Journal of Osseointegration

JO J O U R N A L O F OSSEOINTEGRATION

ISSN 2036-4121 OCTOBER 2014 N. 3 VOL. 6 www.journalofosseointegration.eu

G. Mendoza1, J.D. Reyes2, M.E. Guerrero1, M. de la Rosa-G3, L. Chambrone4 1

Department of Periodontology, School of Dentistry, Cientifica del Sur University, Lima, Peru Department of Periodontology, San Martin de Porres University, Lima, Peru 3 Department of Periodontology, University of Monterrey, Monterrey, Mexico 4 Private practice, São Paulo, SP, Brazil 2

Influence of keratinized tissue on spontaneous exposure of submerged implants: classification and clinical observations to cite this article Mendoza G, Reyes JD, Guerrero ME, De La Rosa-G M, Chambrone L. Influence of keratinized tissue on spontaneous exposure of submerged implants: classification and clinical observations. J Osseointegr 2014;6(3):47-50.

ABSTRACT Aim The reasons for spontaneous early exposure (SEE) of dental implants during healing have not been established yet.

The objective of this study was to assess whether the width of keratinized tissue (KT) and other site-related conditions could be associated with implants’ SEE. Materials and methods Data from 500 implants placed in 138 non-smoking patients, between September 2009 and June 2010, were evaluated. Implants were submerged and allowed to heal for 3 to 6 months. At baseline, the following conditions were documented: the presence of keratinized tissue width > 2 mm; the type of implant site (i.e. fresh extraction socket or edentulous alveolar ridge); concomitant use of guided tissue regeneration. During the healing period, the occurrence of partial or total implants SEE was recorded; thus, a mixed-effects logistic regression analysis was performed to investigate the association between implant site conditions and implant exposure.

Results One hundred and eighty-five implants (37.0%) remained submerged after healing and were classified as Class I, whereas 215 (43.0%) showed partial spontaneous early exposure (SEE) at the first week after implant placement (Class II), and 100 implants (20.0%) developed more extensive exposures (Class III). The variables, baseline width of KT (p = 0.18), fresh extraction socket (p = 0.88) and guided tissue regeneration (GTR) plus bone substitutes (p = 0.42), were not found to be correlated with implants` SEE, with an odds ratio (OR) of 1.29 (95% confidence interval: -0.12–0.63), 1.03 (95% confidence interval: -0.46–0.53) and 1.22 (95% confidence interval: -0.29–0.68), respectively.

Conclusion It was not possible to establish an association between SEE and some implant-related factors; therefore, further investigations focused on the reasons associated to implants’ SEE are needed.

October 2014; 6(3) © ariesdue

Keywords Dental implants; Guided tissue regeneration; Implants exposure classification; Keratinized tissue width.

INTRODUCTION Osseointegration is defined as the achievement of a direct bone deposition on dental implant surfaces at the light microscopic level (1). Due to their biocompatible nature, titanium dental implants have been used as a feasible option in the treatment of completely or partially edentulous patients (1, 2). It has been demonstrated that the installation of dental implants may be performed according to one-stage or twostage protocols (1-6). With respect to the latter, the placement is performed according to the manufacturer’s recommendations in order to allow healing (i.e. osseointegration of the implant) in a submerged manner. However, spontaneous early exposure (SEE) of implants during the osseointegration phase may occur (7). Such an unexpected outcome is not desirable, as the patients may not be able to perform an adequate hygiene of the implant site. Partial implants’ SEE can create a focus for dental biofilm accumulation, leading to an inflammatory response of the tissues (7). It is well established that the formation of biofilm and the succeeding growth and metabolism of bacteria on the peri-implant sulcus are the key triggers for the initiation of inflammatory lesions in the adjacent mucosa (8-10), as well as peri-implant infection, marginal bone loss, and loss of osseointegration (11-13).

It has been suggested that the presence of a width of keratinized tissue (KT) > 2 mm may allow improved gingival health when the implants are installed (14,15).

Moreover, it should be considered that when KT is present in the area where a dental implant is placed, it could help protecting the implant from masticatory trauma, infections and peri-implant bone loss during

47

Mendoza G. et al.

healing (7,15). Thus, the objective of this study was to assess the influence of predictive factors, like the width of KT, and other site related conditions, such as implant placement in a fresh extraction socket and guided tissue regeneration plus bone substitutes, on implants’ SEE.

MATERIAL AND METHODS Study population

The dental records of 138 (287 male and 213 female) healthy, non-smoking patients (30 to 60 years) who attended the dental implants clinic of the university (San Martin de Porres University, Lima, Peru) between September 2009 and June 2010 were reviewed. These subjects were selected among patients who were referred for treatment at the university and had received at least one dental implant (range 1 to 11). The areas selected for implant treatment were fresh extraction sockets or edentulous alveolar ridges. All patients who met these criteria were included. Patients with a history of repeated abscess formation, a known systemic disease (e.g., acquired immunodeficiency syndrome, uncontrolled diabetes mellitus, or other established medical risk factors for periodontal disease), or poor hygiene levels were not included in the study. The study protocol was approved by the San Martin de Porres University (Lima, Peru) Ethics on Research Board, in accordance with the Helsinki Declaration of 1975, as revised in 2000, and all subjects signed an informed consent form.

submerged implant to the mucogingival junction) was recorded by two examiners (G.M. and J.D.R.) using a PC-UNC 15 style periodontal probe (intra-class correlation within and between examiners > 0.90). The measurements were rounded to the nearest 0.5 mm.

After implants installation, the following characteristics were also recorded: 1) type of implant site (i.e. fresh extraction socket or edentulous alveolar ridge); 2) concomitant use of guided tissue regeneration associated with bone substitutes (i.e. xenografts); 3) occurrence of partial or total implants’ SEE during the healing period (from implants’ installation to sutures removal).

Classification of SEE

Spontaneous exposure of implants during the healing period was classified into the following three categories: › Class I, implants remained covered until the second stage surgery (Fig. 1); › Class II, implants were partially exposed, independently to the degree of partial exposure of the cover screw, to the oral environment before the second stage surgery (Fig. 2); › Class III, implants were completely exposed and a second stage surgical procedure for the placement of the healing screw was not necessary (Fig. 3).

Implants placement

A total of 500 external hex dental implants (Restore® Lifecore Biomedical, Chasca, USA), after a healing period of 3 to 6 months, were evaluated. Following initial examination, maxillary and mandibular casts were obtained and temporary removable partial dentures (e.g. flippers) were fabricated. All patients received detailed information about the planned treatment and underwent oral hygiene instruction; moreover, full-mouth supragingival prophylaxis and/or subgingival scaling of natural teeth were indicated. Following these procedures, patients underwent implants placement following the manufacturer’s recommendation (i.e. placed at the level of the crestal bone), and osseointegration was allowed in a submerged manner for three (mandible) or six months (maxilla). Fresh extraction sites were completely covered by coronally advanced flaps, as well as bone grafts were used when the distance between the socket walls and the implant surface was > 2 mm. Additionally, after sutures removal (eight days after surgery) temporary removable partial dentures were delivered and adequately fitted to protect the implant sites.

Outcome measures

Immediately, after implant placement, the width of keratinized tissue (as the distance from the top of the

48

fig. 1 Class I (implant not exposed).

fig. 2 Class II (includes different degrees of partial exposure).

fig. 3 Class III (implant completely exposed).

© ariesdue October 2014; 6(3)

Spontaneous implant exposure

Fresh extraction socket

OR 1.03

SE 0.25

z 0.14

P>|z| 0.88

95% CI -0.46 0.53

Guided tissue regeneration

1.22

0.25

0.79

0.42

-0.29

0.68

Baseline Keratinized tissue

1.29

0.19

1.33

0.18

-0.12

0.63

Statistical analysis

The number and percentages of implants classified according to the different classes were used to synthesize collected data. A mixed-model logistic regression analysis was performed to investigate the association between baseline width of KT, as well as the type of implant site (i.e. alveolar ridge or fresh extraction socket) and the use of GTR plus bone substitutes, with implants` SEE. Thus, such a version of logistic regression was chosen to appropriately account for clustered data. The binary dependent variable was the occurrence of partial or total implant exposure during osseointegration, in order to assess potential factors that might identify the implant sites that were more likely to experience SEE. The Estimated MixedEffects Logistic Regression Model was based on the following formula: Model For Implant_exposure = N [-.213884315408148 + 3.69797024563258E02*(fresh_ extraction_socket=”Y”)+199304493013437* (guid ed_tissue_regeneration=”Y”)254808035344482*(initi al_keratinized_tissue_width=”Y”)]. Moreover, an odds ratio (OR) with a 95% confidence limit was calculated.

A significance level for rejection of the null hypotheses was set at a= 0.05. The analysis was performed using a software package (NCSS 2007, Number Cruncher Statistical System, Kaysville, UT, USA).

RESULTS Of the 500 implants included in the study, 185 (37.0%) remained unexposed at the end of the healing period, and were classified as Class I, 215 (43.0%) presented partial SEE (Class II) and 100 (20.0%) showed complete SEE (Class III). In a follow- up of 3 years only 3 implants were lost; thus, the implant survival rate was 99.4%.

The results of the logistic regression analysis are shown in Table 1. The variables were not found to be correlated with implants` SEE, with an odds ratio (OR) of 1.29 (95% confidence interval [CI]: -0.12–0.63) for baseline width of KT (p = 0.18), 1.03 (95% CI: -0.46–0.53) for fresh extraction socket (p = 0.88) and 1.22 (95% CI: -0.29– 0.68) GTR plus bone substitutes (p = 0.42).

DISCUSSION In this case series, almost half of the inserted dental implants (63.0%) showed partial SEE during the healing

October 2014; 6(3) © ariesdue

tabLE 1 Multivariable mixed-effects logistic regression analysis estimating the association between implant exposure and implant site characteristics.

OR: odds ratio CI: confidence interval S.E= standard Error, Z= value calculated by logistic regression model

period. This is in line with a study conducted by Tal (7) in 1999, who identified possible potential risk factors associated with implants` SEE. In the present study, the influence of site-based independent variables (i.e. width of KT, type of implant site and use of GTR plus bone substitutes) was estimated with logistic regression analysis, but none of them showed statistically significant correlation (p > 0.05).

With respect to the high rate of SEE reported in the present study, it could be argued that such an outcome could be linked to some factors, such as the quality of the suture, flap tension and use of releasing flaps to cover implants. The natural contraction of the flap during healing should be taken into consideration (1618). Also, it is well established that successful tissue flap coverage includes lack of flap tension, as well as complete approximation of wound margins for the correct establishment of an adequate blood supply in order to maintain wound closure and allow primary wound healing (16-18).

