tjh-2011-3

Issue 3

September 2011

40 TL

ISSN 1300-7777

Volume 28

TURKISH JOURNAL OF HEMATOLOGY • VOL.: 28 ISSUE: 3 September 2011

Review Article Allogeneic leukocytes in cardiac surgery Yavuz M. Bilgin et al.; Leiden, the Netherlands

Research Articles Polymorphisms in childhood ITP Emel Okulu et al.; Ankara, Turkey

Cytogenetic abnormalities and survival in ALL Milena Georgieva Velizarova et al.; Sofia, Bulgaria

Variant Ph translocations in six CML patients Dilhan Kuru et al.; İstanbul, Turkey

Chemotherapy-induced febrile neutropenia in the emergency department Joo Han Lim et al.; Incheon, Goyang, Chungju, Korea

Autoimmune hemolytic anemia in children and adolescents Nazan Sarper et al.; Kocaeli, Turkey

Ankaferd® in cardiovascular surgery A. Tulga Ulus et al.; Ankara, Turkey

ADAMTS-13 expression in antiphospholipid syndrome Veysel Sabri Hançer et al.; İstanbul, Turkey

Cover Picture: Dr. Ferit Avcu, 2010

3

Editor-in-Chief

International Review Board

Aytemiz Gürgey

Nejat Akar (Turkey) Görgün Akpek (USA) Serhan Alkan (USA) Çiğdem Altay (Turkey) Koen van Besien (USA) Ayhan Çavdar (Turkey) M.Sıraç Dilber (Sweden) Ahmet Doğan (USA) Peter Dreger (Germany) Thierry Facon (France) Jawed Fareed (USA) Gösta Gahrton (Sweden) Dieter Hoelzer (Germany) Marilyn Manco-Johnson (USA) Andreas Josting (Germany) Emin Kansu (Turkey) Winfried Kern (Germany) Nigel Key (USA) Korgün Koral (USA)

Associate Editors

Mutlu Arat Muzaffer Demir Reyhan Diz Küçükkaya Mehmet Ertem Hale Ören Mehmet Ali Özcan Ayşegül Ünüvar Celalettin Üstün Neşe Yaralı Akif Selim Yavuz Past Editors

Erich Frank Orhan Ulutin Hamdi Akan Senior Advisory Board

Orhan Ulutin Yücel Tangün Osman İlhan Language Editors

Corinne Can Scott Evans Statistic Editor

Mutlu Hayran Editorial Secretary

İpek Durusu Bengü Timoçin Cover Picture: Ferit Avcu was born in 1964 in Turkey.

He is currently working at Gülhane Military Medical Academy, Department of Hematology, Ankara, Turkey

Abdullah Kutlar (USA) Luca Malcovati (Italy) Robert Marcus (United Kingdom) Jean Pierre Marie (France) Ghulam Mufti (UK) Gerassimos A. Pangalis (Greece) Santiago Pavlovsky (Argentina) Antonio Piga (Italy) Ananda Prasad (USA) Jacob M. Rowe (Israel) Jens-Ulrich Rüffer (Germany) Norbert Schmit (Germany) Orhan Sezer (Germany) Anna Sureda (Spain) Ayalew Tefferi (USA) Nüket Tüzüner (Turkey) Catherine Verfaillie (USA) Srdan Verstovsek (USA) Claudio Viscoli (Italy)

Contact Information

All other inquiries should be adressed to

Editorial Correspondence should be addressed to Dr. Aytemiz Gürgey Editor-in-Chief Address: 725. Sok. Görkem Sitesi Yıldızevler No: 39/2 , 06550 Çankaya, Ankara, Turkey Phone: +90 312 438 14 60 E-mail: agurgey@hacettepe.edu.tr

TURKISH JOURNAL OF HEMATOLOGY Address: İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No:8 06550 Çankaya, Ankara/Turkey Phone: +90 312 490 98 97 Fax: +90 312 490 98 68 E-mail: info@tjh.com.tr ISSN: 1300-7777

Turkish Society of Hematology

www.tjh.com.tr

Muhit Özcan, President Mutlu Arat, General Secretary Hale Ören, Vice President Muzaffer Demir, Research Secretary Teoman Soysal, Treasurer Fahir Özkalemkaş, Member Mehmet Sönmez, Member

Sahibi

Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish Journal of Hematology’nin Türk Hematoloji Derneği İkdisadi İşletmesi tarafından yayınlanmasına karar vermiştir.

Web page

Türk Hematoloji Derneği adına Muhit Özcan

Sorumlu Yazı İşleri Müdürü Aytemiz Gürgey

Yayın ve Yönetim Yeri Türk Hematoloji Derneği Türk Ocağı Cad. 17/6 Cağaloğlu-Eminönü-İstanbul Üç ayda bir yayınlanan uluslararası bilimsel dergidir.

Baskı: ADA Ofset Matbaacılık Tic. Ltd. Şti.

Basım Tarihi: Temmuz 2011

Publisher: AVES Yayıncılık Address: Kızılelma cad. 5/3 34096 Fındıkzade-İstanbul-Turkey Phone: +90 212 589 00 53 Fax: +90 212 589 00 94 E-mail: info@avesyayincilik.com

A-I

AIMS AND SCOPE The Turkish Journal of Hematology is the regular publishing organ of the Turkish Society of Hematology. This periodical journal covers subjects on hematology. The journal is an independent, peer-reviewed international periodical, published quarterly (March, June, September and December) in English language. The Turkish Journal of Hematology is a nonprofit scientific peer reviewed journal.

Editorial Board of Turkish Journal of Hematology works under the principles of The World Association of Medical Editors (WAME), the International Council of Medical Journal Editors (ICMJE), and Committee on Publication Ethics (COPE).

The aim of the Turkish Journal Hematology is to publish original research papers of highest scientific and clinical value on hematology. Additionally, educational material, reviews on basic developments, editorial short notes, case reports, original views and letters from specialists on hematology, and hematology medicine covering their experience and comments as well as social subjects are published.

General Practitioners interested in hematology, and internal medicine specialists, are also our target audience, and we will arrange the Turkish Journal of Hematology according to their needs. The Turkish Journal of Hematology is indexed in - Science Citation Index Expanded - EMBASE - Scopus - CINAHL - Gale/Cengage Learning - EBSCO - DOAJ - ProQuest - Index Copernicus - Tübitak/Ulakbim Turkish Medical Database Subscription Information The Turkish Journal of Hematology is sent free of charge to hematologists and academicians in our country as well as to other specialists interested in hematology. All published volumes in full text can be reached free of charge through the web site www.tjh.com.tr Adress: Ilkbahar mah. Turan Güneş Bulvarı 613. sok. No: 8 Çankaya-Ankara, Turkey Telephone: +90 312 490 98 97 Fax: +90 312 490 98 68 Web page: www.tjh.com.tr E-mail: info@tjh.com.tr Permissions Requests for permission to reproduce published material should be sent to the editorial office.

Editor: Prof.Dr. Aytemiz Gürgey Adress: Ilkbahar mah. Turan Güneş Bulvarı 613. sok. No: 8 Çankaya-Ankara, Turkey Telephone: +90 312 490 98 97 Fax: +90 312 490 98 68 Web page: www.tjh.com.tr E-mail: info@tjh.com.tr Instructions for Authors Instructions for authors are published in the journal and on the web page www.tjh.com.tr Material Disclaimer The author(s) is (are) responsible from the articles published in the Turkish Journal of Hematology. The editor, editorial board and publisher do not accept any responsibility for the articles.

The journal is printed on acid-free paper.

A-II

INSTRUCTION TO AUTHORS The Turkish Journal of Hematology accepts invited review articles, research articles, brief reports, case reports, letters to the editor, and images in Hematology on subjects within the scope of hematology, on the condition that they have not been previously published elsewhere.

All papers are subject to editorial revision for purpose of conformity to the style adopted by the Journal. Evaluation is a double blind kind of evaluation.

Original research articles Regular Articles Maximum length for a Regular Article is 4,000 words of text. Abstracts must not exceed 300 words with subheadings; objective, material and methods, results, conclusion. Submissions are limited to a total of 7 figures/tables. References should be limited to 50. The sections of a Regular Article should include Abstract, Introduction, Material and Methods, Results, Discussion, References, Figure Legends. Editorial Board of Turkish Journal of Hematology works under the principles of The World Association of Medical Editors (WAME), the International Council of Medical Journal Editors (ICMJE), and Committee on Publication Ethics (COPE).

Brief Reports Short manuscripts definitively documenting either experimental results or informative clinical observations will be considered as brief report.

Brief Reports should not exceed 1,000 words of text not counting the abstract, figure legends, and references; abstracts must not exceed 300 words.

Review Articles Review articles should not exceed 4,000 words in length, must include an abstract of 300 words or fewer, and may not have more than 100 references.

Letters to the Editor Letters can include no more than 400 words of text, 5-10 references, and 1 figure or table. No abstract is required, but please include a brief title.

Images in Hematology Authors can submit for consideration an illustration (or, where appropriate, two or more related images) which is interesting, instructive and visually attractive, with a few lines of

A-III

explanatory text and references. The images (e.g. a clinical photograph, radiology, cytology, histology, a laboratory test) should be submitted in a digital format.

Preparation of Manuscript Each of the following sections of the manuscript should be typed on separate pages. Title Page should include (in Turkish when possible): (a) title of the article in a concise but informative style, (b) first name, middle initial, last name of each author, (c) name of department(s) and institution(s) to which the work should be attributed, (d) name and address of author responsible for correspondence for the manuscript, (e) name and address of author to whom requests for reprints should be addressed, (f) source(s) of support in the form of grants, equipments, drugs, etc., and (h) short running title of no more than 50 characters.

Authorship Each author should have participated sufficiently in the work to take public responsibility for the content. Any part of an article critical to its main conclusions must be the responsibility of at least one author. All authors’ signatures should be included in the title page.

The signed statement on absence of conflict of interests between authors is required.

Acknowledgments Acknowledge support received from individuals, organizations, grants, corporations, or any other sources. For work involving a biomedical product or potential product partially or wholly supported by corporate funding, a note must be included stating: This study was supported (in part) by research funding from (company name) to (authors’ initials). Grant support, if received, needs to be stated and the specific granting institution(s) name(s) and grant numbers provided when applicable.

Authors are expected to disclose, on the title page of their manuscripts, any commercial or other associations that might pose a conflict of interest in connection with the submitted article. All funding sources supporting the work, and institutional or corporate affiliations of the authors, should be acknowledged on the title page.

Ethics When reporting experiments on human subjects indicate whether the procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation. An approval of research protocols by ethic committee in accordance with international agreements (Helsinki Declaration of 1975, revised 2002 available at http://www. wma.net/en/30publications/10policies/b3/ “Guide for the care and use of laboratory animals www.nap.edu/catalog/5140.html/) is required for experimental, clinical and drug studies.

Do not use patient names, initials, or hospital numbers, especially in any illustrative material.

Manuscripts reporting the results of experimental investigations on human subjects must include a statement to the effect that procedures had received official institutional approval. The statement on the informed consent of patients is required.

We frown upon unethical practices such as plagiarism, duplicate publication, ‘salami’ publication, and efforts to influence the review process with practices such as gifting authorship, inappropriate acknowledgements and references.

Also, authors must respect patients’ right to privacy.

Abstract and key words: The second page should include an Abstract which does not exceed 300 words. For manuscripts sent from Turkey, a title and abstract in Turkish are required. The abstract should state the purpose of the study or investigation, basic procedures, methods, main findings, specific data, statistical significance and the principal conclusions. Provide 4 to 10 key words below the abstract to assist indexers.

Use terms from the Medical Subject Headings List of Index Medicus. The text should be divided into sections with headings as follows: Objective, Materials and Methods, Results and Conclusion. Other types of articles such as case reports, reviews, perspectives and editorials will be published according to uniform requirements.

Introduction: State the purpose of the article and summarize the rationale for the study.

Materials and Methods: Describe your selection of the observational or experimental subjects clearly. Identify the methods and procedures

in sufficient detail to allow other workers to reproduce the results. Give references to established methods (including statistical methods), provide references and brief modified methods, give reasons for using them and evaluate their limitations. Identify all drugs and chemicals used, including generic name(s), dose(s) and route(s) of administration.

Statistics: Describe statistical methods in enough detail to enable a knowledgeable reader with access to the original data to verify the reported results. Give details about randomization, describe treatment complications, give number of observations, and specify any computer program used.

Results: Present your results in logical sequence in the text, tables and illustrations. Do not repeat in the text all the data in the tables or illustrations; emphasize or summarize only important observations.

Discussion: Emphasize the new and important aspects of the study and the conclusions that follow them. Link the conclusions with the goals of the study but avoid unqualified statements and conclusions not completely supported by your data.

References: Identify references in text, tables and legends by Arabic numerals in parentheses.

Number references consecutively in the order in which they are first mentioned in the text. The titles of the journals should be abbreviated according to the style used in Index Medicus; consult List of Journals Indexed in Index Medicus. Include among the references any papers accepted but not yet published, designating the journal and followed by “in press”.

Articles in Journals 1. List all authors Williams RL, Hilton DJ, Pease S, Wilson TA, Stewart CL, Gearing DP, Wagner EF, Metcalf D, Nicola NA, Gough NM. Myeloid leukemia inhibitory factor (LIF) maintains the developmental potential of embryonic stem cells.

Nature 1988;336:684-7.

2. Organization as author Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of syngeneic bone marrow graft without preconditioning in posthepatitis marrow aplasia. Lancet 1977;2:742-4.

A-IV

3. Complete book Adams DO, Edelson PJ, Koren HS. Methods for studying mononuclear phagocytes. San Diego: Academic Press, 1981.

4. Chapter of book Smolen JE, Boxer LA. Functions of Neutrophils.

In: Williams WJ, Beutler E, Erslev AJ, Lichtman MA, eds. Hematology. 4th ed. New York: McGraw-Hill, 1991: 780-94.

5. Abstract Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin) stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).

6. Letter to the Editor Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further definition of 20q deletion in myeloid leukemia using fluorescence in situ hybridization. Blood 1994;84:2821-3.

7. CD-ROM Anderson SC, Poulsen KB, Andersüon’s electronic atlaso hematology [CD-ROM].

Philadelphia: Lippincott Williams&Wilkins: 2002.

8. Journal article on the internet Abood S. Quality improvement intititative in nursing homes: The ANA acts in an advisory role. Am J Nurs [serial on the Internet.] 2002 n [cited 2002 Aug 12]:102(6)[about 3 p.] Available from: http:/www.nursing world.org/AJN/2002/ June/Wawatch.htm.

9. Homepage/Web site Cancer-Pain.org [homepage on the Internet].

New York: Association of Cancer Online Resources, Inc.: c2000-01 [updated 2002 May 16: cited 2002 Jul 9]. Available from: hhtp:// www.cancer-pain.org/.

Tables Type each table on a separate sheet. Number tables consecutively in the order of appearance in the text and supply a brief title for each. Give each column a short or abbreviated heading. Place explanatory statistical measures of variations such as standard deviation or standard error of mean.

Be sure that each table is cited in the text.

Illustrations Figures should be professionally drawn and photographed. Please send sharp, glossy, black

and white photographic prints, usually 9 x 13 cm.

Affix a label to the back of each figure indicating the number of the figure, first author’s name and top of the figure. Type legends for illustrations double-spaced, starting on a separate page with Arabic numerals corresponding to the illustrations.

Explain the internal scale and identify method of staining.

Units of Measurement Measurements should be reported in the metric system in terms of the International System of Units (SI). Consult SI Unit Conversion Guide, New England Journal of Medicine Books 1992, when necessary.

Abbreviations and Symbols Use only standard abbreviations. Avoid abbreviations in the title and abstract. The full term for which an abbreviation stands should precede its first use in the text unless it is a standard abbreviation.

ONLINE MANUSCRIPT PROCESS

SUBMISSION

The Turkish Journal of Hematology now uses submission software powered by ScholarOne Manuscripts. The website for submissions to the Turkish Journal of Hematology is: http:// mc.manuscriptcentral.com/tjh. This system is quick and convenient for both authors and reviewers.

Manuscript Types accepted by the Turkish Journal of Hematology are: Original Article, Case Reports, Images in Hematology, Brief Reports, Letter to the Editor, Invited Review Setting up an account New users to the submission site will need to register and enter their account details before they may submit an article. Log-in or click the “Create Account” option if you are a first-time user. If you are creating a new account: After clicking on “Create Account”, enter your name and e-mail information and click “Next”.

Your e-mail information is very important.

Enter your institution and address information as appropriate, and then click “Next.”

Enter a user ID and password of your choice, and then select your area of expertise.

Click “Finish”.

If you have an account, but have forgotten your log-in details, go to Password Help on the journal’s online submission system and enter your e-mail address. The system will send you an automatic user ID and a new temporary password.

Full instructions and support are available on the site and a user ID and password can be obtained on the first visit. Full support for authors is provided. Each page has a 'Get Help Now' icon on the site connecting directly to the online support system. Contact the journal administrator for any questions about submitting your manuscript to the journal (info@tjh.com.tr). For Customer Support from ScholarOne Manuscripts, click on the Get Help Now link on the top right hand corner of every screen on the site.

The electronic submission process Log-in to your author centre. Once you have logged-in, click the “Submit a Manuscript” link in the menu bar.

Enter data and answer questions as appropriate.

You may copy and paste directly from your paper. Click the "Next" button on each screen to save your work and advance to the next screen.

Upload of files: Click on the “Browse” button and locate the file on your computer.

Select the appropriate designation of each file in the drop-down menu next to the Browse button.

When you have selected all files you wish to upload, click the “Upload Files” button.

Review your submission before sending to the Journal. Click the “Submit” button when you are finished reviewing.

You can check ScholarOne Manuscripts at any time to see the status of your paper. The Journal’s Editorial Office will inform you by e-mail once a decision has been made.

Once your paper has been submitted, a ‘checklist’ will then be completed by the Editorial Assistant.

The Editorial Assistant will check to see that the paper has all required components and adheres to the author guidelines. Once the Editorial Assistant is satisfied with the paper it will be

A-V

forwarded to the Senior Editor who will assign an editor and reviewers.

The review process All papers submitted to TJH are subject to an initial review by the Editorial Office, to check that the paper is proper for TJH’s aims and scope and complies with essential requirements.

Papers sent on to peer review will be assigned to one of TJH’s Associate Editors with expertise in the relevant field. Papers are single-blind peer reviewed. All accepted manuscripts will be sent to a statistical and English Language editor before publishing.

Once papers have been reviewed, the reviewers’ comments are sent to the Editor, who will then make a preliminary decision on the paper. At this stage, based on the feedback from reviewers, manuscripts can be accepted, rejected, or revisions can be recommended.

Following initial peer-review, articles judged worthy of further consideration often require revisions. Revised manuscript generally must be received within 3 months of the date on the initial decision. Extensions must be requested from the Associate Editor at least 2 weeks before the 3-month revision deadline expires.

Otherwise Turkish Journal of Hematology will reject manuscripts which do not received within 3 months of the date on the initial revesion decision. Papers which have extensive revisions recommended will be sent out for further review (usually by the same reviewers) on their resubmission.

When a paper is finally accepted, the Technical Editor undertakes a final edit and a marked-up copy will be emailed to you to make any final adjustments.

Submission of revised papers When you are revising your paper, taking on board the reviewers’ and Editor’s feedback, please highlight all changed text in red font.

Please do not use track changes as they can make papers difficult to follow.

To submit revised papers please log into your author centre in ScholarOne Manuscripts. Your paper will be stored under ‘manuscripts with decisions’. Please click on the ‘create a revision’

link, located to the right of the paper title. A revised paper number will be created for you.

You will then need to click on the ‘continue submission’ option.

You will be taken to a submission process very similar to that for new papers. You will be able to amend any details you wish. At stage 6 (‘File upload’) please delete the file for your original paper, and upload your revised paper.

Please upload an anonymous cover letter, preferably in table format, which includes a point by point response to the feedback given in the decision email, alongside your revised paper word file.

You will then need to review your paper as a PDF, and click ‘submit’. Your paper will have the same ID number as your original paper, with an ‘R’ and a number on the end - for example, TJH-2011-0001 for an original paper, TJH-20110001.R1 for a ‘revision one’, and so on.

Please do not submit your revised paper as a new paper, as revised manuscripts are processed differently. If, when you click on ‘create a revision’, a message is shown saying that the revision option has expired, please contact the Editorial Assistant on info@tjh.com.tr to get it reactivated.

English-language editing All manuscripts are professionally edited by English language editor before publication.

Online Early Turkish Journal of Hematology published abstracts of accepted articles online in advance of their publication in a printed issue. Once an accepted article has been edited, the authors have submitted any final corrections, and all changes have been incorporated, the article will be published online.

Then, the article will receive a Digital Object Identifier (DOI number).

A Copyright transfer and conflict of interest form signed by all authors, must also be submitted by fax to +90 3124909868. Both forms can be found at the web site www.tjh.com.tr Authors of accepted manuscripts will receive electronic page proofs directly from the printer and are responsible for proofreading and checking the entire article, including tables, figures, and references. Page proofs must be returned within 48 hours to avoid delays in publication.

CONTENTS Review Article 160

Allogeneic leukocytes in cardiac surgery: Good or bad?

Yavuz M. Bilgin, Anneke Brand, Leiden, the Netherlands

Research Articles 170

The role of tumor necrosis factor-alpha -308 G/A and transforming growth factor-beta 1 -915 G/C polymorphisms in childhood idiopathic thrombocytopenic purpura Emel Okulu, Talia İleri, Vildan Koşan Çulha, Fatih Mehmet Azık, Yonca Eğin, Zümrüt Uysal, Nejat Akar, Ankara, Turkey

176

Influence of detection of pretreatment cytogenetic abnormalities on first complete remission and survival in adult acute lymphoblastic leukemia

Milena Georgieva Velizarova, Evgueniy A. Hadjiev, Kamelia V. Alexandrova, Ivanka I. Dimova, Draga I. Toncheva, Nadya E. Dimitrova, Sofia, Bulgaria

186

Variant Philadelphia translocations with different breakpoints in six chronic myeloid leukemia patients

193

Outcomes in 102 patients that present to the emergency department with chemotherapyinduced febrile neutropenia

198

Management of autoimmune hemolytic anemia in children and adolescents: A single center experience

206

Surgical and histopathological effects of topical Ankaferd® hemostat on major arterial vessel injury related to elevated intra-arterial blood pressure

Dilhan Kuru, Yelda Tarkan Argüden, Muhlis Cem Ar, Ayşe Çırakoğlu, Şeniz Öngören, Şükriye Yılmaz, Ahmet Emre Eşkazan, Ayhan Deviren, Teoman Soysal, Seniha Hacıhanefioğlu, Birsen Ülkü, İstanbul, Turkey Joo Han Lim, Hoon Kim, Woong Gil Choi, Kyung Hwan Kim, Dong Wun Shin, Moon Hee Lee, Incheon, Goyang, Chungju, Korea Nazan Sarper, Suar Çakı Kılıç, Emine Zengin, Sema Aylan Gelen, Kocaeli, Turkey

A. Tulga Ulus, Nilüfer N. Turan, Sertan Özyalçın, Gülden Aydoğ, Fatma Ulus, Hakan Göker, İbrahim C. Haznedaroğlu, Ankara, Turkey

213

ADAMTS-13 gene expression in antiphospholipid syndrome

Veysel Sabri Hançer, Reyhan Diz Küçükkaya, Ayşegül Topal-Sarıkaya, İstanbul, Turkey

Case Reports 219

The effect of HBB:c.*+96T>C (3’UTR +1570 T>C) on the mild β-thalassemia intermedia phenotype

223

Eculizumab before and after allogeneic hematopoietic stem cell transplantation in a patient with paroxysmal nocturnal hemoglobinuria

Türker Bilgen, Duran Canatan, Yunus Arıkan, Akif Yeşilipek, İbrahim Keser, Antalya, Turkey

Hakan Göker, Burak Uz, Yahya Büyükaşık, Salih Aksu, İbrahim Haznedaroğlu, Nilgün Sayınalp, Yasemin Karacan, Fatma Tekin, Osman İlhami Özcebe, Ankara, Turkey

228

Extramedullary plasmacytoma presenting as a mediastinal mass

232

Non-Hodgkin's lymphoma in a chronic myelocytic leukemia patient treated with imatinib

Arpana Shukla, Vivek Bansal, Ritu Bhutani, Gaurav Kumar, Jai Sharma, Surinder Solanki, Anurag Mehta, Delhi, India Semra Paydaş, Berna Bozkurt Duman, Melek Ergin, Adana, Turkey

Letters to the Editor 235

The incidence of alpha-thalassemia in Iraqi Turks

Arjan Esmael, Ayşenur Öztürk, Nejat Akar, Ankara, Turkey

A-VI

237

Non-Hodgkin’s lymphoma in a hemophilic patient with a traumatic hematoma

239

A chronic eosinophilic leukemia patient presenting with blurred vision

241

The frequency of FV G1691A and PT G20210A mutations in an Albanian population

243

Cytopenia associated with iron deficiency anemia and iron therapy: A report of two cases

245

Accidental intrathecal methotrexate overdose

247

CTLA-4 A49G polymorphism and autoimmune blood disease: A comment

248

Iron deficiency anemia and total antioxidant capacity

249

Decreased erythrocyte catalase level in iron deficiency

250

Partial splenic embolization versus splenectomy for the management of autoimmune hemolytic anemia: A response

Nihal Özdemir, Ayşe Yurt, Emine Türkan, Tiraje Celkan, İstanbul, Turkey Demircan Özbalcı, Ülkü Ergene, Harun Yazgan, Manisa, Turkey

A. Avni Atay, Mustafa Tekin, Klodian Allajalebeu, Yonca Eğin, Nejat Akar, Ankara, Turkey Nihal Özdemir, Tiraje Celkan, Rejin Kebudi, Meltem Bor, İnci Yıldız, İstanbul, Turkey Emel Özyürek, Namık Özbek, Samsun, Ankara, Turkey Viroj Wiwanitkit, Bangkok, Thailand Viroj Wiwanitkit, Bangkok, Thailand Şinasi Özsoylu, Ankara, Turkey

Selami Koçak Toprak, Ankara, Turkey

Images in Hematology 252

A rare cause of iron deficiency anemia in a child: Lithobezoar

254

An unusual cause of iron deficiency anemia in a healthy man: Hijamah

Yasemin Altuner Torun, Edip Torun, Ayşe Betül Ergül, Musa Karakükçü, Türkan Patıroğlu, Kayseri, Turkey Remzi Adnan Akdoğan, Elif Akdoğan, Rize, Turkey

A-VII

160

Review

Allogeneic leukocytes in cardiac surgery: Good or bad?

Kalp cerrahisinde allogeneik lökositler: İyi mi, kötü mü?

Yavuz M. Bilgin, Anneke Brand Leiden University Medical, Department of Immunohematology and Blood Transfusion Center, and Sanquin Bloodbank South West Region, Leiden, the Netherlands

Abstract Worldwide, cardiac surgery is a common procedure requiring a large quantity of allogeneic blood products, which are associated with postoperative complications. Leukocytes present in blood products may play a role in these complications, which are referred to as transfusion-related immunomodulation (TRIM). Several randomized controlled trials (RCTs) in different settings investigated the effects of allogeneic leukocytes in red blood cells (RBCs). Cardiac surgery studies reported a reduction in postoperative infections and mortality in patients that received leukocyte-reduced RBCs compared with leukocyte-containing RBCs; this was mainly due to more deaths due to infections and multiple organ dysfunction syndrome (MODS) in the group that received leukocyte-containing RBCs. Patients with postoperative complications had higher concentrations of inflammatory mediators. These findings suggest that leukocytecontaining transfusion during cardiac surgery induces a second insult to the systemic inflammatory response. In the present review we discuss the possible role of blood transfusions in cardiac surgery.

Especially, we focus on the possible role of allogeneic leukocytes associated with postoperative complications after cardiac surgery. (Turk J Hematol 2011; 28: 160-9) Key words: Blood transfusions, transfusion-related immunomodulation, leukodepletion, infections, mortality, cardiac surgery Received: December 30, 2010

Accepted: April 18, 2011

Özet Kalp cerrahisi, postoperatif komplikasyonlarla ilişkilendirilen çok sayıda allogeneik kan ürünlerini gerektiren dünya genelinde yaygın bir girişimdir. Kan ürünlerinde bulunan lökositler, transfüzyon ile ilişkili immünomodülasyon (TRIM) olarak adlandırılan bu tür etkilerde bir rol oynayabilir. Alyuvarlarda (RBC) allogeneik lökositlerin etkisinin araştırılması için farklı koşullarda çeşitli rasgele (randomize) kontrollü çalışmalar yapılmaktadır. Kalp cerrahisi çalışmalarında lökosit içeren RBC uygulanan hastalarda postoperatif enfeksiyonlar ve mortalitede maliyet etkinliği sağlayan bir azalma gösterilmiştir. Bu etkiler temelde enfeksiyonlar ve çoklu organ disfonksiyonu sendromuna bağlı daha fazla ölümden kaynaklanır. Postoperatif komplikasyonlu hastalarda enflamatuvar mediyatörler daha yüksek konsantrasyonlarda mevcuttur. Bu bulgular kalp cerrahisi sırasında lökosit içeren transfüzyonların sistemik enflamatuvar yanıta bağlı bir hasara neden olduğunu düşündürmektedir. Bu incelemede kalp cerrahisinde allogeneik lökositlerin olası rolleri ele alınmaktadır. Allogeneik lökositlerin rolünün anlaşılabilmesi için olası mekanizmalar önerilmektedir. (Turk J Hematol 2011; 28: 160-9) Anahtar kelimeler: Kan transfüzyonları, transfüzyon ile ilişkili immünomodülasyon, lökodeplesyon, enfeksiyonlar, mortalite, kardiyak cerrahisi Geliş tarihi: 30 Aralık 2010

Kabul tarihi: 18 Nisan 2011

Address for Correspondence: Yavuz M. Bilgin MD, Erasmus Medical Center, Department of Hematology, Postbus 5201, 3008 AE Rotterdam, the Netherlands Phone: +31 10 703 3123 Fax: +31 10 703 5814 E-mail: bilginyavuz@hotmail.com doi:10.5152/tjh.2011.49

Turk J Hematol 2011; 28: 160-9

Introduction Allogeneic blood transfusions are administered to control acute bleeding and to treat severe anemia. Regarding transmission of infections in wellsourced countries, blood transfusion is safer than ever, although blood transfusion will be a never zero-risk procedure [1]. Coronary artery bypass graft (CABG) surgery is frequently performed for revascularization of the myocardium. Worldwide, approximately 1,000,000 patients undergo cardiac surgery annually. Currently, the number of elderly patients, including those with co-morbidity, that undergo surgery is increasing. Due to bleeding, hemodilution, and consumption of coagulation factors and platelets in the extracorporeal circuit patients undergoing cardiac surgery receive a large quantity of blood components. With the advent of blood-sparing procedures the need for blood transfusions has been reduced; however, cardiac surgery still consumes a large proportion of all red blood cell (RBC) transfusions, estimated to be approximately 20% of the total blood supply [2]. The transfusion rate for CABG varies greatly between hospitals, with a mean number of transfused units ranging from 0.4 to 6.3 units patient–1 [3,4].

The clinical effects of blood transfusion in cardiac surgery remains contentious. In the last decade clinical studies have focused on the indications for transfusion, storage of blood products, and leukocytes in blood products in an effort to improve the safety of blood transfusion. The present review concentrates on the effects of blood transfusion in patients undergoing cardiac surgery.

The Effects of the Indications for RBC Transfusion For decade’s a hemoglobin (Hb) level of 10 g-dL (6.2 mmol/L) was considered an appropriate indication for RBC transfusion [5]. A randomized controlled trial (RCT) performed in the 1990s challenged the classical RBC transfusion policy [6], resulting in a tendency for a lower Hb level as an indication [7]. In this large-scale RCT that included 838 patients in an intensive care unit (ICU), the patients were either transfused to maintain an Hb value 7-9 g/dL (restrictive) or >10 g/dL (liberal).

Patients assigned to the restrictive indication group received a mean 2.6 units of RBCs, compared to a mean 5.6 units in the liberal indication group.

Mortality at 30 d the primary outcome measure did not differ significantly between the groups, which was 18.7% and 23.3% in the restrictive and liberal indication groups, respectively (OR: 0.80; 95% CI:

Bilgin et al.

Allogeneic leukocytes in cardiac surgery

161

0.61-1.04 [p=0.11]). Among the subgroups of patients <55 years of age and those with a low APACHE (Acute Physiology And Chronic Health Evaluation) risk score, mortality was significantly lower in the restrictive indication group than in the liberal indication group (5.7% versus 13% [p=0.02] and 8.7% versus 16.1% [p=0.03], respectively) [6].

A recent cardiac surgery RCT that included 502 patients reported that a more restrictive RBC strategy based on a hematocrit of 24% is as safe as a liberal RBC strategy based on a hematocrit of 30%; 30-d mortality and morbidity were approximately 10% in both groups [8]. Since the implementation of universal leukodepletion of RBCs in several countries, 2 observational studies reported that allogeneic blood transfusion was not associated with high mortality rates, but instead, highHb concentrations and receipt of blood transfusions were associated with lowmortality rates [9,10]; however, this finding has yet to be confirmed by RCTs. The Effects of RBC Storage During storage RBCs undergo a number of structural and functional alterations, referred to as storage lesions. Changes in shape, rigidity, depletion of 2,3-diphosphoglycerate (2,3 DPG), and nitric oxide scavenging are presumed to result in impaired perfusion and oxygen delivery [11,12]. The clinical effects have only been evaluated in observational studies in different clinical settings, and the results were inconclusive. Several retrospective cardiac surgery studies investigated RBC storage duration [13-17], but the findings were inconsistent. A recent cardiac surgery observational study investigated the effects of peri-operative transfusion of RBCs stored <14 d or >14 d [18]. The study reported that the 1-year mortality rate was higher in patients that received RBCs stored >14 d; however, the association between storage duration and mortality was based only on unadjusted analysis. Identifying confounders were not adjusted for RBC storage duration, which led to several letters in response [19].

Because different blood products and storage durations were used, meta-analysis could not be used to formulate a reliable consensus on the possible association between RBC storage duration, and morbidity and mortality [20]. As such, results from prospective studies are needed.

Allogeneic Leukocytes in RBC Products Allogeneic RBC transfusion has profound effects on the recipient’s immune system. This immunomodulatory effect of blood transfusion, presumed to

162

Bilgin et al.

Allogeneic leukocytes in cardiac surgery

be due to allogeneic leukocytes, was first recognized in the 1970s in kidney allograft patients in whom pre-transplant blood transfusion improved allograft survival [21]. In the 1980s it was suggested that such immune suppression could cause cancer recurrence and postoperative infections [22]. These possible adverse effects of blood transfusion are referred to as transfusion-related immunomodulation (TRIM) and the mechanisms of TRIM are not fully understood. Many clinical and laboratory studies investigated the possible immunomodulatory effects and mechanisms of TRIM, and several factors have been suggested to play a role. The most commonly suspected factors are allogeneic mononuclear cells, soluble biological response modifiers circulating in plasma, and leukocyte-derived mediators.

Allogeneic leukocytes or soluble factors released by leukocytes during storage have been extensively studied in recent years [23]. Because allogeneic leukocytes are the most important factor thought to be responsible for the clinical effects of TRIM, RCTs investigating their role are indispensable. In an effort to investigate the clinical effects of TRIM several studies compared leukocyte-containing and leukodepleted blood products in different clinical settings. Two RCTs compared the effects of buffy coatpoor RBC and filtered RBC on cancer recurrence following colorectal surgery performed with curative intent. Both studies evaluated long-term outcome after 5 and 7 years of follow-up and did not observe a difference in colorectal cancer recurrence [24-26]. Several RTCs investigated the effect of leukocyte-containing blood transfusion on postoperative infections, primarily in colorectal surgery.

Before the 2000s only selected patients received leukodepleted transfusions for the prevention of HLA alloimmunization, cytomegalovirus (CMV) transmission (or reactivation), and febrile nonhemolytic transfusion reactions (FNHTR) due to cytokines or leukocyte antibodies present in the patient. Since 2002, all patients in the Netherlands that require transfusion receive leukodepleted blood transfusions. In the last decennium last years more countries in the Western World implemented universal leukodepletion for RBCs. Countries that have not yet converted to universal leukodepletion that seek a new policy should base their decision on the available RTC data.

The Clinical Effects of Allogeneic Leukocytes in Cardiac Surgery On average, more patients receive allogeneic blood transfusions during cardiac surgery than in

Turk J Hematol 2011; 28: 160-9

other clinical settings. Several observational studies on cardiac surgery reported that perioperative administration of blood products is dose-dependently associated with increases in the incidence of postoperative infections and mortality [27]. Observational studies observed that RBC transfusion was the most consistent factor associated with mortality and morbidity [28,29]; however, these were retrospective studies and therefore provide no proof of the causal effect of allogeneic RBC transfusion on postoperative morbidity and mortality after cardiac surgery, in which many factors influence outcome; to date, this association is not fully understand. Compared to other unexpected adverse transfusion effects, the clinical effects of leukocyte-mediated TRIM on mortality following cardiac surgery are more well-known [30]; therefore, the role of TRIM in cardiac surgery requires further study in order to increase our understanding of the effects of allogeneic leukocytes on postoperative complications and outcome. As allogeneic leukocytes are the most important factor associated with the clinical effects of TRIM, RCTs investigating their role followed.

Four cardiac surgery RCTs have been published [31-34] and 2 other cardiac surgery studies are available only as abstracts and contain limited data [35,36]. The primary methods and results are shown in the Table 1. Two of these trials randomized patients to receive 3 different blood products. One of the studies compared buffy coat-depleted (BCD)RBCs and 2 different filtered RBCs fresh filtered RBCs before storage (FF-RBCs) or stored filtered RBCs (SF-RBCs) [31]. All products had a similar shelf life of about 13 d. The 60-d mortality rate was 7.8% in the group that received BCD-RBCs, as compared to 3.6% and 3.3% in those that received FF-RBC and SF-RBC products, respectively (p=0.015). This suggests that soluble mediators still present in the SF-RBC products did not cause more adverse effects than FF-RBCs that lacked leukocyte-derived soluble factors. Subgroup analysis showed that the mortality rate was only higher in the patients that received >3 RBC units in the BCD-RBC group than in the filtered RBC group. Wallis et al. [32] conducted a study using 3 types of blood products: filtered whole blood (stored <7 d before filtration), BCD-RBC, and plasma-reduced RBCs. Postoperative mortality at 3 months was 0.5%, 2.9%, and 2.5%, respectively (p=0.2), indicating no additional deleterious effect of the greater number of leukocytes in plasmareduced RBCs, as compared to BCD-RBCs [32]. van

Turk J Hematol 2011; 28: 160-9

de Watering et al. [31] observed that mortality due to multiple-organ-dysfunction-syndrome (MODS) was the major cause of excess death following standard BCD-RBC transfusion. Bilgin et al. studied complex cardiac valve surgery, which has a high probability of multiple RBC transfusions and a high risk for postoperative complications. The aim was to examine the relationship between leukocyte-containing transfusion, and MODS and mortality [33]. The primary endpoint 90-d mortality was (not significantly) reduced by approximately 33% in the patient group that received leukocyte-depleted RBCs, as compared to the group that received BCD-RBCs (12.7% versus 8.4%, p=0.16). Hospital mortality in the leukocyte-depleted RBC group was almost 50% less than that in the BCD-RBC group (5.5% versus 10.1%, p=0.05). Surprisingly, in this study the incidence of MODS (20%) was similar in the groups that received standard BCD-RBCs and pre-storage filtered RBC; however, MODS-related death occurred more often in patients that received BCD-RBCs. Subgroup analysis showed that among the patients that received BCD-RBCs, only those that received >3 units had a higher mortality rate (17.6% versus 8.3%, p=0.02). A small-scale study that included 69 low-risk CABG patients compared bedside-filtered RBCs (containing soluble leukocyte-produced factors) and the same unfiltered RBC product [34]. There was no difference in mortality between both randomized arms. This study was stopped prematurely because interim analysis showed that there were fewer respiratory tract infections in the filtered group (p=0.048), although the total infection rate did not differ (p=0.22). When the results of cardiac surgery RCTs were meta-analyzed, the mortality rate increased to 72% in patients that received leukocyte-containing RBCs (OR: 1.72; 95% CI: 1.05-2.81, p=0.01) [37]; the difference between leukocytecontaining and filtered group was primarily due to the results of the 2 studies from the Netherlands [31,33]. It should be noted that these large studies were comparable and were conducted with patients associated with a high risk for postoperative complications and multiple RBC transfusions. As not all studies have been published in full (some are only available as an abstract), at present, data are l imited. Moreover, some (undocumented) differences in the use and preparation of blood products and in endpoints between studies may be why the findings vary.

Bilgin et al.

Allogeneic leukocytes in cardiac surgery

163

It was reported that the number of units transfused not the soluble mediators leukocytes release during storage [31] or the leukocyte load per transfusion [32] is associated with poor outcome [31,33], suggesting that patients in poor clinical condition that undergo cardiac surgery and require multiple RBC transfusions are more susceptible to TRIM than other patients. We analyzed in detail the causes of death in 2 cardiac surgery RCTs [31,33] and observed that the rate of excessive death due to a combination of infection and MODS among the patients that received standard buffy coat-poor RBCs was higher than that among the patients that received leukodepleted FF-RBCs (OR 2.92; 95% CI 1.22-6.97; p=0.02).

Short-term mortality (60 d) due to infections alone and from MODS alone, or due to bleeding or surgical complications was equal in both transfusion arms [38]. Although in cardiac surgery patient longterm survival is negatively affected by allogeneic blood transfusions, as compared to non-transfused patients [39], the long-term effects of allogeneic leukocytes in RBCs after cardiac surgery are not known and require further study.

In total, 13 RCTs on leukodepleted blood transfusions in different clinical settings evaluated postoperative infections as a primary or secondary endpoint [31-36,40-46]. These studies included singleand multicenter designs, clinical diagnosis, methods for documenting and reporting infections, and the proportion of transfused patients (range: 14%95%). Among them, 5 included patients undergoing colorectal or gastrointestinal surgery [40-44], 1 was performed with patients undergoing aortic aneurysm repair or resection of gastrointestinal malignancy [45], and 1 included trauma patients [46].

The postoperative infection results in these RCTs, which were conducted with different patient populations using different study designs, are inconsistent. Based on intention-to-treat analysis, Vamvakas concluded that there wasnâ&#x20AC;&#x2122;t an association between leukocyte-containing transfusions and the incidence of postoperative infection [37]. Blumberg et al. analyzed subgroups of transfused patients only, excluding 36% of the patients, and concluded that there was a significant and clinically relevant 48% reduction in the postoperative infection rate following transfusion of leukocyte-depleted RBCs [47]. Due to the heterogeneity of the study designs and the types of blood products used in these RCTs, an overall consensus could not be made, not even based on meta-analysis of the studies. Postoperative infection was examined in 6 cardiac surgery RCTs and the

164

Bilgin et al.

Allogeneic leukocytes in cardiac surgery

Turk J Hematol 2011; 28: 160-9

results were inconsistent [31-36]. Two RCTs reported a transfusion dose-dependent beneficial effect of leukocyte-depleted RBCs [31,33], 3 reported no benefit from leukocyte-depleted RBCs [32,35,36], and 1 RCT showed only benefit from leukocyte-depleted RBCs in the incidence of pneumonia [34]. The characteristics and main results of these cardiac surgery RCTs are shown in the Table 1. How postoperative infections was defined in the studies published only as abstracts is not mentioned; this was not different in the studies that were fully published.

Analyses on the cost-effectiveness of leukodepletion are scarce and are mainly based on observational data. The available data show that there is a benefit in selected patient populations. Leukodepletion of whole blood was associated with lower hospital costs than leukocyte-containing blood transfusions in colorectal surgery [48] and that leukodepletion of platelets was beneficial in the treatment of acute myeloid leukemia and lymphoma [49]. The costeffectiveness of cardiac surgery was analyzed based on data derived from 2 studies performed in the Netherlands [31,33]. The results showed that RBC leukodepletion was cost effective. The benefit of leukodepletion of RBCs was between $220-$310 US per life-year gained in CABG patients [50] and $214 US per cardiac valve surgery patient, on average [51].

Because most West European countries have implemented universal leukodepletion, new RCTs from these countries are not expected. As such, observational studies were performed to compare the incidence of complications before and after this implementation. One large multicenter study that included critically ill patients (including cardiac surgery patients) reported a reduction in hospital mortality and a decrease in the occurrence of fever and use of antibiotics after implementation of universal leukodepletion [52]. Despite the large number of studies, leukocyte-containing RBCs remains controversial.

During cardiac surgery RBCs are not the only transfused blood product used. A substantial proportion of patients also receive plasma and platelet transfusions. Plasma transfusions can contribute to adverse outcome by causing transfusion-related acute lung injury (TRALI), a serious life-threatening and underreported complication of allogeneic blood transfusions. The pathophysiology of TRALI is not fully understood; all plasma-containing blood products could be involved in the development of TRALI [53]. It has been suggested that platelet transfusions in cardiac surgery might be associated with postoperative complications. Whether or not platelet and plasma transfusions contribute to such postoperative complications, or are just a surrogate marker for the need for a higher number of RBC transfusions

Table 1. Comparison of RTCs that included patients transfused with leukodepleted and leukocyte-containing RBCs Transfused Units of RBCs Patients (mean±SD

or median)

Main Endpoints

Resultsb

Pb

van de Watering 914/866 (95) CABG±valve et al. 1998 [31] surgery

FF 283 FF 5.3±4.1 SF 280 SF 5.5±5.6 BCD 303 BCD 5.4±5.1

1) Infections 2) 60-d mortality

1) 17.3% vs 23.0% 2) 3.5% vs. 7.8%

1) 0.13 2) 0.01

Bracey et al.

357/295 (83) 2002 [35]a

LD 136 BCC 159

1) Infections 2) Mortality

1) data ND 2) 5.9% vs. 7.5%

1) ns, data ND 2) ns, data ND

1) Infections 2) 90-d mortality

1) 11.1% vs. 17.7% 2) 1.7% vs. 2.5%

1) 0.1 2) 0.2

Study

No. of Patients/ Clinical No. transfused Setting (%)

CAGB±valve surgery

Wallis et al.

597/409 (69) CABG±valve 2002 [32] surgery

LD 3 BCC 3

LD 176 LD 3.9±3.9 BCC 175 BCC 3.5±2.6 PR 158 PR 2.9±1.8

Bilgin et al.

474/432 (91) Valve LD 216 LD 6.2±7.1 1) Infections 1) 22.6% vs. 31.6%% 2004 [33] surgery±CABG BCD 216 BCD 5.9±6.1 2) MODS 2) 20.4% vs. 20.7%

3) Hospital mortality 3) 5.5% vs. 10.1%

4) 90-d mortality 4) 8.4% vs. 12.7% Connery et al.

98/69 (70) Primary CABG LD 38 LD 5.6±13 1) Infections 2005 [34] BCC 31 BCC 5.6±10 2) 30-d mortality

Boshkov et al. 1227/562 (46) CABG LD 304 ND 2006 [36]a ±valve surgery BCC 258

1) Serious infections 2) 60-d mortality

1) 0.02 2) 0.98 3) 0.05 4) 0.16

1) 13.2 vs. 25.8% (PTI: 0% vs. 12.9%) 2) 2.6% vs. 3.2%

1) 0.22 (PTI:0.048) 2) 1.0

1) data ND 2) 4.9% vs. 9.7%

1) ns, data ND 2) 0.36

aAvailable only as abstract bComparison of leukocyte-depleted and leukocyte-containing RBCs

LD: Leukodepleted RBCs; FF: fresh filtered RBCs; SF: stored filtered RBCs; BCD: buffy-coat-depleted RBCs; BCC: buffy-coat-containing; WBF: white blood cell filtered; PR: plasma-reduced; ND: not documented; PTI: pulmonary tract infections; MODS: multiple organ dysfunction syndrome

Turk J Hematol 2011; 28: 160-9

remain unknown. A predominant role of plasma transfusions in cardiac surgery outcome was reported by Ranucci et al. [54]. Other studies that focused on plasma transfusions reported inconsistent findings [55,56]. Moreover, some studies reported that platelet transfusions in cardiac surgery were not independently associated with mortality [57,58], while two studies found an association between platelet transfusions and mortality [59,60]. The role of plasma and platelet transfusions in cardiac surgery complications requires further investigation.

