Tjh 2019 3

Issue 3

September 2019

E-ISSN: 1308-5263

Volume 36

Review Extended Half-Life Coagulation Factors: A New Era in the Management of Hemophilia Patients Muhlis Cem Ar et al.; İstanbul, İzmir, Turkey

Research Articles Long-term Dental Anomalies after Pediatric Cancer Treatment in Children Gülser Kılınç et al.; İzmir, Turkey

Ortho-Topolin Riboside Induced Differentiation through Inhibition of STAT3 Signaling in Acute Myeloid Leukemia HL-60 Cells Li Wang et al.; PanJin, Dalian, China

Acute Lymphoblastic Leukemia in Routine Practice: A Turkish Multicenter Study

Rafiye Çiftçiler et al.; Ankara, İstanbul, Malatya, İzmir, Tekirdağ, Kayseri, Muğla, Turkey

The Role of the Local Bone Marrow Renin-Angiotensin System in Multiple Myeloma Bülent Saka et al.; İstanbul, Turkey

The Use of Allogeneic Mesenchymal Stem Cells in Childhood Steroid-Resistant Acute Graft-Versus-Host Disease: A Retrospective Study of a Single-Center Experience Ceyhun Bozkurt et al.; İstanbul, Turkey

Cover Picture: Smeeta Gajendra, Bhawna Jha, Sarita Prasad, Pratibha Dhiman, Manorama Bhargava, Gurgaon, India An Unusual Presentation of Hairy Cell Leukemia

3

International Review Board

Editor-in-Chief Reyhan Küçükkaya

İstanbul, Turkey rkucukkaya@hotmail.com

Associate Editors

A. Emre Eşkazan

İstanbul University-Cerrahpaşa, İstanbul, Turkey

Ayşegül Ünüvar

İstanbul University, İstanbul, Turkey aysegulu@hotmail.com

Cengiz Beyan

Ufuk University, Ankara, Turkey cengizbeyan@hotmail.com

Hale Ören

Dokuz Eylül University, İzmir, Turkey hale.oren@deu.edu.tr

İbrahim C. Haznedaroğlu

Hacettepe University, Ankara, Turkey haznedar@yahoo.com

M. Cem Ar

İstanbul University-Cerrahpaşa, İstanbul, Turkey mcemar68@yahoo.com

Selami Koçak Toprak

Ankara University, Ankara, Turkey sktoprak@yahoo.com

Semra Paydaş

Çukurova University, Adana, Turkey sepay@cu.edu.tr

Şule Ünal

Hacettepe University, Ankara, Turkey

Assistant Editors Ali İrfan Emre Tekgündüz

Dr. A. Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey

Claudio Cerchione

University of Naples Federico II Napoli, Campania, Italy

Elif Ünal İnce

Ankara University, Ankara, Turkey

İnci Alacacıoğlu

Dokuz Eylül University, İzmir, Turkey

Müge Sayitoğlu

İstanbul University, İstanbul, Turkey

Nil Güler

Ondokuz Mayıs University, Samsun, Turkey

Olga Meltem Akay

Koç University, İstanbul, Turkey

Veysel Sabri Hançer

İstinye University, İstanbul, Turkey

Zühre Kaya

Gazi University, Ankara, Turkey

A-I

Nejat Akar Görgün Akpek Serhan Alkan Çiğdem Altay Koen van Besien Ayhan Çavdar M. Sıraç Dilber Ahmet Doğan Peter Dreger Thierry Facon Jawed Fareed Gösta Gahrton Dieter Hoelzer Marilyn Manco-Johnson Andreas Josting Emin Kansu Winfried Kern Nigel Key Korgün Koral Abdullah Kutlar Luca Malcovati Robert Marcus Jean Pierre Marie Ghulam Mufti Gerassimos A. Pangalis Antonio Piga Ananda Prasad Jacob M. Rowe Jens-Ulrich Rüffer Norbert Schmitz Orhan Sezer Anna Sureda Ayalew Tefferi Nükhet Tüzüner Catherine Verfaillie Srdan Verstovsek Claudio Viscoli

TOBB Economy Technical University Hospital, Ankara, Turkey Maryland School of Medicine, Baltimore, USA Cedars-Sinai Medical Center, USA Ankara, Turkey Chicago Medical Center University, Chicago, USA Ankara, Turkey Karolinska University, Stockholm, Sweden Mayo Clinic Saint Marys Hospital, USA Heidelberg University, Heidelberg, Germany Lille University, Lille, France Loyola University, Maywood, USA Karolinska University Hospital, Stockholm, Sweden Frankfurt University, Frankfurt, Germany Colorado Health Sciences University, USA University Hospital Cologne, Cologne, Germany Hacettepe University, Ankara, Turkey Albert Ludwigs University, Germany University of North Carolina School of Medicine, NC, USA Southwestern Medical Center, Texas, USA Georgia Health Sciences University, Augusta, USA Pavia Medical School University, Pavia, Italy Kings College Hospital, London, UK Pierre et Marie Curie University, Paris, France King’s Hospital, London, UK Athens University, Athens, Greece Torino University, Torino, Italy Wayne State University School of Medicine, Detroit, USA Rambam Medical Center, Haifa, Israel University of Köln, Germany AK St Georg, Hamburg, Germany University Medical Center Hamburg, Germany Santa Creu i Sant Pau Hospital, Barcelona, Spain Mayo Clinic, Rochester, Minnesota, USA İstanbul Cerrahpaşa University, İstanbul, Turkey University of Minnesota, Minnesota, USA The University of Texas MD Anderson Cancer Center, Houston, USA San Martino University, Genoa, Italy

Past Editors Erich Frank Orhan Ulutin Hamdi Akan Aytemiz Gürgey

Language Editor Leslie Demir

Senior Advisory Board Yücel Tangün Osman İlhan Muhit Özcan Teoman Soysal Ahmet Muzaffer Demir

Editorial Office İpek Durusu Bengü Timoçin

Publishing Services

Statistic Editor Hülya Ellidokuz

GALENOS PUBLISHER Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya E-mail : rkucukkaya@hotmail.com

All Inquiries Should be Addressed to TURKISH JOURNAL OF HEMATOLOGY Address Phone Fax E-mail

: Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.) No: 8 06550 Çankaya, Ankara / Turkey : +90 312 490 98 97 : +90 312 490 98 68 : info@tjh.com.tr

E-ISSN: 1308-5263

Publishing Manager

Publishing House

Muhlis Cem Ar

Molla Gürani Mah. Kaçamak Sk. No: 21, 34093 Fındıkzade, İstanbul, Turkey Tel: +90 212 621 99 25

Management Address Türk Hematoloji Derneği Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.) No: 8 06550 Çankaya, Ankara / Turkey

Fax: +90 212 621 99 27 E-mail: info@galenos.com.tr Publisher Certificate Number: 14521

Online Manuscript Submission

Publication Date

http://mc.manuscriptcentral.com/tjh

01.08.2019

Web Page

Cover Picture

www.tjh.com.tr

Owner on Behalf of the Turkish Society of Hematology

Smeeta Gajendra, Bhawna Jha, Sarita Prasad, Pratibha Dhiman, Manorama Bhargava, Gurgaon, India An Unusual Presentation of Hairy Cell Leukemia Bone marrow aspirate showing hairy cells. Bone marrow biopsy showing abnormal lymphoid cell infiltration positive for CD20 and annexin A1.

Güner Hayri Özsan

International scientific journal published quarterly.

The Turkish Journal of Hematology is published by the commercial enterprise of the Turkish Society of Hematology with Decision Number 6 issued by the Society on 7 October 2008.

A-II

AIMS AND SCOPE The Turkish Journal of Hematology is published quarterly (March, June, September, and December) by the Turkish Society of Hematology. It is an independent, non-profit peer-reviewed international English-language periodical encompassing subjects relevant to hematology.

The Editorial Board of The Turkish Journal of Hematology adheres to the principles of the World Association of Medical Editors (WAME), International Council of Medical Journal Editors (ICMJE), Committee on Publication Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and Strengthening the Reporting of Observational Studies in Epidemiology (STROBE).

The aim of The Turkish Journal of Hematology is to publish original hematological research of the highest scientific quality and clinical relevance. Additionally, educational material, reviews on basic developments, editorial short notes, images in hematology, and letters from hematology specialists and clinicians covering their experience and comments on hematology and related medical fields as well as social subjects are published. As of December 2015, The Turkish Journal of Hematology does not accept case reports. Important new findings or data about interesting hematological cases may be submitted as a brief report.

General practitioners interested in hematology and internal medicine specialists are among our target audience, and The Turkish Journal of Hematology aims to publish according to their needs. The Turkish Journal of Hematology is indexed, as follows: - PubMed Medline - PubMed Central - Science Citation Index Expanded - EMBASE - Scopus - CINAHL - Gale/Cengage Learning - EBSCO - DOAJ - ProQuest - Index Copernicus - Tübitak/Ulakbim Turkish Medical Database - Turk Medline - Hinari - QUARE - ARDI - GOALI Impact Factor: 0.779 Open Access Policy Turkish Journal of Hematology is an Open Access journal. This journal provides immediate open access to its content on the principle that making research freely available to the public supports a greater global exchange of knowledge.

Open Access Policy is based on the rules of the Budapest Open Access Initiative (BOAI) http://www.budapestopenaccessinitiative.org/.

Subscription Information The Turkish Journal of Hematology is published electronically only as of 2019. Therefore, subscriptions are not necessary. All published volumes are available in full text free-of-charge online at www.tjh.com.tr.

A-III

Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97 Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh Web page: www.tjh.com.tr E-mail: info@tjh.com.tr Permissions Requests for permission to reproduce published material should be sent to the editorial office.

Editor: Professor Dr. Reyhan Küçükkaya Adress: Turan Güneş Bulv. İlkbahar Mah. Fahrettin Paşa Sokağı (Eski 613. Sokak) No: 8, 06550 Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97 Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh Web page: www.tjh.com.tr E-mail: info@tjh.com.tr Publisher Galenos Yayınevi Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey Telephone : +90 212 621 99 25 Fax : +90 212 621 99 27 info@galenos.com.tr Instructions for Authors Instructions for authors are published in the journal and at www.tjh.com.tr Material Disclaimer Authors are responsible for the manuscripts they publish in The Turkish Journal of Hematology. The editor, editorial board, and publisher do not accept any responsibility for published manuscripts.

If you use a table or figure (or some data in a table or figure) from another source, cite the source directly in the figure or table legend.

Editorial Policy Following receipt of each manuscript, a checklist is completed by the Editorial Assistant. The Editorial Assistant checks that each manuscript contains all required components and adheres to the author guidelines, after which time it will be forwarded to the Editor in Chief. Following the Editor in Chief’s evaluation, each manuscript is forwarded to the Associate Editor, who in turn assigns reviewers. Generally, all manuscripts will be reviewed by at least three reviewers selected by the Associate Editor, based on their relevant expertise. Associate editor could be assigned as a reviewer along with the reviewers. After the reviewing process, all manuscripts are evaluated in the Editorial Board Meeting.

Turkish Journal of Hematology’s editor and Editorial Board members are active researchers. It is possible that they would desire to submit their manuscript to the Turkish Journal of Hematology. This may be creating a conflict of interest. These manuscripts will not be evaluated by the submitting editor(s). The review process will be managed and decisions made by editor-in-chief who will act independently. In some situation, this process will be overseen by an outside independent expert in reviewing submissions from editors.

TURKISH JOURNAL OF HEMATOLOGY INSTRUCTIONS FOR AUTHORS The Turkish Journal of Hematology accepts invited review articles, research articles, brief reports, letters to the editor, and hematological images that are relevant to the scope of hematology, on the condition that they have not been previously published elsewhere. Basic science manuscripts, such as randomized, cohort, cross-sectional, and case-control studies, are given preference. All manuscripts are subject to editorial revision to ensure they conform to the style adopted by the journal. There is a double-blind reviewing system. Review articles are solicited by the Editorin-Chief. Authors wishing to submit an unsolicited review article should contact the Editor-in-Chief prior to submission in order to screen the proposed topic for relevance and priority.

The Turkish Journal of Hematology does not charge any article submission or processing charges.

Manuscripts should be prepared according to ICMJE guidelines (http:// www.icmje.org/). Original manuscripts require a structured abstract. Label each section of the structured abstract with the appropriate subheading (Objective, Materials and Methods, Results, and Conclusion). Letters to the editor do not require an abstract. Research or project support should be acknowledged as a footnote on the title page. Technical and other assistance should be provided on the title page.

Original Manuscripts Title Page Title: The title should provide important information regarding the manuscript’s content. The title must specify that the study is a cohort study, cross-sectional study, case-control study, or randomized study (i.e.

Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability of ferrous succinate tablet formulations without correction for baseline circadian changes in iron concentration in healthy Chinese male subjects: A single-dose, randomized, 2-period crossover study. Clin Ther 2011;33:2054-2059).

The title page should include the authors’ names, degrees, and institutional/ professional affiliations and a short title, abbreviations, keywords, financial disclosure statement, and conflict of interest statement. If a manuscript includes authors from more than one institution, each author’s name should be followed by a superscript number that corresponds to their institution, which is listed separately. Please provide contact information for the corresponding author, including name, e-mail address, and telephone and fax numbers.

Running Head: The running head should not be more than 40 characters, including spaces, and should be located at the bottom of the title page.

Word Count: A word count for the manuscript, excluding abstract, acknowledgments, figure and table legends, and references, should be provided and should not exceed 2500 words. The word count for the abstract should not exceed 300 words.

A-IV

Conflict of Interest Statement: To prevent potential conflicts of interest from being overlooked, this statement must be included in each manuscript. In case there are conflicts of interest, every author should complete the ICMJE general declaration form, which can be obtained at http://www.icmje.org/downloads/coi_disclosure.zip Abstract and Keywords: The second page should include an abstract that does not exceed 300 words. For manuscripts sent by authors in Turkey, a title and abstract in Turkish are also required. As most readers read the abstract first, it is critically important. Moreover, as various electronic databases integrate only abstracts into their index, important findings should be presented in the abstract.

Objective: The abstract should state the objective (the purpose of the study and hypothesis) and summarize the rationale for the study.

Materials and Methods: Important methods should be written respectively.

Results: Important findings and results should be provided here.

Conclusion: The study’s new and important findings should be highlighted and interpreted.

Other types of manuscripts, such as reviews, brief reports, and editorials, will be published according to uniform requirements.

Provide 3-10 keywords below the abstract to assist indexers. Use terms from the Index Medicus Medical Subject Headings List (for randomized studies a CONSORT abstract should be provided: http:// www.consort-statement.org).

Introduction: The introduction should include an overview of the relevant literature presented in summary form (one page), and whatever remains interesting, unique, problematic, relevant, or unknown about the topic must be specified. The introduction should conclude with the rationale for the study, its design, and its objective(s).

Materials and Methods: Clearly describe the selection of observational or experimental participants, such as patients, laboratory animals, and controls, including inclusion and exclusion criteria and a description of the source population. Identify the methods and procedures in sufficient detail to allow other researchers to reproduce your results. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for using them and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. The section should include only information that was available at the time the plan or protocol for the study was devised (https://www.strobe-statement.org/ fileadmin/Strobe/uploads/checklists/STROBE_checklist_v4_combined.pdf).

Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported results. Statistically important data should be given in the

text, tables, and figures. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used.

Results: Present your results in logical sequence in the text, tables, and figures. Do not present all the data provided in the tables and/or figures in the text; emphasize and/or summarize only important findings, results, and observations in the text. For clinical studies provide the number of samples, cases, and controls included in the study. Discrepancies between the planned number and obtained number of participants should be explained. Comparisons and statistically important values (i.e. p-value and confidence interval) should be provided.

Discussion: This section should include a discussion of the data. New and important findings/results and the conclusions they lead to should be emphasized. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by the data. Do not repeat the findings/results in detail; important findings/ results should be compared with those of similar studies in the literature, along with a summarization. In other words, similarities or differences in the obtained findings/results with those previously reported should be discussed.

Study Limitations: Limitations of the study should be detailed. In addition, an evaluation of the implications of the obtained findings/ results for future research should be outlined.

Conclusion: The conclusion of the study should be highlighted.

References Cite references in the text, tables, and figures with numbers in square brackets. Number references consecutively according to the order in which they first appear in the text. Journal titles should be abbreviated according to the style used in Index Medicus (consult List of Journals Indexed in Index Medicus). Include among the references any paper accepted, but not yet published, designating the journal followed by “in press”.

Examples of References: 1. List all authors Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow transplantation from unrelated donors for patients with aplastic anemia after failure of immunosuppressive therapy. Blood 2006;108:1485-1491.

2. Organization as author Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of syngeneic bone marrow graft without preconditioning in post-hepatitis marrow aplasia. Lancet 1977;2:742-744.

3. Book Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961.

4. Book Chapter Perutz MF. Molecular anatomy and physiology of hemoglobin. In: Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin:

A-V

Genetics, Pathophysiology, Clinical Management. New York, Cambridge University Press, 2000.

5. Abstract Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin) stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).

6. Letter to the Editor Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further definition of 20q deletion in myeloid leukemia using fluorescence in situ hybridization. Blood 1994;84:2821-2823.

7. Supplement Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant 2005;9(Suppl 7):81-86.

Brief Reports Abstract length: Not to exceed 150 words.

Article length: Not to exceed 1200 words.

Introduction: State the purpose and summarize the rationale for the study.

Materials and Methods: Clearly describe the selection of the observational or experimental participants. Identify the methods and procedures in sufficient detail. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for their use and an evaluation of their limitations.

Identify all drugs and chemicals used, including generic names, doses, and routes of administration.

Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported findings/results. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used.

Results: Present the findings/results in a logical sequence in the text, tables, and figures. Do not repeat all the findings/results in the tables and figures in the text; emphasize and/or summarize only those that are most important.

Discussion: Highlight the new and important findings/results of the study and the conclusions they lead to. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by your data.

Invited Review Articles Abstract length: Not to exceed 300 words.

Article length: Not to exceed 4000 words.

Review articles should not include more than 100 references. Reviews should include a conclusion, in which a new hypothesis or study about the subject may be posited. Do not publish methods for literature search or level of evidence. Authors who will prepare review articles should already have published research articles on the relevant subject. The study’s new and important findings should be highlighted and interpreted in the Conclusion section. There should be a maximum of two authors for review articles.

Perspectives in Hematology “Perspectives” are articles discussing significant topics relevant to hematology. They are more personal than a Review Article. Authors wishing to submit a Perspective in Hematology article should contact the Editor in Chief prior to submission in order to screen the proposed topic for relevance and priority. Articles submitted for “Perspectives in Hematology” must advance the hot subjects of experimental and/or clinical hematology beyond the articles previously published or in press in TJH. Perspective papers should meet the restrictive criteria of TJH regarding unique scientific and/or educational value, which will impact and enhance clinical hematology practice or the diagnostic understanding of blood diseases.

Priority will be assigned to such manuscripts based upon the prominence, significance, and timeliness of the content. The submitting author must already be an expert with a recognized significant published scientific experience in the specific field related to the “Perspectives” article.

slides. Explain the internal scale and identify the staining method used.

Figures should be submitted as separate files, not in the text file. Highresolution image files are not preferred for initial submission as the file sizes may be too large. The total file size of the PDF for peer review should not exceed 5 MB. Authorship Each author should have participated sufficiently in the work to assume public responsibility for the content. Any portion of a manuscript that is critical to its main conclusions must be the responsibility of at least one author.

Contributor’s Statement

References: Should not include more than 50 references

All submissions should contain a contributor’s statement page. Each statement should contain substantial contributions to idea and design, acquisition of data, and analysis and interpretation of findings. All persons designated as an author should qualify for authorship, and all those that qualify should be listed. Each author should have participated sufficiently in the work to take responsibility for appropriate portions of the text.

Images in Hematology

Acknowledgments

Article length: Not to exceed 200 words.

Acknowledge support received from individuals, organizations, grants, corporations, and any other source. For work involving a biomedical product or potential product partially or wholly supported by corporate funding, a note stating, “This study was financially supported (in part) with funds provided by (company name) to (authors’ initials)”, must be included. Grant support, if received, needs to be stated and the specific granting institutions’ names and grant numbers provided when applicable.

Abstract length: Not to exceed 150 words.

Article length: Not to exceed 1000 words.

Authors can submit for consideration illustrations or photos that are interesting, instructive, and visually attractive, along with a few lines of explanatory text and references. Images in Hematology can include no more than 200 words of text, 5 references, and 3 figures or tables. No abstract, discussion, or conclusion is required, but please include a brief title.

Letters to the Editor Article length: Not to exceed 500 words.

Letters can include no more than 500 words of text, 5-10 references, and 1 figure or table. No abstract is required, but please include a brief title.

The total number is usually limited to a maximum of five authors for a letter to the editor.

Tables Supply each table in a separate file. Number tables according to the order in which they appear in the text, and supply a brief caption for each.

Give each column a short or abbreviated heading. Write explanatory statistical measures of variation, such as standard deviation or standard error of mean. Be sure that each table is cited in the text.

Figures Figures should be professionally drawn and/or photographed. Authors should number figures according to the order in which they appear in the text. Figures include graphs, charts, photographs, and illustrations. Each figure should be accompanied by a legend that does not exceed 50 words.

Use abbreviations only if they have been introduced in the text. Authors are also required to provide the level of magnification for histological

A-VI

Authors are expected to disclose on the title page any commercial or other associations that might pose a conflict of interest in connection with the submitted manuscript. All funding sources that supported the work and the institutional and/or corporate affiliations of the authors should be acknowledged on the title page.

Ethics When reporting experiments conducted with humans indicate that the procedures were in accordance with ethical standards set forth by the committee that oversees human subject research. Approval of research protocols by the relevant ethics committee, in accordance with international agreements (Helsinki Declaration of 1975, revised 2013 available at https://www.wma.net/policies-post/wma-declarationof-helsinki-ethical-principles-for-medical-research-involving-humansubjects/), is required for all experimental, clinical, and drug studies.

Patient names, initials, and hospital identification numbers should not be used. Manuscripts reporting the results of experimental investigations conducted with humans must state that the study protocol received institutional review board approval and that the participants provided informed consent.

Non-compliance with scientific accuracy is not in accord with scientific ethics. Plagiarism: To re-publish, in whole or in part, the contents of another author’s publication as one’s own without providing a reference.

Fabrication: To publish data and findings/results that do not exist.

Duplication: Use of data from another publication, which includes republishing a manuscript in different languages. Salami slicing: To create more than one publication by dividing the results of a study unnecessarily.

We disapprove of such unethical practices as plagiarism, fabrication, duplication, and salami slicing, as well as efforts to influence the review process with such practices as gifting authorship, inappropriate acknowledgments, and references. Additionally, authors must respect participants‘ right to privacy.

On the other hand, short abstracts published in congress books that do not exceed 400 words and present data of preliminary research, and those that are presented in an electronic environment, are not considered as previously published work. Authors in such a situation must declare this status on the first page of the manuscript and in the cover letter.

(The COPE flowchart is available at http://publicationethics.org.)

We use iThenticate to screen all submissions for plagiarism before publication.

Conditions of Publication All authors are required to affirm the following statements before their manuscript is considered: 1. The manuscript is being submitted only to The Turkish Journal of Hematology; 2. The manuscript will not be submitted elsewhere while under consideration by The Turkish Journal of Hematology; 3. The manuscript has not been published elsewhere, and should it be published in The Turkish Journal of Hematology it will not be published elsewhere without the permission of the editors (these restrictions do not apply to abstracts or to press reports for presentations at scientific meetings); 4. All authors are responsible for the manuscript’s content; 5. All authors participated in the study concept and design, analysis and interpretation of the data, and drafting or revising of the manuscript and have approved the manuscript as submitted. In addition, all authors are required to disclose any professional affiliation, financial agreement, or other involvement with any company whose product figures prominently in the submitted manuscript.

Authors of accepted manuscripts will receive electronic page proofs and are responsible for proofreading and checking the entire article within two days. Failure to return the proof in two days will delay publication. If the authors cannot be reached by email or telephone within two weeks, the manuscript will be rejected and will not be published in the journal.

Copyright At the time of submission all authors will receive instructions for submitting an online copyright form. No manuscript will be considered for review until all authors have completed their copyright form. Please note, it is our practice not to accept copyright forms via fax, e-mail, or postal service unless there is a problem with the online author accounts that cannot be resolved. Every effort should be made to use the online

A-VII

copyright system. Corresponding authors can log in to the submission system at any time to check the status of any co-author’s copyright form.

All accepted manuscripts become the permanent property of The Turkish Journal of Hematology and may not be published elsewhere, in whole or in part, without written permission.

Note: We cannot accept any copyright form that has been altered, revised, amended, or otherwise changed. Our original copyright form must be used as is.

Units of Measurement Measurements should be reported using the metric system, according to the International System of Units (SI). Consult the SI Unit Conversion Guide, New England Journal of Medicine Books, 1992.

An extensive list of conversion factors can be found at https://www. nist.gov/sites/default/files/documents/pml/wmd/metric/SP1038.pdf. For more details, see http://www.amamanualofstyle.com/oso/public/jama/ si_conversion_table.html.

Abbreviations and Symbols Use only standard abbreviations. Avoid abbreviations in the title and abstract. The full term for an abbreviation should precede its first use in the text, unless it is a standard abbreviation. All acronyms used in the text should be expanded at first mention, followed by the abbreviation in parentheses; thereafter the acronym only should appear in the text.

Acronyms may be used in the abstract if they occur 3 or more times therein, but must be reintroduced in the body of the text. Generally, abbreviations should be limited to those defined in the AMA Manual of Style, current edition. A list of each abbreviation (and the corresponding full term) used in the manuscript must be provided on the title page.

Online Manuscript Submission Process The Turkish Journal of Hematology uses submission software powered

by ScholarOne Manuscripts. The website for submissions to The Turkish Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This system is quick and convenient, both for authors and reviewers.

Setting Up an Account New users to the submission site will need to register and enter their account details before they can submit a manuscript. Log in, or click the “Create Account” button if you are a first-time user. To create a new account: After clicking the “Create Account” button, enter your name and e-mail address, and then click the “Next” button. Your e-mail address is very important. Enter your institution and address information, as appropriate, and then click the “Next” Button. Enter a user ID and password of your choice, select your area of expertise, and then click the “Finish” button.

If you have an account, but have forgotten your log-in details, go to “Password Help” on the journal’s online submission system and enter your e-mail address. The system will send you an automatic user ID and a new temporary password.

Full instructions and support are available on the site, and a user ID and password can be obtained during your first visit. Full support for

authors is provided. Each page has a “Get Help Now” icon that connects directly to the online support system. Contact the journal administrator with any questions about submitting your manuscript to the journal (info@tjh.com.tr). For ScholarOne Manuscripts customer support, click on the “Get Help Now” link on the top right-hand corner of every page on the site.

The Electronic Submission Process Log in to your author center. Once you have logged in, click the “Submit a Manuscript” link in the menu bar. Enter the appropriate data and answer the questions. You may copy and paste directly from your manuscript.

Click the “Next” button on each screen to save your work and advance to the next screen.

Upload Files Click on the “Browse” button and locate the file on your computer. Select the appropriate designation for each file in the drop-down menu next to the “Browse” button. When you have selected all the files you want to upload, click the “Upload Files” button. Review your submission before sending to the journal. Click the “Submit” button when you are finished reviewing. You can use ScholarOne Manuscripts at any time to check the status of your submission. The journal’s editorial office will inform you by e-mail once a decision has been made. After your manuscript has been submitted, a checklist will then be completed by the Editorial Assistant. The Editorial Assistant will check that the manuscript contains all required components and adheres to the author guidelines. Once the Editorial Assistant is satisfied with the manuscript it will be forwarded to the Senior Editor, who will assign an editor and reviewers.

The Review Processs Each manuscript submitted to The Turkish Journal of Hematology is subject to an initial review by the editorial office in order to determine if it is aligned with the journal’s aims and scope and complies with essential requirements. Manuscripts sent for peer review will be assigned to one of the journal’s associate editors that has expertise relevant to the manuscript’s content. All accepted manuscripts are sent to a statistical and English language editor before publishing. Once papers have been reviewed, the reviewers’ comments are sent to the Editor, who will then make a preliminary decision on the paper. At this stage, based on the feedback from reviewers, manuscripts can be accepted or rejected, or revisions can be recommended. Following initial peer-review, articles judged worthy of further consideration often require revision. Revised manuscripts generally must be received within 3 months of the date of the initial decision. Extensions must be requested from the Associate Editor at least 2 weeks before the 3-month revision deadline expires; The Turkish Journal of Hematology will reject manuscripts that are not received within the 3-month revision deadline. Manuscripts with extensive revision recommendations will be sent for further review (usually by the same reviewers) upon their re-submission. When a manuscript is finally

A-VIII

accepted for publication, the Technical Editor undertakes a final edit and a marked-up copy will be e-mailed to the corresponding author for review and any final adjustments.

Submission of Revised Papers When revising a manuscript based on the reviewers’ and Editor’s feedback, please insert all changed text in red. Please do not use track changes, as this feature can make reading difficult. To submit revised manuscripts, please log in to your author center at ScholarOne Manuscripts. Your manuscript will be stored under “Manuscripts with Decisions”. Please click on the “Create a Revision” link located to the right of the manuscript title.

A revised manuscript number will be created for you; you will then need to click on the “Continue Submission” button. You will then be guided through a submission process very similar to that for new manuscripts.

You will be able to amend any details you wish. At stage 6 (“File Upload”), please delete the file for your original manuscript and upload the revised version. Additionally, please upload an anonymous cover letter, preferably in table format, including a point-by-point response to the reviews’ revision recommendations. You will then need to review your paper as a PDF and click the “Submit” button. Your revised manuscript will have the same ID number as the original version, but with the addition of an R and a number at the end, for example, TJH-2011-0001 for an original and TJH-2011-0001.R1, indicating a first revision; subsequent revisions will end with R2, R3, and so on. Please do not submit a revised manuscript as a new paper, as revised manuscripts are processed differently. If you click on the “Create a Revision” button and receive a message stating that the revision option has expired, please contact the Editorial Assistant at info@tjh.com.tr to reactivate the option.

English Language and Statistical Editing All manuscripts are professionally edited by an English language editor prior to publication. After papers have been accepted for publication, manuscript files are forwarded to the statistical and English language editors before publishing. Editors will make changes to the manuscript to ensure it adheres to TJH requirements. Significant changes or concerns are referred to corresponding authors for editing.

Online Early The Turkish Journal of Hematology publishes abstracts of accepted manuscripts online in advance of their publication. Once an accepted manuscript has been edited, the authors have submitted any final corrections, and all changes have been incorporated, the manuscript will be published online. At that time the manuscript will receive a Digital Object Identifier (DOI) number. Both forms can be found at www.tjh. com.tr. Authors of accepted manuscripts will receive electronic page proofs directly from the printer and are responsible for proofreading and checking the entire manuscript, including tables, figures, and references. Page proofs must be returned within 48 hours to avoid delays in publication.

CONTENTS Review 141 Extended Half-Life Coagulation Factors: A New Era in the Management of Hemophilia Patients

Muhlis Cem Ar, Can Balkan, Kaan Kavaklı; İstanbul, İzmir, Turkey

155

Research Articles

Long-term Dental Anomalies after Pediatric Cancer Treatment in Children Gülser Kılınç, Gülçin Bulut, Fahinur Ertuğrul, Hale Ören, Bengü Demirağ, Ayşe Demiral, Serap Aksoylar, Emine Serra Kamer, Hülya Ellidokuz, Nur Olgun; İzmir, Turkey

162

Ortho-Topolin Riboside Induced Differentiation through Inhibition of STAT3 Signaling in Acute Myeloid Leukemia HL-60 Cells Li Wang, Jiao Cheng, FanLin Lin, ShengXian Liu, Hui Pan, MingDa Li, ShanShan Li, Na Li, WeiPing Li; PanJin, Dalian, China

169

Acute Lymphoblastic Leukemia in Routine Practice: A Turkish Multicenter Study Rafiye Çiftçiler, Ömür Gökmen Sevindik, Ali İrfan Emre Tekgündüz, Mehmet Ali Erkurt, Filiz Vural, Burhan Turgut, Leylagül Kaynar, Bahriye Payzın, Mehmet Hilmi Doğu, Volkan Karakuş, Fevzi Altuntaş, Yahya Büyükaşık, Fatih Demirkan; Ankara, İstanbul, Malatya, İzmir, Tekirdağ, Kayseri, Muğla, Turkey

178

The Role of the Local Bone Marrow Renin-Angiotensin System in Multiple Myeloma Bülent Saka, Müge Sayitoğlu, Zülal İstemihan, M. Akif Karan, Nilgün Erten, Öner Doğan, Uğur Özbek, Sema Genç, Cemil Taşçıoğlu, Sevgi Kalayoğlu-Beşışık; İstanbul, Turkey

186

The Use of Allogeneic Mesenchymal Stem Cells in Childhood Steroid-Resistant Acute Graft-Versus-Host Disease: A Retrospective Study of a Single-Center Experience Ceyhun Bozkurt, Erdal Karaöz, Başak Adaklı Aksoy, Selime Aydoğdu, Tunç Fışgın; İstanbul, Turkey

193

Brief Report

Effectiveness of Sequential Compression Devices in Prevention of Venous Thromboembolism in Medically Ill Hospitalized Patients: A Retrospective Cohort Study Prajwal Dhakal, Ling Wang, Joseph Gardiner, Shiva Shrotriya, Mukta Sharma, Supratik Rayamajhi; Nebraska, Michigan, USA

199

Images in Hematology

201

Blastic Plasmacytoid Dendritic Cell Neoplasm with Leukemic Component Maria Jimenez Esteso; Alicante, Spain

203

Vacuolization in Myeloid and Erythroid Precursors in a Child with Menkes Disease Seçil Sayın, Şule Ünal, Mualla Çetin, Fatma Gümrük; Ankara, Turkey

205

Letters to the Editor

A Case of Anaplastic Lymphoma Kinase-positive Large B-cell Lymphoma Gaurav K. Gupta, Monika Pilichowska; Massachusetts, USA

Pediatric Deep Venous Thrombosis and Pulmonary Embolism: Can It Be Antiphospholipid Syndrome?

Fatma Demir Yenigürbüz, Hale Ören; İzmir, Turkey

A-IX

206

Pediatric Chronic Myeloid Leukemia Presenting in a Mixed Phenotypic Blast Crisis: A Rare Occurrence Jenna Bhattacharya, Richa Gupta; New Delhi, India

208

Myeloid Sarcoma of the Parotid Gland and Stomach Presenting with Obstructive Jaundice: A Rare Presentation Sugeeth M. Thambi, Sreejith G. Nair, Rony Benson, Jayasudha A. Vasudevan, Rekha A. Nair; Thiruvananthapuram, India

210

An Unusual Presentation of Hairy Cell Leukemia Smeeta Gajendra, Bhawna Jha, Sarita Prasad, Pratibha Dhiman, Manorama Bhargava; Gurgaon, India

212

Megakaryocytes in Peripheral Blood Smears Neha Garg, Rashmi Jain Gupta, Sunil Kumar; New Delhi, India

214

Outcome of Thrombotic Thrombocytopenic Purpura Patients: A Single-Center Experience Özcan Çeneli, Seda Yılmaz, Mehmet Ali Karaselek, Kazım Çamlı; Konya, Turkey

215

Severe Bone Marrow Hypoplasia with Black Cumin (Nigella sativa) Ingestion in a Patient with T-ALL in First Complete Remission Zehra Narlı Özdemir, Cemaleddin Öztürk, Işınsu Kuzu, Muhit Özcan; Ankara, Turkey

218

Tumor Lysis Syndrome Due to Targeting of Hepatocellular Carcinoma Associated with Chronic Myelomonocytic Leukemia Müfide Okay, Sıla Çetik, İbrahim C. Haznedaroğlu; Ankara, Turkey

220

MDM2 Oncogene Copy Number Alterations in Chronic Lymphocytic Leukemia Pathum Sookaromdee, Viroj Wiwanitkit; Bangkok, Thailand, Pune, India

A-X

REVIEW DOI: 10.4274/tjh.galenos.2019.2018.0393 Turk J Hematol 2019;36:141-154

Extended Half-Life Coagulation Factors: A New Era in the Management of Hemophilia Patients Uzatılmış Yarı Ömürlü Koagülasyon Faktörleri: Hemofili Tedavisinde Yeni Bir Dönem Muhlis Cem Ar1*,

Can Balkan2*,

Kaan Kavaklı2*

1İstanbul University-Cerrahpaşa, Cerrahpaşa Faculty of Medicine Department of Internal Medicine, Division of Hematology, İstanbul, Turkey 2Ege University Faculty of Medicine, Department of Pediatrics, Division of Hemato-Oncology, İzmir, Turkey

*Members of the Executive Board of Hemophilia Scientific Subcommittee, Turkish Society of Hematology

Abstract

Öz

Despite effective factor replacement and various treatment schedules, there remain several challenges and unmet needs in the prophylactic treatment of hemophilia limiting its adoption and thereby posing an increased risk of spontaneous bleeding. In this regard, extended half-life (EHL) recombinant factor VIII (rFVIII) and factor IX (rFIX) products promise optimal prophylaxis by decreasing the dose frequency, increasing the compliance, and improving the quality of life without compromising safety and efficacy. EHL products might lead to higher trough levels without increasing infusion frequency, or could facilitate the ability to maintain trough levels while reducing infusion frequency. This paper aims to provide a comprehensive review of the rationale for developing EHL coagulation factors and their utility in the management of hemophilia, with special emphasis on optimal techniques for half-life extension and criteria for defining EHL coagulation factors, as well as indications, efficacy, and safety issues of the currently available EHL-rFVIII and EHL-rFIX products.

Potential impacts of these factors on quality of life, health economics, and immune tolerance treatment will also be discussed alongside the challenges in pharmacokinetic-driven prophylaxis and difficulties in monitoring the EHL products with laboratory assays.

Etkin faktör yerine koyma tedavisi ve değişik tedavi programlarına rağmen günümüzde hemofilinin profilaktik tedavisinde hala çözülmemiş sorunlar ve karşılanmamış gereksinimler vardır. Bu nedenle kanama riski ve kanamaya bağlı komplikasyonlar önemini korumaktadır. Bu bağlamda profilakside kullanılacak uzatılmış yarı ömürlü rekombinant faktör VIII ve faktör IX ürünleri tedavinin güvenlilik ve etkililiğinden ödün vermeksizin doz sıklığının azaltılması, hasta uyumunun artması ve yaşam kalitesinin düzelmesini sağlayarak optimal tedavi koşullarının oluşmasına yardımcı olabilir. Uzatılmış yarı ömürlü faktörler infüzyon sıklığını artırmadan daha yüksek çukur değerler ulaşılması veya mevcut çukur değerin daha seyrek infüzyonla idamesi konusunda önemli bir açılım sağlayabilir. Bu derlemede uzatılmış yarı ömürlü faktör konsantrelerinin geliştirilmesine neden gerek duyulduğu, hemofili tedavisindeki olası yerleri, faktör yarı ömrünü uzatmak için kullanılan teknikler ve mevcut uzatılmış yarı ömürlü faktör konsantrelerinin etkililik, güvenlilik ve endikasyonları ile ilişkili kapsamlı bilgi sunulacaktır. Ayrıca bu ürünlerin yaşam kalitesi ve sağlık ekonomisi üzerine etkileri, immün tolerans tedavisindeki yerleri, farmakokinetik temelli profilaside kullanımları ile laboratuvar izleminde karşılaşılan güçlükler tartışılacaktır.

Keywords: Hemophilia, Factor replacement therapy, Extended halflife products, Laboratory assays, Pharmacokinetics, Quality of life

Anahtar Sözcükler: Hemofili, Faktör replasman tedavisi, Uzatılmış yarı ömürlü ürünler, Farmakokinetik, Yaşam kalitesi

Introduction Hemophilia A and B are X-linked monogenic inborn coagulation defects that lead to deficiencies of factor VIII (FVIII) and factor IX (FIX) in approximately 1 of 5000 and 1 of 30,000 male live births, respectively [1,2,3].

The disease phenotype is characterized by recurrent spontaneous or traumatic bleeding episodes predominantly involving the weight-bearing joints, skeletal muscle, and soft tissues. Intracranial and retroperitoneal hematomas are rare but life-threatening complications of severe hemophilia [1,3]. The bleeding phenotype has been defined as “severe”,

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Muhlis Cem AR, M.D., PhD, İstanbul University-Cerrahpaşa, Cerrahpaşa Faculty of Medicine Department of Internal Medicine, Division of Hematology, İstanbul, Turkey Phone : +90 212 414 30 00 E-mail : mcemar68@yahoo.com ORCID-ID: orcid.org/0000-0002-0332-9253

Received/Geliş tarihi: November 11, 2018 Accepted/Kabul tarihi: May 13, 2019

141

Ar MC, et al: A New Era in the Management of Hemophilia Patients

“moderate”, and “mild” based on the level of the residual endogenous factor being <1 IU/dL, 1-5 IU/dL, and 5-40 IU/dL, respectively [4,5].

Replacement of the missing factor constitutes the mainstay of hemophilia treatment. Factor replacement is given either on demand to treat acute bleeding or prophylactically to prevent bleeding [2,6]. In severe hemophilia, recurrent bleeding, typically in the form of joint bleeds and skeletal muscle hematomas, results in progressive hemophilic arthropathy and muscle contractures, which eventually lead to irreversible joint damage, significant disability, and decreased quality of life unless treated with FVIII and FIX [4,5,6,7,8].

Regular prophylactic factor replacement to maintain circulating factor levels of >1 IU/dL (1%) has been recommended as the optimal therapy for people with severe hemophilia, based on evidence showing that prophylaxis is associated with substantial reduction in bleeding episodes and related complications and consequently with an improvement in the quality of life and life expectancy [9,10,11].

In the prophylactic setting, people with severe hemophilia A usually require intravenous injections three times a week, while those with severe hemophilia B are usually treated twice weekly, owing to the longer half-life of FIX compared to FVIII (18-20 h vs. 8-12 h) [2,12].

Due to the relatively short half-life of conventional factor concentrates, frequent intravenous administrations are required to maintain plasma factor levels above the target threshold level to avoid bleeding, and this necessitates frequent injections [13,14]. The requirement for frequent dosing not only creates venous access problems but also poses an obstacle to patient adherence and proper use and adoption of prophylaxis [15,16,17,18]. This, in turn, may lead to treatment failure, resulting in increased disability [19,20,21,22,23]. Hence, there is an unmet need for factor concentrates with longer halflives that would allow for a more successful prophylaxis at less frequent dosing [23,24,25] and would consequently result in reduced prophylactic treatment burden for patients and caregivers.

Much effort has been devoted to the optimization of the pharmacokinetics (PKs) of recombinant factors by molecular modifications to achieve extended half-life (EHL) FVIII and FIX products [3,23,26,27]. The new-generation EHL factor concentrates are expected to facilitate the implementation of optimal prophylaxis, allowing longer treatment intervals without loss of efficacy. Treatment with EHL factors would reduce the burden of frequent intravenous interventions, enable higher adherence to treatment, and improve quality of life [4,28,29,30,31].

142

Turk J Hematol 2019;36:141-154

During the past decade numerous techniques have been invented for the development of EHL-rFVIII and -rFIX molecules, all of which principally exert their effect by decreasing the clearance of the factors. A combination of reduced proteolysis in peripheral blood, decreased renal and hepatic elimination, and decreased receptor-mediated endocytosis usually results in prolongation of the half-life of the factor [32]. Several novel EHL-rFVIII and -rFIX products have entered the market or are about to launch following the completion of their phase 3 studies [33,34,35,36,37,38,39,40,41].

This paper aims to provide a comprehensive review of the rationale for developing EHL coagulation factors and their utility in the management of hemophilia, with special emphasis on optimal techniques for half-life extension and criteria for defining EHL coagulation factors, as well as indications, efficacy, and safety issues of the currently available EHL-rFVIII and EHLrFIX products. Potential impacts of these factors on quality of life, health economics, and immune tolerance treatment will be also be discussed alongside the challenges in PK-driven prophylaxis and difficulties in monitoring EHL products with laboratory assays.

Evolution of Factor Replacement Therapy Management of hemophilia mainly depends on replacing the missing coagulation factor to stop (episodic or on-demand therapy) or to prevent (prophylaxis) bleeding episodes [4,5].

The concept of prophylaxis is based on early experiences with patients having mild to moderate hemophilia (factor levels >1%) who bled less frequently and rarely developed arthropathy [7].

Prophylaxis has been considered as the gold standard for the management of hemophilia as it prevents bleeding and delays development of joint damage by providing sufficient levels of the missing factor [17,42]. Several prospective studies have definitively shown the superiority of prophylaxis compared to on-demand treatment in reducing the frequency of joint bleeds and hemophilic arthropathy, and in improving the quality of life [17,43,44,45,46]. Since 1994 prophylaxis with coagulation factors has been regarded as the standard of care for the management of hemophilia. Early implementation of prophylaxis might prevent the development of arthropathy in children and might slow down the progression of established arthropathy in adults [5,47,48].

EHL Coagulation Factors: An Unmet Need FVIII and FIX are large, complex proteins with relatively short half-lives, necessitating frequent dosing to maintain therapeutic levels. EHL coagulation factors are designed to have prolonged half-lives through some structural modifications, such as chemical alterations or fusion of the factor protein to another molecule with a longer half-life. In theory, an extended

Turk J Hematol 2019;36:141-154

half-life product is expected to result in better adherence to treatment and improved prophylactic outcomes by allowing for less frequent injections [49].

The optimal method for half-life extension should not cause any change in the biological activity and safety of the coagulation factor [49]. The definition of a clinically relevant extension of half-life is usually based on some practical criteria such as the dosing schedule and the intended clinical application (e.g., ondemand vs prophylaxis) [49]. The lower clearance rate of EHL factors provides potential for reducing treatment burden with less frequent injections and equal or improved efficacy without increasing the overall factor consumption [14]. This allows greater flexibility for individualizing prophylaxis according to the needs of the patient, leading to better adherence and consequently improved standard of care in hemophilia [14,50].

Technologies Used for Extending the Half-Life of Recombinant Clotting Factors The strategies to prolong the half-life of recombinant coagulation factors include i) covalent attachment of the coagulation factor to polyethylene glycol (PEG; PEGylation) to reduce interaction with clearance receptors; ii) integrating the coagulation factor with the fragmented crystallizable (Fc) portion of the immunoglobulin G1 (IgG1) molecule to divert the molecule away from lysosomal degradation to delay its clearance or iii) combining the coagulation factor and recombinant albumin, to rescue endocytosed proteins from the intracellular degradation pathway; and iv) single-chain technology for augmenting the stability of the molecule [4,19,51,52].

PEGylation The pharmacokinetic and pharmacodynamic properties of the coagulation factors can be changed through PEGylation, which involves the covalent binding of PEG to FVIII or FIX [19]. The circulating half-life of the PEGylated factor concentrates is increased through PEGylation, which decreases the binding potential of the PEGylated proteins to their clearance receptors and consequently reduces their degradation [19,52].

Overall, PEGylation of therapeutic molecules has generally been associated with a low risk of immunogenicity [19]. The preclinical study results of the extended half-life product BAY 94-9027 suggested that this compound was significantly less immunogenic in hemophilia A mice, normal rats, and normal rabbits when compared to the un-PEGylated rFVIII. However, human data are lacking [53].

PEGylated factors have been reported to have a half-life prolongation of about 1.5-fold when compared to the standard half-life (SHL) factors. Excellent safety and efficacy data in previously treated adults and children with severe hemophilia A have been reported with EHL factors. No inhibitory antibodies

Ar MC, et al: A New Era in the Management of Hemophilia Patients

have been identified to FVIII, the PEGylated product, or to PEG [4,29,33,54,55,56]. The development of antiâ&#x20AC;?PEG antibodies in patients treated with other PEGylated protein products has been reported, which led the FDA to recommend the screening of anti-PEG antibodies in all subjects receiving experimental PEGylated therapeutics, as well as the evaluation of the potential roles of these antibodies on efficacy and safety [57,58,59].

