Veterinaria Italiana, Volume 49 (3), July-September 2013 by Veterinaria Italiana

ISSN 0505-401X

RIVISTA DI SANITÀ PUBBLICA VETERINARIA

VOLUME 49 (3) - LUGLIO-SETTEMBRE / JULY-SEPTEMBER 2013

Rivista trimestrale di Sanità Pubblica Veterinaria, edita dall’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” A quarterly journal devoted to veterinary public health, veterinary science and medicine, published by the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ in Teramo, Italy

Volume 49 (3), 2013

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 TERAMO, Italia telefono +39 0861 3321 fax +39 0861 332251 www.izs.it

Questa rivista è nata nel 1950 con il nome di Croce Azzurra. Dal 1954 si chiamerà Veterinaria Italiana.

Comitato direttivo Managing Scientific Board Romano Marabelli Fernando Arnolfo

Direttore Editor-in-Chief Giovanni Savini

Membri onorari Honorary Members Louis Blajan - France James H. Steele - United States of America

Comitato di redazione Editorial Board Hassan Abdel Aziz Aidaros – Egypt Ayayi Justin Akakpo – Senegal Nicola T. Belev – Bulgaria Stuart C. MacDiarmid – New Zealand J. Gardner Murray – Australia Yoshihiro Ozawa – Japan Alexander N. Panin – Russia

Victor E. Saraiva – Brazil Aristarhos M. Seimenis – Greece Arnon Shimshony – Israel Samba Sidibé – Mali Gavin R. Thomson – South Africa Carlo Turilli – Italy Norman G. Willis – Canada

Comitato scientifico Scientific Advisory Board L. Garry Adams – United States of America Menachem Banai – Israel Elie K. Barbour – Lebanon A.C. David Bayvel – New Zealand Giorgio Battelli – Italy Roy G. Bengis – South Africa Ingrid E. Bergmann – Argentina Peter F. Billingsley – United States of America Silvio Borrello – Italy Canio Buonavoglia – Italy Mike Brown – United Kingdom Gideon Brücknerr – South Africa Giovanni Cattoli – Italy Bernadette Connolly – United Kingdom Julio De Freitas – Brazil Piergiuseppe Facelli – Italy Gianluca Fiore – Italy Cesidio Flammini – Italy Riccardo Forletta – Italy Bruno Garin-Bastuji – France Giorgio Giorgetti – Italy Rob Gregory – New Zealand Anwar Hassan – Malaysia

Barry J. Hill – United Kingdom Katsuyuki Kadoi – Japan Bruce Kaplan – United States of America R. Paul Kitching – Canada Corinne I. Lasmézas – France N. James MacLachlan – United States of America Salvatore Magazzù – Italy Franco Mutinelli – Italy Klaus Nielsen – Canada Lisa Oakley – New Zealand Massimo Palmarini – United Kingdom Attilio Pini – Italy Santino Prosperi – Italy Franco M. Ruggeri – Italy Domenico Rutili – Italy Paul Sutmoller – The Netherlands Peter M. Thornber – Australia Silvio Arruda Vasconcellos – Brazil Patrick Wall – Ireland Alexander I. Wandeler – Canada Kazuya Yamanouchi – Japan Cristóbal Zepeda – United States of America Stéphan Zientara – France

Segreteria di redazione Associate Editors Monica Bucciarelli, Guido Mosca, Mariarosaria Taddeo, Carlo Turilli Recensioni Book reviews Manuel Graziani Progetto grafico e web Graphic and web design Paola Di Giuseppe Amministrazione Administration Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 Teramo, Italia veterinariaitaliana@izs.it Stampa Printer Giservice srl, Teramo, Italia http://www.izs.it/vet_italiana/index.html © 2013 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” Campo Boario, 64100 Teramo, Italia

ISSN 0505-401X Formato elettronico Electronic format ISSN 1828-1427 Stampato su carta ecologica TCF Printed on 50% recycled, 100% chlorine- and acid-free environmentally friendly paper Aut. Trib. Teramo n. 299 del 16/05/1990 Sped. in Abb. Post. Art. 2 comma 20/c L. 66/96 DCB/DC Abruzzo Pescara

Volume 49 (3), 2013

Thomson Reuters Science Journal Citation Reports® database (JCR/Science Edition®) Journal impact factor 2011: 0.667 • National Library of Medicine’s MEDLINE/ PubMed system • Thomson Reuters Science Citation Index Expanded™ (SciSearch®) • CABI’s Full-Text Repository • Directory of Open Access Journals (DOAJ) • Elsevier’s SciVerse Scopus

Le pubblicazioni dell’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” (IZSAM) sono protette dalla legge internazionale sul copyright. Gli estratti possono essere letti, scaricati, copiati, distribuiti, stampati, recuperati; è consentito inoltre il collegamento ai file pdf di Veterinaria Italiana. Informazioni per fini commerciali devono essere richieste all’IZSAM. Le traduzioni a stampa e gli adattamenti sono consentiti previa autorizzazione scritta da parte dell’IZSAM. Le opinioni espresse negli articoli pubblicati sono esclusivamente sotto la responsabilità degli autori. L’eventuale citazione di specifiche Ditte o prodotti, siano essi brevettati o meno, non implica che essi siano stati consigliati dall’IZSAM e vengano preferiti ad altri di simile natura non menzionati nei testi. Si ringrazia Fabrizio Piccari per la gentile concessione dell’immagine di copertina. Publications of the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ (IZSAM) are protected by international copyright law. Users are permitted to read, download, copy, distribute, print, search abstracts; besides they can link to Veterinaria Italiana full pdf files. Should information be required for commercial purposes, prior written permission must be sought from the IZSAM. Published translations and adaptations also require prior written approval from the IZSAM. The views expressed in signed articles are solely the responsibility of the authors. The mention of specific companies or products of manufacturers, whether or not patented, does not imply that these have been endorsed or recommended by the IZSAM in preference to others of a similar nature that are not mentioned. Acknowledgement is made to Fabrizio Piccari for the cover image.

REVIEW Paolo Calistri, Annamaria Conte, Fabrizio Natale, Luigi Possenti, Lara Savini, Maria Luisa Danzetta, Simona Iannetti & Armando Giovannini Systems for prevention and control of epidemic emergencies............................................................................255

Strumenti per la gestione delle emergenze epidemiche (riassunto)......................................... 255

SHORT COMMUNICATION Gioia Capelli, Silvia Ravagnan, Fabrizio Montarsi, Silvia Ciocchetta, Stefania Cazzin, Lebana Bonfanti, Annapia Di Gennaro, Ottavio Portanti, Paolo Mulatti, Isabella Monne, Giovanni Cattoli, Giorgio Cester, Francesca Russo, Giovanni Savini & Stefano Marangon Further evidence of lineage 2 West Nile Virus in Culex pipiens of North-Eastern Italy...........................................................263

Ulteriore evidenza del virus West Nile lineaggio 2 nella zanzara Culex pipiens in Italia nord orientale (riassunto)............................................... 263

Federica Monaco, Maria Goffredo, Valentina Federici, Andrea Carvelli, Andrea Capobianco Dondona, Andrea Polci, Chiara Pinoni, Maria Luisa Danzetta, Lucia Selli, Michela Bonci, Michela Quaglia & Paolo Calistri First cases of Schmallenberg virus in Italy: surveillance strategies ...............................................................................269

Primi casi di infezione da virus Schmallenberg in Italia: strategie di sorveglianza (riassunto)................................................................................................ 270

Elbè Becker, Gert J. Venter, Karien Labuschagne, Telanie Greyling & Huib van Hamburg The effect of anthropogenic activity on the occurrence of Culicoides species in the South-Western Khomas Region, Namibia..........................277

Effetto dell’attività antropogenica sulla presenza di Culicoides nell’area Sud-Occidentale della regione di Khomas, Namibia (riassunto)............................................... 277

SHORT COMMUNICATION Massimo Giangaspero, Giovanni Savini, Riccardo Orusa, Takeshi Osawa & Ryô Harasawa Prevalence of antibodies against Parainfluenza virus type 3, Respiratory syncitial virus and bovine Herpesvirus type 1 in sheep from Northern Prefectures of Japan...........................................285

Prevalenza di anticorpi contro il virus Parainfluenzale di tipo 3, il virus Respiratorio sinciziale e l’Herpesvirus bovino di tipo 1 in pecore nelle Prefetture settentrionali del Giappone (riassunto)............................................ 285

Volume 49 (3), 2013 Bahman Abdi-Hachesoo, Keramat Asasi & Hassan Sharifiyazdi Rapid detection of Escherichia coli gyrA and parC mutants in one-day-old broiler chicks in Iran..........................................................291

Mutazioni nei geni gyrA e parC di Escherichia coli in pulcini di un giorno in allevamenti di polli da carne, Iran (riassunto)........................................................................... 291

Heba A. Ahmed, Mohamed A. Hussein & Ahmed M.M El-Ashram Seafood a potential source of some zoonotic bacteria in Zagazig, Egypt, with the molecular detection of Listeria monocytogenes virulence genes...................................................299

Rilevazione molecolare dei geni di virulenza per Listeria monocytogenes e di batteri responsabili di zoonosi in prodotti ittici commercializzati nei mercati di Zagazig in Egitto (riassunto).................................................................................... 299

SHORT COMMUNICATION Mohammad Mirzaei & Majid Fooladi Coproscopy survey of Gastrointestinal parasites in owned dogs of Kerman city, Iran ...........................................................309

Indagine coproscopica per valutare la presenza di parassiti gastrointestinali in cani di proprietà nella città di Kerman in Iran (riassunto)...................................................... 211

RAPID COMMUNICATION Mattia Calzolari, Federica Monaco, Fabrizio Montarsi, Paolo Bonilauri, Silvia Ravagnan, Romeo Bellini, Giovanni Cattoli, Paolo Cordioli, Stefania Cazzin, Chiara Pinoni, Valeria Marini, Silvano Natalini, Maria Goffredo, Paola Angelini, Francesca Russo, Michele Dottori, Gioia Capelli & Giovanni Savini New incursions of West Nile virus lineage 2 in Italy in 2013: the value of the entomological surveillance as early warning system..............................................................................315

L’importanza della sorveglianza entomologica nel rilevare precocemente la circolazione dei ceppi del virus della West Nile di linea genetica 2: l’esperienza italiana del 2013............................................................................................................. 316

LIBRI/Book reviews (a cura di) Magda Gerou-Ferriani Manuale di ematologia veterinaria e medicina trasfusionale .....................321 Adolf Portman La forma degli animali ......................................................................323

REVIEW Systems for prevention and control of epidemic emergencies Paolo Calistri1*, Annamaria Conte1, Fabrizio Natale2, Luigi Possenti1, Lara Savini1, Maria Luisa Danzetta1, Simona Iannetti1 & Armando Giovannini1 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy European Commission, Joint Research Centre, Institute for the Protection and Security of the Citizen, Ispra (VA), Italy 1

* Corresponding author at: Epidemiology Unit, National Reference Centre for Veterinary Epidemiology, Programming, Information and Risk Analysis, Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy. Tel.: +39 0861 332241, e-mail: p.calistri@izs.it.

Veterinaria Italiana 2013, 49 (3), 255-261. doi: 10.12834/VetIt.1206.06

Accepted: 25.07.2013 | Available on line: 28.08.2013

Keywords Animal movements, Diseases modelling, Early detection, Epidemic emergency, Network analysis, Risk assessment, Risk maps.

Summary The development of early warning systems is fundamental for preventing the spread of infectious diseases. Data collection, however, is a costly activity and it is not possible to implement early warning systems everywhere and for all possible events. Hence, tools helping to improve the focus of surveillance efforts are of paramount importance. Risk assessment methods and other provisional modelling techniques may permit to estimate the probability of introduction and spread of infectious diseases in different geographical areas. Similarly, efficient information systems must be in place to assist the veterinary services in case of epidemic emergencies in order to support the prompt application of control measures for the containment of the infection and the reduction of the magnitude of negative consequences. This review describes two recent approaches to the estimation of the probability of introduction and spread of infectious diseases based on the use of risk maps/ spatial modelling and Social Network Analysis (SNA) techniques. The review also describes a web application developed in Italy to help official veterinary services to trace animals in case of outbreaks of infectious diseases.

Strumenti per la gestione delle emergenze epidemiche Parole chiave Analisi di network, Emergenza epidemica, Mappe di rischio, Modelli predittivi, Movimentazioni animali, Rilevazione precoce, Valutazione del rischio.

Riassunto I sistemi di allerta rapida sono fondamentali nella prevenzione della diffusione delle malattie infettive. La raccolta dei dati è, tuttavia, un’attività economicamente dispendiosa e pertanto non è concretamente possibile mettere in atto tali sistemi per ogni evenienza. Tutti gli strumenti che consentono di indirizzare meglio le attività di sorveglianza risultano, quindi, significativamente importanti. In particolare, le metodologie per la valutazione del rischio e altre tecniche di previsione permettono di stimare la probabilità d’introduzione e di diffusione delle malattie infettive in diverse aree geografiche. Analogamente, devono essere disponibili sistemi informativi efficienti per supportare i servizi veterinari nell’applicazione delle misure di controllo dell’infezione e nel contenimento degli effetti avversi in caso di epidemie. Questa rassegna descrive due recenti approcci utilizzati per la stima della probabilità d’introduzione e di diffusione delle malattie infettive basati sull’uso di mappe di rischio/modelli spaziali e tecniche di Social Network Analysis (SNA). Infine, viene descritta un’applicazione web sviluppata in Italia a sostegno dell’attività dei servizi veterinari finalizzata a tracciare gli spostamenti degli animali da e per i focolai di malattia.

255

Control and prevention of epidemic emergencies

Introduction The existence of surveillance systems able to function as effective early warning systems is pivotal in preventing the spread of infectious diseases (6). So much so that early surveillance warning systems are widespread across Europe. The current Italian sentinel system for Bluetongue (12) and the ornithological surveillance system for West Nile virus (5) may be considered two typical examples of such surveillance programmes. However, data collection is costly and it is not possible to implement ubiquitous early warning systems. The resources are limited and the deployment of such systems is regulated so to achieve the maximum level of efficiency. Therefore, any tool improving the deployment of surveillance measures is fundamental, and the identification of risk factors for the introduction and spread of infectious diseases is becoming a priority. Risk assessment methods and other provisional modelling techniques allow for calculating the probability of introduction and spread of infectious diseases in different geographical areas, as well as the epidemiological analysis of the available data on animal trade. Similarly, efficient information systems must be in place to support veterinary services in case of epidemic emergencies. In fact, the quick reaction of veterinary services and the rapid application of control measures are related to the prompt availability of reliable information. This review describes two recent approaches for the estimation of the probability of the introduction and spread of infectious diseases based on the use of risk maps/spatial modelling and Social Network Analysis (SNA) techniques. It also describes a web application developed in Italy for helping veterinary services in tracing back and forward animals in case of outbreaks of infectious diseases.

Estimation of probability of introduction and spread of infectious diseases Risk maps and modelling The probability of the introduction and spread of an infection into a new territory is often modelled through risk maps. Probability values are estimated through the application of mathematical and statistical models using explanatory variables. A model can be seen as a tool simulating or estimating how an object or a system of objects will behave. When applied to biological sciences, models aim to reduce the complexity of biological systems into basic rules and equations. Models are increasingly being applied to extrapolate

256

Calistri et al.

knowledge and results in time and space (23). These techniques may be used to identify disease risk factors, to better understand epidemic dynamics and for more efficient targeting, control and preventive measures. However, they are still not fully exhaustive. It is impossible to build a fully accurate model due to the complexity of biological systems and due to the limitations of explanatory variables to be used. Models are based on the knowledge of the studied object and it often happens that a fair share of such a knowledge is not (yet) available. This leads to the need to carefully assess the results of any model in relation to the uncertainties existing behind the model itself (15). One of the most frequent approaches in modelling the probability of the spread of an infectious disease is the use of spatial models, which represent a valid method for the identification and quantification of the effect of a set of explanatory variables on the spatial distribution of a specific event/disease (17). The development of risk maps for Culicoides vectors in Europe and in the Mediterranean Basin is an example of application aiming at predicting the possible areas for Bluetongue endemisation. Several maps for the Mediterranean Basin (21, 18) and Italy (8, 9) were developed for the major vector, Culicoides imicola, and for other potential vector species. It is noteworthy that Culicoides imicola could also be the vector for Africa Horse Sickness (AHS) and Epizootic and Haemorrhagic disease (EHD) currently not present in Europe. However, risk maps developed for Culicoides distribution and abundance are a typical example of the possible drawbacks following such an approach. Prior 2006, the absence of the major vector, Culicoides imicola, above 42°N led to the false belief that Northernmost European territories were not susceptible to Bluetongue infection and endemisation. The large Bluetongue outbreak that started in August 2006 and progressively interested almost all European countries during the following two years proved wrong all previous beliefs about the inability of non-Imicola species to sustain an epidemic course. In this case, the limited forecasting of Culicoides risk maps was mainly due to the limited knowledge of vector competencies, although the potential role of non-Imicola vectors was previously observed in the Balkans and in other Mediterranean areas (19, 20). Other risk maps are based on ecological niche models (ENM), which assume that each species is distributed according to its ecological potential. This approach takes into account the details of the ecological patterns responding to the characteristics of individual species’ ecology. More in details, it allows for spatially representing the species ecological niches disguised as ‘suitability’ maps (22). This approach has been endorsed in order to

Veterinaria Italiana 2013, 49 (3), 255-261. doi: 10.12834/VetIt.1206.06

Calistri et al.

predict the areas of potential colonization by several species of ticks, potential vectors of many important diseases, including the emergent Crimean-Congo Haemorrhagic Fever (CCHF) (10).

Identification of crucial herds/flocks for the spread of infectious diseases In spatial models the contacts between subpopulations or individuals that may determine the spread of diseases are implicitly incorporated in the idea of geographic proximity. An alternative approach is to consider more explicitly in the model the relations that are at the basis of these contacts. In the case of diseases transmissible by transported animals, the information concerning animals’ transportation logged in national livestock databases according to EU rules on traceability may be used to understand the possible pathways of introduction and spread of pathogens transmitted by animal-to-animal contacts. In recent years, Social Network Analysis (SNA) techniques have been applied for the analysis of the network represented by the movements of animals. These movements, in fact, can be represented as a network where the premises of origin and destination are defined as ‘nodes’ and the transports of animals between premises as ‘relations’ or ‘edges’. In this type of network edges have a direction from the holding of provenience to that of destination and the strength of the relation can be quantified on the basis of the number of animals that have been transported. The movement of animals along the edges of the network represents a major source of contact between the populations of the two premises of

Figure 1. Distribution of the number of movements of cattle in Italy in 2007 by geodesic distance. Distances are measured between centroids of the municipalities of the premises of origin and the premises of destination (16).

Veterinaria Italiana 2013, 49 (3), 255-261. doi: 10.12834/VetIt.1206.06

Control and prevention of epidemic emergencies

origin and destination and can be considered as a path for the diffusion of a disease, especially in the case of diseases transmissible mainly by direct contact. Social Network Analysis techniques use centrality measures to quantify the role and the importance of each node within the network. The simplest centrality measure is the ‘degree’, which is calculated counting the number of relations that the node has with its direct neighbours. In a directed network, like the one based on animal movements, in addition to counting the total number of edges linked to a node it is possible to consider the ‘indegree’, which is the number of edges arriving to the node and the ‘out-degree’, which is the number of edges leaving from the node. Other centrality measures take into account the structure of the network more globally (24): • the ‘closeness’ is a measure of the number of steps required to reach all the other nodes along the shortest paths; • the ‘betweenness’ is the measure of the number of times the node falls on the geodesic paths between other pairs of nodes in the network; • the ‘eigenvector’ is a measure of centrality proportional to the sum of the centralities of the nodes to which a node is connected (4). The results of a recently published analysis of the Italian network of cattle movements show that 48.5% of movements take place within a short distance, about 20 km from the origin (Figure 1), while only a few transports involve longer paths (16). In addition, the distribution of the number of movements indicates that there is a relative abundance of premises with a very high number

Figure 2. Frequency distribution of the number of movements of the premises in the network of cattle movements in Italy in 2007.

257

Calistri et al.

Control and prevention of epidemic emergencies

of connections having a prominent position in controlling trade flows (Figure 2). This, coupled with the information on the type of premise (dairy or fattening farm, market, assembling or genetic centre), strongly points out the importance of specific nodes as possible ‘super spreaders’ in case of infection (Figure 3).

after simulating epidemics under different scenarios of movement blockage (16). When control measures are applied taking into account the centrality values of premises to be blocked, the efficacy of the measures is much higher (Figure 4).

The results of the analysis on the Italian cattle network are similar to those obtained by other Authors in Denmark (3) and in Great Britain (14).

Systems for the management of epidemic emergencies

A further confirmation of the importance of ‘super spreaders’ is given by the comparison of the results, in terms of reduction of infection spread, obtained

The rapidity of the application of appropriate control measures is crucial for the success of any intervention, once the presence of an infectious

Figure 3. Spatial distribution of premises in Italy with the higher CDC (Complex Degree Centrality) values in 2007. CDC is based on geometric average between the number of connections (degree) and the number of animals moved.

258

Veterinaria Italiana 2013, 49 (3), 255-261. doi: 10.12834/VetIt.1206.06

Calistri et al.

Control and prevention of epidemic emergencies

Figure 4. Number of infected nodes by time for different scenarios of control measures applied on the network of cattle movements in Italy in October 2007. Control measures are simulated by cancelling outgoing movements from selected premises on the basis of their values of centrality (16). disease potentially causing an emergency situation has been confirmed. In other words, the ‘action’ must follow the ‘decision’ in the shortest possible time. However, the efficacy of the reaction rests on the following factors:

is considered the international reference for all national or regional systems. In fact, through its web interface and e-alert system, WAHIS collects and disseminates a large quantity of information on animal disease outbreaks occurring worldwide (2).

• the existence of a short command chain with a clear distribution of competencies and responsibilities;

In Italy a similar application, called Information System for the notification of Animal Diseases (SIMAN) has recently been developed (7). SIMAN website encompasses several tools for data dissemination, including a web-GIS (Geographic Information System) application. It also allows for the collection and communication of data on animal disease outbreaks occurring in Italy according to OIE and European Union standards.

• the presence of standard and clear procedures, already validated during simulations or previous emergencies; • the availability of well trained personnel, appropriate equipment and diagnostic materials; • the availability of adequate financial funds for the compensation of farmers and for other expenses. However, all the above listed requisites would not be sufficient as long as the decision-makers and in-field personnel will lack a good quality of data collection and an efficient information system able to provide updated and reliable information. Several information systems have been developed at national and international level with the aim of helping veterinary services in the management of epidemic emergencies. The World Animal Health Information System (WAHIS), developed by the World Organisation for Animal Health (OIE),

Veterinaria Italiana 2013, 49 (3), 255-261. doi: 10.12834/VetIt.1206.06

More recently, in collaboration with the Institute for the Protection and Security of the Citizen of the European Commission, a new web application, called ‘Epitrace’, has been developed for tracing animal movements between cattle herds. Actually, when an outbreak of a contagious disease is confirmed, two of the most pressing issues are the pin-pointing of most likely infection sources and the identification of the animals that might be infected by a further spread of the disease. The availability of a system able to provide veterinary services with the data of movements in and out the infected establishment in few minutes is, therefore, of paramount importance. Epitrace allows for quickly extracting from the Italian Cattle National Database

259

Control and prevention of epidemic emergencies

Calistri et al.

However, to avoid drawing wrong conclusions, the uncertainties behind any model should not be underestimated. The use of epidemiological models, for example, was strongly debated in the United Kingdom during the 2001 Foot-and-Mouth epidemic (13), especially in their ability of predicting the true magnitude of the epidemic and to supply valuable information for the evaluation of alternative control strategies.

Figure 5. Epitrace web application for the prompt visualization of all direct and indirect links of a specific herd in a given period of time. The application utilises the in real time data stored in the Italian Cattle National Database. all contacts from or towards a specified outbreak herd during a given time span. These contacts are represented as a network (Figure 5), the application can also access details about the identity of premises and the dates and number of animals transported. The analysis can be further extended by expanding specific areas of the network and interrogating the database interactively and in real time. Time is clearly a crucial factor in case of highly transmissible infectious diseases. Delays in recognition of the disease and application of proper control measures may lead to economically devastating consequences and to the choice of inappropriate control measures (1).

Conclusions Epidemiological modelling, risk maps and SNA techniques may help to better prioritize the interventions and the use of resources in the planning of early warning systems and in the management of control actions in case of epidemic emergencies.

260

Especially in the case of vector-borne diseases, the poor knowledge of vector biology and behaviour frequently introduces uncertainties into models, greatly reducing the accuracy of the predictions. Therefore, although sophisticated airborne and ecological models may be beneficial, sometimes relatively simple analyses of basic epidemiological data can be more appropriate. In Italy, for example, a quite uncomplicated risk assessment based on animal movement data allowed for identifying the areas at risk for Bluetongue serotype 8 virus introduction (11). This shows that the general approach of parsimony in the model complexity should always be followed. A different problem is related to the need for prompt and easily accessible information in case of emergency. Nowadays the broad range of technical solutions helps the development of new tools for information dissemination, but the quality of data gathered, stored and processed by the information systems is still the crucial aspect for any surveillance system. Therefore the respect of unambiguous rules and the existence of clear procedures for data collection and updating are essential to provide the decision-makers with reliable and useful information. In this regard, the availability of clear case definition and the presence of well trained personnel, both official veterinarians and practitioners, are all prerequisites for the efficiency of any passive surveillance system, thus facilitating a prompt recognition and response in case of disease occurrence.

Veterinaria Italiana 2013, 49 (3), 255-261. doi: 10.12834/VetIt.1206.06

Calistri et al.

Control and prevention of epidemic emergencies

References 1. Bates T.W., Thurmond M.C. & Carpenter T.E. 2003. Description of an epidemic simulation model for use in evaluating strategies to control an outbreak of footand-mouth disease. Am J Vet Res, 64, 195-204. 2. Ben Jebara K. 2007. WAHIS and the role of the OIE’s reference laboratories and collaborating centres. Dev Biol (Basel), 128, 69-72. 3. Bigras-Poulin M., Thompson R.A., Chriel M., Mortensen S. & Greiner M. 2006. Network analysis of Danish cattle industry trade patterns as an evaluation of risk potential for disease spread. Prev Vet Med, 76 (1-2),11-39. 4. Bonacich P. & Lloyd P. 2001. Eigenvector-like measures of centrality for asymmetric relations. Social Networks, 23, 191-201. 5. Calistri P., Giovannini A., Savini G., Monaco F., Bonfanti L., Ceolin C., Terregino C., Tamba M., Cordioli P. & Lelli R. 2010. West Nile virus transmission in 2008 in NorthEastern Italy. Zoonoses and Public Health, 57, 211-219. 6. Childs J. E. & Gordon E. R. 2009. Surveillance and Control of Zoonotic Agents Prior to Disease Detection in Humans. Mt Sinai J Med, 76 (5), 421-428. 7. Colangeli P., Iannetti S., Cerella A., Ippoliti C., Di Lorenzo A., Santucci U., Simonetti P., Calistri P. & Lelli R. 2011. The national information system for the notification of animal diseases in Italy. Vet Ital, 47 (3), 303-312. 8. Conte A., Giovannini A., Savini L., Goffredo M., Calistri P. & Meiswinkel R. 2003. The effect of climate on the presence of Culicoides imicola in Italy. J Vet Med B Infect Dis Vet Public Health, 50, 139-147. 9. Conte A., Goffredo M., Ippoliti C. & Meiswinkel R. 2007. Influence of biotic and abiotic factors on the distribution and abundance of Culicoides imicola and the Obsoletus Complex in Italy. Vet Parasitol, 150, 333-344. 10. Estrada-Peña A. & Venzal J.M. 2007. Climate Niches of Tick Species in the Mediterranean Region: Modeling of Occurrence Data, Distributional Constraints, and Impact of Climate Change. J Med Entomol, 44 (6), 1130-1138. 11. Giovannini A., Calistri P., Conte A., Goffredo M., Paladini C., Lelli R. & Caporale V. 2008. Bluetongue virus serotype 8 in Europe in 2007–2008 and the risk of virus introduction and spread in Italy. In Symposium on ‘Bluetongue in Europe back to the future’. Brescia (Italy), 7 June 2008. 12. Giovannini A., Paladini C., Calistri P., Conte A., Colangeli P., Santucci U., Nannini D. & Caporale V. 2004.

Veterinaria Italiana 2013, 49 (3), 255-261. doi: 10.12834/VetIt.1206.06

Surveillance system of bluetongue in Italy. Vet Ital, 40 (3), 369-384. 13. Kao R.R. 2002. The role of mathematical modelling in the control of the 2001 FMD epidemic in the UK. Trends Microbiol, 10 (6), 279-286. 14. Kao R.R., Danon L., Green D.M. & Kiss I.Z. 2006. Demographic structure and pathogen dynamics on the network of livestock movements in Great Britain. Proc Biol Sci, 273 (1597), 1999-2007. 15. Keeling M.J. & Rohani P. 2008. Modeling infectious diseases in humans and animals. Princeton University Press. Princeton (US) and Oxford (UK), 366 p. 16. Natale F., Giovannini A., Savini L., Palma D., Possenti L., Fiore G. & Calistri P. 2009. Network analysis of Italian cattle trade patterns and evaluation of risks for potential disease spread. Prev Vet Med, 92, 341-350. 17. Feiffer D.U., Robinson T.P., Stevenson M., Stevens K.B., Rogers D.J. & Clements A.C.A. 2008. Spatial Analysis in Epidemiology. Oxford University Press. 142 p. 18. Sarto I Monteys V., Ventura D., Pages N., Aranda C. & Escosa R. 2005. Expansion of Culicoides imicola, the main bluetongue virus vector in Europe, into Catalonia, Spain. Vet Rec, 156, 415-417. 19. Savini G., Goffredo M., Monaco F., De Santis P. & Meiswinkel R. 2003. Transmission of bluetongue virus in Italy. Vet Rec, 152, 119. 20. Savini G., Goffredo M., Monaco F., Di Gennaro A., Cafiero M.A., Baldi L., De Santis P., Meiswinkel R. & Caporale V. 2005. Bluetongue virus isolations from midges belonging to the Obsoletus complex (Culicoides, Diptera: Ceratopogonidae) in Italy. Vet Rec, 157, 133-139. 21. Tatem A.J., Baylis M., Mellor P.S., Purse B.V., Capela R., Pena I. & Rogers D.J. 2003. Prediction of bluetongue vector distribution in Europe and north Africa using satellite imagery. Vet Microbiol, 97, 13-29. 22. Townsend Peterson A. 2007. Ecological niche modelling and understanding the geography of disease transmission. Vet Ital, 43 (3), 393-400. 23. Van Ittersum M.K., Laffelaar P.A.,VanKeulen H., Kropff M.J., Bastiaans L. & Goudriaan J. 2002. Developments in modelling crop growth, cropping systems and productions systems in the Wageningen School. NJAS - Wageningen Journal of Life Sciences, 50 (2), 239-247. 24. Wasserman S. & Faust K. 1994. Social Network Analysis: Methods and Applications. New York and Cambridge, Cambridge University Press, 825 p.

