badger Badger Badger Golden eagle Black grouse Tawny owl Wild boar Common pigeon Red fox Red fox, short-toed snake-eagle, peregrine falcon Red fox

Veterinaria Italiana 2013, 49 (2), 195-202. doi: 10.12834/VetIt.2013.492.201.208

Botti et al.

Salmonella and antibiotic-resistance in north-western Italy

Table VII. Pattern of Multi Drug Resistant strains.

Serotype

Animal species

Pattern of MDR

S. Typhimurium DT 104 Red fox AM-C-S-T-TE S. Typhimurium DT 193 Long-eared owl AM-AMC-N-S-T-TE S. Typhimurium Common buzzard AM-AMC-S-T-TE Red fox AM-NA-ENR-S-TE Red fox AM-NA-ENR-S-T-TE Red fox S-T-TE S.Brancaster Common kestrel AM-AMC-NA-N-S-K-T-TE-SXT S. Heidelberg Red fox AM-AMC-T-TE S. Bredeney Red fox N-S-T-TE S. Ohio Eagle AM-AMC-S-T-TE New serotype Red fox AM-S-T-TE Untypeable Marten AM-AMC-KF-ENR-T-TE

Discussion This study analyzes the presence of Salmonella in wildlife from north-western Italy (canids, mustelids, ungulates, and wild birds).

To our knowledge this is one of the few studies analyzing several wild animal classes for the presence of Salmonella in Italy. A similar research, performed in Basque Country (20) for a shorter period of time (2001-2002), and on a lower number of animals, showed that the prevalence of Salmonella in wild mammals is comparable to that of wild birds.

Positive animals showed no signs of salmonellosis as reported in our study. However, the frequencies of positivity found in our survey in mammals and birds were lower than those reported from Millán et al. (5.8% vs 7.2% and 2.2% vs 8.5% respectively) (20).

Salmonella infection in canids was tested only in one study performed on red foxes in Norway.

Red foxes were infected with the same serovar of S. Typhimurium that caused outbreaks in Passeriformes (14). In contrast, in our work there is no correlation among strains of S. Typhimurium isolated from different animal species and there is no evidence of salmonellosis outbreaks in wild birds. Nonetheless, some serotypes of Salmonella (S. Infantis, S. Kottbus, S. Livingstone, S. Veneziana) were detected in different food chain related animals {red fox, marten, raptors [short-toed snakeeagle, scops owl (Otus scops), peregrine falcon (Falco peregrinus)] and wild boar (Sus scrofa)}.

The behaviour and the feeding habits of wild animals certainly influence the likelihood to be infected with Salmonella (9). In particular, badgers, red foxes, raptors and wild boars could acquire Salmonella by scavenging on contaminated carcasses or on different human leftover (20).

A survey on nontyphoidal Salmonellae was performed on badger social groups in the United Kingdom, revealing a high prevalence of the

Veterinaria Italiana 2013, 49 (2), 195-202. doi: 10.12834/VetIt.2013.492.201.208

bacteria (72%) (29). These results, even if apparently different, are comparable to our data, which show a high prevalence despite the low sample size.

This frequency can be explained by the biology of badgers: they are social animals that share the same setts and latrines and they have an omnivorous diet that includes a variety of food as insects, small mammals and birds.

In Italy a study (18) was conducted on wild boar, roe deer (Capreolus capreolus), red deer (Cervus elaphus), and red fox in the areas of Lombardia and Emilia Romagna in 2005-2009. Salmonella was isolated from wild boars with various prevalences (from 3.9% to 26%) depending on the geographical area of sampling. Only occasionally, the bacterium was detected in roe deer, red deer and red foxes.

Similarly to our results, the serotyping revealed the presence of S. Typhimurium, S. Napoli, S. Veneziana, S. Mishmarhaeme and, in particular, S. Thompson in wild boars.

Several studies were performed on the presence of Salmonella in wild birds. In Spain, Reche et al.

(24) quoted a prevalence of 4% in raptors, mainly S. Typhimurium DT 104. In another study, a higher Salmonella percentage (10%) is reported in wild raptors (19). In this study, a lower Salmonella positivity (2.2%) was reported in all wild birds, even if half of the isolations occurred in raptors (n=12/24).

As reported by Vieira-Pinto et al. (28) and Hilbert et al. (16), the game animals - in our study wild boars, red deer and black grouse (Tetrao tetrix) - could represent an infection source for humans, when shots in the abdomen or an incorrect evisceration might cause faecal contamination of meat intended for consumption. Another source of human infection can be represented by the incorrect manipulation of live wild animals near rehabilitation centres, especially wild birds - in our study golden eagle (Aquila chrysaetos), scops owl, common kestrel (Falco tinnunculus), tawny owl, common pigeon, long-eared owl (Asio otis), and sparrow.

All the animals sampled in this study can be considered healthy carriers of Salmonella because of the absence of pathological lesions related to salmonellosis (haemorrhagic enteritis, glaucomatous hepatitis, etc.). The majority of positive red foxes and mustelids, analyzed for two matrixes, was positive only for lymph nodes and not for faeces (n=44). Therefore these animals are Salmonella carriers but not excretory at the time of sampling. It is likely that stress factors (adverse climate conditions, nutritional deficiencies, other infectious diseases) facilitate the transfer of Salmonella into faeces, so making the animal an excretory carrier. Wildlife may be a rich reservoir of a great diversity of serotypes, most of which are not considered pathogenic. However, some genes

199

Salmonella spp. and antibiotic-resistant strains in wildlife

encoding for virulence factors, located on plasmids, can be transferred from one strain to another and they can cause an increase in the pathogenicity of serotypes (1).

Different serotypes can be present in different animal species: some of them are considered species-specific, while others are ubiquitous (13).

The presence of virulence plasmids in host‑adapted serovars suggests that horizontal virulence acquisition can have expanded the host range of Salmonella (25).

Among the Salmonella strains isolated in our study, 32% (n=41/130) is also listed in the 2002‑2009 Enter‑net Italy reports as responsible for human infections: S. Enteritidis, S. Typhimurium, S. Heidelberg, S. Muenchen, S. Thompson, S. Bredeney, S. Napoli, and S. Infantis (7, 8). In particular, S. Napoli is an emerging serovar in Italy.

A recent study (12) suggests that S. Napoli is mostly present in the environment whence it can spill over to animals and humans, even if Graziani et al. (12) do not point out a specific source of exposure for humans. Our survey indicates that badgers may be a substantial source of S. Napoli.

S. Thompson has been associated with a salmonellosis outbreak caused by rocket lettuce massively contaminated by irrigation with non‑drinkable water (21). Wild animals, in particular wild birds, might cause the contamination of vegetables crops (15) either directly with faecal material, or indirectly, with pollution of irrigation water.

In a previous study (6), performed in Valle d’Aosta region, we observed that the estimated spatial distribution of carnivores and humans infected

by Salmonella are broadly overlapping. In fact, S. Typhimurium, S. Heidelberg and S. Infantis were isolated from both of them. The overlapping can be explained by the sinantrophic behaviour of wild species that live close to residential areas and near houses, farmland, and waste dumps. The generalist diet of wild boars, badgers and foxes increases the risk to acquire Salmonella and it justifies the high diversity of serotypes (9).

The data analysis revealed the presence of widespread antimicrobial-resistant Salmonella in north-western Italy. The diffusion of zoonotic bacteria resistant to antibiotics is an important concern for the treatment of human infections, because it can compromise the effectiveness of the therapy. All EU Member States collect and analyze a variety of animal and food samples to monitor the presence of antimicrobial‑resistant zoonotic bacteria: commonly Salmonella, Campylobacter, Escherichia coli, and Enterococcus. However, a comparison of our results with previous research is not possible as the only available data about

200

Botti et al.

antimicrobial resistance in wildlife are those reported by EFSA. The antimicrobial resistance rate in wildlife, reported in the present study, was higher (97.7%) than the one indicated by the EFSA report concerning livestock (from 0.2% to 75%) (11); however, EFSA data are referred to a higher number of samples.

In our study, the highest resistance values were recorded for tetracyclines. This can be explained by the fact that this antibiotic is used in two thirds of the therapeutic regimens applied in veterinary medicine (26). In addition, in contrast with European data, our results show a complete sensitivity of strains to cefotaxime and ciprofloxacin.

Among the MDR Salmonellae, a significant case is represented by S. Brancaster isolated by a common kestrel that showed R/IR towards ampicillin, amoxicillin, clavulanic acid, nalidixic acid, neomycin, streptomycin, kanamycin, oxytetracycline, tetracycline, trimethoprim and, sulfamethoxazole.

Epidemiological information concerning this serotype is rather limited. The literature indicates two sporadic isolates: S. Brancaster in Tuscany in 1985 and 1991 from human samples (23), but without antimicrobial susceptibility data.

S. Typhimurium DT 104, considered an emerging pathogen, shows a higher number of antibiotic‑resistance than the other phage types.

So far, it is not known whether the isolates of DT 104 possess greater virulence, or whether the virulence is associated with multiple genes. If the genes for virulence were associated with the antibiotic‑resistance ones, the virulence could be selected by the use of antibiotics (2).

Massive treatments in breeding animals for therapy and prophylaxis of bacterial infections, inaccurate posology and inadequate treatment times are probable causes promoting the selection of antibiotic-resistant strains. Even the use of food supplemented with antibiotics in sub therapeutic conditions, as growth promoters, can produce bacterial resistance towards molecules already in use and those structurally and pharmacologically related (cross-resistance) (13).

Conclusions In conclusion a constant supervision of Salmonella in wildlife and its antibiotic-susceptibility is necessary to the early identification of zoonotic strains and the emergence of new resistance profiles, and to evaluate the control measures. Our findings in wildlife and the widespread Salmonellae outbreaks underline the need to better coordinate investigations between human and veterinary health and food safety organisations and networks.

Veterinaria Italiana 2013, 49 (2), 195-202. doi: 10.12834/VetIt.2013.492.201.208

Botti et al.

Salmonella and antibiotic-resistance in north-western Italy

Acknowledgements

Grant support

The authors wish to express their gratitude to Dr. Lucia Decastelli of Food Safety Department, Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d’Aosta, for identification of serotypes; Dr. Antonia Ricci of National Reference Laboratory for Salmonellosis, Istituto Zooprofilattico Sperimentale delle Venezie, for phage typing; Dr. Roberto Pellizzaro of Rehabilitation Center Valle d’Aosta and Dr. Elena Ghelfi of Parco Fluviale del Po e dell’Orba, Corpo Forestale and Ufficio Fauna Regione Autonoma Valle d’Aosta for the sampling; Dr. Cristina Banchi and Dr. Raffaella Spedicato for technical and analytical support.

This project was partially funded by Italian Ministry of Health - research project PLV 25/07 RC ‘Epidemiosorveglianza in CRAS e CRASE: monitoraggio sanitario di rapaci e passeriformi per la messa a punto di un sistema di prevenzione verso alcune zoonosi (infezione da Chlamydia e Salmonella, influenza aviaria, Newcastle disease e West Nile disease) e parassitosi della avifauna selvatica’ and research project IZS PLV 009/00 ‘Valutazione sulla presenza di alcune patologie nella volpe e nei mustelidi con possibili ripercussioni sulla salute dell’uomo e degli animali domestici’.

References 1. Boyd E.F. & Hartl D.L. 1997. Recent horizontal transmission of plasmids between natural populations of E. coli and Salmonella enterica. J Bacteriol, 179, 1622-1627.

2. Briggs C.E. & Fratamico P.M. 1999. Molecular characterization of an antibiotic resistance gene cluster of Salmonella typhimurium DT104. Antimicrob Agents Chemother, 43, 846-849.

3. Centro di Referenza Nazionale per le Salmonellosi.

2011. Enter-Vet Report 2009. (http://www. izsvenezie.it/images/stories/Pdf/Salmonelle/report_ entervet_2009new.pdf accessed on 24 October 2012).

4. Clinical Laboratory Standard Institute. 2008.

Performance Standards for Antimicrobial Disk and Dilution Susceptibility Test for Bacteria Isolated From Animals, Approved Standard. 3rd Ed. CLSI document M31-A3. Wayne, PA, 99 p.

5. Dionisi A.M., Filetici E., Ocwzarek S., Arena S., Benedetti I., Lucarelli C., Luzzi I., Scavia G., Minelli F., Ciaravino G., Marziano M.L., Caprioli A. & Italy Enter-net Laboratories. 2011. ENTER-NET: Sorveglianza delle infezioni trasmesse da alimenti e acqua. Rapporto dell’attività 2007-2009. Not Ist Super Sanità, 24, 3-10.

6. Domenis L., Orusa R., Lo Valvo T., Balestrieri A., Ferrari A. & Robetto S. 2004. Wild carnivores as bioindicators of Salmonella sp. infections in Aosta Valley-preliminary results. Abstract Book of The Sixth Conference of the European Wildlife Disease Association TSE and CWD Workshop, 68 p.

7. Enter-net Italia a. Sorveglianza delle infezioni da Salmonella. Dati storici dal 2000 al 2006. (http:// www.iss.it/binary/salm/cont/4.e%20%20Dati%20 SALMONELLA%202000-2006.1206455668.pdf accessed on 24 October 2012).

8. Enter-net Italia b. Sorveglianza delle infezioni da Salmonella. Dati storici dal 2007 al 2009. (http://www.iss. it/binary/ente/cont/4f_Dati_SALMONELLA_2007_2009. pdf accessed on 24 October 2012).

9. Euden P.R. 1990. Salmonella isolates from wild animals in Cornwall. Br vet J, 146, 228-232.

Veterinaria Italiana 2013, 49 (2), 195-202. doi: 10.12834/VetIt.2013.492.201.208

10. European Food Safety Authority, European Centre for Disease Prevention and Control; The European Union. 2012. Summary Report on Trends and Sources of Zoonoses, Zoonotic Agents and Food-borne Outbreaks in 2010. EFSA Journal, 10, 2597.

11. European Food Safety Authority and European Centre for Disease Prevention and Control. 2012. The European Union Summary Report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2010. EFSA Journal, 10, 2598.

12. Graziani C., Busani L., Dionisi A.M., Caprioli A. Ivarsson S., Hedenström I. & Luzzi I. 2011. Virulotyping of Salmonella enterica Serovar Napoli strains isolated in Italy from human and nonhuman sources. Foodborne Pathog Dis, 8, 997-1003.

13. Graziani C., Galetta P., Busani L., Dionisi A.M., Filetici E., Ricci A., Caprioli A. & Luzzi I. 2005. Infezioni da Salmonella: diagnostica, epidemiologia e sorveglianza.

Rapporti ISTISAN, 05/27, 1-49.

14. Handeland K., Nesse L.L., Lillehaug A., Vikøren T., Djønne B. & Bergsjø B. 2008. Natural and experimental Salmonella Typhimurium infections in foxes (Vulpes vulpes). Vet Microbiol, 132, 129-134.

15. Hanning I.B., Nutt J.D. & Ricke S.C. 2009. Salmonellosis outbreaks in the United States due to fresh produce: sources and potential intervention measures.

Foodborne Pathog Dis, 6, 635-648.

16. Hilbert F., Smulders F.J.M., Chopra-Dewasthaly R. & Paulsen P. 2011. Salmonella in the wildlife-human interface. Food Res Int, 45, 603-608.

17. Hughes L.A., Shopland S., Wigley P., Bradon H., Leatherbarrow A.H., Williams N.J., Bennet M., de Pinna E., Lawson B., Cunningham A.A. & Chantrey J. 2008.

Characterisation of Salmonella enterica serotype Typhimurium isolates from wild birds in northern England from 2005-2006. BMC Vet Res, 4, 4-13.

18. Magnino S., Frasnelli M., Fabbi M., Bianchi A., Zanoni M.G., Merialdi G., Pacciarini M.L. & Gaffuri A. 2011.

The monitoring of selected zoonotic diseases of

201

Salmonella spp. and antibiotic-resistant strains in wildlife

wildlife in Lombardy and Emilia-Romagna, northern Italy. In Game meat hygiene in focus: Microbiology, epidemiology, risk analysis and quality assurance, (P. Paulsen, A. Bauer, M. Vodnansky, R. Winkelmayer & F.J.M. Smulders, eds.). Wageningen, Wageningen Academic Publishers, 223-244.

19. Molina-Lopez R.A., Valverdú N., Martin M., Mateu E., Obon E., Cerdà-Cuéllar M. & Darwich L. 2011. Wild raptors as carriers of antimicrobial-resistant Salmonella and Campylobacter strains. Vet Rec, 168, 565b-567b.

20. Millán J., Aduriz G., Moreno B., Juste R.A. & Barral M. 2004. Salmonella isolates from wild birds and mammals in the Basque Country (Spain). Rev sci tech Off int Epiz, 23, 905-911.

21. Nygård K., Lassen J., Vold L., Adersson Y., Fisher I., Löfdahl S., Threlfall J., Luzzi I., Peters T., Hampton M., Torpdahl M., Kapperud G. & Aavitsland P. 2008. Outbreak of Salmonella Thompson infections linked to imported rucola lettuce. Foodborne Pathog Dis, 5, 165-173.

22. Office International des Épizooties: OIE (World Organisation for Animal Health). 2010. Salmonellosis.

OIE Terrestrial Manual, Chapter 2.9.9.

23. Pacini R., Quagli E., Galassi R., Tozzi E. & Malloggi L. 1994. Dieci anni di sorveglianza epidemiologica

202

Botti et al.

a Livorno (I parte). Studio epidemiologico sulle salmonelle isolate da portatori sani, nell’area livornese, dal 1984 al 1993. Bollettino di Microbiologia e Indagini di Laboratorio, 14, 9-14.

24. Reche M.P., Jiménez P.A., Alvarez F., García de los Ríos J.E., Rojas A.M. & de Pedro P. 2003. Incidence of Salmonellae in captive and wild free-living raptorial birds in central Spain. J Vet Med B, 50, 42-44.

25. Rotger R. & Casadesús J. 1999. The virulence plasmids of Salmonella. Internatl Microbiol, 2, 177-184.

26. Schwarz S., Kehrenberg C. & Walsh T.R. 2001. Use of antimicrobial agents in veterinary medicine and food animal production. Int J Antimicrob Agents, 17, 431-437.

27. Tizard I. 2004. Salmonellosis in Wild Birds. Semin Avian Exot Pet, 13, 50-66.

28. Vieira-Pinto M., Morais L., Caleja C., Themudo P., Torres C., Igrejas G., Poeta P. & Martins C. 2011. Salmonella sp. in game (Sus scrofa and Oryctolagus cuniculus).

Foodborne Pathog Dis, 8, 739-740.

29. Wilson J.S., Hazel S.M., Williams N.J., Phiri A., French N.P. & Hart C.A. 2003. Nontyphoidal Salmonellae in United Kingdom badgers: prevalence and spatial distribution.

Appl Environ Microbiol, 69, 4312-4315.

Veterinaria Italiana 2013, 49 (2), 195-202. doi: 10.12834/VetIt.2013.492.201.208

Grado di cheratinizzazione dell’epitelio ruminale e valutazione dello stato corporeo in ovini tenuti su pascoli di Brachypodium rupestre Paola Scocco1, Francesca Mercati2, Andrea Brusaferro1, Piero Ceccarelli2, Carlo Belardinelli3, Alessandro Malfatti1 Scuola di Scienze Ambientali, Università di Camerino, Via Gentile III da Varano, 62032 Camerino, Italia paola.scocco@unicam.it 2 Dipartimento di Scienze Biopatologiche e Igiene delle produzioni animali e alimentari, Università di Perugia, Via S. Costanzo 4, 06126 Perugia, Italia 3 Igiene degli alimenti di origine animale, Servizio Veterinario AV3-ASUR Marche, Viale E. Betti 15/A, 62032 Camerino, Italia 1

Parole chiave Brachypodium rupestre, Cheratinizzazione ruminale, Ovini, Prevenzione incendi boschivi, Valutazione dello stato corporeo (BCS).

Riassunto L’articolo valuta e mette in correlazione i cambiamenti del grado di cheratinizzazione della mucosa ruminale con lo stato corporeo di ovini tenuti a pascolare per 20 giorni in un’area ad elevata copertura di paléo rupestre (Brachypodium rupestre). Il pascolo degli ovini in queste aree riduce il rischio di incendi boschivi. Tuttavia, l’assunzione di Brachypodium rupestre protratta per lunghi periodi può compromettere la salute generale degli animali.

Lo scopo di questo studio è di determinare il periodo massimo di permanenza degli animali in queste aree. Ovini mantenuti su un pascolo semi-mesofilo sono stati utilizzati come gruppo di controllo. Nei giorni 1, 10 e 20 della sperimentazione, 5 animali di ogni gruppo sono stati sacrificati per la valutazione delle modificazioni del grado di cheratinizzazione dell’epitelio dell’atrio e del sacco ventrale del rumine. La valutazione dello stato corporeo, o body condition score (BCS), e il peso vivo (PV) sono stati monitorati su altri 10 soggetti per gruppo. Il gruppo di controllo ha mostrato piccole variazioni del grado di cheratinizzazione del rumine che non hanno inciso negativamente sul BCS o sul PV. Il gruppo sperimentale ha mostrato un significativo incremento del grado di cheratinizzazione, già entro i primi dieci giorni, che ha portato ad un graduale abbassamento del BCS e ad un calo di peso tra il decimo e il ventesimo giorno. I dati ottenuti suggeriscono che al fine della prevenzione degli incendi boschivi gli ovini dovrebbero essere utilizzati a turno con periodi di permanenza nei pascoli ad alta copertura di Brachypodium rupestre non superiori ai 10-12 giorni.

Veterinaria Italiana 2013, 49 (2), 203-209. doi: 10.12834/VetIt.2013.492.203.209

Introduzione L’Unione Europea, oltre a promuovere e salvaguardare il benessere animale, sostiene ricerche finalizzate all’utilizzo di animali domestici per la prevenzione degli incendi boschivi (Regolamento CE 1782/2003). La presenza di necromassa nelle zone ecotonali tra bosco e pascolo, spesso caratterizzate da una densa copertura di Brachypodium rupestre, è una potenziale esca per lo sviluppo di incendi boschivi. Questa pianta erbacea, piuttosto alta, è poco appetita dagli ovini per le foglie molto fibrose e ricche di silicati (17). Tuttavia, pecore tenute in recinti in aree densamente coperte da Brachypodium rupestre tendono a sfruttare tutta la risorsa foraggera di cui dispongono e in questo modo rimuovono una possibile causa di innesco di incendio.

Se il Brachypodium rupestre non viene brucato ten-

de a diffondersi nella prateria, limitando la crescita, la riproduzione (sessuale e vegetativa) e la dispersione di specie più appetibili (4, 10, 12, 19). Questa evenienza provoca la modificazione della composizione floristica del pascolo che può portare ad uno squilibrio ecologico che abbassa il valore e la biodiversità del pascolo stesso (1, 2, 7). Le praterie primarie delle montagne dell’Appennino italiano sono ricomprese all’interno di siti di importanza comunitaria (SIC) o di zone di protezione speciale (ZPS) (8). Ciò rende necessario limitare la dispersione di specie invasive che possano incidere negativamente sulla biodiversità di questi territori.

