Turkish Journal of Hematology Volume: 31 - Issue: 1 by LookUs Scientific

Issue 1

March 2014

40 TL

History of Turkish Journal of Hematology Review Article β-Thalassemia Intermedia: A Bird’s-Eye View Anthony Haddad et al.; Beirut, Lebanon

Research Articles A Polymorphism in the IL-5 Gene is Associated with Inhibitor Development in Severe Hemophilia A Patients İnanç Değer Fidancı, et al.; İstanbul, İzmir, Adana, Turkey

Evaluation of Red Cell Membrane Cytoskeletal Disorders Using a Flow Cytometric Method in South Iran Habib Alah Golafshan, et al.; Shiraz, Iran

Childhood Immune Thrombocytopenia: Long-term Follow-up Data Evaluated by the Criteria of the International Working Group on Immune Thrombocytopenic Purpura Melike Sezgin Evim, et al.; Bursa, Turkey

NPM1 Gene Type A Mutation in Bulgarian Adults with Acute Myeloid Leukemia: A Single-Institution Study Gueorgui Balatzenko et al.; Sofia, Bulgaria

Leukocyte Populations and C-Reactive Protein as Predictors of Bacterial Infections in Febrile Outpatient Children Zühre Kaya, et al.; Ankara, Turkey

FIP1L1-PDGFRA-Positive Chronic Eosinophilic Leukemia: A Low-Burden Disease with Dramatic Response to Imatinib - A Report of 5 Cases from South India Anıl Kumar N. et al; Karnataka, Delhi, India

The Association between Obesity and Insulin Resistance and Anemia and Iron Metabolism: A Single-Center, Cross-Sectional Study Esma Altunoğlu; İstanbul, Turkey The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity Ayşenur Bahadır et al; İstanbul, Trabzon, Ankara, Turkey

Cover Picture: Güçhan Alanoğlu Gölcük, Isparta

ISSN 1300-7777

Volume 31

Editor-in-Chief

International Review Board

Aytemiz Gürgey

Nejat Akar Görgün Akpek  Serhan Alkan  Çiğdem Altay  Koen van Besien  Ayhan Çavdar M.Sıraç Dilber  Ahmet Doğan  Peter Dreger  Thierry Facon Jawed Fareed  Gösta Gahrton  Dieter Hoelzer  Marilyn Manco-Johnson Andreas Josting Emin Kansu  Winfried Kern  Nigel Key  Korgün Koral Abdullah Kutlar Luca Malcovati  Robert Marcus  Jean Pierre Marie Ghulam Mufti Gerassimos A. Pangalis Antonio Piga Ananda Prasad Jacob M. Rowe Jens-Ulrich Rüffer Norbert Schmitz Orhan Sezer  Anna Sureda Ayalew Tefferi Nükhet Tüzüner Catherine Verfaillie Srdan Verstovsek Claudio Viscoli

TOBB Economy Technical University Hospital, Ankara, Turkey Maryland School of Medicine, Baltimore, USA  Cedars-Sinai Medical Center, USA  Ankara, Turkey Chicago Medical Center University, Chicago, USA Ankara, Turkey  Karolinska University, Stockholm, Sweden  Mayo Clinic Saint Marys Hospital, USA Heidelberg University, Heidelberg, Germany Lille University, Lille, France  Loyola University, Maywood, USA  Karolinska University Hospital, Stockholm, Sweden Frankfurt University, Frankfurt, Germany Colorado Health Sciences University, USA  University Hospital Cologne, Cologne, Germany  Hacettepe University, Ankara, Turkey  Albert Ludwigs University, Germany  University of North Carolina School of Medicine, NC, USA Southwestern Medical Center, Texas, USA Georgia Health Sciences University, Augusta, USA  Pavia Medical School University, Pavia, Italy  Kings College Hospital, London, UK  Pierre et Marie Curie University, Paris, France  King’s Hospital, London, UK  Athens University, Athens, Greece  Torino University, Torino, Italy  Wayne State University School of Medicine, Detroit, USA Rambam Medical Center, Haifa, Israel  University of Köln, Germany  AK St Georg, Hamburg, Germany  Memorial Şişli Hospital, İstanbul, Turkey  Santa Creu i Sant Pau Hospital, Barcelona, Spain  Mayo Clinic, Rochester, Minnesota, USA  Istanbul Cerrahpaşa University, İstanbul, Turkey  University of Minnesota, Minnesota, USA The University of Texas MD Anderson Cancer Center, Houston, USA San Martino University, Genoa, Italy

Past Editors Erich Frank Orhan Ulutin Hamdi Akan

Language Editor Leslie Demir

Ankara, Turkey

Associate Editors Ayşegül Ünüvar İstanbul University, İstanbul, Turkey

Celalettin Üstün University of Minnesota, Minnesota, USA

Cem Ar İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey

İbrahim Haznedaroğlu Hacettepe University, Ankara, Turkey

İlknur Kozanoğlu Başkent University, Adana, Turkey

Hale Ören Dokuz Eylül University, İzmir, Turkey

Mehmet Ertem Ankara University, Ankara, Turkey

Muzaffer Demir Trakya University, Edirne, Turkey

Reyhan Diz Küçükkaya İstanbul Bilim University, İstanbul, Turkey

Assistant Editors A. Emre Eşkazan İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey

Ali İrfan Emre Tekgündüz Dr. A. Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey

Nil Güler On Dokuz Mayıs University, Samsun, Turkey

Olga Meltem Akay Osmangazi University, Eskişehir, Turkey

Selami Koçak Toprak Ankara University, Ankara, Turkey

Şule Ünal Hacettepe University, Ankara, Turkey

Ümit Üre Bakırköy Dr. Sadi Konuk Training and Research Hospital, İstanbul, Turkey

Statistic Editor Hülya Ellidokuz

Senior Advisory Board Yücel Tangün Osman İlhan Muhit Özcan

Veysel Sabri Hançer İstanbul Bilim University, İstanbul, Turkey

Zühre Kaya Gazi University, Ankara, Turkey

A-I

Publishing Services

Editorial Office İpek Durusu Bengü Timoçin

GALENOS PUBLISHER Molla Gürani Mah. Kaçamak Sk. No: 21, Fındıkzade-İstanbul Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information Editorial Correspondence should be addressed to Dr. Aytemiz Gürgey Editor-in-Chief  Address: 725. Sok. Görkem Sitesi  Yıldızevler No: 39/2, 06550 Çankaya, Ankara / Turkey Phone : +90 312 438 14 60 E-mail : agurgey@hacettepe.edu.tr

All other inquiries should be adressed to TURKISH JOURNAL OF HEMATOLOGY Address: İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No:8 06550 Çankaya, Ankara / Turkey Phone : +90 312 490 98 97 Fax : +90 312 490 98 68  E-mail : info@tjh.com.tr ISSN: 1300-7777

Turkish Society of Hematology

Publishing Manager Sorumlu Yazı İşleri Müdürü

Teoman Soysal, President  Muzaffer Demir, General Secretary Hale Ören, Vice President  İbrahim Haznedaroğlu, Research Secretary Fahir Özkalemkaş, Treasurer  Zahit Bolaman, Member  Mehmet Sönmez, Member

Muzaffer Demir

Management Address Yayın İdare Adresi

Türk Hematoloji Derneği İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No:8 06550 Çankaya, Ankara / Turkey

Publishing House / Yayınevi

Online Manuscript Submission

Molla Gürani Mah. Kaçamak Sk. No: 21, 34093 Fındıkzade, İstanbul Tel: +90 212 621 99 25 Faks: +90 212 621 99 27 E-posta: info@galenos.com.tr Baskı: Senk Ofset Matbaacılık Reklam Promosyon ve Tan. Hiz. San. Dış. Tic. Ltd. Şti. Tel.: +90 212 493 26 26 Topkapı Litros yolu, No: 24, Zeytinburnu, İstanbul

http://mc.manuscriptcentral.com/tjh

Web page www.tjh.com.tr

Owner on behalf of the Turkish Society of Hematology Türk Hematoloji Derneği adına yayın sahibi Teoman Soysal

Printing Date / Basım Tarihi 25.02.2014

Cover Picture

Güçhan Alanoğlu was born in 1959, Turkey. She is currently working at Süleyman Demirel University, Department of Hematology, Isparta. Üç ayda bir yayımlanan İngilizce süreli yayındır. International scientific journal published quarterly. Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish Journal of Hematology’nin Türk Hematoloji Derneği İktisadi İşletmesi tarafından yayınlanmasına karar vermiştir.

A-II

AIMS AND SCOPE The Turkish Journal of Hematology is published quarterly (March, June, September, and December) by the Turkish Society of Hematology. It is an independent, non-profit peer-reviewed international English-language periodical encompassing subjects relevant to hematology. The Editorial Board of The Turkish Journal of Hematology adheres to the principles of the World Association of Medical Editors (WAME), International Council of Medical Journal Editors (ICMJE), Committee on Publication Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and Strengthening the Reporting of Observational Studies in Epidemiology (STROBE). The aim of The Turkish Journal Hematology is to publish original hematological research of the highest scientific quality and clinical relevance. Additionally, educational material, reviews on basic developments, editorial short notes, case reports, images in hematology, and letters from hematology specialists and clinicians covering their experience and comments on hematology and related medical fields as well as social subjects are published. General practitioners interested in hematology and internal medicine specialists are among our target audience, and The Turkish Journal of Hematology aims to publish according to their needs. The Turkish Journal of Hematology is indexed, as follows: - PUBMED Central - Science Citation Index Expanded - EMBASE - Scopus - CINAHL - Gale/Cengage Learning - EBSCO - DOAJ - ProQuest - Index Copernicus - Tübitak/Ulakbim Turkish Medical Database - Turk Medline

Impact Factor: 0.494 Subscription Information

The Turkish Journal of Hematology is sent free-of-charge to members of Turkish Society of Hematology and libraries in Turkey and abroad. Hematologists, other medical specialists that are interested in hematology, and academicians could subscribe for only 40 $ per printed issue. All published volumes are available in full text free-ofcharge online at www.tjh.com.tr.  Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97  Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh  Web page: www.tjh.com.tr  E-mail: info@tjh.com.tr

A-III

Permissions

Requests for permission to reproduce published material should be sent to the editorial office. Editor: Professor Dr. Aytemiz Gürgey  Adress: Ilkbahar Mah, Turan Günes Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey  Telephone: +90 312 490 98 97  Fax: +90 312 490 98 68  Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh  Web page: www.tjh.com.tr  E-mail: info@tjh.com.tr Publisher Galenos Yayinevi Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul Telefon : 0212 621 99 25 Fax : 0212 621 99 27 info@galenos.com.tr

Instructions for Authors Instructions for authors are published in the journal and at www. tjh.com.tr

Material Disclaimer Authors are responsible for the manuscripts they publish in The Turkish Journal of Hematology. The editor, editorial board, and publisher do not accept any responsibility for published manuscripts. The journal is printed on acid-free paper.

Editorial Policy Following receipt of each manuscript, a checklist is completed by the Editorial Assistant. The Editorial Assistant checks that each manuscript contains all required components and adheres to the author guidelines, after which time it will be forwarded to the Editor in Chief. Following the Editor in Chief’s evaluation, each manuscript is forwarded to the Associate Editor, who in turn assigns reviewers. Generally, all manuscripts will be reviewed by at least three reviewers selected by the Associate Editor, based on their relevant expertise. Associate editor could be assigned as a reviewer along with the reviewers. After the reviewing process, all manuscripts are evaluated in the Editorial Board Meeting. Turkish Journal of Hematology’s editor and Editorial Board members are active researchers. It is possible that they would desire to submit their manuscript to the Turkish Journal of Hematology. This may be creating a conflict of interest. These manuscripts will not be evaluated by the submitting editor(s). The review process will be managed and decisions made by editor-in-chief who will act independently. In some situation, this process will be overseen by an outside independent expert in reviewing submissions from editors.

TURKISH JOURNAL OF HEMATOLOGY INSTRUCTIONS TO AUTHORS The Turkish Journal of Hematology accepts invited review articles, research articles, brief reports, case reports, letters to the editor, and hematological images that are relevant to the scope of hematology, on the condition that they have not been previously published elsewhere. Basic science manuscripts, such as randomized, cohort, cross-sectional, and case control studies, are given preference. All manuscripts are subject to editorial revision to ensure they conform to the style adopted by the journal. There is a single blind kind of reviewing system. Manuscripts should be prepared according to ICMJE guidelines (http://www.icmje.org/). Original manuscripts require a structured abstract. Label each section of the structured abstract with the appropriate subheading (Objective, Materials and Methods, Results, and Conclusion). Case reports require short unstructured abstracts. Letters to the editor do not require an abstract. Research or project support should be acknowledged as a footnote on the title page. Technical and other assistance should be provided on the title page.

Conflict-of-Interest Statement: To prevent potential conflicts of interest from being overlooked, this statement must be included in each manuscript. In case there are conflicts of interest, every author should complete the ICMJE general declaration form, which can be obtained at: http://www.icmje.org/coi_disclose.pdf. Abstract and Keywords: The second page should include an abstract that does not exceed 300 words. For manuscripts sent by authors in Turkey, a title and abstract in Turkish are also required. As most readers read the abstract first, it is critically important. Moreover, as various electronic databases integrate only abstracts into their index, important findings should be presented in the abstract. Objective: The abstract should state the objective (the purpose of the study and hypothesis) and summarize the rationale for the study. Materials and Methods: Important methods should be written respectively. Results: Important findings and results should be provided here. Conclusion: The study’s new and important findings should be highlighted and interpreted.

Original Manuscripts Title Page Title: The title should provide important information regarding the manuscript’s content. The title must specify that the study is a cohort study, cross-sectional study, case control study, or randomized study (i.e. Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability of ferrous succinate tablet formulations without correction for baseline circadian changes in iron concentration in healthy Chinese male subjects: A single-dose, randomized, 2-period crossover study. Clin Ther. 2011; 33: 2054-2059). The title page should include the authors’ names, degrees, and institutional/professional affiliations, a short title, abbreviations, keywords, financial disclosure statement, and conflict of interest statement. If a manuscript includes authors from more than one institution, each author’s name should be followed by a superscript number that corresponds to their institution, which is listed separately. Please provide contact information for the corresponding author, including name, e-mail address, and telephone and fax numbers. Running Head: The running head should not be more than 40 characters, including spaces, and should be located at the bottom of the title page. Word Count: A word count for the manuscript, excluding abstract, acknowledgments, figure and table legends, and references, should be provided not exceed 2500 words. The word count for an abstract should be not exceed 300 words.

A-IV

Other types of manuscripts, such as case reports, reviews, perspectives, and editorials, will be published according to uniform requirements. Provide 3-10 keywords below the abstract to assist indexers. Use terms from the Index Medicus Medical Subject Headings List (for randomized studies a CONSORT abstract should be provided (http://www.consort-statement.org). Introduction: The introduction should include an overview of the relevant literature presented in summary form (one page), and what ever remains interesting, unique, problematic, relevant, or unknown about the topic must be specified. The introduction should conclude with the rationale for the study, its design, and its objective(s). Materials and Methods: Clearly describe the selection of observational or experimental participants, such as patients, laboratory animals, and controls, including inclusion and exclusion criteria and a description of the source population. Identify the methods and procedures in sufficient detail to allow other researchers to reproduce your results. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for using them and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. The section should include only information that was available at the time the plan or protocol for the study was devised (http://www.strobe-statement.org/fileadmin/ Strobe/uploads/checklists/STROBE_checklist_v4_combined.pdf).

Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported results. Statistically important data should be given in the text, tables and figures. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used. Results: Present your results in logical sequence in the text, tables, and figures. Do not present all the data provided in the tables and/or figures in the text; emphasize and/or summarize only important findings, results, and observations in the text. For clinical studies provide the number of samples, cases, and controls included in the study. Discrepancies between the planned number and obtained number of participants should be explained. Comparisons, and statistically important values (i.e. P value and confidence interval) should be provided. Discussion: This section should include a discussion of the data. New and important findings/results, and the conclusions they lead to should be emphasized. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by the data. Do not repeat the findings/results in detail; important findings/results should be compared with those of similar studies in the literature, along with a summarization. In other words, similarities or differences in the obtained findings/results with those previously reported should be discussed. Limitations of the study should be detailed. In addition, an evaluation of the implications of the obtained findings/results for future research should be outlined.

4. Book Chapter Perutz MF. Molecular anatomy and physiology of hemoglobin. In: Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin: Genetics, Pathophysiology, Clinical Management. New York, Cambridge University Press, 2000. 5.Abstract Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin) stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract). 6.Letter to the Editor Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further definition of 20q deletion in myeloid leukemia using fluorescence in situ hybridization. Blood 1994;84:2821-2823. 7. Supplement Alter BP. Fanconiâ&#x20AC;&#x2122;s anemia, transplantation, and cancer. Pediatr Transplant. 2005;9(Suppl 7):81-86

Brief Reports

Deeg HJ, Oâ&#x20AC;&#x2122;Donnel M, Tolar J. Optimization of conditioning for marrow transplantation from unrelated donors for patients with aplastic anemia after failure immunosuppressive therapy. Blood 2006;108:1485-1491.

Abstract length: Not to exceed 300 words. Article length: Not to exceed 1200 words. Introduction: State the purpose and summarize the rationale for the study. Materials and Methods: Clearly describe the selection of the observational or experimental participants. Identify the methods and procedures in sufficient detail. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for their use and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported findings/results. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used. Results: Present the findings/results in a logical sequence in the text, tables, and figures. Do not repeat all the findings/results in the tables and figures in the text; emphasize and/or summarize only those that are most important. Discussion: Highlight the new and important findings/results of the study and the conclusions they lead to. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by your data.

2.Organization as author

Case Reports

Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of syngeneic bone marrow graft without preconditioning in posthepatitis marrow aplasia. Lancet 1977;2:742-744.

Abstract length: Not to exceed 300 words. Article length: Not to exceed 1200 words.

3.Book

Abstract

References Cite references in the text, tables, and figures with numbers in parentheses. Number references consecutively according to the order in which they first appear in the text. Journal titles should be abbreviated according to the style used in Index Medicus (consult List of Journals Indexed in Index Medicus). Include among the references any paper accepted, but not yet published, designating the journal and followed by, in press.

Examples of References: 1. List all authors.

Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961.

A-V

Case reports should be structured as follows: An unstructured abstract that summarizes the case.

Introduction: A brief introduction (recommended length: 1-2 paragraphs). Case Presentation: This section describes the case in detail, including the initial diagnosis and outcome. Discussion:This section should include a brief review of the relevant literature and how the presented case furthers our understanding to the disease process.

Invited Review Articles Abstract length: Not to exceed 300 words. Article length: Not to exceed 4000 words. Review articles should not include more than 100 references. Reviews should include a conclusion, in which a new hypothesis or study about the subject may be posited. Do not publish methods for literature search or level of evidence. Authors who will prepare review articles should already have published research articles on therel evant subject. The study’s new and important findings should be highlighted and interpreted in the Conclusion section. There should be a maximum of two authors for review articles.

Images in Hematology Article length: Not exceed 200 words. Authors can submit for consideration an illustration and photos that is interesting, instructive, and visually attractive, along with a few lines of explanatory text and references. Images in Hematology can include no more than 200 words of text, 5 references, and 3 figure or table. No abstract, discussion or conclusion are required but please include a brief title.

Letters to the Editor Article length: Not to exceed 500 words.

Authorship Each author should have participated sufficiently in the work to assume public responsibility for the content. Any portion of a manuscript that is critical to its main conclusions must be the responsibility of at least 1 author.

Contributor’s Statement All submissions should contain a contributor’s statement page. Each manuscript should contain substantial contributions to idea and design, acquisition of data, or analysis and interpretation of findings. All persons designated as an author should qualify for authorship, and all those that qualify should be listed. Each author should have participated sufficiently in the work to take responsibility for appropriate portions of the text.

Acknowledgments Acknowledge support received from individuals, organizations, grants, corporations, and any other source. For work involving a biomedical product or potential product partially or wholly supported by corporate funding, a note stating, “This study was financially supported (in part) with funds provided by (company name) to (authors’ initials)”, must be included. Grant support, if received, needs to be stated and the specific granting institutions’ names and grant numbers provided when applicable. Authors are expected to disclose on the title page any commercial or other associations that might pose a conflict of interest in connection with the submitted manuscript. All funding sources that supported the work and the institutional and/or corporate affiliations of the authors should be acknowledged on the title page.

Ethics

Letters can include no more than 500 words of text, 5-10 references, and 1 figure or table. No abstract is required, but please include a brief title.

Tables Supply each table on a separate file. Number tables according to the order in which they appear in the text, and supply a brief caption for each. Give each column a short or abbreviated heading. Write explanatory statistical measures of variation, such as standard deviation or standard error of mean. Be sure that each table is cited in the text.

Figures Figures should be professionally drawn and/or photographed. Authors should number figures according to the order in which they appear in the text. Figures include graphs, charts, photographs, and illustrations. Each figure should be accompanied by a legend that does not exceed 50 words. Use abbreviations only if they have been introduced in the text. Authors are also required to provide the level of magnification for histological slides. Explain the internal scale and identify the staining method used. Figures should be submitted as separate files, not in the text file. High-resolution image files are not preferred for initial submission as the file sizes may be too large. The total file size of the PDF for peer review should not exceed 5 MB.

A-VI

When reporting experiments conducted with humans indicate that the procedures were in accordance with ethical standards set forth by the committee that oversees human experimentation. Approval of research protocols by the relevant ethics committee, in accordance with international agreements (Helsinki Declaration of 1975, revised 2002 available at http://www.wma.net/e/policy/b3.htm, “Guide for the Care and use of Laboratory Animals” www.nap.edu/catalog/5140. html/), is required for all experimental, clinical, and drug studies. Patient names, initials, and hospital identification numbers should not be used. Manuscripts reporting the results of experimental investigations conducted with humans must state that the study protocol received institutional review board approval and that the participants provided informed consent. Non-compliance with scientific accuracy is not in accord with scientific ethics. Plagiarism: To re-publish-whole or in part-the contents of another author’s publication as one’s own without providing a reference. Fabrication: To publish data and findings/results that do not exist. Duplication: Use of data from another publication, which includes re-publishing a manuscript in different languages. Salamisation: To create more than one publication by dividing the results of a study preternaturally.

We disapprove of such unethical practices as plagiarism, fabrication, duplication, and salamisation, as well as efforts to influence the review process with such practices as gifting authorship, inappropriate acknowledgements, and references. Additionally, authors must respect participant right to privacy. On the other hand, short abstracts published in congress books that do not exceed 400 words and present data of preliminary research, and those that are presented in an electronic environment are not accepted pre-published work. Authors in such situation must declare this status on the first page of the manuscript and in the cover letter. (The COPE flowchart is available at: http://publicationethics.org) Turkish Journal of Hematology uses plagiarism screening service to verify the originality of content submitted before publication.

Units of Measurement Measurements should be reported using the metric system, according to the International System of Units (SI). Consult the SI Unit Conversion Guide, New England Journal of Medicine Books, 1992. An extensive list of conversion factors can be found at http://www. unc.edu/~rowlett/units/scales/clinical_data.html. For more details, see http://www.amamanualofstyle.com/oso/public/jama/si_conversion_ table.html . Example for CBC.

Hematology component

SI units

RBC

6.7-11 x 1012/L

Conditions of Publication

WBC

5.5-19.5 x109/L

All authors are required to affirm the following statements before their manuscript is considered: 1. The manuscript is being submitted only to The Turkish Journal of Hematology; 2. The manuscript will not be submitted elsewhere while under consideration by The Turkish Journal of Hematology; 3. The manuscript has not been published elsewhere, and should it be published in The Turkish Journal of Hematology it will not be published elsewhere without the permission of the editors (these restrictions do not apply to abstracts or to press reports for presentations at scientific meetings); 4. All authors are responsible for the manuscript’s content; 5. All authors participated in the study concept and design, analysis and interpretation of the data, drafting or revising of the manuscript, and have approved the manuscript as submitted. In addition, all authors are required to disclose any professional affiliation, financial agreement, or other involvement with any company whose product figures prominently in the submitted manuscript. Authors of accepted manuscripts will receive electronic page proofs and are responsible for proofreading and checking the entire article within two days. Failure to return the proof in two days will delay publication. If the authors cannot be reached by email or telephone within two weeks, the manuscript will be rejected and will not be published in the journal.

Hemoglobin

116-168 g/L

PCV

0.31-0.46 L/L

MCV

39-53 fL

MCHC

300-360 g/L

MCH

19.5-25 pg

Platelets

300-700 x 109/L

Copyright At the time of submission all authors will receive instructions for submitting an online copyright form. No manuscript will be considered for review until all authors have completed their copyright form. Please note, it is our practice not to accept copyright forms via fax, e-mail, or postal service unless there is a problem with the online author accounts that cannot be resolved. Every effort should be made to use the online copyright system. Corresponding authors can log in to the submission system at any time to check the status of any co-author’s copyright form. All accepted manuscripts become the permanent property of The Turkish Journal of Hematology and may not be published elsewhere-in whole or in part-without written permission. Note: We cannot accept any copyright that has been altered, revised, amended, or otherwise changed. Our original copyright form must be used as is.

A-VII

Source: http://www.vetstream.com/felis/Corporate/993fhtm/ha-mat.htm

Abbreviations and Symbols Use only standard abbreviations. Avoid abbreviations in the title and abstract. The full term for an abbreviation should precede its first use in the text, unless it is a standard abbreviation. All acronyms used in the text should be expanded at first mention, followed by the abbreviation in parentheses; thereafter the acronym only should appear in the text. Acronyms may be used in the abstract if they occur 3 or more times therein, but must be reintroduced in the body of the text. Generally, abbreviations should be limited to those defined in the AMA Manual of Style, current edition. A list of each abbreviation (and the corresponding full term) used in the manuscript must be provided on the title page.

Online Manuscript Submission Process The Turkish Journal of Hematology uses submission software powered by ScholarOne Manuscripts. The website for submissions to The Turkish Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This system is quick and convenient, both for authors and reviewers.

Setting up an account New users to the submission site will need to register and enter their account details before they can submit a manuscript. Log in, or click the “Create Account” button if you are a first-time user. To create a new account: After clicking the “Create Account” button, enter your name and e-mail address, and then click the “Next” button. Your

e-mail address is very important. Enter your institution and address information, as appropriate, and then click the “Next” Button. Enter a user ID and password of your choice, select your area of expertise, and then click the “Finish” button. If you have an account, but have forgotten your log-in details, go to “Password Help” on the journal’s online submission system and enter your e-mail address. The system will send you an automatic user ID and a new temporary password. Full instructions and support are available on the site, and a user ID and password can be obtained during your first visit. Full support for authors is provided. Each page has a “Get Help Now” icon that connects directly to the online support system. Contact the journal administrator with any questions about submitting your manuscript to the journal (info@tjh.com.tr). For ScholarOne Manuscripts customer support, click on the “Get Help Now” link on the top right hand corner of every page on the site.

The Electronic Submission Process Log in to your author center. Once you have logged in, click the “Submit a Manuscript” link in the menu bar. Enter the appropriate data and answer the questions. You may copy and paste directly from your manuscript. Click the “Next” button on each screen to save your work and advance to the next screen.

Upload Files Click on the “Browse” button and locate the file on your computer. Select the appropriate designation for each file in the drop-down menu next to the “Browse” button. When you have selected all the files you want to upload, click the “Upload Files” button. Review your submission before sending to the journal. Click the “Submit” button when you are finished reviewing. You can use ScholarOne Manuscripts at any time to check the status of your submission. The journal’s editorial office will inform you by e-mail once a decision has been made. After your manuscript has been submitted, a checklist will then be completed by the Editorial Assistant. The Editorial Assistant will check that the manuscript contains all required components and adheres to the author guidelines. Once the Editorial Assistant is satisfied with the manuscript it will be forwarded to the Senior Editor, who will assign an editor and reviewers.

The Review Process Each manuscript submitted to The Turkish Journal of Hematology is subject to an initial review by the editorial office in order to determine if it is aligned with the journal’s aims and scope, and complies with essential requirements. Manuscripts sent for peer review will be assigned to one of the journal’s associate editors that has expertise relevant to the manuscript’s content. All manuscripts are single-blind peer reviewed. All accepted manuscripts are sent to a statistical and English language editor before publishing. Once papers have been reviewed, the reviewers’ comments are sent to the Editor, who will then make a preliminary decision on the paper. At this stage, based on the feedback from reviewers, manuscripts can be accepted, rejected, or revisions can be recommended. Following initial peer-review, articles

A-VIII

judged worthy of further consideration often require revision. Revised manuscripts generally must be received within 3 months of the date of the initial decision. Extensions must be requested from the Associate Editor at least 2 weeks before the 3-month revision deadline expires; The Turkish Journal of Hematology will reject manuscripts that are not received within the 3-month revision deadline. Manuscripts with extensive revision recommendations will be sent for further review (usually by the same reviewers) upon their re-submission. When a manuscript is finally accepted for publication, the Technical Editor undertakes a final edit and a marked-up copy will be e-mailed to the corresponding author for review and to make any final adjustments.

Submission of Revised Papers When revising a manuscript based on the reviewers’ and Editor’s feedback, please insert all changed text in red. Please do not use track changes, as this feature can make reading difficult. To submit revised manuscripts, please log into your author center at ScholarOne Manuscripts. Your manuscript will be stored under “Manuscripts with Decisions”. Please click on the “Create a Revision” link located to the right of the manuscript title. A revised manuscript number will be created for you; you will then need to click on the “Continue Submission” button. You will then be guided through a submission process very similar to that for new manuscripts. You will be able to amend any details you wish. At stage 6 (“File Upload”), please delete the file for your original manuscript and upload the revised version. Additionally, please upload an anonymous cover letter, preferably in table format, including a point-by-point response to the reviews’ revision recommendations. You will then need to review your paper as a PDF and click the “Submit” button. Your revised manuscript will have the same ID number as the original version, but with the addition of an R and a number at the end, for example, TJH-2011-0001 for an original and TJH-2011-0001.R1, indicating a first revision; subsequent revisions will end with R2, R3, and so on. Please do not submit a revised manuscript as a new paper, as revised manuscripts are processed differently. If you click on the “Create a Revision” button and receive a message stating that the revision option has expired, please contact the Editorial Assistant at info@tjh.com.tr to reactivate the option.

English Language Editing All manuscripts are professionally edited by an English language editor prior to publication.

Online Early The Turkish Journal of Hematology publishes abstracts of accepted manuscripts online in advance of their publication in print. Once an accepted manuscript has been edited, the authors have submitted any final corrections, and all changes have been incorporated, the manuscript will be published online. At that time the manuscript will receive a Digital Object Identifier (DOI) number. Both forms can be found at www.tjh.com.tr. Authors of accepted manuscripts will receive electronic page proofs directly from the printer, and are responsible for proofreading and checking the entire manuscript, including tables, figures, and references. Page proofs must be returned within 48 hours to avoid delays in publication.

CONTENTS

History of Turkish Journal of Hematology

Turkish Journal of Hematology: From “Istanbul Contribution to Clinical Science” to “Pubmed Central” Hamdi Akan, Bengü Timoçin, İpek Durusu, Aytemiz Gürgey

Review Article

β-Thalassemia Intermedia: A Bird’s-Eye View Anthony Haddad, Paul Tyan, Amr Radwan, Naji Mallat, A1i Taher

Research Articles

Evaluation of Red Cell Membrane Cytoskeletal Disorders Using a Flow Cytometric Method in South Iran Habib Alah Golafshan, Reza Ranjbaran, Tahereh Kalantari, Leili Moezzi, Mehran Karimi, Abbas Behzad- Behbahani, Farzaneh Aboualizadeh, Sedigheh Sharifzadeh

Childhood Immune Thrombocytopenia: Long-term Follow-up Data Evaluated by the Criteria of the International Working Group on Immune Thrombocytopenic Purpura Melike Sezgin Evim, Birol Baytan, Adalet Meral Güneş

NPM1 Gene Type A Mutation in Bulgarian Adults with Acute Myeloid Leukemia: A Single-Institution Study Gueorgui Balatzenko, Branimir Spassov, Nikolay Stoyanov, Penka Ganeva, Tihomit Dikov, Spiro Konstantinov, Vasil Hrischev, Malina Romanova, Stavri Toshkov, Margarita Guenova

Leukocyte Populations and C-Reactive Protein as Predictors of Bacterial Infections in Febrile Outpatient Children Zühre Kaya, Aynur Küçükcongar, Doğuş Vurallı, Hamdi Cihan Emeksiz, Türkiz Gürsel

FIP1L1-PDGFRA-Positive Chronic Eosinophilic Leukemia: A Low-Burden Disease with Dramatic Response to Imatinib - A Report of 5 Cases from South India Anıl Kumar N, Vishwanath Sathyanarayanan, Visweswariah Lakshmi Devi, Namratha N. Rajkumar, Umesh Das, Sarjana Dutt, Lakshmaiah K Chinnagiriyappa

The Association between Obesity and Insulin Resistance and Anemia and Iron Metabolism: A Single-Center, Cross-Sectional Study Esma Altunoğlu, Cüneyt Müderrisoğlu, Füsun Erdenen, Ender Ülgen, M. Cem Ar

The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity Ayşenur Bahadır, Nilgün Kurucu, Mine Kadıoğlu, Engin Yenilmez

Case Reports

Central Nervous System Involvement of T-cell Prolymphocytic Leukemia Diagnosed with Stereotactic Brain Biopsy: Case Report Selçuk Göçmen, Murat Kutlay, Alev Erikçi, Cem Atabey, Özkan Sayan, Aptullah Haholu

Epstein-Barr Virus-Negative Post-Transplant Lymphoproliferative Diseases: Three Distinct Cases from a Single Center Şule Mine Bakanay, Gülşah Kaygusuz, Pervin Topçuoğlu, Şule Şengül, Timur Tunçalı, Kenan Keven, Işınsu Kuzu, Akın Uysal, Mutlu Arat

A Polymorphism in the IL-5 Gene is Associated with Inhibitor Development in Severe Hemophilia A Patients İnanç Değer Fidancı, Bülent Zülfikar, Kaan Kavaklı, M. Cem Ar, Yurdanur Kılınç, Zafer Başlar, Server Hande Çağlayan

A-IX

Serum Level of Lactate Dehydrogenase is a Useful Clinical Marker to Monitor Progressive Multiple Myeloma Diseases: A Case Report Hava Üsküdar Teke, Mustafa Başak, Deniz Teke, Mehmet Kanbay

Isolated Granulocytic Sarcoma of the Breast after Allogeneic Stem Cell Transplantation: A Rare Involvement Also Detected by 18FDG-PET/CT Eren Gündüz, Meltem Olga Akay, Mustafa Karagülle, İlknur Sivrikoz Ak

Letters to the Editor

Acute Myocardial Infarction after First Dose of Rituximab Infusion Ajay Gogia, Sachin Khurana, Raja Paramanik

An Updated Review of Abnormal Hemoglobins in the Turkish Population Nejat Akar

Lenalidomide-Induced Pure Red Cell Aplasia Tuphan Kanti Dolai, Shyamali Dutta, Prakas Kumar Mandal, Sandeep Saha, Maitreyee Bhattacharyya

101

Early Postnatal Hemorrhagic Shock Due to Intraabdominal Hemorrhage in a Newborn with Severe Hemophilia A Sara Erol, Banu Aydın, Dilek Dilli, Barış Malbora, Serdar Beken, Hasibe Gökçe Çınar, Ayşegül Zenciroğlu, Nurullah Okumuş

103

Severe Adenovirus Infection Associated with Hemophagocytic Lymphohistiocytosis Ferda Özbay Hoşnut, Figen Özçay, Barış Malbora, Şamil Hızlı, Namık Özbek

106

107

109

Chronic Myeloid Leukemia as a Secondary Malignancy Following Treatment of Diffuse Large B-Cell Lymphoma Itır Şirinoğlu Demiriz, Emre Tekgündüz, Sinem Civriz Bozdağ, Fevzi Altuntaş

Images in Hematology Cystinosis: Diagnostic Role of Bone Marrow Examination Shahla Ansari, Ghasem Miri-Aliabad, Yousefian Saeed Deviation from Normal Values of Leukocyte and Erythroblast Parameters in Complete Blood Count Is a Messenger for Platelet Abnormalities Cengiz Beyan, Kürşat Kaptan

MRI in Hematology Intrathecal Methotrexate-Induced Posterior Reversible Encephalopathy Syndrome (PRES) İntratekal Metotreksat Tülay Güler, Özden Yener Çakmak, Selami Koçak Toprak, Seda Kibaroğlu, Ufuk Can

A-X

History of Turkish Journal of Hematology DOI: 10.4274/Tjh.31.01

Turkish Journal of Hematology: From “Istanbul Contribution to Clinical Science” to “Pubmed Central” Turkish Journal of Hematology: “İstanbul Contribution To Clinical Science”’dan “Pubmed Central”’a Hamdi Akan, Bengü Timoçin, İpek Durusu, Aytemiz Gürgey

Ord. Prof. Erich Frank We respectfully commemorate Prof. Dr. Erich Frank, who pioneered landmark advances in Turkish medicine and established the predecessor of the Turkish Journal of Hematology, on the 130th anniversary of his birth (18841957) (Figure 1). Dr. Frank completed his doctorate in Strasburg after graduating from the Breslau University School of Medicine and earned the title of professor in 1919. Oscar Minkowski, who was the most influential among his teachers, directed him toward clinical and experimental medicine. Throughout his life, Dr. Frank evaluated clinical and laboratory studies, defined entities such as essential thrombocytopenia, and led the discovery of synthalin, the precursor of oral anti-diabetics. He was a very well-known and respected scientist on an international scale, receiving an invitation from the United States for the original studies that he conducted. Along with publications related to many other diseases, he concentrated his studies on diabetes, hypertension, and hematologic disorders. He suffered in the early 1930s in Germany as pressure was being applied to people of Jewish descent. Upon recommendations by Mustafa Kemal Atatürk, universities in Turkey were reformed in 1933, ten years after the establishment of the modern Turkish Republic. While Turkish universities were striving to adopt Western standards of learning and a contemporary level of education, scientists of Jewish origin in Europe were

simultaneously preparing to leave their countries [1]. Turkey embraced these scientists who were facing persecution at home and work permits were granted to about 100 faculty members and assistants in various scientific branches [2]. Dr. Frank, one such scientist, came to Turkey in 1934 and began to work as director of second Internal Clinic in Istanbul University School of Medicine’s (Vakıf Gureba Hospital). Dr. Frank made much progress in internal medicine during the 23-year period from his arrival in Turkey to his death (19341957) [3]. Patients received modern treatment services and clinical research was done. The students that he taught, who later became faculty members themselves, praised Dr. Frank’s courses and legendary conferences. One of Dr. Frank’s most important services was unquestionably the establishment of the medical journal Istanbul Contribution to Clinical Science, first published in 1951 in English, German, and French. The first four volumes were also published in Turkish under the title of Klinik İlmi. The journal initially focused on advancements in internal medicine. After Dr. Frank’s death, during the period in which Prof. Orhan Ulutin was the longterm (1962-2002) editor, studies began to be published with a primary focus on the hematologic sciences. Prof. Ulutin (1924-2011) worked in Frank’s clinic and laboratory. He was interested in hematology, particularly qualitative platelet disorders and coagulation factors, and he founded the

Address for Correspondence: Hamdi Akan, M.D., Ankara University School of Medicine, Department of Hematology, Ankara, Turkey E-mail: hamdiakan@gmail.com Received/Geliş tarihi : April 20, 2013 Accepted/Kabul tarihi : August 1, 2013

Turk J Hematol 2014;31:1-4

Akan H, et al: Turkish Journal of Hematology: From “Istanbul Contribution To Clinical Science” To “Pubmed Central”

Department of Hematology in the Internal Clinic of Istanbul University in 1963. Ulutin and his colleagues established the Turkish Society of Hematology in 1967. The journal then became the official publication of that association in 1971, under the name of New Istanbul Contribution to Clinical Science. It was indexed in Index Medicus between 1965 and 1982 until the last volume, Volume 13 [4]. The name of the journal was changed to Turkish Journal of Hematology in 1995. Dr. Frank was committed to Turkey during his lifetime and he became a Turkish citizen. After the Second World War, he received brilliant offers from American and German universities because of his scientific capability and creativity, but he declined these opportunities, stating that: “While I was experiencing the bitter astonishment of being thrown out from my country, only Turkey opened its arms and embraced me. This is my country, and I cannot show ingratitude”. Dr. Frank was buried with a state funeral in the Istanbul Aşiyan Cemetery according to his wishes after he passed away in 1957. Prof. Dr. Orhan Ulutin, who had been Dr. Frank’s assistant, gave a conference in 2006 entitled “The Place of Prof. Dr. Erich Frank in the World of Science and His Contributions to Turkish Medicine” and then prepared a book including other information about Dr. Frank [5]. THE JOURNAL NOW The Turkish Journal of Hematology (TJH) is published quarterly by the Turkish Society of Hematology. It is an independent, non-profit, peer-reviewed international English-language periodical encompassing subjects relevant to hematology. The Editorial Board of TJH adheres to the principles of the World Association of Medical Editors (WAME), International Council of Medical Journal Editors (ICMJE), Committee on Publication Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT), and Strengthening the Reporting of Observational Studies in Epidemiology (STROBE). The aim of TJH is to publish original hematological research of the highest scientific quality and clinical relevance. Additionally, educational material, reviews on basic developments, editorial short notes, case reports, images in hematology, and letters from hematology specialists and clinicians covering their experience and comments on hematology and related medical fields as well as social subjects are published (Table 1 and Table 2). TJH is indexed as follows: • PubMed Central (August 2013) • ProQuest (2010) • Science Citation Index Expanded (March 2009) • CINAHL (2008) • Gale/Cengage Learning (2008) • EBSCO (2008) • DOAJ (2008) • TÜBİTAK/ULAKBİM Turkish Medical Database (2008) 2

• Scopus (2007) • EMBASE (1999) • Index Copernicus (1999) Table 1. Manuscripts submitted to the Turkish Journal of Hematology.

Year

Total

Accepted

Rate

2006

84%

2007

68%

2008

105

50%

2009

162

45%

2010

198

39%

2011

202

41%

2012

214

37%

2013

432

125

29%

Table 2. Details of the manuscripts submitted and published between January 2012 and November 2013 (2 years).