Submerged implants protocols assume that implants have to remain covered during osseointegration.

Functional difficulties as well as loss of coronal bone support, when implants are exposed in the initial healing period, have been described (7), and, in addition, it was demonstrated that implants that remained covered or totally exposed during the healing process undergo less bone loss. As this correlation has not been studied before and correct clinical decisions during the healing process could prevent inflammation and plaque accumulation, the present study proposes a new classification to help the clinician to choose the best option. It is important to highlight that another important clinical aspect for peri-implant soft tissue integration is the amount of KT (14,15). From a clinical point of view, implants placed in areas of KT width < 2 mm and with a “thinner periodontal biotype” may experience greater SEE. In this study, the logistic regression analysis failed to support the first assumption. In contrast, Bouri et al.

(19) reported association between narrow zones of KT and alveolar bone loss around dental implants. Similarly, Crespi et al. (20) reported that in their study narrow zones of KT are less resistant to inflammation and may stimulate apical migration of gingival tissues, inducing marginal recessions.

Even tough, the use of osseointegrated dental implants has become a gold standard procedure for the replacement of teeth lost by for several reasons (21), dental plaque formation and the subsequent

49

Mendoza G. et al.

accumulation and metabolism of bacteria on these surfaces is the main trigger for the induction of inflammatory lesions in the adjacent mucosa (8, 13, 22). Therefore, it is also worthwhile to highlight the importance of post surgical plaque control and regular follow up during the healing period (9, 13). Quite often patients with SEE do not follow a regular follow up and show an inadequate dental biofilm control, when they come back for the surgical re-opening of implants. Thus, these factors may have contributed to SEE, as well.

Furthermore, if an implant is partially exposed, it should be fully exposed to avoid biofilm accumulation. Given the case series study design limitations, the results of this study are not externally valid. Also, other implantrelated sites, that were not included in the statistical model of this retrospective assessment, should have been taken into consideration, such as the presence of teeth adjacent to the implant sites and measurements on the depth (thickness) of the keratinized tissue. For instance, single implant sites with intact teeth on either side would undergo less trauma than multiple implants without the protection of nearby teeth. With respect to the KT thickness, this might be more important than the width, since it seems logical that thick tissues would resist to SEE better than thin periodontal biotype tissue.

However, both conditions were not recorded at the time of implants’ placement.

Additionally, it could be argued that the present findings may be considered of low clinical significance, given that modern procedures in implant dentistry are mainly based on non-submerged approaches. Despite the absence of strong associations between absence/ presence of keratinized mucosa and peri-implant health, it is recommended to maximize efforts to preserve existing keratinized mucosa during the treatment procedures. There is a lack of evidence supporting the concept that grafting procedures aiming at increasing the amount of keratinized mucosa improve outcomes of implant therapy.

CONCLUSION Within the limitations of this case series study, it can be concluded that implants` SEE is a common outcome during the period of osseointegration of two-stage implant approaches; however, a direct association with precise risk factors could not be established, thus, further researches are needed on this field.

50

REFERENCES 1. Bränemark P-I, Adell R, Breine U, Hansonn BO, Lindstrom J, Ohlsson A. Intra-osseous anchorage of dental prostheses. I. Experimental studies. Scand J Plast Reconstr Surg 1969; 3:81-100.

2. Schenk RK, Buser D. Osseointegration: a reality. Periodontol 2000 1998; 17:22–35.

3. Adell R, Lekholm U, Rockler B, Brånemark P-I. A 15 year study of osseointegrated implants in the treatment of the edentulous jaw. Int J Oral Surg 1981; 10:387–396.

4. Adell R, Eriksson B, Lekholm U, Brånemark PI, Jemt T. Long-term follow-up study of osseointegrated implants in the treatment of totally edentulous jaws. Int J Oral Maxillofac Implants 1990; 5:347–359.

5. Buser D, Mericske-Stern R, Bernard JP, Behneke A, Behneke N, Hirt HP, et al. Longterm evaluation of non-submerged ITI implants. Part 1: 8-year life table analysis of a prospective multi-center study with 2,359 implants. Clin Oral Implants Res 1997; 8:161–172.

6. Buser D, von Arx T, ten Bruggenkate C, Weingart D. Basic surgical principles with ITI implants. Clin Oral Implants Res. 2000;11(Suppl 1):59-68 7. Tal H. Spontaneus early exposure of submerged implants: I Classification and clinical observations. J Periodontol 1999; 70:213-219.

8. Abrahamsson I, Berglundh T, Lindhe J. Soft tissue response to plaque formation at different implant systems. A comparative study in the dog. Clin Oral Implants Res 1998;9:73-79.

9. Amarante ES, Chambrone L, Lotufo RF, Lima LA. Early dental plaque formation on toothbrushed titanium implant surfaces. Am J Dent 2008;21:318-322.

10. Ericsson I, Berglundh T, Marinello C, Liljenberg B, Lindhe J. Long-standing plaque and gingivitis at implants and teeth in the dog. Clin Oral Implants Res 1992;3:99-103.

11. Lang NP, Wilson TG, Corbet EF. Biological complications with dental implants: Their prevention, diagnosis and treatment. Clin Oral Implants Res 2000;11(Suppl. 1):146-155.

12. Lindhe J, Berglundh T, Ericsson I, Liljenberg B, Marinello C. Experimental breakdown of peri-implant and periodontal tissues. A study in the beagle dog. Clin Oral Implants Res 1992; 3:9-16.

13. Tonetti MS, Schmid J. Pathogenesis of implant failures. Periodontol 2000 1994;4:127138.

14. Schrott AR, Jimenez M, Hwang JW, Fiorellini J, Weber HP. Five-year evaluation of the influence of keratinized mucosa on peri-implant soft-tissue health and stability around implants supporting full-arch mandibular fixed prostheses. Clin Oral Implants Res 2009 20: 1170-1177.

15. Chung DM, Oh TJ, Shotwell JL, Misch CE, Wang HL. Significance of keratinized mucosa in maintenance of dental implants with different surfaces. J Periodontol 2006; 77:14101420.

16. Burkhardt R, Lang NP. Role of flap tension in primary wound closure of mucoperiosteal flaps: a prospective cohort study. Clin Oral Implants Res 2010; 21:50-54.

17. Buser D, Chen ST, Weber HP, Belser UC.Early implant placement following singletooth extraction in the esthetic zone: biologic rationale and surgical procedures. Int J Periodontics Restorative Dent 2008; 28: 441-451.

18. Lang NP, Tonetti MS, Suvan JE, Pierre Bernard J, Botticelli D, Fourmousis I, Hallund M, Jung R, Laurell L, Salvi GE, Shafer D, Weber HP; European Research Group on Periodontology.Immediate implant placement with transmucosal healing in areas of aesthetic priority. A multicentre randomized-controlled clinical trial I. Surgical outcomes. Clin Oral Implants Res 2007; 18: 188-196.

19. Bouri A, Jr, Bissada N, Al-Zahrani MS, Faddoul F, Nouneh I. Width of keratinized gingiva and the health status of the supporting tissues around dental implants. Int J Oral Maxillofac Implants 2008;23:323-326.

20. Crespi R, Cappare P & Gherlone E. A 4-Year Evaluation of the Peri-Implant Parameters of Immediately Loaded Implants Placed in Fresh Extraction Sockets. J Periodontol 2010: 81:1629-1634.

21. Novaes Jr. AB, Muglia VA, ramos, Ud, reino dM, Ayub lG. Immediate implants in extraction sockets with periapical lesions: an illustrated review. J osseointegr 2013;5(3):45-52.

22. Scarano a, Tripodi d, Carinci F, Piccolomini r, d’ercole s. Biofilm formation on titanium alloy and anatase-Bactercline® coated titanium healing screws: an in vivo human study.

J osseointegr 2013;5(1):8-12.

© ariesdue October 2014; 6(3)

M. González-Jaranay1, G. Moreu-Burgos1, G. Gómez-Moreno2, J. Rubio-Roldán3, G. Machuca-Portillo4, V. Perrotti5, A. Boquete-Castro6, J. L. Calvo-Guirado7 1

Director of Master in Periodontics and Implantology, Faculty of Dentistry, University of Granada, Granada, Spain Director of Master in Periodontics and Implantology, Senior Lecturer of Special Care in Dentistry,Director of Pharmacological Research in Dentistry Group, Faculty of Dentistry, University of Granada, Granada, Spain 3 Professor of Master in Periodontics and Implantology, Faculty of Dentistry, University of Granada, Granada, Spain 4 Senior Lecturer of Special Care in Dentistry and Periodontics, Faculty of Dentistry, University of Sevilla, Sevilla, Spain 5 Department of Dentistry and Oral Science, Dental School, University of Chieti-Pescara, Chieti, Italy 6 Department of Special Care Patients, Faculty of Dentistry, University of Granada, Granada, Spain 7 Senior Lecturer of General and Implant Dentistry. Director of Master in Implantology and Biomaterials, Faculty of Medicine and Dentistry, University of Murcia, Murcia, Spain 2

Changes in resonance frequency analysis assessed

by Osstell mentor during osseointegration: comparison between immediately loaded implants and control implants without load to cite this article González-Jaranay M, Moreu-Burgos G, Gómez-Moreno G, Rubio-Roldán J, Machuca-Portillo G, Perrotti V, Boquete-Castro A, Calvo-Guirado JL. Changes in resonance frequency analysis assessed by Osstell mentor during osseointegration: comparison between immediately loaded implants and control implants without load. J Osseointegr 2014;6(3):51-5.

Keywords Dental implants; Immediate loading, ISQ, RFA.

INTRODUCTION ABSTRACT Aim The aim of this prospective clinical study was to evaluate the changes in resonance frequency analysis (RFA), assessed

by Osstell Mentor, obtaining information on the implant stability quotient (ISQ) during implants tissue integration for immediately loaded and non-loaded control implants.

Materials and methods A total of 40 implants, 20 implants with no immediate loading (control) and 20 immediately loaded implants (test), were placed in 15 patients. ISQ implants was evaluated at baseline and at 6 and 8 weeks. Provisional crowns were removed at 8 weeks, when the definitive restoration was placed. Data of control and test implants and maxillary and mandibular areas were statistically compared.

Results At 8 weeks, all implants were integrated and there were no major postoperative complications. A statistically significant difference was found only at baseline between test and control maxillary implants (p=0.009) but not at 6 or 8 weeks (p>0.05).