261

SHORT COMMUNICATION Further evidence of lineage 2 West Nile Virus in Culex pipiens of North-Eastern Italy Gioia Capelli1*, Silvia Ravagnan1, Fabrizio Montarsi1, Silvia Ciocchetta1, Stefania Cazzin1, Lebana Bonfanti1, Annapia Di Gennaro2, Ottavio Portanti2, Paolo Mulatti1, Isabella Monne1, Giovanni Cattoli1, Giorgio Cester3, Francesca Russo4, Giovanni Savini2 & Stefano Marangon1 Istituto Zooprofilattico Sperimentale delle Venezie, Viale dell’Università 10, 35020 Legnaro, Padova, Italy Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy 3 Unità di Progetto Veterinaria, Veneto region, Dorsoduro 3493, 30123 Venice, Italy 4 Direzione Prevenzione, Veneto region, Dorsoduro 3493, 30123 Venice, Italy 1

* Corresponding author at: Laboratorio di Parassitologia, SCS3-Diagnostica specialistica, Istopatologia e Parassitologia. Istituto Zooprofilattico Sperimentale delle Venezie, Viale dell’Università 10, 35020 Legnaro, Padova, Italy. Tel.: +39 049 8084374, fax: +39 049 8084258, e-mail: gcapelli@izsvenezie.it.

Veterinaria Italiana 2013, 49 (3), 263-268. doi: 10.12834/VetIt.1304.02

Accepted: 22.07.2013 | Available on line: 28.08.2013

Keywords Culex pipiens, Mosquitoes, NS3, NS5, Surveillance, Virulence, West Nile virus lineage 2.

Summary West Nile Virus lineage 1 (WNV lin1) emerged in North-Eastern Italy in 2008 and, since then, it has been detected in animals, humans and mosquitoes. Three years later, in the same area, a lineage 2 (lin2) strain of WNV was found in birds and vectors. On August the 21st, during the 2012 WNV entomological surveillance plan, a WNV lin2 strain was detected by RT-PCR in a pool of Culex pipiens mosquitoes captured in Veneto region. According to the alignment of the partial sequences of the NS5 and NS3 genes, no differences between this Italian lineage 2 strain and the Nea Santa-Greece-2010 WNV isolate (Gr-10) were observed. Similarly to the Gr-10 strain, the putative NS3 aminoacid sequences of the Italian strain showed proline in position 249 instead of histidine (H249P). Although proline in position 249 has been suggested to increase the virulence of WNV strains, neither human nor veterinary cases associated to this strain have been reported in the region. A prompt mosquito disinfestation was organized to avoid the spread of this potential threatening virus. The simultaneous circulation of both WNV lineage 1 and 2 confirms North-Eastern Italy as a high risk area for WNV emergence and highlights the need for a continuous surveillance.

Ulteriore evidenza del virus West Nile lineaggio 2 nella zanzara Culex pipiens in Italia nord orientale Parole chiave Culex pipiens, NS3, NS5, Sorveglianza, Virulenza, Virus West Nile lineaggio 2, Zanzare.

Riassunto Il virus West Nile appartenente al lineaggio 1 (WNV lin1) è comparso in Italia nord-orientale nel 2008 e da allora è stato rilevato negli animali, nell’uomo e nel vettore (la zanzara della specie Culex pipiens). Tre anni dopo, nella stessa area, un ceppo di WNV appartenente al lineaggio 2 (WNV lin2) è stato ritrovato in uccelli e nel vettore. Il 21 agosto, durante la sorveglianza entomologica 2012, un pool di Culex pipiens catturato nella regione Veneto è risultato positivo alla RT-PCR per WNV lineaggio 2. Le sequenze parziali dei geni NS3 e NS5 sono risultate identiche al ceppo WNV Nea Santa-Greece-2010 (Gr-10). Come quest’ultimo ceppo, anche quello italiano ha mostrato la presenza di prolina in posizione 249 al posto di istidina nella sequenza amminoacidica NS3. Sebbene a questa sostituzione sia stato attribuito l’aumento di virulenza di alcuni ceppi di WNV, nessun caso umano o veterinario ad esso associato è stato rilevato in tutta l’area. Al fine di evitare il diffondersi di un virus potenzialmente più patogeno, si è ritenuto opportuno organizzare un’azione di disinfestazione straordinaria. La simultanea circolazione dei lineaggi 1 e 2 del WNV conferma quest’area del nord Italia come zona ad alto rischio per l’emergenza del virus e sottolinea l’importanza di una sorveglianza continua.

263

Lineage 2 West Nile Virus in North Eastern Italy

West Nile Virus (WNV) emerged in North-Eastern Italy in 2008 and since then it has been constantly detected in humans, animals and the vector mosquitoes (25, 10, 4, 5, 8, 11, 14). Most of the infections have been caused by WNV lineage 1 (lin1) strains, even though in 2011 a lineage 2 (lin2) strain similar to the Hungarian isolate was detected both in wild birds and local mosquitoes. This article describes the circulation of a WNV lin2 similar to the Nea Santa-Greece-2010 (Gr-2010) (27) strain- in Veneto region, North-Eastern Italy, in 2012. In order to monitor and control WNV circulation, serological, entomological and virological surveillance programmes for West Nile disease (WND) were implemented both at national and regional level (9, 13, 19, 20, 21). In 2012, thirty-four CO2-CDC like mosquito traps were placed in rural and suburban sites in North-Eastern Italy. The traps operated from May until October and were activated every 15 days for one night, from sunset to sunrise. It is noteworthy that the entomological monitoring system used for determining mosquito species composition, density, and WNV rate of infection (8) has also shown to be a very valuable tool for the early detection of virus circulation (11, 14). Collected mosquitoes were immediately refrigerated and transported to the laboratory, counted, identified using standard taxonomic keys (22, 28), and pooled in 50 specimens maximum, according to species, site, and date and then stored at −80 °C. Viral RNA was extracted from pooled mosquitoes (NucleoSpin 96 RNA kit; Machery-Nagel, Duren, Germany) and screened for the presence of flaviviruses by using a one-step SYBR Green-Based rRT-PCR targeting 250bp of the conserved region of the non-structural NS5 gene, with MAMD and cFD2 primers (18, 27). To confirm the presence of WNV, all flavivirus positive samples were tested by an RT-PCR (primer EWN-F and EWN-R) targeting 705bp of NS5 gene (2). PCR products were analyzed for purity and size by electrophoresis in 2% agarose gel after staining with GelRedTM Nucleic Acid Gel Stain (Biotium, Hayward, CA, USA). Amplicons were subsequently purified with ExoSAP-IT (USB Corporation, Cleveland, OH, USA) and sequenced in both directions using the Big Dye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA). The products of the sequencing reactions were cleaned-up using the Performa DTR Ultra 96well kit (Edge BioSystems, Gaithersburg, MD, USA) and analyzed on a 16-capillary ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems). Sequence data were assembled and edited with SeqScape software v 2.5 (Applied Biosystem). They have been aligned and compared with representative sequences available in GenBank.

264

Capelli et al.

On the 21st of August 2012, one pool of 50 Culex pipiens mosquitoes (Cx.pi.2436/12-RO), collected in the Rovigo province, Veneto region, was found positive for WNV. The BLAST and phylogenetic analysis of the sequence confirmed the strain as WNV lin2. This sample was also amplified by using a specific RT-PCR with the primer pair WN-NS3up1 and WN-NS3do1 (26) that target 778bp of the NS3 gene. The representative NS5 sequences of the WNV lin1 and lin2 and the NS3 sequences of the WNV lin2 found from 2008 to 2012 in Cx. pipiens - animals and humans in the same area of North-Eastern Italy - were compared with reference sequences (Figures 1 and 2). Phylogenetic analyses were carried out for NS5 and NS3 partial gene sequences using the neighbour-joining (N-J) method with 1,000 bootstrap replicates implemented in the MEGA 4 programme (30, 31). NS5 and NS3 sequences were submitted to GenBank database (accession numbers JX878387 and JX878386, respectively). RNA partial sequence of NS3 and NS5 genes revealed 99-100% identity with WNV isolate Nea Santa-Greece-2010 (Gr-10) (HQ537483). Based on these sequences, the Cx.pi.2436/12-RO strain was closely related to WNV lin2 strains detected in Italy in 2011 and Hungary in 2004 (Figures 1 and 2). The putative aminoacid sequences of the polyprotein precursor showed the aminoacid substitution histidine vs proline at the 249 site (H249P) in the NS3 helicase. The phylogenetic tree of NS5 sequences of WNV lin1 and lin2 (Figure 2) shows that the North‑Eastern strains of WNV lin1 are separated in two clusters, each defined by high bootstrap values (>70%). In particular, the first group contains viruses closely related to the original strains Italy/08 and NY-99, while the second includes viruses closely related to the Livenza strain (JQ928174), isolated in humans (6). To the best of our knowledge this is the first evidence of WNV lin2 similar to the Greek variant Gr-2010 in Italy. The Cx.pi.2436/12-RO strain characterized in this study holds the H249P substitution which was supposed to be related to the higher virulence of WNV lin2 that emerged in Greece in 2010 (15, 16), causing more than 250 neuroinvasive disease cases with 15% fatality (17). Single non-silent mutations in non-structural genes were indicated to modulate WNV virulence, both exacerbating and attenuating infectivity (29, 12, 32). A NS3-Pro249 substitution was present in the virus isolated in the 1951 Egyptian outbreak and in the 1999 New York outbreak, both associated with high fatality rate (7). In experimental studies the introduction of the substitution T249P in the NS3 helicase of a low-virulence WNV strain generated a phenotype highly virulent to American crows with a higher capacity to replicate, and which would

Veterinaria Italiana 2013, 49 (3), 263-268. doi: 10.12834/VetIt.1304.02

Capelli et al.

likely result in increased virus transmission rates (7). This particular substitution T249P was detected in all human isolates from the 2008 outbreak (WNV lin1) and was heterogeneously distributed among the 2009 human isolates. The authors concluded that it could not be considered a hallmark of the WNV strain causing the outbreak (23, 24). Fortunately, the finding of our WNV lin2 in Cx. pipiens in August was not followed by human or animal cases due to this specific strain. However, in order to avoid further spread of a potential threatening virus, the regional authorities decided to implement the routine mosquito disinfestation with an extraordinary campaign, targeting both larval breeding sites within a three kilometres radius from the positive trap and adult mosquitoes close to human settling. In North-Eastern Italy, WNV lineage 1 and 2 were found to circulate since 2008. Specifically, the WNV lin1 (Italy/08) emerged in 2008 and overwintered through 2010. It was no more detected in hosts and vectors in the following years; the WNV lin1 (Livenza‑Italy/11) emerged in 2010 and was still circulating in summer 2012, affecting humans, animals and mosquitoes; while the WNV lin2

Lineage 2 West Nile Virus in North Eastern Italy

(Hungary-2004) circulated among mosquitoes and birds in 2011. Finally, the WNV lin2 (Gr-2010) strain emerged for the first time in 2012 in mosquitoes collected in an area of the region constantly monitored for the presence of WNV and its future circulation is unpredictable. These findings highlight the fact that new introductions, likely through migratory birds from Africa and within Europe, have occurred in few years (WNV lin1 and lin2) and indicate the capability of these viruses to become endemic and to rapidly evolve and emerge in different sites (3). In conclusions, our results confirm North‑Eastern Italy as a high-risk area for WNV emergence and outbreaks, and strongly call for the need of a continuous surveillance in the future. Authors wish to thank all the personnel of the Local Health Units (ULSS) of Veneto region that supported the field activities. This work was partially supported by the Veneto region (DGRV n. 1094, 26/08/2011; DGRV n. 2562, 29/12/2011) and by the EU grant HEALTH.2010.2.3.3-3 Project 261391 EuroWestNile.

Figure 1. Phylogenetic tree of WNV lineage 2 NS3 partial sequences. Phylogenetic tree based on a fragment of 778bp of NS3 gene of West Nile virus. Sequence dataset was analyzed using MEGA 4, the neighbour-joining (NJ) method, and bootstrap analysis (1,000 replicates) based on the ClustalW algorithm. Significant bootstrapping values (>65%) are shown on the nodes. () Italian WNV lineage 2 strains detected in pools of Culex pipiens in North-Eastern Italy: Cx.pi.2436/12-RO caught in Rovigo province in 2012 and Cx.pi.1968/11UD, caught in Udine Province in 2011. () Italian WNV lineage 2 strain detected in animals: Co.d.5328/11-TV, a collared dove found dead in Treviso province in 2011. WNV lineage 2 strains from GenBank (GenBank accession number, isolation source, country, year): JN858070 human, Italy (Ancona), 2011 (1); DQ116961 goshawk, Hungary, 2004; JF917092 human, Geece, 2010; HQ537483 Culex pipiens, Greece, 2010; JN398476 gallus, Greece, 2011; EF429198 human, South Africa, 2001; DQ318019 Senegal; EF429199 human, South Africa, 2000; HM147823 Madagascar, 1988; HM147822 South Africa, 1958. WNV lineage 1 strain from GenBank AF260968, Egypt.

Veterinaria Italiana 2013, 49 (3), 263-268. doi: 10.12834/VetIt.1304.02

265

Lineage 2 West Nile Virus in North Eastern Italy

Capelli et al.

Figure 2. Phylogenetic tree of WNV lineage 1 and 2 NS5 partial sequences. Phylogenetic tree based on a fragment of 705bp of the NS5 gene of West Nile virus. Sequence dataset was analyzed using MEGA 4, the neighbour-joining (NJ) method, and bootstrap analysis (1,000 replicates) based on the ClustalW algorithm. The tree obtained was rooted with WNlin 3 (AY 765264) strain. Significant bootstrapping values (>70%) are shown on the nodes. () Italian WNV strain detected in pools of Culex pipiens in North-Eastern Italy: Cx.pi.2587/10-VE, Cx.pi.1607/11-VE and Cx.pi.2383/12-VE caught in Venice province in 2010, 2011 and 2012; Cx.pi.2435/10-RO and Cx.pi.2436/12-RO caught in Rovigo province in 2010 and 2012; Cx.pi.1968/11-UD, caught in Udine Province in 2011. () Italian WNV strain detected in animals: Lark-7119-9/12VE found dead in Venice Province in 2012, Co.d.5328/11-TV, a collared dove found dead in Treviso province in 2011. WNV lineage1 strains from GenBank (GenBank accession number, isolation source, country, year): AF202541 human, New York, 1999; AF481864 stork, Israel, 1998; HM152775 human, Israel, 2000; GU011992 human, Italy (Veneto Region), 2009; FJ483548 magpie, Italy, 2008; AF404757 equine, Italy, 1998; AY701412 equine, Morocco, 1996; JN858069 human, Italy, 2011; JQ928174 human, Italy (Livenza), 2011; AF260969 Culex pipiens, Romania, 1996; AY277252 human, Russia, 1999; AF260968 Egypt; AM404308 Culex pipiens, Portugal, 2004. WNV lineage 2 strains from GenBank: EF429198 human, South Africa, 1989; JN858070 human, Italy (Ancona), 2011; DQ116961 goshawk, Hungary, 2004; HQ537483 Culex pipiens, Greece, 2010. WNV lineage 3 strain from GenBank: AY765264 Culex pipiens, Czech Republic, 1997.

266

Veterinaria Italiana 2013, 49 (3), 263-268. doi: 10.12834/VetIt.1304.02

Capelli et al.

Lineage 2 West Nile Virus in North Eastern Italy

References 1. Bagnarelli P., Marinelli K., Trotta D., Monachetti A., Tavio M., Del Gobbo R., Capobianchi M.R., Menzo S., Nicoletti L., Magurano F. & Varaldo P.E. 2011. Human case of autochthonous West Nile virus lineage 2 infection in Italy, September 2011. Euro Surveill, 16 (43), pii=20002. http://www.eurosur veillance.org/ViewAr ticle. aspx?ArticleId=20002. 2. Bakonyi T., Ivanics E., Erdelyi K., Ursu K., Ferenczi E., Weissenbock H. & Nowotny N. 2006. Lineage 1 and 2 strains of encephalitic West Nile virus, central Europe. Emerg Infect Dis, 12 (4), 618-23. 3. Bakonyi T., Ferenczi E., Erdélyi K., Kutasi O., Csörgö T., Seidel B., Weissenböck H., Brugger K., Bán E. & Nowotny N. 2013. Explosive spread of a neuroinvasive lineage 2 West Nile virus in Central Europe, 2008/2009. Vet Microbiol, 165 (1-2), 61-70. 4. Barzon L., Pacenti M., Cusinato R., Cattai M., Franchin E., Pagni S., Martello T., Bressan S., Squarzon L., Cattelan A.M., Pellizzer G., Scotton P., Beltrame A., Gobbi F., Bisoffi Z., Russo F. & Palù G. 2011. Human cases of West Nile Virus Infection in North-Eastern Italy, 15 June to 15 November 2010. Euro Surveill, 16 (33), pii=19949. http://www.eurosur veillance.org/ViewAr ticle. aspx?ArticleId=19949. 5. Barzon L., Pacenti M., Franchin E., Squarzon .L, Lavezzo E., Toppo S., Martello T., Cattai M., Cusinato R. & Palù G. 2012. Novel West Nile virus lineage 1a full genome sequences from human cases of infection in North‑Eastern Italy, 2011. Clin Microbiol Infect, 18 (12), E541-4. 6. Barzon L., Pacenti M., Franchin E., Lavezzo E., Martello T., Squarzon L., Toppo S., Fiorin F., Marchiori G., Russo F., Cattai M., Cusinato R. & Palù G. 2012. New endemic West Nile virus lineage 1a in northern Italy, July 2012. Euro Surveill, 17 (31), pii=20231. http://www.eurosur veillance.org/ViewAr ticle. aspx?ArticleId=20231. 7. Brault A.C., Huang C.Y., Langevin S.A., Kinney R.M., Bowen R.A., Ramey W.N., Panella N.A., Holmes E.C., Powers A.M. & Miller B.R. 2007. A single positively selected West Nile viral mutation confers increased virogenesis in American crows. Nat Genet, 39, 1162‑1166. 8. Busani L., Capelli G., Cecchinato M., Lorenzetto M., Savini G., Terregino C., Vio P., Bonfanti L., Pozza M.D. & Marangon S. 2011. West Nile virus circulation in Veneto region in 2008-2009. Epidemiol Infect, 139 (6), 818-825. 9. Calistri P., Giovannini A., Hubalek Z., Ionescu A., Monaco .F, Savini G. & Lelli R. 2010. Epidemiology of West Nile in Europe and in the Mediterranean basin. Open Virology Journal, 4, 29-37. 10. Calistri P., Giovannini A., Savini G., Monaco F., Bonfanti L., Ceolin C., Terregino C., Tamba M., Cordioli P. & Lelli R. 2010. West Nile virus transmission in 2008 in North‑Eastern Italy. Zoonoses Public Health, 57 (3), 211-219. 11. Gobbi F., Barzon L., Capelli G., Angheben A., Pacenti M., Napoletano G., Piovesan C., Montarsi F., Martini S.,

Veterinaria Italiana 2013, 49 (3), 263-268. doi: 10.12834/VetIt.1304.02

Rigoli R., Cattelan A.M., Rinaldi R., Conforto M., Russo F., Palù G. & Bisoffi Z. 2012. Veneto Summer Fever Study Group. Surveillance for West Nile, dengue, and chikungunya virus infections, Veneto Region, Italy, 2010. Emerg Infect Dis, 18 (4), 671-673. 12. Liu W.J., Wang X.J., Clark D.C., Lobigs M., Hall R.A. & Khromykh A.A. 2006. A single amino acid substitution in the West Nile virus nonstructural protein NS2A disables its ability to inhibit alpha/beta interferon induction and attenuates virus virulence in mice. J Virol, 80, 2396-2404. 13. Ministero della Salute. 2008. Approvazione del Piano di sorveglianza nazionale per la encefalomielite di tipo West Nile (West Nile disease). [Approval of the national surveillance plan for West Nile encephalomyelitis]. Official Journal n. 36 of 12 february 2008. http://www. trovanorme.salute.gov.it/dettaglioAtto?id=25243. 14. Mulatti P., Bonfanti .L, Capelli G., Capello K., Lorenzetto M., Terregino C., Monaco F., Ferri G. & Marangon S. 2013. West Nile Virus in North-Eastern Italy, 2011: Entomological and Equine IgM-Based Surveillance to Detect Active Virus Circulation. Zoonoses Public Health, 60 (5), 375-382. 15. Papa A., Bakonyi T., Xanthopoulou K., Vázquez A., Tenorio A. & Nowotny N. 2011. Genetic characterization of West Nile virus lineage 2, Greece, 2010. Emerg Infect Dis, 17 (5), 920-922. 16. Papa A., Xanthopoulou K., Gewehr S. & Mourelatos S. 2011. Detection of West Nile virus lineage 2 in mosquitoes during a human outbreak in Greece. Clin Microbiol Infect, 17 (8), 1176-1180. 17. Papa A. 2012. West Nile virus infections in Greece: an update. Expert Rev Anti Infect Ther, 10 (7), 743-750. 18. Ravagnan S., Granato A., Porcellato E., Cazzin S., De Nardi R., Mazzacan E., De Battisti C., Marangon S. & Capelli G. 2011. Development of a one-step realtime PCR assay for detection of flaviviruses in pooled mosquitoes. In 5th Annual Meeting EPIZONE, 11–14 April 2011, The Netherlands. 19. Regione Veneto. 2011. Deliberazione della giunta regionale N. 1094 del 26/07/2011 (BUR n. 63 del 23/08/2011). Progetto Sorveglianza sulle zoonosi trasmesse da vettori e valutazione del rischio di diffusione sul territorio della Regione Veneto. http:// bur.regione.veneto.it/Bur vSer vices/Pubblica/ DettaglioDgr.aspx?id=234061. 20. Regione Veneto. 2012. Deliberazione della giunta regionale N. 1519 del 31/07/2012 (BUR n. 71 del 28/08/2012). Progetto Sorveglianza sulle zoonosi trasmesse da vettori e valutazione del rischio di diffusione sul territorio della Regione Veneto. http:// bur.regione.veneto.it/Bur vSer vices/Pubblica/ DettaglioDgr.aspx?id=241875. 21. Regione Veneto. 2011. Deliberazione della giunta regionale N. 2562 del 29/12/2011 (BUR n. 10 del 31/01/2012). Piano Regionale Prevenzione del Veneto - anni 2010-2012. http://bur.regione.veneto.it/ BurvServices/Pubblica/DettaglioDgr.aspx?id=237293.

267

Lineage 2 West Nile Virus in North Eastern Italy

22. Romi R., Pontuale G. & Sabatinelli G. 1997. Le zanzare italiane: generalitĂ e identificazione degli stadi preimaginali (Diptera, Culicidae). Fragmenta entomologica, 29, 1-141. 23. Rossini G., Carletti F., Bordi L., Cavrini F., Gaibani P., Landini M.P., Pierro A., Capobianchi M.R., Di Caro A. & Sambri V. 2011. Phylogenetic analysis of West Nile virus isolates, Italy, 2008-2009. Emerg Infect Dis, 17 (5), 903-906. 24. Rossini G., Carletti F., Rigoli R., Piga S., Bagnarelli P., Gaibani P., Pierro A., Nanni Costa A., Grossi P., Ippolito G., Landini M.P., Di Caro A., Capobianchi M.R. & Sambri V. 2013. Heterogeneity of West Nile virus genotype 1a in Italy, 2011. J Gen Virol, 94 (Pt 2), 314-317. 25. Savini G., Monaco F., Calistri P. & Lelli R. 2008. Phylogenetic analysis of West Nile virus isolated in Italy in 2008. Euro Surveill, 13 (48), pii=19048. http://www. eurosurveillance.org/ViewArticle.aspx?ArticleId=1904. 26. Savini G., Capelli G., Monaco F., Polci A., Russo F., Di Gennaro A., Marini V., Teodori L., Montarsi F., Pinoni C., Pisciella M., Terregino C., Marangon S., Capua I. & Lelli R. 2012. Evidence of West Nile virus lineage 2 circulation in Northern Italy. Vet Microbiol, 158 (3-4), 267-273. 27. Scaramozzino N., Crance J.M., Jouan A., Debriel Da Stoll F. & Garin D. 2001. Comparison of flavivirus universal primer pairs and development of a rapid, highly sensitive heminested reverse transcription-PCR assay

268

Capelli et al.

for detection of flaviviruses targeted to a conserved region of the NS5 gene sequences. J Clin Microbiol, 39, 1922-1927. 28. Severini F., Toma L., Di Luca M. & Romi R. 2009. Le zanzare italiane: generalitĂ e identificazione degli adulti (Diptera, Culicidae). Fragmenta entomologica, 41 (2), 213-372. 29. Shirato K., Miyoshi H., Goto A., Ako Y., Ueki T., Kariwa H. & Takashima I. 2004. Viral envelope protein glycosylation is a molecular determinant of the neuroinvasiveness of the New York strain of West Nile virus. J Gen Virol, 85, 3637-3645. 30. Tamura K., Dudley J., Nei M. & Kumar S. 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 40. Mol Biol Evol, 24, 1596-1599. 31. Thompson J.D., Higgins D.G. & Gibson T.J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res, 22, 4673-4680. 32. Wicker J.A., Whiteman M.C., Beasley D.W., Davis C.T., Zhang S., Schneider B.S., Higgs S., Kinney R.M. & Barrett A.D. 2006. A single amino acid substitution in the central portion of the West Nile virus NS4B protein confers a highly attenuated phenotype in mice. Virology, 349 (2), 245-253.

Veterinaria Italiana 2013, 49 (3), 263-268. doi: 10.12834/VetIt.1304.02

First cases of Schmallenberg virus in Italy: surveillance strategies Federica Monaco1, Maria Goffredo1, Valentina Federici1, Andrea Carvelli1, Andrea Capobianco Dondona1, Andrea Polci1, Chiara Pinoni1, Maria Luisa Danzetta1, Lucia Selli2, Michela Bonci2, Michela Quaglia1 & Paolo Calistri1* 1

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise 'G. Caporale', Campo Boario, 64100 Teramo, Italy 2 Istituto Zooprofilattico Sperimentale delle Venezie, Viale dell'Università 10, 35020 Legnaro (PD), Italy * Corresponding author at: Epidemiology Unit, National Reference Centre for Veterinary Epidemiology, Programming, Information and Risk Analysis, Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy. Tel.: +39 0861 332241, e-mail: p.calistri@izs.it

Veterinaria Italiana 2013, 49 (3), 269-275. doi: 10.12834/VetIt.1101.11

Accepted: 02.09.2013 | Available on line: 24.09.2013

Keywords Control strategies, Epidemiological analysis, Schmallenberg virus (SBV), Surveillance, Italy.

Summary Following the first report of Schmallenberg virus (SBV) in the brain of a dystocic goat foetus in 2012 in Northern Italy, immediate response actions were adopted to avoid the virus circulation. The brain tested positive by 2 different one-step real-time RT-PCR protocols; these results were also confirmed by partial sequencing of the viral genome. At that time this was the first detection of the new Orthobunyavirus genus within the Bunyaviridae family in Italy. An epidemiological investigation in the involved farm was carried out in collaboration with the CESME - National Reference Centre for the study and verification of Foreign Animal Diseases (Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise 'G. Caporale', Italy). Epidemiological information on the flock was provided and analysed, whole blood and serum samples were also collected from all animals in the farm for both virological and serological investigations. All blood samples tested negative for SBV, whereas serological positive results were obtained by virus-neutralization (VN). Epidemiological investigations indicated the possible virus circulation in the area. The subsequent surveillance actions were mainly based on the standardization and reenforcement of passive surveillance protocols, a risk-based serological surveillance programme through VN and an entomological surveillance programme in the involved geographical areas were also put in place. Eventually SBV local circulation was confirmed by real time RT-PCR in 6 Culicoides pools, collected between September and November 2011 in 3 farms in the surroundings of the area of SBV outbreak.

269

Monaco et al.

Surveillance strategies in Italy after SBV outbreak in 2012

Primi casi di infezione da virus Schmallenberg in Italia: strategie di sorveglianza Parole chiave Analisi epidemiologica, Italia, Sorveglianza, Strategie di controllo, Virus Schmallenberg (SBV).

Riassunto Lo studio descrive le strategie di soveglianza implementate in seguito al primo rinvenimento in Italia del virus Schmallenberg (SBV) appartenente al genere Orthobunyavirus. Il virus è stato rilevato nel 2012 nel cervello di un feto di capra nato da un parto distocico nel Nord Italia. Il cervello del feto è risultato positivo a due differenti protocolli di real time RT-PCR one-step, gli stessi risultati sono stati confermati anche mediante sequenziamento parziale del genoma virale. A seguito del rilevamento del virus sono state adottate azioni di risposta immediata per impedirne la diffusione. Un’indagine epidemiologica è stata condotta nell’azienda interessata in collaborazione con il CESME, Centro di Referenza Nazionale per lo studio e l'accertamento delle malattie esotiche degli animali (National Reference Centre for the study and verification of Foreign Animal Diseases - Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale”). L’indagine ha permesso di raccogliere e analizzare informazioni di interesse epidemiologico sul gregge e sottoporre ad analisi sierologiche e virologiche i campioni di siero e sangue intero di tutti gli animali presenti nell’azienda. Gli accertamenti sierologici mediante siero-neutralizzazione hanno dato risultati positivi, a differenza dei campioni di sangue intero risultati negativi a SBV. Le indagini epidemiologiche hanno indicato la possibile circolazione del virus nell’area in esame. Le azioni di sorveglianza seguite all’indagine sono state basate principalmente su: standardizzazione e applicazione di protocolli di sorveglianza passiva, sorveglianza sierologica (basata sul rischio mediante l’impiego di siero-neutralizzazione) e sorveglianza entomologica nelle aree geografiche coinvolte. La circolazione locale di SBV è stata, in seguito, confermata dal real time RT-PCR in sei pool di Culicoides raccolti, tra settembre e novembre 2011, in tre aziende ubicate nelle vicinanze del focolaio di SBV.

Introduction Between the end of 2011 and the beginning of 2012, Schmallenberg virus (SBV) has been reported in ruminants (cattle, sheep, goats and bison) in Germany, the Netherlands, Belgium, United Kingdom, France, Italy, Spain and Luxembourg (8, 9). Preliminary studies on its genome suggested the virus affiliation to the Simbu serogroup, belonging to the genus Orthobunyavirus within the Bunyaviridae family. Adult animals infected with SBV show mild clinical signs persisting for approximately one week and characterized by fever, loss of appetite, up to 50% reduction in milk yield and, sometimes, severe diarrhoea (14). SBV infection is also associated to foetal malformation and stillbirths (16). After the first confirmed cases in several European countries, the Italian Ministry of Health provided indications to enforce passive surveillance in all farms with ruminants, particularly in those that had introduced live animals from affected countries. These provisions, coupled with the information disseminated through the website of the CESME (http://www.izs.it/IZS/Engine/RAServePG.php/ P/357410010300/M/250010010303), the Italian National Reference Centre for the study and verification for Foreign Animal Diseases (Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise 'G. Caporale'), arose the concern of veterinary services. The detection of this new infection on the Italian

270

territory posed new and pressing questions. Due to the lack of information on virus epidemiology, a broad-spectrum approach was chosen to quickly define the area that may have been potentially involved by virus circulation. In this respect, it turned out to be highly important to have in place a valuable entomological surveillance program, as it has been argued by Goffredo (12). This article describes the surveillance approaches endorsed by the Italian Ministry of Health to promptly investigate the impact of the infection and to coordinate the subsequent actions.

Materials and methods First case finding At the beginning of February 2012 suspicions of infection were notified in 3 Italian regions. Eventually, only 1 case was confirmed in a small herd of Treviso Province, Veneto Region (Figure 1). In this farm, where 1 calf and 6 goats were kept, a female goat suddenly died the day after parturition of a healthy kid. The carcass was submitted for post-mortem examination and necropsy revealed the retention of a dystocic foetus showing congenital malformations, namely: scoliosis, arthrogryposis and ankylosis of some of the limb joints. Brain and spleen samples of the foetus were submitted for virus detection.

Veterinaria Italiana 2013, 49 (3), 269-275. doi: 10.12834/VetIt.1101.11

Monaco et al.