Manuscript Type

Total

Brief Reports Case Reports Commentaries Images in Hematology

11 154 2 28

Invited Reviews Letters to the Editor

11 88

Original Articles Total

231 585

Accepted

197

The journal is published by Galenos and online manuscript submission is done via the Thomson-Reuters Scholar One system. The journal has a wide readership and currently receives manuscripts from roughly 40 different countries around the world. The total number of reviewers in 2013 was 3355. Past and current editors are: 1951-1957: Prof. Dr. Erich Frank 1962-2002: Prof. Dr. Orhan Ulutin 2002-2005: Prof. Dr. Hamdi Akan 2006-present: Prof. Dr. Aytemiz Gurgey Turkish Journal of Hematology and Open Access Since the Internet has become a cornerstone of academic life, new concepts have accordingly been introduced to our daily life, such as “open access”. Enormous amounts of information that we never had the chance to reach in the past

Akan H, et al: Turkish Journal of Hematology: From “Istanbul Contribution To Clinical Science” To “Pubmed Central”

can now be accessed immediately, and this has brought about new opportunities in medical journalism. Open access is not only a concept but also a movement. Open access in terms of literature is defined as “free availability on the public internet, permitting any users to read, download, copy, distribute, print, search, or link to the full texts of these articles, crawl them for indexing, pass them as data to software, or use them for any other lawful purpose, without financial, legal, or technical barriers other than those inseparable from gaining access to the internet itself” [6]. This movement first started in Budapest, followed by Bethesda and Berlin. Although the open access movement also covers music and book publishing, these areas depend on their financial structures, limiting their borders of open access. While these industries can only survive by financial expansion, this is not the case for medical journals. Most of the time, the only expense related to online publishing is limited to the server cost, domain name, and salaries for personnel. The automation in on-line publishing makes the process very easy and very cost-effective, reducing manpower and time. The number of journals available with open access is increasing rapidly and the availability of gold and green open access copies by scientific discipline is shown in Table 3 [7]. Open access brought about radical changes in medical journals. The availability of medical journals on the Internet made it possible to reach contents directly from the web pages of the journals, from the domains of publishing companies such as Springer Link or Elsevier, or from journal depositories. In this way, the limited number of readers of a journal increased exponentially. The most important improvement in this area was the addition of PubMed Central (PMC) to the National Library of Medicine; this index became the main repository for journals published online [8]. PMC was launched in 2000 and is a free archive of biomedical and life sciences journal literature. Although the standard

Table 3. Publication bias of included nested case-control studies analysed by funnel plot.

Turk J Hematol 2014;31:1-4

Figure 1. Prof. Dr. Erich Frank (1885-1957) criteria for indexing medical journals are also valid here, an additional requirement is the sending of the articles in a required format (mostly XML or SGML). The Directory of Open Access Journals (DOAJ) is a good example of such repositories [9]. Not only PubMed but also other indexes are covered here. If we look at the number of journals in the DOAJ according to the country of origin, we see that Turkey is the 12th country on the list (Table 4) [9]. Interestingly, Iran is the 11th country on the list. This can be explained by the fact that all Iranian biomedical journals (n=163) have an open access mode [10]. In South Korea, one-third of the open access medical journals are archived in PMC [9]. Some privileged journals such as the BMJ and PLOS have a very significant online impact. Although a journal being indexed in PMC does not necessarily mean that it is also indexed in Medline, all PMC journals can be reached in PubMed. The reason for this is that PubMed covers: 1) MEDLINE indexed journals, 2) journals/manuscripts deposited in PMC, and 3) the NCBI Bookshelf [6]. During the transition of TJH to an international journal in the 1990s, main targets were to become an open access journal and to be indexed in the major databases. The first target was achieved in a short time, followed by indexing in various indexes such as the Science Citation Index Expanded, EMBASE, Scopus, CINAHL, Gale/ Cengage Learning, EBSCO, DOAJ, ProQuest, Index Copernicus, and the TÜBİTAK/ULAKBİM Turkish Medical Database [11]. During this process, TJH was one of the first medical journals in Turkey to publish on the Internet with the full text of articles available to readers. TJH made its first application to PMC immediately in 2000, as soon as PMC was launched. At that time, technical difficulties obstructed the path, but in 2013, TJH became indexed in PMC. TJH is the third journal indexed from Turkey and this number is increasing. Although this is a good 3

Turk J Hematol 2014;31:1-4

Akan H, et al: Turkish Journal of Hematology: From “Istanbul Contribution To Clinical Science” To “Pubmed Central”

Table 4. Publication bias of included nested case-control studies analysed by funnel plot.

Country

Total number of journals in DOAJ 2002 2003 2004 2005

2006 2007 2008

2009

2010 2011

2012

2013

1- United States 2- Brazil 3- India 4- United Kingdom 5- Spain 6- Egypt 7- Germany 8- Romania

15 0 0 5 0 3 4 0

196 7 13 110 5 3 16 4

275 123 29 151 21 4 36 5

353 168 42 188 79 8 70 5

401 213 57 222 125 16 96 12

473 262 73 253 150 33 127 17

593 331 95 284 212 61 153 28

667 372 142 339 238 127 176 64

799 502 268 454 312 158 211 142

1008 630 356 498 383 284 239 210

1098 771 450 563 432 350 256 243

1249 923 651 633 507 415 349 302

9- Italy

135

183

220

285

10- Canada

123

168

210

244

276

11- Iran

116

163

260

12- Turkey

128

172

202

258

13- Colombia

107

140

199

241

14- France

110

128

167

184

15- Poland

124

140

171

achievement, compared to countries such as South Korea, India, or Iran, there is still a long way to go. One-third of the open access medical journals in South Korea are also indexed in PMC. This is also true for India, where nearly all biomedical journals are open access and some have found their way into PMC [10]. Supporting open access journalism is also an accepted strategy in developed countries such as the United Kingdom. In the UK, the government adopted a national strategy in 2012 that supports research funds for open access publishing. Despite these achievements, there are also problems with open access journals. The main criticism is directed toward the peer-review process. A recent paper published in the 4 October 2013 volume of Science [12] underlines one such important problem. Three hundred and four versions of a fake, non-existent study were sent to open access journals and nearly half of these peer-review journals accepted the study with minor or no revisions. This shows that as the stress of publishing online journals increases, the quality of the peer-review process decreases. Of course, this problem may also exist for non-open access journals. Another problem in open access journalism is the fee charged for manuscripts to be published. It looks as if the pressure on medical doctors for publishing new articles opened an avenue for financial benefit among companies that own or host open access journals. In the medical sciences, open access is a revolutionary approach to sharing and distributing research, development, and innovation, provided that strict rules for quality control are maintained all throughout the process. TJH now fulfills this requirement and is proud to be a member of the open access community. References 1. Önsöz Z. Türkiye’ye sığınan Almanlar (Asylum-seeking Germans in Turkey). Available at www.zekionsoz.com, posted on 16 September 011. 4

2. Aksel S. Soykırımdan kaçan Yahudi Hocalar Türkiye’ye sığındı (Jewish academicians running away from genocide take shelter in Turkey). Available at http://blog.radikal. com.tr/Sayfa/soykirimdan-kacan-yahudi-hocalar-turkiyeyesigindi-27309, posted on 10 July 2013. 3. Sever SM, Namal A, Eknoyan G. Erich Frank (18841957): Unsung pioneer in nephrology. Am J Kidney Dis 2011;58:654-665. 4. May H. Yayıncının süreli yayına katkısı (Contribution of the publisher to periodicals). Sağlık Bilimlerinde Süreli Yayıncılık Ulusal Sempozyumu, 28 March 2003, Ankara. Available at http://www.ulakbim.gov.tr/dokumanlar/ sempozyum1/, accessed on 19 November 2013. 5. Ulutin ON. Ord. Prof. Dr. ERICH FRANK’ın dünya tıbbındaki yeri ve Türk tıbbına katkıları (The place of Ord. Prof. ERICH FRANK in the medical world and contribution to Turkish medicine). Istanbul, Istanbul Üniversitesi Istanbul Tıp Fakültesi Deontoloji ve Tıp Tarihi Anabilim Dalı Yayın Serisi, 2007. 6. Suber P, Open Access Overview, Richmond, IN, USA, Earlham College, 2013. Available at http://legacy.earlham. edu/~peters/fos/overview.htm, accessed on 12 March 2013. 7. Björk BC, Welling P, Laakso M, Majlender P, Hedlund T, Gunason G. Open access to the scientific journal literature: situation 2009. PLoS One 2010;5:11273. 8. US National Library of Medicine. PMC Overview. Available at http://www.ncbi.nlm.nih.gov/pmc/about/intro/, accessed on 11 September 2013. 9. DOAJ. Directory of Open Access Journals. Available at http:// www.doaj.org/, accessed on 13 October 2013. 10. Gasparyan AY, Ayvazyan L, Kitas GD. Open access: changing global science publishing. Croat Med J 2013;54:403-406. 11. Turkish Journal of Hematology. Available at http://www.tjh. com.tr, accessed on 13 October 2013. 12. Bohannon J. Who’s afraid of peer review? Science 2013;342:60-65.

DOI: 10.4274/Tjh.2014.0032

Review

β-Thalassemia Intermedia: A Bird’s-Eye View β-Talasemi İntermedya: Kuşbakışı Anthony Haddad1, Paul Tyan2, Amr Radwan1, Naji Mallat1, A1i Taher1 1American

University of Beirut Medical Center, Department of Internal Medicine, Beirut, Lebanon

2American

University of Beirut Faculty of Medicine, Department of Physiology, Beirut, Lebanon

Abstract: Beta-thalassemia is due to a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of a mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end is thalassemia major, characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival. Along the spectrum lies thalassemia intermedia, a term developed to describe patients with manifestations that are neither mild enough nor severe enough to be classified in the spectrum’s extremes. Over the past decade, our understanding of β-thalassemia intermedia has increased tremendously with regards to molecular information as well as pathophysiology. It is now clear that β-thalassemia intermedia has a clinical presentation as well as complications associated with the disease that are different from those of β-thalassemia major. This review is designed to tackle issues related to β-thalassemia intermedia from the basic definition of the disease to paramedical issues, namely the quality of life in these patients. Genetics and pathophysiology are revisited, as well as the complications specific to this disease. These complications include effects on several organ systems, including the cardiovascular, hepatic, endocrine, renal, brain, and skeletal systems. Extramedullary hematopoiesis is also discussed in this article. Risk factors are highlighted and cutoffs are identified to minimize morbidities in β-thalassemia intermedia. Several treatment modalities are considered by shining a light on the pros and cons of each modality, as well as the role of special pharmacological agents in the progress of the disease and its morbidities. Finally, health-related quality of life is discussed in these patients with a direct comparison to the more severe β-thalassemia major. Key Words: Thalassemia, Thalassemia intermedia, Iron chelation, Ineffective erythropoiesis, Iron overload

Özet: Beta talasemi beta globin zincirlerinin sentezindeki defekt sonucu gelişen alfa/beta dengesizliği, inefektif eritropoez ve kronik aneminin sonucudur. Talasemi spektrumu geniş olup, bir uçta hiçbir klinik bulgusu olmayan bireyler varken, diğer uçta bulunan talasemi majorlu hastalar hayatın birinci yılında derin anemi ve hayatta kalabilmek için düzenli transfüzyon gereksinimi ile karakterize şekilde ağır seyirli olabilir. Bu iki ucun arasında ise talasemi major hastaları kadar ağır olmayan, ancak çok da hafif bir seyir göstermeyen hastaları tanımlamada talasemi intermedia terminolojisi kullanılmaktadır. Son on yılda β-talasemi intermedianın moleküler genetiği ve patofizyolojisi hakkındaki bilgilerimiz hızla artmıştır. β-talasemi intermedianın, β-talasemi majorden farklı, kendine özgü klinik başvuru özellikleri ve komplikasyonları olduğu netlik kazanmıştır. Bu derlemede β-talasemi intermedianın temel tanımlamalarından hastaların yaşam kalitesi gibi paramedikal konulara kadar meseleler ele alınmıştır. Genetiği, patofizyolojisi ve bu hastalığa özgü komplikasyonlarına değinilmiştir. Bu komplikasyonlar arasında kardiovasküler, hepatik, endokrin, renal, beyin ve kemiklerle ilgili olanlar vurgulanmıştır. Ekstramedüller hematopoez de bu makalede tartışılmıştır. Risk faktörleri özellikle vurgulanmış ve β-talasemi intermedialı hastalarda morbiditeleri minimuma indirebilmek için kritik eşik değerler belirtilmiştir. Değişik tedavi yaklaşımlarının iyi ve kötü taraflarına ışık tutulmaya çalışılmış ve bazı spesifik farmakolojik ajanların hastalığın progresyonu ve morbiditeleri üzerine etkisi tartışılmıştır. Son olarak bu hastalardaki sağlık ilişkili yaşam kalitesi, çok daha ağır seyirli β-talasemi majorlu hastalardaki ile karşılaştırılmıştır. Anahtar Sözcükler: Talasemi, Talasemi intermedya, Demir şelasyonu, İnefektif eritropoez, Demir yükü Address for Correspondence: Ali Taher, M.D., American University of Beirut Medical Center, Department of Internal Medicine, Beirut, Lebanon Phone: +961 1 350000 E-mail: ataher@aub.edu.lb Received/Geliş tarihi : January 23, 2014 Accepted/Kabul tarihi : February 17, 2014

Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View

Turk J Hematol 2014;31:5-16

Introduction The first reports of thalassemic disorders date back to as early as 1925. The first cases were described in the pediatric population among subjects with anemia, peculiar facies, and other bony changes. The constellation of symptoms led to the hypothesis of a single disease entity back then [1]. Later on, the term “thalassemia” was coined by George Whipple [2]. Throughout the years, research focused on genetics and pathophysiology, and the theory of imbalance in globin chain production as a major culprit was revealed after Sir David Weatherall used labeled reticulocytes with radioactive amino acids to prove the defective production of alpha and beta chains [3,4,5]. Despite that theory being postulated a while ago, this pioneering work led to the modern definition of beta-thalassemia. It is nowadays considered as a defect in the synthesis of the beta-globin chains, leading to alpha/beta imbalance, ineffective erythropoiesis, and chronic anemia [6]. The diversity of the phenotypes in thalassemia make it diagnostically challenging. The spectrum of thalassemias is wide, with one end comprising thalassemia minor, which consists of mild hypochromic microcytic anemia with no obvious clinical manifestations, while on the other end thalassemia major is characterized by patients who present in their first years of life with profound anemia and regular transfusion requirements for survival [7]. In the middle lies thalassemia intermedia (TI), a term developed to describe patients with manifestations too mild to be considered thalassemia major and too severe to be called thalassemia minor. It was first used by Sturgeon, who suggested the term for those who fit into this category [8]. TI belongs to the non-transfusion-dependent thalassemia (NTDT) group, which also includes hemoglobin E/β-thalassemia and α-thalassemia intermedia (hemoglobin H disease). NTDTs extend from sub-Saharan Africa to the Mediterranean region and are also present in South and Southeast Asia. Despite a decreasing worldwide trend in the past few years, especially among the Mediterranean population,

where prevalence and carrier rates were considerably high, thalassemias still remain a major public health burden [9]. Genetics: Grasping the Concept Despite the considerable knowledge gained from research about TI in the past few years, diagnosis is still made on clinical grounds. The wide clinical spectrum of beta-thalassemia intermedia entails a wide range of presentations. Some patients remain asymptomatic for most of their lives with hemoglobin levels ranging between 7 and 10 g/dL, while others present during childhood and require transfusions for normal sustained growth (Table 1) [10]. One of the fundamental concepts of hematology is the fact that an equal number of alpha and beta chains should be present for proper hemoglobin physiology. While betathalassemia major arises from the total absence of the beta chains, TI arises from defective gene function leading to partial suppression of beta-globin protein production. It usually results from a homozygous or a compound heterozygous mutation [11]. In some instances, only one gene may be affected, making it dominantly inherited [12]. In most cases, the reason behind the milder phenotype of TI as compared to thalassemia major usually results from the interplay among 3 different mechanisms. The first is the inheritance of a mild or silent beta-chain mutation, which keeps a low level of beta chains, as opposed to its absence in more severe cases making less of an alpha/beta imbalance. The second is the inheritance of determinants associated with increased gamma chain production, which pair with unbound alpha chains. The third is the co-inheritance of alpha-thalassemia, which decreases the number of unpaired chains due to decreased alpha chain synthesis [13]. It is possible to inherit a triplicated or quadruplicated alpha genotype with beta heterozygosity and have a TI phenotype as a result. Many other factors come into play, with polymorphisms affecting bone, iron, and bilirubin metabolism affecting the disease. They are grouped under the umbrella of tertiary modifiers.

Table 1. Characteristics and manifestations of β-thalassemia intermedia.

Hemoglobin level

7-10 g/dL

HPLC electrophoresis

HbA2 > 4% HbF 10%-50%

Molecular characteristics

Mild/silent mutation Co-inheritance of α-thalassemia may be present Hereditary persistence of HbF, δβ-thalassemia, Gγ XMN1 polymorphism

Pertinent findings on physical exam

Splenomegaly Moderate to severe hepatomegaly Growth retardation Expansion of facial bones Obliteration of maxillary sinuses Protrusion of lower jaw

Haddad A, et al: Î˛-Thalassemia Intermedia: A Birdâ&#x20AC;&#x2122;s-Eye View

Pathophysiology The hemoglobin molecule being usually composed of 2 alpha chains and 2 beta chains, any imbalance in the coupling of these fragments will naturally lead to an abnormal physiology, as equal alpha and beta chains need to be present for proper function. In beta-thalassemia in general, the absence or underproduction of the beta chain causes an imbalance with excess alpha chains deposited inside red blood cells. The latter process leads to oxidative damage to the membranes and eventually cell lysis [14]. This sequence of events is behind the concept of ineffective erythropoiesis. The resulting extra medullary hematopoiesis and marrow hypertrophy lead to expansion of the facial bones and obliteration of the maxillary sinuses, causing protrusion of the upper jaw and the peculiar

Turk J Hematol 2014;31:5-16

thalassemic facies. It may also cause cortical thinning and pathologic fractures in long bones [15,16,17]. The resulting anemia is a consequence of ineffective erythropoiesis; however, hemolysis, in addition to being a contributor to the anemia, also has a role in other outcomes. Chronic anemia eventually leads to a state of continuous iron absorption, leading to iron overload and all of its resulting complications (cardiac, hepatic, endocrine, etc.). The triad of ineffective erythropoiesis, chronic anemia, and iron overload is at the heart of all morbidities related to TI. a contributor to the anemia, also vhas a role in other Complications When TI patients were compared to thalassemia major patients, many complications exclusive to TI suddenly

Indications for transfusion Occasional

Infections l Pregnancy l Surgery l

More regular

Poor growth and development during Childhood l Prevention/management of specific complications (mentioned earlier) l

Figure 1. Indications for transfusion.

Figure 2. Algorithm for iron chelation Abbreviations: NTDT: non-transfusion dependent thalassemia, LIC: liver iron concentration, SF: serum ferritin, DFX: deferasirox.

Haddad A, et al: Î˛-Thalassemia Intermedia: A Birdâ&#x20AC;&#x2122;s-Eye View

Turk J Hematol 2014;31:5-16

surfaced. At the heart of these complications lies the triad of chronic anemia, ineffective erythropoiesis, and iron overload [18,19,20,21,22]. It is important to grasp a solid understanding of these complications in order to tailor management accordingly. A brief summary of the complications is provided in Figure 1, followed by specific complications and management in Table 2. Hepatobiliary Complications The accelerated hemolysis that occurs because of the instability in red blood cells leads to the formation of gallstones. For this reason, any symptomatic gallstone should be treated by a cholecystectomy. One additional consideration

is the need to inspect the gallbladder in any patient who is undergoing splenectomy and consider intervention, since cholecystitis may be life-threatening in any splenectomized patient [23]. Since the majority of iron accumulation is in the liver in TI patients, there is an increased risk, mainly in non-chelated patients, of developing complications such as fibrosis, cirrhosis, and eventually hepatocellular carcinoma. This risk has been shown to be evident with higher iron loads and increased serum ferritin. Case reports from Lebanon and Italy have suggested a link between hepatocellular carcinoma and liver iron loading in hepatitis C-negative patients with TI [24,25].

Table 2. Specific complications of thalassemia intermedia and their management.

Specific Complication

Management

Disease related or Iron and Disease related

Pulmonary Hypertension

Sildenafil citrate, bosentan (small studies suggest moderate benefit)

Iron and Disease related

Extramedullary haemopoietic pseudotumors

Radiation Surgery Hydroxyurea Transfusion

Disease related

Bone Disorders

Calcium and Vitamin D suppleDisease related metation, other preventive measures Bisphosphonates- Practice dependent

Endocrinopathies

Hormonal therapy as with Î˛-TM Proper Iron chelation

Thrombosis and cerebrovascular disease

Risk-assesment models Acetyl salicylic acid or anti-platelets for thrombocytosis LMWH for previous thrombosis

Leg ulcers

Hypertransfusion Supportive measures; Topical GF, Pentoxyfylline, zinc supplementation, leg elevation

Iron and Disease related

Cholelithiasis

Cholecystectomy

Disease related

Splenomegaly

Splenectomy when indicated

Disease related

Iron Overload

Proper Iron chelation with regular monitoring

Iron and Disease related

Liver complications (fibrosis, cirrhosis, cancer)

Adequate transfusion regimen to avoid hepatitis Adequate iron chelation Adequate monitoring for malingnancy

Iron and Disease related

TM: Thalassemia major, LMWH: low-molecular-weight heparin, GF: growth factor.

Iron and Disease related

Turk J Hematol 2014;31:5-16

Haddad A, et al: Î˛-Thalassemia Intermedia: A Birdâ&#x20AC;&#x2122;s-Eye View

Extramedullary Hematopoiesis Extramedullary hematopoiesis is a physiological compensatory phenomenon occurring because of insufficient bone marrow function that becomes unable to meet circulatory demands [26]. Its occurrence in chronic hemolytic anemias remains highest, particularly in transfusion-independent TI [26,27]. Almost all body sites may be involved, including the spleen, liver, lymph nodes, thymus, heart, breasts, prostate, broad ligaments, kidneys, adrenal glands, pleura, retroperitoneal tissue, skin, peripheral and cranial nerves, and spinal canal [28,29,30,31,32]. These sites are thought to normally engage in active hematopoiesis in the fetus during gestation. The incidence of extramedullary hematopoiesis in patients with TI may reach up to 20% compared to polytransfused TM patients, for whom the incidence remains 1% [26,33,34]. A paraspinal location for the hematopoietic tissue occurs in 11%-15% of cases with extramedullary hematopoiesis [27,35]. Paraspinal extramedullary hematopoiesis mainly presents as pseudo-tumors, which may cause a variety of neurological symptoms due to spinal compression. However, it is thought that more than 80% of cases may remain asymptomatic, and the lesions are usually discovered incidentally by radiological techniques [36,37,38]. The male-to-female ratio reaches 5:1 [39]. Various clinical presentations have been reported, including back pain, lower extremity pain, paresthesia, abnormal proprioception, exaggerated or brisk deep tendon reflexes, Babinski response, LasĂ¨gue sign, paraparesis, paraplegia, ankle clonus, spastic gate, urgency of urination, and bowl incontinence [40]. Leg Ulcers Leg ulcers are a common complication of TI, occurring in as many as one-third of patients with untreated or poorly controlled disease. They usually appear in the second decade of life and are generally located on the medial or lateral malleoli. The ulcers emerge after minor trauma and tend to expand rapidly [41]. They are slow to heal and tend to recur or become chronic, causing severe pain, disability, and esthetic problems that are difficult to manage for both patients and physicians [42]. The etiology of thalassemic leg ulcers seems to be multifactorial, with the main pathogenic mechanism appearing to be tissue hypoxia secondary to the anemia and the high affinity of fetal hemoglobin for oxygen [43]. Others factors contributing to ulcer formation include: a) Abnormal rheological behavior of the diseased erythrocytes characterized by increased rigidity of their cellular membrane and enhanced adherence to endothelial cells, b) Local edema due to venous stasis and possibly right heart insufficiency, c) Repetitive local trauma and skin infections,

d) Hypercoagulability and prothrombotic tendency [44]. A Hypercoagulable State The largest epidemiological study to date analyzed data from 8860 thalassemia patients (6670 with thalassemia major and 2190 with TI) and demonstrated that thromboembolic events (TEEs) occurred 4.38 times more frequently in TI than in thalassemia major patients [45]. The hypercoagulability in TI has been attributed to several factors, including a procoagulant activity of hemolyzed circulating red blood cells, increased platelet activation, coagulation factor defects, depletion of antithrombotic factors, and endothelial inflammation, among others [46]. These factors have been observed at a higher rate in splenectomized patients [46]. Clinical studies also confirmed that splenectomized TI patients have a higher incidence of TEE than non-splenectomized controls [45,47,48,49]. In the OPTIMAL CARE study, 73/325 (22.5%) splenectomized patients developed TEEs compared with 9/259 (3.5%) nonsplenectomized patients (p<0.001) [47]. A study indicated that splenectomized TI patients who develop TEE are characterized by high nucleated red blood cell and platelet counts, and they are more likely to have evidence of pulmonary hypertension (PHT) and be transfusion-naive. Moreover, high nucleated red blood cell and platelet counts as well as transfusion naivety are associated with earlier development of TEEs following splenectomy [50]. Silent Brain Infarcts Although strokes are uncommon in TI patients, one study showed that 37.5% of patients with TI have evidence of silent brain infarction on magnetic resonance imaging (MRI) [51]. More recently, in a study done on 30 splenectomized adults with TI, the rate of silent brain infarction was as high as 60% and it involved the subcortical white matter in all patients [52]. Recent studies have also documented a high prevalence of silent brain infarction, large cerebral vessel disease, and decreased neuronal function primarily in the temporal and parietal lobes in splenectomized adults with thalassemia intermedia [53]. There was a significant association between the occurrence of large-vessel cerebrovascular disease and high non-transferrin bound iron (NTBI) levels [54], and decreased neuronal function was observed more frequently in patients with a liver iron concentration (LIC) above 15 mg Fe/g DW [55]. Pulmonary Hypertension Hemolysis is believed to play a key role in the development of PHT in TI patients. It has been shown that chronic hemolysis leads to nitric oxide depletion due to nitric oxide scavenging, arginine catabolism, and endogenous nitric oxide synthesis inhibition, as well as to enhanced platelet activation and increased endothelin-1 release [56,57]. All of those events in turn lead to a vasculopathy 9

Turk J Hematol 2014;31:5-16

characterized by endothelial dysfunction, increased vascular tone, inflammation, hypercoagulability, and, finally, vascular remodeling and destruction of the pulmonary vasculature, which ultimately results in hemolytic anemia-associated PHT [56,58]. Autopsies of a large series of patients with TI revealed thrombotic lesions in the pulmonary arteries, which may have been due to circulating platelet aggregates [59]. Similar findings of multiple microthrombi, which were composed mainly of platelets, were seen in the pulmonary arterioles and microcirculation in autopsies of 2 splenectomized patients with thalassemia [60]. A high rate of PHT in splenectomized TI patients has been documented and attributed to a chronic thromboembolic state [61,62]. Moreover, elevated levels of circulating red blood cell-derived microparticles were detected in splenectomized patients with TI [63]. Whether they contribute to the development of PHT in this patient population warrants evaluation. A recent study by Derchi et al. established for the first time the presence of PHT by right heart catheterization in thalassemic patients. It also showed that the prevalence was higher in TI patients compared to those with thalassemia major [64]. Renal Complications Different renal cell types have different resistances to the decrease of oxygen supply [65]. In vitro and animal models have shown that hypoxia may cause apoptosis of tubular and endothelial cells [66,67,68]. Other in vitro studies showed that hypoxia can induce a fibrogenic phenotype. A final result may be represented by activation of fibroblasts and accumulation of an extracellular matrix of resident renal cells [69,70,71,72]. Hence, it is apparent that chronic hypoxia causes proximal tubular cell dysfunction and interstitial fibrosis, which, in the presence of other renal risk factors, may lead to progressive renal disease. Anemia causes renal defects through mechanisms different from those employed in hypoxia. Anemia affects the glomerulus by inducing renal hyper perfusion and glomerular hyper filtration [73,74,75]. The mechanism is thought to be a decrease in systemic vascular resistance and a subsequent increase in renal plasma flow [76]. This may represent a benefit in the short term [77]. However, over the long term, glomerular hyper perfusion may theoretically mediate progressive renal damage, as reported by experimental and clinical data [78]. Thus, it is theoretically possible that persistent anemia, such as that seen in thalassemia major patients, may contribute to a progressive decrease of the glomerular filtration rate [79]. Iron is a source of oxidative stress in biological systems. In thalassemic patients, the increased intracellular content of non-hemoglobin iron generates free oxygen radicals that bind to different membrane proteins, altering the morphology, function, and structure of membrane proteins [80]. Free iron can also directly catalyze lipid peroxidation 10

Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View

by removing hydrogen atoms from the fatty acids that constitute the lipid bilayer of organelles [81]. Iron Overload Three main factors are responsible for the clinical sequelae of TI: ineffective erythropoiesis, chronic anemia, and iron overload. Iron overload occurs primarily as a result of increased intestinal iron absorption but can also result from occasional transfusion therapy, which may be required to manage certain disease-related complications [18,19]. The pathophysiology of iron loading in TI appears similar to that observed in patients with hereditary forms of hemochromatosis [56] and is different from that seen in thalassemia major, where there is a predilection for NTBI accumulation. NTBI is a powerful catalyst for the formation of hydroxyl radicals from reduced forms of O2 [20]. Labile or “free” iron can convert relatively stable oxidants into powerful radicals. A recent cross-sectional study of 168 non-chelated patients with TI aimed to establish an association between LIC and a variety of serious morbidities noted in this patient population. Each 1 mg Fe/g DW increase in LIC was significantly associated with an increased risk of thrombosis, pulmonary hypertension, hypothyroidism, hypogonadism, and osteoporosis. LIC values of at least 6-7 mg Fe/g DW discriminated patients who developed morbidity from those who did not [21]. A more recent longitudinal follow-up over a 10-year period confirmed these findings in 52 non-chelated patients with TI, and a serum ferritin level of 800 ng/mL was the threshold above which all patients were at risk of developing morbidity [22]. Management General Considerations One way to approach management of TI is by dividing therapy into 3 broad categories. These include conventional modalities such as transfusion and iron chelation therapy, splenectomy, supportive therapies, and psychological support [82]. The non-conventional methods comprise gene therapy and fetal hemoglobin modulation, while stem cell transplantation remains the only curative and radical treatment. Quality of life in patients with TI has been a topic of interest lately, and it is clear that without any treatment, patients are at risk of experiencing more morbidities and poorer health-related quality of life [83,84,85]. Many of the standards of treatment nowadays are derived from years of experience and the evolving concept of evidencebased medicine. Despite many modalities being available, some of them remain experimental in nature or are at an early investigational stage. The most important ones are transfusion therapy, iron chelation, fetal hemoglobin induction, and stem cell transplantation. Transfusion Therapy Although regular blood transfusions are the cornerstone of medical therapy in beta-thalassemia major, one of the most challenging therapeutic decisions in TI is when to initiate transfusion [86].

Turk J Hematol 2014;31:5-16

Haddad A, et al: Î˛-Thalassemia Intermedia: A Birdâ&#x20AC;&#x2122;s-Eye View

The main factors guiding the decision to transfuse are usually the development of signs and symptoms of anemia including growth failure and development failure. Despite a sporadic need for transfusions in many TI patients in situations such as infection, pregnancy, or surgery, patients should never be committed to a regular transfusion program unless the clinical picture dictates it. The main indications for a regular transfusion program remain growth failure, skeletal deformity, exercise intolerance, and declining hemoglobin levels because of progressive splenomegaly (Figure 1) [86,87,88]. The greatest impact of blood transfusions is in the pediatric group, where, in addition to reversing the anemia, it also carries the risk of alloimmunization. This phenomenon was found to be relatively common if a transfusion regimen was started after 12 months of age [89]. Some authorities recommend Rhesus and Kell phenotyping prior to transfusion [90], with the role of steroids for a short period (3-5 days) in preventing alloimmunization yet to be elucidated. Iron Chelation With transfusion therapy comes another very important consideration, that of iron overload. In addition to the natural iron-absorbing state of NTDT patients, the transfusional iron burden is also significant. In the OPTIMAL CARE study, patients who received both transfusions and chelation therapy had a lower incidence of complications than those who received transfusion alone or no treatment at all [47], hence showing the importance of appropriate therapy. The rate of iron loading in patients who do not receive transfusions is thought to be around 2-5 g/year [91], as opposed to 7.5-15.1 g/year in transfused patients [92]. The challenging matter in NTDT in general is the determination of the appropriate time for the initiation of chelation therapy. In 2008, a study by Taher et al. determined that serum ferritin in TI often underestimates the real iron burden. In comparison with MRI, ferritin was found to underestimate LIC [93]. Later findings emphasized the need for a reliable measure of body iron, and the MRI R2 and R2* showed a valid correlation between liver iron and body iron, becoming the preferred modality to guide therapy [93,94,95]. Until recently, the cutoff for starting chelation was an LIC of 7 mg Fe/g DW or above. A recent study, however,

by Musallam et al. showed that complications were more likely to occur at an LIC of 7 mg Fe/g DW, hence signaling the need to start chelating patients earlier [95]. The latest recommendations by the Thalassemia International Federation advocate LIC of 5 mg Fe/g DW and serum ferritin of 800 Âľg/L (Figure 2). Deferoxamine remains the gold standard in TI but the limitations of its use and its side effects have pushed pharmaceutical industries to look for other options. The main limitations reside in the fact that it needs to be administered either intravenously or subcutaneously, therefore increasing patient discomfort and negatively impacting quality of life [96,97]. Many studies evaluated deferoxamine in TI patients, and in 1988 Pippard and Weatherall concluded that the need for an oral chelator was very important despite deferoxamine delivering promising results in the studied group. Deferiprone (L1, Ferriprox) was the first oral chelator to be made available on the market. Small clinical trials demonstrated effective management of iron levels [98], but the lack of large-scale, placebo-controlled trials on deferiprone made the available data very limited. One of the recent products is deferasirox, an oral chelator with a once-daily dosage. It was developed to provide day-long chelation coverage with a suitable safety and efficacy profile [99,100]. The THALASSA trial was the first multicenter placebo-controlled double-blinded randomized trial to be conducted on TI patients, and it showed a sustained reduction in iron burden with deferasirox [101]. Further studies about its safety and efficacy are still ongoing. The latest new entry to the family of oral chelators was developed by Shire Pharmaceuticals, but it is still at an experimental stage with promising results on the horizon [102,103]. HbF Inducers One postulated mechanism of action of hemoglobin F inducers is based on reducing the imbalance between alphaglobin chains and non-alpha chains [86]. These inducers may in fact increase the expression of gamma chain genes. The rationale behind inducing hemoglobin F is to decrease anemia symptoms and improve the clinical status of patients with TI [104]. In the Middle East, experience with HbF inducers is limited. Large series, however, come from Iran and India, where results have been promising, with some patients becoming completely transfusion-independent [105,106,107].

Table 3. Indications for splenectomy.

Indication

Comment

Poor growth and development due to anemia

Generally avoided in patients less than 5 years old

Hypersplenism

Leucopenia and thrombocytopenia

Splenomegaly

Left upper quadrant pain, massive splenomegaly with concern about rupture 11

Turk J Hematol 2014;31:5-16

Splenectomy All guidelines agree that physicians should adopt a guarded approach and restrict splenectomy to certain indications. Splenectomy should be avoided in children of <5 years of age because of a considerably greater risk of fulminant post-splenectomy sepsis (Table 3). However, until a replacement for splenectomy is recommended through evidence-based guidelines, a large number of TI patients will continue to be splenectomized. These, alongside patients who had already undergone splenectomy, constitute a large proportion of TI patients at risk of TEEs [42]. Major adverse effects of splenectomy are sepsis, TEEs, thrombophilia, pulmonary hypertension, and iron overload. Quality of Life Quality of life among patients with chronic diseases is of utter importance as there is a shift in medicine towards not only treating chronic diseases but also making sure that patients are well engaged and functional in their daily activities. A more specific term describing this state is health-related quality of life (HR-QoL). There is a scarcity of information in the literature when it comes to the evaluation of HR-QoL among β-thalassemia intermedia patients. A study by Musallam et al. compared HR-QoL in 32 adult β-thalassemia intermedia (non-transfused, non-chelated) and 48 β-thalassemia major patients [108]. The only significant difference between the groups was that patients with β-thalassemia major had a significantly longer median duration with a known thalassemia diagnosis while patients with β-thalassemia intermedia had a higher prevalence of multiple complications. This study suggested that a longer duration of known disease led to better adaptation and understanding of the disease’s nature; this could also explain how shorter duration of known disease causes high levels of stress and emotional anxiety [108]. A study that included pediatric patients also showed a higher percentage of children with β-thalassemia intermedia and impaired HR-QoL as compared to children with β-thalassemia major [109]. Another study that focused on patients’ mental health showed that a significant proportion of adult patients with both β-thalassemia major and intermedia showed evidence of depression (Beck Depression Inventory) and anxiety (State-Trait Anxiety Inventory) [109]. The risk of silent cerebral infarcts among these patients should not be excluded as an additional risk factor [110]. Nevertheless, more extensive large multicenter trials should be performed to further solidify our understanding of the patient’s quality of life, its implication on the course of the disease, and the possible ways to improve it. Conclusion Although advances in TI are moving at a fast pace, many complications remain with no treatment guidelines. In

Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View

addition, many of those complications can be prevented or adequately treated when caught at an early stage. This is why a low index of suspicion should be kept in mind. The only way to reduce the public health burden remains premarital screening and adequate genetic counseling. Even if birth rates have been declining in the world and the Middle East, adequate prevention strategies remain key. In addition, immigration patterns in the past few years are making thalassemia in general prevalent in many areas of the world. Novel therapeutic modalities are now emerging (JAK2 inhibitors, hepcidin modulators, apo-transferrin, etc.) and, in addition to the growing experience with hematopoietic stem cell transplants, the coming years may provide us with better outcomes. Most of these new modalities remain at an investigational stage at this point in time. Until they are finalized, it is fortunate that recent research in this field has helped elucidate a big part of what we did not know, therefore preventing fatalities. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Cooley TB, Lee P. A series of cases of splenomegaly in children and peculiar changes in bones; report of cases. Am J Dis Child 1927;34:347-363. 2. Whipple GH, Bradford WL. Mediterranean disease“thalassemia” (erythroblastic anemia of Cooley): associated pigment abnormalities simulating hemochromatosis. J Pediatr 1936;9:279-311. 3. Ingram VM, Stretton AO. Genetic basis of the thalassaemia diseases. Nature 1959;184:1903-1909. 4. Weatherall DJ. Thalassemia: the long road from the bedside through the laboratory to the community. Transfus Med 2011;21:218-223. 5. Weatherall DJ, Clegg JB, Naughton MA. Globin synthesis in thalassaemia: an in vitro study. Nature 1965;208:10611065. 6. Weatherall DJ. The thalassemia syndromes. Tex Rep Biol Med 1980;40:323-333. 7. Rund D, Rachmilewitz E. Beta-thalassemia. N Engl J Med 2005;353:1135-1146. 8. Sturgeon P, Itano HA, Bergren WR. Genetic and biochemical studies of intermediate types of Cooley’s anaemia. Br J Haematol 1955;1:264-277. 9. Cao A, Kan YW. The prevention of thalassemia. Cold Spring Harb Perspect Med 2013;3:a011775. 10. Cappellini MD, Musallam KM, Cesaretti C, Taher A. Disorders of Erythropoiesis, Erythrocytes and Iron Metabolism. Genoa, Italy, Forum Service Editore, 2009.

Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View

11. Galanello R, Cao A. Relationship between genotype and phenotype. Thalassemia intermedia. Ann N Y Acad Sci 1998;850:325-333. 12. Weatherall DJ. Thalassaemia: the long road from bedside to genome. Nat Rev Genet 2004;5:625-631. 13. Camaschella C, Mazza U, Roetto A, Gottardi E, Parziale A, Travi M, Fattore S, Bacchiega D, Fiorelli G, Cappellini MD. Genetic interactions in thalassemia intermedia: analysis of β-mutations, alpha-genotype, gamma-promoters, and β-LCR hypersensitive sites 2 and 4 in Italian patients. Am J Hematol 1995;48:82-87. 14. Olivieri NF. The β-thalassemias. N Engl J Med 1999;341:99109. 15. Cappellini M, Musallam K, Cesaretti C, Taher A. Thalassemia intermedia. In: Disorders of Erythropoiesis, Erythrocytes and Iron Metabolism. Genoa, Italy, Forum Service Editore, 2009. 16. Camaschella C, Cappellini MD. Thalassemia intermedia. Haematologica 1995;80:58-68. 17. Cappellini MD, Cerino M, Marelli S, Fiorelli G. Thalassemia intermedia: clinical aspects and management. Haematologica 2001;86:194-196. 18. Taher A, Hershko C, Cappellini MD. Iron overload in thalassaemia intermedia: reassessment of iron chelation strategies. Br J Haematol 2009;147:634-640. 19. Origa R, Galanello R, Ganz T, Giagu N, Maccioni L, Faa G, Nemeth E. Liver iron concentrations and urinary hepcidin in β-thalassemia. Haematologica 2007;92:583-588. 20. Hershko C. Pathogenesis and management of iron toxicity in thalassemia. Ann N Y Acad Sci 2010;1202:1-9. 21. Musallam KM, Cappellini MD, Wood JC, Motta I, Graziadei G, Tamim H, Taher AT. Elevated liver iron concentration is a marker of increased morbidity in patients with β thalassemia intermedia. Haematologica 2011;96:1605-1612. 22. Musallam KM, Cappellini MD, Daar S, Karimi M, El-Beshlawy A, Taher AT. Serum ferritin levels and morbidity  in beta thalassemia intermedia: a 10-year cohort study [abstract]. Blood 2012;120:1021. 23. Musallam KM, Taher AT, Rachmilewitz EA. β-Thalassemia intermedia: a clinical perspective. Cold Spring Harb Perspect Med 2012;2:a013482. 24. Musallam KM, Motta I, Salvatori M, Fraquelli M, Marcon A, Taher AT, Cappellini MD. Longitudinal changes in serum ferritin levels correlate with measures of hepatic stiffness in transfusion-independent patients with β-thalassemia intermedia. Blood Cells Mol Dis 2012;49:136-139. 25. Maakaron JE, Cappellini MD, Graziadei G, Ayache JB, Taher AT. Hepatocellular carcinoma in hepatitis-negative patients with thalassemia intermedia: a closer look at the role of siderosis. Ann Hepatol 2013;12:142-146. 26. Taher A, Isma’eel H, Cappellini MD. Thalassemia intermedia: revisited. Blood Cells Mol Dis 2006;37:12-20.