Laboratory Effects of Allogeneic Leukocytes in Cardiac Surgery Pro- and anti-inflammatory mediators are released during and after cardiac surgery. Cytokine concentration imbalance can play a pivotal role in a balanced equilibrium after cardiac surgery. Cytokines are low molecular weight polypeptides produced by many cells, such as macrophages, monocytes, neutrophils, and platelets. They are divided into 2 groups: pro-inflammatory cytokines, such as interleukin-1 (IL-1), IL-2, IL-8, and IL-12, and anti-inflammatory cytokines, such as IL-4, IL-5, and IL-10. IL-6, on the other hand, has both pro-and anti-inflammatory properties [61,62]. In the early postoperative period an anti-inflammatory response is important for further limiting the post-surgical inflammatory response. Few studies have investigated the possible mechanisms of allogeneic leukocyte-containing blood products in cytokine balance. One study that included 24 burn trauma patients reported a decrease in IL-6 in patients that received leukocytecontaining RBC transfusions [63]. A larger cardiac surgery study noted an association between perioperative allogeneic RBC transfusions and postoperative increase in the concentration of bactericidal permeability increasing protein (BPI), an inflammatory mediator and marker of neutrophil activation, and IL-6 [64]. Nevertheless, none of these studies investigated the relationships between blood products, inflammatory mediators, and outcome.

Bilgin et al. reported that among the patients that developed infections or MODS, or died due to these complications, those that received leukocyte-containing RBCs had higher pro-inflammatory cytokine concentrations and those that received leukocytedepleted RBCs had lower concentrations of antiinflammatory cytokine IL-10 [65]. Patients in both arms of the study had low concentrations of IL-10 upon arrival to the ICU. The IL-6 concentration

Bilgin et al.

Allogeneic leukocytes in cardiac surgery

165

peaked higher and later in the group that received leukocyte-containing RBCs than in the group that received leukocyte-depleted RBCs. These findings indicate that leukocyte-containing blood transfusions amplify the inflammatory response, in addition to an ongoing systemic inflammatory response induced by cardiac surgery. This may lead to a more profound counteractive anti-inflammatory response and may explain increased susceptibility to postoperative infections.

Inflammatory Response and Allogeneic Leukocytes in Cardiac Surgery During cardiac surgery blood is exposed to the extra-corporeal circuit, hypothermia, and ischemia/ reperfusion injury, and many inflammatory responses are activated. These responses lead to post-perfusion systemic inflammatory response syndrome (SIRS). SIRS is immediately counteracted by compensatory anti-inflammatory response syndrome (CARS) [66]. Severe SIRS causes a dormant state of cell metabolism, referred to as MODS; SIRS usually resolves with adequate supportive therapy and most patients recover. Nonetheless, severe SIRS can dominate CARS and progress to MODS, which may lead to mortality. Previous findings indicate that leukocyte-containing blood transfusions amplify inflammatory response in addition to the ongoing systemic inflammatory response induced by cardiac surgery.

This may lead to a more profound counteractive anti-inflammatory response, and may explain increased susceptibility to postoperative infections.

We think that leukocyte-containing RBC transfusions in patients with an activated inflammatory response further imbalances the postoperative SIRS-CARS equilibrium that is initially in favor of SIRS [67].

New Opportunities for Future Cardiac Surgery Research Patients undergoing cardiac surgery are at risk for bleeding because of thrombocytopenia secondary to hemodilution, platelet dysfunction, and consumption of platelets in the extracorporeal circuit. To reduce the risk of bleeding several pharmacological agents are used during and after surgery [68]. On the other hand, to prevent thrombosis anticoagulants are administered intra-operatively, although this cannot completely prevent thrombin formation [69].

There is evidence that the inflammatory response and pro-inflammatory cytokines can lead to activation of the coagulation system and down-regulate

166

Bilgin et al.

Allogeneic leukocytes in cardiac surgery

anticoagulant systems [70]. Activation of coagulation factors can in turn activate inflammation, which may contribute to the development of infections and microvascular thrombi [71]. Both thrombi and infection play a role in the development of MODS and may lead to death [72]. It was recently reported that leukocyte-containing RBCs contain activated platelets that interact with leukocytes, preceding leukocyte apoptosis and death, subsequently producing microparticles with procoagulant activity [73]. It was recently suggested that transfusion of blood prod-

Turk J Hematol 2011; 28: 160-9

ucts could affect the development of thrombosis in high-risk patients [74,75]. The relationship between transfusion and thrombosis requires further detailed investigation.

Any allogeneic RBC transfusion during an already existing inflammatory cascade can be inappropriately timed and can induce a second-hit response.

The presence of leukocytes in blood products increases the production and release of proinflammatory cytokines in the recipient, which can cause SIRS via both activation of the coagulation system

Figure 1. The possible relationship between allogeneic blood transfusions, and inflammation and coagulation

Bilgin et al.

Allogeneic leukocytes in cardiac surgery

Turk J Hematol 2011; 28: 160-9

and the inflammatory response. This second-hit response induced by allogeneic leukocytes may exacerbate MODS (in combination with infections or microvascular thrombosis) and could result in death (Figure 1). Other factors, such as plasma and platelet transfusions (due to activation or storage lesions) and (possible) activation of the coagulation system, may play more important roles in the development of transfusion-associated complications. Thus, many residual questions need to be answered in the future, posing a challenge for new research in transfusion medicine.

Conclusion Worldwide, millions of patients receive blood transfusions. Allogeneic leukocyte-containing RBC transfusions may have immunomodulatory effects that are presumed harmful to recurrence of cancer and to resistance of postoperative infection. This concept informed RTCs on various clinical conditions in different fields of medicine; however, important questions remain as to the nature and magnitude of the clinical benefits and complications ascribed to TRIM, its mechanism, and the putative causal factors in allogeneic blood components. Only RCTs on cardiac surgery reported a beneficial (costsaving) effect of leukodepleted RBC transfusion.

Conducting new RCTs on the effects of leukocytecontaining RBCs in countries that implemented universal leukoreduction of blood products is not possible. Based on available data, in countries that have not yet implemented universal leukoreduction the transfusion of leukodepleted RBCs is recommended for cardiac surgery [23]. Or, if possible, new RCTs should be performed in these countries, which could help answer the many remaining questions.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

References 1.

2.

Klein HG. How safe is blood, really? Biologicals 2010; 38:100-4. [CrossRef] Snyder-Ramos SA, Mohnle P, Weng YS, Bottiger BW, Kulier A, Levin J, Mangano DT; Investigators of the Multicenter Study of Perioperative Ischemia; MCSPI Research Group. The ongoing variability in blood transfusion practices in cardiac surgery. Transfusion 2008; 48:1284-99. [CrossRef]

17.

18.

167

Stover EP, Siegel LC, Parks R, Levin J, Body SC, Maddi R, D'Ambra MN, Mangano DT, Spiess BD. Variability in transfusion practice for coronary artery bypass surgery despite national consensus guidelines. Anesthesiology 1998;88:327-33.

Goodnough LT, Johnston MFM, Toy PTCY. The variability of transfusion practice in coronary artery bypass surgery. JAMA 1991;265:86-90.

Carson JL, Kuriyan M. What should trigger a transfusion? Transfusion 2010;50:2073-5.

Hebert PC, Wells G, Blajchman MA, Marshall J, Martin C, Pagliarello G, Tweeddale M, Schweitzer I, Yetisir E, on behalf of the Canadian TRIC investigators. A multicenter randomised, controlled clinical trial of transfusion requirements in critical care. New Engl J Med 1999;340:409-17.

Crosby E. Re-evalutaing the transfusion trigger: how low is safe? Am J Ther 2002;9:411-6.

Hajjar LA, Vincent JL, Galas FR, Nakamura RE, Silva CM, Santos MH, Fukushima J, Kalil Filho R, Sierra DB, Lopes NH, Mauad T, Roquim AC, Sundin MR, LeĂŁo WC, Almeida JP, Pomerantzeff PM, Dallan LO, Jatene FB, Stolf NA, Auler JO Jr. Transfusion requirements after cardiac surgery. JAMA 2010; 304:1559-67. [CrossRef] Vincent JL, Sakr Y, Sprung C, Harboe S, Damas P; on behalf of the SOAP Investigators. Are blood transfusions associated with greater mortality rates? Results of the Sepsis Occurrence in Acutely Ill Patients study.

Anesthesiology 2008;108:31-9.

Sakr Y, Lobo S, Knuepfer S, Esser E, Bauer M, Settmacher U, Barz D, Reinhart K. Anemia and blood transfusion in a surgical intensive care unit. Crit Care 2010;14:R92.

Ho J, Sibbald WJ, Chin-Yee IH. Effects of storage on efficacy of red cell transfusion: when is it not safe? Crit Care Med 2003;31:S687-97.

Tinmouth A, Fergusson D, Yee IC, HĂŠbert PC; on behalf of the ABLE Investigators. Clinical consequences of red cell storage. Transfusion 2006; 46:2014-27. [CrossRef] Vamvakas EC, Carven JH. Transfusion and postoperative pneumonia in coronary artery bypass graft surgery: effect of the length of storage of transfused red cells. Transfusion 1999;39:701-10.

Yap CH, Lau L, Krishnaswamy M, Gaskell M, Yii M. Age of transfused red cells and early outcomes after cardiac surgery. Ann Thorac Surg 2008; 86:554-9. [CrossRef] Hebert PC, Chin-Yee I, Fergusson D, Blajchman M, Martineau R, Clinch J, Olberg B. A pilot trial evaluating the clinical effects of prolonged storage of red cells.

Anesth Analg 2005;100:1433-8. van de Watering L, Lorinser J, Versteegh M, Westendord R, Brand A. Effects of storage time of red blood cell transfusions on the prognosis of coronary artery bypass graft patients. Transfusion 2006;46:1712-8. van Straten AH, Soliman Hamad MA, van Zundert AA, Martens EJ, ter Woorst JF, de Wolf AM, Scharnhorst V. Effect of duration of red blood cell storage on early and late mortality after coronary artery bypass grafting.

J Thorac Cardiovasc Surg. 2011;141:231-7.

Koch CG, Li L, Sessler DI, Figueroa P, Hoeltge GA, Mihaljevic T, Blackstone EH. Duration of red-cell storage and compliactions after cardiac surgery. N Engl J Med 2008; 358:1229-39. [CrossRef]

168

Bilgin et al.

Allogeneic leukocytes in cardiac surgery

19. Benjamin RJ, Dodd RY. Red-cell storage and complications of cardiac surgery. New Engl J Med 2008;358:2840-1.

20. van de Watering L. Red cell storage and prognosis. Vox Sang 2011;100:36-45.

21. Opelz G, Sengar DDS, Mickey MR, et al. Effect of blood transfusions on subsequent kidney transplants.

Transplant Proc 1973; 5:253-9. [CrossRef] 22. Gantt CL. Red blood cells for cancer patients. Lancet 1981;2:363.

23. Vamvakas EC, Blajchman MA. Transfusion-related immunomodulation (TRIM): an update. Blood reviews 2007; 21:327-48. [CrossRef] 24. Houbiers JGA, Brand A, van de Watering LMG, Hermans J, Verwey PI, Bijnen AB, van de Velde CHJ. A randomized controlled trial comparing the prognosis of colorectal cancer patients transfused with either leukocyte depleted or buffy coat depleted blood. Lancet 1994;344:573-8.

25. van de Watering LM, Brand A, Houbiers JG, Klein Kranenbarg WM, Hermans J, van de Velde C; Cancer Recurrence and Blood transfusion study group.

Perioperative blood transfusions, with or without allogeneic leucocytes, relate to survival, not to cancer recurrence. Br J Surg. 2001;88:267-72.

26. Skanberg J, Lundholm K, Haglind H. Effects of blood transfusion with leucocyte depletion on length of hospital stay, respiratory assistance and survival after curative surgery for colorectal cancer. Acta Oncologica 2007;46:1123-30.

27. Chelemer SB, Prato S, Cox PM, Oâ&#x20AC;&#x2122;Connor GT, Morton JR. Association of bacterial infection and red blood cell transfusion after CABG. Ann Thorac Surg 2002;73:138-42.

28. Leal-Noval SR, Rincon-Ferrari MD, Garcia-Curiel A, Herruzo-AvilĂŠs A, Camacho-Larana P, GarnachoMontero J, Amaya-Villar R. Transfusion of blood components and postoperative infection in patients undergoing cardiac surgery. Chest 2001;119:1461-8.

29. Koch CG, Li L, Duncan AI, Mihaljevic T, Cosgrove DM, Loop FD, Starr NJ, Blackstone EH. Morbidity and mortality risk associated with red blood cell and bloodcomponent transfusion in isolated coronary artery bypass grafting. Crit Care Med 2006;34:1608-16.

30. Despotis G, Eby, C, Lublin DM. A review of transfusion risks and optimal management of perioperative bleeding with cardiac surgery. Transfusion 2008;48:2S-30S. 31. van de Watering LM, Hermans J, Houbiers JG, van den Broek PJ, Bouter H, Boer F, Harvey MS, Huysmans HA, Brand A. Beneficial effects of leukocyte depletion of transfused blood on postoperative complications in patients undergoing cardiac surgery: a randomized clinical trial. Circulation 1998;97:562-8.

32. Wallis JP, Chapman CE, Orr KE, Clark SC, Forty JR. Effect of WBC reduction of transfused RBCs on postoperative infection rates in cardiac surgery. Transfusion 2002;42:1127-34.

33. Bilgin YM, van de Watering LM, Eijsman L, Versteegh MIM, Brand R, van Oers MHJ,Brand A. Double-blind, randomized controlled trial on the effect of leukocytedepleted erythrocyte transfusions in cardiac valve surgery. Circulation 2004;109:2755-60.

Turk J Hematol 2011; 28: 160-9

34. Connery CP, Toumpoulis IK, Anagnostopoulis CE, Hillei Z, Rahman FG, Katritsis D, Swistel DG. Does leukofiltration reduce pulmonary infections in CABG patients? A prospective, randomised study with early results and mid-term survival. Acta Cardiol 2005;60:285-93.

35. Bracey AW, Radovancevic R, Nussmeier NA. Leukocytedepleted blood in open-heart surgery patients: effects on outcome. Transfusion 2002;42(Suppl):5S (Abstract).

36. Boshkov LK, Chien G, VanWinkle D, Furnary AP, Wu Y, Grunkemeirer GL, Morris CD. Prestorage leukoreduction of transfused packed red cells is associated with significant ongoing 1-12 month survival benefit cardiac surgery patients. Blood 2006;108:578.

37. Vamvakas EC. White-blood-cell-containing alloegenic blood transfusions and postoperative infection and mortality: an updated meta-analysis. Vox Sang 2007;92:224-32.

38. Bilgin YM, van de Watering LMG, Eijsman L, Versteegh MIM, van Oers MHJ, Brand A. Is increased mortality associated with postoperative infections after leukocytes containing red blood cell transfusions in cardiac surgery? Transf Med 2007;17:304-11.

39. Engoren M, Habib RH, Hadaway J, Zacharias A, Schwann TA, Riordan CJ, Durham SJ, Shah A. The effect on long-term survival of erythrocyte transfusion given for cardiac valve operations. Ann Thorac Surg 2009;88:95-100.

40. Jensen LS, Andersen AJ, Christiansen PM, Hokland P, Juhl CO, Madsen G, Mortensen J, Moller-Nielsen C, Hanberg-Sorensen F, Hokland M. Postoperative infection and natural killer cell function following blood transfusion in patients undergoing elective colorectal surgery. Br J Surg 1992;79:513-6.

41. Houbiers JG, Brand A, van de Watering LM, Hermans J, Verwey PJ, Bijnen AB, Pahlplatz P, Eeftinck Schattenkerk M, Wobbes T, de Vries JE. Randomised controlled trial comparing transfusion of leucocyte-depleted or buffycoat-depleted blood in surgery for colorectal cancer.

Lancet. 1994;344:573-8.

42. Jensen LS, Kissmeyer-Nielsen P, Wolff B, Qvist N. Randomized comparison of leucocyte-depleted versus buffy-coat poor blood transfusion and complications after colorectal surgey. Lancet 1996;34:841-5.

43. Tartter P, Mohandes K, Azar P, Endres J, Kaplan J, Spivack M. Randomized trial comparing packed red blood cell transfusion with and without leukocyte depletion for gastrointestinal surgey. Am J Surg 1998;176:462-6.

44. Titlestad IL, Ebbesen LS, Ainsworth AP, Lillevang ST, Qvist N, Georgsen J. Leukocyte-depletion of blood components does not significantly reduce the risk of infectious complications. Results of a double-blinded, randomised study. Int J Colorectal Disease 2001;16:147-53.

45. van Hilten JA, van de Watering LMG, van de Velde CHJ, Kievit J, Brand R, van den Hout WB, Geelkerken RH, Roumen RMH, Wesselink RMJ, Koopman-van Gemert AWMM, Koning J, Brand A. Effects of transfusion with red cells filtered to remove leukocytes: randomised controlled trial in patients undergoing major surgery.

BMJ 2004;328:1281-4.

Turk J Hematol 2011; 28: 160-9

46. Nathens AB, Nester TA, Rubenfeld GD, Nirula R, Gernsheimer TB. The effects of leukoreduced blood transfusion on infection risk following injury: a randomized controlled trial. Shock 2006;26:342-7.

47. Blumberg N, Zhao H, Wang H, Messing S, Heal JM, Lyman GH. The intention-to-treat principle in clinical trials and meta-analysis of leukoreduced blood transfusions in surgical patients. Transfusion 2007;47:573-81.

48. Jensen LS, Grunnet N, Hanberg-Sorensen F, Jorgensen J. Cost-effectiveness of blood transfusion and white cell reduction in elective colorectal surgery. Transfusion 1995;35:719-22.

49. Blumberg N, Heal JM, Kirkley SA, DiPersio JF, Rapoport AP, Rowe JM. Leukodepleted-ABO-identical blood components in the treatment of hematologic malignancies: a cost analysis. Am J Hematology 1995;48:108-15.

50. Postma MJ, van de Watering LMG, de Vries R, Versmoren D, van Hulst M, Tobi H, van der Poel CL, Brand A. Cost-effectiveness of leucocyte depletion of red-cell transfusions for patients undergoing cardiac surgery. Vox Sang 2003;84:65-7.

51. van Hulst M, Bilgin YM, van de Watering LMG, de Vries R, van Oers MHJ, Brand A, Postma MJ. Cost-effectiveness of leucocyte-depleted erythrocyte transfusion in cardiac valve surgery. Transf Med 2005;15:209-17.

52. Hebert PC, Fergusson D, Blajchman MA, Wells GA, Kmetic A, Coyle D, Heddle N, Germain M, Goldman M, Toye B, Schweitzer I, vanWalraven C, Devine D, Sher GD, on behalf of the Leukoreduction Study Investigators.

Clinical outcomes following institution of the Canadian universal leukoreduction program for red blood cell transfusions. JAMA 2003;289:1941-9.

53. Silliman CC. The two-event model of TRALI. Crit Care Med 2006; 34:S124-31. [CrossRef] 54. Ranucci M, Pazzaglia A, Bianchini C, Bozzetti G, Isgro G. Body size, gender, and transfusions as determinants of outcome after coronary operations. Ann Thorac Surg 2008;85:481-7.

55. Banbury MK, Brizzio ME, Rajeswaran J, Lytle BW, Blackstone EH. Transfusion increases the risk of postoperative infection after cardiac surgery. J Am Coll Surg 2006;202:131-8.

56. Sreeram GM, Welsby IJ, Sharma AD, Philips-Bute B, Smith PK, Slaughter TF. Infectious complications after cardiac surgery: lack of association with FFP or platelet transfusions. J Cardiothoracic Vasc Anesthesia 2005;19:430-4.

57. Karkouti K, Wijeysundera DN, Yau TM, Callum JL, Meineri M, Wasowicz M, McCluskey SA, Beattie WS. Platelet transfusions are not associated with increased morbidity or mortality in cardiac surgery. Can J Anesth 2006;53:279-87.

58. McGrath T, Koch CG, Xu M, Li L, Mihaljevic T, Figueroa P, Blackstone EH. Platelet transfusion in cardiac surgery does not confer increased risk for adverse morbid outcomes. Ann Thorac Surg 2008;86:543-53.

59. Spiess BD, Royston D, Levy JH, Fitch J, Dietrich W, Body S, Murkin J, Nadel A. Platelet transfusions during CABG surgery are associated with serious adverse outcomes. Transfusion 2004;44:1143-8.

Bilgin et al.

Allogeneic leukocytes in cardiac surgery

169

60. Mangano DT, for the multicenter study of perioperative ischemia research group. Aspirin and mortality from coronary bypass surgery. N Engl J Med 2002;347:1309-17.

61. Dinarello CA. Proinflammatory cytokines. Chest 2000;118:503-8.

62. Opal SM, DePalo VA. Anti-inflammatory cytokines.

Chest 2000;117:1162-72.

63. Nielsen HJ, Hammer JH, Krarup AL, Nielsen LM, Reimert CM, Pedersen AN, Dybkjaer E, Partoft S, Alsbjørn B. Prestorage leukocyte filtration may reduce leukocytederived bioactive substances accumulation in patients operated for burn trauma. Burns 1999;25:162-70.

64. Fransen E, Maessen J, Dentener M, Senden N, Buurman W. Impact of blood transfusions on inflammatory mediator release in patients undergoing cardiac surgery. Chest 1999;116:1233-9.

65. Bilgin YM, van de Watering LMG, MIM Versteegh, MHJ van Oers, A Brand. The effects of allogeneic leukocytes in blood transfusions during cardiac surgery on inflammatory mediators and postoperative complications.

Crit Care Med 2010;38:546-52.

66. Bone RC. Sepsis, SIRS and CARS. Crit Care Med 1996;24:1125-8.

67. Bilgin YM, Brand A. Transfusion-related immunomodulation: a second hit in an inflammatory cascade? Vox Sang 2008;95:261-71.

68. Levi M, Cromheecke ME, de Jonge E, Prins MH, de Mol BJ, Briet E, Buller HR. Pharmacological strategies to decrease excessive blood loss in cardiac surgery: a meta-analysis of clinically relevant endpoints. Lancet 1999;354:1940-7.

69. Paparella D, Galeone A, Venneri MT, Coviello M, Scrascia G, Marraudino N, Quaranta M, de Luca Tupputi Schinosa L, Brister SJ. Activation of the coagulation system during coronary artery bypass grafting: comparison between on-pump and off-pump techniques. J Thorac Cardiovasc Surg 2006;131:290-7.

70. van der Poll T, Levi M, Hack CE, ten Cate H, van Deventer SJ, Eerenberg AJ, de Groot ER, Jansen J, Gallati H, BĂźller HR. Elimination of IL-6 attenuates coagulation activation in experimental endotoxemia in chimpanzees. J Exp Med 1994;179:1253-9.

71. Levi M, Keller TT, van Gorp E, ten Cate H. Infection and inflammation and the coagulation system. Cardiovasc Res 2003;60:23-39.

72. Gando S. Microvascular thrombosis and multiple organ dysfunction syndrome. Crit Care Med 2010;38(Suppl): S35-42.

73. Keating FK, Butenas S, Fung MK, Schneider DJ. Plateletwhite blood cell (WBC) interaction, WBC apoptosis and procoagulant activity in stored red blood cells.

Transfusion 2010;51:1086-95.

74. Khorana AA, Francis CW, Blumberg N, Culakova E, Refaai MA, Lyman GH. Blood transfusions, thrombosis and mortality in hospitalized patients with cancer. Arch Intern Med 2008;168:2377-81.

75. Heal JM, Phipps RP, Blumberg N. One big unhappy family: transfusion alloimmunization, thrombosis, and immune modulation/inflammation. Transfusion 2009;49:1032-6.

170

Research Article

The role of tumor necrosis factor-alpha -308 G/A and transforming growth factor-beta 1 -915 G/C polymorphisms in childhood idiopathic thrombocytopenic purpura Çocukluk çağı idiopatik trombositopenik purpura'da TNF-α-308G/A ve TGF-β1-915G/C polimorfizmlerinin rolü Emel Okulu1, Talia İleri2, Vildan Koşan Çulha3, Fatih Mehmet Azık3, Yonca Eğin4, Zümrüt Uysal2, Nejat Akar4 1Department

of Pediatrics, Faculty of Medicine, Ankara University, Ankara, Turkey

2Department of Pediatrics, Division of Pediatric Hematology, Faculty of Medicine, Ankara University, Ankara, Turkey 3Department

of Pediatric Hematology, Ankara Dışkapı Children’s Health Training and Research Hospital, Ankara, Turkey 4Department of Pediatrics, Division of Pediatric Molecular Pathology and Genetics, Faculty of Medicine, Ankara University, Ankara, Turkey

Abstract Objective: To increase our understanding of the etiology of idiopathic thrombocytopenic purpura (ITP) some cytokine gene polymorphisms were analyzed for susceptibility to the disease. The aim of this study was to investigate the role of tumor necrosis factor-alpha (TNF-α) -308 G/A and transforming growth factor-beta 1 (TGF-β1) –915 G/C polymorphisms in the development and clinical progression of childhood ITP. Materials and Methods: In all, 50 pediatric patients with ITP (25 with acute ITP and 25 with chronic ITP) and 48 healthy controls were investigated via LightCycler® PCR analysis for TNF-α -308 G/A and TGF-β1 -915 G/C polymorphisms.

Results: The frequency of TNF-α -308 G/A polymorphism was 20%, 16%, and 22.9% in the acute ITP patients, chronic ITP patients, and controls, respectively (p>0.05). The frequency of TGF-β1 -915 G/C polymorphism was 16%, 8%, and 8.3% in the acute ITP patients, chronic ITP patients, and controls, respectively (p>0.05). The risk of developing ITP and clinical progression were not associated with TNF-α -308 G/A (OR: 0.738, 95% CI: 0.275-1.981, and OR: 0.762, 95% CI: 0.179-3.249) or TGF-β1 -915 G/C (OR: 1.5, 95% CI: 0.396-5.685, and OR: 0.457, 95% CI: 0.076-2.755) polymorphisms.

Conclusion: The frequency of TNF-α -308 G/A and TGF-β1 -915 G/C polymorphisms did not differ between pediatric ITP patients and healthy controls, and these polymorphisms were not associated with susceptibility to the development and clinical progression of the disease. (Turk J Hematol 2011; 28: 170-5) Key words: Idiopathic thrombocytopenic purpura, childhood, TNF-α, TGF-β1, polymorphism Received: May 24, 2010

Accepted: December 14, 2010

Address for Correspondence: M.D. Emel Okulu, Department of Pediatrics, Faculty of Medicine, Ankara University, 06100 Dikimevi, Ankara, Turkey Phone: +90 312 595 63 90 E-mail: emelderelli@hotmail.com doi:10.5152/tjh.2011.50

Okulu et al.

Polymorphisms in childhood ITP

Turk J Hematol 2011; 28: 170-5

171

Özet Amaç: İdiopatik trombositopenik purpura (ITP)’nın etyolojisini anlayabilmek için, hastalığa yatkınlık üzerinde bazı sitokin gen polimorfizmleri incelenmiştir. Bu çalışmanın amacı çocukluk çağı ITP’sinin gelişimi ve klinik seyrinde tümör nekrozis faktör-alfa (TNF-α) –308G/A ve transforming growth faktörbeta1 (TGF-β1) -915G/C polimorfizmlerinin rolünü araştırmaktır.

Yöntem ve Gereçler: Elli ITP’li çocuk hasta (25 akut ITP, 25 kronik ITP) ve 48 sağlıklı kontrol TNF-α– 308G/A ve TGF-β1–915G/C polimorfizmleri için Light Cycler PCR analizi ile araştırıldı.

Bulgular: Akut ITP, kronik ITP ve kontrollerde TNF-α–308G/A polimorfizm sıklığı sırasıyla %20, %16 ve %22.9 (p>0.05), ve TGF-β1–915G/C polimorfizm sıklığı sırasıyla %16, %8 ve %8.3 (p>0.05) idi. ITP gelişim riski ve klinik seyri ile TNF-α–308G/A (OR: 0.738, %95 Cl: 0.275-1.981 ve OR: 0.762, %95 Cl: 0.179-3.249) ve TGF-β1–915G/C (OR: 1.5, %95 Cl: 0.396-5.685 ve OR: 0.457, %95 Cl: 0.076-2.755) polimorfizmleri arasında ilişki bulunamadı.

Sonuç: Bu sonuçlar, çocukluk çağı ITP hastalarında TNF-α–308G/A ve TGF-β1–915G/C polimorfizmlerinin sıklığının sağlıklılardan farklı olmadığını göstermiş olup, bu polimorfizmlerin ITP gelişimi ve hastalığın klinik seyri için risk oluşturmadığını düşündürmektedir. (Turk J Hematol 2011; 28: 170-5) Anahtar kelimeler: İdiopatik trombositopenik purpura, çocukluk çağı, TNF-α, TGF-β1, polimorfizm Geliş tarihi: 24 Mayıs 2010

Kabul tarihi: 14 Aralık 2010

Introduction Idiopathic thrombocytopenic purpura (ITP) is one of the most frequent causes of acquired thrombocytopenia and is characterized by destruction of autoantibody-mediated platelets. The pathophysiology of ITP is complex and includes antibodies, cytokines, antigen-presenting cells, co-stimulatory molecules, and T- and B-lymphocytes. When autoreactive B-lymphocytes produce anti-platelet antibodies, T-lymphocytes play an important role in this autoimmune process [1-3].

Children with ITP have a Th1-type cytokine pattern with elevated levels of tumor necrosis factoralpha (TNF-α), as in most autoimmune diseases [4].

Researches have shown that polymorphisms in the TNF-α gene at position -308 and -238 affect gene transcription with increased TNF-α production [5,6]. The transcriptionally more active allele of TNF-α (allele 2 of -308) was less frequently observed in pediatric chronic ITP patients than in healthy controls [7].

Transforming growth factor-beta 1 (TGF-β1) is another multifunctional cytokine that plays a critical role in the pathogenesis of inflammatory, autoimmune, and malignant diseases. The expression of TGF-β1 is influenced by polymorphisms in the TGFβ1 gene, which may be partly relevant to certain diseases [8-10]. It was reported that some TGF-β1 polymorphisms are not associated with the development and progress of ITP [11]. The aim of the present study was to determine if TNF-α -308 G/A and TGF-β1 -915 G/C polymorphisms play a role in the development and clinical progression of ITP in children.

Materials and Methods Study population The study was conducted at Ankara University, Faculty of Medicine, Department of Pediatric Hematology, Pediatric Molecular Pathology and Genetics Division, and at Ankara Dışkapı Children’s Health Training and Research Hospital, Department of Pediatric Hematology. In all, 50 pediatric ITP patients (25 acute ITP and 25 chronic ITP) and 48 healthy controls were enrolled in this study. Children diagnosed with acute or chronic ITP and regularly followed-up in the hospitals participating in the study were considered for inclusion.

The diagnosis of ITP was based on medical history, physical examination, and thrombocytopenia.

Thrombocytopenia that resolved within 6 months of onset was defined as acute ITP and thrombocytopenia that persisted for >6 months was defined as chronic ITP. All the controls had a negative history of thrombocytopenia and ITP, and their blood samples were obtained from the DNA bank of Ankara University, Faculty of Medicine, Department of Pediatric Hematology, Pediatric Molecular Pathology and Genetics Department. Informed consent was obtained from all the patients, the controls, and their parents.

The study protocol was approved by the Ankara University Faculty of Medicine Ethics Committee.

Genomic DNA analysis, and TNF-α -308 G/A and TGF-β1 -915 G/C polymorphism genotyping Peripheral blood samples were obtained from all the participants. Blood samples were collected in

172

Okulu et al.

Polymorphisms in childhood ITP

Turk J Hematol 2011; 28: 170-5

microfuge tubes containing ethylenediamine tetraacetic acid as anticoagulant. Genomic DNA was extracted from peripheral blood leukocytes using the phenol-chloroform method.

TNF-α -308 polymorphism Regions containing TNF-α -308 G/A polymorphisms were amplified via polymerase chain reaction (PCR) using 0.1 μg/mL concentration of 2 primer sets, according to our previous report [12].

TGF-β1 -915 polymorphism Regions containing TGF-β1 -915 G/C polymorphisms were amplified via PCR using 0.1 μg/mL concentration of 2 primer sets. The primer sequences used for the TGF-β1 -915 promoter region were as follows: Forward: 5’-ACC ACA CCA GCC CTG TTC GC-3’; Reverse: 5’-AGC TTG GAC AGG ATC TTG CC-3’.

PCR yielded a 224-base pair (bp) long oligonucleotide product and the results were confirmed based on 2% agarose gel electrophoresis containing 0.5 mg/mL ethidium bromide at 100 W for 45 min using an 18-μL PCR product. The gels were evaluated with a UV transilluminator imaging analyzer.

Statistical analysis Statistical analysis was performed using SPSS v.15.0 (Statistical Package for Social Sciences, Inc., Chicago, IL, USA). The demographic features of the acute and chronic ITP patients were compared using Student’s t-test and the Mann-Whitney U-test.

The odds ratio and 95% confidence interval (CI), as estimates of the relative risk of allele frequency, were calculated for the entire study population.

The 95% CI was calculated based on a conditional logistic regression algorithm using the maximum likelihood method.

Results In the present study 50 ITP patients (25 acute ITP and 25 chronic ITP) and 48 controls were analyzed for TNF-α -308 G/A and TGF-β1 -915 G/C polymorphisms. The demographics of the acute and chronic ITP patients are shown in Table 1. The acute ITP patients were aged 4 months to 12 years (median age: 6 years), and the chronic ITP patients were aged 18 months to 15.5 years (median age: 9 years).

The patients with chronic ITP were significantly older (p<0.05). Hemoglobin, leukocyte, and platelet counts in the acute and chronic ITP patients at admission did not differ significantly (p=0.12, 0.99, and 0.64, respectively).

In total, 5 (20%) of the 25 acute ITP patients, 4 (16%) of the 25 chronic ITP patients, and 11 (22.9%) of the 48 control subjects had TNF-α -308 G/A gene polymorphism. The frequency of TNF-α -308 G/A gene polymorphism in the acute ITP, chronic ITP, and control groups did not differ significantly (p>0.05). In addition, the A allele frequency did not differ significantly between the 3 groups (p>0.05).

The frequency of TGF-β1 -915 G/C polymorphism in the acute ITP, chronic ITP, and control groups was 16%, 8%, and 8.3%, respectively, but the difference was not significant (p>0.05). C allele frequency was 2-fold higher in the acute ITP patients (8%) than in the chronic ITP patients (4.1%) and controls (4%); the difference was not statistically significant (p>0.05). The distribution of TNF-α -308 G/A and TGF-β1 -915 G/C polymorphisms in the study and control groups are shown in Tables 2 and 3.

The risk of developing ITP was not associated with TNF-α -308 G/A (OR: 0.738, 95% CI: 0.275-1.981) or TGF-β1 -915 G/C (OR: 1.5, 95% CI: 0.396-5.685) polymorphisms. The frequency of TNF-α -308 G/A and TGF-β1 -915 G/C polymorphisms in the acute and chronic ITP patients did not differ significantly

Table 1. Patient demographics

Age (years) Sex (M/F) Hemoglobin (g/dl)* Leukocyte Platelet

(/mm3)*

(/mm3)*

*Results are expresed as median (range)

Acute ITP (n=25)

Chronic ITP (n=25)

p

5.6±3.5

8.0±3.9

0.028

15/10

11/14

>0.05

11.5 (8.0-14,9)

11.9 (6.8-14.5)

>0.05

8400 (4900-17300)

8100 (5000-23900)

>0.05

8000 (1000-25000)

8000 (1000-78000)

>0.05

Okulu et al.

Polymorphisms in childhood ITP

Turk J Hematol 2011; 28: 170-5

173

Table 2. Distribution of TNF-α-308G/A polymorphism in ITP, acute ITP, chronic ITP patients and controls Genotype frequency

Controls n=48 n (%)

ITP patients n=50 n(%)

Acute ITP n=25 n (%)

Chronic ITP Fischer’s (n=25) exact test n (%)

OR (95% CI)

G/G

37 (77.1)

41 (82)

20 (80)

21 (84)

0.546a

0.738 (0.275-1.981)

G/A

11 (22.9)

9 (18)

5 (20)

4 (16)

1.000b

0.762 (0.179-3.249)

OR Odds ratio; CI confidence interval, aITP group compared with the controls, bAcute ITP group compared with chronic ITP group

Table 3. Distribution of TGF-β1-915G/C polymorphism in ITP, acute ITP, chronic ITP patients and controls Genotype frequency

Controls n=48 n (%)

ITP patients n=50 n (%)

Acute ITP n=25 n (%)

Chronic ITP Fischer’s n=25 exact test n (%)

OR (95% CI)

G/G

44 (91.7)

44 (88)

21 (84)

23 (92)

0.741a

1.5 (0.396-5.685)

G/C

4 (8.3)

6 (12)

4 (16)

2 (8)

0.667b

0.457 (0.076-2.755)

OR Odds ratio; CI confidence interval, aITP group compared with the controls, bAcute ITP group compared with chronic ITP group

(p>0.05), and these polymorphisms did not have an affect on chronic progression of the disease (OR: 0.762, 95% CI: 0.179-3.249 and OR: 0.457, 95% CI: 0.076-2.755, respectively).

Discussion Although the etiology of ITP remains unclear, it is generally accepted that both environmental and genetic factors play an important role in the development of the disease [13,14]. Many recent studies have focused on the association between some cytokine gene polymorphisms and susceptibility to ITP. Studies that investigated genetic risk factors in the pathogenesis of ITP reported that polymorphisms of HLA class II antigens, FcγRIIA and FcγRIIIA, and human platelet antigen (HPA) systems were associated with the development of ITP and response to treatment [7,15-19].

TNF-α is a pleiotropic cytokine produced primarily by macrophages and T-cells, and has a range of inflammatory and immunomodulatory activity [20-22]. Polymorphisms of TNF-α promoter are associated with high levels of TNF-α and have been studied as a determinant of susceptibility to numerous diseases [12,21-25]. A study that examined inflammatory cytokines and Fcγ receptor polymorphisms in chronic childhood ITP reported that polymorphisms in 2 low-affinity FcγR genes (IIIA and IIIB) and 2 proinflammatory cytokine genes (TNF and LTA) were associated with chronic childhood ITP [7]. To the best of our knowledge the role of TNF-α -308 G/A polymorphism in the development and progression of ITP has not been previously studied.

TGF-β is a multifunctional cytokine and TGF-β1 is the most abundant isoform [26,27]. TGF-β1 gene polymorphisms that alter TGF-β1 production have been studied in predicting susceptibility to certain diseases [8,9]. A significant increase in the percentage of NK cells and elevated TGF-β1 levels have been observed in chronic ITP patients in remission [28]. Although it has been shown that TGF-β1 gene polymorphisms (509 G/C, codon 25, and codon 10) were significantly correlated with many diseases and TGF-β1 production, the only study on the role of these polymorphisms in the pathophysiology of ITP reported that they weren’t correlated with the development, clinical progression, or treatment response of the disease [11,29-32].

In the present study the genotype frequency of TNF-α -308 G/A and TGF-β1 -915 G/C polymorphisms was evaluated in terms of their correlation with susceptibility to the development and progression of ITP. At the time of diagnosis it is not possible to predict the progress of the disease. To date, no prognostic factors for the development and clinical progression of the disease have been reported [33].

The results of the present study show that the frequency of TNF-α -308 G/A and TGF-β1 -915 G/C polymorphisms in the acute ITP, chronic ITP, and control groups did not differ significantly. Moreover, associations between these polymorphisms, and the development and clinical progress of ITP were not observed.

Plasma TNF-α and TGF-β1 levels in the patient and control groups were not analyzed in the present study. It is known that a substitution at the -308 position of TNF-α results in increased production of

174

Okulu et al.

Polymorphisms in childhood ITP

TNF-α [6], and that polymorphisms at codon 10 and 25 of the TGF-β1 gene are involved in the upregulation of TGF-β1 secretion. Other studies failed to observe any association between serum TGF-β1 levels and these polymorphisms [34].

In conclusion, TNF-α -308 G/A and TGF-β1 -915 G/C polymorphisms did not play an important role as genetic risk factors for the development and progression of ITP. As the study and control groups were small, different results may be obtained by additional research involving larger patient populations.

Turk J Hematol 2011; 28: 170-5

9.

10.

11.

12.

13.

Acknowledgement This study was supported by the Ankara University Research Fund (project number 20030809168).

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

4.

5.

6.

7.

8.

Nugent DJ. Childhood immune thrombocytopenic purpura. Blood Reviews 2002;16:27-9.

Blanchette V, Bolton-Maggs P. Childhood immune thrombocytopenic purpura: Diagnosis and management. Hematol Oncol Clin N Am 2010;24:249-73.

Yaprak I, Atabay B, Durak I, Turker M, Oniz H, Ozer EA. Variant clinical courses in children with immune thrombocytopenic purpura: Sixteen year experience of a single medical center. Turk J Hematol 2010;27:147-55.

Andersson J. Cytokines in idiopathic thrombocytopenic purpura (ITP). Acta Paediatr Suppl 1998;424:61-4.

Bidwell JL, Wood NA, Morse HR, Olomolaiye OO, Keen LJ, Laundy GJ. Human cytokine gene nucleotide sequence aligments: supplement 1. Eur J Immunogenet 1999;26:135-223.

Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumor necrosis factor α promoter on transcriptional activation. Proc Natl Acad Sci USA 1997;94:3195-9.

Foster CB, Zhu S, Erichsen HC, Lehrnbecher T, Hart ES, Choi E, Stein S, Smith MW, Steinberg SM, Imbach P, Künhe T, Chanock SJ; Early Chronic ITP Study Group.

Polymorphisms in inflammatory cytokines and Fcγ receptors in childhood chronic immune thrombocytopenic purpura: a pilot study. Br J Haematol 2001;113:596-9.

Chang WW, Su H, He L, Zhao KF, Wu JL, Xu ZW. Association between transforming growth factor-β1 T869C polymorphism and rheumatoid arthritis: a metaanalysis. Rheumatology 2010;49:652-6.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

Blobe GC, Schieman WP, Lodish HF. Role of transforming growth factor-β in human disease. N Eng J Med 2000;18:1350-8.

Letterio JJ, Roberts AB. Regulation of immune responses by TGF-β. Annu Rev Immunol 1998;16:137-61.

Atabay B, Oren H, Irken G, Kizildağ S, Tunali S, Türker M, Yilmaz S. Role of transforming growth factor-β1 gene polymorphisms in childhood idiopathic thrombocytopenic purpura. J Pediatr Hematol Oncol 2003;25:885-9.

Akar N, Hasipek M. Tumour necrosis factor-alpha gene polymorphism (-308 G-A) in Turkish pediatric thrombosis patients. Turk J Hematol 2002;19:39-41.

George JN, Woolf SH, Raskob GE, Wasser JS, Aledort LM, Ballem PJ, Blanchette VS, Bussel JB, Cines DB, Kelton JG, Lichtin AE, McMillan R, Okerbloom JA, Regan DH, Warrier I. Idıopathic thrombocytopenic purpura: A practice guideline developed by explicit methods fort he American Society of Hematology. Blood 1996;88:3-40.

Richardson B. Primer; Epigenetics of autoimmunity.

Nat Clin Pract Rheumatol 2007;3:521-7.

Castro V, Oliveira GB, Origa AF, Annichino-Bizzacchi JM, Arruda VR. The human platelet alloantigen 5 polymorphism as a risk fort he development of acute idiopathic purpura. Thromb Haemost 2000;84:360-1.

Thude H, Gatzka E, Anders O, Barz D. Allele frequencies of human platelet antigen 1,2,3 and in normal people. Vox Sang 1999;77:149-53.

Karpatkin S, Fotino M, Gibofsky A, Winchester RJ. Association of HLA-Drw2 with autoimmune thrombocytopenic purpura. J Clin Invest 1979;63:1085-8.

Fujimoto TT, Inoue M, Shimomura T, Fijumura K. Involvement of Fcγ receptor polymorphism in the therapeutic response of idiopathic thrombocytopenic purpura. Br J Haematol 2001;115:125-30.

Cines DB, Blanchette VS. Immune thrombocytopenic purpura. N Eng J Med 2002;346:995-1008.

Allen RD. Polymorphism of the human TNF-alpha promoter-random variation or functional diversity? Mol Immunol 1999;36:1017-27.

Hajeer AH, Hutchinson IV. Influence of TNF-alpha gene polymorphisms on TNF alpha production and disease.

Hum Immunol 2001;62:1191-9.

Hajeer AH, Hutchinson IV. TNF-alpha gene polymorphism: clinical and biological implications. Microsc Res Tech 2000;50:216-28.

Tekeli O, Turacli ME, Egin Y, Akar N, Elhan AH. Tumor necrosis factor alpha-308 gene polymorphism and pseudoexfoliation glaucoma. Mol Vision 2008;14:1815-8.

Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of polymorphism in the human tumor necrosis factor α promoter on transcriptional activation. Proc Natl Acad Sci USA 1997;94:3195-9.

Batikhan H, Gokcan MK, Beder E, Akar N, Ozturk A, Gerceker M. Association of the tumor necrosis factoralpha -308 G/A polymorphism with nasal polyposis. Eur Arch Otorhinolaryngol 2010;267:903-8.

Turk J Hematol 2011; 28: 170-5

26. Massague J. Transforming growth factor-alpha. A model for membrane-anchored growth factors J Biol Chem 1990;265:21393-6.

27. Lyons RM, Gentry LE, Purchio AF, Moses HL. Mechanism of activation of latent recombinant transforming growth factor beta 1 by plasmin. J Cell Biol 1990;110:1361-7.

28. Andersson PO, Stockelberg D, Jacobsson S, Wadenvik V. A transforming growth factor β1-mediated bystander immune suppression could be associated with remission of chronic idiopathic thrombocytopenic purpura.

Ann Hematol 2000;79:507-13.

29. Grainger DJ, Heathcote K, Chiano M, Snieder H, Kemp PR, Metcalfe JC, Carter ND, Spector TD. Genetic control of the circulating concentration of transforming transforming growth factor type β1. Hum Mol Genet 1999;8:93-7.

30. Awad MR, El-Gamel A, Hasleton P, Turner DM, Sinnott PJ, Hutchinson IV. Genotypic variation in the transforming growth factor-β1 gene: association with transforming growth factor-β1 production, fibrotic lung disease and graft fibrosis after lung transplantation.

Transplantation 1998;66:1014-20.

Okulu et al.

Polymorphisms in childhood ITP

175

31. Yamada Y, Miyauchi A, Takagi Y, Tanaka M, Mizuno M, Harada A. Association of the C509→T polymorphism, alone or in combination with the T869→C polymorphism, of the transforming growth factor-β1 gene with bone mineral density and genetic susceptibility to osteoporosis in Japanese women. J Mol Med 2001;79:149-56.

32. Niu W, Qi Y, Gao P, Zhu D. Association of TGFB1 -509 C>T polymorphism with breast cancer: evidence from a meta-analysis involving 23,579 subjects. Breast Cancer Res Treat 2010;124:243-9.

33. Jayabose S, Levendoglu-Tugal O, Ozkaynak MF, Visintainer P, Sandoval C. Long-term outcome of chronic idiopathic thrombocytopenic purpura in children. J Pediatr Hematol Oncol 2004;26:724-6.

34. Hinke V, Seck T, Clanget C, Scheidt-Nave C, Ziegler R, Pfeilschifter J. Association of transforming growth factor-beta1 (TGFbeta1) T29 –4 C gene polymorphism with bone mineral density (BMD), changes in BMD, and serum concentrations of TGF-beta1 in a population-based sample of postmenopausal German women. Calcif Tissue Int 2001;69:315–20.

176

Research Article

Influence of detection of pretreatment cytogenetic abnormalities on first complete remission and survival in adult acute lymphoblastic leukemia Erişkin akut lenfoblastik lösemide ilk tam remisyon ve sağkalım üzerinde tedavi öncesi sitogenetik anomalilerin saptanmasının önemi Milena Georgieva Velizarova1, Evgueniy A. Hadjiev2, Kamelia V. Alexandrova2, Ivanka I. Dimova3, Draga I. Toncheva3, Nadya E. Dimitrova4 1Department

of Clinical Laboratory and Clinical of Immunology, Alexandrovska University Hospital, Sofia, Bulgaria of Hematology, Alexandrovska University Hospital, Sofia, Bulgaria 3Department of Medical Genetics, Medical University, Sofia, Bulgaria 4National Oncological Hospital, Bulgarian National Cancer Registry, Sofia, Bulgaria 2Clinic

Abstract Objective: Treatment of acute lymphoblastic leukemia (ALL) in adults focuses on the initial assessment of the prognostic relevant cytogenetic features as well as a response-guided therapy based on molecular data. We examined the importance of molecular-cytogenetic abnormalities for complete remission (CR) rates and the overall survival (OS) in adult ALLs. Materials and Methods: Conventional cytogenetics and fluorescence in situ hybridization were performed on bone marrow cells from 33 newly-diagnosed ALL adults. Two karyotype categories [standard- risk group- normal karyotype, hyperdiplody and other structural aberrations, and high-risk group-t(11q23)/MLL, t(9;22)/bcr-abl, t(1;19), t(8;14), C-MYC and complex karyotype] and the biologically and clinically relevant ALL ploidy subgroups were prospectively defined.