Gli allevatori che conducono le loro greggi al pascolo su aree ad elevato rischio di incendio possono usufruire di incentivi pubblici per la prevenzione degli stessi e a sostegno della zootecnia attraverso le opportunità offerte dalla Politica Agricola Comu-

203

Effetto del Brachypodium rupestre su cheratinizzazione della mucosa ruminale e BCS

nitaria (9) in relazione all’utilizzo delle best practices finalizzate alla conservazione della biodiversità e al rispetto del benessere animale.

In questo studio sono stati valutati il grado di cheratinizzazione della mucosa ruminale, mediante microscopia ottica, e i cambiamenti dello stato corporeo, basati sull’andamento del body condition score (BCS) e del peso vivo (PV), di ovini alimentati su pascolo a elevata copertura di Brachypodium rupestre nel tentativo di prevenire gli incendi boschivi. Lo scopo di questo studio è di quantificare il periodo in cui gli animali possono permanere in questo tipo di pascolo senza che il loro benessere sia influenzato negativamente.

Materiali e Metodi Piano sperimentale La sperimentazione è stata effettuata durante il mese di ottobre 2009 utilizzando 50 pecore (razza comisana x razza appenninica) di un anno di età. Tutti gli animali, nullipari, sono stati mantenuti senza arieti. Di questi, 25 pecore (gruppo sperimentale) sono state

Scocco et al.

tenute per 4 giorni su un pascolo con scarsa copertura di Brachypodium rupestre (30%) e successivamente per 20 giorni trasferiti su terreno con elevata copertura (60%) di paléo rupestre. Un secondo gruppo costituito dalle restanti 25 pecore è stato tenuto su un pascolo naturale semi-mesofilo (gruppo di controllo) (5). In entrambi i gruppi, 10 pecore sono state utilizzate per la valutazione del BCS e del PV. Altre cinque pecore sono state sacrificate all’inizio dell’esperimento e dopo 10 e 20 giorni di alimentazione nei rispettivi pascoli (giorni: 1, 10 e 20). La distribuzione nei gruppi è stata equilibrata per BCS e PV iniziali.

Su tutti gli animali sono stati effettuati controlli clinici di routine per monitorare lo stato di salute, tra cui osservazioni macroscopiche dirette di labbra, lingua e mucose buccali al fine di evidenziare la presenza di eventuali macrolesioni.

Valutazione morfologica della mucosa ruminale Le macellazioni sono avvenute presso il mattatoio pubblico di Visso (Macerata). I campioni prelevati

Figura 1. Misurazione del grado di cheratinizzazione. Nell’immagine a sinistra, il quadrato delimita un campo selezionato per le misurazioni, l’immagine a destra ne presenta l’ingrandimento. Sono indicate l’altezza totale dello strato epiteliale e quella degli strati nucleati.

204

Veterinaria Italiana 2013, 49 (2), 203-209. doi: 10.12834/VetIt.2013.492.203.209

Scocco et al.

Effetto del Brachypodium rupestre su cheratinizzazione della mucosa ruminale e BCS

dalla parete dell’atrio e del sacco ventrale del rumine sono stati fissati in soluzione di Bouin e inclusi in paraffina.

Per valutare lo strato di cheratina sono state eseguite valutazioni morfologiche su sezioni tissutali dello spessore di 5µm, sottoposte alle seguenti colorazioni: ematossilina/eosina, tricromica di Mallory, floxina B/orange G/alcian blue (16). Per evitare variazioni di colorazione dovute a differenze di temperatura o incubazione, tutti i campioni sono stati processati insieme durante ogni fase della procedura.

Per valutare modificazioni o danni della mucosa del rumine causati da Brachypodium rupestre, le sezioni sono state osservate al microscopio ottico (Eclipse E800, Nikon Corporation, Tokyo, Giappone) e fotografate con fotocamera digitale (Dxm 1200, Nikon Corporation, Tokio, Giappone). Le immagini sono state in seguito impiegate per valutare lo strato di cheratina. È stata misurata l’altezza totale dell’epitelio e quella degli strati nucleati. L’altezza dello strato di cheratina è stata calcolata come differenza. I valori ottenuti sono stati successivamente convertiti in percentuale in relazione all’altezza totale del rivestimento epiteliale. Per ciascun animale sono stati selezionati otto campi di 0,35x0,27 mm. In ogni campo sono state effettuate cinque misurazioni (Figura 1).

Le immagini sono state elaborate con un software di analisi dell’immagine (Lucia Measurement, Laboratory Imaging Ltd, Praga, Repubblica Ceca).

Stato corporeo Gli animali sono stati pesati nei giorni 1, 10 e 20 con bilancia elettronica (Kruuse PS250) e sottoposti a valutazione del BCS. Tale parametro è una stima complessiva dello stato corporeo dell’animale sulla base di proporzioni relative di muscoli e grasso ed è considerato un mezzo utile per valutare il benessere negli animali domestici (3, 11). Negli ovini, la valutazione si basa sui seguenti punti: palpazione dei processi spinosi delle vertebre toraciche e dei processi trasversi delle vertebre lombari, valutazione della massa muscolare/adiposa nella regione dorso-mediale, valutazione dello stato generale dell’animale.

Ciascun animale è stato classificato mediante scala numerica (0-5, con graduazioni di 0,5) considerando il confronto con animali e strutture del corpo descritti e illustrati in una tabella di riferimento. Il valore del BCS è risultato dalla media di tutti i punteggi assegnati a ciascuno dei quattro parametri. In questo studio gli animali sono stati valutati da cinque operatori esperti.

Figura 2. Papilla dell’atrio del rumine colorata con ematossilina/eosina. All’inizio dell’esperimento numerosi e ampi vasi sanguigni () sono presenti sotto l’epitelio e nella zona profonda della tonaca propria-sottomucosa della papilla del rumine. Al giorno 10 (inserto a sinistra), il numero e il calibro dei vasi () è diminuito. Alla fine del periodo sperimentale (inserto a destra), sono presenti solamente pochi e piccoli vasi () nella zona profonda del tessuto connettivo.

Veterinaria Italiana 2013, 49 (2), 203-209. doi: 10.12834/VetIt.2013.492.203.209

205

Effetto del Brachypodium rupestre su cheratinizzazione della mucosa ruminale e BCS

Analisi statistica

Scocco et al.

ha presentato un considerevole aumento del grado di cheratinizzazione dell’epitelio e una riduzione del numero e del calibro dei vasi nel gruppo sperimentale, come mostrato in Figura 2. Nel gruppo di controllo, il grado di cheratinizzazione è risultato leggermente aumentato, non sono state evidenziate differenze apprezzabili del numero e del calibro dei vasi.

Per confrontare la differenza tra gruppo di controllo e gruppo sperimentale è stata utilizzata l’analisi della varianza (one-way). I dati inter-gruppo sono stati considerati come campioni provenienti da popolazioni normali con la stessa varianza. Per verificare queste ipotesi, sono stati utilizzati il test di ShapiroWilk per la normalità e il test di Levene per l’omogeneità. Quando queste condizioni non sono risultate soddisfatte è stato applicato il test non parametrico di Mann-Witney (20). Le analisi sono state effettuate utilizzando il software SPSS PC 8,0.

I livelli di cheratina, misurati nei due comparti del rumine nei tre differenti momenti della sperimentazione, sono riassunti in Tabella I e mostrati nelle Figure 3 e 4. Nel gruppo sperimentale, la percentuale di cheratinizzazione nell’atrio è aumentata dal 17,2% al 31,7%, nel sacco ventrale è salita dal 20,0% al 37,3%.

Nel gruppo di controllo la percentuale di cheratinizzazione è passata dal 17,0% al 19,5% a livello dell’atrio e dal 20,2% al 22,1% nel sacco ventrale.

Risultati Durante la sperimentazione, gli animali del gruppo di controllo e del gruppo sperimentale non hanno presentato problemi clinici e non hanno evidenziato lesioni macroscopiche a livello di labbra, lingua o mucosa buccale. La microscopia ottica non ha evidenziato microlesioni nella mucosa dell’atrio e del sacco ventrale del rumine.

All’inizio dell’esperimento le differenze della percentuale di cheratinizzazione dell’atrio e del sacco ventrale del rumine tra il gruppo di controllo e il gruppo sperimentale non sono risultate significative. Al giorno 10 e 20, la percentuale di cheratinizzazione tra i due gruppi ha mostrato differenze significative sia a livello dell’atrio (P<0,001) che del sacco ventrale del rumine (P<0,001).

All’osservazione morfologica, la mucosa del rumine

Tabella I. Valori medi di cheratinizzazione (in percentuale) del PV (kg) e del BCS in pecore mantenute su pascolo a Brachypodium rupestre (gruppo sperimentale) o semi-mesofilo (gruppo di controllo).

Cheratina (%)

PW (kg)

Giorni

P

Gruppo di controllo

Gruppo sperimentale

P

Gruppo di controllo

Gruppo sperimentale

P

Gruppo di controllo

Gruppo sperimentale

P

1 10 20

17,0 19,2 19,5

17,2 30,9 31,7

0,4030 0,0001 0,0001

20,2 21,7 22,1

20,0 32,9 37,3

0,5790 0,0001 0,0001

50,63 51,65 51,25

50,83 51,66 49,04

0,924 0,994 0,230

2,72 2,67 2,59

2,75 2,05 1,65

0,8060 0,0030 0,0001

35

**

Gruppo controllo

**

Gruppo sperimentale

30 25 20 15 10 5 0

45

Percentuale di cheratinizzazione

Percentuale di cheratinizzazione

40

40

10

20

Figura 3. Percentuale media di cheratina (±SD) nell’epitelio dell’atrio del rumine nel gruppo di controllo e nel gruppo sperimentale ai giorni 1, 10 e 20. (** P = 0,0001 rispetto al gruppo controllo).

**

Gruppo controllo

**

Gruppo sperimentale

35 30 25 20 15 10 5 0

1

Giorni dall’inizio della prova

206

BCS

Gruppo sperimentale

Sacco ventrale

Gruppo di controllo

Atrio

1

10

20

Giorni dall’inizio della prova

Figura 4. Percentuale media di cheratina (±SD) nell’epitelio del sacco ventrale del rumine nel gruppo di controllo e nel gruppo sperimentale ai giorni 1, 10 e 20. (** P = 0,0001 rispetto al gruppo controllo).

Veterinaria Italiana 2013, 49 (2), 203-209. doi: 10.12834/VetIt.2013.492.203.209

Effetto del Brachypodium rupestre su cheratinizzazione della mucosa ruminale e BCS

54

3,1

53

2,9 2,7

52

BCS (punti)

Peso vivo (kg)

Scocco et al.

51 50 49 48 47

*

**

10

20

2,5 2,3 2,1 1,9

Gruppo controllo

1,7

Gruppo sperimentale

1

Gruppo controllo Gruppo sperimentale

1,5

10

20

Giorni dall’inizio della prova

Figura 5. Variazioni della media del peso corporeo (±SD) nel gruppo di controllo e nel gruppo sperimentale ai giorni 1, 10 e 20.

Le variazioni del PV del gruppo di controllo e del gruppo sperimentale sono indicate nella Tabella I e mostrate nella Figura 5. Una considerevole riduzione del PV è stata osservata durante il secondo periodo di pascolo su terreno densamente coperto a Brachypodium rupestre. Gli animali hanno presentato un decremento totale medio del PV di 1,79 kg.

Nel gruppo di controllo il PV è aumentato di 0,62 kg nonostante si sia verificata una leggera riduzione durante il secondo periodo di pascolo. L’analisi della varianza non ha mostrato differenze significative tra il gruppo di controllo e quello sperimentale in nessuno dei momenti di valutazione (Tabella I).

Le variazioni del BCS del gruppo di controllo e del gruppo sperimentale sono indicate nella Tabella I e mostrate nella Figura 6. Le pecore che hanno pascolato su Brachypodium rupestre hanno mostrato una riduzione del BCS (-0,62) al giorno 10 e ulteriore (-1,19) dopo 20 giorni. Nel gruppo di controllo il BCS è risultato diminuito leggermente (-0,13) al giorno 20. All’inizio della prova non sono state rilevate differenze significative del BCS medio tra il gruppo di controllo e quello sperimentale. Al giorno 10 è stata evidenziata una differenza significativa (P=0,003) aumentata dopo 20 giorni (P<0,001).

Discussione Durante la sperimentazione tra il gruppo di controllo e quello sperimentale sono state osservate differenze significative della cheratinizzazione della mucosa ruminale e del BCS, mentre le modificazioni del PV non sono state significativamente diverse.

Sebbene il decremento medio di 1,79 kg del PV non sia statisticamente significativo dovrebbe, comunque, essere tenuto in considerazione dal punto di vista della perdita economica per l’allevatore. Gli animali del gruppo di controllo hanno mostrato un lieve calo del PV alla fine del periodo sperimentale

Veterinaria Italiana 2013, 49 (2), 203-209. doi: 10.12834/VetIt.2013.492.203.209

1

Giorni dall’inizio della prova

Figura 6. Andamento del BCS medio (±SD) durante il periodo sperimentale ai giorni 1, 10 e 20. (*P = 0,003 rispetto al gruppo di controllo; **P = 0,0001 rispetto al gruppo di controllo). legato, probabilmente, al minor valore nutrizionale delle specie vegetali disponibili, dopo la selezione operata durante i primi 10 giorni di pascolo (21) e alle modificazioni della composizione chimica delle piante, dovute all’incremento dei contenuti in cellulosa e lignina (10).

Il maggior incremento nella cheratinizzazione è stato osservato a carico del sacco ventrale del rumine.

La presenza di materiale coriaceo e fibroso nella massa ingesta, che rimane a lungo nel sacco ventrale, può spiegare le differenze nella cheratinizzazione in quanto il contatto diretto con la parete del prestomaco può indurre uno stress meccanico. Dopo soli 10 giorni di pascolo in parcelle a densa copertura di Brachypodium rupestre, è stato osservato un alto grado di cheratinizzazione sia nell’atrio (30,9%) che nel sacco ventrale (32,9%).

La permanenza in parcelle a densa copertura di Brachypodium rupestre ha inciso già dopo 10 giorni anche sullo stato corporeo degli animali: le modificazioni del BCS sono considerate un indicatore più sensibile, rispetto ai cambiamenti del PV, dello stato nutrizionale degli animali. Il PV include, infatti, anche il peso del contenuto gastrointestinale (3).

Le modificazioni del PV possono indurre una sotto o sovra-stima del benessere dell’animale in quanto una relativa scarsità di nutrienti può essere legata ad una assoluta scarsità di cibo come pure ad una assunzione di risorse trofiche inadeguate, portando sia ad una perdita che ad un aumento del PV, spingendo gli animali a sovralimentarsi nel tentativo di soddisfare i propri fabbisogni.

La valutazione del BCS è un metodo semplice e non costoso che permette di stimare lo stato corporeo e avere una indicazione della direzione (e, con una certa approssimazione, il tasso di variazione) dei processi metabolici primari, sia anabolici che catabolici.

L’affidabilità del BCS è confermata dal confronto con parametri ematici endocrini e metabolici (3).

207

Effetto del Brachypodium rupestre su cheratinizzazione della mucosa ruminale e BCS

Un recente studio ha dimostrato che le variazioni della mucosa del sacco ventrale del rumine sono correlate al ciclo vegetativo del pascolo (6), analogamente, durante il ciclo vegetativo del pascolo le modificazioni del BCS sono correlate alle variazioni morfometriche della mucosa ruminale. Il grado di cheratinizzazione dell’epitelio nel sacco ventrale e nell’atrio del rumine ha mostrato valori medi più alti quando il BCS medio è risultato basso, in relazione al periodo di secchezza del pascolo durante il ciclo vegetativo del 2007, anno da considerare siccitoso. Il minor grado di cheratinizzazione si è avuto in corrispondenza del periodo di fioritura del 2008, anno piuttosto piovoso, che ha fatto registrare il BCS medio più alto (6). Il BCS diminuisce quando è bassa la qualità e/o la quantità delle risorsa foraggera, situazione che induce una diminuzione dell’estensione della superficie assorbente del rumine e, quindi, l’assorbimento degli acidi grassi volatili (14, 18). La capacità assorbente, facilitata dalla riduzione degli strati epiteliali (13), è ridotta dall’incremento della cheratinizzazione della mucosa. La probabile riduzione della funzione assorbente nelle pecore utilizzate in questo studio è supportata dal decremento del numero di capillari nella tonaca propria sottomucosa del rumine, analogamente a quanto osservato in animali nutriti con foraggio fibroso dallo scarso valore nutrizionale (13, 14, 15).

Il gruppo di controllo ha mostrato piccole variazioni del grado di cheratinizzazione della mucosa ruminale che, verosimilmente, non hanno alterato la capacità assorbente del rumine né sono risultate collegate a una riduzione significativa del BCS. Al contrario, il gruppo sperimentale ha mostrato un considerevole incremento del grado di cheratinizzazione dell’epitelio ruminale in seguito all’assunzione di foraggio coriaceo e fibroso a basso valore nutrizionale. Nel sacco ventrale del rumine l’alto grado di cheratinizzazione ha presumibilmente alterato la capacità assorbente risultando correlabile con il peggioramento dello stato corporeo sia durante il primo sia nel secondo periodo di permanenza su pascolo ad elevata copertura di Brachypodium rupestre. Il rapido declino del BCS medio nel gruppo sperimentale è

208

Scocco et al.

risultato, verosimilmente, dovuto alle variazioni nella struttura della mucosa ruminale combinato con la bassa qualità nutrizionale del foraggio presente sul pascolo, declino che precede la perdita di peso dell’animale.

Conclusioni Il rumine ha risposto rapidamente agli stimoli meccanici dovuti all’elevata fibrosità delle foglie del Brachypodium rupestre. L’incremento della cheratinizzazione ha preceduto la diminuzione di altri parametri, quali BCS e PV, che divengono apprezzabili quando il benessere degli animali è stato inficiato dall’assunzione di foraggio di scarso valore nutrizionale. L’andamento del grado di cheratinizzazione dell’epitelio ruminale potrebbe essere indicativo della diminuzione dello stato corporeo.

Considerato il rapido aumento della cheratizzazione e l’effetto negativo sul BCS già nei primi 10 giorni di alimentazione su un pascolo ad elevate copertura di Brachypodium rupestre, gli animali non dovrebbero rimanere in questi ambienti pastorali per più di 1012 giorni. La valutazione del BCS può rappresentare un utile strumento di controllo dello stato di benessere degli ovini che pascolano su praterie con risorse foraggere di scarso valore nutrizionale, al fine di prevenire consistenti perdite del PV.

Ringraziamenti Gli autori desiderano ringraziare la dottoressa Paola Coliolo e la signora Maria Gabriella Mancini per la loro eccellente assistenza tecnica. Sono, inoltre, riconoscenti al Centro di Calcolo dell’Università di Camerino per l’utilizzo del programma SPSS.

Finanziamenti Questo lavoro è stato finanziato dalla Regione Marche, Progetto n°16 L.R. 37/99-DGR 1234/05 Zootecnia e Prevenzione Incendi.

Veterinaria Italiana 2013, 49 (2), 203-209. doi: 10.12834/VetIt.2013.492.203.209

Scocco et al.

Effetto del Brachypodium rupestre su cheratinizzazione della mucosa ruminale e BCS

Bibliografia 1. Bobbink R. & Willems J.H. 1987. Increasing dominance of Brachipodium pinnatum (L.) Beauv in chalk grasslands: a threat to a species-rich ecosystem. Biol Cons, 40, 301-314.

2. Bonanomi G. & Allegrezza M. 2004. Effetti della colonizzazione di Brachipodium rupestre (Host) Roemer et Schultes sulla diversità di alcune fitocenosi erbacee dell’Appennino centrale. Fitosociologia, 41, 51-69.

3. Caldeira R.M., Belo A.T., Santos C.C., Vazques M.I. & Portugal A.V. 2007. The effect of long-term feed restriction and over-nutrition on body condition score, blood metabolites and hormonal profiles in ewes.

Small Rumin Res, 68, 242-255.

4. Campbell B.D., Grime J.P. & Mackey J.M.L. 1992. Shoot thrust and its role in plant competition. J Ecol, 80, 633-641.

5. Catorci A., Gatti R. & Ballelli S. 2007. Studio fitosociologico della vegetazione delle praterie montane dell’Appennino maceratese.

BraunBlanquetia, 42,101-143.

6. Ceccarelli P., Scocco P., Malfatti A., Vitali F. & Catorci A. 2009. Changes of sheep ruminal mucosae related to seasonal plant growth: when the anatomy is involved in the management of pastural systems. It J Anat Embryol, 114, 72.

7. Celaya R., Martinez A. & Osoro K. 2007. Vegetation dynamics in Cantabrian heathlands associated with improved pasture areas under single or mixed grazing by sheep and goats. Small Rumin Res, 72, 165-177.

8. Council Directive 92/43/EEC of 21 May 1992 on the conservation of natural habitats and of wild fauna and flora. Off J, L 206, 22/7/1992, 7–50.

9. Council Regulation (EC) No 1782/2003 of 29 September 2003 establishing common rules for direct support schemes under the common agricultural policy and establishing certain support schemes for farmers and amending Regulations (EEC) No 2019/93, (EC) No 1452/2001, (EC) No 1453/2001, (EC) No 1454/2001, (EC) 1868/94, (EC) No 1251/1999, (EC) No 1254/1999, (EC) No 1673/2000, (EEC) No 2358/71 and (EC) No 2529/2001. Off J, L 270, 21/10/2003, 1-69.

Veterinaria Italiana 2013, 49 (2), 203-209. doi: 10.12834/VetIt.2013.492.203.209

10. Crofts A. & Jefferson R.G. 1994. The lowland grassland management handbook. English Nature/Royal Society for Nature Conservation, Ashford, UK, 238 p.

11. Ferguson J.D., Galligan D.T. & Thomsen N. 1994.

Principal descriptors of body condition score in Holstein cows. J Dairy Sci, 77, 2695-2703.

12. Grime J.P. 2001. Plant strategies, vegetation processes, and ecosystem properties, John Wiley & Sons, New York, USA, 456 p.

13. Hofmann R.R. 1989. Evolutionary steps of ecophysiological adaptation and diversification of ruminants: a comparative view of their digestive system. Oecologia, 78, 443-457.

14. Hofmann R.R., Kock R.A., Ludwig J. & Axmacher H. 1988.

Seasonal changes in rumen papillary development and body condition in free ranging Chinese water deer (Hydropotes inermis). J Zool, 216, 103-117.

15. Kamler J. 2001. Morphological variability of forestomach mucosal membrane in red deer, fallow deer and mouflon. Small Rumin Res, 41, 101-107.

16. Melis M., Carpino F. & Di Tondo U. 1992. Tecniche in anatomia patologica. Edi-Ermes, Milan, Italy, 512 p.

17. Roggero P.P., Bagella S. & Farina R. 2002. Un archivio dati di Indici specifici per la valutazione integrate del valore pastorale. Riv Agron, 36, 149-156.

18. Scocco P., Brusaferro A. & Catorci A. 2012. Comparison between two different methods for evaluating rumen papillae measures related to different diets. Microsc Res Tech, 75, 884-889.

19. Sebastià M.T., de Bello F., Puig L. & Taull M. 2008. Grazing as a factor structuring grasslands in the Pyrenees. Appl Veg Sci, 11, 215-222.

20. Sokal R.R. & Rohlf F.J. 1981. Biometry. Freeman W.H. and Company, New York, USA, 859 p.

21. Weir W.C. & Torell D.T. 1959. Selective grazing by sheep as shown by a comparison of the chemical composition of range and pasture forage obtained by hand clipping and that collected by esophagealfistulated sheep. J Anim Sci, 18, 641-649.