Surveillance strategies in Italy after SBV outbreak in 2012

cells (BHK21, ATCC-CCL 10). Serial ten‑fold dilutions of antigen were made. After 5 days the titre was determined by using the Reed and Muench (1938) formula (15). Serum samples were inactivated at 56°C for 30 min. Starting from 1:2, serial twofold dilutions were made from serum samples in microtitre plates, and 100 TCID50 units of antigen were added to each dilution. Thereafter, the mixtures were incubated at 37°C for 1h and 105 BHK21 cells were added to the wells. Plates were read after 5 days of incubation at 37°C. The antibody titre was defined as the reciprocal of the highest dilution of the test serum sample, which showed at least 90% neutralization. Positive and negative control sera were included in each plate.

Figure 1. Geographical area in which confirmed and not confirmed first cases of SBV occurred. After RNA extraction, samples were tested by 2 one-step real-time RT-PCR protocols, developed by the Friedrich Loeffler Institut (FLI) (Insel Riems, Germany), respectively targeting the L1 and S3 genomic fragments (13). Brain tested positive to both protocols, whereas spleen was negative. Both samples were sent to CESME, which confirmed the presence of SBV in the brain by qRT-PCR and partial sequence of the viral genome.

Virus neutralization and sequencing After the outbreak confirmation, an epidemiological investigation in the farm was immediately carried out in collaboration with CESME’s personnel. Epidemiological information on the flock was collected as well as whole blood and serum samples from all animals. The samples were then sent to the CESME’s laboratories for serological and virological analyses. Blood was tested by both qRT-PCRs, whereas the detection of the presence of SBV specific antibodies was assessed by virusneutralization (VN). Both the strain and the positive control used during this study were kindly supplied by the FLI. Prior to the VN test, SBV was titrated in a cytopathic effect (CPE) TCID50 assay using Baby Hamster Kidney 21 Veterinaria Italiana 2013, 49 (3), 269-275. doi: 10.12834/VetIt.1101.11

Total RNA was extracted from 200 µl of cell culture supernatant from the brain of the positive foetus with High Pure Viral Nucleic Acid kit (Roche, Nutley, NJ, USA) and eluted with 50 µl of Elution buffer according to the manufacturer instruction. Viral RNA was reverse transcribed and the small (S) segment amplified. Amplification and sequencing were repeated twice to avoid introduction of artificial substitutions. Raw sequence data were assembled using Contig Express (Vector NTI® suite 9.1, Invitrogen, Carlsbad, CA, USA) and the consensus sequence was aligned with the German SBV strain isolated in 2012 (HE649914) to evaluate the variation within the strains.

Surveillance activities A wide spectrum of surveillance actions was put in place to verify the SBV circulation in the area and possibly define the geographical extension of infection. The choice of an appropriate surveillance strategy was hampered by the absence of a serological assay (i.e. ELISA) for processing a large number of sera when first cases occurred at the beginning of 2012 in Italy. The surveillance programme was mainly based on: • standardization and re-enforcement of passive surveillance protocols; • risk-based serological surveillance through VN; • entomological surveillance in the involved geographical areas. As a first step for the re-enforcement of passive surveillance actions, the Italian Ministry of Health adopted clear definitions of suspected and confirmed cases (Table I). The official publication and dissemination of these definitions, together with the preparation of specific forms to be filled by veterinarians in case of suspicion, allowed for standardizing the veterinary services actions and for a better harmonization of the collected data (4). Given the unavailability at that time of a serological

271

Monaco et al.

Surveillance strategies in Italy after SBV outbreak in 2012

Table I. Definitions of suspected and confirmed SBV cases adopted by the Italian Ministry of Health. Suspected case

Confirmed case

Foetuses and neonates

Arthrogryposis hydranencephaly syndrome (AHS), mummified foetuses, ataxia, paralysed limbs, muscle atrophy, torticollis, brachygnatia, nervous system failure or stillbirths, not attributed to a known cause.

Adult animals

Ruminants with diarrhoea or milk production drop, not attributed to a known cause.

Virus detection or viral genome detection by direct (RTPCR or virus isolation) or indirect (serological assays) in animal samples or virus detection or viral genome detection (RT-PCR) in midges.

Midges

assay for processing large number of sera, a risk‑based approach was chosen for the serological surveillance. In case of suspicion, local veterinary services collected blood samples from all animals in the herd/flock, which were then tested by VN at the CESME laboratory. Additional clinical examinations in epidemiologically linked farms and in all animals living within 4 km of radius were also mandatory. A sample of animals was also tested in order to determine the serological prevalence of infection within suspected herds/flocks. The sample size was calculated for an expected within-herd prevalence of 10% and a level of confidence of 95%. This size was chosen according to previous experiences with bluetongue infection in Italy (2). As for the entomological surveillance, a retrospective survey was carried out on 6 selected sites, located in Veneto and Friuli Venezia Giulia regions: in particular 2 in Treviso province, 1 in Belluno province and 3 in Pordenone province. The selected sites were located in a radium of about 50 km from the outbreak. Between June the 1st and November the 30th 2011, 87 Culicoides collections were made within the framework of the national surveillance plan for bluetongue. The samples were stored in ethanol 70% and were selected to be tested for SBV. A total of 20,380 Culicoides were identified, according to Delécolle (5), Campbell & Pelham-Clinton (3), and Goffredo & Meiswinkel (11). The Obsoletus Complex (including Culicoides obsoletus and Culicoides scoticus) alone represented 94% of the collected midges (n = 19,272), followed by the Nubeculosus and Pulicaris complexes (3% and 1%, respectively). Other species, considered responsible for the transmission of arboviruses, were very low abuntant (i.e. few specimens of Culicoides dewulfi) or absent (i.e. Culicoides chiopterus). All the midges were age-graded according to Dyce (6). The whole bodies of parous and, when present, engorged females were separately sorted out in pools according to species, place and date of collection. All the pools were tested by qRT-PCR for the presence of SBV and by RT-PCR according to the technique describe by Bilk (1). A total of 175 pools were prepared (ranging from 1 to 50 specimens): 138

272

Table II. Suspected and not confirmed cases notified until May the 2nd 2012. Case 1 2 3 4 5

Region Veneto Veneto Veneto Piemonte Sardegna

Province Venezia Venezia Treviso Torino Cagliari

Species Bovine Bovine Bovine Bovine Bovine

Test RT-PCR VN RT-PCR RT-PCR RT-PCR

Repubblica di San Marino

Bovine

RT-PCR

7 8 9 10 11 12 13 14

Piemonte Sardegna Sardegna Sardegna Marche Piemonte Lazio Sardegna

Repubblica di San Marino

Bovine

RT-PCR

Repubblica di San Marino

Bovine

Repubblica di San Marino

Bovine

Repubblica di San Marino

Bovine

Repubblica di San Marino

Bovine

Cuneo Sheep Cagliari Bovine Cagliari Sheep Cagliari Sheep Ascoli Piceno Goat Torino Bovine Frosinone Water buffalo Oristano Sheep

RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR RT-PCR

RT-PCR = real-time RT-PCR assays targeting the L1 and S3 genomic fragments; VN = virus neutralization.

composed by midges belonging to the Obsoletus Complex (number of midges = 4,062), 17 to the Nubeculosus Complex (number of midges = 100) and 20 to the Pulicaris Complex (number of midges = 52).

Results After the molecular detection of the first Italian case of SBV, 19 suspected cases have been submitted to CESME laboratory for confirmation (Table II).

Veterinaria Italiana 2013, 49 (3), 269-275. doi: 10.12834/VetIt.1101.11

Monaco et al.

Surveillance strategies in Italy after SBV outbreak in 2012

The presence of antibodies against the SBV was confirmed in 4 goats and 2 calves, with titres ranging from 1:16 to 1:1280. All the goats and 1 of the calves belonged to the farm where infection was first detected by RT-PCR, whereas a second positive calf was identified thanks to the serological monitoring in a farm located 30 km from the previous outbreak (Table III).

Discussion

Once compared with the sequence of SBV isolated in Germany, the Italian strain showed 100% similarity of the small genome segment.

After SBV occurrence, the most pressing issues to be addressed were:

The epidemiological investigation carried out in the first positive farm excluded the introduction of animals from the EU infected countries, hence supporting the hypothesis of a local virus circulation. A total of 6 pools resulted positive to SBV: 4 pools were collected in a farm located 40 km from the outbreak on September the 6th, in October from the 21st to the 25th and on November the 3rd, 1 pool was collected on October the 4th about 8 km away and another pool was collected on November the 7th about 35 km away from the first SBV outbreak (Table IV). All the positive pools consisted of species of the Obsoletus Complex, 5 of them were composed by parous females (ranging from 5 to 47) and 1 by a single engorged midge collected in Feltre on September the 6th.

The detection of SBV in Central Europe and, eventually, in Italy posed new and complex problems, which needed a tempestive solution. In particular, the lack of knowledge on disease epidemiology and its impact and the availability of limited diagnostic resources forced the Italian Ministry of Health to evaluate different surveillance approaches.

• verify whether SBV had actively circulated within the populations of competent vectors in Italy; • define the geographical extension of SBV transmission; • collect information for assessing the possible impact of the disease on Italian ruminant population. The chosen surveillance approach considered 3 main pillars: • standardization and re-enforcement of passive surveillance protocols; • risk-based serological surveillance through VN; • entomological surveillance in the involved geographical areas.

Table III. Confirmed cases until May the 2nd 2012. Region

Veneto

Province

Farm

Longitude

Latitude

Farm #1

12.401932

45.983328

Treviso Farm #2

12.014148

45.914440

Species

Number of positive animals

Test

Goat

RT-PCR*

Bovine

VN**

Goat

Bovine

RT-PCR = real-time RT-PCR assays targeting the L1 and S3 genomic fragments; VN = virus neutralization.

Table IV. Pools of Culicoides collected within the bluetongue surveillance from June the 1st to November the 30th 2011 and tested for SBV. All the positive pools belong to the Obsoletus Complex, including C. obsoletus and C. scoticus. Region

Province

Farm

Longitude

Latitude

RT-PCR positive / analysed pools (n. midges)

Collection date of positive pools

Friuli Venezia Giulia

Pordenone

Farm #1

12.480959

45.980202

1/16 (45)

04/10/2011

Friuli Venezia Giulia

Pordenone

Farm #4

12.84439

46.15498

0/42

Friuli Venezia Giulia

Pordenone

Farm #5

12.661484

46.145069

0/23

06/09/2011

Veneto

Belluno

Farm #2

11.893233

46.016153

4/34 (1, 28, 42, 47)

21/10/2011 25/10/ 2011 03/11/2011

Veneto

Treviso

Farm #3

12.093435

45.712662

1/46 (5)

7/11/2011

Veneto

Treviso

Farm #6

12.113165

45.784651

0/14

Veterinaria Italiana 2013, 49 (3), 269-275. doi: 10.12834/VetIt.1101.11

273

Surveillance strategies in Italy after SBV outbreak in 2012

Besides the laboratory data, clear definitions of suspected and confirmed cases were developed in accordance with the suggestion of the European Food Safety Authority (8), in order to obtain more accurate temporal and spatial information on the occurrence of SBV infection. The harmonization of case definitions and the collection of standardised epidemiological data at the European level aimed also at assessing the impact of the disease and at providing useful data on the epidemiology of infection. Under this surveillance approach, the activities carried out over few weeks (from February to April 2012) permitted to verify the existence of SBV active transmission in a relatively limited part of Veneto region. Although bluetongue virus and SBV are considered vector borne diseases, SBV seems to have a lower pathogenicity but a much greater spreading capacity. Elbers (7) reported about 70% antibody prevalence for SBV in dairy cattle population in the Netherlands; a within-herd serological prevalence between 70% and 95% in sheep flocks; and prevalence between 70% and 100% in dairy herds. The main differences with bluetongue in relation to the surveillance approaches are related to SBV capacity of infecting foetuses and causing malformations in offspring at parturition. In fact, during the vector season serological and virological surveillance activities in hosts or vectors may be performed (10), but passive surveillance on clinical signs should also consider the length of the gestation periods in the different

274

Monaco et al.

animal species and be concentrated during the Winter and Spring seasons. Although the epidemiological role of vertical transmission in ruminants is currently not clear, nowadays the birth of viraemic calves or kids cannot be excluded suggesting, therefore, the existence of a possible important overwintering and spreading mechanism, influencing also live animal trade. The recommendations of the World Organisation for Animal Health (17) take into account this hypothesis and suggest precautions in moving live pregnant animals and newborns. As already described by Goffredo (12), the presence in Italy of a pre-existing surveillance system for bluetongue permitted, retrospectively, to get critical information on SBV infection in Italy. Looking for SBV through the Culicoides collected within the bluetongue surveillance programme allowed for showing that SBV was circulating in at least 3 Italian provinces since early September, nearly 5 months prior the outbreak and at least 40 km away from the first reported case. It was also confirmed that species of the Obsoletus Complex, including C. obsoletus and C. scoticus, play a role in transmitting this virus. Up to this date Italian Ministry of Health has not activated a wider serological monitoring in other Italian regions and the surveillance on SBV is actually based on the sole notification of suspected clinical cases. This decision is actually hampering the possibility of drawing a more precise picture of SBV distribution in Italy, which remains unknown.

Veterinaria Italiana 2013, 49 (3), 269-275. doi: 10.12834/VetIt.1101.11

Monaco et al.

Surveillance strategies in Italy after SBV outbreak in 2012

References 1. Bilk S., Schulze C., Fischer M., Beer M., Hlinak A. & Hoffmann B. 2012. Organ distribution of Schmallenberg virus RNA in malformed newborns. Vet Microbiol, 159(1-2), 236-238.

10. Giovannini A., Calistri P., Conte A., Savini L., Nannini D., Patta C., Santucci U. & Caporale V. 2004. Bluetongue virus surveillance in a newly infected area. Vet Ital, 40(3), 188-197.

2. Calistri P., Giovannini A., Conte A., Nannini D., Santucci U., Patta C., Rolesu S. & Caporale V. 2004. Bluetongue in Italy: Part I. Vet Ital, 40(3), 243-251.

11. Goffredo M., Conte A. & Meiswinkel R. 2004. Distribution and abundance of Culicoides imicola, Obsoletus Complex and Pulicaris Complex (Diptera: Ceratopogonidae) in Italy. Vet Ital, 40 (3), 270-273.

3. Campbell J.A. & Pelham-Clinton E.C. 1960. A taxonomic review of the British species Culicoides Latreille (Diptera, Ceratopogonidae). Proceedings of the Royal Society of Edinburgh (B), 67(3), 181-302. 4. Colangeli P., Iannetti S., Cerella A., Ippoliti C., Di Lorenzo A., Santucci U., Simonetti P., Calistri P. & Lelli R. 2011. The national information system for the notification of animal diseases in Italy. Vet Ital, 47(3), 303-312. 5. Delécolle J.C. 1985. Nouvelle contibution à l'étude systématique et iconographique des espéces du genre Culicoides (Diptera: Ceratopogonidae) du Nord-Est de la France. Thesis, U.E.R sciences, Vie et Terre, Université Louis Pasteur de Strasbourg, 238 p. 6. Dyce A.L. 1969. The recognition of nulliparous and parous Culicoides (Diptera: Ceratopogonidae) without dissection. J Austr Entomol Soc, 8(1), 11-15. 7. Elbers A., Loeffen W.L.A., Els S.Q., Quak S., de BoerLuijtze E., van der Spek A.N., Bouwstra R., Maas R., Spierenburg M.A.H., de Kluijver E.P., van Schaik G. & van der Poel W.H.M. 2012. Seroprevalence of Schmallenberg Virus Antibodies among Dairy Cattle, the Netherlands, Winter 2011-2012. Emerg Infect Dis, 18(7),1065-1071. 8. European Food Safety Authority (EFSA). 2012. "Schmallenberg" virus: analysis of the epidemiological data. Supporting Publications 2012. EN-261. 30 p. (http://www.efsa.europa.eu/it/search/doc/261e.pdf accessed on 06/04/2012). 9. Gibbens N. 2012. Schmallenberg virus: a novel viral disease in northern Europe. Vet Rec, 170(2), 58.

Veterinaria Italiana 2013, 49 (3), 269-275. doi: 10.12834/VetIt.1101.11

12. Goffredo M., Monaco F., Capelli G., Quaglia M., Federici V., Catalani M., Montarsi F., Polci A., Pinoni C., Calistri P. & Savini G. 2013. Schmallenberg virus in Italy: a retrospective survey in Culicoides stored during the bluetongue Italian surveillance program. Prev Med Vet, 111(3-4), 230-236. 13. Hoffmann B., Scheuch M., Höper D., Jungblut R., Holsteg M., Schirrmeier H., Eschbaumer M., Goller K.V., Wernike K., Fischer M., Breithaupt A., Mettenleiter T.C. & Beer M. 2012. Novel orthobunyavirus in Cattle, Europe, 2011. Emerg Infect Dis, 18(3) 469-472. 14. Muskens J., Smolenaars A.J., van der Poel W.H., Mars M.H., van Wuijckhuise L., Holzhauer M., van Weering H. & Kock P. 2012. Diarrhea and loss of production on Dutch dairy farms caused by the Schmallenberg virus. Tijdschr Diergeneeskd, 137(2), 112-115. 15. Reed, L.J. & H. Muench. 1938. A simple method of estimating fifty percent endpoints. Am J Hyg, 2, 493-497. 16. Van den Brom R., Luttikholt S.J., Lievaart-Peterson K., Peperkamp N.H., Mars M.H., van der Poel W.H. & Vellema P. 2012. Epizootic of ovine congenital malformations associated with Schmallenberg virus infection. Tijdschr Diergeneeskd, 137(2), 106-111. 17. World Organization for Animal Health (Office International des Épizooties: OIE). 2012. Schmallenberg virus. Recommendations endorsed by the OIE Scientific Commission on 16 February 2012. (http:// www.oie.int/en/our-scientific-expertise/specificinformation-and-recommendations/schmallenbergvirus/ accessed on 16/04/2012).

275

The effect of anthropogenic activity on the occurrence of Culicoides species in the South-Western Khomas Region, Namibia Elbè Becker1, Gert J. Venter2, Karien Labuschagne2, Telanie Greyling1 & Huib van Hamburg1* Unit for Environmental Sciences and Management, North-West University, Potchefstroom, 2520, South Africa. Parasites, Vectors and Vector Borne Diseases, Agricultural Research Council – Onderstepoort Veterinary Institute, Private Bag X5, Onderstepoort 0110, South Africa. 1

* Corresponding author at: Unit for Environmental Sciences and Management, North-West University, Potchefstroom, 2520, South Africa. Tel.: +27 (0)18 2994342, e-mail: huib.vanhamburg@nwu.ac.za

Veterinaria Italiana 2013, 49 (3), 277-284. doi: 10.12834/VetIt.1011.10

Accepted: 16.08.2013 | Available on line: 23.09.2013

Keywords African horse sickness virus, Anthropogenic activity, Culicoides, Culicoides imicola, Khomas region, Midge, Namibia, Natural occurrence.

Summary Certain species of midges in the genus Culicoides (Diptera: Ceratopogonidae) are vectors of several serious orbiviral (Reoviridae) diseases, one of which, African horse sickness (AHS), was reported in the South-Western area of Khomas Region, Namibia, where it had been believed to be absent. Culicoides imicola, AHS principal vector, was collected in several farms in the area during the winter of 2009. The objective of this study was to determine whether Culicoides midges, especially C. imicola, were favoured at anthropogenic impacted/homestead sites in the arid Khomas Region, where they were not expected to occur under natural, veld conditions. The natural ‘background’ Culicoides communities where determined from collections made at veld sites, which were then compared to corresponding collections made at homestead sites. Altogether, 10,178 Culicoides midges were collected at homesteads and were then compared to 1,733 individuals collected at veld sites. Culicoides midge numbers were likely boosted in anthropogenic impacted areas/homesteads. This was also the case for the Culicoides species that are vector of AHS. This study indicated the significance of human settlement in the Khomas Region in terms of Culicoides midge abundance and distribution and showed the implications that this may have on the transmission of Culicoides-vectored diseases.

Effetto dell’attività antropogenica sulla presenza di Culicoides nell’area Sud-Occidentale della regione di Khomas, Namibia Parole chiave Attività antropogenica, Culicoides, Culicoides imicola, Moscerino, Namibia, Regione di Khomas, Virus della peste equina.

Riassunto Alcune specie appartenenti al genere Culicoides (Diptera: Ceratopogonidae) sono vettori di numerose e gravi patologie da Orbivirus (Reoviridae) tra cui la peste equina, riscontrata nell’area Sud-Occidentale della regione di Khomas in Namibia, dove invece si riteneva che fosse assente. Durante l’inverno del 2009, esemplari di Culicoides imicola, principale vettore del virus della peste equina, sono stati rilevati in diverse aziende agricole della regione. Lo studio ha avuto l’obiettivo di verificare se le attività antropogeniche presenti nell’area favorissero la presenza di Culicoides, in particolare di C. imicola, che generalmente sono raramente rilevati nelle aree non coltivate. I dati relativi alla cattura di Culicoides in aree con attività antropogenica, come fattorie, sono stati comparati con quelli relativi a zone incolte. Complessivamente, in prossimità delle aziende agricole sono stati catturati 10.178 esemplari di Culicoides che sono stati successivamente comparati con 1.733 esemplari prelevati da aree incolte. L’elevato numero di Culicoides è stato verosimilmente determinato dalla vicinanza alle aziende agricole, dove peraltro sono state rilevate le specie di Culicoides vettori della peste equina. Lo studio mostra gli effetti degli insediamenti umani sulla presenza e distribuzione di esemplari di Culicoides nell’area Sud-Occidentale della regione di Khomas, evidenziandone le possibili implicazioni nella trasmissione delle patologie di cui i Culicoides sono vettori.

277

The presence of Culicoides species in the South-Western Namibia

Introduction Certain species of blood feeding midges in the genus Culicoides (Diptera: Ceratopogonidae) are considered the biological vectors of viruses, protozoa and filarial nematodes, which affect birds, humans and other animals (14, 16). Among the orbiviruses (Reoviridae) transmitted by certain Culicoides species, those causing bluetongue (BT), African horse sickness (AHS), equine encephalosis (EE) and epizootic haemorrhagic disease (EHD) are of major veterinary significance (14, 16). At least 3 of these diseases, BT, AHS and EHD are classified as ‘notifiable’ by the World Organisation for Animal Health (Office International des Épizooties: OIE) (14, 16). Due to the arid climate of the South-Western part of the Khomas Region in Namibia, Culicoides midge abundance and the associated risk for orbiviral transmission was expected to be negligibly low (3). Consequently there was no economic or veterinary incentive to collect Culicoides midges in the region. However, reported outbreaks of AHS vectored by Culicoides (Avaritia) imicola and Culicoides (Avaritia) bolitinos (6, 8, 16, 19) in the area changed this view (3). The risk of orbiviral transmission was furthermore highlighted by the fact that Equus zebra hartmannae (Hartmann’s mountain zebra), a suspected reservoir for AHSV (5, 10), lives in the area and tested positive for circulating antibodies against the disease (3). Not much is known about the occurrence of Culicoides midges in Namibia as a whole and this study will also provide some indication of the occurrence of Culicoides midges in previously undocumented geographical locations. A recent light trap survey conducted from 2009-2010 yielded a surprisingly large number of Culicoides in the arid South-Western part of the Khomas Region (4). However, because of the dependency of the Onderstepoort suction UV‑light traps (24) on 220V electricity, collection sites were restricted to farm homesteads sites where electricity was available. These homestead sites were unavoidably situated in habitats that were also impacted by anthropogenic activity. It should be noted that, due to the low human population, the greatest part of the Khomas Region is mostly unaffected by anthropogenic activity (17). These homesteads sites are therefore atypical of the South‑Western part of the Khomas Region. Culicoides midges depend on moisture (7, 14) both for breeding substrates and for surviving the high temperatures (1, 12). The homestead sites were expected to have more moisture due to garden irrigation (water is supplied via boreholes) and spillage (4), which is uncharacteristic of the predominantly natural veld and undeveloped farmland of the area. The anthropogenic impacted habitats at homesteads showed also a more consistent presence of livestock, kept at relatively

278

Becker et al.

higher densities than the one typically found across the region. Livestock animals serve as vertebrate hosts for many Culicoides species (22) - e.g. C. imicola and C. bolitinos (19) - and may attract and support them in relatively large numbers. Worldwide, most studies have focussed on the occurrence of Culicoides midges found around livestock at homesteads (20), while very few investigations into the occurrence of Culicoides midges in areas distant from anthropogenic habitats have been conducted. It is expected that the occurrence of Culicoides midges in habitats impacted by anthropogenic activity may differ significantly from non-anthropogenic impacted habitats, the knowledge of which may contribute to the understanding of many ecological relationships involving Culicoides midges, such as the transmission of vector-borne diseases among wild, indigenous hosts (20). The objectives of this study were to investigate whether these anthropogenic impacted habitats may have influenced the abundance of Culicoides midges and to assess whether collections made at these habitats would be representative of the region in general. To achieve these objectives, the natural veld or ‘background’ Culicoides populations collected with light traps at veld sites, away from homesteads, were compared to the Culicoides populations collected at farm homesteads.

Materials and methods Study area The South-Western part of the Khomas Region has a semi-desert to desert climate (17), with summer rainfall ranging from 420 mm/a in the North-East to 120 mm/a in the South-West (3). Winters are mild with, on average, 0 to 10 days of frost per year (17). The landscape is undulating, but can be differentiated into the highland plateau, steep escarpment and desert pediment. The escarpment is drained exorheically by the Kuiseb, Oanob and Swakop River basins, although rainfall is mostly too low for the ephemeral flows of the rivers to reach the sea. Several smaller ephemeral rivers end blindly inland (endorheic rivers) in dunes or inland pans (11). However, the river beds are dotted with permanent to semi-permanent rock pools. These pools, as well as earth dams, reservoirs and animal watering troughs, are scattered sparsely throughout the landscape and are the only surface water in the area. The vegetation varies from highland savannah on the plateau in the East to a shrub-dominated transition zone on the escarpment and sparser pre‑Namib vegetation on the pediment in the West [Giess, 1971 as quoted by Joubert (11)]. Riparian

Veterinaria Italiana 2013, 49 (3), 277-284. doi: 10.12834/VetIt.1011.10

Becker et al.

vegetation in ephemeral river beds (11) differs distinctly from the surrounding areas and shows tall trees, which often form a closed canopy. Agriculture is the main land use of the study area (3, 17). Due to the low annual rainfall, animal husbandry, rather than crop cultivation, is preferred, while irrigation is limited to small homestead gardens. Cattle-ranching is the most common agricultural practice. Nonetheless, stocking rates are low, at an average of one head of cattle per 10 km2 (3). Wild animals such as Equus zebra hartmannae, Tragelaphus strepsiceros (kudu) and Oryx gazelle (oryx) roam freely in the area.

Collection Sites The area was surveyed between February the 27th and October the 6th 2010 for Culicoides midges. Light trap collections were made at homestead and veld sites on 4 farms (Neu Heusis, Hureb Süd, Isabis/ Alberta and Corona).

Neu Heusis

The presence of Culicoides species in the South-Western Namibia

even. The UV-light trap was fixed to the outer wall of a horse stable housing young horses on occasion. A variable number of horses (10-15), some 10 m away, were present in very large encampments surrounding the homestead area. No water leakage was observed from water troughs. The garden vegetation was generally sparse and not irrigated regularly. Culicoides midges were collected on February the 27th, March the 27th and 28th, May the 22nd and 24th 2010.

Veld site (22°37.773´ S, 16°45.107´ E) The corresponding veld site (1,707 m) was located 5 km away from the Neu Heusis homestead site (Figure 1). The trap was situated on the side of a hill overlooking an ephemeral stream. A tap leaking water, which formed a large mud pool, was observed about 1.5 km from the trap. The only other moist substrate observed was cow dung. None of the 5 ephemeral pools held water during the study. Culicoides midges were collected during the same nights as at the homestead site.

Homestead site (22°36.660´ S, 16°42.646´ E)

Hureb Süd

Neu Heusis homestead (1,739 m above sea-level) (Figure 1) is situated on the watershed of the Kuiseb River, where the relief is gentle and the landscape

Hureb Süd homestead (1,216 m above sea-level) is situated on the escarpment of the Khomas Hochland

Homestead site (22°29.394´ S, 16°22.172´ E)

Figure 1. The study area with surveyed sites for Culicoides midge collections from February the 27th to October the 6th 2010; Neu Heusis, Hureb Süd, Isabis and Corona in the South-Western Khomas region, Namibia.

Veterinaria Italiana 2013, 49 (3), 277-284. doi: 10.12834/VetIt.1011.10

279

The presence of Culicoides species in the South-Western Namibia

(Figure 1). The homestead was located within the bluff line of an ephemeral river abounded by hills and spurs. The trap was installed on a building in the garden. Some water spillage was observed from outdoor taps in the yard, which was largely vegetation-free. Horses were occasionally kept in door-less stables and paddocks some 15 and 20 m from the trap. Although the horse herd had free‑roam of the farm, they were often concentrated at watering points, situated some 100 m from the trap. The nearby river had not flowed for more than a year. Culicoides midges were collected on March the 7th, May the 19th and 21st, June the 30th and October the 6th 2010.

Veld site 1 (22°37.773´ S, 16°45.107´ E) Four collections were made at this Hureb Süd veld site (1,425 m above sea-level) located 3 km from the homestead site. The trap was situated on the side of a mountain. There were several zebra roll-holes in the area; some of which may fill with water after rain to form pools that can last for up to a week. Neither livestock nor their dung was found in about a 3 km radius of the trap. A visual survey of the area of about 2 km radius revealed no further moist habitats. Any dung that was found was very dry. Collections were made shortly after the wet season on March the 7th and from the 19th to 21st of May 2010.

Veld site 2 (22° 29.506' S, 16° 21.824' E) This veld site was located in the same ephemeral river bed which runs past the homestead. There were many tall trees in the ephemeral river, unlike the rest of the area. Moist substrates were present in tree-hollows and clumps of rotting vegetation material. Dry ephemeral pools were also present, which may hold water after rains or after the river had been in flow. A high concentration of fresh dung was found within the river bed. Culicoides midges were collected on June the 30th 2010.

Becker et al.

was about 50 m away from the trap and was regularly watered. The surrounds of the homestead were covered by a dense growth of native grass species. Culicoides midges were collected from May the 14th to May the 16th 2010, after the wet season.

Veld site (23°38.502´ S, 16°16.728´ E) The corresponding veld site collection of the Isabis homestead collections had been conducted on the farm Alberta 34 km away. Alberta is situated 1,783 m above sea-level, on the plateau and located within the same rainfall zone as the Isabis homestead (Figure 1). The trap was installed in an ephemeral river bed, which is in a wide valley but for its Southern side where it is bordered by a hill. There were very few trees and herbaceous shrubs in the area and grass cover was sparse. No moist habitats were observed in about 2 km radius. The river bed was sandy and therefore it was not expected to hold water for long periods. Culicoides midge collections were made from May the 14th to May the 16th 2010, after the wet season.

Corona Homestead site (23°23.444´S, 16°09.600´E) The Corona homestead (1,185 m above sealevel) is situated at the foot of the escarpment. The average slope is gentle and the landscape is slightly undulating. The homestead is surrounded by steep mountains on the North-East. The trap was installed 20 m away from a water trough, which was frequented by horses. Water from an irrigation pipe from a lush garden (15 m away from the trap) seeped into garden-refuse, which laid 5 m from the trap. Sizable lawns were kept in both the front and back garden. Equus zebra hartmannae sometimes approached the gardens at the homestead. Culicoides midges were collected at this site on February the 14th and 15th and from May the 11th to May the 13th 2010.

Veld site 3 (22° 30.052' S, 16° 21.655' E) The site was very similar to the second Hureb Süd veld site in terms of habitat type. It is situated in a river bed with many tree-hollows, caves and sheltered areas. Culicoides midges were collected on October the 6th 2010.