Fusion Protein Technology (Fc Fusion and Albumin Fusion) Fusion protein technology involves genetic fusion with a protein that has a particularly long half-life, such as immunoglobulins (Fc fusion) or albumin [28,60,61]. Albumin and IgG are naturally occurring proteins with long half-lives (exceeding 20 days) and account for about 80% of the proteins in plasma, making them useful tools for fusion protein technologies [52]. The prolonged half-lives of albumin and IgG are a result of neonatal Fc receptor (FcRn)-mediated recycling, a naturally occurring recycling pathway that prolongs the half-lives of various proteins by diverting them away from lysosomal degradation, which leads to delayed clearance and extended functional plasma half-lives [19,49,52].

Albumin fusion technology has recently been utilized for the prolongation of the half-life of rFIX [28]. The mean half-life extension of rFVIII-Fc is about 1.5-fold that of SHL-FVIII [4,29].

The modest increase in the half-life of FVIII when attached to albumin as compared with the fivefold half-life extension seen with FIX when fused with Fc has been considered to be mainly due to the interaction of FVIII with von Willebrand factor (VWF) as the main regulator of FVIII clearance [54,62].

The long-term efficacy and safety of rFVIII-Fc in the management of bleeding and prophylaxis of previously treated patients (PTPs) with severe hemophilia A have been confirmed by several studies, including pivotal phase III trials (A-LONG) done in adults and adolescents aged >12 years, the Kids A-LONG trial performed in children aged â&#x2030;¤12 years, and ASPIRE, a recently completed extension study [4,34,63,64].

Single-Chain Technology Human FVIII is a heterodimeric structure consisting of a heavy chain (A1-A2-B domains) and a light chain (A3-C1-C2 domains) attached to each other by noncovalent bonds, which makes it relatively unstable and easily dissociable to inactivated FVIII chains [4,23,49]. A novel recombinant single-chain FVIII (rVIIISingleChain) has been engineered, in which the heavy and light chains are covalently bound through a truncated B domain [4,65,66]. This single-chain design has been reported to yield a more stable and homogeneous product, with increased binding affinity for VWF and improved PKs relative to the full-length rFVIII, potentially prolonging the half-life of FVIII [4,23,29].

Although rVIII-SingleChain was well tolerated in clinical studies and did not lead to the development of inhibitory antibodies, 143

Ar MC, et al: A New Era in the Management of Hemophilia Patients

Turk J Hematol 2019;36:141-154

the extension of the half-life using this technology was modest, being 1.1- to 1.4-fold of the original FVIII half-life [65,66,67].

are B-domain-deleted (BDD) rFVIII, whereas BAX 855 is a fulllength rFVIII [6,41,56,68] (Table 1).

Currently Available EHL-rFIX and EHL-rFVIII Products

The main characteristics of EHL concentrates are provided in Table 2. For all three EHL-rFIX, an unmodified rFIX protein was used and an increase in the extension of rFIX half-life (3.8fold, ranging from 2.4- to 4.8-fold) and extension in the dosing frequency for prophylaxis (ranging from 7 to 14 days) were evident when compared to the SHL-FIX [26]. Management of bleeding episodes as well as prophylactic replacement therapy with all three EHL-rFIX products have been reported to be successful, providing evidence for high overall hemostatic activity. Bleeding episodes could effectively be treated with 1 or 2 injections. A consistent decrease in clearance and increased area under the curve (AUC) as well as an increased incremental recovery were noted for all three EHL-rFIX for the same dose of 50 IU/kg of EHL-rFIX in comparison to SHL-rFIX, leading to substantial and meaningful prolongations of halflife and justifying a once weekly dosing regimen. Overall, the safety profiles of all three EHL-rFIX products were satisfactory in the adolescent and adult setting, with no signs of inhibitor development or drug-related serious adverse events (Table 2).

Three EHL-rFIX products have completed phase 3 clinical studies and are licensed for adolescent and adult patients [26,41], including rFIXFc (Alprolix, Sobi, Stockholm, Sweden; Bioverativ, a Sanofi company, Waltham, MA, USA) [37], nonacog beta pegol (N9-GP, Novo Nordisk A/S, BagsvĂŚrd, Denmark) [39], and rFIXFP (Idelvion, CSL Behring, King of Prussia, PA, USA) [38] (Table 1).

There are four EHL-rFVIII products that have completed phase 3 clinical studies. rFVIIIFc (Elocta, Sobi, Stockholm, Sweden; Eloctate, Bioverativ, Waltham, MA, USA) [34] and octocog alfa pegol (Adynovate, BAX 855, Baxalta, Vienna, Austria) [33] are licensed in some countries. Turoctocog alfa pegol (N8-GP, Novo Nordisk A/S, BagsvĂŚrd, Denmark) [35] has completed a phase 3 study and phase 2/3 data were published for BAY 949027 (Jivi, Bayer Healthcare AG, Leverkusen, Germany) [56].

Finally, a B-domain-truncated single-chain rFVIII concentrate, ScrFVIII (Afstyla), has recently been licensed by CSL Behring in some countries [40]. However, this product displays a modest extension in half-life and is not regarded as an extended halflife concentrate (Table 1).

Considering the mechanisms of half-life extension in rFIX concentrates, rFIX-Fc (Alprolix) fuses the Fc immunoglobulin region with FIX, while rFIX-FP (Idelvion) combines FIX with albumin and N9-GP (Rebinyn/Refixia) is a PEGylated version of FIX. As with EHL-rFIX concentrates, EHL-rFVIII concentrates are also based on Fc fusion (rFVIIIFc, Elocta/Eloctate) or PEGylation (N8-GP; BAX 855 and BAY 94-9027). BAY 94-9027 and N8-GP

The half-life extension of EHL-rFVIII products is in the range of 1.4- to 1.6-fold and the annualized bleeding rates (ABRs) were below 4, ranging from 1.3 to 3.6. Bleeds were treated successfully with EHL-rFVIII, resolving with one or two injections in more than 96% of episodes. Hemostatic efficacy was rated as good or excellent in more than 90% of the bleeding episodes.

No inhibitor development has been reported in clinical trials with the EHL-FVIII products (Table 2).

Data on the use of EHL products in the pediatric age group [64,69,70,71] revealed low median ABRs ranging from 1 to 3

Table 1. Currently available EHL-rFVIII and -rFIX concentrates [41].

Generic name

Company

Mechanism

Half-life (h)

Current status

Reference

Factor VIII - extended half-life concentrates Elocta/eloctate (rFVIII-Fc)

Efraloctocog alfa

Bioverativ/ Fc (IgG1) fusion to B-domainSobi deleted FVIII

19.0

Licensed

[34]

Adynovate (BAX 855)

Octocog alfa pegol

Shire

PEGylated to full-length FVIII, porcine sequence

14.3

Licensed

[33]

N8-GP

Turoctocog alfa pegol

Novo Nordisk

PEGylated (40 kDa) B-domain- 19.0 truncated FVIII

In phase 3 trials

[35]

Jivi (BAY 94-9027)

Damoctocog alfa pegol

Bayer

PEGylated (60 kDa) B-domain- 18.7 deleted FVIII

Licensed

[36]

Factor IX - extended half-life concentrates Alprolix

rFIX-Fc

Bioverativ/ Fc fusion to FIX Sobi

82.1

Licensed

[37]

Idelvion

rFIX-FP

CSL Behring

Albumin fusion to FIX

102

Licensed

[38]

Rebinyn/refixia (N9-GP)

Nonacog beta pegol

Novo Nordisk

PEGylation of FIX

96.3

Licensed

[39]

EHL-rFVIII: Extended half-life recombinant factor VIII, FP: fusion protein, PEG: polyethylene glycol.

144

Ar MC, et al: A New Era in the Management of Hemophilia Patients

Turk J Hematol 2019;36:141-154

Table 2. Characteristics of EHL-rFIX and -rFVIII products.

EHL-rFIX products rFIXFc (Alprolix) [37]

rFIX-FP (Idelvion) [39]

N9-GP (Rebinyn/Refixia) [38]

rFIX protein

Non-modified

Non-modified

Non-modified

Half-life extension moiety

Fc portion of Ig

Recombinant human albumin

40-kDa polyethylene glycol moiety

Linking method

Fusion of Fc to rFIX

Fusion of recombinant albumin to rFIX

Site-directed glycoPEGylation of rFIX

Cell line

HEK cells

CHO cells

CHO cells

Mechanism of half-life extension

FcRn recycling

FcRn recycling

Decreased renal filtration, proteolytic degradation, and receptor-mediated clearance of protein

Mean half-life for EHL product

82.1

102

96.25

Mean half-life for standard rFIX

33.8

24.2

19.3

EHL-rFIX to SHL-rFIX ratio

2.4-fold

4.2 fold

4.8-fold

Pharmacokinetic/dynamic properties

rFIXFc (Alprolix)

rFIX-FP (Idelvion)

N9-GP (Rebinyn/Refixia)

Dose used, IU/kg

50

50

40

-

Area under the curve (AUC), h-IU/dL

3664

7176

14,130

-

Clearance, mL/kg

0.74

0.77

0.42

-

Incremental recovery, IU/dL or IU/kg

0.92

1.27

2

-

Efficacy

rFIXFc (Alprolix)

rFIX-FP (Idelvion)

N9-GP (Rebinyn/Refixia)

Dose, IU/kg

50

100

40

75

10

40

Dosing frequency, days

Every 7 days

Every 10/14 days

Every 7 days

Every 14 days

Every 7 days

Every 7 days

Number of participants

61

26

40

21

30

29

Annualized bleeding rate, median (IQR)

3.0 (1.0, 4.4)

1.4 (0.0, 3.4)

0.0 (0.0, 1.87)

1.08 (0.0, 2.7)

2.93 (0.9, 6.0)

1.0 (0.0, 4.0)

No. of injections required for bleed resolution

1-2

1-2

1-2

Overall hemostatic efficacy, %

97.2

96.7

97.1

Safety profile

rFIXFc (Alprolix)

rFIX-FP (Idelvion)

N9-GP (Rebinyn/Refixia)

No. of patients with inhibitors

0

0

0

No. of patients with noninhibitor antibodies

3

0

3

No. of deaths, thromboembolism

0

0

0

No. of drug-related serious adverse events

0

0

0

No. of drug-unrelated serious adverse events

11

3

4

General properties

Half-life properties

145

Ar MC, et al: A New Era in the Management of Hemophilia Patients

Turk J Hematol 2019;36:141-154

Table 2. Continued.

EHL-rFVIII products BAY 94-9027 (Jivi) [35]

BAX 855 rFVIIIFc (Elocta/Eloctate) [34] (Adynovate) [36]

N8-GP [33]

rFIX/rFVIII protein

B-domain-deleted rFVIII

Full-length rFVIII

B-domain-deleted rFVIII

B-domain-deleted rFVIII

Half-life extension moiety

60-kDa PEG molecule

2x20-kDa PEG molecule

Fc portion of Ig

40-kDa PEG molecule

Cell line

BHK

CHO

HEK

CHO

Mechanism of half-life extension

Decreased renal filtration, proteolytic degradation, and receptor-mediated clearance

Decreased renal filtration, proteolytic degradation, and receptormediated clearance

Neonatal Fc receptor recycling

Decreased renal filtration, proteolytic degradation, and receptor-mediated clearance

Mean half-life for EHL product

18.7

14.3

19.0

19.0

Min-max half-life

13.7-28.1

14.3-16.0

17.1-21.1

11.6-27.3

Fold increase in half-life

1.4

1.4

1.5

1.6

Bleeds resolved with 1 injection, %

-

85.4

87.3

84

Bleeds resolved with 1 or 2 injections, %

-

95.9

97.8

96

ABR on prophylaxis, median

2.88 (once weekly) 1.9 (twice weekly) 1.6 (every 3-5 days) [34]

1.3 (q4 days)

Overall hemostatic efficacy, %

>90

>90

>90

-

-

General properties

Linking method

Half-life properties

Efficacy

>90

Safety No. of patients with noninhibitor antibodies

-

-

Pharmacokinetics of EHL-rFVIII and -rFIX products in children Half-life

Dosing

Reference

rFVIIIFc

14.9 (in 6-12 year olds), 12.7 (<6 year olds)

Twice weekly with 25 IU/kg on day 1 and 50 IU/kg on day 4

[65]

rFIXFc

70.3 h (6-12 year olds), 66.5 (<6 year olds)

50-60 IU/kg once weekly

[70]

rFIX-FP

91 h

50 IU/kg once weekly

[71]

N9-GP

76.3 h (6-12 year olds), 69.6 (<6 year olds)

40 IU/kg once weekly

[69]

EHL-rFIX: Extended half-life recombinant factor IX, rFIXFc: recombinant factor IX Fc fusion protein, rFIX-FP: recombinant factor IX albumin fusion protein, N9-GP: glycoPEGylated rFIX, FcRn: neonatal Fc receptor, AUC: area under the curve, EHL-rFIX: extended half-life rFIX, SHL-rFIX: standard half-life rFIX, BHK: baby hamster kidney, CHO: Chinese hamster ovary, HEK: human embryonic kidney, PEG: polyethylene glycol, ABR: annualized bleeding rate.

bleeds, with no major difference between the products and no inhibitor development [26]. The modest prolongation achieved in the half-life of the FVIII products achieved through extension techniques could only reduce the treatment frequency to twice weekly.

146

The safety and efficacy as well as the PK profile of rVIIISingleChain have been studied within the framework of a clinical trial program called AFFINITY, consisting of a series of phase I/III studies [29,66,72]. Preliminary data from this program showed excellent/good hemostatic efficacy in both prophylactic

Turk J Hematol 2019;36:141-154

and episodic treatment with a good safety profile. No inhibitor development has been reported to date with rVIII-SingleChain [72]. PK analysis showed a favorable PK profile for rVIIISingleChain compared to full-length rFVIII, though the half-life was relatively shorter and the clearance relatively higher in the pediatric group [73].

Criteria for Classifying a Replacement Factor as an EHL Product The advent of EHL recombinant factors has been an important evolution in concentrate manufacturing, providing a new treatment tool for individualized hemophilia care [41,74,75].

However, as is the case with every new treatment option that enters the market, the introduction of EHL coagulation factors has also raised concerns regarding their optimal utility to provide the best possible outcome for each patient [52].

Ideally, EHL recombinant factors should allow reduced dosing frequency with retention of hemostatic efficacy compared to SHL recombinant factors for the majority of patients [76]. However, the current literature does not provide clarity regarding the definition of EHL and SHL products [76].

Given the tight non-covalent association of FVIII with VWF in the circulation, which imposes a biological limit on the extension of the half-life of FVIII beyond that of VWF, the EHL-rFVIII products have not had an equally substantial improvement in half-life as observed with EHL-rFIX products [76,77]. EHL-rFIX products demonstrated a 3- to 5-fold increase in half-life compared to standard FIX concentrates, providing a clear threshold for differentiating the EHL products from the standard ones [76,78].

However, this is not always the case for FVIII products. In a modeling study designed to identify the minimum half-life extension ratio required for a reduction in dosing frequency while maintaining the proportion of patients with plasma rFVIII levels >1 IU/dL with no increase in the total weekly dose, the authors found that a meaningful reduction in the infusion burden of an EHL-rFVIII product (relative to a standard rFVIII) is only possible when the half-life extension ratio is ≥1.3 [79]. In addition, it has been suggested that both the AUC ratio and the half-life ratio should be used to provide sufficient PK evidence for a solid definition of EHL [76]. Accordingly, “EHL-rFVIII” designation requires the fulfillment of the following 3 criteria: i) the product should be designed and engineered with relevant technology used to extend the circulating biological half-life; ii) the difference from the SHL-rFVIII comparator should be demonstrated for the majority of patients according to the proposed “bio-difference” criterion based on the lower limit of the 90% CI for the AUC ratio being above the FDA/EMA cut-off for bioequivalence (1.25 or 125%); and iii) a half-life ratio of 1.3 or higher, based on modeling, should be achieved [76,79].

Ar MC, et al: A New Era in the Management of Hemophilia Patients

BAX 855 and rFVIIIFc have been reported to clearly comply with all 3 of these criteria, while rFVIII-SingleChain failed to fulfill the criteria since it cannot be fully differentiated from the standard rFVIII (Advate®), based on the 90% CIs for the AUC ratio extending below 1.25 and a half-life extension ratio of 1.09 when compared to Advate®. This suggests that rFVIIISingleChain may behave like standard rFVIII in some patients despite its modified PK characteristics [76]. Although there are some limitations imposed by the different study designs and reporting, current evidence suggests that both BAY 94-9027 and N8-GP fulfill the criteria for EHL-rFVIII, signifying that they should be classified as EHL-rFVIII products [76].

Definition and classification are always of help for a better understanding of the potential benefits and limitations of recombinant factor products. However, one should never forget that these cannot substitute for careful clinical monitoring of patients, including measurement of rFVIII levels and individual PK profiles.

Indications and Utility of EHL: Switching from SHL Factors to EHL Factors The published phase I-III studies on prophylaxis with EHLrFVIII and -rFIX products revealed improved PK profiles with prolonged half-lives ranging from 1.2- to 1.5-fold for FVIII and 3- to 5-fold for FIX [19]. EHL products were shown to be well tolerated with no inhibitor development in the PTP population.

They were efficacious in the treatment and prevention of bleeding episodes with the potential to reduce the infusion load and to achieve higher trough levels [19,74,76].

The market availability of effective EHL products with the potential of reducing infusion frequency will inevitably induce a transition from SHL to EHL factor concentrates, in both episodic treatment and prophylactic settings. Extension of half-life might lead to higher trough levels without increasing infusion frequency, or could facilitate the ability to maintain trough levels while reducing infusion frequency. Either of these strategies could be implemented to improve outcomes, depending on the characteristics of the patient [74,75]. In a study using dosing simulations to investigate potential clinical outcomes via different prophylactic regimens with rFVIIIFc and rFVIII, the authors suggested that patients with different needs might benefit in different ways from transitioning from rFVIII to rFVIIIFc [14]. A high correlation of PK data between rFVIIIFc and rFVIII was also noted with a one-third lower average clearance for rFVIIIFc, which could be useful for adjusting doses in the case of a transition between the two products [14].

Accordingly, “standardized” (dose and interval fixed to once weekly for FIX and twice weekly for FVIII), “PK-driven” (dosed to a target trough, fixed interval), “phenotype-driven” (variable dose and interval according to bleeding pattern and activity), and 147

Ar MC, et al: A New Era in the Management of Hemophilia Patients

“convenience-driven” (higher dose, longer interval) strategies have been used for the prophylaxis regimens in pivotal clinical trial programs [19].

There might be a concern regarding inhibitor development when switching between different FVIII concentrates as product type is one of treatment-related factors for inhibitor development [77]. Recent real-world data on EHL factor concentrates are in support of the data obtained from previous clinical studies with these products in PTPs, stating that no inhibitor formation was observed in patients who switched from conventional factor VIII or IX replacement to treatment with EHL-rFVIII or -rFIX [78,79,80]. In non-adherent patients, switching to a standardized prophylaxis regimen with EHL factors (once or twice weekly) has been associated with a successful treatment outcome leading to trough levels sufficient to suppress target joint bleeding [19]. Patients who were bleeding under conventional rFVIII treatment have been shown to benefit both from improved bleeding control and reduced injection frequency when switched to rFVIIIFc prophylaxis with similar prophylactic factor consumption [14,84]. Thus, the same total weekly prophylactic dose might be given initially, in divided daily doses, twice weekly instead of 3 times a week when switching from SHL-FVIII to rFVIIIFc. Thereafter, the dose and dosing interval can be adjusted depending on the patient’s clinical needs [14].

Accordingly, data from the ALONG trial showed that 30% of hemophilia A patients in the individualized prophylaxis arm achieved 5-day dosing intervals in the last 3 months of the study [34]. In the ASPIRE trial, the phase 3b extension study, interim data revealed that further prolongation of dosing intervals to 7-day intervals was possible in 2 of the 33 patients who were on twice weekly dosing and 10 of 37 who were on every-5day dosing in the ALONG study [59]. Overall, median ABRs were lower with rFVIIIFc prophylaxis (individualized prophylaxis: 0.66, weekly prophylaxis: 2.03; modified prophylaxis: 1.97) as compared with on-demand treatment (18.36) [63].

A 30% lower total weekly dose of rFVIIIFc has been shown to be likely to give the same FVIII exposure considering that rFVIIIFc has a 30% lower clearance when compared to rFVIII [14]. Based on this, one can conclude that patients on prophylactic treatment who are well controlled with a conventional FVIII product might maintain the same level of bleeding control while benefiting from reduced injection frequency and decreased prophylactic factor consumption when switched to EHL-rFVIII. However, this has to be further investigated in clinical trials.

While the primary focus has been the potential use of EHL factor concentrates in patients with severe hemophilia, the utility of EHL products for the management of bleeding in patients with mild and moderate deficiencies has also been considered [52].

148

Turk J Hematol 2019;36:141-154

Further support with real-life data on the potential advantages of EHL factor concentrates may enable identifying the needs and characteristics of individual patients and the difference in the behavior of SHL-FVIII products as compared to EHL products.

This may help guide clinicians when switching hemophilia A patients from conventional FVIII to EHL products.

Nonetheless, it should be noted that commenting on the comparative efficacy of new long-acting therapies is not possible due to the lack of head-to-head studies. Furthermore, it is difficult to compare different EHL products with the current clinical data since the published studies greatly vary with regard to study populations, study designs, and protocols and they evaluate outcomes using different end-points such as ABR, inhibitor development, number of breakthrough bleeds, or dosing intervals.

Current Evidence on the Impact of Quality of Life and Health Economics Prophylaxis is considered as the gold standard for countries in which it is economically affordable [41,85,86], and it is associated with a better health-related quality of life (HRQoL) as compared to episodic treatment [87]. Furthermore, it leads to a decrease in bleeding-related hospitalization, shortens length of hospital stay, and thus reduces resource utilization [85,88].

EHL factors offer better protection from bleeding while reducing the frequency of injections and allowing trough activity levels to remain above key thresholds for longer periods relative to conventional factor products [19]. Thus, longer half-lives and reduced clearance of EHL factors are suggested to result in reduced factor consumption while maintaining higher trough levels and leading to improved protection from bleeding. This, in turn, causes a considerable reduction in hemophilia-related complications and their associated cost burden [19].

In two phase III studies done with rFVIIIFc and rFIXFc, HRQoL was assessed in adults with severe hemophilia A and B, respectively, who received prophylactic or episodic factor replacement regimens [34,37]. The post hoc analyses of these studies revealed that prophylaxis with rFVIIIFc or rFIXFc was associated with significant improvements in HRQoL (particularly in ‘Physical Health’ and ‘Sports and Leisure’ domains) over time. This has also been noted in patients who had been receiving prophylaxis with SHL-rFVIII/FIX and were switched to EHL-rFVIIIFc and -rFIXFc. Thus, EHL factor concentrates seem to further improve the HRQoL of hemophilia patients [87].

In an analysis of the potential financial consequences of introducing rFVIIIFc to a private payer system in the United States, rFVIIIFc was anticipated to have a budget impact of 1.4% across 2 years for a private payer population of 1,000,000 through reducing the ABR by approximately 3.1 bleeds per

Turk J Hematol 2019;36:141-154

individual patient with hemophilia A [85]. The total population budget was predicted to decrease for episodic treatment with the introduction of rFVIIIFc based on the lower factor consumption data observed in the ASPIRE trial [63,85].

For prophylaxis, the cost per bleed avoided after the introduction of rFVIIIFc was estimated to be 1974$ in year 1 and 1808$ in year 2, while the small decrease in cost per bleed avoided over time was considered to be associated with the likelihood of patients uncontrolled on a fixed prophylaxis regimen to switch to an individualized regimen in year 2, resulting in a more efficient use of factor therapy [85].

In the scenario without rFVIIIFc, the annual cost for the management of the estimated annual 388 bleeding episodes was 2,044,868$, which equates to each bleeding episode costing approximately 5270$. The cost per bleed avoided with rFVIIIFc on the market was approximately 1891$, indicating that prophylaxis with rFVIIIFc provides good value for money in the prevention of joint bleeds and related comorbidities [85].

The introduction of rFVIIIFc to a private payer system is anticipated to have a minimal budget impact while reducing the ABR, alongside a potential for reduced dosing schedule required for rFVIIIFc and reduction in total factor consumption, facilitating adherence to prophylaxis regimens with a likely positive impact on patient quality of life and economic burden [85].

Role of EHL Factors in Immune Tolerance Treatment Occurring in up to 30% of patients with severe hemophilia A, the development of alloantibodies (inhibitors) directed against FVIII is the most serious complication of replacement therapy [2], leading to treatment failure, preventing patients from receiving long-term prophylaxis, and exposing them to an increased risk of mortality, morbidity, and disability [2,6,89].

The current management of patients with inhibitor development involves treating acute bleeding with agents that bypass the need for FVIII or FIX, i.e. activated prothrombin complex concentrate or activated recombinant factor FVII, and using immune tolerance induction (ITI) in order to eradicate the inhibitory antibodies [89]. Several protocols of ITI have been released with overall success rates of about 70% [89,90].

While several meta-analyses failed to demonstrate a significant difference of inhibitor development in patients treated with recombinant FVIII compared to plasma-derived products, a randomized prospective study revealed that the use of recombinant products in previously untreated patients (PUPs) was associated with a 1.8 times greater risk of inhibitor development compared to plasma-derived products [91]. There is no published study to date presenting definitive results

Ar MC, et al: A New Era in the Management of Hemophilia Patients

with novel EHL concentrates in PUPs, while all the studies in PTPs showed an excellent safety profile with substantially no inhibitor development after switching to novel products [6].

Nonetheless, at the immunogenicity level, so far, available data from PTP clinical trials suggest that EHL factors are safe, with no increased risk for inhibitor development [34,64,89].

A potential role for EHL factors for the induction of immune tolerance has also been suggested [19,52]. A series of case reports regarding the use of EHL-rFVIII in ITI described the successful treatment of children with severe hemophilia A and high-titer inhibitor using different doses of rFVIIIFc in ITI ranging from 50 to 200 IU/kg per dose [92,93]. Hence, with no reports of any EHL factors causing inhibitor formation in the initial clinical trials and lack of randomized trials in PUPs and in ITI, the rationale of safely using rFVIIIFc should depend on case reports and strong laboratory data [52,89]. The available evidence encourages the consideration of the use of rFVIIIFc to eradicate inhibitors, particularly in refractory patients and those with a high-risk profile (i.e. those with a family history of failure of ITI with standard factors or history of a high-peak inhibitor) [52,89].

Challenges in Pharmacokinetic-Guided Prophylaxis with EHL Products Prophylactic dosing in severe hemophilia is generally tailored according to the individual needs of the patients. Tailoring of treatment has been guided by either clinical bleeding phenotype or individual PKs of a particular factor concentrate in a patient [19].

PK-tailored prophylaxis was shown to have superior hemostatic efficacy compared to on-demand treatment, along with decreased factor consumption [17]. PK-tailored dosing, explored in several of the phase 3 clinical trials with EHL factors, was associated with good efficacy in bleeding control in these prospective studies [19]. Hence, all licensed EHL products recommend tailoring the dose to the individual patientâ&#x20AC;&#x2122;s PK response, since standardized dosing may result in patients being undertreated if factor clearance is higher than expected [41].

Individualized PK-based dosing is considered as an alternative option for maintaining a predetermined factor trough level [94,95]. However, given the burden and cost of frequent blood sampling required for personalized PK assessment and the likelihood of a lack of ready access to the expertise required for such evaluations, the current prescribing information for the available EHL-FVIII products does not include individualized PKbased dosing [94], while the recommended fixed dose is based on individualized PK-guided dosing in some clinical trials [94].

Unlike hemophilia A, PK-guided prophylaxis has limited value in most adult patients with hemophilia B on standard FIX products [96,97] and PK-guided dosing strategies for EHL-rFIX products 149

Ar MC, et al: A New Era in the Management of Hemophilia Patients

is considered likely to be challenging due to the inter-individual variability and complexity of FIX PKs and the uncertainty regarding the optimal sampling time that best accounts for a prolonged half-life [98]. Accordingly, population-based PK estimation with reduced plasma sampling is considered a more practical and less expensive PK-based estimate of factor requirements than an individualized approach in both hemophilia A and hemophilia B [94,98].

In addition, there are several challenges with PK-guided prophylaxis when EHL factor concentrates are used [99]. In contrast to available conventional FVIII products, which present approximately the same PK characteristics enabling similar treatment outcome when used interchangeably, EHL products demonstrate unique PKs resulting in different dose and dosing interval requirements and consequently variable treatment outcome [14]. Long-term outcome data are also lacking for using low ABR targets as a surrogate for preserved joint health in prophylaxis [19,100].

Given the unpredictable impact of bioengineered products on individual patients, increased knowledge on the PK parameters of new anti-hemophilic molecules with prolonged half-lives will improve tailored prophylaxis based on individual needs and PK characteristics, offering new possibilities for effective prophylaxis [17,19]. Population-based PK models using EHL factors will be available in the near future for routine clinical use to help guide PK tailoring [19].

Challenges in Monitoring Treatment Via Laboratory Assays Monitoring factor levels through laboratory assays is an important part of ensuring patient safety during hemophilia management. Commonly used laboratory assays for measuring FVIII or FIX activity may not be the optimal method for some EHL-rFVIII or -rFIX products, such as those modified through PEGylation or fusion to albumin or immunoglobulin [68,101].

While measurement of recombinant coagulation factor concentrates has always been complicated by the discordance between the measurements carried out with different types of assays [68], the molecular modifications applied to extend the half-lives of clotting factors lead to additional novel interactions with the reagents [68] and create new challenges for laboratories, especially those using one-stage assays to assess therapeutic efficacy [101]. Although it differs between different EHL products to what extent the accuracies of laboratory assays are affected (i.e. how well assay monitoring works) [68], the heterogeneity in assay monitoring is considered to be associated with clinically significant over- or underestimation of plasma factor concentration, which might have an adverse impact on the management of patients and might result in an unnecessary search for inhibitor antibodies [68,101].

150

Turk J Hematol 2019;36:141-154

Apart from the molecular modifications done to prolong the half-lives of the clotting factors, various properties of the original molecules themselves, as well as those of the assays, along with the use of different calibration methods contribute to the discrepancies in determining the plasma factor activity levels [68,102].

Chromogenic assays show less variability than one-stage assays in the measurement of FVIII activity levels, possibly due to a restricted choice of available assay kits and reagents [103,104].

Comparison among assays used for characterization of potency for various modified rFVIII products indicates that the results of chromogenic assays are more reliable across different kits [23,101,103,105].

Hence, chromogenic assays are considered as the assays of choice for monitoring patients treated with several EHL-rFVIII or -rFIX concentrates. However, there are several challenges associated with the implementation of chromogenic assays in routine clinical laboratory practice, including increased expenses and technical complexity as well as the higher interlaboratory variability at very low factor levels when compared to one-stage assays [68,103,106].

Concordance between assays used in laboratories and by pharmaceutical companies to measure the potency of a product, effective communication between the laboratories and the clinicians, and conveyance of relevant information by companies for correct monitoring of their products to both local laboratories and clinicians are essential for proper monitoring [68,101]. Additional laboratory and clinical studies are required for optimization and standardization of the laboratory assays to correctly measure and monitor EHL concentrates [68].

Conclusion EHL factor concentrates have been shown to be well tolerated, safe, and efficacious in the treatment and prevention of bleeding episodes in people with hemophilia. These concentrates have the potential to induce higher trough levels with less frequent injections; thus, they reduce the infusion burden and facilitate adherence to prophylactic regimens [19,76,85]. Moreover, significant improvements in HRQoL have been shown with EHL factors in a large proportion of subjects, including those who have been on prophylaxis with SHL products. EHL products seem to have filled this gap by increasing adherence and further improving the HRQoL of hemophilia patients [87]. In addition to that, the usage of EHL factors in PTPs has not been associated with increased inhibitor formation. Results of clinical studies in PUPs and in the setting of ITI are eagerly awaited. However, available data with rFVIIIFc encourage the use of EHL products in ITI protocols to eradicate inhibitors, particularly in refractory patients and those with high-risk profiles [52,89].

Turk J Hematol 2019;36:141-154

Given the evolutions in the treatment of hemophilia in recent years with the advent of multiple non-replacement treatment options entering the market, clinicians and patients now face the prospect of having a variety of choices for individualizing treatments according to their needs [41]. EHL-rFIX and -rFVIII products have already become important alternatives in improving hemophilia care in clinical practice, while issues like the potential impact of different mechanisms of half-life prolongation on longterm safety (e.g., fusion technology versus PEGylation), cost-effectiveness, and immunogenicity in PUPs are yet to be clarified [29]. EHL factor concentrates will very soon be challenged by alternative products, including subcutaneous non-factor treatments like emicizumab or fitusiran and gene therapy. Exciting developments are about to occur in the near future of hemophilia treatment and we have to wait until all the battle lines are drawn and new options fall into place before discussing which one is optimal.

Acknowledgment The manuscript was prepared by the Hemophilia Scientific Subcommittee of the Turkish Society of Hematology. Sobi has provided financial support to the Turkish Society of Hematology to cover costs for editorial assistance, but has not influenced the content.

Ethics Ethics Committee Approval: This manuscript is a review of the literature and therefore does not require an approval from the ethics committee.

Informed Consent: This manuscript is a review of the literature and not a clinical trial. We therefore did not obtain informed consent.

Authorship Contributions Concept: M.C.A., C.B., K.K.; Design: M.C.A.; Analysis or Interpretation: M.C.A., C.B., K.K.; Literature Search: M.C.A., C.B., K.K.; Writing: M.C.A. Conflict of Interest: No conflict of interest was declared by the authors.

Financial Disclosure: There are no financial conflicts of interest to disclose except that Sobi has provided a non-restricted medical grant to the Turkish Society of Hematology to cover the expenses of editorial assistance.

Ar MC, et al: A New Era in the Management of Hemophilia Patients

3. Arruda VR, Doshi BS, Samelson-Jones BJ. Emerging therapies for hemophilia: controversies and unanswered questions. F1000Res 2018:7.

4. Balkaransingh P, Young G. Novel therapies and current clinical progress in hemophilia A. Ther Adv Hematol 2018;9:49-61.

5. Srivastava A, Brewer AK, Mauser-Bunschoten EP, Key NS, Kitchen S, Llinas A, Ludlam CA, Mahlangu JN, Mulder K, Poon MC, Street A; Treatment Guidelines Working Group on Behalf of the World Federation of Hemophilia. Guidelines for the management of hemophilia. Haemophilia 2013;19:1-47.

6. Castaman G, Linari S. Pharmacokinetic drug evaluation of recombinant factor VIII for the treatment of hemophilia A. Expert Opin Drug Metab Toxicol 2018;14:143-151.

7. Ar MC, Vaide I, Berntorp E, Bjรถrkman S. Methods for individualising factor VIII dosing in prophylaxis. Eur J Haematol Suppl 2014;76:16-20.

8. Klamroth R, Pollmann H, Hermans C, Faradji A, Yarlas AS, Epstein JD, Ewenstein BM. The relative burden of haemophilia A and the impact of target joint development on health-related quality of life: results from the ADVATE Post-Authorization Safety Surveillance (PASS) study. Haemophilia 2011;17:412-421.

9. Manco-Johnson MJ, Abshire TC, Shapiro AD, Riske B, Hacker MR, Kilcoyne R, Ingram JD, Manco-Johnson ML, Funk S, Jacobson L, Valentino LA, Hoots WK, Buchanan GR, DiMichele D, Recht M, Brown D, Leissinger C, Bleak S, Cohen A, Mathew P, Matsunaga A, Medeiros D, Nugent D, Thomas GA, Thompson AA, McRedmond K, Soucie JM, Austin H, Evatt BL. Prophylaxis versus episodic treatment to prevent joint disease in boys with severe hemophilia.

N Engl J Med 2007;357:535-544.

10. Darby SC, Kan SW, Spooner RJ, Giangrande PL, Hill FG, Hay CR, Lee CA, Ludlam CA, Williams M. Mortality rates, life expectancy, and causes of death in people with hemophilia A or B in the United Kingdom who were not infected with HIV. Blood 2007;110:815-825.

11. Lรถfqvist T, Nilsson IM, Berntorp E, Pettersson H. Haemophilia prophylaxis in young patients - a long-term follow-up. J Intern Med 1997;241:395-400.

12. Ljung R. Aspects of prophylactic treatment of hemophilia. Thromb J 2016;14(Suppl 1):30.

13. Carcao M. Changing paradigm of prophylaxis with longer acting factor concentrates. Haemophilia 2014;20(Suppl 4):99-105.

14. Berntorp E, Negrier C, Gozzi P, Blaas PM, Lethagen S. Dosing regimens, FVIII levels and estimated haemostatic protection with special focus on rFVIIIFc. Haemophilia 2016;22:389-396.

15. Roosendaal G, Lafeber F. Prophylactic treatment for prevention of joint disease in hemophilia - cost versus benefit. N Engl J Med 2007;357:603605.

16. Brown SA, Aledort LM, Astermark J, Berntorp E, van den Berg M, Blanchette V, Donfield S, Gringeri A, Hilgartner M, Kulkarni R, Leissinger C, Negrier C, Nuss R, Petterson H, Petrini P, Poulios N, Schramm W; Round Table Group.

Unresolved issues in prophylaxis. Haemophilia 2002;8:817-821.

17. Dargaud Y, Delavenne X, Hart DP, Meunier S, Mismetti P. Individualized PKbased prophylaxis in severe haemophilia. Haemophilia 2018;24(Suppl 2):317.

18. Hacker MR, Geraghty S, Manco-Johnson M. Barriers to compliance with prophylaxis therapy in haemophilia. Haemophilia 2001;7:392-396.

19. Pipe SW. New therapies for hemophilia. Hematology Am Soc Hematol Educ Program 2016;2016:650-656.

References

20. Sheridan C. Hemophilia market awaits next-generation therapies. Nat Biotechnol 2011;29:960.

1. Mannucci PM, Tuddenham EG. The hemophilias--from royal genes to gene therapy. N Engl J Med 2001;344:1773-1779.

21. Fischer K, Van Den Berg M. Prophylaxis for severe haemophilia: clinical and economical issues. Haemophilia 2003;9:376-381.

2. Bolton-Maggs PH, Pasi KJ. Haemophilias A and B. Lancet 2003;361:18011809.

22. Berntorp E. Joint outcomes in patients with haemophilia: the importance of adherence to preventive regimens. Haemophilia 2009;15:1219-1227.

151

Ar MC, et al: A New Era in the Management of Hemophilia Patients

23. Graf L. Extended half-life factor VIII and factor IX preparations. Transfus Med Hemother 2018;45:86-91.

24. von Mackensen S, Kalnins W, Krucker J, Weiss J, Miesbach W, Albisetti M, Pabinger I, Oldenburg J. Haemophilia patients’ unmet needs and their expectations of the new extended half-life factor concentrates.

Haemophilia 2017;23:566-574.

25. Zollner SB, Raquet E, Müller-Cohrs J, Metzner HJ, Weimer T, Pragst I, Dickneite G, Schulte S. Preclinical efficacy and safety of rVIII-SingleChain (CSL627), a novel recombinant single-chain factor VIII. Thromb Res 2013;132:280-287.

26. Young G, Mahlangu JN. Extended half-life clotting factor concentrates: results from published clinical trials. Haemophilia 2016;22(Suppl 5):25-30.

27. Arruda VR, Doshi BS, Samelson-Jones BJ. Novel approaches to hemophilia therapy: successes and challenges. Blood 2017;130:2251-2256.

28. Schulte S. Challenges for new haemophilia products from a manufacturer’s perspective. Thromb Res 2014;134(Suppl 1):72-76.

29. Mancuso ME, Santagostino E. Outcome of clinical trials with new extended half-life FVIII/IX concentrates. J Clin Med 2017:6.

30. Tiede A. Half-life extended factor VIII for the treatment of hemophilia A. J Thromb Haemost 2015;13(Suppl 1):176-179.

31. Coppola A, Di Capua M, Di Minno MN, Di Palo M, Marrone E, Ieranò P, Arturo C, Tufano A, Cerbone AM. Treatment of hemophilia: a review of current advances and ongoing issues. J Blood Med 2010;1:183-195.

32. Kontermann RE. Strategies for extended serum half-life of protein therapeutics. Curr Opin Biotechnol 2011;22:868-876.

33. Konkle BA, Stasyshyn O, Chowdary P, Bevan DH, Mant T, Shima M, Engl W, Dyck-Jones J, Fuerlinger M, Patrone L, Ewenstein B, Abbuehl B. Pegylated, full-length, recombinant factor VIII for prophylactic and on-demand treatment of severe hemophilia A. Blood 2015;126:1078-1085.

34. Mahlangu J, Powell JS, Ragni MV, Chowdary P, Josephson NC, Pabinger I, Hanabusa H, Gupta N, Kulkarni R, Fogarty P, Perry D, Shapiro A, Pasi KJ, Apte S, Nestorov I, Jiang H, Li S, Neelakantan S, Cristiano LM, Goyal J, Sommer JM, Dumont JA, Dodd N, Nugent K, Vigliani G, Luk A, Brennan A, Pierce GF; A-LONG Investigators. Phase 3 study of recombinant factor VIII Fc fusion protein in severe hemophilia A. Blood 2014;123:317-325.

35. Lentz SR, Misgav M, Ozelo M, Salek SZ, Veljkovic D, Recht M, Cerqueira M, Tiede A, Brand B, Mancuso ME, Seremetis S, Lindblom A, Martinowitz U. Results from a large multinational clinical trial (guardian™1) using prophylactic treatment with turoctocog alfa in adolescent and adult patients with severe haemophilia A: safety and efficacy. Haemophilia 2013;19:691-697.

36. Boggio LN, Hong W, Wang M, Eyster ME, Michaels LA. Bleeding phenotype with various bay 94-9027 dosing regimens: subanalyses from the PROTECT VIII study. Blood 2014;124:1526.

37. Powell JS, Pasi KJ, Ragni MV, Ozelo MC, Valentino LA, Mahlangu JN, Josephson NC, Perry D, Manco-Johnson MJ, Apte S, Baker RI, Chan GC, Novitzky N, Wong RS, Krassova S, Allen G, Jiang H, Innes A, Li S, Cristiano LM, Goyal J, Sommer JM, Dumont JA, Nugent K, Vigliani G, Brennan A, Luk A, Pierce GF; B-LONG Investigators. Phase 3 study of recombinant factor IX Fc fusion protein in hemophilia B. N Engl J Med 2013;369:2313-2323.

38. Santagostino E, Martinowitz U, Lissitchkov T, Pan-Petesch B, Hanabusa H, Oldenburg J, Boggio L, Negrier C, Pabinger I, von Depka Prondzinski M, Altisent C, Castaman G, Yamamoto K, Álvarez-Roman MT, Voigt C, Blackman N, Jacobs I; PROLONG-9FP Investigators Study Group. Longacting recombinant coagulation factor IX albumin fusion protein (rIX-FP) in hemophilia B: results of a phase 3 trial. Blood 2016;127:1761-1769.

39. Collins PW, Young G, Knobe K, Karim FA, Angchaisuksiri P, Banner C, Gürsel T, Mahlangu J, Matsushita T, Mauser-Bunschoten EP, Oldenburg J, Walsh CE, Negrier C; Paradigm 2 Investigators. Recombinant long-acting glycoPEGylated factor IX in hemophilia B: a multinational randomized phase 3 trial. Blood 2014;124:3880-3886.

152

Turk J Hematol 2019;36:141-154

40. Schmidbauer S, Witzel R, Robbel L, Sebastian P, Grammel N, Metzner HJ, Schulte S. Physicochemical characterisation of rVIII-SingleChain, a novel recombinant single-chain factor VIII. Thromb Res 2015;136:388‐395.

41. Ling G, Nathwani AC, Tuddenham EGD. Recent advances in developing specific therapies for haemophilia. Br J Haematol 2018;181:161-172.

42. Berntorp E, Shapiro AD. Modern haemophilia care. Lancet 2012;379:14471456.

43. Manco-Johnson MJ, Kempton CL, Reding MT, Lissitchkov T, Goranov S, Gercheva L, Rusen L, Ghinea M, Uscatescu V, Rescia V, Hong W. Randomized, controlled, parallel-group trial of routine prophylaxis vs. on-demand treatment with sucrose-formulated recombinant factor VIII in adults with severe hemophilia A (SPINART). J Thromb Haemost 2013;11:1119-1127.

44. Gringeri A, Lundin B, von Mackensen S, Mantovani L, Mannucci PM; ESPRIT Study Group. A randomized clinical trial of prophylaxis in children with hemophilia A (the ESPRIT Study). J Thromb Haemost 2011;9:700-710.

45. Royal S, Schramm W, Berntorp E, Giangrande P, Gringeri A, Ludlam C, Kroner B, Szucs T; European Haemophilia Economics Study Group. Quality-of-life differences between prophylactic and on-demand factor replacement therapy in European haemophilia patients. Haemophilia 2002;8:44‐50.

46. Aledort LM, Haschmeyer RH, Pettersson H. A longitudinal study of orthopaedic outcomes for severe factor-VIII-deficient haemophiliacs. The Orthopaedic Outcome Study Group. J Intern Med 1994;236:391-399.

47. Berntorp E, Boulyjenkov V, Brettler D, Chandy M, Jones P, Lee C, Lusher J, Mannucci P, Peak I, Rickard K. Modern treatment of haemophilia. Bull World Health Organ 1995;73:691-701.

48. Medical and Scientific Advisory Council (MASAC). Recommendations Concerning Prophylaxis. Medical Bulletin 193. New York, National Hemophilia Foundation, 1994.

49. Schulte S. Innovative coagulation factors: albumin fusion technology and recombinant single-chain factor VIII. Thromb Res 2013;131(Suppl 2):2-6.

50. Weber A, Engelmaier A, Hainzelmayer S, Minibeck E, Anderle H, Schwarz HP, Turecek PL. Development, validation, and application of a novel ligandbinding assay to selectively measure PEGylated recombinant human coagulation factor VIII (BAX 855). Bioconjug Chem 2015;26:2133-2142.

51. Mahdi AJ, Obaji SG, Collins PW. Role of enhanced half-life factor VIII and IX in the treatment of haemophilia. Br J Haematol 2015;169:768-776.

52. Wynn TT, Gumuscu B. Potential role of a new PEGylated recombinant factor VIII for hemophilia A. J Blood Med 2016;7:121-128.

53. Coyle TE, Reding MT, Lin JC, Michaels LA, Shah A, Powell J. Phase I study of BAY 94-9027, a PEGylated B-domain-deleted recombinant factor VIII with an extended half-life, in subjects with hemophilia A. J Thromb Haemost 2014;12:488-496.

54. Cafuir LA, Kempton CL. Current and emerging factor VIII replacement products for hemophilia A. Ther Adv Hematol 2017;8:303-313.

55. Mullins ES, Stasyshyn O, Alvarez-Roman MT, Osman D, Liesner R, Engl W, Sharkhawy M, Abbuehl BE. Extended half-life pegylated, full-length recombinant factor VIII for prophylaxis in children with severe haemophilia A. Haemophilia 2017;23:238-246.

56. Reding MT, Ng HJ, Poulsen LH, Eyster ME, Pabinger I, Shin HJ, Walsch R, Lederman M, Wang M, Hardtke M, Michaels LA. Safety and efficacy of BAY 94-9027, a prolonged-half-life factor VIII. J Thromb Haemost 2017;15:411419.

57. Ganson NJ, Kelly SJ, Scarlett E, Sundy JS, Hershfield MS. Control of hyperuricemia in subjects with refractory gout, and induction of antibody against poly(ethylene glycol) (PEG), in a phase I trial of subcutaneous PEGylated urate oxidase. Arthritis Res Ther 2006;8:12.

58. Armstrong JK, Hempel G, Koling S, Chan LS, Fisher T, Meiselman HJ, Garratty G. Antibody against poly(ethylene glycol) adversely affects PEGasparaginase therapy in acute lymphoblastic leukemia patients. Cancer 2007;110:103-111.

Turk J Hematol 2019;36:141-154

Ar MC, et al: A New Era in the Management of Hemophilia Patients

59. Lubich C, Allacher P, De la Rosa M, Bauer A, Prenninger T, Horling FM, Siekmann J, Oldenburg J, Scheiflinger F, Reipert BM. The mystery of antibodies against polyethylene glycol (PEG) - What do we know? Pharm Res 2016;33:2239-2249.

73. Mahlangu J, Lepatan LM, Vilchevska K, Oldenburg J, Stasyshyn O, Fischer K, Iosava G, Khayat CD, Simpson M, Wang M. RVIII-singlechain pharmacokinetics in adults, adolescents and children. J Thromb Haemost 2015;13:603.