Turk J Hematol 2014;31:5-16

27. Dore F, Cianciulli P, Rovasio S, Oggiano L, Bonfigli S, Murineddu M, Pardini S, Simonetti G, Gualdi G, Papa G. Incidence and clinical study of ectopic erythropoiesis in adult patients with thalassemia intermedia. Ann Ital Med Int 1992;7:137-140. 28. Aessopos A, Tassiopoulos S, Farmakis D, Moyssakis I, Kati M, Polonifi K, Tsironi M. Extramedullary hematopoiesisrelated pleural effusion: the case of β-thalassemia. Ann Thorac Surg 2006;81:2037-2043. 29. Chuang CK, Chu SH, Fang JT, Wu JH. Adrenal extramedullary hematopoietic tumor in a patient with β-thalassemia. J Formos Med Assoc 1998;97:431-433. 30. Kumar A, Aggarwal S, de Tilly LN. Case of the season. Thalassemia major with extramedullary hematopoiesis in the liver. Semin Roentgenol 1995;30:99-101. 31. Brannan D. Extramedullary hematopoiesis in anemias. Bull Johns Hopkins Hosp 1927;41:104-135. 32. Ross P, Logan W. Roentgen findings in extramedullary hematopoiesis. AJR Am J Roentgenol 1969;106:604-613. 33. Logothetis J, Constantoulakis M, Economidou J, Stefanis C, Hakas P, Augoustaki O, Sofroniadou K, Loewenson R, Bilek M. Thalassemia major (homozygous beta-thalassemia). A survey of 138 cases with emphasis on neurologic and muscular aspects. Neurology 1972;22:249-304. 34. Prabhakar S, Chopra J, Khosla VK, Dash S, Banerijee AK. Spinal compression in homozygous β thalassemia. Surg Neurol 1980;13:351-354. 35. Shin KH, Sharma S, Gregoritch SJ, Lifeso RM, Bettigole R, Yoon SS. Combined radiotherapeutic and surgical management of a spinal cord compression by extramedullary hematopoiesis in a patient with hemoglobin E β-thalassemia. Acta Haematol 1994;91:154-157. 36. Parsa K, Oreizy A. Nonsurgical approach to paraparesis due to extramedullary hematopoiesis. J Neurosurg 1995;82:657660. 37. Richter E. Extramedullary hematopoiesis with intraspinal extension in thalassemia. Aktuelle Radiol 1993;3:320-322. 38. Dore F, Pardini S, Gaviano E, Longinotti M, Bonfigli S, Rovasio S, Tomiselli A, Cossu F. Recurrence of spinal cord compression from extramedullary hematopoiesis in thalassemia intermedia treated with low doses of radiotherapy. Am J Hematol 1993;44:148. 39. Salehi SA, Koski T, Ondra SL. Spinal cord compression in β-thalassemia: case report and review of the literature. Spinal Cord 2004;42:117-123. 40. Haidar R, Mhaidli H, Taher AT. Paraspinal extramedullary hematopoiesis in patients with thalassemia intermedia. Eur Spine J 2010;19:871-878. 41. Gimmon Z, Wexler MR, Rachmilewitz EA. Juvenile leg ulceration in β-thalassemia major and intermedia. Plast Reconstr Surg 1982;69:320-325.

Turk J Hematol 2014;31:5-16

Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View

42. Levin C, Koren A. Healing of refractory leg ulcer in a patient with thalassemia intermedia and hypercoagulability after 14 years of unresponsive therapy. IMAJ 2011;13:316-318.

55. Li X, Jankovic J, Le W. Iron chelation and neuroprotection in neurodegenerative diseases. J Neural Transm 2011;118:473477.

43. Galanello R, Barella S, Turco MP, Giagu N, Cao A, Dore F, Liberato NL, Guarnone R, Barosi G. Serum erythropoietin and erythropoiesis in high- and low-fetal hemoglobin β-thalassemia intermedia patients. Blood 1994;83:561-565.

56. Gladwin MT, Vichinsky E. Pulmonary complications of sickle cell disease. N Engl J Med 2008;359:2254-2265.

44. Brandt HRC, De Lorenzo Messina MC, Hirayama JT, Belda W Jr, Benabou JE, Criado PR. Prevalence of thrombophilia associated with leg ulcers. Br J Dermatol 2009;160:202-203. 45. Taher A, Isma’eel H, Mehio G, Bignamini D, Kattamis A, Rachmilewitz EA, Cappellini MD. Prevalence of thromboembolic events among 8,860 patients with thalassaemia major and intermedia in the Mediterranean area and Iran. Thromb Haemost 2006;96:488-491. 46. Taher AT, Otrock ZK, Uthman I, Cappellini MD. Thalassemia and hypercoagulability. Blood Rev 2008;22:283-292. 47. Taher AT, Musallam KM, Karimi M, El-Beshlawy A, Belhoul K, Daar S, Saned MS, El-Chafic AH, Fasulo MR, Cappellini MD. Overview on practices in thalassemia intermedia management aiming for lowering complication rates across a region of endemicity: the OPTIMAL CARE study. Blood 2010;115:1886-1892. 48. Crary SE, Buchanan GR. Vascular complications after splenectomy for hematologic disorders. Blood 2009;114:2861-2868. 49. Cappellini MD, Robbiolo L, Bottasso BM, Coppola R, Fiorelli G, Mannucci AP. Venous thromboembolism and hypercoagulability in splenectomized patients with thalassaemia intermedia. Br J Haematol 2000;111:467-473. 50. Taher AT, Musallam KM, Karimi M, El-Beshlawy A, Belhoul K, Daar S, Saned M, Cesaretti C, Cappellini MD. Splenectomy and thrombosis: the case of thalassemia intermedia. J Thromb Haemost 2010;8:2152-2158. 51. Manfre L, Giarratano E, Maggio A, Banco A, Vaccaro G, Lagalla R. MR imaging of the brain: findings in asymptomatic patients with thalassemia intermedia and sickle cell-thalassemia disease. AJR Am J Roentgenol 1999;173:1477-1480. 52. Taher AT, Musallam KM, Nasreddine W, Hourani R, Inati A, Beydoun A. Asymptomatic brain magnetic resonance imaging abnormalities in splenectomized adults with thalassemia intermedia. J Thromb Haemost 2010;8:54-59. 53. Taher AT, Musallam KM, Wood JC, Cappellini MD. Magnetic resonance evaluation of hepatic and myocardial iron deposition in transfusion-independent thalassemia intermedia compared to regularly transfused thalassemia major patients. Am J Hematol 2010;85:288-290. 54. Origa R, Barella S, Argiolas GM, Bina P, Agus A, Galanello R. No evidence of cardiac iron in 20 never- or minimallytransfused patients with thalassemia intermedia. Haematologica 2008;93:1095-1096.

57. Gladwin MT, Lancaster JR Jr, Freeman BA, Schechter AN. Nitric oxide’s reactions with hemoglobin: a view through the SNO-storm. Nat Med 2003;9:496-500. 58. Aessopos A, Farmakis D, Tsironi M, Diamanti-Kandarakis E, Matzourani M, Fragodimiri C, Hatziliami A, Karagiorga M. Endothelial function and arterial stiffness in sicklethalassemia patients. Atherosclerosis 2007;191:427-432. 59. Sonakul D, Pacharee P, Laohapand T, Fucharoen S, Wasi P. Pulmonary artery obstruction in thalassaemia. Southeast Asian J Trop Med Public Health 1980;11:516-523. 60. Sumiyoshi A, Thakerngpol K, Sonakul D. Pulmonary microthromboemboli in thalassemic cases. Southeast Asian J Trop Med Public Health 1992;23:29-31. 61. Atichartakarn V, Likittanasombat K, Chuncharunee S, Chandanamattha P, Worapongpaiboon S, Angchaisuksiri P, Aryurachai K. Pulmonary arterial hypertension in previously splenectomized patients with β-thalassemic disorders. Int J Hematol 2003;78:139-145. 62. Phrommintikul A, Sukonthasarn A, Kanjanavanit R, Nawarawong W. Splenectomy: a strong risk factor for pulmonary hypertension in patients with thalassaemia.  Heart 2006;92:1467-1472. 63. Habib A, Kunzelmann C, Shamseddeen W, Zobairi F, Freyssinet JM, Taher A. Elevated levels of circulating procoagulant microparticles in patients with β-thalassemia intermedia. Haematologica 2008;93:941-942. 64. Derchi G, Galanello R, Bina P, Cappellini MD, Piga A, Lai ME, Quarta A, Casu G, Perrotta S, Pinto V, Musallam KM, Forni GL; Webthal Pulmonary Arterial Hypertension Group. Prevalence and risk factors for pulmonary arterial hypertension in a large group of β-thalassemia patients using right heart catheterization: A Webthal ® Study. Circulation 2014;129:338-345. 65. Brezis M, Rosen S. Hypoxia of the renal medulla: its implications for disease. N Engl J Med 1995;332:647-655.  66. Tanaka T, Miyata T, Inagi R, Kurokawa K, Adler S, Fujita T, Nangaku M. Hypoxia-induced apoptosis in cultured glomerular endothelial cells: involvement of mitochondrial pathways. Kidney Int 2003;64:2020-2032.  67. Khan S, Cleveland RP, Koch CJ, Schelling JR. Hypoxia induces renal tubular epithelial cell apoptosis in chronic renal disease. Lab Invest 1999;79:1089-1099. 68. Heyman SN, Khamaisi M, Rosen S, Rosenberger C. Renal parenchymal hypoxia, hypoxia response and the progression of chronic kidney disease. Am J Nephrol 2008;28:9981006.

Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View

69. Norman JT, Orphanides C, Garcia P, Fine LG. Hypoxiainduced changes in extracellular matrix metabolism in renal cells. Exp Nephrol 1999;7:463-469.  70. Norman JT, Clark IM, Garcia PL. Hypoxia promotes fibrogenesis in human renal fibroblasts. Kidney Int 2000;58:2351-2366.  71. Zeisberg M, Strutz F, Müller GA. Role of fibroblast activation in inducing interstitial fibrosis. J Nephrol 2000;13(Suppl 3):111-120.  72. Nangaku M. Chronic hypoxia and tubulointerstitial injury: a final common pathway to end-stage renal failure. J Am Soc Nephrol 2006;17:17-25. 73. Ricchi P, Ammirabile M, Costantini S, Di Matola T, Spasiano A, Genna ML, Cinque P, Prossomariti L. Splenectomy is a risk factor for developing hyperuricemia and nephrolithiasis in patients with thalassemia intermedia: a retrospective study. Blood Cells Mol Dis 2012;49:133-135.  74. Quinn CT, Johnson VL, Kim HY, Trachtenberg F, Vogiatzi MG, Kwiatkowski JL, Neufeld EJ, Fung E, Oliveri N, Kirby M, Giardina PJ; Thalassemia Clinical Research Network. Renal dysfunction in patients with thalassaemia. Br J Haematol 2011;153:111-117.  75. Mastrangelo F, Lopez T, Rizzelli S, Manisco G, Corlianò C, Alfonso L. Function of the kidney in adult patients with Cooley’s disease: a preliminary report. Nephron 1975;14:229-236.

Turk J Hematol 2014;31:5-16

84. Musallam KM, Khoury B, Abi-Habib R, Bazzi L, Succar J, Halawi R, Hankir A, Koussa S, Taher AT. Health-related quality of life in adults with transfusion-independent thalassaemia intermedia compared to regularly transfused thalassaemia major: new insights. Eur J Haematol 2011;87:73-79. 85. Musallam KM, Taher AT, Duca L, Cesaretti C, Halawi R, Cappellini MD. Levels of growth differentiation factor-15 are high and correlate with clinical severity in transfusionindependent patients with β thalassemia intermedia. Blood Cells Mol Dis 2011;47:232-234. 86. Taher AT, Musallam KM, Cappellini MD, Weatherall DJ. Optimal management of beta thalassaemia intermedia. Br J Haematol 2011;152:512-523. 87. Borgna-Pignatti C. Modern treatment of thalassaemia intermedia. Br J Haematol 2007;138:291-304. 88. Borgna-Pignatti C, Marsella M, Zanforlin N. The natural history of thalassemia intermedia. Ann N Y Acad Sci 2010;1202:214-220. 89. Spanos T, Karageorga M, Ladis V, Peristeri J, Hatziliami A, Kattamis C. Red cell alloantibodies in patients with thalassemia. Vox Sang 1990;58:50-55. 90. Hmida S, Mojaat N, Maamar M, Bejaoui M, Mediouni M, Boukef K. Red cell alloantibodies in patients with haemoglobinopathies. Nouv Rev Fr Hematol 1994;36:363-366. 91. Pippard MJ, Callender ST, Finch CA. Ferrioxamine excretion in iron-loaded man. Blood 1982;60:288-294.

76. Davis LE, Hohimer AR. Hemodynamics and organ blood flow in fetal sheep subjected to chronic anemia. Am J Physiol 1991;261:R1542-R1548.

92. Thalassemia International Federation. Guidelines for the Clinical Management of Thalassemia. Strovolos, Cyprus, Thalassemia International Federation, 2004.

77. Lafferty HM, Anderson S, Brenner BM. Anemia: a potent modulator of renal hemodynamics in models of progressive renal disease. Am J Kidney Dis 1991;17(Suppl 1):2-7.

93. Taher A, El Rassi F, Isma’eel H, Koussa S, Inati A, Cappellini MD. Correlation of liver iron concentration determined by R2 magnetic resonance imaging with serum ferritin in patients with thalassemia intermedia. Haematologica 2008;93:1584-1586.

78. Brenner BM, Lawler EV, Mackenzie HS. The hyperfiltration theory: a paradigm shift in nephrology. Kidney Int 1996;49:1774-1777. 79. Ponticelli C, Musallam KM, Cianciulli P, Cappellini MD. Renal complications in transfusion-dependent beta thalassaemia. Blood Rev 2010;24:239-244. 80. Sumboonnanonda A, Malasit P, Tanphaichitr VS, Ongajyooth S, Petrarat S, Vongjirad A. Renal tubular dysfunction in alpha-thalassemia. Pediatr Nephrol 2003;18:257-260. 81. Halliwell B, Gutteridge JM. Role of free radicals and catalytic metal ions in human disease: an overview. Methods Enzymol 1990;186:1-85. 82. Maakaron JE, Cappellini MD, Taher AT. An update on thalassemia intermedia. J Med Liban 2013;61:175-182. 83. Taher AT, Musallam KM, El-Beshlawy A, Karimi M, Daar S, Belhoul K, Saned MS, Graziadei G, Cappellini MD. Agerelated complications in treatment-naive patients with thalassaemia intermedia. Br J Haematol 2010;150:486-489.

94. Wood JC, Enriquez C, Ghugre N, Tyzka JM, Carson S, Nelson MD, Coates TD. MRI R2 and R2* mapping accurately estimates hepatic iron concentration in transfusiondependent thalassemia and sickle cell disease patients. Blood 2005;106:1460-1465. 95. St Pierre TG, Clark PR, Chua-anusorn W, Fleming AJ, Jeffrey GP, Olynyk JK, Pootrakul P, Robins E, Lindeman R. Noninvasive measurement and imaging of liver iron concentrations using proton magnetic resonance. Blood 2005;105:855-861. 96. Treadwell MJ, Weissman L. Improving adherence with deferoxamine regimens for patients receiving chronic transfusion therapy. Semin Hematol 2001;38(Suppl 1): 77-84. 97. Cappellini MD. Overcoming the challenge of patient compliance with iron chelation therapy. Semin Hematol 2005;42(Suppl 1):19-21. 15

Turk J Hematol 2014;31:5-16

98. Pootrakul P, Sirankapracha P, Sankote J, Kachintorn U, Maungsub W, Sriphen K, Thakernpol K, Atisuk K, Fucharoen S, Chantraluksri U, Shalev O, Hoffbrand AV. Clinical trial of deferiprone iron chelation therapy in β-thalassaemia/haemoglobin E patients in Thailand. Br J Haematol 2003;122:305-310. 99. Cappellini MD, Cohen A, Piga A, Bejaoui M, Perrotta S, Agaoglu L, Aydinok Y, Kattamis A, Kilinc Y, Porter J, Capra M, Galanello R, Fattoum S, Drelichman G, Magnano C, Verissimo M, Athanassiou-Metaxa M, Giardina P, KourakliSymeonidis A, Janka-Schaub G, Coates T, Vermylen C, Olivieri N, Thuret I, Opitz H, Ressayre-Djaffer C, Marks P, Alberti D. A phase 3 study of deferasirox (ICL670), a oncedaily oral iron chelator, in patients with β-thalassemia. Blood 2006;107:3455-3462. 100. Vichinsky E, Onyekwere O, Porter J, Swerdlow P, Eckman J, Lane P, Files B, Hassell K, Kelly P, Wilson F, Bernaudin F, Forni GL, Okpala I, Ressayre-Djaffer C, Alberti D, Holland J, Marks P, Fung E, Fischer R, Mueller BU, Coates T; Deferasirox in Sickle Cell Investigators. A randomized comparison of deferasirox versus deferoxamine for the treatment of transfusional iron overload in sickle cell disease. Br J Haematol 2007;136:501-508. 101. Taher AT, Porter JB, Viprakasit V, Kattamis A, Chuncharunee S, Sutcharitchan P, Siritanaratkul N, Galanello R, Karakas Z, Lawniczek T, Habr D, Ros J, Zhu Z, Cappellini MD. Deferasirox effectively reduces iron overload in nontransfusion-dependent thalassemia (NTDT) patients: 1-year extension results from the THALASSA study. Ann Hematol 2013;92:1485-1493. 102. Rienhoff HY Jr, Viprakasit V, Tay L, Harmatz P, Vichinsky E, Chirnomas D, Kwiatkowski JL, Tapper A, Kramer W, Porter JB, Neufeld EJ. A phase 1 dose escalation study: safety, tolerability, and pharmacokinetics of FBS0701, a novel oral iron chelator for the treatment of transfusional iron overload. Haematologica 2011;96:521-525.

Haddad A, et al: β-Thalassemia Intermedia: A Bird’s-Eye View

103. Karimi M, Darzi H, Yavarian M. Hematologic and clinical responses of thalassemia intermedia patients to hydroxyurea during 6 years of therapy in Iran. J Pediatr Hematol Oncol 2005;27:380-385. 104. Neufeld EJ, Galanello R, Viprakasit V, Aydinok Y, Piga A, Harmatz P, Forni GL, Shah FT, Grace RF, Porter JB, Wood JC, Peppe J, Jones A, Rienhoff HY Jr. A phase 2 study of the safety, tolerability, and pharmacodynamics of FBS0701, a novel oral iron chelator, in transfusional iron overload. Blood 2012;119:3263-3268. 105. Olivieri NF. Reactivation of fetal hemoglobin in patients with β-thalassemia. Semin Hematol 1996;33:24-42. 106. Dixit A, Chatterjee TC, Mishra P, Choudhry DR, Mahapatra M, Tyagi S, Kabra M, Saxena R, Choudhry VP. Hydroxyurea in thalassemia intermedia–a promising therapy. Ann Hematol 2005;84:441-446. 107. Panigrahi I, Dixit A, Arora S, Kabra M, Mahapatra M, Choudhry VP, Saxena R. Do alpha deletions influence hydroxyurea response in thalassemia intermedia? Hematology 2005;10:61-63. 108. Pakbaz Z, Treadwell M, Yamashita R, Quirolo K, Foote D, Quill L, Singer T, Vichinsky EP. Quality of life in patients with thalassemia intermedia compared to thalassemia major. Ann N Y Acad Sci 2005;1054:457-461. 109. Khoury B, Musallam KM, Abi-Habib R, Bazzi L, Ward ZA, Succar J, Halawi R, Hankir A, Koussa S, Taher AT. Prevalence of depression and anxiety in adult patients with β-thalassemia major and intermedia. Int J Psychiatry Med 2012;44:291-303. 110. Musallam KM, Taher AT, Karimi M, Rachmilewitz EA. Cerebral infarction in β-thalassemia intermedia: breaking the silence. Thromb Res 2012;130:695-702.

Research Article

DOI: 10.4274/Tjh.2012.0197

A Polymorphism in the IL-5 Gene is Associated with Inhibitor Development in Severe Hemophilia A Patients Ağır Hemofili A Hastalarında İnhibitör Gelişimi ile IL-5 Genindeki Bir Polimorfizmin İlişkilendirilmesi İnanç Değer Fidancı1, Bülent Zülfikar2, Kaan Kavaklı3, M. Cem Ar4, Yurdanur Kılınç5, Zafer Başlar6, Server Hande Çağlayan1 1Boğaziçi

University, Department of Molecular Biology and Genetics, İstanbul, Turkey

2İstanbul

University Medical School, Institute of Oncology, İstanbul, Turkey

3Ege

University Medical School, Department of Pediatric Hematology, İzmir, Turkey

4İstanbul

Training and Education Hospital, Department of Hematology, İstanbul, Turkey

5Çukurova 6İstanbul

University Medical School, Department of Pediatric Hematology, Adana, Turkey

University Cerrahpaşa Medical Faculty, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey

Abstract: Objective: A severe complication in the replacement therapy of hemophilia A (HA) patients is the development of

alloantibodies (inhibitors) against factor VIII, which neutralizes the substituted factor. The primary genetic risk factors influencing the development of inhibitors are F8 gene mutations. Interleukins and cytokines that are involved in the regulation of B-lymphocyte development are other possible targets as genetic risk factors. This study assesses the possible involvement of 9 selected single nucleotide gene polymorphisms (SNPs) with interleukins (IL-4, IL-5, and IL-10), transforming growth factor beta 1 (TGF-β1), and interferon gamma (IFN-γ) in inhibitor development in severely affected HA patients carrying a null mutation in the F8 gene. Materials and Methods: A total of 173 HA patients were screened for intron 22 inversion and null mutations (nonsense and deletions). Genotyping of a total of 9 SNPs in genes IL-4, IL-5, IL-10, TGF-β1, and IFN-γ in 103 patients and 100 healthy individuals was carried out. Results: An association analysis between 42 inhibitor (+) and 61 inhibitor (-) patients showed a significant association with the T allele of rs2069812 in the IL-5 gene promoter and patients with inhibitors (p=0.0251). The TT genotype was also significantly associated with this group with a p-value of 0.0082, odds ratio of about 7, and confidence interval of over 90%, suggesting that it is the recessive susceptibility allele and that the C allele is the dominant protective allele. Conclusion: The lack of other variants in the IL-5 gene of patients and controls suggests that rs2069812 may be a regulatory SNP and may have a role in B-lymphocyte development, constituting a genetic risk factor in antibody development. Key Words: Hemophilia A, Inhibitor formation, F8 gene mutation, Single nucleotide gene polymorphisms, Interleukins/ cytokines, Association study

Address for Correspondence: Server Hande Çağlayan, M.D., Boğaziçi University, Department of Molecular Biology and Genetics, İstanbul, Turkey E-mail: hande@boun.edu.tr Phone: +90 212 359 68 81 Received/Geliş tarihi : December 15, 2012 Accepted/Kabul tarihi : July 31, 2013

Turk J Hematol 2014;31:17-24

Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene

Özet: Amaç: Hemofili A hastalarının replasman tedavisinde FVIII’i nötralize eden FVIII antikorların (inhibitör) oluşması ciddi

bir komplikasyondur. F8 mutasyonları ile birlikte başka genetik risk faktörleri de inhibitor gelişimini etkilemektedir. Bunlar arasında B-lenfositlerinin regülasyonunda yer alan IL-4, IL-5, IL-10, TGF-β1 ve IFN-γ gibi interlökin ve sitokinler diğer genetik risk faktörleri olabilecek hedeflerdir. Bu çalışmanın amacı inhibitor geliştiren ağır hemofili hastalarında çeşitli yöntemlerle F8 mutasyon profilini ortaya çıkarmak ve bunu takiben, FVIII yapılmaması ile sonuçlanan F8 mutasyonlu inhibitör geliştiren HA hastalarında 9 seçilmiş interlökin ve sitokin gen polimorfizmleri ile inhibitor gelişimi arasındaki ilişkiyi irdelemektir. Gereç ve Yöntemler: Toplam 173 hasta intron 22 inversiyon mutasyonu ve null mutasyonlar (nonsense ve delesyon mutasyonları) için genetik anlamda taranmıstır. Daha sonra hasta (103) ve sağlıklı birey grupları (100) IL-4, IL-5, IL-10, TGFβ1 ve IFN-γ genlerinde bulunan 9 SNP bölgesi için araştırılmıştır. Bulgular: İnhibitörlü hastalarda en sık rastlanan FVIII işlevini önemli ölçüde etkileyen mutasyonlar, sırasıyla, intron 22 inversiyonu, anlamsız mutasyon ve büyük delesyonlardır. Bu sebeple, bir hasta-kontrol ilişkisi çalışması şeklinde inhibitor (+) ve inhibitor (-) hasta altgrupları oluşturmak için ağır HA hastalarında intron 22 inversiyonu taranmıştır. IL-5 geni promotör bölgesinde yer alan rs2069812’nin T-aleli ile inhibitörlü hastalar arasında p-değeri 0,0251 olan önemli bir ilişki bulunmuştur. TT genotipinin de 0,0082 p-değeri, OR=7 ve %90 ustu CI ile inhibitör (+) grubu ile ilişkili olması T-alelinin çekinik yatkınlık aleli ve C-alelinin baskın koruyucu alel olduğunu düşündürmektedir. Sonuç: Bu bulgular B lenfosit gelişiminde yer alan gen polimorfizmlerinin FVIII yapımı olmayan inhibitörlü ağır HA hastalarında oynadığı rol hakkında önemli bilgi vermekte ve bu alanda ileri çalışmalara önderlik etmektedir. Anahtar Sözcükler: Hemofili A, İnhibitör oluşumu, F8 Gen Mutasyonu, Tek Nükleotid Gen Polimorfizmleri, İnterlökinler /Sitokinler, İlişkilendirme çalışması

Introduction The major complication of replacement therapy is the development of antibodies (inhibitors), which inhibit factor VIII (FVIII) activity in hemophilia A (HA). Inhibitor formation occurs in 20%-30% of patients with severe HA. Both genetic and non-genetic factors play crucial roles in the development of inhibitors against FVIII protein [1]. Genetic factors including mutations or polymorphisms within the factor 8 (F8) gene, some immune response genes like major histocompatibility complex (MHC) class I/II, interleukins (ILs), and cytokines were shown to be decisive risk factors in inhibitor development [2]. However, the same type of F8 gene mutation can be seen in HA patients both with and without inhibitors. Patients with large deletions affecting more than one domain of the FVIII protein are at the highest risk of inhibitor development (75%). Nonsense mutations on the light chain increase the risk of inhibitor development much more than those on the heavy chain. The third highest risk mutation is the intron 22 inversion, with an inhibitor risk about 30%-35% [3]. We have previously reported that the most prevalent F8 gene mutation in severe HA patients with inhibitors is intron 22 inversion, with a frequency of 50% [4]. Risk of inhibitor development increases at times of severe bleeding, trauma, or surgery, especially when high doses of FVIII are used for treatment. This occurs as a result of complicated immune reactions leading to the up-regulation of T- and B-cell responses [5]. In the presence of foreign FVIII, CD4+ T-cells are induced to differentiate into T helper

(Th1 and Th2) cells by secreting IL-12 and IL-18. Cytokines secreted by the Th1 [(IL-2 and interferon gamma (INF-γ)] and Th2 (IL-4, IL-5, and IL-10) cells direct B-cell synthesis for antibodies that function as inhibitors against FVIII. However, Th2 cells can also down-regulate B-cell antibody synthesis under certain circumstances [6]. A strong association with increased risk of inhibitor development and the presence of a 134-bp allele in one of the cytosine adenine (CA) repeat microsatellites (IL-10G) located in the promoter region of the IL-10 gene has been recently reported. IL-10 was the first gene located outside the causative F8 gene mutations shown to be linked to inhibitor development [7]. The single nucleotide polymorphism (SNP) in the promoter region of tumor necrosis factor alpha (TNF-α) was shown to be strongly associated with inhibitor formation in HA siblings in the Malmö International Brother Study [8]. A C/T SNP in the promoter region of the cytotoxic T-lymphocyte antigen-4 (CTLA-4) gene was found to be associated with inhibitor formation in 31.2% of T allele carriers (p=0.012) [9]. The aim of this study was to search for other genetic risk factors that may be associated with inhibitor development. For this purpose, informative SNPs of cytokine genes (IL-4, IL-5, IL-10, TGF-β1, and IFN-γ) involved in the regulation of B-cell responses were studied in a group of HA patients with null mutations (mutations with a major effect). Materials and Methods Patients A total of 173 HA patients were screened for the presence of intron 22 inversion and other null mutations. Three patients

Turk J Hematol 2014;31:17-24

Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene

had moderate phenotypes with FVIII activity of 2%-4%, while the remaining 170 patients had severe phenotypes with FVIII activity of 0%-3% [1]. One hundred and fourteen patients (66%) had no inhibitor history. Forty-two (24%) and 17 patients (10%) of the remaining 59 patients had high and low titer inhibitors, respectively. The median age was 22.6 years (range: 4-50 years). Individual phenotypic characteristics of the 173 unrelated HA patients are given as supplementary information. Intron 22 inversions were detected in 95 patients (54%), of whom 34 had inhibitors and 61 had no inhibitors. Three nonsense mutations and 5 deletions were detected as other types of null mutations, and all of these patients had developed inhibitors. Forty-two and 61 patients, therefore, constituted the 2 groups with and without inhibitors, respectively, for the association analysis (Table 1). The peripheral blood samples from 173 unrelated severe HA patients with and without inhibitors were collected from various hematology clinics within Turkey. The diagnosis of HA was based on clinical and hematological data. One-stage clotting assay was used for measurement of FVIII activity (Sigma Diagnostic, St. Louis, MO, USA). All measurements were performed in duplicate. The mean±standard deviation value for FVIII was 113.98±33.86 U/dL in control subjects. Values over 150 U/dL were accepted as high. The clinical criteria of Eyster et al. were used to determine disease severity [10]. The level of inhibitors was measured as Bethesda units (BU/mL). Patients with <5 BU/mL and >5 BU/mL were defined as having “low titer” and “high titer” inhibitors, respectively [6]. The study was approved by the Ethics Committee of Ege University Medical School. All included patients and healthy volunteers gave written consent before entering the study. DNA Extraction DNA was extracted from 10 mL of peripheral blood of patients by the NaCl method with 2 mL of peripheral blood using a MagNA Pure Compact instrument (Roche Diagnostics, Mannheim, Germany) and from saliva samples of some of the control individuals with the ORAGENE saliva kit (DNA Genotek, Kanata, ON, Canada). Detection of Intron 22 Inversion Intron 22 inversion was detected by inverse polymerase chain reaction (PCR) [11] and long PCR techniques [12]. Detection of F8 Nonsense and Deletion Mutations Intron 22 (-) patients were also screened for missense mutations with exon-specific PCR amplifications. All 26 exons of those patients were amplified and sequenced by automated Sanger sequencing. Selection of the SNPs in Immune Response Genes for Association Study Nine SNPs in genes IL-2, IFN-γ, IL-4, IL-5, IL-10, and TGF-β1 were selected with average heterozygote frequency close to 0.5 in different populations from HapMap and NCBI data.

Genotyping for the Case-Control Association Study Genotyping of a total of 9 SNPs in 173 patients and 100 healthy individuals was carried out using hybridization probes designed by TIB MOLBIOL (Berlin, Germany) on an LC480 platform (Roche Diagnostics) based on melting curve analysis. DNA Sequence Analysis The IL-5 gene was divided into 7 regions for highresolution melting analysis (HRM) and DNA sequencing. Five regions consisting of promoter and coding regions of the IL-5 gene were amplified in PCR reactions that contained 50 ng of genomic DNA, 0.2 pmol of each primer, 0.2 mM of each dNTP, 1X reaction buffer with 2 mM Mg2+, and 1.25 U Taq polymerase in 25 µL. The PCR products of these regions were directly sequenced (Macrogen, Seoul, Korea), whereas the remaining 2 regions were analyzed by HRM on an LC480 platform. The HRM mixture was prepared in a 20 µL volume containing 1X master mix with FastStart Taq DNA polymerase, reaction buffer, dNTP mix, and high-resolution melting dye; 0.2-0.5 mM Mg2+; 0.2-0.5 pmol of each primer pair; and 20-40 ng of genomic DNA. Copy Number Variation Analysis by qPCR A quantitative PCR (qPCR) assay was used to detect copy number variations (CNVs) of the IL-5 gene rs2069812 region in patients. Absolute quantification using the “Fit Points Method” is an analysis used to quantify the target sequence and reference sequence and gives a concentration value. Real-time qPCRs were performed with a LightCycler 480 instrument and a LightCycler 480 SYBR Green I Master Kit and target and reference sequence-specific primers. The target sequence was the IL-5 rs2069812 region and the reference sequence was exon 6 of the sodium channel 1 alpha (SCN1A) gene (Ex6F-5’ CACACGTGTTAAGT, Ex6R5’ AGCCCTCAAGTAT). Statistical Analysis Case-control association analysis was carried out with Haploview 4.1, which calculated the chi-square statistics of SNP alleles between 2 groups at a 0.05 significance level. Genotype frequencies were calculated in patients for 9 SNPs by using the chi-square test on a webpage of the University of Kansas (http://people.ku.edu/~preacher/chisq/chisq.htm). Multiple test correction was done by 100.000 permutations (p=0.0294). Other association tests were performed by using crude, recessive, or dominant models [13]. Power analysis was carried out by assuming an inhibitor development rate of 0.00018 in the general population and a type I error rate of 0.05. The power was over 90% for a recessive genotype effect with a relative risk (RR) of 6.86 for rs2069812. All power calculations were carried out by QUANTO [14,15]. Results SNP Genotyping in Immune Response Genes Genotyping of 1 SNP failed for healthy controls, but 8 SNPs were genotyped in 100 healthy Turkish individuals 19

Turk J Hematol 2014;31:17-24

by HybProbe probes. All SNPs were in Hardy-Weinberg equilibrium and each had a minor allele frequency of >0.120. Genotyping of 9 SNPs in 42 inhibitor (+) and 61 inhibitor (-) severe HA patients revealed that they were in Hardy-Weinberg equilibrium in both patient groups. They had a minor allele frequency of higher than 0.19 and 0.13 for the inhibitor (-) and inhibitor (+) patient groups, respectively. These 2 subgroups, both with known F8 null mutations, comprised the cases and controls, and the association analysis was carried out using Haploview 4.1. The associated alleles and p-values are given in Table 2. The T allele of rs2069812, which resides in the IL-5 gene promoter region, was found to be associated with inhibitor (+) patients with a p-value of 0.0251. Multiple test correction was done with 100.000 permutations (p=0.0294). The test for association was repeated using all patients [i.e. inhibitor (+) and inhibitor (-) groups] against healthy individuals and no significant associations were detected, supporting the association of rs2069812 with inhibitor formation. Genotype frequencies were calculated in 2 patient groups for 9 SNPs by using the chi-square test a webpage of the University of Kansas (http://people.ku.edu/~preacher/chisq/ chisq.htm). The TT genotype of rs2069812 was found to be associated with inhibitor (+) patients with a p-value of 0.0082 (Table 3). These results were compatible with the results of the Haploview 4.1 case-control association analysis. A similar association test run between inhibitor (+) patients and healthy individuals did not reveal any significant associations. The pattern of inheritance of rs2069812 indicated a similar and reduced risk for CT and CC genotypes in inhibitor (+) patients in the crude genetic model (Table 4) [13]. In the model where the T allele was recessive, the TT genotype carried a risk of 6.86-fold compared to CT or CC genotypes, indicating that the T allele was the susceptibility allele. On the other hand, considering that the C allele has a dominant inheritance, CT or CC genotypes reduced the disease risk by 0.02% (odds ratio=0.14). Therefore, the C allele could be considered to have a dominant protective effect. HRM and DNA Sequence Analysis of the IL-5 Gene The IL-5 gene is composed of 4 exons spanning a 2078-bp coding region. In order to detect any pathological changes segregating with the associated rs2069812, the IL-5 gene was divided into 7 regions for HRM and direct DNA sequencing. The promoter region containing rs2069812 was divided into 3 regions. Two of the promoter regions and exons 1, 2, and 4 were amplified by PCR and sequenced in 103 patients. The promoter 1 region and exon 3 of the IL-5 gene were analyzed by HRM in real time in the same patients. Sequence analysis revealed the genotypes of 14 other known SNPs located in the IL-5 gene, but no other rare variants. There were no haplotype associations between these SNPs when tested by the Haploview program. CNV Analysis of rs2069812 Region In order to investigate the presence of CNVs, realtime qPCR analysis was applied to patients who had 20

Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene

homozygote and heterozygote genotypes for associated SNP region rs2069812. Absolute quantification analysis was used to quantify the target sequence and reference sequences. Relative quantification was used to compare these targets and reference sequence concentrations. The target sequence was the IL-5 promoter, including the rs2069812 region, and the reference sequence was exon 6 of the SCN1A gene. qPCR assay was performed for 28 homozygous (for rs2069812) inhibitor (+) patients and 30 homozygous inhibitor (-) patients in 2 groups. The ratio of the normalized target sequence to the reference sequence was near 1, which meant that there were no copy number changes in this region. qPCR assay was also performed for 14 heterozygous (for rs2069812) inhibitor (+) patients and 31 heterozygous inhibitor (-) patients in 2 groups. The ratio of the normalized target sequence to the reference sequence was also near 1 (data not shown). Discussion Genetic variants including SNPs, CNVs, or mutations in immune response genes other than F8 gene mutations may affect inhibitor development in patients with severe HA and cause major complications. It has been proposed that immune response can be up-regulated in most patients with null mutations like intron 22 inversion [3]. In studies of patients with autoimmune disease, polymorphisms in the immune response genes have been found to be associated with antibody formation [21]. In HA patients certain alleles in the promoter regions of the IL-10, TNF-α, and CTLA-4 genes were found to be associated with inhibitor development [7,8,9]. In this study, in order to further understand the role of immune response genes on inhibitor development, patients with a null F8 gene mutation with high prevalence, like intron 22 inversion, were grouped as patients with and without inhibitors and an association analysis was carried out between them using 9 SNPs located in the IL-2, IFN-γ, IL-4, IL-5, IL-10, and TGF-β1 genes. A significant association was seen with the T allele of rs2069812 in the IL-5 promoter and inhibitor positivity in patients with HA. The analysis for the inheritance pattern revealed that carrying the TT genotype for rs2069812 meant a 6.86 times greater probability of developing inhibitors. On the other hand, patients carrying CT or CC had that risk at a rate of 0.02% (OR=0.14) as compared to the TT genotype. Therefore, the T allele was considered as a recessive susceptibility allele and the C allele as a dominant protective allele. The resulting association of the T allele of rs72069812 with over 90% power for a recessive genotype effect indicated a possible role in inhibitor development in inhibitor (+) patients. DNA sequencing analysis of the IL-5 gene promoter and coding sequences and qPCR analysis of the region involving the associated SNP in 103 patients did not reveal any common/ rare variants segregating with the associated SNP.

Turk J Hematol 2014;31:17-24

Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene

IL-5 is an immune response gene whose product plays a role in B-cell antibody synthesis. The IL-5 gene expresses the IL-5 glycoprotein, which plays a pleiotropic role in the immune system and inflammation. It supports growth and differentiation of B cells and has a key mediator role in eosinophil activation. It is produced by Th2 cells and masT-cells. IL-5 cytokines are the key molecules in allergy and eosinophilic inflammation [16]. In previous studies, rs2069812 was found to be associated with diseases like atopic bronchial asthma [17], gastric cancer risk [18], and atopic dermatitis [19]. The IL-5 gene is expressed in CD4+ T-cells, masT-cells, and eosinophils, and in allergic

reactions the expression level of the IL-5 gene can be varied [16]. It may be suggested that rs2069812 localized in the gene promoter could be a regulatory SNP and play a role in the up-regulation or down-regulation of the IL-5 gene and influence the level of IL-5 protein. It could further be suggested that the T variant in inhibitor (+) patients causes increased or decreased production of IL-5 protein, leading to inhibitor formation. In order to see the specific IL-5 gene expression against exogenous FVIII protein, CD4+ T-cells with the T and C alleles of rs72069812 responding to FVIII antigens need to be isolated from peripheral blood and treated with FVIII protein in cell culture studies. In

Table 1. Clinical information of patient groups used in the association analysis.

Patient groups

No.

FVIII:C (%) average

HR no. (%)

LR no. (%)

Age average

Intron 22 inversion (%)

Other mutations

Inhibitor (+) 42 patients

0.85

36 (86)

6 (14)

20.8

34 (80)

8 (20)

Inhibitor (-) patients

0.76

24.9

61 (100)

HR: high responder LR: low responder

Table 2. Test of association between inhibitor (+) and inhibitor (–) patient subgroups.

SNP name

Gene

Position

Associated allele

rs2069812

IL-5

Promoter

rs2069705

IFNγ

Promoter

rs2241715

TGF-β1

IVS1

rs3024496

IL-10

rs1800871

IL-10

Promoter

rs1554286

IL-10

IVS3

rs1861494

IFN-γ

IVS3

rs2243267

IL-4

IVS2

rs2243282

IL-4

IVS3

χ2

p-value

5.019

0.0251

0.022

0.8828

0.875

0.3496

0.288

0.5915

1.221

0.2692

4.016

0.1342

0.037

0.8484

1.254

0.2628

1.654

0.1984

IVS: intervening sequence variation χ2: chi-square

Turk J Hematol 2014;31:17-24

Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene

Table 3. Test of association of genotypes of 9 SNPs.