Isabis Homestead site (23°25.394´ S, 16°30.894´ E) Isabis homestead (1,639 m above sea-level) is situated on the plateau and the average slope is gentle. The trap was installed in stables close to cattle paddocks. Several horses were kept in large encampments around the homestead. The garden

280

Veld site (23°24.194´ S, 16°10.907´ E) The corresponding veld site (1,192 m above sea‑level) is situated on a gentle hill, which lies among mountains, 3 km from the homestead site. There were no permanent surface waters in the immediate surroundings, but several large natural pools and one earthen dam was observed roughly 5 km away. Rain had fallen 2 days prior the records being taken. Several moist habitats were found in about a 10 km radius of the trap. Many hollows were still moist and many rock pools held water. Culicoides midge collections were made during the rainy season, on February the 14th and 15th 2010 and after the principal rainy season, from May the 11th to the 13th 2010.

Veterinaria Italiana 2013, 49 (3), 277-284. doi: 10.12834/VetIt.1011.10

Becker et al.

Sampling equipment and collection methods Onderstepoort 220V suction UV-light traps (24) were installed at farm homesteads and comparative veld sites to collect the Culicoides midges. At all the sites, traps operated at roughly the same height above the ground (1.7 m) and with as similar exposures to their surroundings as possible. The traps operated from sunset to sunrise, regulated and synchronised by the use of a Toptronic® programmable time switches (model TDDT7) (SolarMAX, Kleinmond, Western Cape, South Africa). At the veld sites, light traps were powered by a generator with the power output equal to that of the mains electricity by which the homestead traps were powered. The specimens were collected and preserved as described by Becker (4). The Culicoides midges in all collections were counted and identified to species level. Collections made at each of the 4 homestead sites (n=20) were compared to the nearby veld site (n=20). The results obtained from the 3 closely related veld sites at Hureb Süd were grouped to facilitate comparisons. The Wilcoxon Matched Pairs Test was used to determine statistical significant differences between the total Culicoides midges collected from corresponding homestead and veld sites per farm and between the total collected from homestead and veld site across all farms. Only the most dominant species present in collections from either the veld or the homestead site on a farm were used in the analysis.

Results Forty light trap collections were made between February the 27th and October the 6th 2010. The overall numbers of individuals of each Culicoides species collected at the 4 farms’ corresponding homestead and veld sites is summarised in Table I. A total of 10,178 Culicoides midges were collected in the 20 collections made at the homestead sites compared to only 1,733 individuals collected at the 20 veld sites (Table I). Significantly more Culicoides midges were collected at the homestead than at the veld sites (Z=2.0226. P=0.043). At Hureb Süd, statistically significant more Culicoides midges (3,706) were collected at the homestead site than at the veld site (462) (Z=2.023, P=0.043). It was the same for the collection made at Isabis (Z=2.023, P=0.043), where 5,961 Culicoides midges were collected at the homestead site compared to only 8 collected at the veld site. The higher number of Culicoides midges collected at the Neu Heusis veld site (445) was not statistically different from that at the homestead site (393) (Z=0.405, P=0.686).

Veterinaria Italiana 2013, 49 (3), 277-284. doi: 10.12834/VetIt.1011.10

The presence of Culicoides species in the South-Western Namibia

At Corona, the higher number of midges collected at the veld site (818) compared to that collected at the homestead (118) was borderline significant (Z=1.753, P=0.080). Midges belonging to 31 species were collected from all the sites. Twenty-eight species were collected from the veld sites and 25 species were collected from the homestead sites, 22 of which were present both at homestead and veld sites. Overall, Culicoides ravus was the dominant species at both the homestead and veld sites. The confirmed vector of AHS, C. imicola, was not only 91% represented at homestead sites, but also represented 19.6% and 10.8% of the all Culicoides midges collected at the homestead and veld sites, respectively. The proportional representation of C. imicola was significantly higher at the homestead sites than at the veld sites (p<0.001). The Corona homestead and veld sites each contributed only 1% of the total of the collected C. imicola, whereas Hureb Süd and Isabis homesteads respectively contributed 44% and 45% to the total of the collected C. imicola.

Discussion and conclusions Onderstepoort 220V suction UV-light traps, or similar models, are used routinely worldwide to determine the abundance and the occurrence of Culicoides midges (1, 7, 9, 22). As with any sampling methods light traps have certain shortcomings. They have a relatively short attraction range of about 2-4 m radius (25) and thus they only sample Culicoides midges at a relatively fine scale. The consistency of the fraction of the Culicoides population within this attraction range collected is influenced by the trap’s height above ground level (23) and by the environmental conditions - such as host densities, local variations in air temperature, moisture and wind strength - which may affect the fine-scale distributions of Culicoides midges in immediate surroundings of the traps (26). Despite a great variety of factors that can influence the numbers of Culicoides midges collected with light traps, this is still regarded as the most reliable and practical way to determine vector presence and abundance in a given area (24). Notwithstanding the shortcomings of the collection method, it is clear that overall number of Culicoides individuals collected was significantly greater at homestead sites than at veld sites. The overwhelmingly higher numbers collected at the homestead sites at Isabis and Hureb Süd compared to the veld sites highlight the need to identify the factors that may be responsible for this phenomenon. Further research should investigate to what degree and manner various anthropogenic activities may contribute to the proportional

281

The presence of Culicoides species in the South-Western Namibia

Becker et al.

Table I. Culicoides species and the total of each species collected with light traps at homestead and veld sites located at 4 farms in the South-Western Khomas Region between February and October 2010. Farm name Site No. collections No. of species Culicoides species C. ravus C. imicola C. bolitinos C. pycnostictus C. subschultzei C. leucostictus C. exspectator C. pretoriensis C. tropicalis C. herero C. bedfordi C. tuttifrutti (#30) C. nivosus C. schultzei C. olyslageri C. accraensis group C. similis C. brucei C. neavei C. macintoshi C. #89 C. punctithorax C. #50 C. trifasciellus C. nr albopunctatus C. cornutus C. nigripennis group C. #61 C. #94 C. #33 Total

Neu Heusis House Veld 6 6 12 20 150 44 125 29 29 5 3 1 1 4 1 1 393

229 59 2 58 37 18 4 15 1 3 2 1 4 4 2 1 1 2 1 1 445

Hureb Süd House Veld 6 6 17 19

Isabis House Veld 3 3 12 2

1,331 951 15 285 471 56 453 5 59 13 26 4 12 2 12 12 3,706

2,681 983 780 485 463 24 24 245 52 221 2 1 5,961

201 98 6 72 6 25 22 8 1 1 1 7 1 1 1 2 1 8 462

higher occurrence of C. imicola and other species collected at the homestead sites during the present survey. Very little is known about the general biology, the transmitted diseases, and the vector competences for most of these species. This could have implications for the management of these vector-borne diseases. Seasonal and more extensive surveys are required to pinpoint subtle differences in distribution and abundance of Culicoides midges at various veld sites to ascertain whether potential Culicoides vectors could be present during, for instance, the drier winter months (4). The rather limited current veld collections made at Hureb Süd suggest that this may indeed be possible, especially

282

7 1 8

Corona House Veld 5 5 13 14 50 19 8 10 2 13 5 3 3 1 1 2 1 118

552 30 23 160 1 19 6 9 3 7 4 2 1 1 818

Total collections House Veld 20 20 25 28 4,212 1,997 15 1,198 995 550 482 42 307 18 29 55 226 12 1 6 3 2 1 1 2 0 12 12 1 10,178

982 187 8 160 204 44 26 42 8 13 6 8 1 4 11 4 2 2 2 2 2 2 8 2 1 1 1 1,733

in ephemeral river valleys where some of the veld collections at Hureb Süd were made. However, the numbers of Culicoides midges collected at the Corona veld site was greater than the one collected at the homestead site (Table I), indicating that more factors, variable across a landscape, may contribute to variation in homestead/veld abundances, such as host densities, wind strength, local temperatures and available moisture sources. Available moisture (humidity and soil moisture) is linked to precipitation, but also to topography, vegetation cover and soil type, which determines an area’s ability to store moisture. Lower-lying areas with less porous soils, for instance, are generally

Veterinaria Italiana 2013, 49 (3), 277-284. doi: 10.12834/VetIt.1011.10

Becker et al.

associated with better moisture retention (14). It is noteworthy that, although the total Culicoides midges collected at the Corona veld site was relatively high, the number C. imicola individuals collected was the lowest among all sites. This was the case of both the Corona homestead and veld site. The most abundant species at both the homestead and veld sites in the present survey was C. ravus. Based on its localised and low overall abundance, as found in a country-wide light trap survey in South Africa, its potential as an Orbivirus vector was considered to be low (19). It was, nonetheless, shown that this species will take a blood meal from horses (14) and because the relative abundance of this species in the Khomas Region is high, it may act as a vector of vector-borne diseases such as AHS. Due to the fact that the homestead sites generally supported larger numbers of Culicoides midges than the veld sites, it is proposed that these anthropogenic impacted sites have created favourable ‘islands’ which support greater populations of Culicoides midges than could otherwise have been found in the area. This has implications for the range and distribution of Culicoides-vectored diseases such as AHS into areas where they may otherwise have been limited by the natural environmental conditions.

The presence of Culicoides species in the South-Western Namibia

It is concluded that Culicoides species distribution and/or activity are probably boosted by the favourable conditions provided by anthropological activity. The winter circulation of Culicoides-vectored diseases, such as AHS, is also expected to be limited to these sites. An increase in anthropogenic activity and impacted habitats in the South-Western part of the Khomas Region may also increase the risk of outbreaks of Culicoides-borne diseases.

Acknowledgements We would like to thank the farm owners and managers, who allowed us to make UV-light trap collections on their farms, and their family’s generous hospitality: Dr. Petri-Schwitzer and Corona staff, the Hoff, Estherhuizen and Cranz families. We are sincerely grateful to the Research Unit of Environmental Science and Management at the North-West University for the provision of a motor vehicle, equipment and funding. We also would like to extend our gratitude to all advisors, consultants and those who provided technical help during the study and to the research assistants Edward D’Alton, Francois Becker, Richard Becker and Frikkie Becker. Finally our gratitude goes to Chantel de Beer for the support provided in drawing the figure.

References 1. Baldet T., Delécolle J.C., Cetre-Sossa H.C., Mathieu B., Meiswinkel R. & Gerbier G. 2008. Indoor activity of Culicoides associated with livestock in the bluetongue virus (BTV) affected region of northern France during autumn 2006. Prev Vet Med, 87(1-2), 84-97. 2. Baylis M., Mellor P.S. & Meiswinkel R. 1999. Horse sickness and ENSO in South Africa. Nature, 397(574), 574. 3. Becker E. 2011. The occurrence of African horse sickness in Hartmann’s mountain zebra and its Culicoides vector in the south-western Khomas region, Namibia. MSc Dissertation presented to the School of Environmental Sciences and Development, North-West University, Potchefstroom Campus, November 2011. 4. Becker E., Venter G.J., Labuschagne K., Greyling T. & van Hamburg H. 2012. Culicoides species (Diptera: Ceratopogonidae) occurrence in the Khomas region of Namibia during the winter months. Vet Ital, 48(1), 45-54. 5. Binepal V.S., Wariru B.N., Davies F.G., Soi R. & Olubayo R. 1992. An attempt to define the host range for African Horse Sickness Virus (Orbivirus, Reoviridae) in east Africa, by a serological survey in some Equidae, Camelidae, Loxodontidae and Carnivore. Vet Microbiol, 31(1), 19-23. 6. Coetzer J.A.W. & Guthrie A.J. 2004. African horse sickness. In Infectious diseases of livestock with special reference to southern Africa, vol. 2 (J.A.W

Veterinaria Italiana 2013, 49 (3), 277-284. doi: 10.12834/VetIt.1011.10

Coetzer & R.C. Tustin, eds). Oxford University Press, Cape Town, 1231-1246. 7. Conte A., Goffredo M., Ippoliti C. & Meiswinkel R. 2007. Influence of biotic and abiotic factors on the distribution and abundance of Culicoides imicola and the Obsoletus Complex in Italy. Vet Parasitol, 150(4), 333-344. 8. Du Toit R.M. 1944. The transmission of bluetongue and horse sickness by Culicoides. Onderstepoort J Vet Res, 19(1-2), 7-16. 9. Goffredo M. & Meiswinkel R. 2004. Entomological surveillance of bluetongue in Italy: methods of capture, catch analysis and identification of Culicoides biting midges. Vet Ital, 40(3), 260-265. 10. Hamblin C., Mertens P.P.C., Mellor, P.S., Burroughs J. & Crowther J. 1991. A serogroup specific enzymelinked immunosorbent assay for the detection and identification of African horse sickness viruses. J Virol Methods, 31(2-3), 285-292. 11. Joubert E. 1973. Habitat preference, distribution and status of the Hartmann zebra Equus zebra hartmannae in South West Africa. Madoqua, 7(1), 5-15. 12. Kheir S.M. 2010. Seasonal activity of Culicoides bahrainensis Boorman, 1989 (Diptera: Ceratopogonidae) in Saudi Arabia. JKSU, 22(3), 167-172.

283

The presence of Culicoides species in the South-Western Namibia

13. Meiswinkel R. & Paweska J.T. 2003. Evidence for a new field Culicoides vector of African horse sickness in South Africa. Prev Vet Med, 60(3), 243-253. 14. Meiswinkel R., Venter G.J. & Nevill E.M. 2004. Vectors: Culicoides spp. In Infectious diseases of livestock with special reference to southern Africa, vol. 1, (J.A.W. Coetzer & R.C. Tustin, eds). Oxford University Press, Cape Town, 93-136. 15. Mellor P.S. 1994. Epizootiology and vectors of African horse sickness virus. Comp Immunol Microbiol Infect Dis, 17(3-4), 287-296. 16. Mellor P.S., Boorman J. & Baylis M. 2000. Culicoides biting midges: their role as arbovirus vectors. Ann Rev Entomol, 45(1), 307-340. 17. Mendelsohn J.M., Jarvis A.M., Roberts C.S. & Robertson T. 2002. Atlas of Namibia. David Philip Publishers, Cape Town, 84, 120.

A.J. 2012. Comparison of two trapping methods for Culicoides biting midges and determination of African horse sickness virus prevalence in midge populations at Onderstepoort, South Africa. Vet Parasitol, 185(2-4), 265-273. 22. Takken W., Verhulst N., Scholte E.J., Jacob F., Jomgema Y. & van Lammeren R. 2008. The phenology and population dynamics of Culicoides spp. in different ecosystems in The Netherlands. Prev Vet Med, 87(1‑2), 41-54. 23. Venter G.J., Hermanides K.G., Boikanyo S.N.B., Majatladi D.M. & Morey L. 2009. The effect of light trap height on the numbers of Culicoides midges collected under field conditions in South Africa. Vet Parasitol, 166(3-4), 343-345.

18. Nevill E.M. 1967. Biological studies on some South African Culicoides species (Diptera: Ceratopogonidae) and the morphology of their immature stages. MSc (Agric) thesis. University of Pretoria, Pretoria, 73 pp.

24. Venter G.J., Labuschagne K., Hermanides K.G., Boikanyo S.N.B., Majatladi D.M. & Morey L. 2009. Comparison of the efficiency of five suction light traps under field conditions in South Africa for the collection of Culicoides species. Vet Parasitol, 166(3‑4), 299-307.

19. Nevill E.M., Venter G.J. & Edwardes M. 1992. Potential Culicoides vectors of livestock orbivirus. In Bluetongue, African horse sickness and related orbiviruses (T.E. Walton & B.I. Osburn, eds). CRC Press, Boca Raton, Florida, 306-313.

25. Venter G.J., Majatladi D.M., Labuschagne K., Boikanyo S.N.B. & Morey L. 2012. The attraction range of the Onderstepoort 220V light trap for Culicoides biting midges as determined under South African field conditions. Vet Parasitol, 190(1-2), 222-229.

20. Rigot T., Vercauteren Drubbel M., Delécolle J.-C. & Gilbert M. 2013. Farms, pastures and woodlands: the fine-scale distribution of Palearctic Culicoides spp. biting midges along an agro-ecological gradient. Med Vet Entomol, 27(1), 29-38.

26. Viennet E., Garros C., Rakotoarivony I., Allène X., Gardès L., Lhoir J., Fuentes, I., Venail R., Crochet D., Lancelot R., Riou M., Moulia C., Baldet T. & Balenghien T. 2012. Host-Seeking Activity of Bluetongue Virus Vectors: Endo/Exophagy and Circadian Rhythm of Culicoides in Western Europe. PLoS ONE, 7(10): e48120. doi: 10.1371/ journal.pone.0048120.

21. Scheffer E.G., Venter G.J., Labuschagne K., Page P.C., Mullens B.A., MacLachlan N.J., Osterrieder N. & Guthrie

284

Becker et al.

Veterinaria Italiana 2013, 49 (3), 277-284. doi: 10.12834/VetIt.1011.10

SHORT COMMUNICATION Prevalence of antibodies against Parainfluenza virus type 3, Respiratory syncitial virus and bovine Herpesvirus type 1 in sheep from Northern Prefectures of Japan Massimo Giangaspero1*, Giovanni Savini2, Riccardo Orusa3, Takeshi Osawa4 & Ryô Harasawa1 Department of Veterinary Microbiology, School of Veterinary Medicine, Faculty of Agriculture, Iwate University, Ueda 3-18-8, Morioka, Iwate 020-8550, Japan 2 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy 3 National Reference Centre for Wild Animal Diseases (CeRMAS), Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d'Aosta, Via Regione Amerique 7/g, 11020 Quart (Aosta), Italy 4 Laboratory of Theriogenology, School of Veterinary Medicine, Faculty of Agriculture, Miyazaki University, Gakuenkibanadainishi 1-1, Miyazaki, Miyazaki 889-2192, Japan 1

* Corresponding author at: Department of Veterinary Microbiology, School of Veterinary Medicine, Faculty of Agriculture, Iwate University, Ueda 3-18-8, Morioka, Iwate 020-8550, Japan. Tel.: +81 19 6216229, e-mail: giangasp@gmail.com.

Veterinaria Italiana 2013, 49 (3), 285-289. doi: 10.12834/VetIt.0810.01

Accepted: 16.09.2013 | Available on line: 25.09.2013

Keywords Infectious bovine rhinotracheitis, Japan, Parainfluenza virus type 3, Respiratory syncytial virus, Sheep.

Summary Ovine sera collected in the Prefectures of Hokkaido, Aomori and Iwate in the Northern Japan were examined for the presence of antibodies against Respiratory syncytial virus (RSV), bovine Herpesvirus type 1 (infectious bovine rhinotracheitis: IBR) and Parainfluenza virus type 3 (PIV3) using serum neutralisation (SN) and enzyme-linked immunosorbent assay (ELISA) tests. Twenty-three animals (11.73%) out of the 196 tested were sero-positive to PIV3. Sixteen animals (8.69%) out of the 184 tested reacted to RSV. No animals were positive to IBR antigen. Sero-conversions to PIV3 were detected in Hokkaido and Iwate (14.92% and 8.82%, respectively). Antibodies against RSV were detected in Hokkaido (9.23%) and Aomori (14.28%). Although no diagnostic measures were in place, the infections did not appear to be related to any reduction in sheep productivity.

Prevalenza di anticorpi contro il virus Parainfluenzale di tipo 3, il virus Respiratorio sinciziale e l’Herpesvirus bovino di tipo 1 in pecore nelle Prefetture settentrionali del Giappone Parole chiave Giappone, Pecore, Rinotracheite infettiva bovina, Virus Parainfluenzale di tipo 3, Virus Respiratorio sinciziale.

Riassunto Sieri ovini, raccolti nelle prefetture settentrionali del Giappone (Hokkaido, Aomori e Iwate), sono stati esaminati per la presenza di anticorpi contro il virus Respiratorio sinciziale (RSV), l’Herpesvirus bovino di tipo 1 (rinotracheite infettiva bovina: IBR) e il virus Parainfluenzale di tipo 3 (PIV3) applicando i test di siero neutralizzazione (SN) ed enzyme-linked immunosorbent assay (ELISA). Ventitré animali (11,73%) su 196 campioni testati sono risultati sieropositivi per PIV3. Sedici animali (8,69%) su 184 campioni testati hanno reagito per RSV. Nessun animale è risultato positivo per antigene IBR. Seroconversioni verso PIV3 sono state identificate nelle prefetture di Hokkaido e Iwate (rispettivamente 14,92% e 8,82%). Anticorpi contro RSV sono stati riscontrati nella prefettura di Hokkaido (9,23%) e in quella di Aomori (14,28%). Sebbene non siano state applicate misure diagnostiche, le infezioni non hanno mostrato nessuna relazione con una riduzione di produttività nelle pecore.

285

Giangaspero et al.

Antibodies against PIV3, RSV and IBR1 in sheep from Northern Japan

Respiratory disorders are among the most important problems associated with small ruminant health, causing morbidity and mortality. Respiratory syncytial virus (RSV) and Parainfluenza virus type 3 (PIV3) are among the most well known diseases that affect the respiratory system of sheep and goats (1, 2). Sheep are susceptible to bovine Herpesvirus type 1 (BoHV1), agent of infectious bovine rhinotracheitis (IBR). This is a pathogen of worldwide importance, which primarily affects cattle. So far, the studies conducted on respiratory viral infections in Japan have been mainly focused on cattle (7, 8, 9), hence only scarce information is available on epidemiology of virus pathogens in sheep. No previous epidemiological surveys on RSV, PIV3 or IBR have been undertaken on small ruminants in Japan. Furthermore, no clinical cases due to these infections have been reported among sheep flocks.

Sperimentale dell’Abruzzo e del Molise 'G. Caporale', Teramo, Italy) were included in each plate. Serological testing for antibodies against BoHV1 glycoprotein B was performed by enzyme linked immunosorbent assay (ELISA), using a commercial kit (IDEXX IBR gB, IDEXX, Westbrook, Maine, USA), following the manufacturers’ instructions. As for the flock production, the annual lambing rate was calculated as number of lambs born per ewes exposed to the ram and it was based on a lambing season occurring from February to April, with an exception being made for 1 farm where the reproductive cycle was related to 3 breeding seasons. The proportions of screened pathogens infection rate of the sampled animals were compared using the Pearson’s correlation coefficients statistics in order to calculate the possibility of a relationship between the prevalence of infection and production parameters such as annual lambing rate, annual lamb mortality rate and annual adult mortality rate. Differences were considered to be significant at P<0.05.

To explore the presence of the RSV, PIV3 and IBR and to obtain a preliminary picture of their epidemiology, a serological survey was carried out from September 2007 to January 2008 in the Prefectures of Hokkaido, Aomori and Iwate in the Northern Japan, where the majority of the Japanese sheep, a total of 4,775 sheep (43%), are bred. Details of the sampling methodology and descriptions of the flocks have been reported (5).

Results of serological screening for antibodies to RSV, PIV3 and IBR in sheep from each Prefecture of the Northern Japan are summarized in Table I. All the 267 sera were submitted to IBR testing. Not all the samples were applicable to serological tests for RSV and PIV3 antigens (Table I). Some sera showed cytotoxicity (indicated by cell death, probably caused by the sub-optimal condition of the samples) or they were not tested due insufficient serum quantity. All such samples (n = 83 for RSV and n = 71 for PIV3) were then excluded.

The presence of antibodies against PIV3 and RSV was determined by using serum neutralisation (SN) test. In a 96-well plate, inactivated serum samples were diluted from an initial dilution of 1:2 by doubling and placed in contact with 100TCID50 of previously titrated PIV3 SF-4 or RSV RB-94 strains. After incubation for 1h at 37°C with 5% CO2 to enable viral neutralisation, 5×105/ml of Madin‑Darby bovine kidney (MDBK) cells - suspended in minimum essentials medium (MEM) (Eurobio, Cortaboeuf, France) and containing penicillin 100IU/ml, streptomycin 100µg/ml, gentamicin 5µg/ml, nystatin 50 IU/ml and 10% foetal calf serum (FCS) (Sigma, Hamburg, Germany) - were added to each well. After 5 days, the cytopathic effect (CPE) in the wells was evaluated and the antibody titre was defined as the highest serum dilution able to inhibit at least 75% of the virus’ CPE. Positive and negative reference sera, cell and virus controls (Istituto Zooprofilattico

The SN test revealed 23 samples out of the 196 sera examined positive for anti-PIV3 immunoglobulins (Table I); this corresponds to a prevalence of 11.73%. At flock level positiveness ranged between 5.55% and 88.23%, whereas titres ranged from 1:8 to 1:256. PIV3 infection was detected in 5 out of the 14 sampled flocks. Levels of infection were found in flocks from Hokkaido and Iwate Prefectures, but not in the Aomori Prefecture. Four Suffolk, 1 Cheviot, 1 Corriedale, and 17 cross-breeds, mainly Suffolk × Cheviot, 1 rams and all the other ewes, were affected. RSV infection was detected in 3 flocks, with an overall prevalence of 8.69%; 16 animals, out of 184 sera

Table I. Results of serological screening for antibodies to IBR, RSV and PIV3 in sheep from the Prefectures of Hokkaido, Aomori and Iwate in the Northern Japan. Positive

% Positive*

Negative

Toxic

Total

IBR (ELISA)

267

–

267

RSV (SN)

8.69

168

267

PIV3 (SN)

11.73

173

267

NE = not executed due to insufficient aliquots for testing; * Percentage computed excluding samples resulting toxic or not tested for insufficient serum quantity.

286

Veterinaria Italiana 2013, 49 (3), 285-289. doi: 10.12834/VetIt.0810.01

Giangaspero et al.

Antibodies against PIV3, RSV and IBR1 in sheep from Northern Japan

examined, were observed to be positive for anti-RSV immunoglobulins (Table I). Positive sera originated from 2 flocks from the Hokkaido Prefecture and 1 flock from the Aomori Prefecture. None of the sera collected from the Iwate Prefecture were found to be positive. The percentage of positive sheep was 9.23% and 14.28% in Hokkaido and Aomori Prefectures, respectively. The average incidence of seropositive animals in individual herds was 13.33%, 26.66% and 55.55% respectively for the 3 sampling groups from sero-positive flocks. The obtained titres with SN were 1:256 in all tested positive sera. The seropositive sheep were all females and except for 1 ram. The sheep were of different breeds, 4 Suffolk, 10 Suffolk x Cheviot cross breeds, and 2 Romanov x Poll Dorset x Suffolk cross breeds.

positive for antibodies to RSV and PIV3 per age categories showed that for both the pathogens no seroconversions were present in animals of 1 and 2 years of age and in animals older than 7 years. Seroconversion was related mainly to single infections. However, antibodies against RSV and PIV3 were simultaneously identified in 10 animals from the same flock (sample 5 from Hokkaido Prefecture). The assessment of the possible impact of RSV and PIV3 infections on the production levels in the sampled flocks did not reveal a clear correlation with the reported levels of seropositive animals (Table III). However, with concern to the annual lamb mortality rate, it is noteworthy that in 4 flocks losses of 20% or more have been reported. In 3 out of 4 of these flocks animals were found seropositive to RSV. Although no diagnostic measures were in place and the observation was not statistically significant (pÂ =Â 0.05539), this may suggest a relation of RSV infection with lamb mortality.

The variation of prevalence of the different infections among the 3 Prefectures is reported in Table II. The analysis of the percentage of sheep

All the 267 samples collected were tested for IBR antibodies. None of the tested animals resulted serologically positive.

Table II. Comparison of the 3 Prefectures in Northern Japan for the percentage of sheep positive for antibodies to the different respiratory viruses. No animals reacted to infectious bovine rhinotracheitis antigen.

This survey demonstrates positiveness for antibodies to PIV3 and RSV in sheep flocks in the Northern Prefectures of Japan, where the majority of the Japanese sheep are bred. The survey also provides the first serological evidence of the occurrence of these diseases in sheep in the country. Interviews with farmers revealed that no previous investigations on these pathogens have been carried out in all of the randomly selected sampling units for this study,

Positive (%) PIV3 14.92 8.82 0 11.73

Hokkaido Iwate Aomori Total

RSV 9.23 0 14.28 8.69

PIV3 = Parainfluenza virus type 3; RSV = Respiratory syncytial virus.

Table III. Comparison of different production parameters for the percentage of sheep positive for antibodies to Respiratory syncytial virus and Parainfluenza virus type 3. Flock No.

Prefecture

RSV

PIV3

Annual lambing rate

Annual lamb mortality rate

Annual culling rate

Mortality rate among adults

Hokkaido

21.42

Hokkaido

0.72

1.29

4.76

Hokkaido

1.62

3.46

14.77

9.2

4 5 6 7 8 9 10 11 12 13 14

Hokkaido Hokkaido Hokkaido Hokkaido Hokkaido Hokkaido Hokkaido Iwate Iwate Aomori Aomori

NE 55.55 0 0 13.33 0 0 0 0 0 26.66

NE 88.23 0 0 0 5.55 50 0 17.64 0 0

1.1 1.61 1.48 1.58 2.44 1.23 NR 1.61 1.38 1.54 1.14

12.78 20 17.09 16.92 20.53 0 NR 6.89 9.83 25.35 21.87

2.97 11.73 10.33 6.66 NR 0 NR 0 24.03 17.64 0

0 8.33 9.09 2.22 NR 0 10 11.76 4.8 2.94 9.09

NE = not executed due to insufficient aliquots for testing; NR = not recorded.

Veterinaria Italiana 2013, 49 (3), 285-289. doi: 10.12834/VetIt.0810.01

287

Giangaspero et al.

Antibodies against PIV3, RSV and IBR1 in sheep from Northern Japan

which then should be regarded as the first source of preliminary information on the epidemiology and distribution of such pathogens for the years 2007 and 2008. The demonstration of respiratory virus circulation in sheep flocks in the Northern Prefectures of Japan, based on serological analysis, advanced the knowledge on pathogens affecting domestic sheep in Japan. These interesting findings deserve further evaluations in order to examine the full extent of the problem in small ruminant populations, taking into account that infections with PIV3 and RSV are characterized by a potential negative impact on animal health (1, 2), also indirectly, predisposing lambs to a severe pneumonia caused by several serotypes of Pasteurella haemolitica (enzootic pneumonia) (3, 10, 11, 12). Furthermore, while ovine farming is a relatively minor sector in Japan - the population is constituted by 11,000 heads (according to the Japan Livestock Industry Association 2000) â&#x20AC;&#x201C; it is worth considering that in some farms other domestic animals, i.e. cows, were housed close to sheep pens or had access to common pastures. A sheep flock (sample 7 from Hokkaido Prefecture) originated from a farm mainly focused on dairy cattle breeding, thus being in close contact with a herd of 700 black Japanese cows. Preventive measures should be carefully considered to avoid diffusion and impact on valuable breeding cattle farming. This is evident if one were to consider the potential adverse effects, both direct or indirect, on production of these pathogens detected in sheep and to take into account that in cattle PIV3 and RSV are among the main causes of respiratory disorders

288

(6) along with bovine diarrhoea virus (BVDV). The same goes for IBR, which is known to cause major welfare and economic problems in cattle, the potential for infection in sheep remains consistent when considering that the infection is present in cattle (8, 9) and in particular it is most frequent in Hokkaido, as indicated by reports from 2005 to 2011, which described up to 42 outbreaks in 2009 (14). The importance of sheep in the epidemiology of IBR remains limited, considering the lower capacity of spreading the virus (4). However, according to the World Animal Health Organisation (Office International des Ă&#x2030;pizooties: OIE), IBR is included in the list of reportable diseases of importance to international trade (13).