Conclusion Immediate loading procedures may be applied with primary stability ISQ values >60 and inserted with a force of ≥30 N. The Osstell Mentor RFA may offer an objective method to determine when implant stability is adequate for immediate loading.

October 2014; 6(3) © ariesdue

Single-stage surgery with immediate loading has proven to be a predictable procedure to restore edentulous areas (1-3). However, although widely reported in the mandible, there are few studies on its effectiveness in the maxilla (molars and premolars) (4), where this approach has been contraindicated under certain circumstances (5). Innovations in implant design, such as the development of new surfaces, have facilitated immediate loading. Experimental studies have demonstrated that implants with modified surfaces (sandblasted, large grit, acid etched) have greater bone-implant contact and resistance to lateral forces in comparison to those with machined surfaces (6, 7). The indication for immediate loading generally depends on the subjective evaluation of the primary stability of the implant and its changes over time.

The assessment of primary stability is frequently based on the resistance offered by tissues or on the torsion force required for the implant insertion, while any variations have conventionally been evaluated by percussion test with mirror handle or by counterclockwise torsion test (8). Resonance frequency analysis (RFA) has been proposed as a non-invasive and non-destructive means to measure implant integration and detect stability changes over time (9). This approach has been used to determine changes in the bone-implant interface

51

González-Jaranay M. et al.

and to assess the relationship with surrounding tissues (10, 11). It has also been applied to determine whether implants are sufficiently stable for the final restoration (12) and to identify “risk implants” (13). Two RFA systems are currently available: an electrical device in direct contact with the smart peg and a magnetic one that takes measurements at a distance of a few millimeters.

Osstell Mentor (Osstell AB, Göteborg, Sweden) fourth generation magnetic models formed by a transducer and a smart peg with a magnet in the part screwed into the implant. The magnet is activated for 1 ms by a magnetic pulse from the transducer, producing free vibration of the smart peg and the consequent induction of a voltage in the transducer that represents the RFA measurement signal. The values obtained are quantified in implant stability quotients (ISQs), and the clinical significance of scores is defined by the manufacturer as follows: ISQ value <60, high risk of failure; ISQ value=60-90, optimal integration; and ISQ value>90, bone necrosis (14).

The objective of this study was to assess implant stability by means of a fourth-generation RFA device, and to compare ISQ values between immediately loaded and non-loaded implants in the same patient, same area and same bone type at different time points.

that could affect the implant treatment; smoking habit; drug treatments that could affect implant treatment and radiographic presence of bone defects.

Surgical protocol

A total of 40 dental implants (Essential Cone® (EC), Klockner® Implant System), 20 implants with no immediate loading (control) and 20 immediately loaded implants (test), were inserted. Implants presented a sandblasted and acid-etched surface. In each patient, implants were placed in the same quadrant and region of the arch (Table 1).

Implants were immediately loaded or no immediately loaded according to a randomized procedure established by www.randomization.com which automatically generated random numbers and assigned implants to control or group test. This online program uses a JavaScript random number generator to produce customized sets of random numbers, thus guaranteeing that participants (implants) are randomly assigned to each group (control or test). Crestal incision was made to elevate a full-thickness flap. The implant bed was drilled at 800-1200 rpm depending on the bone consistency, strictly following the protocol recommended by the manufacturer. Implant insertion was first conducted manually and then, after stabilization, with at least 30N calibrated dynamometric wrench. It was obtained in all cases by infra-drilling of the implant bed. All patients received written information on postoperative care and medication (1 g amoxicillin every 8 h for 4 days, 600 mg ibuprofen for 3-7 days, and 0.12% chlorhexidine mouthrinse every 12 h). Sutures were removed after 7 days and patients were examined at 6 and 8 weeks.

MATERIAL AND METHODS Study population

The study sample was randomly selected among patients attending for implant treatment at the Periodontics and Implants Master Clinic of the School of Dentistry of the University of Granada, Granada (Spain). Sixty-seven patients were initially examined and only 15 (10 males and 5 females) with age ranging 40 to 65 years met the inclusion criteria. The perido of the study was from January to March 2013. The study was approved by the Ethics Committee of the University of Granada, Granada (Spain) and all the patients signed an informed consent.

Inclusion criteria were as follows: stable occlusion; implant sites where extractions were performed more than one year ago; need of implants in the same quadrant and region of the arch; good systemic and oral health, bone volume adequate to insert implants with diameter of 4 mm and length of ≥8 mm; similar bone quality in the treatment sites; at least 30N of torque at the implant placement. Exclusion criteria were: any disease

POSITION

11

14 15

Test

1

3

Control Length (mm

52

22 24

1 1

10

16

2 3

10 10 10

1

25 26

35

3 2

RFA assessment

After insertion, dental implants baseline stability was assessed using a fourth-generation RFA device (Osstell Mentor®; Osstell AB, Göteborg, Sweden), recording the implant stability quotients (ISQs). The implants with ISQ values within the range established by the manufacturer (60-90) were immediately loaded, while the non-loaded implants (control) were closed using the closing screw of the implant system. The area was then sutured to ensure a stable closing of the area. Stability of the implants was also determined at 6 and 8 weeks after their placement. Implant stability was always assessed before withdrawing the crown and/or the closing screw

36

37

4 3

1

1

10 10 10 10 10 10

46

44 47

5

TOTAL

1

20

3

20

2

2

1

8

10

10 10

tabLE 1 Distribution, number and length of the implants inserted

© ariesdue October 2014; 6(3)

Changes in RFA during osseointegration

and directing the transducer signal in a bucco-lingual or bucco-palatal direction.

Immediate loading procedure

Provisional crowns were directly prepared in the mouth. After inserting implants and suturing the area, an Octacone® 12º (Klockner® Implant System) taper connection was screwed in place. An octagonal titanium coping was then placed to avoid rotation of the provisional crown, which was a preformed acetate crown (3M ESPE®) filled with self-curing resin and perforated in the occlusal area for the fixing screw.

After polishing and reshaping of the gingival margin of the crown, it was inserted in the mouth, applying a 10N torsion force to the fixing screw, avoiding damage and improving tissue adaptation. Crowns were placed in occlusion, releasing lateral contacts. All implants supported individual crowns, implants were not splinted in any case. Provisional crowns were removed at 6 weeks for RFA measurements and were maintained until 8 weeks, when, after X-ray control, they were lastly removed for the final RFA measurement. The definitive crowns were then placed for the final restoration.

Statistical analysis

All statistical analyses were performed using SPSS software v 20.0 (SPSS Inc., New York, NY, USA). Mean (±standard deviation) implant RFA values (ISQ units) were calculated for test and control groups and for maxilla and mandible. Student’s t test was used because, despite differences in variances, samples had always the

OR

SE

TEST IMPLANTS

CONTROL IMPLANTS

z P>|z| TOTAL MAXILLARY MANDIBULAR TOTAL MAXILLARY MANDIBULAR

same size and the distribution was approximately normal.

To compare between groups and between maxillary and mandibular areas p<0.05 was considered significant.

RESULTS Clinically, there were no major postoperative complications. Treated areas showed no alterations, and good wound-healing was observed 7 days post-surgery.

There were no statistically significant differences between mean ages and groups (p>0.05). Table 2 shows ISQ mean values and standard deviation (SD) in test and control implants at baseline, 6 and 8 weeks. At baseline, maxillary implants showed higher ISQ values, however, they tend to decrease at 6 and 8 weeks. On the contrary, mandibular implants showed lower ISQ values at baseline; this values tend to increase at 6 and 8 weeks (Table 2).

P values between ISQ values for all implants localizations are shown in Table 3. A statistically significant difference was found at baseline in testvs control maxillary implants (p=0.009) but not at 6 or 8 weeks (p>0.05).

Control, non-loaded implants, in both maxilla and mandible showed a tendency to an increase in ISQ values, with no statistically significant differences (p>0.05). Test, immediately loaded implants presented a tendency for initial ISQ values to decrease from loading to 6 weeks, with stabilization at 8 weeks and even the beginning of a slight recovery was observed (Fig. 1). In the maxilla, test implants showed a decrease in ISQ values, whilst in the control implants an increase was found between

Mean ISQ BASELINE 95% CI 66.75 (SD 9.503) 70.90 (SD 7.430) 62.60 (SD 9.857) 58.95 (SD 9.583) 60.20 (SD 8.753) 57.70 (SD10.667)

Mean ISQ 6 WEEKS

Mean ISQ 8 WEEKS

65.35 (SD 6.752)

65.80 (SD 5.625)

66.60 (SD 5.232)

65.80 (SD 4.686)

64.10 (SD 7.767)

65.80 (SD 6.97)

62.60 (SD 6.443)

64.95 (SD 5.165)

63.10 (SD 5.646)

64.50 (SD 4.686)

62.10 (SD 7.430)

65.40 (SD 6.603)

tabLE 2 Mean and standard deviation (SD) ISQ values in test implants and control implants at baseline, 6 and 8 weeks.

OR SE z IMPLANTS LOCALIZATION

P>|z| 95% CI Baseline (p)

6 weeks (p)

8 weeks (p)

Total maxillary/ mandibular

0.095

0.407

0.794

Test maxillary /control maxillary

0.009*

0.168

0.492

Test mandibular /control mandibular

0.300

0.564

0.894

Test maxillary /Test mandibularr

0.049*

0.411

1.000

Control maxillary /control mandibular

0.574

0.739

0.709

October 2014; 6(3) © ariesdue

tabLE 3 P values between ISQ values for all implants localizations, at baseline, 6 and 8 weeks. * (p<0.05 was established as statistical significant difference)

53

GonzĂĄlez-Jaranay M. et al.

fig. 1 Comparison of ISQ values between study and control implants.

fig. 3 Comparison of ISQ values between study and control mandibular implants.

insertion and 8 weeks (p>0.05) (Fig. 2). In both test and control implants between insertion and 8 weeks (p>0.05) an increase in ISQ values was present (Fig. 3).

DISCUSSION The criteria for the immediate loading of implants and its advantages and disadvantages remain controversial.

Some authors have proposed that the criteria for immediate loading are the torsion force applied at the time of insertion and the bone characteristics, while others have established clinical criteria, including the results of percussion tests with mirror handle and probing or radiographic examinations (8). Other researchers have described the surface treatment of the implant as critical to the appropriateness of immediate loading (6,7). To date, however, no study has established objective criteria for taking this clinical decision. Some

54

fig. 2 Comparison of ISQ values between study and control maxillary implants

authors suggested to use repeated implant stability measurements in order to identify implants at risk of failure (15,16). Thus, Glauser et al. (15) demonstrated a continuous decrease in stability in some immediately loaded implants clinically failed after one year, despite their high initial primary stability, while Sennerby et al.