60. Andersen JT, Sandlie I. The versatile MHC class I-related FcRn protects IgG and albumin from degradation: implications for development of new diagnostics and therapeutics. Drug Metab Pharmacokinet 2009;24:318332.

74. Berntorp E, Andersson NG. Prophylaxis for hemophilia in the era of extended half-life factor VIII/factor IX products. Semin Thromb Hemost 2016;42:518‐525.

61. Schulte S. Half-life extension through albumin fusion technologies. Thromb Res 2009;124(Suppl 2):6-8.

62. Berntorp E. Haemophilia treatment in 2030. Haemophilia 2016;22(Suppl 5):15-19.

63. Nolan B, Mahlangu J, Perry D, Young G, Liesner R, Konkle B, Rangarajan S, Brown S, Hanabusa H, Pasi KJ, Pabinger I, Jackson S, Cristiano LM, Li X, Pierce GF, Allen G. Long-term safety and efficacy of recombinant factor VIII Fc fusion protein (rFVIIIFc) in subjects with haemophilia A. Haemophilia 2016;22:72-80.

64. Young G, Mahlangu J, Kulkarni R, Nolan B, Liesner R, Pasi J, Barnes C, Neelakantan S, Gambino G, Cristiano LM, Pierce GF, Allen G. Recombinant factor VIII Fc fusion protein for the prevention and treatment of bleeding in children with severe hemophilia A. J Thromb Haemost 2015;13:967-977.

65. Stasyshyn O, Djambas Khayat C, Iosava G, Ong J, Abdul Karim F, Fischer K, Veldman A, Blackman N, St Ledger K, Pabinger I. Safety, efficacy and pharmacokinetics of rVIII-SingleChain in children with severe hemophilia A: results of a multicenter clinical trial. J Thromb Haemost 2017;15:636-644.

66. Mahlangu J, Kuliczkowski K, Karim FA, Stasyshyn O, Kosinova MV, Lepatan LM, Skotnicki A, Boggio LN, Klamroth R, Oldenburg J, Hellmann A, Santagostino E, Baker RI, Fischer K, Gill JC, P’Ng S, Chowdary P, Escobar MA, Khayat CD, Rusen L, Bensen-Kennedy D, Blackman N, Limsakun T, Veldman A, St Ledger K, Pabinger I; AFFINITY Investigators. Efficacy and safety of rVIII-SingleChain: results of a phase 1/3 multicenter clinical trial in severe hemophilia A. Blood 2016;128:630-637.

67. Klamroth R, Simpson M, von Depka-Prondzinski M, Gill JC, Morfini M, Powell JS, Santagostino E, Davis J, Huth-Kühne A, Leissinger C, Neumeister P, Bensen-Kennedy D, Feussner A, Limsakun T, Zhou M, Veldman A, St Ledger K, Blackman N, Pabinger I. Comparative pharmacokinetics of rVIIISingleChain and octocog alfa (Advate) in patients with severe haemophilia A. Haemophilia 2016;22:730-738.

68. Van den Bossche D, Peerlinck K, Jacquemin M. New challenges and best practices for the laboratory monitoring of factor VIII and factor IX replacement. Int J Lab Hematol 2018;40(Suppl 1):21-29.

69. Carcao M, Zak M, Karim FA, Hanabusa H, Kearney S, Lu MY, Persson P, Rangarajan S, Santagostino E. Safety, efficacy and pharmacokinetics of nonacog beta pegol (N9-GP) in prophylaxis and treatment of bleeding episodes in previously treated pediatric hemophilia B patients. Blood 2014;124:1513.

70. Barnes C, Fischer K, Kulkarni R. Safety, efficacy and pharmacokinetics of recombinant factor IX Fc fusion protein in children with haemophilia B (Kids BLONG). In: Haematology Society of Australia and New Zealand, the Australian & New Zealand Society of Blood Transfusion, and the Australasian Society of Thrombosis and Haemostasis Annual Scientific Meeting, 2015.

71. Kenet G, Chambost H, Male C, Lambert T, Álvarez-Román M, Halimeh S, Chan A, Barnes C, Chernova T, Blatny J, Mancuso M, Meunier S, Komrska V, Laws HJ, Morfini M, Curtain J, Blazek B, Voigt C, Jacobs J, Santagostino E. Efficacy, pharmacokinetics (PK) and safety results of a phase 3 clinical study of recombinant fusion protein linking coagulation factor IX with albumin (RIX-FP) in previously treated children with hemophilia B (abstract OR346).

J Thromb Haemost 2015;13:227-228.

72. Mahlangu J, Kuliczkowski K, Stasyshyn O, Skotricki A, Kasinova M, Kennedy DB, France N, Pabinger I; The AFFINITY Study Group. RVIII-SingleChain: results of the pivotal phase I/III PK, efficacy and safety clinical trial in adults and adolescents with severe hemophilia A. J Thromb Haemost 2015;13:86.

75. Dunn A. The long and short of it: using the new factor products. Hematology Am Soc Hematol Educ Program 2015;2015:26‐32.

76. Mahlangu J, Young G, Hermans C, Blanchette V, Berntorp E, Santagostino E. Defining extended half-life rFVIII-A critical review of the evidence.

Haemophilia 2018;24:348-358.

77. Peyvandi F, Garagiola I. Product type and other environmental risk factors for inhibitor development in severe hemophilia A. Res Pract Thromb Haemost 2018;2:220-227.

78. Dunn AL, Ahuja SP, Mullins ES. Real-world experience with use of Antihemophilic Factor (Recombinant), PEGylated for prophylaxis in severe haemophilia A. Haemophilia 2018;24:84-92.

79. Keepanasseril A, Stoffman J, Bouskill V, Carcao M, Iorio A, Jackson S; Association of Hemophilia Centre Directors of Canada (AHCDC). Switching to extended half-life products in Canada - preliminary data. Haemophilia 2017;23:365-367.

80. Wang C, Young G. Clinical use of recombinant factor VIII Fc and recombinant factor IX Fc in patients with haemophilia A and B. Haemophilia 2018;24:414419.

81. Pipe SW, Montgomery RR, Pratt KP, Lenting PJ, Lillicrap D. Life in the shadow of a dominant partner: the FVIII-VWF association and its clinical implications for hemophilia A. Blood 2016;128:2007‐2016.

82. Collins P, Chalmers E, Chowdary P, Keeling D, Mathias M, O’Donnell J, Pasi KJ, Rangarajan S, Thomas A. The use of enhanced half-life coagulation factor concentrates in routine clinical practice: guidance from UKHCDO. Haemophilia 2016;22:487‐498.

83. Hermans C, Mahlangu J, Booth J, Schütz H, Santagostino E, Young G, Lee HY, Steinitz-Trost KN, Blanchette V, Berntorp E. Pharmacokinetic modelling and validation of the half-life extension needed to reduce the burden of infusions compared with standard factor VIII. Haemophilia 2018;24:376384.

84. Shapiro AD, Ragni MV, Kulkarni R, Oldenberg J, Srivastava A, Quon DV, Pasi KJ, Hanabusa H, Pabinger I, Mahlangu J, Fogarty P, Lillicrap D, Kulke S, Potts J, Neelakantan S, Nestorov I, Li S, Dumont JA, Jiang H, Brennan A, Pierce GF. Recombinant factor VIII Fc fusion protein: extended-interval dosing maintains low bleeding rates and correlates with von Willebrand factor levels. J Thromb Haemost 2014;12:1788-1800.

85. McMullen S, Buckley B, Hall E 2nd, Kendter J, Johnston K. Budget impact analysis of prolonged half-life recombinant FVIII therapy for hemophilia in the United States. Value Health 2017;20:93-99.

86. Berntorp E, Fischer K, Miners A. Models of prophylaxis. Haemophilia 2012;18(Suppl 4):136-140.

87. Wyrwich KW, Krishnan S, Auguste P, Poon JL, von Maltzahn R, Yu R, Pierce GF, Mei B, Mahlangu J, von Mackensen S. Changes in health-related quality of life with treatment of longer-acting clotting factors: results in the A-LONG and B-LONG clinical studies. Haemophilia 2016;22:866-872.

88. Zhou ZY, Koerper MA, Johnson KA, Riske B, Baker JR, Ullman M, Curtis RG, Poon JL, Lou M, Nichol MB. Burden of illness: direct and indirect costs among persons with hemophilia A in the United States. J Med Econ 2015;18:457465.

89. Janbain M, Pipe S. What is the role of an extended half-life product in immune tolerance induction in a patient with severe hemophilia A and high-titer inhibitors? Hematology Am Soc Hematol Educ Program 2016;2016:648-649.

153

Ar MC, et al: A New Era in the Management of Hemophilia Patients

90. Oldenburg J, Austin SK, Kessler CM. ITI choice for the optimal management of inhibitor patients - from a clinical and pharmacoeconomic perspective.

Haemophilia 2014;20(Suppl 6):17-26.

91. Peyvandi F, Mannucci PM, Garagiola I, El-Beshlawy A, Elalfy M, Ramanan V, Eshghi P, Hanagavadi S, Varadarajan R, Karimi M, Manglani MV, Ross C, Young G, Seth T, Apte S, Nayak DM, Santagostino E, Mancuso ME, Sandoval Gonzalez AC, Mahlangu JN, Bonanad Boix S, Cerqueira M, Ewing NP, Male C, Owaidah T, Soto Arellano V, Kobrinsky NL, Majumdar S, Perez Garrido R, Sachdeva A, Simpson M, Thomas M, Zanon E, Antmen B, Kavakli K, MancoJohnson MJ, Martinez M, Marzouka E, Mazzucconi MG, Neme D, Palomo Bravo A, Paredes Aguilera R, Prezotti A, Schmitt K, Wicklund BM, Zulfikar B, Rosendaal FR. A randomized trial of factor VIII and neutralizing antibodies in hemophilia A. N Engl J Med 2016;374:2054-2064.

92. Groomes CL, Gianferante DM, Crouch GD, Parekh DS, Scott DW, Lieuw K. Reduction of factor VIII inhibitor titers during immune tolerance induction with recombinant factor VIII-Fc fusion protein. Pediatr Blood Cancer 2016;63:922-924.

93. Malec LM, Ragni MV, Journeycake JM, Alabek M. Immune tolerance induction using rFVIIIFc (Eloctate) [abstract]. Blood 2015;126:3531.

94. Lambert T, Benson G, Dolan G, Hermans C, Jiménez-Yuste V, Ljung R, Morfini M, Zupančić-Šalek S, Santagostino E. Practical aspects of extended half-life products for the treatment of haemophilia. Ther Adv Hematol 2018;9:295308.

95. Ljung R, Auerswald G, Benson G, Jetter A, Jiménez-Yuste V, Lambert T, Morfini M, Remor E, Sørensen B, Salek SZ. Novel coagulation factor concentrates: issues relating to their clinical implementation and pharmacokinetic assessment for optimal prophylaxis in haemophilia patients. Haemophilia 2013;19:481-486.

96. Björkman S. Pharmacokinetics of plasma-derived and recombinant factor IX: implications for prophylaxis and on-demand therapy. Haemophilia 2013;19:808-813.

97. Djambas Khayat C. Once-weekly prophylactic dosing of recombinant factor IX improves adherence in hemophilia B. J Blood Med 2016;7:275-282.

154

Turk J Hematol 2019;36:141-154

98. Iorio A, Fischer K, Blanchette V, Rangarajan S, Young G, Morfini M; Pharmacokinetic (PK) Expert Working Group of the International Prophylaxis Study Group (the IPSG). Tailoring treatment of haemophilia B: accounting for the distribution and clearance of standard and extended half-life FIX concentrates. Thromb Haemost 2017;117:1023-1030.

99. Collins PW, Fischer K, Morfini M, Blanchette VS, Bjorkman S; International Prophylaxis Study Group Pharmacokinetics Expert Working Group.

Implications of coagulation factor VIII and IX pharmacokinetics in the prophylactic treatment of haemophilia. Haemophilia 2011;17:2-10.

100. Fischer K, Berntorp E. Targeting factor replacement therapy in severe hemophilia: which level is important? Semin Thromb Hemost 2015;41:860863.

101. Kitchen S, Tiefenbacher S, Gosselin R. Factor activity assays for monitoring extended half-life FVIII and factor IX replacement therapies. Semin Thromb Hemost 2017;43:331-337.

102. Sommer JM, Buyue Y, Bardan S, Peters RT, Jiang H, Kamphaus GD, Gray E, Pierce GF. Comparative field study: impact of laboratory assay variability on the assessment of recombinant factor IX Fc fusion protein (rFIXFc) activity.

Thromb Haemost 2014;112:932‐940.

103. Potgieter JJ, Damgaard M, Hillarp A. One-stage vs. chromogenic assays in haemophilia A. Eur J Haematol 2015; 94(Suppl 77):38-44.

104. Pickering W, Hansen M, Kjalke M, Ezban M. Factor VIII chromogenic assays can be used for potency labeling and postadministration monitoring of N8GP. J Thromb Haemost 2016;14:1579-1587.

105. Dodt J, Hubbard AR, Wicks SJ, Gray E, Neugebauer B, Charton E, Silvester G. Potency determination of factor VIII and factor IX for new product labelling and postinfusion testing: challenges for caregivers and regulators.

Haemophilia 2015;21:543-549.

106. Turecek PL, Romeder-Finger S, Apostol C, Bauer A, Crocker-Buqué A, Burger DA, Schall R, Gritsch H. A world-wide survey and field study in clinical haemostasis laboratories to evaluate FVIII: C activity assay variability of ADYNOVATE and OBIZUR in comparison with ADVATE. Haemophilia 2016;22:957‐965.

RESEARCH ARTICLE DOI: 10.4274/tjh.galenos.2018.2018.0248 Turk J Hematol 2019;36:155-161

Long-term Dental Anomalies after Pediatric Cancer Treatment in Children Kanser Tedavisi Gören Çocuklarda Uzun Süre Sonra Görülen Diş Anomalileri Gülser Kılınç1, Gülçin Bulut2, Fahinur Ertuğrul3, Hale Ören4, Emine Serra Kamer8, Hülya Ellidokuz9, Nur Olgun10

Bengü Demirağ5,

Ayşe Demiral6,

Serap Aksoylar7,

1Dokuz Eylül University Faculty of Medicine, Department of Pediatric Dentistry, İzmir, Turkey 2İzmir Training Dental Hospital, Clinic of Pediatric Dentistry, İzmir, Turkey 3Ege University Faculty of Dentistry, Department of Pedodontics, İzmir, Turkey 4Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey 5Behçet Uz Children’s Hospital, Clinic of Pediatric Hematology and Oncology, İzmir, Turkey 6Dokuz Eylül University Faculty of Medicine, Department of Radiation Oncology, İzmir, Turkey 7Ege University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey 8Ege University Faculty of Medicine, Department of Radiation Oncology, İzmir, Turkey 9Dokuz Eylül University, Institute of Oncology, Department of Preventive Oncology, İzmir, Turkey 10Dokuz Eylül University, Institute of Oncology, Department of Pediatric Oncology, İzmir, Turkey

Abstract

Öz

Objective: The aim of this study is to determine the frequency of dental anomalies (DAs) (microdontia, hypodontia, hyperdontia, enamel defect, root malformation) in pediatric cancer patients at the ages <5 years and between 5 and 7 years, and understand their relationship with the received therapy.

Amaç: Çalışmanın amacı <5 ve 5-7 yaş arası kanser tanısı alıp tedavi görmüş hastalarda diş anomalileri (DA) (mikrodonti, hipodonti, hiperdonti, mine kusuru, kök şekil bozukluğu) sıklığını belirlemek ve alınan tedavi ile ilişkini saptamaktır.

Materials and Methods: Pediatric patients who were diagnosed with cancer and treated before the age of 7 years were investigated in a case- control design. The study included 93 pediatric patients whose ages at diagnosis were between 9 months and 7 years and whose treatments were completed before 5-8 years. Group A consisted of patients in the age range of 9 months to 4 years and Group B consisted of patients in the age range of 5-7 years. Seventy-two siblings with compatible dental age ranges were included in the control group. For both groups, intraoral examinations were performed and panoramic radiographs were taken.

Results: Among the 93 pediatric patients, the mean age was 9.54±1.25 (range: 8-13 years) and 48 (51.6%) patients were male.

The most common diagnosis was hematologic malignancy with a rate of 65.5%. At least one DA was detected in 7 (9.7%) individuals of the control group and in 78 (83.9%) of the patient group. While the patients in the study group had all kinds of DAs, those in the control group had only enamel defects. The rates of microdontia (p=0.077) and hypodontia (p=0.058) were detected to be significantly higher in Group A than in Group B. Root malformation was more common in patients receiving chemotherapy and radiotherapy than in those receiving only chemotherapy (p=0.006).

Gereç ve Yöntemler: Kanser tanısı alıp 7 yaş öncesi tedavi görmüş çocuk hastalar olgu kontrol yöntemiyle araştırıldı. Kanser tedavisinin üzerinden en az 5-8 yıl geçmiş, tanı yaşı 9 ay ile 7 yıl arasında değişen, 93 hasta çalışmaya dahil edildi. Grup A 9 ay-4 yaş arasındaki hastalardan, Grup B 5-7 yaş arasındaki hastalardan oluşuyordu.

Kontrol grubu olarak hastaların yaş aralığı uygun 72 kardeşi alındı.

Hasta ve kontrol grubunun ağız içi muayeneleri yapıldı ve panoramik radyografileri alındı.

Bulgular: Doksan üç hastanın yaş ortalaması 9,54±1,25 (dağılım 8-13 yıl) ve 48’i (%51,6) erkekti. En sık rastlanan tanı, %65,5 oranında hematolojik malignitelerdir. En az bir tane DA, hasta grubunun 78’inde (%83,9) ve kontrol grubunun 7’sinde (%9,7) saptandı. Çalışma grubundaki hastalarda her çeşit DA görülürken, kontrol grubunda sadece mine kusuru vardı. Grup A’da mikrodonti (p=0,077), hipodonti (p=0,058) oranlarının, Grup B’ye göre daha yüksek olduğu saptandı.

Kök şekil bozukluğu kemoterapi ve radyoterapi alan hastalarda sadece kemoterapi alanlara göre daha fazla görüldü (p=0,006).

Sonuç: Bu çalışmada 7 yaşından önce kanser tedavisi gören hastaların DA’lar yönünden yüksek riskli grup oluşturduğu saptanmıştır.

Hastalar 5 yaşından önce kanser tedavisi gördüğünde mikrodontia ve hipodontinin sıklığı daha da artmıştır.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Gülser KILINÇ, M.D., Dokuz Eylül University Faculty of Medicine, Department of Pediatric Dentistry, İzmir, Turkey Phone : +90 532 424 87 56 E-mail : gulser.kilinc@deu.edu.tr ORCID-ID: orcid.org/0000-0002-7422-0482

Received/Geliş tarihi: July 19, 2018 Accepted/Kabul tarihi: October 15, 2018

155

Kılınç G, et al: Long-term DAs after Pediatric Cancer Treatment in Children

Turk J Hematol 2019;36:155-161

Abstract

Öz

Conclusion: In this study it was found that the pediatric patients who received cancer treatment before the age of 7 years constituted a high-risk group for DAs. The frequencies of microdontia and hypodontia were increased even more when the patient was treated for cancer before 5 years of age.

Anahtar Sözcükler: Kanser, Çocuk, Diş anomalileri, Hipodonti, Mikrodonti, Kök şekil bozukluğu, Mine defektleri

Keywords: Cancer, Children, Dental anomalies, Microdontia, Root malformation, Enamel defect

Hypodontia,

Introduction Malignant tumors are the second most common cause of death in children around the world [1,2,3]. Various late side effects can develop in these patients after cancer treatment.

Late side effects are defined as permanent changes caused by disease, treatment, or both [1,2,3,4,5]. It has been reported that at least one side effect and related health problems are observed in approximately 40% of children receiving cancer treatment [6,7,8,9,10,11]. Most of these late side effects are not very serious, but they can still cause functional and aesthetic problems later in life, which may cause a decrease in quality of life [7].

The most common types of pediatric cancers are leukemia, central nervous system tumors, and lymphomas [1]. Chemotherapy (CT) and/or radiotherapy (RT) are usually the treatment of choice in these diseases. Most anti-cancer drugs used for cancer treatment block the growth of cancer cells owing to their cytostatic and cytotoxic effects and also enable these cells to be destroyed [1,2]. Previous animal studies have shown dental development disturbances induced by vincristine, vinblastine, doxorubicin, and cyclophosphamide [12,13]. RT can also cause disturbances in dental development in children; however, the minimal RT dose necessary to cause changes in dental development is unknown.

On the other hand, researchers reported that a dose of 10 Gy RT will cause permanent changes in mature ameloblasts and a dose of 30 Gy is enough to stop dental development [13,14].

Therefore, the risk of dental anomalies (DAs) as a long-term side effect is quite high in children after cancer treatment [3,5,6,7].

The frequency and severity of DAs can vary depending on age at diagnosis, type and dose of chemotherapeutic agent used, RT total and fraction dose, and volume of oral cavity involved in the RT field [3,15,16,17,18].

It is known that DAs are more common among children who have received cancer treatment at an earlier age, which is usually before the age of 5 years [3,6,7,8]. On the other hand, the ages of 4-5 years are considered critical for tooth development [7].

For this reason, it is emphasized that it is very important to investigate possible DAs in pediatric patients who have received cancer treatment before the age of 5 years [6,7].

156

There are limited data on the long-term effects of cancer therapy on dental growth in pediatric patients in Turkey. The aim of this study is to determine the frequency of DAs in pediatric patients who were treated for cancer and to compare these patients with their siblings with regard to the frequency of DAs.

Materials and Methods Study Population Patients Pediatric patients who were diagnosed with cancer and treated in the Departments of Pediatric Hematology and Oncology and Radiation Oncology at Dokuz Eylül University and Ege University and in the Outpatient Clinic of Hematology and Oncology at Behçet Uz Children’s Hospital between January 2000 and December 2010 were included in the study. The first signs of root development in permanent teeth are generally observed on panoramic radiographs beginning approximately at the age of 3 to 7.5 years [6,9]. For that reason, patients with an age over 8 years were included in the study and the dental examinations were made between 5 and 8 years after cancer therapy. The patient population was divided into two groups according to the critical age for dental growth and previously published data: Group A consisted of patients in the age range of 9 months to 4 years and Group B consisted of patients in the age range of 5-7 years [7,8]. Leukemia, lymphoma, and Langerhans cell histiocytosis were categorized as lymphoproliferative diseases (LTs) and the remaining cancers were classified as solid cancers (STs). Patients were treated according to appropriate international CT protocols depending on their cancer diagnoses [19].

Controls Among 85 siblings of the 93 treated patients, 72 healthy siblings (8 to 16 years) were included in the control group.

This study was approved by the ethics review committee of Dokuz Eylül University, Faculty of Medicine, İzmir, Turkey. All participants and their parents were given verbal information about the study and written informed consent was obtained from the parents.

Turk J Hematol 2019;36:155-161

Clinical and Radiographic Examination for the Diagnosis of DAs Intraoral examinations of all patients and controls were performed in a dental clinic environment. All teeth and their surfaces were examined by one pediatric dentist (the first author). Panoramic radiographs (Castellini X-Pan 85 2D) were taken just after intraoral examination in the same session. The panoramic radiographs were analyzed to determine the number of present permanent teeth and the changes in the size of the tooth crown or the root structure.

Teeth with short roots or V-shaped roots were evaluated as root malformations (RMs). Hölttä’s Defect Index was used for the assessment of root length as previously described [9,17]. Teeth for which the ratio between the root and crown length was below 1.6 were evaluated as short-rooted teeth. If a tooth was half the size of other teeth in the same group, the condition was accepted as microdontia [1,7,17]. The absence of a tooth or tooth germ in intraoral examination and in the panoramic radiograph without a history of extraction was evaluated as hypodontia. While assessing hypodontia, classification was performed as the absence of a single tooth, absence of 2-5 teeth, and absence of 6 and more teeth (oligodontia) [7]. The presence of white/cream and colored opacities or hypoplasia on the enamel of >2 mm was considered as enamel defect (ED). The condition of having supernumerary teeth in the dental arch was classified as hyperdontia.

Dental findings of all patients and controls in the study were shared with their families. All patients were later followed for treatment of the DAs in our clinics.

Statistical Analysis SPSS 15.0 for Windows (SPSS Inc., Chicago, IL, USA) was used in statistical analyses. Differences in clinical variables were evaluated using the chi-square test or Fisher exact test for qualitative variables. A value of p<0.05 was considered statistically significant.

Results A total of 93 children treated for cancer were included in the study. The mean age was 9.54±1.25 (range: 8-13) years and 48 (51.6%) patients were male. The mean age at cancer treatment was 3.75±2.01 years (range: 9 months to 7 years). The distribution of cancer types is presented in Table 1. The mean age of the control group was 10.60±2.40 (range: 8-16) years. No statistically significant difference was detected in patients and control groups in terms of their age and sex (p>0.05).

Seventy-eight children (83.9%) had at least one DA. ED was detected in 90 teeth of 22 patients (23.7%) in the treatment group and in 20 teeth of 7 patients (9.7%) in the control group (p=0.009).

Kılınç G, et al: Long-term DAs after Pediatric Cancer Treatment in Children

Group A consisted of 59 patients and Group B consisted of 34 patients. The total number of DAs was not different between the groups; however the rates of microdontia and hypodontia were higher in Group A than in Group B (p=0.077 and p=0.058, respectively) (Table 2). The rates of RM and ED were similar in both groups.

No statistically significant difference was detected in patients in terms of sex and frequency of DAs (microdontia, hypodontia, hyperdontia, ED, and RM) (p>0.05) (Table 3).

The frequency of DAs was 80.6% in the ST, 85.5% in the LT, 81.0% in the CT, and 88.6% in the CT+RT groups. There was no significant difference in terms of tumor type and method of treatment (p=0.790 and p=0.338, respectively). However, RMs were observed to be more common in patients receiving CT+RT than in those receiving only CT (p=0.006). When patients receiving CT+RT to the head-neck region were analyzed (n=24), the rate of RMs significantly increased (p=0.001). According to the dose of RT (<20 Gy vs. ≥20 Gy) in 24 patients receiving RT to the head-neck region, only the rate of RMs was observed to significantly increase in parallel with dose (p=0.013) (Table 4).

Table 1. Patient and control group characteristics.

Patient group

Controls

n

93

72

Males, n (%)

48 (51.6)

38 (52.8)

Mean age, years

9.54±1.25

10.60±2.40

Mean age at cancer treatment

3.75±2.01 years

-

Types of cancer LTs Leukemia Lymphoma LCH STs Neuroblastoma Renal tumor STS GCT Hepatic tumor CNS tumor Retinoblastoma

43 (46.2) 18 (19.3) 1 (1.1) 8 (8.6) 8 (8.6) 6 (6.5) 3 (3.2) 3 (3.2) 2 (2.2) 1 (1.1)

Total DAs

78 (83.9)

7 (9.7)*

Types of DAs Hypodontia Microdontia Root malformations Enamel defect Hyperdontia

21 (22.6) 60 (64.5) 24 (25.8) 22 (23.7) 1 (1.1)

7 (9.7) -

*p=0.009.

STs: Solid tumors, LT: lymphoproliferative tumors, STS: soft tissue sarcoma, GCT: germ cell tumor, CNS: central nervous system, LCH: Langerhans cell histiocytosis, DA: dental anomaly.

157

Kılınç G, et al: Long-term DAs after Pediatric Cancer Treatment in Children

Turk J Hematol 2019;36:155-161

In total, 413 teeth of the patients and 20 teeth of the controls were affected by DAs. The number of teeth with DAs was quite high in the patients undergoing cancer treatment (Table 5).

While the numbers of teeth with microdontia and hypodontia were higher in Group A, the numbers of teeth with ED and RMs were close in Groups A and B.

found in the lateral or central incisors and first molars in Group A while in the first and second premolars in Group B. The ED rate was detected to be similar in these groups. Hyperdontia was observed in the right-left mandibular first and second premolars of only one patient in Group A.

Discussion

Microdontia was more frequently found among second incisors, first and second premolars, and second molars in Group A compared to Group B. Hypodontia was often found among second incisors, first and second premolars, and second molars in Group A. RMs were almost equally distributed among all classes of teeth in Groups A and B, but they were more often

Patients receiving cancer treatment in childhood are prone to development of DAs [3,7,8,18,20]. In our study, the overall rate of DAs was found to be 83.9%. There is a wide variation of the rate of DAs in the literature. Despite the presence of studies reporting rates similar to ours (82.9%-89.1%) [3,6,21], some others reported much lower rates (29%-62.3%) [7,20]. These differences are attributed to treatment age, CT protocols that are applied, and the presence of RT to the head and neck [9,22].

Table 2. Comparison of patient groups according to age at treatment.

Group A

Group B

p

n (%)

59 (63.4)

34 (36.6)

Type of tumor, n (%) LT ST

34 (57.6) 25 (42.4)

28 (82.4) 6 (17.6)

0.014

Type of treatment, n (%) CT CT+RT

43 (46.2) 16 (17.2)

15 (16.2) 19 (20.4)

0.005

Total DAs, n (%)

50 (84.7)

28 (82.4)

0.762

Types of DA, n (%) Hypodontia Microdontia Root malformations Enamel defect Hyperdontia

17(28.8) 42 (71.2) 13 (22.0) 14 (23.7) 1 (1.7)

4(11.8) 18 (52.9) 11 (32.4) 8 (23.5) 0 (0.0)

0.058 0.077 0.273 0.982 1.000

In our study, the rates of occurrence of DAs in Group A and Group B were similar. This result can be explained by the fact that dental development between 1 and 7 years is very active. In studies conducted on rats and hamsters, it has been biochemically and histologically demonstrated that chemotherapeutic agents affect developing teeth much more than developed teeth [10,23,24,25].

Maguire et al. [26] reported the absence of a statistically significant difference in the rate of DAs between leukemia and ST cases. Similar results were also found in our study. We found no significant differences between the patients receiving CT and those receiving CT+RT in terms of DAs, except for RM. Maciel et al. [27] reported that, in patients with acute lymphoblastic leukemia, the mean number of teeth with DAs was higher in the group undergoing conventional CT+RT of the whole cranium than in the group undergoing only conventional CT, but the

Pearson chi-square, p<0.05.

ST: Solid tumor, LT: lymphoproliferative tumors, RT: radiotherapy.

Table 3. Comparison of the frequencies of dental anomalies according to sex, type of treatment, and tumor type.

Dental anomaly DA

Sex, n (%) Yes No

Microdontia

Yes No

Hypodontia

Yes No

Root malformations

Yes No

Enamel defect

Yes No

Hyperdontia

Yes No

p

Female

Male

36 (80.0) 9 (20.0)

42 (87.5) 6 (12.5)

30 (66.7) 15 (33.3)

Type of treatment, n (%) C

C+R

0.483

47 (81.0) 11 (19.0)

31 (88.6) 4 (11.4)

30 (62.5) 18 (37.5)

0.674

38 (65.5) 20 (34.5)

11 (24.4) 34 (75.6)

10 (20.8) 38 (79.2)

0.677

10 (20.8) 35 (79.2)

14 (29.2) 34 (70.8)

12 (26.7) 33 (73.3) 0 (0.0) 45 (100.0)

Type of tumor, n (%)

p

LT

ST

0.338

53 (85.5) 9 (14.5)

25 (80.6) 6 (19.4)

0.790

22 (62.9) 13 (37.1)

0.795

40 (62.5) 22 (35.5)

19 (61.3) 12 (38.7)

0.939

16 (27.6) 42 (72.4)

5 (14.3) 30 (85.7)

0.137

12 (19.4) 50 (80.6)

9 (29.0) 22 (71.0)

0.430

0.444

7 (12.1) 51 (87.9)

17 (48.6) 18 (51.4)

0.006

20 (32.3) 42 (67.7)

4 (12.9) 27 (87.1)

0.078

10 (20.8) 38 (79.2)

0.676

11 (19.0) 47 (81.0)

11 (31.4) 24 (68.6)

0.211

17 (27.4) 45 (72.6)

4 (12.9) 27 (87.1)

0.188

1 (2.1) 47 (97.9)

0.330

1 (1.7) 57 (98.3)

0(0.0) 35 (100.0)

1.000

0 (0.0) 61 (100.0)

1 (3.2) 30 (96.8)

0.344

Pearson chi-square, Fisher’s exact test, p<0.05.

DA: Dental anomaly, ST: solid tumor, LT: lymphoproliferative tumor, C: chemotherapy, C+R: chemotherapy and radiotherapy.

158

p

Kılınç G, et al: Long-term DAs after Pediatric Cancer Treatment in Children

Turk J Hematol 2019;36:155-161

difference was not statistically significant. In our study, when the frequency of DA was analyzed considering the dose of RT (<20 Gy vs. ≥20 Gy) in patients receiving RT to the head-neck region, the rate of RM was significantly increased with dose.

Similarly, Kaste et al. [15] reported a dose-dependent risk of having at least one DA among 9308 pediatric cancer survivors; exposure of the jaw to RT doses exceeding 20 Gy contributed to a 4- to 10-fold higher risk of developing DAs [15].

those older than 5 years. Wilberg et al. [28] reported the rate of 54.0% in children with leukemia at the age of ≤5 years. Proc et al. [7] stated that microdontia was mostly observed in the first and second premolars in pediatric patients whose treatments were started at the age of ≤30 months. In our study, the rate of occurrence of microdontia was higher in Group A and first and second premolars were observed to be affected more frequently.

Anti-cancer treatment applied to patients causes hypodontia and its prevalence varies between 6% and 44% [8,9,20,31].

Pedersen et al. [1] reported a strong relationship between microdontia and hypodontia. In our study, the rate of occurrence of hypodontia was 22.6%. Nishimura et al. [18] found the rates of hypodontia and microdontia to be higher in children at the age of ≤4 years. In our study, the rates of microdontia and hypodontia were higher in children younger than 5 years old.

Several studies reported a prevalence of microdontia ranging from 7% to 78% in childhood cancer survivors [6,17,18,21,26,27,28,29]. In our study, the rate of occurrence of microdontia was 64.5%. The rate of microdontia was previously reported to be 0.5% in healthy Turkish children [30]. Hölttä et al. [17] found this rate as 75% in children younger than 3 years, 60% in those between the ages of 3 and 5 years, and 13% in Table 4. Treatment characteristics.

Chemotherapeutic agents

Radiotherapy dose

Total, n (%)

Alkylating agent

Antimetabolite

Leukemia

43 (46.2)

+

Lymphoma

18 (19.3)

Neuroblastoma

Topoisomerase Tubulin inhibitors binding drug

Others

+

+

+

+

+

+

+

+

8 (8.6)

+

-

+

Renal tumor

8 (8.6)

+

-

STS

6 (6.5)

+

-

GCT

3 (3.2)

+

Hepatic tumor

3 (3.2)

CNS tumor

2 (2.2)

Retinoblastoma LCH

Diagnosis

Only CT, n

>20 Gy

<20 Gy

H+N, n

Others, n

H+N, Others, n n

28

13

-

1

1

+

7

2

-

6

3

+

+

5

-

-

-

3

+

+

-

5

-

1

-

2

+

+

-

5

-

-

-

1

-

-

+

-

3

-

-

-

-

+

+

+

-

-

3

-

-

-

-

+

-

+

+

+

-

-

-

-

2

1 (1.1)

+

-

-

+

-

1

-

-

-

-

1 (1.1)

-

+

-

+

+

1

-

-

-

-

STS: Soft tissue sarcoma, GCT: germ cell tumor, CNS: central nervous system, LCH: Langerhans cell histiocytosis, H+N: head-neck alkylating agents (cyclophosphamide, ifosfamide, mechlorethamine, melphalan, busulfan, carmustine, dacarbazine, carboplatin, oxaliplatin, cisplatin, procarbazine, temozolomide), antimetabolites (methotrexate, 6-mercaptopurine, 6-thioguanine, azacitidine, gemcitabine), topoisomerase inhibitors (dactinomycin, daunorubicin, bleomycin, doxorubicin, epirubicin, idarubicin, topotecan, irinotecan, actinomycin D, etoposide, teniposide), tubulin binding drugs (vincristine, vinblastine, vinorelbine), and other chemotherapeutic agents (steroid, imatinib, L-asparaginase, rituximab, 13-cis retinoic acid).

Table 5. Distribution of teeth with anomalies.

Hypodontia, n

Teeth

Microdontia, n

Enamel defect, n

Root malformations, n

Group A

Group B

Group A

Group B

Group A

Group B

Group A

Group B

Central

-

-

-

-

15

15

16

2

Lateral

7

2

16

10

10

11

10

2

Canine

-

-

-

-

-

-

4

3

First premolar

18

3

66

6

6

7

6

20

Second premolar

19

-

23

-

5

6

5

22

First molar

-

-

-

-

5

10

20

4

Second molar

3

-

21

4

-

-

4

5

Total, n (%)

47 (90.4)

5 (9.6)

126 (86.3)

20 (13.7)

41 (45.6)

49 (54.4)

65 (48.9)

58 (51.1)

159

Kılınç G, et al: Long-term DAs after Pediatric Cancer Treatment in Children

Turk J Hematol 2019;36:155-161

While hypodontia is mostly observed in lateral incisors, second premolars, and third molars in healthy individuals [32,33], it is more frequent in second premolars and second molars in patients receiving cancer treatment [7]. The reason for hypodontia to occur in some tooth groups more commonly is that the time of calcification differs for different kinds of teeth [7,34].

the time period between cancer therapy and dental evaluation.

We think that this duration is enough for confirmation of the development of DAs after cancer therapy, especially in patients aged less than 5 years. Another important point is that we have included patients’ siblings as a control group in the study in order to compare possible genetic effects.

In small children, application of CT and/or RT during odontogenesis can delay the development of Hertwig’s epithelial root sheath. For this reason, higher rates of RM are reported for these patients [3,22]. Researchers have found the rate of occurrence of RM to be between 11.5% and 16.1% and it is more frequently encountered in patients older than 4 years [7,9,35]. RMs were significantly more common among first and second premolars and first and second molars. The development of tooth roots begins approximately at the ages of 3 and 4 years and finishes at the age of 16 years [36]. Although the rate of RM was higher in Group B (32.4%) than in Group A (22.0%), there was no statistically significant difference. Similarly, Maciel et al. [27] found no significant difference between patients older than 5 years and patients ≤5 years old in terms of RMs. In our study, RMs were mostly in the central, lateral, and first molars in Group A and in the first and second premolars in Group B. Our findings are consistent with the developmental periods of tooth roots [36].

Conclusion

ED is the most common defect in the general population.

It is the result of ameloblastic damage as far as it concerns the reproductive and secretory function, the membrane permeability, and calcium exchange across the membrane.

Studies have reported that children in long-term remission of a malignant disease display a high incidence of ED [3,8]. It is mentioned that chemotherapeutic agents such as vincristine, vinblastine, and cyclophosphamide affect odontogenesis much more [8,10]. In our study, the rate of ED was higher in the patients (23.7%) than in their siblings (9.7%) and the difference was statistically significant. Similarly, the frequency of ED was higher in patients undergoing cancer treatment compared to their siblings in some other studies [26,31,37].

Hyperdontia was encountered in two teeth of a patient receiving treatment for retinoblastoma. Maciel et al. [27] stated that they found hyperdontia in their study, but its incidence was quite low and there was no difference between the study group and control group.

Study Limitations Our study has several limitations. First, the number of patients is relatively small and our results cannot be generalized to all pediatric cancer patients. However, we have included patients from 3 centers. Second, we did not have detailed information about patients’ routine oral and dental care, which might have an impact on DAs. The strength of the present study is 160

Pediatric patients undergoing cancer treatment at early ages constitute a high-risk group in terms of dental complications.

Therefore, parents of pediatric patients undergoing cancer treatment should be informed by pediatric oncologistshematologists and radiation oncologists about dental abnormalities that can develop in the future. Moreover, pediatric dentists should be integral members in the management of all children receiving cancer therapy. We think that periodic dental control and protective measures, at least twice a year, are essential and should be performed both during and after cancer therapy for pediatric patients.

Ethics Ethics Committee Approval: Dokuz Eylül University, approval number: 571-GOA, 2012/16-22.

Informed Consent: Written informed consent was obtained from the parents.

Authorship Contributions Surgical and Medical Practices: G.K., N.O., S.A., B.D., G.B., F.E.; Concept: G.K., B.D., G.B., N.O.; Design: G.K., E.S.K., S.A.; Data Collection or Processing: G.K., G.B., F.E., E.S.K., N.O., S.A., H.Ö.; Analysis or Interpretation: H.E., G.K.; Literature Search: G.B., F.E., A.D., S.A.; Writing: G.K., N.O., H.Ö., A.D. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Pedersen LB, Clausen, N, Schrøder H, Schmidt M, Poulsen S. Microdontia and hypodontia of premolars and permanent molars in childhood cancer survivors after chemotherapy. Int J Paediatr Dent 2012;22:239-243.

2. Lopez BC, Esteve CG, Perez MGS. Dental treatment considerations in the chemotherapy patient. J Clin Exp Dent 2010;3:31-42.

3. Minicucci EM, Lopes LF, Crocci AJ. Dental abnormalities in children after chemotherapy treatment for acute lymphoid leukemia. Leuk Res 2003;27:45-50.

4. Goho C. Chemoradiation therapy: effect on dental development. Pediatr Dent 1993;15:6-12.

5. Tanaka H, Kurita H, Aizawa H, Kamata T. Agenesis of a large number of permanent teeth after treatment of neonatal leukemia. J Oral Maxillofac Surg Med Pathol 2015;27:558-561.

Turk J Hematol 2019;36:155-161

Kılınç G, et al: Long-term DAs after Pediatric Cancer Treatment in Children

6. Carrillo, CM, Corrêa FN, Lopes NN, Fava M, Odone Filho V. Dental anomalies in children submitted to antineoplastic therapy. Clinics (Sao Paulo) 2014;69:433-437.

22. Kaste SC, Hopkins KP, Jones D, Crorn D, Greenwald CA, Santana VW. Dental abnormalities in children treated for acute lymphoblastic leukemia.

Leukemia 1997;11:792-796.

7. Proc P, Szczepańska J, Skiba A, Zubowska M, Fendler W, Młynarski W. Dental anomalies as late adverse effect among young children treated for cancer.

Cancer Res Treat 2016;48:658-667.

23. Lyaruu DM, van Duin MA, Bervoets TJ, Woltgens JH, Bronckers AL. Effects of actinomycin D on developing hamster molar tooth germs in vitro. Eur J Oral Sci 1997;105:52-58.

8. Oğuz A, Cetiner S, Karadeniz C, Alpaslan G, Alpaslan C, Pinarli G. Long-term effects of chemotherapy on orodental structures in children with nonHodgkin’s lymphoma. Eur J Oral Sci 2004;112:8-11.

24. Lyaruu DM, van Duin MA, Bervoets TJ, Bronckers AL, Wöltgens JH. Daunorubicin-induced pathology in the developing hamster molar tooth germ in vitro. Cancer Detect Prev 1999;23:343-350.

9. Hölttä P, Hovi L, Saarinen-Pihkala UM, Peltola J, Alaluusua S. Disturbed root development of permanent teeth after pediatric stem cell transplantation.

Dental root development after SCT. Cancer 2005;103:1484-1493.

25. Kawakami T, Nakamura Y, Karibe H. Cyclophosphamide-induced morphological changes in dental root development of ICR mice. PLoS One 2015;11:0133256.

10. Nasman M, Forsberg CM, Dahllöf G. Long-term dental development in children after treatment for malignant disease. Eur J Orthod 1997;19:151159.

26. Maguire A, Craft AW, Evans RG, Amineddine H, Kernahan J, Macleod RI, Murray JJ, Welbury RR. The long-term effects of treatment on the dental condition of children surviving malignant disease. Cancer 1987;60:25702575.

11. Doğan C, Haytaç C, Antmen B, Şaşmaz İ, Tanyeli A. Oral health in children with acute lymphoblastic leukemia and lymphoma. Turk J Hematol 2001;18:179-183.

12. Nasman M, Hammarström L. Influence of the antineoplastic agent cyclophosphamide on dental development in rat molars. Acta Odontol Scand 1996;54:287-294.

13. Nasman M, Hultenby K, Forsberg CM. A scanning electron microscopy study of disturbances in the developing rat molar induced by cyclophosphamide.

Acta Odontol Scand 1997;55:186-191.

14. Dury DC, Roberts MW, Miser JS, Folio J. Dental root agenesis secondary to irradiation therapy in a case of rhabdomyosarcoma of the middle ear. Oral Surg Oral Med Oral Pathol 1984;57:595-599.

15. Kaste SC, Goodman P, Leisenring W, Stovall M, Hayashi RJ, Yeazel M, Beiraghi S, Hudson MM, Sklar CA, Robison LL, Baker KS. Impact of radiation and chemotherapy on risk of dental abnormalities: a report from the Childhood Cancer Survivor Study. Cancer 2009;115:5817-5827.

16. Gawade PL, Hudson MM, Kaste SC, Neglia JP, Constine LS, Robison LL, Ness KK. A systematic review of dental late effects in survivors of childhood cancer. Pediatr Blood Cancer 2014;61:407-416.

17. Hölttä P, Alaluusua S, Saarinen-Pihkala UM, Peltola J, Hovi L. Agenesis and microdontia of permanent teeth as late adverse effects after stem cell transplantation in young children. Cancer 2005;103:181-190.

27. Maciel JC, de Castro CG Jr, Brunetto AL, Di Leone LP, da Silveira HE. Oral health and dental anomalies in patients treated for leukemia in childhood and adolescence. Pediatr Blood Cancer 2009;53:361-365.

28. Wilberg P, Kanellopoulos A, Ruud E, Hjermsta MJ, Fossa SD, Herlofson BB. Dental abnormalities after chemotherapy in long-term survivors of childhood acute lymphoblastic leukemia 7-40 years after diagnosis.

Support Care Cancer 2016;24:1497-1506.

29. Hölttä P, Alaluusua S, Saarinen-Pihkala UM, Wolf J, Nyström M, Hovi L. Long-term adverse effects on dentition in children with poor-risk neuroblastoma treated with high-dose chemotherapy and autologous stem cell transplantation with or without total body irradiation. Bone Marrow Transplant 2002;29:121-127.

30. Aren G, Güven Y, Güney Tolgay G, Özcan İ, Bayar ÖF, Köse TE, Koyuncuoğlu G, Ak G. The prevalence of dental anomalies in a Turkish population. J Istanbul Univ Fac Dent 2015;49:23-28.

31. Kaste SC, Hopkins KP, Bowman LC, Santana VM. Dental abnormalities in children treated for neuroblastoma. Med Pediatr Oncol 1998;30:22-27.

32. Backman B, Wahlin YB. Variations in number and morphology of permanent teeth in 7-year-old Swedish children. Int J Paediatr Dent 2001;11:11-17.

33. Tan SP, van Wijk AJ, Prahl-Andersen B. Severe hypodontia: identifying patterns of human tooth agenesis. Eur J Orthod 2011;33:150-154.

18. Nishimura S, Inada H, Sawa Y, Ishikawa H. Risk factors to cause tooth formation anomalies in chemotherapy of paediatric cancers. Eur J Cancer Care (Engl) 2013;22:353-360.

34. Logan WHG, Kronfeld R. Development of the human jaws and surrounding structures from birth to the age of fifteen years. J Am Dent Assoc 1933;20:379-428.

19. Adamson PC, Blaney SM, Bagatell R, Skdnik JM, Bolis FM. General principles of chemotherapy. In: Pizzo PA, Poclack DG (eds). Principles and Practice of Pediatric Oncology. Philadelphia, Lippincott, 2016.

35. Tanaka M, Kamata T, Yanagisawa R, Morita D, Saito S, Sakashita K, Shiohara M, Kurita H, Koike K, Nakazawa Y. Increasing risk of disturbed root development in permanent teeth in childhood cancer survivors undergoing cancer treatment at older age. J Pediatr Hematol Oncol 2017:39:150-154.

20. Lopes NN, Petrilli AS, Caran EM, França CM, Chilvarquer I, Lederman H. Dental abnormalities in children submitted to antineoplastic therapy. J Dent Child (Chic) 2006;73:140-145.

21. Cubukcu CE, Sevinir B, Ercan I. Disturbed dental development of permanent teeth in children with solid tumors and lymphomas. Pediatr Blood Cancer 2012;58:80-84.