209

Keratinisation degree of rumen epithelium and body condition score in sheep grazing on Brachypodium rupestre Paola Scocco1, Francesca Mercati2, Andrea Brusaferro1, Piero Ceccarelli2, Carlo Belardinelli3 & Alessandro Malfatti1 Scuola di Scienze Ambientali, UniversitĂ di Camerino, Via Gentile III da Varano, 62032 Camerino, Italy paola.scocco@unicam.it 2 Dipartimento di Scienze Biopatologiche e Igiene delle produzioni animali e alimentari, UniversitĂ di Perugia, Via S. Costanzo 4, 06126 Perugia, Italy 3 Igiene degli alimenti di origine animale, Servizio Veterinario AV3-ASUR Marche, Viale E. Betti 15/A, 62032 Camerino, Italy 1

Keywords Body condition score, Brachypodium rupestre, Fire prevention, Rumen keratinisation, Sheep.

Summary This article describes the result of a study focusing on the keratinisation degree of rumen mucosa and changes in the body condition of sheep that had grazed for 20 days in a pasture densely covered with Brachypodium rupestre. Grazing in this type of pasture can reduce the probability of fires in a Mediterranean mountain setting. However, foraging in areas with a prevalence of Brachypodium rupestre can affect animalsâ&#x20AC;&#x2122; welfare. In this respect, it is essential to determine the length of time during which the animals can remain in this environment before their welfare is compromised by this type of pasture. Ewes grazing on a semi-mesophilic pasture were included as a control. On days 1, 10, and 20, five ewes from each group were sacrificed to evaluate the variations of the epithelial keratinization degree of the rumen atrium and ventral sac. Body weight (BW) and body condition score (BCS) were assessed in ten ewes per group. The control animals showed little variation in the keratinisation degree of rumen mucosa without any detrimental effects on the BCS and BW. The experimental animals showed a significant increase in the epithelial keratinisation degree within 10 days and a decrease of BCS and BW within 20 days. The data collected suggest that animals should not remain for longer than 10-12 days on pasture highly covered with Brachypodium rupestre.

Veterinaria Italiana 2013, 49 (2), 211-217. doi: 10.12834/VetIt.2013.492.211.217

Introduction The European Union, besides promoting and defending animal welfare, supports research focused on the use of domestic animals to prevent forest fires (Rule CE 1782/2003). Necromass on the periphery of pastures, which are often characterised by a dense covering of Brachypodium rupestre, is a potential cause of forest fires. This tall grass is unfavourable for ovine grazing because it is rich in silicates and has highly fibrous leaves (17). However, sheep that are fenced in areas covered with Brachypodium rupestre tend to exploit all foraging resources and may remove the fire primer.

When Brachypodium is not grazed, it tends to spread on pastures which limits the growth of more palatable species weaking the sexual and vegetative reproduction and spread phases of these species (4, 10, 12, 19). This affects the floristic composition of the pasture, which can in turn lead to an ecological imbalance that lowers grazing value and biodiversity (1, 2, 7). The primary pastures in the Italian Apennine

Mountains are located within sites of community interest and special protection areas (8). Therefore, it is necessary to limit the dispersal of highly invasive species that can negatively affect the biodiversity in these territories.

Sheep breeders who allow their flocks to graze in areas that are at an increased risk of fires could use public funds for fire prevention and increase the aid of husbandry through the Common Agricultural Policy (9), which is linked to the use of the best practices aimed at preserving biodiversity and respecting animal welfare.

This study evaluated the degree of keratinisation in the ruminal mucosa using optical microscopy and changes in the body condition based on trends in mean body weight (BW) and body condition score (BCS) of sheep grazing on Brachypodium rupestre.

The purpose of the analysis was to determine the length of time the animals can remain in these pastures without their welfare being negatively affected.

211

Effect of Brachypodium rupestre on rumen epithelium and BCS

Materials and Methods

Scocco et al.

the presence of macrolesions, were performed on all the living animals.

Animals and experimental plan The experiments were performed during the month of October 2009. A total of 50 Comisana x Appenninica yearling sheep were used. All the animals were nulliparous and housed without rams. Twenty five animals (experimental group) were maintained for 4 days on a plot with sparse coverage (30%) of Brachypodium rupestre. The animals were then transferred to a densely (60%) covered plot for 20 days (from day 1 to day 20).

Twenty five sheep in the same physiological conditions as the experimental animals were maintained in a semi-mesophilic natural pasture (control group) (5). In both groups, 10 sheep were used for BCS and BW evaluations, while five sheep were sacrificed at the beginning of the experiment and 10 and 20 days after grazing on respective pasture (day 1, 10, and 20).

Routine controls to monitor the health of the animals, including direct macroscopic observations of the lip, tongue and buccal mucosae to screen for

Morphological evaluation of the rumen mucosa Animals in the experimental and control groups were slaughtered at the Visso (Macerata, Italy) slaughterhouse. Samples from the rumen atrium and ventral sac wall were removed, fixed in Bouin’s fluid and embedded in paraffin wax.

Morphological evaluations to assess the keratinised layer were performed on 5-µm thick tissue sections using the following stains: haematoxylin and eosin, Mallory’s trichrome, and Floxin B/Orange G/Alcian blue (16). To avoid variations in staining due to slight differences in temperature or incubation, all the samples were processed concurrently during each step of the procedure.

To evaluate changes or damage to the mucosa of the rumen caused by Brachypodium rupestre, the tissue sections were observed under a light microscope (Eclipse E800, Nikon Corporation, Tokyo,

Figure 1. Measuring the degree of keratinisation. The left image shows the selected field where measurement data were collected. The same field is enlarged in the right image. The heights of the total epithelium and nucleated layers are reported.

212

Veterinaria Italiana 2013, 49 (2), 211-217. doi: 10.12834/VetIt.2013.492.211.217

Scocco et al.

Japan) and photographed with a digital camera (Dxm 1200, Nikon Corporation). The images were used to measure the keratin layer. The height of the epithelial and nucleated layers was measured, and the height of the keratin layer was calculated as the difference. The values were then converted to percentages of the total height of the epithelial layer. Eight fields of 0.35x0.27 mm were selected for each animal, and five measurements were recorded in each field (Figure 1). The images were processed using image analysis software (Lucia Measurement, Laboratory Imaging Ltd, Praga, Czech Republic).

Body state The animals were weighed at day 1, 10, and 20 with an electronic balance (Kruuse PS250) and evaluated for BCS. The BCS is a comprehensive assessment of the animal’s body status based on relative proportions of muscle and fat, and is considered a useful management tool in determining the welfare of domestic animals (3, 11). In sheep, the assessment is based on the following steps: palpation of body structures, which are represented by the spinous processes of the thoracic vertebrae and the transverse processes of the lumbar vertebrae; evaluation of the muscle/adipose mass in the dorso‑medial area; and

Effect of Brachypodium rupestre on rumen epithelium and BCS

evaluation of the general status of the animal. Each animal is graded on a numerical scale (0-5) based on comparison with animals and body structures as described and pictured on a chart. The BCS is the mean of all assigned scores for the four parameters.

The animals were scored by five experienced operators, scores were assigned for each parameter by different operators.

Statistical analysis One-way analysis of variance (ANOVA) was used to compare the difference between the control and experimental groups. The inter-group data were assumed to be samples from normal populations with the same variances. To test these assumptions, Shapiro-Wilk test of normality and Levene’s test of homogeneity were used. When these conditions were not satisfied, a nonparametric Mann-Witney test was applied (20). The analyses were performed using SPSS PC 8.0 software.

Results During the experiment, the animals in the control and experimental groups were healthy and did not

Figure 2. Rumen atrium papilla of sheep grazing on Brachypodium rupestre. Haematoxylin and eosin. At the beginning of the experiment, numerous large blood vessels () were present in the subepithelia and inner zone of the tunica propria submucosa of the rumen papilla. On experimental day 10 (left inset), the number and calibre of blood vessels () decreased. At the end of the experimental period (right inset), only a few small blood vessels () were present in the inner connective tissue.

Veterinaria Italiana 2013, 49 (2), 211-217. doi: 10.12834/VetIt.2013.492.211.217

213

Effect of Brachypodium rupestre on rumen epithelium and BCS

Scocco et al.

show any macroscopic damage to the lip, tongue or buccal mucosae due to feeding. Light microscopy did not reveal any microlesions in the mucosa of the rumen atrium and ventral sac in sheep grazing on Brachypodium rupestre.

experimental groups in the rumen atrium and the ventral sac. On days 10 and 20, the percentage of keratinisation showed significant differences in the rumen atrium (P<0.001) and the ventral sac (P<0.001).

Histological observation of the rumen mucosa showed a considerable increase in the degree of keratinisation of the rumen epithelium and a decrease in the number and calibre of rumen vessels in the experimental group, as shown in Figure 2. In the control group, the degree of keratinisation was slightly enhanced, and no appreciable differences in the number and calibre of vessels were observed.

The BW trends in the control and experimental groups are reported in Table I and shown in Figure 5.

A major decrease in BW occurred during the second phase of grazing on the plot densely covered with Brachypodium rupestre. The animals had a total mean BW loss of 1.79 kg. In the control group, BW increased by 0.62 kg, although a slight decrease occurred during the second phase of grazing. Analysis of variance did not show significant differences between the control and experimental groups at any of the experimental time points (Table I).

The keratin levels from various sites in the rumen measured at three different time points during the experiment are summarised in Table I and shown in Figures 3 and 4. In the rumen atrium, the percentage of keratinisation increased from 17.2% to 31.7%, while in the rumen ventral sac it increased from 20.0% to 37.3%. In the control group, the percentage of keratinisation increased from 17.0% to 19.5% in the rumen atrium and from 20.2% to 22.1% in the ventral sac.

At the beginning of the experiment, there were no significant differences in the percentage of keratinisation between the control and

The BCS trends in the control and experimental groups are reported in Table I and shown in Figure 6.

The sheep grazing on Brachypodium rupestre showed a decrease in BCS (-0.62) on day 10. The BCS decreased to -1.19 after 20 days. In the control group, BCS decreased slightly (-0.13) on day 20. At the beginning of the trial, there were no significant differences in mean BCS between the control and experimental groups. On day 10, there was a significant difference in mean BCS (P=0.003), which increased after 20 days (P<0.001).

Table I. Mean values of keratinisation of the rumen epithelium (percentage), body weight (BW) (kg) and body condition score (BCS) in sheep that grazed on Brachypodium rupestre (Exper) and semi-mesophilic pastures (Control).

Keratin (%) Days

Atrium Exper 17.2 30.9 31.7

Control 17.0 19.2 19.5

1 10 20

Ventral sac Control Exper P 20.2 20.0 0.5790 21.7 32.9 0.0001 22.1 37.3 0.0001

P 0.4030 0.0001 0.0001

BW (kg) Control 50.63 51.65 51.25

40

30 25 20 15 10 5 0

P 0.924 0.994 0.230

Control 2.72 2.67 2.59

Exper 2.75 2.05 1.65

P 0.8060 0.0030 0.0001

**

Control group

**

Experim. group

35 30 25 20 15 10 5 0

1

10

20

Days from the start of the trial

Figure 3. Mean percentage of keratin (±SD) in the rumen atrium epithelium in the control and experimental groups on days 1, 10, and 20 (** P<0.001).

214

40

**

Experim. group

Keratin percentage

Keratin percentage

35

Exper 50.83 51.66 49.04

45

**

Control group

BCS

1

10

20

Days from the start of the trial

Figure 4. Mean percentage of keratin (±SD) in the epithelium of the rumen ventral sac in the control and experimental groups on days 1, 10, and 20 (** P<0.001).

Veterinaria Italiana 2013, 49 (2), 211-217. doi: 10.12834/VetIt.2013.492.211.217

Scocco et al.

Effect of Brachypodium rupestre on rumen epithelium and BCS

3.1

54

2.9 2.7

52

BCS value

Body weight (kg)

53

51 50

**

10

20

2.5 2.3 2.1 1.9

49 48

*

Control group

1.7

Experim. group

1.5

47

1

10

20

Days from the start of the trial

Figure 5. Trends in mean body weight (±SD) in the control and experimental groups on days 1, 10, and 20.

Discussion There were differences observed in the keratinisation of the rumen mucosa and BCS between the control group and the experimental group.

Changes in BW were not significant between the two groups. Although the mean decrease in BW of 1.79 kg was not statistically significant, it should be taken into account as it represents an economic loss for the farmers. The sheep in the control group showed a slight decrease in mean BW at the end of the trial, which was likely due to the lower nutritional value of the plants selected by ewes during the first 10 days of grazing (21) and modifications in the chemical composition of plants due to an increase in cellulose and lignin contents (10).

The greatest increase in keratinisation was observed in the ventral sac of the rumen. Tough and fibrous foods remain longer in the ventral sac, which could explain the differences in keratinisation because direct contact between food and the forestomach wall can induce mechanical stress. A high degree of keratinisation in the epithelial lining was observed after only 10 days of grazing in the plot densely covered with Brachypodium rupestre in the rumen atrium (30.9%) and ventral sac (32.9%).

Grazing on Brachypodium rupestre in a densely covered plot affected the body condition of the animals within 10 days of exposure. Changes in BCS are considered a more sensitive indicator of the nutritional status of the animals than changes in BW. Body weight takes into account the total weight of the gastrointestinal contents (3). Changes in BW can lead to an over- or underestimation of the welfare of the animal because a relative scarcity of nutrients can be linked to an absolute scarcity of food, and consumption of inadequate food sources can result in a loss or a gain in BW. Evaluation of BCS is a simple, inexpensive method

Veterinaria Italiana 2013, 49 (2), 211-217. doi: 10.12834/VetIt.2013.492.211.217

Control group Experim. group 1

Days from the start of the trial

Figure 6. Trends in mean body condition score (BCS) (±SD) during the experimental period on days 1, 10, and 20 (* P=0.003, ** P<0.001) with respect to the control group. that allows the available reserves to be assessed and indicates the direction (and, to some extent, the rate) of the primary metabolic processes of anabolism and catabolism. The reliability of BCS was confirmed by several endocrine and metabolic blood indicators (3).

A previous study stated that morphometric variations in the mucosa of the ventral sac of the rumen are related to vegetative cycles in the pasture (6). Similarly, changes in BCS observed during vegetative cycles in the pasture were related to mucosal morphometric variations. The degree of epithelial keratinisation in the ventral sac and atrium of the rumen showed the highest mean values when mean BCS was low and the pasture was in a dry phase of the vegetative cycle in 2007, which was a drought year. The lowest degree of keratinisation corresponded with the period when the pasture was blooming in the spring of 2008, which was a rainy year, and mean BCS was higher (6). Body condition score declines in the presence of low quality- and/ or low quantity- foraging resources, which directly alters the extent of the absorptive surface of the rumen and the absorption of volatile fatty acids (14, 18). The absorption capacity, which is facilitated by reduced epithelial cell layers (13), is lowered due to increased mucosal keratinisation.

The probable reduction in absorption function observed in the sheep in this study is supported by a decrease in the number of vessels in the rumen tunica propria submucosa during the experimental period, which has been previously verified in animals that were nourished with highly fibrous foods with low nutritional values (13, 14, 15). The control group showed little variation in the degree of keratinisation in the rumen mucosa, which did not alter the absorptive capacity of the rumen or reduce BCS. In contrast, the experimental group showed a considerable increase in the degree of keratinisation in the rumen epithelium due to consumption of a

215

Effect of Brachypodium rupestre on rumen epithelium and BCS

tough, fibrous food source with a low nutritional value. In the ventral sac of the rumen, the high degree of keratinisation altered the absorption capacity and worsened the body condition during the first and second stage in the experimental plot. The rapid decline in mean BCS in the experimental group was likely due to changes in the structure of the rumen mucosa combined with the low nutritional quality of available food in the pasture, which preceded the weight loss.

Conclusions The results of the present experiment show that the rumen responded rapidly to mechanical abuse as a result of the highly fibrous Brachypodium rupestre leaves. Besides, the increase in keratinisation preceded the decline of other parameters, such as BW and BCS, which were appreciable when the welfare of the animal had already been affected by consuming foods with low nutritional values.

Therefore, trends in the keratinisation of the rumen epithelium could be indicative of body state detriment.

216

Scocco et al.

Due to the rapid increase in keratinisation and the negative effects on BCS within 10 days of grazing on a pasture densely covered with Brachypodium rupestre, animals should not remain in these pasture environments for more than 10-12 days. The assessment of BCS could represent a useful means of controlling the welfare status of sheep grazing in pastures with foraging materials that have low nutritional values to prevent consistent loss of BW.

Acknowledgements The authors would like to thank Dr. Paola Coliolo and Mrs. Maria Gabriella Mancini for their excellent technical assistance. We are also grateful to the Camerino University Calculation Centre for access to computers and software for analyses using the SPSS program.

Grant support This work was supported by a grant from Marche Region, Project n째16 L.R. 37/99-DGR 1234/05 Zootechny and Fire Prevention.

Veterinaria Italiana 2013, 49 (2), 211-217. doi: 10.12834/VetIt.2013.492.211.217

Scocco et al.

Effect of Brachypodium rupestre on rumen epithelium and BCS

References 1. Bobbink R. & Willems J.H. 1987. Increasing dominance of Brachipodium pinnatum (L.) Beauv in chalk grasslands: a threat to a species-rich ecosystem. Biol Cons, 40, 301-314.

2. Bonanomi G. & Allegrezza M. 2004. Effetti della colonizzazione di Brachipodium rupestre (Host) Roemer et Schultes sulla diversità di alcune fitocenosi erbacee dell’Appennino centrale. Fitosociologia, 41, 51-69.

3. Caldeira R.M., Belo A.T., Santos C.C., Vazques M.I. & Portugal A.V. 2007. The effect of long-term feed restriction and over-nutrition on body condition score, blood metabolites and hormonal profiles in ewes.

Small Rumin Res, 68, 242-255.

4. Campbell B.D., Grime J.P. & Mackey J.M.L. 1992. Shoot thrust and its role in plant competition. J Ecol, 80, 633-641.

5. Catorci A., Gatti R. & Ballelli S. 2007. Studio fitosociologico della vegetazione delle praterie montane dell’Appennino maceratese.

BraunBlanquetia, 42,101-143.

6. Ceccarelli P., Scocco P., Malfatti A., Vitali F. & Catorci A. 2009. Changes of sheep ruminal mucosae related to seasonal plant growth: when the anatomy is involved in the management of pastural systems. It J Anat Embryol, 114, 72.

7. Celaya R., Martinez A. & Osoro K. 2007. Vegetation dynamics in Cantabrian heathlands associated with improved pasture areas under single or mixed grazing by sheep and goats. Small Rumin Res, 72, 165-177.

8. Council Directive 92/43/EEC of 21 May 1992 on the conservation of natural habitats and of wild fauna and flora. Off J, L 206, 22/7/1992, 7–50.

9. Council Regulation (EC) No 1782/2003 of 29 September 2003 establishing common rules for direct support schemes under the common agricultural policy and establishing certain support schemes for farmers and amending Regulations (EEC) No 2019/93, (EC) No 1452/2001, (EC) No 1453/2001, (EC) No 1454/2001, (EC) 1868/94, (EC) No 1251/1999, (EC) No 1254/1999, (EC) No 1673/2000, (EEC) No 2358/71 and (EC) No 2529/2001. Off J, L 270, 21/10/2003, 1-69.

Veterinaria Italiana 2013, 49 (2), 211-217. doi: 10.12834/VetIt.2013.492.211.217

10. Crofts A. & Jefferson R.G. 1994. The lowland grassland management handbook. English Nature/Royal Society for Nature Conservation, Ashford, UK, 238 p.

11. Ferguson J.D., Galligan D.T. & Thomsen N. 1994.

Principal descriptors of body condition score in Holstein cows. J Dairy Sci, 77, 2695-2703.

12. Grime J.P. 2001. Plant strategies, vegetation processes, and ecosystem properties, John Wiley & Sons, New York, USA, 456 p.

13. Hofmann R.R. 1989. Evolutionary steps of ecophysiological adaptation and diversification of ruminants: a comparative view of their digestive system. Oecologia, 78, 443-457.

14. Hofmann R.R., Kock R.A., Ludwig J. & Axmacher H. 1988.

Seasonal changes in rumen papillary development and body condition in free ranging Chinese water deer (Hydropotes inermis). J Zool, 216, 103-117.

15. Kamler J. 2001. Morphological variability of forestomach mucosal membrane in red deer, fallow deer and mouflon. Small Rumin Res, 41, 101-107.

16. Melis M., Carpino F. & Di Tondo U. 1992. Tecniche in anatomia patologica. Edi-Ermes, Milan, Italy, 512 p.

17. Roggero P.P., Bagella S. & Farina R. 2002. Un archivio dati di Indici specifici per la valutazione integrate del valore pastorale. Riv Agron, 36, 149-156.

18. Scocco P., Brusaferro A. & Catorci A. 2012. Comparison between two different methods for evaluating rumen papillae measures related to different diets. Microsc Res Tech, 75, 884-889.

19. Sebastià M.T., de Bello F., Puig L. & Taull M. 2008. Grazing as a factor structuring grasslands in the Pyrenees. Appl Veg Sci, 11, 215-222.

20. Sokal R.R. & Rohlf F.J. 1981. Biometry. Freeman W.H. and Company, New York, USA, 859 p.

21. Weir W.C. & Torell D.T. 1959. Selective grazing by sheep as shown by a comparison of the chemical composition of range and pasture forage obtained by hand clipping and that collected by esophagealfistulated sheep. J Anim Sci, 18, 641-649.

217

Risposte comportamentali e fisiologiche al confinamento del cane lungodegente in canile Paolo Dalla Villa1, Shanis Barnard1, Elisa Di Fede1, Michele Podaliri1, Luca Candeloro1, Antonio Di Nardo1, Carlo Siracusa2, James A. Serpell2 1

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale”, Campo Boario, 64100 Teramo, Italia p.dallavilla@izs.it 2 Dipartimento di Studi Clinici, Scuola di Medicina Veterinaria, Università della Pennsylvania, 3850 Spruce Street, Philadelphia, PA 19104-6010, USA

Parole chiave Benessere animale, Cane, Canile, Canis familiaris, Comportamento, Cortisolo, Lungodegenza.

Riassunto In Italia, la normativa riguardante gli animali di affezione e la prevenzione del randagismo (legge quadro n. 281 del 14 agosto 1991) impedisce la soppressione dei cani ospitati in canile se non gravemente malati o pericolosi. In quasi tutti i comuni italiani, il rapporto fra ingressi e adozioni nei canili è sbilanciato. Si generano pertanto, condizioni di sovraffollamento in cui un numero variabile di cani tende inevitabilmente a permanere nella struttura per periodi anche molto lunghi. La conoscenza degli effetti della lungodegenza sui cani di canile è ancora carente e necessita di studi mirati per permettere di fornire a questi animali il più alto grado possibile di benessere. Nel presente studio si valuta l’effetto di due differenti forme di confinamento (in gruppo o in coppia) su cani lungodegenti alloggiati in canile mediante lo studio di parametri comportamentali e fisiologici. Dati osservazionali e campioni di saliva per l’analisi quantitativa di cortisolo sono stati raccolti in entrambe le condizioni di confinamento per essere utilizzati come indicatori di benessere. Il confinamento di coppia ha offerto un minor numero di stimoli sociali e ambientali, infatti, i risultati comportamentali hanno permesso di mettere in evidenza come i cani trascorrano un tempo minore in attività locomotorie, esplorative e sociali. Le analisi delle concentrazioni di cortisolo hanno lasciato supporre che le differenze riscontrate a livello fisiologico non siano imputabili al tipo di confinamento. Nonostante in questo studio non siano emerse evidenze che permettano di affermare che una forma di confinamento abbia un maggior impatto negativo sul benessere animale (ad esempio: manifestazione di comportamenti aberranti, picchi di concentrazione di cortisolo), il differente tipo di confinamento ha avuto un effetto significativo sull’espressione di una varietà di comportamenti che, comunque, appartengono al normale repertorio della specie canina. Queste variazioni devono essere tenute in debito conto nel momento in cui si prendono decisioni sul tipo di confinamento da assegnare a cani di canile lungodegenti.