(16) observed a correlation between marginal bone loss and implant stability in a study on a dog model.

There is an evident need for a simple and objective method to quantify implant stability at immediate loading, and RFA measurements appear to be a promising candidate for this purpose (9). In this study, stability was measured by using the Osstell Mentor (Osstell AB, GĂśteborg, Sweden) transducer. It has been reported (8) that the direction in which the transducer is used may affect measurements. In the present study, all measurements were standardized and conducted in the same direction (buccal to lingual or palatine) by a single operator. Fischer et al. (17) followed up 139 maxillary implants in 24 patients at 3 and 5 years and found that the implant failure was associated with ISQ values <54.

In the present study, an ISQ value >60 was a criterion for immediate implant loading.

The magnitude and type of loading on the restoration is a key parameter in immediately loaded implants (14, 18), when parafunctions are a major risk factor for implant failure. In our patients, the prosthetist carried out meticulous occlusal adjustments at follow-up sessions in all the provisional/temporary crowns restorations, ensuring the absence of interference or any lateral movement. Although all implants in our study were inserted with the same torsion force (>30N), the Osstell ISQ measurements revealed differences in their stability.

Hence, the measurement of ISQ units appears to offer an objective method to quantify implant stability, to decide the timing of loading and to evaluate implant stability during the first stages of integration. However, as noted by Aparicio et al. (8), the need to develop an

Š ariesdue October 2014; 6(3)

Changes in RFA during osseointegration

ISQ value scale that can define the characteristics of the bone-implant interface or quantitatively assess integration still remains.

We observed a decrease in ISQ values in maxillary implants, but a small increase in mandibular implants, and the difference between mandibular and maxillary values was significant at baseline. This may be explained by a higher amount of cortical bone in the mandible, where bone remodeling takes place between the first and fourth week, producing newly formed bone; bone remodeling occurs later in the more spongy bone of the maxilla. These results are in line with previous reports (9,19-22). Globally, a small progressive decrease in stability values from baseline to 8 weeks was found in the present study. Previous studies on immediately loaded implants evidenced an initial decrease in stability that was reversed after 3 months, attributing this behavior to bone remodeling and to the load exerted by the restoration (23-28).We found an increase in the stability of non-loaded implants (in both mandible and maxilla) between baseline and measurements at 8 weeks, when the provisional restoration was removed.

Glauser et al. (29) studied 81 implants over a 1-year period and also found that the stability of loaded implants initially decreased and then increased when the load was removed.

In conclusion, implants with primary stability (with ISQ> 60) and inserted with a force of ≥ 30 N demonstrated optimal clinical behavior during the integration period after immediate loading. The timing of implant loading in this initial phase did not influence the success rate.

The Osstell Mentor® RFA system offered an objective method to determine whether implant stability was adequate for immediate loading. Since immediate loading was not performed on implants with ISQ < 60, following the manufacturer’s assessment, we cannot draw conclusions on the immediate loading of implants with lower ISQ values. Further researches are required to develop an ISQ value scale that yields reliable information on the characteristics of the bone-implant interface and the state of integration.

Acknowledgments The authors are grateful to Javier Fernández Delgado, Juan José Fernández de Rota Conde and Juan José Gijón from the Masters in Periodontics and Implants at the School of Dentistry, University of Granada, for their collaboration in this study. They also thank D. Jordi Marínez, the Product Manager of Klockner, for his cooperation.

REFERENCES 1. Chee W, Jivraj S. Efficiency of immediately loaded mandibular full-arch implants restoration.

Clin Implant Dent Relat Res 2003;5:52-6.

2. Ostman PO. Immediate/early loading of dental implants.Clinical documentation and presentation of a treatment concept. Periodontology 2000 2008;37:90-112.

October 2014; 6(3) © ariesdue

3. Enríquez-Sacristán C, Barona-Dorado C, Calvo-Guirado JL, Leco-Berrocal I, MartínezGonzález JM. Immediate post-extraction implants subject to immediate loading: a metaanalytic study. Med Oral Patol Oral Cir Bucal 2011;16:e919-4.

4. Achilli A, Tura F, Euwe E. Inmediate/early function with tapered implants supporting maxillary and mandibular posterior fixed partial dentures: preliminary results of a prospective multicenter study. J Prosthet Dent 2007;97:52-8.

5. Sennerby L, Rocci A, Becker W, Jonsson L, Johansson LA, Albrektsson T.Short-term clinical results of Nobel Direct implants: a retrospective multicentre analysis. Clin Oral Implants Res 2008;19:219-26.

6. Wennerberg A, Albrektsson T, Andersson B. Bone tissue response to commercially pure titanium implant blasted with fine and coarse particles of aluminum oxide. Int J Oral Maxillofac Implants1996;11:38-45.

7. Buser D, Nydegger T, Oxland T, Cochran DL, Schenk RK, Hirt HP, et al. Interface shearstrength of titanium implants with a sandblasted and acid-etched surface: abiomechanicalstudy in the maxilla of miniature pigs. J Biomed Master Res 1999;45:75-83.

8. Aparicio C, Lang NP, Rangert B. Validity and clinical significance of biomechanical testing of implant/bone interface. Clin Oral Implants Res2006;17:2-7.

9. BoronatLópez A, BalaguerMartínez J, Lamas Pelayo J, Carrillo García C, PeñarrochaDiago M. Resonance frequency analysis of dental implant stability during the healing period. Med OralPatol Oral Cir Bucal 2008;13:e244-47.

10. Friberg B, Sennerby L, Linden B, Grondahl K, Lekholm U. Stability measurements of onestage Branemark implants during healing in mandibles. A clinical resonance frequency analysis study.Int J Oral MaxillofacSurg 1999;28:266-72.

11. Lundgren S, Andersson S, Gualini F, Sennerby L. Bone reformation with sinus membrane elevation: A new surgical technique for maxillary sinus floor augmentation. Clin Implant Dent Relat Res 2004;6:165-73.

12. Galluci GO, Bernard JP, Bertosa M, Belser UC. Immediate loading with fixed Screw- Retained provisional restorations in edentulous jaws: The pickup technique. Int J Oral Maxillofac Implants 2004;19:524-33.

13. Meredith N, Shagaldi F, Alleyne D, Sennerby L, Cawley P. The application of resonance frequency measurements to study the stability of titanium implants during healing in the rabbit tibia. Clin Oral Implants Res 1997;8:234-43.

14. Herrero-Climent M, Albertini M, Rios-Santos JV, Lázaro-Calvo P, Fernández-Palacín A, Bullon P. Resonance frequency analysis-reliability in third generation instruments: Osstell mentor®.

Med Oral Patol Oral Cir Bucal 2012;17:e801-6.

15. Glauser R, Sennerby L, Meredih N, Rée A, Lundgren A, Gottlow J, Hämmerle CH. Resonance frequency analysis of implants subjected to immediate or early functional occlusal loading.

Successful vs. failing implants.Clin Oral Implant Res 2004;15:428-34.

16. Sennerby L, Persson LG, Berhlundh T, Wennerberg A, Lindhe J. Implant stability during initiation and resolution of experimental peri-implantitis: an experimental study in dog. Clin Implant Dent Relat Res 2005;7:136-40.

17. Fischer K, Stenberg T, Hedin M, Sennerby L. Five-year results from a randomized, controlled trial on early and delayed loading of implants supporting full-arch prosthesis in the edentulous maxilla. Clin Oral Implants Res 2008;19:433-41.

18. Farré-Pagés N, Augé-Castro ML, Alaejos-Algarra F, Mareque-Bueno J, Ferrés-Padró E, Hernández-Alfaro F. Relation between bone density and primary implant stability. Med Oral Patol Oral Cir Bucal 2011;16:e62-7.

19. Balleri P, Cozzolino A, Ghelli L, Momicchioli G, Varriale A.Stability measurements of osseointegrated implants using Osstell in partially edentulous jaws after 1 year of loading: a pilot study. Clin Implant Dent Relat Res 2002;4:128-32.

20. Bischof M, Nedir R,Szmukler-Moncler S, Bernard JP, Samson J. Implant stability measurement of delayed and immediately loaded implants during healing.Clin Oral Implants Res 2004;15:529-39.

21. Myamoto I, Tsuboi Y, Wada E, Suwa H, Iizuka T. Influence of cortical bone thickness and implant length on implant stability at the time of surgery-clinical, prospective, biomechanical, and imaging study. Bone 2005;37:776-80.

22. Boronat-López A, Peñarrocha-Diago M, Martínez-Cortissoz O, Mínguez-Martínez I. Resonance frequency analysis after the placement of 133 dental implants. Med Oral Patol Oral Cir Bucal 2006;11:e272-76.

23. González-García R, Monje F, Moreno-García C. Predictability of the resonance frequency analysis in the survival of dental implants placed in the anterior non-atrophied edentulous mandible. Med Oral Patol Oral Cir Bucal 2011;16:e664-9.

24. Glauser R, Lundgren AK,Gottlow J,Sennerby L,Portmann M, Ruhstaller P, et al.Immediate occlusal loading of BrånemarkTiUnite implants placed predominantly in soft bone: 1-year results of a prospective clinical study: 1-year results of a prospective clinical study.

ClinImplantDentRelat Res 2003;5:47-56.

25. Calvo Guirado JL, Ortiz Ruiz AJ, Gómez Moreno G, López Marí L, Bravo González LA. Immediate loading and immediate restoration in 105 expanded-platform implants via the Diem System after a 16-month follow-up period. Med Oral Patol Oral Cir Bucal 2008;13:e576-81.

26. Marković A, Calvo-Guirado JL, Lazić Z, Gómez-Moreno G, Calasan D, Guardia J, et al.Evaluation of Primary Stability of Self-Tapping and Non-Self-Tapping Dental Implants. A 12-Week Clinical Study.Clin Implant Dent Relat Res 2011; doi: 10.1111/j.1708-8208.2011.00415.x.

27. Berglundh T, Abrahamsson I, Lang NP, Lindhe J.De novo alveolar bone formation adjacent to endosseous implants.Clin Oral Implants Res 2003;14:251-62.

28. Vetri M,Balleri P,Ferrari M. Influence of transducer orientation on osstell stability measurements of osseointegrated implants. Clin Implant Den Relat Res 2007;9:60-4.

29. Glauser R, Ree A, Lundgren A, Gottlow J, Hammerle GH, Scharer P. Immediate occlusal loading of Branemark implants applied in various jawbone regions: a prospective, 1 year clinical study. Clin Implant Dent RelatRes 2001;3:204-13.