Allele frequency (%)

rs2069812 Inhibitor (+) patients Inhibitor (-) patients

Genotype frequency (%) Missing data

30 (53) 87 (71)

26 (46) 35 (29)

16 (38) 29 (47)

15 (35) 29 (47)

11 (27) 3 (5) -

Total χ2 42 61 9.603

Allele frequency (%)

rs1554286 Inhibitor (+) patients Inhibitor (-) patients

Missing data

Total χ2

42 (75) 93 (84)

24 (32) 17 (15)

16 (56) 42 (70)

10 (35) 9 (16)

2 (7) 4 (7)

14 6

42 61

Allele frequency (%)

Inhibitor (+) patients Inhibitor (-) patients

p-value

0.1342

Genotype frequency (%) Missing data

20 (40) 49 (48)

30 (60) 53 (52)

9 (36) 18 (35)

12 (48) 17 (33)

4 (16) 17 16 (31) 10

Total χ2

Allele frequency (%)

p-value

42 61 2.455

rs3024496

0.0082

Genotype frequency (%)

4.016

rs2241715

p-value

0.2930

Genotype frequency (%)

Missing Total χ2 data

34 (60) 63 (57)

22(40) 47 (43)

10 (36) 18 (33)

14 (50) 27 (49)

4 (14) 10 (18)

14 6

p-value

42 61 0.219 0.8962

rs1800871 Inhibitor (+) patients Inhibitor (-) patients

Allele frequency (%)

Genotype frequency (%)

Missing Total χ2 data

38 (70) 82 (77)

16 (30) 24 (23)

13 (48) 33 (62)

12 (44) 16 (30)

2 (8) 4 (8)

15 8

p-value

42 61 1.659 0.4362

rs2069705

Inhibitor (+) patients Inhibitor (-) patients

Allele frequency (%)

Genotype fr equency (%)

Missing Total χ2 data

39 (70) 76 (72)

17 (30) 30 (28)

14 (50) 27 (51)

11 (39) 22 (42)

3 (11) 4 (8)

14 9

p-value

42 61 0.238 0.8878

Turk J Hematol 2014;31:17-24

Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene

Table 3. Test of association of genotypes of 9 SNPs (continued).

rs1861494 Inhibitor (+) patients Inhibitor (-) patients

rs2243267

Inhibitor (+) patients Inhibitor (-) patients

rs2243267

Inhibitor (+) patients Inhibitor (-) patients

Allele frequency (%)

Genotype frequency (%)

Missing Total χ2 data

11 (20) 24 (22)

45 (80) 86 (78)

17 (61) 35 (64)

11 (39) 16 (29)

0 (0) 4 (7)

14 6

Allele frequency (%)

42 61

1.659

p-value 0.4362

Genotype frequency (%)

Missing Total χ2 data

35 (62) 86 (78)

21 (38) 24 (22)

17 (61) 42 (76)

1 (4) 2 (4)

10 (36) 11 (20)

14 6

Allele frequency (%)

42 61

2.45

p-value 0.2937

Genotype frequency (%)

Missing Total χ2 data

44 (79) 95 (86)

12 (21) 15 (14)

17 (61) 42 (76)

10 (36) 11 (20)

1 (4) 2 (4)

14 6

p-value

42 61 2.45

0.2937

Table 4. Test of association between rs2069812 genotypes and inhibitor development. Genetic model

Genotypes

χ2

p-value

Crude OR (vs. TT)

0.15

0.14

9.603

0.0082

Dominant T allele OR (vs. CT+CC)

0.68

0.902

0.3422

Recessive T allele OR (vs. CT+CC)

6.86

9.584

0.0019

Dominant C allele OR (vs. TT)

0.14

9.584

0.0019

χ2: chi-square OR: odds ratio df: degrees of freedom

silico analysis, however, does not reveal any alteration in the transcription factor binding scores of either the T or the C allele of rs2069812 (http://alggen.lsi.upc.es/cgi-bin/ promo_v3/). In addition, SNPs may be involved in epigenetic regulation since some SNPs and CpG sites show significant cis- or trans-associations. It was hypothesized that a considerable proportion of CpG sites may be quantitative traits with regard to regulation by specific genetic variants [20]. rs2069812 is not located at a CpG site and a CpG island was not detected within approximately 5000 bases of the 5’ region of the IL-5 gene (http://www.ualberta.ca/~stothard/ javascript/cpg_islands.html), suggesting that it is not a cisregulatory SNP. However, the IL-5 gene, together with genes IL-4, IL-13, and colony stimulating factor 2 (CSF-2), form a

cytokine gene cluster on chromosome 5q31. CSF-2, IL-4, and IL-13 are regulated coordinately by long-range regulatory elements of 120 kb in length on chromosome 5q31. When this region was scanned for CpG islands, approximately 70 CpG islands were found. Whether rs2069812 is in cis- or trans-association with a distant CpG island remains to be studied further. In conclusion, the associated T allele of the promoter SNP in the IL-5 gene may be part of the complex genetic background involved in the development of inhibitors in severe HA patients. Acknowledgments We thank Dr. Tiraje Celkan, Department of Pediatrics, Cerrahpaşa Medical School, İstanbul University, İstanbul, Turkey; Dr. Çetin Timur, Department of Pediatrics and 23

Turk J Hematol 2014;31:17-24

Fidancı Dİ, et al: A Polymorphism in the IL-5 Gene

Hematology, Göztepe State Hospital, İstanbul, Turkey; Dr. Canan Vergin, Dr. Behçet Uz Pediatric Hospital, İzmir, Turkey; and Dr. Canan Uçar, Department of Pediatric Hematology, 19 Mayıs University Medical School, Samsun, Turkey, for providing patient samples. We greatly appreciate the help of Dr. Fikret Bezgal from the Turkish Hemophilia Society and the technical help of Aslı Gündoğdu, and we are grateful to all patients for their participation in this study. This study was financially supported by TÜBİTAK (the Scientific and Technological Research Council of Turkey) project number 108S095; Boğaziçi University Research Foundation projects 09HB101D, 08HB104D, and 07HB103D; and EczacıbaşıBaxter, İstanbul, Turkey. İnanç D. Fidancı designed the study, performed the experiments, performed the analysis, and wrote the manuscript. Bülent Zülfikar, Kaan Kavaklı, Yurdanur Kılınç, and Cem Ar provided the patient samples and clinical information. Zafer Başlar followed up on the inhibitor development in most of the patients. S. Hande Çağlayan designed the study, performed the analysis, and wrote the manuscript. None of the authors have any conflict of interest to disclose We confirm that we have read the journal’s position on issues involved in ethical publication and affirm that this report is consistent with those guidelines. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Kavaklı K, Aktuğlu G, Kemahlı S, Başlar Z, Ertem M, Balkan C, Ar C, Karapınar DY, Bilenoğlu B, Gülseven M, Gürman C. Inhibitor screening for patients with hemophilia in Turkey. Turk J Hematol 2006;23:25-32. 2. Oldenburg J. Mutation profiling in haemophilia A. Throm Haemost 2001;85:577–579. 3. Oldenburg J, El-Maarri O, Schwaab R. Inhibitor development in correlation to factor VIII genotypes. Hemophilia 2002;2:23-29. 4. Fidanci ID, Kavakli K, Ucar C, Timur C, Meral A, Kilinc Y, Sayilan H, Kazanci E, Caglayan SH. Factor 8 (F8) gene mutation profile of Turkish hemophilia A patients with inhibitors. Blood Coagul Fibrinolysis 2008;19:383-388. 5. Coppola A, Santoro C, Tagliaferri A, Franchini M, Di Minno G. Understanding inhibitor development in haemophilia A: towards clinical prediction and prevention strategies. Haemophilia 2010;16:13-19. 6. Key N. Inhibitors in congenital disorders. Br J Haematol 2004;127:379-391.

7. Astermark J, Oldenburg J, Pavlova A, Berntorp E, Lefvert AK. Polymorphisms in the IL10 but not IL1beta and IL4 genes are associated with inhibitor development in patients with hemophilia A. Blood 2006;107:3167-3172. 8. Astermark J, Oldenburg J, Carlson J, Pavlova A, Kavakli K, Berntop E, Lefvert AK. Polymorphisms in the TNFA gene and the risk of inhibitor development in patients with hemophilia A. Blood 2006;108:3739-3745. 9. Astermark J, Wang X, Oldenburg J, Berntorp E, Lefvert AK. Polymorphisms in the CTLA-4 gene and inhibitor development in patients with severe hemophilia A. J Thromb Haemost 2007:5:263-265. 10. Eyster ME, Lewis JH, Shapiro SS. The Pennsylvania hemophilia program 1973-78. Am J Hematol 1980;9:77-86. 11. Rosetti LC, Radic CP, Larripa IP, De Brasi CD. Genotyping the hemophilia inversion hotspot by use of inverse PCR. Clin Chem 2005;7:1154-1158. 12. Liu Q, Sommer SS. Subcycling-PCR for multiplex long distance amplification of regions with high and low GC content: application to the inversion hotspot in the factor VIII gene. Biotechniques 1998;25:1022-1028. 13. Lunetta KL. Genetic association studies. J Am Heart Assoc 2009;118:96-101. 14. Gauderman WJ. Sample size requirements for matched case-control studies of gene-environment interaction. Stat Med 2002;21:35-50. 15. Gauderman WJ, Morrison JM. QUANTO 1.1: A Computer Program for Power and Sample Size Calculations for Genetic-Epidemiology Studies. 2006. Available at http:// hydra.usc.edu/gxe. 16. Takatsu K. Interleukin 5 and B-cell differentiation. Cytokine Growth Factor Rev 1998;9:25-35. 17. Freidin MB, Kobyakova OS, Ogorodova LM, Puzyrev VP. Association of polymorphisms in the human IL4 and IL5 genes with atopic bronchial asthma and severity of the disease. Comp Funct Genomics 2003;4:346-350. 18. Mahajan R, El-Omar EM, Lissowka J, Grillo PG, Rabkin CS. Genetic variants in T helper cell type 1, 2 and 3 pathways and gastric cancer risk in a Polish population. Jpn J Clin Oncology 2008;9:626-633. 19. Yamamoto N, Suguira H, Tanaka K, Uehara M. Heterogeneity of interleukin 5 genetic background in atopic dermatitis patients: significant difference between those with blood eosinophilia and normal eosinophil levels. J Dermatol Sci 2003;33:121-126. 20. Zhang D, Cheng L, Badner JA, Chen C, Chen Q, Wei L, Craig DW, Redman M, Gershon EM, Chunyu L. Genetic control of individual differences in gene-specific methylation in human brain. Am J Hum Genet 2010;86:411-419. 21. Bioque G, Crusius JB, Koutroubakis I. Allelic polymorphism in IL-1 beta and IL-1 receptor antagonist (IL-1Ra) genes in inflammatory bowel disease. Clin Exp Immunology 1995;102:379-383.

Research Article

DOI: 10.4274/Tjh.2012.0146

Evaluation of Red Cell Membrane Cytoskeletal Disorders Using a Flow Cytometric Method in South Iran Güney İran’da Eritrosit Zarı Hücre İskelet Bozukluklarının Akım Sitometri ile Değerlendirilmesi Habib Alah Golafshan1,2, Reza Ranjbaran1,2, Tahereh Kalantari1,2, Leili Moezzi1,2, Mehran Karimi3, Abbas Behzad- Behbahani1,2, Farzaneh Aboualizadeh1,2, Sedigheh Sharifzadeh1,2 1Diagnostic Laboratory, Sciences and Research Technology Center, Shiraz University of Medical Sciences, Shiraz, Iran 2School of Para Medical Sciences, Shiraz University of Medical Sciences, Shiraz, Iran 3Hematology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran

Abstract: Objective: The diagnosis of hereditary red blood cell (RBC) membrane disorders, and in particular hereditary spherocytosis (HS) and Southeast Asian ovalocytosis (SAO), is based on clinical history, RBC morphology, and other conventional tests such as osmotic fragility. However, there are some milder cases of these disorders that are difficult to diagnose. The application of eosin-5’-maleimide (EMA) was evaluated for screening of RBC membrane defects along with some other anemias. We used EMA dye, which binds mostly to band 3 protein and to a lesser extent some other membrane proteins, for screening of some membrane defects such as HS.

Materials and Methods: Fresh RBCs from hematologically normal controls and patients with HS, SAO, hereditary elliptocytosis, hereditary spherocytosis with pincered cells, severe iron deficiency, thalassemia minor, and autoimmune hemolytic anemia were stained with EMA dye and analyzed for mean fluorescent intensity (MFI) using a flow cytometer. Results: RBCs from patients with HS and iron deficiency showed a significant reduction in MFI compared to those from normal controls (p<0.0001 and p<0.001, respectively), while macrocytic RBCs showed a significant increase in MFI (p<0.01). A significant correlation was shown between mean corpuscular volume and MFI, with the exceptions of HS and thalassemia minor.

Conclusion: Our results showed that the flow cytometric method could be a reliable diagnostic method for screening and confirmation, with higher sensitivity and specificity (95% and 93%, respectively) than conventional routine tests for HS patients prior to further specific membrane protein molecular tests.

Key Words: RBC, Membrane disorders, Band 3, Flow cytometry

Address for Correspondence: Sedigheh Sharifzadeh, M.D., Deputy Paramedical Education, School of Para Medicine, Shiraz University of Medical Sciences, Shiraz, Iran Phone: +989173152327 E-mail: sharifsd@sums.ac.ir Received/Geliş tarihi : October 08, 2012 Accepted/Kabul tarihi : July 08, 2013

Turk J Hematol 2014;31:25-31

Golafshan AH, et al: Diagnosis of RBC Membrane Defects

Özet: Amaç: Kalıtsal eritrosit zarı bozukluklarının ve özellikle kalıtsal sferositoz ve Güneydoğu Asya ovalositozunun tanısı klinik öykü, eritrosit morfolojisi ve ozmotik frajilite gibi konvansiyonel testlere dayanmaktadır. Ancak bu hastalıkların tanı koymada zorlanılan daha hafif formları bulunmaktadır. Eozin-5-malemid’in (EMA) kullanımı diğer anemiler yanında eritrosit zarı bozukluklarının taramasında değerlendirilmiştir. Biz HS gibi bazı zar bozukluklarının değerlendirilmesinde, öncelikle band 3 proteinini ve daha az oranda diğer zar proteinlerini bağlayan, EMA boyasını kullandık.

Gereç ve Yöntemler: Hematolojik açıdan normal kontrollerin ve HS, SAO, kalıtsal eliptositoz, kıskaç hücreli kalıtsal sferositoz, ağır demir eksikliği anemisi, talasemi minor ve otoimmun hemolitik anemi hastalarının taze eritrositleri EMA ile boyandı ve akım sitometri kullanılarak ortalama floresan yoğunluğu (MFI) değerlendirildi.

Bulgular: HS ve demir eksikliği olan hastaların eritrositleri normal kontrollere kıyasla MFI açısından anlamlı düşüklük gösterirken (sırasıyla p<0,0001 and p<0,001), makrositik eritrositlerde MFI anlamlı olarak yüksekti (p<0,01). HS ve talasemi minor haricinde ortalama eritrosit hacmi ile MFI’nin anlamlı düzeyde ilişkili olduğu gösterildi. Sonuç: Sonuçlarımız HS hastalarının taraması ve doğrulaması için, konvansiyonel rutin testlerden daha yüksek duyarlık (%95) ve özgünlüğe (%93) sahip olan akım sitometrinin zar proteinlerine yönelik ek, özgün moleküler testler öncesinde güvenilir bir tanısal yöntem olabileceğini göstermektedir. Anahtar Sözcükler: Eritrosit, zar bozuklukları, band 3, akım sitometri

Introduction The normal biconcave discoid shape (donut shape) of the red blood cell (RBC) is maintained by cytoskeletal proteins underneath the membrane, which mainly include the proteins α- and β-spectrin, ankyrin, actin, and bands 4.1 and 4.2. This protein network and its link with the lipid bilayer are essential for RBCs to remain flexible and carry out their physiological functions [1]. A number of disorders including hereditary spherocytosis and elliptocytosis are caused by decreased expression or mutation of cytoskeletal proteins [2]. Genetic defects in various cytoskeletal proteins may cause some disorders such as hereditary spherocytosis (HS), hereditary pyropoikilocytosis (HPP), hereditary elliptocytosis (HE), and stomatocytosis [3]. HS, which is a genetically transmitted (autosomal dominant) form of spherocytosis with sphere-shaped RBCs rather than a biconcave discoid shape, is prone to hemolysis. The genes responsible for HS encode one or more proteins of the cytoskeleton of the RBC membrane, which are ankyrin, spectrin, pallidin (protein 4.2), and band 3 protein (anion exchanger 1) [4]. Inheritance of HS is autosomal dominant in approximately two-thirds of the patients (typical HS), in which ankyrin mutations are the most common cause of HS. The remaining HS cases with nondominant autosomal recessive inheritance are due to defects in either α-spectrin or protein 4.2. Molecular studies have revealed that certain membrane protein defects are tied to specific morphologic results, as in HS with pincered RBCs (HSPR), which is specifically associated with a defect in band 3 [5]. Clinical manifestations of HS are usually marked by evidence of hemolysis with anemia, reticulocytosis, splenomegaly, jaundice, and a positive family history. According to the laboratory findings, evidence of HS includes 26

obvious spherocytes lacking central pallor on peripheral blood smear and increased erythrocyte osmotic fragility. HE is inherited in an autosomal dominant pattern and is characterized by the presence of elliptical, elongated erythrocytes on peripheral blood smear [4,6]. HE has a worldwide distribution but is more common in individuals of African and Mediterranean ancestry, presumably because of some resistance of the patients to malaria [6]. HPP is a rare cause of severe hemolytic anemia that has a strong association with HE. Patients with HPP usually present in the early newborn period with severe hemolytic anemia, RBC fragmentation, poikilocytosis, elliptocytosis, and microspherocytosis on peripheral blood smear [7]. Up to one-third of family members of HPP patients have HE. A genetic defect of spectrin has been identified in many cases of HE and HPP [8]. More than 60% of cases of HE are the result of mutations of α-spectrin, while 30% and 5% are the result of mutations of β-spectrin and protein 4.1, respectively [7]. In typical HE patients, the osmotic fragility is normal, but in severe HE and HPP, osmotic fragility is increased [6]. Southeast Asian ovalocytosis (SAO; also known as Melanesian elliptocytosis or stomatocytic elliptocytosis) is an unusual, inherited HE variant found in Malaysia, the Philippines, and other parts of Southeast Asia [9]. Rounded elliptocytes, or ovalocytes, and characteristic stomatocytes with longitudinal slits are found on peripheral blood smear. In these patients a 27-bp genomic deletion leads to deletion of 9 amino acids located at the N-terminal cytoplasmic domain of the band 3 protein [10,11]. RBC membrane protein disorders, particularly HS, are therefore primarily screened by clinical symptoms, family history, and peripheral smear examination accompanied with other laboratory tests such as osmotic fragility and

Golafshan AH, et al: Diagnosis of RBC Membrane Defects

Turk J Hematol 2014;31:25-31

the acidified glycerol lysis test. Nevertheless, these tests have been shown to have lower sensitivity and specificity. Diagnosis of these cell membrane disorders has been shown to be confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) [12].

suspension was added to 1.4 mL of PBS-BSA solution for analysis. Fluorescence intensity, as mean fluorescence intensity (MFI), was determined for 10,000 events in the FL1 channel of a BD FACS caliber flow cytometer (BD FACSCalibur, USA).

Recently, the fluorescence intensity of intact red cells has been measured by a flow cytometric approach using the dye eosin-5’-maleimide (EMA), which binds specifically in higher amounts to lysine-430 on the first extracellular loop of the band 3 protein and in lower amounts to Rh blood group proteins and CD47 of the RBC membrane [13,14].

Statistical Analysis The means and standard deviations (SDs) were calculated using SPSS 17.0 for Windows and mean±SD values were compared using a 2-tailed Student t-test. The correlation between MFI and MCV was compared with the Pearson correlation test. A p-value of <0.05 was considered statistically significant.

The aim of this study was evaluation of this flow cytometric method for screening of membrane protein disorders such as HS and SAO from other hematological red cell disorders. An ethics committee approved this study. Material and Methods Patient and Control Groups The patient group included 20 cases of HS, 2 cases of HSPR, 22 cases of HE, 2 cases of HPP, and 2 cases of SAO, along with 36 cases of other RBC disorders including macrocytosis with megaloblastic anemia (14 cases), thalassemia minor (7 cases), severe iron deficiency with mean corpuscular volume (MCV) of lower than 70 fL (13 cases), and autoimmune hemolytic anemia (AIHA) (2 cases). Fifteen healthy subjects with normal hematological parameters and red cell morphology were investigated as a normal control group. Laboratory Investigations Hematological indices were measured on a Sysmex automated cell counter (Sysmex KX-21, Japan). Red cell morphology was studied on Wright-stained peripheral smears. Diagnostic criteria for HS patients were increased red-cell turnover (reticulocytosis/polychromasia), typical spherocytes, and associated absence of an immune cause (negative direct antiglobulin test or Coombs test). The results of peripheral smears and hematological indices were evaluated by 2 expert scientists. SDS-PAGE analysis of RBC membrane proteins was carried out using a modification of Laemmli’s method [15]. Flow Cytometric Analysis of Red Cells The method described by King et al. [13] was used. Briefly, RBCs were washed twice with phosphate buffered saline (PBS) of pH 7.4. Five microliters of packed RBCs was incubated with 25 µL of EMA (0.5 mg/mL PBS; Fluka, USA) for 1 h at room temperature in the dark. The cell suspension was centrifuged for 1 min in a microcentrifuge and the supernatant containing unbound dye was removed. The labeled RBCs were washed 3 times with 500 µL of PBS-bovine serum albumin (BSA) solution (0.5% BSA in PBS). The RBC pellet was suspended again in 0.5 mL of PBS-BSA solution and a 100-µL aliquot of the cell

Results Diagnosis of the Patients According to membrane defect criteria, the results of peripheral smear evaluations are demonstrated in Figure 1. Evaluation of EMA-labeled RBCs of Patients by MFI Level Fluorescence histograms of EMA-labeled RBCs from normal controls and patients with HS, HSPR, HE, HPP, SAO, macrocytosis, iron deficiency, thalassemia minor, and AIHA are presented in Figure 2. Fluorescence intensity was determined as MFI in the FL1 channel. Labeled red cells from HS, HSPR, HPP, SAO, and iron deficient patient groups showed less fluorescence intensity than those of the normal control group, while labeled RBCs from patients with macrocytosis demonstrated more fluorescence intensity than those of the control group. Only patients with HS, iron deficiency, and macrocytosis showed significant differences compared to the control group (p<0.0001, p<0.001, and p<0.01, respectively). The data of the normal control group and all patient groups are demonstrated in Table 1. MFI values of RBCs from patients with HS (n=20) and iron deficiency (n=13) were significantly lower than those of the normal group (252±57, p=0.0001 and 280±19, p=0.001, respectively), while the related results of MFI from patients with macrocytosis (n=14) were significantly higher than those from the control group (416±82, p<0.01). MFI values of RBCs from patients with HE (n=22) and thalassemia minor (n=7) were not significantly different from those of the normal controls (335±35, p>0.5 and 344±35, p>0.5, respectively). However, patients with HSPR (n=2), HPP (n=2), and SAO (n=2) showed lower MFIs than the control group, while the MFI values of patients with AIHA (n=2) showed no differences compared to the control group. Evaluation of MFI Test We checked some statistical tests, such as sensitivity and specificity, positive and negative predictivity, and positive and negative likelihood ratios, to evaluate the MFI test in the HS patient group. The sensitivity and specificity and the positive and negative predictivity of the MFI test were 95%, 93%, 95%, and 93%, respectively. Furthermore, the positive 27

Golafshan AH, et al: Diagnosis of RBC Membrane Defects

Turk J Hematol 2014;31:25-31

and negative likelihood ratios of the test were 14 and 0.05, respectively. Assessment of MFI/MCV Correlation Correlations between MCV and MFI in each group were studied (Table 1). There was a significant correlation between MCV and MFI within each group among the normal control (MCV: 92±4.4, MFI: 337±44, p=0.045), HE (MCV: 84±7.5, MFI: 335±35, p=0.039), macrocytosis (MCV: 113±10.2, MFI: 416±82, p=0.033), and iron deficiency (MCV: 66±5.8, MFI: 280±19, p=0.028) groups. No significant correlation was seen between MCV and MFI in HS (MCV: 88±9.5, MFI: 252±57, p>0.5) or thalassemia minor (MCV: 67±6.6, MFI: 344±35, p>0.5) patients. Discussion Red cell membrane disorders are generally diagnosed based on clinical history of the disease and peripheral smear examination, along with some routine hematologic tests such as the osmotic fragility test [16]. However, these methods have not shown precise specificity and sensitivity for detection of milder or atypical cases of cytoskeletal disorders. On the other hand, measuring the amount of cytoskeletal proteins in the red cell membrane is difficult,

because small variations from normal must be accurately measured. In line with this, some patients with HS have only a 10% to 15% decrease in the affected membrane protein. Therefore, for this purpose, SDS-PAGE of red cell membranes is done in a few specialized laboratories. However, it does not have the required precision and accuracy to measure small reductions in the membrane proteins of mild cases [17]. Our results from SDS-PAGE did not show significant differences between HS patients and the control group. Most of the HS patients had only 10% to 15% or even lower percentages of spherocytes, which may lead to poor diagnosis with SDS-PAGE as the result of small reductions in their affected membrane proteins. This was a motivation to find an easy approach, such as flow cytometry using EMA dye, for diagnosis of cytoskeletal disorders. This method only takes 2 h and has higher sensitivity and specificity than general methods such as osmotic fragility, which is used for screening of HS patients. Our flow cytometric results from labeled RBCs of HS, HSPR, SAO, HPP, and iron deficiency patients showed lower MFIs as compared to the control group, which was significant only for HS and iron deficiency patients (p<0.0001 and p<0.0001, respectively). According to the MFIs, the labeled

Table 1. Flow cytometric analysis of EMA-labeled RBCs (MFI) in different hematological disorders and evaluation of correlation between the resultant MFI and MCV.

Comparison of patient and control groups for MFI (p-value)

Control and patient groups

Cases MFI (n) (mean±SD)

Hematologically normal adults

337±44

Hereditary spherocytosis

252±57

Hereditary spherocytosis with pincered RBC

199 & 80

Hereditary elliptocytosis

Hereditary pyropoikilocytosis

335±35 271 & 260

Southeast Asian ovalocytosis

279 & 274

94 & 101

Autoimmune hemolytic anemia

419 & 332

105 & 106

Macrocytosis

416±82

<0.01**

113±10 0.033*

Iron deficiency

280±19

<0.001**

66±5.8

0.028*

Thalassemia minor

344±35

>0.5

67±6.6

0.5

<0.0001**

92±4.3

0.045*

88±9.5

>0.5

86 & 89 >0.5

*: p< 0.05, **: p< 0.01. For groups with only 2 patients, the MFI and MCV of each of the patients are shown.

MCV (fL, mean±SD)

Correlation between MCV and MFI (p-value)

84±7.5 54 & 57

0.039*

Golafshan AH, et al: Diagnosis of RBC Membrane Defects

Figure 1. Blood morphology of red cell membrane defects of patients with HS (A), HSPR (B), HPP (C), SAO (D), and HE (E). HS (A) and HSPR (B): The peripheral blood smear of a patient with HS shows spherocytosis, anisocytosis, and polychromasia (increased reticulocytes). Spherocytes are developed due to a loss of RBC membrane, resulting in small, round, dense red cells without central pallor. HPP (C): The red cells of hereditary pyropoikilocytosis demonstrate bizarre forms, anisocytosis, fragments, micropoikilocytosis, microspherocytosis, and budding red blood cells. SAO (D): The red cells of Southeast Asian ovalocytosis are often described as being stomatocytic elliptocytes. The red cells have a slit-like area of central pallor instead of being discocytes. A small proportion of these stomatocytes have 2 transverse slits, giving the appearance of double stomatocytes. HE (E): The peripheral smear of a patient with hereditary elliptocytosis shows elliptical rather than typically biconcave disc-shaped RBCs. Abbreviations: HS: hereditary spherocytosis, HSPR: hereditary spherocytosis with pincered RBC, HPP: hereditary pyropoikilocytosis, SAO: Southeast Asian ovalocytosis, and HE: hereditary elliptocytosis. RBCs of patients with HE, thalassemia minor, and AIHA showed no significant differences from the control group. On the other hand, patients with macrocytic RBCs showed higher and significantly different MFIs compared to the normal control group (p<0.01). The probable cause of the nonsignificant flow cytometric results of the patients with HSPR (in which their mean MFI was also lower than that of HS patients), SAO, and HPP would be the low number of cases compared to HS. The labeled RBCs of the patients with HPP showed a unique pattern of MFI, with 2 histogram peaks. The MFIs of HE red cells were similar to normal red cells. Our results are consistent with those of other investigators [13] who found no significant difference in MFIs of red cells between common HE and normal control subjects.

Turk J Hematol 2014;31:25-31

Figure 2. Fluorescence histogram of EMA-labeled RBCs from normal controls and patients with HS (A), HSPR (B), HE (C), Th.m (D), HPP (E), SAO and iron deficiency (F), macrocytosis (G), and AIHA (H). Red blood cells were stained with EMA dye and their intensity was measured as MFI using a flow cytometer. Abbreviations: N: normal control group, Th.m: thalassemia minor, ID: iron deficiency, M: macrocytosis, and AIHA: autoimmune hemolytic anemia. The most common deficiency of cytoskeletal proteins of RBCs in HS patients is ankyrin deficiency, which results in the release of band 3 from low-affinity binding sites on ankyrin [18]. This increased release of band 3 in HS patients causes a reduction of band 3 in their cytoskeletal membrane. The most important cause of genetic defects in HSPR and SAO is a defect in band 3. An abnormal expression of band 3 in iron deficiency anemia has also been shown, which is consistent with our results [19,20]. According to the specific binding of EMA dye to band 3, we also measured the correlation between the MCV and MFI of individuals in each group. A significant correlation between them was seen in patients with HE (MCV: 84±7.7, MFI: 335±35, p=0.039), macrocytic RBCs (MCV: 113±10.2, MFI: 416±82, p=0.033), and iron deficiency (MCV: 66±5.8, MFI: 280±19, p=0.028), and in RBCs from healthy controls (MCV: 92±4.4, MFI: 337±44, p=0.045). There was no significant correlation between MCV and MFI in HS patients (MCV: 78.5±9.5, MFI: 250±58, p>0.5) or thalassemia minor patients (MCV: 67±6.6, MFI: 344±35, p>0.5). It seems that there is a direct correlation between MCV and MFI (increased MCV may lead to increased MFI and vice versa), which also results in a direct correlation between MCV and the surface 29

Golafshan AH, et al: Diagnosis of RBC Membrane Defects

Turk J Hematol 2014;31:25-31

area of RBCs and expression of band 3. Therefore, there is no direct relationship between MCV and MFI in HS and thalassemia minor patients and exceptions to this finding occurred in the HS and thalassemia minor anemia patients. Although spherocytes appear as red blood cells that are smaller than normal on a blood smear (because the diameter of the cells can be assessed on a smear, but noT-cell volume), they have normal volumes and do not have a change in MCV due to cell membrane rigidity. Moreover, in most cases, spherocytes have normal volumes and no change in MCV, while only rare cases show low MCV due to the production of microspherocytes with lower cell volumes. Therefore, in spherocytosis, the defect in RBC membranes and therefore the lowered MFI cannot be affected by the MCV. On the other hand, in spite of the lower MCV in thalassemia minor, which is because of low hemoglobin levels, there is no variation in MFI. Therefore, the normal level of MFI in thalassemia minor patients could be due to absence of a defect in the expression of band 3. Some studies have reported variable sensitivity of the osmotic fragility test from 48% to 95%, independent of the cytoskeletal abnormality and of the amount of protein deficiency for diagnosis of HS [21]. However, a sensitivity of 99% was obtained when the osmotic fragility test was done along with the acidified glycerol lysis test on incubated blood [21]. In this study, our emphasis was on patientsâ&#x20AC;&#x2122; history, and morphological changes in RBCs reported by experts from blood smear examinations can give useful information about RBC membrane defects (Figure 1). All patients suspected of HS with reported spherocytes in their blood smears showed significant decreases in MFI. Taken together, it seems that the fluorescence dyebased method is a reliable diagnostic assay with higher sensitivity and specificity (95% and 93%, respectively) than conventional routine tests for HS patients. We propose that this approach will contribute a rapid screening and confirmation test for diagnosis of HS, HSPR, SAO, and HPP patients before performing further specific membrane protein molecular tests. Acknowledgment This study was done at and supported by Shiraz University of Medical Sciences (grant no. 90-5697). Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Zeman K, Engelhard H, Sackmann E. Bending undulations and elasticity of the erythrocyte membrane: effects of cell shape and membrane organization. Eur Biophys J 1990;18:203-219. 30

2. Palek J. Hereditary elliptocytosis, spherocytosis and related disorders: consequences of a deficiency or a mutation of membrane skeletal proteins. Blood Rev 1987;1:147-168. 3. Cynober T, Mohandas N, Tchernia G. Red cell abnormalities in hereditary spherocytosis: relevance to diagnosis and understanding of the variable expression of clinical severity. J Lab Clin Med 1996;128:259-269. 4. Gallagher PG. Update on the clinical spectrum and genetics of red blood cell membrane disorders. Curr Hematol Rep 2004;3:85-91. 5. Gallagher PG. Red cell membrane disorders. Hematology Am Soc Hematol Educ Program 2005:13-18. 6. Gallagher PG. Hereditary elliptocytosis: spectrin and protein 4.1R. Semin Hematol 2004;41:142-164. 7. Bain BJ. Blood Cells: A Practical Guide, 4th ed. Oxford, Blackwell, 2006. 8. Zhang Z, Weed SA, Gallagher PG, Morrow JS. Dynamic molecular modeling of pathogenic mutations in the spectrin self-association domain. Blood 2001;98:1645-1653. 9. Mohandas N, Lie-Injo LE, Friedman M, Mak JW. Rigid membranes of Malayan ovalocytes: a likely genetic barrier against malaria. Blood 1984;63:1385-1392. 10. Liu SC, Palek J, Prchal J, Castleberry RP. Altered spectrin dimer-dimer association and instability of erythrocyte membrane skeletons in hereditary pyropoikilocytosis. J Clin Invest 1981;68:597-605. 11. Schofield AE, Tanner MJA, Pinder JC, Clough B, Bayley PM, Nash GB, Dluzewski AR, Reardon DM, Cox TM, Wilson RJM, Gratzer WB. Basis of unique red cell membrane properties in hereditary ovalocytosis. J Mol Biol 1992;223:949-958. 12. Fairbanks G, Steck TL, Wallach DF. Electrophoretic analysis of the major polypeptides of the human erythrocyte membrane. Biochemistry 1971;10:2606-2617. 13. King MJ, Behrens J, Rogers C, Flynn C, Greenwood D, Chambers K. Rapid flow cytometric test for the diagnosis of membrane cytoskeleton-associated haemolytic anaemia. Br J Haematol 2000;111:924-933. 14. King MJ, Smythe JS, Mushens R. Eosin 5 maleimide binding to band 3 and Rhrelated proteins forms the basis of a screening test for hereditary spherocytosis. Br J Haematol 2004;124:106-113. 15. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680-685. 16. Bolton-Maggs PH, Langer JC, Iolascon A, Tittensor P, King MJ, General Haematology Task Force of the British Committee for Standards in Haematology. Guidelines for the diagnosis and management of hereditary spherocytosis. Br J Haematol 2004;126:455-474.

Golafshan AH, et al: Diagnosis of RBC Membrane Defects

17. Eber S, Lux SE. Hereditary spherocytosis-defects in proteins that connect the membrane skeleton to the lipid bilayer. Semin Hematol 2004;41:118-141. 18. Reinhardt D, Witt O, Miosge N, Herken R, Pekrun A. Increase in band 3 density and aggregation in hereditary spherocytosis. Blood Cells Mol Dis 2001;27:399-406. 19. Li JY, Li JX, Yang ZM. Abnormalities of ion-exchange proteins of the red cell membrane in iron deficiency anemia. Chin Med J (Engl) 1992;105:116-119.

Turk J Hematol 2014;31:25-31

20. Huang Q, Li J, Feng W, Xu Y, Huang Z, Lv S, Zhou H, Gao L. Erythroid 5-aminolevulinate synthase mediates the upregulation of membrane band 3 protein expression by iron. Cell Biochem Funct 2010;28:122-125. 21. Mariani M, Barcellini W, Vercellati C, Marcello AP, Fermo E, Pedotti P, Boschetti C, Zanella A. Clinical and hematologic features of 300 patients affected by hereditary spherocytosis grouped according to the type of the membrane protein defect. Haematologica 2008;93:1310-1317.

Research Article

DOI: 10.4274/Tjh.2012.0049

Childhood Immune Thrombocytopenia: Long-term Follow-up Data Evaluated by the Criteria of the International Working Group on Immune Thrombocytopenic Purpura Çocukluk Çağında İmmun Trombositopeni: Uluslararası İmmun Trombositopeni Çalışma Grubunun Kriterlerine Göre Uzun İzlem Verilerinin Değerlendirilmesi Melike Sezgin Evim, Birol Baytan, Adalet Meral Güneş Uludağ University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Bursa, Turkey

Abstract: Objective: Immune thrombocytopenia (ITP) is a common bleeding disorder in childhood, characterized by isolated thrombocytopenia. The International Working Group (IWG) on ITP recently published a consensus report about the standardization of terminology, definitions, and outcome criteria in ITP to overcome the difficulties in these areas. Materials and Methods: The records of patients were retrospectively collected from January 2000 to December 2009 to evaluate the data of children with ITP by using the new definitions of the IWG. Results: The data of 201 children were included in the study. The median follow-up period was 22 months (range: 12-131 months). The median age and platelet count at presentation were 69 months (range: 7-208 months) and 19x109/L (range: 1x109/L to 93x109/L), respectively. We found 2 risk factors for chronic course of ITP: female sex (OR=2.55, CI=1.31-4.95) and age being more than 10 years (OR=3.0, CI=1.5-5.98). Life-threatening bleeding occurred in 5% (n=9) of the patients. Splenectomy was required in 7 (3%) cases. When we excluded 2 splenectomized cases, complete remission at 1 year was achieved in 70% (n=139/199). The disease was resolved in 9 more children between 12 and 90 months. Conclusion: Female sex and age above 10 years old significantly influenced chronicity. Therefore, long-term follow-up is necessary in these children.

Key Words: Thrombocytopenia, Long-term survival, Children Özet: Amaç: İmmün trombositopeni (ITP), izole trombositopeni ile karakterize çocukluk çağında yaygın görülen bir kanama hastalığıdır. Uluslar arası ITP çalışma grubu (IWG), zorlukların üstesinden gelmek için ITP’de terminolojinin, tanımların ve sürecin standardizasyonu hakkında bir uzlaşı raporu yayınlamıştır. Address for Correspondence: Melike Sezgİn Evİm M.D., Uludağ University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Bursa, Turkey Phone: +90 224 295 05 64 E-mail: melikevim@yahoo.com Received/Geliş tarihi Accepted/Kabul tarihi

: April 13, 2012 : January 17, 2013

Evim SM, et al: Childhood Immune Thrombocytopenia

Turk J Hematol 2014;31:32-39

Gereç ve Yöntemler: ITP’li hastalarımıza ait kayıtlar Ocak 2000’den Kasım 2009’a kadar, geriye yönelik olarak, IWG’nin

yeni kriterleri kullanılarak değerlendirilmek üzere toplandı. Bulgular: İki yüz bir çocuğun verileri çalışmaya dahil edildi. Ortanca takip süresi 22 ay (12-131 ay) idi. Başvuru anında ortanca yaş ve trombosit sayısı, sırası ile 69 ay (7-208 ay) ve 19x109/L (1-93x109/L) idi. Hastalığın kronikleşmesi açısından iki risk faktörü saptadık: Kız cinsiyet (OR=2,55, CI=1,31-4,95) ve yaşın 10’dan büyük olması (OR=3,0, CI=1,5-5,98). Hayatı tehdit edici kanama, hastaların 5%’inde (n=9) görüldü. Splenektomi yapılması,7 hastada (3%) gerekti. İlk bir yılda splenektomi yapılan 2 hasta göz ardı edildiğinde, tam remisyon (CR) 70% (n=139/199) hastada görüldü. Hastalık, kronik ITP’li olguların 9’unda (%15; 9/60) daha tanıdan itibaren12 ile 90 ay içerisinde düzeldi. Sonuç: Kız cinsiyet ve yaşın 10’dan büyük olması, kronikleşmeyi belirgin olarak etkiledi. Ancak bu çocuklarda uzun sureli takip gereklidir. Anahtar Sözcükler: Trombositopeni, Çocuk, Uzun dönem takip

Introduction Immune thrombocytopenia (ITP) is one of the most frequent acquired bleeding diseases in children. It is characterized by destruction of the antibody-sensitized platelets by the reticuloendothelial system and the presence of isolated thrombocytopenia in the absence of splenomegaly [1,2]. In the majority of the children, it is a self-limiting disease with complete recovery of the platelets. However, 20% to 30% of children develop the chronic form of the disease [3]. Clinical definition, terminology in evaluating patient characteristics, treatment responses, and outcome in both adults and children with ITP show great variety from one study to another. Therefore, a new revision in children and adults has been made for standardization of terminology, definition, and outcome [4]. The aim of this study was to evaluate the data, and longterm outcome in children with ITP according to the recent International Working Group (IWG) report. Materials and Methods The records of patients diagnosed with ITP from January 2000 to December 2009 at the Department of Pediatric Hematology of Uludağ University Hospital were retrospectively collected. The study was approved by the local ethics committee. The data were evaluated according to the recent consensus report of the IWG on ITP [4]. Patients with the following criteria were excluded: 1) thrombocytopenia due to systemic disease or medication, 2) children less than 6 months old, 3) patients with incomplete clinical data. The diagnosis was made with the history, physical examination, complete blood count, and examination of the peripheral blood smear [5]. The diagnosis of ITP and the management, treatment, complications, and outcome of the disease was discussed with each family individually during their outpatient appointments, and written informed consent was obtained from all.

Age, sex, history of preceding infection and vaccination platelet count, bleeding manifestations, seasonal difference, treatment and treatment response at first presentation were recorded. All children had a minimum of 1 year of followup. Treatment was given to children with either platelet count of less than 10x109/L and/or severe bleeding symptoms. Children with minor and/or mucous bleeding symptoms with platelet count of less than 20x109/L to 30x109/L were closely observed and received treatment on demand [5,6,7]. Prednisone at 3-5 mg kg-1 day-1 for 3-7 days or intravenous immunoglobulin G (IVIG) at 0.81 g kg-1 day-1 were the initial therapeutic options. IWG criteria were used for assessing response to treatment; “complete response” (CR) was defined as platelet count greater than 100x109/L. “Response” was defined as platelet count between 30x109/L and 100x109/L or doubling of the baseline count. Any platelet count lower than 30x109/L or less than doubling of the baseline count was described as “no response”. “Refractory” patients included either those with failed splenectomy or those with either severe ITP or increased risk of bleeding requiring frequent therapeutic intervention [4]. The new terms “newly diagnosed” and “persistent” replaced the previous term “acute” for children diagnosed with ITP within the last 3 months and for cases lasting between 3 and 12 months from diagnosis, respectively. Chronic ITP was defined as persisting thrombocytopenia of less than 100x109/L lasting for more than 12 months [4]. The effects of age at diagnosis in progression to chronic ITP were evaluated by classifying the study group into 3 different age groups [8,9]. The groups were as follows: group 1: between ≥6 and ≤12 months, group 2: between >1 year and ≤10 years, and group 3: >10 years. Autoimmune tests such as antinuclear antibody (ANA) and antiphospholipid antibodies (APAs), direct antiglobulin test, hepatitis B (HBV) and hepatitis C (HCV) viruses, and antigenemia were also tested in children with chronic ITP. Helicobacter pylori was also looked for with the urea breath test in the same group. 33

Turk J Hematol 2014;31:32-39

Evim SM, et al: Childhood Immune Thrombocytopenia

Life-threatening bleeding was defined as intracranial hemorrhage (ICH) and/or severe hemorrhage at any site requiring blood transfusion. The indication of splenectomy and recovery following the operation were separately addressed for each case. Two patients had splenectomy within the first 12 months of diagnosis. After excluding these cases, the rates of platelet recovery according to patients’ platelet count were evaluated at the 3rd, 6th, and 12th months of diagnosis. Statistical calculations were performed using SPSS 16 for Windows. Normal distribution was tested using the Shapiro-Wilk test. Numerical data and categorical variables were analyzed by the Mann-Whitney U or t-tests and the chi-square test, respectively. The odds ratio (OR) and 95% confidence interval (CI) were used to determine the increased relative risk. The results are reported as median, maximum, and minimum values. Statistical significance was accepted as p<0.05. Results A total of 201 children’s records out of 227 were included in the study. The other 26 children’s records were not eligible for the study due to incomplete data. The median follow-up period for all children was 22 months (range: 12131 months). The median age and platelet count at presentation were 69 months (range: 7-208 months) and 19x109/L (range: 1x109/L to 93x109/L), respectively. Females comprised 54% of the study group (n=108) while males were 46% (n=93). The platelet count and age at diagnosis between the sexes were found to be similar (p>0.05). There was no previous history of infection and vaccination for 39% of the children (n=78). History of upper respiratory tract infection, viral exanthemas, and acute gastroenteritis was seen in 50% (n=101), 6% (n=12), and 4% (n=8) of the patients, respectively. Two patients (1%) had a history of recent vaccination (rabies and diphtheria-tetanus-pertussis)

The most frequent symptoms were petechia and ecchymosis (71%). Thirty-six children (18%) were admitted with epistaxis and/or gum bleeding along with petechia and ecchymosis. Twenty-three patients (11%) had no bleeding manifestations. No significant seasonal fluctuation in the incidence of disease was found (p>0.05). Therapy was given to 102 (51%) children at first presentation. The rest (n=99; 49%) were observed according to their clinical symptoms. Initial age and sex did not differ between the treatment and nontreatment arms (p>0.05). IVIG was administered to 66 (65%) children, whereas 36 (35%) received corticosteroids as the first therapeutic choice. The features of the different treatment arms at diagnosis are given in Table 1. Treatment response was found similar for both drugs (p>0.05). Drugrelated acute complications were seen in 2 (1%) children. Aseptic meningitis due to IVIG was observed in one of these patients, and the other developed severe tonsillitis following corticosteroid treatment. Within the first 12 months, 2 children required urgent splenectomy. When we excluded these cases, the rest of the patients (30%; n=60) had chronic ITP lasting more than 12 months. Platelet counts and bleeding symptoms at diagnosis, history of preceding infections, and treatment response were found similar between the persistent and chronic groups (p>0.05). However, females had a significantly higher incidence of developing chronic ITP than males (p=0.007) (Figure 1). The median age of children with chronic ITP was higher than children with persistent ITP (88 months (range: 10-196 months) and 61 months (range: 7-208 months) respectively, p=0.002). When we evaluated children in 3 different age groups according to their presenting age, children older than 10 years had a significantly higher incidence of developing chronic ITP than the others (Figure 2). Among the possible predicting factors for developing chronic ITP, the major predictors were found to be age of more than 10 years old at presentation (OR=3.0, CI=1.5-

Table 1. The features of the different treatment arms at diagnosis.