Results: Chromosomal abnormalities were found in 52% of the cases with a high rate of poor-risk translocations - t(9;22), t(8q24), t(11q23), t(1;19). The total CR rate was 67% and the median time for achievement 2.33 months. Male sex, an age below 35 years and the absence of high risk translocations might have contributed to the high CR rates. Female patients, hyperdiplody, low white blood cells (WBC), and random cytogenetic aberrations had the longest OS. OS, 3- and 5-years survival periods were significantly shorter for poor-risk than standard risk group (p=.015, p=.001 and p=.005, respectively).

Conclusion: This study emphasizes the lack of influence of cytogenetic aberrations on the CR and the time to achieve CR. However, our observations show that these aberrations are an independent prognostic factor in adult ALL - they allow predicting therapy resistance and the OS time after intense treatment. (Turk J Hematol 2011; 28: 176-85) Key words: Adult acute lymphoblastic leukemia, complete remission, karyotype, overall survival Received: March 08, 2011

Accepted: May 17, 2011

Address for Correspondence: M.D. Milena Georgieva, 1 G. Sofijski Str. 1431 Sofia, Bulgaria Phone: +359 2 91 72 916 E-mail: m_velizarova@hotmail.com doi:10.5152/tjh.2011.51

Velizarova et al.

Cytogenetic abnormalities and survival in ALL

Turk J Hematol 2011; 28: 176-85

177

Özet Amaç: Erişkinlerde akut lenfoblastik lösemi (ALL) tedavisinde prognostik açıdan önemli sitogenetik özelliklerin değerlendirmesi ve bunun yanı sıra moleküler verilere göre yanıt yönlendirmeli tedaviye odaklanılmaktadır. Erişkin ALL’de tam yanıt (TR) oranları ve genel sağkalım (GS) için moleküler sitogenetik anomalilerin önemi incelenmiştir.

Yöntemler ve Gereçler: Yeni tanı alan 33 erişkin ALL’li hastadan alınan kemik iliği hücreleri klasik sitogenetik ve floresans in situ hibridizasyon yöntemi ile incelendi. Olgular iki karyotip grubuna [standart-risk grubu- normal karyotip, hiperdiplodi ve diğer yapısal aberasyonlar ve yüksek-risk grubu - t(11q23)/ MLL, t(9;22)/bcr-abl, t(1;19), t(8;14), C-MYC ve kompleks karyotip] ve biyolojik / klinik açıdan önemli ALL ploidi alt gruplarının ayrılarak tanımlanmıştır.

Bulgular: Kötü riskli t(9;22), t(8q24), t(11q23), t(1;19) kromozom anomalileri yüksek orandadır, olguların %52’sinde belirlenmiştir. Toplam tam yanıt (TR) oranı %67 olup TR sağlanana kadar geçen ortalama süre 2.33 aydır. Erkek cinsiyeti, 35’in altındaki yaş ve yüksek risk translokasyonlarının bulunmaması yüksek TR oranlarına ulaşılmasında katkıda bulunmuş olabilir. Kadın hastalar, hiperdiplodi, düşük lökosit sayısı (WBC) ve random sitogenetik anomaliler de en uzun GS gözlenmiştir. Üç ve beş yıllık sağkalım aralıklarında, GS, standart riskli gruba göre düşük riskli grupta anlamlı şekilde daha kısadır (sırasıyla p=.015, p=.001 ve p=.005).

Sonuç: Bu çalışmada sitogenetik aberasyonların TR oranı ve TR sağlanana kadar geçen süre üzerinde etkisinin bulunmadığı vurgulanmaktadır. Bununla birlikte gözlemlerimiz bu aberasyonların erişkin ALL’de bağımsız bir prognostik faktör olduğunu göstermektedir. Bu bulgular tedaviye direncin ve yoğun tedavi sonrası GS süresinin öngörülmesine izin verir. (Turk J Hematol 2011; 28: 176-85) Anahtar kelimeler: Erişkin akut lenfoblastik lösemi, tam remisyon, karyotip, genel sağkalım Geliş tarihi: 08 Mart 2011

Kabul tarihi: 17 Mayıs 2011

Introduction Acute lymphoblastic leukemia (ALL) is a fairly uncommon disease in adults and is associated with a poor prognosis. The treatment of adult ALL is based on the initial assessment of relevant prognostic molecular-cytogenetic features and responseguided therapy based on molecular data. In more than 50% of adult ALL patients clonal chromosomal abnormalities that deregulate candidate oncogenes or transcription factors by introducing a heterologous promoter or enhancer are observed [1-3].

Altered cell cycle progression or upregulated tyrosine kinase activity are other important mechanisms in ALL [2-5]. Most translocations can lead to generation of fusion genes that translate into chimeric oncogenic proteins, providing targets for novel therapeutic agents. The most important prognostic factors in ALL are cytogenetic abnormalities, the time to achieve complete remission (CR), the initial leukocyte count, age, and immunologic subtype [4-8]. Cytogenetic abnormalities observed in ALL patients are among the most important independent prognostic variables that predict outcome; [5,6,9] ploidy and translocations are correlated with prognosis [10,11] ALL is heterogeneous and can be subtyped based on chromosomal, immunophenotypic, and

molecular criteria. The prognostic implications of different ALL subtypes strongly influence the choice of treatment in adults [5,6,12]. Many patients with T-cell ALL can be cured with chemotherapy alone.

In contrast, patients with early B-lineage ALL and certain chromosomal abnormalities, especially the Philadelphia chromosome, do not have durable responses to chemotherapy and should undergo bone marrow transplantation [13,14].

The aim of the present study was to determine the frequency and prognostic significance of molecular-cytogenetic abnormalities, and to ascertain whether or not karyotype is a significant prognostic factor in adult ALL patients, independent of new intensive chemotherapy regimens and initial clinical characteristics.

Material and Methods Study design Patients The study included 33 patients (aged >18 years) that were newly diagnosed with ALL at Alexandrovska University Hospital, Hematology Clinic, Sofia, Bulgaria during a 3-year period. Diagnosis of ALL was based on the French-American-British (FAB) classification system’s morphological and cytochemical criteria, and on lymphoid immunophenotype.

178

Velizarova et al.

Cytogenetic abnormalities and survival in ALL

Treatment Each patient underwent a standard induction regimen consisting of combination anthracycline, vincristine, prednisone, and cyclophosphamide, and prophylactic intrathecal methotrexate, methylprednisolone, and cytarabine, according to GETLALA-94 (Groupe d‘Etude et de Traitement de la Leucémie Aiguë Lymphoblastique de l’Adulte) [15].

CR was followed by multidrug consolidation treatment, central nervous system prophylaxis, late intensification, and maintenance chemotherapy for 24 months.

Definition of remission state CR was defined as ≤5% blast cells in normocellular or hypercellular bone marrow, a normal peripheral and differential blood count, and no extramedullary disease. Complete remission time was defined as the time from diagnosis to CR. Definition of resistant disease ALL was considered as resistant disease (RD) if CR was not achieved after 3 courses of induction therapy.

Definition of overall survival Overall survival (OS) was the time of treatment onset to the time of death. Patients were censored for survival only at the date they were last known to be in complete remission or alive, respectively.

Methods Immunophenotyping Immunophenotyping was performed at Alexandrovska University Hospital, Allergology and Immunology Clinic. Leukemic cells obtained from fresh bone marrow or peripheral blood samples collected in EDTA-containing tubes were analyzed.

Surface, cytoplasmic, and nuclear antigens were detected via a standard 2-color direct immunofluorescence assay using a broad panel of commercially available lymphoid and myeloid-associated monoclonal antibodies (MoAbs).

According to the European Group for Immunophenotyping of Leukemia (EGIL) [16], B-lineage acute leukemias were separated into the following 4 groups: pro-B-ALL (BI): CD19+, CD22+, cyCD79a+, CD10- cyIg-, and sIg-; common B-ALL (BII): CD10+ (CALLA+), cyIg-, sIg-; pre-B-ALL (BIII): CD10+/-, cyIg+, and sIg-; mature B-ALL (BIV): sIg+.

T-lineage ALL was characterized based on CD1a,

Turk J Hematol 2011; 28: 176-85

CD2, CD3, CD4, CD5, CD7, and CD8 cell marker expression. Myeloid markers (CD13, CD33, CD14, and CD15) were tested in most patients. For every antigen tested cell expression >20% was considered a positive reaction.

Conventional cytogenetics Conventional (routine) cytogenetic analysis was performed on material obtained from bone marrow aspiration. Bone marrow was treated with direct (without cell cultivation) and indirect methods (after 48 h of cultivation with 15% fetal bovine serum at 37°C in RPMI) to obtain metaphases.

Chromosomes were stained using the G-banding method and were analyzed via light microscopy and Icarus Metasystem software. Karyotypes were determined according to International System for Human Cytogenetic (ISHC) nomenclature [17]. The presence of ≥2 metaphases with the same structural change, the same chromosome gain, or ≥3 metaphases with deletion of the same chromosomes was considered as clonal aberration. At least 20 metaphases for each patient were carried out.

Hypodiploid and hyperdiploid karyotypes were defined as having <45 and >46 chromosomes, respectively.

Fluorescence in situ hybridization (FISH) FISH analysis was performed on cytogenetic preparations obtained from bone marrow cells. Direct labeling locus-specific probes (Vysis, Ltd.) were used for MLL gene rearrangements, bcr/abl gene fusion, and C-MYC rearrangements. Fluorescence signals were detected using fluorescence microscopy and ISIS Metasystem software. The size of genetically abnormal clones was determined after analyzing at least 100 successfully hybridized cells.

Statistical methods The statistical variables tested for potential prognostic value were as follows: molecular-cytogenetic abnormalities, age, WBC count, hemoglobin value, platelet (PLT) count, immunologic subgroup, CR rates, frequency of RD, early deaths, and survival times. Three- and 5-year survivals were estimated using the life tables’ method. Kaplan-Meier [18] curves were constructed for CR time and survival; A Log rank test was used to compare these curves in both cytogenetic groups.

Comparison of quantitative variables between patient groups was performed using one-way analy-

Velizarova et al.

Cytogenetic abnormalities and survival in ALL

Turk J Hematol 2011; 28: 176-85

179

Results

sis of variance. Comparison of qualitative data was performed using the chi-square test and t-test. All statistical analyses were 2-sided. P values <0.05 were considered statistically significant.

Cytogenetic abnormalities were classified into 2 groups, as follows: 1) high risk: t(11q23)/MLL, t(9;22)/bcr-abl, hypodiploidy (<45 chromosomes), t(1;19), t(8q24)/C-MYC, and complex karyotype; 2) standard risk: normal karyotype, hyperdiploidy, and other structural aberrations. The parameters were selected according to internationally accepted prognostic factors in ALL [7,11,19-21]. As a prognostic factor, cytogenetics was considered a binomial variable (high-risk group versus standard-risk group).

Clinical and biological characteristics of the patients Clinical and biological characteristics of the patients are shown in Table 1. The frequency of ALL increased with age; 61% of the patients were aged >35 years. More patients had B-cell leukemia (84.8%) than T-cell leukemia (15.2%, p<0.001), and most had a WBC count <30.109 /L (82%, p<0.001).

Cytogenetic data and correlations with clinical and hematological features Based on routine cytogenetic and FISH analysis, clonal chromosomal abnormalities were noted in 17

Table 1. Clinical and biological features of the adult patients with newly diagnosed ALL Characteristics Parameters n (%) CR n (%)

Time to CR (months)

OS (months)

Sex

Male

19 (57.6%)

14 (73.7%)

2.33 (0.97-3.69)

11.13 (8.05-14.21)

Female

14 (42.4%)

8 (57.1%)

1.93 (1.05-2.81)

12.43 (4.80-20.06)

Age (years)

Median (range)

41 (18-74)

<35

13 (39%)

11 (84.6%)

1.43 (0.85-2.00)

10.16 (0.00-28.05)

>35

20 (61%)

11 (55%)

0.60 (1.44-3.82)

12.33 (10.17-14.48)

WBC (Ă&#x2014;109 /L)

Median (range)

<30

27 (82%)

18 (66.7%)

2.40 (0.30-1.80)

12.43 (9.14-15.72)

>30

6 (18%)

4 (66.7%)

1.36 (1.06-1.67)

6.66 (0.00-13.66)

Immunophenotype

B-lineage

24 (72.7%)

15 (62.5%)

2.33 (0.32-1.69)

T-lineage*

5 (15.2%)

4 (80%)

2.33 (0.76-0.83)

Burkitt´s type-B lineage

4 (12.1%)

3 (75%)

1.36 (0.29-0.78)

Chromosomal pattern

Cell ploidy abnormalities

Normal diploid

16 (48.5%)

9 (56.3%)

1.93 (0.80-3.05)

12.43 (0.00-28.24)

Pseudodiploid (46, abnormal)

13 (49.4%)

6 (46.2%)

1.40 (0.32-2.47)

10.16 (3.73-16.59)

Hyperdiploid >46

4 (12.1%)

2 (50%)

2.50 (1.70-3.29)

17.36 (0.00-44.38)

Hypodiploid

Structural abnormalities

Non-random

12 (36.3%)

6 (50%)

1.96 (0.92-3.01)

10.16 (3.89-16.43)

Random

5 (15.2%)

3 (60%)

2.50 (0.45-4.54)

13.16 (0.00-30.41)

Normal diploidy

16 (48.5%)

9 (56.3%)

1.93 (0.80-3.05)

12.43 (0.00-28.24)

16.5 (1.7-300)

0 (0%)

8.50 (2.69-14.30)

10.86 (0.00-27.03)

0 (0%)

*OS in T-lineage ALL was not estimated because more than 50% of the patients died. Median OS is the time, which are gone through 50% of patients in the respectively group, CR- complete remission; OS- overall survival

180

Velizarova et al.

Cytogenetic abnormalities and survival in ALL

Turk J Hematol 2011; 28: 176-85

of the 33 ALL patients (52%). Ploidy groups and structural changes were analyzed (Table 1). The ALL patients were divided into 2 risk groups (Table 2) according to molecular-cytogenetic aberrations, and basic biological and laboratory parameters at the time of diagnosis: high risk (n=14, 42.4%) and standard risk (n=24, 69.7%).

Cell ploidy abnormalities Distribution of chromosomal ploidy anomalies in the patients was as follows: normal (46, normal): 16 cases (45.5%); hyperdiploidy (>46): 4 cases (12.1%); pseudodiploidy (46, abnormal): 13 cases (49.4%); hypodiploidy 0 cases (Table 1). Among the pseudodiploid karyotypes, changes were variable. The following chromosomes were involved with high frequency in balanced translocations: 4, 7, 8, 9, 11, 14, and 22. The short arms of chromosomes 4 and 12 were involved in deletion events. In 3 patients hyperdiploidy (>46) was combined with structural

aberrations t(9;22), del 12p, and del l4p. The incidence of hyperdiploid cell lines in individual patients ranged between 20% and 100% of the analyzed metaphases; chromosomes 8, 6, 12, and 21 were the most frequently involved.

Structural abnormalities Structural changes were observed in 17 patients (52%) with high-risk translocations t(9;22)(q34;q11), t(8q24), t(11q23), and t(1;19)(q23;p13). The other structural abnormalities exhibited deletion of the short arm of chromosomes 4 and 12, and isochromosome 7.

Differences in CR rates The CR rate for the 33 patients was 67%; 11 patients did not achieve CR. The median time to achieve CR was 2.33 months (range: 1.47-3.19 months). Male gender, T-marker expression, age <35 years, and absence of high-risk translocations

Table 2. Pretreatment characteristics according to cytogenetic risk group Group Total Age (years)*

Poor risk**

WBC count Hb (g/L)* (Ă&#x2014;109 /L)*

PLT count (Ă&#x2014;109 /L)*

Phenotype B-ALL T-ALL

14 (42.4%)

43.5 (25-63)

22.05 (3.6-300)

92.0 (49-161)

61.0 (5-147)

14

0

t(9;22)/bcr-abl

5

41.8 (33-58)

9.2 (3.6-20.1)

106 (87-161)

48 (5-125)

4

0

t(11q23)/MLL

2

25 (25-25)

184.0 (68-300.0)

95.5 (68-123)

76.5 (23-130)

2

0

t(8q24)/C-MYC

4

48.5 (25-63)

21.4 (7.7-33.6)

84 (67-106)

93.7 (8-147)

4

0

t(1;19)/E2A-PBX1

1

31

69.6

49

10

1

0

Complex karyotype

2

44 (33-55)

16.1 (3.6-28.6)

75 (63-87)

67.5 (10-125)

2

0

24 (69.7%)

41.0 (18-72)

12.95 (1.7-300)

86.5 (58-149)

89 (7-214)

20

5

Normal karyotype

16

41.7 (18-72)

12.5 (1.7-87.3)

84.5 (58-149)

119.2 (17-214)

11

5

Hyperdiploidy

4

37.8 (31-49)

13.2 (3.6-23.0)

92 (86-136)

49.0 (7-125)

4

0

del (4p)

2

52 (49-55)

24.7 (20.7-28.6)

72 (63-82)

9 (8-10)

2

0

i(7q)

2

37.5 (25-50)

153.4 (6.8-300)

96.5 (68-125)

20 (17-23)

2

0

del(12p)

1

49

23.0

81

8

1

0

Standard risk**

*Median and range in parentheses WBC: White blood cells; Hb: hemoglobin; PLT: platelets **Three patients had karyotypes with both high-risk and standard-risk abnormalities, and were included in both groups

Table 3. First CR and survival rates Group CR rates Time to achieve CR (months) RD rates or OS rates

(%) Median 95% CI Sign. early death in Median 95% CI Sign.

3-year 5-year

the first 3 months (months) survival survival High risk (n=14)

9 (41%)

1.97

1.30-3.36 0.515

6 (43%)

9.85

Standard risk (n=24)

13 (59%)

2.33

0.92-3.01

8 (33%)

Total (n=33)

22 (100%)

2.33

1.47- 3.19

14 (42%)

CR- complete remission; CI- confidential interval; RD- resistant disease; OS- overall survival

3.89-16.43 .015

10%

10%

18.00 1.11-25.23

29%

24%

13.93 9.27-15.39

19.5%

17%

Velizarova et al.

Cytogenetic abnormalities and survival in ALL

Turk J Hematol 2011; 28: 176-85

might have contributed to the high CR rate (Table 1).

The CR rate was 64% in the high-risk group and 54% in the standard-risk group (p=0.755) (Table 3).

Patients with t(1;19), i(7q), and del (12p) had the highest CR rates (Table 4), but the number of patients with these aberrations was very low- 5 of 33 cases.

Female gender, age >35 years, Burkittâ&#x20AC;&#x2122;s-type ALL, and pseudodiploidy were associated with the shortest time to first CR (Table 1). The median time to achieve CR was not statistically different between the 2 groups 2.3 months in the standard-risk group and 1.9 months in the high-risk group (p=0.515) (Table 3). Patients with t(9;22)/bcr-abl had the longest time to CR and the highest RD rate (Table 4).

Differences between 3-year, 5-year, and overall survival Patients with hyperdiploidy karyotypes, a low WBC count, random cytogenetic aberrations, and females had the longest OS (Table 1). As indicated in Table 3 and the Figure, median OS was significantly shorter in the high-risk group (9.85 months) than in the standardrisk group (18 months) (p=0.015). The estimated Table 4. Estimated CR rates, and time to first CR or RD according to molecular-cytogenetic abnormalities Groups Cytogenetic CR rates Time to

aberrations (%) achieve

CR

(months)

RD rate or early death in the first 3 months

High risk

t(9;22)/bcr-abl

60%

2.73

60%

(n=14)

t(11q23)/MLL

50%

1.0

50%

t(8q24)/C-MYC

75%

1.9

50%

t(1;19)/E2A-PBX1

100%

1.4

0%

complex karyotype 50%

2.5

50%

Standard

normal karyotype

60%

1.7

40%

risk (n=24) hyperdiploidy

50%

2.25

50%

50%

2.57

50%

del (4p)

i (7q)

100%

1

0%

del(12p)

100%

2.5

0%

CR- complete remission; RD- resistant disease

181

3-year survival was 19.5% for all patients; 10% for the high-risk group vs. 29% for the standard risk group (p=0.001). In all, 17% of the patients had 5-year survival; 10% in the high-risk group and 24% in the standard risk group (p=0.005). A significant difference in OS was observed between the patients with and without CR (p=0.001) (Table 5).

A comparison of the frequency and types of molecular-cytogenetic aberrations in the immunological subgroups is presented in Table 6. The frequency of Đ&#x2019;-lineage ALL (28 cases, 84.8%) was statistically higher than T-lineage ALL (5 cases, 15.2%) (p<0.001). Among the B-ALL patients, 60.7% were common B-ALL (BII), 17.9% were pro-B ALL (BI), 17.9% were mature B-ALL (B-IV), and 3.5% were pre-B ALL (B-III).

Discussion It has been reported that cytogenetics is the most important prognostic factor in adult ALL patients [12,22-25]. Based on their results, these researchers were able to classify patients into standard-, intermediate-, and high-risk groups with significant differences in survival.

The present study compared patient characteristics, molecular-cytogenetic data, CR, and OS in a group of 33 newly diagnosed adult ALL patients that were treated with the standard adult ALL protocol.

In all, 42.4% of the patients were included in the high-risk group. All the patients were aged >35 years (except MLL (+) patients with a median age of 25 years, p=0.02). The median time to achieve CR differed insignificantly between the 2 molecularcytogenetic groups. Interestingly, time to CR was shorter in the high-risk group than in the standardrisk group.

The Philadelphia (Ph) chromosome was the most frequent karyotypic aberration in the high-risk group (35.7% in the high-risk group versus 15.15% in all 33 ALL patients), which is higher than previously reported (15%- 30%) [7,13,19,26-30]. Our observa-

Table 5. OS (months) according to remission status Status remission

Number

Percents

Median

OS (months)

Std. Error

95% CI

Patients without CR

11

33.3%

4.33

1.96

0.49

8.18

Patients with CR

22

66.7%

13.17

8.06

0.00

28.96

Overall

33

100%

12.33

1.56

9.27

15.39

OS- Overall survival, CI- confidential interval

182

Velizarova et al.

Cytogenetic abnormalities and survival in ALL

Turk J Hematol 2011; 28: 176-85

Table 6. Cytogenetic and laboratory data according to phenotype

Pro Common Pre Mature T-ALL B-ALL B-ALL B-ALL B-ALL

Total patients

5

17

2

4

5

Normal karyotype

3

8

0

1

5

Hyperdiploidy

2

1

1

0

0

Translocations

1

5

2

3

0

Deletions

1

4

0

0

0

Complex karyotype

0

1

1

0

0

44.6

40.7

27.5

49

36.8

20.7

67.5

13.8

36.8

24.0

Age* (years) WBC*

(×109/L)

Hb* (g/L)

80.4

88.0

96.5

74.6

83.4

PLT* (×109/L)

66.8

79.5

66.5

67.5

112

CR rate (%)

40%

64.70%

100%

75%

80%

Figure 1. Estimated OS (months) according to cytogenetic risk group. Standard-risk group: normal karyotype, hyperdiploidy, and other structural aberrations; high-risk group: t(11q23), t(9;22), t(1;19), t(8;14), and complex karyotype

tion pointed for variable immunophenotypes in Ph(+) ALL, without any apparent connection to a specific phenotype. Leukemic blasts in Ph(+) ALL expressed B-lineage-specific markers and aberrant myeloid markers in 3 of the 4 cases. According to Tabernero et al., [31] the frequency of myeloid coexpression in Ph(+) ALL is higher than that in Ph(-) ALL. High myeloid expression of CD13, CD33, and CD15 in 75% of lymphoblasts in Ph(-) ALL has been observed. In the present study patients with t(9;22) and/or bcr/abl rearrangements had a 60% CR rate and longer time to CR (2.73 months) than other cases in the high-risk group.

In all, 14.3% of the high-risk patients and 6.1% of all the patients in the present study had t(4; 11) (q21;q23) translocation and/or rearrangement of the MLL gene. Most leukemic blasts with this translocation had a pro-B-ALL or CALLA(+) phenotype.

One MLL(+) patient expressed myeloid antigens CD33 and cyCD13 without fulfilling the criteria for biphenotypic leukemia. The lowest median age was in patients with 11q23/MLL and a high correlation index (r=0.999) of the translocation with a high leukocyte level (median WBC count: 95.5×109/L).

CR was achieved in 1 of the MLL cases. The time to CR was the shortest (1 month), despite the presence of markers of poor prognosis (high WBC count and myeloid co-expression). These findings highlight the difficulty in confirming the independent prognostic importance of relatively small cytogenetic subgroups that are strongly correlated with other risk factors, such as the WBC count and age [20,23,32-34]. In the present study the frequency of 8q24 translocations and/or rearrangements of the C-MYC proto-oncogene was high 28.6% in the highrisk group and 12% in all 33 patients. Translocations (8q24)/C-MYC are the molecular-cytogenetic label of Burkitt’s leukemia/lymphoma [7,21,22,34,35].

Interestingly, only 3 of the 33 patients in the present study had typical mature B-cell phenotype-positive CD19, CD20, CD10, surface IgM, and CD 79a, and negative CD5, CD23, and TdT. Among the pre-B-ALL patients, involvement of the MYC gene was confirmed in 1. This is not the first time that t(8;14) has been reported beyond the context of mature B-ALL [36]. The presence of t(8q24)/C-MYC is associated with poor prognosis and a low CR rate [7,23,33,35,37].

We observed a high CR rate (75%) in the present study, but 50% of 8q24 cases had RD or early death in the 3 months following diagnosis.

Translocation t(1;19)(q23;p13) was observed in 1 (2.9%) of the ALL patients in the present study; the patient had a high WBC count (69.6×109/L), very low hemoglobin (49g/L), and low PLT count (10x109/L). This translocation is a rare cytogenetic aberration in adult ALL and correlates with immature B-lineage phenotypes, especially pro-B-ALL [7,32,37,38]. The patient’s leukemic blasts presented as non-typical for t(1;19) more mature immunophenotype with expression of CD10 (CALLA ) antigens. CR in this t(1;19)(+) patient was achieved rapidly and without therapy resistance 1 month after starting the initial treatment.

Complex chromosomal abnormalities are rare in

Turk J Hematol 2011; 28: 176-85

adult ALL patients [7,8,10,12,39]. Using cytogenetic methods we characterized complex karyotypes in 2 of the 33 cases (6.1%); among them, only 1 achieved hematological CR, despite the presence of Ph(+) blasts in multiple chromosomal aberrations. Among the 33 patients in the present study, 24 (73%) were in the standard-risk group, which had the highest prevalence of normal karyotypes (62.5%). This frequency correlates with previously published data [12,22,24]. Patients in the standard-risk group had a higher rate of first CR (59% vs. 41% in high-risk group, p=0.775), but the time to CR was longer (2.33 vs. 1.9 months, p=0.515). The standard-risk group had a lower RD and early death rates (33%) than the high-risk group (43%, p=0.05). Studies of survival in adult ALL patients have consistently shown that those with standard-risk cytogenetic aberrations survive longer than do patients with poor prognostic abnormalities. In the present study median OS in standard-risk patients was significantly longer (18 months vs. 9.85 months, p=0.02).

To date, analysis of cytogenetic aberration changes in cell ploidy in adult ALL patients are rare, but are most often combined with structural abnormalities (pseudodiploid (46, abnormal). Most likely they have no clear self-diagnostic or prognostic significance, as in pediatric ALL patients [10,11,35,40].

Poor prognosis associated with pseudodiploidy is likely a reflection of structural rearrangements and other unfavorable features. CR was achieved in patients with the hyperdiploidy karyotype only among those without t(9;22) or bcr/abl rearrangements.

Among the structural aberrations in adult ALL, deletions and isochromosomes were the second most frequent changes after translocations [7,11,33].

These chromosome abnormalities are usually classified as miscellaneous or random changes with an unclear disease prognosis [12,22,23] Inactivation of tumor suppressor genes located in regions 4p, 12p, and 7q often leads to the start of a leukemic process [7,11,33,41]. In all but 1 of the patients in the present study with a combination of del(4p) and t(4;11) deletions presented as single cytogenetic aberrations. Despite having unfavorable pretreatment laboratory characteristics (age >35 years and low PLT count), the patients with miscellaneous abnormalities had a better CR rate than the patients with nonrandom chromosome changes.

Distribution of immunophenotypes in the pres-

Velizarova et al.

Cytogenetic abnormalities and survival in ALL

183

ent study was similar to that previously published [41-43]. Numerical and structural translocations were more frequent in the mature B-ALL (75% of B IV cases) and pre-B-ALL (100%) patients. A lot of them were with poor prognostic significance t(9;22)/bcr-abl, t(8q14)/C-MYC and complex karyotype. The high CR rate in these patients (100% in pre-B-ALL and 75% in mature B-ALL) show that molecular-cytogenetic abnormalities were important, but not determinative of the achievement of the first CR, and that pretreatment laboratory and biological characteristics affected the management of the disease. The most common lymphoblast leukemia among the presented patients was common B-ALL (51.5%), which was associated with a high WBC count at presentation and high-risk cytogenetic aberrations. The common B-ALL patients had a higher incidence of Ph/bcr-abl(+) leukemia (24% of the common B-ALL cases) and a lower CR rate (64.7%) than the mature B-ALL patients. The pro-BALL (BI) patients had the lowest CR rate (40%), despite the presence of standard-risk cytogenetic changes. It is likely that the immunologically immature features of leukemic blasts were associated with poor disease outcome.

In all, 25%-30% of adult ALL cases have T-lineage ALL [42,44-46]. We studied a small group of T-ALL patients (15.2% of all ALL cases) and observed a higher CR rate in the T-ALL patients than in the B-ALL and Burkittâ&#x20AC;&#x2122;s-type leukemia patients. The CR rate in the adult ALL patients appeared to be influenced positively by the absence of high-risk translocations and favorable pretreatment laboratory characteristics.

Conclusion The present study shows that karyotype was an independent prognostic factor in the adult ALL patients for predicting OS following intensive treatment regimens, and that laboratory and biologic features (age, and WBC and PLT counts), and immunophenotype greatly influenced CR and disease outcome.

This small cohort of adult ALL cases and the high-quality cytogenetic data obtained demonstrate the value of cytogenetics for identifying patients with high and low risk of treatment failure. Future randomized clinical trials on adult ALL can and should use cytogenetic data to stratify patients into appropriate risk groups, so as to ensure they receive the most suitable therapy.

Additional cytogenetic and molecular genetic

184

Velizarova et al.

Cytogenetic abnormalities and survival in ALL

studies of adult ALL are urgently required to further characterize this disease, thereby increasing the number of patients than can benefit from alternative treatment strategies.

Acknowledgement We extend our gratitude to the International Scientific Committee for awarding this report the First Prize at the 2010 Balkan Awards for Clinical Laboratory Research, sponsored by BioSystems.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

Demczuk S. Oncogenes: a review ot their clinical application. Crit Rev oncol Hematol 1991;11:209-39.

2. Metcalf D. The molecular control of cell division, differentiation commitment and maturation in haemopoietic cells. Nature 1989;339:27-30.

3. Prasad KN, Hohland AR, Nahreini P, Cole WC, Hohland P, Kuman B, Prasad KC. Differentiation on genes: are they primary targets for human carcinogenesis? Exp Biom Med 2001;226:805-13.

4. Lee J, Sait SN, Wetzler M. Characterization of dendriticlike cells derived from t(9;22) acute lymphoblastic leukemia blasts. Int Immunol 2004;16:1377-89.

5. Hangaishi A, Ogawa S, Imamura N, Miyawaki S, Miura Y, Uike N, Shimazaki C, Emi N, Takeyama K, Hirosawa S, Kamada N, Kobayashi Y, Takemoto Y, Kitani T, Toyama K, Ohtake S, Yazaki Y, Ueda R, Hirai H. Inactivation of multiple tumor-suppressor genes involved in negative regulation of the cell cycle, MTS1/p16INK4A/CDKN2, MTS2/p15INK4B, p53, and Rb genes in primary lymphoid malignancies. Blood 1996;87:4949-58.

6. Bloomfield CD, Secker-Walker LM, Goldman AI, Van Den Berghe H, de la Chapelle A, Ruutu T, Alimena G, Garson OM, Golomb HM, Rowley JD, et al. Six-year followup of the clinical significance of karyotype in acute lymphoblastic leukemia. Cancer Genet Cytogenet 1989;40:171-85.

7. Hoelzer D, Arnold R, Bartram CR, Bohme A, Freund M, Ganser A, Kneba M, Lipp T, Ludwig WD, Maschmeyer G, Rieder H, Thiel E, Messerer D, Weiss A, Gokbuget N. Acute lymphatic leukemia in the adult. Diagnosis, risk groups and therapy. Internist (Berl) 2002;43:1212-6.

8. Hoelzer D, Thiel E, Loffler H, Buchner T, Ganser A, Heil G, Koch P, Freund M, Diedrich H, Ruhl H. Prognostic factors in a multicenter study for treatment of acute lymphoblastic leukemia in adults. Blood 1988;71:123-31.

9. Larson RA. Management of acute lymphoblastic leukemia in older patients. Semin Hematol 2006;43:126-33.

10. Ramos MM, Palacios JL, López JM, Rodríguez MG,

Turk J Hematol 2011; 28: 176-85

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

Izquierdo AM, Miranda EB. Karyotype and prognosis in adult Spanish acute lymphoblastic leukemia.

Haematologica 2001;86:438-9.

Faderl S, Kantarjian HM, Talpaz M, Estrov Z. Clinical significance of cytogenetic abnormalities in adult acute lymphoblastic leukemia. Blood 1998;91:3995-4019.

Moorman AV, Harrison CJ, Buck GN, Richards SM, Secker-Walker LM, Martineau M, Vance GH,Cherry AM, Higgins RR, Fielding AK, Foroni L. Karyotype is an independent prognostic factor in adult acute lymphoblastic leukemia (ALL): analysis of cytogenetic data from patients treated on the Medical Research Council (MRC) UKALLXII/Eastern Cooperative Oncology Group(ECOG) 2993 trial. Blood 2007;109:3189-97.

Westbrook CA, Hooberman AL, Spino C, Dodge RK, Larson RA, Davey F, Wurster- Hill DH, Sobol RE, Schiffer C, Bloomfield CD. Clinical significance of the BCR-ABL fusion gene in adult acute lymphoblastic leukemia: A Cancer and Leukemia Group B Study (8762). Blood 1992;80:2983-90.

Hoelzer D, Gokbuget N. New approaches to acute lymphoblastic leukemia in adults: where do we go? Semin Oncol 2000;27:540-59.

Thomas X, Boiron JM, Huguet F, Dombret H, Bradstock K, Vey N, Kovacsovics T, Delannoy A, Fegueux N, Fenaux P, Stamatoullas A, Vernant JP, Tournilhac O, Buzyn A, Reman O, Charrin C, Boucheix C, Gabert J, Lhéritier V, Fiere D. Outcome of treatment in adults with acute lymphoblastic leukemia: analysis of the LALA-94 trial. J Clin Oncol 2004;22:4075-86.

Bene MC, Castoldi G, Knapp W, Ludwig WD, Matutes E, Orfao A, van't Veer MB. Proposals for the immunological classification of acute leukemias. European Group for the Immunological Characterization of Leukemias (EGIL). Leukemia. 1995;9:1783-86.

Shaffer LG, Tommerup N, editors. An International System for Human Cytogenetic Nomenclature. Karger 2005.

Kaplan E, Meier P. Nonparametric estimation from incomplete observations. J Am Stat Assoc 1958;53:457-81.

Thomas DA. Philadelphia Chromosome–Positive Acute Lymphocytic Leukemia: A New Era of Challenges.

Hematology Am Soc Hematol Educ Program. 2007;435-43.

Gökbuget N, Hoelzer D. Recent approaches in acute lymphoblastic leukemia in adults. Rev Clin Exp Hematol 2002;6:114-41.

Pui CH, Evans WE. Acute lymphoblastic leukemia. N Engl J Med 1998;339:605-15.

Wetzler M, Dodge RK, Mrózek K, Carroll AJ, Tantravahi R, Block AW, Pettenati MJ, Le Beau, MM, Frankel SR, Stewart CC, Szatrowski, Schiffer CA, Larson RA, CD Bloomfield. Prospective karyotype analysis in adult acute lymphoblastic leukemia: The Cancer and Leukemia Group B Experience. Blood 1999;93:3983-93.

Cytogenetic abnormalities in adult acute lymphoblastic leukemia: correlations with hematologic findings and outcome. A Collaborative Study of the Group Français de Cytogénétique Hématologique. Blood 1996;87:3135-42.

Secker-Walker LM, Prentice HG, Durrant J, Richards, Hall E, Harrison G. Cytogenetics adds independent prognostic information in adults with acute lympho-

Turk J Hematol 2011; 28: 176-85

25.

26.

27.

28.

29.

30.

31.

32.

33.

blastic leukemia on MRC trial UKALL XA. Br J Haematol 1997;96:601-10.

Mancini M, Scappaticci D, Cimino G, Nanni M, Derme V, Elia L, Tafuri A, Vignetti M, Vitale A, Cuneo A, Castoldi G, Saglio G, Pane F, Mecucci C, Camera A, Specchia G, Tedeschi A, Di Raimondo F, Fioritoni G, Fabbiano F, Marmont F, Ferrara F, Cascavilla N, Todeschini G, Nobile F, Kropp MG, Leoni P, Tabilio A, Luppi M, Annino L, Mandelli F, Foà R. A comprehensive genetic classification of adult acute lymphoblastic leukemia (ALL): analysis of the GIMEMA 0496 protocol. Blood 2005; 105:3434-41. [CrossRef] Yanada M, Takeuchi J, Sugiura I, Akiyama H, Usui N, Yagasaki F, Nishii K, Ueda Y, Takeuchi M, Miyawaki S, Maruta A, Narimatsu H, Miyazaki Y, Ohtake S, Jinnai I, Matsuo K, Naoe T, Ohno R; Japan Adult Leukemia Study Group. Karyotype at diagnosis is the major prognostic factor predicting relapse-free survival for patients with Philadelphia chromosome-positive acute lymphoblastic leukemia treated with imatinib-combined chemotherapy. Haematologica 2008;93:287-90.

Pane F, Intrieri M, Quintarelli C, Izzo B,Muccioli GC, Salvatore F. BCR/ABL genes and leukemic phenotype: from molecular mechanisms to clinical correlations.

Oncogene 2002;21:8652-67.

Nashed AL,Rao KW,Gulley ML. Clinical applications of BCR-ABL molecular testing in acute leukemia. J Mol Diagn 2003;5:63-72.

Faderl S, O'Brien S, Pui C-H, Stock W, Wetzler M, Hoelzer D, Kantarjian H. Adult acute lymphoblastic leukemia concepts and strategies. Cancer 2010;116:1165-76.

Huret JL, Minor SL, Dorkeld F, Dessen P, Bernheim A. Atlas of genetics and cytogenetics in oncology and hematology, an interactive database. T (9; 22)(q34; q11). Nucleic Acids Res 2000;28:349-51.

Tabernero MD, Bortoluci AM, Alaejos I, Lopez-Berges MC, Rasillo A, Garcia-Sanz R, Garcia M, Sayagues JM, Gonzalez M, Mateo G, San Miguel JF, Orfao A. Adult precursor B-ALL with BCR/ABL gene rearrangements displays a unique immunophenotype based on the pattern of CD10, CD34, CD13, and CD38 expresssion.

Leukemia. 2001;5:406-14.

Huret JL. 11q23 rearrangements in leukaemia. Atlas Genet Cytogenet Oncol Haematol 2003. http://www. infobiogen.fr/services/chromcancer/ Anomalies/ 11q23ID1030.html.

Pullarkat V, Slovak ML, Kopecky KJ, Forman SJ, Appelbaum FR. Impact of cytogenetics on the outcome of adult acute lymphoblastic leukemia: results of Southwest Oncology Group 9400 study. Blood

Velizarova et al.

Cytogenetic abnormalities and survival in ALL

185

2008;111:2563-72.

34. Abe R, Sandberg AA. Significance of abnormalities involving chromosomal segment 11q22-25 in acute leukemia. Cancer Genet Cytogenet 1984;13:121-7.

35. Levitt L, Lin R. Biology and treatment of adult acute lymphoblastic leukemia. West j Med 1996;164:143-55.

36. Bellan C, Lazzi S, De Falco G, Nyongo A, Giordano A, Leoncini L. Burkitt’s lymphoma: new insights into molecular pathogenesis. J Clin Pathol 2003;56:188-92.

37. Mitelman Database of Chromosome Aberrations and Gene Fusions in Cancer . Mitelman F, Johansson B and Mertens F (Eds.), 2010. Available at: http://cgap.nci.nih. gov/Chromosomes/Mitelman.

38. Nourse J, Mellentin JD, Galili N, Wilkinson J, Stanbridge E, Smith SD, Cleary ML. Chromosomal translocation t(1;19) results in synthesis of a homeobox fusion mRNA that codes for a potential chimeric transcription factor. Cell 1990;60:535-45.

39. Ludwig WD, Rieder H, Bartram CR, Heinze B, Schwartz S, Gassmann W, Loffler H, Hossfeld D, Heil G, Handt S, Heyll A, Diedrich H, Fischer K, Weiss A, Volkers B, Aydemir U, Fonatsch C, Gokbuget N, Thiel E, Hoelzer D. Immunophenotypic and genotypic features, clinical characteristics, and treatment outcome of adult pro-B acute lymphoblastic leukemia: results of the German Multicenter Trials GMALL 03/87 and 04/89. Blood 1998;92:1898-909.

40. Pui CH, Relling MV, Downing JR. Acute lymphoblastic leukemia. N Engl J Med 2004; 350:1535-48. [CrossRef] 41. Brozek I, Babinska M, Kardas I, Wozniak A, Balcerska A, Hellmann A, Limon J. Cytogenetic analysis and clinical significance of chromosome 7 aberrations in acute leukaemia. J Appl Genet 2003;44:401-12.

42. Jennings CD, Foon KA. Recent аdvances in flow cytometry: application to the diagnosis of hematologic malignancy. Blood 1997;90:2863-92.

43. Gill PS, Meyer PR, Pavlova Z, Levine AM.B cell acute lymphocytic leukemia in adults-Clinical, morphologic, and immunologic findings. J Clin Oncol 1986;4:737-43.

44. Drexler HG, Thiel E. Ludwig WD. Review of the incidence and clinical relevance of myeloid antigen-positive acute lymphoblastic leukemia. Leukemia 1991;5:637-45.

45. Raimondi SC. T-lineage acute lymphoblastic leukemia (T-ALL). Atlas Genet Cytogenet OncolHaematol.2007;URL: h t t p : / / A t l a s G e n e t i c s O n c o l o g y. o r g / A n o m a l i e s / TALLID1374.html 46. Hoelzer D, Gökbuget N, Ottmann O, Pui CH, Relling MV, Appelbaum FR, van Dongen JM, Szczepanski T. Acute Lymphoblastic Leukemia. Hematology 2002;2:162-92.

186

Research Article

Variant Philadelphia translocations with different breakpoints in six chronic myeloid leukemia patients Altı Kronik miyeloid lösemi olgusunda farklı kırık noktalı varyant Philadelphia translokasyonları Dilhan Kuru1, Yelda Tarkan Argüden1, Muhlis Cem Ar3, Ayşe Çırakoğlu1, Şeniz Öngören3, Şükriye Yılmaz1, Ahmet Emre Eşkazan3, Ayhan Deviren2, Teoman Soysal3, Seniha Hacıhanefioğlu2, Birsen Ülkü3 1Department

of Medical Biology, Cerrahpaşa Faculty of Medicine, İstanbul University, İstanbul, Turkey of Medical Genetics, Cerrahpaşa Faculty of Medicine, İstanbul University, İstanbul, Turkey 3Department of Internal Medicine, Division of Hematology, Cerrahpaşa Faculty of Medicine, İstanbul University, İstanbul, Turkey 2Department

Abstract Objective: The Philadelphia (Ph) chromosome, consisting of the t(9;22)(q34;q11) translocation, is observed in ~90% of patients with chronic myeloid leukemia (CML). Variant Ph translocations are observed in 5%-10% of CML patients. In variant translocations 3 and possibly more chromosomes are involved. Herein we report 6 CML patients with variant Ph translocations.

Materials and Methods: Bone marrow samples were examined using conventional cytogenetic meth ods. Fluorescence in situ hybridization (FISH) with whole-chromosome paints and BCR-ABL 1D probes were used to confirm and/or complement the findings, and identify rearrangements beyond the resolution of conventional cytogenetic methods.

Results: Variant Ph translocations in the 6 patients were as follows: t(7;22)(p22;q11), t(9;22;15) (q34;q11;q22), t(15;22)(p11;q11), t(1;9;22;3)(q24;q34;q11;q21), t(12;22)(p13;q11), and t(4;8;9;22) (q11;q13;q34;q11).

Conclusion: Among the patients, 3 had simple and 3 had complex variant Ph translocations. Two of the presented cases had variant Ph chromosomes not previously described, 1 of which had a new complex Ph translocation involving chromosomes 1, 3, 9, 22, and t(1;9;22;3)(q24;q34;q11;q21) apart from a clone with a classical Ph, and the other case had variant Ph translocation with chromosomes 4, 8, 9, and 22, and t(4;8;9;22)(q11;q13;q34;q11) full complex translocation. Number of studies reported that some patients with variant Ph translocation were poor responders to imatinib. All of our patients with variant Ph translocations had suboptimal responses to imatinib, denoting a poor prognosis also.

Variant Ph translocations may be important as they are associated with prognosis and therapy for CML patients. (Turk J Hematol 2011; 28: 186-92) Key words: Chronic myeloid leukemia (CML), variant Ph chromosome, cytogenetics, fluorescence in situ hybridization (FISH) Received: June 25, 2010

Accepted: August 19, 2010

Address for Correspondence: Dr. Dilhan Kuru, Department of Medical Biology, Cerrahpaşa Faculty of Medicine, İstanbul University, İstanbul, Turkey Phone: +90 212 414 30 34 E-mail: dilhank@istanbul.edu.tr doi:10.5152/tjh.2011.52

Kuru et al.

Variant Ph translocations in six CML patients

Turk J Hematol 2011; 28: 186-92

187

Özet Amaç: t(9;22)(q34;q11) sonucu oluşan Philadelphia (Ph) kromozomu, kronik miyeloid lösemi (KML) olgularının %90’ dan fazlasında gözlenir. KML hastalarının %5-10 unda varyant Ph translokasyonları bulunur. Varyant translokasyonlar üç ve daha fazla kromozom içerebilmektedir. Bu çalışmada varyant Ph translokasyonlu 6 KML olgusu sunulmaktadır.

Yöntemler ve Gereçler: Kemik iliği örnekleri konvansiyonel sitogenetik kullanılarak incelendi; BCRABL 1D problarının kullanıldığı Floresan İn Situ Hibridizasyon (FISH) yöntemi bulguların doğrulanması ve konvansiyonel sitogenetik yöntemlerinin tespit etmekte yetersiz kaldığı yeniden düzenlemelerin tanımlanması amacıyla uygulandı.

Bulgular: Çalışmada yer alan 6 hastanın varyant Ph translokasyonları: t(7;22)(p22;q11), t(9;22;15) (q34;q11;q22), t(15;22)(p11;q11), t(1;9;22;3)(q24;q34;q11;q21), t(12;22)(p13;q11) ve t(4;8;9;22) (q11;q13;q34;q11) dır.

Sonuç: Üç olguda basit, 3 olguda ise karmaşık (kompleks) varyant Ph translokasyonları saptamış bulunuyoruz. Olgularımızın ikisi daha önce bildirilmeyen varyant Ph kromozomları taşıyorlardı. Bu olgulardan biri klasik Ph’lı bir klonun yanısıra 1, 9, 22 ve 3 numaralı kromozomları içeren t(1;9;22;3) (q24;q34;q11;q21) formüllü yeni bir kompleks Ph translokasyonuna; diğeri ise 4, 8, 9 ve 22 numaralı kromozomları içeren t(4;8;9;22)(q11;q13;q34;q11) kompleks translokasyonlu varyant Ph’ya sahiptiler. Varyant Ph’lı 6 olgunun tümü kötü prognoza işaret eden yetersiz imatinib cevabı gösterdiler.