36. Nelson SJ, Ash MM Jr. Wheeler’s Dental Anatomy, Physiology and Occlusion.

9th ed. St. Louis, Saunders, 2010.

37. Duggal MS, Curzon ME, Bailey CC, Lewis IJ, Prendergast M. Dental parameters in the long-term survivors of childhood cancer compared with siblings. Oral Oncol 1997;33:348-353.

161

RESEARCH ARTICLE DOI: 10.4274/tjh.galenos.2019.2019.0020 Turk J Hematol 2019;36:162-168

Ortho-Topolin Riboside Induced Differentiation through Inhibition of STAT3 Signaling in Acute Myeloid Leukemia HL-60 Cells Akut Myeloid Lösemi HL-60 Hücre Serisinde Orto-Topolin Ribozid ile Diferansiyasyonun STAT3 Sinyal İnhibisyonu Yoluyla İndüklenmesi Li Wang1,

Jiao Cheng1,

FanLin Lin1,

ShengXian Liu1,

Hui Pan1,

MingDa Li1,

ShanShan Li1,

Na Li2,

WeiPing Li2

1School of Life and Medicine, Dalian University of Technology, PanJin, China 2The Second Hospital of Dalian Medical University, Dalian, China

Abstract

Öz

Objective: We previously demonstrated that ortho-topolin riboside (oTR) as a naturally occurring cytokinin secreted from Populus × robusta has great potential anticancer effects via the mitochondrial apoptotic pathway and endoplasmic reticulum stress pathway. In the present study, we reveal that oTR induced the differentiation of acute myeloid leukemia (AML) HL-60 cells, which represent the M2 subtype of AML.

Amaç: Daha önceki çalışmalarımızda Populus × robusta’dan doğal olarak oluşan sitokin orto-topolin ribozidin (oTR) mitokondrial apopitotik yolaklar ve endoplazmik retikulum stres yolakları vasıtasıyla önemli bir antikanser potansiyelinin olduğunu göstermiştik. Bu çalışmada, oTR’nin AML M2 subtipi özelliğindeki HL-60 hücre serisinde diferansiyasyonu indüklediğini gösterdik.

Materials and Methods: After the incubation of HL-60 cells with oTR, its effect was analyzed with cell viability assay, Wright-Giemsa staining, CD11b protein expression analysis, western blot analysis, and polymerase chain reaction.

Results: We found that oTR arrested the cell cycle at the S phase, upregulated the expression of myeloid surface marker CD11b, reduced the nuclear cytoplasmic ratio, and altered the horseshoe shape of nuclei, as evidenced by Wright-Giemsa staining. Furthermore, we found that the protein level of phosphorylated STAT3 was decreased when cells were treated with oTR, while phosphorylated STAT1 was activated. Moreover, the protein level of phosphorylated STAT3 and its upstream kinase, Janus kinase 2, were also inhibited when cells were treated with oTR after increased time. Additionally, the levels of phosphorylated SHP-1 were increased while phosphorylated SHP-2 was decreased.

Conclusion: Collectively, our data indicate a differentiationinduced mechanism underlying the inhibition of STAT3 signaling upon treatment with oTR. Therefore, oTR may constitute a novel differentiation-induced therapeutic for use in clinical treatment of AML.

Gereç ve Yöntemler: HL-60 hücrelerinin oTR ile inkübasyonunu takiben hücre üzerideki etkileri hücre canlılık testleri, Wright-Giemsa boyaması, CD11b protein ekspresyon analizi, western blot analizi ve polimeraz zincir reaksiyonu ile araştırıldı.

Bulgular: oTR’nin hücre siklusunun S fazında duraklattığını, myeloid hücre yüzey belirteçlerinden CD11b ekspresyonunun arttığını, çekirdek sitoplazma oranının azaldığını ve çekirdeğin atnalı şeklinin değiştiğini Wright-Giemsa boyası ile destekleyerek gördük. oTR ile muamele edilmiş hücrelerde fosforile STAT3 protein düzeyinin azaldığını, fosforile STAT1’in ise aktive olduğunu bulduk. Ayrıca fosforile STAT3 ve yukarı yöndeki kinaz olan Janus kinaz 2’nin, hücrelerin oTR ile inkübasyonunda artmış zamanla inhibe olduğu görüldü. Ek olarak fosforile SHP-1 düzeyleri artarken fosforile SHP-2 düzeyi azaldı.

Sonuç: Birlikte değerlendirildiğinde, sonuçlarımız oTR ile STAT3 inhibisyonu üzerinden bir diferansiyasyon indükleme mekanizmasını işaret etmektedir. Bu nedenle, oTR AML tedavisinde yeni bir diferansiyasyon-indükleyici terapötik olarak yer alabilir.

Anahtar Sözcükler: Orto-topolin ribozid, Diferansiyasyon, STAT3 sinyali, HL-60 hücreler

Keywords: Ortho-topolin riboside, Differentiation, STAT3 signal, HL60 cells

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Na LI and WeiPing LI, M.D., The Second Hospital of Dalian Medical University, Shahekou District, Dalian, China Phone : +86 17709873550, +86 17709871051 E-mail : linaonly828@163.com, liweiping0910@sina.com ORCID-ID: orcid.org/0000-0002-1843-9906

162

Received/Geliş tarihi: January 14, 2019 Accepted/Kabul tarihi: May 20, 2019

Turk J Hematol 2019;36:162-168

Wang L, et al: Ortho-Topolin Riboside Induced Differentiation through Inhibition of STAT3 Signaling in AML HL-60 Cells

Introduction

Materials and Methods

Leukemia comprises a group of malignant blood diseases characterized by uncontrolled overproduction of hematopoietic progenitors or terminally differentiated leukocytes [1]. It remains particularly difficult to treat acute myeloid leukemia (AML) [2]. Thus far, cytotoxic drugs targeting proliferating cells have shown limited efficacy in the treatment of AML; notably, such drugs also exhibit significant toxicity. All-trans retinoic acid (ATRA) and arsenic trioxide (ATO) provide new options for differentiation therapy, but have been limited to treatments of AML-M3 and are not suitable for other subtypes of AML [3]. Therefore, development of new chemotherapy drugs that can effectively promote differentiation and eliminate AML is urgently needed.

Materials

The level of tyrosine phosphorylation must be balanced during a variety of cellular processes such as growth and differentiation.

This is maintained by protein tyrosine kinases and protein tyrosine phosphatases (PTPs) [4]. SHP-1 and SHP-2 (SH2 domain-containing phosphatases 1 and 2) are two PTPs that play important roles in lymphocytes and other hematopoietic cells [5]. Signal transducer and activator of transcription (STAT) proteins are very important in the regulation of cell proliferation, survival, differentiation, and immune response [6]. It has been reported that aberrant STAT signaling often occurred in cases of AML [7,8,9]. Notably, some natural products have been reported to inhibit STAT3 activity through the regulation of SHP-1 and/ or SHP-2 in cancer cells [10].

Cytokinins are important phytohormones that control a variety of cellular processes in plants [11]. Moreover, cytokinin ribosides (N6-substituted adenosines) exhibit significant anticancer activity in mammals [12,13]. It was found that cytokinin ribosides can induce cell apoptosis and block cell cycling in various cancer cell lines, as well as in several xenografts and in a small clinical trial [14].

Ortho-topolin riboside (oTR; also known as 6-(2-hydroxybenzylamino)-9-D-ribofuranosylpurine, Figure 1) is a naturally occurring cytokinin secreted from Populus × robusta leaves after sunrise [15]. oTR has shown unique cytotoxic activity against NCI60 cell lines compared with the activity of other cytokinin ribosides [14]. However, a detailed molecular mechanism underlying the effect of oTR on differentiation has not been elucidated with respect to AML cells. We previously reported that oTR exhibited antitumor activity by inducing differentiation in the U937 human leukemia cell line, but the differentiation-inducing properties of oTR remain undefined in HL-60 cells. In this study, we detected the antitumor effect of oTR on HL-60 cells.

Ortho-topolin riboside (oTR, purity >99%) was obtained from OlChemim GmbH (Czech Republic). RPMI 1640 and fetal bovine serum (FBS) were obtained from GIBCO (USA). Anti-STAT3, anti-phospho-STAT3Y705, anti-JAK2, anti-phospho-JAK2Y1007/1008, anti-phospho-SHP-1Tyr564, anti-phospho-SHP-2Tyr542, anti-SHP-1, anti-SHP-2, and β-actin were obtained from Cell Signaling (USA). Wright-Giemsa staining solution was obtained from Sigma-Aldrich Corporation (USA). Penicillin-streptomycin, Cell Counting Kit-8 (CCK-8), and phosphatase inhibitor complex were obtained from the Beyotime Institute of Biotechnology (Beijing, China). Anti-human CD11b-PE was obtained from eBioscience (USA).

Cell Culture HL-60 cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were incubated in complete RPMI 1640 (RPMI 1640 with 10% (v/v) FBS and 100 U/mL of penicillin and streptomycin) at 37 °C in a humidified atmosphere containing 5% CO2.

Cell Viability Assay Cell viability was assayed using the CCK-8 assay. At a density of 1x104 cells/100 µL per well the cells were seeded, and then they were treated with increasing concentrations of oTR (0.1, 1, 10, 50, and 100 µM). After 24 h incubation, 10 µL of the CCK-8 solution was added to each well for a further 3 h of incubation at 37 °C. Then the absorbance was detected at 450 nm using a microplate reader (3001, Thermo Scientific, Finland). The cell viability was expressed as sample OD/control OD x 100%.

Wright-Giemsa Staining After treating the cells in the 96-well plate with the compound for different lengths of time, the cells were collected and washed with PBS. Cells were mounted on glass slides by bench-top low speed centrifuge (L2-4K, Hunan, China), and morphological

Figure 1. Structure of ortho-topolin riboside.

163

Wang L, et al: Ortho-Topolin Riboside Induced Differentiation through Inhibition of STAT3 Signaling in AML HL-60 Cells

evaluation of differentiation was assessed using a WrightGiemsa staining kit. Samples were dried overnight at room temperature and observed using a microscope (DMI 4000B, Leica, Germany).

CD11b Protein Expression Analysis The treated cells were collected and analyzed for expression of the cell surface differentiation marker CD11b using a FACSCalibur flow cytometer (FACSCalibur, Becton Dickinson, USA). After treatment, cells were harvested and washed with PBS, and the cells were incubated with the blocking antibody anti-mouse CD16/CD32 for 15 min at room temperature, then incubated with anti-human CD11b-PE antibody for 30 min at room temperature in the dark, and then analyzed by flow cytometry.

Western Blot Analysis After treatment with oTR for the time indicated, cells were washed twice with PBS buffer and then resuspended in RIPA buffer. After incubation on ice for 20 min, the RIPA buffer was centrifuged at 12,000 rpm for 20 min at 4 °C. The protein concentrations were measured by Bio-Rad protein assay (Bio-Rad, USA). The protein extracts (30 µg) were boiled and resolved by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis. After transfer to polyvinylidene fluoride membranes, the membranes were blocked with 5% dry milk in Tris-buffered saline Tween-20 (TBST) at room temperature for 1 h. The membrane was probed with the indicated primary antibody for STAT3, phospho-STAT3, JAK2, phospho-JAK2, SHP-1, SHP-2, phospho-SHP-1, phospho-SHP-2, and β-actin and then incubated with horseradish peroxidase-conjugated secondary antibody for 1 h. Immunoreactive proteins were detected by a chemiluminescence blotting detection system (FluorChem HD2, Alpha Innotech, USA).

Reverse Transcription-Polymerase Chain Reaction Analysis The oTR-treated HL-60 cells were collected and washed with PBS buffer, and the total RNA was extracted with TRIzol according to the reagent instructions and quantified by NanoDrop.

According to the manufacturer’s instructions, the genomic DNA was removed by adding gDNA Eraser Buffer, gDNA Eraser, total RNA, and RNase-free dH2O using the PrimeScript RT kit. Then the above DNA-removing reaction solution, which was mixed with RNase-free dH2O, PrimeScript Buffer, RT Prime Mix, and PrimeScript RT Enzyme Mix, was reverse-transcribed using a Thermal Cycler Dice instrument (TaKaRa, Japan). The polymerase chain reaction (PCR) mixture consisted of TB Green Premix Ex Taq II (Tli RNaseH Plus), PCR primer, DNA template, and sterilized ddH2O according to the kit (TaKaRa, No. RR820A). The cycle threshold (CT) value of each gene mRNA was detected by real-time PCR using the LightCycler 96 and analyzed by 2-ΔΔCT method. The PCR primer sequences are given in Table 1.

164

Turk J Hematol 2019;36:162-168

Statistical Analysis For the RT-PCR analysis, the CT was determined using the default settings: ΔCT(test) = CT(target gene, test) - CT(GAPDH, test); ΔCT(calibrator) = CT(target gene, calibrator) - CT(GAPDH, calibrator); ΔΔCT = ΔCT(test) - ΔCT(calibrator); Relative gene expression ratio = 2-ΔΔCT. Data are expressed as mean ± standard deviation. Student’s t-test and one-way ANOVA were used to compare the test and control values. *p<0.05 and **p<0.01 were considered statistically significant compared to the control.

Results oTR Inhibited Cell Proliferation in HL-60 Cells After treatment with increasing concentrations of oTR (0.1, 1, 10, 50, and 100 µM) for 24 h in HL-60 cells, we tested the cell proliferation by the CCK-8 assay. The results showed that the cell viability was inhibited significantly from 91.1±1.3% to 11.3±2.1% upon treatment with increased concentrations of oTR. The half maximal inhibitory concentration (IC50) value was 3.4 µM (Figure 2). oTR Induced the Differentiation of HL-60 cells To detect antiproliferative activity in HL-60 cells, the changes in cell cycle arrest were examined upon treatment with oTR. We found that oTR arrested the cell cycle at S in HL-60 cells (Figure 3A). Because cell growth arrest is coupled with cell differentiation in cancer cells, we used CD11b as a mature granulocyte marker to test the differentiation of HL-60 cells.

We found that the levels of the myeloid CD11b marker were elevated upon treatment with 1 µM oTR for 24 h (Figure 3B).

We also confirmed induced differentiation by morphological analysis using Wright-Giemsa staining. We found that untreated HL-60 cells were round with large and round nuclei and sparse cytoplasm. Treatment with oTR reduced the nuclear cytoplasmic ratio and altered the horseshoe morphology of nuclei (Figure 3C).

All these findings indicated that oTR induced the differentiation of HL-60 cells into mature granulocytes.

Table 1. The sequences of primers for real-time polymerase chain reaction.

PU.1

Forward: 5’-GCCCTATGACACGGATCTATAC-3’ Reverse: 5’-AAGTCCCAGTAATGGTCGCTAT-3’

C/EBPα

Forward: 5’-GACAAGAACAGCAACGAGTAC-3’ Reverse: 5’-TCATTGTCACTGGTCAGCTC-3’

C/EBPβ

Forward: 5’-CATCGACTCAGCCCGTAC-3’ Reverse: 5’-GAGAAGAGGTCGGAGAGGAAG-3’

GAPDH

Forward: 5’-TGGTGAAGCAGGCATCTGAG-3’ Reverse: 5’-CTCCTGCGACTTCAACAGCA-3’

Turk J Hematol 2019;36:162-168

Wang L, et al: Ortho-Topolin Riboside Induced Differentiation through Inhibition of STAT3 Signaling in AML HL-60 Cells

oTR Suppressed STAT3 Activation in oTR-induced AML Differentiation While Inducing the Activation of STAT1 It has been reported that STAT proteins, as latent cytoplasmic transcription factors, are very important in cellular processes including cell proliferation, differentiation, and apoptosis [16,17]. Here we found that oTR inhibited the protein levels of p-JAK2Tyr1007 and p-STAT3tyr705 obviously, but not the total protein of JAK2 and STAT3 in HL-60 cells (Figure 4). We also determined whether the activation of STAT1 phosphorylation is involved in the differentiation. Here we found that oTR induced differentiation in HL-60 cells by acting through the activation of p-STAT1.

Figure 2. Effects of cell viability of ortho-topolin riboside (oTR) on HL-60 cells. Cell viability was analyzed by CCK-8 assay after 24 h of treatment with increasing concentrations of oTR. The values are expressed as mean ± standard deviation from three individual experiments. ***p<0.001 versus control.

oTR Changed the Effects of oTR on mRNA Levels of C/EBPα, C/EBPβ, and PU.1 To further examine the ability of myeloid differentiation after treatment with oTR in HL-60 cells, we detected the mRNA

Figure 3. Differentiation-inducing activity of ortho-topolin riboside (oTR) in HL-60 cells. A) The HL-60 cells were treated with oTR (1 µM) for 24 h, and cell cycle analysis was detected by flow cytometry. B) The percentage of CD11b expressed in HL-60 cells. *p<0.05, **p<0.01 versus the control group without any treatment. C) Effects of oTR on the morphology of HL-60 cells. Cells were treated with 1 µM oTR or vehicle (0.1% DMSO) as a positive control for 24 h, and morphological changes were observed by phase contrast microscopy. Black arrows: Differentiated cells.

165

Wang L, et al: Ortho-Topolin Riboside Induced Differentiation through Inhibition of STAT3 Signaling in AML HL-60 Cells

expression of the monocytic transcription factors C/EBPα, C/ EBPβ, and PU.1. Consistent with monocytic differentiation, we found that C/EBPα, C/EBPβ, and PU.1 were upregulated compared with untreated cells at 48 h after treatment with oTR (Figure 5). oTR Decreased the Phosphorylation of SHP-2 While Increasing the Phosphorylation of SHP-1 It has been reported that SHP-1 and SHP-2 have important roles in hematopoietic cells [18,19]. The expression of SHP-1 in HL-60 cells was examined. We found that oTR increased phosphorylated SHP-1 protein expression (Figure 6). SHP-2 participates in JAK/ STAT signaling and positively contributes to cell differentiation and cell cycle maintenance [20,21,22]. The effect of oTR on the

Turk J Hematol 2019;36:162-168

expression of phosphorylated SHP-2 was also detected. Here we found that oTR inhibited the phosphorylation of SHP-2.

Discussion Differentiation therapies involve conversion of malignant tumors to curable tumors or terminally differentiated cells that undergo no further proliferation [23].

AML has been classified into eight subtypes, M0 to M7, according to the French-American-British group, which used morphology and cytochemistry to characterize AML [24,25].

Acute promyelocytic leukemia (APL) is the AML-M3 subtype characterized by the t(15;17) translocation [26]. ATRA and ATO are therapeutics specifically designed for this molecular feature [27]. Although these two drugs have greatly improved the prognosis for APL patients, they are not suitable for other subtypes of AML. Therefore, new differentiation-induced agents are needed for AML. The HL-60 cell line is the M2 subtype of AML [28]. In the present study, we found that cytokinin oTR was effective for inducing granulocytic differentiation of HL-60 AML cells. oTR increased the phosphorylation of SHP-1 while inhibiting the phosphorylation of SHP-2. We also found that oTR reduced the expression of phosphorylated STAT3 and the upstream kinase, Janus kinase 2, in a time-dependent manner. Our findings indicate that oTR can exert antitumor activity in HL-60 cells by inducing differentiation through the STAT3 signaling pathway.

Figure 4. Effects of ortho-topolin riboside (oTR) on protein levels of phosphorylated STAT1, STAT3, and JAK in HL-60 cells.

HL-60 cells were treated with oTR (1 µM) for 24 h. The western blot experiments were repeated three times and the data show representative results.

Figure 5. Cells were treated with 1 µM oTR for 48 h. The mRNA expressions of C/EBPα, C/EBPβ, and PU.1 were detected by qRTPCR. Data presented are the mean ± standard deviation of three independent experiments. **p<0.01.

166

Cytokinins are a class of naturally occurring plant hormones and purine derivatives that play important roles in plant growth and differentiation; moreover, they exhibit anticancer activity in vitro and in vivo in mammals [12,14]. Thus, cytokinins may be useful in the treatment of human diseases that involve dysregulated cell proliferation and/or differentiation [12]. oTR is a naturally occurring nucleoside that can be extracted from plants. In our study, we showed that oTR significantly inhibited the proliferation of HL-60 AML cells, as indicated

Figure 6. Effects of ortho-topolin riboside (oTR) on protein levels of phosphorylated SHP-1 and SHP-2 in HL-60 cells. HL-60 cells were treated with oTR (1 µM) for 24 h. The protein levels were detected by western blot analysis. The experiments were repeated three times and the data show representative results.

Turk J Hematol 2019;36:162-168

Wang L, et al: Ortho-Topolin Riboside Induced Differentiation through Inhibition of STAT3 Signaling in AML HL-60 Cells

by reduced viability of HL-60 cells upon treatment with oTR. Furthermore, we found that HL-60 cells were induced into mature granulocytes when treated with oTR. oTR also arrested the cell cycle at the S phase and upregulated the expression of CD11b. We confirmed the induction of differentiation by morphological analysis. We found that treatment with oTR reduced the nuclear cytoplasmic ratio and altered the horseshoe morphology of nuclei. Taken together, these findings indicated that oTR induced the differentiation of HL-60 cells into mature granulocytes.

STAT1 and STAT3 activation is important for the terminal differentiation of immature leukemia cells [29]. The activation of STAT1 has been confirmed in the differentiation of various drug-induced leukemia cells [30,31,32]. Activation of STAT1 is important in ATRA and other various drug-induced differentiation therapies for myeloid cells in APL and other subtypes of acute leukemia. Phosphorylated STAT1 can transactivate downstream target genes, such as PU.1, C/EBPα, C/EBPβ, CXCL-10, RIG-G, and IRF-I, in order to induce cell differentiation.

Abnormal STAT3 activation is often detected in many human cancer cells, including leukemia [33]. Homodimerization of STAT3 can lead to nuclear translocation, DNA binding, and subsequent gene transcription involved in the activation of STAT3 [33]. During activation, STAT3 phosphorylation is performed through activation of its upstream Janus kinases [34]. Agents that suppress the activation of STAT3 reportedly have potential for cancer prevention and treatment [6]. Here, we found that oTR suppressed STAT3 activation in oTR-induced AML differentiation therapy, while it induced the activation of STAT1; moreover, oTR induced the regulation of transcription factors C/EBPα, C/EBPβ, and PU.1, all of which are important during myeloid differentiation.

SHP-1 is encoded by the PTPN6 gene and expressed widely in the hematopoietic system; it exhibits various impacts on cell signaling pathways [6,35]. SHP-1 has been reported to negatively regulate the phosphorylation of STAT3 during tumor development, including in the formation of leukemias, as well as in gastric and breast cancers [20,36]. SHP-2 is encoded by the PTPN11 gene; its overexpression has been observed at both protein and RNA levels in human AML cell lines [37]. Notably, SHP-2 can inhibit apoptosis in cancer stem cells and enhance the growth of leukemia stem cells [20,37,38]. Although SHP-2 is traditionally regarded as a PTP, such that it should inhibit the activity of kinases and exhibit negative regulation of cell function, SHP-2 has been reported to promote cell growth through both upregulation of positive signaling pathways and downregulation of negative signaling pathways [39,40,41].

Here, we found that oTR inhibited the phosphorylation of SHP2, whereas it increased the phosphorylation of SHP-1 in HL-60 cells.

Conclusion Our results demonstrated that oTR induced the differentiation of HL-60 human AML cells by suppression of the STAT3 signaling pathway and induction of STAT1 activation. We also found that oTR reduced the level of phosphorylated SHP-2, while it increased the level of phosphorylated SHP-1 in HL-60 cells. Our data suggest that oTR might be applicable in the treatment of AML patients with M2 subtype by inducing cell differentiation, but not all subtypes of AML. Therefore, future studies on the antitumor effect of oTR are needed.

Acknowledgments We thank Liwen Bianji, Edanz Group China (www.liwenbianji.cn/ac), for editing the English text of a draft of this manuscript. This work was financially supported by the Natural Science Foundation of Liaoning Province (20170540184) and the Fundamental Research Funds for the Central Universities of China (DUT18LK30).

Ethics Ethics Committee Approval: Dalian University of Technology.

Informed Consent: N/A. Authorship Contributions Concept: W.L., N.L.; Design: L.W., J.C.; Data Collection or Processing: F.L., S.L.; Analysis or Interpretation: H.P., M.L.; Literature Search: S.L.; Writing: L.W. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Kang X, Lu Z, Cui C, Deng M, Fan Y, Dong B, Han X, Xie F, Tyner JW, Coligan JE, Collins RH, Xiao X, You MJ, Zhang CC. The ITIM-containing receptor LAIR1 is essential for acute myeloid leukaemia development. Nat Cell Biol 2015;17:665-677.

2. Guerrouahen BS, Futami M, Vaklavas C, Kanerva J, Whichard ZL, Nwawka K, Blanchard EG, Lee FY, Robinson LJ, Arceci R, Kornblau SM, Wieder E, Cayre YE, Corey SJ. Dasatinib inhibits the growth of molecularly heterogeneous myeloid leukemias. Clin Cancer Res 2010;16:1149-1158.

3. Hatzimichael E, Georgiou G, Benetatos L, Briasoulis E. Gene mutations and molecularly targeted therapies in acute myeloid leukemia. Am J Blood Res 2013;3:29-51.

4. Hunter T. Tyrosine phosphorylation: thirty years and counting. Curr Opin Cell Biol 2009;21:140-146.

5. Dempke WCM, Uciechowski P, Fenchel K, Chevassut T. Targeting SHP-1, 2 and SHIP pathways: a novel strategy for cancer treatment? Oncology 2018;95:257-269.

6. Bi L, Yu Z, Wu J, Yu K, Hong G, Lu Z, Gao S. Honokiol inhibits constitutive and inducible STAT3 signaling via PU.1-induced SHP1 expression in acute myeloid leukemia cells. Tohoku J Exp Med 2015;237:163-172.

7. Lin TS, Mahajan S, Frank DA. STAT signaling in the pathogenesis and treatment of leukemias. Oncogene 2000;19:2496-2504.

167

Wang L, et al: Ortho-Topolin Riboside Induced Differentiation through Inhibition of STAT3 Signaling in AML HL-60 Cells

8. Van Roosbroeck K, Cox L, Tousseyn T, Lahortiga I, Gielen O, Cauwelier B, De Paepe P, Verhoef G, Marynen P, Vandenberghe P, De Wolf-Peeters C, Cools J, Wlodarska I. JAK2 rearrangements, including the novel SEC31A-JAK2 fusion, are recurrent in classical Hodgkin lymphoma. Blood 2011;117:4056-4064.

9. Teramo A, Gattazzo C, Passeri F, Lico A, Tasca G, Cabrelle A, Martini V, Frezzato F, Trimarco V, Ave E, Boscaro E, Piazza F, Facco M, Trentin L, Semenzato G, Zambello R. Intrinsic and extrinsic mechanisms contribute to maintain the JAK/STAT pathway aberrantly activated in T-type large granular lymphocyte leukemia. Blood 2013;121:3843-3854.

10. Lee JH, Chiang SY, Nam D, Chung WS, Lee J, Na YS, Sethi G, Ahn KS. Capillarisin inhibits constitutive and inducible STAT3 activation through induction of SHP-1 and SHP-2 tyrosine phosphatases. Cancer Lett 2014;345:140-148.

11. Ishii Y, Sakai S, Honma Y. Cytokinin-induced differentiation of human myeloid leukemia HL-60 cells is associated with the formation of nucleotides, but not with incorporation into DNA or RNA. Biochim Biophys Acta 2003;1643:11-24.

12. Voller J, Zatloukal M, Lenobel R, Dolezal K, Béres T, Krystof V, Spíchal L, Niemann P, Dzubák P, Hajdúch M, Strnad M. Anticancer activity of natural cytokinins: a structure-activity relationship study. Phytochemistry 2010;71:1350-1359.

13. Li M, Qi Y, Wei J, Lu L, Zhao X, Zhou L. N6-Isopentenyladenosine promoted HeLa cell apoptosis through inhibitions of AKT and transforming growth factor beta-activated kinase 1 activation. Tumour Biol 2017;39:1010428317695966.

14. Voller J, Beres T, Zatloukal M, Kaminski PA, Niemann P, Dolezal K, Dzubak P, Hajduch M, Strnad M. The natural cytokinin 2OH3MeOBAR induces cell death by a mechanism that is different from that of the “classical” cytokinin ribosides. Phytochemistry 2017;136:156-164.

15. Hewett EW, Wareing PF. Cytokinins in Populus x robusta (Schneid): light effects on endogenous levels. Planta 1973;114:119-129.

16. Darnell JE Jr. STATs and gene regulation. Science 1997;277:1630-1635.

17. Finidori J, Kelly PA. Cytokine receptor signalling through two novel families of transducer molecules: Janus kinases, and signal transducers and activators of transcription. J Endocrinol 1995;147:11-23.

18. Han Y, Amin HM, Franko B, Frantz C, Shi X, Lai R. Loss of SHP1 enhances JAK3/STAT3 signaling and decreases proteosome degradation of JAK3 and NPM-ALK in ALK+ anaplastic large-cell lymphoma. Blood 2006;108:27962803.

19. Wu C, Sun M, Liu L, Zhou GW. The function of the protein tyrosine phosphatase SHP-1 in cancer. Gene 2003;306:1-12.

20. Nabinger SC, Chan RJ. Shp2 function in hematopoietic stem cell biology and leukemogenesis. Curr Opin Hematol 2012;19:273-279.

21. Tajan M, de Rocca Serra A, Valet P, Edouard T, Yart A. SHP2 sails from physiology to pathology. Eur J Med Genet 2015;58:509-525.

22. Zhang J, Zhang F, Niu R. Functions of Shp2 in cancer. J Cell Mol Med 2015;19:2075-2083.

23. Spira AI, Carducci MA. Differentiation therapy. Curr Opin Pharmacol 2003;3:338-343.

24. Thuler LCS, Pombo-de-Oliveira MS. Acute promyelocytic leukaemia is highly frequent among acute myeloid leukaemias in Brazil: a hospital-based cancer registry study from 2001 to 2012. Ann Hematol 2017;96:355-362.

168

Turk J Hematol 2019;36:162-168

25. Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, Gralnick HR, Sultan C. Proposal for the recognition of minimally differentiated acute myeloid leukaemia (AML-MO). Br J Haematol 1991;78:325-329.

26. Varghese L, Janckila A, Yam LT. Acute promyelocytic leukemia. New methods in diagnosis and treatment. J Ky Med Assoc 1999;97:61-65.

27. Slack JL, Waxman S, Tricot G, Tallman MS, Bloomfield CD. Advances in the management of acute promyelocytic leukemia and other hematologic malignancies with arsenic trioxide. Oncologist 2002;7(Suppl 1):1-13.

28. Dalton WT Jr, Ahearn MJ, McCredie KB, Freireich EJ, Stass SA, Trujillo JM. HL-60 cell line was derived from a patient with FAB-M2 and not FAB-M3.

Blood 1988;71:242-247.

29. Gao J, Fan M, Xiang G, Wang J, Zhang X, Guo W, Wu X, Sun Y, Gu Y, Ge H, Tan R, Qiu H, Shen Y, Xu Q. Diptoindonesin G promotes ERK-mediated nuclear translocation of p-STAT1 (Ser727) and cell differentiation in AML cells. Cell Death Dis 2017;8:2765.

30. Shao X, Liu Y, Li Y, Xian M, Zhou Q, Yang B, Ying M, He Q. The HER2 inhibitor TAK165 sensitizes human acute myeloid leukemia cells to retinoic acid-induced myeloid differentiation by activating MEK/ERK mediated RARalpha/STAT1 axis. Sci Rep 2016;6:24589.

31. Ying M, Zhou X, Zhong L, Lin N, Jing H, Luo P, Yang X, Song H, Yang B, He Q. Bortezomib sensitizes human acute myeloid leukemia cells to all-transretinoic acid-induced differentiation by modifying the RARα/STAT1 axis.

Mol Cancer Ther 2013;12:195-206.

32. Fang Y, Zhong L, Lin M, Zhou X, Jing H, Ying M, Luo P, Yang B, He Q. MEK/ERK dependent activation of STAT1 mediates dasatinib-induced differentiation of acute myeloid leukemia. PLoS One 2013;8:e66915.

33. Rhee YH, Jeong SJ, Lee HJ, Lee HJ, Koh W, Jung JH, Kim SH, Sung-Hoon K. Inhibition of STAT3 signaling and induction of SHP1 mediate antiangiogenic and antitumor activities of ergosterol peroxide in U266 multiple myeloma cells. BMC Cancer 2012;12:28.

34. Schreiner SJ, Schiavone AP, Smithgall TE. Activation of STAT3 by the Src family kinase Hck requires a functional SH3 domain. J Biol Chem 2002;277:45680-45687.

35. Abram CL, Lowell CA. Shp1 function in myeloid cells. J Leukoc Biol 2017;102:657-675.

36. Huang TT, Su JC, Liu CY, Shiau CW, Chen KF. Alteration of SHP-1/pSTAT3 signaling: a potential target for anticancer therapy. Int J Mol Sci 2017;18:1234.

37. Xu R, Yu Y, Zheng S, Zhao X, Dong Q, He Z, Liang Y, Lu Q, Fang Y, Gan X, Xu X, Zhang S, Dong Q, Zhang X, Feng GS. Overexpression of Shp2 tyrosine phosphatase is implicated in leukemogenesis in adult human leukemia.

Blood 2005;106:3142-3149.

38. Yang W, Klaman LD, Chen B, Araki T, Harada H, Thomas SM, George EL, Neel BG. An Shp2/SFK/Ras/Erk signaling pathway controls trophoblast stem cell survival. Dev Cell 2006;10:317-327.

39. Neel BG, Gu H, Pao L. The ‘Shp’ing news: SH2 domain-containing tyrosine phosphatases in cell signaling. Trends Biochem Sci 2003;28:284-293.

40. Xu D, Qu CK. Protein tyrosine phosphatases in the JAK/STAT pathway. Front Biosci 2008;13:4925-4932.

41. Liu X, Qu CK. Protein tyrosine phosphatase SHP-2 (PTPN11) in hematopoiesis and leukemogenesis. J Signal Transduct 2011;2011:195239.

RESEARCH ARTICLE DOI: 10.4274/tjh.galenos.2019.2019.0008 Turk J Hematol 2019;36:169-177

Acute Lymphoblastic Leukemia in Routine Practice: A Turkish Multicenter Study Rutin Uygulamada Akut Lenfoblastik Lösemi: Türkiye’den Çok Merkezli Bir Çalışma Rafiye Çiftçiler1, Ömür Gökmen Sevindik2, Ali İrfan Emre Tekgündüz3, Mehmet Ali Erkurt4, Filiz Vural5, Burhan Turgut6, Leylagül Kaynar7, Bahriye Payzın8, Mehmet Hilmi Doğu9, Volkan Karakuş10, Fevzi Altuntaş11, Yahya Büyükaşık1, Fatih Demirkan12 1Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey 2Medipol University Hospital, Clinic of Hematology, İstanbul, Turkey 3Memorial Bahçelievler Hospital, Clinic of Hematology, İstanbul, Turkey 4İnönü University Faculty of Medicine, Department of Hematology, Malatya, Turkey 5Ege University Faculty of Medicine, Department of Hematology, İzmir, Turkey 6Namık Kemal University Faculty of Medicine, Department of Hematology, Tekirdağ, Turkey 7Erciyes University Faculty of Medicine, Department of Hematology, Kayseri, Turkey 8İzmir Atatürk Training and Research Hospital, Clinic of Hematology, İzmir, Turkey 9İstanbul Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey 10Muğla Sıtkı Koçman University Faculty of Medicine, Department of Hematology, Muğla, Turkey 11Ankara Oncology Training and Research Hospital, Clinic of Hematology, Ankara, Turkey 12Dokuz Eylül University Faculty of Medicine, Department of Hematology, İzmir, Turkey

Abstract

Öz

Objective: Significant developments occurred in the clinical management of acute lymphoblastic leukemia (ALL) in adults in recent decades. However, treatment results are still not satisfactory, especially in routine practice. The objective of this study was to evaluate the general clinical features, treatment details, and outcomes of a large group of patients followed in multiple centers in Turkey with a diagnosis of ALL.

Amaç: Son yıllarda erişkinlerde akut lenfoblastik löseminin (ALL) tedavi yönetiminde önemli gelişmeler meydana gelmiştir. Bununla birlikte, özellikle rutin uygulamada tedavi sonuçları hala tatmin edici değildir. Çalışmanın amacı, Türkiye’de birden fazla merkezde takip edilen geniş bir ALL hasta grubunun genel klinik özelliklerini, tedavi özelliklerini ve sağkalım sonuçlarını değerlendirmektir.

Materials and Methods: A retrospective analysis of the data of patients with ALL was made, the patients having been diagnosed and treated between January 2003 and June 2017 by different protocols in the hematology clinics of ten different centers. A total of 288 patients, aged between 17 and 76 years old, were included in the study. In this retrospective multicenter analysis of patients with ALL, classification of patients was performed based on treatment period, Philadelphia chromosome positivity, treatment regimen, and administration of allogeneic hematopoietic stem cell transplantation (allo-HSCT).

Results: The majority of cases were B-cell in origin, while 224 patients had B-ALL and 64 of the patients had T-ALL. Median follow-up duration for all patients was 18.2 months (range: 0.03-161 months).

Philadelphia chromosome positivity was determined in 49 patients (21.9%), and 54 patients (18.8%) were receiving allo-HSCT. After induction chemotherapy, 219 patients (76.0%) achieved complete

Gereç ve Yöntemler: Ocak 2003 ile Haziran 2017 tarihleri arasında on farklı merkezdeki hematoloji kliniğinde tanı konulan ve farklı protokollerle tedavi edilen ALL hastalarının verilerinin retrospektif analizi yapıldı. Çalışmaya yaşları 17 ile 76 arasında değişen toplam 288 hasta dahil edildi. Bu çalışmada ALL’li hastalar tedavi periyoduna, Philadelphia kromozom pozitifliğine, tedavi protokolü ve allojenik hematopoetik kök hücre nakli (AHKHN) yapılıp yapılmamasına göre sınıflandırıldı.

Bulgular: Olguların 224’ü B-ALL, 64’ü T-ALL idi. Tüm hastalar için ortanca takip süresi 18,2 ay (dağılım, 0,03-161 ay) idi. Philadelphia kromozomu (Ph+) pozitifliği 49 (%21,9) hastada saptandı ve 54 hastaya (%18,8) AHKHN yapıldığı izlendi. İndüksiyon kemoterapisinden sonra 219 hasta (%76) tam remisyona girdi, 32 hasta tedaviye refrakter (%11,2) olarak değerlendirildi, 37 hastada ise (%12,8) mortalite gözlendi. Ortanca genel sağkalım 47,7 ay (%95 güven aralığı: 36,159,2) ve ortanca hastalıksız sağkalım tüm hastalar için 23,4 ay (%95 güven aralığı: 6,7-40,0) idi.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Rafiye ÇİFTÇİLER, M.D., Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey Phone : +90 505 583 17 98 E-mail : rafiyesarigul@gmail.com ORCID-ID: orcid.org/0000-0001-5687-8531

Received/Geliş tarihi: January 03, 2019 Accepted/Kabul tarihi: May 24, 2019

169

Çiftçiler R, et al: Acute Lymphoblastic Leukemia in Routine Practice

Turk J Hematol 2019;36:169-177

Abstract

Öz

remission, 32 patients (11.2%) were evaluated as treatment refractory, and 37 patients (12.8%) were deceased. Median overall survival was 47.7 months (95% confidence interval: 36.1-59.2) and median disease-free survival was 23.4 months (95% confidence interval: 6.740.0) for all patients.

Sonuç: Sonuç olarak, çok merkezli çalışmalar, belirli bir hastalığın spesifik klinik özelliklerini tanımlamak için büyük öneme sahiptir. Bu çalışmanın sonuçları, Türk ALL hasta profili hakkında değerli bilgiler sağlayan gerçek hayat verilerini yansıttığı için literatüre önemli bir katkı sağlayacaktır.

Conclusion: Multicenter studies are extremely important for defining the specific clinical features of a particular disease. The results of this study will make a significant contribution to the literature as they reflect real-life data providing valuable information about the Turkish ALL patient profile.

Anahtar Sözcükler: Akut lenfoblastik lösemi, Pediatrik rejim, Pediatrik rejimden ilham alan rejim, Philadelphia kromozomu

Keywords: Acute lymphoblastic leukemia, Pediatric regimen, Pediatric-inspired regimen, Philadelphia chromosome

Introduction Significant developments have occurred in the clinical management of acute lymphoblastic leukemia (ALL) in adults in the last decades. However, treatment results are still not satisfactory, especially in routine practice. Disease biology, higherrisk leukemia genetics, absence of sufficiently effective therapies, noncompliance with treatment, and intolerance of chemotherapy are the main reasons for unsatisfactory results [1]. Another challenge in adult ALL treatment is the lack of a standardized regimen. However, gradual stable improvement has been observed recently in adult ALL as a result of adopting pediatric-inspired regimens, better identification of high-risk patients and early referral for allogeneic hematopoietic stem cell transplantation (allo-HSCT), increased availability of donors, and the inclusion of minimal residual disease (MRD) in ALL treatment decisions [2,3].

The objective of this study was to evaluate the general clinical features, treatment details, and outcomes of a large group of patients with ALL followed in multiple centers in Turkey.

Materials and Methods Study Design and Data Collection A retrospective analysis was made of the data of ALL patients who were diagnosed and treated with different protocols in ten hematology clinics between January 2003 and June 2017. Patients were classified by treatment period, Philadelphia chromosome positivity (Ph+), treatment regimen, and administration of allo-HSCT. A total of 288 patients were included from the ten participating centers. The primary outcome was overall survival (OS) and secondary outcomes were complete remission (CR) rate and disease-free survival (DFS).

The presence of ALL was diagnosed by the detection of ≥20% blasts in the bone marrow. Immunophenotype was detected using flow cytometry (peripheral blood or bone marrow) or immunohistochemical techniques (bone marrow biopsy or 170

aspiration) for each patient. The presence of the Ph chromosome/ BCR-ABL fusion transcript was investigated using conventional cytogenetic analysis (karyotyping) on bone marrow samples.

Quantitative polymerase chain reaction (RQ-PCR) was performed to monitor BCR/ABL fusion transcripts during follow-up.

Intensive regimens were classified as pediatric regimens (BFM, Dana Farber), pediatric-inspired chemotherapy (DFCIALL consortium protocol, CALGB, Linker-4 regimen, MRC UKALLXII/ECOG-2993, GMALL), or adult intensive chemotherapy (HYPERCVAD, CODOX-M, CHOEP, GRAALL-2003, FLAG, FLAGIDA). Nonintensive regimens were classified as POMP and EWALL regimens. A total of 86 patients (29.9%) were treated with a pediatric regimen, 84 (29.1%) with pediatric-inspired chemotherapy, 105 (36.5%) with adult intensive chemotherapy, and 13 (4.5%) with a nonintensive regimen. At the time of diagnosis, patients with good general condition and good ECOG performance status were treated with intensive regimens such as a pediatric regimen, pediatric-inspired chemotherapy, or adult intensive chemotherapy. Patients with poor general condition and poor ECOG performance status were given nonintensive regimens such as EWALL and POMP chemotherapy protocols.

The treatment regimens are presented in Table 1.

All patients received growth factor support during chemotherapy, and anti-infective prophylaxis with fluconazole (400 mg/day), valacyclovir (2x500 mg/day), and trimethoprim/ sulfamethoxazole (160/800 mg, 2 days a week) was used in the intensive chemotherapy group. All patients underwent bone marrow aspiration and biopsy on median day 28 of treatment (range: days 18-48) to evaluate patients’ responses to induction chemotherapy. CR was defined as <5% blasts in regenerating bone marrow without the finding of extramedullary residual disease.

All of the ethical considerations were strictly followed in accordance with the 1964 Helsinki Declaration. As standard care/action of the hospitals has been recognized from the

Çiftçiler R, et al: Acute Lymphoblastic Leukemia in Routine Practice

Turk J Hematol 2019;36:169-177

patient records that all of the studied patients gave informed consent at the time of admission to the hospital and before the administration of chemotherapy and other relevant diagnostic/ therapeutic standards of care.

Statistical Analysis Demographic characteristics were presented using proportions and medians (minimum-maximum) for categorical and continuous variables, respectively. Statistical comparisons were made using the chi-square test for categorical data. Survival analyses were made using the Kaplan-Meier test. The log-rank test was applied to compare survival data. OS was calculated from the date of diagnosis to death for any reason. Surviving patients were counted on the date of the final follow-up examination.

DFS was calculated from the date of CR to relapse or death in

Results Patient and Treatment Group Characteristics

Table 1. Treatment regimens.

Treatment regimens

remission. Patients surviving in remission were counted on the date of the final follow-up examination. Univariate analyses of the differences in OS and DFS were applied using log-rank tests.

Receiving allo-HSCT, age (≤30 years), sex (male), Ph chromosome (negativity), treatment regimen (pediatric regimen vs. other regimens), and time period (2011-2017 vs. 2003-2011) were evaluated as prognostic factors. Univariate comparisons with a p-value of <0.15 were included in the multivariate analyses, in which p<0.05 was considered statistically significant. Cox regression analysis was performed to study the simultaneous impact of selected factors on survival. Values of p<0.05 were accepted as statistically significant. The statistical analyses were conducted using SPSS 17 (SPSS Inc., Chicago, IL, USA).

n

Intensive regimen - Pediatric regimen BFM [4]

71

Dana Farber [5]

15

- Pediatric-inspired chemotherapy DFCI-ALL [6]

25

CALGB [7]

51

Linker-4 regimen [8]

3

MRC UK-ALLXII/ECOG-2993 [9]

2

GMALL [10]

3

- Adult intensive chemotherapy

The study included 288 patients, consisting of 173 males and 115 females with a median age of 34 (range: 17-95 years). The majority of cases were B-cell in origin; 224 (77.8%) patients had B-ALL and 64 (22.2%) had T-ALL. Philadelphia chromosome positivity (Ph+) was determined in 49 (21.9%) patients. All patients with Ph+ ALL were diagnosed after 2005. Imatinib was added to the chemotherapy protocol for 47 Ph+ ALL patients (95.9%). Rituximab was added to the chemotherapy protocol for patients with CD20-positive B-cell ALL. Allo-HSCT was administered to 54 (18.8%) patients. The clinical characteristics of the ALL patients are given in Table 2.

Table 2. Baseline characteristics of acute lymphoblastic leukemia patients.

HYPERCVAD (hyperfractionated cyclophosphamide, vincristine, doxorubicin, and dexamethasone alternating with high-dose methotrexate and cytarabine) [11]

92

CODOX-M (cyclophosphamide, vincristine, doxorubicin, high-dose methotrexate/ifosfamide, etoposide, and high-dose cytarabine) [12]

1

CHOEP (cyclophosphamide, doxorubicin, vincristine, etoposide, prednisone) [13]

1

T-ALL / B-ALL

64 (22.2%)/224 (77.8%)

GRAALL-2003 [14]

4

Ph-positive (Ph+) ALL (among B-ALL cases)

49 (21.9%)

FLAG (fludarabine, cytarabine, granulocyte colonystimulating factor) [15]

2

Intensive / nonintensive treatment

275 (95.4%)/13 (4.5%)

FLAG-IDA (fludarabine, cytarabine, granulocyte colony-stimulating factor, idarubicin) [15]

5

Age, years

34 (17-95)

Sex, F/M

115/173

Follow-up duration for all and surviving 18.3 (0.03-161) and 23.3 patients, months (0.03-161)

Treatment protocols*

Nonintensive regimen EWALL [16]

4

POMP (mercaptopurine, vincristine, methotrexate, prednisone) [17]

9

Total

n (range or percentage)

288

BFM: Berlin-Frankfurt-Munster, DFCI: Dana Farber Cancer Institute, CALGB: Cancer and Leukemia Group B, ECOG: Eastern Cooperative Oncology Group, EWALL: European Working Group on Adult ALL, MRC: Medical Research Council, n: number of patients, GMALL: German Multicenter ALL Study Group, GRAALL: Group for Research on Adult Acute Lymphoblastic Leukemia.