Veterinaria Italiana 2013, 49 (2), 219-230. doi: 10.12834/VetIt.2013.492.219.230

Introduzione Le popolazioni canine sono in crescita in tutto il mondo. In molti Paesi il randagismo rappresenta un notevole problema di salute pubblica, potendo esitare in: episodi di attacco di cani a persone e bestiame, incidenti automobilistici, trasmissione di zoonosi. Per gestire le popolazioni randagie si possono mettere in atto diverse strategie, in alcune di queste il canile riveste un ruolo primario (8). Il confinamento per un animale implica, generalmente, restrizione fisica, ambienti scarni, isolamento sociale, scarso controllo degli eventi e capacità di predirli. In Italia, la legge quadro n. 281 del 14 agosto 1991, riguardante gli animali di affezione e la prevenzione del randagismo, proibisce l’eutanasia dei cani alloggiati in canile, se non gravemente malati o pericolosi.

Questa disposizione, inevitabilmente, ha determinato condizioni di sovraffollamento nelle strutture, dove il benessere degli animali diventa un problema fondamentale. È importante, pertanto, adottare un modello di gestione e alloggiamento dei cani basato su elevati standard di benessere.

Secoli di selezione artificiale hanno generato molteplici livelli di diversificazione genetica e morfologica nel cane domestico. La razza, il temperamento e le precedenti esperienze di confinamento hanno dimostrato di svolgere un ruolo importante nell’abilità dei cani a far fronte ad un successivo confinamento (6, 12, 13, 14). Tali variabili dovrebbero essere normalmente prese in considerazione quando si studia l’adattamento dei cani alla permanenza in canile. Tuttavia, quando si studiano i cani di canile,

219

Dalla Villa et al.

Lungodegenza in canile e risposte comportamentali e fisiologiche

gli animali sono in gran parte adulti di razza mista il cui background è sconosciuto. In questo contesto le misure di benessere dovrebbero essere in grado di individuare lo stato di ciascun animale nell’ambiente attribuito a prescindere dal loro passato o bagaglio genetico. Studi precedenti hanno individuato alcuni indicatori di benessere, applicabili ai cani confinati in diversi ambienti di canile, principalmente basati su parametri comportamentali e fisiologici (10, 15, 27, 28). I parametri comportamentali forniscono informazioni importanti sulle esigenze e le preferenze degli animali, non sono invasivi e sono facilmente osservabili. Beerda e colleghi (3) hanno identificato modelli comportamentali specifici in risposta a condizioni di stress indotte sperimentalmente. Risultati simili sono stati rilevati in ricerche successive (14, 23). Nello specifico, in questi studi è stato dimostrato che le conseguenze di un confinamento inappropriato e dell’isolamento sociale hanno come risultato: calo di attività, auto-pulizia (auto-grooming), vocalizzazioni eccessive, alterazioni del comportamento esplorativo e locomotorio, modifiche del ciclo di sonno-veglia. Altri studi, analizzando gli effetti del confinamento dei cani, hanno suggerito che le dimensioni di un canile non influiscono in modo significativo sulla quantità ma sulla qualità delle attività (7, 11). È ampiamente accettato che la qualità dell’ambiente in cui l’animale è alloggiato svolga un ruolo cruciale nel benessere degli animali (16). L’ambiente ideale dovrebbe offrire stimoli sufficienti a motivare l’espressione del naturale comportamento canino. I cani ospitati nei canili, tuttavia, trascorrono tipicamente la maggior parte del loro tempo in condizione di inattività (16, 21). Hughes e Campbell (18) hanno riportato come gli animali, a prescindere dalle dimensioni della gabbia (1 m2 vs 7 m2) o dall’accesso ad un ampio recinto all’aperto, effettuino attività per un tempo medio pari a 30-90 minuti al giorno. La differenza osservata tra le condizioni di alloggiamento è stata la distanza percorsa ogni giorno, suggerendo che spazi più ampi potrebbero incoraggiare i cani a correre o a trottare. L’attività risulta aumentata quando i cani sono stimolati dal contesto sociale e ambientale (17). L’alloggiamento di gruppo, per esempio, fornisce un ambiente relativamente complesso che incoraggia l’attività locomotoria, l’esplorazione olfattiva e l’interazione sociale.

Studi precedenti incentrati sugli effetti dell’alloggiamento di gruppo hanno dimostrato che l’isolamento ha effetti negativi sul benessere dei cani (4, 5, 15). Altri studi hanno evidenziato un maggior indice di benessere nel caso di cani alloggiati a coppie rispetto a quelli alloggiati individualmente (6, 11). L’alloggiamento di gruppo, quando possibile, viene evitato in quanto sembra accrescere il rischio di trasmissione delle malattie e del comportamento aggressivo tra conspecifici (29).

220

I glucocorticoidi, nella forma del cortisolo, sono comunemente marcatori fisiologici impiegati per la valutazione del benessere del soggetto (2) in quanto le loro concentrazioni riflettono in modo attendibile l’attività dell’asse ipotalamo-ipofisi-surrene reattivo allo stress (20). Concentrazioni più elevate di cortisolo sono state rilevate in cani confinati, rispetto a quelli da compagnia che vivono in casa, e nei cani socialmente isolati, rispetto a quelli alloggiati in gruppi (6, 13, 26). Il cortisolo urinario e quello salivare costituiscono un’alternativa di valutazione del benessere attendibile e meno invasiva del cortisolo plasmatico (2). È stato dimostrato che il periodo di tempo in un canile rifiugio influenzi il comportamento dei cani ospitati nel canile, tuttavia gli effetti di un confinamento a lungo termine sul benessere dei cani non sono tuttora chiari e necessitano di ulteriori indagini (12, 30). Il presente studio si sviluppa sulla base di lavori precedenti in tale ambito e cerca di fornire un’ulteriore comprensione su come l’alloggiamento influisca, nel lungo periodo, sul benessere dei cani di canile. In modo più specifico, sono stati analizzati gli effetti di due diverse forme di confinamento mediante la valutazione delle attività comportamentali e dei parametri fisiologici, scientificamente riconosciuti.

Materiali e metodi Condizioni sperimentali Diciasette cani (7 femmine, 10 maschi) sono stati scelti tra quelli ospitati nel canile dell’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” (IZS A&M) a Teramo. Tutti i cani selezionati, adulti tra i 5 e i 9 anni di età, sono risultati presenti nel canile da almeno quattro anni dall’inizio dell’osservazione. I cani di taglia medio-grande, non ascrivibili ad alcuna razza specifica, sono risultati ascrivibili, in buon numero, a incroci di razze di cani da pastore. Tutti gli animali sono sono risultati sterilizzati o castrati e dichiarati sani dai veterinari del canile.

I gruppi di cani sono stati formati durante la fase pre-sperimentale durata 4 mesi. Sessioni giornaliere di socializzazione di gruppo sono state effettuate in modo da identificare i cani compatibili. Al termine della verifica, sono stati identificati, come da progetto, i quattro gruppi sperimentali ospitati nei rispettivi recinti. Per consentire l’adattamento nel nuovo ambiente, la raccolta dati è iniziata il mese successivo all’alloggiamento. La prima raccolta dati (Tempo 1, T1) è stata effettuata nel seguente contesto sperimentale: i cani sono stati alloggiati, alle stesse condizioni di confinamento, in gruppi di 4-5 animali di ambedue i sessi, in quattro recinzioni all’aperto con pavimentazione in terra battuta, adiacenti l’una all’altra, ciascuna di circa 35 m2, delimitate da reti me-

Veterinaria Italiana 2013, 49 (2), 219-230. doi: 10.12834/VetIt.2013.492.219.230

Dalla Villa et al.

talliche cementate in un muretto di 50 cm di altezza.

Un tetto di 11 m2 ha avuto la funzione di coprire una parte del recinto per proteggere cani e cucce in plastica da sole e intemperie. I cani sono stati alimentati una volta al giorno, durante le ore mattutine, con mangime secco e acqua fresca disponibile a tutte le ore. Al fine di prevenire un comportamento competitivo, i cani sono stati abituati durante l’alimentazione a essere legati al recinto con un guinzaglio lungo un metro. I cani nella prima fase sperimentale sono sempre rimasti nel recinto assegnato.

Al termine della prima raccolta dati, 8 cani (4 femmine e 4 maschi) ospitati in due delle quattro recinzioni sono stati trasferiti a coppie in box più piccoli (6 m2). Questi cani hanno costituito il gruppo sperimentale, i restanti 9 sono rimasti nelle due stesse recinzioni d’origine in qualità di gruppo di controllo.

Al fine di prevenire problemi di gestione e comportamenti aggressivi indesiderati, che avrebbero potuto compromettere la sicurezza dei cani o l’esito dello studio, i compagni di recinto sono stati selezionati in base al rispettivo passato di positiva interazione nel corso dell’alloggiamento di gruppo. Le coppie sono state composte da un maschio e una femmina. I box di coppia sono stati completamente coperti da un tetto e dotati di recinzione a maglie nella parte anteriore. La recinzione laterale è stata realizzata con pareti solide, alte un metro, con presenza alla sommità di rete metallica. Tali box sono stati dotati di accesso ad un’area comune recintata (120 m2) dove è stato consentito ai cani di stare a coppie per 2 ore al giorno, solitamente la mattina durante le attività di pulizia. La procedura di alimentazione è stata la stessa descritta in precedenza. Ai cani è stato consentito di ambientarsi per un mese alle nuove condizioni di confinamento, prima dell’inizio della seconda raccolta dati (Tempo 2, T2).

Raccolta dati La raccolta dati è stata standardizzata per tutti i gruppi di cani durante T1 e T2. I dati sul loro comportamento sono stati raccolti tramite registrazioni video delle attività in due sessioni giornaliere, per tre giorni consecutivi: 40 minuti al mattino prima dell’ora di alimentazione (06.15h-06.55h) e 40 minuti nel pomeriggio (17.15h-17.55h). Tutte le registrazioni sono state effettuate in assenza di attività da parte del personale. Sono state installate telecamere con accensione e spegnimento demandati a un operatore non presente, come previsto, durante le registrazioni. Dal momento che i cani avrebbero potuto reagire più intensamente all’arrivo di un addetto (18), sono stati scartati dalla valutazione i primi e gli ultimi 5 minuti di ciascuna sessione di registrazione. Le valutazioni dei video sono state effettuate impiegando un software di registrazione dati dedicato (The Observer XT 8.0, Noldus Information

Veterinaria Italiana 2013, 49 (2), 219-230. doi: 10.12834/VetIt.2013.492.219.230

Lungodegenza in canile e risposte comportamentali e fisiologiche

Technology, Wageningen, The Netherlands) e sulla base di un etogramma esistente (15). Sono stati osservati 38 comportamenti e i relativi modelli comportamentali sono stati raggruppati in categorie distinte (Tabella I). Le frequenze di comportamento e la durata degli episodi sono state registrate in continuo nel corso di osservazioni di 30 minuti ciascuna, per un totale di circa 180 minuti di registrazione per ciascun periodo di tempo e per ciascuno dei 17 cani studiati.

Il cortisolo è stato analizzato da campioni di saliva prelevati da tutti i cani. Per il controllo della variabilità nel medesimo soggetto, il cortisolo è stato campionato da ciascun cane per tre giorni consecutivi, durante ambedue i periodi di osservazione dello studio (T1 e T2), immediatamente dopo le registrazioni video del mattino e nel momento in cui i cani sono stati legati prima dell’assunzione di cibo.

Il valore medio dei tre giorni è stato considerato rappresentativo del livello di cortisolo in ciascun cane, durante ogni fase di osservazione. I campioni di saliva sono stati prelevati dal cavo orale degli animali per mezzo del kit Salivette® (Starstedt, Verona, Italia). Il prelievo è stato effettuato dagli stessi veterinari del canile agevolati dalla loro familiarità con i cani. Ogni prelievo è stato eseguito in maniera standardizzata acquisendo ogni campione entro 3 minuti, al fine di prevenire misurazioni distorte dei livelli di cortisolo indotte dal trattamento. I campioni sono stati stoccati a –25°C fino a ulteriori analisi.

La determinazione del cortisolo è stata effettuata tramite immunodosaggio per mezzo del kit Salivary Cortisol (Salimetrics, State College, PA, USA) disponibile in commercio e seguendo le indicazioni del produttore.

Elaborazione dati e analisi statistica Prima dell’effettuazione delle analisi statistiche sono state applicate correzioni ai dati sia per le misure comportamentali che per quelle del cortisolo.

I cani non risultando sempre visibili in tutti i momenti di osservazione (ad es. presenza in cuccia o dietro barriera visiva) è stato assunto che il loro comportamento fosse lo stesso sia dentro che fuori il campo di ripresa della telecamera. Pertanto i dati approssimati sul comportamento sono stati calcolati come percentuale di tempo in cui gli animali oggetto di studio sono risultati visibili. Ciascuna variabile è stata modificata moltiplicandola per un coefficiente di correzione (k) equivalente al tempo di osservazione totale (Tt = 10.800 sec) diviso per il tempo visibile (Tt - x) dove x è il tempo in cui l’animale non è risultato visibile (cioè fuori dal campo visivo o nascosto nell’ombra). Alcuni dei comportamenti elencati nell’etogramma o non sono stati mai registrati (ovvero salto, accoppiamento, masticazione, insegui-

221

Dalla Villa et al.

Lungodegenza in canile e risposte comportamentali e fisiologiche

Tabella I. Categorie comportamentali e variabili rilevate durante lo studio e misurate come frequenze (f) o durate (d) di insorgenza Categoria

Comportamento

Comportamento attivo

Camminare Trottare Saltare Zampe posteriori Comportamento inattivo Decubito Seduto Postura quadrupedale Riposarea Comportamento attivo-ripetitivo Girare in cerchio Andatura rapida Passo rapido sociale Inseguimento coda Rimbalzare contro un muro Interazione socialeb

Amichevole Giocosa Minacciosa Postura rigida/alta Difensiva Accoppiamento Annusarea Sguardo socialea

Altri

Auto-grooming Scavare Fuori vista Ombraa

Coda Esplorazione dell’ambiente

Abbaiare Scrollarsi Stirarsi Vocalizzazioni prolungatea Scodinzolare Coda bassa/arricciataa Esplorazione visivaa Esplorazione olfattivaa

Alimentare

a b

222

Bere Masticare Urinare Defecare Coprofagia

Definizione

f/d

Andatura locomotoria Andatura al trotto Saltare sul tetto delle cucce In piedi sulle zampe posteriori appoggiando gli arti anteriori contro un muro/recinto Posizione sdraiata sternale o laterale Sedersi sulle zampe posteriori In piedi a quattro zampe Il soggetto dorme o è sdraiato con testa a terra Girare ripetutamente intorno al recinto Camminare ripetutamente con passo rapido solitamente lungo una recinzione Camminare ripetutamente con passo rapido lungo un recinto parallelamente ad un cane che si trova dall’altro lato Inseguimento ripetuto della coda

d d d d d d d d d d

Salti ripetuti contro un muro con rimbalzo

d

Leccare e grattare con zampa un conspecifico o allo-grooming, spesso con scodinzolamento Chinarsi, brevi cariche con rimbalzi, espressione giocosa, fare la lotta, inseguimento giocoso Pelo eretto, vocalizzazioni aggressive, scatto contro altro cane L’animale in piedi con postura rigida, testa e coda dritte in alto, bocca chiusa, scodinzolamento assente o molto limitato, posizione a T o parallela con altro cane Evitare gli altri cani, aumentare la distanza, o rannicchiarsi, rotolarsi Il cane monta/è montato un altro/da un altro cane L’animale in esame annusa un altro cane L’animale si orienta verso un altro cane e mantiene il contatto visivo, comportamento solitamente associato ad un cambiamento nel movimento della coda e/o nella posizione della stessa Comportamento da parte del soggetto diretto verso il proprio corpo, come ad es. grattarsi, leccarsi o mordersi Scavare a terra con zampe anteriori Il soggetto non è visibile, solitamente in una cuccia o dietro una barriera Il soggetto si trova in area poco illuminata, non è possibile osservarne le espressioni facciali Staccato, brevi vocalizzazioni Oscillamento vigoroso di testa e corpo lungo l’asse longitudinale Stiramento del corpo e degli arti

d d

d d d d d d d d d d d d f f f

Ululati e guaiti

d

Scodinzolamento ripetuto La coda è arricciata tra gli arti posteriori, postura solitamente bassa Osservare l’ambiente o i compagni di recinto Camminare con il naso raso al suolo o contro altri oggetti con chiari movimenti inalatori Bere acqua Masticare materiale non nutritivo Urinare con arto sollevato o in posizione di squat Espellere il contenuto dell’intestino Mangiare le proprie feci o di altro cane

d d d d f f f f f

Comportamento non mutualmente esclusivo: può verificarsi contemporaneamente ad altri comportamenti.

D urante il rilevamento di una interazione sociale, è stato registrato anche il destinatario del comportamento, identificandolo come: un compagno di recinto dello stesso sesso; un compagno di recinto di sesso opposto; un cane nel recinto adiacente.

Veterinaria Italiana 2013, 49 (2), 219-230. doi: 10.12834/VetIt.2013.492.219.230

Dalla Villa et al.

Lungodegenza in canile e risposte comportamentali e fisiologiche

mento coda, rimbalzo contro parete) oppure sono stati registrati una sola volta (coda bassa/tra gli arti posteriori, coprofagia). Tali comportamenti sono stati pertanto scartati da successive analisi. A causa della bassa percentuale di manifestazione, alcuni

30

Sociale positivo Agonistico

25

Sec

20 15 10 5 0 Stesso sesso

Sesso opposto

Recinto adiacente

Destinatario

Figura 1. Comportamento sociale a Tempo 1. Destinatari del comportamento sociale positivo (giocoso, amichevole) e agonistico (postura rigida/alta, difensiva, minacciosa) a T1 durante l’alloggiamento di gruppo.

comportamenti sono stati raggruppati e considerati come singole variabili, ad esempio: girare in cerchio o andatura rapida sono stati analizzati come categoria di comportamenti attivi ripetitivi. Le posture amichevole, giocosa, minacciosa, rigida/alta e difensiva sono state analizzate come categoria d’interazione sociale. Annusare un conspecifico e lo sguardo sociale (comportamenti non mutualmente esclusivi) sono stati analizzati come categoria di segnali comunicativi. Per tutti i comportamenti inclusi nella categoria dell’etogramma interazione sociale, i dati sono stati ponderati secondo il numero dei soggetti presenti in ciascuna recinzione e il destinatario è stato registrato come compagno di recinto dello stesso sesso, del sesso opposto o come cane in un recinto adiacente.

Per valutare gli effetti principali (gruppo e tempo) e la loro interazione, è stata eseguita per tutte le variabili un ANOVA a due vie per misure ripetute su un fattore. Dato che lo stesso soggetto è stato osservato per due volte (T1 e T2), il fattore tempo è stato trattato come misura intra-gruppo e il fattore gruppo (sperimentale o di controllo) è stato considerato misura tra gruppi. Sebbene l’analisi statistica sia stata considerata sufficientemente solida (poiché è stata rispettata l’assunzione di campioni omogenei), la distribuzione dei dati è stata ispezionata visiva-

Tabella II. ANOVA a due vie con misure ripetute su un fattore (tempo).

Variable Attivo ripetuto Auto-grooming Abbaiare Segnali comunicativi Defecare Scavare Bere Arti posteriori Coricarsi Esplorazione olfattiva Vocalizzazioni prolungate Riposare Scrollarsi Sedersi Interazione sociale Posizione quadrupedale Decubito Scodinzolare Trottare Urinare Esplorazione visiva Camminare

Effetti tra gruppi Gruppo F-statistico p-valore 1,82 0,197 4,20 0,058 0,24 0,635 1,77 0,203 0,06 0,809 2,83 0,113 0,38 0,545 1,84 0,195 1,31 0,270 0,08 0,780 0,08 0,779 6,16 0,025 1,65 0,218 2,13 0,165 1,27 0,278 0,59 0,453 0,33 0,573 0,12 0,739 0,06 0,811 0,83 0,378 0,38 0,549 0,06 0,811

Effetti intra-gruppo Tempo F-statistico 1,66 6,15 2,14 4,82 0,12 2,40 0,08 3,17 24,13 0,76 7,31 35,36 0,13 0,06 1,84 12,97 1,86 0,34 7,59 0,14 16,07 8,57

p-valore 0,217 0,025 0,164 0,044 0,738 0,142 0,778 0,095 0,000 0,398 0,016 0,000 0,720 0,810 0,195 0,003 0,193 0,568 0,015 0,718 0,001 0,010

Interazione F-statistico p-valore 2,42 0,141 1,36 0,261 2,72 0,120 11,35 0,004 0,89 0,360 5,43 0,034 12,55 0,003 0,91 0,355 5,60 0,032 5,86 0,029 2,20 0,159 3,64 0,076 2,44 0,139 0,06 0,813 1,61 0,224 10,86 0,005 0,00 0,992 4,75 0,046 8,90 0,009 13,49 0,002 12,17 0,003 14,65 0,002

I valori p significativi (< 0,05) sono in grassetto.

Veterinaria Italiana 2013, 49 (2), 219-230. doi: 10.12834/VetIt.2013.492.219.230

223

Dalla Villa et al.

Lungodegenza in canile e risposte comportamentali e fisiologiche

a.

250

Sperimentale

Controllo 100

Tempo (sec)

200

80 150 60 100

40

50

20

0 T1

b.

1500

T2

Sperimentale

T1

T2

T1

T2

T1

T2

Controllo

Tempo (sec)

800 100

600 400

500

200

0 T1

T2

T1

T2

Figura 2. Variazioni comportamentali. Per le variabili comportamentali (a) trottare e (b) camminare, i box-plot rappresentano cambiamenti nella durata del comportamento tra le due fasi dello studio (T1 e T2) sia per i cani sperimentali che per quelli di controllo (confronti all’interno dello stesso gruppo).

I grafici interattivi rappresentano la direzione del comportamento (linee tratteggiate crescenti o decrescenti) da T1 a T2 sia per il gruppo sperimentale (triangoli solidi) che per il gruppo di controllo (cerchi solidi).

Tabella III. Tempo di osservazione medio e relativo errore standard registrato per ciascun comportamento.