(Turk J Hematol 2011; 28: 186-92)

Anahtar kelimeler: Kronik myeloid lösemi (KML), varyant Philadelphia kromozomu, sitogenetik, floresan in situ hibridizasyon (FISH) Geliş tarihi: 25 Haziran 2010

Kabul tarihi: 19 Ağustos 2010

Introduction Chronic myeloid leukemia (CML) is a clonal myeloproliferative neoplasm arising from neoplastic transformation of a pluripotent stem cell. The Philadelphia (Ph) chromosome, which is the result of t(9;22)(q34;q11), is observed in ~90% of CML patients. The translocation leads to fusion of the proto-oncogene Abelson (ABL) and a particular DNA sequence known as breakpoint cluster region (BCR), thereby giving rise to 2 new chimeric genes 5’ ABL-3’ BCR on the derivative chromosome 9 and 5’ BCR-3’ ABL on the derivative chromosome 22.

Variant Ph translocations have been observed in 5%-10% of CML patients [1]. These variant translocations may be simple or complex. Simple variant translocations occur when the deleted segment of 22q is translocated onto a chromosome other than chromosome 9. In complex translocations, 3 and possibly more chromosomes are involved [2,3]. In a few cases of variant Ph translocations the BCR-ABL fusion gene is located on chromosomal sites other than 22q11 [4].

More than 1 mechanism plays a role in the evolution of variant Ph translocation; it can originate secondary to simple Ph translocation or can arise simultaneously in a 3-way rearrangement. Different mechanisms involved in the formation of a variant translo-

cation may have different clinical implications: a 2-step evolution might resemble a clonal evolution, whereas variant translocations that evolve simultaneously in a 3-way rearrangement may be similar to simple Ph translocation [5]. The clinical significance of variant t(9;22) translocations is not clear [4].

In the present study bone marrow samples from 6 CML patients were examined using conventional cytogenetic methods, FISH with whole-chromosome paints, and BCR-ABL 1D probes to confirm and/or complement the findings, and identify rearrangements beyond the resolution of conventional cytogenetic methods. Additionally, 2 of the CML patients had new complex translocations; 1 between chromosomes 1, 3, 9, 22, and other between 4, 8, 9, and 22. Possible correlations between chromosome breakpoints other than 9 and 22 in these Ph variant tranlocations, and recent updates for the map locations of consistent cancer breakpoints, fragile sites, and oncogenes are discussed.

Materials and Methods Patients The study included 6 clinically diagnosed CML patients that were referred for cytogenetic analysis and had variant Ph translocations. Clinical features of the patients are shown in Table 1.

188

Kuru et al.

Variant Ph translocations in six CML patients

Turk J Hematol 2011; 28: 186-92

Table 1. Clinical features of the patients Case

1

2

3

4

5

6

Age/Sex

39/F

23/M

52/M

33/F

60/F

32/M

Reason for referral

CML

CML

CML

CML

CML

CML

0

NA

0

15

0

25

9.7

NA

13.9

9,7

11

8,4

360

NA

220

360

180

214

75.4

NA

67.7

160

69,7

123,7

1

NA

0

1

0

3

Sokal score

Low

NA

Low

Intermediate

Low

High

Best cytogenetic response

PCR

NA

CCR

NCR

NCR

NCR

HU, IFN, IM

NA

HU, IFN,I M

HU, IFN, ARA-C, IM, D

HU, GL

HU, IM, D

Splenomegaly (cm below the costal margin) Hemoglobin level (g/dL) Platelet count

(mm3)

Leukocyte count

(mm3)

Blasts in PB (%)

Treatment

NA: Not Available; F: Female; M: Male; PB: Peripheral Blood; HU: Hydroxyurea; INF: Interferon; ARA-C: Cytosine arabinoside; IM: Imatinib mesylate; D: Dasatinib; PCR: Partial cytogenetic response; CCR: Complete cytogenetic response; NCR: No cytogenetic response

Cytogenetic and FISH analysis Bone marrow (BM) samples were used for cytogenetic and FISH analysis.

Cytogenetics Cytogenetic analysis was performed on overnight and 24-h unstimulated BM cultures using standard procedures. The GTL (G-bands via trypsin using Leishman) banding technique [6] was applied to the slides, karyotypes were described according to the International System for Human Cytogenetic Nomenclature (2005) [7], and 15-20 metaphases were analyzed for each sample.

FISH analysis Fresh slides were used for FISH analysis. Before hybridization the slides were pre-treated with pepsin, followed by post-fixation and denaturation.

FISH analysis was performed according to the manufacturerâ&#x20AC;&#x2122;s protocols. BCR-ABL1 rearrangement was examined using a BCR-ABL1 D-FISH probe (BCR: 500 Kb in red; ABL1: 600 Kb in green; Oncor, Inc., Gaithersburg, MD, USA).

FISH analyses using whole chromosome paint (WCP) probes to characterize only complex variant translocations in patients 2, 4 and 6.: for patient 2 painting probes for chromosomes 15 and 22 were digoxigenin labeled (WCP 15 and WCP 22; Oncor, Gaithersburg, MD, USA); for patient 4 painting probes for chromosomes 1, 9, and 22 (WCP 1, 9, and 22; XCP-MetaSystems); for patient

6 painting probes for chromosomes 4, 8, 9, and 22 (WCP 4, 8, 9, and 22; XCP-MetaSystems and Cytocell). Fluorescence microscopy was performed with a Nikon E600 microscope with a triple-pass filter and a cooled monochrome CCD camera, using MacProbe FISH analysis software and a CytoVision Ultra system (Applied Imaging, Pittsburgh, PA).

Results Variant Ph translocations were identified in all 6 patients using G-banding analysis, and were confirmed via FISH analysis. G-banding and FISH results are shown in Table 2.

Table 2. G-Banding and FISH results in the patients Patient Karyotype Probe

Hybridization pattern

1 46,XX,t(7;22)(p22;q11)

BCR-ABL (+)

BCR-ABL1 D-FISH

2

46,XY,t(9;22;15) WCP 15 and 22 confirmed (q34;q11;q22)

3

46,XY,t(13;15)(p11;q13), BCR-ABL1 t(15;22)(p11;q11) D-FISH

BCR-ABL (+)

4

46,XX,t(9;22)(q34;q11)/ BCR-ABL1 46,XX,t(1;9;22;3) D-FISH (q24;q34;q11;q21) WCP 1, 9, 22

BCR-ABL (+), confirmed

5 46,XX,t(12;22)(p13;q11) BCR-ABL1

D-FISH

BCR-ABL (+)

6 46,XY,t(4;8;9;22)

(q11;q13;q34;q11)

BCR-ABL (+), confirmed

BCR-ABL1 D-FISH WCP 4, 8, 9, and 22

Turk J Hematol 2011; 28: 186-92

Cytogenetics In all, 3 of the patients (1, 3, and 5) had simple variant Ph translocations and 3 (2, 4, and 6) had complex translocations. Among the complex variant Ph translocations, 3 chromosomes were involved in 1 patient (2) and 4 chromosomes were involved in 2 patients (4 and 6). Clonal evolution was observed only in patient 4; there were 2 clones 1 with a classical Ph and 1 with t(1;9;22;3) (q24;q34;q11;q21). The chromosomal breakpoints of the variant Ph translocations were 1q24, 3q21, 4q11, 7p22, 8q13, 12p13,15p11, and 15q22. In patient 3 additional clonal chromosomal changes along with variant Ph translocation were observed [t(13;15)(p11;q13)]. Partial G-banding karyotypes are presented in Figure 1.

FISH analysis In 5 patients (1, 3, 4, 5, and 6) dual-color FISH with the use of the BCR and ABL probes showed the BCR-ABL fusion gene on the Ph chromosome. In patient 2 BCR and ABL probes could not be used due to insufficient material. With the WCP probes involvement of chromosomes other than 9 and 22 in the complex variant translocations were confirmed in patients 2, 4, and 6. FISH images are shown in Figure 2.

Kuru et al.

Variant Ph translocations in six CML patients

189

Figure 1. Partial G-banding karyotypes in the 6 patients. A. Patient 1: t(7;22)(p22;q11). B. Patient 2: t(9;22;15)(q34;q11;q22). C. Patient 3: t(15;22)(p11;q11) and clonal chromosomal changes t(13;15) (p11;q13). D. Patient 4: t(1;9;22;3)(q24;q34;q11;q21). E. Patient 5: t(12;22)(p13;q11). F. Patient 6: t(4;8;9;22)(q11;q13;q34;q11)

Discussion In the present study chromosomal breakpoints of the variant Ph translocations other than classical 9 and 22 breakpoints were 1q24, 3q21, 4q11, 7p22, 8q13, 12p13,15p11, and 15q22. All 8 breakpoints observed in the 6 patients are listed as variant Ph translocations in the Mitelman database (http:// www.cgap.nci.nih.gov/Chromosomes/Mitelman; updated 23 February 2009) [8]. Among the chromosomes that constituted variant Ph translocations in the presented patients, those that were previously described are shown in Table 3.

It was reported that breakpoints involved in variant Ph translocations are primarily located in lightstaining bands [2]. Apart from 1q24, the breakpoints observed in the present study were also in lightstaining bands. Most of the breakpoints observed in the present study harbor genes known to be associated with neoplasia. GPA33 in 1q24, DIRC2 and HSPBAP1 in 3q21, BTL in 4q11, ETV6 in 12p13, and PML in 15q22 genes are implicated in different leu-

Figure 2. FISH analysis results. A. Signals of BCR-ABL fusion on interphase cells via the BCR-ABL1 D-FISH probe (ONCOR). Green signals on 1 of chromosome 9, red signals on 1 of chromosome 22, and yellow signals on the Ph chromosome showing BCR-ABL fusion. B. In patient 2 metaphase FISH showing t(9;22;15) via WCP 15 (ONCOR) red signals. C. In patient 4 metaphase FISH showing t(1;9;22;3) via WCP 1, 9, and 22 (MetaSystems). CI. Chromosome 1 is green and chromosome 22 is red. CII. and chhromosome 9 is green and chromosome 22 is red. D. In patient 6 metaphase FISH showing t(4;8;9;22) via WCP 4 and 8, (Cytocell), and WCP 9 and 22 (MetaSystems). DI. Chromosome 4 is green and chromosome 8 is red. DII. Chromosome 4 is green and chromosome 22 is red. DIII. Chromosome 8 is red and chromosome 9 is green

190

Kuru et al.

Variant Ph translocations in six CML patients

Turk J Hematol 2011; 28: 186-92

kemias and solid tumors, but the gene in 8q13 is unknown [20]. Band 7p22 in patient 1 corresponded to the map location of common fragile sites [21].

Among the 6 presented patients, 3 had simple and 3 had complex variant Ph translocations. To the best of our knowledge only a few cases of variant Ph translocations involving >3 chromosomes have been reported [1,5,9,11-19,22,23]. In all, 2 of the presented patients (4 and 6) had 4-way rearrangement [t(1;9;22;3)(q24;q34;q11;q21) and t(4;8;9;22) (q11;q13;q34;q11)], including breakpoints that differed from those previously reported. CML studies reported 1q24 and 3q21 in simple and 3-way variant Ph translocations [8,20]. The literature does not contain any reports of 4-way complex translocations involving the chromosomal band 1q24 in CML patients. Similarly, simple and complex variant Ph translocations involving chromosomal bands 4q11 and 8q13 have not yet been reported in CML patients. In CML patients 8q13 has been reported in

translocations other than Ph and 4q11 was reported in association with ANLL [8,18,20]. Specific chromosomal abnormalities involving band 3q21 have been observed in all FAB subtypes of acute myeloid leukemia (AML), in myelodysplastic syndrome, occasionally in the blastic phase of chronic myeloid leukemia, and rarely in chronic phase CML. In some older studies variant Ph translocations involving 3q21 were considered a marker of poor prognosis in CML, and were used to justify the necessity of increasing the dose of imatinib, as commonly administered in the accelerated phase [24]. Patient 4 in the present study did not have a hematological or cytogenetic response to imatinib.

Consequently, imatinib was replaced by dasatinib, which was administered for 1 year, but also did not result in a cytogenetic or hematological response.

Excluding patient 3, all the presented patients with variant Ph translocations were poor responders to imatinib and were therefore treated with dasatinib.

Table 3. Chromosomes involved in variant Ph translocations in the 6 patients and previously reported breakpoints Chromosomes seen in our cases

Type of translocations reported in the literature

Reference

4p14, 14q32

t(4;14;9;22)(p14;q32;q34;q11)

Aoun et al. 2004 [1]

6q25, 8q22

t(6;8;9;22)(q25;q22;q34;q11)

Acar et al. 1997 [9]

1p36

t(1;9;22)(p36;q34;q11)

3p25

t(3;9;22)(p25;q34;q11)

4p14

t(4;9;22)(p14;q34;q11)

12q22

t(9;22;12)(q34;q11;q22)

7q22

t(7;9;22)(q22;q34;q11)

8q12

t(8;9;22)(q12;q34;q11)

3q26

t(3;9;22)(q26;q34;q11)

4p14

t(4;9;22)(p14;q34;q11)

4p16

t(4;9;22)(p16;q34;q11)

6p22, 12q13

t(6,9;12;22)(p22;q34;q13;q11)

1q36

t(1;22)(q36;q11)

4q31

t(4;9;22)(q31;q34;q11)

7q12

t(7;9;22)(q31;q34;q12)

12q24.1

t(9;22;12)(q34;q11;q24.1)

3q26.2, 17q21

t(3;17;9;22)(q26.2;q21;q34;q11)

1p36

der(1)t(1;9;22)(p36.1;q34;q11.2)

1q42

t(1;9;22)(q42; q34;q11.2)

7q11.2

der(9;22;7)ins(7;22)(q11.2;q11q.12)

t(9;22;7)(q34;q11.2;q11.2)

12p13

t(9;22;12)(q34;11.2;p13)

15q15, 21q11.2

t(9;22;15;21)(q34;q11.2;q15;q11.2)

1q25, 20q13, 1p35

t(1;20;9;22;1)(q25;q13;q34;q11.2; p35)

Yehuda et al. 1999 [5]

Zagariaa et al. 2004 [4]

Morel et al. 2003 [10] Zagariaa et al. 2006 [11]

Zang et al. 1993 [12]

Reddy et al. 2000 [13]

Kuru et al.

Variant Ph translocations in six CML patients

Turk J Hematol 2011; 28: 186-92

191

Table 3. Continued Chromosomes seen in our cases

Type of translocations reported in the literature

Reference

1p36

t(1;9;22)(p36.1;q34;q11.2)

1q21

t(1;9;22)(q21;q34;q11.2)

12p13

t(9;22;12)(q34;q11.2;p13)

12q13

t(9;22;12)(q34;q11.2;q13)

12p13, 20q12

t(9;22;20;12)(q34;q11.2;q12;p13)

1p36

t(1;9;22)(p36;q34;q11)

3p11

t(3;9;22)(p11;q34;q11)

3q12

t(3;9;22)(q12;q34;q11)

4q12

t(4;9;22)(q12;q34;q11)

1p36,11p15q23

t(1;11;22)(p36.2;p15q13;q12),

4q34

t(4;9;22)(q34;q34;q11)

1p36

t(1;9;22)(p36;q34;q11)

1q32

t(1;9;22)(q32;q34;q11)

1q42

t(1;9;22)(q42;q34;q11)

3p21

t(3;9;22)(p21;q34;q11)

3q21

t(3;22)(q21;q11)

4p14

t(4;9;22)(p14;q34;q11)

4p16

t(4;22)(p16;q11)

4q31

t(4;9;22)(q31;q34;q11)

7q11

t(7;9;22)(q11;q34;q11)

7q32

t(7,9,22)(q32;q34;q11)

12p12

t(12;22)(p12;q11)

12q13

t(9;22;12)(q34;q11;q13)

12q14

t(9;22;12)(q34;q11;q14)

15q15

t(9;22;15)(q34;q11;q15)

15q15

t(15;22)(q15;q11)

15q24

t(9;22;15)(q34;q11;q24)

5q13,7q11

t(5;7;9;22)(q13;q11;q34;q11)

6q24, 8q24

t(6;9;22;8)(q24;q34;q11;q24)

7q22,15q14

t(7;9;22;15)(q22;q34;q11;q14)

4q12

t(4;22)(q12;q11)

Baxter et al. 2002 [18]

4q25

t(4;9;22)(q25;q34;q11)

Sheth et al. 2005 [19]

Costa et al. 2006 [14]

Markovic et al. 2000 [15]

Babicka et al. 2006 [16]

Reid et al. 2003 [17]

Note. The same breakpoints with ours that involved in variant Ph translocations in literature were marked by bold character

The strongest evidence for serial stepwise rearrangements resulting in variant Ph translocation comes from the rare observation of patients with a standard Ph in 1 clone and a complex variant Ph in another clone, as in patient 4 in the present study, who had 1 clone with t(9;22)(q34;q11) and 1 clone with a complex variant Ph translocation t(1;9;22;3)(q24;q34;q11;q21).

Cytogenetic evidence suggests that complex Ph translocation is derived from simple Ph translocation [17,25].

The breakpoints of variant Ph translocations in CML patients may be important, as they are associated with carcinogenesis. Above all, monitorization of chromosomes and localization of precise breakpoints involved in the complex rearrangements in CML patients will improve our understanding of the genetic mechanisms that play a role in the progression of malignant disease. We trust that the present studyâ&#x20AC;&#x2122;s results will contribute to the scientific com-

192

Kuru et al.

Variant Ph translocations in six CML patients

munity’s knowledge of CML cytogenetics. Written informed consent was obtained from all the patients.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

Aoun P, Pickering D, Foran J, Rasheed H, Wiggins M, Pavletic SZ, Sanger W. Interphase fluorescence in situ hybridization studies for the detection of 9q34 deletions in chronic myelogenous leukemia : a practical approach to clinical diagnosis. Cancer Genet Cytogenet 2004;154:138-43.

2. Stopera SA, Ray M, Riordan D, Christie N, Wickstrom D. Variant Philadelphia translocations in chronic myeloid leukemia: correlation with cancer breakpoints, fragil sites and oncogenes. Cancer Lett 55:249-53.

3. Lazarevic V, Jankovic G, Kraguljac N, Djordjevic V, Miljic P, Bogunovic M, Rajic Z, Cemerikic-Martinovic V, Suvajdzic N, Colovic M. Clinical, Immunophenotypic and Cytogenetic Features of Megakaryocytic Blast Crisis of Chronic Myeloid Leukemia: A Single Institution Study. Turk J Haematol 2001;18:107-15.

4. Zagaria A, Anelli L, Albano F. A fluorescence in situ hybridization study of complex t(9;22)(q34;q11) in two chronic myeloid leukemia cases with in a masked Philadelphia choromosome. Cancer Genet Cytogenet 2004;150:81-5.

5. Yehuda O, Abeliovich D, Ben- Neriah S, Sverdlin I, Cohen R, Varadi G et al. Clinical implications of Fluorescence In Situ Hybridization Analysis in 13 Chronic Myeloid Leukemia Cases: Ph-Negative and Variant Ph-positive. Cancer Genet Cytogenet 1999;114:100-7.

6. Yunis J. Comparative analysis of high resolution chromosome techniques for leukemia bone marrows.

Cancer Genet Cytogenet 1982;7:43-50.

7. Shaffer LG, Tommerup N. (eds) ISCN: An International system for Human Cytogenetic Nomenclature International Standing Committee on Human Cytogenetic Nomenclature. In: Neoplasia, Basel: S. Karger, 2005. pp. 88-95.

8. Mitelman F, Johansson B, Mertens F. Mitelman database of chromosome aberrations in cancer. Available from: http://www.cgap. nci.nih.gov/Chromosomes/ Mitelman. Accessed 23 February 2009.

9. Acar H, Stewart J, Boyd E, Connor MJ. Identification of Variant Translocations in Chronic Myeloid Leukemia by Fluorescence In Situ Hybridization. Cancer Genet Cytogenet 1997;93:115-8.

10. Morel F, Herry A, Le Bris MJ. Contribution of fluorescence in situ hybridization analyses to the characterization of masked and complex Philadelphia chromosome translocations in chronic myelocytic leukemia.

Cancer Genet Cytogenet 2003;147:115-20.

Turk J Hematol 2011; 28: 186-92

11. Zagariaa A, Anellia L, Albanob F, Vicaric L, Schiavoned E M, Annunziatad M et al. Molecular cytogenetic characterization of deletions on der(9) in chronic myelocytic leukemia. Cancer Genet Cytogenet 2006;167:97-102.

12. Zhang J, Meltzer P, Jenkins R, Guan X-Y, Trent J. Application of Chromosome Microdissection Probes for Elucidation BCR-ABL Fusion and Variant Philadelphia Chromosome Translocations of in Chronic Myelogenous Leukemia. Blood 1993;81:3365-71.

13. Reddy KS, Sulcova V. A FISH Study of Variant Philadelphia Rearrangements. Cancer Genet Cytogenet 2000;118:121-31.

14. Costa D, Carrio A, Madrigal I, Arias A, Valera A, Colomer D et al. Studies of complex Ph translocations in cases with chronic myelogenous leukemia and one with acute lymphoblastic leukemia. Cancer Genet Cytogenet 2006;166:89-93.

15. Markovic VD, Bouman D, Bayani J, Al-Maghrabi J, Kamel-Reid S, Squire JA. Lack of BCR/ABL reciprocal fusion in variant Philadelphia chromosome translocations: a use of double fusion signal FISH and spectral karyotyping. Leukemia 2000;14:1157-60.

16. Babicka L, Pavlistova L, Brezinova J, Zemanova Z, Ransdorfova S, Houskova L. Complex chromosomal rearrangements in patients with chronic myeloid leukemia. Cancer Genet Cytogenet 2006;168:22-9.

17. Reid AG, Huntly BJP, Grace C, Green AR, Nacheva1 EP. Survival implications of molecular heterogeneity in variant Philadelphia- positive chronic myeloid leukaemia. Br J Haematol 2003;121:19-27.

18. Baxter EJ, Hochhaus A , Bolufer P , Reiter A , Senent L, Cervera J , Moscardo et al. The t(4;22)(q12;q11) in atypical hronic myeloid leukaemia fuses BCR to PDGFRA. Hum Mol Genet 2002;11:1391-7.

19. Sheth F J, Sheth JJ, Verhest A. A three way complex translocation (4;9;22) in two patients with chronic myelocytic leukemia. J Cancer Res Ther 2005;1:108-10 (BRIEF COMMUNICATIONS).

20. Atlas of Genetics and Cytogenetics in Oncology and Haematology.

Available from: URL http:// AtlasGeneticsOncology.org/ 21. Huret JL, Tanzer J, Henry-Amar M. Aberrant breakpoints in chronic myelogenous leukemia; oncogenes and fragile sites. Hum Genet 1986;74:447-8.

22. Sessarego M, Fugazza G, Bruzzone R, Ballestrero A, Mıglıno M, Bacıgalupo A. Complex chromosome rearrangements may locate the bcr/abl fusion gene sites other 22q11. Haematologica 2000;85:35-9.

23. Reid A, Gribble SM, Huntly BJP, Andrews KM, Campbell L, Grace CD. Variant Philadelphia translocations in chronic myeloid leukaemia can mimic tpycal blastic crisis chromosome abnormalities or classic t(9;22): a report of two cases. Br J Haematol 2001;113:439-42.

24. Buda G, Orciuolo E, Galimberti S, Benedetti E, Caracciolo F, Cervetti G, Carulli G, Papineschi F, Petrini M. Complex translocation t(3;9;22)(q21;q34;q11) at diagnosis is a negative prognostic index in chronic myeloid leukemia. Leuk Res 2000;32:192-4.

25. Juan PME , Cardenas VJP, Jimenez EAV, Angulo MG, Flores MAE, Garcia JRG. A complex translocation (9;22;16)(q34;q11.2;p13) in chronic myelocytic leukemia. Cancer Genet Cytogenet 2005;157:175-7.

Research Article

193

Outcomes in 102 patients that present to the emergency department with chemotherapyinduced febrile neutropenia Kemoterapi kaynaklı febril nötropeni şikâyetiyle acil servise başvuran 102 hastanın sonuçları Joo Han Lim1, Hoon Kim2, Woong Gil Choi3, Kyung Hwan Kim2, Dong Wun Shin2, Moon Hee Lee1 1Department

of Internal Medicine, Faculty of Medicine, Inha University, Incheon, Korea of Emergency Medicine, Inje University Ilsan Paik Hospital, Goyang, Korea 3Department of Internal Medicine, Konkuk University Hospital, Chungju, Korea 2Department

Abstract Objective: Febrile neutropenia (FN) is a major toxic responseto chemotherapy requiring prompt medical attention. There are a limited number of reports on clinical outcome in patients with FN that present to emergency departments.

Materials and Methods: We retrospectively evaluated clinical manifestations, therapeutic outcomes, and risk factors for FN in 102 adult patients that presented to the emergency department between 1 January 2006 and 31 March 2009. FN was defined as a body temperature>38°C and a neutrophil count >0.5×109/L on the day of fever onset or the day after.

Results: Mean age of the patients was 57 years. Mean absolute neutrophil count (ANC) was 436.8/mm3 (range: 0-1000/mm3). In all, 23 of the patients (22.5%) died due to complications related to FN. There were not a statistical difference in therapeutic outcome among tumor types, performance status, sex, depth of neutropenia, or time from emergency department presentationto initiation of antibiotic therapy.

Age was an important prognostic factor for therapeutic outcome. Mean age of fatal cases was 65 years versus 56 years for non-fatal cases (p=0.016). Bacteremia was noted in 19 patients, 10 (53%) of which died. The mortality rate was significantly higher in thepatients with blood culture-proven bacteria than in those whose blood culture yielded no organism (p=0.013).

Conclusion: FN patients that presented to the emergency department had a high mortality rate that increased with age. Given the increasing age of patients diagnosed with cancer as well as therapeutic interventions, the high mortality rate associated withchemotherapy-induced FN in elderly patients requires further study in order to reduce the risk of death. (Turk J Hematol 2011; 28: 193-7) Key words: Neutropenia,fever, emergency department, chemotherapy Received: December 09, 2010

Accepted: March 28, 2011

Address for Correspondence: Prof. Hoon Kim, 2240 Daehwa-dong, Ilsan Seo-gu, Goyang-si, Gyeonggi-do, Korea Goyang-si - Korea Phone: +82-31-910-9782 E-mail: megali@hanmail.net doi:10.5152/tjh.2011.53

194

Lim et al.

Chemotherapy-induced febrile neutropenia in the emergency department

Turk J Hematol 2011; 28: 193-7

Özet Amaç: Febril nötropeni (FN), uygun tıbbi tedaviyi gerektiren kemoterapiye bağlı gelişen önemli bir toksik yanıttır. Acil servise başvuran FN’li hastalarda klinik sonuçlara yönelik sınırlı sayıda bildiri mevcuttur.

Gereçler ve Yöntemler: 1 Ocak 2006 ile 31 Mart 2009 arasında acil servise gelen 102 erişkin FN hastasında klinik belirtiler, tedavi sonuçları ve FN için risk faktörleri geriye dönük olarak değerlendirilmiştir. FN >38°C vücut sıcaklığı ve ateş başladığı gün veya ertesi günde >0.5×109/L nötrofil sayısı olarak tanımlanmıştır.

Bulgular: Hastaların yaş ortalaması 57’dir. Ortalama mutlak nötrofil sayımı (ANC) 436.8 mm/3’dir (aralık: 0-1000/mm3). Genel anlamda hastaların 23’ünde (%22.5) FN ile ilişkili komplikasyonlar nedeniyle ölüm meydana gelmiştir. Tümör tipleri, performans durumu, cinsiyet, nötropeni ağırlığı veya acil duruma gelmeden antibiyotik tedavisine başlanmasına kadar geçen süre arasında tedavi sonuçları açısından istatistiksel bir fark görülmemiştir. Yaş tedavi sonuçları yönünden önemli bir prognoz faktörüdür. Ölümcül olgularda ortalama yaş 65 iken ölümcül olmayanlarda 56’dır (p=0.016). Bakteriemi 19 hastada gözlenmiş olup bunlardan 10’u ölmüştür (%53). Kan kültürüyle bakterinin kanıtlandığı hastalarda ölüm oranı, kan kültürü ile bir organizma gösterilemeyen hastalara göre anlamlı bir şekilde daha yüksektir (p=0.013).

Sonuç: Acil servise başvuran FN hastalarında yaş ilerledikçe daha yüksek bir ölüm oranı gözlenmiştir.

Kanser tanısı konulan hastalarda ileri yaş ve yanı sıra tedavi girişimleri göz önüne alınarak, yaşlı hastalarda kemoterapi kaynaklı FN ile ilişkili yüksek ölüm oranının azaltılması için daha fazla çalışma gerekmektedir.

(Turk J Hematol 2011; 28: 193-7)

Anahtar kelimeler: Nötropeni, ateş, acil servis, kemoterapi Geliş tarihi: 09 Aralık 2010

Kabul tarihi: 28 Mart 2011

Introduction The association between neutropenia and infection, which inevitably develop following chemotherapy, is a frequent cause of morbidity and mortality in cancer patients [1,2]. Chemotherapy-induced febrile neutropenia (FN) is one of the most important and potentially life-threatening oncologic emergencies, which requires prompt medical assessment and treatment with antibiotics. In febrile patients with neutropenia, body fluids should be obtained for cultures and treatment with broadspectrum antibiotics should be started. It was recently reported that the prevalence of gram-positive infection in cancer patients with FN is increasing [3].

Although the standard of care is to treat FN as an oncologic emergency, patients generally wait for prolonged periods before receiving the necessary treatment. Prior to the present study, few data have been collected regarding the outcome of patients with FN that present to an emergency department (ED). Additional research is therefore required in order to examine the characteristics and outcome in patients that visited an ED due to chemotherapyinduced FN and to identify the risk factors associated with mortality in these patients. Accordingly, the present study retrospectively analyzed the charac-

teristics and outcomes in patients with chemotherapy-induced FN that presented to our ED.

Methods and Materials We retrospectively evaluated clinical manifestations, outcomes, and risk factors for FN following chemotherapy in 143 solid adult tumor and lymphoma patients between 1 January 2006 and 31 March 2009. Patients were selected for inclusion in the study based on the diagnosis of neutropenia and fever. Fever was defined by the criteria given in the Infectious Disease Society Guidelines, which is a fever >38°C for more than 1 h or any single temperature measurement >38.3°C [4,5]. Patients that did not receive chemotherapy were excluded from the analysis, as were those that were not febrile or neutropenic. Patients whose neutropenia and fever were diagnosed in the hematology and oncology department clinics were admitted to hospital directly without an ED visit and were likewise not included in this study. We defined FN as a body temperature >38°C and a neutrophil count ≤0.5×109/L on the same day as fever onset or the day after.

ED records for consecutive oncology patients with FN were reviewed and mortality, intensive care unit (ICU) use, blood culture results, time from ED

Turk J Hematol 2011; 28: 193-7

Lim et al.

Chemotherapy-induced febrile neutropenia in the emergency department

presentation and administration of empirical antibiotics, and age were recorded. ED and subsequent inpatient records were also reviewed for the following: vital signs, symptoms, physical findings, suspected source of infection in the ED, white blood cell count (WBC) or absolute neutrophil count (ANC), chest radiograph results, urinalysis results, hospital course, use of granulocyte colony-stimulating factor (G-CSF), blood, urine, or other culture results, and outcome. The time from fever onset to ED presentation was defined as the time from the onset of subjective symptoms (based on patient history) and presentation to the ED. The time from ED to antibiotic administration was defined as the time from presentation to the ED and the commencement of antibiotic therapy.

Treatment We performed blood cultures as soon as possible in patients suspected of FN in the ED. Empirical antibiotics (3rd- or 4th-generation cephalosporin in combination with aminoglycoside) were administered to most of the patients. If FN was accompanied by renal insufficiency, ciprofloxacin was used as an empirical antibiotic in preference to aminoglycoside.

Statistical analysis The survival rate, as the treatment outcome, was analyzed using the Kaplan-Meier method, with the date of presentation to the ED as the starting date.

We also performed Cox regression analysis using the following variables: age, sex, time from ED presentation to the start of antibiotic therapy, the effect of G-CSF, cancer type (solid tumor or lymphoma), and performance status. All statistical analyses were conducted using SPSS v.12.0 software (SPSS, Chicago, IL). A p value of less than 0.05 was considered to be statistically significant.

Results Patient characteristics We analyzed 102 patients that presented to our ED due to chemotherapy-induced FN between 1 January 2006 and 31 March 2009. The characteristics of these patients are summarized in Table 1.

The Eastern Cooperative Oncology Group (ECOG) performance status of the patients was as follows: 20 patients had a performance status of 2, 67 had a performance status of 1, and 15 had a performance

195

status of 0. Mean age of the patients was 57 years (range: 25-84 years) and 53% were male. Mean ANC was 436.8 mm3 (range: 0-1000 mm3); 4 patients had an ANC <10 mm3.

Treatment and survival outcome Survival of elderly patients (≥65) was inferior to that of the younger patients (<65). Mean age of the patients that died due to an FN event (65 years) was significantly (p=0.016) higher than that of the patients that didn’t (56 years). There wasn’t a difference in the outcome of FN between patients with lymphomas and those with solid tumors. Median time from the onset of fever to ED presentation was 24 h; the difference between the patients that died and survived was not significant (Table 2). We also analyzed the patients according to those that presented to the ED within 24 h of the onset of fever and after 24 h; however, there wasn’t a significant difference in outcome between these 2 groups. Median time from ED presentation to the start of antibiotic therapy was approximately 2 h (110 min; range: 0.6-13.3 h), and there wasn’t a significant difference between the patients that died and those that survived.

Table 1. Patient characteristics Total Patients

n=102

Sex

Male

50 (49%)

Female

52 (51%)

Median age, years

57

Cancer Type

Lymphoma

30 (29.4%)

Solid Tumor

72 (70.6%)

ANC median,

number/mm3

90 (range; 5-760)

ANC ≤100 mm3

53 (52%)

ANC >100 mm3

49 (48%)

Symptom to ED time

≤ 24hr

> 24hr

Median ED to Antibiotics time (min)

49 (48%) 53 (52%) 110 (range; 35-615)

Blood culture result

Bacteremia

19 (18.6%)

gram-positive

6 (5.9%)

gram-positive

13 (512.7%)

No growth

80 (70.4%)

No culture

3 (2.9%)

196

Lim et al.

Chemotherapy-induced febrile neutropenia in the emergency department

Among the patients that presented to the ED outside regular working hours, the time from ED presentation to the start of antibiotic therapy was longer than that in patients that presented during regular working hours; however, the difference was not statistically significant and there was no difference in the outcome of FN. In all, 24 patients (23.5%) required ICU management, of which 18 (75%) died due to complications associated with FN. Patients with FN that required ICU care had a significantly higher mortality rate than those did not require ICU care (p<0.05). Patients treated in the ICU were older than those treated in a general ward (median age: 68 vs. 55, respectively).

We also analyzed the relationship between blood culture positivity and treatment outcome. In total, 19 patients had blood culture-positive results; 6 had gram-positive bacteremia and 13 had gram-negative bacteremia. Figure 1 shows the microorganisms isolated via blood culture. The 19 patients with bacteremia were initially treated with the 3rd-generation antibiotics cephalosporin and aminoglycoside, except 2 patients highly suspected for grampositive infection (1 patient had phlebitis and 1 patient had catheter-related infection). The mortality rate was significantly higher among the culturepositive patients than among those whose blood culture yielded no organism (47.4% versus 16.3%, p=0.013). In total, 23 patients died due to an infection associated with FN. The patients that died were significantly older than those that survived.

Discussion Chemotherapy-induced neutropenia is a common toxicity that increases patient risk of morbidity and mortality, and may compromise the effectiveness of treatment via a reduction in chemotherapy dose intensity or dose density [6]. In the present study advanced age, necessity of ICU care, and bacteremia (confirmed by blood culture) were risk factors for mortality in the patients that presented to our ED with chemotherapy-induced FN. Intensive education for patients that receive chemotherapy began at our hospital in 2005. The education we provide includes information on nutrition, chemotherapy toxicity, and conditions that should prompt presentation to hospital. A fever >38°C is emphasized as a major side effect that necessitates immediate medical

Turk J Hematol 2011; 28: 193-7

Table 2. Comparison of the patients that died and survived

Age (years) Blood Culture Results

Survived 56 (25-84)

Died

65 (45-84) 0.016

n

n

Bacteremia

10

9

non-bacteremia

67

13

Cancer Type

n

n

Lymphoma

22

8

Solid

57

15

n

n

ANC <100

44

9

ANC >100

35

14

n

n

Absoulte Neutrophil Count

Time of symptom to ED

p

Symptom to ED <24h

52

13

Symptom to ED >24h

27

10

0.013

0.521

0.162

0.414

Figure 1. Culture results isolated in the patients with bacteremia

assessment; however, only 34 of the patients in the present study received individual education regarding chemotherapy and its toxicity. There was a statistically significant difference in outcome between the patients that received education and those that did not. It would nevertheless be imprudent to conclude that intensive education contributed to the survival of patients with FN; however, there is no doubting the value of education for cancer patients scheduled to receive cytotoxic chemotherapy.

Many researchers are now exploring alternatives to the standard approach to treating FN, including prophylactic oral antibiotic treatment, administration of prophylactic hematopoietic growth factors, and even oral antibiotic therapy for low-risk outpatients [7-10].

As the present study used retrospective analysis of data obtained at only 1 academic institution that treats patients with malignancies, it might not

Turk J Hematol 2011; 28: 193-7

Lim et al.

Chemotherapy-induced febrile neutropenia in the emergency department

reflect care in the community at large or that at other institutions. The retrospective design of the present study and the small sample involved should be taken into account when making inferences and recommendations based on the findings.

In conclusion, we analyzed the outcome of patients that presented to our ED due to chemotherapy-induced FN. We observed considerable mortality, particularly in the elderly patients. Given the increasing age of adults diagnosed with cancer that undergo chemotherapy, and the heightened risk of FN among elderly patients, further prospective studies are warranted in order to establish a more appropriate management strategy for chemotherapy-induced FN, and for reducing the incidence of mortality and morbidity due to chemotherapy.

Acknowledgment IRB committee of Inha university hospital approved our study. IRB committee approval is same an ethical committee approval.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

Weycker D, Malin J, Kim J, Barron R, Edelsberg J, Kartashov A, et al. Risk of hospitalization for neutropenic complications of chemotherapy in patients with primary solid tumors receiving pegfilgrastim or filgras-

197

tim prophylaxis: a retrospective cohort study. Clin Ther 2009,31:1069-81.

2. Caggiano V, Weiss RV, Rickert TS, Linde-Zwirble WT. Incidence, cost, and mortality of neutropenia hospitalization associated with chemotherapy. Cancer 2005;103:1916-24.

3. Zinner SH. Changing epidemiology of infections in patients with neutropenia and cancer: emphasis on gram-positive and resistant bacteria. Clin Infect Dis. 1999,29:490-4.

4. Paul M, Gafter-Gvili A, Leibovici L, Bishara J, Levy I, Yaniv I, et al. The epidemiology of bacteremia with febrile neutropenia: experience from a single center, 1988-2004. Isr Med Assoc J 2007;9:424-9.

5. Rabagliati BR, Fuentes LG, Orellana UE, Oporto CJ, Dominguez MI, Benitez GR, et al. [Etiology of febrile neutropenia episodes among cancer patients from Hospital Clinico Universidad Catolica, Santiago-Chile.].

Rev Chilena Infectol 2009;26:106-13.

6. Lyman GH, Lyman CH, Agboola O. Risk models for predicting chemotherapy-induced neutropenia.

Oncologist 2005,10:427-37.

7. Zinner SH. Changing epidemiology of infections in patients with neutropenia and cancer: emphasis on gram-positive and resistant bacteria. Clin Infect Dis 1999,29:490-4.

8. Marti FM, Cullen MH, Roila F. Management of febrile neutropenia: ESMO clinical recommendations. Ann Oncol 2009,4:166-9.

9. Timmer-Bonte JN, Tjan-Heijnen VC. Febrile neutropenia: highlighting the role of prophylactic antibiotics and granulocyte colony-stimulating factor during standard dose chemotherapy for solid tumors. Anticancer Drugs 2006;17:881-9.

10. Herbst C, Naumann F, Kruse EB, Monsef I, Bohlius J, Schulz H, et al. Prophylactic antibiotics or G-CSF for the prevention of infections and improvement of survival in cancer patients undergoing chemotherapy.

Cochrane Database Syst Rev 2009;CD007107.

198

Research Article

Management of autoimmune hemolytic anemia in children and adolescents: A single center experience Çocuk ve ergenlerde otoimmün hemolitik anemi tedavisi: Tek merkez deneyimi Nazan Sarper, Suar Çakı Kılıç, Emine Zengin, Sema Aylan Gelen Department of Pediatric Hematology, Faculty of Medicine, Kocaeli University, Kocaeli, Turkey

Abstract Objective: To present and discuss the treatment of autoimmune hemolytic anemia (AIHA).

Materials and Methods: The medical records of all patients (n=19) diagnosed in a tertiary hematology center between 1999 and 2010 were retrospectively reviewed.

Results: Median age at diagnosis of AIHA was 5 years (range: 4 months-17 years). In all, 13 patients had primary (idiopathic) AIHA, whereas 2 had primary Evans Syndrome (ES), 2 had autoimmune lymphoproliferative syndrome (ALPS)+ES, and 1 had Wiskott-Aldrich syndrome (WAS)+AIHA. Among the 13 primary idiopathic AIHA patients, 9 recovered following a 4-8-week course of prednisolone treatment without relapses, whereas 3 patients required a longer course of prednisolone. One AIHA patient that was very resistant to prednisolone recovered after cyclosporine A was added to the treatment. All patients with primary idiopathic AIHA were in remission for a median of 3 years (range: 4 months-10 years) at the time this manuscript was written. Among the patients with primary ES, 2 had relapses similar to the ALPS patients. Splenectomy was performed in 1 primary ES patient, who at the time this report was written was also in remission. One ALPS patient required the addition of mycophenolate mofetil due to prednisolone resistance. The WAS patient was treatment resistant and died due to septicemia.

Conclusions: Primary AIHA in pediatric patients generally has an acute onset and good response to corticosteroids. Primary or secondary ES has a chronic or relapsing course, and treatment may require other immunosuppressive agents in addition to corticosteroids. Complications of splenectomy must not be underestimated in patients with underlying immunodeficiency. AIHA often causes considerable morbidity and mortality in WAS. (Turk J Hematol 2011; 28: 198-205) Key words: Autoimmune hemolytic anemia, Evans Syndrome, childhood, autoimmune lymphoproliferative syndrome Received: September 23, 2010

Accepted: March 05, 2011

Özet Amaç: Bu makalede otoimmün hemolitik anemi tedavisinin tartışılması amaçlanmıştır.

Yöntemler ve Gereçler: Üçüncü basamak bir hematoloji merkezinde 10 yıl içinde tanı alan tüm otoimAddress for Correspondence: Prof. Dr. Nazan Sarper, Department of Pediatric Hematology, Faculty of Medicine, Kocaeli University, 41300 Kocaeli, Turkey Phone: +90 262 303 72 16 E-mail: nazan_sarper@hotmail.com doi:10.5152/tjh.2011.54

Turk J Hematol 2011; 28: 198-205

Sarper et al.

Autoimmune hemolytic anemia in children and adolescents

199

mün hemolitik anemi olgularının (OİHA) (n=19) hastane kayıtları geriye dönük olarak incelenmiştir.

Tanı sırasında ortanca yaş 5 (4 ay-17 yaş) tir. On üç hastada primer (idyopatik) OİHA, 3 hastada primer Evans Sendromu (ES), 2 hastada otoimmün lenfoproliferatif sendrom (OLPS) +ES, ve 1 hastada Wiskott-Aldrich sendromu (WAS) +OIHA saptanmıştır. On üç primer OİHA’li hastadan dokuzu 4-8 haftalık prednizolon tedavisine cevap verirken ve nüks etmezken, üç hasta daha uzun süreli prednizolon gerektirdi. Hastalardan biri prednizolona oldukça dirençliydi ve siklosporin A (CsA) ilavesiyle hemoliz kontrol altına alınabildi. Tüm primer OİHA’li hastalar ortalama 3 yıllık (4 ay-10 yıl) takipte remisyondaydı. Primer ES’lu hastaların ikisinde OİHA, OLPS’li hastalara benzer şekilde nükslerle seyretti. Primer ES’li hastaların birine splenektomi yapıldı ve halen remisyondadır. OLPS’li hastaların biri prednizolona ilave olarak dirençli OİHA nedeniyle mikofenolat mofetil de gerektirdi. WAS lı hasta dirençli OİHA atağı sırasında septisemi ile kaybedildi.

Sonuç: Çocukluk çağında primer OİHA genellikle kortikosteroide iyi cevap veren akut bir seyir gösterirken, primer veya sekonder ES nükslerle giden kronik bir seyir gösterir ve tedavide kortikosteroidlere ilave olarak diğer immunosupresif ajanlar da gerekebilir. Altta yatan immün yetersizlik olduğunda splenektominin komplikasyonları göz ardı edilmemelidir. WAS’da OİHA kayda değer morbidite ve mortalite nedenidir. (Turk J Hematol 2011; 28: 198-205) Anahtar kelimeler: Otoimmün hemolitik anemi, Evans sendromu, çocukluk çağı, otoimmün lenfoproliferatif sendrom Geliş tarihi: 23 Eylül 2010

Kabul tarihi: 05 Mart 2011

Introduction Autoimmune hemolytic anemia (AIHA) is characterized by the production of antibodies directed against red blood cells (RBCs). These antigens initiate RBC destruction via the complement and reticuloendothelial systems [1]. AIHA follows viral infection or vaccination more often in children than in adults [2]. Immunodeficiency or malignancy (especially malignancies of lymphoreticular tissues), systemic lupus erythematosus (SLE), and other types of collagen vascular diseases are the most common causes of secondary AIHA in children [3]. Also some rare disorders such as giant cell hepatitis may cause AIHA [4].

Childhood AIHA often presents as an acute selflimited illness, with good response to short-term steroid therapy in 80% of the patients [5]. In infants and adolescents onset can be insidious, with a tendency to become chronic [6]. When there is underlying immune deficiency control of the hemolytic process is not always easy, and the addition of immunosuppressive drugs and splenectomy further increase the risk of severe infections and mortality.

Although corticosteroids are always the first-line therapy, there are many alternative second and third line treatments. AIHA is an uncommon condition; treatment responses are not standard and there is a lack of prospective controlled trials for determining the optimal therapy. Hematologists must individually tailor therapy for every chronic or unresponsive patient. Herein we present our experience with 19 pediatric and adolescent patients with

AIHA and Evans syndrome (ES), and a discussion of treatment options in the light of the literature is reviewed.

Materials and Methods

The medical records from a single tertiary pediatric hematology center that was established in 1999 were retrospectively reviewed. All patients with AIHA and ES that were diagnosed and/or followed-up between 1999 and 2010 were included in the study. The study protocol was approved by the Kocaeli University Ethics Committee. Diagnoses were based on low-level hemoglobin, fragmented red cells, microspherocytes, polychromasia, macrocytosis, nucleated red cells on peripheral blood smear, elevated reticulocytes, and positive direct Coombs test (IgG+C3). Age, gender, underlying disease associated with AIHA, complete blood counts, reticulocyte counts, Coombs test results, treatment drugs, splenectomy, treatment responses, relapses, and follow-up periods were recorded. ES was defined as the combination of (either simultaneously or sequentially) autoimmune hemolytic anemia, immune thrombocytopenic purpura (ITP) and immune neutropenia. AIHA and ES were defined as the primary disease when there was no underlying disease, such as autoimmune lymphoproliferative syndrome (ALPS), congenital immunodeficiency, common variable immunodeficiency, SLE, and lymphomas.

Patients were treated with oral prednisolone 2-4 mg/kg/day in 2-3 divided doses for 2-4 weeks, with tapering over another 2-6 weeks. If hematological

200

Sarper et al.

Autoimmune hemolytic anemia in children and adolescents

response was not good, prednisolone 30 mg/kg/ day was administered intravenously for 3 days. If the Hb level decreased during steroid tapering, the dose reverted to the preceding dose. Patients were also transfused with packed red cells if their Hb was <7 g/dL. Patients were defined as steroid responsive if the Hb level was stable or increased along with decreased reticulocyte count within 14 d of starting steroid treatment.

Relapse was defined as a decrease in Hb while tapering steroid treatment or following discontinuation of corticosteroids. Chronic AIHA was defined as symptoms and laboratory abnormalities persisting for >6 months. In unresponsive, steroid-dependent, and relapsing patients cyclosporine A (CsA) and, rarely, intravenous immunoglobulin (IVIG 1 g/kg/day for 2 d) or rituximab 375 mg/m2 weekly were tried as second-line treatment. In patients with primary or secondary ES corticosteroids and CsA were always administered, but mycophenolate mofetil (MM) 600 mg/m2 b.i.d and azathioprine 3 mg/kg/day was also used as second-line treatments. Splenectomy was performed in chronic AIHA and ES patients if there was no evidence of underlying immunodeficiency. In patients with chronic AIHA, ES, or lymphoproliferation, history of frequent infections, growth failure, and eczema or any other autoimmune disease serum immunoglobulin assay and flow cytometric analysis of peripheral lymphocyte subsets and double negative T cells (DNTC) were also performed.