55

F. Rossi1, M.E. Pasqualini2, L. Grivet Brancot3, D. Colombo4, M. Corradini5, B. Lorè6, L. Calabrese7 1

Private practice Busto Arsizio, Italy.

Private practice Milano, Italy.

3 Private practice Torino, Italy.

4 Private practice Como, Italy 5 Private practice Trento, Italy 6 Chair in Maxillo Facial Surgery University Tor Vergata of Roma.

7 Director of Maxillo Facial Surgery University Tor Vergata of Roma.

2

Minimally invasive piezosurgery for a safe placement of blade dental implants in jaws with severe bone loss to cite this article Rossi F, Pasqualini ME, Grivet Brancot L, Colombo D, Corradini M, Lorè B, Calabrese L. Minimally invasive piezosurgery for a safe placement of blade dental implants in jaws with severe bone loss. J Osseointegr 2014;6(3):56-60.

ABSTRACT Aim Severe atrophies of edentulous jaws require major reconstructive bone surgery in order to allow the placement of root-form implants with standard diameter. These bone augmentation techniques represent the best option reported in the literature, but they are often rejected by patients because of their high economic and biological costs in addition to the possibility of failure in the short and/or long term. In the maxilla regenerative methods (onlay, inlay, and distraction) have high success rates, whereas in the mandible, especially in the distal atrophic area, they are not so predictable. In such situations an alternative technique for fixed prosthethic rebilitation is the insertion of platform blade implants, which have their elective indication for atrophic bone ridges with reduced width, owing to their reduced thickness. The aim of this study is to assess the effectiveness of the use of piezoelectric ultrasonic handpieces, in order to simplify the placement of blade implants, making it safer and less traumatic than with conventional surgical procedures.

Materials and methods Platform blade implants are extension implant functionally and aesthetically reliable, even if they require a more difficult surgical technique compared with the one currently in use for screw implants. A minimally invasive procedure by means of piezosurgery that was performed on 142 subjects is presented and a case is reported which highlights the successful results.

Results and conclusion The use of piezoelectric ultrasonic handpieces simplifies the surgical procedure for the placement of blade implant, making it safer and less traumatic.

Keywords Blade implants, Inferior alveolar nerve; Minimally invasive surgery; Piezosurgery; Posterior mandibular atrophy.

October 2014; 6(3) Š ariesdue

Introduction The scientific progress in oral implantology gave rise to enhanced surgical techniques aimed at increasing the volume of atrophic ridges in view of the subsequent placement of implants. These bone regeneration procedures are achieved mainly by means of bone grafts (onlays-inlays) or of distraction osteogenesis (1-7). However, they imply different levels of stress that risk patients can not afford. Furthermore, their outcomes are not enough predictable and complications are numerous (8-18). Consequently, bone regeneration procedures can be performed only in selected cases. In particular, in the lower jaw the use of standard diameter root-form implants often results in problems during insertion owing to insufficient bone volume.

Atrophic areas, being generally highly mineralized and poorly vascularized, do not respond positively to the various grafting techniques because of the possibility of failure and their high biological cost. For these reasons, according to EBM (Evidence Based Medicine), these techniques are not sufficiently predictable (19 -22).

An alternative to augmentation techniques in posterior areas of the jaw with severe horizontal and vertical resorption and with bone width less than 3 mm, is offered by the placement of platform or blade implants with reduced thickness.

Blade implant were developed by Linkow and Roberts at the end of the 60s of the last century, when they created an endosseous implant with an all-in-one abutment with a fixture of variable form, for the adaptation in different bone sites. Over the years, Leonard Linkow modified and improved both the shape and the implant surface (23-26).

In 1972 Ugo Pasqualini presented the "polymorphic blade", which is the only implant that can be shaped according to the morphological characteristics of the bone in which it has to be inserted.

The polymorphic blade is a one stage implant, structured with an emerging threaded part which prevents that external mechanical stresses (caused by swallowing,

56

A protocol for blade implants insertion by means of piezosurgery

Male (59)

Female (83)

TOTAL

Age

N. implants

5 year succes rate

51-60

3

94,8

61-70

31

93,1

> 71

25

92,4

51-60

12

95,3

61-70

39

94,6

> 71

32

92,7

142

93,8

tongue and jaw muscles) reach the submerged structures.

In 1972 Ugo Pasqualini wrote: «The best conditions for rapid healing of surgical wounds, unavoidable for the insertion of implants, with bone recovery around, above and through implants themselves, occur only when these have been completely submerged, without communication with the outer site. This is useful not so much to eliminate the dreaded but unlikely risk of microbial contamination, but rather to prevent that the lever arm of the external abutment transfers dangerous mechanical stresses to the inner part, thus subjecting the implant to continuous mobilizations that could affect the achievement of including osteogenesis (that is osseointegration)» (27-30).

Conventional blade implant insertion is performed in open flap surgery, in order to expose the bone ridge where a sagittal cut is performed for the placement of the submerged part of the blade (minimum bone thickness required is 2 mm). Grooves are made by means of a fissure bur (according to the length of the shank) mounted on a handpiece. They should accommodate all the intraosseous part of the blade. The drilling of the bone requires simultaneous cooling of the surgical site by means of irrigation with saline solution. The blade is manually placed on the groove, and then locked in place by gently hammering it with a mallet. The blade should lie at least 2 mm below the edge of the ridge, in order to be completely covered by bone tissue during the healing period (31-33).

This technique requires considerable surgical skill during groove preparation, the cut has to be very accurate and precise. In order to overcome problems connected to inaccuracy of the operator's hand or unpredictable movements of the patient, Linkow recommended to perform a series of small holes on the cortical surface and subsequently merge them using a fissure bur. We recommend the use of Geyer’s cog wheel, which is a low speed contra-angle bur, made of an indented disk 1 mm thick and 5 mm in diameter, which is used to draw

October 2014; 6(3) © ariesdue

Avg success rate 93,4

tabLE 1 The table summarizes the 142 cases of mandibular distal atrophy treated with blade implants.

94,2

a grove along the cortical bone, and then the cut is deepened through the bone with a fissure bur (34-36).

Recently thanks to piezosurgery, the placement of blade implants has become more precise and safer since deeper soft tissues, particularly those inside the mandibular canal, are not traumatized (37-38).

A protocol was devised using an ultrasonic surgery device and, in order to assess its advantages, in terms of selective micrometric, precise and secure cutting, a multicenter study was performed.

MATERIALS AND METHODS In order to assess the procedure, a multicenter study was carried out in five Italian private practices (Busto Arsizio, Milano, Torino, Como, and Trento) on 142 subjects with atrophic edentulous posterior jaw (Table 1), between 2005 and 2008, and the 5 years follow up in 2013. The study was carried out in accordance with the ethical standards specified in the Declaration of Helsinki and written informed consent was obtained from all participants, prior to their inclusion in the study.

Inclusion criteria were the following: atrophic edentulous posterior jaw requiring implant-supported prosthetic rehabilitation.

All subjects were treated following the same surgical procedure, local anesthesia included. Local anaesthesia was performed by injecting a reduced dose (0.90 ml x 1) of articaine 40 mg/ml with adrenaline 1: 100,000 on both sides of the bone crest, or with the use of intraligamentary anaesthesia (Peripress) along the edentulous ridge (39).

These topical anesthetics allow to keep a deep sensitivity, which is perceived by the patient even close to the mandibular nerve, and it guarantees the absolute respect of the vascular-nervous structure. Nerve-block anesthesia is absolutely contraindicated even with any other implant technique.

57

Rossi F. et al.

Surgical procedure

The flap should be raised on the ridge without vertical incisions, allowing for adequate blood supply to the atrophic bone and direct observation of the entire morphology and topography of bone itself. Once the bone is exposed, the muco-periosteal tissues are dissected with the periosteal elevator and gently folded down. A surgical gap is achieved, using the flat serrated insert (ES071) of the Ultrasonic Bone Surgery unit (Italia Medica Srl; Milano, Italy). After radiographic and anatomic analysis by means of OPT and Cone Beam CT, a blade implant of adequate size is inserted (in the case presented it is 12 mm in length).

The surgical gap should meet the following requirements: equal or slightly longer than the mesio-distal length of the implant selected, a width in the buccal lingual sense slightly narrower than the width of the upper edge of the implant blade (bladeâ&#x20AC;&#x2122;s shoulder thickness 1.4 mm, lower edge thickness 0.5 mm), so as to prevent its passive insertion in the furrow but for some millimeters, in order to immediately achieve primary stability, after implant insertion (press-fit). The depth should be equal to the height of the implant blade, from its lower edge to the basis of the screw abutment. The height of commercially available blades generally varies from 5 to 12 mm (in this case it is 9 mm). The implant blade is inserted into the grove by locking it in place with a special chisel awl; the groove is prepared by means of a special serrated piezosurgery device. The shoulder of the implant must lie at least 2 mm below the edge of the bone crest. The mucosa is then sutured with interrupted sutures (40).

Post-surgical procedure

In our multicenter study, polymorphic one-stage blade

implants were used with screwable abutments (approved with CE 0301, CE 0476 Single-stage blade, CE 0476 Mini blade, Single-stage double-abutment blade EC 0068/ QCO-DM038-2009, validated in the European Union).

After a period of at least 3 months, healing caps are removed, the final abutments are placed and the prosthetic phase can start. The prosthesis may include a natural tooth when it is not possible to connect the blade with another implant, according to the American Dental Association (ADA) which has established the validity of this procedure (41). It should be noted that in 2013, the FDA (Food and Drug Administration), in the United States, has proposed the requalification of the blade implant, bringing the surgical risk from grade 3 to grade 2 as for all other standard root form implants (42).

CASE REPORT Here we report the case of a 46 years old female patient with severe atrophy of the right mandible.

CAT (computerised axial tomography) highlighted the severe atrophy of the edentulous area with the presence of an impacted third molar and an ankylosed residual root, which was asymptomatic and kept in situ according to the wish of the patient (Fig. 1). After the millimetric controls for the choice of the fittest polymorphous blade for the specific site and having exposed the ridge bone into plain sight, osteotomy was performed using exclusively the specific insert ES071 applied to the piezoelectric handpiece for ultrasonic surgery (Fig. 2).

This surgical technique allowed a selective micrometric, precise and secure cutting (Fig. 3), ensuring a good view of the operative field, furthermore the healing of the bone and soft tissue occurred without any fig. 1 CAT scan series, highlighting the bone atrophy, and the panoramic radiograph. Yellow arrows mark the implant area, the impacted third molar and the ankylosed residual root.

58

Š ariesdue October 2014; 6(3)

A protocol for blade implants insertion by means of piezosurgery

complications and with minimal pain.