Pediatric regimen

86 (29.9%)

Pediatric-inspired chemotherapy

84 (29.1%)

Adult intensive chemotherapy

105 (36.5%)

Non-intensive (POMP or EWALL)

13 (4.5%)

*Tyrosine kinase inhibitor

47 patients (95.9%)

Allo-HSCT

54 (18.75%)

*Imatinib was added to the chemotherapy protocol for Philadelphia-positive ALL patients. Rituximab was added to the chemotherapy protocol for CD20-positive B-cell ALL. B-ALL: B-cell acute lymphoblastic leukemia, CR: complete remission, n: number of patients, T-ALL: T-cell acute lymphoblastic leukemia.

171

Ă&#x2021;iftçiler R, et al: Acute Lymphoblastic Leukemia in Routine Practice

Overall Outcomes The median follow-up period for all patients was 18.2 months (range: 0.03-161.0 months). After induction chemotherapy, 219 patients (76.0%) achieved complete remission, 32 patients (11.2%) were evaluated as treatment refractory, and 37 patients (12.8%) were deceased. Median OS was 47.7 months (95% confidence interval (CI): 36.1-59.2) and median DFS was 23.4 months (95% CI: 6.7-40.0) for all patients. The 3-year OS and DFS rates were 56% and 45%, respectively. The 5-year OS and DFS rates were 43% and 35%, respectively.

Median OS was 33.9 months (95% CI: 17.4-50.3) for Ph+ ALL patients and 73.7 months (95% CI: 33.9-113.5) for Ph-negative (Ph-) ALL patients (p=0.48). Median DFS was 7.1 months (95% CI: 5.0-9.3) for Ph+ ALL patients and 34.6 months (95% CI: 16.0-53.2) for Ph- ALL patients. DFS was statistically significant longer in Ph- patients than Ph+ patients (p=0.008). The 5-year OS was 50% in Ph- patients and 16% in Ph+ patients, respectively. The 5-year DFS was 35% in Ph- patients and 11% in Ph+ patients (Figure 1).

Median OS was 53.4 months (95% CI: 37.9-63.5) in patients receiving a pediatric regimen and 42.9 months (95% CI: 19.966.6) in patients receiving other intensive regimens (p=0.05).

Median DFS was 16.9 months (95% CI: 3.9-23.6) in patients receiving a pediatric regimen and 13.3 months (95% CI: 6.520) in patients receiving other intensive regimens (p=0.78).

The 5-year OS was 45% in patients who received a pediatric regimen and 43% in patients who received other intensive regimens. The 5-year DFS was 23% in patients who received a pediatric regimen and 25% in patients who received other intensive regimens (Figure 2).

Turk J Hematol 2019;36:169-177

When only the patients under 30 years of age were analyzed, no significant difference was determined between pediatric and other intensive regimens in terms of OS and DFS. The 3-year OS was 77% in patients under 30 years of age who received a pediatric regimen and 66% in patients who received other intensive regimens. The 5-year OS was 53% in patients under 30 years of age who received a pediatric regimen and 56% in patients who received other intensive regimens (p=0.68). The 3-year DFS was 54% in patients under 30 years of age who received a pediatric regimen and 45% in patients who received other intensive regimens. The 5-year DFS was 36% in patients under 30 years of age who received a pediatric regimen and 31% in patients who received other intensive regimens (p=0.84).

The 2-year periods between 2003 and 2017 for treatment regimens are shown in Figure 3. From 2003 to 2017, the usage of pediatric regimens increased in ALL patients. The count of patients diagnosed with ALL and the treatment protocols used were observed to vary over time. While adult intensive regimens were used more commonly in the past, there is a tendency to use pediatric regimens at present time.

The follow-up dates between January 2003 and April 2017 were divided into 7 treatment periods (Table 3). There was no statistically significant improvement in OS according to time among the ALL patients (p=0.58). There was no statistically significant improvement in DFS according to time for ALL patients (p=0.92). The success of CR did not differ significantly over the years (p=0.49). OS and DFS were higher between the years of 2007 and 2011 compared to other periods. OS and DFS were higher in the 2007-2011 period, but not at a statistically significant level. The 5-year OS rate was 73% in 2007-2011 and

Figure 1. Overall survival (p=0.48) and disease-free survival (p=0.008) for acute lymphoblastic leukemia patients according to Philadelphia chromosome status.

OS: Overall survival, DFS: disease-free survival.

172

Çiftçiler R, et al: Acute Lymphoblastic Leukemia in Routine Practice

Turk J Hematol 2019;36:169-177

Table 3. Complete remission rate, overall survival, and disease-free survival according to time periods.

Time period

20032005

20052007

20072009

2009-2011 2011-2013 20132015

20152017

Total

p

CR (%)

80%

64%

57.9%

73%

69.8%

77.2%

77.9%

73.2%

0.49

DFS, months, median (95% CI) % ± SE at 3 years

10.3 (0.69-20) 33.3±13.6

13.3 (10-16.5) 19±11.25

64.1 (0-139.6) 54.5±15

54.5 (0-129) 51.1±12

39 (25.3-52.6) 57.6±8.7

13.6 (2.4-24.7) 43.8±8

17.0 (13.5-20.5) 52.1±8

18.9 (2-35.7) 45±4.2

0.92

OS, months, median (95% CI) % ± SE at 3 years

53.7 (0-118) 40.4±9.3

22.6 (9.5-35.6) 36.9±10.6

90 (0-182) 65.5±11.6

60.0 (43.2-76.8) 48.5±11.3

53.4 (33.8-73) 61.1±7.3

47.7 (25.8-69.5) 56.8±7.3

22.6 (20.2-25.0) 58±7.3

43.1 (31.2-55.1) 56±3.5

0.58

OS: Overall survival, DFS: disease-free survival, CI: confidence interval, CR: complete remission

Figure 2. Overall survival (p=0.05) and disease-free survival (p=0.78) for acute lymphoblastic leukemia patients according to pediatric regimens and other intensive regimens.

OS: Overall survival, DFS: disease-free survival.

Figure 3. Two-year periods between 2003 and 2017 for treatment regimens.

173

Çiftçiler R, et al: Acute Lymphoblastic Leukemia in Routine Practice

Turk J Hematol 2019;36:169-177

36% in the remaining period (p=0.08). The 5-year DFS rate was 55% in 2007-2011 and 24% in the remaining period (p=0.11).

patients has improved the OS rate, unfortunately it is still as poor as 30%-40% at 5 years [18,19,20].

Cox Regression Analyses

In this study, patients were classified by treatment period, Philadelphia chromosome positivity, treatment regimen, and administration of allo-HSCT. The results consisted of induction therapy and survival outcomes of patients from ten participating centers. A variety of factors were determined that could affect OS and DFS in adult ALL patients, such as Philadelphia chromosome negativity, treatment regimen, younger age, being male, cellular origin of the disease, and receiving allo-HSCT.

In univariate analyses the variables that affected OS were determined to be receiving allo-HSCT (p=0.01), cellular origin of the disease (B-cell ALL) (p=0.02), patient age (≤30 years) (p=0.001), being male (p=0.03), and treatment regimen (receiving a pediatric regimen) (p=0.05) (Table 4). Cox regression analysis revealed patient age (≤30 years) (p<0.001) and cellular origin of the disease (B-cell origin) (p=0.04) as the parameters predicting OS. In univariate analyses the variables that affected DFS were receiving allo-HSCT (p=0.02), patient age (≤30 years) (p=0.02), being male (p=0.10), and Ph chromosome negativity (p=0.009).

Cox regression analysis did not reveal any parameters predicting DFS.

Discussion ALL is one of the most common hematological malignancies in pediatric patients, with a cure rate of approximately 80%.

However, in adults, ALL is uncommon and has a bad prognosis [9]. Despite the improvement in CR rates, most adults with ALL will relapse and finally die because of this illness. Although advanced therapy such as allo-HSCT and supportive care for ALL

Ph+ ALL is a leukemia mainly encountered in adult patients, and its incidence tends to grow with age [21]. The Ph chromosome marks a group of patients at very high risk, as shown by the data published by a French study in which of 25 patients with Ph+ ALL only 60% reached CR after a course of chemotherapy and 4 patients reached CR after salvage chemotherapy. The CR rate was 76%, the mean DFS was 5.6 months, and the mean OS was 10.1 months [22]. Gokbuget et al. [23] reported 50 Ph+ patients who had poor responses to age-adjusted chemotherapy compared to Ph- patients. The remission rate was reported as 19% for Ph+ patients and 64% for Ph- patients. In the current study, OS was longer in Ph- patients than Ph+ patients but there was no statistically significant difference. In addition, DFS was statistically significantly longer in Ph- patients than Ph+ patients. All patients with Ph+ ALL were diagnosed after 2005

Table 4. Univariate and multivariate analyses (Cox model) of overall survival and disease-free survival.

Favorable factor Parameters for OS

Univariate analyses

Multivariate analyses

Hazard ratio

95% confidence interval

p

Hazard ratio

95% confidence interval

p

Allo-HSCT*

Receiving allo-HSCT

1.733

1.069-2.808

0.01

-

-

-

Cellular origin of disease (B or T)

B-cell origin

1.858

1.071-3.222

0.02

0.557

0.318-0.977

0.04

Age

≤30 years

0.466

0.302-0.720

0.001

2.077

1.338-3.223

0.001

Sex

Male

0.652

0.438-0.970

0.03

0.890

0.725-1.093

0.26

Ph chromosome

Ph-negative

1.194

0.730-1.954

0.48

-

-

-

Treatment regimens

Pediatric regimens

0.676

0.439-1.041

0.05

0.823

0.528-1.281

0.38

Time period

2011-2017

0.915

0.606-1.381

0.67

-

-

-

Allo-HSCT*

Receiving allo-HSCT

1.789

1.067-2.999

0.02

-

-

-

Cellular origin of disease (B or T)

B-cell origin

1.083

0.652-1.800

0.75

-

-

-

Age

≤30 years

1.593

1.067-2.379

0.02

1.422

0.937-2.156

0.09

Sex

Male

0.706

0.464-1.074

0.10

0.854

0.699-1.042

0.12

Ph chromosome

Ph-negative

2.041

1.191-3.497

0.009

1.823

0.931-2.857

0.08

Treatment regimens

Pediatric regimens

1.107

0.741-1.654

0.78

-

-

-

Time period

2011-2017

1.079

0.720-1.618

0.71

-

-

-

Parameters for DFS

Note: Univariate comparisons with a p-value of <0.15 were included in multivariate analyses. *Multivariate analyses could not be applied because allo-HSCT could not be quantified.

HSCT: Hematopoietic stem cell transplantation.

174

Turk J Hematol 2019;36:169-177

in this study. Imatinib treatment was added to the treatment protocols of 95.9% of patients with Ph+ ALL. Tyrosine kinase inhibitors are added in most standard ALL protocols for young patients with Ph+ ALL. However, for older patients higher induction mortality rates have been reported with such approaches [24,25]. Some studies that examined the use of a combination of tyrosine kinase inhibitors (imatinib or dasatinib) with mild therapy including a steroid with or without vincristine reported CR in the majority of patients with Ph+ ALL [26,27].

Significant improvements have been achieved in ALL treatment using new clinical protocols. Developments regarding the immunobiology of ALL and better recognition of prognostic factors have resulted in better characterization of risk groups and the tailoring of therapy [4,5,28]. In the current study, the followup period between January 2003 and June 2017 was divided into 7 treatment periods. There was no statistically significant improvement in survival outcomes in ALL patients according to these periods. Furthermore, the achievement of CR was not determined to have been improved over time in the overall study period. It is thought that this is due to the fact that new agents are not added to treatment protocols for the treatment of ALL in adults, especially in developing countries. Recent developments in the treatment of ALL need to be used more effectively. Additionally, every ALL patient should be followed with MRD. Treatment options after induction chemotherapy of patients, especially allo-HSCT, should be planned according to the results of MRD follow-up, but unfortunately very few centers in Turkey follow MRD. Over the recent 40 years, numerous efficacious chemotherapy regimens have been developed for the treatment of ALL, mostly based on pediatric regimens. Some prospective trials have compared different regimens in ALL patients. Most progress in ALL treatment has been seen in children and adolescents, while the advancement reported for adults is restricted [29,30].

The existing data in terms of tolerability and efficacy of BFM chemotherapy in adults are insufficient [31,32]. In a singlecenter study with BFM chemotherapy in adult ALL patients, the CR rate was 90% with induction chemotherapy and 5-year OS was 62% [32]. The current study showed that there was a nearly statistically significant difference in OS in patients receiving a pediatric regimen compared to other intensive regimens (p=0.05). Furthermore, there was no statistically significant difference in DFS in patients receiving the original pediatric regimen compared to other intensive regimens (p=0.78).

Pediatric regimens did not show a substantial superiority in this study. As in children, the choice is sometimes made to not give optimal dose treatment to adult ALL patients, considering that the patients cannot tolerate it. Therefore, pediatric regimens may not have demonstrated superiority in this study. We think that new agents and new protocols should be considered in the treatment of adult ALL patients.

Ă&#x2021;iftçiler R, et al: Acute Lymphoblastic Leukemia in Routine Practice

Allo-HSCT remains an important component in adult ALL therapy, and it is particularly demonstrated to be a main part of treatment for adults with high-risk ALL [1]. In the univariate analysis of the current study, OS and DFS were significantly higher in patients who underwent allo-HSCT. However, only 18.7% of the total 288 patients received allo-HSCT. In both univariate and multivariate analysis, OS was significantly higher in young patients (â&#x2030;¤30 years) than in patients aged >30 years.

Previous multiple retrospective analyses in adult and pediatric prospective clinical studies comparing the outcomes of ALL treatment in adolescents and young adults have demonstrated the superiority of pediatric regimens in those age groups over adult regimens [33,34]. In the current study, the superiority of the pediatric regimens in terms of both OS and DFS could not be demonstrated compared to other intensive regimens.

OS was almost statistically significantly better in patients who received pediatric regimens compared to patients who received other intensive regimens, such as pediatric-inspired chemotherapy and adult intensive regimens. In the univariate analyses, however, there was no statistically significant improvement in OS or DFS according to time in ALL patients.

DFS was statistically significantly higher in Ph- patients than Ph+ patients in univariate analyses. However, this was not statistically significant in multivariate analyses. The outcomes of adults with T-cell ALL have improved with recent ALL regimens, and outcomes today are comparable to those of patients with the precursor B-cell subtype [35,36]. In this study, patients with B-cell ALL had longer OS than patients with T-cell ALL in univariate and multivariate analyses. However, DFS was not affected by the cellular origin of the disease.

Study Limitations This study had some limitations. First, the study was retrospective, and second, cytogenetic results were not obtained for each patient. Third, there were differences in treatment modalities between the centers, so many different types of treatment regimens were used for these ALL patients. Moreover, the infrastructure and quality of each center are different. Hence, it is very difficult to draw conclusions from these heterogeneous results. Searching for an improvement in CR rates in such a heterogeneous group of patients is highly challenging. The retrospective nature and treatment heterogeneity may be a limitation; however, at the same time they are the major strengths of this study. In addition, outside of clinical studies, pediatric protocols may fail to substantially improve outcomes due to excessive toxicity, treatment delays, and dose reductions.

Conclusion Multicenter studies are particularly important for defining the specific clinical features of a particular disease. The results of this study can be considered to make a significant contribution 175

Çiftçiler R, et al: Acute Lymphoblastic Leukemia in Routine Practice

to the literature because they reflect real-life data providing valuable information about the Turkish ALL patient profile.

Ethics Ethics Committee Approval: All of the ethical considerations were strictly followed in accordance with the 1964 Helsinki Declaration. As a standard care/action of the hospitals, it has been recognized from the patient records that all of the studied patients gave informed consent at the time of admission to the hospital and before the administration of chemotherapy and other relevant diagnostic/therapeutic standards of care.

Informed Consent: All of the studied patients gave informed consent at the time of admission to the hospital.

Authorship Contributions Surgical and Medical Practices: R.Ç.; Concept: F.D., F.A., Y.B.; Design: Y.B.; Data Collection or Processing: R.Ç., Ö.G.S., A.İ.E.T., M.A.E., F.V., B.T., L.K., B.P., M.H.D., V.K., F.A.; Analysis or Interpretation: Y.B.; Literature Search: Y.B.; R.Ç.; Writing: R.Ç.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Aldoss I, Stein AS. Advances in adult acute lymphoblastic leukemia therapy.

Leuk Lymphoma 2018;59:1033-1050.

2. Dinmohamed AG, Szabo A, Van der Mark M, Visser O, Sonneveld P, Cornelissen J, Jongen-Lavrencic M, Rijneveld AW. Improved survival in adult patients with acute lymphoblastic leukemia in the Netherlands: a population-based study on treatment, trial participation and survival.

Leukemia 2016;30:310-317.

3. Geyer MB, Hsu M, Devlin SM, Tallman MS, Douer D, Park JH. Overall survival among older US adults with ALL remains low despite modest improvement since 1980: SEER analysis. Blood 2017;129:1878-1881.

4. Möricke A, Reiter A, Zimmermann M, Gadner H, Stanulla M, Dördelmann M, Löning L, Beier R, Ludwig WD, Ratei R, Harbott J, Boos J, Mann G, Niggli F, Feldges A, Henze G, Welte K, Beck JD, Klingebiel T, Niemeyer C, Zintl F, Bode U, Urban C, Wehinger H, Niethammer D, Riehm H, Schrappe M; German-Austrian-Swiss ALL-BFM Study Group. Risk-adjusted therapy of acute lymphoblastic leukemia can decrease treatment burden and improve survival: treatment results of 2169 unselected pediatric and adolescent patients enrolled in the trial ALL-BFM 95. Blood 2008;111:4477-4489.

5. Silverman LB, Gelber RD, Dalton VK, Asselin BL, Barr RD, Clavell LA, Hurwitz CA, Moghrabi A, Samson Y, Schorin MA, Arkin S, Declerck L, Cohen HJ, Sallan SE. Improved outcome for children with acute lymphoblastic leukemia: results of Dana-Farber Consortium Protocol 91-01. Blood 2001;97:12111218.

6. DeAngelo DJ, Stevenson KE, Dahlberg SE, Silverman LB, Couban S, Supko JG, Amrein PC, Ballen KK, Seftel MD, Turner AR, Leber B, Howson-Jan K, Kelly K, Cohen S, Matthews JH, Savoie L, Wadleigh M, Sirulnik LA, Galinsky I, Neuberg DS, Sallan SE, Stone RM. Long-term outcome of a pediatricinspired regimen used for adults aged 18-50 years with newly diagnosed acute lymphoblastic leukemia. Leukemia 2015;29:526-534.

7. Larson RA, Dodge RK, Burns CP, Lee EJ, Stone RM, Schulman P, Duggan D, Davey FR, Sobol RE, Frankel SR. A five-drug remission induction regimen

176

Turk J Hematol 2019;36:169-177

with intensive consolidation for adults with acute lymphoblastic leukemia: Cancer and Leukemia Group B study 8811. Blood 1995;85:2025-2037.

8. Linker C, Damon L, Ries C, Navarro W. Intensified and shortened cyclical chemotherapy for adult acute lymphoblastic leukemia. J Clin Oncol 2002;20:2464-2471.

9. Rowe JM, Buck G, Burnett AK, Chopra R, Wiernik PH, Richards SM, Lazarus HM, Franklin IM, Litzow MR, Ciobanu N, Prentice HG, Durrant J, Tallman MS, Goldstone AH; ECOG; MRC/NCRI Adult Leukemia Working Party. Induction therapy for adults with acute lymphoblastic leukemia: results of more than 1500 patients from the international ALL trial: MRC UKALL XII/ECOG E2993.

Blood 2005;106:3760-3767.

10. Gökbuget N, Arnold R, Böhme A, Fietkau R, Freund M, Ganser A, Kneba M, Lipp T, Ludwig WD, Maschmeyer G, Messerer D, Rieder H, Thiel E, Hoelzer D; German Multicenter Study Group for Adult ALL (GMALL). Treatment of adult ALL according to protocols of the German Multicenter Study Group for Adult ALL (GMALL). In: Estey EH, Faderl SH, Kantarjian HM (eds). Acute Leukemias. Berlin, Springer, 2008.

11. Kantarjian HM, O’Brien S, Smith TL, Cortes J, Giles FJ, Beran M, Pierce S, Huh Y, Andreeff M, Koller C, Ha CS, Keating MJ, Murphy S, Freireich EJ. Results of treatment with hyper-CVAD, a dose-intensive regimen, in adult acute lymphocytic leukemia. J Clin Oncol 2000;18:547-561.

12. Mead GM, Sydes MR, Walewski J, Grigg A, Hatton CS, Pescosta N, Guarnaccia C, Lewis MS, McKendrick J, Stenning SP, Wright D; UKLG LY06 collaborators.

An international evaluation of CODOX-M and CODOX-M alternating with IVAC in adult Burkitt’s lymphoma: results of United Kingdom Lymphoma Group LY06 study. Ann Oncol 2002;13:1264-1274.

13. Pfreundschuh M, Trümper L, Kloess M, Schmits R, Feller AC, Rudolph C, Reiser M, Hossfeld DK, Metzner B, Hasenclever D, Schmitz N, Glass B, Rübe C, Loeffler M; German High-Grade Non-Hodgkin’s Lymphoma Study Group.

Two-weekly or 3-weekly CHOP chemotherapy with or without etoposide for the treatment of young patients with good-prognosis (normal LDH) aggressive lymphomas: results of the NHL-B1 trial of the DSHNHL. Blood 2004;104:626-633.

14. Huguet F, Leguay T, Raffoux E, Thomas X, Beldjord K, Delabesse E, Chevallier P, Buzyn A, Delannoy A, Chalandon Y, Vernant JP, Lafage-Pochitaloff M, Chassevent A, Lhéritier V, Macintyre E, Béné MC, Ifrah N, Dombret H. Pediatric-inspired therapy in adults with Philadelphia chromosomenegative acute lymphoblastic leukemia: the GRAALL-2003 study. J Clin Oncol 2009;27:911-918.

15. Pastore D, Specchia G, Carluccio P, Liso A, Mestice A, Rizzi R, Greco G, Buquicchio C, Liso V. FLAG-IDA in the treatment of refractory/relapsed acute myeloid leukemia: single-center experience. Ann Hematol 2003;82:231235.

16. Schwartz P, Hunault-Berger M, Chevallier P. French results with the EWALL chemotherapy backbone in older patients with Philadelphia chromosomenegative acute lymphoblastic leukemia. A GRAALL report. Haematologica 2013;98:463.

17. Wiernik PH, Serpick AA. A randomized clinical trial of daunorubicin and a combination of prednisone, vincristine, 6-mercaptopurine, and methotrexate in adult acute nonlymphocytic leukemia. Cancer Res 1972;32:2023-2026.

18. Pulte D, Gondos A, Brenner H. Improvement in survival in younger patients with acute lymphoblastic leukemia from the 1980s to the early 21st century.

Blood 2009;113:1408-1411.

19. Vitale A, Guarini A, Chiaretti S, Foà R. The changing scene of adult acute lymphoblastic leukemia. Curr Opin Oncol 2006;18:652-659.

20. Pui CH, Evans WE. Treatment of acute lymphoblastic leukemia. N Engl J Med 2006;354:166-178.

21. Moorman AV, Chilton L, Wilkinson J, Ensor HM, Bown N, Proctor SJ. A population-based cytogenetic study of adults with acute lymphoblastic leukemia. Blood 2010;115:206-214.

Turk J Hematol 2019;36:169-177

22. Houot R, Tavernier E, Le QH, Lhéritier V, Thiebaut A, Thomas X. Philadelphia chromosome-positive acute lymphoblastic leukemia in the elderly: prognostic factors and treatment outcome. Hematology 2004;9:369-376.

23. Gokbuget N, Hoelzer D, Arnold R, Böhme A, Bartram CR, Freund M, Ganser A, Kneba M, Langer W, Lipp T, Ludwig WD, Maschmeyer G, Rieder H, Thiel E, Weiss A, Messerer D. Results of a shortened, dose reduced treatment protocol in elderly patients with acute lymphoblastic leukemia (ALL). Blood 2000;96:718-719.

24. Pagano L, Mele L, Trape G, Leone G. The treatment of acute lymphoblastic leukaemia in the elderly. Leuk Lymphoma 2004;45:117-123.

25. Martell MP, Atenafu EG, Minden MD, Schuh AC, Yee KW, Schimmer AD, Gupta V, Brandwein JM. Treatment of elderly patients with acute lymphoblastic leukaemia using a paediatric-based protocol. Br J Haematol 2013;163:458-464.

26. Rousselot P, Coudé MM, Gokbuget N, Gambacorti Passerini C, Hayette S, Cayuela JM, Huguet F, Leguay T, Chevallier P, Salanoubat C, Bonmati C, Alexis M, Hunault M, Glaisner S, Agape P, Berthou C, Jourdan E, Fernandes J, Sutton L, Banos A, Reman O, Lioure B, Thomas X, Ifrah N, Lafage-Pochitaloff M, Bornand A, Morisset L, Robin V, Pfeifer H, Delannoy A, Ribera J, Bassan R, Delord M, Hoelzer D, Dombret H, Ottmann OG; European Working Group on Adult ALL (EWALL) group. Dasatinib and low-intensity chemotherapy in elderly patients with Philadelphia chromosome–positive ALL. Blood 2016;128:774-782.

27. Vignetti M, Fazi P, Cimino G, Martinelli G, Di Raimondo F, Ferrara F, Meloni G, Ambrosetti A, Quarta G, Pagano L, Rege-Cambrin G, Elia L, Bertieri R, Annino L, Foà R, Baccarani M, Mandelli F. Imatinib plus steroids induces complete remissions and prolonged survival in elderly Philadelphia chromosome– positive patients with acute lymphoblastic leukemia without additional chemotherapy: results of the Gruppo Italiano Malattie Ematologiche dell’Adulto (GIMEMA) LAL0201-B protocol. Blood 2007;109:3676-3678.

28. Pui CH, Mullighan CG, Evans WE, Relling MV. Pediatric acute lymphoblastic leukemia: where are we going and how do we get there? Blood 2012;120:1165-1174.

29. Riehm H, Gadner H, Henze G, Langermann HJ, Odenwald E. The Berlin childhood acute lymphoblastic leukemia therapy study, 1970-1976. J Pediatr Hematol Oncol 1980;2:299-306.

Çiftçiler R, et al: Acute Lymphoblastic Leukemia in Routine Practice

30. Gaynon PS, Steinherz PG, Bleyer WA, Ablin AR, Albo VC, Finklestein JZ, Grossman NJ, Littman PS, Novak LT, Pyesmany AF, Sather HN, Hammond GD. Intensive therapy for children with acute lymphoblastic leukaemia and unfavourable presenting features: early conclusions of study CCG-106 by the Childrens Cancer Study Group. Lancet 1988;332:921-924.

31. Malhotra P, Varma S, Varma N, Kumari S, Das R, Jain S, Ahluwalia J, Mahi S, Sharma SC, Radhika S. Outcome of adult acute lymphoblastic leukemia with BFM protocol in a resource-constrained setting. Leuk Lymphoma 2007;48:1173-1178.

32. Chang JE, Medlin SC, Kahl BS, Longo WL, Williams EC, Lionberger J, Kim K, Kim J, Esterberg E, Juckett MB. Augmented and standard Berlin-FrankfurtMünster chemotherapy for treatment of adult acute lymphoblastic leukemia. Leuk Lymphoma 2008;49:2298-2307.

33. Boissel N, Auclerc MF, Lhéritier V, Perel Y, Thomas X, Leblanc T, Rousselot P, Cayuela JM, Gabert J, Fegueux N, Piguet C, Huguet-Rigal F, Berthou C, Boiron JM, Pautas C, Michel G, Fière D, Leverger G, Dombret H, Baruchel A. Should adolescents with acute lymphoblastic leukemia be treated as old children or young adults? Comparison of the French FRALLE-93 and LALA94 trials. J Clin Oncol 2003;21:774-780.

34. de Bont JM, Holt Bv, Dekker AW, van der Does-van den Berg A, Sonneveld P, Pieters R. Significant difference in outcome for adolescents with acute lymphoblastic leukemia treated on pediatric vs adult protocols in the Netherlands. Leukemia 2004;18:2032-2035.

35. Marks DI, Paietta EM, Moorman AV, Richards SM, Buck G, DeWald G, Ferrando A, Fielding AK, Goldstone AH, Ketterling RP, Litzow MR, Luger SM, McMillan AK, Mansour MR, Rowe JM, Tallman MS, Lazarus HM. T-cell acute lymphoblastic leukemia in adults: clinical features, immunophenotype, cytogenetics, and outcome from the large randomized prospective trial (UKALL XII/ECOG 2993). Blood 2009;114:5136-5145.

36. Stock W, Luger SM, Advani AS, Geyer S, Harvey RC, Mullighan CG, Willman CL, Malnassy G, Parker E, Laumann KM, Sanford B, Marcucci G, Paietta EM, Liedtke M, Claxton DF, Foster MC, Appelbaum FR, Erba H, Litzow MR, Tallman MS, Stone RM, Larson RA. Favorable outcomes for older adolescents and young adults (AYA) with acute lymphoblastic leukemia (ALL): early results of US Intergroup Trial C10403. Blood 2014;124:796.

177

RESEARCH ARTICLE DOI: 10.4274/tjh.galenos.2019.2018.0420 Turk J Hematol 2019;36:178-185

The Role of the Local Bone Marrow Renin-Angiotensin System in Multiple Myeloma Multipl Myelomda Lokal Kemik İliği Renin-Anjiyotensin Sisteminin Rolü Bülent Saka1, Sema Genç4,

Müge Sayitoğlu2, Zülal İstemihan1, M. Akif Karan1, Cemil Taşçıoğlu1, Sevgi Kalayoğlu-Beşışık1

Nilgün Erten1,

Öner Doğan3,

Uğur Özbek2,

1İstanbul University, İstanbul Faculty of Medicine, Department of Internal Medicine, İstanbul, Turkey 2İstanbul University, Aziz Sancar Institute of Experimental Research, Department of Genetics, İstanbul, Turkey 3İstanbul University, İstanbul Faculty of Medicine, Department of Pathology, İstanbul, Turkey 4İstanbul University, İstanbul Faculty of Medicine, Department of Biochemistry, İstanbul, Turkey

Abstract

Öz

Objective: Angiotensin II promotes growth and angiogenesis via type 1 receptors (AGTR1) in certain tumors. In this study, we examine the bone marrow AGTR1 expression in multiple myeloma (MM) and its relationship with the regulation of angiogenesis and prognostic factors.

Amaç: Anjiyotensin II, bazı tümörlerde tip 1 reseptörleri (AGTR1) yoluyla bir büyüme promotörü veya anjiyojenik faktör olarak görev yapar. Bu çalışmada, multipl myelomda (MM) kemik iliği AGTR1 ekspresyonunu ve bunun anjiyogenez ve prognostik faktörlerin düzenlenmesi ile ilişkisini incelemekteyiz.

Materials and Methods: Bone marrow AGTR1 mRNA levels of 39 MM patients and 15 healthy controls were analyzed with quantitative RTPCR. Immunohistochemical staining of the tissue vascular endothelial growth factor (VEGF), CD34, and factor VIIIrAg (fVIIIrAg) was used to assess bone marrow angiogenesis.

Gereç ve Yöntemler: Otuz dokuz MM hastası ve 15 sağlıklı kontrolde, kemik iliği AGTR1 mRNA düzeyleri kantitatif RT-PCR ile analiz edildi.

Kemik iliği anjiogenezi, doku vasküler endotel büyüme faktörü (VEGF), CD34 ve faktör VIIIrAg’nın (fVIIIrAg) immünohistokimyasal ölçümü ile değerlendirildi.

Results: Bone marrow samples of the patients showed increased VEGF, fVIIIrAg, and CD34 staining and higher AGTR1 expression levels when compared to controls. Patients with severe-diffuse bone marrow infiltration showed higher bone marrow VEGF, fVIIIrAg, CD34, and AGTR1 mRNA levels when compared to other patients.

Bulgular: Hastalar kontrollerle karşılaştırıldığında daha yüksek kemik iliği VEGF, fVIIIrAg, CD34 ve AGTR1 ekspresyon seviyelerine sahipti ve şiddetli yaygın kemik iliği infiltrasyonu olan hastalar diğer hastalara göre daha yüksek kemik iliği VEGF, fVIIIrAg, CD34 ve AGTR1 mRNA seviyeleri gösterdi.

Conclusion: AGTR1 expression was found positively correlated with plasma β2-microglobulin level and patients with increased AGTR1 expression showed increased bone marrow CD34 levels.

Sonuç: AGTR1 ekspresyonu, plazma β2-mikroglobulin seviyesi ile korele bulundu ve artan AGTR1 ekspresyonu olan hastalarda kemik iliği CD34 seviyelerinde artış görüldü.

Keywords: Multiple myeloma, Renin-angiotensin system, Angiotensin type 1a receptor

Anahtar Sözcükler: Multipl myelom, Renin-anjiyotensin sistemi, Anjiyotensin tip 1a reseptörü

Introduction Side effects of angiotensin-converting enzyme inhibitors (ACEIs) such as anemia and leukopenia indicate inhibitory effects of these drugs on normal bone marrow hematopoiesis. With previous data on locally acting growth factor-like effects of

angiotensin II (ATII), Haznedaroglu et al. [1] and Haznedaroglu and Ozturk [2] first mentioned a local renin-angiotensin system (RAS) in the bone marrow. The possible role of the bone marrow RAS was later reported in acute myeloid leukemia [3,4]. Abali et al. [5] showed increased bone marrow angiotensin-converting enzyme (ACE) levels compared to serum ACE in acute leukemia.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Bülent SAKA, M.D., İstanbul University, İstanbul Faculty of Medicine, Department of Internal Medicine, İstanbul, Turkey Phone : +90 212 414 20 00/31478 E-mail : drsakab@yahoo.com ORCID-ID: orcid.org/0000-0001-5404-5579

Received/Geliş tarihi: December 03, 2018 Accepted/Kabul tarihi: April 25, 2019

This study was presented as a poster on February 26-March 1, 2009, at the XII. International Myeloma Workshop Congress and published as an abstract in the Clinical Lymphoma, Myeloma & Leukemia Journal at 2009;9:10.

178

Turk J Hematol 2019;36:178-185

Saka B, et al: The Role of the Local Bone Marrow Renin-Angiotensin System in MM

ATII was also related to angiogenesis, which could be inhibited with ACEI and ATII type 1a receptor (AGTR1) antagonists [6,7,8]. It can induce neovascularization due to increased expression of different growth factors (angiopoietin 2, vascular endothelial growth factor (VEGF), fibroblast growth factor, platelet-derived growth factor, transforming growth factor beta, and epidermal growth factor), nitric oxide synthase, and metalloproteinases [9]. Tamarat et al. [6] showed increased neovascularization with subcutaneous ATII injection in a rat model, which was found to be well correlated with serum VEGF and endothelial nitric oxide levels. AGTR1 antagonists and VEGF neutralizing antibodies completely prevented the ATII-induced angiogenesis. In another study, ATII was related to tumoral enlargement by inducing angiogenesis and malignant cell proliferation via AGTR1, while ACEI was shown to decrease cancer risk [8]. Egami et al. [10] compared rats with Agtr1+ and Agtr1- malignant melanoma and found decreased tumor angiogenesis and doubling time in Agtr1- rats, which resulted in increased survival rate. AGTR1 antagonists showed suppressed tumor growth in Agtr1+ rats.

The interaction between malignant plasma cells and the bone marrow microenvironment is important in the etiopathogenesis of multiple myeloma (MM). Increased angiogenesis was shown in the bone marrow microenvironment, which was related to disease progression, resistance to treatment, and worse prognosis [11]. Tumor growth and angiogenesis may result from various cytokines and factors. VEGF is the best characterized pro-angiogenic factor produced by myeloma cells. It also stimulates stromal cells to produce interleukin-6, which is a potent myeloma growth factor [12,13].

The aim of this study was to find out any possible relationship between local bone marrow RAS activity and MM. Bone marrow RAS activities of patients were compared with their disease activity and bone marrow angiogenesis.

Materials and Methods Patients and Controls De novo MM patients (n=39) without any previous treatment were enrolled in the study group. The control group (n=15) included healthy bone marrow donors and those with normal bone marrow histology who were examined clinically for any other reason (Figure 1). Patients and controls taking drugs with possible effects on the RAS were excluded (ACE inhibitors, AGTR1 antagonists, beta blockers, spironolactone). Patients and controls with acute and/or chronic infectious diseases, inflammatory rheumatoid diseases, and any other cancer were also excluded. This study was approved by the Ethics Committee of İstanbul University İstanbul Medical Faculty (reference number 2008/305). Every patient included in the study provided signed informed consent.

RNA Isolation and cDNA Synthesis Bone marrow samples were collected in 2-mL ethylene diamine tetraacetic acid tubes. Total RNA was isolated from white blood cells (QIAGEN, Germany). RNA quality and quantity were measured by spectrophotometer (ND-1000, NanoDrop Technologies, Inc., USA), and 1 µg of total RNA was used.

Random primers (20 µM, Roche Diagnostics, Germany), 10 mM dNTP set (Fermentas UAB, Lithuania), RiboLock RNase Inhibitor (20 U/µL, Fermentas), and Moloney murine leukemia virus reverse transcriptase (200 U/µL, Fermentas) were used for cDNA synthesis. cDNA samples were stored at -20 °C. Quantitative Real-Time Polymerase Chain Reaction Analysis Real-time quantitative PCR was performed with a LightCycler 480 instrument (Roche Applied Sciences, Germany) (Table 1).

Real-time amplification was performed with LightCycler 480 Probe Master Mix (Roche) according to the manufacturer’s protocol. Real-time amplification was performed with a final

Figure 1. Flowchart of the study.

AGTR1 mRNA: Angiotensin II type 1a receptor mRNA relative expression level, VEGF: vascular endothelial growth factor, MM: multiple myeloma, qRTPCR: quantitative real-time polymerase chain reaction, ACE: angiotensin-converting enzyme.

179

Saka B, et al: The Role of the Local Bone Marrow Renin-Angiotensin System in MM

reaction mixture of 20 µL containing 5 µM of each primer, 0.5 µM of each probe, LightCycler 480 Probe Master Mix, and 100 ng/µL of cDNA. The three most stable genes (B-ACTIN, CYCLOPHILIN A, and ABL) were selected for normalization by geNorm software V3.4 (University of Liege, Belgium) (Table 1).

Each sample was studied in duplicate and all runs were repeated twice. The PCR protocol was as follows: initial denaturation at 95 °C for 7 min, and amplification for 5 s at 95 °C, 10 s at 60 °C, and 10 s at 72 °C for 45 cycles. The ΔΔCt method was used to calculate relative expressions [14].

Immunohistochemical Studies Bone marrow angiogenesis was evaluated with the immunohistochemical measurement of tissue VEGF (Figure 2), CD34 (Figure 3), and factor VIIIrAg (fVIIIrAg) indexes.

Bone marrow biopsy samples were fixed in formalin (10%) and then embedded into tissue paraffin blocks. After staining with hematoxylin and eosin, they were examined under a microscope. Tissue samples were incubated with anti-VEGF mouse monoclonal antibodies (clone G153-694) at 2 µg antibody/mL dilution. Immunocytochemical streptavidin-biotin peroxidase complex was used in the next stage, followed by diaminobenzidine chromogen for visualization of peroxidase reaction. Immunohistochemical staining activity was estimated semiquantitatively by using the immunoreactive score [15].

Scores were given to intensity of the reaction (stain) (0 to 3) and percentage of the cells with positive reaction (0 to 4). The

Figure 2. Bone marrow anti-vascular endothelial growth factor antibody, AEC chromogen, 400x.

Turk J Hematol 2019;36:178-185

final score was then obtained with the multiplication of both scores (0 to 12) (Table 2).

Staining of vascular endothelial cells with anti-CD34 murine monoclonal antibodies (Clone QBEnd/10, NeoMarkers, USA) at 1/100 dilution was also used to show bone marrow angiogenesis as described by Perez-Atayde et al. [16]. Bone marrow biopsy samples were examined at 80x magnification and five distinct fields were selected for evaluation. Mean number of CD34-stained vascular structures was defined as number of vessels/mm2. Factor VIIIrAg was also used to demonstrate bone marrow angiogenesis (Table 3).

Serum ACE levels of both groups were measured by sandwich ELISA method. One microplate was coated with an ACE-specific monoclonal antibody. Standards and serum samples were put in small Eppendorf tubes and ACE was bound with immobilized antibodies. After unbound materials were washed out of the wells, ACE-specific enzyme-linked polyclonal antibody was added to the tubes. Later, unbound antibody-enzyme particles were washed out, followed by the addition of substrate solution to samples. Color changes that occurred in the Eppendorf tubes were parallel to the ACE levels.

Statistical Analysis SPSS 15.0 was used to analyze data. Continuous variables were described with the use of statistical characteristics (means, standard deviations, median). Discrete variables were described as counts and percentages. The Kolmogorov-Smirnov test was

Figure 3. Bone marrow anti-CD34 antibody, AEC chromogen, 400x.

Table 1. Primers and probes used in quantitative real-time polymerase chain reaction.

Gene

Forward (5’→3’)

Reverse (5’→3’)

UPL probe no.

AGTR1

ccattatgagtcccaaaattcaa

aaaggaaacaggaaacccagta

23

ABL

cagagaaggtctatgaactcatgc

ggtggatttcagcaaaggag

86

CYPA

cctaaagcatacgggtcctg

cactttgccaaacaccacat

48

B ACTIN

aggcccctctgaacccta

ggggtgttgaaggtctcaaa

β ACTIN

180

Saka B, et al: The Role of the Local Bone Marrow Renin-Angiotensin System in MM

Turk J Hematol 2019;36:178-185

used to analyze distribution of the variables. Independent samples t-tests, Mann-Whitney U tests, and Pearson correlation analyses were used during evaluation of the results. A value of p≤0.05 was considered statistically significant.

Results AGTR1 mRNA Expression in MM Cases and Controls

Patients with higher AGTR1 mRNA expression showed increased bone marrow CD34 (p=0.011, Student’s t-test). Similarly, patients with higher AGTR1 mRNA expression showed increased bone marrow VEGF and fVIIIrAg indexes, although these did not reach statistical significance (VEGF: p=0.088, Mann-Whitney U test, fVIIIrAg: p=0.345, Student’s t-test).

Discussion

Thirty-nine MM patients (male/female: 20/19) were enrolled in the study. The control group included five healthy bone marrow donors and 10 people with normal cellular bone marrow biopsies who were examined for any other reason (male/female: 8/7). Mean ages of the patients and controls were 63±10 (minimum-maximum: 44-81) and 49±14 (minimummaximum: 27-80) years, respectively. Clinical characteristics of the patients are given in Table 4. Bone marrow VEGF, CD34, and fVIIIrAg and AGTR1 mRNA expression levels of the patients are given in Table 5. MM patients had higher bone marrow VEGF, CD34, and fVIIIrAg levels and increased AGTR1 mRNA expression levels when compared to controls (Table 6). Patients with severe-diffuse bone marrow infiltration patterns showed higher bone marrow VEGF, CD34, and fVIIIrAg levels and higher bone marrow AGTR1 mRNA expression when compared to others with mild-patchy infiltration patterns (Table 7; Figure 4).

Plasma β2-microglobulin (B2M) concentrations of the patients were found to be well correlated with their bone marrow AGTR1 mRNA expression levels (Figure 5; p=0.002). No association was found between disease stage and bone marrow AGTR1 mRNA expression (p=0.760). Serum ACE levels of MM patients did not show any significant difference when compared to the control group (Student’s t-test).

The RAS has attracted attention because of its physiological and therapeutic potential. An extensive transcriptomic metaanalysis showed the expression patterns of RAS members in normal human tissues, including hematopoietic cells and bone marrow stem cells. AGT ligand was determined to be expressed in almost all tissue types, indicating its physiological importance.

Bone marrow-derived cells have prominent expression of classical systemic RAS participants (AGT-REN-ACE-AGTR1) and they have almost the same expression patterns, indicating that transcriptional coordination may be preserved during cell lineage [17].

The RAS plays a role in hematopoietic stem cell plasticity. There is increasing evidence that the deregulated local bone marrow

Table 2. Estimation of the bone marrow vascular endothelial growth factor index with immunoreactive score.

Score

Positive cells (%)

Intensity of the reaction

0

Negative

Negative

1

<10

Weak

2

10-50

Moderate

3

51-80

Strong

4

>81

Very strong

Figure 4. Correlation of the bone marrow infiltration ratio and AGTR1 mRNA expression of the patients.

AGTR1 mRNA: Angiotensin II type 1a receptor mRNA relative expression level.

Table 3. Bone marrow immunohistochemical studies of angiogenesis.

Primary antibody

Producer

Antigen retrieval

Primary antibody dilution

Incubation time

Incubation temperature

Amplification system

Chromogen

VEGF

NeoMarkers

EDTA irradiation in microwave oven

1/50

1h

Room temperature

Biotin-streptavidinperoxidase

AEC

CD34

Cell Marque

Boiling in citrate buffer under high pressure

1/50

1h

Room temperature

Biotin-streptavidinperoxidase

AEC

Factor VIIIrAg

NeoMarkers

Boiling in citrate buffer under high pressure

1/50

1h

Room temperature

Biotin-streptavidinperoxidase

AEC

VEGF: Vascular endothelial growth factor, EDTA: ethylenediaminetetraacetic acid.

181

Saka B, et al: The Role of the Local Bone Marrow Renin-Angiotensin System in MM

RAS could play a role in malignant transformation by increasing cellular proliferation and differentiation. ACE induces bone marrow stem cells to enter the S-phase through increasing hydrolysis of acetyl-N-Ser-Asp-Lys-Pro (AcSDKP), which inhibits the proliferation of bone marrow stem cells [18,19]. Conversely, ACEIs increase plasma AcSDKP and downregulate hematopoiesis [20]. ACEI treatment significantly decreased the hematocrit level of a patient with polycythemia vera [21].

Wulf et al. [3,4] showed renin-like activity in leukemic blast cells of a patient and isolated renin-like peptide from myeloblasts.

Figure 5. Correlation of the bone marrow AGTR1 mRNA expression and serum β2-microglobulin levels of the patients.

AGTR1 mRNA: Angiotensin II type 1a receptor mRNA relative expression level.

Table 4. Clinical characteristics of the patients.

Age (years)

Mean ± SD (minimum - maximum)

Male Female Total

64±10 (44-81) 63±9 (45-80) 63±10 (44-81)

Durie-Salmon classification

No. of patients

IA IIA IIB IIIA IIIB

2 9 2 16 10

Paraprotein type

No. of patients

IgG IgA IgD Light chain

24 7 2 6

Bone marrow infiltration pattern

No. of patients

Patchy Diffuse

15 24

SD: Standard deviation, Ig: immunoglobulin.

182

Turk J Hematol 2019;36:178-185

Abali et al. [5] compared serum and bone marrow ACE concentrations of newly diagnosed acute leukemia patients and found significant increase in the latter. Serum ACE levels were found correlated with bone marrow infiltration rate and the number of blasts in the peripheral blood. RAS members’ expressions were detected in different myeloid blast cells [22,23].

RAS and NOTCH pathways are in communication, and the RBP-J gene (recombination signal binding protein for immunoglobulin kappa J region) is an important transcriptional regulator of the NOTCH pathway. An RBP-J-deleted mouse model showed Ren expression leading to leukemogenesis in B-cell progenitors.

Moreover, there are limited data showing RBP-J gene mutations in leukemia patients [24,25]. Serum ACE was found increased in MM patients and local RAS components were also found in the following studies [26,27].

ATII plays a fundamental role in controlling cardiovascular function and renal homeostasis. It has many physiologic effects other than regulating vascular tone, such as hormone secretion, tissue growth, and neural activity. It has four receptors. AGTR1 stimulation activates intracellular pathways that finally lead to vasoconstriction, inflammation, and proliferation [9].

Like other cytokines, ATII was shown to use the JAK-STAT pathway (JAnus or Just Another Kinase-Signal Transducers and Activators of Transcription) in the regulation of hematopoiesis [28]. Gomez et al. [29] revealed the ability of rat leukocytes to produce angiotensinogen and ATII, and Crabos et al. [30] found Agtr1 on thrombocytes. Rodgers et al. [31] showed Agtr1 on CD34+CD38- and CD34+CD38+ cells, lymphocytes, and bone marrow stromal cells, and they reported increased bone marrow stem cell proliferation with ATII that was inhibited with the AGTR1 antagonist losartan. Mrug et al. [32] reported similar effects of the local bone marrow RAS on the erythroid cell lineage. Jokubaitis et al. [33] identified a 160-kDa cell surface glycoprotein, BB9, which is found on hematopoietic stem cells (HSCs) throughout hematopoietic development, even at the earliest definitive phases. They demonstrated that BB9 monoclonal Ab identifies the somatic form of angiotensinconverting enzyme (ACE/CD143), which suggested its expression

by HSCs from primitive phases to adulthood. ACE/CD143 may thus play a role in the regulation of hematopoietic cells.