IVIG group,ª (n=66)

Steroid group,b (n=36)

No treatment group,c (n=99)

Age (months)

56.5 (7-200)

77.5 (14-202)

70 (7-208)

a vs. b, <0.05 a vs. c, <0.05 b vs. c, >0.05

Sex (male/female)

33/33

12/24

48/51

>0.05

Platelet count (mean±standard deviation)

13.328±11.784

16.297±15.813

40.255±23.756

a vs. b, >0.05 a vs. c, <0.0001 b vs. c, <0.0001

Mucosal bleeding

15 (22.7%)

9 (25%)

13 (13.1%)

>0.05

Chronic course

16 (24.2%)

14 (38.9%)

30 (30.3%)

>0.05

p-value

Turk J Hematol 2014;31:32-39

Evim SM, et al: Childhood Immune Thrombocytopenia

5.98) and female sex (OR=2.55, CI=1.31-4.95). When we excluded children above 10 years of age, females still had a significantly higher risk of chronicity than males (OR=4.01, CI=1.70-9.50). The rate of recovery according to patients’ platelet counts at the 3rd, 6th, and 12th months of diagnosis excluding the 2 splenectomized cases are shown in Figure 3. Eleven (15%) out of 71 children with platelet counts lower than 100x109/L at 6 months achieved CR at 12 months. In total, the platelet count in 139 (70%) out of 199 children gradually rose to normal levels (≥100x109/L) during 12 months of follow-up.

Figure 1. The number of children with persistent versus chronic ITP according to sex.

In addition, platelet recovery subsequently occurred during 20 months (range: 14-90 months) of follow-up in 9 (15%) out of 60 children who were previously defined as “chronic” at 12 months of diagnosis. The sex, age, and initial platelet counts of these children did not differ from those of the nonresponders (p>0.05). In total, 15 out of 201 (7.5%) children were refractory, including cases with severe bleeding (n=9) and 6 other children with high risk of bleeding requiring frequent therapy intervention. The characteristics of children with severe bleeding are given in Table 2. Splenectomy had to be performed in 7 of them due to insufficient treatment response to control bleeding symptoms. Splenectomy had to be performed urgently in 2 of them within the first 12 months of diagnosis. CR was achieved immediately in 4 of the 7 splenectomized cases. Autoimmune diseases were screened in children with chronic ITP. ANA was found positive in 10% (n=6, 3 females and 3 males) of the children, whereas 8% (n=5) of them had APA positivity. Direct antiglobulin test was also found positive in 3% (n=2) of them without any clinical or laboratory signs of hemolytic anemia. Only one child developed microscopic hematuria. Viral diseases as HBV, and HCV were also screened in 87% (n=52) of the chronic patients, and 4% (n=2) were found positive for the hepatitis B antigen. Eleven out of 60 patients with chronic ITP were screened for H. pylori. Six out of 11 children (67%) were found positive and H. pylori eradication was commenced. None had an increase in platelet count following the eradication. Discussion

Figure 2. The number of children with persistent versus chronic ITP according to different age groups at diagnosis. *Group 1: between ≥6 and ≤12 months, **Group 2: between >1 year and ≤10 years, ***Group 3: >10 years.

Figure 3. The rate of platelet recovery during 12 months of follow-up (excluding 2 splenectomized patients).

The IWG in 2009 published a consensus report on standardization of terminology, definition, and outcome criteria in ITP for both adults and children [4]. One of the changes in the criteria of defining ITP was the platelet count; the threshold for diagnosis was established as less than 100x109/L instead of the previously used platelet count of 150x109/L [10,11,12]. Another change made by the IWG was in the term “chronic ITP”. The group reserved this term for children with ITP lasting more than 12 months instead of 6 months [4]. Various studies also report that thrombocytopenia resolves in around 70% of children with ITP by 6 months [3,13]. However, complete remission could be achieved in a time longer than this period [14]. The chances of spontaneous remissions are still significant during long-term follow-up, both in adults and children [15,16]. Imbach et al. [2] reported that 25% of children with persistent thrombocytopenia at 6 months had recovered by 12 months. In our study, 11 (15%) out of 71 children with low platelet count at 6 months achieved CR at 12 months (Figure 3). In addition, when the follow-up period was prolonged beyond 12 months, recovery in platelet counts occurred in 9 (15%; n=9/60) more children who were 35

16.6

5.5

9.6/18.6

14.3/20.7

6.2/10.6

1.7/8

10.3/11

6.2/6.5

2.3/14.8

*Splenectomy was performed within the first 12 months of diagnosis. CR: complete response, R: response, NR: no response.

125

108

Time interval between diagnosis and splenectomy (months)

Sex Age at diagnosis/age at the time of splenectomy (years)

108

5.5

Time interval between diagnosis and severe bleeding episode (months)

14.4

1.8

9.8

6.8

6.4

Hematochezia

Melena + intracranial hemorrhage

Menorrhagia + intraabdominal hemorrhage

Hematuria + melena

Melena

Hematuria

Epistaxis

Melena

Menorrhagia

Platelet count x109/L Bleeding at time of site bleeding episode

Yes

Need of transfusion Splenectomy

Table 2. The features of the children with severe bleeding symptoms and characteristics of splenectomized patients.

Rď&#x192; NR

Outcome

Turk J Hematol 2014;31:32-39

Evim SM, et al: Childhood Immune Thrombocytopenia

Turk J Hematol 2014;31:32-39

Evim SM, et al: Childhood Immune Thrombocytopenia

defined as chronic at 12 months. Watts [13] also reported that thrombocytopenia resolved spontaneously in 37 (37%) out of 99 patients with persistent thrombocytopenia between 7 and 96 months from the initial diagnosis. The largest study about childhood ITP including 2540 children reported that the mean age and the male/female ratio of the cases of acute and chronic disease were similar [17]. However, it showed that chronic ITP was seen less frequently in infants than in children above 10 years of age [8]. Yaprak et al. [18] from Turkey also reported that children older than 10 years of age had an at least 2-fold increased probability of a chronic outcome. Similar findings were also determined by other reports, revealing that older age is an important predictor of the chronic disease [13,14]. In the current study, we also supported this result, indicating that the risk of developing chronic ITP significantly increased in children older than 10 years of age (OR: 3.0, CI: 1.5-5.98). The other predictor for chronic ITP in our data was female sex. A significant increase of chronicity was noted in females (OR: 2.55, CI: 1.31-4.95). Several studies noted no difference in the incidence of chronic ITP in male versus female patients [13,19]. However, females older than 10 years of age have been reported to develop a more chronic course [6,20,21]. In our study, when we excluded children above 10 years of age, females still had a significantly higher risk of chronicity than males (OR=4.01, CI=1.70-9.50). In our cohort, 51% of the patients were treated at diagnosis either with corticosteroids or IVIG. Treatment response did not differ by therapy. Many other studies also supported our finding [13,19]. Various studies from Turkey also reported that the therapy response to prednisolone and IVIG treatments were similar [22,23,24]. The ASH guidelines of 1996 suggested treatment for children with platelet counts of <20x109/L and significant mucous membrane bleeding and for those with counts of <10x109/L and minor purpura [5]. They also recommended hospitalization and treatment intervention in a child with severe, life-threatening bleeding regardless of the platelet counts and for a child with platelet counts of <20x109/L and mucous membrane bleeding. Duru et al. [23] from Turkey also recommended no treatment for children without active bleeding even if they had mucosal bleeding, unless it was continuous and extensive. Current opinion suggests that the treatment decision should be made according to various factors such as the severity of bleeding symptoms, the platelet count, and psychosocial and lifestyle issues [25,26]. The ASH in 2011 also recommended that children without bleeding or with minor bleeding (defined as skin manifestations only, such as bruising and petechia) should be managed with observation alone regardless of their platelet count, but if the child develops an episode of epistaxis that lasts about 15 min, a decision should be made to treat based on the bleeding [27]. Serious bleeding in our group was determined in 5% (n=9) of the children. Various studies also reported that clinically significant bleeding symptoms

were observed in between 3% and 6% of children with ITP [6,13,28]. In pediatric literature, ICH incidence ranges from 0.1% to 0.5% [15,29]. ICH occurred only in one child (0.5%). In the current study, splenectomy had to be performed in 4% (n=7) of the children (Table 1). Only 2 patients with acute ITP underwent splenectomy within 8 months of diagnosis due to life-threatening bleeding. The rest were chronic cases. Complete remission was achieved in 4 (57%) of 7 splenectomized cases. The recovery rate in the literature varies from 66% to 86% in splenectomized children [30,31]. In adults, 1% to 5% of patients with ITP later develop systemic lupus erythematosus (SLE) [33]. In children, 2 main studies evaluated the risk of developing SLE. Hazzan et al. [34] noted that 4% of children (8/222) developed SLE during a mean 4.2 years of follow-up. Zimmerman and Ware [35] suggested a careful follow-up for ANA-positive children with ITP developing autoimmune symptoms. In our study, only one child with ANA positivity developed microscopic hematuria. The role of H. pylori infection in ITP is controversial [26]. The recent guidelines of the ASH do not recommend routine testing for H. pylori in children with persistent and chronic ITP [27]. HIV and HCV screening is recommended in adults upon diagnosis of ITP [26,27]. However, it has been recommended in children if there is a clinical suspicion or high local prevalence and no improvement after 3 to 6 months [26]. We also screened HBV in our cohort since Turkey is considered one of the countries with intermediate endemicity in Europe by the World Health Organization [36]. In summary, excluding 2 splenectomized cases, 70% (n=139/199) of patients achieved CR within 1 year. In addition, 9 children achieved CR after 1 year. Girls and children older than 10 years old also carry significantly higher risks of developing the chronic form of the disease. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Nugent DJ. Immune thrombocytopenic purpura of childhood. Hematology Am Soc Hematol Educ Program 2006:97-103. 2. Geddis AE, Balduini CL. Diagnosis of immune thrombocytopenic purpura in children. Curr Opin Hematol 2007;14:520-525. 3. K端hne T, Imbach P, Bolton-Maggs PH, Berchtold W, Blanchette V, Buchanan GR, Intercontinental Childhood ITP Study Group. Newly diagnosed idiopathic thrombocytopenic purpura in childhood: an observational study. Lancet 2001;358:2122-2125. 37

Turk J Hematol 2014;31:32-39

4. Rodeghiero F, Stasi R, Gernsheimer T, Michel M, Provan D, Arnold DM, Bussel JB, Cines DB, Chong BH, Cooper N, Godeau B, Lechner K, Mazzucconi MG, McMillan R, Sanz MA, Imbach P, Blanchette V, Kühne T, Ruggeri M, George JN. Standardization of terminology, definitions and outcome criteria in immune thrombocytopenic purpura of adults and children: report from an international working group. Blood 2009;113:2386-2393. 5. George JN, Woolf SH, Raskob GE, Wasser JS, Aledort LM, Ballem PJ, Blanchette VS, Bussel JB, Cines DB, Kelton JG, Lichtin AE, McMillan R, Okerbloom JA, Regan DH, Warrier I. Idiopathic thrombocytopenic purpura: a practice guideline developed by explicit methods for the American Society of Hematology. Blood 1996;88:3-40. 6. Sutor AH, Harms A, Kaufmehl K. Acute immune thrombocytopenia (ITP) in childhood: retrospective and prospective survey in Germany. Semin Thromb Hemost 2001;27:253-267. 7. British Committee for Standards in Haematology General Haematology Task Force. Guidelines for the investigation and management of idiopathic thrombocytopenic purpura in adults, children and in pregnancy. Br J Haematol 2003;120:574-596. 8. Kühne T, Buchanan GR, Zimmerman S, Michaels LA, Kohan R, Berchtold W, Imbach P, Intercontinental Childhood ITP Study Group, Intercontinental Childhood ITP Study Group. A prospective comparative study of 2540 infants and children with newly diagnosed idiopathic thrombocytopenic purpura (ITP) from the Intercontinental Childhood ITP Study Group. J Pediatr 2003;143:605-608. 9. ElAlfy M, Farid S, Abdel Maksoud A. Predictors of chronic idiopathic thrombocytopenic purpura. Pediatr Blood Cancer 2010;54:959-962. 10. Stasi R, Amadori S, Osborn J, Newland AC, Provan D. Long-term outcome of otherwise healthy individuals with incidentally discovered borderline thrombocytopenia. PLoS Med 2006;3:388-394. 11. Bain BJ. Ethnic and sex differences in the total and differential white cell count and platelet count. J Clin Pathol 1996;49:664-666. 12. Adibi P, Faghih Imani E, Talaei M, Ghanei M. Populationbased platelet reference values for an Iranian population. Int J Lab Hematol 2007;29:195-199. 13. Watts RG. Idiopathic thrombocytopenic purpura: a 10-year natural history study at the Children’s Hospital of Alabama. Clin Pediatr 2004;43:691-702. 14. Donato H, Picón A, Martinez M, Rapetti MC, Rosso A, Gomez S, Rossi N, Bacciedoni V, Schvartzman G, Riccheri C, Costa A, Di Santo J. Demographic data, natural history, and prognostic factors of idiopathic thrombocytopenic purpura in children: a multicentered study from Argentina. Pediatr Blood Cancer 2009;52:491-496. 38

Evim SM, et al: Childhood Immune Thrombocytopenia

15. Stasi R, Stipa E, Masi M, Cecconi M, Scimò MT, Oliva F, Sciarra A, Perrotti AP, Adomo G, Amadori S, Papa G. Longterm observation of 208 adults with chronic idiopathic thrombocytopenic purpura. Am J Med 1995;98:436-442. 16. Sailer T, Lechner K, Panzer S, Kyrle PA, Pabinger I. The course of severe autoimmune thrombocytopenia in patients not undergoing splenectomy. Haematologica 2006;91:1041-1045. 17. Imbach P, Kühne T, Müller D, Berchtold W, Zimmerman S, Elalfy M, Buchanan GR. Childhood ITP: 12 months followup data from the prospective registry I of the Intercontinental Childhood ITP Study Group (ICIS). Pediatr Blood Cancer 2006;46:351-356. 18. Yaprak I, Atabey B, Durak İ, Türker M, Öniz H, Arun Özer E. Variant clinical courses in children with immune thrombocytopenic purpura: sixteen year experience of a single medical center. Turk J Hematol 2010;27:147-155. 19. Roganovic J, Letica-Crepulja M. Idiopathic thrombocytopenic purpura: a 15-year natural history study at the Children’s Hospital Rijeka, Croatia. Pediatr Blood Cancer 2006;47:662664. 20. Rosthøj S, Hedlund-Treutiger I, Rajantie J, Zeller B, Jonsson OG, Elinder G, Wesenberg F, Henter JI, NOPHO ITP Working Group. Duration and morbidity of newly diagnosed idiopathic thrombocytopenic purpura in children: a prospective Nordic study of an unselected cohort. J Pediatr 2003;143:302-307. 21. Wong MS, Chan GC, Ha SY, Lau YL. Clinical characteristics of chronic idiopathic thrombocytopenia in Chinese children. J Pediatr Hematol Oncol 2002;24:648-652. 22. Koçak U, Aral YZ, Kaya Z, Oztürk G, Gürsel T. Evaluation of clinical characteristics, diagnosis and management in childhood immune thrombocytopenic purpura: a single center’s experience. Turk J Pediatr 2007;49:250-255. 23. Duru F, Fisgin T, Yarali N, Kara A. Clinical course of children with immune thrombocytopenic purpura treated with intravenous immunoglobulin G or megadose methylprednisolone or observed without therapy. Pediatr Hematol Oncol 2002;19:219-225. 24. Demircioğlu F, Saygi M, Yilmaz S, Oren H, Irken G. Clinical features, treatment responses, and outcome of children with idiopathic thrombocytopenic purpura. Pediatr Hematol Oncol 2009;26:526-532. 25. Segel GB, Feig SA. Controversies in the diagnosis and management of childhood acute immune thrombocytopenic purpura. Pediatr Blood Cancer 2009;53:318-324. 26. Provan D, Stasi R, Newland AC, Blanchette VS, BoltonMaggs P, Bussel JB, Chong BH, Cines DB, Gernsheimer TB, Godeau B, Grainger J, Greer I, Hunt BJ, Imbach PA, Lyons G, McMillan R, Rodeghiero F, Sanz MA, Tarantino M, Watson S, Young J, Kuter DJ. International consensus report on the investigation and management of primary immune thrombocytopenia. Blood 2010;115:168-186.

Evim SM, et al: Childhood Immune Thrombocytopenia

27. Neunert C, Lim W, Crowther M, Cohen A, Solberg L Jr, Crowther MA, American Society of Hematology. The American Society of Hematology 2011 evidence-based practice guideline for immune thrombocytopenia. Blood 2011;117:4190-4207. 28. Neunert CE, Buchanan GR, Imbach P, Bolton-Maggs PH, Bennett CM, Neufeld EJ, Vesely SK, Adix L, Blanchette VS, K端hne T, Intercontinental Childhood ITP Study Group Registry II Participants. Severe hemorrhage in children with newly diagnosed immune thrombocytopenic purpura. Blood 2008;112:4003-4008.

Turk J Hematol 2014;31:32-39

32. K端hne T, Blanchette V, Buchanan GR, Ramenghi U, Donato H, Tamminga RY, Rischewski J, Berchtold W, Imbach P, Intercontinental Childhood ITP Study Group. Splenectomy in children with idiopathic thrombocytopenic purpura: a prospective study of 134 children from the Intercontinental Childhood ITP Study Group. Pediatr Blood Cancer 2007;49:829-834. 33. Perez HD, Katler E, Embury S. Idiopathic thrombocytopenic purpura with high-titer, speckled pattern antinuclear antibodies: possible marker for systemic lupus erythematosus. Arthritis Rheum 1985;28:596-597.

29. Lilleyman JS. Intracranial haemorrhage in idiopathic thrombocytopenic purpura. Paediatric Haematology Forum of the British Society for Haematology. Arch Dis Child 1994;71:251-253.

34. Hazzan R, Mukamel M, Yacobovich J, Yaniv I, Tamary H. Risk factors for future development of systemic lupus erythematosus in children with idiopathic thrombocytopenic purpura. Pediatr Blood Cancer 2006;47:657-659.

30. Aronis S, Platokouki H, Avgeri M, Pergantou H, Keramidas D. Retrospective evaluation of long-term efficacy and safety of splenectomy in chronic idiopathic thrombocytopenic purpura in children. Acta Paediatr 2004;93:638-642.

35. Zimmerman SA, Ware RE. Clinical significance of the antinuclear antibody test in selected children with idiopathic thrombocytopenic purpura. J Pediatr Hematol Oncol 1997;19:297-303.

31. Schwartz J, Leber MD, Gillis S, Giunta A, Eldor A, Bussel JB. Long term follow-up after splenectomy performed for immune thrombocytopenic purpura (ITP). Am J Hematol 2003;72:94-98.

38. Groshiede P, van Damme P. Epidemiology of hepatitis B infection and prevention and control of hepatitis B in the community. Communicable Disease Series 1996;1:17-26.

Research Article

DOI: 10.4274/Tjh.2013.0023

NPM1 Gene Type A Mutation in Bulgarian Adults with Acute Myeloid Leukemia: A Single-Institution Study Akut Miyeloid Lösemi Olan Erişkin Bulgar Hastalarda NPM1 Geni Tip A Mutasyonu: Tek Merkez Çalışması Gueorgui Balatzenko1,2, Branimir Spassov2,3, Nikolay Stoyanov2,4, Penka Ganeva2,3, Tihomit Dikov4, Spiro Konstantinov3,5, Vasil Hrischev3, Malina Romanova1, Stavri Toshkov1, Margarita Guenova2,4 1National

Specialized Hospital for Active Treatment of Hematological Diseases, Laboratory of Cytogenetics and Molecular Biology, Sofia, Bulgaria of Excellence for Translational Research in Hematology, Sofia, Bulgaria 3National Specialized Hospital for Active Treatment of Hematological Diseases, Hematology Clinic, Sofia, Bulgaria 4 National Specialized Hospital for Active Treatment of Hematological Diseases, Laboratory of Hematopathology and Immunology, Sofia, Bulgaria 5 Medical University of Sofia, Faculty of Pharmacy, Department of Pharmacology, Toxicology and Pharmacotherapy, Sofia, Bulgaria 2Center

Abstract: Objective: Mutations of the nucleophosmin (NPM1) gene are considered as the most frequent acute myeloid leukemia (AML)associated genetic lesion, reported with various incidences in different studies, and type A (NPM1-A) is the most frequent type. However, since most series in the literature report on the features of all patients regardless of the type of mutation, NPM1-A(+) cases have not been well characterized yet. Therefore, we evaluated the prevalence of NPM1-A in Bulgarian AML patients and searched for an association with clinical and laboratory features. Materials and Methods: One hundred and four adults (51 men, 53 women) were included in the study. NPM1-A status was determined using allele-specific reverse-transcription polymerase chain reaction with co-amplification of NPM1-A and β-actin and real-time quantitative TaqMan-based polymerase chain reaction. Patients received conventional induction chemotherapy and were followed for 13.2±16.4 months. Results: NPM1-A was detected in 26 (24.8%) patients. NPM1-A mutation was detected in all AML categories, including in one patient with RUNX1-RUNX1T1. There were no differences associated with the NPM1-A status with respect to age, sex, hemoglobin, platelet counts, percentage of bone marrow blasts, splenomegaly, complete remission rates, and overall survival. NPM1-A(+) patients, compared to NPM1-A(-) patients, were characterized by higher leukocyte counts [(75.4±81.9)x10 9/L vs. (42.5±65.9)x109/L; p=0.049], higher frequency of normal karyotype [14/18 (77.8%) vs. 26/62 (41.9%); p=0.014], higher frequency of FLT3-ITD [11/26 (42.3%) vs. 8/77 (10.4%); p=0.001], and lower incidence of CD34(+) [6/21 (28.8%) vs. 28/45 (62.2%); p=0.017]. Within the FLT3-ITD(-) group, the median overall survival of NPM1-A(-) patients was 14 months, while NPM1-A(+) patients did not reach the median (p=0.10). Conclusion: The prevalence of NPM1-A mutation in adult Bulgarian AML patients was similar to that reported in other studies. NPM1-A(+) patients were characterized by higher leukocyte counts, higher frequency of normal karyotypes and FLT3ITD, and lower incidence of CD34(+), supporting the idea that the specific features of type A mutations might contribute to the general clinical and laboratory profile of NPM1(+) AML patients. Key Words: Acute myeloid leukemia, NPM1 gene type A mutation, FLT3-ITD, allele-specific polymerase chain reaction Address for Correspondence: Gueorgui Balatzenko, MD, PhD, National Specialized Hospital for Active Treatment of Hematological Diseases, Laboratory of Cytogenetics and Molecular Biology, Sofia, Bulgaria Phone: +3592 9701137 E-mail: balatzenko@hotmail.com Received/Geliş tarihi : January 23, 2013 Accepted/Kabul tarihi : June 10, 2013

Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients

Turk J Hematol 2014;31:40-48

Özet: Amaç: Nukleofosmin (NPM1) genine ait mutasyonlar değişik çalışmalarda farklı insidanslar bildirilmekle birlikte, akut

miyeloid lösemi (AML)-ilişkili genetik bozuklukların en sık görülenidir ve bunlar arasında tip A (NPM1-A) en sık rastlanan tipidir. Ancak literatürdeki serilerin çoğu mutasyon tipinden bağımsız olarak tüm hastaların özelliklerini sunmakta olup, NPM1-A(+) olgular bundan önce ayrıntılı olarak tanımlanmamıştır. Bu yüzden, Bulgar AML hastalarında NPM1-A prevalansı değerlendirilmiş, klinik ve laboratuvar özellikler ile ilişkileri araştırılmıştır. Gereç ve Yöntemler: Çalışmaya yüz dört hasta (51 erkek, 53 kadın) dahil edilmiştir. NPM1-A durumu allel-özgül polimeraz zincir reaksiyonu ile NPM1-A ve b-aktinin birlikte amplifikasyonu ve gerçek-zamanlı TaqMan-bazlı polimeraz zincir reaksiyonu ile belirlenmiştir. Hastalar konvansiyonel indüksiyon kemoterapisi almış ve 13,2±16,4 ay takip edilmişlerdir. Bulgular: NPM1-A 26 hastada (%24,8) tespit edildi. NPM1-A mutasyonu, RUNX1-RUNX1T1 taşıyan bir hastayı da içeren tüm AML kategorilerinde gösterilmiştir. Yaş, cinsiyet, hemoglobin, trombosit sayısı, kemik iliğindeki blast yüzdesi, splenomegali, tam remisyon oranları ve genel sağkalım ile NPM1-A durumu ile ilişkili farklılık saptanmadı. NPM1-A(+) hastalar, NPM1-A(-) hastalar ile karşılaştırıldıklarında daha yüksek lökosit sayısına [(75,4±81,9)x109/L vs. (42,5±65,9)x109/L; p=0,049], daha sık normal karyotipe [14/18 (%77,8) vs. 26/62 (%41,9); p=0,014], daha sık FLT3-ITD’ye [11/26 (%42,3) vs. 8/77 (%10,4); p=0,001] sahipti ve daha seyrek CD34 (+) [6/21 (%28,8) vs. 28/45 (%62,2); p=0,017] idi. FLT3-ITD(-) grup içinde, NPM1-A(-) hastaların ortanca genel sağkalımı 14 aydı, ancak NPM1-A(+) hastalar ortancaya ulaşmadı (p=0,10). Sonuç: Erişkin Bulgar hastalarda NPM1-A mutasyonunun prevalansı diğer çalışmalarda bildirilenlerle benzer bulundu. NPM1-A(+) hastalar, tip A mutasyonların spesifik özelliklerinin NPM1(+) AML hastaların genel klinik ve laboratuvar profiline katkıda bulunabileceği fikrini destekler nitelikte yüksek lökosit sayısı, daha sık normal karyotip ve FLT3-ITD ile daha seyrek CD34(+) sıklığı ile karakterizeydi. Anahtar Sözcükler: Akut miyeloid lösemi, NPM1 geni tip A mutasyonu, FLT3-ITD, allel-özgül polimeraz zincir reaksiyonu

Introduction Acute myeloid leukemia (AML) is a heterogeneous group of clonal disorders with great variability in terms of pathogenesis; morphological, genetic, and immunophenotypic characteristics of the leukemic blast population; clinical course; and response to therapy. It is believed that this heterogeneity is largely related to variations in the spectrum of the underlying molecular abnormalities that alter normal cellular mechanisms of self-renewal, proliferation, and differentiation [1]. Several lines of evidence support the idea that hematopoietic precursor cells in AML undergo malignant transformation in a multistep process of acquisition of different genetic abnormalities that might range from relatively large chromosome alterations to single nucleotide changes, deregulated gene expression, or epigenetic changes [2]. Some of these abnormalities exhibit strong correlations with the phenotypic features of the disease and/or treatment outcome and define biologically and prognostically different subtypes of AML, as recognized in the latest World Health Organization (WHO) classification system in 2008. The category of “AML with recurrent genetic abnormalities” consists of 6 subtypes, characterized by specific chromosome translocations that lead to the formation of fusion genes. Additionally, 2 provisional entities, AML with mutated nucleophosmin (NPM1) and AML with mutated CCAAT/ enhancer binding protein alpha (CEBPA), have also been recognized [3]. The former is considered as the most frequent AML-associated genetic lesion.

The NPM1 gene maps to chromosome 5q35 and encodes a ubiquitously expressed chaperone protein that shuttles between the nucleus and cytoplasm but predominantly resides in the nucleus. It is involved in multiple functions and plays key roles in ribosome biogenesis, centrosome duplication, genomic stability, cell cycle progression, and apoptosis [4]. NPM1 is frequently overexpressed in solid tumors [5], while in hematological malignancies, the NPM1 locus is lost [6] or translocated, leading to the formation of fusion genes and proteins [7]. Recently somatic mutations in exon 12 of the NPM1 gene have been found in approximately one-third of all adult patients with AML [4,8]. Mutations of the NPM1 gene induce delocalization of the NPM1 protein in AML, while in solid tumors, only NPM1 overexpression, but not delocalization, has been reported so far [9]. Some differences in the incidence of NPM1 mutations were observed, suggesting the possible influence of ethnic and geographic factors [10,11]. Therefore, data concerning the incidence of the molecular abnormality in particular countries might be helpful in the analysis of the impact of local factors. As reported so far, NPM1-mutation-positive patients are more often females, with a normal karyotype, and usually present with high white blood cell (WBC) counts and higher percentages of bone marrow blasts, frequently with myelomonocytic or monocytic morphology, with absent or low expression of CD34, and with frequent FLT3 mutations [12,13]. The presence of NPM1 mutations is associated with 41

Turk J Hematol 2014;31:40-48

unique gene expression [14] and microRNA profiles [15]. NPM1 mutations predict an excellent response to induction therapy [12] and provide important prognostic information as stable markers for minimal residual disease monitoring in AML patients [16,17]. Currently there are 55 described mutations of NPM1 exon 12 in AML that result in similar alterations at the C-terminus of the mutant proteins. The most prevalent types of mutations are mutation A (75%-80%), mutation B (10%), and mutation D (5%), while all other mutations are very rare [4,18]. To date, most studies have focused on the clinical and laboratory profile of all NPM1-mutated AML patients regardless of the type of the mutation, and, therefore, the clinical and laboratory characteristics of patients, particularly those with the most frequent type A mutations, have not been precisely recorded. Certain differences might be expected since some studies suggested that the outcome and prognosis in patients with type A and non-A mutations might not be identical [19,20]. Therefore, in this study we performed molecular screening aiming at establishing the prevalence of type A mutation of the NPM1 gene in Bulgarian adult AML patients and searched for an association with major clinical and laboratory features commonly reported in literature. Material and Methods Patients The NPM1 type A [NPM1-A] mutation was studied in the bone marrow cells of 104 adults (51 men, 53 women) at a mean age of 53.7±15.8 years (range: 22-82 years), diagnosed and treated at the National Specialized Hospital for Active Treatment of Hematological Diseases, Sofia, Bulgaria, after receiving informed consent. The diagnosis of AML was based on WHO 2008 classification criteria using a combination of clinical data and morphological, cytochemical, flow cytometric, and/or immunohistochemical, cytogenetic, and molecular features. Analysis of NPM1-A Mutation by Reverse-Transcription Polymerase Chain Reaction (RT-PCR) At the time of diagnosis, bone marrow mononuclear cells were separated after red blood cell destruction with a lysis buffer (155 mM NH4Cl, 10 mM KHCO3, 0.1 mM EDTA). Total cellular RNA was isolated using TRIzol Reagent (Invitrogen, Karlsruhe, Germany) according to the manufacturer’s protocol. cDNA was synthesized by reverse transcription of 1 µg of RNA in a reaction medium with a final volume of 20 µL containing 1X first-strand buffer, 200 U of MMLV reverse transcriptase (USB Products, Affimetrics, Cleveland, OH, USA), 1 mM of each deoxynucleoside-5’triphosphate (dNTP), 20 U of RNase Inhibitor (Invitrogen), and 5 µM of random hexamers (Thermo Scientific, Waltham, MA, USA), by consecutive incubation of the samples at 37 °C for 1 h and at 99 °C for 3 min. 42

Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients

The presence of NPM1-A mutation was determined using 2 different PCR approaches. In the first, allelespecific PCR was carried out by simultaneous amplification of NPM1-A with allele-specific primers and β-actin cDNA as an internal control. Briefly, 3 µL of cDNA was amplified in a reaction medium with a final volume of 25 µL containing 1X PCR buffer, 2.5 mM MgCl2, 200 µM of each dNTP, 1 U of Taq polymerase (Promega, Madison, WI, USA), and 10 pmol of each of the following primers: NPM1-mutA (F): 5′-caagaggctattcaagatctctgtctg-3’ and NPM-REV-6 (R): 5’-accatttccatgtctgagcacc-3’ (NPM1-A), together with b-actin (S) 5’-ggcatcgtgatggactccg-3’ and b-actin (AS) 5’-gctggaaggtggacagcga-3’ (β-actin). The reaction started with denaturation at 95 °C for 7 min; proceeded with 35 cycles of amplification at 95 °C for 45 s, at 67 °C for 45 s, and at 72 °C for 45 s; and terminated at 72 °C for 7 min on a Veriti Thermal Cycler (Applied Biosystems, Foster City, CA, USA). Amplification products were run in 2% (w/v) agarose gel, stained with ethidium bromide, and visualized after UV exposure. The second approach employed real-time quantitative TaqManbased PCR using the MutaQuant® Kit NPM1 mutation A (Ipsogen, Marseille, France) following the manufacturer’s instructions on a Rotor-Gene 6000 thermocycler (Corbett Life Science, Mortlake, Australia). Treatment Sixty-three patients with non-acute promyelocytic leukemia (non-APL) received conventional induction chemotherapy with one of the anthracyclines (doxorubicin or idarubicin) for 3 days and cytosine arabinoside for 7 days. Patients with APL received all-trans retinoic acid with or without concurrent induction chemotherapy. After complete remission was achieved, patients received consolidation chemotherapy with conventional doses of cytosine arabinoside and one anthracycline or with highdose cytosine arabinoside. The mean period of follow-up of treated patients was 13.2±16.4 months. Five of the patients died before the start of any treatment. Early death during the first induction course occurred in 16 (15.4%) patients. Due to old age and/or poor performance status, no chemotherapy or only low-dose cytosine arabinoside was given in 16 patients. One patient was lost from contact. Statistical Analysis All statistical analysis was performed using SPSS 16.0.1. The Wilcoxon Mann-Whitney test was used to compare the distributions of numerically valued variables. Univariate differences between categorical variable subsets were evaluated with Fisher’s exact test. Overall survival (OS) was estimated for patients who received at least one induction course of therapy using the KaplanMeier method. Two-sided p<0.05 was considered to be of statistical significance.

Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients

Results A positive reaction for NPM1-A mutation [NPM1-A(+)] by both approaches was detected in 26 of 104 (24.8%) patients (Figure 1). No discrepancies in the results generated by the 2 methods were observed. There were no significant differences between NPM1-A(+) and NPM1-A(-) patients with respect to age, sex, hemoglobin, platelet counts, percentage of bone marrow blasts, or the presence of splenomegaly (Table 1). However, the mean WBC count was significantly higher in NPM1-A(+) compared to NPM1-A(-) patients at (75.4±81.9) x109/L versus (42.5±65.9)x109/L, respectively (p=0.049). The statistical analysis did not show any significant differences in the frequency of the molecular abnormality in the defined AML categories. However, the incidence of NPM1-A(+) was clearly lower in AML with recurrent genetic abnormalities, at 1/11 (9.1%), compared to AML with myelodysplasia-related changes (AML-MRC) at 4/11 (36.4%), therapy-related myeloid neoplasms at 3/15 (20.0%), and AML not otherwise specified (NOS) at 15/65 (27.7%).

Turk J Hematol 2014;31:40-48

Among the different subtypes of AML and NOS cases, no statistical differences in the prevalence of NPM1-A(+) were observed, with a relatively higher value in AML without maturation [6/13 (46.2%)] and in AML with maturation and acute myelomonocytic leukemia [4/11 (36.4%) and 5/16 (31.2%), respectively]. No positive reaction for NPM1-A was found in patients with AML with minimal differentiation, acute erythroid leukemia, and acute megakaryoblastic leukemia; however, the number of studied cases was too low for more general conclusions. Immunophenotyping of patients with and without NPM1-A revealed statistically lower frequency of CD34(+) in NPM1-A(+) compared to NPM1-A(-) patients, at 6/21 (28.8%) versus 28/45 (62.2%), respectively (p=0.017), while no differences were observed in regard to aberrant coexpression of lymphoid antigens or CD56.

The tendency for a lower frequency of NPM1-A mutations in patients with recurrent genetic abnormalities was even more prominent when all patients regardless of previous chemo- and/or radiotherapy were analyzed. Thus, a total of 17 patients comprising 11 de novo cases and 6 therapy-related AML cases with fusion transcripts (PMLRARA, n=2; RUNX1-RUNX1T1, n=3; CBFb-MYH11, n=1) included only 1 (5.9%) positive case, versus 25/87 (28.7%) in the remaining group of patients (p=0.064).

Figure 1. Pattern of detection of NPM1-A mutation by reverse-transcription polymerase chain reaction (RT-PCR). A) Detection of NPM1-A mutation by allele-specific RT-PCR:1=negative control; 5,7=NPM1-A(+) patients; 2,3,4,6,8=NPM1-A(-) patients.

Figure 2. Kaplan-Meier survival curves.

B) Detection of NPM1-A mutation by quantitative real-time RT-PCR.

B) OS of NPM1-A(+) and NPM1-A(-) AML patients within the group of patients without FLT3-ITD.

A) OS of NPM1-A(+) and NPM1-A(-) AML patients.

Turk J Hematol 2014;31:40-48

Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients

Table 1. Patient characteristics according to NPM1-A mutation status. NS: Not significant.