After a healing period of three months, enough for the complete achievement of osseointegration, the prosthetic rehabilitation was started, which included two natural teeth, that had previously undergone endodontic treatment (Fig. 4).

At the 5-year follow-up, periodontal and peri-implant soft tissues health was assessed, as a result of the periodic check ups and the adequate hygiene, and a stable occlusal harmony was achieved (Fig. 5, 6).

DISCUSSION AND CONCLUSION

fig. 2 A The serrated insert working in depth. B Profile of the polimorphic blade with Pasqualini’s screw abutment, just inserted. C Osteotomy with the correct insertion of the implant. fig. 3 A The definitive prothesis in gold and porcelain. B Final radiographic control (2008).

fig. 4 Soft tissues and the X-ray evidence the success of the implantprosthetic rehabilitation with blade and natural teeth after 5 years (2013).

Blade implants are part of the evolution of prosthetic implants started in the late 60's with its maximum development in the 70’s, during which blade implants were modified and improved, playing for a certain period the role of the most widely used implant system in the world. With the advent of root form implants, blades went into gradual disuse: only a few operators still use this technique, which is the elective procedure in terms of success and reliability in the rehabilitations of atrophic edentulous distal areas of the mandible, without discrediting the insertion techniques used for biphasic implants. This elective use, however, does not exclude the excellent behavior of blade implants in areas with severe deficiency of bone thickness in the upper jaw (43-45).

The conventional surgical technique still is a complex procedure where the slightest mistake inevitably leads to failure. Most blade implant failures reported in the literature are in fact related to the surgeon’s inadequate skill in performing the technique. Indeed, it requires strict patient selection and adherence to its crucial steps.

When properly used, blade implants can be very successful in atrophic conditions with reduced thickness, for which they were in fact originally devised (46, 47).

These difficulties are greatly reduced by piezosurgery, which results in: less invasive procedures, micrometric and selective cuts are more easily performed, advantages determined by the cavitation effect, extreme precision and safety with respect of the soft tissues, in particular the vascular-nervous components, reduced tissue heating, provided that the serrated insert is gently pressed and abundant irrigation with saline solution is supplied. Moreover, clear view of the surgical field, reduced rehabilitation time, pain reduction are also provided. As drawbacks, there are extended surgical times, which need sensitiveness and patience from both the surgeon and the patient. However, the increased working comfort amply compensates for the extended surgical time.

Acknowledgements

October 2014; 6(3) © ariesdue

59

Rossi F. et al.

This multicentric study was carried out with the assistance of the colleagues: Luca Dal Carlo, PierAngelo Manenti, Enrico Belotti, Lucio Bilucaglia, Enrico Moglioni, Federico Meynardi, Marco Gnalducci, Emanuele Morella, Giancarlo Cortese, Giorgio Galassi, Michele Nardone, Francesco Grecchi.

REFERENCES 1. Basa S, Varol A, Serer ID, Sertgoz A. Posterior maxillary segmental osteotomy for restoring the mandible with dental implants: a clinical report. J Prosthet Dent 2008 May; 99(5):340-3.

2. Buser D, Dahlin C, Schenk RK. Guided bone regeneration in implant dentistry. Chicago: Quintessence; 1994.

3. Chiapasco M, Zaniboni M, Boisco M. Augmentation procedures for the rehabilitation of deficient edentulous ridges with oral implants. Clin Oral Implant Res 2006 Oct;17 suppl 2:136-59.

4. Chiapasco M, Romeo E, Casentini P, Rimondini L. Alveolar distraction osteogenesis vs. vertical guide bone regeneration for the correction of vertically deficient edentulous ridges: a 1-3 years retrospective study on humans. Clin Oral Implants Res 2004 Feb; 15(1):82-95.

5. Chiapasco M, Zaniboni M, Rimondini L. Autogenous onlay bone grafts vs alveolar distraction osteogenesis for the correction of vertically deficient edentulous ridges: a 2-4 years prospective study on humans. Clin Oral Implants Res 2007 Aug;18(4):432-40.

6. Felice P, Iezzi G, Lizio G, Piattelli A, Marchetti C. Reconstruction of atrophic posterior mandible with inlay technique and mandibular ramus block graft for implant prosthetic rehabilitation. Oral Maxillofacial Surg 2009 Feb; 67(2):372-80.

7. Jensen OT. Distraction osteogenesis and its use with dental implants. Dent Implantable Update 1999;10:33-6.

8. Kamal D, Abida S, Jammet P, Goudot P, Yachouh J. Outcome of oral implants after autogenous bone reconstruction. Rev Stomatol Chir Maxillofac 2009 Apr;110(2):86-8.

9. Melloning JT, Nevins M. Guided bone regeneration of one defects associated with implants: an evidence-based outcome assessment. Int J Periodontics Restorative Dent 1995;15:168-85.

10. Nystrom E, Nilson H, Gunne J, Lundgren S. A 9-14 year follow up of onlay bone grafting in the atrophic maxilla. Int J Oral Maxillofac Surg 2009 Feb; 38(2):3-6.

11. Barone A, Covani U. Maxillary alveolar ridge reconstruction with non vascularised autogenous block bone: clinical results. J Oral Maxillofac Surg 2007 Oct;65(10):203946.

12. Enislidis G, Fock N, Millesi-Schobel G, Klug C, Wittwer G, Yerit K, Ewers R. Analysis of complications following alveolar distraction osteogenesis and implant placement in the partially edentulous mandible. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2005 Jul;100(1):25-30.

13. Garcia A, MartinM, Vila P, Maceiras J. Minor complications arising in alveolar distraction osteogenesis. J Oral Maxillofac Surg 2002;60:496-501.

14. Maurer P, Eckert AW, Kriwalsky MS, Scubert J. Scope and limitations of methods of mandibular reconstruction: a long term follow-up. Br J Oral Maxillofacial Surg 2009 Jul; 31.

15. Perdijk FB, Meijeer GJ, StriJen PJ, Koole R. Complications in alveolar distraction osteogenesis of the atrophic mandible. Int J Oral Maxillofac Surg 2007 Oct;36(10):916-21.

16. Saulacic N, Martin MS, Comacho M, Garcia A. Complications in alveolar distraction osteogenesis: a clinical investigation. J Oral Maxillofac Surg 2007;65:267-74.

17. Smoka W, Brosshardt DD, Mercske Spurn R, Iizuka T. Reconstruction of the severely atrophic mandible using calvarial splint bone grafts for implant supported oral rehabilitation. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2006 Jan;101(1):35-42.

18. Troulis MJ, Kaban LB. Complications of mandibular distraction osteogenesis. Oral Maxillofac Surg Clin North Am 2003 May;15(2):251-64.

19. Mangano F, Bazzoli M, Tettamanti L, Farronato D et al. Custom-made, selective laser sintering (SLS) blade implants as a non conventional solution for the prosthetic

60

rehabilitation of extremely atrophied posterior mandible. Lasers Med-Sci. SpringerVerlag: London; 2012.

20. Mangano C, Mangano F, Shibli JA et al. Prospective clinical evaluation of 201 direct laser metal forming implants: results from a 1-year multi center study on 62 patients. Lasers Med Sci 2012 Jan;27(1):181-9. Epub 2011 Apr 26.

21. Chaushu G, Mardinger O, Peleg M, Ghelfan O, Nissan J. Analysis of complications following augmentation with cancellous block allografts. J Periodontol 2010 Dec;81(12):1759-64. Epub 2010 Aug 3.

22. Flanagan D. Avoiding osseous grafting in the atrophic posterior mandible for implant-supported fixed partial dentures: a report of 2 cases. J Oral Implantol 2011 Dec;37(6):705-11.

23. Linkow LI. The blade vent- a new dimension in endosseous implantology. Dent Concepts 1968;11:3-12.

24. Linkow L. Endosseous bladevent implant-insertion guidelines. Dentistry Today 1984;3.

25. Linkow L. The endosseous blade: a new dimension in oral implantology. Rev Trim Implant 1968;5:13-24.

26. Roberts RA. Types, uses, and evaluation of the plate-form implant. J Oral Implantol 1996;22:111-8.

27. Pasqualini U. Endosseous implants. Protection of reparative osteogenesis with the “screw stump”. Dent Cadmos 1972 Aug;40(8):1185-94.

28. Pasqualini U, Pasqualini ME. Treatise of Implant Dentistry. The Italian tribute to the modern implantology. Ariesdue: Carimate (Co); 2009. p 105-113.

29. Pasqualini U. Le patologie occlusali: Masson Milano; 1993.

30. Pasqualini ME. Implantoprotesi in un caso di monoedentulismo. Analisi retrospettiva a 38 anni. Dental Cadmos 2010 Dic;78(10):65-70.

31. Ricciardi A. Nine years with Pasqualini implants--a full mandibular arch. J Oral Implantol 1980;9:83-94.

32. Misch CE. Osteintegration and the submerged blade-vent implant. J Houston Dist Dent Soc 1988:12-6.

33. Iezzi G, Scarano A, Perrotti V, Tripodi D, Piattelli A. Immediately loaded blade implants. a histological and histomorphometrical evaluation after a long loading period. a retrospective 20 years analysis (1989-2009). J Osseointegr 2012,3(4):39-42.

34. Grafelmann HL. The latest developments in blade implant clinical applications. Dent Implantol Update 1993;4:22-5.

35. Viscido AJ. Submerged functional predictive endosteal blade implants. Oral Implantol 1974;5:195-209.

36. Dal Carlo L, Brinon E.N. Influencia de la lengua en la integraciòn de los implantes intraòseos. Revista Espanola Odontoestomatològica de Implantes 2004; 12(2):102-11.

37. Seshan H, Konuganti K, Zope S. Piezosurgery in periodontology and oral implantology.

J Indian Soc Periodontol 2009 Sep;13(3):155-6.

38. Vercellotti T. Technological characteristics and clinical indications of piezoelectric bone surgery. Minerva Stomatol 2004 May;53(5):207-14.

39. Castagnola L, Chenaux G, Colombo A. Intra-ligament anesthesia with the Peripress syringe. Dent Cadmos 1976 Nov; 44 (11):7-14.

40. Pasqualini U, Pasqualini ME. Treatise of Implant Dentistry. The Italian tribute to the modern implantology. Ariesdue: Carimate (Co); 2009. p 114-128.

41. Blade Dental Implants information: atlantadentalimplants.com; 2013.

42. Dental Tribune International: “FDA considers reclassification of dental implants”.

News Americas 05/feb/2013.