According to our results, the bone marrow AGTR1 expression of our patients showed positive correlation with their bone marrow infiltration pattern and serum B2M levels. Serum B2M level and the morphology of myeloma cells are reliable prognostic factors in MM. Moreover, serum B2M was found as the most important parameter in predicting high-risk patients [34,35].

The positive correlation between bone marrow AGTR1 mRNA levels, bone marrow morphology, and plasma B2M showed that bone marrow AGTR1 expression can give information about prognosis in MM.

Saka B, et al: The Role of the Local Bone Marrow Renin-Angiotensin System in MM

Turk J Hematol 2019;36:178-185

Table 5. Patient group characteristics, bone marrow proangiogenic factors, and AGTR1 mRNA relative expression.

No.

Sex

Age

1

M

2

M

3 4

fVIIIrAg

AGTR1 mRNA

PP

Stage

B2M

VEGF

CD34

73

IgG kappa

IIIB

9.08

12

21.5

50.2

1.57

76

IgG lambda

IIIB

9.30

12

57.6

74.0

0.87

M

75

IgA lambda

IIIA

11.00

12

153.0

54.8

1.21

F

64

IgG kappa

IIA

1.45

6

33.0

19.4

0.85

5

F

60

IgG lambda

IIIA

11.49

8

50.0

36.8

2.64

6

M

63

IgG kappa

IIIA

3.63

12

76.0

188.2

0.79

7

F

80

IgG kappa

IIA

8.09

3

20.0

23.4

0.86

8

M

69

IgG kappa

IIIA

8.83

12

76.0

118.3

67.29

9

M

54

IgG kappa

IIIA

3.16

12

57.3

26.0

0.24

10

M

55

IgG kappa

IIIB

22.20

8

42.2

36.4

8.33

11

M

74

Lambda

IIIA

7.00

3

44.3

23.0

0.06

12

M

45

IgG kappa

IIIB

9.10

8

50.7

46.7

0.41

13

M

58

IgA kappa

IIA

1.80

12

112.0

77.6

1.084

14

F

70

IgG kappa

IIA

4.90

8

44.0

14.5

0.79

15

F

45

IgG kappa

IIIA

2.60

8

42.0

29.8

0.55

16

F

65

IgG lambda

IIIA

7.30

12

68.0

56.7

0.38

17

M

76

IgG lambda

IA

2.12

.8

.52.0

52.5

0.66

18

M

55

IgG kappa

IIB

10.10

12

41.8

13.4

0.86

19

M

60

IgG lambda

IIIA

4.06

8

53.0

20.0

13.88

20

F

51

Kappa

IIIB

75.70

12

80.7

73.6

66.67

21

M

44

IgG kappa

IIIB

17.40

12

83.8

65.4

4.83

22

M

81

IgG kappa

IIIA

5.30

12

126.5

23.2

1.67

23

F

75

IgG lambda

IA

2.60

8

36.6

52.4

3.70

24

F

57

Kappa

IIIB

30.09

6

52.8

46.0

0.18

25

F

52

IgD lambda

IIIA

5.30

12

47.8

51.3

0.16

26

F

73

Kappa

IIIA

6.00

12

84.0

63.5

4.25

27

M

57

IgA kappa

IIB

9.10

6

24.6

24.3

0.54

28

F

67

IgA lambda

IIA

2.20

12

50.6

18.4

61.02

29

F

73

IgA kappa

IIIA

6.00

12

64.6

45.5

1.40

30

F

62

IgD lambda

IIIA

7.70

8

43.4

32.4

2.54

31

F

60

IgG kappa

IIIB

7.05

6

20.0

20.0

0.87

32

F

68

Kappa

IIA

11.23

8

95.4

89.3

2.36

33

F

59

IgG kappa

IIA

3.40

12

52.8

57.0

1.44

34

M

64

IgG kappa

IIA

3.00

12

110.0

77.7

1.08

35

M

68

IgA kappa

IIIA

12.50

12

96.0

84.0

0.59

36

F

54

IgG lambda

IIIA

7.00

8

44.4

42.0

0.96

37

F

62

IgA lambda

IIIB

17.40

12

122.4

133.0

4.04

38

M

65

Lambda

IIA

3.10

12

62.4

52.3

1.01

39

M

58

IgG lambda

IIIB

18.60

4

29.0

26.0

3.16

PP: Paraprotein, B2M: β2-microglobulin (ng/mL), VEGF: vascular endothelial growth factor (score), CD34 and fVIIIrAg: no. of stained vessels/mm2, AGTR1 mRNA: angiotensin II type 1a receptor mRNA relative expression level (%) F: female, M: male, Ig: immunoglobulin.

Increased bone marrow VEGF, CD34, and fVIIIrAg indexes in

as a consequence of greater production of reactive oxygen

our patients reflected neovascularization. Advancing age

species (e.g., superoxide) without a compensatory increase in

is associated with the development of vascular endothelial

antioxidant defenses. In our study, the control group seemed

dysfunction. Vascular oxidative stress increases with age

to be younger than the MM group (range: 27-80 years), but 183

Saka B, et al: The Role of the Local Bone Marrow Renin-Angiotensin System in MM

Table 6. Angiogenesis factors and AGTR1 mRNA expression levels of the patients and controls.

Patients

Controls

p-value

VEGF index

10±3

2±1

<0.001

CD34 (no. of vessels)

62.37±31.81

38.55±17.26

0.001

Factor VIIIrAg (U/mL)

52.28±35.96

28.09±14.49

0.001

AGTR1 mRNA

6.82±17.22

1.17±1.09

0.044

AGTR1 mRNA: Angiotensin II type 1a receptor mRNA relative expression level, VEGF: vascular endothelial growth factor.

Table 7. Angiogenesis factors and AGTR1 mRNA expression levels according to bone marrow infiltration pattern of the patients.

Mild-patchy infiltration

Severediffuse infiltration

p-value

VEGF index

8±3

10±2

0.017

CD34 (no. of vessels)

47.24±24.92

69.36±32.61

0.045

Factor VIIIrAg (U/mL)

37.16±21.44

59.25±39.39

0.032

AGTR1 mRNA

0.81±0.32

9.82±20.56

0.035

AGTR1 mRNA: Angiotensin II type 1a receptor mRNA relative expression level, VEGF: vascular endothelial growth factor.

was within the age range at which MM develops. Patients with higher AGTR1 expression showed increased bone marrow CD34 index. In our opinion, the statistically nonsignificant increase in the bone marrow VEGF and fVIIIrAg indexes of these patients was related to the number of subjects enrolled in the study.

Bone marrow AGTR1 mRNA expression was 2%-4% in 5 patients and >4% in 8 patients. Three patients had extremely high levels of expression (67.29%, 66.67%, and 61.02%) when compared to others. The first patient was a 69-year-old man with IgG kappa light chain MM of stage 3. He had 30% bone marrow infiltration and his serum monoclonal band, lactate dehydrogenase (LDH), and B2M were 5.28 g/dL, 412 IU/L, and 8.83 ng/mL, respectively.

The second patient was a 51-year-old woman with kappa light chain secreting disease of stage 3. Her laboratory analysis revealed overt disease activity (76% bone marrow infiltration, serum monoclonal band 6.9 g/dL, LDH 696 IU/L, and B2M 75.76 ng/mL). The third patient was a 67-year-old woman with IgA lambda light chain secreting disease of stage 2. She had mild disease activity at diagnosis (21% bone marrow infiltration, serum monoclonal band 1.94 g/dL, LDH 264 IU/L, and B2M 2.24 ng/mL). Bone marrow VEGF, CD34, and fVIIIrAg indexes of these three patients were also found to be significantly increased.

Only 3 control subjects showed 2%-4% bone marrow AGTR1 mRNA expression. Two of them were under medical examination for another reason and showed normocellular bone marrow histology, and the third one was a healthy bone marrow donor.

Moreover, they had relatively low levels of bone marrow VEGF, CD34, and fVIIIrAg indexes when compared with MM patients.

184

Turk J Hematol 2019;36:178-185

A clinically relevant aspect of the interactions of MM plasma cells in the bone marrow microenvironment is neovascularization, a constant hallmark of disease progression. Myeloma plasma cells also induce angiogenesis indirectly via recruitment and activation of stromal inflammatory cells (i.e. macrophages and mast cells) to secrete their own angiogenic factors. RAS signaling pathway mutations have been reported in newly diagnosed MM cases and even more so in relapsed/refractory MM [36,37], which could correlate with ACE expression level. Both findings may encourage the use of ACEIs or mitogen-activated protein kinase inhibitors in MM. Study Limitations The limitation of this study was the low number of MM patients enrolled, which was caused by the planned time schedule and the difficulty of finding de novo myeloma patients.

Conclusion Bone marrow AGTR1 expression can give information about bone marrow morphology and can predict disease progression in MM. Further studies are needed to ascertain such an association.

Ethics Ethics Committee Approval: The study was approved by the Ethical Commitee of İstanbul University, İstanbul Faculty of Medicine (2008/305), and every patient included in the study signed an informed consent.

Authorship Contributions Surgical and Medical Practices: B.S., M.S., Z.İ., S.K.B., M.A.K., N.E., C.T.; Concept: B.S., M.S., Z.İ., S.K.B., M.A.K., N.E., C.T., U.O.; Design: B.S., S.K.B., M.S., U.Ö., Ö.D.; Data Collection or Processing: B.S., S.K.B., M.S., U.Ö., Ö.D., S.G., M.A.K., N.E., C.T., Z.İ.; Analysis or Interpretation: B.S., S.K.B., M.S., U.Ö., Ö.D., S.G., Z.İ.; Literature Search: B.S., S.K.B., B.S., S.K.B., M.S., Z.İ., Writing: B.S., S.K.B., M.S., Z.İ.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Financial Disclosure: This work was supported by the Scientific and Technological Research Council of Turkey (TÜBİTAK) under project no. 105S432.

References 1. Haznedaroglu IC, Tuncer S, Gürsoy M. A local renin-angiotensin system in the bone marrow. Med Hypotheses 1996;46:507-510.

2. Haznedaroglu IC, Oztürk MA. Towards the understanding of the local hematopoietic bone marrow renin-angiotensin system. Int J Biochem Cell Biol 2003;35:867-880.

Turk J Hematol 2019;36:178-185

Saka B, et al: The Role of the Local Bone Marrow Renin-Angiotensin System in MM

3. Wulf GG, Jahns-Streubel G, Strutz F, Basenau D, Hüfner M, Buske C, Wörmann B, Hiddemann W. Paraneoplastic hypokalemia in acute myeloid leukemia: a case of renin activity in AML blast cells. Ann Hematol 1996;73:139-141.

4. Wulf GG, Jahns-Streubel G, Nobiling R, Strutz F, Hemmerlein B, Hiddemann W, Wörmann B. Renin in acute myeloid leukaemia blasts. Br J Haematol 1998;100:335-337.

5. Abali H, Haznedaroglu IC, Goker H, Celik I, Ozatli D, Koray Z, Caglar M. Circulating and local bone marrow renin-angiotensin system in leukemic hematopoiesis: preliminary evidences. Hematology 2002;7:75-82.

6. Tamarat R, Silvestre JS, Durie M, Levy BI. Angiotensin II angiogenic effect in vivo involves vascular endothelial growth factor- and inflammation-related pathways. Lab Invest 2002;82:747-756.

7. Muramatsu M, Katada J, Hayashi L, Majima M. Chymase as a proangiogenic factor. A possible involvement of chymase-angiotensin-dependent pathway in the hamster sponge angiogenesis model. J Biol Chem 2000;275:5545-5552.

8. Lever AF, Hole DJ, Gillis CR, McCallum IR, McInnes GT, MacKinnon PL, Meredith PA, Murray LS, Reid JL, Robertson JW. Do inhibitors of angiotensin-I-converting enzyme protect against risk of cancer? Lancet 1998;352:179-184.

9. Escobar E, Rodríguez-Reyna TS, Arrieta O, Sotelo J. Angiotensin II, cell proliferation and angiogenesis regulator: biologic and therapeutic implications in cancer. Curr Vasc Pharmacol 2004;2:385-399.

22. Beyazit Y, Aksu S, Haznedaroglu IC, Kekilli M, Misirlioglu M, Tuncer S, Karakaya J, Koca E, Buyukasik Y, Sayinalp N, Goker H. Overexpression of the local bone marrow renin-angiotensin system in acute myeloid leukemia. J Natl Med Assoc 2007;99:57-63.

23. Haznedaroglu IC, Malkan UY. Local bone marrow renin-angiotensin system in the genesis of leukemia and other malignancies. Eur Rev Med Pharmacol Sci 2016;20:4089-4111.

24. Schuh A, Becq J, Humphray S, Alexa A, Burns A, Clifford R, Feller SM, Grocock R, Henderson S, Khrebtukova I, Kingsbury Z, Luo S, McBride D, Murray L, Menju T, Timbs A, Ross M, Taylor J, Bentley D. Monitoring chronic lymphocytic leukemia progression by whole genome sequencing reveals heterogeneous clonal evolution patterns. Blood 2012;120:4191-4196.

25. Belyea BC, Xu F, Pentz ES, Medrano S, Li M, Hu Y, Turner S, Legallo R, Jones CA, Tario JD, Liang P, Gross KW, Sequeira-Lopez ML, Gomez RA. Identification of renin progenitors in the mouse bone marrow that give rise to B-cell leukaemia. Nat Commun 2014;5:3273.

26. Albayrak M, Celebi H, Albayrak A, Sayilir A, Yesil Y, Balcik OS, Yokus O, Celik T. Elevated serum angiotensin converting enzyme levels as a reflection of bone marrow renin-angiotensin system activation in multiple myeloma. J Renin Angiotensin Aldosterone Syst 2012;13:259-264.

10. Egami K, Murohara T, Shimada T, Sasaki K, Shintani S, Sugaya T, Ishii M, Akagi T, Ikeda H, Matsuishi T, Imaizumi T. Role of host angiotensin II type 1 receptor in tumor angiogenesis and growth. J Clin Invest 2003;112:67-75.

27. Uz B, Tatonyan SÇ, Sayitoğlu M, Erbilgin Y, Hatırnaz O, Aksu S, Büyükaşık Y, Sayınalp N, Göker H, Ozcebe Oİ, Ozbek U, Haznedaroğlu IC. Local reninangiotensin system in normal hematopoietic and multiple myeloma-related progenitor cells. Turk J Hematol 2014;31:136-142.

11. Munshi NC, Wilson C. Increased bone marrow microvessel density in newly diagnosed multiple myeloma carries a poor prognosis. Semin Oncol 2001;28:565-569.

28. Haznedaroglu IC, Arici M, Büyükaşik Y. A unifying hypothesis for the reninangiotensin system and hematopoiesis: sticking the pieces together with the JAK-STAT pathway. Med Hypotheses 2000;54:80-83.

12. Vacca A, Ribatti D, Roncali L, Ranieri G, Serio G, Silvestris F, Dammacco F. Bone marrow angiogenesis and progression in multiple myeloma. Br J Haematol 1994;87:503-508.

29. Gomez RA, Norling LL, Wilfong N, Isakson P, Lynch KR, Hock R, Quesenberry P. Leukocytes synthesize angiotensinogen. Hypertension 1993;21:470-475.

13. Vacca A, Ria R, Ribatti D, Semeraro F, Djonov V, Di Raimondo F, Dammacco F. A paracrine loop in the vascular endothelial growth factor pathway triggers tumor angiogenesis and growth in multiple myeloma. Haematologica 2003;88:176-185.

14. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2-ΔΔCT method. Methods 2001;25:402-408.

15. Remmele W, Stegner HE. Recommendation for uniform definition of an immunoreactive score (IRS) for immunohistochemical estrogen receptor detection (ER-ICA) in breast cancer tissue. Pathologe 1987;8:138-140.

30. Crabos M, Bertschin S, Bühler FR, Rogg H, Evéquoz D, Eberhard M, Erne P. Identification of AT1 receptors on human platelets and decreased angiotensin II binding in hypertension. J Hypertens 1993;11:230-231.

31. Rodgers KE, Xiong S, Steer R, diZerega GS. Effect of angiotensin II on hematopoietic progenitor cell proliferation. Stem Cells 2000;18:287-294.

32. Mrug M, Stopka T, Julian BA, Prchal JF, Prchal JT. Angiotensin II stimulates proliferation of normal early erythroid progenitors. J Clin Invest 1997;100:2310-2314.

16. Perez-Atayde AR, Sallan SE, Tedrow U, Connors S, Allred E, Folkman J. Spectrum of tumor angiogenesis in the bone marrow of children with acute lymphoblastic leukemia. Am J Pathol 1997;150:815-821.

33. Jokubaitis VJ, Sinka L, Driessen R, Whitty G, Haylock DN, Bertoncello I, Smith I, Péault B, Tavian M, Simmons PJ. Angiotensin-converting enzyme (CD143) marks hematopoietic stem cells in human embryonic, fetal, and adult hematopoietic tissues. Blood 2008;111:4055-4063.

17. Nehme A, Cerutti C, Dhaouadi N, Gustin MP, Courand PY, Zibara K, Bricca G. Atlas of tissue renin-angiotensin-aldosterone system in human: a transcriptomic meta-analysis. Sci Rep 2015;5:10035.

34. Durie BG, Stock-Novack D, Salmon SE, Finley P, Beckord J, Crowley J, Coltman CA. Prognostic value of pretreatment serum beta 2 microglobulin in myeloma: a Southwest Oncology Group Study. Blood 1990;75:823-830.

18. Rousseau-Plasse A, Lenfant M, Potier P. Catabolism of the hemoregulatory peptide N-acetyl-Ser-Asp-Lys-Pro: a new insight into the physiological role of the angiotensin-I-converting enzyme N-active site. Bioorg Med Chem 1996;4:1113-1119.

35. Murakami H, Hayashi K, Hatsumi N, Saitoh T, Yokohama A, Matsushima T, Tsukamoto N, Morita K, Karasawa M, Ogawara H, Sawamura M, Nojima Y. Risk factors for early death in patients undergoing treatment for multiple myeloma. Ann Hematol 2001;80:452-455.

19. Li J, Volkov L, Comte L, Herve P, Praloran V, Charbord P. Production and consumption of the tetrapeptide AcSDKP, a negative regulator of hematopoietic stem cells, by hematopoietic microenvironmental cells. Exp Hematol 1997;25:140-146.

36. Bezieau S, Devilder MC, Avet-Loiseau H, Mellerin MP, Puthier D, Pennarun E, Rapp MJ, Harousseau JL, Moisan JP, Bataille R. High incidence of N and K-Ras activating mutations in multiple myeloma and primary plasma cell leukemia at diagnosis. Hum Mutat 2001;8:212-224.

20. Azizi M, Rousseau A, Ezan E, Guyene TT, Michelet S, Grognet JM, Lenfant M, Corvol P, Ménard J. Acute angiotensin-converting enzyme inhibition increases the plasma level of the natural stem cell regulator N-acetylserylaspartyl-lysyl-proline. J Clin Invest 1996;97:839-844.

37. Walker BA, Boyle EM, Wardell CP, Murison A, Begum DB, Dahir NM, Proszek PZ, Johnson DC, Kaiser MF, Melchor L, Aronson LI, Scales M, Pawlyn C, Mirabella F, Jones JR, Brioli A, Mikulasova A, Cairns DA, Gregory WM, Quartilho A, Drayson MT, Russell N, Cook G, Jackson GH, Leleu X, Davies FE, Morgan GJ. Mutational spectrum, copy number changes, and outcome: results of a sequencing study of patients with newly diagnosed myeloma. J Clin Oncol 2015;33:3911-3920.

21. Nomura S, Sugihara T, Tomiyama T, Kitano Y, Yawata Y, Osawa G. Polycythaemia vera: response to treatment with angiotensin-converting enzyme inhibitor. Eur J Haematol 1996;57:117-119.

185

RESEARCH ARTICLE DOI: 10.4274/tjh.galenos.2019.2019.0090 Turk J Hematol 2019;36:186-192

The Use of Allogeneic Mesenchymal Stem Cells in Childhood Steroid-Resistant Acute Graft-Versus-Host Disease: A Retrospective Study of a Single-Center Experience Çocukluk Çağı Steroid Dirençli Akut Graft Versus-Host Hastalığında Allojenik Mezenkimal Kök Hücre Kullanımı: Retrospektif Bir Çalışma, Tek Merkez Deneyimi Ceyhun Bozkurt1,2,

Erdal Karaöz3,4,5,

Başak Adaklı Aksoy1,2,

Selime Aydoğdu2,

Tunç Fışgın2

1İstinye University Faculty of Medicine, Department of Pediatrics, İstanbul, Turkey 2Altınbaş University Faculty of Medicine, Bahçelievler Medical Park Hospital Pediatric Bone Marrow Transplantation Unit, İstanbul, Turkey 3İstinye University Faculty of Medicine, Department of Histology-Embryology, İstanbul, Turkey 4İstinye University Faculty of Medicine, Stem Cell and Tissue Engineering Research and Application Center, İstanbul, Turkey 5Liv Hospital, Regenerative Medicine, Stem Cell Production Center, İstanbul, Turkey

Abstract

Öz

Objective: Steroid-resistant acute graft-versus-host disease (srAGVHD) is the most important cause of morbidity and mortality after allogeneic stem cell transplantation. There are several treatment methods available, including mesenchymal stem cell (MSC) application. The aim of this study was to evaluate the results of MSC therapy performed in children with srAGVHD.

Amaç: Steroid dirençli akut graft versus host hastalığı (sdAGVHH), allojenik kök hücre naklinden sonra en önemli morbidite ve mortalite nedenidir. Mezenkimal kök hücre (MKH) uygulaması da dahil olmak üzere çeşitli tedavi yöntemleri mevcuttur. Bu çalışmanın amacı, sdAGVHH’li çocuklarda yapılan MKH tedavisi sonuçlarını değerlendirmektir.

Materials and Methods: MSC therapy was used in our center between November 2014 and December 2017 for 22 patients who developed srAGVHD. The patients were retrospectively evaluated in terms of treatment response and survival.

Gereç ve Yöntemler: Merkezimizde sdAGVHH gelişen 22 hasta için Kasım 2014 - Aralık 2017 tarihleri arasında MKH tedavisi uygulandı.

Hastalar tedaviye yanıt ve sağkalım yönünden retrospektif olarak değerlendirildi.

Results: After application of MSCs, complete response was obtained in 45.5% of the subjects, partial response was obtained in 13.6%, and no response was obtained in 40.9%. We found that 45.5% of the patients were alive and 54.5% had died and our treatment results were similar to those in the literature. Response to MSC treatment was found to be the only prognostic marker affecting mortality.

Bulgular: MKH uygulanmasından sonra, deneklerin %45,5’inde tam cevap, %13,6’sında kısmi yanıt alınmıştır. Deneklerin %40,9’unda yanıt alınamamıştır. Hastaların %45,5’inin hayatta olduğunu ve %54,5’inin öldüğünü ve tedavi sonuçlarımızın literatürle benzer olduğunu bulduk. MKH tedavisine yanıt mortaliteyi etkileyen tek prognostik belirteç olarak bulundu.

Conclusion: MSC application is a treatment method that can be used safely together with other treatment methods in srAGVHD, a condition that has a high mortality rate. There are almost no acute side effects. There are also no serious long-term side effects in the literature. Prospective randomized studies are required to obtain highquality data.

Sonuç: MKH uygulaması, mortalite oranı yüksek bir durum olan sdAGVHH’de diğer tedavi yöntemleriyle birlikte güvenle kullanılabilecek bir tedavi yöntemidir. Neredeyse hiçbir akut yan etkisi yoktur. Ayrıca literatürde uzun vadeli ciddi bir yan etkisi yoktur.

Prospektif randomize çalışmalar, yüksek kaliteli veri elde etmek için gereklidir.

Keywords: Childhood, Stem cell transplantation, Steroid-resistant acute graft-versus-host disease, Mesenchymal stem cell

Anahtar Sözcükler: Çocukluk çağı, Kök hücre nakli, Steroid dirençli akut graft versus host hastalığı, Mezenkimal kök hücre

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Ceyhun BOZKURT, M.D., İstinye University Faculty of Medicine, Department of Pediatrics, İstanbul, Turkey Phone : +90 536 573 34 71 E-mail : bozkurt.ceyhun@gmail.com ORCID-ID: orcid.org/0000-0001-6771-9894

186

Received/Geliş tarihi: February 27, 2019 Accepted/Kabul tarihi: June 17, 2019

Turk J Hematol 2019;36:186-192

Introduction Steroid-resistant acute graft-versus-host disease (srAGVHD) is the most important cause of morbidity and mortality developing after allogeneic stem cell transplantation. The mortality rate in srAGVHD can reach 90%. Treatment methods such as the use of various types of immunosuppressive agents, extracorporeal photopheresis (ECP), and mesenchymal stem cells (MSCs) are being attempted as second-line treatments in srAGVHD. Various rates of success have been reported with these treatment methods. The use of MSCs derived from humans has been initiated in recent years and there is an increase in the number of publications reporting that the use of MSCs is effective in srAGVHD. The mechanisms of action could be as follows: MSCs are involved in immunosuppressive and trophic immune regulation by secreting various growth factors and cytokines and by their cell-cell interaction mechanisms. Recent studies have shown that MSCs remain in the circulation for a very short time, but they are effective through immunomodulation or inhibition of T-cell activation via the exosomes they secrete, and also by influencing the tryptophan metabolism with indoleamine 2,3-dioxygenase, one of the degradation metabolites of these cells, influencing the adenosine receptor signal system of ectonucleotidase enzymes. They also act by inhibiting the immunomodulatory prostaglandins, cytokines such as IL10 and IL7, chemokines such as chemokine ligand 9, and growth factors such as transforming growth factor via programmed death receptor 1-2 (PDR 1-2) [1,2,3,4,5].

The aim of this study was to evaluate the results of MSC application in patients who developed srAGVHD that could not be controlled with other methods used in our clinic.

Materials and Methods The files of 22 patients diagnosed with srAGVHD who had undergone allogeneic MSC administration under suitable conditions with the approval of the ethics committee and the Ministry of Health of Turkey between November 2014 and December 2017 at the Altınbaş University Faculty of Medicine’s Bahçelievler Medical Park Hospital, Children’s Bone Marrow Transplantation Unit, were analyzed retrospectively. Assessment of AGVHD was performed according to the previously published international criteria [6]. Prednisolone or methyl-prednisolone treatment (2 mg/kg/day) was initiated for patients who had clinical manifestations of AGVHD. Progression in one of the clinical symptoms in the first 3 days after this treatment was initiated or absence of response to the treatment within 7 days was defined as srAGVHD. Secondary treatment modalities included the addition of a new drug such as mycophenolate mofetil or sirolimus and performing an ECP procedure. An ECP procedure was performed for 17 subjects for a total of 4 times on 2 consecutive days with an interval

Bozkurt C, et al: Mesenchymal Stem Cell Application in srAGVHD

of 1 week. MSCs were administered to the subjects who did not respond immediately after the 4th ECP procedure. MSCs were administered to all patients in the form of an intravenous infusion within 1 h in isotonic saline at a standard dose of 2 million/kg for a minimum of 2 doses and a maximum of 4 doses according to the clinical response observed, with an interval of 1 week. The median duration between the diagnosis of AGVHD and initiation of MSC therapy was 15 days (range: 6-55).

Ten patients received 2 doses, 4 patients received 3 doses, and 8 patients received 4 doses. The median dose of MSCs was 3x106 cells per kilogram of body weight. Complete response (CR) to treatment was defined as improvement of all symptoms.

Partial response (PR) was defined as improvement of clinical symptoms without complete disappearance. No response was defined as absence of response in clinical symptoms or worsening of the clinical picture. Evaluation of the patients’ responses to MSC treatment was performed 28 days after the first infusion and evaluation of survival was performed at least 6 months after the first infusion. In accordance with the Declaration of Helsinki, informed consent was obtained from the families of the patients who were administered MSCs. Approval was also obtained from the İstinye University Faculty of Medicine’s Ethics Committee for this study with approval number (2017-KAEK-120)/51.

Procedure for Preparing Mesenchymal Stem Cells Umbilical cord tissue-derived MSCs manufactured under current good manufacturing practice (cGMP) conditions (LivMedCell, İstanbul, Turkey) were used in this study. Human umbilical cords were obtained from healthy donors with their written approval. Each umbilical cord unit was manipulated under sterile conditions. These units were cut into sections of approximately 5 cm. The parts were washed with DPBS solution to remove the blood. The arteries and veins were removed to avoid endothelial cell contamination. Wharton’s jelly sections were then divided into smaller pieces. Tissue explants were placed into 100-mm2 cell culture plates and cultured in the Nutristem cell culture medium supplemented with 2% human serum and 50 U/mL penicillin-streptomycin. MSCs were grown in a humid atmosphere containing 5% CO2 at 37 °C. The cells were subcultured to the third passage. Cell preparation steps were performed according to cGMP requirements as described previously [7,8,9]. The cells were characterized by identifying the potential for differentiation using a flow cytometer and immunohistochemical analysis, cell aging, cell cycle, annexin V/PI staining, and telomerase enzyme activity at the third passage. Quality control and quality assurance for the production of these cells were conducted in accordance with the standards of the Turkish Pharmaceuticals and Medical Devices Agency (TMMDA).

187

Bozkurt C, et al: Mesenchymal Stem Cell Application in srAGVHD

Statistical Analysis IBM SPSS Statistics 22 (IBM SPSS, Turkey) was used for the statistical analyses. While evaluating the study data, the compliance of quantitative data with a normal distribution was evaluated with the Shapiro-Wilks test and it was found that the parameters did not show a normal distribution. In addition to descriptive statistical methods (mean, standard deviation, frequency), the Kruskal-Wallis test was used for comparison of age for response and the Mann-Whitney U test was used for comparison of age for outcome when comparing quantitative data. Fisherâ&#x20AC;&#x2122;s exact chi-square test and the Fisher-FreemanHalton test were used for comparison of the quantitative data.

A p-value of <0.05 was considered statistically significant.

Results A total of 22 subjects who developed srAGVHD following allogeneic stem cell transplantation between November 2014 and December 2017 were evaluated. The study was conducted with children aged 15 to 204 months. The study group consisted of 10 (45.5%) male and 12 (54.5%) female subjects. The mean age of the children was 88.95Âą61.82 months and the median age was 66 months. Table 1 presents the transplantation diagnosis and transplantation process data for these patients.

Table 1. Patient and transplantation parameters. n

%

Malignant

9

40.9

Non-malignant

13

59.1

Source of hematopoietic stem cells

PB

11

50

BM

9

41

PB+BM

2

9

Donor type

MRD

9

40.9

MUD

12

54.5

Haploidentical

1

4.5

Diagnosis

Conditioning regimen Myeloablative

19

86.4

Non-myeloablative

3

13.6

Extracorporeal photopheresis procedure

Performed

17

77.3

Not performed

5

22.7

Response to MSC treatment

No response

9

40.9

Partial response

3

13.6

Complete response

10

45.5

2

4

18.2

3

10

45.5

4

8

36.3

Exitus

12

54.5

Alive

10

45.5

Overall GVHD grade

Final status

PB: Peripheral blood, BM: bone marrow, MRD: matched related donor, MUD: matched unrelated donor, MSC: mesenchymal stem cell, GVHD: graft-versus-host disease.

188

Turk J Hematol 2019;36:186-192

Malignancy was present in 41% of the children. The stem cell source was peripheral blood (PB) in 50%, bone marrow (BM) in 40.9%, and PB+BM in 9.1%. The donor source for transplantation was a matched unrelated donor (MUD) in 54.5% cases and matched related donor (MRD) in 40.9%. Haploidentical transplantation was performed for only 1 child. A myeloablative regimen was administered for preparation in 86.4% of the children. ECP was performed for 77.3% of the subjects who developed AGVHD. When the subjects were graded according to their pre-treatment AGVHD status, it was found that 18.2% had Grade 2 AGVHD, 45.5% Grade 3 AGVHD, and 36.4% Grade 4 AGVHD. After administration of MSCs, CR was obtained in 45.5% of the subjects, PR was obtained in 13.6%, and no response was obtained in 40.9%. Table 2 presents the overall and organspecific AGVHD grades and the general response to MSC therapy. When the patients were evaluated according to organspecific response, a 42% response rate was obtained in the liver AGVHD group, a 77% response rate was obtained in the skin AGVHD group, and a 44% response rate was obtained in the gastrointestinal AGVHD group. When the final status was evaluated, it was found that 45.5% of the patients were alive and 54.5% had died.

When the deceased subjects were evaluated, it was found that 40% of the male subjects and 66.7% of the female subjects had died. The difference was not statistically significant (p>0.05).

There was also no statistically significant difference between the mean ages of the children who had died and those who were alive (p>0.05).

We found that 44.4% of the children diagnosed with a malignancy and 61.5% of the children who had a non-malignant disorder had died. The difference was not statistically significant (p>0.05).

The mortality rate was found to be 36.4% in the children whose stem cell source was PB, 77.8% in the children whose stem cell source was BM, and 50% in the children whose stem cell source was PB+BM. The difference was not statistically significant (p>0.05). Similarly, the mortality rate was found to be 66.7% in the children whose donor type was MRD and 50% in those whose donor type was MUD. Again, the difference was not statistically significant (p>0.05).

The mortality rate was found to be 47.4% in the children with a myeloablative conditioning regime and 53.6% in those with a non-myeloablative conditioning regimen. The difference was not statistically significant (p>0.05).

The mortality rate was found to be 67.4% in the children who had undergone ECP and 20% in the children who had not undergone ECP. The difference was not statistically significant (p>0.05).

Bozkurt C, et al: Mesenchymal Stem Cell Application in srAGVHD

Turk J Hematol 2019;36:186-192

The mortality rates by grade of AGVHD were found to be 50%, 50%, and 62.5% for Grades 2, 3, and 4, respectively. The difference was not statistically significant (p>0.05).

was reported to be better in cases of childhood srAGVHD in studies that evaluated pediatric and adult cases together [16,18]. The response rate in our series was approximately 58%, comparable to the literature.

A statistically significant correlation was found between treatment response and mortality (p=0.001; p<0.05). Mortality was observed in all patients who did not respond to MSC treatment (100%), in 66.7% of those with PR, and only in 10% of those with CR. A statistically significant correlation was found between response to MSC treatment and mortality based on these results (p<0.001; p<0.05).

There are various applications regarding the MSC donor source.

The usual MSC source is bone marrow [19,20]. We obtained MSCs from Wharton’s jelly derived from the cord blood of a single donor. Kuçi et al. [21] reported an overall survival rate of 71±11% at 2 years of follow-up for their entire patient cohort with MSCs that they prepared from monocytes from multiple donors compared to a survival rate of 51.4±9.0% in their historical control group. They stated that the reason could be allosuppression differences that might have been present between the MSCs obtained from the donors, and they believed that they could increase the mean allosuppression rate in MSC treatments by increasing donor diversity. Randomized prospective studies are required to determine the effectiveness of MSCs obtained from single or multiple donors.

Table 3 presents the factors affecting survival in our patients.

We did not observe any side effects related to MSC infusion in any of the patients.

Discussion The use of MSCs in srAGVHD has gradually increased since 2004 when they were clinically used for the first time. Although it has been reported that prophylactic use of MSCs before stem cell application decreases the AGVHD rate [10,11,12], MSC therapy is usually used after AGVHD is diagnosed. It has been reported that the response rate is 15%-75% [13,14,15,16,17]. The response

The frequency and number of infusions for MSC applications can vary. The reported number of MSC doses ranges from 1 to 7 and the doses range from 0.4x106/kg to 10x106/kg [19].

Kurtzberg et al. [14] administered MSC treatment in pediatric

Table 2. Overall and organ-specific acute graft-versus-host disease grades and response to mesenchymal stem cell therapy.

Patient no.

Overall AGVHD grade

Skin AGVHD grade

Liver AGVHD grade

Gastrointestinal AGVHD grade

General response

Outcome

1

3

2

3

0

CR

Alive

2

3

2

2

3

NR

Dead (infection)

3

3

2

3

2

CR

Alive (chronic GVHD)

4

3

3

2

0

CR

Alive

5

4

2

2

4

NR

Dead (infection)

6

2

2

1

0

PR

Alive (chronic GVHD)

7

3

2

1

3

NR

Dead (infection)

8

4

1

2

4

NR

Dead (infection)

9

4

2

3

4

NR

Dead (infection)

10

4

3

3

4

NR

Dead (infection)

11

3

2

0

1

CR

Alive (chronic GVHD)

12

2

2

1

0

CR

Alive

13

3

2

0

3

NR

Dead

14

3

3

0

2

CR

Dead (relapse)

15

2

2

1

2

PR

Dead (infection)

16

3

2

0

3

CR

Alive

17

4

2

2

4

NR

Dead (infection)

18

4

2

0

4

CR

Alive (chronic GVHD)

19

2

2

2

2

PR

Dead

20

3

2

0

3

NR

Dead

21

4

3

0

4

CR

Alive (chronic GVHD)

22

4

3

0

4

CR

Alive

CR: Complete response, PR: partial response, NR: no response, AGVHD: acute graft-versus-host disease.

189

Bozkurt C, et al: Mesenchymal Stem Cell Application in srAGVHD

Turk J Hematol 2019;36:186-192

Table 3. Evaluation of the parameters affecting final status.

Final status

Sex Diagnosis

Source of hematopoietic stem cells

Donor type

Conditioning regimen Extracorporeal photopheresis procedure

Overall AGVHD grade

Response to MSC treatment

Alive

Dead

n (%)

n (%)

Male

4 (40%)

6 (60%)

Female

8 (66.7%)

4 (33.3%)

Malignant

4 (44.4%)

5 (55.6%)

Non-malignant

8 (61.5%)

5 (38.5%)

PB

4 (36.4%)

7 (63.6%)

BM

7 (77.8%)

2 (22.2%)

PB+BM

1 (50%)

1 (50) %

MRD

6 (66.7%)

3 (33.3%)

MUD

6 (50%)

6 (50%)

Haploidentical

0 (0%)

1 (100%)

Myeloablative

9 (47.4%)

10 (52.6%)

Non-myeloablative

3 (100%)

0 (0%)

Performed

11 (64.7%)

6 (35.3%)

Not performed

1 (20%)

4 (80%)

2

2 (50%)

2 (50%)

3

5 (50%)

5 (50%)

4

5 (62.5%)

3 (37.5%)

No response

9 (100%)

0 (0%)

Partial response

2 (66.7%)

1 (33.3%)

Complete response

1 (10%)

9 (90%)

99.83±66.33 (83)

75.90±56.50 (66)

Age, mean ± SD (median) 1Fisher’s

p

0.3911 0.6661 0.1382

0.6602

0.2211 0.1351 0.8642

0.001*2

0.3193

exact test, 2Fisher-Freeman-Halton test, 3Mann-Whitney U test, *Statistically significant.

PB: Peripheral blood, BM: bone marrow, MRD: matched related donor, MUD: matched unrelated donor, MSC: mesenchymal stem cell, AGVHD: acute graft-versus-host disease.

cases of srAGVHD for a consecutive 4-week period at a dose of 2 million/kg (the same dose as in our study) twice a week. The general response rate was 61.3%. This response rate is similar to ours. Evaluation of these two studies revealed that application of MSC treatment twice a week had no additional benefit and increased treatment costs. Similar results were obtained with MSC application in cases of srAGVHD using intervals of 2 weeks with a different method in the study of Erbey et al. [22]. MSC applications are generally conducted with intervals of 1 week according to the literature.

When the factors affecting survival in MSC treatments were investigated in our study, the presence of a response to MSC treatment was the only prognostic indicator affecting mortality.

The general survival rate was found to be 63.8% in patients with CR to MSC treatment in the 2nd year following MSC application, whereas it was found to be 0% in the groups with PR or no response in the study conducted by Erbey et al. [22] in Turkey. Similarly, the general survival rate was found to be 69% in patients with CR to treatment, whereas it was found to be 0% during the 2.9-year follow-up period following MSC 190

administration in srAGVHD patients in the study by Ball et al.

[23]. In the study conducted by Resnick et al. [18], multivariate analysis demonstrated that initial response (partial or complete) had a significant independent influence on 6-month survival (hazard ratio: 29.4). These findings also support our results showing a high survival rate with MSC treatment when CR was obtained.

Introna et al. [16] reported better response in Grade 2 subjects compared to Grade 3 and 4 subjects in their study. Resnick et al. [18] reported that the overall survival was lower in Grade 4 GVHD patients compared to Grade 2 and 3 GVHD patients. No association was observed between grade status and treatment response in our patients.

It has been proposed that tumor recurrence [24,25] and an increase in infections may occur as a long-term side effect of MSC applications. No short-term acute side effects were observed in relation to the MSC applications in our study.

Disease relapse was observed in one of the 9 patients who had malignancy in our study. Kuçi et al. [21] found that the relapse rate was 9% in their patients who had srAGVHD. We did not

Turk J Hematol 2019;36:186-192

evaluate whether the infection rate had increased. Other studies have not reported an adverse effect that increased the rate of infection [12,26,27].

In a great portion of our subjects, ECP was applied before MSC administration. The weakness of our study was thus that the responses were not solely associated with MSC administration.

There was a possibility that the ECP procedure also contributed to this improvement. MSC application might have increased the immunosuppressive effect of ECP or might have possibly led to an improvement in GVHD by itself.

Conclusion MSC administration is a treatment method that can be used safely together with other treatment methods in srAGVHD, a condition that has a high mortality rate. There are almost no acute side effects. The literature also reports no serious longterm side effects. Randomized prospective studies are required to obtain high-quality data about the effectiveness, safety, and side effects of MSC application in cases of srAGVHD. Ethics Ethics Committee Approval: This study was approved by the İstinye University Faculty of Medicine Ethics Committee, approval number: (2017-KAEK-120)/51. This study was conducted in accordance with the World Medical Association’s Declaration of Helsinki (2000).

Informed Consent: Informed consent was obtained from parents or legal guardians before enrollment in the study.

Authorship Contributions Medical Practices: C.B, E.K., B.A.A., S.A., T.F.; Concept: C.B, E.K., T.F.; Design: C.B, E.K., T.F.; Data Collection or Processing: C.B, B.A.A.; Analysis or Interpretation: C.B, E.K., B.A.A., S.A., T.F.; Literature Search: C.B, E.K., B.A.A., S.A., T.F.; Writing: C.B, E.K., T.F. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Tekeli S, Naghavi EA, Gökçe B, Sır G, Yiğittürk G, Çavuşoğlu T, Uyanikgil Y. Kök hücreler; mezenkimal kök hücreler ve güncel klinik uygulamaları. FNG & Bilim Tıp Transplantasyon Dergisi 2016;1:72-83.

2. Dunavin N, Dias A, Li M, McGuirk J. Mesenchymal stromal cells: what is the mechanism in acute graft-versus-host disease? Biomedicines 2017:5.

3. Ma Y, Wang Z, Zhang A, Xu F, Zhao N, Xue J, Zhang H, Luan X. Human placenta-derived mesenchymal stem cells ameliorate GVHD by modulating Th17/Tr1 balance via expression of PD-L2. Life Sci 2018;214:98-105.

4. Fan X, Guo D, Cheung AMS, Poon ZY, Yap CS, Goh SE, Guo D, Li H, Bari S, Li S, Lim KH, Hwang WYK. Mesenchymal stromal cell (MSC)-derived combination of CXCL5 and anti-CCL24 is synergistic and superior to MSC

Bozkurt C, et al: Mesenchymal Stem Cell Application in srAGVHD

and cyclosporine for the treatment of graft-versus-host disease. Biol Blood Marrow Transplant 2018;24:1971-1980.

5. Su J, Chen X, Huang Y, Li W, Li J, Cao K, Cao G, Zhang L, Li F, Roberts AI, Kang H, Yu P, Ren G, Ji W, Wang Y, Shi Y. Phylogenetic distinction of iNOS and IDO function in mesenchymal stem cell-mediated immunosuppression in mammalian species. Cell Death Differen 2014;21:388-396.

6. Rowlings PA, Przepiorka D, Kleinetal JP, Gale RP, Passweg JR, HensleeDowney PJ, Cahn JY, Calderwood S, Gratwohl A, Socié G, Abecasis MM, Sobocinski KA, Zhang MJ, Horowitz MM. IBMTR Severity Index for grading acute graft-versus-host disease: retrospective comparison with Glucksberg grade. Br J Haematol 1997;4:855-864.

7. Kabataş S, Civelek E, İnci Ç, Yalçınkaya EY, Günel G, Kır G, Albayrak E, Öztürk E, Adaş G, Karaöz E. Wharton’s jelly-derived mesenchymal stem cell transplantation in a patient with hypoxic-ischemic encephalopathy: a pilot study. Cell Transplant 2018;27:1425-1433.

8. Dai A, Baspinar O, Yeşilyurt A, Sun E, Aydemir Çİ, Öztel ON, Capkan DU, Pinarli F, Agar A, Karaöz E. Efficacy of stem cell therapy in ambulatory and nonambulatory children with Duchenne muscular dystrophy - Phase I-II. Degener Neurol Neuromuscul Dis 2018;8:63-77.

9. Okur SÇ, Erdoğan S, Demir CS, Günel G, Karaöz E. The effect of umbilical cord-derived mesenchymal stem cell transplantation in a patient with cerebral palsy: a case report. Int J Stem Cells 2018;11:141-147.

10. Baron F, Lechanteur C, Willems E, Bruck F, Baudoux E, Seidel L, Vanbellinghen JF, Hafraoui K, Lejeune M, Gothot A, Fillet G, Beguin Y. Cotransplantation of mesenchymal stem cells might prevent death from graft-versus-host disease (GVHD) without abrogating graft-versus-tumor effects after HLA-mismatched allogeneic transplantation following nonmyeloablative conditioning. Biol Blood Marrow Transplant 2010;16:838-847.

11. Gao L, Zhang Y, Hu B, Liu J, Kong P, Lou S, Su Y, Yang T, Li H, Liu Y, Zhang C, Gao L, Zhu L, Wen Q, Wang P, Chen X, Zhong J, Zhang X. Phase II multicenter, randomized, double-blind controlled study of efficacy and safety of umbilical cord-derived mesenchymal stromal cells in the prophylaxis of chronic graft-versus-host disease after HLA-haploidentical stem-cell transplantation. J Clin Oncol 2016;34:2843-2850.

12. Wang L, Zhu CY, Ma DX, Gu ZY, Xu CC, Wang FY, Chen JG, Liu CJ, Guan LX, Gao R, Gao Z, Fang S, Zhuo DJ, Liu SF, Gao CJ. Efficacy and safety of mesenchymal stromal cells for the prophylaxis of chronic graft-versus-host disease after allogeneic hematopoietic stem cell transplantation: a metaanalysis of randomized controlled trials. Ann Hematol 2018;97:19411950.

13. Dotoli GM, De Santis GC, Orellana MD, de Lima Prata K, Caruso SR, Fernandes TR, Rensi Colturato VA, Kondo AT, Hamerschlak N, Simões BP, Covas DT. Mesenchymal stromal cell infusion to treat steroid-refractory acute GvHD III/IV after hematopoietic stem cell transplantation. Bone Marrow Transplant 2017;52:859-862.

14. Kurtzberg J, Prockop S, Teira P, Bittencourt H, Lewis V, Chan KW, Horn B, Yu L, Talano JA, Nemecek E, Mills CR, Chaudhury S. Allogeneic human mesenchymal stem cell therapy (remestemcel-L, Prochymal) as a rescue agent for severe refractory acute graft-versus-host disease in pediatric patients. Biol Blood Marrow Transplant 2014;20:229-235.

15. Thielen FW, Blommestein HM, Oosten LEM, Calkoen FG, Lankester AC, Zwaginga JJ, Le Blanc K, Redondo A, Sánchez-Guijo F, Algeri M, Locatelli F, Fibbe WE, Uyl-de Groot CA. Second-line treatment for acute graftversus-host disease with mesenchymal stromal cells: a decision model. Eur J Haematol 2018.