Acknowledgements We extend our thanks to all those who kindly helped us in the realization of this study, including Dr Claudio Apicella, Ministry of Health, Rome, Italy, Dr Shingo Tatami, Dounan Agricultural Mutual Aid Association, Yakumo, Hokkaido, Dr Eishu Takagi, Dairy Farm Research, Kitami, Hokkaido, Dr Hiroaki Moriya, Tokachi Agricultural Mutual Aid Association, Obihiro, Hokkaido, Dr Norimoto Okura, Kamikawa Chuo Agricultural Mutual Aid Association, Asahikawa, Hokkaido, Dr Kazuo Kato, Nemuro-chiku Agricultural Mutual Aid Association, Kenebetsu, Hokkaido, Dr Atsushi Kimura, Morioka-chiiki Agricultural Mutual Aid Association, Yahaba, Iwate, Dr Sakae Yamanaka, Minami Sorachi Agricultural Mutual Aid Association, Dr Seiko Komiya, Iwate University, and, naturally all the farmers who agreed to participate in this study.

Veterinaria Italiana 2013, 49 (3), 285-289. doi: 10.12834/VetIt.0810.01

Giangaspero et al.

Antibodies against PIV3, RSV and IBR1 in sheep from Northern Japan

References 1. Al Darraji A.M., Cutlip R.C. & Lehmkuhl H.D. 1982. Experimental infection of lambs with bovine respiratory syncytial virus and Pasteurella haemolytica: pathologic studies. Am J Vet Res, 43(2), 224-229. 2. Cutlip R.C. & Lehmkuhl H.D. 1982. Experimentally induced parainfluenza type 3 virus infection in young lambs: pathological response. Am J Vet Res, 43(12), 2101-2107. 3. Davies D.H., Dungworth D.L., Humphreys S. & Johnson A.J. 1977. Concurrent infection of lambs with pareinfluenza virus type 3 and Pasteurella haemolytica. NZ Vet J, 25(10), 263-265. 4. Galais-Duhamel C. 2006. Les herpèsvirus bovins chez les ruminants. Ph.D. thesis, National Veterinary School, Maisons-Alfort, France, 124 p. (http://theses.vet-alfort. fr/telecharger.php?id=85 accessed on 20.09.2013). 5. Giangaspero M., Ibata G., Savini G., Osawa T., Tatami S., Takagi E., Moriya H., Okura N., Kimura, A. & Harasawa R. 2011. Epidemiological Survey for Border Disease virus among Sheep from Northern Districts of Japan. J Vet Med Sci, 73(12), 1629-1633. 6. Hodgins D.C., Conlon J.A. & Shewen P.E. 2002. Respiratory viruses and bacteria in cattle. Chapter 12. In Polymicrobial diseases (K.A. Brogden & J.M. Guthmiller, eds.), ASM Press, Washington, DC. (http:// w w w.ncbi.nlm.nih.gov/books/NBK2480/#top accessed on 20.09.2013). 7. Inaba Y., Tanaka Y., Sato L., Omori T. & Matumoto M. 1972. Bovine respiratory syncytial virus studies on an outbreak in Japan, 1968-1969. Jpn J Microbiol, 16(5), 373-383.

Veterinaria Italiana 2013, 49 (3), 285-289. doi: 10.12834/VetIt.0810.01

8. Ogino H., Inui S. & Narita M. 1996. Demonstration of infectious bovine rhinotracheitis virus antigen by immunoperoxidase method in tissues of aborted bovine fetuses preserved for 25 years in paraffin blocks. J Vet Med Sci, 58(5), 459-460. 9. Ogino H., Kaneko K., Nakabayashi D., Watanabe T & Murayama J. 1996. Pathology of bovine abortion and newborn calf death caused by dual infection with Chlamydia psittaci and infectious bovine rhinotracheitis virus. J Vet Med Sci, 58(1), 67-70. 10. Rushton B., Sharp J.M., Gilmour N.J.L. & Thompson D.A. 1979. Pathology of an experimental infection of specific pathogen-free lambs with parainfluenza virus type 3 and Pasteurella haemolytica. J Comp Pathol, 89(3), 321-329. 11. Sharp J.M., Gilmour N.J.L. & Thompson D.A. 1978. Experimental infection of specific pathogen-free lambs with parainfluenza virus type 3 and Pasteurella haemolytica. J Comp Pathol, 88(2), 237-243. 12. Trigo F.J., Breeze R.G., Liggit H.D., Evermann J.F. & Trigo E. 1984. Interaction of bovine respiratory syncytial virus and Pasteurella haemolytica in the ovine lung. Am J Vet Res, 45(8), 1671-1678. 13. World Organisation for Animal Health (Office International des Épizooties: OIE). 2012. OIE listed diseases 2012 (www.oie.int/en/animal-health-in-theworld accessed on 20.09.2012). 14. World Organisation for Animal Health (Office International des Épizooties: OIE). 2012. World Animal Health Information System (www.oie.int/wahis/public. php accessed on 20.09.2012).

289

Rapid detection of Escherichia coli gyrA and parC mutants in one-day-old broiler chicks in Iran Bahman Abdi-Hachesoo1, Keramat Asasi1 & Hassan Sharifiyazdi2* Poultry Diseases Research Center, School of Veterinary Medicine, Shiraz University, Shiraz, P.O. Box 1731, 71345, Iran Department of Clinical Sciences, School of Veterinary Medicine, Shiraz University, Shiraz, P.O. Box 1731, 71345, Iran

1 2

* Corresponding author at: Department of Clinical Sciences, School of Veterinary Medicine, Shiraz University, Shiraz, P.O. Box 1731, Shiraz, 71345, Iran. Tel.: +98 711 6138917, e-mail: Sharifiy@shirazu.ac.ir

Veterinaria Italiana 2013, 49 (3), 291-297. doi: 10.12834/VetIt.1304.08

Accepted: 02.09.2013 | Available on line: 23.09.2013

Keywords Escherichia coli, Fluoroquinolone resistance, gyrA, parC, Iran, one-day-old broiler chicks, PCR-RFLP, sequencing.

Summary Vertical and consequently horizontal transmission of quinolone and fluoroquinolone resistant Escherichia coli clones following hatch in chickens enables a massive amplification of these clones into a large population. The aim of this study was to determine the antibiotic resistance and susceptibility of Iranian E. coli isolates (n=105) from one-day-old chicks to fluoroquinolones and the relation of this resistance with mutations in gyrA and parC genes using PCR-RFLP. For the first time, EcoRV restriction enzyme was used for rapid mutation screening in parC (Ser80Ile). The results showed that the low level of Minimum Inhibitory Concentration (MIC) for ciprofloxacin (0.25-4μg ml-1) and enrofloxacin (0.25-4μg ml-1) corresponded to a single mutation in gyrA, while intermediary to high level of MIC for ciprofloxacin (864 μg ml-1) and enrofloxacin (1664 μg ml-1) were related to 2 mutations in gyrA or 3 mutations, 2 in gyrA and 1 in parC. There was a strong positive correlation (R = 0.93, P < 0.001) between MIC levels of enrofloxacin and ciprofloxacin among these isolates. The article concludes by stressing that the rising incidence of enrofloxacin resistant E. coli isolates from chicken sources may increase the potential risk of ciprofloxacin resistant E. coli acquisition by humans.

Mutazioni nei geni gyrA e parC di Escherichia coli in pulcini di un giorno in allevamenti di polli da carne, Iran Parole chiave Escherichia coli, Resistenza a fluorochinolone, Gene gyrA, Gene parC, Iran, PCR-RFLP, Pulcino, Sequenziamento.

Riassunto La trasmissione verticale e orizzontale di cloni di Escherichia coli resistenti a chinoloni e fluorochinoloni nei polli dopo la schiusa delle uova provoca una massiccia amplificazione dei cloni in un notevole numero di soggetti. Lo studio ha avuto l’obiettivo di determinare resistenza e suscettibilità ai fluorochinoloni di isolati (n=105) di E. coli prelevati da pulcini di un giorno e di verificare, mediante PCR-RFLP, la relazione tra questa stessa resistenza e le mutazioni nei geni gyrA e parC. Per la prima volta è stato utilizzato l’enzima di restrizione EcoRV per effettuare rapidamente lo screening delle mutazioni presenti in parC (Ser80Ile). I risultati hanno evidenziato una singola mutazione in gyrA in presenza di un basso livello di concentrazione minima inibente (MIC) per ciprocloxacina (0,25-4 μg ml-1) ed enrofloxacina (0,25-4 μg ml-1). Sono state invece evidenziate 2 mutazioni in gyrA o 3 mutazioni, 2 in gyrA e 1 in parC, in presenza di una concentrazione minima inibente (MIC) intermedia-alta per ciprocloxacina (864 μg ml-1) ed enrofloxacina (1664 μg ml-1). Negli isolati è stata anche riscontrata una significativa correlazione positiva tra i livelli di MIC per ciprocloxacina e enrofloxacina (R = 0,93, P< 0,001). Lo studio evidenzia la relazione tra un crescente numero di isolamenti di E. coli resistente ad enrofloxacina nei polli e l’aumento potenziale del rischio di acquisizione di E. coli resistente ad ciprofloxacina nell’uomo.

291

Escherichia coli mutants in one-day-old broiler chicks in Iran

Introduction

Bacterial isolation and identification

Quinolones and fluoroquinolones (FQs) constitute a family of antibacterial agents that damage bacterial DNA via inhibition of type II topoisomerases. These are heterotetrameric enzymes including DNA gyrase with two subunits A and B (respectively encoded by gyrA and gyrB genes) and DNA topoisomerase IV with two subunits A and B (respectively encoded by parC and parE genes) (21). These enzymes work together in the replication, transcription, recombination, and repair of bacterial DNA (12). Alterations in quinolone resistance determining regions (QRDRs) via mutations have been recognized as one of the main resistance mechanisms in Escherichia coli (22). At the same time, the amino-acid substitution in these regions has significant effects on quinolone and FQ Minimum Inhibitory Concentration (MIC) values (24). In quinolone resistant gram negative bacteria, such as E. coli, mutations occurring in gyrA (mainly at Ser-83 and ASP-87) and parC (mainly at Ser-80 and Glu-84) subunits have been described as a secondary target (12).

Samples were spread onto MacConkey agar (Merck, Darmstadt, Germany) plates and incubated overnight at 37°C. One of the pink colour colonies from each plate was picked, spread onto Eosin Methylene Blue agar (Merck, Darmstadt, Germany) plates, and incubated overnight at 37°C. Blue-black colonies with dark centres and greenish metallic sheen were considered as E. coli - identified using a panel of biochemical tests (gram stain, oxidase, TSI, indole, citrate, methyl red, and urea agar) and stored at -70˚C in TSB with 30% glycerol until antibiotic susceptibility test and DNA extraction were performed.

E. coli as a component of the bacterial inhabitants of chicken gastrointestinal tract is an indicator of faecal contamination in poultry processing (8). Quinolone and FQ resistant E. coli isolates from broilers, broiler meat and humans are closely related and show clonal links, indicating that poultry and their food products can be a source of resistant E. coli in humans (10, 11, 14, 17, 18). Quinolone and FQ resistant E. coli has been reported in retail chicken products and in both healthy and clinically affected chickens (1, 3, 13, 15, 16, 20, 25). However data regarding FQ resistance in E. coli isolated from one-day-old broiler chicks on arrival at the farms are limited. This study was conducted on these chicks to investigate gyrA and parC mutations as the most important mechanism for FQ resistance in these E. coli isolates via DNA sequencing and PCR-RFLP.

Materials and methods Sample collection This study was conducted on 21 broiler farms located in the county of Shiraz, in Fars province, Iran. Sampling was done on one-day-old broiler chicks on their arrival at the farms from the hatcheries located in 5 different geographical areas of Iran. Fifteen cloacal samples were taken from each farm using sterile wood applicators. Each 3 swabs were pooled in a sterile tube containing tryptic soy broth (TSB) (Merck, Darmstadt, Germany) and immediately taken to the laboratory.

292

Abdi-Hachesoo et al.

Antimicrobial susceptibility test Resistance of 105 E. coli isolates (5 isolates from each farm) to fivequinolone and FQ antimicrobials nalidixic acid (30µg), ciprofloxacin (5µg), enrofloxacin (5µg), flumequine (30µg) and norfloxacin (10µg) was investigated using the disk diffusion method in Mueller-Hinton agar (Merck, Darmstadt, Germany) following National Committee for Clinical Laboratory Standards (NCCLS/CLSI) guidelines. The results were interpreted according to NCCLS/CLSI standards at the National Reference Laboratory for Antimicrobial Resistance (5, 6). Quality control was performed using the E. coli ATCC 25922 reference strain.

Fluoroquinolone susceptibility test Minimum inhibitory concentration (MIC) was determined by broth macrodilution method according to CLSI guidelines using enrofloxacin and ciprofloxacin (Bayer AG, Leverkusen, Germany). Susceptibility (≤) and resistance (≥) breakpoints (mg/L) were those defined by the CLSI (2010): 1 and 4 for ciprofloxacin, 0.25 and 2 for enrofloxacin.

PCR amplification and sequencing of gyrA and parC A few E. coli colonies were transferred to distilled water in an Eppendorf tube and boiled to prepare DNA templates for PCR (23). GyrA amplification was performed using 5’- ACGTACTAGGCAATGACTGG-3’ and 5’-AGAAGTCGCCGTCGATAGAAC‑3’primers. ParC amplification was performed using 5’-TGTATGCGATGTCTGAACTG-3’ and 5’-CTCAATAGCAGCTCGGAATA-3’ primers (7). GyrA and parC amplicons were amplified using a DNA thermo cycler (MJ mini, BioRad, Hercules, CA, USA) as follows: initial denaturation at 94°C for 5min, followed by 45 amplification cycles (94°C for 45s, 55°C used for gyrA and 58°C used for parC for 45s, 72°C for 45s) and a final extension cycle (72°C for 5min).

Veterinaria Italiana 2013, 49 (3), 291-297. doi: 10.12834/VetIt.1304.08

Abdi-Hachesoo et al.

PCR products from 9 E. coli isolates with high MIC levels (MIC≥16μg ml-1) were first selected randomly and sequenced (ABI 3730 Capillary DNA analyser Applied Biosystems, Foster City, CA, USA) in order to find possible existing patterns of mutations in gyrA and parC genes. Then a PCR-RFLP method, based on the obtained pattern of mutations in gyrA and parC after sequencing, was used for all isolates (n= 105).

RFLP-PCR for mutation detection in the gyrA and parC genes On the basis of the preliminary sequencing results (mutations at Ser-83 and Asp-87 in gyrA and Ser80Ile in parC) PCR-RFLP was used as a fast and reliable method for mutation detection. For gyrA, a sense primer, EC-GYRA-A (5'-CGCGTACTTTACGCCATGAACGTA-3') and an antisense primer, EC-GYRA-HinfI (5'-ATATA ACGCAGCGAGAATGGCTGCGCCATGCGGACAATCG AG-3'́) with a mismatch nucleotide (substitution of Thymine with Adenosine) were used to produce a 164-bp DNA fragment as previously described by Ozeki (19). Primer EC-GYRA-HinfI was adjacent to the Asp‑87 codon and differed by 1 base (underlined) from the wild type gyrA gene sequence to generate a HinfI recognition site. These primers amplified a 164 bp PCR product encompassing the QRDR of the gyrA with 2 natural and artificial HinfI restriction sites in the Ser-83 and Asp-87 regions, respectively (19). The PCR reaction (25μL) was performed in 10mM Tris–HCl, pH 8.4, 50 mMKCl, 2mM MgCl2, 100μM of each dNTP, 20pmol of each primer (Cinnagen Inc., Tehran, Iran), and 2 U Taq DNA polymerase (Cinnagen Inc.) using 2μL of DNA extracted as template. Amplification reactions were carried out using a DNA thermo cycler as follows: initial denaturation step at 94°C for 5min, followed by 45 cycles of denaturation at 94°C for 45s, annealing at 56°C for 1min and extension at 72°C for 1min. The final extension step was carried out at 72°C for 10min. PCR products were digested with HinfI (Jena Bioscience, Jena, Germany) to screen for mutations at positions Ser-83 and Asp87. Enzyme digestion was performed in a 20µl mixture containing 12µl of the PCR product, 0.5µl (2 U) of enzyme, 2µl B3 buffer and 5.5µl of distilled water at 37°C for 5hrs. After digestion with HinfI, the presence of PCR products was determined by electrophoresis of 10µl of each reaction product in 3% (w/v) Agarose gel with Trisborate EDTA electrophoresis buffer and visualized under UV light. A 265bp parC region containing the QRDR was amplified following the conditions described in (7) and the mutation of Ser80Ile was detected using EcoRV enzyme (Jena Bioscience). Digestion was performed in a final volume of 20µl reaction mixture containing 12µl of the PCR product, 2µl B2 buffer, 0.34µl (2U) enzyme and 5.66μl of distilled water at 37°C for 4hrs.

Veterinaria Italiana 2013, 49 (3), 291-297. doi: 10.12834/VetIt.1304.08

Escherichia coli mutants in one-day-old broiler chicks in Iran

Statistical analysis The correlation between MIC values of enrofloxacin and ciprofloxacin was analysed by Pearson correlation test. Analysis was performed using SPSS version 16.0 (SPSS Inc., Chicago, IL, USA).

Results Susceptibility or resistance to quinolone and FQ agents of 105 E. coli isolates from one-day-old chicks were first analysed using Disk Diffusion method (Table I). There was moderate resistance to ciprofloxacin, enrofloxacin and norfloxacin and high resistance to nalidixic acid and flumequine. Susceptibility or resistance to enrofloxacin and ciprofloxacin was also determined by MIC for all E. coli isolates. The percentage of resistance, intermediate resistance and susceptibility, of these isolates to enrofloxacin was 41.9%, 34.3% and 23.6%, respectively; while for ciprofloxacin the percentages were 36.2%, 2.9% and 60.9%, respectively. There was a significant positive correlation between MIC levels of enrofloxacin and ciprofloxacin (R = 0.93, P < 0.001). The distribution of MIC for enrofloxacin and ciprofloxacin by amino-acid mutation in gyrA and parC are presented in Table II and Table III. Sequencing results showed that all the sequenced isolates (n=9) shared a similar pattern of mutations in amplified regions of gyrA and parC genes. Two amino-acid substitutions in the QRDR of gyrA protein (Ser83Leu and Asp87Asn) and a single amino-acid substitution in the QRDR of parC protein (Ser80Ile) were detected in these sequenced isolates. Two silent mutations (Val-85 and Arg-91) in gyrA and 1 nucleotide mutation without amino-acid substitution in Gly-107 in parC were also detected in the sequenced isolates. One isolate (KC567240) also had an additional silent mutation (Gln-91) in parC (Figure 1). Accordingly, a total of 105 E. coli isolates were analysed by PCR-RFLP method to detect mutations at Ser-83 and Asp-87 in the gyrA gene as well as Ser‑80 in parC (Figure 2). Table I. Percentages of E. coli isolates (n=105) from one day-old broilers susceptible (S), intermediate (I) and resistant (R) to quinolone and FQs antimicrobial agents by NCCLS disc diffusion methods. Diffusion Number of resistance or susceptible E. coli isolates (%) Antimicrobial zone agent (μg) breakpoint Susceptible Intermediate Resistant (mm)

Nalidixic acid (30)

≤13

23 (21.9%)

5 (4.8%)

77 (73.3%)

Enrofloxacin (5)

≤16

25 (23.8%)

34 (32.4%)

46 (43.8%)

Ciprofloxacin (5)

≤ 15

62 (59.1%)

6 (5.7%)

37 (35.2%)

Norfloxacin (10)

≤12

59 (56.2%)

7 (6.7%)

39 (37.1%)

Flumequine (30)

≤16

25 (23.8%)

2 (1.9%)

78 (74.3%)

293

Escherichia coli mutants in one-day-old broiler chicks in Iran

Abdi-Hachesoo et al.

Table II. Amino-acid changes in gyrA and parC genes of E. coli isolated from one-day-old chicks and corresponding Minimum Inhibitory Concentration (MIC) of enrofloxacin. Substitution site gyrA parC a wt wt Ser83 wt Asp87 wt Ser83 and Asp87 wt wt Ser80 Ser83 Ser80 Asp87 Ser80 Ser83 and Asp87 Ser80 a

Number of isolates 28 38 2 2 0 0 0 35

<0.125 22

0.125 3

No. of E. coli isolates corresponding MIC (μg ml-1)b 0.25 0.5 1 2 4 8 16 32 3 7 25 5 1 2 2

64<

wild type; b MIC (μg ml-1) according to resistance-criteria of NCCLS is shown in shaded area.

Table III. Amino-acid changes in gyrA and parC genes of E. coli isolated from one-day-old chicks and corresponding Minimum Inhibitory Concentration (MIC) of ciprofloxacin. Substitution site gyrA parC a wt wt Ser83 wt Asp87 wt Ser83 and Asp87 wt wt Ser80 Ser83 Ser80 Asp87 Ser80 Ser83 and Asp87 Ser80 a

Number of isolates 28 38 2 2 0 0 0 35

<0.125 22

0.125 2

No. of E. coli isolates corresponding MIC (μg ml-1)b 0.25 0.5 1 2 4 8 16 32 1 1 2 11 23 3 1 1 1 2

64<

wild type; MIC (μg ml ) according to resistance-criteria of NCCLS is shown in shaded area. b

-1

Figure 1. Simultaneous alignment of partial parC nucleotide and amino-acid sequences from 1 susceptible (E. coli ATCC25922) and 2 resistant E. coli isolates (KC567240 and KC567242) to FQs, showing single location with 2 different patterns of amino-acid substitutions (Ser80Ile or Ser80Arg). Substitution of Ile instead of Ser produced a cut site (GAT/ATC) for EcoRV enzyme. Direct sequencing of the PCR-amplified parC gene showed a single amino-acid substitution in the Ser‑80 codon (Ser80Ile). The point mutation in this area (TC) led to the creation of a new restriction site (GAT/ATC) for EcoRV enzyme (Figure 1). When 2 DNA fragments of 101 bp and 164 bp

294

were produced from a PCR product (Figure 2), as observed for KC567240, the isolate was assumed to have a TC mutation at Ser-80. All the parC PCR products from E. coli isolates (n=105) were examined using EcoRV. Sixty-seven strains for which the MIC of ciprofloxacin was <4μg ml-1 showed no

Veterinaria Italiana 2013, 49 (3), 291-297. doi: 10.12834/VetIt.1304.08

Abdi-Hachesoo et al.

Escherichia coli mutants in one-day-old broiler chicks in Iran

265bp 164bp 101bp

200bp 164bp 124bp 109bp 55bp 40bp

Figure 2. (A) EcoRV PCR-RFLP patterns of parC. L1: PCR product E. coli ATCC25922. L2: E. coli ATCC25922 (uncut). L3: KC567240 PCR product. L4: RFLP pattern of KC567240 (Ser80Ile): the EcoRV restriction enzyme digestion produced 2 DNA fragments of 164bp and 101bp. M: DNA size marker (50 bp ladder, Vivantis, Subang Jaya, Malaysia).

(B) HinfI PCR-RFLP patterns of gyrA. L1: sample with mutations at both Ser-83 and Asp-87 (164bp). L2: E. coli ATCC25922 with no mutations at either Ser-83 or Asp-87(109 bp and 40 bp). L3: sample with a single mutation at Ser-83 (124 bp and 40 bp). L4: sample with a single mutation at Asp-87 (109 bp and 55 bp). L5: sample with no mutations (109 bp and 40 bp). L6: the gyrA PCR product (164 bp) of E. coli ATCC25922. M: DNA size marker (50 bp ladder, Vivantis).

restriction site at Ser-80. Among the 38 ciprofloxacin resistant isolates (MIC≥4μg ml-1), 34 isolates had this restriction site at Ser-80 and were assumed to have Ser to Ile substitution in this codon. Four remaining ciprofloxacin resistant isolates were investigated for other mutations in this region by DNA sequencing. One of these isolates with a low level of ciprofloxacin resistance phenotype (MIC=4μg ml-1) had no mutation at Ser-80. However, 3 isolates (mutant2), with MIC≥16μg ml-1, had Arginine (Arg) substitution instead of Serine-80 (Figure 1).

Discussion In this study, 105 E. coli isolates from the normal microflora of one-day-old chicks in Iran were analysed for their enrofloxacin and ciprofloxacin MIC values and mutation detection in QRDRs of gyrA and parC. A significant positive correlation was found between MIC levels of enrofloxacin and ciprofloxacin (R = 0.93, P < 0.001). Additionally, enrofloxacin and ciprofloxacin resistance rates were approximately similar for E. coli isolates (41.9% and 36.2%, respectively), even if there were more ciprofloxacin

Veterinaria Italiana 2013, 49 (3), 291-297. doi: 10.12834/VetIt.1304.08

than enrofloxacin susceptible isolates (60.9% and 23.8%, respectively). These results could be attributed to the fact that the susceptibility and resistance break points for enrofloxacin (0.25mg/L and 2mg/L, respectively) are lower than ciprofloxacin (1mg/L and 4mg/L, respectively) (5, 6). In other words, about 76% of these isolates were resistant or intermediate resistant to enrofloxacin, whereas only 39% of all E. coli isolates were ciprofloxacin resistant or ciprofloxacin intermediate resistant. A single mutation in the gyrA was associated with a decrease in susceptibility of these E. coli isolates to ciprofloxacin and enrofloxacin. Nonetheless, all of these isolates, except 1 for ciprofloxacin and 6 for enrofloxacin, were still susceptible to these 2 FQs. A single mutation in Ser-83 is the most frequent single mutation site in gyrA gene. This mutation is the first step in the acquisition of FQ resistance and usually results in high-level resistance to nalidixic acid (22). However, an additional mutation in gyrA or parC is required to obtain high levels of resistance to second generation FQs such as ciprofloxacin and enrofloxacin (Table II and Table III). This step-by-step acquisition of FQ resistance is in agreement with previous findings (22). Two isolates with single aminoacid substitution in Asp-87 were also detected but this single substitution was not enough to increase MIC values up to enrofloxacin and ciprofloxacin resistance breakpoint. Simultaneous mutations in gyrA (Ser-83 and Asp-87) without any amino-acid substitution in parC were seen in 2 isolates with high values of MIC for enrofloxacin (32μg ml-1) and ciprofloxacin (16μg ml-1). The emergence of these higher levels of FQ resistance could be associated with plasmid-mediated quinolone resistance (PMQR) mechanisms, such as qnr gene, qepA, oqxAB and aac(60)-Ib-cr, which have been studied and increasingly reported in recent years (21). Considering these findings, it seems that low level of MIC for ciprofloxacin and enrofloxacin corresponded to a single mutation in gyrA, while intermediary to high values of MIC for ciprofloxacin and enrofloxacin were related to 2 mutations in gyrA or 3 mutations, 2 in gyrA and 1 in parC. This was in agreement with previous studies on E. coli isolated from chickens (15, 16, 25). Ruiz (22) stated that the most common mutations in ciprofloxacin resistant E. coli are present in the QRDR of gyrA at positions Ser-83 and Asp-87 and at position Ser-80 and Glu-84 of parC. In our study, all 9 preliminary E. coli isolates, which were sequenced for GRDR of gyrA and parC, showed 2 amino-acid substitutions (Ser83Leu and Asp87Asn) in gyrA and 1 substitution in parC (Ser80Ile). Based on these constant mutation features, PCR-RFLP technique was used for rapid detection of these mutation sites. For the first time mutation RFLP analysis in parC (Ser80Ile) was developed using EcoRV in the present study.

295

Escherichia coli mutants in one-day-old broiler chicks in Iran

Knowledge of the emergence of FQ resistance mechanisms in E. coli isolates from one‑day‑old broiler chicks is limited. This study showed a strong positive correlation between MIC levels of enrofloxacin and ciprofloxacin in E. coli isolates of one-day-old broiler chicks. This correlation indicates that most of the enrofloxacin resistant E. coli isolates were concomitantly resistant to ciprofloxacin. This correlation is not unexpected, because enrofloxacin is extensively metabolized into ciprofloxacin (2). The history of farms with high FQ-resistant isolates showed that enrofloxacin was used in the rearing or laying period. There is some evidence of vertical transmission of enrofloxacin resistant E. coli from healthy broiler breeders (20). Vertical transmission, and consequently horizontal dissemination, has been mentioned as an important approach for distribution of E. coli clones in poultry farms. Horizontal transmission following hatch enables a massive amplification of these clones into the large population (9). Vertical transmission of FQ resistant E. coli from parents to broilers (4) and horizontal transmission in one-day-old chicks following hatch leads to multiplication of this resistance in large populations (20). The horizontal transmission

Abdi-Hachesoo et al.

of these resistant clones in the hatcheries could spread these clones through the integrated broiler operations and lead to clinical outbreaks of FQ‑resistant colibacillosis in poultry farms (20). These FQ-resistant E. coli may also be transmitted from contaminated chicken meat products to humans (10, 14, 17).

Conclusions There was a strong positive correlation between MIC levels of enrofloxacin and ciprofloxacin in the E. coli isolates considered in this study. The role of chicken as a reservoir to the extension of ciprofloxacin resistance in humans has not been completely quantified. However, the indiscriminate use of FQ antibiotics, such as flumequine and enrofloxacin, should be avoided or minimized, in broiler chickens as well as in other poultry production cycles such as broiler breeders for example.

Acknowledgments This research was financially supported by a grant from the Shiraz University Research Council.

References 1. Alessiani A., Di Giannatale E., Perilli M., Forcella C., Amicosante G. & Zilli K. 2009. Preliminary investigations into fluoroquinolone resistance in Escherichia coli strains resistant to nalidixic acid isolated from animal faeces. Vet Ital, 45(4), 521-527.

7. Everett M.J., Jin Y.F., Ricci V. & Piddock L. 1996. Contributions of individual mechanisms to fluoroquinolone resistance in 36 Escherichia coli strains isolated from humans and animals. Antimicrob Agents Chemother, 40(10), 2380-2386.

2. Anadon A., Martinez-Larranaga M., Diaz M., Bringas P., Martinez M., Fernandez-Cruz M., Fernandez M. & Fernandez R. 1995. Pharmacokinetics and residues of enrofloxacin in chickens. Am J Vet Res, 56(4), 501-506.

8. Geornaras I., Hastings J.W. & Von Holy A. 2001. Genotypic analysis of Escherichia coli strains from poultry carcasses and their susceptibilities to antimicrobial agents. Appl Environ Microbiol, 67(4), 1940-1944.

3. Blanco J.E., Blanco M., Mora A. & Blanco J. 1997. Prevalence of bacterial resistance to quinolones and other antimicrobials among avian Escherichia coli strains isolated from septicemic and healthy chickens in Spain. J Clin Microbiol, 35(8), 2184-2185.

9. Giovanardi D., Campagnari E., Ruffoni L.S., Pesente P., Ortali G. & Furlattini V. 2005. Avian pathogenic Escherichia coli transmission from broiler breeders to their progeny in an integrated poultry production chain. Avian Pathol, 34(4), 313-318.

4. Bortolaia V., Bisgaard M. & Bojesen A.M. 2010. Distribution and possible transmission of ampicillinand nalidixic acid-resistant Escherichia coli within the broiler industry. Vet Microbiol, 142(3-4), 379-386.

10. Giufrè M., Graziani C., Accogli M., Luzzi I., Busani L. & Cerquetti M. 2012. Escherichia coli of human and avian origin: detection of clonal groups associated with fluoroquinolone and multidrug resistance in Italy. J Antimicrob Chemother, 67(4), 860-867.

5. Clinical and Laboratory Standards Institute (CLSI previously NCCLS). 2002. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals; Approved Standard – 3rd Ed. CLSI, Wayne, Pennsylvania, M31-A2, 22(6), 107 p. 6. Clinical and Laboratory Standards Institute (CLSI previously NCCLS). 2010. Performance standards for antibiotic susceptibility testing: twentieth informational supplement. CLSI, Wayne, Pennsylvania, M100-S20, 30(1), 44 p.

296

11. Jacobs‐Reitsma W., Kan C. & Bolder N. 1994. The induction of quinolone resistance in Campylobacter bacteria in broilers by quinolone treatment. Lett Appl Microbiol, 19(4), 228-231. 12. Jacoby G.A. 2005. Mechanisms of resistance to quinolones. Clin Infect Dis, 41, S120-S126. 13. Johnson J.R., Murray A.C., Gajewski A., Sullivan M., Snippes P., Kuskowski M.A. & Smith K.E. 2003.