43. Strecha J, Jurkovic R, Siebert T, Prachar P, Bartakova S. Fixed bicortical screw and blade implants as a non-standard solution to an edentulous (toothless) mandible. Int J Oral Sci 2010 Jun;2(2):105-10.

44. Di Stefano D, Iezzi G, Scarano A, Perrotti V, Piattelli A. Immediately loaded blade implant retrieved from a after a 20-year loading period: a histologic and histomorphometric case report. J Oral Implantol 2006;32(4):171-6.

45. Dal Carlo L, Pasqualini ME, Carinci F, Corradini M, Vannini F, Nardone M, Linkow LI. A brief history and guidelines of blade implant technique: a retrospective study on 522 implants. Annals of Oral Maxillofacial Surgery 2013 Feb 01;1(1):3.

46. Koch WL. Statistical evaluation of success and reasons for failure in 700 endoosseous blade implants done in the office. Oral Implantol 1974 Apr; 1(1): 105-38.

47. Smithloff M, Fritz ME. The use of blade implants in a selected population of partially edentolous adults. A 15- year report. J Periodontol 1987 Sept; 58(9): 589-93.

© ariesdue October 2014; 6(3)

Diego Lops1§, Letizia Ferroni2§, Chiara Gardin2, Sara Ricci3, Riccardo Guazzo3, Luca Sbricoli3, Eugenio Romeo1, José L. Calvo-Guirado4, Eriberto Bressan3, Barbara Zavan2 1

Department of Prosthodontics, University of Milan, School of Dentistry, Dental Clinic, S. Paolo Hospital, Milano, Italy Department of Biomedical Sciences, University of Padua, Padua, Italy 3 Department of Neurosciences, University of Padua, Padua, Italy 4 Department of General Dentistry, Faculty of Medicine and Dentistry, University of Murcia, Murcia, Spain § These authors equally contributed to this work 2

Osteoproperties of polyethylene glycol hydrogel material to cite this article Lops D, Ferroni L, Gardin C, Ricci S, Guazzo R, Sbricoli L, Romeo E, Calvo-Guirado JL, Bressan E, Zavan B. Osteoproperties of polyethylene glycol hydrogel material. J Osseointegr 2014;6(3):61-5.

ABSTRACT Aim The aim of the present study was to test the osteogenic potential of a synthetic hydrogel made of polyethylene glycol (PEG), loaded with adult mesenchymal stem cells, used as a biodegradable membrane for guided bone regeneration (GBR).

Materials and methods Adult mesenchymal stem cells derived from adipose tissue (ADSCs) were isolated, characterized, and seeded on the hydrogel. After 15 days of culture, the scaffolds were analyzed with scanning electron microscopy (SEM) and real-time PCR to assess osteogenesis, and by means array CGH (Comparative Genomic Hybridization) to test their safety.

Results The in vitro results confirmed that the ADSCs were able to attach to the hydrogel and differentiate towards the osteogenic phenotype. Furthermore, array CGH analysis detected no chromosomal abnormalities, confirming the safety of the 3D cultures.

Conclusion The PEG hydrogel, loaded with adult mesenchymal stem cells, seems to have an osteogenic potential and therefore could be successfully used as a membrane in the treatment of bone defects.

Keywords Adipose derived stem cells, Guided bone regeneration, Hydrogel, Osteogenesis, Polyethylene glycol.

INTRODUCTION The treatment of bone defects represents a great challenge for orthopedic and cranio-maxillofacial surgery, as well as in dentistry. Although several methods for bone reconstruction exist, all of them have specific

October 2014; 6(3) © ariesdue

indications and limitations. The concept of using barrier membranes for the restoration of defective bones has been developed to simplify their treatment by offering a single-stage procedure. The established methods are distraction osteogenesis and bone transport or bone grafting, performed with autologous bone grafts, bone marrow aspirates, allografts, or bone substitutes supplied with growth factors (1-4). Furthermore, the concept of an induced membrane represents another strategy for bone regeneration. This method involves a two-stage procedure in which a ‘biological’ membrane is placed after the application of a cement spacer in the first stage, acting as a ‘chamber’ for the insertion of a bone graft in the second stage (1-3).

It has been shown that this membrane possesses osteoinductive, osteogenic and angiogenic properties, and several clinical studies have reported satisfactory results (1-4). Finally, the procedure of guided bone regeneration (GBR) using a bioabsorbable or nonresorbable membrane, that acts as a barrier to prevent soft tissue invasion into the defect and forms a ‘chamber’ to ‘guide’ the bone regeneration process (5-7), has also been used for bone reconstruction. In dental implants, for example, cell- or tissue-occlusive membranes help to restore the functional osseous tissue by allocating space for bone growth and preventing the competition between bone regeneration and soft tissue in-growth.

The materials used for GBR membranes have to meet specific criteria, such as biocompatibility, cell or tissue occlusion, space provision, and tissue integration.

Membranes made of several different materials are commercially available and are either non-resorbable (e.g., expanded polytetrafluoroethylene) or resorbable (e.g., polylactic acid or collagen). The advantage of the resorbable materials is that they do not require a second surgery for their removal.

The vast majority of membranes available on the market today have to be trimmed to the desired shape. A liquidapplicable, in situ-formed biodegradable membrane would offer many advantages, especially for complicated

61

Lops D. et al.

shapes (e.g., when used around a dental implant) or sites that are difficult to reach (8). In this regard, a novel polyethylene glycol (PEG) hydrogel was recently developed due to its biocompatibility and is already used in several medical devices (9). In a recent animal study, the barrier function of PEG was examined after subcutaneous placement in rats (10). Histological analysis revealed that it prevented cellular penetration in the membrane group for up to 4 months. To date, no information regarding the use of this material for osteogenesis induction is available. The present study was performed to test the osteogenetic properties of a PEG-based in situ applicable hydrogel. Adult mesenchymal stem cells derived from adipose tissue (ADSCs) were isolated and seeded on PEG-based scaffolds. The biocompatibility and osteogenic properties of the scaffolds were tested by quantification of DNA content, morphologic analysis (electron microscopy), and gene expression. Moreover, the genetic safety of the scaffolds (i.e., ability to induce tumorigenesis) was assessed with array CGH.

content in the cell cultures after 3, 7 and 15 days from seeding in medium without any differentiation factor (standard medium). The DNA was extracted using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) also suitable for purification of total DNA from cells. The DNA concentration was detected by measuring the absorbance at 260 nm in a spectrophotometer. The number of cells was then determined from a standard curve (micrograms of DNA versus cell number) generated by DNA extracted from counted cells. The standard curve was linear over the tested range of 5-80 µg DNA (r=0.99).

MATERIALS AND METHODS

Real-time PCR

Biomaterial

PEG hydrogels (Institut Straumann AG, Basel, Switzerland) were used as scaffolds for cell cultures.

The hydrogels were composed of two PEG molecules.

The single molecules, dissolved in its buffer, were mixed and then solidified within 20-50 s at room temperature.

Cell cultures

ADSCs were extracted from the adipose tissue of 5 healthy women and 5 healthy men (age: 21-36; BMI: 3038) undergoing cosmetic surgery procedures according to the guidelines of the Plastic Surgery Clinic at the University of Padua. The adipose tissues were digested and the cells isolated, expanded, and seeded following our previous protocol (11).

Proliferation test

The cell proliferation was assessed by measuring DNA

Gene

Scanning Electron Microscopy (SEM)

Samples were fixed with 2.5% glutaraldehyde in 0.1 M cacodylate buffer for 1 h before processing with either hexamethyldisilazane or critical-point drying followed by gold-palladium coating. All micrographs were obtained at 20 kV on a JEOL 6360LV SEM microscope (JEOL, Tokyo, Japan). The SEM analysis was carried out at the Interdepartmental Service Center C.U.G.A.S. (University of Padua).

For the first-strand cDNA synthesis, 800 ng of total RNA of each sample was reverse transcribed with M-MLV Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA), following the manufacturer’s protocol. Human primers were selected for each target gene with Primer 3 software (Table 1). Real-time PCRs were carried out using the designed primers at a concentration of 300 nM and FastStart SYBR Green Master (Roche Diagnostics, Mannheim, Germany) on a Rotor-Gene 3000 (Corbett Research, Sydney, Australia). Thermal cycling conditions were as follows: 15 min denaturation at 95°C; followed by 40 cycles of 15 s denaturation at 95°C; annealing for 30 s at 60°C; and 20 s elongation at 72°C. Values were normalized to the expression of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) internal reference, whose abundance did not change under our experimental conditions. Experiments were performed with 3 different cell preparations and repeated at least 3 times.

For (5’ - 3’)

Rev (5’ - 3’)

Product length (bp)

Osteonectin

TGCATGTGTCTTAGTCTTAGTCACC

GCTAACTTAGTGCTTACAGGAACCA

186

Osteopontin

TGGAAAGCGAGGAGTTGAATGG

GCTCATTGCTCTCATCATTGGC

192

Collagen type I

TGAGCCAGCAGATCGAGA

ACCAGTCTCCATGTTGCAGA

178

CD31

TCCAGCCAACTTCACCATCC

TGGGAGAGCATTTCACATACGA

171

GCTTCACTTACGTTCTGCATGA

CCTTCACTCGGACACACTCATTG

174

TCAACAGCGACACCCAC

GGGTCTCTCTCTTCCTCTTGTG

203

von Willebrand Factor GAPDH

tabLE 1 Human primer sequences.

62

© ariesdue October 2014; 6(3)

Osteoproperties of polyethylene glycol

Array CGH (Comparative Genomic Hybridization)

Array CGH was conducted using the Agilent Human Genome CGH Microarray 4x44K Kit (Agilent Technologies, Palo Alto, CA, USA) with a median resolution of 43 kb.

Labeling and hybridization were performed following the Agilent protocols. The graphical overview was obtained using the CGH analytics software (v3.1) (Agilent Technologies, Santa Clara, CA, USA).

RESULTS Cell proliferation and morphology

ADSCs were able to proliferate on the top of the scaffold, increasing their number, as demonstrated by the proliferation test performed at 3, 7 and 15 days of culture in standard medium (Fig. 1).

The SEM images acquired 3 hours after seeding revealed that the cells started to attach to the substrate (Fig. 2A).

After 15 days of in vitro culturing without differentiation medium, ADSCs adhered to the scaffolds, forming a continuous cell monolayer characterized by a typical osteoblastic (star-like) phenotype (Fig. 2B).

fig. 1 Proliferation test of ADSCs seeded on PEG hydrogels. Cell proliferation was assessed by measuring DNA content in the cell cultures after 3, 7 and 15 days from seeding in standard medium.