16. Introna M, Lucchini G, Dander E, Galimberti S, Rovelli A, Balduzzi A, Longoni D, Pavan F, Masciocchi F, Algarotti A, Micò C, Grassi A, Deola S, Cavattoni I, Gaipa G, Belotti D, Perseghin P, Parma M, Pogliani E, Golay J, Pedrini O, Capelli C, Cortelazzo S, D’Amico G, Biondi A, Rambaldi A, Biagi E. Treatment of graft versus host disease with mesenchymal stromal cells: a phase I study on 40 adult and pediatric patients. Biol Blood Marrow Transplant 2014;20:375-381.

191

Bozkurt C, et al: Mesenchymal Stem Cell Application in srAGVHD

17. Sánchez-Guijo F, Caballero-Velázquez T, López-Villar O, Redondo A, Parody R, Martínez C, Olavarría E, Andreu E, Prósper F, Díez-Campelo M, Regidor C, Villaron E, López-Corral L, Caballero D, Cañizo MC, PérezSimon JA. Sequential third-party mesenchymal stromal cell therapy for refractory acute graft-versus-host disease. Biol Blood Marrow Transplant 2014;20:1580-1585.

18. Resnick IB, Barkats C, Shapira MY, Stepensky P, Bloom AI, Shimoni A, Mankuta D, Bloom NV, Rheingold L, Yeshurun M, Bielorai B, Toren A, Zuckerman T, Nagler A, Or R. Treatment of severe steroid resistant acute GVHD with mesenchymal stromal cells (MSC). Am J Blood Res 2013;3:225238.

19. Rizk M, Monaghan M, Shorr R, Kekre N, Bredeson CN, Allan DS. Heterogeneity in studies of mesenchymal stromal cells to treat or prevent graft-versus-host disease: a scoping review of the evidence. Biol Blood Marrow Transplant 2016;22:1416-1423.

20. Trento C, Bernardo ME, Nagler A, Kuçi S, Bornhäuser M, Köhl U, Strunk D, Galleu A, Sanchez-Guijo F, Gaipa G, Introna M, Bukauskas A, Le Blanc K, Apperley J, Roelofs H, Van Campenhout A, Beguin Y, Kuball J, Lazzari L, Avanzini MA, Fibbe W, Chabannon C, Bonini C, Dazzi F. Manufacturing mesenchymal stromal cells for the treatment of graft-versus-host disease: a survey among centers affiliated with the european society for blood and marrow transplantation. Biol Blood Marrow Transplant 2018;24:2365-2370.

21. Kuçi Z, Bönig H, Kreyenberg H, Bunos M, Jauch A, Janssen JW, Škifić M, Michel K, Eising B, Lucchini G, Bakhtiar S, Greil J, Lang P, Basu O, von Luettichau I, Schulz A, Sykora KW, Jarisch A, Soerensen J, SalzmannManrique E, Seifried E, Klingebiel T, Bader P, Kuçi S. Mesenchymal stromal cells from pooled mononuclear cells of multiple bone marrow donors as

192

Turk J Hematol 2019;36:186-192

rescue therapy in pediatric severe steroid-refractory graft-versus-host disease: a multicenter survey. Haematologica 2016;101:985-994.

22. Erbey F, Atay D, Akcay A, Ovali E, Ozturk G. Mesenchymal stem cell treatment for steroid refractory graft-versus-host disease in children: a pilot and first study from Turkey. Stem Cells Int 2016;2016:1641402.

23. Ball LM, Bernardo ME, Roelofs H, van Tol MJ, Contoli B, Zwaginga JJ, Avanzini MA, Conforti A, Bertaina A, Giorgiani G, Jol-van der Zijde CM, Zecca M, Le Blanc K, Frassoni F, Egeler RM, Fibbe WE, Lankester AC, Locatelli F. Multiple infusions of mesenchymal stromal cells induce sustained remission in children with steroid-refractory, grade III-IV acute graftversus-host disease. Br J Haematol 2013;163:501-509.

24. Suzuki K, Sun R, Origuchi M, Kanehira M, Takahata T, Itoh J, Umezawa A, Kijima H, Fukuda S, Saijo Y. Mesenchymal stromal cells promote tumor growth through the enhancement of neovascularization. Mol Med 2011;17:579-587.

25. Brennen WN, Chen S, Denmeade S, Isaacs JT. Quantification of mesenchymal stem cells (MSCs) at sites of human prostate cancer. Oncotarget 2013;4:106117.

26. Stoma I, Karpov I, Krivenko S, Iskrov I, Milanovich N, Koritko A, Uss A. Mesenchymal stem cells transplantation in hematological patients with acute graft-versus-host disease: characteristics and risk factors for infectious complications. Ann Hematol 2018;97:885-891.

27. Schmidt S, Tramsen L, Schneider A, Schubert R, Balan A, Degistirici Ö, Meisel R, Lehrnbecher T. Impact of human mesenchymal stromal cells on antifungal host response against Aspergillus fumigatus. Oncotarget 2017;8:9549595503.

BRIEF REPORT DOI: 10.4274/tjh.galenos.2019.2018.0413 Turk J Hematol 2019;36:193-198

Effectiveness of Sequential Compression Devices in Prevention of Venous Thromboembolism in Medically Ill Hospitalized Patients: A Retrospective Cohort Study Hastanede Dahili Hastalıklar Nedeniyle Yatan Hastalarda Ardışık Kompresyon Cihazlarının Venöz Tromboemboliyi Önlemedeki Etkinliği Prajwal Dhakal1,2,

Ling Wang3,

Joseph Gardiner4,

Shiva Shrotriya3,

Mukta Sharma3,

Supratik Rayamajhi3

1University of Nebraska Medical Center, Department of Internal Medicine, Division of Oncology and Hematology, Omaha, Nebraska, USA 2Fred and Pamela Buffett Cancer Center, University of Nebraska Medical Center, Omaha, Nebraska, USA 3Michigan State University, Department of Medicine, East Lansing, Michigan, USA 4Michigan State University, Department of Epidemiology and Biostatistics, East Lansing, Michigan, USA

Abstract

Öz

Objective: To evaluate the effectiveness of sequential compression devices (SCDs) for venous thromboembolism (VTE) prevention in medically ill hospitalized patients.

Amaç: Çalışmanın amacı hastanede dahili hastalıklar nedeniyle yatan hastalarda ardışık kompresyon cihazlarının (SCD) venöz tromboemboliyi (VTE) önlemedeki etkinliğinin değerlendirilmesidir.

Materials and Methods: Adult patients admitted to a teaching hospital from April 2015 to March 2016 were included. Patients on anticoagulants with or without SCDs were excluded. We analyzed VTE risk, length of hospital stay, and other comorbidities among propensity score-matched patients on SCDs and those without thromboprophylaxis (NONE).

Gereç ve Yöntemler: Çalışmaya Nisan 2015 ile Mart 2016 tarihleri arasında eğitim hastanesine yatan erişkin hastalar alınmıştır.

Antikoagülan tedavi alanlar, SCD kullanılsın ya da kullanılmasın, çalışma dışında bırakılmıştır. VTE riski, hastanede yatış süresi ve diğer komorbiditeler eğilim skoru eşlenmiş SCD grubu ve tromboproflaksi kullanmayan grup (NONE) için analiz edilmiştir.

Results: Among 30,824 patients, 67 patients (0.22%) developed VTE during their hospital stays, with deep vein thrombosis (DVT) in 55 cases and pulmonary embolism (PE) in 12. VTE was seen in 47 out of 20,018 patients on SCDs (41 DVT, 6 PE) and 20 out of 10,819 patients without SCDs (14 DVT, 6 PE). Risk-adjusted analysis showed no significant difference in VTE incidence in the SCD group compared to NONE (odds ratio 0.99, 95% confidence interval 0.57-1.73, p=0.74).

Bulgular: 30,824 hastadan 67 hasta (%0,22) hastanede yatış süresi içinde VTE geçirdi, bunların 55 tanesi derin ven trombozu (DVT), 12 tanesi pulmoner emboli (PE) idi. SCD kullanılan 20,018 hastadan 47’sinde (41 DVT, 6 PE), SCD kullanmayan 10,819 hastanın 20’sinde (14 DVT, 6 PE) VTE görüldü. Riske göre düzeltilmiş analiz SCD grubu ve NONE grubu arasında VTE insidansında anlamlı bir farklılık göstermemiştir (odds oranı 0,99, %95 güven aralığı 0,57-1,73, p=0,74).

Conclusion: Compared to the NONE group, SCDs are not associated with decreased VTE incidence during hospital stay.

Sonuç: Yatış süresince SCD grubunda NONE grubu ile karşılaştırıldığında VTE insidansında bir azalma gözlenmemiştir.

Keywords: Sequential compression devices, Venous thromboembolism, Hospitalized patients, Effectiveness

Anahtar Sözcükler: Ardışık kompresyon tromboemboli, Yatan hasta, Etkinlik

cihazları,

Venöz

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Supratik RAYAMAJHI, M.D., University of Nebraska Medical Center, Department of Internal Medicine, Division of Oncology and Hematology, Omaha, Nebraska, USA Phone : 517-353-5100 E-mail : supratik.rayamajhi@hc.msu.edu

Received/Geliş tarihi: November 29, 2018 Accepted/Kabul tarihi: April 25, 2019

This paper was presented as an abstract, after preliminary data analysis, at the 59th American Society of Hematology 2017 Annual Meeting held on December 9, 2017, in Atlanta, Georgia.

193

Dhakal P, et al: SCDs for VTE Prevention in Hospitalized Patients

Introduction Venous thromboembolism (VTE), which includes deep vein thrombosis (DVT) and pulmonary embolism (PE), affects 1 million patients in the United States each year [1,2,3].

Hospitalization is a major risk factor for VTE, with 150-fold increase in risk compared to non-hospitalized individuals [2,4]. Anticoagulants are commonly used for VTE prevention in hospitalized patients, and sequential compression devices (SCDs) are recommended in combination with anticoagulants or when anticoagulants are contraindicated [5]. Current guidelines for SCD use are consensus-based, derived mostly from surgical patients by comparing the effects of SCDs plus anticoagulation versus anticoagulation alone [5,6,7,8]. In routine practice, SCDs are used extensively in hospitals despite limited evidence in medically ill patients [6,9]. We explored the effectiveness of SCDs in medically ill hospitalized patients.

Materials and Methods Participants and Study Design We included all patients admitted to the medical inpatient service from April 2015 to March 2016 at Sparrow Hospital, a secondary care teaching hospital (Figure 1). Patients <18 years

Figure 1. CONSORT diagram for cohort selection.

194

Turk J Hematol 2019;36:193-198

of age or diagnosed with VTE upon admission were excluded.

Patients using anticoagulants at home or in the hospital were excluded to eliminate the effects of anticoagulant use. Trained investigators abstracted the data including demographic characteristics, diagnostic methods, methods for VTE prevention, length of hospital stay (LOS), VTE events, and comorbidities.

The Charlson Comorbidity Index (CCI) was calculated. Eligible patients were divided into the SCD group (only on SCDs during hospital stay) and the NONE group (no VTE prophylaxis during hospital stay).

Study Outcomes The primary outcome was a new diagnosis of symptomatic VTE during the hospital stay. Outcomes were confirmed with Doppler ultrasonography for DVT and computed tomography pulmonary angiogram or ventilation-perfusion scan for PE. Statistical Analysis Differences between the SCD group and NONE group were compared using t-tests or Wilcoxon rank sum tests for continuous variables and chi-square tests for categorical variables. Since patients were not randomly assigned to receive SCDs, propensity score analysis was performed. For each patient, we estimated the propensity score (likelihood of receiving SCD) from a multivariable logistic regression model. There are features of randomness in the selection of treated patients and their matches that could lead to different models for assessing the propensity scores. We experimented with different specifications, especially for LOS and CCI, with the same qualitative conclusion. The variables included in the final model for propensity scores were sex, any type of cancer, comorbidities, and three continuous variables modeled by splines: age (6 terms), log-transformed LOS (3 terms), and CCI (4 terms). A spline function of a continuous variable is a smooth function composed of polynomial pieces connected at interior points called knots in the range of the variable [10,11].

The c-statistic was 0.707, indicating an acceptable level of discrimination between SCD and NONE patients. Figure 2 depicts the adjusted odds ratios (ORs) and 95% confidence intervals (CIs) for the binary variables. We followed published principles and guidelines to form treated and non-treated pairs based on their propensity scores [12,13]. A randomly chosen SCD patient was matched to one NONE patient in the common region of propensity scores extended by 0.25 times the pooled estimate of the standard deviation of the logits of propensity scores in the two groups. This greedy matching algorithm, which proceeded sequentially with SCD patients selected in random order of propensity scores and matched to a unique NONE patient, resulted in 10,071 unique pairs. The SAS procedure PSMATCH was used for matching. In the matched sample, we examined the quality of the matching by comparing the standardized mean differences and variance ratios between SCD and NONE

Turk J Hematol 2019;36:193-198

[14,15]. We used conditional logistic regression to obtain the adjusted OR and 95% CI for the association of SCDs with VTE incidence. We also performed a risk-adjusted analysis for VTE incidence with an indicator of SCD use. A multivariable logistic model with a subset of the covariate mix was applied using information criteria for model selection [16].

The study was determined exempt by Michigan State University and Sparrow Hospital with IRB # i051275.

Dhakal P, et al: SCDs for VTE Prevention in Hospitalized Patients

(Table 2). Conditional logistic regression after propensity matching yielded an adjusted OR of 0.9 (95% CI 0.47-1.7, p=0.75) for VTE incidence with SCDs. Similarly, the adjusted OR for SCDs after multivariable logistic regression was 0.99 (95% CI: 0.57-1.73, p=0.98).

Discussion

SCD Impact on VTE Incidence

Our large retrospective study of 30,824 medically ill patients demonstrated a similar incidence of VTE with SCDs only compared to the NONE group. In comparison to NONE, SCD patients had significant differences in risk factors for VTE, including higher CCI, higher prevalence of cancer and obesity, and longer LOS. Propensity score matching matched the SCD and NONE groups with no statistical difference in VTE incidence.

The overall incidence of symptomatic VTE was <1% in our study, which might have played a role in the results. Previous studies reported significantly higher incidences of VTE in critically ill patients compared to other non-critical medically ill patients [17,18,19,20,21]. Critically ill patients on anticoagulants or both anticoagulants and SCDs were not eligible for analysis in our study, which could be one of the causes of the lower incidence of VTE. Multiple studies also screened patients for VTE before discharge, which would lead to the diagnosis of asymptomatic VTE and subsequently increase the overall incidence of VTE [22].

We studied symptomatic patients only and no screening for asymptomatic VTE was performed.

In the unadjusted analysis, use of SCDs was not associated with decreased VTE incidence (OR 1.27, 95% CI 0.75-2.14, p=0.37)

Despite significant results in surgical patients, the existing literature contains mixed results regarding the use of SCDs

Results Patient Characteristics A total of 30,824 patients were included in the analysis; mean age was 54±21 years and 61.5% were female. Mean CCI was 4.5±2.4. Mean LOS was 4.5±4.3 days. Out of the total patients, 20,018 (64.9%) were on SCDs and 10,819 (35.1%) were not.

Patient characteristics, including those on anticoagulants, are provided in Table 1.

Outcome Sixty-seven (0.22%) patients had VTE, with DVT in 55 cases and PE in 12 cases. DVT and PE occurrences in the SCD group were 41 and 6, compared to 14 and 6 in the NONE group. Thus, 0.23% of total patients on SCDs developed VTE compared to 0.18% in the NONE group.

Figure 2. Standardized differences in observed variables between matched pairs. Standardized difference between sequential compression device-treated and matched non-treated patients is the difference in means or proportions divided by an estimate of standard deviation obtained as the square-root of the average variance in treated and non-treated groups. In the matched sample, the differences are within the ±0.25 reference lines for good variable balance.

195

Dhakal P, et al: SCDs for VTE Prevention in Hospitalized Patients

in medically ill patients. This could be related to publication bias in these types of study. Limpus et al. [23] performed a systematic review of compression and pneumatic devices for thromboprophylaxis in intensive care patients. Twenty-one studies with >4000 individuals were analyzed and there was no

Turk J Hematol 2019;36:193-198

significant difference with the use of compressive and pneumatic devices compared to no treatment or use of anticoagulants [23].

In another review, the strength of the evidence was insufficient to determine the effectiveness of SCDs for thromboprophylaxis in high-risk medical patients because of limited data [24]. The

Table 1. Patient characteristics.

Variables

SCD, n=20,018

NONE, n=10,819

AC, n=2126

BOTH, n=5019

Age, years, mean ± SD

57±21

49±21

65±16

65±16

Charlson Comorbidity Index, mean ± SD

4.7±2.4

4.2±2.2

5.6±2.6

5.9±2.7

Length of stay, days, mean ± SD

4.1±4.6

2.7±3.5

6±8

7.8±8.7

Sex, male, n (%)

8263 (41.3)

3623 (33.5)

1146 (53.9)

2594 (51.7)

Infection, n (%)

1766 (8.82)

699 (6.46)

222 (10.4)

783 (15.6)

Pulmonary disease, n (%)

2958 (14.78)

1333 (12.32)

370 (17.4)

1113 (22.18)

Hypertension, n (%)

4147 (20.72)

1712 (15.82)

472 (22.2)

1112 (22.2)

Renal disease, n (%)

1698 (8.48)

588 (5.43)

297 (13.97)

1004 (20)

Diabetes, n (%)

2306 (11.52)

957 (8.85)

390 (18.34)

888 (17.69)

Congestive heart failure, n (%)

1168 (5.83)

444 (4.10)

276 (13)

819 (16.3)

Hepatic disease, n (%)

728 (3.64)

193 (1.78)

65 (3.1)

186 (3.7)

Anemia, n (%)

615 (3.07)

184 (1.70)

44 (2.07)

176 (3.51)

Obesity, n (%)

1435 (7.17)

612 (5.66)

210 (9.9)

443 (8.8)

Any cancer, n (%)

545 (2.7)

145 (1.34)

55 (2.59)

183 (3.65)

Abdominal, n (%)

18 (0.09)

6 (0.06)

2 (0.09)

6 (0.12)

Brain, n (%)

23 (0.11)

1 (0.01)

0 (0)

2 (0.04)

Breast (females), n (%)

63 (0.31)

12 (0.11)

2 (0.09)

18 (0.36)

Cervical (females), n (%)

27 (0.13)

3 (0.03)

2 (0.1)

7 (0.14)

Colon, n (%)

30 (0.15)

7 (0.06)

1 (0.05)

7 (0.14)

Esophageal, n (%)

10 (0.05)

2 (0.02)

0 (0)

6 (0.12)

Head, n (%)

13 (0.06)

2 (0.02)

0 (0)

3 (0.06)

Hodgkin, n (%)

6 (0.03)

3 (0.03)

1 (0.05)

4 (0.08)

Leukemia, n (%)

40 (0.20)

28 (0.26)

14 (0.66)

14 (0.28)

Lung, n (%)

117 (0.58)

32 (0.30)

11 (0.52)

38 (0.76)

Lymphoma, n (%)

25 (0.12)

8 (0.07)

2 (0.09)

13 (0.26)

Myeloma, n (%)

22 (0.11)

1 (0.01)

4 (0.19)

10 (0.2)

Non-Hodgkin, n (%)

34 (0.17)

16 (0.15)

5 (0.24)

17 (0.34)

Ovarian (females), n (%)

33 (0.16)

3 (0.03)

3 (0.14)

7 (0.14)

Pancreatic, n (%)

21 (0.10)

6 (0.06)

1 (0.05)

6 (0.12)

Rectal, n (%)

27 (0.13)

4 (0.04)

1 (0.05)

4 (0.08)

Renal, n (%)

16 (0.08)

6 (0.06)

1 (0.05)

10 (0.2)

Sarcoma, n (%)

5 (0.02)

1 (0.01)

0 (0)

1 (0.02)

Stomach, n (%)

7 (0.03)

4 (0.04)

0 (0)

2 (0.04)

Testicular (males), n (%)

1(0.01)

0 (0)

0 (0)

0 (0)

Bladder, n (%)

20 (0.10)

3 (0.03)

3 (0.14)

8 (0.16)

Prostate (males), n (%)

32 (0.16)

10 (0.09)

2 (0.09)

62 (1.24)

Comorbidities

Cancer

Missing data: LOS=12, sex=1.

AC: Anticoagulant, BOTH: anticoagulants and SCDs, LOS: length of stay, NONE: no SCD, SCD: sequential compression device, SD: standard deviation. Obesity was defined as body mass index of >30 kg/m2.

196

Dhakal P, et al: SCDs for VTE Prevention in Hospitalized Patients

Turk J Hematol 2019;36:193-198

Table 2. Effect of sequential compression devices on incidence of venous thromboembolism compared to no prophylaxis.

Model

Odds ratio

95% confidence interval

p-value

Covariates

Unadjusted

1.27

0.75-2.14

0.37

NONE

Adjusted for covariates

0.99

0.57-1.74

0.98

Log (age), spline CCI, spline log (LOS), infection, pulmonary disease

Propensity matched

0.90

0.48-1.70

0.75

Nonparsimonious propensity score model for SCD usage; see text

CCI: Charlson Comorbidity index, LOS: length of stay, SCD: sequential compression device.

CLOTS III trial reported significant effectiveness of SCDs in DVT prevention in immobile patients with acute stroke. Since these patients were considerably less mobile, the results may not be reproducible in our study. Some other studies reported lower incidence of VTE with SCDs compared to NONE but the results were not statistically significant [7,25].

Our study should be viewed in the context of its strengths and limitations. Although the risk of VTE in hospitalized patients tends to persist for weeks after hospitalization, we focused on VTE during hospital stay, which might have led to decreased VTE incidence [26]. In fact, the number of symptomatic VTE events during hospital stay in medically ill patients has been reported to be similar to the number of VTE events after discharge [26].

However, with VTE incidence of <1%, the projected number of VTE events after discharge in our study population would still be lower than that reported in the literature. Our analysis excluded high-risk patients who received anticoagulants with or without SCDs and thus may not represent all hospitalized medical patients seen in clinical practice. The compliance and appropriate use of the SCDs could not be verified in all cases. However, this is one of the few analyses looking at the effectiveness of SCDs in acutely medically ill patients. We matched patients from a large sample to minimize many potential confounders of association between the preventive methods and outcomes. The number of patients given anticoagulants was modest and lower than recommended by many contemporary guidelines. Our study supports scaling back the current guidelines recommending widespread use of anticoagulants or SCDs until better prospective evidence from randomized trials is available.

hospital stay, although asymptomatic VTE may have occurred before discharge. The strength of the evidence might be insufficient to exclude clinically important differences in treatment effects because of selection bias in the choice of therapy, undetermined number of VTE events after discharge, and exclusion of higher-risk patients on anticoagulation.

Further prospective studies are needed to clarify the role of SCD in medically ill patients.

Acknowledgments The authors would like to thank Dr. Anas Al-Janadi for his contribution to the manuscript. The authors would also like to thank Dr. Vijaya Raj Bhatt for kindly reviewing this article.

Ethics Ethics Committee Approval: N/A. Informed Consent: N/A. Authorship Contributions Surgical and Medical Practices: P.D., S.R., S.S., M.S.; Concept: P.D.; Design: P.D., L.W.; Data Collection or Processing: P.D., Analysis or Interpretation: L.W., J.G.; Literature Search: P.D.; Writing: P.D. Conflict of Interest: This study was funded in part by a Resident-Led Research Mini Grant to Prajwal Dhakal from Graduate Medical Education, Inc., Michigan State University/ Sparrow Hospital. The other authors have no conflict of interest to disclose.

References 1. Heit JA, Spencer FA, White RH. The epidemiology of venous thromboembolism. J Thromb Thrombolysis 2016;41:3-14.

2. Heit JA, Melton LJ 3rd, Lohse CM, Petterson TM, Silverstein MD, Mohr DN, Oâ&#x20AC;&#x2122;Fallon WM. Incidence of venous thromboembolism in hospitalized patients vs community residents. Mayo Clin Proc 2001;76:1102-1110.

3. Raskob GE, Silverstein R, Bratzler DW, Heit JA, White RH. Surveillance for deep vein thrombosis and pulmonary embolism: recommendations from a national workshop. Am J Prev Med 2010;38(Suppl 4):502-509.

4. Beckman MG, Hooper WC, Critchley SE, Ortel TL. Venous thromboembolism: a public health concern. Am J Prev Med 2010;38(Suppl 4):495-501.

5. Kahn SR, Lim W, Dunn AS, Cushman M, Dentali F, Akl EA, Cook DJ, Balekian AA, Klein RC, Le H, Schulman S, Murad MH. Prevention of VTE in nonsurgical patients: Antithrombotic Therapy and Prevention of Thrombosis, 9th ed: American College of Chest Physicians Evidence-Based Clinical Practice Guidelines. Chest 2012;141(Suppl 2):195-226.

6. Kakkos SK, Caprini JA, Geroulakos G, Nicolaides AN, Stansby GP, Reddy DJ. Combined intermittent pneumatic leg compression and pharmacological prophylaxis for prevention of venous thromboembolism in high-risk patients. Cochrane Database Syst Rev 2008:CD005258.

Conclusion

7. Park J, Myung Lee, Lee JS, Cho YJ. Pharmacological and mechanical thromboprophylaxis in critically ill patients: a network meta-analysis of 12 trials. J Korean Med Sci 2016;31:1828-1837.

Compared to the NONE group, SCD usage was not associated with decreased VTE incidence. VTE incidence was <1% during

8. Eisele R, Kinzl L, Koelsch T. Rapid-inflation intermittent pneumatic compression for prevention of deep venous thrombosis. J Bone Joint Surg Am 2007;89:1050-1056.

197

Dhakal P, et al: SCDs for VTE Prevention in Hospitalized Patients

9. Pavon JM, Adam SS, Razouki ZA, McDuffie JR, Lachiewicz PF, Kosinski AS, Beadles CA, Ortel TL, Nagi A, Williams JW Jr. Effectiveness of Intermittent pneumatic compression devices for venous thromboembolism prophylaxis in high-risk surgical patients: a systematic review. J Arthroplasty 2016;31:524532.

10. Gurrin LC, Scurrah KJ, Hazelton ML. Tutorial in biostatistics: spline smoothing with linear mixed models. Stat Med 2005;24:3361-3381.

11. Harrell FE Jr, Lee KL, Pollock BG. Regression models in clinical studies: determining relationships between predictors and response. J Natl Cancer Inst 1988;80:1198-1202.

12. Austin PC. A comparison of 12 algorithms for matching on the propensity score. Stat Med 2014;33:1057-1069.

13. Luo Z, Gardiner JC, Bradley CJ. Applying propensity score methods in medical research: pitfalls and prospects. Med Care Res Rev 2010;67:528554.

14. Austin PC. Balance diagnostics for comparing the distribution of baseline covariates between treatment groups in propensityâ&#x20AC;?score matched samples.

Stat Med 2009;28:3083-3107.

15. Guo S, Fraser MW. Propensity Score Analysis: Statistical Methods and Analysis. Thousand Oaks, Sage, 2010.

16. Burnham KP, Anderson DR. Model Selection and Inference: A Practical Information-Theoretic Approach. Berlin, Springer, 1998.

17. Roderick P, Ferris G, Wilson K, Halls H, Jackson D, Collins R, Baigent C. Towards evidence-based guidelines for the prevention of venous thromboembolism: systematic reviews of mechanical methods, oral anticoagulation, dextran and regional anaesthesia as thromboprophylaxis. Health Technol Assess 2005:9.

18. Arabi YM, Khedr M, Dara SI, Dhar GS, Bhat SA, Tamim HM, Afesh LY. Use of intermittent pneumatic compression and not graduated compression

198

Turk J Hematol 2019;36:193-198

stockings is associated with lower incident VTE in critically ill patients: a multiple propensity scores adjusted analysis. Chest 2013;144:152-159.

19. Ho KM, Tan JA. Stratified meta-analysis of intermittent pneumatic compression of the lower limbs to prevent venous thromboembolism in hospitalized patients. Circulation 2013;128:1003-1020.

20. Kakkar AK, Cimminiello C, Goldhaber SZ, Parakh R, Wang C, Bergmann JF; LIFENOX Investigators. Low-molecular-weight heparin and mortality in acutely ill medical patients. New Engl J Med 2011;365:2463-2472.

21. Guyatt GH, Akl EA, Crowther M, Gutterman DD, SchuĂźnemann HJ; American College of Chest Physicians Antithrombotic Therapy and Prevention of Thrombosis Panel. Executive summary: Antithrombotic Therapy and Prevention of Thrombosis, 9th ed: American College of Chest Physicians Evidence-Based Clinical Practice Guidelines. Chest 2012;141(Suppl 2):7-47.

22. Chan NC, Stehouwer AC, Hirsh J, Ginsberg JS, Alazzoni A, Coppens M, Guyatt GH, Eikelboom JW. Lack of consistency in the relationship between asymptomatic DVT detected by venography and symptomatic VTE in thromboprophylaxis trials. Thromb Haemost 2015;114:1049-1057.

23. Limpus A, Chaboyer W, McDonald E, Thalib L. Mechanical thromboprophylaxis in critically ill patients: a systematic review and meta-analysis. Am J Crit Care 2006;15:402-412.

24. Durham N, Williams JW Jr. Effectiveness of Intermittent Pneumatic Compression Devices for Venous Thromboembolism Prophylaxis in HighRisk Surgical and Medical Patients. Washington, Department of Veterans Affairs, 2015.

25. Kwak HS, Cho JH, Kim JT, Yoo JJ, Kim HJ. Intermittent pneumatic compression for the prevention of venous thromboembolism after total hip arthroplasty.

Clin Orthop Surg 2017;9:37-42.

26. Amin AN, Varker H, Princic N, Lin J, Thompson S, Johnston S. Duration of venous thromboembolism risk across a continuum in medically ill hospitalized patients. J Hosp Med 2012;7:231-238.

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.galenos.2019.2019.0064 Turk J Hematol 2019;36:199-200

A Case of Anaplastic Lymphoma Kinase-positive Large B-cell Lymphoma Anaplastik Lenfoma Kinaz-pozitif Büyük B-hücreli Lenfoma Olgusu Gaurav K. Gupta,

Monika Pilichowska

Tufts Medical Center, Department of Pathology and Laboratory Medicine, Boston, Massachusetts, USA

Figure 1. A) Diffuse atypical lymphoid infiltrate by hematoxylin and eosin staining; B) large, monomorphic, immunoblast-like atypical cells with vesicular chromatin, prominent central nucleoli, and abundant amphophilic cytoplasm; positivity of CD45 (C), CD4 (D), CD138 (E), MUM1 (F), lambda light chain (G), EMA (H), and anaplastic lymphoma kinase immunostain (I).

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Gaurav K. GUPTA, M.D., PhD, Laboratory of Pathology, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland Phone : 301-480-8479 E-mail : gaurav.gupta2@nih.gov ORCID-ID: orcid.org/0000-0002-2951-0034

Received/Geliş tarihi: February 15, 2019 Accepted/Kabul tarihi: May 16, 2019

199

Gupta GK and Pilichowska M, ALK-positive Large B-cell Lymphoma

A 48-year-old male presented to the emergency department with a 2-week history of fever, mild pancytopenia, night sweats, and back pain. A computed tomography scan revealed a large retroperitoneal mass (11x6x5 cm). A core biopsy was performed.

Hematoxylin and eosin staining from the retroperitoneal mass biopsy showed diffuse atypical lymphoid infiltrate (Figure 1A), composed of large, monomorphic, immunoblast-like atypical cells with vesicular chromatin, prominent central nucleoli, and abundant amphophilic cytoplasm (Figure 1B).

Immunohistochemical staining showed that atypical cells were positive for CD45 (weak, arrow; strong positivity in the background lymphocytes, arrowhead) (Figure 1C), CD4 (Figure 1D), CD138 (Figure 1E), MUM1 (Figure 1F), lambda light chain (Figure 1G), EMA (Figure 1H), and anaplastic lymphoma kinase (ALK) immunostain (Figure 1I), showing strong nuclear and cytoplasmic positivity. The atypical cells were negative for CD20, CD79a, CD30, CD3, CD2, CD5, CD7, CD10, and kappa light chain. ALK rearrangement t (2; 5) was identified by fluorescence in situ hybridization, confirming a diagnosis of ALK-positive large B-cell lymphoma (ALK-LBCL). ALK-LBCL is an exceedingly

200

Turk J Hematol 2019;36:199-200

rare and rather recently identified [1] aggressive B-cell neoplasm with approximately 100 cases reported so far in the literature. The diagnosis can be challenging due to the unusual immunophenotype of neoplastic cells and histologic features overlapping with those of other hematologic malignancies.

Keywords: Lymphoma, Non-Hodgkin, Anaplastic lymphoma kinase large B-cell lymphoma Anahtar Sözcükler: Lenfoma, Hodgkin-dışı, ALK büyük B-hücreli lenfoma Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Reference 1. Delsol G, Lamant L, Mariame B, Pulford K, Dastugue N, Brousset P, RigalHuguet F, Al Saati T, Cerretti DP, Morris SW, Mason DY. A new subtype of large B-cell lymphoma expressing the ALK kinase and lacking the 2; 5 translocation. Blood 1997;89:1483-1490.

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.galenos.2019.2018.0363 Turk J Hematol 2019;36:201-202

Blastic Plasmacytoid Dendritic Cell Neoplasm with Leukemic Component Lösemi Komponenti Olan Blastik Plazmasitoid Hücre Neoplazmı Maria Jimenez Esteso1,2 1Hospital Marina Baixa, Clinic of Hematology, Alicante, Spain 2Hospital General Universitari d’Alacant, Clinic of Hematology, Alicante, Spain

Figure 1. Cutaneous infiltration at diagnosis.

Figure 2. Peripheral blood smear demonstrated 97% medium-sized blastoid cells with gray-blue cytoplasm, occasional cytoplasmic vacuoles, nucleoli, and some nuclear folds (A, B). Bone marrow was packed (98% cellularity) with immature cells negative for myeloperoxidase, alpha-naphthyl butyrate esterase, and naphthol-ASD chloroacetate esterase staining and positive for periodic acidSchiff (C). This neoplasm comprises a heterogeneous group of lymphoproliferative disorders with different clinical, morphologic, and immunophenotypic features.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Maria JIMENEZ ESTESO, M.D., Hospital Marina Baixa, Clinic of Hematology, Alicante, Spain Phone : 966 85 98 00 E-mail : mrjimenezesteso@gmail.com ORCID-ID: orcid.org/0000-0002-0127-3663

Received/Geliş tarihi: October 22, 2018 Accepted/Kabul tarihi: February 26, 2019

201

Maria Jimenez Esteso, Dendritic Acute Leukemia

Turk J Hematol 2019;36:201-202

A 72-year-old man was admitted to our hospital with a reddish skin tumor, which had appeared 3 weeks ago on his arm. The histopathological examination of a skin biopsy specimen led to the diagnosis of blastic plasmacytoid dendritic cell neoplasm (BPDCN) based on the World Health Organization’s 2008 classification (Figure 1). Physical examination revealed erythematous lesions on plaques, slightly indurated, on the back and arms.

cytometry analysis showed blast cells expressing CD4/CD56/ CD7/CD33/HLADR/dimCD45 with absence of CD34.

Three months later, the patient came to the emergency department complaining of dizziness and feeling unwell.

Physical examination revealed no significant findings. Complete blood count at this time showed a hemoglobin level of 10.2 g/ dL, white blood cell count of 13.8x109/L, and platelet count of 51x109/L. Peripheral blood smear demonstrated 97% mediumsized blastoid cells with gray-blue cytoplasm, occasional cytoplasmic vacuoles, nucleoli, and some nuclear folds (Figures 2A and 2B). The bone marrow was packed (98% cellularity) with immature cells negative for myeloperoxidase, alpha-naphthyl butyrate esterase, and naphthol-ASD chloroacetate esterase staining and positive for periodic acid-Schiff (Figure 2C). Flow

This neoplasm is a heterogeneous group of lymphoproliferative disorders, with different clinical, morphologic, and immunophenotypic features.

202

The diagnosis was BPDCN with involvement of peripheral blood.

BPDCN is an aggressive hematologic malignancy originating from the precursors of plasmacytoid dendritic cells. It has a high frequency of cutaneous and bone marrow involvement and leukemic dissemination.

Keywords: Mast cells, Dendritic cells, Acute leukemia Anahtar Sözcükler: Mast hücreleri, Dendritik hücreler, Akut lösemi Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.galenos.2018.2018.0104 Turk J Hematol 2019;36:203-204

Vacuolization in Myeloid and Erythroid Precursors in a Child with Menkes Disease Menkes Hastalıklı Bir Çocukta Myeloid ve Eritroid Öncüllerde Vaküolizasyon Seçil Sayın,

Şule Ünal,

Mualla Çetin,

Fatma Gümrük

Hacettepe University Faculty of Medicine, Department of Child Health and Diseases, Unit of Hematology, Ankara, Turkey

Figure 1. Bone marrow aspiration smears: a) cytoplasmic vacuolization in myeloid precursors (white arrow) and erythroid precursors (black arrow); b) cytoplasmic vacuolization in myeloid precursors (black arrow) and erythroid precursors (white arrow). May-Grünwald Giemsa stain, original magnification 100x.

A 5-year-old boy who was in follow-up with a clinical and biochemical diagnosis of Menkes disease (MD) since 10 months of age was admitted with diarrhea. On examination he had a characteristic cherubic face, hypopigmented and sparse hair, hepatosplenomegaly, and hypotonia with brisk deep tendon reflexes. A complete blood count revealed the following: hemoglobin, 5.5 g/dL; hematocrit, 16.2%; red blood cells, 1.69x1012/L; mean corpuscular volume, 95.8 fL; mean corpuscular hemoglobin, 32.3 pg; red blood cell distribution width, 19.2%; white blood cells, 2.2x109/L; and platelet count, 157x109/L. Serum vitamin B12 level was 575 pg/mL. Serum copper level was 81 µg/dL and serum zinc level was 152 µg/ dL. Peripheral blood smear revealed 34% polymorphonuclear leukocytes, 62% lymphocytes, and 4% monocytes. Bone marrow examination revealed normocellular marrow with megaloblastic

changes and widespread cytoplasmic vacuolization in myeloid and erythroid progenitors (Figure 1).

Menkes disease is a neurodegenerative disorder due to mutations in the ATP7A gene, which ends with deficiency of copper-dependent enzymes [1].

Cytoplasmic vacuoles of myeloid and erythroid lineages have been described in patients with copper deficiency [2], Pearson syndrome [3], and acute alcoholic intoxication [4]. There have also been reports of megaloblastic changes in copper deficiency [2]. Herein, we exhibited both erythroid and myeloid vacuolizations and severe megaloblastic changes together in a patient with MD. All of these morphological findings in our patient were attributed to copper deficiency.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Seçil SAYIN, M.D., Hacettepe University Faculty of Medicine, Department of Child Health and Diseases, Unit of Hematology, Ankara, Turkey Phone : +90 312 305 50 00 E-mail : drsecilgonen@hotmail.com ORCID-ID: orcid.org/0000-0001-6581-6121

Received/Geliş tarihi: March 18, 2018 Accepted/Kabul tarihi: April 30, 2018

203

Sayın S, et al: Vacuolization in Myeloid and Erythroid Precursors in a Child with MD

Keywords: Menkes disease, Copper deficiency, Vacuolization, Bone marrow Anahtar Sözcükler: Menkes Vaküolizasyon, Kemik iliği

hastalığı,

Bakır

eksikliği,

Informed Consent: Received.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

204

Turk J Hematol 2019;36:203-204

References 1. Kaler SG, Holmes CS, Goldstein DS, Tang J, Godwin SC, Donsante A, Liew CJ, Sato S, Patronas N. Neonatal diagnosis and treatment of Menkes disease. N Engl J Med 2008;358:605-614.

2. Tamura H, Hirose S, Watanabe O, Arai K, Murakawa M, Matsumura O, Isoda K. Anemia and neutropenia due to copper deficiency in enteral nutrition.

JPEN J Parenter Enteral Nutr 1994;18:185-189.

3. Topaloğlu R, Lebre AS, Demirkaya E, Kuşkonmaz B, Coşkun T, Orhan D, Gürgey A, Gümrük F. Two new cases with Pearson syndrome and review of Hacettepe experience. Turk J Pediatr 2008;50:572-576.

4. Yeung KY, Klug PP, Lessin LS. Alcohol-induced vacuolization in bone marrow cells: ultrastructure and mechanism of formation. Blood Cells 1988;13:487502.

LETTERS TO THE EDITOR Turk J Hematol 2019;36:205-221

Pediatric Deep Venous Thrombosis and Pulmonary Embolism: Can It Be Antiphospholipid Syndrome?

Pediatrik Derin Ven Trombozu ve Pulmoner Emboli: Antifosfolipid Sendromu Olabilir mi?

Fatma Demir Yenigürbüz,

Hale Ören

Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey

To the Editor, In pediatric patients with deep venous thrombosis (DVT) and pulmonary embolism (PE), antiphospholipid syndrome (APS) should be considered early and efforts must be made to ensure timely diagnosis of this potentially life-threatening condition.

Pediatric APS is an autoimmune disease characterized by vascular thrombosis and persistently positive antiphospholipid antibodies [1,2,3,4,5]. Primary APS is rarely seen in childhood [4]. A 14-year-old adolescent was admitted with complaints of left upper leg edema for 1 week. On physical examination, obesity, hypertension, and edema of the leg were present.

Hyperlipidemia and D-dimer elevation were remarkable. Doppler ultrasonography showed DVT in his left femoral vein and abdominal computed tomography (CT) demonstrated iliac vein thrombosis (Figure 1). Since he had widespread DVT, thorax CT

angiography was also performed without any clinical symptoms of PE and it demonstrated filling defects in the right pulmonary artery (Figure 2). Anticoagulation was given and complete recanalization was observed. A diet program was started. When thrombophilia risk factors were evaluated, there was no family history and the genetic thrombophilia panel was negative, LA was positive twice with an interval of 12 weeks (first sample was before treatment), and other APS antibodies were found negative. Systemic lupus erythematosus (SLE) and SLE-like diseases were excluded. The patient was diagnosed with primary APS. Metabolic syndrome was the additional thrombotic risk factor. Long-term anticoagulation therapy (lifetime) was given to the patient.

Keywords: Deep venous thrombosis, Pulmonary embolism, Antiphospholipid syndrome Anahtar Sözcükler: Derin ven trombozu, Pulmoner emboli, Antifosfolipid sendromu Informed Consent: Received.

Figure 1. Abdominal computed tomography of the patient demonstrating iliac vein thrombosis (arrows).

Figure 2. Thorax computed tomography angiography of the patient demonstrating filling defects in right pulmonary artery (arrows).

205

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

3. Aguiar CL, Soybilgic A, Avcin T, Myones BL. Pediatric antiphospholipid syndrome. Curr Rheumatol Rep 2015;17:27.

References

5. Groot N, de Graeff N, Avcin T, Bader-Meunier B, Dolezalova P, Feldman B, Kenet G, Koné-Paut I, Lahdenne P, Marks SD, McCann L, Pilkington CA, Ravelli A, van Royen-Kerkhof A, Uziel Y, Vastert SJ, Wulffraat NM, Ozen S, Brogan P, Kamphuis S, Beresford MW. European evidence-based recommendations for diagnosis and treatment of paediatric antiphospholipid syndrome: the SHARE initiative. Ann Rheum Dis 2017;76:1637-1641.

1. Yang JY, Chan AK. Pediatric thrombophilia. Pediatr Clin North Am 2013;60:1443-1462.

2. Biss TT. Pulmonary embolism in childhood: how can we be sure not to miss it? Arch Dis Child 2018;103:814-816.

4. Rumsey DG, Myones B, Massicotte P. Diagnosis and treatment of antiphospholipid syndrome in childhood: a review. Blood Cells Mol Dis 2017;67:34-40.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Fatma DEMİR YENİGÜRBÜZ, M.D., Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey E-mail : ftmdmr@yahoo.com ORCID-ID: orcid.org/0000-0001-8692-2767

Received/Geliş tarihi: June 20, 2018 Accepted/Kabul tarihi: September 11, 2018 DOI: 10.4274/tjh.galenos.2018.2018.0214

Pediatric Chronic Myeloid Leukemia Presenting in a Mixed Phenotypic Blast Crisis: A Rare Occurrence Bir Karışık Fenotipik Blast Krizinde Pediatrik Kronik Myeloid Lösemi Sunumu: Nadir Bir Durum Jenna Bhattacharya,

Richa Gupta

Maulana Azad Medical College, Department of Pathology, New Delhi, India

To the Editor, Pediatric chronic myeloid leukemia (CML) comprises 3% of childhood leukemia cases [1]. Similar to adults, most of the patients present in the chronic phase, but 5% may present in a blast crisis (BC) [2]. Mixed phenotypic BC has rarely been reported in children [3]. A 10-year-old male presented with fever, fatigue, dull abdominal pain, and massive splenomegaly for 2 months. Complete blood count results were as follows: total leukocyte count (TLC), 544x109/L; hemoglobin, 8 g/dL; and platelet count, 80x109/L. Differential count on peripheral smear revealed the following: blasts - 25%, promyelocytes - 3%, myelocytes - 20%, metamyelocytes - 10%, eosinophils - 5%, basophils - 4%, monocytes - 2%, lymphocytes - 16%, and neutrophils - 15%. No dysplasia was noted. The blasts had moderate cytoplasm and prominent nucleoli. On cytochemistry, these blasts were negative for myeloperoxidase and periodic acid-Schiff. Bone marrow aspirate revealed a hypercellular marrow with myeloid predominance (M:E ratio of 25:1) with 55% blasts. Megakaryocytes were adequate with some dwarf forms. Bone marrow biopsy was hypercellular with near total replacement of marrow spaces with sheets of blasts having vesicular nuclei and prominent nucleoli (Figure 1). Blasts were positive for CD34, anti-MPO, CD19, and CD20 (Figure 1) and 206

negative for CD3. Considering the high TLC and peripheral blood and bone marrow picture, RT-PCR for M-BCR-ABL1 was done, which confirmed the presence of a 210-kDa transcript.

Considering the clinical presentation, the peripheral blood picture (basophilia, many myelocytes and metamyelocytes), and the 210-kDa BCR-ABL1 transcript, a diagnosis of mixed phenotypic BC in CML was issued and treatment was initiated with imatinib. Subsequently, the patient improved with lowering of TLC and disappearance of blasts from the peripheral blood. However, molecular response in follow-up could not be determined due to economic constraints.

The incidence of progression to BC in adults is 10% but the same is not well known in children [3]. BC is usually myeloid and rarely mixed phenotypic [4]. The biology of progression of pediatric CML to BC is supposed to be similar to that of adults [2]. Accumulation of additional chromosomal anomalies in the proliferating clone, especially deletions in the CDKN2A/B gene, deletions in the IKZF gene, and chromosomal aberrations associated with myelodysplasia, have been implicated with progression [5]. Mixed phenotypic BC in CML needs to be differentiated from de novo mixed phenotypic acute leukemia (MPAL). Differentiation may be difficult since MPAL can also show M-BCR-ABL1 translocation [6]. The points in favor of

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

Figure 1. A) Bone marrow (BM) biopsy showing hypercellular marrow, H&E, 100x; B) BM biopsy showing blasts with prominent nucleoli, H&E, 400x; C) BM biopsy showing CD34 positivity in blasts, 400x; D) BM biopsy showing anti-MPO positivity in blasts, 400x; E) BM biopsy showing CD19 positivity in blasts, 400x; F) BM biopsy showing CD20 positivity in blasts, 400x.

CML include high TLC at presentation, massive splenomegaly, peripheral blood basophilia and all myeloid precursors, absence of dysplasia, and the 210-kDa transcript on PCR. In such cases, if M-BCR-ABL1 fusion signals are detected by FISH/PCR in mature neutrophils as well as in blasts (present in our case), then CML-BC is the most likely diagnosis [3]. Moreover, in a case of MPAL, if post-induction RT-PCR shows a high number of ablbcr transcripts despite reduction in blast count, the diagnosis of BC in CML should be considered. The progression to blast phase warrants a poor prognosis in CML, which is further worsened by the presence of the mixed phenotypic type of BC [3]. Such cases should be treated with tyrosine kinase inhibitors plus chemotherapy based on the blast phenotype [4,7].