Veterinaria Italiana 2013, 49 (3), 291-297. doi: 10.12834/VetIt.1304.08

Abdi-Hachesoo et al.

Isolation and molecular characterization of nalidixic acid-resistant extraintestinal pathogenic Escherichia coli from retail chicken products. Antimicrob Agents Chemother, 47(7), 2161-2168. 14. Johnson J.R., Kuskowski M.A., Menard M., Gajewski A., Xercavins M. & Garau J. 2006. Similarity between human and chicken Escherichia coli isolates in relation to ciprofloxacin resistance status. J Infect Dis,194(1), 71-78. 15. Kmet V. & Kmetová M. 2010. High level of quinolone resistance in Escherichia coli from healthy chicken broilers. Folia Microbiol (Praha), 55(1), 79-82. 16. Lee Y., Cho J., Kim K., Tak R., Kim A., Kim J., Im S. & Kim B. 2005. Fluoroquinolone resistance and gyrA and parC mutations of Escherichia coli isolated from chicken. J Microbiol, 43(5), 391-397. 17. Literak I., Reitschmied T., Bujnakova D., Dolejska M., Cizek A., Bardon J., Pokludova L., Alexa P., Halova D. & Jamborova I. 2013. Broilers as a Source of QuinoloneResistant and Extraintestinal Pathogenic Escherichia coli in the Czech Republic. Microb Drug Resist, 19(1), 57-63.

Escherichia coli mutants in one-day-old broiler chicks in Iran

patients with complicated urinary tract infections. J Clin Microbiol, 35(9), 2315-2319. 20. Petersen A., Christensen J.P., Kuhnert P., Bisgaard M. & Olsen J.E. 2006. Vertical transmission of a fluoroquinolone-resistant Escherichia coli within an integrated broiler operation. Vet Microbiol, 116(1-3), 120-128. 21. Rodríguez-Martínez J.M., Cano M.E., Velasco C., Martínez-Martínez L. & Pascual Á. 2011. Plasmidmediated quinolone resistance: an update. J Infect Chemother, 17(2), 149-182. 22. Ruiz J. 2003. Mechanisms of resistance to quinolones: target alterations, decreased accumulation and DNA gyrase protection. J Antimicrob Chemother, 51(5), 1109-1117. 23. Sambrook J. & Russell D.W. 2001. Molecular cloning: a laboratory manual, 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 3 vol.

18. Nelson J.M., Chiller T.M., Powers J.H. & Angulo F.J. 2007. Fluoroquinolone-resistant Campylobacter species and the withdrawal of fluoroquinolones from use in poultry: a public health success story. Clin Infect Dis, 44 (7), 977-980.

24. Shigemura K., Tanaka K., Yamamichi F., Shirakawa T., Miyake H. & Fujisawa M. 2012. Does mutation in gyrA and/or parC or efflux pump expression play the main role in fluoroquinolone resistance in Escherichia coli urinary tract infections?: A statistical analysis study. Int J Antimicrob Agents, 40(6), 516-520.

19. Ozeki S., Deguchi T., Yasuda M., Nakano M., Kawamura T., Nishino Y. & Kawada Y. 1997. Development of a rapid assay for detecting gyrA mutations in Escherichia coli and determination of incidence of gyrA mutations in clinical strains isolated from

25. White D.G., Piddock L.J.V., Maurer J.J., Zhao S., Ricci V. & Thayer S.G. 2000. Characterization of fluoroquinolone resistance among veterinary isolates of avian Escherichia coli. Antimicrob Agents Chemother, 44(10), 2897-2899.

Veterinaria Italiana 2013, 49 (3), 291-297. doi: 10.12834/VetIt.1304.08

297

Seafood a potential source of some zoonotic bacteria in Zagazig, Egypt, with the molecular detection of Listeria monocytogenes virulence genes Heba A. Ahmed1*, Mohamed A. Hussein2 & Ahmed M.M El-Ashram3 1

Department of Zoonoses, Faculty of Veterinary Medicine, Zagazig University, 44511 Zagazig, Egypt 2 Department of Food Control and Technology, Faculty of Veterinary Medicine, Zagazig University, 44511 Zagazig, Egypt 3 Department of Fish Health, Central Laboratory for Aquaculture Research, Egypt

* Corresponding author at: Department of Zoonoses, Faculty of Veterinary Medicine, Zagazig University, 44511 Zagazig, Egypt Tel.: +201003282923, e-mail: heba_ahmed@zu.edu.eg

Veterinaria Italiana 2013, 49 (3), 299-308. doi: 10.12834/VetIt.1305.05

Accepted: 02.09.2013 | Available on line: 30.09.2013

Keywords Escherichia coli, Egypt, Internalin genes, Listeria monocytogenes, Listeriolysin O, Seafood, Virulence factors.

Summary This article describes the results of a study conducted on 71 fresh seafood samples (fish and shellfish) marketed in Zagazig city, Sharkia province, Egypt, as well as on 50 human stool samples collected at the Zagazig University Hospital. The samples were examined for the presence of Listeria monocytogenes and Escherichia coli. The investigation of L. monocytogenes virulence genes was performed using Polymerase Chain Reaction (PCR), while the microbiological quality of the seafood samples was evaluated using the coliform count and aerobic plate count (APC) as indicators. Out of the examined 71 seafood samples, 20 (28.2%) were identified as L. monocytogenes, 15 (75%) of which were confirmed as virulent strains. Also, out of 50 human stool samples, only 1 (2%) was identified as virulent L. monocytogenes. E. coli serotypes were isolated from only 11.3% of seafood and 30% of human stool samples. In shellfish, the APC and most probable number of coliforms (MPC) were higher than those obtained from other fish samples. Multiplex PCR targeting internalin genes allowed simultaneous identification of L. monocytogenes and differentiation of virulent strains, thus enabling more timely detection of cases and sources of food borne listeriosis. The article concludes by stressing that the isolation of potentially virulent L. monocytogenes and E. coli from both seafood samples and humans emphasises the potential public health hazard caused by eating raw or undercooked shellfish.

Rilevazione molecolare dei geni di virulenza per Listeria monocytogenes e di batteri responsabili di zoonosi in prodotti ittici commercializzati nei mercati di Zagazig in Egitto Parole chiave Egitto, Escherichia coli, Internalina, Listeria monocytogenes, Listeriolisina O, Molluschi, Pesce, Virulenza.

Riassunto L’articolo descrive i risultati di uno studio condotto su 71 campioni di prodotti ittici freschi (pesci e molluschi), commercializzati nella città di Zagazig (provincia di Sharkia) in Egitto, e su 50 campioni di feci umane, prelevati da pazienti dell’Ospedale Universitario della stessa città, con l’obiettivo di valutare la presenza di Listeria monocytogenes ed Escherichia coli. I geni di virulenza per L. monocytogenes sono stati analizzati impiegando la polymerase chain reaction (PCR). L’analisi microbiologica dei campioni ha previsto la conta dei Coliformi e la conta aerobica su piastra. In 20 (28,2%) dei 71 campioni ittici esaminati è stata rilevata la presenza di L. monocytogenes. In 15 (75%) di questi 20 campioni e in 1 (2%) dei 50 campioni di feci umane sono stati riscontrati ceppi virulenti di L. monocytogenes. Sierotipi di E. coli sono stati isolati solo nell’11,3% dei campioni ittici e nel 30% dei campioni di feci umane. L’analisi microbiologica ha evidenziato nei molluschi valori più elevati rispetto ai campioni di pesce. L’utilizzo di Multiplex PCR sui geni dell’internalina ha permesso di identificare simultaneamente L. monocytogenes e altri ceppi virulenti rilevando tempestivamente i casi e le fonti di listeriosi di origine alimentare. Lo studio evidenzia il potenziale rischio per la salute pubblica derivante dal consumo di prodotti ittici crudi o non adeguatamente cotti.

299

Ahmed et al.

Seafood a potential source of some zoonotic bacteria in Zagazig, Egypt

Introduction Consumers of seafood worldwide are becoming increasingly concerned about the safety and nutritional quality of their food. Nonetheless, seafood still plays a significant role in causing food borne diseases (55). Contamination of seafood with zoonotic bacteria could occur during slaughter, refrigeration and processing, resulting in the transmission of such bacteria to consumers (23). Listeria monocytogenes has been recognized as an important opportunistic human pathogen since 1929 and as a food borne pathogen since 1981 (35). The involvement of seafood in the transmission of listeriosis was suggested by Lennon et al. (39), who proposed that consumption of shellfish and raw fish was responsible for an epidemic of prenatal listeriosis in New Zealand in 1980. L. monocytogenes primarily affects children, elderly and immune-compromised individuals causing severe diseases such as septicemia, encephalitis and meningitis (62). It also causes abortion and stillbirth in pregnant women, in addition, Listeria infects healthy people causing fever, vomiting and diarrhoea (47). Multiple key virulence factors are important in L. monocytogenes pathogenesis (56), therefore it is necessary to identify virulent from avirulent strains by molecular techniques such as Polymerase Chain Reaction (PCR) (40) in order to implement effective control and preventive measures against L. monocytogenes infections. Pathogenic strains of Escherichia coli are transferred to seafood through sewage pollution or by contamination after harvest (69). E. coli strains can cause a variety of diseases, including diarrhoea, dysentery, and haemolytic uremic syndrome (31, 67). Faecal coliforms and the aerobic plate count (APC) have been adopted as indicator to assess the quality of seafood flesh and, consequently, to predict the risk of seafood consumption (44, 71). The aim of this study is to generate information on the prevalence of L. monocytogenes and E. coli biotypes in some seafood marketed in Zagazig city in Egypt, as well as in stool samples collected from patients attending the Zagazig University Hospital, Egypt. In addition, the detection and differentiation of virulent and avirulent L. monocytogenes isolates by PCR was performed. The coliform count and APC were used as indicators to assess the microbiological quality of the examined seafood.

Materials and methods Sample collection and preparation A total of 71 seafood samples, including 13 Nile‑tilapias (Oreochromis niloticus), 10 mullets (Mugil cephalus), 10 bivalve mollusks (Caelatura laronia),

300

12 blue crabs (Calinectes sapidus), 12 tuna (Thunnus thynnus), and 14 shrimps (Penaeus semisulcatus) were collected from fish markets in Zagazig city. Also, 50 stool swabs were collected from diarrheic patients, with a history of chronic diseases, attending the University Hospital in Zagazig city. Ten grams of the interior flesh content from the seafood sample were homogenized in 90 ml of sterile 0.1% peptone water using a blender for 2 min (55). The homogenate was firstly used for APC and most probable number of coliforms (MPN) determination and then incubated at 37°C for 24 hours for pre‑enrichment of the samples. Stool samples were collected in a clean sterile container and then a swab from each sample was inserted in 0.1% peptone water for pre-enrichment and incubated at 37°C for 24 hours (61).

Isolation and molecular identification of L. monocytogenes Isolation of L. monocytogenes L. monocytogenes was isolated according to the US Food and Drug Administration (FDA) methods (27). For enrichment, 25 ml of the pre-enriched sample was added into 225 ml of Listeria Enrichment Broth (LEB) (Himedia, Catalogue # 569-500G, Mumbai, India) and incubated at 30°C for 2-7 days. For isolation, a loopful from the LEB culture was streaked onto OXFORD media (Himedia, Catalogue # MV1145-500G with Listeria Oxford supplement Himedia, Catalogue # FD071, Mumbai, India) and incubated for 24-48 hrs at 35°C. The suspected colonies obtained by cultural methods were re-suspended in LEB and incubated at 30°C for 2 days. Bacterial cells were harvested in a microcentrifuge tube by centrifugation at 10,000 rpm for 30 sec. The supernatant was discarded and the bacterial pellet was suspended and washed in 200 µl physiological saline 0.9% and the suspension was then centrifuged again at 10,000 rpm for 30 sec. DNA extraction was performed according to the manufacturer guidelines using Bacterial DNA Extraction Kit (Spin-column) (BioTeke Corporation, Shanghai, China).

Multiplex PCR for detection of internalin genes Purified DNA of the suspected colonies was subjected to a Multiplex PCR for the identification of L. monocytogenes and also for the detection of internalin virulence factors according to Liu et al. (40). Oligonucleotide primers (AlphaDNA, Montreal, Quebec, Canada) were used for the amplification of

Veterinaria Italiana 2013, 49 (3), 299-308. doi: 10.12834/VetIt.1305.05

Ahmed et al.

Seafood a potential source of some zoonotic bacteria in Zagazig, Egypt

Table I. Primer sequences and expected product sizes of the Multiplex PCR. The inlA primers were intended for species-specific recognition, and the inlC and inlJ primers were designed for virulence determination of Listeria monocytogenes.

inlA inlC inlJ

Gene

Primer sequence (5'3')

inlA-Forward

ACGAGTAACGGGACAAATGC

inlA-Reverse

CCCGACAGTGGTGCTAGATT

inlC-Forward

AATTCCCACAGGACACAACC

inlC-Reverse

CGGGAATGCAATTTTTCACTA

inlJ-Forward

TGTAACCCCGCTTACACAGTT

inlJ-Reverse

AGCGGCTTGGCAGTCTAATA

Expected product size (bp) 800 bp 517 bp 238 bp

L. monocytogenes internalin genes inlA, inlC and inlJ. Table I shows the sequence of the primers and the expected product sizes. The reaction was performed in 25 µl reaction volume containing 12.5 µl of readymade 2x power Taq PCR mastermix (BioTeke Corporation) and 40 pmol each inlA, 30 pmol each inlC and 20 pmol each inlJ primers and 2 µl of the purified DNA. A reaction mixture with no added DNA was run in the PCR as a negative control. A positive control of serologically confirmed L. monocytogenes isolate was kindly obtained from the department of Food Control, Faculty of Veterinary Medicine, Zagazig University, Egypt. The reaction conditions consisted of one cycle of 95°C for 2 min followed by 30 cycles of 94°C for 20 sec, 55°C for 20 sec and 72°C for 50 sec, a final cycle of 72°C for 2 min. The reaction was carried out in Primus (MWG-Biotech Thermal Cycler, Ebersberg, Germany). Amplification products were resolved in 1.2% (w/v) agarose gels along with 100 bp molecular weight ladder (BioTeke Corporation). The agarose gel was prepared in 1 x TBE (89 mM Tris‑Borate; 2 mM EDTA; and pH 8.3) stained with 5 μM ethidium bromide. The gels were run in 1 x TBE, 5 μM ethidium bromide for at least 45 min at 100 V and then visualized under Ultra Violet light of ultraviolet transilluminator (Spectroline, Westbury, NY, USA).

PCR for detection of Listeriolysin O virulence genes A second PCR was used for the detection of Listeriolysin O virulence gene (LLO) in the molecularly identified L. monocytogenes (34). The primers (AlphaDNA, Montreal, Quebec, Canada) had the following sequences: hlyA-Forward: 5’- CGG AGG TTC CGC AAA AGA TG-3’ and hlyA-Reverse: 5’CCT CCA GAG TGA TCG ATG TT-3’ (45). The reaction was performed in 25 µl reaction volume containing

Veterinaria Italiana 2013, 49 (3), 299-308. doi: 10.12834/VetIt.1305.05

12.5 µl of readymade 2x power Taq PCR master mix and 100 nM of each hlyA primers and 2 µl of the purified DNA. A reaction mixture with no added DNA as a negative control and a positive control of serologically identified strain were run in the PCR reaction. The reaction conditions consisted of one cycle 94°C for 3 min followed by 35 cycles of 94°C for 1 min, 60°C for 2 min and 72°C for 1 min and a final extension at 72°C for 2 min. The visualization of the expected 234 bp amplified products was performed as previously described in the Multiplex PCR.

Isolation and identification of E. coli One ml of the pre-enriched samples was directly inoculated into 9 ml MacConkey broth (Oxoid, CM 5a, Adelaide, Australia) and incubated at 37°C overnight for enrichment (9). After enrichment, a loopful from the incubated enrichment broth was streaked directly onto Eosin-Methylene-Blue agar EMB (Oxoid, CM69, Adelaide, Australia) and incubated at 37°C for 18-24 hrs. The suspected E. coli colonies were subjected to biochemical identification (6) and then the biochemically confirmed isolates were serotyped (37) using rapid diagnostic E.coli antisera sets (DIFCO Laboratories, Detroit Michigan, USA). Serotyping was performed at the Food Analysis Centre, Faculty of Veterinary Medicine, Benha University, Egypt.

Aerobic plate count and most probable number of coliforms For the examined samples, the APC was determined according to Stevenson and Segner (63). The total APC per gram sample was calculated according to the following equation: total APC = number of colonies x dilution factor. The total APC was presented as colony forming units (CFU/g). The APC was considered acceptable, marginally acceptable or not acceptable according to the Food and Drug Administration, Centre for Food Safety and Applied Nutrition of United States (FDA CFSAN) (16). The coliform counts were determined according to Thatcher and Clark (66). Positive tubes with acid and gas production were recorded and for each dilution, the results were presented as a fraction as follows: number of positive tubes/number of inoculated tubes. The MPN was then estimated using MPN index (67) and the concentration of coliform bacteria was presented as MPN/g of the sample. A test of significance of observed differences in bacterial counts in the different seafood species examined was conducted using a one-way analysis of variance (ANOVA) computed by SPSS (version XI). P < 0.05 was regarded as statistically significant.

301

Ahmed et al.

Seafood a potential source of some zoonotic bacteria in Zagazig, Egypt

Figure 1. Multiplex PCR of Listeria monocytogenes suspected isolates for the detection of inlA, inlC and inlJ genes. L: 100 bp ladder; 1: negative control; 12: positive control; 2-5 and 7-9: negative samples; 6, 10-11, 13-14, 16, 17, 19: virulent L. monocytogenes; 15, 18, 20-22: avirulent L. monocytogenes. Table II. Confirmed and virulent Listeria monocytogenes detected by Multiplex PCR. Confirmed L. monocytogenes strains were detected by amplification of inlA gene, while virulent strains were distinguished by the presence of inlC and inlJ genes. Sample type

Number Confirmed Virulent of Listeria Listeria samples monocytogenes monoctogenes

Blue crab

4 (33.3%)

3 (75%)

Shrimp

6 (42.9%)

5 (83.3%)

Bivalve mollusks

6 (60%)

5 (83.3%)

Total

16 (44.4%)

13 (81.3%)

Nile tilapia

Mullet

2 (20%)

1 (50%)

Tuna

2 (16.7%)

1 (50%)

Total

4 (11.4%)

2 (50%)

Total seafood

20 (28.2%)

15 (75%)

Human

1 (2%)

100%

Shellfish

Fish

Results Prevalence of L. monocytogenes in seafood and in human samples Seventy-one seafood samples were examined for the prevalence of L. monocytogenes, 20 (28.2%) were identified by the amplification of inlA gene which is a species-specific protein used for the identification of L. monocytogenes that produced 800 bp amplicon (Figure 1). Comparing the prevalence of L. monocytogenes in shellfish and other fish species,

302

Figure 2. Listeriolysin O PCR of Listeria monocytogenes suspected isolates. L: 100 bp ladder; 1: negative control; 2: positive control; 3-7 positive L.Â monocytogenes for Listriolysin O. L. monocytogenes was isolated from shellfish with an overall percentage of 44.4% and 11.4% from the other fish samples (Table II). L. monocytogenes was isolated from diarrheic patients, with a history of chronic diseases, attending the University Hospital, Zagazig city (Table II).

Detection of virulent L. monocytogenes strains L. monocytogenes strains harbouring internalin virulence genes were determined by the amplification of inlC and inlJ (Table II and Figure 1). The presence of LLO was investigated and detected in all virulent strains harbouring inlC and inlJ genes so to fully investigate the pathogenicity of L.Â monocytogenes to humans. Some L. monocytogenes isolates positive for LLO are shown in Figure 2.

Veterinaria Italiana 2013, 49 (3), 299-308. doi: 10.12834/VetIt.1305.05

Ahmed et al.

Seafood a potential source of some zoonotic bacteria in Zagazig, Egypt

Table III. Serotypes and biotypes of Escherichia coli in the examined samples. Serotypes of E. coli were identified by slide agglutination method using polyvalent and monovalent antisera. Number of samples

Sample type

Shrimp

Bivalve mollusks

Nile tilapia Mullet

13 10

Tuna

Total Human

71 50

Total

15 (30%)

Fish

7 6

1 (8.3%) 1 (8.3%) 0 1 (10%) 1 (10%) 1 (7.7%) 1 (10%) 1 (8.3%) 1 (8.3%) 8 (11.3%) 3 (6%) 5 (10%) 2 (4%) 5 (10%)

Blue crab Shellfish

c e

CFU/g

Number of Escherichia coli Escherichia coli serotypes Escherichia coli biotypes isolates (%)

4 3 2 1 0

Blue crab

Prawn

Bivalve moulluscs

Tilapia nilotica

Mullet

Tuna

Figure 3. Mean log-aerobic plate count per gram of examined fish and shell fish samples, error bars contain SD. Means carrying different letter are significantly different (p < 0.05) based on one-way ANOVA.

Prevalence of E. coli in seafood and human samples E. coli was isolated from seafood and diarrheic patients, the serotypes of the isolated E. coli isolates were determined (Table III). The results of the APC revealed that APC of examined blue crab ranged from 5.04 to 6.21 with a mean ± SD value of 5.405 ± 0.338 log CFU/g (Figure 3). The aerobic plate count of examined bivalve mollusks showed that 20% had bacterial load in extremely high numbers >7 log CFU/g, also no samples had acceptable level of total bacterial count (<5.69 log CFU/gm) and 80% of samples are marginally accepted (5.69 and 7 log CFU/g), the mean APC was 6.81 ± 0.349 log CFU/g. In shrimps, about 50% of the

Veterinaria Italiana 2013, 49 (3), 299-308. doi: 10.12834/VetIt.1305.05

O124:K72(B17) O111:K58(B9) O128:K67(B12) O127:K63(B8) O111:K58(B9) O128:K67(B12) O86:K61(B7) O26:K60(B6)

EIEC EHEC ETEC ETEC EHEC ETEC EPEC EHEC

O111:K58(B9) O124:K72(B17) O86:K61(B7) O26:K60(B6)

EHEC EIEC EPEC EHEC

examined samples was accepted, while the other 50% was only marginally accepted according to FDA CFSAN. In Tilapia, APC was 5.06 ± 0.292 log CFU/g, all the examined Tilapia samples in the current study were within the acceptable level of APC (<5.69 log CFU/g). The results showed also that the APC in the examined Mullet fish ranged from 6.04 to 6.32, with a mean value of 6.18 ± 0.08 log CFU/g and 100% of samples marginally accepted (5.69 and 7 log CFU/g). The APC in the examined Tuna samples ranged from 4.59 to 4.84 with a mean value of 4.72 ± 0.174 log CFU/g and 100% of the samples were accepted (< 5.69 log CFU/g ).

Most probable number of coliforms The results showed that MPN of coliforms in examined crab and shrimp samples were respectively 1.42 ± 0.345 log MPN/g and 2.24 ± 0.362 log MPN/g (Figure 4). However, bivalve mollusks contain MPN of coliforms within average of 2.79 ± 276 log MPN/g. The MPN of coliforms in examined Tilapia, Mullet and Tuna were respectively 1.6 ± 0.256, 1.35 ± 0.241and 1.54 ± 0.306 log MPN/g.

Discussion Seafood is able to carry potentially pathogenic bacteria for human beings to non-polluted water causing infection when fish are consumed or handled (11). Therefore, it is important to gather information about the prevalence of L. monocytogenes and E. coli in order to estimate the public health hazard

303

Seafood a potential source of some zoonotic bacteria in Zagazig, Egypt

3.5

MPN/g

2.5 2

1.5

1 0.5 0

Blue crab

Prawn

Bivalve moulluscs

Tilapia nilotica

Mullet

Tuna

Figure 4. Mean log-most probable number of coliform per gram of examined fish and shell fish samples error bars contain SD. Means carrying different letter are significantly different (p < 0.05) based on one-way ANOVA. of shellfish and fish as a potential source for these pathogens. In this study, a total of 71 seafood samples (fish and shellfish) were examined for their contamination with L. monocytogenes and E. coli. Moreover, 50 stool samples from patients attending Zagazig University Hospital were examined for the presence of L. monocytogenes and E. coli serotypes. The yearly medical costs and productivity losses from the acute illness from food borne listeriosis in the USA are estimated to be equal to the costs caused by Salmonella spp., twice the costs of CampylobacterÂ spp. and 3 times the costs related to E. coli O157:H, despite the prevalence of these latter diseases being over 500, 700 and 25 times the number of listeriosis cases, respectively (13). Biochemical identification of L. monocytogenes is not always accurate and is not always accurate and depends on phenotypic characteristics of the bacteria (5). Of the 11 common L. monocytogenes serotypes, over 98% of clinical isolates from human listeriosis belong to only 4 serotypes (33, 41). Therefore, it is pivotal to distinguish between potentially virulent and avirulent strains by the amplification of different virulence genes such as inlJ (34). Some potentially virulent L. monocytogenes strains lack inlJ gene, an additional virulence-associated gene InlC, has been used in the Multiplex PCR in association with inlJ and inlA for rapid and simultaneous confirmation of L. monocytogenes species identity and its potential virulence (34, 36). In this study, the isolation of L. monocytogenes by amplification of inlA gene indicates the usefulness of the Multiplex PCR as a rapid and accurate method compared to the time consuming and less accurate biochemical tests for the identification of L. monocytogenes. The obtained percentage of L.Â monocytogenes from seafood (28.8%) was nearly similar to previously reported studies in France (29%) (29) and in USA (30%) (28), while a relatively

304

Ahmed et al.

higher isolation rate of 39% was recorded in the Nordic countries (24). Other studies have found that the prevalence of L. monocytogenes in raw seafood is quite low, for instance: 0.8% in European fish (10), 2.3% in Ethiopia (48), and 12% in Portugal (45). In India, L. monocytogenes was isolated from seafood with the percentages of 1.8% (48) and 8% (64). The relatively low prevalence rate of L. monocytogenes reported in the aforementioned studies compared to the current study could be attributed to the use of molecular techniques for L. monocytogenes detection endorsed for this study and the difference in the water quality of the study areas. The isolation of L. monocytogenes from shrimp (Table II) was similar to 44% percentage reported in Malaysia (4). In Gao region (India) 4.5% of seafood samples were positive for L. monocytogenes, of which, bivalves were found to have a maximum percentage of 12.5%, followed by prawns (3.84%) and finfishes (2.9%). These results are consistent with those obtained in this study, in which bivalves had higher prevalence rate. The higher isolation rate of L. monocytogenes in bivalves could be attributed to the fact that bivalves are filter feeders and they can accumulate more microorganisms than fish, from water impacted by sewage pollution (19). The consumption of bivalve mollusks is relatively high in Egypt due to the cheapest price compared to other seafood, therefore, the habit of eating these kinds of mollusks raw or undercooked constitute an important source of infection with L. monocytogenes. Lower prevalence of L. monocytogenes (12.1%) was reported in shellfish samples from India (35). The obtained results showed also that Tilapia was free from L. monocytogenes, which in turn has an important impact on public health considering the fact that this is one of the most popular fish types consumed in Egypt. Since L. monocytogenes is commonly found in coastal waters and in surface waters of lakes (15), water should be regarded as the source of seafood contamination with L. monocytogenes. Other possible sources for contamination of seafood are soiled surfaces and boxes, as well as contamination from human and avian sources (54). Although L.Â monocytogenes has no hazard for consumers when seafood undergoes processing, they pose some risk to susceptible populations when consumed raw or lightly cooked. In addition, the possibility of cross contamination in the processing plant, kitchen or food service establishment is also of concern (68). L. monocytogenes was previously isolated from human stool samples with low percentages of 0.7% (50) and 5% (58). The isolation of L. monocytogenes from diarrhoeic patients suffering from chronic diseases, although with low percentage, is of great importance because L. monocytogenes fatality rate

Veterinaria Italiana 2013, 49 (3), 299-308. doi: 10.12834/VetIt.1305.05

Ahmed et al.

may be up to 30% (8, 59). The risks for human beings following the consumption of seafood contaminated with L. monocytogenes was previously documented in a Finnish retrospective study (42), which reported that a L. monocytogenes type recovered from several sporadic listeriosis cases turned out to be identical to an epidemic strain that originated from fish. Similarly, a retrospective subtyping analysis of 42 human isolates identified in Italy through Multiplex PCR. In this case, the results showed that the human isolates tested positive for inlA, inlC and inlJ genes (43). Such results concur with those presented in this article, in which the obtained human isolate tested also positive for the aforementioned genes. Previously conducted studies reported that L. monocytogenes strains harbouring internalin genes inlC and inlJ could be unable to produce human disease via oral ingestion due to inability to cross the host’s intestinal barriers during infection (40). Meanwhile, for a L. monocytogenes strain to cause infection in humans via ingestion, it requires involvement of other known virulence genes such as listeriolysin O. In this regard, a PCR which amplifies LLO has been used in the current study to fully investigate the potential of the isolated strains to cause human disease. The results indicated the detection of LLO in all virulent strains (Figure 2). These results highlight the usefulness of LLO as virulence indicator for L. monocytogenes causing human infection. Testing of seafood for the presence of E. coli is still a gold standard used to assess the faecal contamination of seafood (20). E. coli was isolated from the examined seafood in the current study (Table III), lower percentage (6.7%) was reported in Korea (60), while higher percentage (48.95%) was documented in India (25). In Egypt, E. coli was also isolated from different seafood samples such as raw shellfish (48%, Suez Canal) (3) and bivalve mollusks, (30%, Ismailia) (32). In Domiatta, E. coli was isolated from shrimps, crabs and bivalve mollusks with the percentages of 8%, 12% and 80%, respectively (12). The differences in the prevalence of E. coli in seafood samples reported in the current studies and those previously reported could be due to environmental conditions, microbial quality of fish farms and sanitary conditions of markets. Similarly to the obtained results, serotypes O111 and O86 were previously identified in stool samples from diarrheic children in South Africa with nearly similar percentages of 6.5% and 4.8%, respectively (18). E. coli serotypes identified from human stool were similar to those identified from seafood in the present study suggesting the potential of E. coli transmission from seafood to human either by consumption or handling. However, the transmission of such serotypes could be further investigated using molecular typing methods to determine the

Veterinaria Italiana 2013, 49 (3), 299-308. doi: 10.12834/VetIt.1305.05

Seafood a potential source of some zoonotic bacteria in Zagazig, Egypt

genetic relationship of the serotypes identified from human and seafood sources. The APC indicates the level of microorganisms in a product, quality, shelf life and post heat-processing contamination (44). It is useful in order to measure the conditions of the raw material, effectiveness of processing and hygienic conditions during processing, sanitary conditions of equipment and utensils and time temperature profile during storage and distribution. According to FDA CFSAN (16), the permissible limit of APC in seafood was reported to be less than 5.69 log CFU/g, while if the bacterial count is between 5.69 and 7 log CFU/g, it would be marginally accepted. Whenever the count is more than 7 log CFU/g, the quality of seafood would be unacceptable (16). Compared to APC in crab samples (Figure 3), lower APC ranged from 0.78 to 3.26 log CFU/g was obtained by Giuffrida (22), while higher rang of 6.53 to 9.23 log CFU/g was obtained by Gillman and Skonberg (21). The obtained results shrimp samples (Figure 3) coincide with Nayem (52) who reported APC in fresh water prawn in Bangladesh, with range of 4.83 to 6.2 log CFU/g. Nearly similar APC range of 6.39 to 6.43 log CFU/g in bivalve mollusks was obtained by Hatha (26) in India. Higher means for APC in Tilapia were reported in Nigeria by Adetunji (1) than those obtained in the current study (Figure 3). In Mullet samples, lower APC of 4.79 log CFU/g was detected in Nigerian Mullet fish (53), while higher APC of 5.90 to 8.95 log CFU/g was reported in Tuna samples in Taiwan (7). In the current study, APC arranged in descending manner as following bivalve mollusks > Mullet > shrimp > blue crab > Tilapia > Tuna (Figure 3). There is a significant difference between all examined species (p < 0.05), Tilapia and Tuna are not significantly different compared to each other, as they both have a low APC. The time of fish exposure to temperature during marketing is considered a critical factor, where the increase in temperature leads to multiplication of mesophillic microorganisms. This in turn explains the low APC reported in Tuna and Tilapia samples because these kinds of fish are of the same price (lower than other types of seafood) and are also popular to consumers in Zagazig, therefore the time of marketing is low due to high demand. Counts of commensal coliform bacteria have traditionally been used to indicate the potential presence of pathogenic microbes of intestinal origin (2). Fish of good quality should have coliform count of less than 10/g according to the USA food and drug administration report (16). Higher MPN of coliforms in crabs was obtained by Hatha (26) in India, where counts ranged from 2.04 to 3.04 log MPN/g. Lower MPN of 1.32 log MPN/g were reported by Wentz (70). In shrimps, higher MPN of coliforms than the one obtained in this study were detected in fresh water prawn of Bangladesh where count ranged from

305

Seafood a potential source of some zoonotic bacteria in Zagazig, Egypt

2.17 to 5.25 log MPN/g (52); while in Giza, Egypt, MPN of coliform count in raw shrimp samples was 3.72 log MPN/g (51). Once again bivalve mollusks were the most contaminated samples compared to other types of samples (p < 0.05). Nearly similar MPN of coliforms in 48 bivalve mollusks ranged from 2 to 2.69 log MPN/g were reported by Qadri (57), while higher MPN of coliforms (4.86 log MPN/g) was obtained in Alexandria, Egypt (14). The MPN of coliforms in examined Tilapia, Mullet and Tuna were 1.6, 1.35 and 1.54 log MPN/g, respectively (Figure Â 4). Nearly similar results were obtained by Landeiro (38) in Brazilian fish, where the detected value was 1.7 log MPN/g. There was no significant difference among these examined fish species (p > 0.05), which show the same level of sewage contamination in the site from which fish were harvested.