Statistical methods SSPS v.13.0 for Windows and descriptive statistics were used to calculate median hemoglobin level, age, and follow-up period.

Results

Between 1999 and 2010 we followed-up 19 AIHA and ES patients (14 male and 5 female). In all, 17 of the patients had warm autoantibodies and 2 patients had negative Coombs test results. Patient characteristics, management, and outcome are presented in the Table 1. Median age at diagnosis of AIHA was 5 years (range: 4 months-17 years). In total, 7 (36.8 %) of the patients were <12 months of age when AIHA was diagnosed; 13 patients (patients 1-13) had primary (idiopathic) AIHA, whereas 3 had primary ES, 2 had ALPS+ES, and 1 had Wiskott-Aldrich syndrome (WAS)+AIHA. Patients with ES had either sequential or simultaneous ITP. Median Hb concen-

Turk J Hematol 2011; 28: 198-205

tration at admission was 5.6 g/dL (range: 2.9-11.3g/ dL). Patient 7 was followed-up for neutropenia for 3 months, followed by spontaneous recovery and the development of AIHA. Among the 5 patients with ES, 3 also had neutropenia. All neutropenia and thrombocytopenia responded to immunosuppressive therapy at the same time anemia did. All the patients, except patients 6, 7, and 13, received packed red cells in addition to prednisolone at admission. Intravenous prednisolone was administered to infants during initial therapy due to ingestion problems. Generally, there was incompatibility during cross-matching. The least reactive packed red cells were transfused, and no severe hemolytic reactions attributable to transfusion were observed; however, patient 2 was previously typed as AB Rh positive at another center and the patient was transfused twice with AB Rh-positive packed red cells.

Transfusion increased hemolysis. The patient’s actual blood type was not known prior to admission. Transfusion with O Rh-negative packed red cells did not cause any hemolytic reaction and the patient was correctly typed as O Rh positive.

In all, 9 of the 13 primary idiopathic AIHA patients recovered following a 4-8-week course of prednisolone 2-4 mg/kg/day without relapses, whereas 3 patients required a longer course of prednisolone treatment (patients 2, 6, and 8 due to relapse during prednisolone tapering). Patient 2 received low-dose prednisolone (0.5 mg/kg/day) for 20 months to control hemolysis. In total, 12 patients exhibited rapid response to prednisolone, but patient 12 was very resistant to prednisolone and responded after CsA was added to the treatment (started at a dose of 6 mg/kg/day, with a target blood level of 200 ng/mL with monitoring). Patient 12 was also treated with IVIG 1 mg/kg/day for 2 d, and rituximab 375 mg m-2 QWK (only 2 doses were available due to off-label administration) was administered in an effort to discontinue CsA, but CsA dependence persisted for 13 months, after which time it was discontinued. All primary idiopathic AIHA patients were in remission for a median of 3 years (range: 4 months-10 years) at the time this report was written.

Among the patients with primary ES, 3 had relapses or chronic cytopenias. Relapses in patients 14 and 16 were controlled with 4-6-week courses of prednisolone, whereas patient 15 required CsA due to dependence on corticosteroids. Patient 14 had 3 AIHA attacks in 3 years, including AIHA-associated thrombocytopenia during the last attack. Patient 15

Sarper et al.

Autoimmune hemolytic anemia in children and adolescents

Turk J Hematol 2011; 28: 198-205

201

Table 1. Characteristics, management, and outcome in the patients with AIHA and ES Patients Age at first Hb Reticulocyte *PLT Coombs Underlying Relapse Drugs

AIHA attack, (g/dL) (%) count/ test disease treatment

gender absolute ANC duration

Follow-up duration after first AIHA attack

Outcome

10 years 10 years

remission

2 9 months, F 3.3 1.2 N/N + No 3 relapses Pred., IVIG 11 years

ND

26 month

(maintenance)

remission 9 years

3 11 months, M 5.5

23 N/N – No No ND

Pred.

5 years 8 weeks

remission 5 years

4 16 years, M 5.6

11 N/N + No No ND

Pred.

5 years 8 weeks

remission 5 years

1 4 months, M 4.4

5

2 years, F

6.2

25 N/N + No No ND

4

N/N

+

No

No

Pred.

5 weeks

Pred.

14 months

remission

128,000

8 weeks

12 months

6 8 years, M 9.3

8.4 N/N + No No 274,000

Pred.

3.8 years 16 weeks

remission 3.5 years

7 6 months, M 7.7

0.44 N/L –/+ No No 25,300

Pred.

3.5 years 8 weeks

remission 3.3 years

8 9 months, F 3.7

15 N/N + No 1 relapse 288,000

Pred.

2 years 16 weeks

remission 20 months

9 11 years, M 5.6

27.1 N/N + No No 871,000

Pred.

11 months 4 weeks

remission 10 months

10 9 months, F 4.1

2.29 N/N – No No 75,000

Pred.

18 months 4 weeks

remission 17 months

11 5 years, M 6.5

18.2 N/N + No No 424,000

Pred.

3.1 years 4 weeks

remission 3 years

12 4 months, F 2.9 1.72 N/N + No No

ND

Pred.

3 years IVIG CsA Rituximab 13 months

remission 2 years

13 13 years, M 11.3 1.39 N/N + No No

Pred 9 months 4 weeks

remission 8 months

14 3 years, M 3 9 L/N + Primary 3 relapses

248 700 Evans

3 Pred.

3.1 years courses within 3 years

last remission 4 months

15 15 years, M 6.8 3.5 L/L + Primary No

Evans

16 17 years, M 6.6 4.2 L/L + Primary 2 relapses

Evans

17 10 years, M 5.2 18 N/L + ALPS multiple

Evans relapses

†18 7 years, M 7 25 N/N +

ALPS 3 relapses Evans

Pred., 2.3 years Remission CsA 20 months 8 months postsplenectomy Splenectomy 14 months 2 Pred.

3.1 years courses within 3 years

Remission 2.5 years

Pred.

5.2 years Deflazacort MM 9 months

Remission 4.5 years

Pred.

13 years ND

remission 2 years

19 5 years, M 3.7 0.7 L/N + WAS Resistant Pred.

50 days

attack 5 weeks,

CsA 4 weeks

IVIG

Azathioprine

50 days

Eksitus Septicemia 50 days

ANC: Absolute neutrophil count; PLT: platelets; N: normal; L: low *Normal values: PLT: 150,000-450,000 mm3; ANC: >1000 mm3 for infants and >1500 mm3 for children >1 year of age Coombs test=direct anti-globulin test; CsA: cyclosporin A; MM: mycophenolate mofetil; †: followed-up elsewhere in the past; IVIG: intravenous immunoglobulin; ND: not defined

202

Sarper et al.

Autoimmune hemolytic anemia in children and adolescents

presented with ITP at the age of 3 years and was previously treated with several courses of IVIG at other centers. On his admission to our center he had a history of chronic ITP and neutropenia. He had perianal and oral lesions (3-4 attacks yearly).

We administered a 10-d course of antibiotics for each attack. Immunoglobulin levels were within normal levels during follow-up in our center. He did not have other infections indicative of immunodeficiency. When he was fifteen, he had an AIHA attack.

The following year AIHA, thrombocytopenia, and neutropenia were in remission following CsA treatment and he underwent splenectomy; 14 months post-splenectomy he no longer had cytopenias or oral/ perianal infections. Patient 16 presented as chronic ITP with remissions and relapses, and responded to short-course prednisolone. When he was 17 years old he suffered 2 moderate attacks of AIHA that responded to short-course prednisolone.

He had eczema, and low-level IgA and IgM, but no history of recurrent infections. At the time this report was written he was 20 years old and in remission. In his family history, there was a sister with ITP. Patient 17 had ALPS (severe eczema, asthma, splenomegaly, lymphadenopathy, DNTCS 7%)+ES and multiple relapses within a 9-month period: the patient presented with a very resistant, but finally prednisolone-dependent disease course. During maintenance treatment prednisolone was replaced by deflazacort to minimize adverse effects.

Considering that 6 mg of deflazacort has approximately the same anti-inflammatory potency as 5 mg of prednisolone or prednisone, the patient received deflazacort 0.25 mg/kg/day during maintenance.

MM 600 mg/m2 b.i.d was also added to the treatment. The patientâ&#x20AC;&#x2122;s parents did not consent to offlabel use of rituximab. We recommended maintenance with MM to this patient after recovery of cytopenias, but his compliance with treatment was poor. This patientâ&#x20AC;&#x2122;s autoimmune cytopenias were in remission for 4.5 years at the time this report was written. Patient 18 had ALPS (DNTS 6.3%)+ ES and was previously diagnosed and followed-up at a different hematology center. The patient had 3 relapses in a 13 year-period, which were managed with prednisolone; as of the time this report was written he was in remission. He had low-level IgA and IgM. Patient 19, who was followed-up for WAS (congenital thrombocytopenia with small platelets, eczema, frequent infections, and absence of WAS protein), developed AIHA at the age of 5 years. Treatment

Turk J Hematol 2011; 28: 198-205

began with prednisolone 4 mg/kg and increased to 9 mg/kg on the second day due to severe hemolysis.

On the 4th day of treatment CsA 6 mg/kg/day was also administered to control hemolysis and prednisolone was decreased to 4 mg/kg/day. To control hemolysis, on day 9 azothiopurin 3 mg/kg/day was also administered but withdrawn on day 12 because it was ineffective. The patientâ&#x20AC;&#x2122;s hemoglobin was stable on day 15 with prednisolon and CsA. Prednisolon was decreased to 3 mg/kg/day on day 20 but on day 27 hemoglobin began to decrease although the patient was on prednisolon and CsA. The patient required 15 packed red cell transfusions; he died due to septicemia on day 50 even though antimicrobial agents were administered for 12 d.

Discussion The clinical pattern of childhood AIHA in 70%80% of cases is predominantly acute transient-type lasting 3-6 months, which is similar to that observed in 11 of the 13 patients (84%) in the present study with primary idiopathic AIHA that responded to a prednisolone course of only 4-8 weeks. As previously reported, the presented patients generally showed some improvement within 1 week of treatment onset [1].

The direct Coombs test (warm antibodies) was initially negative in 3 of the presented patients, but was subsequently positive in 1; all had a good response to prednisolone. Direct Coombs test results were reported as false negative in 2%-4% of cases [7]; this may be due to a low level of antibodies on red blood cells or low sensitivity of the test [8].

Some of the presented patients had reticulocytopenia. The cause of reticulocytopenia in AIHA is not well known. Reticulocytopenia might be indicative of concomitant accelerated immune-mediated destruction or autoantibody-induced apoptosis of RBC precursors in the bone marrow, temporary suppression of bone marrow activity secondary to infection, and/or delayed bone marrow response to hemolytic events [9,10].

Transfusion can be difficult in AIHA patients due to difficulty in finding serocompatible blood. Pan agglutinating warm autoantibodies complicate cross-matching. A panreactive autoantibody can mask an existing alloantibody by making all donor units appear cross-match incompatible. It is best to use blood of the same ABO and Rh group with the least incompatibility [11]. Packed red cells should

Turk J Hematol 2011; 28: 198-205

Sarper et al.

Autoimmune hemolytic anemia in children and adolescents

be transfused very slowly while the child is monitored for signs of hemolytic reactions [12]. In the present study 16 patients presented with acute hemolysis that could not be hemodynamically compensated and we had to perform transfusions.

Following the above principals we did not observe transfusion-related hemolysis, except in patient 2, in whom blood typing was troublesome due to AIHA. Some steroid-dependent patients, such as patient 2, may require maintenance with low-dose corticosteroids for an extended period [13]. In patients dependent on high daily doses (prednisolone >0.5 mg/kg) or in corticosteroid-refractory patients, cyclosporine should be tried before rituximab, cyclophosphamide, or splenectomy [5]. In the present study 1 patient with primary AIHA and 1 with primary ES required CsA. Two doses of rituximab were also administered to the AIHA patient, but its efficacy could not be determined because other drugs were also used. Rao et al. reported that 4 of 5 pediatric patients with AIHA had complete response (no response in 1 patient) after 4 doses and 1 patient had partial response after 6 doses of rituximab during 18 months of follow-up [14].

One study reported an 83% overall response rate to mercaptopurine in children with refractory cytopenias [15]. No other immunosuppressive agents were required in the presented patients with primary AIHA. Some researchers emphasized the exclusion of an underlying disease for the definition of true ES [16], whereas others defined secondary ES based on underlying disease; we agree with the latter definition. ES is more than a coincidental combination of immune cytopenias; rather, it is a chronic state of profound dysregulation of the immune system [17]. Despite discrepancies in descriptions, all researchers conclude that cytopenias are recurrent, often refractory to IVIG, corticosteroids, and splenectomy, and that the syndrome may be fatal [18].

In very severe and refractory cases hematopoietic stem cell transplantation (HSCT) offers long-term cure, but again carries the risk of severe morbidity and transplant-related mortality [16]. The present study included 3 patients with primary ES, all of whom had a chronic course. There is consensus concerning the first- and second-line therapies in ES, but the timing of splenectomy must be considered individually, so that the morbidity and mortality associated with the procedure can be justified. In patient 15 we planned splenectomy to prevent sub-

203

sequent attacks of AIHA and neutropenia-induced perianal infections, and to avoid the adverse effects of corticosteroids and CsA, and absence from school. Prior to his diagnosis of AIHA, despite thrombocytopenia he did not have any bleeding and perianal infections rarely had a negative affect on his quality of life. In contrast to our observation, some researchers reported that the role of splenectomy has never been established in ES and remissions last only 1-2 months without support [16,1820]. In a survey of ES mainly from the US and Canada 15 patients underwent splenectomy at a median age of 10 years (range: 1.2-26.5 years). The duration of response was 1 week-5 years, but median response was only 1 month [20].

Northon et al. evaluated the response to rituximab in 8 pediatric patients (aged 0.3-16 years) with ES from the literature [16]. Seven had complete remission during a follow-up period of 12-15 months, but 2 had relapses and achieved a second complete remission with rituximab. Although we did not try rituximab in our ES patients, the results seem encouraging and it may be worth trying before splenectomy [16]. Bader-Meunier et al. also reported successful results using rituximab therapy in ES. Complete or partial remission of at least one cytopenia was achieved in 13 of 17 patients (76%), and persisted in 11 with a mean follow-up of 2.4 years (range: 0.5-7 years). Corticosteroid therapy was either stopped or tapered at 50%-100% of the baseline dosage in all long-term responders. Moderate side effects and infection occurred only in 4 patients and 1 patient, respectively. They suggested that rituximab should be promptly proposed as secondline treatment early in the course of pediatric ES refractory to steroids [21].

As in the presented patients, cytopenias may be sequential in ES. A second cytopenia may emerge over the course of 10 years [17]. Patient 14 presented with AIHA and also had ITP 3 years later. Patients 15 and 16 had chronic ITP, followed by AIHA 12 and 11 years later, respectively. In secondary ES underlying conditions may increase the risk of post-splenectomy sepsis and death. This procedure must be the last alternative after immunosuppressive treatments and rituximab have been tried. We did not perform splenectomy in patients with ALPS. Even in patients with primary ES some abnormalities in immunological studies have been reported. These abnormalities are hypogammaglobulinemia, decreased T-cell numbers, and an elevated IgG level [22,23]. Patient 16

204

Sarper et al.

Autoimmune hemolytic anemia in children and adolescents

with primary ES had low IgA and IgM levels, but no history of recurrent infections.

AIHA and ITP have been observed in 23%-51% of ALPS patients in different series, and autoimmune neutropenia was also common (19%-27%).

Autoimmune cytopenias may mark the clinical onset of the disease, even in the absence of signs of lymphoproliferation [24]. In patients diagnosed with ES laboratory work-up for ALPS is recommended.

Markedly elevated DNTC (â&#x2030;Ľ5%) was a strong predictor of ALPS, whereas no patients with DNTC <2.5% had ALPS, based on apoptosis testing [25]. In the present series DNTC in the patients with ALPS was 7% and 6.3%. Autoimmune cytopenias in ALPS patients are often severe and refractory to treatment. As such, splenectomy has frequently been used in the management of ALPS; however, this approach is associated with significant risk of sepsis.

Successful results have been reported with MM and sirolimus. Use of rituximab, with the intent to ablate autoreactive B cells, has been associated with neutropenia and persistent hypogammaglobulinemia [23]. Cytopenias in ALPS patients do not respond to IVIG [26]. In 1 of the presented ALPS patients we used only prednisolone, but in ALPS patient 17 we used MM in addition to corticosteroids. In patient 17 AIHA was severe and persisted for 9 months.

In a recent review by Teachey et al. an algorithm for the treatment of ALPS was proposed.

Prednisolone must be the first-line therapy in moderate disease cases and MM must be the secondline treatment if there is intolerance or refractoriness to prednisolone. In severe cases of disease, sirolimus may be added to prednisolone as first-line therapy. In patients with inadequate response, refractory disease, or relapses, other agents, such as vincristine and methotrexate, are recommended as third-line treatment. Rituximab and splenectomy are considered fourth-line therapies [26].

In WAS the risk of developing an autoimmune disorder increases with age. Forty percent of males that survive the early complications of WAS develop one or more autoimmune conditions [27]. AIHA always develops before the age of 5 years [28]. It was reported that 2 WAS patients had resolution of AIHA after rituximab therapy, but 1 relapsed in 7 weeks and the other underwent HSCT and was lost to follow-up [29]. When long-term survivors of HSCT were evaluated 88% of HLA-identical and 38% of HLA-non-identical HSCT receivers exhibited nor-

Turk J Hematol 2011; 28: 198-205

mal autoimmunity [30]. The only curative therapy for WAS is early HSCT, even from alternative donors, before development of autoimmune complications and severe infections [31]. Although transplants from HLA-matched sibling donors have the best outcomes (81%-88% event-free survival), a matched unrelated donor also should be considered (71% event-free survival); results are best in patients <5 years [32]. Chronic GVHD-independent autoimmunity is observed in 20% of patients and is strongly associated with mixed/split chimerism status, suggesting that residual host lymphocytes can mediate an autoimmune disease despite the coexistence of donor lymphocytes. Infectious complications related to splenectomy are also significant and splenectomy is not recommended prior to HSCT [30]. Other researchers also do not recommend splenectomy, which was commonly performed in the past to increase platelet counts and reduce the risk of fatal hemorrhage [33]. For patients that cannot undergo HSCT short-term immunosuppression with steroids, and/or CsA and IVIG remain treatment of choise for control of autoimmune cytopenias with carefull prophylaxis of infections.

Autoimmune complications are a cause of considerable morbidity and mortality in WAS patients [34]. Cyclophosphamide and azathioprine was effective in some patients with AIHA, although all these patients underwent HSCT. AIHA has never been cured by immunosuppressive therapy. These treatments are partially or transiently effective. HSCT is recommended as early as possible for patients with severe autoimmune complications [28]. A patient in the present study did not have a matched donor and died due to septicemia and resistant AIHA following immunosuppressive therapy.

In conclusion, childhood primary AIHA generally has an acute onset that is responsive to 4-8 weeks of corticosteroid therapy. In patients with primary ES, the clinical course is chronic. Similarly, secondary ES in ALPS also has a chronic and relapsing course. Treatment may require immunosuppressive treatment other than corticosteroids. Complications of splenectomy should not be underestimated in patients with underlying immunodeficiency. AIHA is associated with a high mortality rate in WAS patients and HSCT is recommended before the development of autoimmune cytopenias. Treatment of childhood AIHA must be individually tailored to patients and evidence of underlying disease must not be overlooked.

Turk J Hematol 2011; 28: 198-205

Sarper et al.

Autoimmune hemolytic anemia in children and adolescents

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

Gehrs BC and Friedberg RC. Autoimmune Hemolytic Anemia. Am J Hematol 2002;69:258-71.

Seltsam A, Shukry-Schulz S, Salama A. Vaccinationassociated immune hemolytic anemia in two children.

Transfusion 2000;40:907-9: Vaglio S, Arista MC, Perrone MP et al. Autoimmune hemolytic anemia in childhood: serologic features in 100 cases. Transfusion 2007;47:50-4.

Unal S, Kuskonmaz B, Balamtekin N et al. Autoimmune hemolytic anemia and giant cell hepatitis: Report of three infants. Turk J Hematol 2010;27:308-13.

Naithani R, Agrawal N, Mahapatra M, et al. Autoimmune hemolytic anemia in children. Pediatr Hematol Oncol 2007;24:309-15.

Gurgey A, Yenicesu I, Kanra T, et al. Autoimmune hemolytic anemia with warm antibodies in children: retrospective analysis of 51 cases. Turk J Pediatr 1999;74:245-57.

Agarwal B. Autoimmune hemolytic anemia. Indian J Pediatr 1998;65: 663-8.

Collins PW, Newland AC. Treatment modalities of autoimmune blood disorder. Semin Hematol 1992;29:64-74.

Liesveld JL, Rowe JM, Lichtman MA. Variability of the erythropoietic response in autoimmune hemolytic anemia: analysis of 109 cases. Blood 1987;69:820-6.

Van De Loosdrecht AA, Hendriks DW, Blom NR, et al.

Excessive apoptosis of bone marrow erythroblasts in a patient with autoimmune haemolytic anaemia with reticulocytopenia. Br J Haematol 2000;108: 313-5.

Shah A. Acquired hemolyic anemia. Indian J Med Sci 2004;58:533-6.

Park DC, Yang CH, Kim KY. Autoimmune hemolytic anemia in children. Yonsei Med J 1987;28:313-21.

Murphy S, LoBuglio AF. Drug therapy of autoimmune hemolytic anemia. Semin Hematol 1976; 13:323-34.

Rao A, Kelly M, Musselman M, Ramadas J, Wilson D, Grossman W, Shenoy S. Safety, efficacy, and immune reconstitution after rituximab therapy in pediatric patients with chronic or refractory hematologic autoimmune cytopenias. Pediatr Blood Cancer 2008;50:822-85.

Sobota A, Neufeld EJ, Lapsia S, Bennett CM. Response to mercaptopurine for refractory autoimmune cytopenias in children. Pediatr Blood Cancer 2009;52:80-4.

Norton A, Roberts I. Management of Evans syndrome.

Br J Hematol 2005;132:125-37.

Michel M, Chanet V, Dechartres A et al. The spectrum of Evans syndrome in adults: new insight into the disease based on the analysis of 68 cases. Blood 2009;114:3167-72.

205

18. Wang WC. Evans syndrome in childhood: pathophysiology, clinical course and treatment. J Pediatr Hematol Oncol 1988;10:330-8.

19. Pui Ch, Williams J, Wang W. Evans syndrome in childhood. J Pediatr 1980;97:754-8.

20. Mathew P, Chen C, Wang W. Evans syndrome: results of a national survey. J Pediatr Hematol Oncol 1997;19:433-5.

21. Bader-Meunier B, Aladjidi N, Bellmann F, Monpoux F, Nelken B, Robert A, Armari-Alla C, Picard C, Ledeist F, Munzer M, Yacouben K, Bertrand Y, Pariente A, Chaussé A, Perel Y, Leverger G. Rituximab therapy for childhood Evans syndrome. Haematologica 2007;92:1691-4.

22. Wang W, Herrod H, Pui C, Presbury Q& Williams J. Immunoregulatory abnormalities in Evans syndrome.

Am J Hematol 1983;15:381-90.

23. Karakantza M, Moukaki A, Theodoropoulou M, Bussel B & Maniatis A. Th1 and Th2 cytokines in patients with Evans’ syndrome and profound lymphopenia. Br J Hematol 2000;110:968-70.

24. Notarangelo LD. Primary immunodeficiencies (PIDs) presenting with cytopenias. Hematology Am Soc Hematol Educ Program. 2009;139-43.

25. Seif AE, Manno CS, Sheen C et al. Identifying autoimmune lymphoproliferative syndrome in children with Evans syndrome: a multi-institutional study. Blood 2010;115:2142-5.

26. Teachey DT, Seif AE, Grupp SA. Advances in the management and understanding of autoimmune lymphoproliferative syndrome (ALPS). Br J Hematol 2010;148:205-16.

27. Sullivan KE, Mullen CA, Blease RM, Winkelstein JA. A multiinstutional survey of the Wiskott-Aldrich syndrome. J Pediatr 1994;125:876-85.

28. Dupuis-Girod S, Medioni J, Haddad E, et al.

Autoimmunity in Wiskott-Aldrich syndrome: Risk factors, clinical features, and outcome in a singlecenter cohort of 55 Patients. Pediatrics 2003;111:622-7.

29. Kim JJ, Thrasher AJ, Jones AM, et al. Rituximab for the treatment of autoimmune cytopenias in children with immune deficiency. Br J Haematol 2007;138:94-6.

30. Özsahin H, Cavazzana-Calvo M, Notarangelo LD. Longterm outcome following hematopoietic stem-cell transplantation in Wiskott-Aldrich syndrome: collaborative study of the European Society for Immunodeficiencies and European Group for Blood and Marrow Transplantation. Blood 2008;111:439-45.

31. Lee PP, Chen TX, Jiang LP. et al. Clinical and molecular characteristics of 35 Chinese children with WiskottAldrich syndrome. J Clin Immunol 2009;29:490-500.

32. Ochs HD, Filipovich AH, Veys P et al. Wiskott-Aldrich syndrome: diagnosis, clinical and laboratory manifestations, and treatment. Biol Blood Marrow Transplant 2009;15:84-90.

33. Filipovich AH, Johnson J, Zhang K. WAS related disorders In: Pagon RA, Bird TC, Dolan CR, Stephens K, editors. GeneReviews [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2004 Sep 30 [updated 2007 Apr 27] 34. Shurman SH, Candotti F. Autoimmunity in WiskottAldrich syndrome. Curr Opin Rheumatol 2003;15:446-53.

206

Research Article

Surgical and histopathological effects of topical Ankaferd® hemostat on major arterial vessel injury related to elevated intra-arterial blood pressure Topikal Ankaferd® hemostatın büyük arter yaralanmalarında artmış arter içi basınç ile ilişkili cerrahi ve histopatolojik etkileri A. Tulga Ulus1, Nilüfer N. Turan3, Sertan Özyalçın1, Gülden Aydoğ2, Fatma Ulus4, Hakan Göker5, İbrahim C. Haznedaroğlu5 1Department

of Cardiovascular Surgery, Turkiye Yuksek Ihtisas Education and Research Hospital, Ankara, Turkey of Pathology, Turkiye Yuksek Ihtisas Education and Research Hospital, Ankara, Turkey 3Department of Pharmacology, Faculty of Pharmacy, Gazi University, Ankara, Turkey 4Department of Anesthesiology and Reanimation, Ataturk Chest Disease and Thoracic Surgery Education and Research Hospital, Ankara, Turkey 5Department of Hematology, Faculty of Medicine, Hacettepe University, Ankara, Turkey 2Department

Abstract Objective: The aim of this study was to assess the surgical and histopathological hemostatic effects of topical Ankaferd blood stopper (ABS) on major arterial vessel injury related to elevated intra-arterial blood pressure in an experimental rabbit model.

Materials and Methods: The study included 14 New Zealand rabbits. ABS was used to treat femoral artery puncture on 1 side in each animal and the other untreated side served as the control. Likewise, for abdominal aortic puncture, only 50% of the aortic injuries received topical liquid ABS and the others did not (control). The experiment was performed under conditions of normal arterial blood pressure and was repeated with a 50% increase in blood pressure. Histopathological analysis was performed in all of the studied animals.

Results: Mean bleeding time in the control femoral arteries was 105.0±18.3 s, versus 51.4±9.8 s (p<0.05) in those treated with ABS. Mean blood loss from the punctured control femoral arteries was 5.0±1.5 mg and 1.6±0.4 mg from those treated with ABS (p<0.05). Histopathological examination of the damaged arterial structures showed that ABS induced red blood cell aggregates.

Conclusion: ABS administered to experimental major arterial vessel injury reduced both bleeding time and blood loss under conditions of normal and elevated intra-arterial blood pressure. ABS-induced erythroid aggregation was prominent at the vascular tissue level. These findings will inform the design of future experimental and clinical studies on the anti-bleeding and vascular repairing effects of the novel hemostatic agent ABS. (Turk J Hematol 2011; 28: 206-12) Key words: Bleeding, cardiovascular, surgery, hemostasis Received: August 27, 2010

Accepted: March 05, 2011

Address for Correspondence: Assoc. Prof. A. Tulga Ulus, Niğde Sok., 20/6 Dikmen 06460 Ankara, Turkey Phone: +90 312 306 12 30 E-mail: uluss@yahoo.com doi:10.5152/tjh.2011.55

Ulus et al.

Ankaferd® in cardiovascular surgery

Turk J Hematol 2011; 28: 206-12

207

Özet Amaç: Bu çalışmanın amacı büyük arter yaralanmalarında arter içi basınç artışı ile paralel olarak uygulanan topikal Ankaferd Blood Stopper (ABS)’ın cerrahi ve histopatolojik hemostatik etkilerini deneysel bir tavşan modelinde değerlendirmektir.

Yöntemler ve Gereçler: Çalışma grubunu ondört Yeni Zelanda tavşanı oluşturmuştur. Hayvanların bir ekstremitesinde oluşturulan femoral arter hasarında ABS uygulanırken karşı ekstremite kontrol olarak kullanılmıştır. Benzer biçimde, abdominal aort hasarı oluşturulan hayvanlarda, hayvanların yarısında topikal ABS uygulanırken diğer grup kontrol olarak çalışmaya alınmıştır. Büyük arter kanamaları normal arteriyel basınç altında oluşturulmuşken, çalışma intra-arteriyel basınç %50 arttırılarak tekrar edilmiştir. Histopatholojik incelemeler çalışılan tüm hayvanlarda gerçekleştirilmiştir.

Bulgular: Hasar görmüş femoral arterden gelişen ortalama ‘kanama zamanı’ ABS olmadan 105.0±18.3 sn. iken topikal ABS uygulamasıyla 51.4±9.8 saniyeye düşürülmüştür (p<0.05). Hasar görmüş femoral arterden gelişen ortalama ‘kanama miktarı’ ABS olmadan 5.0±1.5 mg iken topikal ABS uygulamasıyla 1.6±0.4 mg’a gerilemiştir (p<0.05). Abdominal aorta kanama modelinde ise ortalama ‘kanama zamanı’ ve ortalama ‘kanama miktarı’ kan basıncı yükseltildiğinde bile ABS kullanımıyla azalmasına karşın kontrol grupları ile farklılık istatistiksel anlamlılık düzeylerine erişmemiştir. Hasar görmüş arteriyel yapıların histopatolojik incelemelerinde ABS uygulaması ile ilişkili kırmızı küre aggregatları belirgin biçimde gözlenmiştir.

Sonuç: Topikal Ankaferd Hemostat uygulaması deneysel büyük arter modelinde “kanama zamanı” ve “kanama miktarı” değerlerini normal ve yüksek arter-içi basınç durumlarında aşağıya çekmiştir. ABSbağımlı eritroid aggregasyon vasküler doku düzeyinde belirgin olarak gösterilmiştir. Gözlemler bu yeni hemostatik ajan’ın kanamayı engelleyici ve damar onarımına zemin hazırlayan etkilerinin gelecek deneysel ve klinik çalışmalarla ortaya konulması için temel teşkil etmektedir.

(Turk J Hematol 2011; 28: 206-12)

Anahtar kelimeler: Ankaferd, kanama, kardiyovasküler cerrahi, hemostaz Geliş tarihi: 27 Ağustos 2010

Kabul tarihi: 05 Mart 2011

Introduction Ankaferd blood stopper (ABS) is an herbal extract [1] that has been historically used as a hemostatic agent in traditional Turkish medicine [2] for centuries. The herbal medicine is comprised of a standardized mixture of Thymus vulgaris, Glycyrrhiza glabra, Vitis vinifera, Alpinia officinarum, and Urtica dioica [3]. Each of these herbs affect endothelium, blood cells, angiogenesis, cell proliferation, vascular dynamics, and cellular mediators. G. glabra inhibits angiogenesis, and decreases vascular endothelial growth factor production and cytokine-induced neovascularization. T. vulgaris has been shown to exhibit varying levels of antioxidant activity, which may help prevent in vivo oxidative damage, such as lipid peroxidation associated with atherosclerosis. V. vinifera has an anti-atherosclerotic effect. A. officinarum inhibits nitric oxide production in lipopolysaccharideactivated mouse peritoneal macrophages. U. dioica produces hypotensive responses via a vasorelaxation effect mediated by the release of endothelial nitric oxide and the opening of potassium channels, and via negative inotropic action [3]. The basic mechanism of action of ABS is the formation of an encapsu-

lated protein network representing focal points for vital erythrocyte aggregation [1].

ABS was shown to effectively manage external bleeding in numerous clinical settings [4-13]. ABSinduced formation of the protein network with vital erythroid aggregation encompasses the entire physiological hemostatic process. The ABS-induced hemostatic network includes important distinct components. Vital erythroid aggregation occurs in spectrin and ankyrin receptors on the surface of red blood cells. These proteins and the required ATP bioenergy are included in the ABS protein library. ABS also upregulates the GATA/FOG transcription system, which affects erythroid functions. Urotensin II is also an essential component of ABS and represents the link between injured vascular endothelium, adhesive proteins, and active erythroid cells [14-16].

The aim of the present study was to assess the surgical and histopathological hemostatic effects of topical ABS on major arterial vessel injury related to elevated intra-arterial blood pressure in an experimental rabbit model. As there are some anecdotal reports on the use of ABS in in different surgical interventions [17-21], elucidation of the surgical and histopathological effects of ABS will inform future research on this novel hemostatic agent.

208

Ulus et al.

Ankaferd® in cardiovascular surgery

Materials and Methods Study population The study included 14 male white New Zealand rabbits obtained from the Refik Saydam Institute.

The animals were kept in a room at a constant optimal temperature (20-22°C) under 12 h of darkness and 12 h of sun light. All of the animal experiments were carried out in accordance with the European Community Council Directive of 24 November 1986 and were approved by the Gazi University Animal Experiments Ethics Committee (G.Ü.ET-09.045).

Study design and experiments The animals underwent surgery to generate major arterial bleeding under normal blood pressure conditions (set-up 1) and a 50% increase in arterial blood pressure (set-up 2) induced via concurrent dopamine infusion (5-10 µg·kg/min) [22].

Set-up 1 included 8 rabbits and set-up 2 included 6 rabbits. Liquid ABS was topically applied to the femoral artery puncture in 1 extremity in each animal (femoral artery 1), but not to the other extremity, which served as the control (femoral artery 2).

Abdominal aortic injury was treated likewise; 50% of the aortic injuries were treated with 1 mL of liquid ABS (abdominal aorta 1) and the others were untreated and served as the control (abdominal aorta 2). Histopathological analysis was performed in all the animals.

All of the rabbits underwent surgery under proper general anesthesia without intubation. An arterial line was placed for monitorization via the ear artery and infusion vein. A 22G cannula was used for catheterization. Anesthesia was provided via intramuscular injection of ketamine hydrochloride 50 mg/kg and xylazine hydrochloride 5 mg/kg. All of the rabbits underwent femoral artery and abdominal aorta surgery. After administration of anesthesia, both femoral arteries were explored using a sterile surgical technique, and separated from the femoral vein and femoral nerve. The femoral arteries were rounded with tapes and a 21G injector needle was inserted once at 90° into the arteries to induce major bleeding [23]. After bleeding began we immediately applied compression with gasses and calculated the bleeding time and blood loss by measuring the weight of the gasses before and after decompression. After the first bleeding stopped,

Turk J Hematol 2011; 28: 206-12

major bleeding was induced in the other extremity using the same needle. After the second bleeding started we immediately applied 1 mL of liquid ABS and compression, and again measured the bleeding time and blood loss, as described above. After the bleeding from both femoral arteries stopped, we made a paramedian incision to explore the abdominal aorta and rounded it with tapes just below the renal arteries. Major bleeding was induced using the same method as described above. After the experiment we obtained vessel samples (from 0.5 cm below and above the needle hole, just below the renal arteries for the abdominal aorta and femoral arteries) for pathological examination. When the experiment was completed the rabbits were sacrificed for histopathological analyses via IM pentamine injection. Systolic and diastolic oscillations in arterial blood pressure were monitored from the left carotid artery using a BIOPAC MP30 recorder (BIOPAC System, Inc., California, USA).

We analyzed the hemoglobin, hematocrit, and INR measurements before and after the procedure, and calculated blood loss and bleeding time as well. Pathological specimens were preserved in formaldehyde. Histopathological assessment of the tissue samples was performed using standard histological techniques, including formalin fixation, dehydration, embedding in paraffin blocks, obtaining serial transverse sections (4 µm), and hematoxylin-eosin staining. All histopathological investigations were carried out by the same pathologist using a light microscope.

Statistical analysis All values are presented as mean±SEM. Comparison of findings between the treatment and control femoral arteries and abdominal aortas were statistically analyzed using the Mann-Whitney U test. Alterations in the parameters over time were analyzed using the Wilcoxon test. A p value <0.05 was considered statistically significant.

Results Mean hemoglobin value before the procedure was 12.2±0.7 g/dL, versus 11.8±0.6 g/dL after the procedure (p>0.05). Mean INR was 1.0±0.3 before the procedure and 0.8±0.1 after the procedure (p>0.05). According to these measurements, ABS

Ulus et al.

Ankaferd® in cardiovascular surgery

*

Abdominal aorta

Blood Loss (mg)

Figure 1. Femoral artery and abdominal aorta bleeding time without dopamine infusion (normal blood pressure) (*p<0.05)

10 9 8 7 6 5 4 3 2 1 0

Ankaferd (-) Ankaferd (+)

*

Femoral artery

Abdominal aorta

Figure 2. Femoral artery and abdominal aorta blood loss without dopamine infusion (normal blood pressure) (*p<0.05).

Ankaferd (-) Ankaferd (+)

600 500 400 300 200 100 0

Femoral artery

Abdominal aorta

Figure 3. Femoral artery and abdominal aorta bleeding time with dopamine infusion (elevated blood pressure)

12 Blood Loss (mg)

Discussion The present study aimed to determine if ABS could be successfully used to control major arterial bleeding from the femoral artery and abdominal aorta, particularly in the presence of elevated systemic arterial blood pressure. In cardiovascular surgery major bleeding is an important complication that leads to morbidity and mortality. Bleeding sometimes cannot be controlled with current con-

150 100 50 0

209

Ankaferd (-) Ankaferd (+)

350 300 250 200

Femoral artery

Bleeding Time (s)

did not significantly affect the basic coagulation parameters we studied.

In the set-up 1 animals (normal blood pressure) mean bleeding time from femoral artery 2 (control) was 105.0±18.3 s, versus 51.4±9.8 s from femoral artery 1 (ABS treatment) (p<0.05) (Figure 1). Mean blood loss from femoral artery 2 was 5.0±1.5 mg and 1.6±0.4 mg from femoral artery 1 (p<0.05) (Figure 2). Mean bleeding time from abdominal aorta 1 (control) was 243.8±48.5 s, versus 205.0±94.6 s in abdominal aorta 1 (ABS treatment) (p>0.05) (Figure 1). Mean blood loss was 6.6±2.6 mg from abdominal aorta 2 and 3.7±0.1 mg from abdominal aorta 1 (p>0.05) (Figure 2).

In the set-up 2 animals (elevated blood pressure) we intended to increase the blood pressure by 50% using dopamine infusion, and then performed the same procedure as in set-up 1 animals. We obtained an arterial line from the ear artery, and measured blood pressure before and after dopamine infusion.

Mean blood pressure before the procedure was 83.3±6.5 mmHg, versus 137.5±11.6 mmHg after starting dopamine infusion (p<0.05). Mean bleeding time from femoral artery 2 was 150.8±21.6 s, versus 139±23.5 s from femoral artery 1 (p>0.05) (Figure 3). Mean blood loss was 7.1±2.9 mg from femoral artery 2 and 3.1±0.7 mg from femoral artery 1 (p>0.05) (Figure 4). Mean bleeding time from abdominal aorta 2 was 306.7±208 s, versus 206.7±17.6 s from abdominal aorta 1 (p>0.05) (Figure 3). Mean blood loss was 3.4±1.5 mg and 1.8±1.2 mg from abdominal aorta 2 and 1, respectively (p>0.05) (Figure 4).

Histopathological examination of the injured vessels showed that the vessel lumens were enriched with erythrocyte aggregates following ABS administration (Figure 5). In contrast, control vessels had fewer erythrocytes, without aggregation (Figure 6).

Bleeding Time (s)

Turk J Hematol 2011; 28: 206-12

Ankaferd (-) Ankaferd (+)

10 8 6 4 2 0

Femoral artery

Abdominal aorta

Figure 4. Femoral artery and abdominal aorta blood loss with dopamine infusion (elevated blood pressure)

210

Ulus et al.

Ankaferd® in cardiovascular surgery

Figure 5. ABS-induced erythrocyte aggregates in the vessel lumen (H&E, 100×)

Figure 6. Fewer erythrocytes next to the wall in a vessel lumen not administered ABS (H&E, 100×)

ventional methods, even during re-operations, when the focal surgical bleeding point cannot be found and/or bleeding is massive, originating from all of the surrounding tissues. The findings of the present study represent a starting point in the search for the clinical anti-hemorrhagic effects of the novel liquid hemostatic agent, ABS. In the present study bleeding time from the injured major arteries was shorter and blood loss was lower following the use of ABS. Better essential hemostatic parameters were observed following administration of ABS, even in the presence of elevated arterial blood pressure. Three ABS phase III studies [4,10,12] on vascular port insertion bleeding, anterior epistaxis, and post-tonsillectomy hemorrhage have led to its approval as a hemostatic agent in Turkey. Use of ABS to control bleeding in gastrointestinal disorders [8, 24-27] and mediastinal bleeding [5,17] shed further light on its hemostatic efficacy. As such, the anti-hemorrhagic efficacy and

Turk J Hematol 2011; 28: 206-12

safety of ABS was determined based on a wide variety of findings designed in different ways of clinical and experimental studies ABS has the diverse dynamic reversible actions of an EPCR and PAI-1 inside vascular endothelial cells in an HUVEC model. Immediate enhanced expression of pro-hemostatic PAI-1 and down-regulation of anti-coagulant EPCR upon exposure to ABS are compatible with the sudden anti-hemorrhagic efficacy previously shown in experimental and clinical settings. The topical hemostatic efficacy of ABS has been previously tested in animals with normal and defective hemostasis [28,29]. Experimental studies have set the preclinical stage for the development of this hemostatic product. The short-term hematological and biochemical safety of oral systemic administration of ABS to rabbits have been reported. Acute mucosal toxicity, hematotoxicity, hepatotoxicity, nephrotoxicity, and biochemical toxicity were not observed during the short-term follow-up of the animals [30]. Those preclinical results represent a starting point in the search for any possible systemic confounding effects of ABS when topically applied to internal surfaces. Use of ABS as a hemostatic agent for external hemorrhages and dental treatment in humans constitutes the first reports of ABS’s safety and efficacy in humans. A phase I, double-blind randomized cross-over placebo-controlled clinical study with a 5-d wash-out period between the cross-over periods, which was conducted with healthy volunteers, reported that ABS was safe [6]. Physiological cell-based coagulation could be clinically managed via topical ABS application, so as to prevent and treat bleeding associated with many distinct clinicopathological states.

ABS also has pleiotropic cellular action [31], acting on anti-infective [32-34], wound healing [35-37], vascular dynamics [38], and apoptotic processes [15,39,40]. Histopathological examination of the damaged arterial structures in the present study showed that ABS induced red blood cell aggregates, supporting the hypothesis that ABS-induced formation of the protein network with vital erythroid aggregation encompasses the entire physiological hemostatic process.

In conclusion, topical application of ABS in an experimental major arterial vessel injury model reduced bleeding time and blood loss under normal and elevated intra-arterial blood pressure con-

Turk J Hematol 2011; 28: 206-12

ditions. ABS-induced erythroid aggregation was prominent at the vascular tissue level. The present study’s findings will inform the design of future experimental and clinical studies on the anti-bleeding and vascular repairing effects of this novel hemostatic agent.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

Haznedaroglu BZ, Haznedaroglu IC, Walker SL, et al.

Ultrastructural and Morphological Analyses of the In Vitro and In Vivo Hemostatic Effects of Ankaferd Blood Stopper. Clinical and Applied Thrombosis-Hemostasis 2010;16:446-53.

2. Haznedaroglu IC. Time to take a healthier view of history. Nature 1998;396:108.

3. Goker H, Haznedaroglu IC, Ercetin S, et al. Haemostatic actions of the folkloric medicinal plant extract Ankaferd Blood Stopper. Journal of International Medical Research 2008;36:163-70.

4. Al B, Yildirim C, Cavdar M, et al. Effectiveness of Ankaferd blood stopper in the topical control of active bleeding due to cutaneous-subcutaneous incisions.

Saudi Medical Journal 2009;30:1520-5.

5. Arslan S, Haznedaroglu IC, Oz B, et al. Endobronchial application of Ankaferd blood stopper to control profuse lung bleeding leading to hypoxemia and hemodynamic instability. Respiratory Medicine 2008;doi:10.1016/j.rmedc.2008.10.016 6. Balcik OS, Koroglu M, Cipil H, Kaftan O, Maral, S, Gurel A, Goker H, Haznedaroglu I, C Kosar, A. A PlaceboControlled, Randomized, Double-Blinded, Cross-Over Phase I Clinical Study to Demonstrate Safety of Ankaferd Blood Stopper Topical Usage In Healthy Volunteers. Int J Lab Hem 2010;32:126-7.

7. Baykul T, Alanoglu EG, Kocer G. Use of Ankaferd Blood Stopper as a hemostatic agent: a clinical experience.

J Contemp Dent Pract 2010;11:E088-94.

8. Kurt M, Akdogan M, Ibis M, Haznedaroglu IC. Ankaferd blood stopper for gastrointestinal bleeding. Journal of Investigative Surgery 2010;23:239.

9. Kurt M, Oztas E, Kuran S, Onal IK, Kekilli M, Haznedaroglu IC. Tandem oral, rectal, and nasal administrations of Ankaferd Blood Stopper to control profuse bleeding leading to hemodynamic instability.

Am J Emerg Med 2009;27:631 e1-2.

10. Meric Teker A, Korkut AY, Kahya V, et al. Prospective, randomized, controlled clinical trial of Ankaferd Blood Stopper in patients with acute anterior epistaxis. Eur Arch Otorhinolaryngol 2010;267:1377-81.

Ulus et al.

Ankaferd® in cardiovascular surgery

211

11. Oner A, Dogan M, Kaya A, et al. New Coagulant Agent (Ankaferd Blood Stopper) for Open Hemorrhages in Hemophilia With Inhibitor. Clin Appl Thromb Hemost 2009.

12. Teker AM, Korkut AY, Gedikli O, et al. Prospective, controlled clinical trial of Ankaferd Blood Stopper in children undergoing tonsillectomy. International Journal of Pediatric Otorhinolaryngology 2009;73:1742-5.

13. Teker AM, Korkut AY, Kahya V, et al. Prospective, randomized, controlled clinical trial of Ankaferd Blood Stopper in patients with acute anterior epistaxis.

European Archives of Oto-Rhino-Laryngology 2010;267:1377-81.

14. Demiralp DO, Haznedaroglu IC, Akar N. Functional proteomic analysis of Ankaferd (R) Blood Stopper.

Turkish Journal of Hematology 2010;27:70-7.

15. Karabiyik A, Yılmaz E, Gulec S, Haznedaroglu IC, Akar N. Dual diverse dynamic reversible actions of Ankaferd on EPCR and PAI-1 inside vascular endothelial cells with and without LPS. Turk J Hematol 2010: in press.

16. Yılmaz E, Gulec S, Haznedaroglu IC, Akar N. The effects of Ankaferd® Blood Stopper on transcription factors in HUVEC and erythrocyte protein profile. Turk J Hematol 2010:in press. [CrossRef] 17. Ergenoglu MU, Yerebakan H, Kucukaksu DS. A New Practical Alternative for the Control of Sternal Bleeding during Cardiac Surgery: Ankaferd Blood Stopper. Heart Surg Forum 2010;13:E379-80.

18. Huri E, Akgul T, Ayyildiz A, et al. First Clinical Experience of Ankaferd Bloodstopper as a Hemostatic Agent in Partial Nephrectomy. Kaohsiung Journal of Medical Sciences 2010;26:493-5.