Variable

NPM1-A (+)

NPM1-A (-)

Gender: Males Females

12 [23.5%] 14 [25.9%]

39 (76.5%) 40 (74.1%)

0.82

Age [years]

54.8±11.0

53.7±17.3

0.76

White Blood Cells count [x109/L]

75.4±81.9

42.5±65.9

0.049

Platelets count [x109/L]

83.5±86.4

84.7±88.8

0.95

Hemoglobin concentration [g/L]

84.1±21.3

88.3±21.4

0.41

Blasts/blasts equivalents in bone marrow [%]

77.8±21.0

71.2±22.2

0.38

Splenomegaly

6/19 (31.6%)

12/62 (19.4%)

0.34

WHO categories: AML with recurrent genetic abnormalities AML with t(8;21); RUNX1-RUNX1T1 AML with inv(16) or t(16;16); CBFB-MYH11 APL with t(15;17);PML-RARA AML with t(9;11); MLLT3-MLL AML with t(6;9); DEK-NUP214

1/11 (9.1%) 1/5 0/1 0/3 0/1 0/1

10/11(90.9%) 4/5 1/1 3/3 1/1 1/1

AML with myelodysplasia-related changes

4/11 (36.4%)

7/11 (63.6%)

Therapy-related myeloid neoplasms

3/15 (20.0%)

12/15 (80.0%)

Acute Myeloid Leukemia, Not Otherwise Specified AML with minimal differentiation AML without maturation AML with maturation Acute myelomonocytic leukemia Acute monoblastic and monocytic leukemia Acute erythroid leukemia Acute megakaryoblastic leukemia

18/65 (27.7%) 0/5 (0%) 6/13 (46.2%) 4/11 (36.4%) 5/16 (31.2%) 3/16 (18.7%) 0/3 (0%) 0/1 (0%)

47/65 (72.3%) 5/5 (100%) 7/13 (53.8%) 7/11 (63.6%) 11/16 (68.7%) 13/16 (81.3%) 2/2 (100%) 1/1 (100%)

AML unknown

0/2 (0.0%)

2/2 (100.0%)

Immunophenotype CD34(+) CD56 Lymphoid Antigens

6/21 (28.8%) 8/21 (38.1%) 6/20 (30.0%)

28/45 (62.2%) 14/43 (32.6%) 17/44 (38.6%)

0.017 0.78 0.58

Normal Katyotype

14/18 (77.8%)

26/62 (41.9%)

0.014

FLT3-ITD(+) [n=]

11/26 (42.3%)

8/77 (10.4%)

0.001

MLL-PTD(+)

0/23 (0%)

7/61 (11.5%)

0.18

EVI1-overexpression

4/20 (20.0%)

5/51 (9.8%)

0.26

Early deaths

5/24 (20.8%)

11/75 (14.7%)

0.16

Complete remission

11/16 (68.7%)

27/50 (54.0%)

0.24

Mean OS (months)

17.4

11.3

0.62

Mean OS within the FLT3-ITD(-) group (months)

27.28

30.41

0.10

Median OS within the FLT3-ITD(-) group (months)

Not reached

14.00

p=0.463 NS

Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients

The overall incidence of NPM1-A mutation among patients with a normal karyotype was 14/40 (35%). Interestingly, within the NPM1-A(+) group, a distinct overrepresentation of patients with a normal karyotype [14/18 (77.8%) vs. 26/62 (41.9%); p=0.014] and internal tandem duplication of the FLT3 gene (FLT3-ITD) [11/26 (42.3%) vs. 8/77 (10.4%); p=0.001] was observed compared to patients without the mutation. No association between NPM1-A status and the presence of partial tandem duplication of the MLL gene (MLL-PTD) and overexpression of the EVI1 gene was detected. Sixteen patients (15.4%) died within the first month after diagnosis; however, no differences in the early death rates between the NPM1-A(+) and NPM1-A(-) groups were observed [5/24 (20.8%) and 11/75 (14.7%), respectively; p=0.16]. Overall, a complete remission was achieved in 38 of 66 (57.6%) patients, including 11 out of 16 (68.7%) NPM1-A(+) patients and 27 out of 50 (54.0%) NPM1-A(-) patients (p=0.24). The median OS for NPM1-A(+) non-APL patients was 18.0 months, compared to 12.0 months for NPM1-A(-) nonAPL patients [log rank test, p=0.322]. When patients were additionally stratified according to their FLT3-ITD status, we found that, within the FLT3-ITD(-) group, the median OS of patients without the NPM1-A mutation was 14 months, while NPM1-A(+) patients did not reach this median. Due to the relatively small number of patients, this tendency was still not statistically significant (p=0.10). Within the FLT3-ITD(+) group, the median OS for NPM1-A(+) and NPM1-A(-) was 12 months and 5 months, respectively (p=0.88) (Figure 2). Discussion In this study, we screened 104 adult Bulgarian patients with AML for NPM1 gene type A mutation using 2 different RT-PCR based approaches and positive results by both methods were found in 24.8% of patients. This result was similar to previously reported frequencies of 19.1%-20.3% for NPM1-A [21,22], while the incidence of all forms of NPM1 mutations in adults varied from 24.9% to 34.5% in the literature [22]. Several studies, including ours, clearly demonstrated that the frequency of NPM1 gene mutations is significantly higher in AML patients with a normal karyotype [22], despite results being heterogeneous and varying from 38.1% to 63.8% [22,23]. The data concerning the incidence of NPM1-A mutation in particular within the category of patients with normal karyotypes are still scarce, mainly because the reported data encompass the whole spectrum of NPM1 gene mutations in most of the studies and only in a few of them did the authors specify the frequency of type A mutation. In our study, we found NPM1-A mutations in 35%

Turk J Hematol 2014;31:40-48

of normal-karyotype patients, similar to the results reported by Schnittger et al. (41.4%) [24] and Döhner et al. (36.7%) [13]. The group of NPM1-A(+) patients in our study was characterized by a higher WBC count at diagnosis (p=0.049), higher frequency of normal karyotypes (p=0.012) and FLT3ITD (p=0.001), and lower incidence of CD34(+) (p=0.017). These results corresponded to the characteristics of patients with NPM1 gene mutations generally described in the literature regardless of the type of mutation [25,26]. In contrast, several other findings in our study differed from those of other reports. According to some authors, NPM1 mutations occur almost exclusively in de novo AML cases [25], while, in our study, the abnormality was observed in 20% of therapy-related AML cases, confirming recently published data that 16% of patients with therapy-related AML are also positive for NPM1 mutations [27]. Presumably the presence of NPM1 mutations in some cases might be associated with the development of de novo AML, regardless of the impact of the prior radio-/chemotherapy [28]. Earlier, it was suggested that NPM1 mutations and recurrent genetic abnormalities are mutually exclusive in AML patients [29]. However, our study demonstrated at least one patient with simultaneous co-expression of NPM1-A and RUNX1-RUNX1T1 transcripts. Occasionally, similar cases were reported by others, both in adults and children [18,21,23,30]. Errors in sample registration, PCR contamination, or other technical factors might explain these findings in some [29], but not all, of these cases. Therefore, several questions, such as whether NPM1 mutations and concurrent genetic abnormalities occur in the same or different leukemic cell populations and whether the occurrence of 2 or more specific genetic markers in exceptional cases is just coincidental or represents a true association, are still not understood [29]. Other variables that are still a subject of controversy are the sex- and age-associated differences in the incidence of NPM1 mutation. Previously, a significantly higher incidence of NPM1 mutations in females was reported by Thiede et al. [18] and Falini et al. [7]; however, these observation were not confirmed by our study or others [21,31]. Similarly, according to Schneider et al. [32], NPM1 mutations significantly decreased with age, while others reported that patients with NPM1 mutations were older than those without the mutation [11,21,33]. In our study, as well as in those of Döhner et al. [13] and Luo et al. [31], no ageassociated differences in the NPM1-A mutation status were found. Several factors might contribute to the heterogeneity of the obtained results, such as variations in the biological characteristics of patients (whole AML group vs. AML patients with normal cytogenetics) or in the applied method for NPM1 gene mutation detection and the methodological technical variables [29]. 45

Turk J Hematol 2014;31:40-48

In our study, in addition to AML-MRC and therapyrelated AML, NPM1-A has been also detected in AML without maturation, AML with maturation, acute myelomonocytic leukemia, and acute monoblastic/monocytic leukemia within the category of AML-NOS without significant differences in the incidence among the various subtypes (p=0.50). Previously, it has been suggested that NPM1 mutations could be found in different AML French-American-British (FAB) entities [23], with a higher frequency in the M4/M5 subtypes [13,24]. Mutations were never found in FAB M3 and were less common in M0, M4eo, M6, and M7 [18], in agreement with our data. However, according to Luo et al., in AML patients with normal cytogenetics, there was no correlation between NPM1 mutations and FAB morphologic subtypes, with a positive reaction for NPM1 predominantly in M2 and M5 cases [31]. Interestingly, in a study of 252 NPM1-positive patients, those with AML M5 represented only 12.7% of the whole group, while the majority of patients had AML M1 (21.9%), AML M2 (25.1%), and AML M4 (27.9%) morphology [34]. Within the category of AML-MRC, we found NPM1-A(+) in 36.4% of patients, similarly to Döhner et al., who found 5 patients with NPM1 mutations out of 13 (38.5%) with secondary AML following myelodysplastic syndrome [13]. In contrast, Devillier et al. reported positive results in only 8% of AML-MRC cases [35], while Falini et al. initially reported that NPM1 gene mutations were found only in de novo AML and not in the 135 AML cases arising from myelodysplasia [12]. It is difficult to explain the reasons for these differences. First, the number of analyzed cases in our cohort of patients, as well as in that reported by Döhner et al. [13], was too low for definitive conclusions concerning the real incidence. On the other hand, the category of AML-MRC consists of 3 subtypes, including cases with previous history of Myelodysplastic syndrome, cases with Myelodysplastic syndrome-related cytogenetic abnormality, and cases with multilineage dysplasia [36]. Depending on the prevalence of the particular subtype, the incidence of NPM1 mutations may vary. Regardless of the precise frequency, the identification of these patients is important from a clinical point of view in 2 aspects: first, in regard to the classification as AML-MRC (applying the WHO morphologic criteria) or as AML with NPM1 mutation (using the WHO genetic criteria), and second, because multilineage dysplasia has no impact on the biologic, clinicopathologic, and prognostic features of AML with mutated nucleophosmin [37]. In a number of studies, a favorable impact of NPM1 gene mutations, particularly of type A mutations, on the outcome was reported [21]. In this study we did not find significant differences between NPM1-A(+) and NPM1-A(-) patients with regard to achievement of complete remission (CR) and OS, despite a clear tendency for better treatment response being observed in the group of patients with concomitant FLT3-ITD. Similarly, no differences in CR rates between 46

Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients

NPM-mutated and NPM wild-type patients were reported by Boissel et al. [38]. Several factors might have an impact on these results, such as the overall efficiency of the applied treatment protocols, the rate of intensive induction course approaches [38], the patients’ ages [39], or the presence of other molecular abnormalities. In conclusion, the prevalence of NPM1-A mutations in adult Bulgarian AML patients was similar to that reported by other studies. NPM1-A(+) patients in our study were characterized by higher leukocyte counts at diagnosis, higher frequency of normal karyotypes, higher frequency of FLT3ITD, and lower incidence of CD34(+) immunophenotypes, supporting the idea that the specific features of type A mutations of the gene might contribute to the general clinical and laboratory profiles of AML patients with NPM1 mutations. Acknowledgments This study was supported by a grant from the National Research Fund, Bulgarian Ministry of Education and Science (D02-35/2009). Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Döhner K, Döhner H. Molecular characterization of acute myeloid leukemia. Haematologica 2008;93:976-982. 2. Wertheim GB, Hexner E, Bagg A. Molecular-based classification of acute myeloid leukemia and its role in directing rational therapy: personalized medicine for profoundly promiscuous proliferations. Mol Diagn Ther 2012;16:357-369. 3. Arber DA, Brunning RD, Le Beau MM, Falini B, Vardiman JW, Porwit A, Thiele J, Bloomfield CD. Acute myeloid leukaemia with recurrent genetic abnormalities. In: Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J, Vardiman JW (eds). WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues, 4th ed. Lyon, France, International Agency for Research on Cancer, 2008. 4. Rau R, Brown P. Nucleophosmin (NPM1) mutations in adult and childhood acute myeloid leukaemia: towards definition of a new leukaemia entity. Hematol Oncol 2009;27:171181. 5. Grisendi S, Mecucci C, Falini B, Pandolfi PP. Nucleophosmin and cancer. Nat Rev Cancer 2006;6:493-505. 6. La Starza R, Matteucci C, Gorello P, Brandimarte L, Pierini V, Crescenzi B, Nofrini V, Rosati R, Gottardi E, Saglio G, Santucci A, Berchicci L, Arcioni F, Falini B, Martelli MF, Sambani C, Aventin A, Mecucci C. NPM1 deletion is associated with gross chromosomal rearrangements in leukemia. PLoS One 2010;5:e12855.

Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients

7. Falini B, Nicoletti I, Bolli N, Martelli MP, Liso A, Gorello P, Mandelli F, Mecucci C, Martelli MF. Translocations and mutations involving the nucleophosmin (NPM1) gene in lymphomas and leukemias. Haematologica 2007;92:519532. 8. Falini B, Gionfriddo I, Cecchetti F, Ballanti S, Pettirossi V, Martelli MP. Acute myeloid leukemia with mutated nucleophosmin (NPM1): any hope for a targeted therapy? Blood Rev 2011;25:247-254. 9. Pianta A, Puppin C, Passon N, Franzoni A, Romanello M, Tell G, Di Loreto C, Bulotta S, Russo D, Damante G. Nucleophosmin delocalization in thyroid tumour cells. Endocr Pathol 2011;22:18-23. 10. Falini B, Mecucci C, Tiacci E, Alcalay M, Rosati R, Pasqualucci L, La Starza R, Diverio D, Colombo E, Santucci A, Bigerna B, Pacini R, Pucciarini A, Liso A, Vignetti M, Fazi P, Meani N, Pettirossi V, Saglio G, Mandelli F, LoCoco F, Pelicci PG, Martelli MF; GIMEMA Acute Leukemia Working Party. Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype. N Engl J Med 2005;352:254-266. 11. Döhner K, Schlenk RF, Habdank M, Scholl C, Rücker FG, Corbacioglu A, Bullinger L, Fröhling S, Döhner H. Mutant nucleophosmin (NPM1) predicts favorable prognosis in younger adults with acute myeloid leukemia and normal cytogenetics: interaction with other gene mutations. Blood 2005;106:3740-3746. 12. Alcalay M, Tiacci E, Bergomas R, Bigerna B, Venturini E, Minardi SP, Meani N, Diverio D, Bernard L, Tizzoni L, Volorio S, Luzi L, Colombo E, Lo Coco F, Mecucci C, Falini B, Pelicci PG. Acute myeloid leukemia bearing cytoplasmic nucleophosmin (NPMc+ AML) shows a distinct gene expression profile characterized by up-regulation of genes involved in stem-cell maintenance. Blood 2005;106:899902. 13. Garzon R, Garofalo M, Martelli MP, Briesewitz R, Wang L, Fernandez-Cymering C, Volinia S, Liu CG, Schnittger S, Haferlach T, Liso A, Diverio D, Mancini M, Meloni G, Foa R, Martelli MF, Mecucci C, Croce CM, Falini B. Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proc Natl Acad Sci U S A 2008;105:3945-3950. 14. Kristensen T, Møller MB, Friis L, Bergmann OJ, Preiss B. NPM1 mutation is a stable marker for minimal residual disease monitoring in acute myeloid leukaemia patients with increased sensitivity compared to WT1 expression. Eur J Haematol 2011;87:400-408. 15. Thiede C, Koch S, Creutzig E, Steudel C, Illmer T, Schaich M, Ehninger G. Prevalence and prognostic impact of NPM1 mutations in 1485 adult patients with acute myeloid leukemia (AML). Blood 2006;107:4011-4020.

Turk J Hematol 2014;31:40-48

16. Koh Y, Park J, Bae EK, Ahn KS, Kim I, Bang SM, Lee JH, Yoon SS, Lee DS, Lee YY, Park S, Kim BK. Non-A type nucleophosmin 1 gene mutation predicts poor clinical outcome in de novo adult acute myeloid leukemia: differential clinical importance of NPM1 mutation according to subtype. Int J Hematol 2009;90:1-5. 17. Park BG, Chi HS, Park SJ, Min SK, Jang S, Park CJ, Kim DY, Lee JH, Lee JH, Lee KH. Clinical implications of non-A-type NPM1 and FLT3 mutations in patients with normal karyotype acute myeloid leukemia. Acta Haematol 2012;127:63-71. 18. Yan L, Chen S, Liang J, Feng Y, Cen J, He J, Chang W, Zhu Z, Pan J, Wu Y, Xue Y, Wu D. Analysis of NPM1 gene mutations in Chinese adults with acute myeloid leukemia. Int J Hematol 2007;86:143-146. 19. Ghosh K, Swaminathan S, Madkaikar M, Gupta M, Kerketta L, Vundinti B. FLT3 and NPM1 mutations in a cohort of AML patients and detection of a novel mutation in tyrosine kinase domain of FLT3 gene from western India. Ann Hematol 2012;91:1703-1712. 20. van Dongen JJ, Macintyre EA, Gabert JA, Delabesse E, Rossi V, Saglio G, Gottardi E, Rambaldi A, Dotti G, Griesinger F, Parreira A, Gameiro P, Diáz MG, Malec M, Langerak AW, San Miguel JF, Biondi A. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia. Leukemia 1999;13:1901-1928. 21. Suzuki T, Kiyoi H, Ozeki K, Tomita A, Yamaji S, Suzuki R, Kodera Y, Miyawaki S, Asou N, Kuriyama K, Yagasaki F, Shimazaki C, Akiyama H, Nishimura M, Motoji T, Shinagawa K, Takeshita A, Ueda R, Kinoshita T, Emi N, Naoe T. Clinical characteristics and prognostic implications of NPM1 mutations in acute myeloid leukemia. Blood 2005;106:2854-2861. 22. Boonthimat C, Thongnoppakhun W, Auewarakul CU. Nucleophosmin mutation in Southeast Asian acute myeloid leukemia: eight novel variants, FLT3 coexistence and prognostic impact of NPM1/FLT3 mutations. Haematologica 2008;93:1565-1569. 23. Verhaak RG, Goudswaard CS, van Putten W, Bijl MA, Sanders MA, Hugens W, Uitterlinden AG, Erpelinck CA, Delwel R, Löwenberg B, Valk PJ. Mutations in nucleophosmin (NPM1) in acute myeloid leukemia (AML): association with other gene abnormalities and previously established gene expression signatures and their favorable prognostic significance. Blood 2005;106:3747-3754. 24. Schnittger S, Schoch C, Kern W, Mecucci C, Tschulik C, Martelli MF, Haferlach T, Hiddemann W, Falini B. Nucleophosmin gene mutations are predictors of favorable prognosis in acute myelogenous leukemia with a normal karyotype. Blood 2005;106:3733-3739. 47

Turk J Hematol 2014;31:40-48

25. Renneville A, Roumier C, Biggio V, Nibourel O, Boissel N, Fenaux P, Preudhomme C. Cooperating gene mutations in acute myeloid leukemia: a review of the literature. Leukemia 2008;22:915-931. 26. Falini B, Martelli MP, Bolli N, Sportoletti P, Liso A, Tiacci E, Haferlach T. Acute myeloid leukemia with mutated nucleophosmin (NPM1): is it a distinct entity? Blood 2011;117:1109-1120. 27. Kayser S, Döhner K, Krauter J, Köhne CH, Horst HA, Held G, von Lilienfeld-Toal M, Wilhelm S, Kündgen A, Götze K, Rummel M, Nachbaur D, Schlegelberger B, Göhring G, Späth D, Morlok C, Zucknick M, Ganser A, Döhner H, Schlenk RF; German-Austrian AMLSG. The impact of therapy-related acute myeloid leukemia (AML) on outcome in 2853 adult patients with newly diagnosed AML. Blood 2011;117:2137-2145. 28. Andersen MT, Andersen MK, Christiansen DH, PedersenBjergaard J. NPM1 mutations in therapy-related acute myeloid leukemia with uncharacteristic features. Leukemia 2008;22:951-955. 29. Falini B, Mecucci C, Saglio G, Lo Coco F, Diverio D, Brown P, Pane F, Mancini M, Martelli MP, Pileri S, Haferlach T, Haferlach C, Schnittger S. NPM1 mutations and cytoplasmic nucleophosmin are mutually exclusive of recurrent genetic abnormalities: a comparative analysis of 2562 patients with acute myeloid leukemia. Haematologica 2008;93:439-442. 30. Braoudaki M, Papathanassiou C, Katsibardi K, Tourkadoni N, Karamolegou K, Tzortzatou-Stathopoulou F. The frequency of NPM1 mutations in childhood acute myeloid leukemia. J Hematol Oncol 2010;3:41. 31. Luo J, Qi C, Xu W, Kamel-Reid S, Brandwein J, Chang H. Cytoplasmic expression of nucleophosmin accurately predicts mutation in the nucleophosmin gene in patients with acute myeloid leukemia and normal karyotype. Am J Clin Pathol 2010;133:34-40. 32. Schneider F, Hoster E, Schneider S, Dufour A, Benthaus T, Kakadia PM, Bohlander SK, Braess J, Heinecke A, Sauerland MC, Berdel WE, Buechner T, Woermann BJ, FeuringBuske M, Buske C, Creutzig U, Thiede C, Zwaan MC, van den Heuvel-Eibrink MM, Reinhardt D, Hiddemann W, Spiekermann K. Age-dependent frequencies of NPM1 mutations and FLT3-ITD in patients with normal karyotype AML (NK-AML). Ann Hematol 2012;91:9-18.

Balatzenko G, et al: NPM1 Gene “A” Mutation in Bulgarian AML Patients

33. Chen W, Rassidakis GZ, Medeiros LJ. Nucleophosmin gene mutations in acute myeloid leukemia. Arch Pathol Lab Med 2006;130:1687-1692. 34. Schnittger S, Kern W, Tschulik C, Weiss T, Dicker F, Falini B, Haferlach C, Haferlach T. Minimal residual disease levels assessed by NPM1 mutation-specific RQ-PCR provide important prognostic information in AML. Blood 2009;114:2220-2231. 35. Devillier R, Gelsi-Boyer V, Brecqueville M, Carbuccia N, Murati A, Vey N, Birnbaum D, Mozziconacci MJ. Acute myeloid leukemia with myelodysplasia-related changes are characterized by a specific molecular pattern with high frequency of ASXL1 mutations. Am J Hematol 2012;87:659662. 36. Arber DA, Brunning RD, Orazi A, Bain BJ, Porwit A, Vardiman JW, Le Beau MM, Greenberg PL. Acute myeloid leukaemia with myelodysplasia-related changes. In: Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J, Vardiman JW (eds). WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues, 4th ed. Lyon, France, International Agency for Research on Cancer, 2008. 37. Falini B, Macijewski K, Weiss T, Bacher U, Schnittger S, Kern W, Kohlmann A, Klein HU, Vignetti M, Piciocchi A, Fazi P, Martelli MP, Vitale A, Pileri S, Miesner M, Santucci A, Haferlach C, Mandelli F, Haferlach T. Multilineage dysplasia has no impact on biologic, clinicopathologic, and prognostic features of AML with mutated nucleophosmin (NPM1). Blood 2010;115:3776-3786. 38. Boissel N, Renneville A, Biggio V, Philippe N, Thomas X, Cayuela JM, Terre C, Tigaud I, Castaigne S, Raffoux E, De Botton S, Fenaux P, Dombret H, Preudhomme C. Prevalence, clinical profile, and prognosis of NPM mutations in AML with normal karyotype. Blood 2005;106:3618-3620. 39. Becker H, Marcucci G, Maharry K, Radmacher MD, Mrózek K, Margeson D, Whitman SP, Wu YZ, Schwind S, Paschka P, Powell BL, Carter TH, Kolitz JE, Wetzler M, Carroll AJ, Baer MR, Caligiuri MA, Larson RA, Bloomfield CD. Favorable prognostic impact of NPM1 mutations in older patients with cytogenetically normal de novo acute myeloid leukemia and associated gene- and microRNA-expression signatures: a Cancer and Leukemia Group B study. J Clin Oncol 2010;28:596-604.

Research Article

DOI: 10.4274/Tjh.2013.0057

Leukocyte Populations and C-Reactive Protein as Predictors of Bacterial Infections in Febrile Outpatient Children Polikliniğe Başvuran Ateşli Çocuklarda Bakteriyel Enfeksiyonu Belirlemek için CRP Düzeyi ve Lökosit Popülasyonu Zühre Kaya, Aynur Küçükcongar, Doğuş Vurallı, Hamdi Cihan Emeksiz, Türkiz Gürsel Gazi University Medical School, The Pediatric Hematology Unit, Department of Pediatrics, Ankara, Turkey

Abstract: Objective: Infections remain the major cause of unnecessary antibiotic use in pediatric outpatient settings. Complete blood

count (CBC) is the essential test in the diagnosis of infections. C-reactive protein (CRP) is also useful for assessment of young children with serious bacterial infections. The purpose of the study was to evaluate leukocyte populations and CRP level to predict bacterial infections in febrile outpatient children. Materials and Methods: The values of CBC by Cell-DYN 4000 autoanalyzer and serum CRP levels were evaluated in 120 febrile patients with documented infections (n:74 bacterial, n:46 viral) and 22 healthy controls. Results: The mean CRP, neutrophil and immature granulocyte (IG) values were significantly higher in bacterial infections than in viral infections and controls (p<0.05). C-reactive protein was significantly correlated with neutrophil level in bacterial infections (r: 0.76, p<0.05). Specificity of IG was greatest at 93%, only a modest 56% for neutrophil and mild 18% for CRP, whereas 100% for combination of IG, neutrophil and CRP. Conclusion: Acute bacterial infection seems to be very unlikely in children with normal leukocyte populations and CRP values, even if clinically signs and symptoms indicate acute bacterial infections. Key Words: Leukocyte populations, C-reactive protein, Febrile children

Özet: Amaç: Enfeksiyonlar pediatri polikliniklerinde gereksiz antibiyotik kullanımının en önemli nedeni olmaya devam etmektedir. Tam kan sayımı (CBC) enfeksiyonların tanısında kullanılan önemli bir testtir. C-reaktif protein (CRP) ise ciddi bakteriyel enfeksiyonu olan küçük çocukların değerlendirilmesinde yararlıdır. Bu çalışmanın amacı polikliniğe başvuran ateşli çocuklarda bakteriyel enfeksiyonu ayırdetmede CRP düzeyi ve lökosit popülasyonunun önemini değerlendirmektir.

Gereç ve Yöntemler: Polikliniğe başvuran 120 ateşli çocukta Cell-DYN 4000 ile analiz edilen CBC değerleri ile CRP düzeyi, 74 bakteriyel, 46 viral ve 22 kontrol grubunda değerlendirildi.

Bulgular: Ortalama CRP, nötrofil ve immature granulosit (IG) değerleri bakteriyel enfeksiyonlarda, viral enfeksiyon ve kontrol grubuna göre anlamlı yüksekti (p<0,05). Bakteriyel enfeksiyonlarda CRP ve nötrofil değerleri arasında anlamlı ilişki bulundu

Address for Correspondence: Zühre KAYA, MD, Gazi University Medical School, The Pediatric Hematology Unit,Department of Pediatrics, Ankara, Turkey E-mail: zuhrekaya@gazi.edu.tr Received/Geliş tarihi : February 15, 2013 Accepted/Kabul tarihi : July 02, 2013

Turk J Hematol 2014;31:49-55

Kaya Z, et al: Leukocyte Populations and C-Reactive Protein in Febrile Children

(r:0,76, p<0,05). Özgüllük IG için %93 ile en yüksek, nötrofil için %56 ile orta ve CRP için %18 düşük düzeyde bulunmasına rağmen IG, nötrofil ve CRP kombinasyonu için %100 bulundu. Sonuç: Çocuklarda klinik belirti ve bulgular akut bakteriyel enfeksiyonu işaret etse bile, normal lökosit popülasyonu ve CRP değeri olan hastalarda akut bakteriyel enfeksiyon olasılığı düşüktür. Anahtar Sözcükler: Lökosit popülasyonu, C-reaktif protein, Ateşli çocuk

Introduction Despite rapid improvement in health care over the past decades, fever continues to be a major cause of admissions, laboratory work-up and antibiotic uses in pediatric outpatient settings (POS) [1,2,3,4]. Fever due to viral infections can be particularly difficult to distinguish from that in children with clinical signs of bacterial infections [5]. To date, C-reactive protein (CRP) has been used to make distinction between bacterial and viral infections but it has been reported as neither sensitive nor specific enough for bacterial infections [6,7]. One available strategy is to monitor changes in leukocyte populations and CRP associated with the host response to pathogens [8,9]. However, these markers have mostly been studied in infants and younger children below 3 years of age and for serious bacterial infections excluding older children and localized bacterial infections [10,11,12]. Furthermore, novel hemogram analysers allow reliable measurement of a broad panel of complete blood count (CBC) parameters. The variant lymphocyte (VL) and immature granulocyte (IG) parameters have become increasingly popular. Usefulness of monitoring VL and IG for identifying infectious process have been examined in a few studies [13,14,15,16]. However, its usefulness remains controversial in children. The aim of this study was to evaluate the usefulness of CRP and leukocyte populations as early diagnostic markers of bacterial infections in febrile outpatient children. Material and Methods Data were collected from 120 consecutive children who presented with fever and 22 children with age matched healthy controls during two months period at Pediatric Outpatient Clinic of Gazi University Hospital. Patients were eligible to participate if they had a clinical and/or radiological and/or microbiological diagnosis of viral or bacterial infections confirmed by residents in Department of Pediatrics and decision for antibiotic treatment was made in accordance with the management of infection guidance for primary care at www.hpa.org.uk web page [17]. The inclusion criteria were: 1) age between 2 and 18 years, 2) fever was defined as an axillary temperature above 38o C, as used for the diagnostic criteria of febrile episodes in the past 24 hours. We excluded infants <2 years, children requiring hospitalization for fever, ongoing antibiotic 50

treatment at the time of evaluation and specific chronic conditions. Informed consent and approval by our Institutional Review Board were obtained. Laboratory Analysis Venous blood samples for complete blood count (CBC) were collected into vacutainer tubes containing K2EDTA (Becton Dickinson, New Jersey, USA) and analysed by CellDYN 4000 Hematology Analyzer (Abbott Diagnostics, Santa Clara, CA) within 6 hours of admission. The upper limit of the reference interval for leukocyte populations was described according to the age (Table 1) (18). Serum level of CRP was measured using a nephelometric assay (Specific Protein Analyser, Beckman, Marburg, Germany) with the normal range as 0 to 6 mg/L. The abnormal values for CRP and leukocyte populations were regarded as above the upper normal limit of the reference interval. The microbiological tests including viral serology for EBV, CMV, HSV, Parvo-B19, urine, throat and stool cultures were retriewed from Hospital Information System. All radiological tests were evaluated by expert radiologists. Statistical Analysis Statistical analysis was performed using SPSS 15.0 (SPSS Inc., Chicago, IL). Data was expressed in mean±SD. All the categorical variables were calculated using Chi-square analysis. Different groups of patients were compared using the Mann-Whitney U test and correlations were calculated by Spearman’s correlation test. Wilcoxon test was used to evaluate within the group comparison. Parameters considered significantly associated with a high risk of bacterial infections were selected in univariate analysis, and the logistic regression for multivariate analysis was calculated for odds ratio (OR) and 95% confidence interval (CI). P values <0.05 were considered to be statistically significant. Results Demographic and clinical characteristics of patients are summarized in Table 1. Of the 120 children, 76 (63.4%) were boys and 44 (36.6%) were girls. The median age was 5 years (2-18 years). There was no difference between bacterial and viral pathogens in respect to mean age and gender (p>0.05). Infection Types and Locations The most common primary sites of infection in order of frequency were ear-nose-throat, lung and urinary tract system.

Turk J Hematol 2014;31:49-55

Kaya Z, et al: Leukocyte Populations and C-Reactive Protein in Febrile Children

Seven (5.8%) of the 120 children had definitive and 67 had (56.0%) probable bacterial infections. Probable viral infections comprised 44 patients (36.6%) with upper respiratory tract infections along with flu-like symptoms and negative bacterial markers (no viral cultures were performed), one patient with documented EBV, and one with Parvo-B19 (1.6%). CBC and CRP Levels The mean levels of CRP and the leukocyte populations are demonstrated in Table 2. At the time of diagnosis, patients with bacterial infections had increased serum CRP level, neutrophil, lymphocyte, and monocyte percent compared with the control group (p<0.05). The mean level of serum CRP, neutrophil and IG levels showed significant decrease two weeks after the start of antibiotic treatment as compared to their baseline at diagnosis (p<0.05). Elevated CRP and neutrophil levels were noted in only 27 of 67 patients with probable bacterial infections who were treated with antibiotics. Univariate analysis showed that a high levels of CRP and neutrophils were associated with bacterial infections, while VL positivitiy was more diagnostic for viral infections in febrile children. In multivariate analysis, CRP was a better indicator for bacterial infections with an odds ratio of 6.1 (95% CI, 1.5-24.6 ) (Table 3). The specificity of neutrophil and IG levels was higher for diagnosing bacterial infections than that of CRP alone. However, the combination of CRP, neutrophil and IG levels had the highest specificity for predicting bacterial infections. Normal values for neutrophil, IG and CRP excluded bacterial infections had a 100% specificity and positive predictive value in a generic context. Variant lymphocyte and lymphocyte levels were found highly specific and statistically superior to CRP in viral infections (Table 4). There was a significant positive correlation (r:0.76, p<0.05) between CRP and neutrophil level in the bacterial infections while there was a significant negative correlation between CRP and lymphocyte (r:-0.75, p<0.05) for viral infections (Figure 1).

otitis and sinusitis may indicate bacterial infections in many cases of fever. Although cultures are the gold standard for the diagnosis of bacterial infections, sampling and testing is time consuming and their results are not immediately available. Therefore, a predictive tool to diagnose bacterial infections in fever is crucial for early diagnosis and treatment in POS. Several inflammatory markers have been studied for the diagnosis of infections. Among them, CRP is frequently used and is a good marker for infection [22,23,24,25]. Few data are available evaluating CRP for the detection of bacterial infections in children with fever [25,26,27]. The prevalance rate of bacterial infections varies between 28% and 82% in febrile children seen at the emergency departments. In the present study, we have found the prevalance of proven and probable bacterial infections to be 62% in children with fever who started antibiotic treatment in POS. So far, the association between CRP and bacterial infections was only evaluated in the hospitalized children or at the emergency department and predominantly in younger children below three years of age [6,7,8,9,10,11,12,25,26,27,28]. Most authors concluded that CRP >40 mg/dL indicates severe bacterial infections [6,9,22]. We also found that the bacterial infections had higher mean CRP levels compared with the viral infections in POS. However, a multivariate model showed that CRP was the only independent variable for the association between viral and bacterial infections. More recently, several authors have reported the quantitative evaluation of CRP as a diagnostic marker of bacterial infections, sensitivity and specificity ranging from 57% to 100% and from 50% to 100%, respectively [6,7,8,9,25]. In our study, CRP was found to be a highly (89%) sensitivite but has quite low (18%) specificity. It has been widely accepted that CRP was not elevated during viral infections. We found that CRP was weakly positive in only 3 of 16 patients with viral infections. It is possible that there may be coexisting latent bacterial infections in these patients. Thus, CRP positivity alone 20.00

Discussion Despite viral infections represent the most frequent outpatient infections in children, the increasing rates of antibiotic resistance due to unnecessary antibiotic use have become a major threat for child health [1,2,3,4]. Therefore an immediate and appropriate strategy for this population in POS is required to prevent unnecessary antibiotic use and to reduce treatment delays. In this study, we analysed 120 febrile patients in POS and validated the diagnostic value of CRP and CBC for infectious complications in children. The early diagnosis of bacterial infections in patients with fever is challenging [19,20,21]. Focus of infection is uncertain, and only a few clinical signs such as tonsillopharyngitis,

0.00

-20.00

-40.00

-250.00

-200.00

-150.00

-100.00

-50.00

0.00

Figure 1. Correlation between changes in C reactive protein and neutrophil percent 51

Turk J Hematol 2014;31:49-55

Kaya Z, et al: Leukocyte Populations and C-Reactive Protein in Febrile Children

Table 1. Demographic features and clinical characteristics of patients.

n (%) Age 2-7y 8-18y Gender (Female/Male) Clinical Diagnosis Definitive bacterial Strep. tonsillitis Urinary tract infection Probable bacterial Otitis Sinusitis Tonsillitis Lymphadenitis Bacterial pneumonia Urinary tract infection Definitive virus EBV Parvo B19 Probable virus Upper respiratory tract infections Viral pneumonia White Blood count (x109/L) (Age, Normal range) 1-3 yr (5.5-17.5) Low 4-7 yr (5.0-17.0) Normal 8-13 yr (4.5-13.5) High >13 yr (4.5-11.5) Neutrophil percent (%) (Age, Normal range) 1-3 yr (22-46) Low 4-7 yr (30-60) Normal 8-13 yr (35-65) High >13 yr (50-70) Lymphocyte percent (%) (Age, Normal range) 1-3 yr (37-73) Low 4-7 yr (29-65) Normal 8-13 yr (23-53) High >13 yr (18-42) Monocyte percent (%) (Age, Normal range) 1-18 yr (2-11) Normal High Variant lymphocyte (%) (n:89) Absent Present Immature granulocyte (%) (n:89) Absent Present C-reactive protein (mg/L) (n:62) â&#x2030;¤6 >6 52

87 (72.5) 33 (27.5) 44/76

2 (1.6) 5 (4.2) 6 (5.0) 11 (9.2) 33 (27.6) 6 (5.0) 4 (3.4) 7 (5.8) 1 (0.8) 1 (0.8) 38 (31.6) 6 (5.0) 11 (9.2) 95 (79.2) 14 (11.6)

12 (10.0) 68 (56.6) 40 (33.4)

37 (30.8) 77 (64.2) 6 (5.0)

79 (65.8) 41 (34.2) 67 (75.3) 22 (24.7) 75 (84.3) 14 (15.7) 32 (51.8) 30 (48.2)

Turk J Hematol 2014;31:49-55

Kaya Z, et al: Leukocyte Populations and C-Reactive Protein in Febrile Children

Table 2. Changes in variables from baseline to two weeks following antibiotic treatment.

Control Baseline values At 2 week values Changes in values (mean±SD) n:22 (mean±SD) (n:55) (mean±SD) (n:55) (mean±SD) (n:55) WBC(x109/L)

9.6±2.1

10.1±5.2

8.6±3.5

-1.4±6.2

Neutrophil (%)

43.1±12.3¶

51.3±19.1*

42.1±13.3*

-9.2±18.8

Lymphocyte (%)

45.3±12.1¶

31.3±17.9*

45.7±13.6*

9.4±19.1

Monocyte (%)

6.9±2.1

9.1±3.1*

7.8±2.4*

-1.1±2.9

Variant lymphocyte (%)

1.4±4.6*

0.42±1.7*

-1.9±7.1

Immature Granulocyte (%)

0.37±1.1*

0.14±0.64*

-0.25±1.1

CRP(mg/L)

2.1±5.8¶

49.9±56.8*

8.3±11.8*

-63.4±76.5

Data are expressed at mean±standard deviation *p<0.05, Between baseline and at 2 weeks ¶ p<0.05, Between baseline and control

Table 3. C-reactive protein and leukocyte populations in relation to the infections using by univarite and multivariate analysis.

C-reactive protein (n:62) Normal Abnormal Leukocyte (n:120) Normal Abnormal Neutrophil (n:120) Normal Abnormal Lymphocyte (n:120) Normal Abnormal Monocyte (n:120) Normal Abnormal Variant lymphocyte (n:89) Absent Present Immature granulocyte (n:89) Absent Present

Viral infection n (%)

Bacterial infection n (%)

Univariate Multivariate OR (95%CI) p value p value

13 (81.3%) 3 (18.8%)

19 (41.3%) 27 (58.7%)

0.006*

43 (93.5%) 3 (6.5%) 37 (80.4%) 9 (19.6%)

63 (85.1%) 11 (14.9%) 43 (58.1%) 31 (41.9%)

0.24

44 (95.7%) 2 (4.3%)

70 (94.6%) 4 (5.4 %)

0.96

29 (63.0%) 17 (37.0%)

50 (67.6%) 24 (32.4%)

0.75

23 (62.2%) 14 (37.8%)

44 (84.6%) 8 (15.4%)

0.03*

33 (91.7%) 3 (8.3%)

42 (79.2%) 11 (20.8%)

0.14

0.02*

6.1(1.5-24.6)

2.1(1.1-3.8)

1.7 (1.0-3.1)

*p<0.05

may not be helpful to estimate the causative pathogens particularly in febrile patients. Other authors have described “unconventional” inflammatory markers such as procalcitonin, interleukin 6, which have been used as

research tools but not achieved widespread acceptance in routine practice [22,23,24]. Some laboratory routine tests such as CBC are fast, economical, and universally available, and often aid 53

Turk J Hematol 2014;31:49-55

Kaya Z, et al: Leukocyte Populations and C-Reactive Protein in Febrile Children

Table 4. Diagnostic accuracy of C-reactive protein (CRP) and leukocyte populations in viral and bacterial infections.

Sensitivity

Specificity

Positive predictive value

Negative predictive value

52% 19%

56% 94%

77% 90%

29% 28%

C-reactive protein(CRP) Neutrophil+IG Neutrophil+CRP IG+CRP Neutrophil+CRP+IG Viral infections Lymphocyte

90% 13% 52% 20% 13%

18% 100% 69% 93% 100%

76% 100% 83% 90% 100%

38% 29% 34% 29% 29%

95%

66%

62%

Variant lymphocyte (<5%)

16%

96%

75%

61%

Bacterial infections Neutrophil Immature granulocyte(IG)

primary clinicians with decision making about patients with suspected bacterial infections [29,30]. Thus the rapid availability of the results of CBC as well as CRP could provide considerable advantage for both patients and clinicans. In the present study, we have used Cell-DYN 4000 device which enabled us simultaneously measure several different CBC parameters. As in other studies, our results showed a significant positive correlation between CRP and neutrophil levels in supporting of bacterial infection. On the other hand, in patients with viral infections, lymphocyte showed negative correlation with CRP level (r:-0.75, p<0.05) [24]. The suggested cut-off values of <5% variant lymphocyte excluded viral infections with the 96% specificity (Table 4). Our results have shown that normal neutrophil and IG levels and CRP value excluded bacterial infections with a predictive value of 100% in children presenting with fever. Antibiotics should not be recommended in such cases with a normal neutrophil and IG levels and CRP value, even when bacterial infections is suspected clinically. If typical signs and symptoms of acute bacterial infections continue and abnormal leukocyte populations and/or CRP value increases above the upper limit of the reference interval, the patient should be treated by antibiotic. Otherwise, continued observation is recommended. A single CRP test will not be very indicative of bacterial infection but a combination of neutrophil, IG and CRP may provide more valid information considering the complex relationship between the antibiotic use and the clinical features of bacterial infection. To our knowledge, there are no previous studies relating measurement of IG and VL in febrile outpatient children. Although our results should be confirmed in a prospective study including larger number of patients, we believe that IG, neutrophil and CRP values 54

may guide physicians to make a distinction between viral and bacterial infections. In conclusion, neutrophil and IG levels together with CRP constitute a rapid and cheap diagnostic tool with moderate diagnostic value in children with bacterial infections. Using these laboratory test, physicians can avoid unnecessary antibiotic use in approximately two thirds of children with suspected bacterial infections in POS. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included. References 1. Dosh SA, Hickner JM, Mainous AG, Ebell MH. Predictors of antibiotic prescribing for nonspecific upper respiratory infections, acute bronchitis, and acute sinusitis. An UPRNet Study. J Fam Pract 2000;49:407-414. 2. Mangione-Smith R, Elliott MN, Stivers T, McDonald L, Heritage J, McGlynn EA. Racial/Ethnic variation in parent expectations for antibiotics: implications for Public Health Campaigns. Pediatrics 2004;113:385-394. 3. Mangione-Smith R, Elliott MN, Stivers T, McDonald LL, Heritage J. Ruling out the need for antibiotics: are we sending the right message? Arch Pediatr Adolesc Med 2006;160:945-952. 4. Linder JA, Schnipper JL, Tsurikova R, Volk LA, Middleton B. Self reported familiarity with acute respiratory infection quidelines and antibiotic prescribing in primary care. Int J Qual Health Care 2010;22:469-475. 5. Lorrot M, Moulin F, Coste J, Ravilly S, Guerin S, Lebon P, Lacombe C, Raymond J, Bohuon C, Gendrel D. Procalcitonin in pediatric emergencies: comparison with

Kaya Z, et al: Leukocyte Populations and C-Reactive Protein in Febrile Children

C-reactive protein, interleukin 6 and interferon alpha in the differentation between bacterial and viral infections. Presse Med 2000;29:128-134. 6. Putto A, Ruuskanen O, Meurman O, Ekblad H, Korvenranta H, Mertsola J, Peltola H, Sarkkinen H, Vijanen MK, Halonen P. C-reactive protein in the evaluation of febrile illness. Arch Dis Child 1986;61:24-29. 7. Isaacman DJ, Burke BL. Utility of the serum C-reactive protein for detection of occult bacterial infection in children. Arch Pediatr Adolesc Med 2002;156:905-909. 8. Al-Gwaiz LA, Babay HH. The diagnostic value of absolute neutrophil count, band count and morphologic changes of neutrophils in predicting bacterial infections. Med Princ Pract 2007;16:344-347. 9. Peltola V, Toikka P, Irjala K, Mertsola J, Ruuskanen O. Discrepancy between total white blood cell counts and serum C-reactive protein levels in febrile children. Scand J Infect Dis 2007;39:560-565. 10. Isaacman DJ, Shults J, Gross TK, Davis PH, Harper M. Predictors of bacteriemia in febrile children 3 to 36 months of age. Pediatrics 2000;106:977-982. 11. Pulliam PN, Attia MW, Cronan KM. C-reactive protein in febrile children 1 to 36 months of age with clinically undetectable serious bacterial infection. Pediatrics 2001;108:1275-1279. 12. Pratt A, Attia MW. Duration of fever and markers of serious bacterial infection in young febrile children. Pediatr Int 2007;49:31-35. 13. Chan YK, Tsai MH, Huang DC, Zheng ZH, Hung KD. Leukocyte nucleus segmentation and nucleus lobe counting. BMC Bioinformatics 2010;11.558. 14. Roehrl MH, Lantz D, Sylvester C, Wang JY. Age dependent reference ranges for automated assessment of immature granulocytes and clinical significance in an outpatient setting. Arch Pathol Lab Med 2011;135:471-477. 15. Senthilnayagam B, Kumar T, Sukumaran J, MJ, Rao KR. Automated measurement of immature granulocytes: performance characteristics and utility in routine clinical practice. Patholog Res Int. 2012; DOI:10.1155/2012/483670. 16. Chaves F, Tierno B, Xu D. Quantitative determination of neutrophil VCS parameters by the Coulter automated hematology analyzer: new and reliable indicators for acute bacterial infection. Am J Clin Pathol 2005;124:440444. 17. HPA. Management of infection guidance for primary care for consultation and local adaptation.http://www.hpa.org. uk/webc/HPAwebFile/HPAweb_C/1279888711402 (5 July 2010, date last accessed).