Conclusions The results obtained from this study demonstrated the presence of L. monocytogenes and E. coli in

Ahmed et al.

seafood marketed in Zagazig city, Egypt. The presence of these pathogens and the high concentration of bacterial contaminants is an indication that the hygiene and safety of such seafood is compromised. Therefore, suitable processing parameters and post processing handling should be treated as important control measures to minimize or eliminate the hazard associated with these organisms. The detection of LLO in all potentially virulent L. monocytogenes strains is of great concern because this gene is an indicator of virulence and has a role in the pathogenicity of the organism in humans via the oral route. The current study recommends the use of the Multiplex PCR targeting internalin genes for the identification of L. monocytogenes and for differentiation virulent and avirulent strains instead of the conventional biochemical testing. Evaluation of the genetic similarity between L. monocytogenes and E. coli isolates from seafood and humans is recommended for further investigation of the public health potential of such isolates.

References 1. Adetunji V.O., Shoola A.A.E. & Odetokun I.A. 2012. Biofilm assessment in bacteria isolates from Claria gariepinus and Tilapia species. Nature and Science, 10(10), 157-161. 2. American Public Health Association (APHA). 1995. Standard methods for the examination of water and wastewater. 19th ed., American Public Health Association, Washington, D.C. 3. Amine N.E., Salama A.A., Mowafy L.E. & Marzouk M.A. 1984. The bacteriological examination of clams (Amarada sp.) from sea shores of Egypt. Zagazig Veterinary Medical Journal, 9, 309-311. 4. Arumugaswamy R.K., Ali G.R.R. & Abd Hamid S.N. 1994. Prevalence of Listeria monocytogenes in foods in Malaysia. Int J Food Microbiol, 23(1), 117-121. 5. Aznar R. & Alarcon B. 2002. On the specificity of PCR detection of Listeria monocytogenes in food: a comparison of published primers. Syst Appl Microbiol, 25(1), 109-119. 6. Barrow G.I. & Feltham R.K.A. 1993. Cowan and Steelâ&#x20AC;&#x2122;s manual for the identification of medical bacteria. Characteristics of Gram-negative bacteria, the enterobacteria. 3rd ed, Cambridge University Press, Great Britain, 128-179 p. 7. Chen H.C., Kung H. F., Chen W.C., Lin W.F., Hwang D.F., Lee Y.C. & Tsai Y.H. 2008. Determination of histamine and histamine-forming bacteria in tuna dumpling implicated in a food-borne poisoning. Food Chem, 106(2), 612-618. 8. Chukwu C.O.O., Ogbonna C.I.C, Olabode A.O, Chukwu D.I, Onwuliri F.C & Nwankiti O.O. 2006. Listeria

306

monocytogenes in Nigerian processed meats and ready to eat dairy products. Niger J Microbiol, 20(1), 900-904. 9. Cruickshank R., Duguid J.P., Marmion B.P. & Swain R.H.A. 1975. Medical Microbiology. The Practice of Medical Microbiology. 12th ed., vol. II. Churchill Livingstone, Edinburgh, London and New York., 170-188 p.. 10. Davies A.R., Capell C., Jehanno D., Nychas G.J.E. & Kirby R.M. 2001. Incidence of foodborne pathogens on European fish. Food Control, 12(2), 67-71. 11. DePaola A., Capers G. & Alexander D. 1994. Densities of Vibrio vulnificus in the intestines of fish from the US Gulf Coast. Appl Environ Microbiol, 60(3), 984-988. 12. Dorah E.H.I. 2002. Study on quality of some shellfish. PhD Thesis, Fac. Vet. Med. Beni Suef Cairo University, Meat Hygiene. 13. Economic Research Service (ERS, USDA). 2000. Foodborne Illness Cost Calculator (www.ers.usda.gov accessed on 16.09.2013). 14. El-Sahn M.A., El-Banna A.A. & El-Tabey S.A.M. 1986. Microbiological examination of market mollusks shellfish. Alex J Agri Res, 31(1), 157-166. 15. Food Agricultural Organization (FAO). 1999. Fisheries Report No. 604. Expert consultation on the trade impact of Listeria in fish products. Amherst, MA, USA. 16. Food and drug administration, Center for Food Safety and Applied Nutrition (FDA- CFSAN). 1986 National manual of operations. Part 1, Sanitation of shellfish growing areas. Revision, Washington DC. 17. Food and Drug Administration - Centre for Food Safety

Veterinaria Italiana 2013, 49 (3), 299-308. doi: 10.12834/VetIt.1305.05

Ahmed et al.

and Applied Nutrition (FDA-CFSAN). 2003. National Shellfish Sanitation Program. Guide for the control of molluscan shellfish,Washington DC. 18. Galane P.M. & Le Roux M. 2001. Molecular epidemiology of Escherichia coli isolated from young South African children with diarrhoeal diseases. J Health Popul Nutr, 19(1), 31-38. 19. Gawade L., Barbuddhe S.B. & Bhosle S. 2010. Isolation and confirmation of Listeria species from seafood off Goa Region by Polymerase Chain Reaction. Indian J Microbiol, 50(4), 385-389. 20. Geldrich E.E. 1997. Coliforms: a new beginning to an old problem. In Kay D. & Fricker C. (eds.) Coliforms and E. coli: Problem or Solution, Atheaneum Press, UK, 3-11 p. 21. Gillman B. & Skonberg D. 2001. Effects of additives on quality of mechanically extracted Jonah crab (Cancer borealis) mince during refrigerated storage. Journal of Food Quality, 25(4), 265-275. 22. Giuffrida A., Ziino G., La Paola R., Bottari T. & Panebianco A. 2004. Bacteriology of unshelled frozen blue swimming crab (Portunus pelagicus). J Food Prot, 67(4), 809-812. 23. Gonzalez-Rodriguez M.N., Sanz J.J., Santos J.A, Otero A. & Garcia-Lopez M.L. 2002. Numbers and types of microorganisms in vacuum-packed cold-smoked freshwater fish at the retail level. Int J Food Microbiol, 77(1-2), 161-168. 24. Gudbjรถrnsdรณttir B., Suihkob M.L., Gustavssonc P., Thorkelssona G., Salob S., Sjรถbergb A.M., Niclasend O. & Bredholte S. 2004. The incidence of Listeria monocytogenes in meat, poultry and seafood plants in the Nordic countries. Food Microbiol, 21, 217-225.

Seafood a potential source of some zoonotic bacteria in Zagazig, Egypt

ecology of foods. Vol. 1. 2nd Ed. University of Toronto Press, Toronto, Canada. 32. Ismail T. H. 1994. Studies on the microbiological quality of mollusks in Suez Canal area. MVSc Thesis, Fac. Vet. Med. Suez Canal University, Meat Hygiene. 33. Jacquet C., Gouin E., Jeannel D., Cossart P., Rocourt J. 2002. Expression of ActA, Ami, InlB, and listeriolysin O in Listeria monocytogenes of human and food origin. Appl Environ Microbiol, 68(2), 616-622. 34. Jaradat Z.W., Schutze G.E. & Bhunia A.K. 2002. Genetic homogeneity among Listeria monocytogenes strains from infected patients and meat products from two geographic locations determined by phenotyping, ribotyping and PCR analysis of virulence genes. Int J Food Microbiol, 76(1-2), 1-10. 35. Jeyasekaran G., Karunasagar I. & Karunasagar I. 1996. Incidence of Listeria spp. in tropical fish. Int J Food Microbiol, 31(1-3), 333-340. 36. Jung Y.S., Frank J.F., Brackett R.E. & Chen J. 2003. Polymerase chain reaction detection of Listeria monocytogenes on frankfurters using oligonucleotide primers targeting the genes encoding internalin AB. J Food Prot, 66(2), 237-241. 37. Kok T., Worswich D. & Gowans E. 1996. Some serological techniques for microbial and viral infections. In Practical Medical Microbiology (Collee J., Fraser A., Marmion B. and Simmons A. eds.), 14th ed., Edinburgh, Churchill Livingstone, UK. 38. Landeiro C.M.P.A., Almeida R.C.C., Nascimento A.T.M., Ferreira J.S., Yano T. & Almeida P.F. 2007. Hazards and critical control points in Brazilian seafood dish preparation. Food Control, 18(5), 513-520.

25. Gupta B., Ghatak S. & Gill J.P.S. 2013. Incidence and virulence properties of E. coli isolated from fresh fish and ready-to-eat fish products. Vet World, 6(1), 5-9.

39. Lennon D., Lewis B., Mantell C., Becraft D., Dove B. & Farmer K. 1984. Epidemic perinatal listeriosis. Pediatric Infectious Disease, 3, 30-34.

26. Hatha A.A., Christi K.S., Reema S. & Shristi K. 2005. Bacteriology of the fresh water bivalve clam Batissa violacea (Kai) sold in the Suva market. The South Pacific Journal of Natural Science, 23(1), 48-50.

40. Liu D., Lawrence M.L., Austin F.W. & Ainsworth A.J. 2007. A multiplex PCR for species- and virulencespecific determination of Listeria monocytogenes. J Microbiol Methods, 71(2), 133-140.

27. Hitchins A.D. 1995. Listeria monocytogenes. In Food and drug administration, bacteriological analytical Manual, 8th ed. Gaithersburg, USA: AOAC International, 10.01-10.13 p.

41. Liu D., Ainsworth A.J., Austin F.W. & Lawrence M.L. 2003. Characterization of virulent and avirulent Listeria monocytogenes strains by PCR amplification of putative transcriptional regulator and internalin genes. J Med Microbiol, 52(12), 1066-1070.

28. Hoffman A., Gall K.L., Norton D.M. & Wiedmann M. 2003. Listeria monocytogenes contamination patterns for the smoked fish processing environment and for raw fish. J Food Protect, 66(1), 52-60. 29. Hong E., Doumith M., Duperrier S., Giovannacci I., Morvan A., Glaser P., Buchrieser C., Jacquet C. & Martin P. 2007. Genetic diversity of Listeria monocytogenes recovered from infected persons and pork, seafood and dairy products on retail sale in France during 2000 and 2001. Int J Food Microbiol, 114(2), 187-194. 30. International Commission on Microbiological Specifications for Foods (ICMSF). 2002. Microorganisms in Food. 7. Microbiological Testing in Food Safety Management. Kluwer Academic/Plenum, NY. 31. International Commission on Microbiological Specification for Foods (ICMSF). 1986. Microbial

Veterinaria Italiana 2013, 49 (3), 299-308. doi: 10.12834/VetIt.1305.05

42. Lukinmaa S., Miettinen M., Nakari U.M., Korkeala H. & Siitonen A. 2003. Listeria monocytogenes isolates from invasive infections: variation of sero and genotypes during an 11-year period in Finland. J Clin Microbiol, 41(4), 1694-1700. 43. Mammina C., Aleo A., Romani C., Pellissier N., Nicoletti P., Pecile P., Nastasi A. & Pontello M.M. 2009. Characterization of Listeria monocytogenes isolates from human listeriosis cases in Italy. J Clin Microbiol, 47(9), 2925-2930. 44. Maturin L.J. & Peeler J.T. 1998. Aerobic plate count. Ch. 3. In Food and Drug Administration Bacteriological Analytical Manual, 8th ed. (revision A), (CD-ROM version). R.L. Merker (Ed.). AOAC International, Gaithersburg, MD.

307

Seafood a potential source of some zoonotic bacteria in Zagazig, Egypt

45. Mena C., Almeida G., Carneiro L., Teixeira P., Hogg T. & Gibbs P.A. 2004. Incidence of Listeria monocytogenes in different food products commercialized in Portugal. Food Microbiol, 21(2), 213-216.

59. Rocourt J., Hogue A., Toyofuku H., Jacquet C. & Schlundt J. 2001. Listeria and listeriosis: risk assessment as a new tool to unravel a multifaceted problem. Am J Infect Control, 29(4), 225-227.

46. Mengaud J., Vicente M.F. & Cossart P. 1989. Transcriptional mapping and nucleotide sequence of the Listeria monocytogenes hlyA region reveal structural features that may be involved in regulation. Infect Immun, 57(12), 3695-3701.

60. Ryu S.H., Park S.G., Choi S.M., Hwang Y.O., Ham H.J., Kim S.U., Lee Y.K., Kim M.S., Park G.Y., Kim K.S. & Chae Y.Z. 2012. Antimicrobial resistance and resistance genes in Escherichia coli strains isolated from commercial fish and seafood. Int J Food Microb, 152(1-2), 14-18.

47. Miettinen M.K., Siitonen A., Heiskanen P., Haajanen H., Bjorkroth K.J. & Korkeala H.J. 1999. Molecular epidemiology of an outbreak of febrile gastroenteritis caused by Listeria monocytogenes in cold-smoked rainbow trout. J Clin Microbiol, 37(7), 2358-2360. 48. Moharem A.S., Charith Raj A.P. & Janardhana G.R. 2007. Incidence of Listeria species in seafood products of Mysore, India. J Food Safety, 27(4), 362-372. 49. Molla B., Yilma R. & Alemayehu D. 2004. Listeria monocytogenes and other Listeria species in retail meat and meat products in Addis-Ababa, Ethiopia. Ethiop J Health Dev, 18(3), 208-212. 50. Muller H.E. 1990. Listeria isolation from feces of patients with diarrhea and from healthy food handlers. Infection, 18(2), 39-42. 51. Naglaa S.H., Saleh S.K. & Eman M.S.Z. 2002. Hygienic quality of shrimp in Giza fish markets. J Egypt Vet Med Assoc, 62(6b), 113-120. 52. Nayem M.J., Fakhruddin A.N., Chowdhury A.Z., Alam Z.M., Fardous K., Rashid H. & Hossian M.A. 2011. Pathogenic bacteria pesticides residues and metal content in giant fresh water prawn, Macrobrachium rosenbergii (deman) sold in local markets. Journal of Bangladesh Academy of Sciences, 35(1), 91-97. 53. Okoro C., Aboaba O. & Babajide O. 2010. Quality Assessment of a Nigerian Marine Fish, Mullet (Liza falcipinnis) under different Storage Conditions. New York Science Journal, 3(8), 21-28. 54. Parihar V.S., Barbuddhe S.B., Danielsson-Tham M.L., & Tham W. 2008. Isolation and characterization of Listeria species from tropical seafoods. Food Control, 19, 566-569. 55. Popovic N.T., Skukan A.B, Dzidara P., Coz-Rakovac R., Strunjak-Perovic I., Kozacinski L., Jadan M. & BrlekGorski D. 2010. Microbiological quality of marketed fresh and frozen seafood caught off the Adriatic coast of Croatia. Veterinarni Medicina, 55(5), 233-241. 56. Portnoy D.A., Chakraborty T., Goebel W. & Cossart P. 1992. Molecular determinants of Listeria monocytogenes pathogenesis. Infect Immun, 60(4), 1263-1267. 57. Qadri R.B., Buckle K.A. & Edwards R.A. 1975. Sewage pollution in oysters grown in Georges Rivers, Botany Bay area. Food Technol Australia, 27(10), 236-242. 58. Rocourt J. 1988. The recognition and identification of Listeria species by classical methods. Infeksiyon Dergisi (Turkish Journal of Infection), 2, 471-485.

308

Ahmed et al.

61. Sadoma A.M. 1997. Salmonella in chicken in connection with human infection. M.V.Sc. Thesis, Faculty Veterinary Medicine, Tanta University. 62. Schuchat A., Swaminathan B. & Broome C.V. 1991. Epidemiology of human listeriosis. Clin Microbiol Rev, 4(2), 169-183. 63. Stevenson K.E. & Segner W.P. 1992. Mesophilic aerobic sporeformes. In American Public Health Association (Ed.), Compendium of methods for the microbiological examination of foods 3rd ed., Washington, APHA. 265-289 p. 64. Swetha C.S., Madhava Rao T., Krishnaiah N. & Vijaya Kumar A. 2012. Detection of Listeria monocytogenes in fish samples by PCR assay. Annals of Biological Research, 3(4), 1880-1884. 65. Teophilo G.N., dos Fernandes Vieira R.H., dos Prazeres Rodrigues D. & Menezes F.G. 2002. Escherichia coli isolated from seafood: toxicity and plasmid profiles. Int Microbiol, 5(1), 11-4. 66. Thatcher F.S. & Clark D.S. 1978. Microorganisms in food. Vol. 1. Academic Press, New York. 67. United States Department of Agriculture-Food Safety and Inspection Services (USDA). 2008. Microbiology Laboratory Guidebook, Ch. 2, Rev 3. Most Probable Number Procedure and Tables. (http://www.fsis. usda.gov/wps/wcm/connec t/8872ec11- d6a34fcf-86df-4d87e57780f5/MLG_Appendix_2_03. pdf?MOD=AJPERES accessed on 25.10. 2010). 68. Wan Norhana M.N., Poole S.E., Deeth H.C., Dykes G.A. 2010. Prevalence, persistence and control of Salmonella and Listeria in shrimp and shrimp products: A review. Food Control, 21(4), 343-361. 69. Ward D., Bernard D., Collette R., Kraemer D., Hart K., Price R. & Otwell S. 1997. Hazards Found in Seafoods, Appendix III. In HACCP: Hazard Analysis and Critical Control Point Training Curriculum, 2nd ed., 173-188 p. 70. Wentz B.A., Duran A.P., Swartzentruber A., Schwab A.H. & Read R.B. 1983. Microbiological quality of fresh blue crab meat, clams, oysters. J Food Prot, 46(11), 978-981. 71. Zambuchini B., Fiorini D., Verdenelli M.C., Orpianesi C. & Ballini R. 2008. Inhibition of microbiological activity during sole (Solea solea L.) chilled storage by applying ellagic and ascorbic acids. Food Sci Tech, 41(9), 1733-1738.

Veterinaria Italiana 2013, 49 (3), 299-308. doi: 10.12834/VetIt.1305.05

SHORT COMMUNICATION Coproscopy survey of Gastrointestinal parasites in owned dogs of Kerman city, Iran Mohammad Mirzaei* & Majid Fooladi Pathobiology Department, School of Veterinary Medicine, Shahid Bahonar University of Kerman, 22 Bahman Boulevard, 7616914111, Kerman, Iran * Corresponding author at: Pathobiology Department, School of Veterinary Medicine, Shahid Bahonar University of Kerman, 22 Bahman Boulevard, 7616914111, Kerman, Iran. Tel.: +98 341 3222047, e-mail: dr_mirzaie_mo@uk.ac.ir

Veterinaria Italiana 2013, 49 (3), 309-313. doi: 10.12834/VetIt.1209.01

Accepted: 02.09.2013 | Available on line: 16.09.2013

Keywords Coproscopy, Gastrointestinal parasites, Iran, Kerman city, Owned dogs, Troglotrema salmincola.

Summary A coproscopy survey was conducted on 100 owned dogs in Kerman city from July 2011 to July 2012 with the objective to assess the presence of Gastrointestinal parasites with zoonotic potential. Faecal samples from 100 dogs were examined for the presence of parasites. Samples (n=100) collected from dogs of different ages and genders were analysed using 5 techniques, i.e. centrifugal flotation in sucrose solution, centrifugal flotation in 33% Zinc sulphate solution, Ziehl-Neelsen staining, trichrome staining, and iodine staining. The overall proportion of Gastrointestinal parasitic infection was 16% (16/100). The most frequently observed parasites in this study were Toxocara canis (9%), followed by Taeniidae eggs (3%), Cryptosporidium spp. (3%), Troglotrema salmincola (1%), Toxoscaris leonina (1%) and Isospora canis (1%). Most of the dogs (62%) included in the study were regularly dewormed and no significant association was found between parasitic infection and sex, age and breed of the dogs. It is noteworthy that this is the first report of Troglotrema salmincola infection in Iran.

Indagine coproscopica per valutare la presenza di parassiti gastrointestinali in cani di proprietà nella città di Kerman in Iran Parole chiave Cani di proprietà, Città di Kerman, Coproscopia, Iran, Parassita gastrointestinale, Troglotrema salmincola.

Riassunto Lo studio riporta i dati relativi a un’indagine coproscopica condotta su 100 cani di proprietà nella città di Kerman, in Iran, nel periodo compreso tra luglio 2011 e luglio 2012. L’indagine è stata condotta con l’obiettivo di valutare la presenza di parassiti gastrointestinali capaci di indurre zoonosi. I campioni (n=100) raccolti da cani di diversa età e sesso sono stati analizzati usando 5 tecniche: flottazione in soluzione di saccarosio, flottazione in soluzione di solfato di zinco (33%), colorazione Ziehl-Neelsen, colorazione tricromica e colorazione con iodio. La percentuale di infezione da parassiti gastrointestinali è risultata pari al 16% (16/100). I parassiti osservati con più frequenza sono stati: Toxocara canis (9%), Taeniidae (3%), Cryptosporidium spp. (3%), Troglotrema salmincola (1%), Toxascaris leonina (1%) e Isospora canis (1%). È importante sottolineare che la maggior parte dei cani (62%) è stata regolarmente sverminata e che non è stata rilevata un’associazione significativa tra le infezioni da parassiti e il sesso, la razza e l’età dei cani. Lo studio è il primo rapporto sulle infezioni da Troglotrema salmincola in Iran.

309

Gastrointestinal parasites in owned dogs of Kerman city, Iran

Domestic dogs (Canis familiaris) are generally regarded as the first domesticated mammal (3). Unfortunately, some of these animals are infected with parasites including parasitic worms and thus, at times, they can be a major source of infections causing mild to life threatening diseases in humans (10). In fact, dogs are associated with more than 60 zoonotic diseases among which parasites, helminthosis in particular, can cause serious health problems as well as significant economic impact from a veterinary standpoint (28, 36). The prevalence of parasites varies considerably from one region to another and also changes depending on the different diagnostic techniques employed (30). Visceral and ocular larva migrans caused by Toxocara canis and cutaneous larva migrans caused by Ancylostoma brasiliense are some zoonotic aspects related to helminth infections in dogs (34). In Iran, the prevalence of parasites considerably varies from one region to another and among the different diagnostic techniques employed (30). Nonetheless, all the 4 categories of canids - feral or stray dogs - working sheepdogs, pet dogs and wild canids, such as foxes and jackals, constitute a threat to the public health (9, 14). Several epidemiological studies have been conducted to assess the situation of intestinal parasitic infections in dogs in many parts of the world (6, 10, 18, 19, 20, 25, 27, 29, 36, 37), but information on the Gastrointestinal parasites in owned dogs in Iran and specially in Kerman province is scanty (11, 22, 23). Hence, the main objective of the study was to assess the presence of Gastrointestinal parasites with zoonotic potential in owned dogs in Kerman city.

Kerman

Caspian Sea

I.R. Iran

Persian Gulf

Oman Sea

Figure 1. Map of Iran, location of Kerman city.

310

Mirzaei et al.

This is the most important town of the Kerman province, Iran. Kerman city is located at 30°17’13”N and 57°04’09”E South-East of Iran, at an altitude of about 1,755m above sea level. The city is close to the Kavir-e lut desert and the climate is hot and arid, with an average annual rainfall of 135mm. Vegetation types and agricultural systems may vary in Kerman area depending on climate, soil, and other geographical conditions (Figure 1). From July 2011 to July 2012, faecal samples from 100 dogs were examined for the presence of parasites. Each faecal sample consisted of approximately 5g of fresh stool, collected from the rectum of the owned dogs. Samples were immediately processed in the parasitology diagnostic laboratory of the Veterinary School of Shahid Bahonar, University of Kerman. An aliquot of the specimens was concentrated by the formalin-ether sedimentation method. Smears were made from the sediment (20μL) and stained by the modified Ziehl-Neelson technique. The complete surface of the smear was examined for Cryptosporidium oocysts. Smears were prepared from the faeces and stained with trichrome and iodine in order to detect cysts or trophozoites of Giardia and Entamoeba. Centrifugal flotation in 33% Zinc sulphate solution was also used to investigate the presence of Giardia cysts and trophozoites (24). Furthermore, faecal flotations in Sheathers sugar solution (500g of sugar, 320mL of water, 6.5g of phenol) with a specific density of 1.3g mL-1 were examined by light microscopy for eggs of intestinal helminthes and oocysts of Isospora spp. Each observed egg or cyst was identified according to morphological characteristics as previously described (33). A dog was classified as positive if at least one egg or cyst was observed. Data on gender, breed and age of the dogs were also collected from the owners. Information on faecal consistency and frequency of deworming treatment was also recorded. Chi square test (x2) was used to determine any significant association between infection and the observed variables. The significance level applied was P<0.05. Protozoa and helminth eggs were detected in the faeces of 100 dogs and their prevalence is presented in Table I. The overall prevalence of infection with Gastrointestinal parasites was 16% (16/100). Infections with multiple parasite species (2/16=12.5%) were less common than infections with a single parasite species (14/16=87.5%). The most frequently observed parasites in this study were Toxocara canis (9%), followed by Taeniidae eggs (3%), Cryptosporidium spp. (3%), Troglotrema salmincola (1%), Toxoscaris leonina (1%) and Isospora canis (1%). Troglotrema salmincola was found only in one male dog, while Isospora canis and

Veterinaria Italiana 2013, 49 (3), 309-313. doi: 10.12834/VetIt.1209.01

Mirzaei et al.

Gastrointestinal parasites in owned dogs of Kerman city, Iran

Table I. Prevalence of Gastrointestinal parasites in owned dogs in Kerman city according to sex, age, faecal consistency, and breed. Number of Infected dogs examined Number (%) dogs Sex Male Female Age < 6 months > 6 months Faecal consistency Diarrheic Non diarrheic Breed Mix Pure

Statistical significance (x2)*

68 32

13 3

19.11a 9.37b

a vs b: P>0.05

56 44

11 5

19.64a a vs b: P>0.05 11.36b

24 76

12 4

50a 5.26b

23 77

4 12

17.39a a vs b: P>0.05 15.58b

Deworming

No of examined dogs

Received Non received Total

62 38 100

Infected dogs No (%) 2 3.22a 14 36.84b 16 16

P=0.00001 a vs b: P<0.05

a vs b: P>0.05 P=0.00001

* Chi square test.

Toxoscaris leonina were found only in females. No significant difference (P>0.05) in overall prevalence of Gastrointestinal parasites was found in relation to sex, age and breed (Table I). Faeces were also classified according to the consistency as diarrheic (24/100) and non diarrheic (76/100). A significant association was found between consistency of the faeces and presence of parasites, which were found more often (P<0.05) in diarrheic (50%) than in non-diarrheic (5.26%) samples (Table I). This survey reported for the first time Troglotrema salmincola infection in Iran. In direct smear and formalin-ether sedimentation methods, the eggs were light brown, ovoid, and operculate at one end, with a small blunt projection at the other end. They measure 0.087mm to 0.097mm by 0.038mm to 0.057mm (n=5). Most of the dogs (62%) considered in our study were regularly dewormed and parasites were found only in two of them (Table II, P<0.05). Several studies have been conducted on the general prevalence of Gastrointestinal parasites in dog population worldwide (6, 10, 19, 20, 21, 26, 28, 30, 38, 39). The prevalence values ranged from 7.14% to 89.15% depending on a number of factors, i.e. age, living conditions, diagnostic methodology employed, region studied and frequency of deworming treatment (23, 29, 3, 7, 27, 8, 19, 36, 17, 16, 6, 11, 1, 15, 10, 13). In this study, the overall proportion of Gastrointestinal parasitic infection (16%) was similar to the one found in 2009 in Iran (30) and in Ethiopia (3); it was twice higher than the proportion reported in a similar study carried out in Iran, but significantly lower than the one

Veterinaria Italiana 2013, 49 (3), 309-313. doi: 10.12834/VetIt.1209.01

Table II. Association between the prevalence of Gastrointestinal parasites and deworming in owned dogs.

found in stray dogs living in different regions of the world (1, 3, 6, 7, 8, 10, 11, 13, 14, 15, 16, 17, 19, 23, 27, 29, 36). These results can be explained because, in contrast to the dogs considered in this study, these surveys were carried out on stray dogs with no health control measure. In agreement with other comparable studies, single infection was the most common situation discovered in this survey (6, 18, 19, 35). Similarly, in this study, Toxocara canis was the most commonly identified canine helminth (6, 11, 32, 23). Many studies reported that Toxocara canis infections are more common and higher in male dogs (18, 19, 25, 32), hormonal factors and sex associated behaviours, such as roaming, being the factors potentially involved (20). Troglotrema salmincola infects various mammals including humans, dogs, cats, raccoons, foxes, and three species of birds on the Pacific coast of North America and Canada, and Eastern Siberia (4, 21). Troglotrema salmincola is also endemic in the farEastern part of Russia including Amur and Ussuri valleys of Khabarovsk territory and North Sakhalin (31). Therefore, the Kerman dog could become infected by eating fresh and raw meat. The absence of Giardia and Entamoeba positive samples may be due to the fact that only one sample was collected, while Bowman (5) and Decock (12) recommended to take samples on 2 or 3 successive days to detect this parasite. Based on the relatively high occurrence of Toxocara canis and Cryptosporidium spp. in dogs found in this study, treatment is needed in order to decrease the likelihood of environmental contamination, since this parasite represents a potential hazard to human and animal health. In conclusion, ascertaining the presence of parasites and identifying them is pivotal for any possible recommendations that could be put forward concerning deworming strategies for the dog population. Deworming recommendations should be based on the prevalence, epidemiology, life cycles, pathogenicity and zoonotic potential of these parasites (26). The main reasons for routine deworming of pet dogs are to reduce the

311

Gastrointestinal parasites in owned dogs of Kerman city, Iran

risk of infection in dogs and to prevent human infections. The majority of dog owners are aware of the potential risk to human health from canine parasites. Nonetheless, only one-third of the pet owners are aware of the risk of transmission to

Mirzaei et al.

humans (2). Although animals, such as dogs and cats, are usually considered as ‘members of the family’, it is important to keep in mind that they can harbour intestinal parasites that may infect their owners.