19. Huri E, Akgül T, Ayyildiz A, Bağcioğlu M, Germiyanoğlu C. Efficacy of Ankaferd Blood Stopper in postpolypectomy bleeding. J Altern Complement Med 2010;16:1027-8.

20. Karaman K, Bostanci EB, Ercan M, et al. Topical Ankaferd Application to Presacral Bleeding due to Total Mesorectal Excision in Rectal Carcinoma. Journal of Investigative Surgery 2010;23:175.

21. Ozaslan E, Purnak T, Yildiz A, Haznedaroglu IC. A new practical alternative for tumoural gastrointestinal bleeding: Ankaferd blood stopper. Digestive and Liver Disease 2010;42:594-5.

22. Malinovsky JM, Benhamou D, Alafandy M, Mussini JM, Coussaert C, Couarraze G, Pinaud M, Legros FJ. Neurotoxicological assessment after intracisternal injection of liposomal bupivacaine in rabbits. Anesth Analg 1997;85:1331-6.

23. Bilgili H, Kosar A, Kurt M, Onal IK, Goker H, Captug O, Shorbagi A, Turgut M, Kekilli M, Kurt OK, Kirazli S, Aksu S, Haznedaroglu IC. Hemostatic efficacy of Ankaferd Blood Stopper in a swine bleeding model. Med Princ Pract. 2009;18:165-9.

24. Ak G, Cakir O, Kazancioglu HO, et al. The use of a new hemostatic agent: Ankaferd Blood Stopper in hemophiliacs. Haemophilia 2010;16:51-1.

25. Kurt M, Akdogan M, Onal IK, Kekilli M, Arhan M, Shorbagi A, Aksu S, Kurt OK, Haznedaroglu IC. Endoscopic topical application of Ankaferd Blood

212

26.

27.

28.

29.

30.

31.

32.

Ulus et al.

AnkaferdÂŽ in cardiovascular surgery

Stopper for neoplastic gastrointestinal bleeding: A retrospective analysis. Digestive and Liver Disease 2010;42:196-9.

Kurt M, Kacar S, Onal IK, Akdogan M, Haznedaroglu IC. Ankaferd Blood Stopper as an effective adjunctive hemostatic agent for the management of life-threatening arterial bleeding of the digestive tract. Endoscopy 2008;40 Suppl 2:E262.

Ozaslan E. Ankaferd Blood Stopper for controlling gastrointestinal bleeding due to distinct benign lesions refractory to conventional antihemorrhagic measures.

Canadian Journal of Gastroenterology 2010;24:380-4.

Cipil HS, Kosar A, Kaya A, Uz B, Haznedaroglu IC, Goker H, Ozdemir O, Koroglu M, Kirazli S, Firat HC. In Vivo Hemostatic Effect of the Medicinal Plant Extract Ankaferd Blood Stopper in Rats Pretreated With Warfarin. Clin Appl Thromb Hemost 2009;15:270-6.

Kosar A, Cipil HS, Kaya A, et al. The efficacy of Ankaferd Blood Stopper in antithrombotic druginduced primary and secondary hemostatic abnormalities of a rat-bleeding model. Blood Coagulation & Fibrinolysis 2009;20:185-90.

Bilgili H, Captug O, Kosar A, et al. Oral Systemic Administration of Ankaferd Blood Stopper Has No Short-Term Toxicity in an in Vivo Rabbit Experimental Model. Clin Appl Thromb Hemost 2010;16:533-6.

Haznedaroglu IC. Molecular Basis of the Pleiotropic Effects of Ankaferd Blood Stopper. IUBMB Life 2009;61:290.

Akkoc N, Akcelik M, Haznedaroglu IC, et al. In Vitro Anti-Bacterial Activities of Ankaferd Medicinal Plant Extract. Turkiye Klinikleri Tip Bilimleri Dergisi 2009;29:410-5.

Turk J Hematol 2011; 28: 206-12

33. Tasdelen Fisgin N, Tanriverdi Cayci Y, Coban AY, et al.

Antimicrobial activity of plant extract Ankaferd Blood Stopper. Fitoterapia 2009;80:48-50.

34. Saribas Z, Sener B, Haznedaroglu IC, et al. Antimicrobial activity of Ankaferd Blood Stopper against nosocomial bacterial pathogens. Central European Journal of Medicine 2010;5:198-202.

35. Akgul T, Huri E, Ayyildiz A, et al. Haemostatic and Histopathological Effects of Ankaferd Blood Stopper, on Penile Cavernosal Tissue in Rats. Uhod-Uluslararasi Hematoloji-Onkoloji Dergisi 2009;19:159-65.

36. Huri E, Akgul T, Astarci M, et al. The Effect of a Novel Hemostatic Agent, Ankaferd Bloodstopper (R) (Abs), on Renal Tubular Apoptosis in Rat Partial Nephrectomy Model. Journal of Endourology 2009;23:A2-A2.

37. Huri E, Akgul T, Yucel O, et al. The Second Step in vitro Trial of Ankaferd Bloodstopper: Comparison with the Other Hemostatic Agents, Glubran 2, Floseal and Celox. Journal of Endourology 2009;23:A189.

38. Aktas A, Er N, Onur MA. Effects of ankaferd blood stopper on vascular response in rat carotid artery. UhodUluslararasi Hematoloji-Onkoloji Dergisi 2010;20:156-62.

39. Huri E, Haznedaroglu IC, Akgul T, Astarci M, Ustun H, Germiyanoulu C. Biphasic effects of ankaferd blood stopper on renal tubular apoptosis in the rat partial nephrectomy model representing distinct levels of hemorrhage. Saudi Medical Journal 2010;30:864-8.

40. Karabiyik A, Gulec, S., Yilmaz, E., Haznedaroglu, I.C., Akar, N. Reversible Protease-Activated Receptor 1 Down-regulation Mediated By Ankaferd Blood Stopper Inducible With Lipopolysaccharides Inside The Human Umbilical Vein Endothelial Cells. Clin Appl Thromb Hemost 2010;in press.

Research Article

213

ADAMTS-13 gene expression in antiphospholipid syndrome Antifosfolipid sendromunda ADAMTS-13 gen ekspresyonu Veysel Sabri Hançer1, Reyhan Diz Küçükkaya2, Ayşegül Topal-Sarıkaya3 1Department

of Medical Biology and Genetics, Faculty of Medicine, İstanbul Bilim University, İstanbul, Turkey

3Department

of Molecular Biology and Genetics, Faculty of Science, İstanbul University, İstanbul, Turkey

2Department of Internal Medicine, Division of Hematology, Faculty of Medicine, İstanbul Bilim University, İstanbul, Turkey

Abstract

Antiphospholipid syndrome (APS) is an autoimmune disorder characterized by recurrent thrombosis and fetal mortality. Thrombotic microangiopathy (TMA) is an important histological finding in catastrophic APS (CAPS) and in APS patients with nephropathy. Analysis of familial thrombotic thrombocytopenic purpura patients showed that there are mutations in the ADAMTS-13 gene that lead to functional defects in the ADAMTS-13 enzyme. The aim of this study was to investigate the prevalence of the aforementioned mutations in APS, as well as to evaluate the level and activity of the ADAMTS-13 enzyme in patients with APS. C365del, Q449stop codon, P475S, and C508Y mutations were analyzed in APS patients. Transcriptions were analyzed using real-time PCR, and the level and activity of ADAMTS-13 were analyzed via fluorogenic assay. None of the mutations tested were present in the patient or control groups. The level of ADAMTS-13 mRNA in the patient group was 50% lower than that in the control group. Although a significant difference in ADAMTS-13 activity was not observed between the patient and control groups, a significant association was observed with the level of ADAMTS-13 (p<0.0001). The level and activity of ADAMTS-13 were not associated with thrombotic complications, thrombocytopenia, or pregnancy complications in the patients with APS. (Turk J Hematol 2011; 28: 213-8)

Key words: Antiphospholipid syndrome, ADAMTS-13, gene expression Received: April 22, 2011

Accepted: April 28, 2011

Özet

Antifosfolipid sendrom (AFS), tekrarlayan tromboz ve fetal kayıplar ile karakterize olan otoimmün bir hastalıktır. Trombotik mikroanjiyopati (TMA), katastrofik AFS ve nefropatinin eşlik ettiği AFS olgularında önemli bir histolojik bulgudur. Ailesel trombotik trombositopenik purpura olgularının incelenmesi sonucu, ADAMTS-13 enziminin işlev bozukluğuna yol açan mutasyonların varlığını göstermiştir.

Bu çalışmada ADAMTS-13 mutasyonları ile, enzimin aktivite ve miktarının AFS’ye katkısının olup olmadığının araştırılması amaçlanmıştır. Bu kapsamda C365del, Q449stop kodonu, P475S ve C508Y mutasyonları analiz edildi. Transkripsiyon aşaması gerçek zamanlı polimeraz zincir reaksiyonu, enzimin aktivite ve miktarı ise florojenik bir yöntem ile incelendi. Varlığı araştırılan mutasyonlar kontrol ve hasta gruplarında tespit edilmedi. ADAMTS-13 mRNA ve protein miktarının hasta grubunda kontrol grubundaki düzeyin yarısı kadar olduğu saptandı. (p<0.0001). Enzim aktivitesi açısından ise iki Address for Correspondence: Asst. Prof. Veysel Sabri Hançer, Department of Medical Biology and Genetics, Faculty of Medicine, İstanbul Bilim University, Esentepe, Istanbul, Turkey Phone: +90 533 634 30 14 E-mail: vshancer@istanbul.edu.tr doi:10.5152/tjh.2011.56

214

Hançer et al.

ADAMTS-13 expression in antiphospholipid syndrome

Turk J Hematol 2011; 28: 213-8

grup arasında istatistik olarak anlamlı bir fark gözlenmedi. Sonuç olarak, ADAMTS-13 enzim aktivitesi ve miktarının AFS hastalarında trombotik komplikasyonlar, trombositopeni ve gebelik komplikasyonları ile ilişkili olmadığı saptandı. (Turk J Hematol 2011; 28: 213-8) Anahtar kelimeler: Antifosfolipid sendrom, ADAMTS-13, gen ekspresyonu.

Geliş tarihi: 22 Nisan 2011

Kabul tarihi: 28 Nisan 2011

Introduction Antiphospholipid syndrome (APS) is characterized by both arterial and venous thrombosis, and fetal mortality in the presence of antiphospholipid antibodies (aPLAs) [1]. aPLA antibodies are directed against plasma proteins bound to anionic phospholipids [2]. Research has shown that aPLA-associated vascular lesions are predominantly noninflammatory vessel alterations with thrombotic luminal obliteration [2-6]. Thrombotic microangiopathy (TMA), which is histologically defined as the development of hyaline thrombi in small vessels, is a frequent finding in patients with thrombotic thrombocytopenic purpura (TTP) and hemolytic uremic syndrome (HUS).

TTP is a rare disorder caused by inhibition of or low-level ADAMTS-13 (a disintegrin-like metalloprotease with thrombospondin type-1 motif, member 13), an enzyme responsible for cleaving von Willebrand factor (vWF). vWF is a large, multidomain glycoprotein in human blood and secretory granules of both endothelial cells and platelets [7]. vWF circulates as a multimer and is composed of identical units that range in molecular weight from 500 kDa to >20,000 kDa. Immediately downstream of the site of injury the multimeric size of vWF is physiologically regulated to prevent the formation of thrombi. ADAMTS-13 cleaves vWF between Tyr842 and Met843 in the A2 domain of the vWF monomer [7-13], yielding typical fragments of 176 and 140 kDa, as well as smaller multimers.

Severe ADAMTS-13 deficiency may result in ultralarge vWF multimers that spontaneously interact with platelet receptors and cause thrombi in microcirculation [14-17]. Very low-level ADAMTS-13 activity (<5% of values in normal plasma), caused either by mutations of the ADAMTS-13 gene [10, 18-20] or inhibitory antibodies against ADAMTS-13 [15, 16], is linked to TTP/HUS. TMA is an important histological finding in patients with CAPS and in APS patients with nephropathy. The present study aimed to

examine ADAMTS-13 level and activity, C365del, Q449stop, P475S, and C508Y mutations, and mRNA levels.

Materials and Methods Study population The study included 37 APS patients with thrombotic complications and 33 aPLA-positive patients without thrombotic complications, and 70 age- and sex-matched healthy controls. APS was diagnosed in patients with arterial and/or venous thrombosis based on the presence of lupus anticoagulant (LA) or anticardiolipin antibodies (ACA) [1]. All the healthy controls were Caucasian with a negative history of thrombosis and fetal mortality. The study protocol was approved by the Istanbul Bilim University, Faculty of Medicine Ethics Committee and written and signed informed consent was provided by all the participants.

APS patients with thrombosis Of the 37 APS patients, 23 were female. LA was diagnosed based on activated partial thromboplastin time, kaolin clotting time, and Russell’s viper venom test results, as previously reported [21]. The presence of IgG and IgM antibodies was determined via enzyme-linked immunosorbent assay (ELISA) [22], and levels ≥3 standard deviations were regarded as positive. ACA and LA tests were repeated 2 months after the first test. aPLA-positive patients without thrombosis Among the 33 aPLA-positive patients without thrombosis, 28 were female. These patients had first trimester fetal mortality or thrombocytopenia, and persistently positive aPLA test results, but no thrombotic complications during ≥3 years of follow-up. In all, 14 of the patients had thrombocytopenia, 7 had first trimester fetal mortality, and 12 had both thrombocytopenia and first trimester fetal mortality in the presence of aPLA (Table 1). None of the patients had clinical evidence of TMA events.

Hançer et al.

ADAMTS-13 expression in antiphospholipid syndrome

Turk J Hematol 2011; 28: 213-8

Table 1. Characteristics of the APS patients and healthy controls

APS patients aPLA (+) patients with thrombosis without thrombosis n=37 n=33

Female/male ratio

23/14

28/5

Controls n=70 51/19

Age (years) Median±SD Range

37±2.2

37±2.3

39±4.2

18-54

22-56

18-53

Thrombosis, n (%) Arterial

14 (37.84)

0

0

Venous

19 (51.35)

0

0

Arterial and venous

4 (10.81)

0

0

Thrombocytopenia, 6 (16.22) n (%)

14 (42.42)

0

Fetal losses, n (%)

11 (29.73)

7 (21.21)

0

0

12 (36.36)

0

Thrombocytopenia and fetal mortality, n (%)

Presence of anticardiolipin antibodies (% of the involved group) IgG

39.3

60

negative

IgM

47.8

46.6

negative

Lupus anticoagulant 80

86.6

negative

Mean Ct (mRNA level) 0.36

0.38

0.77

ADAMTS-13 antigen (%)

66.63

63.39

98.2

ADAMTS-13 activity (%)

88.39

92.91

92.72

APS: Antiphospholipid syndrome; aPLA: antiphospholipid antibodiesi IgM: Immunoglobulin M; IgG: immunoglobulin G; mRNA: messenger ribonucleic acid; ADAMTS-13: A disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 13; Ct: cycle threshold

Genotyping Genomic DNA was extracted from venous blood samples using a High Pure PCR Template Preparation Kit (Roche Diagnostics, IN, USA). DNA was amplified via polymerase chain reaction (PCR) using 100 ng of DNA, 200 nM of each primer, 200 µM of each dNTP, 1.0 µM of MgCl2, and 1.5 U of Taq DNA polymerase for 35 cycles in order to analyze mutations. PCR products were digested with restriction enzymes for C365del, Q449stop, and P475S (Table 2). For the C508Y mutation, PCR products were directly sequenced using an ABI 310 genetic analyzer (Applied Biosystems, Foster City, CA, USA).

215

Quantification of ADAMTS-13 transcripts Total RNA was extracted from venous blood samples using the RNA Preparation Kit (Roche Diagnostics, IN, USA). cDNA was obtained from total RNA using the RevertAid First Strand cDNA Synthesis Kit (MBI-Fermentas, St. Leon-Rot, Germany). The target gene (ADAMTS-13) and a reference gene (HPRT1) were analyzed via real-time PCR using a LightCycler 2.0 (Roche Diagnostics, Mannheim, Germany).

Activity and antigen levels ADAMTS-13 activity and antigen levels were simultaneously measured in the same sample via fluorogenic assay (Technozym ADAMTS-13, Technoclone, Wien, Austria). Fluorescence was measured at 360/460 nm with a spectrofluorometer (Biotek reader FLX 800, Austria).

Statistical analysis The t-test was used to analyze associations between quantitative data and a p value <0.05 was considered statistically significant. Correlations were investigated using Spearman’s rank test. All calculations were performed using Graph-PAD Instat v.3.06 (GraphPad software Inc., San Diego, CA, USA).

Results ADAMTS-13 mutations C365del, Q449stop, P475S, and C508Y ADAMTS-13 mutations, which were previously reported to affect ADAMTS-13 activity, were investigated. None of these mutations were noted in the patient or control groups. In order to determine if these nucleotide changes are polymorphic, an additional 250 healthy Turkish individuals (female/male: 148/102) were genotyped, and none had the aforementioned mutations.

ADAMTS-13 mRNA The level of ADAMTS-13 mRNA in the APS patients was 50% less than that in the control group, based on the Pfaffl equation [23], as follows: ratio = (Etarget)∆CP target (control-sample)/(Ereference) ∆CP reference (control-sample)

ratio = 1,978-1,48/1,964-0,38 = 0.5

216

Hançer et al.

ADAMTS-13 expression in antiphospholipid syndrome

Turk J Hematol 2011; 28: 213-8

Table 2. Primer sequences, probes, and restriction enzymes Exon number, Primer name

Primer sequence

PCR product (bp)

Enzyme

10+11,C365del 1

5'GGGATCCCTATGGGTGAGTT3'

561

Alw21I

10+11 ,C365del 2

5'CCTGGTGTGAACCACAGATG 3'

561

Alw21I

12,Q449stop1

5'GTGCCATGTAGTCTCCCAGTGACAACACC3'

327

FspBI

12,Q449stop2

5'CCAGAGCCTGAACCACTTTGCCCAGTGC3'

327

FspBI

12, P475S 1

5'GTGCCATGTAGTCTCCCAGTGACAACACC3'

327

Eco130I

12, P475S 2

5'CCAGAGCCTGAACCACTTTGCCCAGTGC3'

327

Eco130I

13+14, C508Y 1

5'CCCAGATGCAAAGGATGAAG3'

839

-

13+14, C508Y 2

5'ATCCAGGGCTGAGTGAGTGT3'

839

-

A-13 Forward

5'AGTACAGAGTGGCCCTCACC3'

106

A-13 Reverse

5'CCATACCGCCTGTAAACCTG3'

106

Probe

FAM-UPL Probe #25 (Roche)-dark quencher

HPRT1 Forward

5'TGACCTTGATTTATTTTGCATACC3'

102

HPRT1 Reverse

5'CGAGCAAGACGTTCAGTCT3'

102

Probe

FAM-UPL Probe #73 (Roche)-dark quencher

ADAMTS-13 antigen and activity Median ADAMTS-13 activity was 92.55% (range: 62%-124%) in the patient group and 92.72% (range: 68%-124%) in the control group. ADAMTS-13 activity was 88.39% and 92.91% in the APS patients with and without a history of thrombosis, respectively, and although ADAMTS-13 activity was lower in the APS patients with thrombosis, the difference was not statistically significant (t-test, p=0.4369, 95% CI: 62.91-96.94). Median ADAMTS-13 antigen level was significantly lower (64.88%) in the patient group (66.63% in the APS patients with thrombosis and 63.39% in those without thrombosis) than in the control group (98.2% [range: 55%-159%]) (t-test, p<0.0001, 95% CI: 56.91-138.94). ADAMTS-13 activity in the control group was correlated with gender (p=0.0038), but not with age. There wasn’t a correlation between the level of ADAMTS-13 and its activity, and ADAMTS-13 activity varied in participants that had the same level of ADAMTS-13.

Discussion The presence of neutralizing anti-ADAMTS-13 autoantibodies or mutations resulting in severe ADAMTS-13 deficiency is a well-known major cause of acquired and congenital TTP. ADAMTS-13 activity in TTP patients, however, is generally <5% or 10%.

Amoura et al. reported 2 APS patients with unde-

tectable ADAMTS-13 activity that developed TTP. They also investigated ADAMTS-13 activity in their APS cohort (n=20), and observed that mean ADAMTS-13 activity was normal (116%; range: 44%250%) and that none of the patients had severe ADAMTS-13 deficiency [24].

The literature contains only a few studies on antiADAMTS-13 antibodies and ADAMTS-13 activity in APS patients. Austin et al. [25] reported that 52 of 68 APS patients had IgG antibodies against ADAMTS-13 based on ELISA, and 22 patients had low-level ADAMTS-13 activity, although median ADAMTS-13 activity was 34%. Rieger et al. reported that the prevalence of anti-ADAMTS-13 IgG and IgM antibodies among 55 APS patients was 5% and 18%, respectively. ADAMTS-13 activity in APS patients ranged from 32% to 114%, and there wasn’t a correlation between autoantibody titers and ADAMTS-13 activity [26].

The present study has 2 limitations: the study population was small and although many mutations have been reported in TTP, only 4 previously reported to affect ADAMTS-13 activity were investigated; however, to the best of our knowledge this is the first study to investigate these 4 mutations in APS. The present study investigated mutations that affect ADAMTS-13 activity, mRNA level, and antigen level in APS patients with thrombosis, aPLA-positive patients without thrombosis, and healthy controls.

Genotyping for ADAMTS-13 mutations (C365del,

Turk J Hematol 2011; 28: 213-8

Q449stop codon, C508Y, and P475S) showed that none of the patients or controls carried these mutations. The present study’s findings are the first to show that there isn’t a relationship between ADAMTS-13 mutations and APS. ADAMTS-13 mRNA and antigen levels were lower in the patients than in the controls. This finding suggests that the ADAMTS-13 gene is negatively regulated during transcription, mutation/s may be present in the promoter region, or there may be an epigenetic effect.

Although ADAMTS-13 activity was also low in the APS patients with thrombosis but, ADAMTS-13 activity did not reach statistical significance when compared with controls. ADAMTS-13 activity and level were not associated with thrombotic complications, thrombocytopenia, or pregnancy complications in the patients with APS. Acknowledgements This study was supported by the Istanbul University Research Fund (project no. 1454).

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Hançer et al.

ADAMTS-13 expression in antiphospholipid syndrome

8.

9.

10.

11.

12.

13.

14.

References 1.

2.

3.

4.

5.

6.

7.

Miyakis S, Lockshin MD, Atsumi T, Branch DW, Brey RL, Cervera R, Derksen RH, DE Groot PG, Koike T, Meroni PL, Reber G, Shoenfeld Y, Tincani A, Vlachoyiannopoulos PG, Krilis SA. International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS). J Thromb Haemost 2006;4:295-306.

Salmon JE, de Groot PG. Pathogenic role of antiphospholipid antibodies. Lupus 2008;17:405-11.

Levine JS, Branch DW, Rauch J. The antiphospholipid syndrome. N Engl J Med 2002;346:752-63.

Nimmo MC, Carter CJ. The antiphospholipid antibody syndrome: a riddle wrapped in a mystery inside an enigma. Clin Appl Immunol Rev 2003;4:125-40.

Lockshin MD, Erkan D. Treatment of antiphospholipid syndrome. N Engl J Med 2003;349:1177-9.

Diz-Kucukkaya R. Thrombosis in the antiphospholipid syndrome. Turk J Hematol 2006;2:5-14.

Moake JL, Turner NA, Stathopoulos NA, Nolasco LH, Hellums JD. Involvement of large plasma von Willebrand factor (vWF) multimers and unusually large vWF forms derived from endothelial cells in shear stress-induced platelet aggregation. J Clin Invest 1986;78:1456-61.

15.

16.

17.

18.

19.

217

Furlan M, Robles R, Lämmle B. Partial purification and characterization of a protease from human plasma cleaving von Willebrand factor to fragments produced by in vivo proteolysis. Blood 1996;87:4223-34.

Tsai HM. Physiologic cleavage of von Willebrand factor by a plasma protease is dependent on its conformation and requires calcium ion. Blood 1996;87:4235-44.

Levy GG, Nichols WC, Lian EC, Foroud T, McClintick JN, McGee BM, Yang AY, Siemieniak DR, Stark KR, Gruppo R, Sarode R, Shurin SB, Chandrasekaran V, Stabler SP, Sabio H, Bouhassira EE, Upshaw JD Jr, Ginsburg D, Tsai HM. Mutations in a member of the ADAMTS gene family cause thrombotic thrombocytopenic purpura. Nature 2001;413:488-94.

Soejima K, Mimura N, Hirashima M, Maeda H, Hamamoto T, Nakagaki T, Nozaki C. A novel human metalloprotease synthesized in the liver and secreted into the blood: possibly, the von Willebrand factorcleaving protease?. J Biochem 2001;130:475-80.

Cal S, Obaya AJ, Llamazares M, Garabaya C, Quesada V, López-Otín C. Cloning, expression analysis, and structural characterization of seven novel human ADAMTSs, a family of metalloproteinases with disintegrin and thrombospondin- 1 domains. Gene 2002;283:49-62.

Dent JA, Berkowitz SD, Ware J, Kasper CK, Ruggeri ZM. Identification of a cleavage site directing the immunochemical detection of molecular abnormalities in type IIA von Willebrand factor. Proc Natl Acad Sci U.S.A. 1990;87:6306-10.

Manea M, Kristoffersson A, Tsai HM, Zhou W, Winqvist I, Oldaeus G, Billström R, Björk P, Holmberg L, Karpman D. ADAMTS13 phenotype in plasma from normal individuals and patients with thrombotic thrombocytopenic purpura. Eur J Pediatr 2007;166:249-57.

Veyradier A, Obert B, Haddad E, Cloarec S, Nivet H, Foulard M, Lesure F, Delattre P, Lakhdari M, Meyer D, Girma JP, Loirat C. Severe deficiency of the specific von Willebrand factor-cleaving protease (ADAMTS 13) activity in a subgroup of children with atypical hemolytic uremic syndrome. J Pediatr 2003;142:310-7.

Scully M, Cohen H, Cavenagh J, Benjamin S, Starke R, Killick S, Mackie I, Machin SJ. Remission in acute refractory and relapsing thrombotic thrombocytopenic purpura following rituximab is associated with a reduction in IgG antibodies to ADAMTS-13. Br J Haematol 2007;136:451-61.

Plaimauer B, Zimmermann K, Volkel D, Antoine G, Kerschbaumer R, Jenab P, Furlan M, Gerritsen H, Lämmle B, Schwarz HP, Scheiflinger F. Cloning, expression, and functional characterization of the von Willebrand factor-cleaving protease (ADAMTS13).

Blood 2002;100:3626-32.

Pimanda JE, Maekawa A, Wind T, Paxton J, Chesterman CN, Hogg PJ. Congenital thrombotic thrombocytopenic purpura in association with a mutation in the second CUB domain of ADAMTS13. Blood 2004;103:627-9.

Veyradier A, Lavergne JM, Ribba AS, Obert B, Loirat C, Meyer D, Girma JP. Ten candidate ADAMTS13 mutations in six French families with congenital thrombotic

218

20.

21.

22.

23.

Hançer et al.

ADAMTS-13 expression in antiphospholipid syndrome

thrombocytopenic purpura (Upshaw Schulman syndrome). J Thromb Haemost 2004;2:424-9.

Tao Z, Anthony K, Peng Y, Choi H, Nolasco L, Rice L, Moake JL, Dong JF. Novel ADAMTS-13 mutations in an adult with delayed onset thrombotic thrombocytopenic purpura. J Thromb Haemost 2006;4:1931-35.

Pengo V, Tripodi A, Reber G, Rand JH, Ortel TL, Galli M, De Groot PG. Update of the guidelines for lupus anticoagulant detection. Subcommittee on Lupus Anticoagulant/Antiphospholipid Antibody of the Scientific and Standardisation Committee of the International Society on Thrombosis and Haemostasis.

J Thromb Haemost 2009;7:1737-40.

Harris EN. Antiphospholipid antibodies. Br J Haematol 1990;74:1-9.

Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29:e45.

Turk J Hematol 2011; 28: 213-8

24. Amoura Z, Costedoat-Chalumeau N, Veyradier A, Wolf M, Ghillani-Dalbin P, Cacoub P, Meyer D, Piette JC. Thrombotic thrombocytopenic purpura with severe ADAMTS-13 deficiency in two patients with primary antiphospholipid syndrome. Arthritis Rheum 2004;50:3260-4.

25. Austin SK, Starke RD, Lawrie AS, Cohen H, Machin SJ, Mackie IJ. The VWF/ADAMTS13 axis in the antiphospholipid syndrome: ADAMTS13 antibodies and ADAMTS13 dysfunction. Br J Haematol 2008;141:536-44.

26. Rieger M, Mannucci PM, Kremer Hovinga JA, Herzog A, Gerstenbauer G, Konetschny C, Zimmermann K, Scharrer I, Peyvandi F, Galbusera M, Remuzzi G, Böhm M, Plaimauer B, Lämmle B, Scheiflinger F. ADAMTS13 autoantibodies in patients with thrombotic microangiopathies and other immunomediated diseases. Blood 2005;106:1262-7.

Case Report

219

The effect of HBB:c.*+96T>C (3’UTR +1570 T>C) on the mild b-thalassemia intermedia phenotype HBB:c.*+96T>C (3’UTR +1570 T>C) mutasyonunun ılımlı tip betatalasemi intermedia fenotipi üzerine etkisi Türker Bilgen1, Duran Canatan2, Yunus Arıkan1, Akif Yeşilipek3, İbrahim Keser1 1Department

of Medical Biology and Genetics, Faculty of Medicine, Akdeniz University, Antalya, Turkey Blood Disease Foundation, Hemoglobinopathy Diagnosis Center, Antalya, Turkey 3Department of Pediatric Hematology, Faculty of Medicine, Akdeniz University, Antalya, Turkey 2Mediterranean

Abstract Hemoglobin beta (HBB):c.*+96T>C substitution is very rare among β-globin gene mutations and its clinical significance remains to be clarified. The present study aimed to investigate the role of HBB:c.*+96T>C in the β-thalassemia intermedia phenotype in a Turkish family. The proband and parents were screened for β-globin gene mutations via direct sequencing. Hematological and physical examination results were recorded, and correlated according to genotype. The proband was compound heterozygous for Cod 8 (-AA) and HBB:c.*+96T>C, whereas his mother and father were heterozygous for Cod 8 (-AA) and HBB:c.*+96T>C, respectively. The father had almost normal hematological findings, whereas the mother had the typical β-thalassemia trait phenotype. The proband was diagnosed as mild β-thalassemia intermedia based on hepatosplenomegaly and hematological findings. To the best of our knowledge this is the first report of HBB:c.*+96T>C mutation in a Turkish family.

HBB:c.* 96T>C substitution is a very rare, but clinically relevant β-globin gene mutation. Additionally, we think that if 1 spouse is a carrier for β-globin gene mutation the other should be screened for silent mutations, such as HBB:c.*+96T>C mutation of the β-globin gene, even if she/he does not have any clinical or hematological signs of the β-thalassemia trait phenotype. (Turk J Hematol 2011; 28: 219-22) Key words: Mild β-thalassemia intermedia, b-globin gene, HBB:c.*+96T>C Received: October 23, 2010

Accepted: January 12, 2011

Özet Hemoglobin beta (HBB):c.*+96T>C, β-globin geninde çok nadir görülen ve klinik önemi henüz tam olarak aydınlatılamamış bir değişimdir. Bu çalışmada; bir Türk ailede HBB:c.*+96T>C değişiminin beta-talasemi intermedia fenotipi üzerine etkisini araştırmayı amaçladık. Beta-talasemi intermedia ön tanılı çocuk ile anne ve babasının β-globin gen mutasyonları DNA dizi analizi yöntemiyle tarandı. Aile bireylerinin hematolojik ve klinik bulguları elde edilerek, genotipleri ile birlikte değerlendirildi. Direkt Address for Correspondence: Prof. İbrahim Keser, Department of Medical Biology and Genetics, Faculty of Medicine, Akdeniz University, 07059 Antalya, Turkey Phone: +90 242 249 69 73 E-mail: keser@akdeniz.edu.tr doi:10.5152/tjh.2011.57

220

Bilgen et al. c.*+96T>C causes mild β-thalassemia intermedia

Turk J Hematol 2011; 28: 219-22

DNA dizi analizi yöntemiyle mutasyon taranması sonucunda, olgunun Cod 8 (-AA) ve HBB:c.*+96T>C mutasyonları açısından birleşik heterozigot olduğu belirlendi. Annenin Cod 8 (-AA) mutasyonu, babanın ise HBB:c.*+96T>C mutasyonu yönünden taşıyıcı oldukları görüldü. Anne klasik beta-talasemi taşıyıcı bulgularına sahip iken, babanın klinik ve hematolojik açıdan normale yakın olduğu belirlendi.

Diğer yandan olgu, hematoloji bulgularına ek olarak, hepato-splenomegalinin varlığı ile ılımlı tip betatalasemi intermedia tanısı aldı. Bu çalışmada, HBB:c.*+96T>C değişimi ilk kez bir Türk ailesinde bildirilmektedir. Cod 8 (-AA) ve HBB:c.*+96T>C değişimleri açısından birlikte heterozigot olan olguda, sadece Cod 8 (-AA) mutasyonu ile açıklanamayacak klinik bulguların gözlenmesi nedeniyle, HBB:c.*+96T>C’ nın taşıyıcılarda sessiz, ancak başka bir mutasyonla birlikte olduğunda hastalık şiddetini artıran, klinik açıdan önemli bir β-globin geni mutasyonu olduğu sonucuna varıldı. Ayrıca, çiftlerden birinin taşıyıcılığının genetik testlerle kesinleştiği durumlarda, diğerinin klinik ve hematolojik olarak taşıyıcı bulgularına sahip olmasa bile, HBB:c.*+96T>C gibi hematolojik açıdan sessiz mutasyonlar için taranması gerektiğini önermekteyiz. (Turk J Hematol 2011; 28: 219-22) Anahtar kelimeler: Ilımlı tip beta-talasemi intermedia, Beta-globin geni, HBB:c.*+96T>C Geliş tarihi: 23 Ekim 2010

Kabul tarihi: 12 Ocak 2011

Introduction b-thalassemia is a hereditary blood disorder characterized by anomalies in hemoglobin (Hb) beta-chain synthesis and is the most frequently observed genetic condition in the world [1].

Diagnosis of b-thalassemia is based on hematologic and molecular genetic test results [2]. To date, more than 200 mutations have been reported; the disease exhibits a high level of molecular and clinical heterogeneity [3,4]. Among b-globin gene mutations, HBB:c.25_26delAA (Cod 8 [-AA]), which results in frame shift and stop codon at the 21st amino acid, is a rare mutation with an incidence of 2.1% among all b-globin gene mutations in Antalya Province [5]. HBB:c.*+96T>C or 3’UTR+1570 T>C is a very rare mutation located 12 nucleotides upstream of the polyadenylation signal in 3’ UTR of the b-globin gene. There are a limited number of reports on the prevalence and clinical role of HBB:c.*+96T>C [6]. Additionally, there is a lack of consensus concerning the clinical importance of HBB:c.*+96T>C. To the best of our knowledge the present study is the first to report HBB:c.*+96T>C substitution in Turkey. The present study aimed to investigate the effect of the co-existence Cod 8 (-AA) and HBB:c.*+96T>C substitution on mildtype b-thalassemia intermedia in a Turkish family.

Materials and Methods The proband, with ultrasound findings of hepatomegaly and splenomegaly, and unusual blood parameters, and his parents were referred from the hematology department to our laboratory

for screening of b-globin gene mutations. The family’s hematological findings were recorded. Informed consent was obtained from all the family members.

Following genomic DNA extraction from whole blood using the salting-out method [7], genomic DNA was measured using a NanoDrop 1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The proband and his parents were screened via direct sequencing of the region including 5’ UTR (-101 position) of the b-globin to 3’ UTR (Poly-A signal) in the b-globin gene. Sequencing was performed using a BigDye Terminator v3.1 Cycle Sequencing kit and an ABI prism 3130 genetic analyzer (Applied-Biosystems, Foster City, CA).

Results Clinical examination showed that the proband had hepatomegaly with a longitudinal measure of 167 mm (normal: <155 mm) and splenomegaly with a longitudinal measure of 172 mm (normal: <130 mm), based on abdominal ultrasound findings. Hematological findings for the proband and parents are given in the Table. The proband was compound heterozygous for HBB:c.*+96T>C and Cod 8 (-AA) mutations according to DNA sequencing. His mother was a carrier of the Cod 8 (-AA) mutation, and his father was a carrier of the HBB:c.*+96T>C mutation. b-globin DNA sequencing showed HBB:c.*+96T>C and Cod 8 (-AA) mutations in the proband (Figure).

Following clinical and hematological examinations, the proband was diagnosed as mild type b-thalassemia intermedia. Although the patient’s MCH level was low (18.60 pg/cell), his Hb level (11.5

Bilgen et al. c.*+96T>C causes mild b-thalassemia intermedia

Turk J Hematol 2011; 28: 219-22

g/dL) was compensated by an elevated RBC count (6.16 million mm3). The proband’s mother had hematological findings that correlated with the b-thalassemia trait due to Cod 8 (-AA) mutation, whereas the father (who only had the HBB:c.*+96T>C mutation) did not have hematological findings associated with the b-thalassemia trait.

Discussion b-thalassemia due to structurally abnormal hemoglobin or an insufficient quantity of Hb is the most common genetic disease with a wide spectrum of phenotypic heterogeneity caused by genetic variation. The modifier factors that play in the severity of b-thalassemia are not well known. Cod 8 (-AA) is a frame shift mutation that creates a stop codon at the 21st codon, leading to b0-thalassemia. The modified C-terminal amino acid sequence in the b-globin gene with Cod 8 (-AA) mutation is as follows: (8)ValCys-Arg-Tyr-Cys-Pro-Val-Gly-Gln-Gly-Glu-Arg-(20)GlyCOOH (http://globin.bx.psu.edu/cgi-bin/hbvar/ query_vars3). On the other hand, Cai et al. reported that HBB:c.*+96T>C was the only genomic alteration responsible for the b-thalassemia trait phenotype with elevated HbA2 levels in 5 members of an Irish family. They also reported that the b-thalassemia trait phenotype in the family was caused by the known mutation IVS-II-654 C>T [8,9]. Additionally, Divoky et al. reported that HBB:c.*+96T>C was not associated with b-thalassemia phenotypes in Czech patients and that HBB:c.*+96T>C is linked to IVS-II-654 C>T mutation [6]. We examined our sequence results for such a mutation, but IVS-II-654 C>T mutation was not present in the presented family. Giambona et al. reported HBB:c.*+96T>C mutation in an Italian patient with a slightly elevated HbA2 level [10].

Moreover, Boussiou et al. observed the HBB:c.*+96T>C mutation in 7 Greek patients without any clinical symptoms [11].

The presented proband had compound heterozygosity for Cod 8 (-AA) mutation and

221

HBB:c.*+96T>C, and had clinical and hematological findings associated with mild b-thalassemia intermedia, whereas his mother had some findings indicative of anemia, such as paleness and fatigue, in addition to hematological parameters consistent with the trait phenotype due to Cod 8 (-AA) mutation (she occasionally takes folic acid and zinc tablets). Compared to the mother’s blood parameters, the proband’s Hb (11.5 g/dL), MCV (59.9 fL), and MCH (18.6 pg/cell) levels were lower, and RBC (6.16×1012 mm3), HbA2 (5.65%), and HbF (2.20%) levels were higher (Table 1). On the other hand, the proband’s father was clinically normal, despite being a carrier of the HBB:c.*+96T>C mutation.

The father’s laboratory tests did not show any significant hematological findings that could be due to HBB:c.*+96T>C mutation other than a slightly reduced RBC count (4.0×1012 mm3) and Hb level (12.9 g/dL). This implies that HBB:c.*+96T>C carriers might be hematologically asymptomatic. Although by itself HBB:c.*+96T>C mutation does not cause the b-thalassemia trait phenotype in carriers, it probably has an additive affect when it co-exists with other b-globin gene mutations such as Cod 8 (-AA).

It was suggested that T>C substitution at position +1570 in the b-globin gene (12 bp upstream of the AATAAA polyadenylation signal) may contribute to the b-thalassemia phenotype by destabilizing b-globin mRNA [12]. Destabilization of mRNA processing due to HBB:c.*+96T>C mutation together with Cod 8 (-AA) mutation may have resulted in

Figure 1. T>C transition at the c.*+96 position (left) and the frame shift mutation Cod 8 (-AA) (right) detected via DNA sequencing in the proband

Table 1. Hematological and molecular findings in the family members Age/ gender

b-globin gene mutation(s)

RBC (mm3)

Hb (g/dL)

MCV (fL)

MCH (pg/cell)

MCHC (g/dL)

HbA2 (%)

HbF (%)

Proband

20/M

Cod 8 (-AA)/ HBB:c.*+96T>C

6.16

11.5

59.9

18.60

31.1

5.65

2.20

Father

59/M

HBB:c.*+96T>C

4.00

12.9

92.60

32.30

34.9

2.20

0.20

Mother

49/F

Cod 8 (-AA)

6.14

12.5

61.9

20.30

32.8

4.40

0.30

222

Bilgen et al. c.*+96T>C causes mild b-thalassemia intermedia

the mild b-thalassemia intermedia phenotype in the presented proband, as patients that are heterozygous for the Cod 8 (-AA) mutation do not have the mild b-thalassemia intermedia phenotype with hepatosplenomegaly. As such, we think that the combination of b-globin gene mutations is important for the expression of the mild b-thalassemia intermedia phenotype.

To the best of our knowledge the present study is the first to report the combination of HBB:c.*+96T>C and Cod 8 (-AA). In addition, based on the very low frequency of HBB:c.*+96T>C substitution in the thousands of patients that have been sequenced in our laboratory, as well as in other laboratories, it can be considered a clinically important mutation that causes mild b-thalassemia. More detailed molecular studies on other factors, such as mRNA instability and other globin genes, should be performed to further clarify the role of HBB:c.*+96T>C mutation in the b-thalassemia trait phenotype.

In conclusion, we think that if 1 spouse is a carrier of a b-globin gene mutation, the other should be screened for silent mutations of the b-globin gene, even if she/he does not have any clinical or hematological signs of the b-thalassemia trait phenotype.

Acknowledgements: This study was supported by the Akdeniz University Scientific Research Projects Management Unit.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

Trent RJ. Diagnosis of the haemoglobinopathies. Clin Biochem Rev 2006;27:27-38.

Turk J Hematol 2011; 28: 219-22

2.

Galanello R, Melis MA, Ruggeri R, Addis M, Scalas MT, Maccioni L, Furbetta M, Angius A, Tuveri T, Cao A. Beta 0 thalassemia trait in sardinia. Hemoglobin 1979;3:33-46.

3. Giardine B, van Baal S, Kaimakis P, Riemer C, Miller W, Samara M, Kollia P, Anagnou NP, Chui DH, Wajcman H, Hardison RC, Patrinos GP. Hbvar database of human hemoglobin variants and thalassemia mutations: 2007 update. Hum Mutat 2007;28:206. [CrossRef] 4. Wong C, Antonarakis SE, Goff SC, Orkin SH, Boehm CD, Kazazian HH, Jr. On the origin and spread of beta-thalassemia: Recurrent observation of four mutations in different ethnic groups. Proc Natl Acad Sci U S A 1986;83:6529-32.

5. Keser I, Sanlioglu AD, Manguoglu E, Guzeloglu Kayisli O, Nal N, Sargin F, Yesilipek A, Simsek M, Mendilcioglu I, Canatan D, Luleci G. Molecular analysis of beta-thalassemia and sickle cell anemia in Antalya. Acta Haematol 2004;111:205-10.

6. Divoky V, Baysal E, Oner R, CĂźrĂźk MA, Walker EL 3rd, Indrak K, Huisman TH. The t-->c mutation at position +96 of the untranslated region 3' to the terminating codon of the beta-globin gene is a rare polymorphism that does not cause a beta-thalassemia as previously ascribed. Hum Genet 1994;93:77-8.

7. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215.

8. Cai SP, Eng B, Francombe WH, Olivieri NF, Kendall AG, Waye JS, Chui DH. Two novel beta-thalassemia mutations in the 5' and 3' noncoding regions of the beta-globin gene. Blood 1992;79:1342-6.

9. Eng B, Waye JS, Chui DH. The t----c substitution at nucleotide + 1570 of the beta-globin gene is a polymorphism.

Blood 1992;80:1365.

10. Giambona A, Passarello C, Vinciguerra M, Li Muli R, Teresi P, Anza M, Ruggeri G, Renda D, Maggio A. Significance of borderline hemoglobin a2 values in an italian population with a high prevalence of beta-thalassemia. Haematologica 2008;93:1380-4.

11. Boussiou M, Karababa P, Sinopoulou K, Tsaftaridis P, Plata E, Loutradi-Anagnostou A. The molecular heterogeneity of beta-thalassemia in greece. Blood Cells Mol Dis 2008;40:317-9.

12. Cooper DN. Human gene mutations affecting rna processing and translation. Ann Med 1993;25:11-7.

Case Report

223

Eculizumab before and after allogeneic hematopoietic stem cell transplantation in a patient with paroxysmal nocturnal hemoglobinuria Paroksismal noktürnal hemoglobinürili bir hastada allojeneik hematopoetik kök hücre nakli öncesi ve sonrasında Ekulizumab kullanımı Hakan Göker, Burak Uz, Yahya Büyükaşık, Salih Aksu, İbrahim Haznedaroğlu, Nilgün Sayınalp, Yasemin Karacan, Fatma Tekin, Osman İlhami Özcebe Department of Hematology, Faculty of Medicine, Hacettepe University, Ankara, Turkey

Abstract Paroxysmal nocturnal hemoglobinuria (PNH) is characterized by the triad of intravascular hemolysis, venous thrombosis, and cytopenia. Treatment of PNH is generally supportive. Bone marrow transplantation is the only curative therapy for PNH, but is associated with significant morbidity and mortality.

Herein, we present a patient with PNH that received eculizumab, a humanized monoclonal antibody that blocks activation of the terminal complement at C5, before and immediately following allogeneic peripheral stem cell transplantation. Prior to hematopoietic stem cell transplantation eculizumab treatment markedly reduced hemolysis and transfusion requirement; however, 1 d post transplantation a hemolytic episode occured, which was successfully stopped with eculizumab re-treatment. Afterwards the patient did not require additional transfusions. The results of this study indicate that early administration of eculizumab may be a safe and effective therapy for hemolytic episodes associated with allogeneic peripheral stem cell transplantation in patients with PNH. (Turk J Hematol 2011; 28: 223-7) Key words: Paroxysmal nocturnal hemoglobinuria, eculizumab, complement, hemolytic episode Received: February 14, 2011

Accepted: April 22, 2011

Özet Paroksismal noktürnal hemoglobinüri (PNH) intravasküler hemoliz, venöz trombozlar ve sitopenilerden oluşan bir triadla kendini gösterir. Hastalığın tedavisi genellikle destekleyici türdedir. Kök hücre nakli tek şifa sağlayıcı tedavi yolu olmakla birlikte, anlamlı oranda morbidite ve mortaliteyle birliktedir. Burada ekulizumab (C5 düzeyinde terminal kompleman aktivitesini inhibe eden monoklonal insan kaynaklı antikor) tedavisinin işlem öncesi ve hemen sonrasında kullanıldığı bir allojeneik çevresel kök hücre transplantasyonu olgusunu sunmak istedik. Ekulizumab, allojeneik nakil öncesinde kullanıldığında hastanın hemoliz ataklarında ve transfüzyon ihtiyacında belirgin bir azalma gözlendi. Bununla birlikte, naklin ilk gününde meydana gelen hemolitik atak nedeniyle ekulizumab uygulaması tekrarlandı.

Address for Correspondence: M.D. Burak Uz, Department of Hematology, Faculty of Medicine, Hacettepe University, Samanpazarı, Sıhhıye, 06100 Ankara, Turkey Phone: +90 312 305 15 36 E-mail: burakuz78@gmail.com doi:10.5152/tjh.2011.58

224

Göker et al.

Eculizumab and paroxysmal nocturnal hemoglobinuria

Turk J Hematol 2011; 28: 223-7

Hemolitik atak başarıyla tedavi edilirken, sonrasında hastanın transfüzyon ihtiyacı olmadı. Bu olgu sunumu bize, PNH'lı ve allojeneik periferik kök hücre nakli uygulaması yapılan hastalarda meydana gelebilecek hemolitik atakların tedavisinde ekulizumabın güvenli ve etkili bir şekilde uygulanabileceğini düşündürmektedir. (Turk J Hematol 2011; 28: 223-7) Anahtar kelimeler: Paroksismal noktürnal hemoglobinüri, ekulizumab, kompleman, hemolitik atak Geliş tarihi: 14 Şubat 2011

Kabul tarihi: 22 Nisan 2011

Introduction Paroxysmal nocturnal hemoglobinuria (PNH) is a rare, acquired clonal hematopoietic stem cell disorder, which is caused by a somatic mutation in the phosphatidylinositol glycan-complementation class A gene, with an estimated prevalence of 1-2 cases per million people in the United States [1-2]. The disorder causes partial or complete deficiency of the complement inhibitors CD55 and CD59, which results in red blood cell susceptibility to terminal complement-mediated lysis. CD55 inhibits complement at the C3 level, whereas CD59 prevents terminal complements from forming a hemolytic membrane pore (C5b9) [3-5]. Subsequent chronic intravascular hemolysis is the hallmark of the disease, and causes morbidity and mortality [6].