Variabile Attivo ripetuto Auto-grooming Abbaiare Segnali comunicativi Defecare Scavare Bere Arti posteriori Posizione di decubito Esplorazione olfattiva Vocalizzazioni prolungate Riposare Scrollarsi Sedersi Interazione sociale Posizione quadrupedale Stirarsi Scondinzolare Trottare Urinare Esplorazione visiva Camminare

Gruppo di controllo T1 (s) T2 (s) 7,2±1,1 13,7±2,06 30,8±6,1 169,0±29,6 140,0±11,2 149,1±22,1 70,9±5,8 114,4±13,7 0,4±0,1 0,8±0,2 0 7,2±1,8 0,4±0,1 3,4±0,3 238,8±49,2 156,8±26,0 6406,1±233,2 7470,4±185,0 299,7±14,4 487,1±53,7 9,6±1,0 21,9±4,3 2110,9±215,4 4874,7±165,9 1,7±0,1 4,2±0,3 577,0±88,9 574,6±77,1 33,3±6,6 67,0±10,5 1723,8±70,9 1605,9±95,1 2,1±0,4 3,7±0,2 436,6±45,6 734,6±73,7 63,5±4,7 64,5±6,7 0,4±0,1 4,1±0,3 4170,0±280,8 3798,0±199,5 435,5±31,4 510,1±34,2

Gruppo sperimentale T1 (s) T2 (s) 111,5±26,6 4,9±1,7 210,7±52,9 583,5±61,7 355,9±38,8 34,7±4,7 295,2±18,8 39,3±4,7 0,6±0,1 0,4±0,1 44,9±8,1 0 3,9±0,5 1,0±0,2 35,5±5,3 12,0±3,6 6222,7±214,3 9168,9±145,2 654,7±37,2 198,0±16,3 0 40,3±6,4 2565,2±221,1 7875,1±249,2 7,8±0,4 3,2±0,4 209,5±35,0 146,1±20,8 11,6±7,2 11,8±3,4 2248,2±136,1 556,8±75,4 2,9±0,3 4,5±0,7 803,0±106,0 216,0±49,3 111,3±11,2 5,1±0,8 6,1±0,9 1,0±0,1 5521,4±159,0 1539,3±138,2 898,2±92,8 132,5±18,7

T1 rappresenta il primo periodo di osservazione in cui tutti i cani sono alloggiati in gruppo in recinti all’aperto.

T2 rappresenta il secondo periodo di osservazione in cui i cani del gruppo sperimentale sono alloggiati in box a coppie e il gruppo di controllo è rimasto negli stessi recinti all’aperto.

224

Veterinaria Italiana 2013, 49 (2), 219-230. doi: 10.12834/VetIt.2013.492.219.230

Dalla Villa et al.

Lungodegenza in canile e risposte comportamentali e fisiologiche

mente tramite grafici box-plot, al fine di individuare eventuali deviazioni dalla curva di normalità.

Per le differenze tra e intra-gruppi sono stati anche calcolati gli intervalli di confidenza (IC) al 95% per campioni appaiati, come mostrato in Tabella I. Dal momento che sono stati effettuati tre confronti (due confronti tra i tempi intra-gruppo e un confronto tra i gruppi a T1), per verificare il tasso di errore complessivo, gli intervalli di confidenza sono stati calcolati utilizzando la correzione di Bonferroni (quindi il tasso d’errore di tipo I è stato corretto a 0,05/3=0,0167).

Ogni volta che, sulla base dell’ispezione visiva, la distribuzione delle variabili è sembrata diversa da quella normale, sono stati effettuati test statistici non parametrici (il test per somme di ranghi di Wilcoxon per campioni appaiati e/o indipendenti applicando la correzione di Bonferroni).

A causa delle ridotte dimensioni dei campioni, non sono stati effettuati confronti statistici tra i sessi sugli effetti dell’alloggiamento in canile. Tutte le analisi dei dati sono state eseguite mediante il sistema R-2.13.0 per Windows.

Risultati Per ottenere una visione d’insieme dell’attività generale dei cani alloggiati in gruppi, è stata effettua-

ta un’analisi descrittiva preliminare esaminando i dati dei 17 cani a T1. I cani alloggiati in gruppo hanno trascorso in media il 90% del proprio tempo inattivi, il 6,5% del tempo attivi e tutti gli altri comportamenti si sono manifestati per meno del 3% del tempo (ad es. interazioni sociali, comportamento alimentare). Sebbene la porzione maggiore di tempo sia trascorsa in modo inattivo, solo per il 42% di quel tempo i cani hanno, in realtà, riposato o dormito. Per il tempo rimanente, sono stati attenti, scrutando l’ambiente circostante. Le interazioni sociali si sono manifestate solo per lo 0,3% del tempo di osservazione totale. I cani hanno manifestato un comportamento giocoso per gran parte del tempo trascorso a interagire tra loro (77,33%), specie nei confronti dei compagni di recinto di sesso opposto (Figura 1). Le interazioni agonistiche (postura minacciosa, difensiva e rigida/alta) si sono manifestate con minore frequenza (17,84%), quasi sempre nei confronti di conspecifici dello stesso sesso (Figura 1).

Comportamenti a confronto Tutti i valori statistici per ciascun fattore dell’ANOVA a due vie sono riportati in Tabella II. Il test tra i gruppi non ha rivelato nel complesso notevoli differenze a T1, ad eccezione del comportamento di

a.

12000

Sperimentale

Controllo

Tempo (sec)

10000

9000 8500

8000

8000

6000

7500

4000

7000

2000

6500

0 T1

T2

T1

T2

T1

T2

T1

T2

b.

4000

Sperimentale

Controllo

Tempo (sec)

2000 3000 1500

2000

1000

1000 0

500 T1

T2

T1

T2

Figura 3. Variazioni comportamentali. Per le variabili comportamentali (a) decubito e (b) posizione quadrupedale, i box-plot rappresentano cambiamenti nella durata del comportamento tra le due fasi dello studio (T1 e T2) sia per i cani del gruppo sperimentale che per quelli del gruppo di controllo (confronti all’interno dello stesso gruppo). I grafici di interazione rappresentano la direzione del comportamento (linee tratteggiate crescenti o decrescenti) da T1 a T2 sia per il gruppo sperimentale (triangoli solidi) che per quello di controllo (cerchi solidi).

Veterinaria Italiana 2013, 49 (2), 219-230. doi: 10.12834/VetIt.2013.492.219.230

225

Dalla Villa et al.

Lungodegenza in canile e risposte comportamentali e fisiologiche

a.

8000

Sperimentale

Controllo

Tempo (sec)

5000 6000 4000 4000 3000 2000 2000 0 T1

b.

T2

Sperimentale

T1

T2

Controllo

T2

T1

T2

0,120 0,115

0,15 μg/dl

T1

0,110 0,105

0,10

0,100 0,095

0,05

0,090 0,00

0,085 T1

T2

T1

T2

Figure 4. Variazioni comportamentali e dei livelli di cortisolo. Per la variabile comportamentale (a) esplorazione visiva e per la variabile (b) concentrazione dei livelli di cortisolo, i box-plot rappresentano i cambiamenti tra le due fasi dello studio (T1 e T2) sia per i cani del gruppo sperimentale che per quelli del gruppo di controllo (confronti all’interno dello stesso gruppo). I grafici di interazione rappresentano la direzione del comportamento o della concentrazione di cortisolo (linee tratteggiate crescenti o decrescenti) da T1 a T2 sia per il gruppo sperimentale (triangoli solidi) che per quello di controllo (cerchi solidi). riposo. Tuttavia, la differenza non è stata confermata tramite analisi Post-hoc. Tale variabile è risultata anche altamente significativa per il fattore “tempo” dell’ANOVA. L’analisi Post-hoc ha mostrato un notevole incremento nella durata a T2 rispetto a T1 per entrambi i gruppi (IC controllo: U=5230,3; L=297,3; IC sperimentale: U=7926,1; L=2693,8).

Sei variabili (segnali comunicativi, decubito, posizione quadrupedale, trotto, esplorazione visiva e cammino) hanno mostrato un notevole effetto dei fattori “tempo” e “interazione tempo-gruppo”. Quando i cani sperimentali sono stati trasferiti dal confinamento di gruppo all’alloggiamento a coppie, è emerso un notevole calo della durata di due comportamenti attivi, trottare e camminare (Figura 2).

In media i cani hanno camminato l’86% in meno e hanno trottato il 95% in meno (Tabella III). L’espressione di altri tre comportamenti (decubito, posizione quadrupedale ed esplorazione visiva) è stata anche influenzata dal mutamento delle condizioni di confinamento (Figure 3 e 4). I cani sperimentali alloggiati nei box hanno trascorso notevolmente più tempo in posizione di decubito (IC T2-T1: U=4504,9; L=1387,5), notevolmente meno tempo in piedi (IC T2-T1: U=-755,6; L=-2627,3) ed esplo-

226

rando visivamente (IC T2-T1: U=-1953,8; L=-6010,4) rispetto all’alloggiamento di gruppo. Dopo il trasferimento nei box, la durata della manifestazione dei segnali comunicativi (annusare conspecifici e sguardo sociale) nei cani sperimentali è calata in media dell’86,7% (Tabella III). Ciononostante, secondo il test Post-hoc con applicazione della correzione di Bonferroni (p=0,039) la differenza non si è confermata significativa.

L’ANOVA ha evidenziato un significativo valore p per la variabile di esplorazione olfattiva (Tabella II).

Il test per campioni appaiati di Wilcoxon ha individuato un notevole calo tra T1 e T2 rispetto al periodo di tempo trascorso dal gruppo sperimentale nel mostrare tale comportamento (V=1, p= 0,015). Un incremento nel periodo di tempo medio trascorso per l’auto-grooming è stato osservato in entrambi i gruppi di cani (Tabella III). Tuttavia, i test Post-hoc hanno rivelato un incremento significativo soltanto per i cani di controllo (V=44, p=0,008).

Dall’analisi ANOVA sono emersi altri valori significativi come: scavare, scodinzolare, vocalizzi prolungati e comportamenti alimentari. Tuttavia, il confronto Post-hoc non ha confermato tali differenze.

Veterinaria Italiana 2013, 49 (2), 219-230. doi: 10.12834/VetIt.2013.492.219.230

Dalla Villa et al.

Confronto delle concentrazioni di cortisolo Da 102 campioni di saliva prelevati durante le due fasi dello studio, 5 sono stati scartati per insufficienza di materiale fisiologico. L’analisi è stata effettuata sui restanti 97 campioni. Il test ANOVA ha rivelato come i due gruppi di cani non differissero nei livelli di cortisolo a T1 (F=0,15, n.s.), ma che vi è stato un notevole effetto del fattore tempo (F=18,47, p<0,001).

La Figura 4 mostra un calo nel livello di cortisolo da T1 a T2, tale mutamento è risultato consistente per ambedue i gruppi di cani (interazione: F=0,01, n.s.).

Discussione I canili dovrebbero essere rifugi temporanei per i cani randagi e abbandonati in attesa di una nuova dimora. Sfortunatamente, i sistemi di adozione sono spesso inadeguati a far fronte al gran numero di cani che entrano nei canili, mentre le politiche di non soppressione aumentano le probabilità che un cane possa trascorrere il resto della vita in canile, qualora l’animale non riesca a trovare una sistemazione alternativa o una famiglia che lo adotti. In Italia vi sono attualmente circa 150.000 cani ospitati in canili, di cui il 41%, secondo le stime, sono cani adulti (di età superiore a 4 anni) con scarsa possibilità di essere adottati (dati non pubblicati). In tale situazione, le condizioni di alloggiamento (ossia lo spazio fornito, gli stimoli ambientali e sociali) potrebbero avere un considerevole impatto sul benessere dei cani.

Nel presente lavoro sono stati esaminati i potenziali effetti di due diverse condizioni di alloggiamento sul benessere di cani lungodegenti in canile. I cani alloggiati in gruppi hanno trascorso inattivamente buona parte del tempo d’osservazione e i livelli di attività (6,5%), in generale, sono stati inferiori a quelli registrati negli studi precedenti. Per esempio, Hubrecht e colleghi (15) hanno rilevato che i cani di canile sistemati in ampie recinzioni all’aperto (744 m2) hanno trascorso il 23,5% del loro tempo attivi a differenza dei cani da laboratorio in gruppi, sistemati in recinti al chiuso meno ampi (6,7 m2), che ne hanno trascorso il 19,1%. L’età dei soggetti potrebbe aiutare a spiegare alcune di queste differenze: nel presente studio, dai 5 ai 9 anni di età; nello studio di Hubrecht (15), 1,7 anni di età media. Poiché l’età e il periodo di tempo trascorso nel canile sembrerebbero influire sui livelli di attività dei cani (30), questi aspetti dovrebbero essere presi in considerazione nella determinazione delle strategie di confinamento per i cani. Gli animali del presente studio hanno trascorso poco tempo in attività locomotorie, con il trotto quasi assente quando i cani hanno alloggiato nelle recinzioni più piccole. Tali risultati convengono con quelli dei precedenti studi, mostrando cali nell’attività e nella locomozione dovuti a limitazioni sociali

Veterinaria Italiana 2013, 49 (2), 219-230. doi: 10.12834/VetIt.2013.492.219.230

Lungodegenza in canile e risposte comportamentali e fisiologiche

e di spazio (11, 15). Altri autori (6, 13) hanno rilevato un incremento nell’attività locomotoria in condizioni di alloggiamento più austere. Tale incremento è stato associato a elevati livelli di stress, sottolineando che l’attività di per sé non è necessariamente un buon indicatore di benessere.

La qualità dell’attività potrebbe essere rilevante a questo proposito. Le attività locomotorie stereotipate sono solitamente un segno di stress cronico e di scarse condizioni di benessere se associate all’alloggiamento a lungo termine (17). Le stereotipie sono state descritte nella categoria di comportamenti attivi ripetitivi dell’etogramma. Le attività ripetute non sono sempre un riflesso diretto di scarso benessere, ma potrebbero far parte di una strategia per far fronte a condizioni di stress (12, 13). Nel presente studio, i comportamenti attivi ripetuti (andatura rapida e girare in cerchio) si sono manifestati in modo sporadico (0,3% del tempo totale d’osservazione) in alcuni soggetti, specie in quelli alloggiati in gruppo, probabilmente in risposta a momenti di elevata eccitazione dovuta a stimoli esterni. Il comportamento inattivo ha presentato variazioni in relazione alle diverse condizioni di alloggiamento: i cani nei box hanno trascorso un tempo maggiore in posizione di decubito e i cani nei recinti di gruppo hanno trascorso più tempo in piedi. La postura quadrupedale si è rilevata più vantaggiosa nelle recinzioni all’aperto, in quanto il muro in cemento intorno al perimetro non ha consentito al cane di poter vedere l’ambiente esterno da una posizione sdraiata. Inoltre, i cani alloggiati in gruppi hanno trascorso un tempo maggiore attivi, camminando o trottando, aumentando il tempo trascorso in piedi anziché sdraiati. Sebbene non sia stato sempre possibile vedere se gli occhi del cane fossero aperti o chiusi, quando i cani si sono presentati sdraiati con la testa appoggiata a terra (comportamento di riposo), si è supposto che i soggetti stessero dormendo o riposando. È dimostrato che un ritorno a modelli di sonno ordinari rappresenta, in diverse specie, un indicatore dell’adattamento dell’animale a una situazione ambientale nuova (24). Hetts e colleghi (11) hanno rilevato che i soggetti che dormono di meno sono quelli confinati in condizioni più austere (ad es. isolati socialmente). Nel presente studio non sono stati documentati i modelli di riposo dei cani, ma si è osservato che i soggetti alloggiati a coppie hanno trascorso un tempo maggiore riposando (in media il 38,1% in più) rispetto alla condizione di alloggiamento in gruppo. Un ambiente inadatto potrebbe inibire gran parte dell’attività dell’animale, portando a una compromissione del suo stato di benessere.

Tuttavia, la medesima tendenza è emersa anche per i cani nel gruppo di controllo e nessun effetto della condizione di alloggiamento è stato rilevato dall’ANOVA. Pertanto, tale variazione non può essere considerata di per sé indicatore di uno stato di benesse-

227

Lungodegenza in canile e risposte comportamentali e fisiologiche

re compromesso. In studi futuri, misure psicologiche accurate dei modelli di sonno potrebbero fornire uno strumento attendibile per la valutazione della velocità di adattamento dei cani a nuove o diverse condizioni di alloggiamento.

L’auto-grooming è un altro comportamento la cui frequenza aumenta come conseguenza delle restrizioni sociali e di spazio (4). Sebbene le attuali conoscenze abbiano individuato qualche variazione di tale comportamento, questo non risulta legato al cambio di alloggio. Precedenti studi hanno anche osservato come i cani intraprendessero maggiormente l’auto-grooming unitamente ad un comportamento legato a ridotti stati di stress, di allerta e alla ricerca di attenzioni, rispecchiando forse un miglior livello di benessere (13, 23). Nel presente studio è stato rilevato solo un significativo effetto del fattore tempo nel gruppo di controllo. Considerato l’incremento dei tempi di riposo osservato, si potrebbe suggerire che tali variazioni fossero legate all’abitudine e ad una minore eccitazione dei cani.

Quando si valuta il benessere animale, l’attenzione va solitamente sugli indicatori di stress e sugli stati emotivi negativi (32). Tuttavia, un buono stato di benessere è il risultato di stati emotivi positivi: comportamenti giocosi e affiliativi, per esempio, sono spesso considerati indicatori di benessere (9). Sebbene il comportamento sociale si sia manifestato per solo lo 0,3% del tempo di osservazione complessivo, la descrizione e il target del tipo di interazione sociale possono spiegare le dinamiche sociali nel confinamento dei cani alloggiati in gruppo. Quando i cani hanno interagito con i conspecifici, i soggetti alloggiati nei recinti di gruppo hanno trascorso giocando buona parte del loro tempo d’interazione sociale.

Il gioco sociale si è manifestato principalmente nei confronti dei compagni di recinto di sesso opposto. I comportamenti agonistici (postura minacciosa, rigida/alta) sono stati rari, quando rilevati sono risultati principalmente diretti verso i compagni di recinto dello stesso sesso. Sebbene la scelta delle coppie da trasferire nei box non sia stata arbitraria, tali risultati tendono a supportare la scelta di abbinare animali di sesso opposto e compatibili per evitare problemi di gestione e aggressioni. Infatti, nella condizione di alloggiamento a coppie, le interazioni sociali sono state sempre positive (giocose e amichevoli), mentre il comportamento agonistico non si è mai presentato.

Un compagno di recinto appropriato in condizione di confinamento potrebbe aiutare ambedue gli animali a far fronte al nuovo ambiente, tuttavia si richiedono ulteriori studi al fine di determinare il valore di tale ruolo.

Come evidenziato in lavori precedenti, la presenza di altri conspecifici e di un ambiente arricchito può suscitare la manifestazione di un comportamento naturale (22). Il confinamento di gruppo ha fornito

228

Dalla Villa et al.

più stimoli sociali e ambientali (ad es. suolo, attrezzature, alberi) rispetto all’alloggiamento a coppie e, come previsto, i cani hanno manifestato comportamenti più esplorativi (visivi e olfattivi). Nel complesso, i confronti statistici e i valori medi hanno mostrato cani motivati a esprimere comportamenti quali: scavare nel terreno, dare segnali comunicativi e scodinzolare quando alloggiati nei recinti all’aperto rispetto all’alloggiamento a coppie. Tuttavia, tali differenze non sono state confermate dall’analisi Post-hoc. Una più ampia raccolta di dati potrebbe contribuire a chiarire tali risultati. Il cortisolo salivare è ritenuto una valida misura per la valutazione dello stress acuto e cronico nei cani (2, 5), sebbene elevate concentrazioni siano prodotte anche in risposta a momenti di eccitamento prolungato (13). Le attuali scoperte hanno individuato un notevole calo dei livelli di cortisolo, tra il primo e il secondo periodo della raccolta dati per ambedue i gruppi di cani, indipendente dal tipo di confinamento. Sebbene i livelli di cortisolo potrebbero essere stati influenzati dall’attesa di cibo, dall’arrivo del personale del canile o dalla manipolazione, è certo che il prelievo dei campioni di saliva è stato effettuato da veterinari del canile in maniera altamente standardizzata in entrambi gli intervalli di tempo, pertanto è improbabile che ciò sia stato l’origine di tale differenza.

Esaminando più in dettaglio i livelli basali di cortisolo salivare, riportati in altri studi, è stato rilevato che i dati sono piuttosto variabili. Beerda e collaboratori (5) hanno registrato un livello medio basale durante l’alloggiamento di gruppo all’aperto di 0,08 ± 0,01 µg/dl con notevoli variazioni tra le ore del mattino (prima delle ore 10,00) e il resto della giornata. In un altro studio (3) il livello basale rilevato è stato mediamente pari a 0,22 µg/dl e il campionamento effettuato dopo le ore 10,00. Horvath e collaboratori (14) hanno registrato una livello base medio di 0,12 ± 0,11 µg/dl durante il campionamento effettuato al mattino e di 0,07 ± 0,07 µg/dl durante il campionamento nel pomeriggio. Nel presente studio, il livello di cortisolo è stato in media di 0,12 ± 0,002 durante T1 e di 0,09±0,001 durante T2.

Di conseguenza è possibile asserire che fattori esterni (ad es.: variazioni di stagione, condizioni ambientali non documentate come parte dello studio) potrebbero aver influito su tale mutamento fisiologico, ma che i valori rilevati rimangano nel complesso entro i livelli basali della concentrazione di cortisolo salivare registrati per la specie. Un campionamento più frequente dei livelli di cortisolo (5) avrebbe potuto fornire una più chiara curva di adattamento dei soggetti alle condizioni di alloggio.

In termini di praticità, l’alloggiamento a coppie nei box risulta essere migliore: gli animali possono essere gestiti più facilmente, vi è un maggior grado di controllo sull’igiene e sullo stato sanitario e il rischio di interazioni agonistiche tra i compagni di recinto

Veterinaria Italiana 2013, 49 (2), 219-230. doi: 10.12834/VetIt.2013.492.219.230

Dalla Villa et al.

è ridotto (25, 31). Tuttavia, una gestione e un monitoraggio attento delle strutture adibite all’alloggiamento di gruppo possono ridurre buona parte dei rischi associati a questo sistema. Nel presente studio non si sono verificati gravi attacchi tra i cani alloggiati in gruppi e i dati clinici non hanno rivelato alcun aumento nella prevalenza di problemi sanitari rispetto all’alloggiamento a coppie.

Un calo generale in molte attività (ad es.: locomotorie, sociali ed esplorative) è stato rilevato quando i cani sono stati trasferiti dalla condizione di alloggiamento di gruppo a quella di alloggiamento a coppia, confermando che le restrizioni di spazio e la parziale deprivazione sociale possono aumentare l’inattività dei cani adulti lungodegenti in canile. Ciononostante, andrebbe rilevato che i cani alloggiati a coppie nel presente studio hanno avuto accesso, tutti i giorni, a recinti all’aperto e che il comportamento manifestato durante questo arco di tempo non è stato registrato. È possibile che correre e giocare durante i periodi di esercizio all’aperto possa aver ridotto nei cani il desiderio di attività esplorative, sociali e locomotorie quando questi si sono trovati nei loro box abituali. Sebbene notevoli variazioni nel comportamento siano state associate alle diverse condizioni di confinamento, non sono stati rilevati altri segni evidenti che indicassero come una forma di confinamento avesse ridotto più dell’altra il benessere di questi animali.