References 1. Anene B., Nnaji T. & Chime A. 1996. Intestinal parasitic infections of dogs in the Nsukka area of Enugu state, Nigeria. Prev Vet Med, 27(1-2), 89-94. 2. Asano K., Suzuki K., Matsumoto T., Sakai T. & Asano R. 2004. Prevalence of dogs with intestinal parasites in Tochigi, Japan in 1979, 1991 and 2002. Vet Parasitol, 120(3), 243-248. 3. Awoke E., Bogale B. & Chanie M. 2011. Intestinal Nematode Parasites of Dogs: Prevalence and Associated Risk Factors. Int J Anim Veter Adv, 3(5), 374-378. 4. Beaver P.C., Jung R.C., Cupp E.W. & Craig C.F. 1984. Clinical parasitology. Lea & Febiger Philadelphia, Pennsylvania, 686 p. 5. Bowman D.D. 1999. Georgis’ parasitology for veterinarians. WB Saunders, Philadelphia, Pennsylvania, 414 p. 6. Bridger K.E. & Whitney H. 2009. Gastrointestinal parasites in dogs from the Island of St. Pierre off the South coast of Newfoundland. Vet Parasitol, 162(1-2), 167-170. 7. Bugg R., Robertson I., Elliot A. & Thompson R. 1999. Gastrointestinal parasites of urban dogs in Perth, Western Australia. Vet J, 157(3), 295-301. 8. Coggins J. 1998. Effect of season, sex, and age on prevalence of parasitism in dogs from Southeastern Wisconsin. Journal of the Helminthological Society of Washington, 65(2), 219-224. 9. Dalimi A. & Mobedi I. 1992. Helminth parasites of carnivores in northern Iran. Ann Trop Med Parasitol, 86(4), 395-397. 10. Dalimi A., Sattari A. & Motamedi G. 2006. A study on intestinal helminthes of dogs, foxes and jackals in the western part of Iran. Vet Parasitol, 142(1-2), 129-133. 11. Daryani A., Sharif M., Amouei A. & Gholami S. 2009. Prevalence of Toxocara canis in stray dogs, northern Iran. Pak J Biol Sci, 12(14), 1031-1035. 12. Decock C., Cadiergues M., Larcher M., Vermot S. & Franc M. 2003. Comparison of two techniques for diagnosis of giardiasis in dogs. Parasite, 10(1), 69-72. 13. Eguía-Aguilar P., Cruz-Reyes A. & Martínez-Maya J. 2005. Ecological analysis and description of the intestinal helminths present in dogs in Mexico City. Vet Parasitol, 127(2), 139-146. 14. Eslami A. & Mohebali M. 1988. Parasitisme des chiens de bergers et implications en santé publique en Iran. Bull Soc Pathol Exot, 81(4), 94-96. 15. Eslami A., Ranjbar-Bahadori S., Meshgi B., Dehghan M. & Bokaie S. 2010. Helminth Infections of Stray Dogs

312

from Garmsar, Semnan Province, Central Iran. Iranian J Parasitol, 5(4), 37-41. 16. Fok E., Szatmari V., Busak K. & Rozgonyi F. 2001. Epidemiology: Prevalence of intestinal parasites in dogs in some urban and rural areas of Hungary. Vet Q, 23(2), 96-98. 17. Fontanarrosa M.F., Vezzani D., Basabe J. & Eiras D.F. 2006. An epidemiological study of gastrointestinal parasites of dogs from Southern Greater Buenos Aires (Argentina): age, gender, breed, mixed infections, and seasonal and spatial patterns. Vet Parasitol, 136(3-4), 283-295. 18. Gonzalez L.M., Montero E., Harrison L.J.S., Parkhouse R.M.E. & Garate T. 2000. Differential diagnosis of Taenia saginata and Taenia solium infection by PCR. J Clin Microbiol, 38(2), 737-744. 19. Hoskins J., Malone J. & Smith P. 1982. Prevalence of parasitism diagnosed by fecal examination in Louisiana dogs. Am J Vet Res, 43(6), 1106-1109. 20. Kirkpatrick C.E. 1988. Epizootiology of endoparasitic infections in pet dogs and cats presented to a veterinary teaching hospital. Vet Parasitol, 30(2), 113-124. 21. Lappin M.R. 2002. Pet ownership by immunocompromised people. Compend Contin Educ Pract Vet, 24(S), 16-25. 22. Millemann R.E. & Knapp S.E. 1970. Biology of Nanophyetus salmincola and “salmon poisoning” disease. Adv Parasitol, 8(1), 1-41. 23. Mirzaei M. 2012. Epidemiological survey of Cryptosporidium spp. in companion and stray dogs in Kerman, Iran. Vet Ital, 48(3), 291-296. 24. Mirzaei M. & Fooladi M. 2012. Prevalence of intestinal helminthes in owned dogs in Kerman city, Iran. Asian Pac J Trop Med, 5(9), 735-737. 25. Mundim M., Rosa L., Hortencio S., Faria E., Rodrigues R. & Cury M. 2007. Prevalence of Giardia duodenalis and Cryptosporidium spp. in dogs from different living conditions in Uberlândia, Brazil. Vet Parasitol, 144(3-4), 356-359. 26. Oliveira-Sequeira T., Amarante A., Ferrari T. & Nunes L. 2002. Prevalence of intestinal parasites in dogs from São Paulo State, Brazil. Vet Parasitol, 103(1-2), 19-27. 27. Pullola T., Vierimaa J., Saari S., Virtala A.M., Nikander S. & Sukura A. 2006. Canine intestinal helminths in Finland: prevalence, risk factors and endoparasite control practices. Vet Parasitol, 140(3-4), 321-326. 28. Ramírez-Barrios R.A., Barboza-Mena G., Muñoz J., Angulo-Cubillán F., Hernández E., González F. & Escalona F. 2004. Prevalence of intestinal parasites in

Veterinaria Italiana 2013, 49 (3), 309-313. doi: 10.12834/VetIt.1209.01

Mirzaei et al.

Gastrointestinal parasites in owned dogs of Kerman city, Iran

dogs under veterinary care in Maracaibo, Venezuela. Vet Parasitol, 121(1-2), 11-20.

special reference to Toxocara canis. J Helmint, 80(3), 299-304.

29. Ranjbar-Bahadori S., Lotfollahzadeh S., Vaezi G. & Eslami A. 2008. Epidemiological study of the human cystic echinococcosis in Iran. Res J Parasitol, 3(4), 130-136.

35. Soulsby E.J.L. 1986. Helminths, arthropods and protozoa of domesticated animals, 7 ed. Bailliere Tindall London, UK, 809 p.

30. Razmi G.R. 2009. Survey of Dogsâ&#x20AC;&#x2122; Parasites in Khorasan Razavi Province, Iran. Iranian J Parasitol, 4(4), 48-54.

36. Umar Y. 2009. Intestinal Helminthoses in Dogs in Kaduna Metropolis, Kaduna State, Nigeria. Iranian J Parasitol, 4(1), 34-39.

31. Robertson I., Irwin P., Lymbery A. & Thompson R. 2000. The role of companion animals in the emergence of parasitic zoonoses. Int J Parasitol, 30(12-13), 1369-1377. 32. Scrimgeour E., Smith H., Prentice M. & McGahy I. 1996. Toxocara control: Failure of dogâ&#x20AC;?owners to carry out regular deworming of their pets. Int J Environ Health Res, 6(1), 27-30. 33. Sen-Hai Y. & Mott K.E. 1994. Epidemiology and morbidity of food-borne intestinal trematode infections. Trop Dis Bull, 91, R125-R152. 34. Senlik B., Cirak V. & Karabacak A. 2006. Intestinal nematode infections in Turkish military dogs with

Veterinaria Italiana 2013, 49 (3), 309-313. doi: 10.12834/VetIt.1209.01

37. Visco R., Corwin R. & Selby L. 1977. Effect of age and sex on the prevalence of intestinal parasitism in dogs. J Am Vet Med Assoc, 170(8), 835-837. 38. Yagoob G. & Mashaei S.S. 2011. Prevalence of Gastrointestinal Helminthic Infestation in Pet and Stray Dogs in Tabriz (East-Azerbaijan Province), Iran. J Anim Vety Adv, 10(11), 1477-1479. 39. Zewdu E., Semahegn Y. & Mekibib B. 2011. Prevalence of helminth parasites of dogs and owners awareness about zoonotic parasites in Ambo town, central Ethiopia. Ethiopian Veterinary Journal, 14(2), 17-30.

313

RAPID COMMUNICATION New incursions of West Nile virus lineage 2 in Italy in 2013: the value of the entomological surveillance as early warning system Mattia Calzolari1, Federica Monaco2, Fabrizio Montarsi3, Paolo Bonilauri1, Silvia Ravagnan3, Romeo Bellini4, Giovanni Cattoli3, Paolo Cordioli1, Stefania Cazzin3, Chiara Pinoni2, Valeria Marini2, Silvano Natalini5, Maria Goffredo2, Paola Angelini5, Francesca Russo6, Michele Dottori1, Gioia Capelli3 & Giovanni Savini2* Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna ‘Bruno Ubertini’, Via Bianchi 7/9, 25124 Brescia, Italy 2 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy 3 Istituto Zooprofilattico Sperimentale delle Venezie, Viale dell’Università 10, 35020 Legnaro (PD), Italy 4 Centro Agricoltura Ambiente ‘G. Nicoli’ (CAA), Via Argini Nord 3351, 40014 Crevalcore (BO), Italy 5 DG Sanità e Politiche Sociali, Regione Emilia-Romagna, Viale Aldo Moro 21, 40127Bologna, Italy 6 Direzione Prevenzione, Regione Veneto, Dorsoduro 3493, 30123 Venezia, Italy 1

* Corresponding author at: National Reference Centre for the study of Exotic Animal Diseases, OIE Reference Laboratory for West Nile Disease, Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy. Tel.: +39 0861 332440, e-mail: g.savini@izs.it.

Veterinaria Italiana 2013, 49 (3), 315-319. doi: 10.12834/VetIt.1308.04

Accepted: 28.08.2013 | Available on line: 04.09.2013

Keywords Culex pipiens, Early warning system, Entomological surveillance system, Italy, West Nile virus lineage 2.

Summary West Nile virus (WNV) is one of the most serious public health threats that Europe and the Mediterranean countries are currently facing. In Italy, WNV emerged in 1998 and has been circulating since 2008. To tackle its continuous incursions, Italian national and regional institutions set up a surveillance program, which includes the serological screening of sentinel horses, sentinel-chickens and backyard poultry flocks and the surveillance on all equine neurological cases, resident captured and wild dead birds, and vectors. This communication aims to assess the importance of the entomological surveillance program as an early warning system for WNV circulation. In the province of Modena, the circulation of WNV lineage 2 strains was first detected in pools of Culex pipiens on July the 3rd, 42 days prior to the onset of the first 2013 human WNV neuroinvasive case reported in the same province. Similarly in Veneto, WNV was first detected on July 3rd in a pool of Cx. pipiens collected in the province of Venezia. The first human neuroinvasive case in this region occurred in the Rovigo province on July the 24th, seven days after the detection of WNV lineage 2 in a mosquito pool collected in the same province. Up to the end of July 2013, WNV circulation was further detected in several other pools of Cx. pipiens mosquitoes collected in Emilia-Romagna, Veneto and Lombardia. According to the NS3 partial sequence alignments including all recent European and Italian Lineage 2 strains, the new circulating WNV lineage 2 strains share high nt homology with the Hungarian and with the previous lineage 2 strains isolated in Veneto and Sardegna in 2011 and 2012. These data provide a clear and practical demonstration of the relevance of a reliable entomological surveillance program to early detect WNV in Italy.

315

Calzolari et al.

West Nile virus lineage 2 in Italy

L’importanza della sorveglianza entomologica nel rilevare precocemente la circolazione dei ceppi del virus della West Nile di linea genetica 2: l’esperienza italiana del 2013 Parole chiave Culex pipiens, Italia, Sistema di allerta rapido, Sorveglianza entomologica, Virus della West Nile linea genetica 2.

Riassunto Il virus della West Nile costituisce una delle emergenze sanitarie che attualmente minacciano la sanità pubblica europea e dei paesi del Mediterraneo. In Italia il virus è comparso per la prima volta nel 1998, è quindi riapparso nel 2008 e da allora non ha smesso di circolare. Per fronteggiare le continue incursioni virali, le Autorità nazionali e regionali hanno realizzato un piano di sorveglianza che implica l’utilizzo di polli e cavalli sentinella, l’esame di tutti i cavalli affetti da forme nervose, delle carcasse di uccelli selvatici e domestici recuperate nelle aree a rischio e dei vettori. Questa comunicazione vuole valutare l’importanza della sorveglianza entomologica come sistema di allerta rapido per rilevare la circolazione del virus della West Nile. Nel 2013, ceppi di WNV di linea genetica 2 sono stati rilevati per la prima volta in un pool di zanzare Culex pipiens catturate in provincia di Modena il 3 luglio, in anticipo di 42 giorni rispetto al primo caso umano della forma neuroinvasiva di West Nile riscontrato nella stessa provincia. Analogamente in Veneto, il virus è stato rilevato per la prima volta il 3 luglio 2013 in un pool di zanzare Cx. pipiens catturate in provincia di Venezia. In questa regione, il primo caso di encefalite umana da WNV è stato diagnosticato in provincia di Rovigo il 24 luglio, 7 giorni dopo il primo rilevamento del virus in un pool di zanzare Cx. pipiens catturate nella stessa provincia. Altre positività al WNV sono state rilevate in pool di zanzare Cx. pipiens prelevate in Lombardia, Emilia Romagna e Veneto. Il multiallineamento delle sequenze parziali del gene NS3 dei nuovi ceppi di WNV di linea genetica 2 rilevati in questo studio con quelli circolati di recente in Italia e in Europa, ha evidenziato un’elevata omologia tra i nuovi ceppi e quelli isolati in Ungheria nel 2004 e in Italia nel 2011 e 2012. Quanto riscontrato è una chiara dimostrazione dell’efficacia della sorveglianza entomologica come sistema di allerta rapido per il virus della West Nile.

West Nile virus (WNV) is today the most widespread arbovirus in the world and is one of the most serious public health threats that Europe and the Mediterranean countries are currently facing. WNV belongs to the family Flaviviridae of the genus Flavivirus. Serologically, it is included in the Japanese encephalitis group, while virologically it can be designated into 8 phylogenetic lineages (23). Only lineage 1 and 2 West Nile viruses have been associated with significant outbreaks in humans and horses, which act as incidental hosts in the natural enzootic bird-mosquito-bird cycle. Infections are usually subclinical and only part of them develops clinical signs as either West Nile fever (25%) or neuroinvasive disease (1%) (16). Before 1990s, human and horse cases were sporadic and mainly confined to Africa. Since the mid 1990s new viral strains, with likely African origin, invaded Western countries causing disease in humans, horses and birds. Large outbreaks of increased clinical severity have been reported in parts of Russia, Southern and Eastern Europe, Northern Africa and North and South America (12). Until 2010, strains of WNV lineage 1 were responsible for most of these outbreaks. After 2010, in a sort of baton passing, lineage 2 replaced lineage 1 strains as the major virus responsible for European WND outbreaks. Between 2011-2012, 1,276 human cases were recorded in

316

Europe, Russian Federation and Mediterranean basin (10). New human cases have been already reported in Greece, Macedonia, Russian Federation and Israel in 2013 (10). Two neuroinvasive cases have also been described in Italy where the WNV situation is quite complex due to the concurrent circulation of both lineages (17, 18). In Italy, WNV lineage 1 first appeared in 1998 (2). It then reappeared in the North-Eastern part of Italy in 2008 (5) where it became endemic (4, 11, 14). Unrelated new foci were also reported in Central and Southern Italy (6) and, more recently, lineage 2 strains were detected in Central (3) and Northern‑Eastern Italy as well as in Sardegna (8, 19, 20). Following the first outbreak of West Nile, the Italian government put in place a multi-species national surveillance program including birds, chicken, horses, mosquitoes, and humans. The aim of this program is to detect early incursions of new viruses and monitor the possible spread of infection. The national program includes the serological screening of sentinel horses, sentinel-chickens and backyard poultry flocks and the surveillance on all equine neurological cases, resident captured and wild dead birds, and vectors (13, 22). Ten high‑risk areas have been identified on the basis of the presence of significant numbers of waterfowl and species of migratory birds. The surveillance plan

Veterinaria Italiana 2013, 49 (3), 315-319. doi: 10.12834/VetIt.1308.04

Calzolari et al.

has been updated annually in line with changes in the WNV epidemiological situation. Besides the entomological activities supported by the Ministry of Health at national level, more comprehensive surveillance programs are also carried out at Regional level in WNV affected areas (1, 7, 15). The entomological surveillance is based on a range of collection sites placed either in at-risk areas or in areas with virus circulation and aims both at identifying possible WNV vector species and at determining their abundance and distribution. Mosquitoes were collected by attractive traps, grouped in pools (50 or 200 of specimens) according to species, data and sites of sampling and screened by biomolecular analysis for the presence of WNV (20). The purpose of this rapid communication is to emphasize the importance of having in place a functional entomological surveillance program to early detect the WNV circulation. The 2013 entomological plan started on May the 6th in Veneto and on June the 4th in Emilia-Romagna. By the end of July, 247,914 mosquitoes were classified and tested in Veneto, and 173,009 in Emilia-Romagna. Most of these mosquitoes (86.7%) were identified as Culex pipiens, the main vector of WNV in Italy. On July the 3rd, 42 days before the occurrence of the first 2013 human neuroinvasive case in the province

West Nile virus lineage 2 in Italy

of Modena (17), two Cx. pipiens mosquito pools were found positive to WNV lineage 2. The positive mosquitoes were from Finale Emilia (Modena province) and Jesolo (Venezia province). In contrast to the province of Modena, no human or horse cases have been reported in the Venezia province after the positive catch; in Veneto the first human neuroinvasive case occurred in the Rovigo province on July the 24th (18), seven days after a mosquito pool collected in the same province was first found positive to the WNV lineage 2. In the following weeks, the circulation of the virus was further detected in several other pools of Cx. pipiens mosquitoes collected in Emilia-Romagna and Veneto (Figure 1). Furthermore, WNV was also detected in a pool of mosquitoes sampled for experimental purposes in Lombardia region (Figure 1). The NS3 423-bp fragment of the detected WNVs were amplified by nested RT–PCR (9), purified and used for direct sequencing in both directions using internal primers as described previously (19). Raw sequence data were assembled and translated into amino-acid sequences (Vector NTI software, Life Technology, Grand Island, NY, USA). Consensus sequences were aligned with other WNV lineage 2 NS3 sequences by using ClustalW program (21). The included sequences were those detected in Hungary in 2004

Figure 1. Geographic location of the Culex pipiens pools found positive to West Nile virus lineage 2 by specific RT-PCR (last update: 31st of July 2013).

Veterinaria Italiana 2013, 49 (3), 315-319. doi: 10.12834/VetIt.1308.04

317

West Nile virus lineage 2 in Italy

(accession no. DQ116961), in Greece (accession no. HQ537483) and Italy (19) in 2010 and again in Italy in 2011 and 2012 (8, 19, 20). According to the partial NS3 sequence analyses, the 2013 North-Eastern strains share a high nt homology with the Hungarian and with the previous lineage 2 strains isolated in Veneto and Sardegna in 2011 and 2012, respectively (19, 20). Comparison of the deduced amino‑acid sequences highlights a complete homology between these strains. Compared to the Greek isolate and to the strain isolated in the province of Rovigo in 2012 (8), all the 2013 detected strains showed histidine instead of proline at position 249.

Calzolari et al.

These data provide a clear and practical demonstration of the relevance of a reliable entomological surveillance program to early detect WNV in Italy. The plan allowed for detecting WNV circulation much earlier than the occurrence of the human cases and provided important epidemiological information on the strains circulating in the surveyed area, which could infect humans. Having such a rapid health alarm system in place is of extreme value as it enables national and regional infrastructures to prevent/control infections as well as to be prepared to effectively face new infection waves.

References 1. Angelini P., Tamba M., Finarelli A.C., Bellini R., Albieri A., Bonilauri P., Cavrini F., Dottori M., Gaibani P., Martini E., Mattivi A., Pierro A.M., Rugna G., Sambri V., Squintani G. & Macini P. 2010. West Nile virus circulation in EmiliaRomagna, Italy: the integrated surveillance system 2009. Euro Surveill, 15(16), pii: 19547. 2. Autorino G.L., Battisti A., Deubel V., Ferrari G., Forletta R., Giovannini A., Lelli R., Murri S. & Scicluna M.T. 2002. West Nile virus epidemic in horses, Tuscany region, Italy. Emerg Infec Dis, 8, 1372-1378. 3. Bagnarelli P., Marinelli K., Trotta D., Monachetti A., Tavio M., Del Gobbo R., Capobianchi M., Menzo S., Nicoletti L., Magurano F. & Varaldo P. 2011. Human case of autochthonous West Nile virus lineage 2 infection in Italy, September. Euro Surveill, 16(43), pii: 20002. 4. Busani L., Capelli G., Cecchinato M., Lorenzetto M., Savini G., Terregino C., Vio P., Bonfanti L., Pozza M.D. & Marangon S. 2011. West Nile virus circulation in Veneto region in 2008-2009. Epidemiol Infect, 139(6), 818-825.

10. European Centre for Disease Prevention and Control (ECDC). 2013. www.ecdc.europa.eu (accessed on 01/08/2013). 11. Gobbi F., Barzon L., Capelli G., Angheben A., Pacenti M., Napoletano G., Piovesan C., Montarsi F., Martini S., Rigoli R., Cattelan A.M., Rinaldi R., Conforto M., Russo F., Palù G. & Bisoffi Z. 2012. Veneto Summer Fever Study Group. Surveillance for West Nile, dengue, and chikungunya virus infections, Veneto Region, Italy, 2010. Emerg Infect Dis, 18(4), 671-673. 12. May F.J., Davis C.T., Tesh R.B. & Barrett A.D., 2011. Phylogeography of West Nile virus. J Virol, 85(6), 2964-2974. 13. Monaco F., Lelli R., Teodori L., Pinoni C., Di Gennaro A., Polci A., Calistri P. & Savini G. 2010. Re-emergence of West Nile virus in Italy. Zoonoses Public Health, 57(7-8), 476-486.

5. Calistri P., Giovannini A., Savini G., Monaco F., Bonfanti L., Ceolin C., Terregino C., Tamba M., Cordioli P. & Lelli R. 2010. West Nile virus transmission in 2008 in NorthEastern Italy. Zoonoses Public Health, 57(3), 211-219.

14. Monaco F., Savini G., Calistri P., Polci A., Pinoni C., Bruno R. & Lelli R., 2011. 2009 West Nile disease epidemic in Italy: first evidence of overwintering in Western Europe? Res Vet Sci, 91(2), 321-326.

6. Calistri P., Monaco F., Savini G., Guercio A., Purpari G., Vicari D., Cascio S. & Lelli R. 2010. Further spread of West Nile virus in Italy. Vet Ital, 46(4), 467-474.

15. Mulatti P., Bonfanti L., Capelli G., Capello K., Lorenzetto M., Terregino C., Monaco F., Ferri G. & Marangon S. 2013. West Nile Virus in North-Eastern Italy, 2011: Entomological and Equine IgM-Based Surveillance to Detect Active Virus Circulation. Zoonoses Public Health, 60(5), 375-382.

7. Calzolari M., Bonilauri P., Bellini R., Albieri A., Defilippo F., Tamba M., Tassinari M., Gelati A., Cordioli P., Angelini P. & Dottori M. 2013. Usutu virus persistence and West Nile virus inactivity in the Emilia-Romagna region (Italy) in 2011. PLoS One, 8(5), e63978. 8. Capelli G., Ravagnan S., Montarsi F., Ciocchetta S., Cazzin S., Bonfanti L., Di Gennaro A., Portanti O., Mulatti P., Monne I., Cattoli G., Cester G., Russo F., Savini G. & Marangon S. 2013. Further evidence of lineage 2 West Nile Virus in Culex pipiens of North-Eastern Italy. Vet Ital, [Ahead of print] doi: 10.12834/VetIt.1304.02. http://www.izs.it/vet_italiana/pdf/VetIt_1304_02.pdf. 9. Chaskopoulou A., Dovas C., Chaintoutis S., Bouzalas I., Ara G. & Papanastassopoulou M. 2011. Evidence of

318

enzootic circulation of West Nile virus (Nea SantaGreece-2010, lineage 2), Greece, May to July 2011. Euro Surveill, 16(31), pii: 19933.

16. Petersen L.R., Carson P.J., Biggerstaff B.J., Custer B., Borchardt S.M. & Busch M.P., 2012. Estimated cumulative incidence of West Nile virus infection in US adults, 1999-2010. Epidemiol Infect, 141(3), 591-595. 17. Regione Emilia Romagna. 2013. PG/2013/202287 del 14 agosto. Nuove evidenze di circolazione del virus West Nile in Emilia Romagna, aggiornamento delle note del PG/2013/191065 del 30 luglio e del PG/2013/198147 dell’8 agosto u.s. recante indicazioni per la sorveglianza ed il controllo del virus della West Nile. http://www.saluter.it/documentazione/leggi/

Veterinaria Italiana 2013, 49 (3), 315-319. doi: 10.12834/VetIt.1308.04

Calzolari et al.

West Nile virus lineage 2 in Italy

regionali/comunicazioni/Nota%20Comuni%20e%20 Ausl%2014%20agosto%202013.pdf.

Infect, 24(1-4). [Epubahead of print] doi:10.1017/ S0950268812003147.

18. Regione Veneto. 2013. West Nile. Comunicato Stampa. http://www.regione.veneto.it/web/sanita/dalla-a-allaz-dettaglio1?_spp_detailId=2548293.

21. Thompson J.D., Higgins D.G. & Gibson T.J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res, 22(22), 4673-4680.

19. Savini G., Capelli G., Monaco F., Polci A., Russo F., Di Gennaro A., Marini V., Teodori L., Montarsi F., Pinoni C., Pisciella M., Terregino C., Marangon S., Capua I. & Lelli R. 2012. Evidence of West Nile virus lineage 2 circulation in Northern Italy. Vet Microbiol, 158(3-4), 267-273. 20. Savini G., Puggioni G., Di Gennaro A., Di Francesco G., Rocchigiani A.M., Polci A., Marini V., Pinoni C., Rolesu S., Marruchella G., Lorusso A. & Monaco F. 2013. West Nile virus lineage 2 in Sardinian wild birds in 2012: a further threat to public health. Epidemiol

Veterinaria Italiana 2013, 49 (3), 315-319. doi: 10.12834/VetIt.1308.04

22. Toma L., Cipriani M., Goffredo M., Romi R. & Lelli R. 2008. First report on entomological field activities for the surveillance of West Nile disease in Italy. Vet Ital, 44(3), 499-512. 23. Vazquez A., Sanchez-Seco M.P., Ruiz S., Molero F., Hernandez L., Moreno J., Magallanes A., Tejedor C.G. & Tenorio A. 2010. Putative new lineage of West Nile virus, Spain. Emerg Infect Dis, 16(3), 549-552.

319

a cura di Manuel Graziani

LIBRI/Book reviews

(a cura di) Magda Gerou-Ferriani

Manuale di ematologia veterinaria e medicina trasfusionale (Edizioni Veterinarie, pp. 156, € 60,00) http://cms.evsrl.it

Il volume curato dalla dott.ssa Magda Gerou-Ferriani dell’Ospedale veterinario “Portoni Rossi” di Bologna e dell’Università di Liverpool viene presentato come il primo manuale di ematologia veterinaria italiano. Un volume realizzato per essere utilizzato dagli studenti e dai veterinari nella pratica quotidiana. Da qui deriva la scelta della sua struttura organizzata per capitoli autonomi in modo che il lettore possa consultare le tematiche di proprio interesse indipendentemente dal resto. I primi due capitoli del manuale sono dedicati alle nozioni di base e forniscono informazioni concrete per ciò che riguarda i prelievi del sangue nella pratica veterinaria, l’allestimento e la corretta lettura del vetrino e tutto quanto è necessario sapere sulle trasfusioni. Nel terzo capitolo viene illustrata nel dettaglio l’interpretazione dell’eritrogramma, del leucogramma e del siderogramma. A seguire, nei capitoli 4 e 5, vengono trattate le patologie più spesso riscontrate dei globuli rossi, dei globuli bianchi e delle piastrine. Il sesto capitolo è dedicato alla coagulazione, un argomento spesso difficile da comprendere e da applicare, vengono illustrati i vari test, quando e come eseguirli ed interpretarli. Il manuale si conclude con un capitolo dedicato all’interpretazione dell’esame del midollo e con l’ultimo capitolo che contiene esempi pratici di casi clinici. Manuale di ematologia veterinaria e medicina trasfusionale è un testo pratico, di facile consultazione, ben curato sia sotto l’aspetto della presentazione dei contenuti che sotto l’aspetto editoriale: dal grande formato A4, alla copertina rigida. Alla curatrice Magda Gerou-Ferriani sono affiancati come autori Erika Carli, Stefano Comazzi, Silvia Tasca e Andrea Zoia, tutti medici veterinari.

321

a cura di Manuel Graziani

LIBRI/Book reviews

Adolf Portmann

La forma degli animali (Raffaello Cortina, pp. 254, € 24,00) www.raffaellocortina.it

Nel 1931 il biologo Adolf Portmann era già talmente noto a livello internazionale per le sue ricerche da guadagnarsi la cattedra in zoologia nell’università della sua città natale, Basilea, all’età di appena 34 anni. All’attività di docente universitario ha sempre affiancato un’originale riflessione sul significato delle scienze della vita, imponendosi come una delle figure chiave nel dibattito tra biologia teoretica, estetica e antropologia filosofica. La forma degli animali, la sua opera più celebre, si pone al confine tra varie discipline e conserva un grande interesse ancora oggi che il dialogo tra estetica e biologia si è fatto nuovamente intenso. Pubblicata nel 1948 e in forma ampliata nel 1960 (da cui deriva questa prima edizione italiana a cura di Pietro Conte) l’opera rappresenta il frutto più maturo delle sue ricerche “interdisciplinari”. Un saggio che nasce dall’insoddisfazione nei confronti dei paradigmi scientifici consolidati e che ripropone l’idea morfologica in biologia sulla scorta del pensiero di J. W. Goethe il quale affermava che “tutto ciò che è deve anche dar cenno di sé e mostrarsi”. Adolf Portmann è un convinto sostenitore che dalla forma si possano dedurne le complessive caratteristiche interne ed esterne degli animali. Secondo questa prospettiva la peculiare fisionomia dell’organismo dipende dalla congiunzione delle sue parti e dalle loro reciproche funzioni. Tuttavia l’autore non vede nello studio della forma l’alternativa al funzionalismo quanto, piuttosto, il suo necessario bilanciamento come dichiara nell’introduzione: “… per giungere alla conoscenza della vita animale di strade ce ne sono molte, e tutte possono contribuire ad arricchire la nostra esperienza. Questo lavoro si occupa della forma degli animali e si propone di mettere in luce la peculiare natura dell’aspetto visibile. Ci sono persone che si dedicano allo studio degli animali, conoscono moltissime specie, hanno imparato centinaia di nomi e sono riuscite ad acquisire una conoscenza dettagliata della struttura interna di organi e tessuti, e tuttavia sanno poco o nulla dell’aspetto visibile e giudicano solo sulla base dell’utilità e degli adattamenti più elementari, perdendo di vista la caratteristica specifica che distingue una forma dall’altra”.

323