The clinical course of PNH varies and is affected by hemolytic episodes and/or thrombotic events.

Fifteen percent of patients with PNH may experience spontaneous remission and long-term survival [7]. Allogeneic hematopoietic stem cell transplantation (HSCT) is the only therapeutic intervention that can result in eradication of the PNH clone [7].

Eradication of the PNH clone has been achieved with both myeloablative and reduced-intensity conditioning regimens [8-12]. Transplant-related mortality in a recent study was 42% (26% and 63% for transplant patients following myeloablative and reduced intensity conditioning, respectively) [13].

As our understanding of the pathogenesis and clinical course of PNH increases, more specific therapies become available for clinical use. Prior to the advent of eculizumab, treatment options for patients with PNH were generally supportive and directed towards palliation of clinical symptoms rather than treatment of the underlying disease process [14]. While the optimal timing of transplantation may be changing in the era of eculizumab, the most effective conditioning regimen (myeloablative or reduced-intensity) is yet to be determined. The use of HSCT in the treatment of PNH has become

less frequent now that there is an effective targeted therapy [13]. Eculizumab is a humanized monoclonal antibody that specifically binds to the C5 complement protein, preventing its cleavage to C5a and C5b, and therefore preventing formation of the membrane attack complex. It is the first approved drug that specifically targets complement activation [15]. Herein we present a case with recurrent hemolytic episodes due to PNH. Administration of eculizumab during hemolytic episodes, both before and after allogeneic HSCT, are discussed.

Case Report A 45-year-old male patient was diagnosed with PNH in March 2008. Flow-cytometric analysis of peripheral blood stem cells revealed CD55 expression of 7% and CD59 expression of 9% in granulocytes, and 7% and 13% in erythrocytes, respectively.

The initial bone marrow biopsy specimen was normocellular and showed significant dysplasia in erythroid progenitor cells. The patient was treated with cyclosporin 100 mg/d (p.o.) and danazol 200 mg/d (p.o.). One month later the drugs were discontinued due to hepatotoxicity and renal toxicity. The patient has been transfusion-dependent since April 2008, requiring about 3-4 units of packed RBCs each month. Prior to the use of eculizumab he was transfused with a total of 22 units of packed RBCs. Due to this transfusion history and frequent hemoglobinuria episodes, eculizumab treatment was used.

The patient was vaccinated against Neisseria meningitides 2 weeks prior to the initiation of eculizumab treatment. Eculizumab (Soliris, Alexion Pharmaceuticals®) therapy began in November 2008 with an induction dose of 600 mg QWK for 4 weeks, and then 900 mg (single dose) 7 days later, followed by a maintenance dose of 900 mg (single dose) after 1 month. The drug was administered via intravenous infusion over a period of 30 min. The patient’s hematological parameters before treatment were as follows: Hb: 9.7 g/L (normal range: 13.6-17.2 g/L); WBC:

Turk J Hematol 2011; 28: 223-7

6.2×109/L (normal range: 4.3-10.3 109/L); Plt: 56×109/L (normal range: 156-373×109/L).

The patient had 2 hemolytic episodes during eculizumab therapy that were confirmed via peripheral blood smear and hemolytic parameters, including reticulocyte 3.94% (normal range: 0.60%-2.60%), haptoglobin <5.83 mg/dL (normal range: 36-195 mg/dL), lactate dehydrogenase 1388 U/L (normal range: 240-480 U/L); the 1st episode occurred 2 d after the 2nd dose and the 2nd episode occurred 4 d after the 4th dose. Hemoglobin levels ranged from 7.8 to 10.7 g/L during these two hemolytic episodes.

After the sixth dose of eculizumab was administered the patient’s Hb level was successfully stabilized and his platelet count was in the normal range without transfusion. Only 3 units of packed RBCs were transfused during the course of eculizumab treatment, and no adverse effects were observed due to its use.

The patient did not require transfusion for 3 months after receiving the last dose of eculizumab.

He then underwent allogeneic HSCT from an identical sibling female donor. ABO incompatibility was not noted between the patient and the donor. Prior to transplantation the patient’s blood count was as follows: Hb: 8.9 g/L (normal range: 13.6-17.2/L); WBC: 6.5×109/L (normal range: 4.3-10.3/L); Plt: 154×109/L (normal range: 156-373×109/L). His conditioning regimen consisted of intravenous (IV) melphalan (140 mg m2), IV fludarabine (25 mg m2), and IV anti-thymocyte globulin (300 mg/d for 2 d).

Allogeneic HCST with a reduced intensity regimen was used due to the patients’ poor clinical condition. Peripheric stem cells (932 cc [5×108 mononuclear cells/kg and 7.44×106 CD34+ allogeneic hematopoietic stem cells/kg]) were transplanted.

Unfortunately, 1 d post transplantation a hemolytic episode occurred and the patient’s Hb level decreased from 8.9 to 5.1 g/L; the same day 900 mg single dose of eculizumab was administered to the patient without any side effects. The patient was given 6 units of packed RBCs over the course of 6 d.

Afterwards his Hb level (14.5 g/L) and platelet count were normal. The patient was transfusion-independent with a stable Hb level for 21 months following allogeneic HSCT. For graft-versus-host disease (GVHD) prophylaxis the patient received cyclosporin (175 mg/d) and methotrexate (20, 15, 15, and 15 mg 1, 3, 6, and 11 d post transplantation). Myeloid

Göker et al.

Eculizumab and paroxysmal nocturnal hemoglobinuria

225

cell chimerism analysis performed 6 months post transplantation showed 99% donor chimerism, according to 6 alleles (ABI 310 genetic analyzer). As of the time this paper was written the patient had mild chronic GVHD and resumed normal activity.

Discussion Treatment of PNH is generally supportive and consists of transfusion, folate supplements, and corticosteroid and androgen therapy [16]. Currently, allogeneic bone marrow transplantation (BMT) and eculizumab for complement inhibition are the proven effective therapies for patients with classic PNH [17].

BMT is the only curative therapy for PNH, but is associated with significant morbidity and mortality [17].

Some researchers recommend allogeneic HSCT only for PNH patients with life-threatening cytopenias, or the rare patient with disabling hemolysis or thrombosis that is non-responsive to eculizumab therapy [17].

In fact, use of eculizumab must be considered on a case-specific basis because of the heterogenity of PNH; however, in the era of eculizumab the role of HSCT in the treatment of PNH has changed [13].

Eculizumab has been evaluated in 3 studies, a phase II pilot study and 2 phase III case-parent studies. Results from these studies showed that eculizumab was highly effective in decreasing intravascular hemolysis in patients with classic PNH. It also improved quality of life, reduced or eliminated the need for blood transfusion, and reduced the risk of thrombosis [18-20]. On the other hand, eculizumab treatment does not eradicate the underlying faulty PNH clone and must be given lifelong; therefore, it is best reserved for symptomatic patients with a large percentage (more than 10%) of PNH clones or PNH patients with thrombosis irrespective of the size of the PNH clone [17].

The presented case received eculizumab prior to and immediately following allogeneic HSCT because of hemolytic attacks due to PNH; however, the exact cause of the hemolytic attacks was not determined. The patient was treated successfully with eculizumab, and no drug-related adverse effects were observed. During the course of eculizumab therapy (for 9 weeks) the patient had 2 hemolytic episodes and received 3 units of packed RBCs. After allogeneic HSCT the patient did not have any hemo-

226

Göker et al.

Eculizumab and paroxysmal nocturnal hemoglobinuria

lytic attacks for 3 months and therefore received only 3 units of packed RBCs during a period of 5 months.

We think that eculizumab treatment reduced the incidence of hemolysis and reduced the need for transfusion. Each patient treated with eculizumab in a multicenter phase III study had a substantial reduction in hemolysis, according to LDH levels. The number of packed RBC units transfused was also reduced significantly, as compared to pretreatment transfusion requirements. Acute hemolytic exacerbation can occur regularly or unpredictably, and negatively affect quality of life [20].

Mild to moderate thrombocytopenia is common in patients with PNH [21] and the need for transfusion requirement varies widely [20]. Thrombocytopenia in PNH may be related to bone marrow failure or thrombocyte consumption. Data reported by the SHEPHERD trial suggest that patients with a low platelet count (lower than 65×109/L) benefit from eculizumab [20]. The presented case had a platelet count of 56×109/L before treatment, during eculizumab therapy it ranged from 67×109/L to 264×109/L, and post treatment it progressively increased to >300×109/L. The effectiveness of eculizumab as a therapeutic agent is based on a small number of short-term clinical trials. The cost of eculizumab and a potential lack of access to the medication in some regions may limit its use. Eculizumab administration did not negatively affect the outcome or engraftment of allogeneic HSCT in the presented case. To the best of our knowledge eculizumab treatment during the course of allogeneic HSCT, i.e. during the conditioning process, has not been previously reported in the English language literature. Additional investigations are needed to definitely demonstrate the effectiveness of eculizumab in patients with PNH and allogeneic HSCT. Acknowledgments Written informed consent was obtained from the presented case.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2011; 28: 223-7

References 1.

Brodsky RA. Narrative review: paroxysmal nocturnal hemoglobinuria: the physiology of complement-related hemolytic anemia. Ann Intern Med 2008;148:587-95.

2. Bessler M, Mason PJ, Hillmen P, Miyata T, Yamada N, Takeda J, Luzzatto L, Kinoshito T. Paroxysmal nocturnal hemoglobinuria (PNH) is caused by somatic mutations in the PIG-A gene. EMBO Journal 1994;13:110-7.

3. Fujita T, Inoue T, Ogawa K, Iida K, Tamura N. The mechanism of action of decay-accelerating factor (DAF). DAF inhibits the assembly of C3 convertases by dissociating C2a and Bb. J Exp Med 1987;166:1221-8.

4. Holguin MH, Fredrick LR, Bernshaw NJ, Wilcox LA, Parker CJ. Isolation and characterization of a membrane protein from normal human erythrocytes that inhibits reactive lysis of the erythrocytes of paroxysmal nocturnal hemoglobinuria. J Clin Invest 1989;84:7-17.

5. Rollins SA, Sims PJ. The complement-inhibitory activity of CD59 resides in its capacity to block incorporation of C9 into membrane C5b-9. J Immunol 1990;144:3478-83.

6. Rother RP, Bell L, Hillmen P, Gladwin MT. The clinical sequelae of intravascular hemolysis and plasma hemoglobin: a novel mechanism of human disease. JAMA 2005;293:1653-62.

7. Matos-Fernandez NA, Abou Mourad YR, Caceres W, Kharfan-Dabaja MA. Current status of allogeneic hematopoietic stem cell transplantation for paroxysmal nocturnal hemoglobinuria. Biol Blood Marrow Transplant 2009;15:656-61.

8. Bemba M, Guardiola P, Garderet L, Devergie A, Ribaud P, Esperou H, Noguera MH, Gluckman E, Socie G. Bone marrow transplantation for paroxysmal nocturnal haemoglobinuria. Br J Haematol. 1999;105:366-8.

9. Hegenbart U, Niederwieser D, Forman S, Holler E, Leiblein S, Johnston L, Pönisch W, Epner E, Witherspoon R, Blume K, Storb R. Haematopoietic cell transplantation from related and unrelated donors after minimal conditioning as curative treatment modality for severe paroxysmal nocturnal hemoglobinuria. Biol Blood Marrow Transplant 2003;9:689-97.

10. Raiola AM, Van Lint MT, Lamparelli T, Gualandi F, Benvenuto F, Figari O, Mordini R, Berisso G, Bregante S, Frassoni F, Bacigalupo A. Bone marrow transplantation for paroxysmal nocturnal hemoglobinuria.

Haematologica. 2000;85:59-62.

11. Woodard P, Wang W, Pitts N, Benaim E, Horwitz E, Cunningham J, Bowman L. Successful unrelated donor bone marrow transplantation for paroxysmal nocturnal hemoglobinuria. Bone Marrow Transplant.

2001;27:589-92.

12. Srinivasan R, Takahashi Y, McCoy JP, Espinoza-Delgado I, Dorrance C, Igarashi T, Lundqvist A, Barrett AJ, Young NS, Geller N, Childs RW. Overcoming graft rejection in heavily transfused and allo-immunised patients with bone marrow failure syndromes using fludarabinebased haematopoietic cell transplantation. Br J Haematol. 2006;133:305-14.

Turk J Hematol 2011; 28: 223-7

Göker et al.

Eculizumab and paroxysmal nocturnal hemoglobinuria

13. Santarone S, Bacigalupo A, Risitano AM, Tagliaferri E, Di Bartolomeo E, lori AP, Rambaldi A, Angelucci E, Spagnoli A, Papineschi F, Tamiazzo S, Di Nicola M, Di Bartolomeo P. Hematopoietic stem cell transplantation for paroxysmal nocturnal hemoglobinuria: long-term results of a retrospective study on behalf of the Gruppo Italiano Trapianto Midollo Osseo (GITMO).

Haematologica 2010;95:983-8.

14. Schubert J, Hillmen P, Röth A, Young NS, Elebute MO, Szer J, Gianfaldoni G, Socié G, Browne P, Geller R, Rother RP, Muus P. Eculizumab, a terminal complement inhibitor, improves anaemia in patients with paroxysmal nocturnal haemoglobinuria. Br J Haematol 2008;142:263-72.

15. Hillmen P. The role of complement inhibition in PNH. Hematology 2008;116-23.

16. Parker C, Omine M, Richards S, Nishimura J, Bessler M, Ware R, Hillmen P, Luzzatto L, Young N, Kinoshita T, Rosse W, Socié G; International PNH Interest Group.

Diagnosis and management of paroxysmal nocturnal hemoglobinuria. Blood 2005;106:3699-709.

17. Brodsky RA. How I treat paroxysmal nocturnal hemoglobinuria. Blood 2009;113:6522-7.

18. Hillmen P, Hall C, Marsh JC, Elebute M, Bombara MP, Petro BE, Cullen MJ, Richards SJ, Rollins SA, Mojcik CF, Rother RP. Effect of eculizumab on hemolysis and transfusion requirements in patients with paroxysmal nocturnal hemoglobinuria. N Engl J Med 2004;350:552-9.

19. Hillmen P, Young NS, Schubert J, Brodsky RA, Socié G, Muus P, Röth A, Szer J, Elebute MO, Nakamura R, Browne P, Risitano AM, Hill A, Schrezenmeier H, Fu CL, Maciejewski J, Rollins SA, Mojcik CF, Rother RP, Luzzatto L. The complement inhibitor eculizumab in paroxysmal nocturnal hemoglobinuria. N Engl J Med 2006;355:1233-43.

20. Brodsky RA, Young NS, Antonioli E, Risitano AM, Schrezenmeier H, Schubert J, Gaya A, Coyle L, de Castro C, Fu CL, Maciejewski JP, Bessler M, Kroon HA, Rother RP, Hillmen P. Multicenter phase 3 study of the complement inhibitor eculizumab for the treatment of patients with paroxysmal nocturnal hemoglobinuria.

Blood 2008;111:1840-7.

21. Moyo VM, Mukhina GL, Garrett ES, Brodsky RA. Natural history of paroxysmal nocturnal haemoglobinuria using modern diagnostic assays. Br J Haematol 2004;126:133-8.

227

228

Case Report

Extramedullary plasmacytoma presenting as a mediastinal mass Mediastende kitle ile beliren ilik dışı (ekstramedüller) plazmositom Arpana Shukla, Vivek Bansal, Ritu Bhutani, Gaurav Kumar, Jai Sharma, Surinder Solanki, Anurag Mehta Rajiv Gandhi Cancer Institute and Research Centre, Department of Radiation Oncology, Sector V, Rohini, Delhi, India

Abstract Extramedullary plasmacytoma (EMP) is a plasma cell neoplasm without bone marrow involvement or other systemic characteristics of multiple myeloma. Few large-scale clinical studies have been conducted because of the rarity of EMP, especially when it arises from the mediastinum. Herein we report a rare case of solitary mediastinal plasmacytoma with reactive pleural effusion. A 58-year-old female presented with grade 4 dyspnea and dysphagia, with a mediastinal mass observed with on PET. CT-guided biopsy results were suggestive of IgG kappa-type EMP arising from the anterior mediastinum. The patient was treated with local radiotherapy to the mediastinum, and had clinical and radiological response s were good. Radiotherapy is an effective treatment for mediastinal EMP, but a complete workup is mandatory, including PET, as the majority of such masses coexist with multiple myeloma. (Turk J Hematol 2011; 28: 228-31) Key words: Extramedullary, plasmacytoma, mediastinal, radiotherapy Received: August 26, 2010

Accepted: January 12, 2011

Özet Ekstramedüller plazmasitom (EMP) kemik iliği tutulumu veya multipl miyelomun diğer sistemik özelliklerinin bulunmadığı bir plazma hücre neoplazisidir. Özellikle mediasten kökenli EMP seyrek görüldüğünden büyük ölçekli klinik çalışma sayısı oldukça azdır. Burada reaktif plevra sıvısı ile birlikte mediastende plazmasitomun görüldüğü nadir bir olgu bildirilmektedir. Derece 4 dispne ve disfajiden yakınan 58 yaşındaki bir kadında PET incelemesi mediasten kitlesini ortaya çıkarmıştır. CT-yönlendirmeli biyopsi bulguları ön mediastenden kaynaklanan IgG kappa-tip EMP tanısını koydurmuştur. Mediastene lokal radyoterapi uygulanarak iyi klinik ve radyolojik yanıt elde edilmiştir. Radyoterapi mediasten kökenli EMP için etkin bir tedavi olmakla birlikte. bu kitlelerin büyük bir bölümü multipl miyelomla birlikte geliştiğinden PET’i de içeren tam bir klinik çalışma yapmak zorunludur.

(Turk J Hematol 2011; 28: 228-31)

Anahtar kelimeler: Ekstramedüller plazmasitom, plazmasitom, mediastinal, radyoterapi Geliş tarihi: 26 Ağustos 2010

Kabul tarihi: 12 Ocak 2011

Address for Correspondence: M.D. Ritu Bhutani, Rajiv Gandhi Cancer Institute and Research Centre, Department of Radiation Oncology, Sector V, Rohini 110085 Delhi, India Phone: 91-11-47022222 E-mail: bhutaniritu@gmail.com doi:10.5152/tjh.2011.59

Turk J Hematol 2011; 28: 228-31

Introduction Extramedullary plasmacytoma (EMP) is a plasma cell neoplasm involving soft tissues without any signs of systemic spread. It occurs in <5% of cases and mediastinal presentation is. a rare presentation Herein we report a rare case of solitary mediastinal plasmacytoma and a review of the literature.

Case presentation A 58-year-old female presented with upper chest swelling associated with grade 4 dyspnea and difficulty swallowing. Physical examination showed a 4×3-cm supraclavicular mass with diffuse borders and a 5×5-cm infraclavicular bulge fixed to underly-

Figure 1. PET/CT shows a 10.3×8.2-cm anterior mediastinal mass (SUV: 2.6), with bilateral pleural effusion and collapse of the left lung. Saggital (A), coronal (B), and axial (C) views

Shukla et al.

Mediastinal plasmacytoma

229

ing structures. Her breathing sounds were slightly coarse, without rales or rhonchi on auscultation.

She was treated in the intensive care unit due to her inability to maintain oxygen saturation. PET CT showed an anterior mediastinal mass (10.3×8.2 cm) extending up to the left supraclavicular region (Figure 1). The mass was abutting the major mediastinal vessels, overlying the manubrium sterni and chest wall, and was associated with bilateral pleural effusion. Cranial, spinal, and pelvic X-ray showed that there weren’t any osteolytic regions. Light microscopic examination showed scattered oval cells with eccentric nuclei and abundant eosinophilic cytoplasm suggestive of plasmacytoma. The plasma cells stained positive with LCA, CD138, and reduced kappa light-chain concentrations (Figure 2). Bone marrow biopsy results showed normal patterns of cell distribution. Pleural fluid cytological examination showed lymphocytes and reactive mesothelial cells. Serum calcium was normal and urine was negative for Bence Jones proteins. Serum electrophoresis showed an M spike in the gamma globulin (IgG kappa) region with a value of 3.07 g/dL. Based on these findings, the patient was diagnosed as mediastinal plasmacytoma. The patient received 3-dimensional conformal external beam radiotherapy (3D-CRT) to the mediastinum (46.2 Gy in 26 fractions). Gross target volume GTV was contoured under FDG-PET guidance with margins based on our institutional protocol. The treatment was

Figure 2. Microscopic examination. A. Diffuse sheets of plasma cells (H&E, 100×). B. Plasma cells show abundant eosinophilic cytoplasm, eccentric cartwheel nuclei with mitosis (thick arrow), and para nuclear halos (thin arrow) (H&E, 200×). C and D. Tumor cells show kappa light chain restriction (C), but no lambda restriction (D) (DAB, 200×)

230

Shukla et al.

Mediastinal plasmacytoma

Turk J Hematol 2011; 28: 228-31

planned using a PLATO 2.7.7 system and was administered under imaging guidance. Clinical improvement was evident after 2 weeks of treatment, as the patients was weaned from oxygen, and able to walk and swallow liquids, and at the end of the treatment an excellent radiological response was noted. At the time this report was written, the patient was receiving adjuvant chemotherapy. We had taken a written informed consent from the patient. We have ethical committee approval.

Discussion EMP is a soft tissue plasma cell tumor occurring in the absence of systemic signs of multiple myeloma, such as a bone osteolytic lesion, plasma cell infiltration in bone marrow, a lytic bone lesion, and serum or urine myeloma proteins [1]. A historical review [2] of 700 patients showed that there was head and neck involvement in 80%-90%, especially in the aerodigestive tract. Case reports of involvement of the liver, pancreas, lungs, skin, and thyroid gland do exist. It is most unusual for this tumor to present in the mediastinum as a primary solitary lesion. To date, only 12 cases of EMP involving the mediastinum have been reported in the English language literature; mean age at presentation was 55

years. Presentation (Table 1) included a mediastinum mass associated with intralobar effusion [3], pulmonary nodules [4], multiple myeloma [5,6], and mimicking hemangioma [7]; however, the presented case is unusual, as it involved a solitary anterior mediastinal mass that presented with grade 4 dyspnea, and responded quickly during the course of treatment. The plasmacytoma in the presented case was aggressive, which was evident by increased contrast uptake observed with PET, in contrast to the lack of increased uptake in indolent plasmacytoma. The presented case also highlights the clinical usefulness of PET/CT in imaging plasmacytomas, as suggested by Masood et al. [5].

Pathologically proven pleural effusion is an occasional finding in patients with multiple myeloma, which occurs in approximately 6% of patients [8].

The cause of pleural effusion in the presented case was not clear and as it was reactive, lymphatic drainage obstruction caused by the mediastinal mass might have been responsible.

Plasma cell neoplasms are relatively sensitive to radiotherapy; however, a review of the literature by Alexiou et al. [2] reported that combined therapy (surgery and radiotherapy) results in better overall and recurrence-free survival (p=0.027). Nonetheless, these results span the greater part of a century (19051997) and radiotherapy techniques have changed

Table 1. Published reports of mediastinal mass Serial no

Author

Presentation

Treatment

Follow-up

1

Divis and Sikl (1928)

Anterior mediastinum

Resection

Alive at 3 months

2

Bross (1931)

Posterior mediastinum

Resection

Necropsy report

3

Snapper (1953)

Mediastinum and lung with MM

Radiotherapy

Necropsy report

4

Niwa1 (1987)

Superior mediastinum

-

-

5

Miyazaki (1992)

Anterior mediastinum +lobar effusion

No treatment

Alive at 2 years

6 Moran (1995) Anterior mediastinum Chemotherapy

Posterior mediastinum Surgery

6 months 2 years (developed multiple myeloma)

7

Ahmed (2000)

Posterior mediastinum

Surgery

Nor available

8 Nandekar (2000)

Middle mediastinum mimics hemangioma with MM

Chemotherapy

Alive at 2 years

9

Yamaguchi (2005)

Anterior mediastinum

Radiotherapy

Alive

10

Lee (2005)

Posterior mediastinum

Radiotherapy

Alive at 6 months

11

Ashiq (2008)

Posterior mediastinum with MM

Chemotherapy

Not available

Anterior mediastinum + pleural nodules + pleural effusions with MM

Chemotherapy

Not available

12 Hyemin (2010)

Shukla et al.

Mediastinal plasmacytoma

Turk J Hematol 2011; 28: 228-31

during that time. Currently, radiotherapy is the treatment of choice for solitary plasmacytoma and the dose of 40-50 Gy (depending on tumor size) is delivered over 4-6 weeks. It is associated with a <5% risk of local recurrence and most carefully staged patients with solitary EMP can be cured [9, 10]. There is no published evidence for the role of adjuvant chemotherapy in the treatment of solitary extramedullary plasmacytoma Tsang et al. [11] and Holland et al.

[12] suggest that tumours >5 cm are associated with a high risk of failure, which was a rationale for proposing chemotherapy to the presented patient.

Though 5% of patients have coexistent multiple myeloma [11], our literature review suggests 30% involvement in mediastinal EMP. This indicates that plasmacytoma involving the mediastinum provides an early hint to the diagnosis of occult multiple myeloma and should be included in the differential diagnosis of mediastinal masses. Thusly, after the diagnosis of plasmacytoma, aggressive investigation for multiple myeloma is vital, as such patients can be candidates for adjuvant chemotherapy.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

Soesan M, Paccagnella A, Chiarion-Sileni V, Salvagno L, Fornasiero A,Sotti G, Zorat P-L, Favaretto A, Fiorentino M. Extramedullary plasmacytoma: Clinical behaviour and response to treatment. Ann Oncol 1992;3:51-7.

2.

231

Alexiou C, Kau RJ, Dietzfelbinger H, Kremer M, Spiess JC, SchratzenstallerB, Arnold W. Extra medullary plasmacytoma: tumor occurrence and therapeutic concepts. Cancer 1999;85:2305-14.

3. Ji Hye Min, Tae Sung Kim, Young-Hyeh Ko, Ki-Hyun Kim. A Case of Mediastinal Extramedullary Plasmacytoma associated with multiple myeloma. J Korean Soc Radiol 2010;62:365-8.

4. Herskovic T, Andersen HA, Bayrd ED. Intrathoratic plasmacytomas: Presentation of 21 cases and review of literature. Dis Chest 1965;47:1.

5. Masood A, Hudhud KH, Hegazi A, Syed G. Mediastinal plasmacytoma with multiple myeloma presenting as a diagnostic dilemma..Cases J. 2008;21:116.

6. Moran CA, Suster S, Fishback NF, Koss MN. Extramedullary plasmacytomas presenting as mediastinal masses: clinicopathologic study of two cases preceding the onset of multiple myeloma..Mod Pathol 1995;8:257.

7. Nandedkar MA, Abbondanzo SL, Miettinen M. Extramedullary manifestation of multiple myeloma (systemic plasmacytoma) that simulates hemangioma.

Arch Pathol Lab Med 2000;124:628-31.

8. Pacheco A, Perpiùå A, Escribano L, Sanz I, Bellas C. Pleural effusion as first sign of extramedullary plasmacytoma.Chest. 1992;102:296-7.

9. Liebross RH, Ha CS, Cox JD,. Solitary bone plasmacytoma: outcome and prognostic factors following radiotherapy. Int J Radiat Oncol Biol Phys 1998;41:1063-7.

10. Liebross RH, Ha CS, Cox JD. Clinical course of solitary extramedullary plasmacytoma. Radiother Oncol. Sep 1999;52:245-9.

11. Tsang, R.W., Gospodarowicz, M.K., Pintilie, M., Bezjak, A., Wells, W.,Hodgson, D.C. & Stewart.Solitary plasmacytoma treated with radiotherapy: impact of tumour size on outcome. International Journal of Radiation Oncology, Biology, Physics 2001;50,113-20.

12. Holland J, Trenkner DA, Wasserman TH, Fineberg B. Plasmacytoma. Treatment results and conversion to myeloma.Cancer. 1992;15;69:1513-7.

232

Case Report

Non-Hodgkin's lymphoma in a chronic myelocytic leukemia patient treated with imatinib İmatinib alan bir kronik miyeloid lösemi olgusunda gelişen non-Hodgkin lenfoma Semra Paydaş1, Berna Bozkurt Duman1, Melek Ergin2 1Department 2Department

of Oncology, Faculty of Medicine, Çukurova University, Adana, Turkey of Pathology, Faculty of Medicine, Çukurova University, Adana, Turkey

Abstract Imatinib is an important example of tyrosine kinase inhibitors (TKIs) used in clinical practice. Imatinib blocks the ATP binding site of the Bcr-Abl fusion protein and selectively inhibits Bcr-Abl tyrosine kinase (TK) activity. Treatment of chronic myelocytic leukemia (CML) with imatinib is encouraging and it has an acceptable toxicity profile, and as such has changed the management of CML during the last decade. As with all drugs used in clinical practice, side effects of imatinib have been reported in studies with extended follow-up periods. In addition, some neoplastic disorders have been reported to occur during imatinib therapy. Herein we present a CML case that developed non-Hodgkin’s lymphoma (NHL) while receiving imatinib treatment. (Turk J Hematol 2011; 28: 232-4) Key words: Imatinib, chronic myelocytic leukemia, non-Hodgkin’s lymphoma Received: July 04, 2009

Accepted: March 22, 2010

Özet İmatinib klinikte kullanılan tirozin kinaz (TK) inhibitörlerinin önemli bir örneğidir. Bcr Abl füzyon proteininin ATP bağlayan bölgesini bloke eder ve selektif olarak TK aktivitesini bloke eder. Kronik miyeloid lösemide (KML) imatinib'e yanıt heyecan vericidir ve kabul edilebilir toksisite profiline sahiptir. Bu özellikleri ile son on yılda KML yönetimini değiştirmiştir. Klinikte kullanılan her ilaçta olduğu gibi bazı yan etkiler uzun süreli takipte rapor edilmektedir. Diğer yan etkilerine ek olarak, imatinib tedavisi sırasında bazı neoplastik bozukluklar yayımlanmıştır. Burada KML nedeniyle imatinib almakta iken non-Hodgkin lenfoma (NHL) gelişen bir olgu sunulmuştur.

(Turk J Hematol 2011; 28: 232-4)

Anahtar kelimeler: İmatinib, kronik miyeloid lösemi, non-Hodgkin lenfoma Geliş tarihi: 04 Temmuz 2009

Kabul tarihi: 22 Mart 2010

Address for Correspondence: Prof. Semra Paydaş, Department of Oncology, Faculty of Medicine, Çukurova University, 01330 Adana, Turkey Phone: +90 322 338 60 60-3142 E-mail: sepay@cu.edu.tr doi:10.5152/tjh.2011.60

Paydaş et al.

Imatinib and secondary neoplasia

Turk J Hematol 2011; 28: 232-4

Case A 49-year-old man that was diagnosed with chronic myelocytic leukemia (CML) 14 months earlier presented to our unit with the diagnosis of nonHodgkin’s lymphoma (NHL). He had been treated with imatinib for 13 months and complete hematologic response was achieved within 1 month.

Cytogenetic remission was noted at the 6th month of the therapy. One month before presenting to our hospital he was in complete molecular remission and experienced abdominal pain. Imatinib was withdrawn at that time. CT scans showed jejunal wall pathology and dilatation. Due to abdominal pain and distention, exploratory surgery was performed, including partial small bowel resection + side-toside anastomosis and feeding jejunostomy. Following that surgery he was referred to our unit. Written informed consent was obtained from the patient.

Physical examination showed pallor, the incision from abdominal surgery, and the jejunal feeding tube. There was no evidence of organomegaly.

Laboratory test results were as follows: Hb: 11.2 g/ dL; total protein/albumin: 7.9/3.7 g/dL; LDH: 475 IU. CT scans of the thorax, abdomen, and pelvis showed small subpleural nodules in both lungs and jejunal wall thickening. The radiology department reported these lesions as leukemic infiltration.

A small bowel biopsy specimen obtained during surgery was reported as diffuse large B-cell lymphoma (DLBCL). The specimen showed diffuse infiltration by atypical large cells. The cells had a high N:C ratio and clumped chromatin (Figure 1).

Immunohistochemical analysis showed that the tumor was positive for LCA and CD20, and was negative for myeloperoxidase, cytokeratin, and CD3.

CD79a, bcl-2, bcl-6, and Ki-67 analyses were not performed due to the obvious DLBCL histopathology.

The bowel biopsy specimen was also examined for Bcr-Abl and there was no evidence of its expression. Bone marrow biopsy was negative for lymphomatous infiltration. Systemic staging showed no other evidence of lymphomatous infiltration. The patient was treated with 6 cycles of R-CHOP chemotherapy and complete remission was achieved.

After DLBCL therapy, imatinib was re-started; molecular remission was achieved and at the time this paper was written the patient was receiving standard imatinib treatment.

233

Discussion Imatinib is an important choice of treatment in cases with CML and its clinical use is increasing in daily practice due to its efficaciousness; however, this drug has some side effects, as do other drugs.

The most frequently affects the skin, liver, and bone marrow. Although very rare, some secondary neoplasms during imatinib therapy have been reported.

Rapid CML-blastic crisis (CML-BC) has been reported in a few patients that received imatinib [1]. MDS and AML have also been reported in some patients during or following imatinib treatment [2-5]. The precise incidence of these secondary events is not known; in a large study, only 3 cases with secondary neoplasia among 1701 CML cases treated with imatinib were reported [4]. Other neoplasias associated with imatinib treatment are squamous cell cancer and multiple myeloma [6,7].

Two cases of Epstein-Barr virus (EBV)-related lymphoproliferative disease (LPD) have been reported to date. The first case of EBV (+) cutaneous B-cell LPD was published in 2003. In that case a rapidly progressing ulcerating tumor on the head developed; interestingly, spontaneous resolution of the tumor occurred after lowering the dose of imatinib from 500 to 400 mg/d [8]. In the second case LPD occurred after 30 months of imatinib treatment. Pancytopenia, fever, night sweats, and DIC were the first manifestations of the lymphoma while the first to occur while the patient was in complete molecular remission.

Bone marrow biopsy showed EBV (+) LPD; however, the tumor did not resolve after discontinuation of imatinib therapy [9].

Figure 1. Lymphoma infiltration in the small bowel (H&E, 200×)

234

PaydaĹ&#x; et al.

Imatinib and secondary neoplasia

In the presented case the first symptom was abdominal pain. Repeated radiographic examinations showed jejunal thickening and the patient underwent exploratory surgery due to severe abdominal pain and subileus. It is well known that masses or nodules that develop in CML patients are indicative of a granulocytic sarcoma evidence of disease progression [10]. Upon presentation to the surgery department, the presented case was first diagnosed as leukemic infiltration; however, jejunal biopsy showed lymphoma. It is well known that granulocytic sarcoma histopathologically resembles NHL. The clinical working diagnosis of the presented case was leukemic infiltration-granulocytic sarcoma due to the accelerated/blastic phase of CML; however, histopathological findings were compatible with DLBCL. Myeloperoxidase was performed to exclude granulocytic sarcoma and the reaction was negative, as was Bcr-Abl. Although the cooccurrence of CML and DLBCL in the presented case cannot be ruled out, there were no symptoms indicative of small bowel disease at the beginning, and the abdominal symptoms and signs developed after 13 months of imatinib therapy. As such, to the best of our knowledge this is the first reported case of DLBCL in a CML patient treated with imatinib.

The etiology of secondary neoplasias in patients treated with imatinib is not known. In vitro studies have shown that imatinib inhibits the proliferation and activation of T-cells, and significantly reduces the antigen-triggered exposure of CD8 (+) T-cells in response to immunodominant CMV and EBV peptides [11]. One vitro study reported centrosome and chromosome aberrations in fibroblast cultures in association with varying concentrations of imatinib.

These observations suggest a causative role for imatinib in clonal chromosomal aberrations in Bcr-Abl (-) progenitor cells [12]. In conclusion, although rare, secondary neoplastic disorders, including NHL, may be seen during imatinib treatment.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2011; 28: 232-4

References 1.

Miyazaki K, Kon S, Watanabe T, Togano T, Ohsaka M, Suzuki Y, Danbara M, Horie R, Kanda Y, Maruta A, Higashihara M. Early blastic transformation within a year of imatinib treatment in 2 cases of chronic myeloid leukemia. Rinsho Ketsueki. 2007;48:297-304.

2. Andersen MK, Pedersen-Bjergaard J, Kjedsen L, Dufva IH, Brondum K. Clonal Ph-negative hematopoiesis in CML after therapy with imatinib mesylate is frequently characterized by trisomy 8. Leukemia 2002;16:1390-5.

3. Chee YL, Vickers MA, Stevenson D, H olyoake TL, Culligan DJ. Fatal myelodysplastic syndrome developing during therapy with imatinib mesylate and characterised by the emergence of complex Philadelphia negative clones. Leukemia 2003;17:634-5.

4. Kovitz C, Kantarjian H, Garcia-Manero G, Abruzzo LV, Cortes J. Myelodysplastic syndromes and acute leukemia developing after imatinib mesylate therapy for chronic myelocytic leukemia. Blood 2006;108:2811-3.

5. Ross DM, Jackson SR, Browett PJ. Phialdelphia-negative secondary acute myeloid leukaemia during imatinib treatment for chronic phase myelocytic leukaemia.

Leuk Lymphoma 2007;48:1231-3.

6. Baskaynak G, Kreuzer KA, Schwarz M, Zuber J, Audring H, Riess H, DĂśrken B, Coutre P. Squamous cutaneous epithelial cell carcinoma in two CML patients with progressive disease under imatinib treatment. Eur J Haematol. 2003;70:231-4.

7. Garipidou V, Vakalopoulou S, Tzimalos K. Development of multiple myeloma in a patient with chronic myelocytic leukemia after treatment with imatinib mesylate.

Oncologist 2005;10:457-8.

8. Bekkenk MW, Vermeer MH, Meijer C, Jansen P, Middeldorp J, Stevens S, ReinWillemze. EBV-positive cutaneous B-cell lymphoproliferative disease after imatinib mesylate. Blood 2003;102:4243.

9. Leguay T, Foucaud C, Parrens M, Fitoussi O, Bouabdallah K, Belaud-Rotureau MA, Tabrizi R, Marit G, Pigneux A, Milpie N. EBV-positive lymphoproliferative disease with medullary, splenic and hepatic infiltration after imatinib mesylate therapy for chronic myeloid leukemia.

Leukemia 2007;1-3.

10. Paydas S, Zorludemir S, Ergin M. Granulocytic sarcoma: 32 cases and review of the literature. Leuk Lymphoma 2006;47:2527-41.

11. Seggewiss R, Lore K, Greiner E, Magnusson MK, Price DA, Douek DC, Dunbar CE, Wiestner A. Imatinib inhibits T-cell receptor-mediated T-cell proliferation and activation in a dose-dependent manner. Blood 2005;105:2473-9.

12. Fabarius A, Giehl M, Frank O, Hochhaus A, Hehlmann R, Seifarth W. Induction of centrosome aberrations by imatinib in vitro. Leukemia 2005;1-6.

Letter to the Editor

235

The incidence of alpha-thalassemia in Iraqi Turks Irak Türklerinde alfa-talasemi sıklığı Arjan Esmael, Ayşenur Öztürk, Nejat Akar Department of Pediatric Genetics, Faculty of Medicine, Ankara University, Ankara, Turkey

To the Editor Thalassemias are characterized by impaired quantitative synthesis of globin chains. Several mutations have been identified in patients with thalassemia, which are usually in alpha- or beta-globin genes. Alpha-thalassemia commonly occurs in Southeast Asian, Mediterranean, and Middle Eastern populations [1]. The gene responsible for the alphaglobin chain is located on the short arm of chromosome 16 (16p13.3) and consists 2 zeta, 2 pseudoalpha, and 2 alpha genes (α1 and α2) [2]. Each of the homologous chromosomes has 2 alpha genes; thus, there are 4 functional alpha genes in total.

Molecular defects in alpha-thalassemia are usually gene deletions. Deletions of 1, 2, 3, or all 4 of the alpha genes may occur, and the severity of disease is directly proportional to the number of affected alpha genes. The most common of these are -α3.7 and -α4.2 single alpha-globin gene deletions, and --MED and -α20.5 double gene deletions, which are widespread in the Mediterranean region [3].

The most common genotypes reported in the Dohuk region of Iraq were -α3.7/αα, --MED/αα, and -α3.7/-α3.7, which were observed in 84.3% of patients [4]. Another study reported that -α3.7 and --MED deletions were common mutations [5]. Additionally, -α3.7 deletion and alpha-globin triplication anti-3.7

kb type were observed in an Iraqi family with betathalassemia [6]. Nonetheless, there are no data on the frequency of alpha-thalassemia gene deletions in Iraqi Turks. As such, the present study aimed to determine the molecular characterization of the alpha-thalassemia gene in healthy Iraqi Turks, in terms of -α3.7, -α4.2, --MED, and -α20.5 deletions.

Iraqi Turkmens are the descendants of the Oghuz Turks that originated from Central Asia, an ethnic group that now primarily lives in northern Iraq. The study group included 83 unrelated individuals from northern Iraq: 39 from Kirkuk, 20 from Mosul, 10 from Arbil, 10 from Baghdad, and 4 from the Diala and Tikrit regions. After all the participants provided informed consent blood samples were collected into tubes containing EDTA, and then DNA was extracted from peripheral blood leukocytes using the phenol-chloroform method. Multiplex polymerase chain reaction (PCR) was performed for mutation analysis, as previously described [7,8].

In all, 8 of the 83 participants were diagnosed with alpha-thalassemia an incidence rate of 9.6%.

Multiplex PCR analysis of the 83 blood samples showed that the incidence of alpha-thalassemia, particularly 3.7 kb deletion, was high in the Iraqi Turk study population. In total, 3 alpha-globin genotypes were identified; the incidence of -α3.7/αα, -α3.7/-α3.7, and -α3.7/-α4.2 was 6.0%, 1.2%, and 2.4%,

Address for Correspondence: Prof. Nejat Akar, Koru Mah 2621. Sok., Uyum Sitesi 18, Çayyolu, Ankara, Turkey Phone: +90 312 241 39 80 E-mail: akar@medicine.ankara.edu.tr doi:10.5152/tjh.2011.61

236

Esmael et al.

Alpha-thalassemia in Iraqi Turks

respectively, whereas --MED and -α20.5 deletions were not observed in the study group.

The frequency of alpha-thalassemia was 3.6% among Turkish newborns in a study that employed globin gene mapping analysis of DNA [9].

Additionally, the alpha-thalassemia trait was observed in 0.63% of participants in a study conducted in the Antalya region of Turkey [10]. The incidence of alpha-thalassemia was much higher in the Iraqi Turks in the present study than that reported in studies from Turkey; the difference could be due to geographic and ethnic differences.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

Sengchanh S, Sanguansermsri T, Horst D, Horst J, Flatz G: High frequency of alphathalassemia in the So ethnic group of South Laos. Acta Haematol 2005;114:164-6.

Deisseroth A, Nienhuis A, Turner P, Velez R, Anderson WF, Ruddle F, Lawrence J, Creagan R, Kucherlapati R. Localization of the human α-globin structural gene to chromosome 16 in somatic cell hybrids by molecular hybridization assay. Cell 1977;12:205-18.

Turk J Hematol 2011; 28: 235-6

3.

Kattamis AC, Camaschella C, Sivera P, Surrey S, Fortina P. Human alpha-thalassemia syndromes: detection of molecular defects. Am J Hematol 1996;53:81-91.

4. Al-Allawi NA, Badi AI, Imanian H, Nikzat N, Jubrael JM, Najmabadi H. Molecular characterization of alpha-thalassemia in the Dohuk region of Iraq. Hemoglobin 2009;33:37-44.

5. Al-Allawi NA, Shamdeen MY, Rasheed NS. Homozygosity for the Mediterranean a-thalassemic deletion (hemoglobin Barts hydrops fetalis). Ann Saudi Med. 2010;30:153-5.

6. Deutsch S, Darbellay R, Offord R, Frutiger A, Kister J, Wajcman H, Beris P. Hb Iraq-Halabja beta10 (A7) Ala->Val (GCC-->GTC): a new beta-chain silent variant in a family with multiple Hb disorders. Am J Hematol.

1999;61:187-93.

7. Oron-Karni V, Filon D, Oppenheim A, Rund D. Rapid detection of the common Mediterranean alpha-globin deletions/rearrangements using PCR. Am J Hematol 1998;58:306-10.

8. Tan AS, Quah TC, Low PS, Chong SS. A rapid and reliable 7-deletion multiplex polymerase chain reaction assay for alpha-thalassemia. Blood. 2001;98:250-1.

9. Fei YJ, Kutlar F, Harris HF, Wilson MM, Milana A, Sciacca P, Schiliro G, Masala B, Manca L, Altay C, Gurgey A, Ma de Pablos J, Villegas A, Huisman THJ. A search for anomalies in the zeta, alpha, beta, and gamma globin gene arrangements in normal black, Italian, Turkish, and Spanish newborns. Hemoglobin. 1989;13:45-65.

10. Canatan D, Oğuz N, Güvendik İ, Yıldırım S. The Incidence of Alpha-Thalassemia in Antalya-Turkey. Turk J Haematol 2002;19:433-4.

Letter to the Editor

237

Non-Hodgkin’s lymphoma in a hemophilic patient with a traumatic hematoma Travmatik hematomu olan hemofilik hastada non-Hodgkin lenfoma Nihal Özdemir1, Ayşe Yurt1, Emine Türkan2, Tiraje Celkan1 1Department 2Department

of Pediatric Hematology, Cerrahpaşa Faculty of Medicine, İstanbul University, İstanbul, Turkey of Pediatric Hematology Oncology, Okmeydanı State Hospital, İstanbul, Turkey

To the editor, Hemophilia A, the most common severe inherited bleeding disorder, is characterized by FVIII deficiency.

The use of recombinant FVIII products and improved purity of plasma-derived concentrates have decreased the risk of HIV, and hepatitis B and C virus transmission in patients with hemophilia. Malignancies reported in hemophilic patients are usually associated with HIV, and hepatitis B and C infection. The incidence of non-infection-related malignancy is not known due to the limited quantity of data in the literature [1].

Herein we report a boy with hemophilia A that was followed-up with the initial diagnosis of a neck hematoma; examination of a subsequent excisional biopsy specimen resulted in the diagnosis of nonHodgkin’s lymphoma (NHL).

A 12-year-old boy with mild hemophilia A (FVIII coagulant activity 7%; vWF Ag: 78%; Ricof: 72%) had been followed-up at another center since he was 5 years old. Six months before presentation at our institution the patient had a tooth extracted and developed a mass in the neck. Initially, a muscle hematoma was suspected. As the mass enlarged, needle aspiration was performed, and the result

showed reactive hyperplasia. The patient was referred to our clinic for further investigation.

The patient did not have symptoms suggesting lymphoma or any other malignancy. Physical examination was normal, except for a 2×1.5-cm soft mass in the neck. Full blood count, peripheral blood smear, sedimentation rate (7 mm/h), and lactate dehydrogenase (LDH: 184 IU/L) were normal.

Cervical magnetic resonance imaging (MRI) showed a heterogenous solid mass between the submandibular gland and sternocleidomastoid muscle.

Thoracic and abdominal computed tomography (CT) results were normal. Positron emission tomography (PET) showed hypermetabolic lymphadenopathies in the left inferior cervical and supraclavicular fossa. Excisional biopsy under factor replacement showed T cell-rich diffuse B cell NHL. There was no bone marrow or cerebrospinal fluid involvement, and he was classified as stage 2 NHL. Viral serology, including HIV, and hepatitis B and C viruses was negative. The patient was treated according to the BFM-NHL 95 protocol and did not have any severe bleeding episodes during chemotherapy. Moreover, no complications occurred during cerebrospinal fluid tap or bone marrow aspiration/biopsy.

Address for Correspondence: Dr. Nihal Özdemir, Department of Pediatric Hematology, Cerrahpaşa Faculty of Medicine, İstanbul University, İstanbul, Turkey Phone: +90 212 414 30 00 E-mail: gnozdemir@hotmail.com doi:10.5152/tjh.2011.62

238

Özdemir et al.