Keywords: Pediatric, Chronic myeloid leukemia, Blast crisis Anahtar Sözcükler: Pediatrik, Kronik myeloid lösemi, Blast kriz

Informed Consent: Received.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Millot F, Traore P, Guilhot J, Nelken B, Leblanc T, Leverger G, Plantaz D, Bertrand Y, Bordigoni P, Guilhot F. Clinical and biological features at diagnosis in 40 children with chronic myeloid leukemia. Pediatrics 2005;116:140-143.

2. Iyer P, Carney P, Bown N, Samarasinghe S. Pediatric chronic myeloid leukemia with B-cell lymphoid blast crisis at presentation. Blood Res 2013;48:149-163.

3. Choi W, Kim M, Lim J, HanK, Lee S, Lee JW, Chung NG, Kim Y. Four cases of chronic myelogenous leukemia in mixed phenotype blast phase at initial presentation mimicking mixed phenotype acute leukemia with t(9;22). Ann Lab Med 2014;34:60-63.

207

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

4. Gong Z, Bai S, Hu S. Mixed phenotype blast phase of chronic myeloid leukemia in the era of tyrosine kinase inhibitor therapy. Blood J 2016;128:5438.

5. Neuendorff NR, Burmeister T, Dörken B, Westermann J. BCR-ABL-positive acute myeloid leukemia: a new entity? Analysis of clinical and molecular features. Ann Hematol 2016;95:1211-1221.

6. Millot F, Baruchel A, Guilhot J, Petit A, Leblanc T, Bertrand Y, Mazingue F, Lutz P, Vérité C, Berthou C, Galambrun C, Bernard F, Yacouben K, Bordigoni P, Edan C, Reguerre Y, Couillault G, Méchinaud F, Cayuela JM, Guilhot F.

Imatinib is effective in children with previously untreated CML in early chronic phase: results of the French national phase IV trial. J Clin Oncol 2011;29:2827-2832.

7. de la Fuente J, Baruchel A, Biondi A, de Bont E, Dresse MF, Suttorp M, Millot F; International BFM Group (iBFM) Study Group Chronic Myeloid Leukaemia Committee. Managing children with chronic myeloid leukaemia (CML): recommendations for the management of CML in children and young people up to the age of 18 years. Br J Haematol 2014;167:33-47.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Richa GUPTA, M.D., Maulana Azad Medical College, Department of Pathology, New Delhi, India Phone : +91-9910790101 E-mail : richagupta0209@gmail.com ORCID-ID: orcid.org/0000-0003-2086-8352

Received/Geliş tarihi: December 13, 2018 Accepted/Kabul tarihi: March 15, 2019 DOI: 10.4274/tjh.galenos.2019.2018.0428

Myeloid Sarcoma of the Parotid Gland and Stomach Presenting with Obstructive Jaundice: A Rare Presentation Obstrüktif Sarılık ile Başvuran Parotis Bezi ve Midenin Myeloid Sarkoması: Nadir Bir Sunum Sugeeth M. Thambi1,

Sreejith G. Nair1,

Rony Benson1,

Jayasudha A. Vasudevan2,

Rekha A. Nair2

1Regional Cancer Centre, Department of Medical Oncology, Thiruvananthapuram, India 2Regional Cancer Centre, Department of Pathology, Thiruvananthapuram, India

To the Editor, Myeloid sarcoma (MS) is the extramedullary deposit of immature myeloid cells and disrupts the normal tissue architecture [1].

MS commonly occurs in the skin, central nervous system, eyes, and testes. Gastrointestinal involvement is common [2,3]. Here we present a case of isolated MS of the parotid and stomach presenting with jaundice.

A 55-year-old male was evaluated with swelling of the right parotid gland for two months. Fine-needle aspiration was suggestive of a parotid neoplasm and the patient underwent a right-sided total parotidectomy. Post-op histopathological examination was suggestive of non-Hodgkin’s lymphoma.

While the patient was recovering, he developed jaundice. Liver function tests showed bilirubin of 5.3 mg/dL (direct: 4.2 mg/dL).

Contrast-enhanced computed tomography of the neck, chest, and abdomen was performed, which showed irregular soft tissue thickening in the parotid bed along with an enlarged enhancing left level IB nodal area (21x12 mm). The abdomen showed intrahepatic biliary radicle dilatation with a soft tissue nodule at the porta. There was also soft tissue thickening involving the cardia and lesser curvature of the stomach along with multiple enlarged perigastric nodes (Figure 1).

Peripheral smear and bone marrow studies were normal.

Review of the parotidectomy specimen showed a neoplasm 208

composed of atypical medium to large cells. Tumor cells were myeloperoxidase-positive, CD33-positive, CD43 focalpositive, and CD68-negative and were compatible with MS (Figure 2). During work-up bilirubin increased to 20 mg/dL and the patient underwent percutaneous transhepatic biliary drainage. Upper gastrointestinal endoscopy was suggestive of mucosal irregularity involving the cardia and lesser curvature of the stomach. Endoscopic guided biopsy from the lesion was suggestive of MS. The patient’s bilirubin normalized after stenting.

The patient was scheduled for 7+3 induction (7 days of cytarabine at 100 mg/m2 as a 24-hour infusion along with 3 days of daunorubicin at 60 mg/m2). Post-induction reevaluation was done and contrast-enhanced computed tomography showed no significant lymph nodes, with significant reduction in the gastric and duodenal wall thickening along with resolution of the intrahepatic biliary radicle dilatation. The patient was scheduled for consolidation with high-dose cytarabine and received 3 cycles. He remained on follow-up after the completion of 3 cycles.

Isolated MS usually does not produce any specific symptoms besides the local symptoms of the organ involved. Local imaging is usually warranted in the form of computed tomography or magnetic resonance imaging [4]. Bone marrow study is also warranted to confirm isolated MS as

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

Figure 1. Contrast-enhanced computed tomography of the neck, chest, and abdomen showing intrahepatic biliary radicle dilatation and stomach wall thickening involving the cardia and lesser curvature of the stomach (a) and post-induction scan showing significant reduction in the stomach wall thickening and resolution of intrahepatic biliary radicle dilatation (b).

Figure 2. (a) Hematoxylin and eosin results showing medium to large atypical cells with scanty cytoplasm and irregular nuclear membranes; (b) tumor cells positive for myeloperoxidase. most cases occur in patients with AML. Systemic therapy is warranted in such cases where patients receive induction chemotherapy similar to AML, as in our case [5]. The 5-year survival in patients with MS is about 20% and the use of chemotherapy has been associated with better survival [6].

There are reports that malignant cells in chloroma may evade immune surveillance and thus have a higher chance of survival. Another contributing factor to immune escape is the partial loss of several human leukocyte antigen class I genes [7].

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Campidelli C, Agostinelli C, Stitson R, Pileri SA. Myeloid sarcoma: extramedullary manifestation of myeloid disorders. Am J Clin Pathol 2009;132:426-437.

2. Vachhani P, Bose P. Isolated gastric myeloid sarcoma: a case report and review of the literature. Case Rep Hematol 2014;2014:541807.

Anahtar SĂśzcĂźkler: Myeloid sarkoma, Parotis bezi, Mide

3. Derenzini E, Paolini S, Martinelli G, Campidelli C, Grazi GL, Calabrese C, Zinzani PL, Baccarani M. Extramedullary myeloid tumour of the stomach and duodenum presenting without acute myeloblastic leukemia: a diagnostic and therapeutic challenge. Leuk Lymphoma 2008;491:159-162.

Informed Consent: Received.

4. Bakst RL, Tallman MS, Douer D, Yahalom J. How I treat extramedullary acute myeloid leukemia. Blood 2011;118:3785-3793.

Keywords: Myeloid sarcoma, Parotid gland, Stomach

209

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

5. Yamauchi K, Yasuda M. Comparison in treatments of nonleukemic granulocytic sarcoma: report of two cases and a review of 72 cases in the literature. Cancer 2002;94:1739-1746.

6. Lan TY, Lin DT, Tien HF, Yang RS, Chen CY, Wu K. Prognostic factors of treatment outcomes in patients with granulocytic sarcoma. Acta Haematol 2009;122:238-246.

7. Johansen S, Kollsete Gjelberg H, Ahmed AB, Bruserud Ø, Reikvam H. Myeloid sarcoma after allogenic stem cell transplantation for acute myeloid leukemia: successful consolidation treatment approaches in two patients. Case Rep Oncol Med 2018;2018:7697283.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Received/Geliş tarihi: August 31, 2018 Accepted/Kabul tarihi: April 17, 2019

Address for Correspondence/Yazışma Adresi: Rony BENSON, M.D., Regional Cancer Centre, Department of Medical Oncology, Thiruvananthapuram, India Phone : +91-944792936 E-mail : ronybenson@gmail.com ORCID-ID: orcid.org/0000-0002-2120-1376

DOI: 10.4274/tjh.galenos.2019.2018.0302

An Unusual Presentation of Hairy Cell Leukemia Tüylü Hücreli Löseminin Alışılmadık Prezantasyonu Smeeta Gajendra1,

Bhawna Jha1,

Sarita Prasad1,

Pratibha Dhiman2,

Manorama Bhargava1

1Medanta - The Medicity, Departments of Pathology and Laboratory Medicine, Gurgaon, India 2Medanta - The Medicity, Department of Medical Oncology and Hematology, Gurgaon, India

To the Editor, The aberrant expression of CD5 in both hairy cell leukemia (HCL) and HCL-variant (HCL-v) is very rare; only 26 such cases have been reported in the literature [1]. Simultaneous absence of splenomegaly and cytopenia(s) is even rarer, which may pose a diagnostic dilemma. We describe a case of CD5-positive HCL with absence of splenomegaly and cytopenia. To the best of our knowledge, only one case of HCL without cytopenia and splenomegaly has been reported in the literature to date [2], but without CD5 positivity. Our patient was a 59-year-male, who presented with intermittent cough with expectoration for the last 3 to 4 years with no history of fever. Radiological investigations including X-ray and computed tomography scans were normal. Complete blood counts showed hemoglobin of 15.1 g/dL, white blood cell count of 7.73x109/L (neutrophils: 52%, lymphocytes: 45%, monocytes: 2%), and platelet count of 153x109/L. Peripheral blood smear (PBS) and bone marrow aspirate (BMA) showed 10% and 24% abnormal lymphoid cells, respectively (Figure 1A). These cells were small to medium in size, with abundant pale blue cytoplasm and circumferential hairy projections. Bone marrow biopsy showed interstitial aggregates of abnormal lymphoid cells (Figure 1B), which were positive for CD20 and annexin 1. Flow cytometric immunophenotyping (Figure 1C) revealed these cells to be positive for CD19, CD20, CD22, CD103, CD11c, CD123, CD25, CD5 (heterogeneous), CD200, CD23 (dim), and kappa and negative for CD10 and FMC7.

The patient was found to be positive for BRAF V600E mutation.

A diagnosis of HCL with aberrant CD5 was made.

210

HCL is an indolent small mature B lymphoid malignancy accounting for 2% of lymphoid leukemias [3]. The three most important findings for diagnosis are splenomegaly, cytopenia(s), and bone marrow dry tap resulting from marrow fibrosis [4]. In unsuspected cases with unusual presentation, the best approach for diagnosis is the careful examination of morphological details on PBS and BMA to identify the morphological features of hairy cells, which are further confirmed upon characteristic immunophenotypic profiles, as in our case. Differential diagnoses of HCL include chronic lymphocytic leukemia, prolymphocytic leukemia, splenic marginal zone lymphoma, HCL-v, and mantle cell lymphoma, which can be excluded based on characteristic morphological and immunophenotypic features. Hairy cells are 10-15 µm in diameter, with central or eccentric round, oval, or indented nuclei; reticular or netlike chromatin pattern; indistinct or absent nucleoli; pale blue cytoplasm with fine, hair-like projections or ruffled borders; and positive staining for tartrate-resistant acid phosphatase [5]. A typical combination of immunophenotypic markers expressed by hairy cells such as CD19, CD22, and CD79b, with brighter expression of CD20, along with co-expression of CD103, CD123, CD25, and CD11c, confirms the diagnosis [6].

In conclusion, this case posed a diagnostic challenge as the patient had no cytopenias or splenomegaly along with CD5 positivity. This case is important because it creates awareness of this uncommon presentation of HCL and emphasizes that the best approach in diagnosing HCL is to give careful attention to morphological details while interpreting peripheral blood, as in our case, which can prompt detailed evaluation of bone marrow

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

Figure 1. Bone marrow aspirate showing hairy cells (A: arrow). Bone marrow biopsy (B) showing abnormal lymphoid cell infiltration positive for CD20 and annexin A1. (C) Immunophenotyping showing bright CD45 positivity and further gated CD19-positive abnormal lymphoid cells, which were positive for CD20, CD22, CD103, CD11c, CD25, CD5, CD123, CD200, and kappa and negative for CD10. with immunophenotyping in such cases for early diagnosis and management of the patient.

Keywords: Hairy cell Splenomegaly, Cytopenias

leukemia,

Immunophenotyping,

Anahtar Sözcükler: Tüylü hücreli lösemi, İmmünfenotipleme, Splenomegali, Sitopeniler Informed Consent: Informed consent was obtained from the patient.

Ethical Approval: This article does not contain any studies with human participants or animals performed by any of the authors.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Jain D, Dorwal P, Gajendra S, Pande A, Mehra S, Sachdev R. CD5 positive hairy cell leukemia: a rare case report with brief review of literature.

Cytometry B Clin Cytom 2016;90:467-472.

2. Chai KL, Morris T, Bazargan A. A case report of hairy cell leukemia: an unusual presentation. Ann Clin Case Rep 2017;2:1412.

3. Foucar K, Falini B, Catovsky D, Stein H. Hairy cell lymphoma. In: Swerdlow SH, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J, Vardiman JW, (eds). WHO Classification of Tumours of Haemtopoietic and Lymphoid Tissues. Lyon, IARC, 2008.

4. Wanko SO, de Castro C. Hairy cell leukemia: an elusive but treatable disease.

Oncologist 2006;11:780-789.

5. Cawley JC. Hairy cell leukemia. In: Young NS, Gerson SL, High KA, (eds).

Clinical Hematology. Philadelphia, Mosby-Elsevier, 2006.

6. Stetler-Stevenson M, Tembhare PR. Diagnosis of hairy cell leukemia by flow cytometry. Leuk Lymphoma 2011;52(Suppl 2):11-13.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Smeeta GAJENDRA, M.D., Medanta - The Medicity, Departments of Pathology and Laboratory Medicine, Gurgaon, India Phone : +90-13590875 E-mail : drsmeeta@gmail.com ORCID-ID: orcid.org/0000-0002-1759-7857

Received/Geliş tarihi: September 3, 2018 Accepted/Kabul tarihi: March 15, 2019 DOI: 10.4274/tjh.galenos.2019.2018.0304

211

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

Megakaryocytes in Peripheral Blood Smears Periferik Kan YaymalarÄąnda Megakaryositler Neha Garg,

Rashmi Jain Gupta,

Sunil Kumar

Lok Nayak Hospital, Department of Clinical Pathology, Delhi Gate, New Delhi, India

To the Editor, Megakaryocytes (MKs) are large polypoidal cells found within the bone marrow (BM), comprising 0.01% of all nucleated cells [1]. Circulating MKs have been described in the literature but normal MKs in peripheral blood smears (PBSs) have rarely been reported [2]. We report here 4 cases in which we found MKs in the PBS. In the first case, a 10-year-old boy presented with weakness and decreased appetite. PBS showed microcytic hypochromic anemia (MHA), leukocytosis, and reactive thrombocytosis. In the second case, a 30-year-old female presented with fever and skin rash with positive dengue serology. PBS showed MHA with thrombocytopenia. In the third case, a 15-year-old female presented with fever with chills and rigor. PBS showed macrocytic anemia, thrombocytopenia, and trophozoites of

Plasmodium vivax. In the fourth case, a 14-year-old male was admitted for grafting for a burn on his hand. PBS showed MHA with reactive thrombocytosis. A MK, round-elongated in shape, with moderate-abundant amount of granular cytoplasm and compact lobulated nucleus, was seen in each of these cases at the tail end of the PBS (Figures 1a-1d). None of these patients had hepatosplenomegaly or evidence of any hematological disorders. Table 1 shows their hematological parameters.

MKs develop from hematopoietic stem cells that reside in the BM. The finding of MKs in peripheral blood (PB) is usually indicative of a serious disorder of the BM, such as myelodysplasia, granulocytic leukemia, or other myeloproliferative disorders [3].

PBSs in such cases may show leukoerythroblastic reaction, large cytoplasmic fragments of MKs, and dwarf micromegakaryocytes [3]. Though normal MKs were reported in PBS in a case of post-

Figure 1. (a-d) High power view of Giemsa-stained peripheral blood smear (PBS) in cases 1-4, respectively, showing megakaryocyte, round-elongated in shape, with moderate-abundant amount of granular cytoplasm with compact lobulated nucleus at the tail end of the PBS. (b, c) A large megakaryocyte is seen at the tail end of the PBS in cases 2 and 3 (100x).

212

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

Table 1. Hematological parameters with diagnosis.

S. no.

Case 1

Case 2

Case 3

Case 4

Hb (g/L)

58

87

87

63

RBC (/µL)

3.66x106

3.46x106

2.36x106

2.55x106

Hct (proportion of 1)

0.21

0.24

0.26

0.20

MCV (fL)

57.9

70

113

81

MCH (pg)

15.8

24.8

36

24.6

TLC (/L)

14.4x109

6.4x109

5.4x109

6.4x109

PLT (/L)

922x109

0.58x109

0.90x109

7.27x109

Diagnosis

MHA

MHA, thrombocytopenia, with dengue

Macrocytic anemia, thrombocytopenia with malaria (P. vivax)

MHA

Hb: Hemoglobin, Hct: hematocrit, RBC: red blood cell, MCV: mean corpuscular volume, MCH: mean corpuscular hemoglobin, MHA: microcytic hypochromic anemia, TLC: total leukocyte count, PLT: platelet count.

essential thrombocythemia-myelofibrosis, the PBS additionally showed the presence of leukoerythroblastic reaction and blasts [2]. Our patients had neither a history of myeloproliferative disorders nor such additional findings in the PBS. In 1965 Kaufman et al. [4] demonstrated that 20%-25% of mature MKs leave the BM with sufficient cytoplasm to enter the PB and migrate to the lungs and 7%-17% of the body’s platelets are released in pulmonary capillaries, hence suggesting that MKs normally circulate in the PB and are normal constituents of the PB [4]. However, the identification of normal MKs in PBSs of normal patients has never been reported.

In response to anemia, there is stimulation of erythropoietin (EPO) receptors by EPO, present on erythroid precursors as well as on MKs in BM [5]. There is also an increase in TPO levels in response to thrombocytopenia, with resultant increase in MK differentiation. This might be a cause of increase in number of circulating MKs with consequent detection in the PBS. In conclusion, detection of MKs in PB is usually indicative of a serious BM disturbance. However, one should keep in mind that mature MKs normally circulate in the PB and can also be seen in PBSs in cases of increased MK differentiation. The clinical significance of this finding is unclear, but as large cells like blasts, large atypical lymphocytes, organisms, or in this case MKs can be found at the edge of PBSs, a routine examination

of the feathered edge of the PBS is advised as it has diagnostic importance.

Keywords: Megakaryocyte, Peripheral blood smear, Peripheral blood Anahtar Sözcükler: Megakaryosit, Periferik kan yayması, Periferik kan Informed Consent: Received.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Machlus RK, Italiano JE Jr. The incredible journey: from megakaryocyte development to platelet formation. J Cell Biol 2013;201:785-796.

2. Ku NK, Rashidi H. Unusual finding of a megakaryocyte in a peripheral blood smear. Blood 2017;130:2573.

3. Whitby L. The significance of megakaryocytes in the peripheral circulation.

Blood 1948;3:934-938.

4. Kaufman RM, Airo R, Pollack S, Crosby WH. Circulating megakaryocytes and platelet release in the lung. Blood 1965;26:720-731.

5. Quigley GJ, Means TR, Glader B. The birth, life, and death of red blood cells: erythropoiesis, the mature red blood cell, and cell destruction. In: Greer JP, Arber DA, (eds). Wintrobe’s Clinical Hematology. 13th ed. Philadelphia, Lippincott Williams and Wilkins, 2014.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Neha GARG, M.D., Lok Nayak Hospital, Department of Clinical Pathology, Delhi Gate, New Delhi, India Phone : +91-9911577812 E-mail : gargdoc118@gmail.com ORCID-ID: orcid.org/0000-0002-5767-8037

Received/Geliş tarihi: January 16, 2019 Accepted/Kabul tarihi: March 08, 2019 DOI: 10.4274/tjh.galenos.2019.2019.0022

213

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

Outcome of Thrombotic Thrombocytopenic Purpura Patients: A Single-Center Experience Trombotik Trombositopenik Purpura Hastalarının İzlem Sonuçları: Tek Merkez Deneyimi Özcan Çeneli,

Seda Yılmaz,

Mehmet Ali Karaselek,

Kazım Çamlı

Necmettin Erbakan University, Meram Faculty of Medicine, Department of Hematology, Konya, Turkey

To the Editor, Thrombotic thrombocytopenic purpura (TTP) is a rare, lifethreatening condition [1,2]. It is characterized by plateletrich thrombi in the microcirculation caused by severely decreased activity of the von Willebrand factor-cleaving protease ADAMTS13 (a disintegrin and metalloprotease with thrombospondin type motif 13), leading to the accumulation of ultra-large von Willebrand factor multimers, microangiopathic hemolytic anemia, and sometimes organ damage. TTP can be acquired due to autoantibody inhibitor development against ADAMTS13, or it can be hereditary due to inherited mutations in ADAMTS13. Hereditary TTP represents less than 5% of all TTP cases; over 95% are cases of acquired autoimmune TTP [3]. TTP is a hematologic emergency that is almost always fatal if appropriate treatment is not initiated promptly, and even with treatment, the mortality can reach 10% to 20% [1].

In our retrospective study we aimed to investigate the factors affecting the outcome of TTP patients. Written informed consent was obtained from all patients. Nineteen TTP patients (11 females and 8 males) had a mean age of 41.5±12.7 (1860) years; 12 (63.1%) had neurologic features, 4 (21.1%) fever, and 3 (15.7%) renal impairment (Table 1). All patients received Table 1. Characteristics of the patients.

Characteristics

n

%

Age, mean (range) 41.5 (18-60) Sex Female Male

11 8

Neurological features Syncope Coma Confusion Headache Dizziness Seizures Slurred speech

3 3 2 1 1 1 1

15.8 15.8 10.5 5.3 5.3 5.3 5.3

Renal manifestations

3

15.7

Fever

4

21.1

214

plasma exchange (PEX) therapy within 5 h of admission.

Eighteen (94.7%) patients received 1 mg/kg adjunctive methylprednisolone (except for one hereditary TTP patient).

One refractory patient and two relapsed patients received rituximab. Statistical analyses were performed with Jamovi 0.9.2.6 software. We used Kruskal-Wallis and Mann-Whitney U tests to examine the mean differences. A p-value of <0.05 was considered statistically significant.

Laboratory results are presented in Table 2. Relapsed/ refractory patients and non-relapsed/refractory patients were compared in terms of number of PEX sessions until obtaining remission, laboratory values, and ADAMTS13 panel.

Table 2. Laboratory results.

Parameter

Mean ± SD (minimummaximum) values of patients

Normal reference range

WBC count

8.14±3.37 (2.92-16)x109/L

4-10x109/L

Hemoglobin

8.59±1.63 (5.93-12.4) g/dL

12-16 g/dL

Platelet count

26.42±25.11 (1-110)x109/L

150-400x109/L

Urea

47.4±19.8 (22-92) mg/dL

15-44 mg/dL

Creatinine

0.98±0.41 (0.5-2.26) mg/dL 0.72-1.25 mg/dL

Total bilirubin

3.33 (0.72-9.43) mg/dL

0.2-1.2 mg/dL

Indirect bilirubin

2.42 (0.44-8.89) mg/dL

0.1-0.7 mg/dL

Lactate dehydrogenase

1186 (228-2570) U/L

125-220 U/L

Alanine aminotransferase

31.2 (10-90)

0-55 U/L

Aspartate aminotransferase

41.8 (14-79)

5-34 U/L

Prothrombin time

15.4 (12.1-29.4) s

International normalized ratio

1.24±0.39 (0.89-2.75)

1-1.5

Activated partial thromboplastin time

38.3 (16.1-180) s

26.5-40 s

D-Dimer

2.65 (0.54-10.7) µg/mL

0-0.4 µg/mL

Fibrinogen

341±106 (149-566) mg/dL

200-400 mg/dL

C-Reactive protein

20.3±24.1 (0.1-77.8) mg/L

0.1-5 mg/L

Mean platelet volume

10.7±2.85 (5.98-16.2) fL

7.8-11 fL

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

Table 2. Continued.

Parameter

Mean ± SD (minimummaximum) values of patients

Normal reference range

Mean ADAMTS13 antigen

0.151 (0.02-0.70) µg/mL

0.60-1.60 µg/mL

Mean ADAMTS13 activity

1.09% (0%-8%)

40%-130%

Mean ADAMTS13 inhibitor

45.9 (4.4-90) U/mL

<12

SD: Standard deviation.

In conclusion, three interesting results were identified after analysis of data in our study. First, our overall mortality rate was 1 in 19 (5.3%). Higher mortality rates were reported in previous studies (10%-20%) [1,2]. This result may show that early PEX initiation is an effective factor in mortality reduction. Secondly, the mean d-dimer value of our TTP patients was higher than the reference limit at 2.65 µg/mL (reference values: 0-0.4 µg/mL). Thus, in cases of slightly elevated d-dimer levels, one should not hesitate to start urgent PEX treatment in patients with clinically high suspicion of TTP if ADAMTS13 panel results are not obtained quickly. Thirdly, relapsed/refractory patients needed more PEX sessions to achieve first remission. A smaller number of PEX

sessions to achieve response may be predictive of durable remission without relapse.

Keywords: Thrombotic thrombocytopenic purpura, Plasma exchange, ADAMTS13, Rituximab Anahtar Sözcükler: Trombotik trombositopenik purpura, Plazmaferez, ADAMTS13, Rituksimab Informed Consent: Received.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Nunez Zuno JA, Bhimji SS. Thrombotic Thrombocytopenic Purpura.

StatPearls, NCBI Bookshelf. Bethesda, National Institutes of Health, 2017.

2. Iqbal S, Zaidi SZ, Motabi IH, Alshehry NF, AlGhamdi MS, Khan Tailor IK. Thrombotic thrombocytopenic purpura - analysis of clinical features, laboratory characteristics and therapeutic outcome of 24 patients treated at a tertiary care center in Saudi Arabia. Pak J Med Sci 2016;32:1494-1499.

3. George JN, Cuker A. Hereditary thrombotic thrombocytopenic purpura (TTP). UptoDate website, 2017. Available at https://www.uptodate.com/ contents/hereditary-thrombotic-thrombocytopenic-purpura-ttp.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Özcan ÇENELİ, M.D., Kırıkkale University Faculty of Medicine, Department of Hematology, Kırıkkale, Turkey Phone : +90 532 362 95 50 E-mail : cenelio@yahoo.com ORCID-ID: orcid.org/0000-0003-2541-1335

Received/Geliş tarihi: February 03, 2019 Accepted/Kabul tarihi: March 20, 2019 DOI: 10.4274/tjh.galenos.2019.2019.0048

Severe Bone Marrow Hypoplasia with Black Cumin (Nigella sativa) Ingestion in a Patient with T-ALL in First Complete Remission Tam Remisyonda T-ALL Hastasında Çörek Otu (Nigella sativa) Alımı Sonrası Gelişen Ağır Kemik İliği Yetmezliği Zehra Narlı Özdemir1,

Cemaleddin Öztürk1,

Işınsu Kuzu2,

Muhit Özcan1

1Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey 2Ankara University Faculty of Medicine, Department of Pathology, Ankara, Turkey

To the Editor, Nigella sativa L., commonly known as black cumin, black seed, or black caraway, contains the active component thymoquinone and has a historically extensive usage in traditional medicine.

Most studies have focused on its beneficial effects and studies

focusing on its possible toxicity are limited. To the best of our knowledge, this is the first report of an association between black cumin extract intake and myelosuppression.

A 36-year-old man with T-cell acute lymphoblastic leukemia (T-ALL) in complete remission-1 (Figure 1) in a period with 215

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

Figure 1. The bone marrow after treatment was normocellular in low (A) and high (B) power views. Following the Nigella sativa extract intake, a striking decrease in cellularity (C and D) was observed (H&E). The bone marrow biopsy following the treatment was normocellular (E) with dominant MPO-expressing myeloid lineage (F), increased nucleated glycophorin A-expressing erythroid precursors (G), and scattered megakaryocytes (red arrows) (H). Following N. sativa extract intake, within 2 months bone marrow biopsy showed severe decrease in cellularity (I). Seriously decreased number of MPO-expressing myeloid precursors (yellow arrow) (J), erythroid precursors (K), and vanished megakaryocytes (L) revealed that serious myeloid suppression was the cause of pancytopenia. no maintenance treatment was admitted to our clinic with neutropenic fever and pancytopenia.

He had been diagnosed with T-ALL a year ago. A modified LINKER chemotherapy protocol was administered for T-ALL. Complete remission was achieved 3 weeks later and minimal residual disease (MRD) was negative by flow cytometric analysis.

After 5 cycles of consolidation, 6-mercaptopurine (6-MP) and methotrexate (MTX) maintenance therapy was initiated orally.

After 1 month the maintenance therapy was stopped because of 216

toxic hepatitis. The clinical picture of toxic hepatitis was resolved 1 month after termination of the 6-MP/MTX treatment. Bone marrow aspiration and biopsy were performed to check the disease status and complete blood count results were normal at the same visit. The histopathological examination confirmed the presence of normocellular bone marrow with no MRD (Figure 1) and it was decided not to administer any medication for a while.

Two months later, the patient was admitted to our emergency department with neutropenic fever with severe pancytopenia.

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

The clinical history of the last 2 months revealed intake of a milled powder of N. sativa seed in the amount of a teaspoon twice daily without any professional medical counseling. Laboratory tests at admission were as follows: hemoglobin, 8.1 g/L (reference range: 11.7-15.5 g/dL); leukocytes, 0.6x109/L (4.5-11x109/L); neutrophils, 0.08x109/L (1.8-7.7x109/L); monocytes, 0.02x109/L (0.2-0.95x109/L); lymphocytes, 0.48x109/L (1.5-4x109/L); reticulocytes, 0.0024x1012/L (0.2-0.16x1012/L); platelets, 4x109/L (150-400x109/L); serum vitamin B12, 1211 pg/mL (126505 pg/mL); and serum folic acid, 19.75 ng/mL (5.9-24.8 ng/mL).

The blood film was compatible with aplasia without any signs of blastic infiltration. Quantitative PCR for serum parvovirus B19, CMV PCR, and HIV serology were negative and serum EBV VCA IGG/IGM and haptoglobin levels were in the normal ranges.

There was no infectious explanation for pancytopenia. No paroxysmal nocturnal hemoglobinuria clones could be detected.

The patient used N. sativa L. called “çameli”, the only black cumin seed cultivated in Turkey, which is smaller than seeds planted in other Mediterranean countries, the Middle East, and North Africa. The active component of N. sativa and the blood level of the molecule were not analyzed since the patient had not taken black cumin for a week.

Bone marrow aspiration and biopsy were performed. On microscopic examination the bone marrow was hypocellular with suppression of all cell lineages, without any obvious infiltrative pathology (Figure 1). For supportive therapy, granulocyte colony-stimulating factor together with transfusion with packed red blood cells and platelets were administered.

The patient’s neutrophil and platelet counts returned to normal on days 15 and 17, respectively, and after stopping N. sativa ingestion values were as follows: hemoglobin, 13.2 g/L; leukocytes,: 5.6x109/L; neutrophils, 3.0x109/L; monocytes, 0.5x109/L; lymphocytes, 2.0x109/L; platelets, 162x109/L. The 6-MP and MTX maintenance therapy was completed with a dose reduction. He was in complete remission with no MRD at the last follow-up visit.

Thymoquinone is the best known component of N. sativa and has cytotoxic and immunosuppressive effects on cancer cell lines [1,2]. In rats, N. sativa oil induced about a 2-fold decrease in antibody production in response to typhoid vaccination as compared to the control group and a particularly significant decrease in neutrophil counts was demonstrated [1]. A study performed by Swamy and Tan [3] showed cytotoxic and

immunopotentiating effects of an ethanolic extract of N. sativa seeds on different types of cancer cell lines. Zaoui et al. [4] reported alterations in hemoglobin metabolism and decreased leukocyte and platelet counts due to chronic exposure to the fixed oil of N. sativa in rats. The results of these studies support the suppressing effect of N. sativa seeds on bone marrow cells due to the various effective chemicals in its content [5].

Although there is lack of evidence about their advantages and disadvantages, complementary and alternative medicines are becoming popular. Ingesting herbal medicines or extracts can cause drug/drug and drug/herb interactions. Although the US Food and Drug Administration classified N. sativa seeds as “generally recognized as safe”, the sphere of influence of N. sativa seed extracts on bone marrow has not been elaborated and still remains unknown. This is the first presented case of N. sativa-induced pancytopenia and the myelosuppressive effect of black cumin is worthy of further investigation.

Keywords: Nigella sativa, T-cell acute lymphoblastic leukemia, Bone marrow hypoplasia Anahtar Sözcükler: Nigella sativa, T hücreli akut lenfoblastik lösemi, Kemik iliği yetmezliği Informed Consent: Received.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Ahmad A, Husain A, Mujeeb M, Khan SA, Kalam Najmi AK, Siddique NA, Damanhouri ZA, Anwar F. A review on therapeutic potential of Nigella sativa: a miracle herb. Asian Pac J Trop Biomed 2013;3:337-352.

2. Torres MP, Ponnusamy MP, Chakraborty S, Smith LM, Das S, Arafat HA, Batra SK. Effects of thymoquinone in the expression of mucin 4 in pancreatic cancer cells: implications for the development of novel cancer therapies.

Mol Cancer Ther 2010;9:1419-1431.

3. Swamy SM, Tan BK. Cytotoxic and immunopotentiating effects of ethanolic extract of Nigella sativa L. seeds. J Ethnopharmacol 2000;70:1-7.

4. Zaoui A, Cherrah Y, Mahassini N, Alaoui K, Amarouch H, Hassar M. Acute and chronic toxicity of Nigella sativa fixed oil. Phytomedicine 2002;9:6974.

5. Islam SN, Begum P, Ahsan T, Huque S, Ahsan M. Immunosuppressive and cytotoxic properties of Nigella sativa. Phytother Res 2004;18:395-398.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Zehra NARLI ÖZDEMİR, M.D., Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey E-mail : zehranarli@hotmail.com • zehra.narli@gmail.com ORCID-ID: orcid.org/0000-0003-3237-320X

Received/Geliş tarihi: March 02, 2019 Accepted/Kabul tarihi: June 11, 2019 DOI: 10.4274/tjh.galenos.2019.2019.0093

217

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

Tumor Lysis Syndrome Due to Targeting of Hepatocellular Carcinoma Associated with Chronic Myelomonocytic Leukemia Kronik Myelomonositik Lösemi ile İlişkili Hepatoselüler Karsinomun Hedefe Yönelik Tedavisine Bağlı Tümör Lizis Sendromu Müfide Okay1,

Sıla Çetik2,

İbrahim C. Haznedaroğlu1

1Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey 2Hacettepe University Faculty of Medicine, Department of Internal Medicine, Ankara, Turkey

To the Editor, Targeting hepatic tumors through locoregional application is feasible for anti-tumoral management [1]. Transarterial chemoembolization (TACE) aims to localize chemotherapeutic drugs solely to the tumor, avoiding systemic toxicities [2].

However, the co-existence of hematological malignancies may adversely affect that aim. We would like to point out systemic medical risks by sharing our TACE experience in a patient with hepatocellular carcinoma (HCC) and chronic myelomonocytic leukemia (CMML).

A 61-year-old male patient with a past medical history of CMML was admitted to our hospital with the findings of right upper quadrant pain and hepatosplenomegaly. Physical examination revealed hepatosplenomegaly compatible with extramedullary hematopoiesis. The clinical presentation was CMML based on the presence of persistent monocytosis, leukocytosis, and dysplastic circulating cells (Figure 1). Although the cytogenetic

Figure 1. Peripheral blood smear of the patient.

218

results revealed a normal karyotype, detailed histopathological bone marrow examination clearly demonstrated CMML with the usual nature of clonality. Four cycles of azacytidine epigenetic therapy were administered immediately after the diagnosis of CMML. The patient was positive for hepatitis B surface antigen and the hepatitis B viral load was high. A diagnosis of chronic hepatitis B infection was reached with histopathological confirmation (fibrosis and hepatitis). Upon admission, his laboratory tests were as follows: alanine aminotransferase, 64 U/L; aspartate aminotransferase, 53 U/L; alkaline phosphatase, 190 U/L; and gamma glutamyl transferase, 162 U/L. Hepatobiliary ultrasound disclosed hypoechoic lesions of 86x66 mm and 67x55 mm with necrosis in the right lobe of the liver. Abdominal magnetic resonance imaging revealed two heterogeneous mass lesions (5.3 cm and 5 cm, respectively) (Figure 2). In the histopathological examination of the liver, HCC was detected.

Liver biopsy also showed increments in CD34-positive cells and extramedullary hematopoiesis, consistent with CMML. The patient was diagnosed with HCC, which was classified as stage B according to the Barcelona Clinic Cancer staging. Transarterial ethanol and lipiodol embolization (TACE) therapy was done

Figure 2. Hepatic tumor in abdominal magnetic resonance imaging.

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

for tumor ablation. Before TACE, his laboratory tests were as follows: leukocytes, 24.5x103/µL; hemoglobin, 7.9 g/dL; absolute neutrophil count, 15.6x103/µL; platelets, 100x103/ µL; creatinine, 1.18 mg/dL; lactate dehydrogenase, 240 U/L; uric acid, 6 mg/dL; calcium, 8.3 md/dL; potassium, 4 mEq/L; and phosphorus, 4.3 mg/dL. During clinical follow-up, two weeks after the procedure, biochemical studies revealed acute renal failure. Renal function tests were as follows: creatinine, 6.3 mg/dL; phosphorus, 7.1 mg/dL; potassium, 4.7 mEq/L; calcium, 8.8 mg/dL; and uric acid, 30.6 mg/dL. Tumor lysis syndrome was suspected and the patient was hospitalized. Supportive intravenous hydration was started immediately. Allopurinol was initiated at 300 mg twice a day. After two days, his urine output decreased below 100 mL/day and hemodialysis was started. Even though uric acid levels decreased to 7 mg/dL, the patient remained anuric.

His clinical condition deteriorated and he developed respiratory distress caused by hemothorax. The complication of hemothorax was ascribed to hemorrhagic diathesis/leukostasis of CMML. The patient was lost due to those systemic complications after 10 days of treatment. Metabolic complications of the patient were ascribed to the TACE procedure during clinical followup. The patient signed the informed consent form for sharing patient information.

Chronic myeloid neoplasms of the elderly are associated with poor prognosis [3]. CMML and solid tumors can be observed concurrently [4]. HCC is a malignant tumor due to infection of hepatitis B virus and hepatitis C virus [5]. In our patient, there was hepatitis B positivity and CMML. Moreover, neoplastic CD34-positive cells and malignant tumor cells in the liver microenvironment were striking findings of this case. This is the first such co-existence established in the published literature.

TACE is a targeting therapy for HCC lesions with numerous complications [6]. Clinicians should be aware of the fact that

targeting tumors can not only cause “local” complications but also could generate systemic adverse medical events such as tumor lysis syndrome and related metabolic disorders, especially in cases of the existence of hematological malignancies [7].

Keywords: Leukemia, Myelomonocytic, Chronic, Tumor lysis syndrome, Hematologic neoplasms Anahtar Sözcükler: Lösemi, Myelomonositik, Kronik, Tümör lizis sendromu, Hematolojik neoplaziler Informed Consent: Received.

Conflict of Interest: No benefits in any form have been received or will be received from a commercial party related directly or indirectly to the subject of this article.

References 1. Winkler N, Strübing F, Groß W, Mier W, Ryschich E. Phenomenon of endothelial antibody capture: principles and potential for locoregional targeting of hepatic tumors. Hepatology 2018;68:1804-1816.

2. Lencioni R, de Baere T, Soulen MC, Rilling WS, Geschwind JF. Lipiodol transarterial chemoembolization for hepatocellular carcinoma: a systematic review of efficacy and safety data. Hepatology 2016;64:106-116.

3. Itzykson R, Duchmann M, Lucas N, Solary E. CMML: Clinical and molecular aspects. Int J Hematol 2017;105:711-719.

4. Rovira M, Cervantes F, Lozano M, Ribera JM, Reverter JC, Rozman C. Chronic myelomonocytic leukemia and solid neoplasms: is it a causal or a fortuitous association? Sangre (Barc) 1989;34:207-209.

5. Budny A, Kozlowski P, Kaminska M, Jankiewicz M, Kolak A, Budny B, Budny W, Niemunis-Sawicka J, Szczypior G, Kurniawka B, Burdan F. Epidemiology and risk factors of hepatocellular carcinoma. Pol Merkur Lekarski 2017;43:133-139.

6. Tu J, Jia Z, Ying X, Zhang D, Li S, Tian F, Jiang G. The incidence and outcome of major complication following conventional TAE/TACE for hepatocellular carcinoma. Medicine (Baltimore) 2016;95:5606.

7. Muzykantov VR, Brenner JS. Vascular immunotargeting: take the highway to the first exit. Hepatology 2018;68:1672-1674.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Müfide OKAY, M.D., Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey Phone : +90 532 135 66 95 E-mail : mufideokay87@gmail.com ORCID-ID: orcid.org/0000-0001-5317-0597

Received/Geliş tarihi: March 15, 2019 Accepted/Kabul tarihi: May 07, 2019

DOI: 10.4274/tjh.galenos.2019.2019.0113

219

LETTERS TO THE EDITOR

Turk J Hematol 2019;36:205-221

MDM2 Oncogene Copy Number Alterations in Chronic Lymphocytic Leukemia Kronik Lenfositik Lösemide MDM2 Onkogen Kopya Sayısı Değişiklikleri Pathum Sookaromdee1,

Viroj Wiwanitkit2

1TWS Medical Center, Bangkok, Thailand 2Dr. DY Patil University, Pune, India

To the Editor, We read “Investigation of MDM2 oncogene copy number alterations in cases of chronic lymphocytic leukemia” (CLL) with great interest [1]. Darbaş et al. [1] stated: “In previous studies, MDM2 overexpression was examined at mRNA and protein levels, but amplification of the MDM2 gene at DNA level in CLL patients has been examined for the first time in our study” [1]. Indeed, MDM2 overexpression is an important pathological phenomenon seen in CLL [2]. The investigation of MDM2 overexpression can be useful in the diagnostic and therapeutic management of the patient. Nevertheless, we would like to point out that the present report by Darbaş et al. [1] is not the first report studying amplification of the MDM2 gene at DNA level in CLL patients. A previous report by Watanabe et al. [3] already investigated this issue, although in those case the results were negative.

Keywords: MDM2, Oncogene, Copy number, Chronic lymphocytic leukemia

Anahtar Sözcükler: MDM2, Onkogen, Kopya sayısı, Kronik lenfositik lösemi Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Darbaş Ş, Aydın Ç, Salim O, Berker Karaüzüm S. Investigation of MDM2 oncogene copy number alterations in cases of chronic lymphocytic leukemia. Turk J Hematol 2019;36:126-127.

2. Bixby D, Kujawski L, Wang S, Malek SN. The pre-clinical development of MDM2 inhibitors in chronic lymphocytic leukemia uncovers a central role for p53 status in sensitivity to MDM2 inhibitor-mediated apoptosis. Cell Cycle 2008;7:971-979.

3. Watanabe T, Ichikawa A, Saito H, Hotta T. Overexpression of the MDM2 oncogene in leukemia and lymphoma. Leuk Lymphoma 1996;21:391397.

©Copyright 2019 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Pathum SOOKAROMDEE, M.D., TWS Medical Center, Bangkok, Thailand E-mail : pathumsook@gmail.com ORCID-ID: orcid.org/0000-0002-8859-5322

Received/Geliş tarihi: May 07, 2019 Accepted/Kabul tarihi: May 20, 2019 DOI: 10.4274/tjh.galenos.2019.2019.0179

Reply from the Authors To the Editor, We would like to thank the authors for showing interest in our letter, which was titled “Investigation of MDM2 oncogene copy number alterations in cases of chronic lymphocytic leukemia” [1]. The authors have shown two previously published articles related to overexpression of MDM2 in CLL patients. One of them was written by Watanabe et al. [2]; they performed Southern blot analysis to examine whether MDM2 was amplified in 23 B-CLL specimens and found that none of the patients showed amplification. In the other study, Bixby et al. [3] reported that they had found three copies of the MDM2 gene in 37 of 178 CLL patients using 50K SNParray technology. After screening the literature in detail, we found two additional studies. Bueso-Ramos et al. [4] reported 5 CLL patients not showing amplification using the Southern blot method and Huang et al. [5] reported 4 of 11 patients with CLL showing amplification of the MDM2 gene using the Southern blot technique. Considering these four studies, amplification of the MDM2 gene 220

Turk J Hematol 2019;36:205-221

LETTERS TO THE EDITOR

at DNA level in CLL patients had been previously examined by Southern blot and array techniques, but we used the FISH technique in our study to demonstrate MDM2 amplification in CLL patients.

References 1. Darbaş Ş, Aydın Ç, Salim O, Berker Karaüzüm S. Investigation of MDM2 oncogene copy number alterations in cases of chronic lymphocytic leukemia. Turk J Hematol 2019;36:126-127.

2. Watanabe T, Ichikawa A, Saito H, Hotta T. Overexpression of the MDM2 oncogene in leukemia and lymphoma. Leuk Lymphoma 1996;21:391-397.

3. Bixby D, Kujawski L, Wang S, Malek SN. The pre-clinical development of MDM2 inhibitors in chronic lymphocytic leukemia uncovers a central role for p53 status in sensitivity to MDM2 inhibitor-mediated apoptosis. Cell Cycle 2008;7:971-979.

4. Bueso-Ramos CE, Yang Y, deLeon E, McCown P, Stass SA, Albitar M. The human MDM-2 oncogene is overexpressed in leukemias. Blood 1993;82:2617-2623.

5. Huang YQ, Raphael B, Buchbinder A, Li JJ, Zhang WG, Friedman-Kien AE. Rearrangement and expression of MDM2 oncogene in chronic lymphocytic leukemia. Am J Hematol 1994;47:139-141.

221

Advisory Board of This Issue (September 2019) Ahmet Emre Eşkazan, Turkey Alphan Küpesiz, Turkey Andrew Kotaska, Canada Birol Baytan, Turkey Cafer Adıgüzel, Turkey Canan Vergin, Turkey Cassyanne Aguiar, USA Cengiz Beyan, Turkey Claudio Cerchione, Italy Ece Eden, Turkey Ekrem Ünal, Turkey Engin Kaptan, Turkey Engin Kelkitli, Turkey Eric Berntorp, Sweden Fatih Erbey, Turkey

Giovanni Marconi, Italy Hakon Reikvam, Norway İbrahim Eker, Turkey İnci Alacacıoğlu, Turkey Ivan Petkovic, Serbia Johnny N. Mahlangu, South Africa Kıvanç Bektaş, Turkey Lisa J. McReynolds, USA Marcello Fiorini, Italy Maria K. Angelopoulou, Greece Meliha Nalçacı, Turkey Meral Beksaç, Turkey Meryem Albayrak, Turkey Michael R. Grever, USA Mukul Aggarwal, India

Musa Karakükçü, Turkey Musa Yılmaz, Turkey Nargess Arandi, Iran Natasa Tosic, Serbia Nükhet Tüzüner, Turkey Özlem Tüfekçi, Turkey Sema Anak, Turkey Serap Aksoyler, Turkey Takashi Taga, Japan Turan Bayhan, Turkey Türkan Patıroğlu, Turkey Ümit Yavuz Malkan, Turkey Vahap Okan, Turkey Vahid Afshar-Kharghan, USA Zahit Bolaman, Turkey