Turk J Hematol 2014;31:49-55

19. Baraff LJ. Management of fever without source in infants and children. Ann Emerg Med. 2000;36.602-614. 20. Friedman JF, Lee GM, Kleinman KP, Finkelstein JA. Acute care and antibiotic seeking for upper respiratory tract infections for children in day care. Parental knowledge and day care center policies. Arch Pediatr Adolesc Med 2003;157:369-374. 21. Brent AJ, Lakhanpaul M, Thompson M, Collier J, Ray S, Ninis N, Levin M, MacFaul R. Risk score to stratify children with suspected serious bacterial infection: observational cohort study. Arch Dis Child 2011;96:361-367. 22. Hatherill M, Tibby SM, Sykes K, Turner C, Murdoch IA. Diagnostic markers of infection: Comparison of procalcitonin with C reactive protein and leucocyte count. Arch Dis Child 1999;81:417-421. 23. Andreola B, Bressan S, Callegaro S, Liverani A, Plebani M, Da Dalt L. Procalcitonin and C-reactive protein as diagnostic markers of severe bacterial infections in febrile infants and children in the emergency department. Pediatr Infect Dis J 2007;26:672-677. 24. Pourakbari B, Mamishi S, Zafari J, Khairkhah H, Ashtiani MH, Abedini M, Afsharpairman S, Rad SS. Evaluation of procalcitonin and neopterin level in serum of patients with acute bacterial infection. Braz J Infect Dis 2010;14:252-255. 25. Sanders S, Barnett A, Correa-Velez I, Coulthard M, Doust J. Systematic review of the diagnostic accuracy of C reactive protein to detect bacterial infection in nonhospitalized infants and children with fever. J Pediatr 2008;153:570574. 26. McCarthy PL, Jekel JF, Dolan TF Jr. Comparison of acute phase reactants in pediatric patients with fever. Pediatrics 1978;62:716-720. 27. Tejani NR, Chonmaitree T, Rassin DK, Howie VM, Owen MJ, Goldman AS. Use of C-reactive protein in differentiation between acute bacterial and viral otitis media. Pediatrics 1995;95:664-669. 28. dos Anjos BL, Grotto HZ. Evaluation of C-reactive protein and serum amyloid A in the detection of inflammatory and infectious disease in children. Clin Chem Lab Med 2010;48:493-499. 29. Nixon DF, Parsons AJ, Elgin RP. Routine full blood counts as indicators of acute viral infections. J Clin Pathol 1987;40:673-675. 30. Van den Bruel A, Thompson MJ, Haj-Hassan T, Stevens R, Moll H, Lakhanpaul M, Mant D. Diagnostic value of laboratory tests in identifying serious infections in febrile children: systematic review. BMJ. 2011; 342:3082.

18. Dallman PR. Blood and blood-forming tissues, In Rudolph AM, editor. Pediatrics. 16th ed. New York, AppletonCentury-Crofts, 1977. p. 1178. 55

Research Article

DOI: 10.4274/Tjh.2013.0086

FIP1L1-PDGFRA-Positive Chronic Eosinophilic Leukemia: A Low-Burden Disease with Dramatic Response to Imatinib - A Report of 5 Cases from South India FIP1L1-PDGFRA Pozitif Kronik Eozinofilik Lösemi: İmatinib için Dramatik Yanıt ile Bir Düşük Yük Hastalığı-Güney Hindistan’dan 5 Olgu Sunumu Anıl Kumar N.1, Vishwanath Sathyanarayanan1, Visweswariah Lakshmi Devi2, Namratha N. Rajkumar2, Umesh Das1, Sarjana Dutt3, Lakshmaiah K Chinnagiriyappa1 1Kidwai

Memorial Institute of Oncology, Department of Medical Oncology, Karnataka, India

2Kidwai

Memorial Institute of Oncology, Department of Pathology, Karnataka, India

3Oncquest

Laboratories Ltd., New Delhi, India

Abstract: Objective: Eosinophilia associated with FIP1L1-PDGFRA rearrangement represents a subset of chronic eosinophilic leukemia

and affected patients are sensitive to imatinib treatment. This study was undertaken to learn the prevalence and associated clinicopathologic and genetic features of FIP1L1-PDGFRA rearrangement in a cohort of 26 adult patients presenting with profound eosinophilia (>1.5x109/L). Materials and Methods: Reverse-transcriptase polymerase chain reaction and gel electrophoresis were used for the detection of FIP1L1-PDGFRA rearrangement. Results: Five male patients with splenomegaly carried the FIP1L1-PDGFRA gene rearrangement. All patients achieved complete hematological response within 4 weeks of starting imatinib. One patient had previous deep vein thrombosis and 1 patient had cardiomyopathy, which improved with steroids and imatinib. Conventional cytogenetics was normal in all these patients. No primary resistance to imatinib was noted. Conclusion: This study indicates the need to do the FIP1L1-PDGFRA assay in patients with hypereosinophilic syndrome. Prompt treatment of this condition with imatinib can lead to complete hematological response and resolution of the organ damage that can be seen in this setting. Key Words: PDGFRA, Chronic eosinophilic Leukemia, Imatinib, India

Özet: Amaç: FIP1L1-PDGFRA rearranjmanı ilişkili eozinofili, kronik eozinofilik löseminin bir alt grubunu temsil eder ve etkilenen

hastalar imatinib tedavisine duyarlıdır. Bu çalışma, şiddetli eozinofili ile başvuran 26 erişkin hastadan oluşan bir grupta FIP1L1-PDGFRA rearranjmanının klinikopatolojik ve genetik yaygınlığını, ve özelliklerini öğrenmek için yapıldı. Gereç ve Yöntemler: FIP1L1-PDGFRA rearranjmanının tespiti için revers-transkriptaz polimeraz zincir reaksiyonu ve jel elektroforezi kullanıldı. Address for Correspondence: Anıl Kumar N, M.D., Kidwai Memorial Institute of Oncology, Department of Medical Oncology, Karnataka, India Phone: +91 9980446774 E-mail: anianeel@gmail.com Received/Geliş tarihi : March 08, 2013 Accepted/Kabul tarihi : July 08, 2013

Turk J Hematol 2014;31:56-60

Kumar A, et al: FIP1L1-PDGFRA-positive Chronic Eosinophilic Leukemia

Bulgular: Splenomegaliye sahip beş erkek hasta FIP1L1-PDGFRA gen yeniden düzenlenmesini taşıyordu. İmatinib başlangıcından 4 hafta içinde tüm hastalarda tam hematolojik yanıt elde etti. Bir hastada önceden var olan derin ven trombozu ve 1 hastada steroid ve imatinib ile düzelen kardiyomiyopati vardı. Tüm bu hastalarda konvansiyonel sitogenetik normaldi. İmatinibe karşı birincil direnç kaydedilmedi. Sonuç: Bu çalışma hipereozinofilik sendromlu hastalarda FIP1L1-PDGFRA testinin yapılması gerektiğini gösterir. Imatinib ile bu durumun acil tedavisi tam hematolojik yanıta ve bu durumda görülebilecek organ hasarının engellenmesine yol açabilir. Anahtar Sözcükler: PDGFRA, Kronik eozinofilik lösemi, İmatinib, Hindistan

Introduction Hypereosinophilic syndrome (HES) is an uncommon disorder with persistent eosinophilia and multiple organ dysfunction due to eosinophilic infiltration [1]. The spectrum of clinical manifestations are variable and patients may be asymptomatic or may have endomyocardial fibrosis or restrictive lung disease. Clonal or neoplastic eosinophilia is defined as eosinophilia originating from the malignant clone in hematopoietic stem cells and myeloid neoplasms. Myeloproliferative neoplasm with eosinophilia and plateletderived growth factor receptor-alpha gene and Fip1-like 1 gene mutation (FIP1L1-PDGFRA; F/P) is a low-burden disease with dramatic response to imatinib therapy. Various classifications over the last 20 years, and especially from the Year 2011 Working Conference on Eosinophil Disorders and Syndromes, have tried to give us a better understanding of the pathophysiology and management of this rare but clinically important and treatable hematological malignancy [1]. There are numerous reports indicating an ongoing effort for treatment of this condition in patients of different genetic backgrounds, such as those of Özbalcı et al. from Turkey [2], Loules et al. from Greece [3], Arai et al. from Japan [4], and Helbig et al. from Poland [5]. There are very few reports from India, including those of Kumar et al. [6], Sreedhar Babu et al. [7], and Arora [8]. Hence, we undertook this study to learn the clinical profile and outcome in our region. Materials and Methods This study was done at the Kidwai Memorial Institute of Oncology, Bangalore, Karnataka, India, a tertiary care oncology center in southern India. During the period from January 2008 to December 2011, among the patients attending our hematology clinic, cases of eosinophilia were reviewed. he clinical profile, history, physical examination findings, hemogram investigations and metabolic panels were reviewed. Patients underwent bone marrow aspiration and biopsy when required. Where indicated in the investigation, F/P fusion assay was done by Oncquest Laboratory, New Delhi, India, using the protocol described below (Figure 1). Informed consent was obtained. RNA Isolation RNA was extracted from bone marrow or peripheral blood using the RNeasy Mini Kit supplied by QIAGEN as per the manufacturer’s instructions. RNA was quantified

using a SmartSpec 3000 spectrophotometer (Bio-Rad). The quality of RNA was ascertained by resolving it on 1.2% formaldehyde MOPS gel. The purified RNA was stored at -80 °C until further processing. cDNA Preparation cDNA was prepared using the RevertAid First Strand cDNA Kit supplied by MBI Fermentas. First, 1 µg of total RNA was taken in a thin-walled, 0.2 mL tube and the volume was made up to 12 µL with nuclease-free water. The RNA was denatured by incubating at 65 °C for 5 min in a Dyad Peltier Thermal Cycler (Bio-Rad). The denatured RNA was snap-chilled by keeping it on ice for 2 to 4 min, and then 1 µL of dNTPs, 1 µL of random hexamer primer, 4 µL of 5X RT buffer, and 1 µL of RNase inhibitor was added to the tube. This was incubated at 20 °C for 4 min in the thermal cycler; 1 µL of reverse transcriptase was then added and this was incubated at 42 °C for 50 min. The cDNA hybrid was denatured by incubating at 93 °C for 5 min. The cDNA was stored at -80 °C in a deep freezer until further processing. PCR and Analysis Fusion of FIP1L1 to PDGFRA was analyzed in an endpoint polymerase chain reaction (PCR) using the following primers: FIP1L1 FP (5’ ACCTGGTGCTGATCTTTCTGAT 3’) and PDGFRA RP (5’ TGAGAGCTTGTTTTTCACTGGA 3’). Briefly, 3 µL of cDNA was taken in a 0.2 mL PCR tube. To this was added 2 µL each of 5 µM forward and reverse primers (Sigma), 0.5 µL of 10 mM dNTP mix, 2.5 µL of 10X buffer, and 0.5 µL of DyNAzyme II DNA polymerase (all from Finnzymes). The final reaction volume was made up to 25 µL with nuclease-free water (Ambion). After an initial denaturation at 94 °C for 3 min, the PCR was run for 45 cycles with these conditions: 94 °C for 30 s; 60 °C for 30 s; and 72 °C for 30 s followed by a final extension at 72 °C for 2 min. PCR directed at the amplification of a housekeeping gene was used as an internal control to ensure mRNA quality. A “no template control” (NTC) was used to detect the incidence of false-positive reactions. All reactions were carried out in a Dyad Peltier Thermal Cycler (Bio-Rad). The amplicon was resolved on 2% agarose gel to ascertain the specificity of amplification. The resolved PCR products were visualized under UV illumination and documented on a gel doc system (UVP). Presence of the FIP1L1-PDGFRA deletion mutation resulted in varying amplicons of 700-1000 bp. 57

Kumar A, et al: FIP1L1-PDGFRA-positive Chronic Eosinophilic Leukemia

Turk J Hematol 2014;31:56-60

1 2 3 4 5 6 7 8 9 10 11 12 Lanes 1 and 2: NTC for housekeeping control and FIP1L1. Lanes 3 and 4: Amplicon for housekeeping gene (330 bp) and FIP1L1-PDGFRA (700-1000 bp) of patient A. Lanes 5 and 6: Amplicon for housekeeping gene (330 bp) and FIP1L1-PDGFRA (700-1000 bp) of patient B. Lane 7: 100-bp marker. Lanes 8 and 9: Amplicon for housekeeping gene (330 bp) and FIP1L1-PDGFRA (700-1000 bp) of positive control. Lanes 10 and 11: Amplicon for housekeeping gene (330 bp) and FIP1L1-PDGFRA (700-1000 bp) of negative control. Lane 12: 100-bp marker. Results During the time period mentioned, 26 patients had analysis for the F/P mutation, with 5 positive cases representing 19.2% of total cases. This is probably a falsely high figure and does not reflect the true incidence, as our hospital is a reference center for oncology. All 5 patients were male. The median age was 43.8 years (range: 21-52). Palpable splenomegaly was seen in all patients, which was confirmed by ultrasound. The clinical and laboratory parameters are included in Table 1. Bone marrow showed a marked increase in eosinophils. These were mostly mature; however, eosinophils with sparse purple granules, vacuolation, and hyposegmented forms were seen. Few or no blasts and an increase in masT-cells were seen. Conventional cytogenetics, done in all cases, showed normal karyotypes. All patients were started on imatinib at 100 mg or 400 mg per day as per the physician’s preference. All patients achieved complete hematological response within 4 weeks. One patient was symptomatic with pedal edema

Figure 1. PCR analysis of FIP1L1-PDGFRA fusion isolated from one of our patients. 58

and dyspnea. Two-dimensional echocardiogram revealed cardiomyopathy with left ventricular thrombus. The patient showed significant improvement in symptoms with imatinib and steroids. Another patient had pre-existing deep vein thrombosis, which also resolved with imatinib therapy. Discussion The Year 2011 Working Conference on Eosinophil Disorders and Syndromes (Vienna, Austria) was a multispecialty discussion held in order to formulate a consensus statement on the classification of eosinophil disorders and related syndromes [1]. HES is characterized by persistent eosinophilia and is associated with damage to multiple organs. Hardy and Anderson first described this entity in 1968 [9]. Later, in 1975, Chusid et al. defined the prerequisites for the diagnosis of HES [10] as follows: 1. Absolute eosinophil count of greater than >1500/ µL persisting for longer than 6 months. Outcomes of the Year 2011 Working Conference on Eosinophil Disorders and Syndromes suggested that at least 2 occasions with a minimum time interval of 4 weeks of eosinophilia can also be considered persistent [1]. 2. No identifiable etiology for eosinophilia. 3. Patients must have signs and symptoms of organ involvement. Other causes of eosinophilia, like familial eosinophilia, and acquired causes that are subcategorized as secondary, clonal, and idiopathic eosinophilia should be considered [1]. The rational algorithm for a patient with eosinophilia includes peripheral blood smear to rule out an underlying myeloid malignancy (eg., circulating blasts and dysplastic cells) and serum tryptase level. Peripheral blood testing for the F/P mutation should also be done as an initial test. The next step would be to do a bone marrow aspiration to rule out myeloid neoplasm or chronic eosinophilic leukemia not otherwise specified (CEL-NOS) [11,12]. In CEL-NOS, persistent eosinophilia associated with blasts in the peripheral blood or bone marrow of 20% or clonality of the eosinophils must be proven [11]. A separate category has been made for myeloid and lymphoid neoplasms with eosinophilia and abnormalities of PDGFRA, PDGFRB, or FGFR1. In neoplasms with F/P mutation, the presentation is usually CEL and less often acute myeloid leukemia or T-lymphoblastic lymphoma [12]. After the tremendous success of imatinib therapy in BCRABL-positive chronic myelogenous leukemia, imatinib was tried in various myeloproliferative disorders and patients with eosinophilia were found to be particularly sensitive. A translational research effort led to the identification of a constitutively activated fusion tyrosine kinase on chromosome 4q12, derived from an interstitial deletion, that fuses with PDGFRA to an uncharacterized human gene, FIP1L1, first described by Cools et al. in 2003 [13]. They

10 months 400 mg 195 211 3.36 4.80

178 118 4.09 5.84

193 102 3.24 5.24

188 123 3.86 4.83

194 113

49 5

46 4

51 3

21 2

Cough, pain in abdomen, firm spleen 3 cm below LCM Cough, dyspnea, firm spleen 5 cm below LCM Lower limb edema, cough, firm spleen 5 cm below LCM Pain in abdomen, rash, firm spleen 8 cm below LCM Cough, firm spleen 7 cm below LCM M 52 1

Abbreviations: M- male; WBC- white blood cell count; PB- peripheral blood; Hb- hemoglobin; CHR- complete hematological response; LV- left ventricle; LCM- left costal margin.

18 months 400 mg

Deep vein thrombosis of left lower extremity

11 months 100 mg

13 months 100 mg

3 months 100 mg

Duration of treatment (109/L)

Platelets

Hb (g/L)

Eosinophils in PB (109/L) 2.24 WBC in PB (109/L) 3.30 Clinical features Sex Age, years

Table 1. Clinical and laboratory profiles of 5 patients.

Turk J Hematol 2014;31:56-60

used a nested PCR approach, but our used method was reverse-transcriptase PCR.

Imatinib dosage/day

CHR within 4 weeks +

Complications

Cardiomyopathy and LV thrombus

Kumar A, et al: FIP1L1-PDGFRA-positive Chronic Eosinophilic Leukemia

There have been reports from around the world regarding the treatment of F/P-positive CEL with imatinib [2,3,4,5]. In most of the reports, all patients were male, except for 2 of 27 patients reported by Helbig et al. [5]. All patients had splenomegaly, which is also reflected in our series. All of our patients achieved complete hematologic response within 4 weeks, which is on par with the results of other studies. The optimal dose of imatinib has been a subject of debate. Successful treatment regimens have ranged from 100 mg/week to 400 mg/day [5,14]. The frequency of emergence of imatinib resistance in F/P-positive disease is currently unclear [15,16]. We observed no hematologic relapses among our patients, although our follow-up time was short. The concentration of imatinib required to inhibiTcells transformed by FIP1L1-PDGFRA by 50% (IC50) was 3.2 nM, whereas the IC50 for BCR-ABL was 582 nM. Hence, complete remission even with low doses of imatinib is seen, which is also evident in our case series. One of our patients showed a resolution of cardiac complications similar to that reported by Arai et al. [4]. Few cases have been reported from India and ours is the largest reported Indian series. The patient reported by Arora [8] had a cytogenetic abnormality, t (1; 4) (q24; q35). In all other cases, diagnoses were made on clinical and morphological grounds and the F/P mutation was not analyzed. Due to this, the true incidence of CEL in India is not known. Conclusion PDGFRA-positive myeloid neoplasm with eosinophilia is a rare disease and this study indicates the need to do the PDGFRA assay in patients with HES. A high index of suspicion among clinicians and awareness of this condition is essential for prompt initiation of therapy. The response is dramatic and can lead to complete hematological response and prevention or resolution of organ damage due to eosinophilic infiltration. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Valent P, Klion AD, Horny HP, Roufosse F, Gotlib J, Weller PF, Hellmann A, Metzgeroth G, Leiferman KM, Arock M, Butterfield JH, Sperr WR, Sotlar K, Vandenberghe P, Haferlach T, Simon HU, Reiter A, Gleich GJ. Contemporary consensus proposal on criteria and classification of eosinophilic disorders and related syndromes. J Allergy Clin Immunol 2012;130:607-612. 59

Turk J Hematol 2014;31:56-60

2. Özbalcı D, Ergene Ü, Yazgan H. A chronic eosinophilic leukemia patient presenting with blurred vision. Turk J Hematol 2011;28:239-240. 3. Loules G, Kalala F, Giannakoulas N, Papadakis E, Matsouka P, Speletas M. FIP1L1-PDGFRA molecular analysis in the differential diagnosis of eosinophilia. BMC Blood Disorders 2009;9:1. 4. Arai A, Yan W, Wakabayashi S, Hayashi S, Inazawa J, Miura O. Successful imatinib treatment of cardiac involvement of FIP1L1-PDGFRA-positive chronic eosinophilic leukemia followed by severe hepatotoxicity. Int J Hematol 2007;86:233-237. 5. Helbig G, Moskwa A, Swiderska A, Urbanowicz A, Calbecka M, Gajkowska J, Zdziarska B, Brzezniakiewicz K, Pogrzeba J, Krzemien S. Weekly imatinib dosage for chronic eosinophilic leukaemia expressing FIP1L1-PDGFRA fusion transcript: extended follow-up. Br J Haematol 2009;145:132-134. 6. Kumar A, Sinha S, Tripathi AK. Chronic eosinophilic leukemia: a case report and review of literature. Indian J Hematol Blood Transfus 2007;23:112-115. 7. Sreedhar Babu KV, Chowhan AK, Rukmangadha N, Kumaraswamy Reddy M. Chronic eosinophilic leukaemia: a case report. J Clin Sci Res 2012;1:46-48. 8. Arora RS. Chronic eosinophilic leukemia with a unique translocation. Indian Pediatr 2009;46:525-527. 9. Hardy WR, Anderson RE. The hypereosinophilic syndromes. Ann Intern Med 1968;68:1220-1229. 10. Chusid MJ, Dale DC, West BC, Wolff SM. The hypereosinophilic syndrome: analysis of fourteen cases with review of the literature. Medicine (Baltimore) 1975;54:1-27.

Kumar A, et al: FIP1L1-PDGFRA-positive Chronic Eosinophilic Leukemia

11. Vardiman J, Hyjek E. World Health Organization classification, evaluation, and genetics of the myeloproliferative neoplasm variants. Hematology Am Soc Hematol Educ Program 2011;2011:250-256. 12. Bain BJ, Gilliland DG, Horny HP, Vardiman JW. Myeloid and lymphoid neoplasms with eosinophilia and abnormalities of PDGFRA, PDGFRB or FGFR1. In: Swerdlow S, Campo E, Lee Harris N, Jaffe E, Pileri S, Stein H, Thiele J, Vardiman J (eds). WHO Classification of Tumors of Hematopoietic and Lymphoid Tissues. Lyon, France, IARC, 2008. 13. Cools J, DeAngelo DJ, Gotlib J, Stover EH, Legare RD, Cortes J, Kutok J, Clark J, Galinsky I, Griffin JD, Cross NC, Tefferi A, Malone J, Alam R, Schrier SL, Schmid J, Rose M, Vandenberghe P, Verhoef G, Boogaerts M, Wlodarska I, Kantarjian H, Marynen P, Coutre SE, Stone R, Gilliland DG. A tyrosine kinase created by fusion of the PDGFRA and FIP1L1 genes as a therapeutic target of imatinib in idiopathic hypereosinophilic syndrome. N Engl J Med 2003;348:1201-1214. 14. Klion AD. How I treat hypereosinophilia syndromes. Blood 2009;114:3736-3741. 15. Seifert M, Gerth J, Gajda M, Pester F, Pfeifer R, Wolf G. [Eosinophilia - a challenging differential diagnosis]. Med Klin (Munich) 2008;103:591-597. 16. Gleich GJ, Leiferman KM. The hypereosinophilic syndromes: current concepts and treatments. Br J Haematol 2009;145:271-285.

Research Article

DOI: 10.4274/Tjh.2012.0187

The Impact of Obesity and Insulin Resistance on Iron and Red Blood Cell Parameters: A Single Center, Cross-Sectional Study Obezite ve İnsulin Direncinin Demir ve Eritrosit Parametreleri Üzerine Etkisi: Kesitsel, Tek Merkezli Bir Çalışma Esma Altunoğlu1, Cüneyt Müderrisoğlu1, Füsun Erdenen1, Ender Ülgen1, M. Cem Ar2 1İstanbul

Training and Research Hospital, Department of Internal Medicine, İstanbul, Turkey

2Istanbul

University, Cerrahpaşa Medical Faculty, Department of Internal Medicine, Division of Haematology, Istanbul, Turkey

Abstract: Objective: Obesity and iron deficiency (ID) are the 2 most common nutritional disorders worldwide causing significant public health implications. Obesity is characterized by the presence of low-grade inflammation, which may lead to a number of diseases including insulin resistance (IR) and type 2 diabetes. Increased levels of acute-phase proteins such as C-reactive protein (CRP) have been reported in obesity-related inflammation. The aim of this study was to investigate the impact of obesity/IR on iron and red blood cell related parameters.

Materials and Methods: A total of 206 patients and 45 control subjects of normal weight were included in this crosssectional study. Venous blood samples were taken from each patient to measure hemoglobin (Hb), serum iron (Fe), ironbinding capacity (IBC), ferritin, CRP, fasting blood glucose, and fasting insulin. Body mass index (BMI) and waist-to-hip ratio (WHR) were calculated for each patient. IR was determined using the HOMA-IR formula.

Results: Subjects were divided into 3 groups according to BMI. There were 152 severely obese (BMI: 42.6±10.1), 54 mildly obese (BMI: 32.4±2.1), and 45 normal-weight (BMI: 24.3±1.3) patients. Hb levels in severely obese patients and normal controls were 12.8±1.3 g/dL and 13.6±1.8 g/dL, respectively. We found decreasing Fe levels with increasing weight (14.9±6.9 µmol/L, 13.6±6.3 µmol/L, and 10.9±4.6 µmol/L for normal controls and mildly and severely obese patients, respectively). Hb levels were slightly lower in patients with higher HOMA-IR values (13.1±1.5 g/dL vs. 13.2±1.2 g/dL; p=0.36). Serum iron levels were significantly higher in the group with low HOMA-IR values (13.6±5.9 µmol/L vs. 11.6±4.9 µmol/L; p=0.008). IBC was found to be similar in both groups (60.2±11.4 µmol/L vs. 61.9±10.7 µmol/L; p=0.23). Ferritin was slightly higher in patients with higher HOMA-IR values (156.1±209.5 pmol/L vs. 145.3±131.5 pmol/L; p=0.62).

Conclusion: Elevated BMI and IR are associated with lower Fe and hemoglobin levels. These findings may be explained by the chronic inflammation of obesity and may contribute to obesity-related co-morbidities. People with IR may present with ID without anemia.

Key Words: Obesity, Insulin resistance, Anemia, Inflammation Address for Correspondence: Esma Altunoğlu, M.D., İstanbul Training and Research Hospital, Department of Internal Medicine, İstanbul, Turkey Phone: +90 212 459 67 79 E-mail: esmaaltunoglu@yahoo.com Received/Geliş tarihi : November 30, 2012 Accepted/Kabul tarihi : May 8, 2013

Turk J Hematol 2014;31:61-67

Altunoğlu E, et al: Anemia and Iron Parameters in Obesity

Özet: Amaç: Dünyada en sık görülen beslenme bozukluklarından olan obezite ve demir eksikliği önemli halk sağlığı sorunlarına yol açmaktadır. Kronik, düşük dereceli inflamasyon ile karakterize olan obezite insülin direnci ve tip 2 diyabetes mellitus gibi ciddi hastalıklara zemin hazırlar. Obezite ile ilişkili inflamasyonun C reaktif protein (CRP) ve bazı sitokinler gibi akut faz yanıtı oluşturan proteinlerin düzeyinde artışa neden olduğu gösterilmiştir. Bu çalışmada obezite ve insülin direncinin demir ve eritrosit ile ilişkili parametreler üzerindeki etkisinin araştırılması amaçlanmıştır.

Gereç ve Yöntemler: Bu tek merkezli, kesitsel çalışmaya obezite polikliniğine başvuran 206 hasta ve 45 normal kilolu sağlıklı kontrol dahil edilmiştir. Hastalardan alınan venöz kan örneklerinde hemoglobin (Hb), demir, demir bağlama kapasitesi (DBK), ferritin, CRP, açlık şekeri ve insülin düzeyleri çalışılmıştır. Ayrıca çalışmaya alınan her hastanın vücut kütle indeksi (VKİ), bel/kalça oranı (BKO) hesaplanmış, insülin direnci HOMA-IR formülü ile bulunmuştur.

Bulgular: Hastalar VKİ’lerine göre 3 gruba ayrıldı. Buna göre ileri derecede obez olan 152 hasta (VKİ: 42,6±10,1), hafif obez 54 hasta (VKİ: 32,4±2,1) ve normal kilolu 45 kontrol (VKİ: 24,3±1,3) vardı. İleri derecede obezlerle karşılaştırıldığında normal kilolu hastalarda Hb düzeyleri daha yüksek (sırasıyla 12,8±1,3 g/dL ve 13,6±1,8 g/dL) saptandı. Serum demir düzeylerinin artan kilo ile birlikte azaldığı görüldü (normal, hafif ve ileri derecede kilolu hastalarda sırasıyla 14,9±6,9 µmol/L, 13,6±6,3 µmol/L ve 10,9±4,6 µmol/L) HOMA-IR değeri yüksek hastalarda düşük olanlara nazaran Hb düzeyleri hafif azalmış bulundu (13,1±1,5 g/dL’ye karşılık 13,2±1,2 g/dL; p=0,36). Serum demir düzeyleri düşük HOMA-IR’lı hastalarda anlamlı olarak daha yüksekti (13,6±5,9 µmol/L’ye karşılık 11,6±4,9 µmol/L; p=0,008). DBK her iki grupta da benzerdi (60,2±11,4 µmol/L’ye karşılık 61,9±10,7 µmol/L; p=0,23). Ferritin düzeyleri yüksek HOMA-IR’lı grupta anlamlı olmasa da daha yüksek bulundu (156,1±209,5 pmol/L’ye karşılık 145,3±131,5 pmol/L; p=0,62).

Sonuç: Artmış VKİ ve insülin direnci, düşük hemoglobin ve serum demir düzeyleri ile ilişkili bulunmuştur. Bu bulgular kısmen obezitede görülen düşük dereceli inflamasyon ile açıklanabilir ve obezite ile ilişkili ek hastalıkların oluşmasına katkı sağlıyor olabilir. İnsülin direnci bulunan hastalarda anemi gözlenmeksizin subklinik demir eksikliği görülebilir.

Anahtar Sözcükler: Obezite, İnsülin direnci, Anemi, İnflamasyon

Introduction Obesity and iron deficiency (ID) are 2 of the most common nutritional disorders worldwide [1]. ID, in developed countries, is the most common nutritional deficiency and has been linked to obesity in adults and children [2]. The association between iron status and obesity is one that should be explored further, as obesity and ID are diseases that continue to evolve globally, and both have significant public health implications [3]. The global incidence of obesity has increased dramatically over the past 50 years. Currently more than 1 billion people are thought to have a body mass index (BMI) of more than 30 kg/m2, and the number is expected to increase dramatically over the next 30 years [4]. The prevalence of ID and iron deficiency anemia (IDA) is highest in the developing world; however, suboptimal iron status continues to exist in the developed countries. Epidemiological studies have shown that the prevalence of anemia increases with age [5]. Among micronutrients, iron plays a major role not only for hemoglobin synthesis alone, but also for oxidative metabolism and energy production. ID and IDA have been shown to underlie important public health issues; diminished iron reserves affect cognitive development and behavior, energy metabolism, immune function, bone health, and work capacity in humans [6]. The inverse correlation between plasma iron and adiposity in children and adolescents was recently reported 62

by Pinhas-Hamiel et al. They showed that low iron levels were present in 38.8%, 12.1%, and 4.4% of obese, overweight, and normal-weight children, respectively [7]. Obesity is characterized by the presence of low-grade inflammation and the risk of developing a number of chronic diseases, such as insulin resistance (IR) and type 2 diabetes. Obesity-related inflammation increases plasma levels of many acute-phase proteins such as C-reactive protein (CRP), hepcidin, and several cytokines [8]. We hypothesized that IR and obesity may be associated with decreased hemoglobin and changes in the iron parameters, including serum iron levels, ironbinding capacity (IBC), and serum ferritin. Obesity-related inflammation is expected to result in reduced hemoglobin and serum iron levels in obese adults and subjects with IR. The purpose our study was to examine the relation among hemoglobin, serum iron, total IBC, CRP, and IR in obese patients and compare this to normal-weight adults. Materials and Methods This cross-sectional study included 251 subjects (203 females and 48 males) comprising 206 patients, with no established chronic or hematologic diseases, and 45 normalweight healthy controls without any prior personal history of obesity or diet. None of the patients had undergone gastric bypass surgery or an intervention for the surgical treatment of obesity. Menstrual cycles and reproductive history were obtained in premenopausal women. Women with menstrual

Turk J Hematol 2014;31:61-67

Altunoğlu E, et al: Anemia and Iron Parameters in Obesity

irregularities were excluded. People on iron therapy or consuming dietary supplements or vitamins containing iron, and subjects having received non-steroidal anti-inflammatory drugs 48 h prior to blood sampling, were also exempted. None of the included subjects had a history of blood donation or transfusion. Neither patients nor the healthy controls were regular alcohol drinkers. All patients were weighed using a digital weighing scale with light clothing on, and without shoes. Their heights were measured standing on a fixed stadiometer. BMI was calculated by dividing body weight in kilograms by body height squared in meters and patients were divided according to the World Health Organization recommended cut-off points into 5 groups: normal weight (BMI of <25 kg/m2), overweight (BMI of 25 to <30 kg/m2), mildly obese (BMI of 30 to <35 kg/m2), moderately obese (BMI of 35 to <40 kg/m2), and severely obese (BMI of >40 kg/m2). Waist circumference (WC) and hip circumference (HC) were also measured using a flexible measuring tape and waist-to hip ratio (WHR) was then calculated. All subjects fasted for at least 12 h before blood sampling for biochemical analysis. Fasting blood glucose levels were measured spectrophotometrically using the Abbot Aeroset 2.0 (Abbot Diagnostic, USA). Serum iron was measured by the ferrozine method. Serum iron of less than 8.95 µmol/L indicated ID based on the reference ranges (normal range: 8.95-30.43 µmol/L) provided by the manufacturer. Ferritin was measured using the chemiluminescence method and values of less than 22.47 pmol/L (normal range: 22.47633.65 pmol/L) were accepted as ID. The analysis of CRP was performed by immunoturbidity. Hemoglobin and hematocrit were measured with the Advia 2120 Siemens blood counter. According to World Health Organization guideliness the standard values of grading of anemia are <12 g of hemoglobin in female and <13 g of hemoglobin in male. Insulin was measured by the electro-chemiluminescence immunoassay method on a Roche-Hitachi E 170. IR was calculated using the homeostasis model assessment formula: HOMA-IR =(fasting insulin (mU/L) x glucose

(mmol/dL)/22.5. The study was conducted in accordance with the Helsinki Declaration and rules of Good Clinical Practice. It was approved by the local ethics committee. Statistics Statistical analysis was performed using SPSS 17.00 for Windows. Baseline data were expressed as means±standard deviations. To analyze differences between groups we used the independent samples t-test. A value of p<0.05 was considered as significant. Results The information about age, sex, and body measurements of the 251 subjects are given in Table 1. On the basis of BMI, 3 groups were identified: there were 152 severely obese (BMI: 42.6±10.1), 54 mildly obese (BMI: 32.4±2.1), and 45 normal-weight (BMI: 24.3±1.3) patients. As expected, severely and mildly obese patients had significantly higher values for BMI, WC, HC, and WHR when compared to normal controls. CRP levels were higher in the obese group, although without statistical significance. Hemoglobin and hematocrit levels were significantly higher in people with normal weight when compared to the severely obese (13.6±1.1 g/dL vs. 12.8±1.3 g/dL, p=0.015; 41.0±3.8% vs. 38.5±3.6%, p=0.007, respectively) (Table 2). This may partly be explained by the lower female-to-male ratio in the normalweight healthy controls in comparison to the severely obese group (0.64 vs. 0.90). Hemoglobin and hematocrit levels were higher in both normal and obese males than normal and obese females. Hemoglobin values were 14.2±0.8g/ dl vs 14.7±1.1g/dl p=0.15; 13.1±0.6g/dl vs12.7±1.2g/dl p=0.02 respectively. Hematocrit values were 44; 0±42.6% vs 44.0±43.1% p=0.98; 39.0±2.4% vs. 38.1±3.5% p=0.37, respectively (Table 3). Although there was no significant association between ferritin levels and the degree of obesity, ferritin values were higher in the non-obese group. Serum iron levels were measured to be significantly higher in people with normal weight than in the obese subjects (p=0.001). An opposite trend was observed for IBC. In comparison to obese

Table 1. Age, sex, and body measurements of the subjects.

Normal controls

Mildly obese

Severely obese

152

44.0±13.3

42.7±12.7

40.2±16.9

16/29

17/37

13/139

BMI (kg/m )

24.3±2.3

32.5±2.1

42.6±10.1

WC (cm)

85.5±12.3

104.4±10.1

181.6±12.3

HC (cm)

94.7±6.3

114.3±8.9

131.8±11.44

WHR

0.90±0.05

0.91±0.06

0.90±0.07

n Age (years) Sex (male/female) 2

BMI, Body mass index; HC, hip circumference; WC, waist circumference; WHR, waist-to-hip ratio

Altunoğlu E, et al: Anemia and Iron Parameters in Obesity

Turk J Hematol 2014;31:61-67

Table 2. Laboratory characteristics of the patients according to BMI.

Normal controls n

Mildly obese

Severely obese

152

Hemoglobin (g/dL)

13.6±1.1

13.3±1.6

12.8±1.3

Hematocrit (%)

41.0±3.8

40.1±4.8

38.5±3.6

Iron (µmol/L)

14.9±6.9

13.6±6.3

10.9±4.6

IBC (µmol/L)

52.8±9.4

63.2±9.1

63.2±10.8

232.1±145.2

172.1±224.3

112.6±174.8

15.2±14.3

9.5±9.5

10.5±9.5

Ferritin (pmol/L) CRP (nmol/L) CRP, C-reactive protein; IBC, iron binding capacity

Table 3. Haematologic laboratory characteristics of patients according to gender.

Normal male

Obese male

Normal female

Obese female

188

Hemoglobin (g/dL)

14.2±0.8

14.7±1.1

13.1±0.6

12.7±1.2

Hematocrit (%)

14.0±2.6

44.0±3.1

39.0±2.4

38.1±3.5

Iron (µmol/L)

103.0±33.4

88.8±37.3

82.0±23.8

61.1±24.2

IBC (µmol/L)

283.8±59.9

345.1±53.6

296.2±43.7

349.9±60.1

Ferritin (pmol/L)

149.3±73.1

114.8±110.2

72.9±45.7

55.1±72.9

subjects, those with normal weight had lower levels of IBC. The cut-off value for HOMA-IR was accepted as 2.5. There were 86 and 165 patients with HOMA-IR levels of ≤2.5 and >2.5, respectively. Hemoglobin levels in people with higher IR (as indicated by increased HOMA-IR) were slightly lower as compared to those with lower HOMA-IR values (13.1±1.5 g/dL vs. 13.2±1.2 g/dL; p=0.36). No difference in hematocrit levels was observed between patients with >2.5 and ≤2.5 HOMA-IR values (39.8±3.7% vs. 39.1±4.3%; p=0.20). Serum iron levels were significantly higher in the group with HOMA-IR values of ≤2.5 (11.6±4.9 µmol/L vs. 13.6±5.9 µmol/L; p=0.008). IBC was found similar in both groups (60.2±11.4 µmol/L vs. 61.9±10.7 µmol/L; p=0.23). Ferritin levels were slightly higher in the group with >2.5 HOMAIR values (156.1±209.5 pmol/L vs. 145.3±131.5 pmol/L; p=0.62). CRP levels in the group with high HOMA-IR values were higher than those in the group with low HOMA-IR values, but the difference was not significant (11.1±10.1 nmol/L vs. 11.3±11.4 nmol/L; p=0.83). Demographic and hematological characteristics of the groups according to IR are shown in Table 3. Discussion Obesity and related complications as well as ID are 2 major issues that affect significant proportions of the global population [9]. This is of considerable concern for the wellbeing of the population given that overweight and obese 64

people are at increased risk for co-morbidities, functional decline, impaired quality of life, increased use of health care resources, and increased mortality. Iron plays a vital role in hemoglobin production and erythrocyte maturation. Two of the most common causes of anemia, IDA and the anemia of chronic inflammation, result from abnormalities in iron homeostasis [10]. Iron homeostasis in the body is controlled by a very complex mechanism, the main components of which are erythropoietic activity, hypoxia, iron stores, and inflammation [6]. However, iron may also function in the maintenance of body weight and composition, as a number of studies have suggested an association between iron status and obesity. The first such study, published in 1962 by Wenzel et al., demonstrated significantly lower serum iron concentrations in obese adolescents in comparison to normal controls [11]. Subsequently, Selzer and Mayer reported similar findings in 1963 [12]. More recently, in a cross-sectional study, overweight Israeli children and adolescents had lower iron status compared with normal-weight individuals [7]. Data from NHANES III support these findings, as multivariate regression analysis determined that overweight American children were twice as likely to be iron deficient than normalweight children and adolescents [13]. Similar associations have also been reported in adults [10]. Menzie et al. found significantly lower levels of serum iron and transferrin saturation in obese people when

AltunoÄ&#x;lu E, et al: Anemia and Iron Parameters in Obesity

compared to non-obese adult volunteers. They reported that the obese and the non-obese subjects did not differ in total daily iron consumption but that fat mass was a significant negative predictor of serum iron level [14]. Our study resulted in similar findings. We found significantly lower serum iron levels in severely obese patients than in the mildly obese group, and the mildly obese group had levels that were lower than those of the normal controls. IBC levels were lower in normal-weight individuals compared to obese patients. The mechanism underlying the reduced iron status in obese individuals remains to be clarified. Iron depletion might result from the increased iron requirement of obese people because of their larger blood volume and/or their consumption of energy-dense, nutrient-poor foods [3,7,14]. Another cause of hypoferremia may be the chronic inflammation seen in obesity [15]. Hepcidin levels are usually anticipated to increase due to the low-grade inflammation together with other acute phase markers, including ferritin. However, ferritin levels were unexpectedly lower in our obese patient group when compared to normal controls. This may partly be explained by the disproportionately higher male-tofemale ratio in the control group. On the other hand, low ferritin levels in our obese patient group might also reflect the low total iron body stores. Although IDA was one of the exclusion criteria of this study, we might have missed cases of occult ID due to low-iron diets, poor absorption, etc. as the study was of cross-sectional design and no bone marrow biopsies were performed to confirm iron body stores. Yanoff et al. found similar results and stated that the hypoferremia of obesity appears to be explained both by true ID and by inflammatory-mediated functional ID [15]. As previously stated, obesity is characterized by the presence of low-grade inflammation and the risk of developing a number of chronic diseases such as IR, impaired glucose tolerance, and type 2 diabetes [16]. As expected, we observed a higher rate of IR in people with higher BMIs. We found a negative correlation between IR and serum iron levels. In the group with high HOMA-IR, serum iron and hemoglobin levels were low and serum IBC and ferritin values were high. Insulin causes a rapid stimulation of iron uptake by faT-cells and hepatocytes. Reciprocally, iron interferes with insulin action in the liver [17,18]. In addition, iron is a potent pro-oxidant that increases cellular oxidative stress, causing inhibition of insulin internalization and action, which results in hyperinsulinemia, IR, and abnormal Î˛-cell function through iron toxicity [16,20,21,22,23,24,25]. Furthermore, iron overload may lead to IR disorders such as the metabolic syndrome and type 2 diabetes [26,27]. This involvement appears to be bidirectional: on one hand, iron accumulation favors IR and thus contributes to pancreatic beta cell dysfunction and diabetes; on the other hand, IR seems to facilitate iron accumulation within the body [27].