Hemophilia and non-Hodgkin’s lymphoma

Cerebrospinal fluid tap was performed 4 times by an experienced hematologist every time, and FVIII infusion and fresh frozen plasma were not administered. At the end of therapy, PET-CT was normal and the patient has been in remission for 1 year, as of the time this report was written.

Most malignancies in hemophilic patients are related to HIV and hepatitis infections due to contaminated blood products. Walker and Julian analyzed the cause of death in Canadians with hemophilia between 1980 and 1995, and reported a marked increase in deaths from liver cancer and lymphoma in patients with HCV or HIV infections, as compared to the general population [2]. A study performed in the UK between 1978 and 1999 with a hemophilic population reported 67 NHL cases in HIV-positive patients [3], whereas the incidence was much lower in HIV-negative individuals only 9 cases. The number of cases of NHL among HIVnegative hemophilic patients was equal to the number of cases expected in the general population.

There are also reports of HIV-negative patients with Hodgkin’s lymphoma [4,5].

Hemophilia may influence the clinical presentation and diagnostic evaluation of malignancies. As the presented case had hemophilia and a history of trauma, there was a delay in the diagnosis of lymphoma. A similar case with severe hemophilia and Hodgkin’s disease also highlights the importance of clinical awareness when the signs and symptoms of a presumed hematoma do not resolve with time [5].

There are also case reports of patients with hemophilia that were eventually diagnosed with soft tissue sarcomas that mimicked pseudotumors [6].

Another important issue is the difficulty in treatment caused by the coexistence of bleeding diathesis and malignancy. Specific clinical problems may emerge during chemotherapy in patients with hemophilia and cancer, which may be challenging for physicians. The inherent tendency for bleeding may increase the probability of bleeding due to thrombocytopenia caused by chemotherapy.

Invasive procedures, such as bone marrow biopsy or catheter replacement, may require factor replacement. Chemotherapy-induced cytopenia, mucosal toxicity, and hemostatic disturbances may be more problematic than expected. There are only few case reports on the management of leukemia in hemophilic patients [7-9]. A study of 2 patients by Zulfikar reported the existence of social and psychological

Turk J Hematol 2011; 28: 237-8

burden associated with the coexistence of 2 difficult diseases, such as acute leukemia and severe hemophilia, among patients and families [7]. Based on our experience managing such cases, we recommend regular and adequate factor replacement in order to minimize the risk of bleeding during treatment. As the presented case had mild hemophilia, there were no major problems during his treatment.

In conclusion, the management of cancer in hemophilic patients is challenging. Consideration of probable malignancy in the differential diagnosis of patients with hemophilia and posttraumatic hematoma is critical. Additional research on the management of hemophilic patients with cancer may result in improved treatment options. Written informed consent was obtained from the patient.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

Dunn AL. Malignancy in patients with hemophilia: a review of the literature. Hemophilia 2010;16:427-36.

Walker IR, Julian JA. Causes of death in Canadians with hemophilia 1980-1995. Association of Hemophilia Clinic Directors of Canada. Hemophilia 1998;4:714-20.

Wilde JT, Lee CA, Darby SC, Kan SW, Giangrande P, Phillips AN, Winter M, Spooner R, Ludlam CA; UK Haemophilia Centre Doctors' Organisation. The incidence of lymphoma in the UK hemophilia population between 1978 and 1999. AIDS 2002;16:1803-7.

Koç A, Varan A, Büyükpamukçu M, Gürgey A. A case of hemophilia A associated with Hodgkin's disease. Turk J Pediatr 1999;41:517-20.

Smith R, Marson B, Smith M, Rangarajan S. Incidental finding of Hodgkin's disease following initial presentation with traumatic haematoma in the thoracic inlet.

Hemophilia 2008;14:610-2.

Connor P, Cheung B, Rangarajan S. Malignant sarcoma masquerading as a pseudotumour in a patient with mild hemophilia. Br J Haematol 2003;123:191.

Zulfikar B. Two patients with hemophilia and acute leukaemia. Hemophilia 2002;8:698-702.

Altay C, Hicsonmez G, Zamani VP, Sagin G, Tuncer M, Ozsoylu S. Acute leukemia in two patients with hemophilia. Cancer 1985;55:510-1.

Clark C, Gidvani VK. Acute myelogenous leukemia in a patient with a severe factor IX deficiency. Pediatr Blood and Cancer 2011;56:156-7.

Letter to the Editor

239

A chronic eosinophilic leukemia patient presenting with blurred vision Bulanık görmeyle başvuran kronik eozinofilik lösemi hastası Demircan Özbalcı1, Ülkü Ergene1, Harun Yazgan2 1Department 2Department

of Hematology, Faculty of Medicine, Celal Bayar University, Manisa, Turkey of Internal Medicine, Faculty of Medicine, Celal Bayar University, Manisa, Turkey

Chronic eosinophilic leukemia (CEL), a rare entity, is classified by the WHO as 2 groups of patients with neoplastic eosinophils: those that have a myeloid or lymphoid neoplasm with eosinophilia, and abnormalities in PDGFRA, PDGFRB, or FGFR1 genes, and those integrated in a subchapter as MPN that have chronic eosinophilic leukemia, not otherwise specified [1-3]. Hepatosplenomegaly, eosinophilia with systemic disturbances, anemia, thrombocytopenia, and in particular cardiac involvement are major components of the disease [4].

A 32-year-old male that had previously been healthy presented to our clinic with fatigue, blurred vision, non-productive cough, and sore throat that began 10 d earlier. Physical examination showed splenomegaly 10 cm below the costal margin, and segmentation and dilatation of capillaries around the optic disc. His hemogram results were as follows: Hg: 9.2 g/dL, WBC: 50,000/μL; Plt count: 98,000/μL; eosinophils: 21,100/μL. Peripheral blood smear showed 62% eosinophils. Bone marrow aspiration showed <50% myeloid cells that were eosinophils and ≤3% blasts.

Fluorescent in situ hybridization analysis of t(9; 22) was negative. Tests for BCR-ABL and FIP1L1-

PDGFRA rearrangement with real time PCR were performed. Parasite tests for eosinophilia were negative. Hypotensive attacks with dynamic electrocardiographic changes were observed and methylprednisolone 1 mg/kg/d was initiated following observation of pericardial effusion. The effusion resolved, but despite steroid therapy his eosinophil count did not change as expected, and red blood cell and thrombocyte transfusions were required during follow-up. BCR-ABL rearrangement was negative and FIPL1-PDGFRA rearrangement of RNA was observed; therefore, imatinib 100 mg/d was initiated and steroid therapy was immediately withdrawn. His clinical condition quickly improved, eosinophilia disappeared, vision improved, and he was transfusion free. The patient was discharged in good health and during his last outpatient follow-up his Hg was 12.3 g/dL, WBC was 5600/μL, Plt count was 148,000/μL, and eosinophils was 0.4%.

CEL, once a disease with a poor prognosis, is now a manageable disease associated with a good quality of life using tyrosine kinase inhibitors. The FIP1L1-PDGFRA fusion gene was reported to be 50-fold more sensitive to the tyrosine kinase inhibitor imatinib [5] than BCR-ABL, and as such low-

Address for Correspondence: Dr. Demircan Özbalcı, Department of Hematology, Faculty of Medicine, Celal Bayar University, Manisa, Turkey Phone: +90 236 233 07 25 E-mail: demircan.ozbalci@bayar.edu.tr doi:10.5152/tjh.2011.63

240

Ă&#x2013;zbalcÄą et al.

Chronic eosinophilic leukemia with blurred vision

dose (100 mg/d) imatinib rapidly achieves hematologic and molecular response. The presented case was transfusion-dependent and had vision loss attributed to eosinophilia; however, following initiation of imatinib therapy his clinical and hematologic condition quickly improved.

We had obtained written informed consent from the patient.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

Valent P. Pathogenesis, classification and therapy of eosinophilia and eosinophil disorders. Blood Reviews 2009;23:157-65.

Bain B, Gilliland DG, Vardiman JW, Horny HP. Chronic eosinophilic leukaemia, not otherwise specified. In:

Turk J Hematol 2011; 28: 239-40

3.

4.

5.

Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J, Vardiman JW, editors. WHO classification of tumours of haematopoietic and lymphoid tissues, vol. 2. Geneva (Switzerland) and Albany (NY, USA): WHO Press; 2008;51-3.

Bain B, Gilliland DG, Horny HP, Vardiman JW. Myeloid and lymphoid neoplasms with eosinophilia and abnormalities of PDGFRA, PDGFRB, orFGFR1. In: Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J, Vardiman JW, editors. WHO classification of tumours of haematopoietic and lymphoid tissues, vol.

2. Geneva (Switzerland) and Albany (NY, USA): WHO Press; 2008;68-73.

Sheikh J, Weller FW. Advances in diagnosis and treatment of eosinophilia. Current Opinion in Hematology 2009;16:3-8.

Cools J, DeAngelo DJ, Gotlib J, Stover EH, Legare RD, Cortes J, Kutok J, Clark J, Galinsky I, Griffin JD, Cross NC, Tefferi A, Malone J, Alam R, Schrier SL, Schmid J, Rose M, Vandenberghe P, Verhoef G, Boogaerts M, Wlodarska I, Kantarjian H, Marynen P, Coutre SE, Stone R, Gilliland DG. A tyrosine kinase created by fusion of the PDGFRA and FIP1L1 genes as a therapeutic target of imatinib in idiopathic hypereosinophilic syndrome.

N Engl J Med 2003;348:1201-14.

Letter to the Editor

241

The frequency of FV G1691A and PT G20210A mutations in an Albanian population Arnavut popülasyonunda FV G1691A ve PT G20210A mutasyonu sıklığı A. Avni Atay1, Mustafa Tekin2, Klodian Allajalebeu2, Yonca Eğin2, Nejat Akar2 1Department 2Department

of Pediatric Hematology, Gülhane Military Medical Academy, Ankara, Turkey of Pediatric Molecular Genetics, Faculty of Medicine, Ankara University, Ankara, Turkey

To the Editor Venous thrombosis can be the result of various acquired and genetic factors. Several alterations in the genetics of hemostatic factors that contribute to thrombosis have been described [1]. Inherited anticoagulant protein deficiency-related hypercoagulability is responsible for 5%-10% of all cases of venous thromboembolism (VTE) [2]. An important recognized inherited cause of VTE is resistance to activated protein C (APC), which is mostly due to a single point mutation in the blood coagulation factor V gene (G1691A) [3].

Furthermore, a genetic factor that increases the risk of VTE G20210A variation in the prothrombin gene associated with elevated plasma prothrombin level has been described [4].

These 2 genetic prothrombotic factors have heterogeneous geographic distribution patterns. Factor V Leiden and prothrombin G20210A mutation allele frequencies in Europeans are been reported to be 1.4%-7.0% and 3.0%, respectively [5,6]. There may be important differences in the allelic frequency of these mutations in different European populations, and they may exhibit regional variations in Europe

[7-10]. The aim of the present study was to determine the frequency of factor V Leiden and prothrombin G20210A mutations in an Albanian population. Such data may help elucidate the ethnic and/ or geographic differences in the incidence of thrombotic diseases.

We assessed the genetic frequency of the 2 thrombotic risk polymorphisms in a group of 225 randomly selected healthy Albanians, which included a mixture of all cultural groups in Albania, according to a previously reported method [11]. Blood samples were collected at a referral center that serviced people from different regions of Albania. The control group was in Hardy-Weinberg equilibrium.

The participants were not chosen from any specific population. The additional members of the same family and those with a family history of any kind of thrombosis were excluded. Written informed consent was obtained from every participant.

Factor V Leiden and prothrombin G20210A prothrombotic alleles are inherited prothrombotic mutations with population-dependent frequencies.

Differences in geographic distribution primarily account for regional variation in the incidence of thromboembolism [11]. The high incidence rate in

Address for Correspondence: Assoc. Prof. A. Avni Atay, Özel Gaziosmanpaşa Hastanesi, Çukurçeşme Caddesi No: 51 Gaziosmanpaşa 34245 İstanbul, Turkey Phone: +90 212 615 38 38 E-mail: avniatay@yahoo.com doi:10.5152/tjh.2011.64

242

Atay et al.

The frequency of FVL and PT in Albania

Turk J Hematol 2011; 28: 241-2

References

Table 1. The prevalence of Factor V Leiden and prothrombin G20210A mutations in an Albanian population

Total

n

%

Frequency

F V 1691A

225

4

1.8

4/450 (0.009)

PT 20210A

225

7

3.1

7/450 (0.016)

Europeans, as a risk factor for thromboembolic diseases, suggests that screening populations for this mutation is of great importance. The distribution of prothrombin G20210A, the second most frequent prothrombotic polymorphism in humans, has a north-south gradient in Europe. A carrier frequency of 3.0% has been reported in southern Europe, nearly 2-fold greater than that in northern Europe [6]. It has a very high prevalence in Mediterranean countries. In addition, some microheterogeneity is observed within populations [12].

Factor V Leiden and prothrombin G20210A mutations have not been previously reported in Albanians.

To the best of our knowledge this is the first study to examine the frequency of 2 thrombosis-related polymorphisms in healthy Albanians. Factor V Leiden and prothrombin G20210A mutation was observed in 1.8% and 3.1% of the participants, respectively (Table 1).

The present study’s results show that prothrombin gene 20210GA variation in the Albanian study population did not differ from that reported in other European studies. The 1691GA mutation is not frequent in the Albanian population and its prevalence is similar to that reported from Italy and Spain, and lower than in Greece [13-14].

The present study determined the frequency of 2 thrombophilic polymorphisms in an Albanian population. Determination of the heterogeneity of the prevalence of these 2 common risk factors can help elucidate the geographic differences in the incidence of thromboembolic diseases. Additional research on thrombotic Albanian patients is warranted, as the results may aid in the improvement of evidence-based management.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

Lane DA, Grant GJ. Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease, Blood 2000;95:1517-32.

Heijboer H, Brandjes DP, Buller HR, Sturk A, Ten Cate JW. Deficiencies of coagulation-inhibiting and fibrinolytic proteins in outpatients with deep-vein thrombosis.

N Engl Med 1990;323:1512-6.

Dahlback B, Carlsson M, Svensson PJ. Familial thrombophilia due to a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: prediction of a cofactor to activated protein C. Proc Natl Acad Sci USA 1993;90:1004-8.

Poort SR, Rosendall FR, Reitsma PH, Bertina RM. A common genetic variation in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood 1996;88:3698-703.

Rees DC, Cox M, Clegg JB. World Distrubition of factor V Leiden. Lancet 1995;346:1133-4.

Rosendall FR. Geographic distribution of the 20210 G to A prothrombin variant. Thromb Haemost 1998;79:706-8.

Akar N, Dalgın G, Sözüöz A, Ömürlü K, Cin Ş. Frequency of factor V (1691 G-A) mutation in Turkish population.

Thromb Haemost 1997;78:1527-8.

Akar N. Factor V 1691 G-A mutation distribution in a healthy Turkish population. Turk J Hematol 2009;26:9-11.

Akar N, Mısırlıoğlu M, Akar E, Avcu F, Yalçın A, Sözüöz A. Prothrombin gene 20210 G-A mutation in the Turkish population. Am J Hematol 1998;58:249.

Bauduer F, Lacombe D. Factor V Leiden, prothrombin 20210A, methylenetetrahydrofolate reductase 677T, and population genetics. Mol Genet Metab. 2005;86:91-9.

Akar N. Molecular biology for clinicians: Site specific mutagenesis: Usage for the mutation detection in thrombosis. Turk J Hematol 1998;15:123-4.

García-Gala JM, Alvarez V, Pinto CR, Soto I, Urgellés MF, Menéndez MJ, Carracedo C, López-Larrea C, Coto E. Factor V Leiden (R506Q) and risk of venous thromboembolism: a case-control study based on the Spanish population. Clin Genet 1997;52:206-10.

Mannucci PM, Duca F, Peyvandi F, et al. Frequency of factor V Arg506 Gln in Italians. Tromb Haemost 1996;75:694.

Antoniadi T, Hatzis T, Kroupis C, et al. Prevalence of factor V Leiden, prothrombin G20210A, and MTHFR C677T mutations in a Greek population of blood donors. Am J Hematol 1999;61:265-7.

Letter to the Editor

243

Cytopenia associated with iron deficiency anemia and iron therapy: A report of two cases Demir eksikliği anemisi ve demir tedavisi ile ilişkili sitopeni: İki olgu sunumu Nihal Özdemir, Tiraje Celkan, Rejin Kebudi, Meltem Bor, İnci Yıldız Department of Pediatric Hematology, Cerrahpaşa Faculty of Medicine, İstanbul University, İstanbul, Turkey

To the editor, Thrombocytopenia before and after iron therapy has been reported in children with severe iron deficiency anemia (IDA), but the association and mechanism of action are not well established [1-6].

Herein we present 2 children with IDA that had low platelet and leukocyte counts at presentation (n=1) and following oral iron therapy (n=1). Written informed consent was obtained from the patient.

Case 1 A 7-year-old boy with pica presented with a diagnosis of leukemia. He did not have hepatosplenomegaly, lymphadenopathy, or infection. Laboratory results were as follows: hemoglobin (Hb): 6.9 g/dL; mean corpuscular volume (MCV): 66 fL; red cell distribution width (RDW): 20.3%. Iron studies results were consistent with iron deficiency, as follows: serum iron: 13 µg/dL; total iron binding capacity: 416 µg/dL; ferritin level: 10 ng/mL. The patient’s white blood cell (WBC) count was 2.9×103/µL (1.5×103/µL neutrophils) and platelet count was 28×103/µL. Bone marrow aspiration showed a normal number of megakaryocytes, low-level stored iron, and no blasts.

The patient was diagnosed as IDA. On d 5 of iron treatment the patient’s findings were as follows: Hb: 7.4 g/dL; MCV: 68 fL; RDW: 25.7%; WBC: 5.6×103/µL; platelet count: 430×103/µL.

Case 2 A 2-year-old boy presented with fatigue, pallor, diminished appetite, and irritability. Laboratory results were as follows: Hb: 5.3 g/dL; MCV: 54.5 fL; RDW: 32.5%; WBC: 8.4×103/µL; and platelet count: 769×103/µL. Iron study results were as follows: serum iron: 7 µg/dL; total iron binding capacity: 423 µg/dL; ferritin level: 1.8 ng/mL. On d 6 of iron treatment there was a sudden decrease in his platelet count (31×103/µL), but he had no signs of infection and viral serology was negative. Bone marrow aspiration showed a normal number of megakaryocytes, low-level stored iron, and no blasts. After iron therapy his platelet count was 194×103/µL on d 10, and 382×103/µL on d 12.

Discussion Thrombocytopenia is an uncommon manifestation of iron deficiency (2% of IDA patients) [7].

Address for Correspondence: Prof. Tiraje Celkan, Department of Pediatric Hematology, Cerrahpaşa Faculty of Medicine, İstanbul University, İstanbul, Turkey Phone: +90 212 414 30 00/21956 E-mail: tirajecelkan@yahoo.com doi:10.5152/tjh.2011.65

244

Ă&#x2013;zdemir et al.

Iron deficiency anemia and cytopenia

Perlman et al. reported 6 children with IDA and thrombocytopenia with a mean platelet count of 64Ă&#x2014;109/L. After initiation of oral iron therapy the patients had rapid increases in their platelet counts.

The researchers speculated that iron-dependent processes critical to thrombopoiesis were altered [3].

The mechanism of thrombocytopenia in iron deficiency might be an early response to direct stimulation of the EPO receptor on megakaryocytes or shunting into the erythroid precursors pathway, leading to decreased platelet formation [8].

Leukopenia may also occur in patients with IDA [3], though the exact mechanism is unclear; alteration in the activity of iron-dependent enzymes in leucopoiesis may be the cause. Animal experiments and in vitro studies have demonstrated that administration of erythropoietin down-regulated neutrophil production [9].

In conclusion, the 2 presented cases had a very common disease, but uncommon findings. IDA and iron therapy may be associated with decreased platelet and leucocyte counts.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2011; 28: 243-4

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

Lopas H, Rabiner SF. Thrombocytopenia associated with iron deficiency anemia. Clin Pediar 1966;5:609-16.

Berger M, Brass LF. Severe thrombocytopenia in iron deficiency anemia. Am J Hematol 1987;24:425-8.

Perlman MK, Schwab JG, Nachman JB, Rubin CM. Thrombocytopenia in children with severe iron deficiency anemia. J Pediatr Hematol Oncol 2002;24:380-4.

Go RS, Porrata LF, Call TG. Thrombocytopenia after iron dextran administration in a patient with severe iron deficiency anemia. Ann Intern Med 2000;132;925.

Ganti AK, Shonka NA, Haire WD. Pancytopenia due to iron deficiency worsened by iron infusion: a case report 2007;7;1:175.

Hurvitz H, Kerem E, Gross-Kieselstein E, Brand A, Branski D. et al. Pancytopenia caused by iron-dextran.

Arch Dis Child 1986;61:194-6.

Kadikoylu G, Yavasoglu I, Bolaman Z, Senturk T. Platelet parameters in women with iron deficiency anemia. J Natl Med Assoc 2006;98:398-402.

McDonald TP, Clift RE, Cottrell MB. Large, chronic doses of erythropoietin cause thrombocytopenia in mice. Blood 1992,80:352-8.

Christensen RD, Liechty KW, Koenig JM, Schibler KR, Ohls RK. Administration of erythropoietin to newborn rats results in diminished neutrophil production. Blood 1991;78:1241-6.

Letter to the Editor

245

Accidental intrathecal methotrexate overdose İntratekal yüksek doz metotreksatın yanlışlıkla uygulanması Emel Özyürek1, Namık Özbek2 1Department 2Department

of Pediatric Hematology, Faculty of Medicine, Ondokuz Mayıs University, Samsun, Turkey of Pediatric Hematology, Faculty of Medicine, Başkent University, Ankara, Turkey

We read your recent article about intrathecal methotrexate overdose with great interest [1].

Although intrathecal methotrexate overdose rarely occurs, it is frequently lethal and may result in neurologic sequelae. Thus, new case reports may enhance our knowledge of this potentially lethal toxicity. Intrathecal methotrexate overdose was accidentally administered to two children that subsequently developed progressive neurologic symptoms and signs shortly afterwards; however, no neurologic manifestations were observed in a case we recently published, which resulted in delayed recognition of the intrathecal methotrexate overdose [2]. An intrathecal dose of 50-120 mg may cause no or mild neurologic signs. There seems to be variation in neurologic signs that may be related to differences in cerebrospinal fluid dynamics between individuals [3,4].

Various EEG patterns reported in patients with methotrexate overdose may have been due to intrathecal methotrexate overdose or due to systemic high-dose methotrexate given concomitantly [2,5,6]. We observed EEG findings indicative of encephalopathy in our patient, including slow activation increase in the background and paroxysmal activation of the temporal region [2]; however, we did not administer anticonvulsant therapy to the

patient because she did not have any neurologic symptom.

Current management recommendations for intrathecal methotrexate overdose are based on case reports and small case series. It is important to drain the cerebrospinal fluid as soon as possible after overdose is determined. We think cerebrospinal exchange, as described in Kazancı et al.’s cases and our case, is more effective [1,2]. Concomitant administration of high-dose folinic acid rescue and dexamethasone are recommended in all published reports [1].

The cause of intrathecal methotrexate overdose in our case was accidental intrathecal administration of higher intravenous dose vial in small volume [2], which resulted from the resemblance of the labels of two different strength methotrexate preparations, as reported by Kazancı et al. [1]. As previously suggested, to prevent this lethal error, separate package-specific labeling of preparations for intrathecal and intravenous use by pharmaceutical companies may be helpful [7].

In conclusion, accidental intrathecal methotrexate overdose may not cause neurologic symptoms; however, in cases of delayed recognition of intrathecal methotrexate overdose the treatment protocol that was successfully used in our case is recommended.

Address for Correspondence: M.D. Emel Özyürek, Department of Pediatric Hematology, Faculty of Medicine, Ondokuz Mayıs University, Kurupelit 55139 Samsun, Turkey Phone: +90 362 312 19 19-3751 E-mail: heozyurek@yahoo.com doi:10.5152/tjh.2011.66

246

Özyürek et al.

Accidental intrathecal methotrexate overdose

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

Kazancı E, Gülen H, Erbay A, Vergin C. Treatment of intrathecal methotrexate overdose with folinic acid rescue and lumbar cerebrospinal fluid exchange: a report of two cases. Turk J Hematol 2011;28:63-7.

Malbora B, Ozyurek E, Kocum AI, Ozbek N. Delayed recognition of intrathecal methotrexate overdose. J Pediatr Hematol Oncol 2009;31:352-4.

Addiego JE Jr, Ridgway D, Bleyer WA. The acute management of intrathecal methotrexate overdose: phar-

Turk J Hematol 2011; 28: 245-6

4.

5.

6.

7.

macologic rationale and guidelines. J Pediatr 1981;98:825-8.

Jacobson AM, Kreuger A, Mortimer O, Henningsson S, Seidel H, Moe PJ. Cerebrospinal fluid exchange after intrathecal methotrexate overdose. A report of two cases. Acta Paediatr 1992;81:359-61.

Riva L, Conter V, Rizzari C, Jankovic M, Sala A, Milani M. Successful treatment of inatrathecal methotrexate overdose with folinic acid rescue: a case report. Acta Paediatr 1999;88:780-2.

O’Marcaigh AS, Johnson CM, Smithson WA, Patterson MC, Widemann BC, Adamson PC, McManus MJ. Successful treatment of intrathecal methotrexate overdose by using ventriculolumbar perfusion and intrathecal instillation of carboxypeptidase G2. Mayo Clin Proc 1996;71:161-5.

Poplack DG. Massive intrathecal overdose: “check the label twice!” N Eng J Med 1984;311:400-2.

Letter to the Editor

247

CTLA-4 A49G polymorphism and autoimmune blood disease: A comment CTLA-4 A49G polimorfizmi ve otoimmün kan hastalığı: Bir yorum Viroj Wiwanitkit Wiwanitkit House, Bangkhae, Bangkok, Thailand

To the Editor, I read the recent publication on cytotoxic T lymphocyte antigen-4 (CTLA-4) A49G polymorphism with a great interest [1]. Aktürk et al. concluded that, “these data suggest that CTLA-4 A49G polymorphism does not contribute to the pathogenesis of lymphoproliferative diseases itself, nor does it increase the risk of autoimmune complications in patients with lymphoproliferative disease [1].”

Aktürk et al. tried to determine allele frequencies and genotype distributions for some autoimmune blood diseases. There are some problems with their conclusion. First, the study included only a few patients and no controls. Second, not all autoimmune blood diseases were analyzed; therefore, they cannot conclude that their finding supports or

refutes the contribution of the studied polymorphism to the pathogenesis or risk of disease. Third, when investigating a single polymorphism the possibility of other polymorphisms that were not investigated, must be considered.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

Aktürk F, Hançer VS, Küçükkaya R. Cytotoxic T lymphocyte antigen-4 (CTLA-4) A49G polymorphism and autoimmune blood diseases. Turk J Hematol. 2010;27:78-81.

Address for Correspondence: Prof. Viroj Wiwanitkit, Wiwanitkit House, Bangkhae, 10160 Bangkok, Thailand Phone: 662-4132436 E-mail: wviroj@yahoo.com doi:10.5152/tjh.2011.67

248

Letter to the Editor

Iron deficiency anemia and total antioxidant capacity Demir eksikliği anemisi ve toplam antioksidan kapasitesi Viroj Wiwanitkit Wiwanitkit House, Bangkhae, Bangkok, Thailand

To the Editor, I read the recent publication on evaluation of iron deficiency anemia via total antioxidant capacity with great interest [1]. It concluded that, “increased oxidative stress may play a role in the pathogenesis of iron deficiency anemia” and that ,“the automated assay is a reliable and easily applied method for measurement of serum total antioxidant capacity in iron deficiency anemia” [1]. There are some issues I want to address. First, based on the limited and imbalanced number of cases and controls in that study, the statistical acceptance is questionable.

Second, there was no exclusion of important confounding conditions, especially hemoglobin disorders and thalassemias. Indeed, those conditions are associated with oxidative stress [2]. Finally, there wasn’t a complete assessment of the analytical

(detection limit, interference, precision, accuracy, etc.) or diagnostic (sensitivity, specificity, predictive value, etc.) properties of the automated assay.

Hence, it might not be appropriate to report that the assay is reliable.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

Aslan M, Horoz M, Çelik H. Evaluation of oxidative status in iron deficiency anemia through total an tioxidant capacity measured using an automated method. Turk J Hematol 2011;28:42-6.

Fibach E, Rachmilewitz E. The role of oxidative stress in hemolytic anemia. Curr Mol Med 2008;8:609-19.

Address for Correspondence: Prof. Viroj Wiwanitkit, Wiwanitkit House, Bangkhae, 10160 Bangkok, Thailand Phone: 662-4132436 E-mail: wviroj@yahoo.com doi:10.5152/tjh.2011.68

Letter to the Editor

249

Decreased erythrocyte catalase level in iron deficiency Demir eksikliğinde eritrosit katalaz seviyesinin azalması Şinasi Özsoylu To the Editor,

should be amended with, “as increased oxidative stress occurs as a result of iron deficiency”.

Arslan et al.’s recent study provides an opportunity to discuss our earlier results from a 1964 study on early diagnosis only iron deficiency anemia and sideropenia [1,2]. Catalase is present in almost all cells, including red cells, and is known to be the most active enzyme involved in the destruction of hydrogen peroxide, which causes oxidative stress. In iron deficiency red cell catalase synthesis decreases before the hemoglobin level does. When its synthesis decreases in iron deficiency anemia and sideropenia, the level of oxidative stress-associated substances increases as a result. As such, the authors’ statement, “increased oxidative stress may play a role in the pathogenesis of iron deficiency anemia”

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

Arslan N, Horoz M, Çelik H. Evaluation of oxidative status in iron deficiency anemia through total antioxidant capacity using an automated method. Turk J Hematol 2011;28:42-46 Özsoylu Ş. Decreased activity of iron-containing enzyme catalase in human iron deficiency anemia. Turk J Pediatr 1964;6:200-210

Address for Correspondence: M.D. Şinasi Özsoylu, Altunşehir Sitesi No.30, Beysukent, Ankara, Turkey Phone: +90 312 203 55 55 E-mail: sinasiozsoylu@hotmail.com doi:10.5152/tjh.2011.69

250

Letter to the Editor

Partial splenic embolization versus splenectomy for the management of autoimmune hemolytic anemia: A response Otoimmün hemolitik anemi tedavisinde splenektomiye karşılık kısmi splenik embolizasyon: Bir yanıt Selami Koçak Toprak Department of Hematology, Faculty of Medicine, Başkent University, Ankara, Turkey

To the Editor, I read with great interest the recent publication by Tanrıöver et al. on splenic artery embolization, in which they reached in conclusion that splenic artery embolization might be an option for hemolytic anemia as a bridging therapy to surgery or as an alternative therapy, especially in critically ill patients with disorders that contraindicate surgery [1]. Partial splenic embolization (PSE) is a non-surgical procedure developed to treat hypersplenism as a result of hepatic disease and thus avoid the disadvantages of splenectomy [2]. Furthermore, splenic artery embolisation has been used to treat various conditions, which include chronic idiopathic thrombocytopenic purpura, hereditary spherocytosis, and also splenic trauma in haemodynamically unstable patients. PSE provides a minimally invasive alternative to splenectomy in patients who are severely compromised because of splenomegaly or sequestration and destroying in the spleen. But, it should not be forgotten that this procedure is not innocent. There are

severe numerous complications of this method such as post infarction syndrome (fever, left upper quadrant pain, risk of infection and abscess formation), and embolization are related to migration or inappropriate placement of embolic material [3,4]. These are the most dangerous and lethal complications of the procedure. One of the other serious potential complications associated with pulmonary disorders.

Pneumonia, atelectasis, and pleural effusion, usually develop in the left lung and are associated with embolization of the upper pole of the spleen. Splenic abscesses, rupture of the spleen, and septicemia, have been previously reported after PSE [5].

Decreased portal-vein flow and a rapid increase in the platelet count after PSE may induce portal-vein thrombosis [2]. Moreover, the extent of embolization seems to be critical for longterm efficacy of PSE. Embolization of less than 50% of the splenic mass was almost always associated with a relapse of hypersplenism or continuation of splenic activity [5].

Splenectomy can safely be performed laparoscopically in almost all cases of primary autoimmune

Address for Correspondence: M.D. Selami Koçak Toprak, Department of Hematology, Faculty of Medicine, Başkent University, Ankara, Turkey Phone: +90 532 656 02 66 E-mail: sktoprak@yahoo.com doi:10.5152/tjh.2011.71

Toprak SK. Splenic embolization versus splenectomy in AIHA

Turk J Hematol 2011; 28: 250-1

hemolytic anemia (AIHA), because the spleen is usually of normal size [6]. In second-line treatment, medical reasons in favor of rituximab are relative contraindications for splenectomy such as massive obesity, technical problems, and a high risk of venous thromboembolism. A contraindication to rituximab treatment is an untreated hepatitis B virus infection.

Additionally; intravenous immune globulin is not recommended for routine use in either acute or chronic treatment of AIHA. Based on consensus by the expert panel, IVIG may be considered among the options for treatment of severe life-threatening AIHA [7].

I propose that the process performed by Tanrıöver et al. should be applied only in selected patients with a very low preoperative level of hemoglobin and not susceptible to any hematologic and surgical conservative treatment. Therefore; splenic artery embolisation preceding laparoscopic splenectomy should not be carried out routinely as appropriate use of blood products and correct surgical technique will be adequate in controlling blood loss.

Conflict of interest statement Author of this paper has no conflict of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included in this manuscript.

References 1.

2.

3.

4.

5.

Tanrıöver MD, Peynircioğlu B, Arsava BE, İskit AT. Splenic artery embolization: An alternative approach in a critically ill patient with autoimmune hemolytic anemia.

Turk J Hematol 2011;28:135-8.

Yoshida H, Mamada Y, Taniai N, Tajiri T. Partial splenic embolization. Hepatol Res 2008;38:225-33.

Sakai T, Shiraki K, Inoue H, Sugimoto K, Ohmori S, Murata K, Takase K, Nakano T. Complications of partial splenic embolization in cirrhotic patients. Dig Dis Sci 2002;47:388-91.

Gooi Z, Lee R, Wong KK, Tam PKh. The use of splenic artery embolisation as a bridge to safe laparoscopic splenectomy in a patient with resistant immune thrombocytopenic purpura. J Paediatr Child Health 2009;45:767-9.

Amin MA, el-Gendy MM, Dawoud IE, Shoma A, Negm AM, Amer TA. Partial splenic embolization versus sple-

6.

7.

251

nectomy for the management of hypersplenism in cirrhotic patients. World J Surg 2009;33:1702-10.

Lechner K, Jäger U. How I treat autoimmune hemolytic anemias in adults. Blood 2010;116:1831-8.

Anderson D, Ali K, Blanchette V, Brouwers M, Couban S, Radmoor P, Huebsch L, Hume H, McLeod A, Meyer R, Moltzan C, Nahirniak S, Nantel S, Pineo G, Rock G. Guidelines on the use of intravenous immune globulin for hematologic conditions. Transfus Med Rev 2007;21:S9-56.

Author Reply Thank you for your comments and contribution.

Complications of splenic artery embolization have been very briefly discussed in this paper due to word count limitations. Indeed, all of the serious adverse events and complications that you have mentioned are to be considered while deciding to proceed with splenic artery embolization. The case patient had hemoglobin values as low as 1.4 g dL-1 and no compatible erythrocyte suspension could be obtained for several days, which lead the surgeons abstain from surgery. Intravenous immune globulin was also administered because of this critical situation of the patient. Critical patients require critical, immediate and sometimes brave decisions in the intensive care unit. We think that splenic artery embolization was the right decision regarding the challenges of the patient presented. Morever, bleeding could not be controlled during splenectomy which led to a fatal hypovolemic shock, making us think what would happen if the patient had not undergone surgery. We pointed out that “it might be a valuable option” for selected cases, but of course should not be the first line treatment for uncomplicated, low risk patients who are suitable for surgery.

Mine Durusu Tanrıöver Hacettepe University School of Medicine, Department of Internal Medicine, Section of General Internal Medicine 06100, Ankara, Turkey Phone: +90 312 305 30 29 E-mail: mdurusu@hacettepe.edu.tr

252

Images in Hematology

A rare cause of iron deficiency anemia in a child: Lithobezoar Çocuklarda demir eksikliği anemisinin nadir bir sebebi: Litobezoar Yasemin Altuner Torun1, Edip Torun2, Ayşe Betül Ergül3, Musa Karakükçü4, Türkan Patıroğlu4 1Department of Pediatrics, Division of Pediatric Hematology, Kayseri Education and Research Hospital, Kayseri, Turkey 2Department

of Gastroenterology, Faculty of Medicine, Erciyes University, Kayseri, Turkey of Pediatrics, Division of Pediatrics, Kayseri Education and Research Hospital, Kayseri, Turkey 4Department of Pediatric Hematology, Faculty of Medicine, Erciyes University Kayseri, Turkey 3Department

Bezoars are the accumulation of undigested foreign bodies or food material in the gastrointestinal tract that form a conglomeration [1,2]. They may be composed of hair (trichobezoars), vegetable matter (phytobezoars), milk curd (lactobezoars), and, very rarely, stones (lithobezoars) [3]. Lithobezoars are very rare in childhood and are most often seen in neglected and emotionally disturbed children [4,5].

This study aimed to present the clinical features of a 15-year-old male patient with a history of pica and iron deficiency that did not respond to oral iron therapy, and to highlight the diagnostic and management challenges of childhood lithobezoars.

A 15-year-old boy was referred to our department with iron deficiency anemia. He had a history of constipation, recurrent abdominal pain, and fatigue for 5 years. The boy was a neglected child of a family with low socioeconomic status. He was working as a carpenter in wood industry. He appeared pale and had sensitivity in both lower quadrants of the abdomen. Laboratory findings were as follows: hemoglobin: 7.5 g dL-1; MCV: 54 fL;

serum iron: 8 µg dL-1; iron binding capacity: 395 µg dL-1. Peripheral blood examination showed hypochromic microcytic anemia, anisocytosis, and target cells. Plain abdominal X-ray showed numerous opacities scattered within the small intestine, ileocecal valve, and descending colon (Figure 1).

Detailed anamnesis showed that he had been eating pieces of charcoal for 8 years. Because the patient did not satisfactorily respond to long-term oral iron supplementation, he was referred to admit to a hematologist by his family practitioner. When he submitted us in Training and Research Hospital, parental iron therapy was applied because of the persistent anemia. He was referred to the department of psychiatry because of behavioral problems.

Bezoars result from pica, an appetite for unpalatable or non-nutritive objects. The etiology of pica is unknown; it may be a consequence of parental neglect and deprivation early in life. It is more commonly observed in impoverished, emotionally disturbed children of low socioeconomic status that often have a problematic home environment. A his-

Address for Correspondence: M.D. Yasemin Altuner Torun, Tuna Cad. Yeni Tuna Apt. No: 11/39 Kayseri, Turkey Phone: +90 533 938 52 82 E-mail: yaseminaltuner@yahoo.com doi:10.5152/tjh.2011.72

253

Torun et al.

Iron deficiency anemia and lithobezoar in a child

Turk J Hematol 2011; 28: 252-3

ous radiopaque masses in the lower abdomen or the rectosigmoid junction, referred to as corn on the cob, is pathognomonic for lithobezoars [5,7].

In the presented case a history of ingestion of charcoal, iron deficiency anemia, constipation, and recurrent episodes of abdominal pain contributed significantly to the diagnosis. As in all cases of bezoars, psychiatric evaluation is essential to prevent recurrence. Early diagnosis and intervention are necessary in suspected cases of lithobezoars to avoid intestinal obstruction.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References Figure 1. Plain abdominal radiograph shows opacities in the small intestine, ileocecal valve, and descending colon

tory of pica invariably precedes the formation of a lithobezoar [6]. The presented case also had pica.

Bezoar patients may present with a history of ingestion of sand, constipation, and recurrent episodes of abdominal pain that may result in significantly painful defecation, which is an important indication for the diagnosis of lithobezoars.

Abdominal palpation and rectal examination provide important diagnostic evidence of colonic lithobezoars. Palpation of a prickly mass on rectal examination is known as the colonic crunch sign and can be observed in cases of sunflower seed bezoars and lithobezoars. Plain abdominal X-ray is especially important in the diagnosis of this type of colonic intraluminal mass. The presence of numer-

1.

2.

3.

4.

5.

6.

7.

Vijayambika K. Lithobezoar. Indian Pediatr 2004;41:1168.

GĂźrses, N, Ozkan K. Bezoars: analysis of seven cases.

Z Kinderchir 1987;42:291-2.

Rao PL, Mitra SK, Pathak IC. Trichobezoars in children. Int Surg 1981;66:63-5.

Mohammad MA. Rectosigmoid lithobezoar in a eightyear-old. Afr J Paediatr Surg 2010;7:38-9.

Baran T, Ragip O, Abdulllah O, Naim K. Giant rectosigmoid lithobezoar in a child:four significant clues obtained from history, abdominal palpation, rectal examination and plain abdominal X-ray. Eur J Radiol 2004;49:23-4.

Narayanan SK, Akbar Sherif VS, Babu PR, Nandakumar TK. Intestinal obstruction secondary to a colonic lithobezoar. J Pediatr Surg 2008;43:9-10.

NumanoÄ&#x;lu KV, Tatli D. A rare cause of partial intestinal obstruction in a child: colonic lithobezoar. Emerg Med J 2008;25:312-3.

254

Images in Hematology

An unusual cause of iron deficiency anemia in a healthy man: Hijamah Sağlıklı bir erkekte demir eksikliği anemisinin nadir görülen bir nedeni: Hijamah Remzi Adnan Akdoğan1, Elif Akdoğan2 1Department 2Department

of Gastroenterology, Rize Education and Research Hospital, Rize, Turkey of Hematology, Rize Education and Research Hospital, Rize, Turkey

Bloodletting with cupping is used by numerous populations throughout the world. There is an Islamic basis for this type of therapy, which is known as hijamah. Hijamah is a process of removing blood from the skin, and is thought to enhance health, detoxify the body, and enhance immunity; however, blood loss from the skin may occur with voluntary incisions and bloodletting with cupping.

A 50-year-old man presented to our hospital with fatigue. A medical review of systems was negative for other symptoms. The patient‘s history of serious illnesses, hospitalization, and major surgery was negative. Although he had no complaints, he had been performing bloodletting with cupping for 4 years in an effort to improve his health. Physical examination showed signs of variably sized incisions and suction marks on his back and abdomen (Figures 1-3). His conjunctivas and skin were markedly pale.

The patient’s initial findings were as follows: hemoglobin level: 3.6 g/dL; hematocrit level: 16.4%; mean corpuscular volume: 50 fL; mean corpuscular hemoglobin concentration: 21.9 g/dL; platelet count: 852,000/μL. The patient was diagnosed as iron deficiency anemia. The iron level was 22 ng/dL, total iron binding capacity was 581 ng/dL, ferritin was

0.99 ng/mL, and reticulocyte count was 2%.

Peripheral blood smear showed microcytic hypochromic anemia with anisocytosis (Figure 4).

Electrolytes, vitamin B12, folate level, and routine serum analyses were normal. Fecal occult blood testing was performed 3 times and the results were negative. Even though the patient’s hemoglobin and biochemical analyses were normal before performing hijamah, endoscopy and colonoscopy were offered to the patient for differential diagnosis, but we couldn’t perform the procedures because of the social medicine problems. Written informed consent was obtained from the patient.

Iron deficiency anemia in men is not as common as in women and children, and it is generally associated with blood loss. Patient must be evaluated specifically for benign and malign gastrointestinal disorders [1]. Cupping is a popular alternative medicinal practice in East Asia, but is rare in Islamic countries. Bloodletting with cupping is a widely used therapeutic method in Chinese medicine. The procedure dates back several thousand years. There are several types, including cupping, bloodletting with cupping, and moving cupping. Cupping practitioners usually heat the cup with a flame to achieve

Address for Correspondence: M.D. Remzi Adnan Akdoğan, Department of Internal Medicine, Division of Gastroenterology, School of Medicine, Rize University, 53100 Rize, Turkey Phone: +90 464 213 04 91 E-mail: remziadnan@yahoo.com doi:10.5152/tjh.2011.73

Turk J Hematol 2011; 28: 254-6

AkdoÄ&#x;an et al.

Iron deficiency anemia caused by hijamah

255

Figure 1. Signs of incisions and suctions on the skin

Figure 2. Signs of incisions on the skin

Figure 3. Signs of incisions on the skin

Figure 4. Peripheral blood smear

suction and negative pressure inside the cup.

Another method of cupping is bleeding cupping, as used by the presented patient. First, practitioners make small incisions and after bleeding occurs they create negative pressure suction in the cup. Cuppingbased therapies are used for a variety of diseases and therapeutic purposes [1].

The literature contains several case reports from East Asia. One such report describes reversible cardiac hypertrophy in a patient with severe chronic anemia due to long-term bloodletting with cupping and another describes cupping therapy induced iron deficiency anemia [2,3]. In the presented case blood loss from the skin was caused by self-made

256

AkdoÄ&#x;an et al.

Iron deficiency anemia caused by hijamah

incisions and bloodletting with cupping. Even though the presented patient had no complaints, he reported that he performed bloodletting with cupping to improve his health. To the best of our knowledge this is the first Turkish case report of iron deficiency anemia in a healthy man caused by bloodletting with cupping (hijamah).

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2011; 28: 254-6

References 1.

2.

3.

Cao H, Han M, Li X, Dong S, Shang Y, Wang Q, Xu S, Liu J. Clinical research evidence of cupping therapy in china: a systematic literature review. BMC Complementary and Alternative Medicine 2010;10:70.

Sohn IS, Jin ES, Cho JM, Kim CJ, Bae JH, Moon JY, Lee SH, Kim MJ. Bloodletting-induced cardiomyopathy: reversible cardiac hypertrophy in severe chronic anaemia from long-term bloodletting with cupping.

European Journal of Echocardiography 2008;9:585-6.

Lee HJ, Park NH, Yun HJ, Kim S, Jo DY. CuppingTherapy induced iron deficiency anemia in a healthy man. American Journal of Internal Medicine 2008;121:e5-6.

Advisory Board of This Issue (September 2011) A. Nazlı Başak, Turkey

Fevzi Altuntaş, Turkey

Akif Selim Yavuz, Turkey

Fikriye Uras, Turkey Günay Balta, Turkey Hakan Göker, Turkey Hale Ören, Turkey Hamdi Akan, Turkey Hayri Özsan, Turkey Hilmi Apak, Turkey İlhan Satman, Turkey İsmet Aydoğdu, Turkey Mualla Çetin, Turkey Murat Akova, Turkey Murat Akyıldız, Turkey Mutlu Arat, Turkey Muzaffer Demir, Turkey Namık Özbek, Turkey Nazan Çetingül, Turkey Nerbil Kılıç, Switzerland Neşe Yaralı, Turkey Nina Worel, Austria Önder Arslan, Turkey

Ali Turhan, France Ali Uğur Ural, Turkey Ali Ünal, Turkey Aydan İkincioğulları, Turkey Aytemiz Gürgey, Turkey Barış Kuşkonmaz, Turkey Bülent Eser, Turkey Can Boğa, Turkey Çiğdem Altay, Turkey Dilber Talia İleri, Turkey Duran Canatan, Turkey Emin Kürekçi, Turkey Evren Özdemir, Turkey Fahir Özkalemkaş, Turkey Fatma Gümrük, Turkey Feride Duru, Turkey Feride İffet Şahin, Turkey Ferit Avcu, Turkey

Regis Peffault Delatour, France Reyhan Öner, Turkey Rıdvan Ali, Turkey Rüçhan Akar, Turkey Sema Anak, Turkey Sema Karakuş, Turkey Sevgi Beşışık Kalayoğlu, Turkey Süleyman Sami Kartı, Turkey Şule Ünal, Turkey Tansu Sipahi, Turkey Tiraje Celkan, Turkey Türkan Patıroğlu, Turkey Türkiz Gürsel, Turkey Vefki Gürhan Kadıköylü, Turkey Yahya Büyükaşık, Turkey Yeşim Aydınok, Turkey Yurdanur Kılınç , Turkey Yusuf Baran, Turkey Zafer Başlar, Turkey Zahit Bolaman, Turkey Zühre Kaya, Turkey

Announcements 9-11 September 2011 Turkish School of Hematology 12 - Stem Cell Course Ankara, Turkey

10-13 December 2011 53rd ASH Annual Meeting and Exposition San Diego, USA

19-22 October 2011 37. Turkish National Hematology Congress Ankara, Turkey

23-25 December 2011 Practical Basic Hematology Laboratory Course 1