Gene expression

Real-time PCR was performed on 3D ADSCs cultures in the presence of osteoinductive factors, vasculogenic factors or standard medium. ADSCs cultured on PEG hydrogel without differentiation medium showed a well-defined osteoblastic expression profile (Fig. 3, green bars). Indeed, the expression of osteonectin, osteocalcin, and collagen type I was observed, with values comparable to those obtained with osteogenic medium (Fig. 3, blue bars). These results confirm that fig. 2 SEM analysis of ADSCs on PEG hydrogel after 3 hours (A) and 15 days (B) of culture in standard medium. fig. 3 Real time PCR analysis of ADSCs cultured on PEG hydrogel for 15 days in osteogenic medium (blue bars), standard medium (green bars) or vasculogenic medium (orange bars). Expression profile of osteogenic markers (osteonectin, osteocalcin and collagen type I) and vasculogenic markers (CD31 and von Willebrand Factor).

October 2014; 6(3) Š ariesdue

63

Lops D. et al.

the presence of the hydrogel alone was enough to induce bone commitment of the stem cells. ADSCs cultured on PEG hydrogel with vasculogenic medium (Fig. 3, orange bars) expressed markers of vascular cell phenotype (CD31 and von Willebrand Factor). On the contrary, no vascular markers expression was detected in ADSCs cultured in standard medium.

and seeded on PEG hydrogel material for up to 15 days.

As shown in Figure 4, no chromosomal imbalances (duplications or deletions of DNA regions) were detectable in either the donor cell populations, confirming that neither long-term cultures nor the use of growth factors induced structural alterations of the DNA.

Array CGH analysis

DISCUSSION and conclusion

fig. 4 Array CGH analysis of ADSCs cultured on PEG hydrogel for 15 days.

Cells isolated from two different donors and 3D cultured in osteogenic medium (A, B), standard medium (C, D) or vasculogenic medium (E, F). The figure shows a representative region of the whole genome analyzed, in particular the region of the p53 gene (indicated by the red ovals).

Today, implant therapy is regarded as an extremely reliable approach to replace missing teeth. The introduction of osseointegrated implants in dentistry represented a turning point in dental clinical practice.

A patientâ&#x20AC;&#x2122;s expectations for prosthetic rehabilitation are increasingly high, especially with regard to quality of life and functionality. The introduction of dental implants has led to a turning point in the rehabilitation of partially or totally edentulous patients. However, the placement of standard-length dental implants is not always possible or feasible in the first instance (12-14).

As a general principle for implant surgery, the implant surfaces should be surrounded by alveolar bone.

Sometimes, due to the prosthetic or anatomical limitations of the alveolar ridge, it is not possible to appropriately insert the implants in bone. Several methods are used for the reconstruction of destroyed alveolar bone, including GBR. In most cases of GBR, the membranes are supported by protective materials consisting of allografts, synthetic materials or xenografts (15). In this context, a novel in situ gelling hydrogel composed of two PEG components was recently suggested as a new material for GBR procedures. In particular, PEG components have been proven to be highly biocompatible, cell occlusive, and biodegradable, thus meeting the important criteria required for serving as a barrier membrane (16).

In light of these considerations, the present study aimed to assess the osteogenic properties of PEG hydrogel loaded with adult stem cells derived from human adipose tissue.

Proliferation test based on DNA quantification confirmed that the ADSCs seeded onto PEG hydrogel increased in number and generated a vital tissue. The SEM morphological analysis showed that the cells were able to adhere to the niches of the biomaterial, forming a thin monolayer. In the context of tissue engineering and regenerative medicine, it is increasingly recognized that it is important for different cell types to co-exist in a 3D environment to generate structures with greater functionality and engraftment capacity (11).

In this study, adipose tissue was used as a readily available source of cells for the generation of a 3D structure with both osteogenic and vasculogenic properties.

The gene expression analysis for osteogenic markers strongly supported the commitment of cells towards the osteogenic phenotype. Real-time PCR confirmed the

In order to identify genomic alterations, the DNA was extracted from cells derived from two different donors

64

Š ariesdue October 2014; 6(3)

Osteoproperties of polyethylene glycol

presence of extracellular matrix components, such as osteonectin and osteocalcin, which play a fundamental role in the interaction of cells with the bone matrix and in matrix mineralization, after 15 days of 3D culture. The expression of collagen type I, which is essential to the formation and maturation of hydroxyapatite crystals, was also clearly detectable, confirming the correct extracellular matrix composition. In parallel cultures containing vasculogenic factors, ADSCs were committed to mature endothelial cells, as confirmed by the expression of surface markers, such as CD31, and specific endothelial soluble factors, such as von Willebrand Factor. Surprisingly, expression of osteogenic markers was also detectable when the ADSCs were cultured on the hydrogel without any differentiation factors.

Detailed cytogenetic analyses were performed to validate the safety of the PEG hydrogel loaded with ADSCs. The safety of cell-based products need to be guaranteed before use in in vivo implantations, for example through the validation of chromosomal stability. Chromosome analysis remains one of the most commonly performed diagnostic genetic tests and it is suitable for a wide variety of indications in oncology, gynecology and pediatrics. At the cytological level, banded human chromosomes show a consistent and similar pattern in clinically healthy individuals. Hence, balanced and unbalanced chromosomal aberrations can serve as informative markers for a clinical phenotype, such as the dangerous transformation of a normal genotype into a tumor one. Array CGH represents an innovative molecular cytogenetic assay to test the chromosome stability. This technique allows the screening of the DNA content at high resolution, revealing DNA copy number changes (gains/losses), even if DNA is extracted from 3D cell cultures (11). In this way it is possible to establish whether prolonged in vitro cultures can give rise to chromosomal anomalies that might be implicated in the etiology of diseases or disorders (17).

The aim of the present study was to test the chromosomal stability of ADSCs expanded in vitro on PEG hydrogels.

The results of the array CGH showed no DNA alterations, thus confirming that the cells were able to differentiate while maintaining genomic stability.

In conclusion, PEG hydrogel behaves as a good scaffold to induce the osteogenic commitment of adult stem cells, commonly used for tissue engineered bone products, and at the same time it seems to be genetically safe.

ACKNOWLEDGMENTS This research was supported by funds from University of Padua, Progetto di Ateneo awarded to Barbara Zavan.

October 2014; 6(3) Š ariesdue

AUTHOR DISCLOSURE STATEMENT The authors declare that there are no competing interests.

REFERENCES 1. Giannoudis PV, Faour O, Goff T, Kanakaris N, Dimitriou R. Masquelet technique for the treatment of bone defects: tips-tricks and future directions. Injury 2011; 42:591-598.

2. Meinig RP. Clinical use of resorbable polymeric membranes in the treatment of bone defects. Orthop Clin North Am 2010; 41:39-47; table of contents.

3. Retzepi M, Donos N. Guided Bone Regeneration: biological principle and therapeutic applications. Clin Oral Impl Res 2010; 21:567-576.

4. Gottlow J. Guided tissue regeneration using bioresorbable and non-resorbable devices: initial healing and long-term results. J Periodontol 1993; 64:1157-1165.

5. Masquelet AC, Begue T. The concept of induced membrane for reconstruction of long bone defects. Orthop Clin North Am 2010; 41:27-37; table of contents.

6. Pelissier P, Masquelet AC, Bareille R, Pelissier SM, Amedee J. Induced membranes secrete growth factors including vascular and osteoinductive factors and could stimulate bone regeneration. J Orthop Res (official publication of Orthopaedic Research Society )2004; 22:73-79.

7. Viateau V, Guillemin G, Calando Y, Logeart D, Oudina K, Sedel L, Hannouche D, Bousson V, Petite H. Induction of a barrier membrane to facilitate reconstruction of massive segmental diaphyseal bone defects: an ovine model. Veterinary Surg 2006; 35:445452.

8. Dimitriou R, Mataliotakis GI, Calori GM, Giannoudis PV. The role of barrier membranes for guided bone regeneration and restoration of large bone defects: current experimental and clinical evidence. BMC Medicine 2012; 10:81.

9. Hammerle CH, Jung RE. Bone augmentation by means of barrier membranes.

Periodontology 2000 2003; 33:36-53.

10. Wechsler S, Fehr D, Molenberg A, Raeber G, Schense JC, Weber FE. A novel, tissue occlusive poly(ethylene glycol) hydrogel material. Part A. J Biomed Mater Res 2008; 85:285-292.

11. Gardin C, Bressan E, Ferroni L, Nalesso E, Vindigni V, Stellini E, Pinton P, Sivolella S, Zavan B. In vitro concurrent endothelial and osteogenic commitment of adiposederived stem cells and their genomical analyses through comparative genomic hybridization array: novel strategies to increase the successful engraftment of tissueengineered bone grafts. Stem Cells Develop 2012; 21:767-777.

12. Lops D, Bressan E, Pisoni G, Cea N, Corazza B, Romeo E. Short implants in partially edentuolous maxillae and mandibles: a 10 to 20 years retrospective evaluation.

Internat J Dent 2012;2012:351793. doi: 10.1155/2012/351793. Epub 2012 Jul 9. Erratum in: Int J Dent. 2013;2013:372864.

13. Bressan E, Paniz G, Lops D, Corazza B, Romeo E, Favero G. Influence of abutment material on the gingival color of implant-supported all-ceramic restorations: a prospective multicenter study. Clin Oral Impl Res 2011; 22:631-637.

14. Lops D, Chiapasco M, Rossi A, Bressan E, Romeo E. Incidence of inter-proximal papilla between a tooth and an adjacent immediate implant placed into a fresh extraction socket: 1-year prospective study. Clin Oral Impl Res 2008; 19:1135-1140.

15. Abed AM, Pestekan RH, Yaghini J, Razavi SM, Tavakoli M, Amjadi M. A comparision of two types of decalcified freeze-dried bone allograft in treatment of dehiscence defects around implants in dogs. Dental Res J 2011; 8:132-137.

16. Jung RE, Zwahlen R, Weber FE, Molenberg A, van Lenthe GH, Hämmerle CH. Evaluation of an in situ formed synthetic hydrogel as a biodegradable membrane for guided bone regeneration. Clin Oral Impl Res 2006; 17:426-433.

17. Cardarelli L, Sparago A, De Crescenzo A, Nalesso E, Zavan B, Cubellis MV, Selicorni A, Cavicchioli P, Pozzan GB, Petrella M, Riccio A. Silver-Russell syndrome and BeckwithWiedemann syndrome phenotypes associated with 11p duplication in a single family.

Pediatric and developmental pathology (official journal of the Society for Pediatric Pathology and Paediatric Pathology Society) 2010; 13:326-330.

65