Identificare una condizione di confinamento a vita per i cani degenti in canile, che sia economicamente

Veterinaria Italiana 2013, 49 (2), 219-230. doi: 10.12834/VetIt.2013.492.219.230

Lungodegenza in canile e risposte comportamentali e fisiologiche

sostenibile e accettabile dal punto di vista etico, è una sfida notevole. Molti fattori concorrono ad aiutare un cane nel processo di adattamento quando si presenta un nuovo ambiente o una situazione impegnativa. I risultati del presente studio forniscono ulteriori spunti in merito agli effetti del confinamento sui cani lungodegenti in canile, concentrandosi sulle reazioni di animali adulti con esperienza in canile per 4 o più anni. Tali dati confermano anche che i parametri comportamentali sono indicatori sensibili delle reazioni del cane a nuovi ambienti di alloggio.

Le attuali procedure di gestione e ulteriori indagini in questo ambito dovrebbero concentrarsi sulla variabilità individuale e sull’identificazione di misure standard relative all’animale (ad es.: salute, stato fisico, comportamento, ecc.) per fornire un chiaro sistema di valutazione del benessere per i cani ospitati in canile.

Ringraziamenti Gli autori ringraziano Loredana Annunziata e Giampiero Scortichini per il supporto professionale e Fabrizio Palucci per il lavoro di traduzione in lingua italiana.

Finanziamento Questo progetto di ricerca è stato finanziato dal Ministero della Salute.

229

Lungodegenza in canile e risposte comportamentali e fisiologiche

Dalla Villa et al.

Bibliografia 1. Agresti A., & Finlay B. 2007. Statistical Methods for the Social Sciences, 2nd Ed. (Prentice Hall ed.), New Jersey, USA, 395-402.

2. Beerda B., Schilder M.B.H., Janssen N.S.C.R.M., & Mol J.A. 1996. The use of saliva cortisol, urinary cortisol and catecholamine measurements for a non-invasive assessment of stress responses in dogs. Horm Behav, 30, 272-279.

3. Beerda B., Schilder M.B.H., van Hooff J.A.R.A.M., de Vries H.W. & Mol J.A. 1998. Behavioural, saliva cortisol and heart rate responses to different types of stimuli in dogs. Appl Anim Behav Sci, 58, 365-381.

4. Beerda B., Schilder M.B.H., van Hooff J.A.R.A.M., de Vries H.W. & Mol J.A. 1999. Chronic stress in dogs subjected to social and spatial restriction. 1. Behavioural responses. Phisiol Behav, 66, 233-242.

5. Beerda B., Schilder M.B.H., van Hooff J.A.R.A.M., de Vries H.W. & Mol J.A. 1999. Chronic stress in dogs subjected to social and spatial restriction. II. Hormonal and immunological responses. Phisiol Behav, 66, 243-254.

6. Beerda B., Schilder M.B.H., van Hooff J.A.R.A.M., de Vries H.W. & Mol J.A. 2000. Behavioural and hormonal indicators of enduring environmental stress in dogs.

Animal Welfare, 9, 49-62.

7. Clark J.D., Rager D.R., Crowell-Davis S. & Evans D.L. 1997.

Housing and exercise of dogs: effects on behaviour, immune function, and cortisol concentration. Lab Anim Sci, 47, 500-510.

8. Dalla Villa P., Kahn S., Stuardo L., Iannetti L., Di Nardo A. & Serpell J.A. 2010. Free-roaming dog control among OIE-member countries. Prev Vet Med, 97, 58-63.

9. Fraser D. & Duncan I.J. 1998. ‘Pleasures’, ‘pains’ and animal welfare: toward a natural history of affect.

Animal Welfare, 7, 383–396.

10. Hennessy M.B., Davis H.N., Williams M.T., Mellott C. & Douglas C.W. 1997. Plasma cortisol levels of dogs at a county animal shelter. Physiol Behav, 62, 485-490.

11. Hetts S., Clark J.D., Calpin J.P., Arnold C.E. & Mateo J.M. 1992. Influence of housing conditions on beagle behaviour. Appl Anim Behav Sci, 34, 137-155.

12. Hewson C.J., Hiby E.F. & Bradshaw J.W.S. 2007.

Assessing quality of life in companion and kennelled dogs: a critical review. Animal Welfare, 16, 89-95.

13. Hiby E.F., Rooney N.J. & Bradshaw J.W.S. 2007.

Behavioural and physiological responses of dogs entering re-homing kennels. Physiol Behav, 89, 385-391.

14. Horvath Z., Igyarto B.-Z., Magyar A. & Miklosi A. 2007.

Three different coping styles in police dogs exposed to a short-term challenge. Horm Behav, 52, 621-630.

15. Hubrecht R.C., Serpell J.A. & Poole T.B. 1992. Correlates of pen size and housing conditions on the behaviour of kennelled dogs. Appl Anim Behav Sci, 34, 365-383.

16. Hubrecht R.C. 1993. A comparison of social and environmental enrichment methods for laboratory housed dogs. Appl Anim Behav Sci, 37, 345-361.

230

17. Hubrecht R.C. 2002. Comfortable quarters for dogs in research institutions. In Comfortable quarters for Laboratory Animals 2nd Ed. (V. Reinhardt & A. Reinhardt, ed). Animal Welfare Institute, Washington DC, USA, 56-64.

18. Hughes H.C. & Campbell S.A. 1990. Effect of primary enclosure size and human contact. In Canine Research Environment (J.A. Mench & E. Krulisch, ed). Scientists Center for Animal Welfare, Bethesda MD, USA, 66-73.

19. Italian Law, 281/1991. Legge quadro in materia di animali d’affezione e prevenzione del randagismo. Off J, 203, 30 August 1991.

20. Matteri R.L., Carroll J.A. & Dyer C.J. 2000.

Neuroendocrine response to stress. In The Biology Of Animal Stress (G.P. Moberg & J.A. Mench, ed). CABI Publishing, Wallingford UK, 43-76.

21. Meers L., Normando S., Odberg F.O. & Bono G. 2004.

Behavioural responses of adult beagles to interruption in a walking program. In Proc. Companion Animal Behaviour Therapy Study Group Study Day, 31st March 2004, (Heath S.E. ed.), Birmingham, 41-42.

22. Mertens P.A. & Unshelm J. 1996. Effects of group and individual housing on the behaviour of kennelled dogs in animal shelters. Anthrozoos, 9, 40-51.

23. Rooney N.J., Gaines S.A. & Bradshaw J.W.S. 2007.

Behavioural and glucocorticoid responses of dogs (Canis familiaris) to kennelling: investigating mitigation prior to habituation. Phisiol Behav, 92, 847-854.

24. Ruckebusch Y. 1975. The hypnogram as an index of adaptation of farm animals to changes in their environment. Appl Anim Ethol, 2, 3-18.

25. Sonderegger S.M. & Turner D.C. 1996. Introducing dogs into kennels: prediction of social tendencies to facilitate integration. Animal Welfare, 5, 391-404.

26. Stephen J.M. & Ledger R.A. 2006. A longitudinal evaluation of urinary cortisol in kennelled dogs, Canis familiaris. Phisiol Behav, 30, 911-916.

27. Tuber D.S., Hennessy M.B., Sanders S. & Miller J.A. 1996.

Behavioural and glucocorticoid responses of adult domestic dogs (Canis familiaris) to companionship and social separation. J Comp Psychol, 110, 103-108.

28. Tyson E.J. 2005. Behavioural and physiological measures of stress in dogs (Canis familiaris) in a rescue shelter. Thesis, Royal School of Veterinary Studies, University of Edinburgh UK. 29. Weipkema P.R. & Schouten W.P.G. 1990. Mechanisms of coping in social situations. In Social stress in domestic animals (R. Zayan & R. Dantzer, ed). Kluwer Academic Publishers, Dordrecht, Boston and London, 8-24.

30. Wells D.L., Graham L. & Hepper P.G. 2002. The influence of length of time spent in a rescue shelter on the behaviour of kennelled dogs. Animal Welfare, 11, 317–325.

31. Wells D.L. 2004. A review of environmental enrichment for kennel dogs, Canis familiaris. Appl Anim Behav ScI, 85, 307-317.

32. Yeates J.W. & Main D.C.J. 2008. Assessment of positive welfare: a review. Vet J, 175, 293-300.

Veterinaria Italiana 2013, 49 (2), 219-230. doi: 10.12834/VetIt.2013.492.219.230

Behavioural and physiological responses of shelter dogs to long-term confinement Paolo Dalla Villa1, Shanis Barnard1, Elisa Di Fede1, Michele Podaliri1, Luca Candeloro1, Antonio Di Nardo1, Carlo Siracusa2 & James A. Serpell2 1

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy p.dallavilla@izs.it 2 Dep. Clinical Studies, School of Veterinary Medicine, University of Pennsylvania, 3850 Spruce Street, Philadelphia, PA 19104-6010, USA

Keywords Animal welfare, Behaviour, Canis familiaris, Cortisol, Dog, Long-term confinement, Rescue shelter.

Summary In Italy, National Law (281/1991) prohibits euthanasia of shelter dogs if they are not dangerous or suffering seriously. Adoption rates in rescue shelters are often lower than entrance rates, leading inevitably to overcrowded facilities where animals are likely to spend the rest of their lives in kennels. In this situation, housing conditions (i.e. space provided, environmental, and social stimulation) may have an impact on canine welfare. In this research project, the effects of two different forms of housing (group- and pair housing) on long-term shelter dogs were compared using behavioural and physiological parameters. Observational data and saliva samples were collected from dogs exposed to both experimental settings; behaviour and cortisol concentration levels were used as welfare indicators. Pair housing offered fewer social and environmental stimuli and behavioural analysis showed a significant decrease in locomotor, exploratory, and social behaviour. Cortisol levels show that this parameter varied independently of housing conditions. Although this study found no evidence suggesting that one form of confinement reduced animal welfare more than the other (e.g. in terms of abnormal behaviour, or higher cortisol concentrations), the type of confinement did affect the expression of a variety of behaviours and these variations should not be ignored with respect to housing decisions for long-term shelter dogs.

Veterinaria Italiana 2013, 49 (2), 231-241. doi: 10.12834/VetIt.2013.492.231.241

Introduction Canine populations are increasing worldwide and in many countries free-roaming dogs represent a significant public health problem due to the risks of dog attacks on people and livestock, zoonoses and car accidents. Different strategies can be applied to the management of free-roaming populations, shelters being one of the most important (8). The confinement of an animal generally implies physical restriction, impoverished environments, social isolation, and little control over, or ability to predict, events. Italian National Law (19) on ‘companion animals and stray dog population control’ prohibits euthanasia of shelter dogs if they are not dangerous or seriously suffering. This leads inevitably to overcrowded facilities where animal welfare is a major issue. It is therefore important to move toward a model of dog management and housing based on high standard levels of welfare.

Centuries of artificial selection have generated high levels of genetic and morphological diversification in the domestic dog. Breed, temperament, and

previous experience of confinement have all been shown to play a significant role in dogs’ ability to cope with subsequent confinement (6, 12, 13, 14), and these variables should normally be taken into account when studying dogs’ adaptation to kenneling. However, when studying shelter populations, animals are mostly mixed breed adults of unknown background. Hence, in these circumstances, welfare measures should be able to detect the state of each animal in that specific environment regardless of its history.

Previous studies have succeeded in describing welfare indicators of dogs confined in different kennel environments, mainly based on behavioural and physiological parameters (10, 15, 27, 28).

Behavioural parameters also give important information on animal needs and preferences, while being non-invasive and easily observable.

Beerda and colleagues (3) have identified specific behavioural patterns shown in response to experimentally induced stress challenges, and similar results were found in later research (14, 23). Specifically, it has been demonstrated that

231

Dalla Villa et al.

Shelter dogs and long term confinement

consequences of inappropriate confinement conditions and of social isolation are a decrease in activity, excessive autogrooming and vocalisations, and alterations in exploratory and locomotor behaviour and sleep patterns. Other studies, analysing the effects of confinement on dogs, suggest that kennel size per se does not affect significantly the quantity of behaviour but does influence the quality of activities (7, 11). It is now widely accepted that the quality of the housing environment plays a crucial role in animal welfare (16); the ideal environment should offer sufficient stimuli to motivate the expression of most normal canine behaviour. Dogs in shelters, however, typically spend most their time inactive (16, 21). Hughes and Campbell (18) reported an average time of 30-90 min a day dogs spent active regardless of cage size (1 m2 vs 7 m2) or access to a large outdoor pen. What differed between housing conditions was the distance travelled per day, suggesting that larger spaces may encourage the dogs to run or trot. Activity increases when dogs are socially or environmentally stimulated (17). Grouphousing, for example, provides a relatively complex environment that encourages locomotor activity, olfactory exploration, and social interaction.

Previous studies that focused on the effect of group-housing in comparison to isolation (4, 5, 15) demonstrated that isolation has negative effects on dogs’ welfare. Other studies have highlighted improved welfare indicators with pair-housed dogs compared to those housed individually (6, 11).

Some authors, however, report that group-housing is often avoided since it seems to increase the risk of disease transmission and aggressive behaviour between conspecifics (29).

Glucocorticoids, in the form of cortisol, are physiological markers commonly used for the assessment of welfare (2) since their concentrations reflect reliably the activity of the stress responsive hypothalamic-pituitary-adrenal axis (20). Higher cortisol concentrations have been found in confined dogs compared to pet dogs living at home, and in socially isolated dogs compared to dogs housed in groups (6, 13, 26). Urinary and salivary cortisol are reliable and less invasive alternatives to plasma cortisol (2).

There is evidence that the length of time in a rescue shelter influences the behaviour of kennelled dogs, however the effects of long-term confinement on canine welfare are still unclear and need further investigation (12, 30). The present study builds on earlier work in this area and seeks to provide further insight on how housing affects the welfare of shelter dogs in the long-term. More specifically, the effects of two different forms of confinement were analysed by means of established behavioural and physiological parameters.

232

Materials and methods Animals and experimental conditions Seventeen dogs (7 females, 10 males) were chosen among those housed at the animal shelter of Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ in Teramo, Italy. All were adult dogs (between 5 and 9 years old) that had lived in the shelter for four years or more at the time of observation. All dogs were medium-large size and not ascribable to any specific breed, although the majority could be described as crosses of herding or shepherd breeds. All animals were spayed or neutered, and declared healthy by shelter veterinarians.

Groups of dogs were formed during a pre‑experimental phase that lasted 4 months.

Daily sessions of group socialisation were carried out in order to identify compatible dogs. At the end of this process, the four experimental groups were identified, and they were housed in their experimental pens. To allow habituation to the new environment, data collection started one month after the introduction to the new housing. The first data collection (Time 1, T1) was carried out in the following experimental setting: dogs were all housed in the same confinement conditions, in groups of 4-5 animals of both sexes, in four outdoor enclosures of about 35 m2 each. See-through wire mesh ran along all sides of the enclosures, cemented into a 50 cm high concrete wall. The pens were adjacent to one another. An 11 m2 roof, with beds underneath, covered a portion of the pen to give protection from the sun and bad weather. The ground was unpaved soil. Dogs were fed once in the morning with dry pellets, and fresh water was available at all times. To avoid competitive behaviour, dogs were accustomed to being tethered to the fence with a 1 m leash during feeding. Dogs remained confined in their pen environment at all times.

Once the first data collection period was over, eight dogs (4 females and 4 males) housed in two of the four enclosures, were transferred in pairs to smaller enclosures (6 m2). These dogs were defined as the experimental group, while the remaining nine dogs were left in the same two original outdoor enclosures as a control group. To avoid management problems and undesired aggressive behaviour that could compromise dogs’ safety or the accomplishment of the study, pen-mates were selected based on prior histories of positive interaction within the grouphousing condition. Pairs were all composed of one male and one female. The smaller enclosures were totally covered by a roof, and had visually transparent fencing at the front. Adjacent pens were separated by 1 m high solid partitions with wire mesh above.

Veterinaria Italiana 2013, 49 (2), 231-241. doi: 10.12834/VetIt.2013.492.231.241

Dalla Villa et al.

Shelter dogs and long term confinement

Wooden sleeping platforms (100 x 120 cm) were placed on the floor of each pen as resting places.

These enclosures had access to a common fenced area (120 m2) where dogs were allowed to exercise in pairs for 2 h/day, usually in the morning during cleaning routines. The feeding routine was the same as previously described. Dogs were allowed to acclimatize to the new confinement condition for one month before commencement of the second data collection (Time 2, T2).

Data collection Data collection was standardised for all groups of dogs during both T1 and T2. Behavioural data were collected by video recording dogs’ activities during two daily sessions, for three consecutive days: 40 min in the morning before feeding time (06.15h-06.55h) and 40 min in the afternoon (17.15h-17.55h). All recordings were carried out in the absence of staff activities, cameras were fixed and an operator was

Table I. Behavioural categories and variables recorded during the study and measured as frequencies (f) or durations (d) of occurrence.

Category Active behaviour

Inactive behaviour

Active repetitive

Social interactionb

Behaviour Walking Trotting Jumping Hind legs Lying Sitting Standing Resting Circling Pacing Social pacing Tail chasing Wall bouncing Amicable Play Threat Rigid/high posture Defensive Mount dog Sniffing doga Social looka

Other

Tail Environment exploration Alimentary

Autogrooming Digging Out of sight Shadea Barking Shaking off Stretching Prolonged vocalisationsa Tail wagginga Tail low/curleda Visual explorationa Olfactory explorationa Drinking Chewing Urinating Defecating Coprophagy

Definition Ambulatory gait Trotting gait Jumping on the kennels’ roof Standing on hind legs using forelegs against a wall/fence to support the body Sternal or lateral recumbence Sit on hind legs Standing on four legs The subject is sleeping, or lying with head touching the ground Repetitive circling around pen Repetitive pacing usually along a fence Repetitive pacing along fence in parallel with a dog on the other side Repetitive chasing of tail Repetitive jumping at wall, rebounding off it Lick, paw or allogrooming dog, often with tail wag Bow, short charges with bouncing gait, play face, wrestle, play chase Raise hackles, aggressive vocalisations, lunge toward dog Focus animal is standing with rigid posture, head and tail are elevated high, mouth is shut, no or very narrow tail wagging, T or parallel position with other dog Avoid dog, increase distance, or cower, roll over Focal dog mounting/ mounted of/by another dog Focal animal noses another dog Focal animal orients toward another dog and keeps eye contact, usually this is associated with a change in tail movement and/or tail position Behaviour directed towards the subject own body, like scratching, licking and self-biting Dig at ground with fore paws The subject is not visible, usually inside a kennel or behind a barrier The subject is in a poor light so it is not possible to see facial expressions Staccato, short vocalisations Oscillate vigorously the head and body on its longitudinal axis Stretching of the body and limbs Including howling and whining Repetitive wagging movements of the tail Tail is curled between hind legs, and posture is usually low The subject observing the environment or the pennmates inside the enclosure Nose moved along the ground or other objects with clear sniffing movements Drink water Chew non nutritive material Urinate with one leg cocked or in squatting position Excreting the contents of the bowels Eat own or other dog's foeces

f/d d d d d d d d d d d d d d d d d d d d d d d d d d f f f d d d d d f f f f f

(a) Non-exclusive behaviour: can occur together with other behaviours. (b) When recording social behaviour, the recipient was also recorded, identifying it as: a same sex pen-mate; an opposite sex pen-mate; a dog in the adjacent pen.

Veterinaria Italiana 2013, 49 (2), 231-241. doi: 10.12834/VetIt.2013.492.231.241

233

Dalla Villa et al.

Shelter dogs and long term confinement

in charge of turning them on and off, leaving the place during recordings. Since dogs can react more intensely to the arrival of a human attendant (18), the first and the last 5 min of each recording session were discarded from the analysis. Video analyses were carried out using a dedicated data recording system (The Observer XT 8.0, Noldus, The Netherlands) on the basis of an existing ethogram (15). A total of 38 behaviours were observed, and related patterns of behaviour were grouped together into distinct categories (Table I). Behavioural frequencies and duration of occurrences were recorded continuously during each 30 min observation bout, for a total of 180 min of recordings for each time period and for each of the 17 dogs included in the study.

Cortisol was assayed from saliva samples taken from all dogs in the study. To control for within-subject variability, cortisol was sampled from each dog for three consecutive days during both observation periods of the study (T1 and T2), immediately after the morning video recordings and when dogs were tethered before food administration.

The three-day average value was considered as representative of the cortisol level of each dog during each observation phase. Saliva samples were collected from dogs’ cheek pouches using Salivette® cortisol system (Starstedt, Verona, Italy).

Saliva collection was carried out by the same shelter veterinarians familiar with the dogs, and it was done in a standardised way in less than 3 min to avoid measuring biased cortisol levels induced by manipulation. Samples were stored at –25°C until further analysis. Cortisol determination was carried out through immunoassay using the commercially available kit Salivary Cortisol (Salimetrics, State College, USA) and following the guidelines of the manufacturer.

further analysis. Due to the low percentage of expression, some behaviours were also pooled and considered as single variables: for example, circle and pace were analysed as active repetitive category; amicable, play, threat, rigid/high posture, defensive were analysed as social interaction category; sniff dog and social look (non-exclusive behaviour) were analysed as communicative signals. For all behaviours included in the ethogram category social interaction, data were weighted according to the number of subjects present in each enclosure, and the recipient was recorded as either same sex pen-mate, opposite sex pen-mate, or dog in adjacent pen.

To test for each main effect (group and time) as well as their interaction, a two-way ANOVA with repeated measures on one factor was performed for all variables. Given that the same subject was observed twice (T1 and T2), time was treated as the within-subjects factor while group (experimental or control) was considered the between-subject factor. Although statistical analysis was considered sufficiently robust (since the assumption of homogeneous samples was respected), data distributions were visually inspected through box‑plots to detect any deviations from normality.

Differences between and within groups were also calculated by 95% confidence intervals (CI) pair-wise comparisons, according to (1). As three comparisons were performed (two comparisons between times within the same group and one comparison between groups at T1), to control for the overall error rate, confidence intervals were calculated using Bonferroni correction (so the type I error rate was corrected to 0.05/3=0.0167). Whenever variable distributions appeared to be different from normal based on visual inspection, non-parametric

Data processing and statistical analysis

234

30

Positive social Agonistic

25 20

Sec

Before statistical analysis could be carried out, data adjustments were applied for both behavioural and cortisol measures. Since dogs were at times not visible (e.g. inside a kennel or behind a visual barrier), and supposing that dogs’ behaviour was the same when not within sight of the camera, raw behavioural data were calculated as a percentage of time during which the focal animals were visible. Each variable was corrected multiplying it for an adjustment coefficient (k) equal to the total observational time (Tt = 10,800 sec) divided by the visible time (Tt - x), x being the time the animal was not visible (i.e. out of sight, hidden in shade). Some of the behaviours listed in the ethogram were either never recorded (i.e. jump, mount dog, chew, social pace, tail chase, wall bounce) or recorded just once (tail low/curled between hind legs, coprophagy); these behaviours were therefore discarded from

15 10 5 0 Same sex

Opposite sex

Adjacent pen

Recipient

Figure 1. Social behaviour at Time 1. Recipients of positive (play, amicable) and agonistic (rigid/high posture, defensive, threat) social behaviour at T1 during group housing.

Veterinaria Italiana 2013, 49 (2), 231-241. doi: 10.12834/VetIt.2013.492.231.241

Dalla Villa et al.

Shelter dogs and long term confinement

statistical tests (Wilcoxon Rank Sum Test for paired and/or independent samples applying Bonferroni correction) were also performed.

Due to small sample sizes, between-sex statistical comparisons of the effects of housing were not carried out. All data analyses were carried out using R-2.13.0 for Windows software.

Results To obtain an overview of the general activity of dogs housed in groups, a preliminary descriptive analysis was carried out looking at the data collected for all 17 dogs at T1. Dogs housed in groups spent an average 90% of their time inactive, 6.5% of their time active and all other behaviours were shown for less than 3% of the time (e.g. social interactions, alimentary behaviour). Although the greater portion of the time was spent inactive, only for 42% of that time were dogs actually resting or asleep. The remaining time they were attentive, and scanning the environment visually. Social interactions were shown for only 0.3% of the total observation time. Dogs showed play behaviour for the greatest portion of the time spent in social interactions (77.33%), especially towards opposite

sex pen-mates (Figure 1). Agonistic interactions (threat, defensive, and rigid/high posture) were shown less frequently (17.84%) and almost always towards same sex conspecifics (Figure 1).

Behavioural comparisons All statistical values and levels of significance for each factor of the two-way ANOVA are presented in Table II. The between-subjects test revealed no significant overall differences between groups of dogs at T1, with the exception of resting behaviour.

However, this difference was not confirmed by post-hoc analysis. This variable was also highly significant for ANOVA factor ‘time’, post-hoc showed a significant increase in duration at T2 compared to T1 for both groups (CI control: U=5,230.3; L=297.3; CI experimental: U=7,926.1; L=2,693.8).

‘Time’ and ‘time by group interaction’ factor significantly affected six variables (communicative signals, lying, standing, trotting, visual exploration, and walking). A significant drop in duration emerged for two active behaviours, trotting and walking (Figure 2), when experimental dogs were transferred from group confinement to pair housing. On average, dogs walked 86% less and trotted 95% less (Table III). The expression of three other behaviours

Table II. Two-Way ANOVA with repeated measures on one factor (Time).

Variable Active repetitive Autogrooming Barking Communicative signals Defecating Digging Drinking Hind legs Lying Olfactory exploration Prolonged vocalisations Resting Shaking off Sitting Social interaction Standing Stretching Tail wagging Trotting Urinating Visual exploration Walking

Between-subjects effects Group F-statistic p-value 1.82 0.197 4.20 0.058 0.24 0.635 1.77 0.203 0.06 0.809 2.83 0.113 0.38 0.545 1.84 0.195 1.31 0.270 0.08 0.780 0.08 0.779 6.16 0.025 1.65 0.218 2.13 0.165 1.27 0.278 0.59 0.453 0.33 0.573 0.12 0.739 0.06 0.811 0.83 0.378 0.38 0.549 0.06 0.811

Within-subjects effects Time F-statistic 1.66 6.15 2.14 4.82 0.12 2.40 0.08 3.17 24.13 0.76 7.31 35.36 0.13 0.06 1.84 12.97 1.86 0.34 7.59 0.14 16.07 8.57

p-value 0.217 0.025 0.164 0.044 0.738 0.142 0.778 0.095 0.000 0.398 0.016 0.000 0.720 0.810 0.195 0.003 0.193 0.568 0.015 0.718 0.001 0.010

Interaction F-statistic p-value 2.42 0.141 1.36 0.261 2.72 0.120 11.35 0.004 0.89 0.360 5.43 0.034 12.55 0.003 0.91 0.355 5.60 0.032 5.86 0.029 2.20 0.159 3.64 0.076 2.44 0.139 0.06 0.813 1.61 0.224 10.86 0.005 0.00 0.992 4.75 0.046 8.90 0.009 13.49 0.002 12.17 0.003 14.65 0.002

Signifcant P values (< 0.05) are in bold.

Veterinaria Italiana 2013, 49 (2), 231-241. doi: 10.12834/VetIt.2013.492.231.241

235

Dalla Villa et al.

Shelter dogs and long term confinement

a.

250

Experimental

Control 100

200 Time (sec)

80 150 60 100

40

50

20

0 T1

b.

1500

T2

T2

T1

Experimental

T1

T2

T1

T2

Control

Time (sec)

800 100

600 400

500

200

0 T1

T2

T2

T1

Figure 2. Behavioural variations. For the behavioural variables (a) trotting and (b) walking, box-plots represent changes in the duration of the behaviour between the two phases of the study (T1 and T2) for both experimental and control dogs (within-group comparisons); interaction plots represent the direction of the behaviour (increasing or decreasing dashed lines) from T1 to T2 for both experimental (solid triangles) and control (solid circles) group.

Table III. Mean osservational time (±SEM) recorded for each behaviour.

Variable Active repetitive Autogrooming Barking Communicative signals Defecating Digging Drinking Hind legs Lying Olfactory exploration Prolonged vocalisations Resting Shaking off Sitting Social interaction Standing Stretching Tail wagging Trotting Urinating Visual exploration Walking

Control group T1 (s) 7.2±1.1 30.8±6.1 140.0±11.2 70.9±5.8 0.4±0.1 0 0.4±0.1 238.8±49.2 6406.1±233.2 299.7±14.4 9.6±1.0 2110.9±215.4 1.7±0.1 577.0±88.9 33.3±6.6 1723.8±70.9 2.1±0.4 436.6±45.6 63.5±4.7 0.4±0.1 4170.0±280.8 435.5±31.4

T2 (s) 13.7±2.06 169.0±29.6 149.1±22.1 114.4±13.7 0.8±0.2 7.2±1.8 3.4±0.3 156.8±26.0 7470.4±185.0 487.1±53.7 21.9±4.3 4874.7±165.9 4.2±0.3 574.6±77.1 67.0±10.5 1605.9±95.1 3.7±0.2 734.6±73.7 64.5±6.7 4.1±0.3 3798.0±199.5 510.1±34.2

Experimental group T1 (s) 111.5±26.6 210.7±52.9 355.9±38.8 295.2±18.8 0.6±0.1 44.9±8.1 3.9±0.5 35.5±5.3 6222.7±214.3 654.7±37.2 0 2565.2±221.1 7.8±0.4 209.5±35.0 11.6±7.2 2248.2±136.1 2.9±0.3 803.0±106.0 111.3±11.2 6.1±0.9 5521.4±159.0 898.2±92.8

T2 (s) 4.9±1.7 583.5±61.7 34.7±4.7 39.3±4.7 0.4±0.1 0 1.0±0.2 12.0±3.6 9168.9±145.2 198.0±16.3 40.3±6.4 7875.1±249.2 3.2±0.4 146.1±20.8 11.8±3.4 556.8±75.4 4.5±0.7 216.0±49.3 5.1±0.8 1.0±0.1 1539.3±138.2 132.5±18.7

T1 represents the first observational period where all dogs were group-housed in outdoor pens.

T2 represents the second observational period where dogs of the experimental group were pair-housed while the control group was left in the same outdoor pens.

236

Veterinaria Italiana 2013, 49 (2), 231-241. doi: 10.12834/VetIt.2013.492.231.241

Dalla Villa et al.

Shelter dogs and long term confinement

(lying, standing, and visual exploration) was also influenced by the change in the confinement conditions (Figures 3 and 4a). Experimental dogs in pair housing spent significantly more time lying (CI T2‑T1: U=4,504.9; L=1,387.5) and significantly less time standing (CI T2-T1: U=-755.6; L=-2,627.3) and showing visual exploration (CI T2-T1: U=-1,953.8; L=‑6,010.4) compared to group-housing. After being transferred to the smaller enclosure, the duration of the expression of communicative signals (i.e. sniff dog, social look) by experimental dogs dropped on average by 86.7% (Table III). Despite this, the difference was not significant according to the post‑hoc test applying Bonferroni correction (p=0.039).

ANOVA results highlighted a significant p-level for the olfactory exploration variable (Table II).

Wilcoxon pair test detected a significant decrease between T1 and T2 in the time spent by the experimental group showing this behaviour (V=1, p= 0.015). An increase in the average time spent autogrooming was observed in both groups of dogs (Table III). However, post-hoc tests revealed that this increase was only significant for control dogs (V=44, p=0.008).

Other overall significant values emerged from ANOVA analysis, concerning digging, tail wagging, prolonged vocalizations, and alimentary behaviour.

However, post-hoc comparison did not confirm these differences.

Cortisol comparison Five saliva samples, out of a total of 102 collected during the two phases of the study, were discarded due to insufficient physiological material. Analysis was carried out on the remaining 97 samples. ANOVA test revealed that the two groups of dogs did not differ in cortisol levels at T1 (F=0.15, n.s.), but time had a significant effect (F=18.47, p<0.001). Figure 4 shows that there was a decrease in cortisol levels from T1 to T2, and that this change was consistent for both groups of dogs (interaction: F=0.01, n.s.).

Discussion Rescue shelters should be temporary refuges for stray and abandoned dogs waiting to be re‑homed. Unfortunately, adoption systems are often insufficient to overcome the large numbers of dogs entering shelters, while no‑kill policies ensure that, if a dog fails to find a new home, it is likely to spend the rest of its life in shelter housing.

In the Italian context there are currently around 150,000 shelter dogs 41% of which are estimated to be adult dogs (over 4 years old) with almost no

a.

12000

Experimental

Control

Time (sec)

10000

9000 8500

8000

8000

6000

7500

4000

7000

2000

6500

0 T1

T2

T1

T2

T1

T2

T1

T2

b.

4000

Experimental

Control

Time (sec)

2000 3000 1500

2000

1000

1000 0

500 T1

T2

T1

T2

Figure 3. Behavioural variations. For the behavioural variables (a) lying and (b) standing, box-plots represent changes in the duration of the behaviour between the two phases of the study (T1 and T2) for both experimental and control dogs (within-group comparisons); interaction plots represent the direction of the behaviour (increasing or decreasing dashed lines) from T1 to T2 for both experimental (solid triangles) and control (solid circles) group.

Veterinaria Italiana 2013, 49 (2), 231-241. doi: 10.12834/VetIt.2013.492.231.241

237

Dalla Villa et al.

Shelter dogs and long term confinement

a.

8000

Experimental

Control

Time (sec)

5000 6000 4000 4000 3000 2000 2000 0 T1

b.

T2

T1

Experimental

T2 Control

T2

T1

T2

0.120 0.115

0.15 μg/dl

T1

0.110 0.105

0.10

0.100 0.095

0.05

0.090 0.00

0.085 T1

T2

T1

T2

Figure 4. Behavioural and cortisol variations. For the behavioural variable (a) visual exploration and for the (b)cortisol concentration levels, box-plots represent changes between the two phases of the study (T1 and T2) for both experimental and control dogs (within-group comparisons); interaction plots represent the direction of the behaviour or cortisol concentration (increasing or decreasing dashed lines) from T1 to T2 for both experimental (solid triangles) and control (solid circles) group.

chance of being adopted (unpublished data). In this situation, housing conditions (i.e. space provided, environmental and social stimulation) may have a considerable impact on canine welfare. In this paper, the potential welfare effects of two different housing conditions on long‑term shelter dogs were examined.

When dogs were housed in groups they spent most of the observed time inactive, and activity levels (6.5%) in general were lower than those recorded in previous studies. For example, Hubrecht and colleagues (15), found that shelter dogs housed in large outdoor enclosures (744 m2) spent 23.5% of their time active, while laboratory group-housed dogs in smaller indoor pens (6.7 m2) spent 19.1%.

The age of the subjects may help to explain some of these differences: in the current study animals were older adults (from 5 to 9 years old), whereas in Hubrecht’s (15) study subjects were younger (mean age 1.7 years old). Since age and time spent in shelters seems to affect activity levels of dogs (30), these elements should be taken into consideration when determining confinement strategies for dogs. Dogs in the current study spent little time in locomotor activities, and trotting was almost absent when housed in the smaller enclosures compared to the larger ones. These results concur with those

238

of previous studies, showing decrease in activity and locomotion due to social and spatial restriction (11, 15). Other authors (6, 13) found an increase in locomotor activity in more austere housing conditions. This increase was associated with high stress levels, underlining the fact that activity per se is not necessarily a good indicator of welfare. The quality of activity may be important in this respect.

Stereotypic locomotor activities are usually a sign of chronic stress and poor welfare conditions when associated with long-term housing (17). Stereotypies were described in the active repetitive category of the ethogram. Repetitive activities are not always a direct reflection of poor welfare, but they might be part of a strategy to cope psychologically with stressful conditions (12, 13). In the present study active repetitive behaviours (i.e. pacing and circling) were shown sporadically (0.3% of total observation time) by some individuals mainly in group-housing, probably in response to moments of high arousal caused by external stimuli.

Inactive behaviour differed between housing conditions: dogs housed in pairs, spent more time in a lying position while dogs housed in groups spent more time in a standing posture. The standing posture was more advantageous in the outdoor enclosures since the concrete wall around the

Veterinaria Italiana 2013, 49 (2), 231-241. doi: 10.12834/VetIt.2013.492.231.241

Dalla Villa et al.

Shelter dogs and long term confinement

perimeter did not allow visibility of the external environment from a recumbent position. Moreover, dogs in the group-housing condition spent more time active, walking or trotting, increasing the time spent standing rather than lying down. Although it wasn’t always possible to see if a dog’s eyes were open or closed, when dogs were lying with their head down (recorded as resting behaviour), it was likely that subjects were either sleeping or resting. There is evidence that a return to normal sleep patterns in different species is an indicator of the animal’s adaptation to a new environmental situation (24). Hetts and colleagues (11) found that subjects confined in more austere conditions (i.e. socially isolated) slept less. We did not record dogs’ sleeping patterns, but it was observed that subjects in the pair housing condition spent longer time resting (on average 38.1% more) compared to when they were group-housed. Poor environment could inhibit most of the animal’s activity leading to an impairment of its welfare. However, the same trend emerged also for the dogs in the control group, and no effect of housing condition was detected in ANOVA. Therefore this variation cannot be considered on its own an indicator of impaired welfare. In future research, accurate physiological measures of dogs’ sleep patterns may provide a reliable tool for assessing their rate of adaptation to new or different housing conditions.

were rare, and when they occurred they were mainly directed toward same sex pen-mates. Although pairs to be transferred into smaller enclosures were not chosen randomly, these results tend to support the choice of matching opposite sex and compatible animals to avoid management and aggression problems. In the pair housing condition, social interactions were always positive (play and amicable) while agonistic behaviour was never recorded. An appropriate pen-mate in a confinement situation may help both animals to cope with the new environment, but further research is needed to determine the value of this role.

An increase in autogrooming is usually observed as a consequence of social and spatial restriction (4). Although the current findings detected some variation in this behaviour, this was not related to the change in housing. Previous studies have also observed dogs engaging in more self-grooming activity in association with decreased stress‑related behaviour, allertness and attention‑seeking, perhaps reflecting improved welfare (13, 23). In the current study, only a significant effect of time was observed in the control group. The increase observed in resting time could suggest that these variations were related to habituation and lower arousal of dogs.

Saliva cortisol is considered a valid measure for the assessment of acute, but also chronic, stress in dogs (2, 5), although high concentrations are also produced in response to moments of sustained arousal (13). The current findings detected a significant decrease in cortisol levels, between the first and the second data collection periods for both groups of dogs, that was independent of the type of confinement. Although cortisol levels could have been affected by food anticipation, arrival of kennel staff, or physical handling, we are confident that saliva sampling was carried out by shelter veterinarians in a highly standardised fashion at both time points and, therefore, sampling is unlikely to have been the source of this difference.

Looking more in detail at basal salivary cortisol levels reported in other studies, we found that data are rather variable. Beerda et al. (5) recorded an average basal level during outdoor group housing of 0.08 ± 0.01 µg/dl with significant variations between morning hours (before 10.00 h) and the rest of the day. In another study (3) basal level was on average 0.22 µg/dl and sampling was carried out after 10.00 h. Horvath et al. (14) recorded an average baseline of 0.12 ± 0.11 µg/dl during morning sampling and 0.07 ± 0.07 µg/dl during afternoon sampling. In the present study, cortisol level was on average 0.12 ± 0.002 during T1 and 0.09 ± 0.001 during T2. We could conclude that external

When assessing animal welfare, attention is usually focused on stress indicators and negative emotional states (32). However, good welfare is also reflected by positive emotional states: play and affiliative behaviour, for example, are often considered indicators of good welfare (9). Although social behaviour was shown for only 0.3% of the total observation time, the description of the type of social interaction and to whom it was directed was informative of the social dynamics of group‑housed dogs in confinement. When interacting with conspecifics, subjects housed in groups spent most of their social interaction time playing. Social play was shown mainly toward opposite sex pen-mates.

Agonistic behaviours (threat, rigid/high posture)

Veterinaria Italiana 2013, 49 (2), 231-241. doi: 10.12834/VetIt.2013.492.231.241

As highlighted in previous works, the presence of other conspecifics, and of an enriched environment, can elicit the expression of natural behaviour (22). Group confinement offered more social and environmental stimuli (e.g. soil, furniture, trees) compared to pair housing, and as expected, in this situation dogs performed more exploratory behaviours (visual and olfactory). Overall statistical comparisons and mean values showed that dogs were more motivated to express behaviours such as digging the ground, giving communicative signals, and tail wagging when housed in the outdoor pens compared to pair housing. However, these differencese were not confirmed by post‑hoc analysis; a larger data collection could help to clarify these results.

239

Dalla Villa et al.

Shelter dogs and long term confinement

factors (e.g. seasonal variations, environmental conditions not recorded as part of the study) may have affected this physiological change, but that overall values remain within basal levels of saliva cortisol concentration recorded for this species.

More frequent sampling of cortisol levels (see for example procedure in (5) might have provided a more informative adaptation curve to the housing conditions.

In terms of practicality, pair housing enclosures are more functional: animals can be managed more easily, there is a greater degree of control over sanitation and health, and the risks of agonistic interactions between pen-mates are reduced (25, 31). However, careful management and monitoring of group housing facilities can reduce most of the risks associated with this housing system. In the present study, no severe attacks occurred between group-housed dogs, and clinical data revealed no increased prevalence of health problems when compared with pair housing.

A general decrease in most activities (e.g. locomotor, social, and exploratory) was recorded when dogs were transferred from the group to pair housing condition, confirming that spatial restriction and partial social deprivation can increase inactivity of adult long-term shelter dogs. Nevertheless, it should be noted that, in the present sudy, pair-housed dogs had daily access to outdoor runs, and the behaviour expressed during that time was not recorded.

It is possible that running and playing during exercise periods may have reduced the desire for exploratory, social or locomotor activities when in kennel. Although significant variations in behaviour

240

were associated with the different confinement conditions, there were no other evident signs that one form of confinement reduced the welfare of these animals more than the other.

Identifying a life-long confinement condition for shelter dogs that is both economically sustainable and ethically acceptable is a considerable challenge. Many factors concur to help a dog in the coping process when a new environment or challenging situation is presented. The results of this study provide further insights into the effects of confinement on long-term shelter dogs, focusing on the reactions of adult animals that had experienced kennelling for 4 years or more. They also confirm that behavioural parameters are sensitive indicators of dog responses to new housing environments.

Current management procedures and further investigation in this area should focus on individual variability and on the identification of standardised animal-based measures (e.g. health, physical condition, behaviour, etc.) that can provide a clear welfare assessment system for shelter dogs.

Acknowledgment The authors wish to thank Loredana Annunziata and Giampiero Scortichini for their professional assistance during the study.

Grant support This research project was funded by the Italian Ministry of Health.

Veterinaria Italiana 2013, 49 (2), 231-241. doi: 10.12834/VetIt.2013.492.231.241

Dalla Villa et al.

Shelter dogs and long term confinement

References 1. Agresti A., & Finlay B. 2007. Statistical Methods for the Social Sciences, 2nd Ed. (Prentice Hall ed.), New Jersey, USA, 395-402.

2. Beerda B., Schilder M.B.H., Janssen N.S.C.R.M., & Mol J.A. 1996. The use of saliva cortisol, urinary cortisol and catecholamine measurements for a non-invasive assessment of stress responses in dogs. Horm Behav, 30, 272-279.

3. Beerda B., Schilder M.B.H., van Hooff J.A.R.A.M., de Vries H.W. & Mol J.A. 1998. Behavioural, saliva cortisol and heart rate responses to different types of stimuli in dogs. Appl Anim Behav Sci, 58, 365-381.

4. Beerda B., Schilder M.B.H., van Hooff J.A.R.A.M., de Vries H.W. & Mol J.A. 1999. Chronic stress in dogs subjected to social and spatial restriction. 1. Behavioural responses. Phisiol Behav, 66, 233-242.

5. Beerda B., Schilder M.B.H., van Hooff J.A.R.A.M., de Vries H.W. & Mol J.A. 1999. Chronic stress in dogs subjected to social and spatial restriction. II. Hormonal and immunological responses. Phisiol Behav, 66, 243-254.

6. Beerda B., Schilder M.B.H., van Hooff J.A.R.A.M., de Vries H.W. & Mol J.A. 2000. Behavioural and hormonal indicators of enduring environmental stress in dogs.

Animal Welfare, 9, 49-62.

7. Clark J.D., Rager D.R., Crowell-Davis S. & Evans D.L. 1997.

Housing and exercise of dogs: effects on behaviour, immune function, and cortisol concentration. Lab Anim Sci, 47, 500-510.

8. Dalla Villa P., Kahn S., Stuardo L., Iannetti L., Di Nardo A. & Serpell J.A. 2010. Free-roaming dog control among OIE-member countries. Prev Vet Med, 97, 58-63.

9. Fraser D. & Duncan I.J. 1998. ‘Pleasures’, ‘pains’ and animal welfare: toward a natural history of affect.

Animal Welfare, 7, 383–396.

10. Hennessy M.B., Davis H.N., Williams M.T., Mellott C. & Douglas C.W. 1997. Plasma cortisol levels of dogs at a county animal shelter. Physiol Behav, 62, 485-490.

11. Hetts S., Clark J.D., Calpin J.P., Arnold C.E. & Mateo J.M. 1992. Influence of housing conditions on beagle behaviour. Appl Anim Behav Sci, 34, 137-155.

12. Hewson C.J., Hiby E.F. & Bradshaw J.W.S. 2007.

Assessing quality of life in companion and kennelled dogs: a critical review. Animal Welfare, 16, 89-95.

13. Hiby E.F., Rooney N.J. & Bradshaw J.W.S. 2007.

Behavioural and physiological responses of dogs entering re-homing kennels. Physiol Behav, 89, 385-391.

14. Horvath Z., Igyarto B.-Z., Magyar A. & Miklosi A. 2007.

Three different coping styles in police dogs exposed to a short-term challenge. Horm Behav, 52, 621-630.

15. Hubrecht R.C., Serpell J.A. & Poole T.B. 1992. Correlates of pen size and housing conditions on the behaviour of kennelled dogs. Appl Anim Behav Sci, 34, 365-383.

16. Hubrecht R.C. 1993. A comparison of social and environmental enrichment methods for laboratory housed dogs. Appl Anim Behav Sci, 37, 345-361.

Veterinaria Italiana 2013, 49 (2), 231-241. doi: 10.12834/VetIt.2013.492.231.241

17. Hubrecht R.C. 2002. Comfortable quarters for dogs in research institutions. In Comfortable quarters for Laboratory Animals 2nd Ed. (V. Reinhardt & A. Reinhardt, ed). Animal Welfare Institute, Washington DC, USA, 56-64.

18. Hughes H.C. & Campbell S.A. 1990. Effect of primary enclosure size and human contact. In Canine Research Environment (J.A. Mench & E. Krulisch, ed). Scientists Center for Animal Welfare, Bethesda MD, USA, 66-73.

19. Italian Law, 281/1991. Legge quadro in materia di animali d’affezione e prevenzione del randagismo. Off J, 203, 30 August 1991.

20. Matteri R.L., Carroll J.A. & Dyer C.J. 2000.

Neuroendocrine response to stress. In The Biology Of Animal Stress (G.P. Moberg & J.A. Mench, ed). CABI Publishing, Wallingford UK, 43-76.

21. Meers L., Normando S., Odberg F.O. & Bono G. 2004.

Behavioural responses of adult beagles to interruption in a walking program. In Proc. Companion Animal Behaviour Therapy Study Group Study Day, 31st March 2004, (Heath S.E. ed.), Birmingham, 41-42.

22. Mertens P.A. & Unshelm J. 1996. Effects of group and individual housing on the behaviour of kennelled dogs in animal shelters. Anthrozoos, 9, 40-51.

23. Rooney N.J., Gaines S.A. & Bradshaw J.W.S. 2007.

Behavioural and glucocorticoid responses of dogs (Canis familiaris) to kennelling: investigating mitigation prior to habituation. Phisiol Behav, 92, 847-854.

24. Ruckebusch Y. 1975. The hypnogram as an index of adaptation of farm animals to changes in their environment. Appl Anim Ethol, 2, 3-18.

25. Sonderegger S.M. & Turner D.C. 1996. Introducing dogs into kennels: prediction of social tendencies to facilitate integration. Animal Welfare, 5, 391-404.

26. Stephen J.M. & Ledger R.A. 2006. A longitudinal evaluation of urinary cortisol in kennelled dogs, Canis familiaris. Phisiol Behav, 30, 911-916.

27. Tuber D.S., Hennessy M.B., Sanders S. & Miller J.A. 1996.

Behavioural and glucocorticoid responses of adult domestic dogs (Canis familiaris) to companionship and social separation. J Comp Psychol, 110, 103-108.

28. Tyson E.J. 2005. Behavioural and physiological measures of stress in dogs (Canis familiaris) in a rescue shelter. Thesis, Royal School of Veterinary Studies, University of Edinburgh UK. 29. Weipkema P.R. & Schouten W.P.G. 1990. Mechanisms of coping in social situations. In Social stress in domestic animals (R. Zayan & R. Dantzer, ed). Kluwer Academic Publishers, Dordrecht, Boston and London, 8-24.

30. Wells D.L., Graham L. & Hepper P.G. 2002. The influence of length of time spent in a rescue shelter on the behaviour of kennelled dogs. Animal Welfare, 11, 317–325.

31. Wells D.L. 2004. A review of environmental enrichment for kennel dogs, Canis familiaris. Appl Anim Behav ScI, 85, 307-317.

32. Yeates J.W. & Main D.C.J. 2008. Assessment of positive welfare: a review. Vet J, 175, 293-300.

241

SHORT COMMUNICATION Immune response in spirlins (Alburnoides bipunctatus, Bloch 1782) infested by Ligula intestinalis parasite Mostafa Halimi1, Abasalt Hosseinzadeh Colagar2 & Mohammad Reza Youssefi3 Department of Fishery College, Islamic Azad University, Babol-Branch, Babol, 47167-17861, Iran m_halimi82@yahoo.com 2 Department of Biology, Nano and Biotechnology Research Group, Faculty of Basic Sciences, University of Mazandaran, Babol, 47167-17861, Iran 3 Department of Veterinary Parasitology, Islamic Azad University, Babol-Branch, Babol, 47167-17861, Iran 1

Keywords Ligula intestinalis, SDS-PAGE, Roach (Rutilus rutilus), Spirlin (Alburnoides bipunctatus).

Summary Ligula intestinalis parasite is a cestode that can cause remarkable damages to fishes. SDS-PAGE is one of the methods that can be used to determine the immune serum band polymorphism and immune responses in fishes infested by Ligula intestinalis. This study reports the results of an investigation conducted using SDS-PAGE focusing on immune serum band polymorphism and on the reaction of the immune system in spirlins (Alburnoides bipunctatus) infested by pleurocercoids of Ligula intestinalis parasite. Serum samples from infested spirlins revealed a polymorphism band which differed from that reported in sera of roaches (Rutilus rutilus), a species of the same Cyprinidae family.

Risposta immunitaria in alborelle bipuntate infestate da Ligula intestinalis Parole chiave Alborella bipuntata (Alburnoides bipunctatus), Ligula intestinalis, Rutilo (Rutilus rutilus), SDS-PAGE.

Riassunto Lo studio descritto in questo articolo utilizza il metodo SDS-PAGE per analizzare bande di polimorfismo in immunosieri di alborelle bipuntate (Alburnoides bipunctatus) infestate da pleurocercoidi del parassita Ligula intestinalis. Gli immunosieri sono stati ottenuti da alborelle bipuntate infestate da Ligula intestinalis. Quando esaminati in SDS-PAGE, i sieri di alborelle hanno evidenziato presenza di bande di 40 e 65 kDa che differiscono con quanto evidenziato nei sieri di rutilo (Rutilus rutilus), una specie appartenente alla stessa famiglia Ciprinidae.

Veterinaria Italiana 2013, 49 (2), 243-246. doi: 10.12834/VetIt.2013.492.243-246

Pleurocercoids of the tapeworm Ligula intestinalis are important pathogenic agents of spirlins (Alburnoides bipunctatus). They are localized in the body cavity of cyprinids, which are supplementary hosts of this parasite. During their growth and life activities they constrinct the inner organs causing their atrophy and pathological effects. They also cause morpho physiological shifts in the infested host (2, 3), which mainly include the inhibition of gonadal development resulting from changes in the secretion of releasing hormones by the hypothalamus, and a decrease in the level of particular immunological and biochemical parameters (9, 12, 15, 19, 26, 27). These pathogenic agents may have a strong influence on ecosystem function by inducing a variety of behavioral and physiological changes in

their hosts (20). In particular, parasites that impair host reproduction consume high amounts of energy and can have significant impacts on host population dynamics (10, 11). Ligula intestinalis is characterised by a life cycle involving three hosts, with copepods as the first and fish as the second intermediate host.

The final hosts are piscivorous birds, i.e. gulls (Larus cachinnans) or grey herons (Ardea cinerea). The parasites persist in the gut of birds for a few days to reach sexual maturity and to reproduce (7). This study aimed to investigate the immune response of spirlins infested by Ligula intestinalis.

Preparation of the immune spirlin serum (ISS) was done in the Parasitology Laboratory of Veterinary Medicine of University of Tehran. Immune spirlin serum was recovered from naturally infected spirlins

243

Immune response in spirlins infested by Ligula intestinalis Halimi et al.

evaluated by ELISA. Afterward, the sera with high titration were selected and stored at -70 °C. After preparation of ISS the serum was run on sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE), composed of 5% resolving gel and 10% stacking gel, under reducing conditions using the discontinuous buffer system (13). For size estimation in SDS-PAGE, a pre-stained protein marker - 10.5-175 kDa molecular weight range (pr0602) - was used.

The results of SDS-PAGE procedure are shown in Figure 1. Two bands of 40 kDa and 65 kDa were observed in the immune spirlin serum.

These findings were in contrast with those found

by William and Hoole (33) who observed bands of 65, 90 and 100 kDa in sera of roaches infested by Ligula intestinalis and tested by SDS-PAGE. These discrepancies evidence that the immune system of species belonging to same family (Cyprinidae) can react in different ways to the infection of Ligula intestinalis parasite. The SDS-PAGE also revealed a band polymorphism.

Polymorphism of several immune molecules has been shown to play an important role for defense against parasites. Links between polymorphism and disease resistance have already been studied with the complement C3 (28, 29).

Other studies (14, 21, 22) suggest the involvement of the immune system in determining parasite establishment and population dynamics.

Figure 1. Results obtained with SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) in immune spirlin serum (ISS).

M = marker, ISS = immune spirlin serum. immediately after collection from their habitat. We used 6 spirlins (mean weight 23 ± 2 g, mean length 15 ± 2 cm) infected with Ligula intestinalis parasite and showing prevalent symptoms of ligulosis disease.

In each infected fish, 3 parasites (mean weight 6 ± 1 g) were separated from abdominal cavity and blood samples were taken from the fish by caudal puncture. The blood samples were then centrifuged at 2000 × (g) 5 min, their serum was separated and

244

As it has been shown in this article, cestodes can stimulate immune response in fish following infection, it is possible to elicit antibodies to acanthocephalan (30), nematode (8), monogenean (4), digenean (17, 18, 34), and other cestode (23, 25) parasites.

Immunisation with dead parasite material will also capable of eliciting antibody responses to nematodes (8), digeneans (16, 31), and cestodes (24, 32).

In conclusion, this study proved that two different species belonging to different genera but within the same family might have different immune responses although infested with the same parasite.

We would like to sincerely thank the experts of Parasitology Laboratory, Faculty of Veterinary Medicine, University of Tehran who helped us in performing this research.

Veterinaria Italiana 2013, 49 (2), 243-246. doi: 10.12834/VetIt.2013.492.243-246

Halimi et al.

Immune response in spirlins infested by Ligula intestinalis

References 1. Arme R. 1968. Effects of the plerocercoid larva of a pseudophillidean cestode, Ligula intestinalis on the pituitary gland and gonads of its host. Biol Bull, 134, 15-25.

2. Arme C. 2002. Ligula intestinalis: a Tapeworm contraceptive. Biologist (London), 49 (6), 265-269.

3. Brown S.P., Loot G., Teriokhin A., Brunel A., Brunel C. & Guégan J.-F. 2002. Host Manipulation by Ligula intestinalis: a cause or consequence of parasite aggregation? Int J Parasitol, 32, 817-824.

4. Buchmann K. 1993. A note on the humoral immune response of infected Anguilla anguilla against the gill monogenean Pseudodactylogyrus bini. Fish Shellfish Immunol, 3, 397-399.

5. Dobson A.P., Kuris A.M., & Lafferty K.D. 2006. Parasites dominate food web links. Proc Natl Acad Sci USA, 103, 11211-11216.

6. Dubinina M.N. 1966. Tapeworms of the USSR Fauna (Nauka, Moscow) [in Russian], 262 p.

7. Dubinina M.N. 1980. Tapeworms (Cestoda, Ligulidae) of the fauna of the USSR. Amerind Publishing Co., New Delhi, 160-170.

8. Hoglund J. & Pilstrom L. 1994. Purification of adult Anguillicola crassus whole-worm extract antigens for detection of specific antibodies in serum from the European eel (Anguilla anguilfa) by ELISA. Fish Shellfish Immunol, 4, 311-319.

9. Izvekova G.I. 1999. Some aspects of parasite– host relations in the Ligula intestinalis (Cestoda, Pseudorphyllidea) - Bream System. Ian Biol, 4, 432-438.

10. Kennedy C.R., Shears P.C. & Shears J.A. 2001. Long-term dynamics of Ligula intestinalis and roach Rutilus rutilus: a study of three epizootic cycles over thirty-one years.

Parasitology, 123 (Pt3), 257-269.

11. Kuris A.M., Hechinger R.F., Shaw J.C., Whitney K.L., Aguirre-Macedo L., Boch C.A., Dobson A.P., Dunham E.J., Fredensborg B.L., Huspeni T.C., Lorda J., Mababa L., Mancini F.T., Mora A.B., Pickering M., Talhouk N.L., Torchin M.E. & Lafferty K.D. 2008. Ecosystem energetic implications of parasite and free-living biomass in three estuaries. Nature, 454, 515-518.

12. Kurovskaya L.Ya. 1987. Changes in morphophysiological and biochemical indices in two-year old grass carp at invasion with helminths. Gidrobiol Zh, 23 (3), 47-51.

13. Laemmli U.K. 1970. Cleavage of structural proteins during the assembly of the head of bactriophage T4.

Nature, 227, 680-685.

16. Matthews R.A. & Matthews B.F. 1993. Cryprocoryle lingua in mullet, Chelon labrosus; significance of metacercarial excretory proteins in the stimulation of the immune response. J Helminthol, 67, 1-9.

17. McArthur C.R. 1978. Humoral antibody production by New Zealand eels, against the intestinal nematode Telogaster opisthorchis, Macfarlane. 1945, J Fish Dis, 1, 377-387.

18. McArthur C.P. & Sengupta S. 1982. A rapid micromethod for screening eel sera for antibodies against the digenean Telogaster opisthorchis Macfarlane, 1945.

J Fish Dis, 5, 67-70.

19. Mikryakov V.R. & Silkina N.I. 1997. Some Immunophysiological and Biochemical Aspects of Relations in the “Parasite–Host” System with Reference to Ligula intestinalis (L.) (Cestoda, Pseudophyllidea) Bream (Abramis brama L.) In Ecological Monitoring of Parasites. Parasite Systems in a Changing Environment: Forecast of Consequences of the Global Climate Warming and the Increasing Anthropogenic Load.

Proceedings of the 2nd Congress of Parasitological Society at RAS (St. Petersburg, 1997), 156–157 pp.

20. Poulin R. 1999. The functional importance of parasites in animal communities: many roles at many levels? Int. J Parasitol, 29, 903-914.

21. Scott M.E. & Robinson M.A. 1984. Challenge infections of Gyrodactylus bullatarudis (Monogenea) on guppies, Poccilia reticulata (Peters), following treatment. J Fish Biol, 24, 581-586.

22. Scott M.E. 1985. Experimental epidemiology of Gyrodacrylus bullatarudis (Monogenea) on guppies (Poecilia reticulara): short- and long-term studies. In Ecology and genetics of hostparasite interactions (D. Rollinson & R. M. Anderson, eds). Academic Press, New York, 21-38.

23. Sharp G.J.E., Pike A.W. & Secombes C.J. 1989.

The immune response of wild rainbow trout, Salmo gaitrineri Richardson, to naturally acquired plerocercoid infections of Diphyllobothrium dendriticum (Nitzsch, 1824) and D. ditremum (Creplin, 1825). J Fish Biol, 35, 781-794.

24. Sharp G.J.E., Pike A.W. & Secombes C.J. 1991.

Rainbow trout (Oncorhychus mykiss Walbaum, 1792) leucocyte interactions with metacestode stages of Diphyllobothrium dendriticum (Nitzsch, 1824), (Cestoda, Pseudophyllidea). Fish Shellfish Immunol, I, 195-211.

14. Madhavi R. & Anderson R.M. 1985. Variability in the susceptibility of the fish host, Poecilia reticulata, to infection with Gyrodactylus bullatarudis (Monogenea).

Parasitology, 91, 531-544.

25. Sharp G.J.E., Pike A.W. & Secombes C.J. 1992.

Sequential development of the immune response in rainbow trout [Onchorhynchus mykiss (Walbaum, 1792)] to experimental plerocercoid infections of Diphyllobothrium dendriticum (Nitzsch, 1824).

Parasitology, 104,169-178.

15. Makarskaya G.V., Tarskikh S.V. & Lopatin V.N. 2001. Specific Features of Functional Activity of Immunocompetent Cells in the Blood Cells of Fish in Krasnoyarsk Reservoir. In Proceedings of the 8th Congress of the Hydrobiological Society of RAS, Kaliningrad, 2001 (2001), Vol. 1, 118-119.

26. Silkina N.I. & Mikryakov V.R. 2003. Some Immunophysiological and Biochemical Aspects of Relations in the Parasite–Host System with Reference to Ligula intestinalis (Cestoda: Pseudophyllidea) Bream Abramis brama (L.). In Fish Parasites: Modern Aspects of Research. Proceedings of the Conference

Veterinaria Italiana 2013, 49 (2), 243-246. doi: 10.12834/VetIt.2013.492.243-246

245

Immune response in spirlins infested by Ligula intestinalis Halimi et al.

Dedicated to Dr. Sci. (Biol.), Prof. B.I. Kuperman (19332002), Borok, 2003, 49.

27. Silkina N.I. & Zharikova A.N. 2003. Effects of Ligula intestinalis on the Pattern of Lipid Metabolism in the Blood of Host Abramis brama. Parazitologiya, 37 (3), 201-205.

28. Sliemndrecht W.J., Jensen L.B., Horlyck V. & Koch C. 1993. Genetic polymorphism of complement C3 in rainbow trout (Oncorhynchus mykiss) and resistance to viral haemorrhagic septicaemia. Fish Shellfish Immunol, 3, 199-206.

29. Slierendrecht W.J., Olesen N.J., Lorenxen N., Jorgensen P.E.V., Gottschau A., Koch C. 1996. Genetic alloforms of rainbow trout (Oncorhynchus mykiss) complement component C3 and resistance to viral haemorrhagic septicaemia under experimental conditions. Fish Shellfish Immunol, 6, 235-237.

30. Szalai A.J., Danell G.V. & Dick T.A. 1988. Intestinal leakage and precipitating antibodies in the serum of quillback, Carpiodes cyprinus (Lesueur),

246

infected with Neoechinorhynchus carpiodi Dechtiar, 1968 (Acanthocephala: Neoechinorhynchidae). J Parasitol, 74, 415-420.

31. Whyte S.K., Allan J.C., Secombes C.J. & Chappell L.H. 1987. Cercariae and diplostomules of Diplostomum sparhaceum (Digenea) elicit an immune response in rainbow trout, Salmo gairdneri Richardson. J Fish Biol, 31A, 185-190.

32. Williams M.A. & Hoole D. 1992. Antibody response of the fish Rutilus rutilus to the metacestode of Ligula intestinalis. Dis Aquatic Organisms, 12, 83-89.

33. Williams M.A. & Hoole D. 1995. Immunolabelling of fish host molecules on the tegumental surface of Ligula intestinalis (Cestoda: Pseudophyllidea). International Journal for Parasitology, 25, 249-256.

34. Wood B.P. & Matthews R.A. 1987. The immune response of the thick-lipped grey mullet, Chelon labrosus (Risso, 1826), to metacercarial infections of Cryptocotyle lingua (Creplin, 1825). J Fish Biol, 31, 175-183.

Veterinaria Italiana 2013, 49 (2), 243-246. doi: 10.12834/VetIt.2013.492.243-246

a cura di Manuel Graziani

LIBRI/Book reviews

Maria Caramelli

Per non scoprirlo mangiando…

(Instar, pp. 96, € 10,00) www.instarlibri.it

L’incidenza delle malattie trasmesse dagli alimenti sta crescendo in maniera esponenziale, le insidie nascoste negli alimenti sono sempre di più e di varia natura. Questo accade soprattutto in Occidente: “Nei Paesi del terzo mondo ci si ammala e si muore per l’assenza di cibo. Nei Paesi industrializzati, invece, ogni anno più di una persona su quattro contrae malattie associate al consumo di alimenti.” Si stima che nel 2010 in Europa più di 45.000 persone si siano ammalate a causa di acqua o cibo contaminati; secondo i dati dell’Istituto Superiore di Sanità in Italia sono circa 30.000 all’anno le tossinfezioni alimentari. Un incremento di malattie alimentari che, per paradosso, è frutto dell’evoluzione di un mondo senza più frontiere nel quale gli scambi di animali, mangimi e materie prime di origine animale sono oramai incontrollabili.

Nonostante i consumatori europei pongano i rischi chimici (come gli additivi) in cima alle preoccupazioni per la propria sicurezza alimentare, secondo la FAO e l’OMS i pericoli maggiori sono invece di natura microbiologica, riguardano cioè virus e batteri in grado di provocare intossicazioni e infezioni con conseguenze anche drammatiche: microrganismi spesso difficili da identificare e in continua espansione, favoriti dalla globalizzazione, dalla trasformazione delle nostre abitudini, dalla complessità dei processi di produzione e distribuzione dei cibi.

L’agile libro della dott.ssa Maria Caramelli, Direttore generale dell’IZS di Piemonte Liguria e Valle d’Aosta ed esperta di sicurezza alimentare (una delle più autorevoli studiose italiane di BSE), indaga il vasto mondo delle malattie alimentari partendo dai casi che hanno scatenato allarmi sanitari e crisi economiche di vaste proporzioni scuotendo mass media e opinione pubblica: mucca pazza (BSE), influenza aviaria, diossina nei maiali, mozzarella blu “color puffo”, ricotta rosa, fino all’epidemia tedesca del batterio killer nei germogli che tra maggio e luglio del 2011 ha contagiato circa 4.000 persone e provocato 46 decessi. Per non scoprirlo mangiando… La sicurezza alimentare nel nostro Paese è un libro “utile”, divulgativo, alla portata di tutti, che dimostra quanto mangiare sia un’attività a rischio. Un libro che ci ricorda, peraltro, che l’Italia è all’avanguardia nella tutela dei consumatori, assicurata dal lavoro rigoroso delle istituzioni preposte al controllo degli alimenti come gli Istituti Zooprofilattici Sperimentali.

247

a cura di Manuel Graziani

LIBRI/Book reviews

Eric Chaline

50 Animali che hanno cambiato il corso della Storia (Ricca, pp. 224, € 20,00) www.riccaeditore.it

Copertina rigida “anticata”, brossura cucita, carta di pregio, grafica curata nei minimi dettagli. Rientra senza dubbio nel novero della pubblicistica divulgativa di qualità questo volume uscito in Italia per i tipi di Ricca Editore. Un volume, elegante e classico, che racconta l’evoluzione dell’uomo da cacciatore ad agricoltore/pastore e, più in generale, di come ha preso piede nella storia il nuovo approccio nei confronti del regno animale. “Oltre al ruolo nel commercio e nell’agricoltura” scrive l’autore, ”gli animali hanno contribuito in diversi altri modi alla cultura e alla storia dell’uomo. Alcuni come il leone, lo scarabeo sacro, il cobra e l’aquila di mare testa bianca hanno una lunga storia come simboli politici e religiosi. Nel campo della scienza e della medicina, lo studio di animali come il moscerino della frutta, il fringuello e l’iguanodonte è stato determinante per lo sviluppo della nostra conoscenza dell’evoluzione del mondo naturale.”

Ad ognuno dei 50 animali “che hanno cambiato il corso della Storia” viene dedicato un paragrafo sintetico, ma comunque esaustivo, corredato da foto, illustrazioni, immagini d’epoca e brevi notizie storiche, curiose e al contempo istruttive. Cosa unisce la zanzara al gin tonic? E l’ape alla mandorla? Lo sapevate che Buffalo Bill dove aver cacciato 4.000 bisonti nella sola stagione 1867-1868 divenne uno strenuo difensore della creatura vivente più grande dell’America del Nord? E che il lombrico, oltre alla sua incessante azione di riciclo biologico e minerale, è considerato una vera prelibatezza dai Maori della Nuova Zelanda? E ancora, che durante la seconda guerra mondiale un piccione chiamato G.I. Joe ricevette una medaglia dall’esercito degli Stati Uniti per aver salvato oltre mille persone? Oppure che, in contrasto con le superstizioni occidentali secondo le quali il gatto è di cattivo auspicio, in Giappone i gatti sono considerati dei veri portafortuna e che lo sport del polo ebbe origine nell’antica Persia come modo per addestrare le truppe della cavalleria alle tattiche di battaglia?

249