Turk J Hematol 2014;31:61-67

Several studies have shown that IR is closely related to the total body iron stores [26]. Oxidative stress and inflammation are involved in the interplay between iron overload and IR [27]. Ferritin levels have been shown to correlate positively with blood glucose and fasting serum insulin and negatively with insulin sensitivity [28]. In our study, serum ferritin levels were higher in patients with IR. Ferritin is an index of body iron stores and is also an inflammatory marker. Increased serum ferritin concentrations and excessive iron can contribute to hyperinsulinemia and reduced insulin function [20,24]. High levels of serum ferritin have been suggested to be a component of IR. High ferritin levels in insulin-resistant patients are thought to be mainly the result of a chronic inflammatory state. Lee et al. recently reported a significant relationship between IR and ferritin levels [29]. The estrogen binding protein levels may be reduced with increasing adiposity with concomitant increase in insulin. Therefore levels of free estrogen may rise up which may cause suppression of erythropoesis in female [30]. In our study we found that both normal and obese female subjects had lower hemoglobin levels than male. This is in accordance with the knowledge that women have lower hemoglobin values than male subjects as determined by reference interwals of WHO. CRP values were higher in this group. Adipose tissue, especially visceral adipose tissue, releases pro-inflammatory cytokines such as interleukin-6, tumor necrosis factor-Îą, and plasminogen activator inhibitor-I, which lead to increased plasma levels of acute-phase proteins such as CRP [10,30,31]. Inflammation has been reported to be mild, but it can promote anemia [32]. The low-grade inflammation induced by the aforementioned cytokines may contribute to the development of obesity-associated anemia, which is characterized by hypoferremia and high to normal serum ferritin levels. We used CRP as an inflammatory marker in this study. CRP levels were increased in correlation with BMI, although the association was not statistically significant. However, earlier studies showed a strong association between high levels of BMI and elevated CRP as a surrogate marker of low-grade inflammation [9,15]. Proinflammatory cytokine release might lead to the increased production and secretion of hepcidin from liver and adipose tissue [33,34]. Hepcidin inhibits intestinal iron absorption and sequesters iron within the macrophages, thereby restricting iron availability for erythrocyte production by inducing hypoferremia [24]. Recent studies have shown that dietary iron absorption is impaired in obese individuals despite adequate dietary intake and bioavailability [31,35]. Limitations of our study include the lack of additional tests required for evaluation of iron status, such as transferrin receptor concentration, reticulocyte count, hepcidin levels, and bone morrow iron stores. Bone morrow aspirates for stainable iron are sometimes required to confirm ID in obese subjects with high IBC. As our aim was to investigate the hematological parameters in patients with IR, we did not evaluate hepcidin and the aforementioned parameters. 65

Turk J Hematol 2014;31:61-67

Altunoğlu E, et al: Anemia and Iron Parameters in Obesity

Another limitation is that this study was cross-sectional in design and therefore no conclusions regarding causal relationships could be drawn. The duration of obesity could not be calculated in our study population. Although obese patients had lower values for iron, they were not anemic. Given the cross-sectional design of this study, subjects were not followed to determine whether they would develop IDA over time. Conclusion Increasing BMI has been associated with low serum iron and hemoglobin as well as elevated serum ferritin levels. These findings may be explained by the low-grade chronic inflammation of obesity and have been implicated in many obesity-related problems, such as IR. Subjects with IR may have subclinical abnormalities in iron status without anemia. Thus, routine screening for serum ferritin and serum iron in people with IR and obese patients should be considered to assess the body iron store and the risk for developing anemia. IR should be included in the differential diagnosis of hyperferritinemia. We recommend close monitoring of the iron status for people with IR and/or obesity who are on strict diet programs since hypoferremia appears to be the result of both true ID and the inflammatory-mediated functional ID. The patients with identified ID should receive iron supplements.

6. Choudhry VP. Hepicidin and its role in iron metabolism. Indian J Pediatr 2010;77:787-789. 7. Pinhas-Hamiel O, Newfield RS, Koren I, Agmon A, Lilos P, Phillip M. Greater prevalence of iron deficiency in overweight and obese children and adolescents. Int J Obes Relat Metab Disord 2003;27:416-418. 8. Dandona P, Aljada A, Bandyopadhyay A. Inflammation: the link between insulin resistance, obesity and diabetes. Trends Immunol 2004;25:4-7. 9. Cheng HL, Bryant C, Cook R, O’Connor H, Rooney K, Steinbeck K. The relationship between obesity and hypoferraemia in adults: a systematic review. Obes Rev 2012;13:150-161. 10. Ausk KJ, Ioannou GN. Is obesity associated with anemia of chronic disease? A population-based study. Obesity 2008;16:2356-2361. 11. Wenzel BJ, Stults HB, Mayer J. Hypoferraemia in obese adolescents. Lancet 1962;2:327-328. 12. Seltzer CC, Mayer JC. Serum iron and iron binding capacity in adolescents. II. Comparison of obese and non-obese subjects. Am J Clin Nutr 1963;13:341-361. 13. Nead KG, Halterman JS, Kaczorowski JM, Auinger P, Weitzman M. Overweight children and adolescents: a risk group for iron deficiency. Pediatrics 2004;114:104-108.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

14. Menzie CM, Yanoff LB, Denkinger BI, McHugh T, Sebring NG, Calis KA, Yanovski JA. Obesity-related hypoferremia is not explained by differences in reported intake of heme and nonheme iron or intake of dietary factors that can affect iron absorption. J Am Diet Assoc 2008:108:145-148.

References

15. Yanoff LB, Menzie CM, Denkinger B, Sebring NG, McHugh T, Remaley AT, Yanovski JA. Inflammation and iron deficiency in the hypoferremia of obesity. Int J Obes (Lond) 2007;31:1412-1419.

1. del Giudice EM, Santoro N, Amato A, Brienza C, Calabrò P, Wiegerinck ET, Cirillo G, Tartaglione N, Grandone A, Swinkels DW, Perrone L. Hepcidin in obese children as a potential mediator of the association between obesity and iron deficiency. J Clin Endocrinol Metab 2009;94:51025107. 2. Amato A, Santoro N, Calabro P, Grandone A, Swinkels DW, Perrone L, del Giudice EM. Effect of body mass index reduction on serum hepcidin levels and iron status in obese children. Int J Obes 2010;34:1772-1774. 3. McClung JP, Karl JP. Iron deficiency and obesity: the contribution of inflammation and diminished iron absorption. Nutr Rev 2009;67:100-104.

16. Tuomainen TP, Nyyssönen K, Salonen R, Tervahauta A, Korpela H, Lakka T, Kaplan GA, Salonen JT. Body iron stores are associated with serum insulin and blood glucose concentrations. Population study in 1,013 eastern Finnish men. Diabetes Care 1997;20:426-428. 17. Lecube A, Carrera A, Losada E, Hernandez C, Simo R, Mesa J. Iron deficiency in obese postmenopausal women. Obesity 2006;14:1724-1730. 18. de Luca C, Olefsky JM. Inflammation and insulin resistance. FEBS Lett 2008;582:97-105.

4. Chung B, Matak P, McKie AT, Sharp P. Leptin increases the expression of the iron regulatory hormone hepcidin in HuH7 human hepatoma cells. J Nutr 2007;137:2366-2370.

19. Suarez-Ortegon MF, Arbelaez A, Mosquera M, Mendez F, de Plata CA. Body iron stores as predictors of insulin resistance in apparently healthy urban Colombian men. Biol Trace Elem Res 2012;145:283-285.

5. Przybyszewska J, Zekanowska E, Kedziora-Kornatowska K, Boinska J, Cichon R, Porzych K. Prohepcidin and iron metabolism parameters in the obese elderly patients with anemia. J Nutr Health Aging 2011;15:259-264.

20. Senghor A, Bharathya N, Kumar JS, William E, Balasubramaniam. Serum ferritin, iron, TIBC, Hb in male patients with dysglycemia. Int J Biol Med Res 2012;3:16091611.

AltunoÄ&#x;lu E, et al: Anemia and Iron Parameters in Obesity

21. Dandona P, Hussain MA, Varghese Z, Politis D, Flynn DM, Hoffbrand AV. Insulin resistance and iron overload. Ann Clin Biochem 1983;20:77-79. 22. Ferrannini E. Insulin resistance, iron, and the liver. Lancet 2000;355:2181-2282. 23. Wilson JG, Lindquist JH, Grambow SC, Crook ED, Maher JF. Potential role of increased iron stores in diabetes. Am J Med Sci 2003;325:332-339. 24. Kang HT, Linton JA, Shim JY. Serum ferritin level is associated with the prevalence of metabolic syndrome in Korean adults: The 2007-2008 Korean National Health and Nutrition Examination Survey. Clin Chim Acta 2012;413:636-641.

Turk J Hematol 2014;31:61-67

29. Lee JY, Park JM, Hong JA, Lee DC, Im JA, Lee JW. Serum ferritin is differentially associated with anti-oxidative status and insulin resistance in healthy obese and non-obese women. Korean J Fam Med 2012;33:205-210. 30. Zeyda M, Stulnig TM. Obesity, inflammation and insulin resistance-a mini-review. Gerontology 2009;55:379-386. 31. Tussing-Humphreys LM, Nemeth E, Fantuzzi G, Freels S, Holterman AX, Galvani C, Ayloo S, Vitello J, Braunschweig C. Decreased serum hepcidin and improved functional iron status 6 months after restrictive bariatric surgery. Obesity 2010;18:2010-2016. 32. Roy CN. Anemia of inflammation. Hematology Am Soc Hematol Educ Program 2010;2010:276-280.

25. Fargion S, Dongiovanni P, Guzzo A, Colombo S, Valanti L, Fracanzani L. Iron and insulin resistance. Aliment Pharmacol Ther 2005;22(Suppl. 2):61-63.

33. Escobar-Morreale HF. Iron metabolism and the polycystic ovary syndrome. Trends Endocrinol Metab 2012;23:509515.

26. Ford ES, Cogswell ME. Diabetes and serum ferritin concentration among U.S. adults. Diabetes Care 1999;22:1978-1983.

34. Hintze KJ, Snow D, Nabor D, Timbimboo H. Adipocyte hypoxia increases hepatocyte hepcidin expression. Biol Trace Elem Res 2011;143:764-771.

27. Martinez-Garcia MA, Luque-Ramirez M, San-Millan JL, Escobar-Morreale HF. Body iron stores and glucose intolerance in premenopausal women: role of hyperandrogenism, insulin resistance, and genomic variants related to inflammation, oxidative stress, and iron metabolism. Diabetes Care 2009;32:1525-1530.

35. Aeberli I, Hurrell RF, Zimmermann MB. Overweight children have higher circulating hepcidin concentrations and lower iron status but have dietary iron intakes and bioavailability comparable with normal weight children. Int J Obes 2009;33:1111-1117.

28. Zafon C, Lecube A, Simo R. Iron in obesity. An ancient micronutrient for a modern disease. Obes Rev 2010;11:322328.

Research Article

DOI: 10.4274/Tjh.2012.0013

The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity: Experimental Study Doksorubisine Bağlı Kardiyotoksisitede Nitrik Oksitin Rolü: Deneysel Çalışma Ayşenur Bahadır1, Nilgün Kurucu2, Mine Kadıoğlu3, Engin Yenilmez4 1Karadeniz Technical University, School of Medicine, Department of Pediatric Hematology, Trabzon, Turkey 2Ankara Oncology Hospital, Department of Pediatric Oncology, Ankara, Turkey 3Karadeniz Technical University, School of Medicine, Department of Pharmacology, Trabzon, Turkey 4Karadeniz Technical University, School of Medicine, Department of Histology, Trabzon, Turkey

Abstract: Objective: We evaluated the myocardial damage in rats treated with doxorubicin (DOX) alone and in combination with nitric oxide synthase (NOS) inhibitors. Materials and Methods: Twenty-four male Sprague Dawley rats (12 weeks old, weighing 262±18 g) were randomly assigned into 4 groups (n=6). Group I was the control group. In Group II, rats were treated with intraperitoneal (ip) injections of 3 mg/kg DOX once a week for 5 weeks. In Group III, rats received weekly ip injections of 30 mg/kg L-NAME (nonspecific NOS inhibitor) 30 min before DOX injections for 5 weeks. In Group IV, rats received weekly ip injections of 3 mg/kg L-NIL (inducible NOS inhibitor) 30 min before DOX injections for 5 weeks. Rats were weighed 2 times a week. At the end of 6 weeks, hearts were excised and then fixed for light and electron microscopy evaluation and tissue lipid peroxidation (malondialdehyde). Blood samples were also obtained for measuring plasma lipid peroxidation.

Results: Weight loss was observed in Group II, Group III, and Group IV. Weight loss was statistically significant in the DOX group. Findings of myocardial damage were significantly higher in animals treated with DOX only than in the control group. Histopathological findings of cardiotoxicity in rats treated with DOX in combination with L-NAME and L-NIL were not significantly different compared with the control group. The level of plasma malondialdehyde in the DOX group (9.3±3.4 µmol/L) was higher than those of all other groups.

Conclusion: Our results showed that DOX cardiotoxicity was significantly decreased when DOX was given with NO synthase inhibitors.

Key Words: Doxorubicin, Nitric oxide, Nitric oxide synthase inhibitors Özet: Amaç: Bu çalışmada sıçanlarda doksorubisinin (DOX) tek başına ve nitrik oksit sentaz (NOS) inhibitörleri ile birlikte kullanımının kalp kası üzerinde yarattığı hasar araştırıldı.

Address for Correspondence: Ayşenur Bahadır, M.D., Karadeniz Technical University School of Medicine, Department of Pediatric Hematology, Trabzon Turkey Phone: +90 462 377 57 76 E-mail: aysenurkbr@yahoo.com Received/Geliş tarihi : January 23, 2012 Accepted/Kabul tarihi : April 8, 2013

Bahadır A, et al: The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity

Turk J Hematol 2014;31:68-74

Gereç ve Yöntemler: Çalışmada 12 haftalık 24 adet erkek “Sprague Dawley” sıçanı (ortalama ağırlık 262±18 gr) rastgele dört gruba (n=6) dağıtıldı. Grup I kontrol grubu olarak ayırıldı. Grup II’ye haftada bir kez intraperitoneal (ip) 3 mg/kg, beş hafta DOX uygulandı. Grup III’e DOX enjeksiyonundan 30 dakika önce ip 30 mg/kg L-NAME (nonselektif NOS inhibitörü) 5 hafta uygulandı. Grup IV’e DOX enjeksiyonundan 30 dakika önce ip 3 mg/kg L-NIL (indüklenebilir NOS inhibitörü) 5 hafta uygulandı. Çalışma süresince sıçanlar haftada iki kez tartıldı. Altıncı haftada kalbin sol ventrikülünden alınan parçalardan elektron ve ışık mikroskobik inceleme ve lipit peroksidasyonu tayini (malondialdehid) yapıldı. Plazma lipit peroksidasyonunun belirlenmesi amacı ile sıçanlardan kan alındı. Bulgular: Grup II, Grup III ve Grup IV’te kilo kaybı gözlendi. DOX uygulanan grupta istatistiksel olarak anlamlı kilo kaybı saptandı. Miyokard hasarı bulguları tek başına DOX alan hayvanlarda kontrol grubuna oranla daha yüksek oranda izlendi. DOX’le beraber L-NAME ve L-NIL verilen sıçanlarda kardiyotoksitenin histopatolojik bulguları kontrol grubundan farklı değildi. Plazma malondialdehid düzeyi DOX grubunda (9,3± 3,4), diğer tüm gruplara göre daha yüksek olarak ölçüldü.

Sonuç: Bizim çalışmamızda DOX’la beraber NOS inhibitörleri uygulandığında DOX’a bağlı kardiyak toksisite bulgularında anlamlı azalma olduğu gösterilmiştir.

Anahtar Sözcükler: Doksorubisin, nitrik oksit, nitrik oksit sentaz inhibitörleri

Introduction

Materials and Methods

Doxorubicin (DOX) is an anthracycline-group antibiotic that is commonly used in the treatment of childhood tumors, and 60% of the treatment protocols include anthracyclinegroup agents. The most significant side effect of these drugs cardiotoxicity [1,2]. Today, long-term side effects such as cardiac toxicity are more frequently observed due to the increased rates of survival in childhood cancers.

Twenty-four 12-week-old male Sprague Dawley rats were used in the study. The animals were housed in cages with free access to food and water. The cages were placed in a quiet and temperature- and humidity-controlled room (22±2 °C and 60±5%, respectively) in which a 12:12-h lightdark cycle was maintained. The weight of the rats varied between 240 and 320 g (mean: 262±18 g). During the trial, the rats were evaluated for their health status twice daily and any changes in their activity were recorded. The rats were also weighed twice weekly. Experiments were conducted between 09:00 and 17:00 hours to minimize diurnal variation. The experimental protocol was approved by the Institutional Animal Ethics Committee of the Karadeniz Technical University Medical School. Animals were allowed a 1-week acclimatization period before being used in experiments.

Cardiotoxicity secondary to anthracyclines is dependent on the cumulative dose. The patients may consequently experience irreversible chronic cardiomyopathy and congestive cardiac failure [1,3]. Several trials have been performed on the mechanism of DOX-associated cardiotoxicity. Currently the most widely accepted opinion is the injury of myocardial cells by free radicals occurring during DOX metabolism [1,4,5]. Trials have demonstrated that the risk of cardiotoxicity could be decreased by using free radical scavengers [6,7,8]. Nitric oxide (NO) is a potent vasodilator and a significant mediator in myocardial contraction, and it is shown to be involved in the pathogenesis of cardiac diseases such as cardiac failure, ischemia/perfusion injury, and cardiomyopathy [9]. Recent trials have demonstrated that NO is involved in the cardiotoxicity associated with DOX. It was shown that DOX increased NO synthesis in plasma and cardiac tissue [10,11]. NO increase is believed to be mediated by inducible NO synthase (iNOS) and endothelial NO synthase (eNOS) enzymes [12,13]. This trial was designed to investigate the role of NO in the cardiotoxicity induced by DOX in rats. For this purpose, the extend of the myocardial injury in the rat heart and the level of lipid peroxide products were assessed.

The cardiac toxicity results obtained by the use of DOX alone (Carlo Erba, Turkey) and in combination with NOS inhibitors were evaluated. Among the NOS inhibitors, NG-nitro-L-arginine methyl ester (L-NAME, Sigma), a nonselective inhibitor, and N6-(1-iminoethyl)-L- lysine (L-NIL, Sigma), an inducible NO inhibitor, were used. The rats were randomized into 4 groups, each consisting of 6 rats. Group I: Control group. The rats in this group received saline injection at a dose of 10 mL/kg via intraperitoneal route once a week for 5 weeks. Group II: DOX group. In this group, the rats received DOX injection at a dose of 3 mL/kg via intraperitoneal route once a week for 5 weeks (total cumulative dose: 15 mg/kg). Group III: DOX + L-NAME group. Differently from the rats in the second experimental group, the rats in this group 69

Turk J Hematol 2014;31:68-74

were also injected with L-NAME at a dose of 30 mg/kg via intraperitoneal route for 5 weeks 30 min before the injection of DOX once a week. Group IV: DOX + L-NIL group. Differently from the rats in the second experimental group, the rats in this group were also injected with L-NIL at a dose of 3 mg/kg via intraperitoneal route for 5 weeks 30 min before the injection of DOX once a week. Surgical Excision of the Heart The animals were observed for 1 week after the last injection and the heart was surgically excised at the end of 6 weeks in the pharmacology department. Blood samples were drawn from the renal artery for determining the plasma lipid peroxidation products. The left ventricle of the excised heart was divided into 3 pieces and placed in the appropriate solutions for electron microscopic investigation, light microscopic examination, and lipid peroxidation assay. Light Microscopy and Electron Microscopy Study A portion of the excised left ventricle was placed in 10% formalin for light microscopy examination and another portion was placed in 2% glutaraldehyde fixative for electron microscopy examination. The preparations were examined and evaluated by a single histologist blind to the study using an Olympus BH2 light microscope and JEOL 1010 electron microscope, and pictures were subsequently taken. The findings related to myocardial injury occurring secondarily to the toxic effect of DOX, including edema in the myocytes and interstitium, edema in the sarcoplasmic reticulum, vacuolization in the myocytes, loss of myofibrils, and injury of mitochondria (edema, atrophy, crista clustering, and loss of crista), were evaluated by using light and electron microscopy; the results were recorded either as absence (-) or presence (+) of injury. Lipid Peroxide Assay For an indirect evaluation of the free radicals produced in each of the experimental groups, the experimental groups, lipid peroxidation products were measured in the rat heart and plasma. The level of malondialdehyde (MDA), a thiobarbiturate reagent, was determined via measurement in the biochemistry department. Statistical Method The statistical analyses were performed using SPSS for Windows. SPSS 13 (Statistical Package for Social Screnu) for Windows©” The results were expressed in terms of means±standard deviations and percentages. The toxicity results detected by electron microscopy and light microscopy in the DOX, DOX + L-NAME, and DOX + L-NIL groups were compared to the results from the control group. The DOX + L-NAME and DOX + L-NIL groups were also compared to each other. The comparison of the numeric data (means) within the same group and for different groups was done using the Wilcoxon test followed by the Mann-Whitney U test for post-hoc analysis, while the nominal data (ratios) were compared using the Fisher test. Values of p≤0.05 were considered statistically significant. 70

Bahadır A, et al: The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity

Results During the 6-week monitoring period of the rats, 1 rat in the DOX + L-NIL group died after 2 weeks. The autopsy did not reveal the cause of death. During the monitoring period, the rats receiving DOX showed a marked reduction in their activity relative to the control group, while the rats in the DOX + L-NAME and DOX + L-NIL groups had better activity compared to the rats receiving only DOX. The rats did not exhibit any changes in health status except for the reduced activity. The comparison of the weights revealed a 12% increase in rat weight from baseline to the end of the study in the control group (p=0.02), while the rats in Group II, Group III, and Group IV exhibited respective reductions in weight of 12%, 7%, and 6%. The highest weight reduction was detected in the group receiving DOX alone; there was a statistically significant difference between the initial and final weighing (p=0.02). The rates of weight loss were similar between Group III and Group IV and no statistically significant difference was detected between the initial and final weights of the rats in these groups (p=0.20 and p=0.78, respectively). The myocardial toxicities occurring with the use of DOX alone and in combination with the NOS inhibitors were assessed histopathologically by light and electron microscopy. Photos obtained in relation to the electron microscopic examination are presented in Figures 1, 2, 3, 4. While no findings of myocardial toxicity were detected in the rats in the control group, all the rats in Group II had at least one myocardial injury finding histopathologically. In 50% of the Group II rats, myocyte edema, vacuolization in myocytes, and loss of myofibrils were detected, while 83% had interstitial edema. Mitochondrial injury was detected in all rats. In Group III and Group IV, myocardial toxicity was detected at a lower rate. None of the rats in Group III were detected to have myocyte edema, interstitial edema,

Figure 1. Group I=control; normal histopathological morphology, no findings of myocardial toxicity.

Turk J Hematol 2014;31:68-74

Bahadır A, et al: The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity

vacuolization in the myocytes, or loss of fibrils, while 66% of the rats were observed to have sarcoplasmic reticulum edema and mitochondrial injury. As for Group IV, 80% of the rats did not have interstitial edema, sarcoplasmic reticulum edema, or vacuolization in the myocytes; 40% had myocyte edema and mitochondrial injury. There was no loss of fibrils (Table 1).

Figure 2. Group II =DOX; arrow shows the myocyte edema, ‘a’ shows mitochondrial injury, and ‘b’ shows sarcoplasmic reticulum edema. There is also loss of myofibrils.

The comparison of the histopathological cardiac toxicity findings (Table 2) revealed significantly increased rates of interstitial edema, sarcoplasmic reticulum edema, myocyte vacuolization, and mitochondrial injury in the group receiving DOX alone compared to the control group. There was no difference in the comparison of the myocyte edema and loss of myofibrils. In the group receiving L-NAME in combination with DOX, only the presence of sarcoplasmic reticulum edema was statistically significantly higher compared to the control group. There was no statistically significant difference in the toxicity findings of the group receiving L-NIL in combination with DOX when compared to the control group. With respect to the histopathological toxicity findings, the group receiving DOX alone had more marked findings; however, the difference from between the groups receiving L-NAME and L-NIL with DOX was not statistically significant. Binary comparison of the DOX + L-NAME and DOX + L-NIL groups revealed no statistically significant difference in the toxicity findings.

Figure 3. Group III=DOX + L-NAME; there is less mitochondrial injury.

Upon comparison of the tissue and plasma MDA levels measured for demonstrating lipid peroxidation, the mean plasma MDA level (9.3±3.4 µmol/L) was detected to be higher in the DOX group compared to the other groups; the difference was statistically significant compared to the control group and the DOX + L-NAME group (p=0.03 for both). However, there was no marked difference between the groups with regard to the MDA values obtained from tissue. This was attributed to the difficulty of preparing homogenate from the cardiac tissue and the technical difficulty of the MDA assay. Discussion Several trials have been performed to determine the mechanisms involved in DOX-associated toxicity. The most widely accepted mechanism is the myocardial injury secondary to free radical formation. Anthracyclines were detected to increase the superoxide anion and hydrogen peroxide formation in the heart sarcosome, mitochondria, and cytoplasm depending on the drug concentration [1,5,6].

Figure 4. Group IV=DOX + L-NIL; less myocyte edema is observed.

NO as the major regulator of the vascular tonus is significantly involved in cardiac functions and diseases. Cardiac NO production is mediated by the eNOS and iNOS enzymes [14,15,16]. While the basal NO production regulates the cardiomyocyte contractility and the blood flow, the excessively produced NO is involved in cardiac pathologies such as dilated cardiomyopathy and congestive cardiac failure [9,17,18,19]. Recent trials reported that NO was involved in the cardiotoxicity of DOX [10,11,13,20,21]. 71

Turk J Hematol 2014;31:68-74

Bahad覺r A, et al: The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity

Table 1. Histopathological evaluation of myocardial toxicity findings.

Histopathological findings

Group I* + (n) - (n)

Group II* + (n) - (n)

Group III* + (n) - (n)

Group IV* + (n) - (n)

Myocyte edema

Interstitial edema

Sarcoplasmic reticulum edema

Vacuolization in the myocytes

Loss of myofibrils

Mitochondrial injury

* Group I =Control, Group II =DOX, Group III =DOX + L-NAME, Group IV =DOX + L-NIL; n =number of rats. All groups contained 6 rats, except Group IV, which had 5 rats.

Table 2. The comparison of the histopathological cardiac toxicity findings in the control group and drug groups.

Histopathological findings

p value Group I vs. II

Group Group I vs. III I vs. IV

Myocyte edema

>0.05

Interstitial edema

0.02

>0.05

Sarcoplasmic reticulum edema

0.002

0.02

>0.05

Vacuolization in the myocytes

0.02

>0.05

Loss of myofibrils

>0.05

Mitochondrial injury

0.002

>0.05

*Group I =Control, Group II =DOX, Group III =DOX + L-NAME, Group IV =DOX + L-NIL.

This trial was designed to investigate the role of NO in the DOX-associated cardiac toxicity. A higher rate of weight loss was detected in the rats receiving DOX alone in comparison to the rats receiving additional L-NIL and L-NAME. In addition, marked reduction in activity was detected. The literature data included reduced activity, weight loss, and acid formation as the clinical findings for DOXassociated toxicity. Guerra et al. reported that those with cardiomyopathy findings among rats that were administered a cumulative DOX dose of 13.5 mg/kg had significantly lower weight gain relative to the control group [11]. In the trial by Hirano et al., the rats receiving intravenous DOX weekly at a dose of 1.25 mg/kg (total dose: 5 mg/kg) and 2.5 mg/kg for 4 weeks (total dose: 10 mg/kg) exhibited reduction in weight in line with the cardiomyopathy findings; this was particularly marked in the group receiving the dose of 2.5 mg/kg/week [22]. The histopathological findings obtained in the cardiotoxicity models in empirical studies established by administering an intravenous or intraperitoneal dose of 1.572

3 mg/kg/week for 5 to 9 weeks (at cumulative doses of 1020 mg/kg) were similar to findings in humans. The light and electron microscopy examination of rat heart resulted in reports of cytoplasmic vacuolization, myofibril loss, sarcoplasmic edema, and mitochondrial injury [4,23]. In our study, the histopathological investigation of the rat heart revealed marked findings of cardiac injury in the group receiving DOX. In particular, the interstitial edema (p=0.02), sarcoplasmic reticulum edema (p=0.002), vacuolization in the myocytes (p=0.02), and mitochondrial injury (p=0.002) were statistically significant compared to the control group. While toxicity findings were also detected in the groups receiving DOX + L-NAME and DOX + L-NIL, there was no statistically significant difference compared to the control group. One of the first trials reported in the literature to investigate the contribution of NO to DOX-associated cardiac injury was performed by Guerra et al. Rats were administered 1.5 mg/kg of DOX for 9 weeks (total dose: 13.5 mg/kg) and the plasma NO levels were measured. The histopathological investigation of the rat hearts revealed findings of cardiac injury, and the plasma NO level was markedly higher compared to the control group. This study detected a positive correlation between the cardiomyopathy score and the NO level [11]. Sayed-Ahmed et al. measured the cardiac NO level after administering a single high dose (20 mg/kg) and gradually increasing daily doses of DOX (525 mg/kg) in rats. They reported that the cardiac NO levels were increased in cardiotoxicity induced with DOX at single and increasing doses. However, they were unable to detect any increase in the NO level and suggested that NO increase secondary to DOX was specific to the tissue [10]. In a trial where the culture of the rat cardiac cell was incubated with DOX for 24 h, DOX was reported to cause marked increase in NOS activity in the cells and the amount of NO in the supernatant, and this increase was inhibited by the addition of iron. This study concluded that DOX increased NO synthesis in the cardiomyocytes by affecting iron hemostasis [12]. However, we could not directly measure cardiac or plasma NO level due to lack of related laboratory systems.

Turk J Hematol 2014;31:68-74

Bahadır A, et al: The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity

The cardiac NO increase secondary to DOX was found to be mediated by iNOS. Aldieri et al. showed that the increase in the NO amount following treatment of the cardiac cells with DOX was associated with the increase in the iNOS gene expression [12]. Pacher et al. demonstrated that following DOX administration in mice with iNOS gene deletion, cardiac functions were better conserved [24]. The trial by Weinstein et al. demonstrated immunohistochemically that the myocardial iNOS was increased upon DOX administration [25]. Cardiac iNOS induction was shown to increase the myocardial injury secondary to oxidative stress by leading to the inactivation of the glutathione peroxidase, an intrinsic antioxidant [26]. After the contribution of myocardial NO formation to DOX cardiotoxicity was shown, the mechanism through which NO causes myocardial injury has been started to be investigated. The relevant trials have indicated that NO contributed to the peroxynitrite formation together with the superoxide formed by DOX. DOX toxicity is related to free radical formation. Oxygen and hydroxyl free radicals are produced via the DOX redox cycle catalyzed by flavor enzymes such as NADPH, cytochrome P450 reductase, and mitochondrial NADH dehydrogenase. These enzymes contribute to cardiomyopathy development secondary to DOX. NO is structurally similar to P450 reductase and was suggested to be involved in DOX metabolism [13,14,27]. All 3 isoforms of NOS have the capacity to catalyze the DOX redox cycle in the tumor tissue and form free radicals. DOX binds to the reductase domain of e-NOS and is reduced to the semiquinone form. Semiquinone causes formation of superoxide by reacting with the oxygen at a radical rate. All NOS isoforms form superoxide by reducing DOX under hypoxic conditions [13,14]. The high amount of NO produced by the iNOS enzyme causes formation of peroxynitrite by reacting with the superoxide anion. The resulting peroxynitrite oxides the cellular structures and contributes to myocardial oxidative injury, apoptosis, and necrosis by leading to lipid peroxidation [14,26,28,29]. Various studies demonstrated that NOS inhibitors prevented DOX cardiotoxicity. Administration of aminoguanidine, an iNOS inhibitor, with DOX to rats reduced the DOX mortality and acid formation and enhanced the histopathological changes in the rat heart [30]. Similarly, a trial by Pacher et al., performed on mice that were administered DOX in combination with aminoguanidine, showed a reduction in the cardiac dysfunction and mortality induced by DOX and improvement of the histopathological changes in the cardiac tissue [24]. Barnabe et al. added NOS inhibitors L-NAME and NG-monomethyl-L-arginine (L-NMMA) to medium before incubation with DOX in their study on cell cultures obtained from neonatal rat cardiac myocytes. They reported that pre-treatment administration of L-NAME and L-NMMA could prevent the myocyte injury associated with DOX [31]. In our study, we also observed reduction in the histopathological toxicity findings associated with DOX by L-NIL, a specific-selective iNOS inhibitor, and L-NAME, a nonspecific NOS inhibitor.

Packer et al. showed that MDA increased in the cardiac tissue as the lipid peroxidation product in mice that were administered DOX and were detected to have impairment in the left ventricle function; FP15, a peroxynitrite decomposition catalyst, prevented this increase [24]. In their trials, Fadılloğlu et al. administered an antioxidant, erdosteine, as a protective agent together with DOX, and they observed a marked increase in lipid peroxidation in the plasma and platelets in the group receiving DOX alone. Administration of erdosteine with DOX was shown to prevent intracellular and extracellular lipid peroxidation, thus exhibiting a protective effect. In addition, erdosteine was considered to inhibit the iNOS enzyme, thereby preventing NO production and thus peroxidation formation [32,33]. In our study, we also observed significantly increased MDA levels (a lipid peroxidation product) in rats receiving DOX relative to the control group. The L-NAME and L-NIL groups had a statistically significantly decreased MDA level compared to the DOX group. This represents a finding supporting the hypothesis that prevention of NO synthesis is protective against DOX cardiotoxicity. Conclusion The assessment of both our results and the literature data suggest that NO, and especially that produced by iNOS, was involved in cardiac toxicity by leading to lipid peroxidation via peroxynitrite formation. An attempt to prevent NO production via inhibition of iNOS may be a solution for cardiac toxicity due to DOX in humans. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Minotti G, Menna P, Salvatorelli E, Cairo G, Gianni L. Anthracyclines: molecular advances and pharmacologic developments in antitumor activity and cardiotoxicity. Pharmocol Rev 2004;56:185-229. 2. Paulides M, Kremers A, Stöhr W, Bielack S, Jürgens H, Treuner J, Beck JD, Langer T; German Late Effects Working Group in the Society of Pediatric Oncology and Haematology (GPOH). Prospective longitudinal evaluation of doxorubicin-induced cardiomyopathy in sarcoma patients: a report of the late effects surveillance system (LESS). Pediatr Blood Cancer 2006;46:489-495. 3. Kremer LC, van Dalen EC, Offringa M, Ottenkamp J, Voûte PA. Anthracycline-induced clinical heart failure in a cohort of 607 children: long-term follow-up study. J Clin Oncol 2001;19:191-196. 4. Doroshow JH. Effect of anthracycline antibiotics on oxygen radical formation in rat heart. Cancer Res 1983;43:460-472. 5. Keizer HG, Pinedo HM, Schuurhuis GJ, Joenje H. Doxorubicin (adriamycin): a critical review of free radical-dependent mechanisms of cytotoxicity. Pharmacol Ther 1990;47:219-231. 73

Turk J Hematol 2014;31:68-74

6. Iarussi D, Indolfi P, Casale F, Coppolino P, Tedesco MA, Di Tullio MT. Recent advances in the prevention of anthracycline cardiotoxicity in childhood. Curr Med Chem 2001;8:16491660. 7. Morishima I, Matsui H, Mukawa H, Hayashi K, Toki Y, Okumura K, Ito T, Hayakawa T. Melatonin, a pineal hormone with antioxidant property, protects against adriamycin cardiomyopathy in rats. Life Sci 1998;63:511-521. 8. Villani F, Galimberti M, Monti E, Piccinini F, Lanza E, Rozza A, Favalli L, Poggi P, Zunino F. Effect of glutathione and N-acetylcysteine on in vitro and in vivo cardiac toxicity of doxorubicin. Free Radic Res Commun 1990;11:145-151. 9. Vallance P, Hingorani A. Endothelial nitric oxide in humans in health and disease. Int J Exp Pathol 1999;80:291-303. 10. Sayed-Ahmed MM, Khattab MM, Gad MZ, Osman AM. Increased plasma endothelin-1 and cardiac nitric oxide during doxorubicin-induced cardiomyopathy. Pharmacol Toxicol 2001;89:140-144. 11. Guerra J, De Jesus A, Santiago-Borrero P, Roman-Franco A, Rodríguez E, Crespo MJ. Plasma nitric oxide levels used as an indicator of doxorubicin-induced cardiotoxicity in rats. Hematol J 2005;5:584-588. 12. Aldieri E, Bergandi L, Riganti C, Costamagna C, Bosia A, Ghigo D. Doxorubicin induces an increase of nitric oxide synthesis in rat cardiac cells that is inhibited by iron supplementation. Toxicol Appl Pharmacol 2002;85:85-90. 13. Vásquez-Vivar J, Martasek P, Hogg N, Masters BS, Pritchard KA Jr, Kalyanaraman B. Endothelial nitric oxide synthasedependent superoxide generation from adriamycin. Biochemistry 1997;36:11293-11297. 14. Garner AP, Paine MJ, Rodriguez-Crespo I, Chinje EC, Ortiz De Montellano P, Stratford IJ, Tew DG, Wolf CR. Nitric oxide synthases catalyze the activation of redox cycling and bioreductive anticancer agents. Cancer Res 1999;59:19291934. 15. Habib FM, Springall DR, Davies GJ, Oakley CM, Yacoub MH, Polak JM. Tumour necrosis factor and inducible nitric oxide synthase in dilated cardiomyopathy. Lancet 1996;347:11511155. 16. Balligand JL, Cannon PJ. Nitric oxide synthases and cardiac muscle. Autocrine and paracrine influences. Arterioscler Thromb Vasc Biol 1997;17:1846-1858. 17. Moncada S. Nitric oxide: discovery and impact on clinical medicine. J R Soc Med 1999;92:164-169. 18. Palmer RM, Ferrige AG, Moncada S. Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor. Nature 1987;327:524-526. 19. Kröncke KD, Fehsel K, Kolb-Bachofen V. Inducible nitric oxide synthase in human diseasesc. Clin Exp Immunol 1998;113:147-156. 20. Kalivendi SV, Kotamraju S, Zhao H, Joseph J, Kalyanaraman B. Doxorubicin-induced apoptosis is associated with increased transcription of endothelial nitric-oxide synthase. Effect of antiapoptotic antioxidants and calcium. J Biol Chem 2001;276:47266-47276.

Bahadır A, et al: The Role of Nitric Oxide in Doxorubicin-Induced Cardiotoxicity

21. Deng S, Kruger A, Schmidt A, Metzger A, Yan T, GödtelArmbrust U, Hasenfuss G, Brunner F, Wojnowski L. Differential roles of nitric oxide synthase isozymes in cardiotoxicity and mortality following chronic doxorubicin treatment in mice. Naunyn Schmiedebergs Arch Pharmacol 2009;380:25-34. 22. Hirano S, Wakazono K, Agata N, Iguchi H, Tone H. Comparison of cardiotoxicity of pirarubicin, epirubicin and doxorubicin in the rat. Drugs Exp Clin Res 1994;20:153-160. 23. Zhou S, Starkov A, Froberg MK, Leino RL, Wallace KB. Cumulative and irreversible cardiac mitochondrial dysfunction induced by doxorubicin. Cancer Res 2001;61:771-777. 24. Pacher P, Liaudet L, Bai P, Mabley JG, Kaminski PM, Virág L, Deb A, Szabó E, Ungvári Z, Wolin MS, Groves JT, Szabó C. Potent metalloporphyrin peroxynitrite decomposition catalyst protects against the development of doxorubicin-induced cardiac dysfunction. Circulation 2003;107:896-910. 25. Weinstein DM, Mihm MJ, Bauer JA. Cardiac peroxynitrite formation and left ventricular dysfunction following doxorubicin treatment in mice. J Pharmacol Exp Ther 2000;294:396-401. 26. Igarashi J, Nishida M, Hoshida S, Yamashita N, Kosaka H, Hori M, Kuzuya T, Tada M. Inducible nitric oxide synthase augments injury elicited by oxidative stress in rat cardiac myocytes. Am J Physiol 1998;274:245-252. 27. Drummond GR, Cai H, Davis ME, Ramasamy S, Harrison DG. Transcriptional and posttranscriptional regulation of endothelial nitric oxide synthase expression by hydrogen peroxide. Circ Res 2000;86:347-354. 28. Radi R, Beckman JS, Bush KM, Freeman BA. Peroxynitrite oxidation of sulfhydryls. The cytotoxic potential of superoxide and nitric oxide. J Biol Chem 1991;266:4244-4250. 29. Adams V, Jiang H, Yu J, Möbius-Winkler S, Fiehn E, Linke A, Weigl C, Schuler G, Hambrecht R. Apoptosis in skeletal myocytes of patients with chronic heart failure is associated with exercise intolerance. J Am Coll Cardiol 1999;33:959965. 30. Mostafa AM, Nagi MN, Al Rikabi AC, Al-Shabanah OA, El-Kashef HA. Protective effect of aminoguanidine against cardiovascular toxicity of chronic doxorubicin treatment in rats. Res Commun Mol Pathol Pharmocol 1999;106:193202. 31. Barnabé N, Marusak RA, Hasinoff BB. Prevention of doxorubicin-induced damage to rat heart myocytes by arginine analog nitric oxide synthase inhibitors and their enantiomers. Nitric Oxide 2003;9:211-216. 32. Fadillioglu E, Erdoğan H. Effects of erdosteine treatment against doxorubicin-induced toxicity through erythrocyte and plasma oxidant/antioxidant status in rats. Pharmocol Res 2003;47:317-322. 33. Fadillioglu E, Yilmaz HR, Erdogan H, Sogut S. The activities of tissue xanthine oxidase and adenosine deaminase and the levels of hydroxyproline and nitric oxide in rat hearts subjected to doxorubicin: protective effect of erdosteine. Toxicology 2003;191:153-158.

Case Report

DOI: 10.4274/Tjh.2012.0028

Central Nervous System Involvement of T-cell Prolymphocytic Leukemia Diagnosed with Stereotactic Brain Biopsy: Case Report Stereotaktik Beyin Biyopsisi ile Tanı Koyulan T-hücreli Prolenfositik Löseminin Santral Sinir Sistemi Tutulumu: Olgu Sunumu Selçuk Göçmen1, Murat Kutlay2, Alev Erikçi3, Cem Atabey1, Özkan Sayan3, Aptullah Haholu4 1Gülhane Military Medical Academy, Haydarpaşa Training Hospital, Department of Neurosurgery, İstanbul, Turkey 2Gülhane Military Medical Academy, Department of Neurosurgery, Ankara, Turkey 3Gülhane Military Medical Academy, Haydarpaşa Training Hospital, Department of Hematology, İstanbul, Turkey 4Gülhane Military Medical Academy, Haydarpaşa Training Hospital, Department of Pathology, İstanbul, Turkey

Abstract: Prolymphocytic leukemia (PLL) is a generalized malignancy of the lymphoid tissue characterized by the accumulation of monoclonal lymphocytes, usually of B cell type. Involvement of the central nervous system (CNS) is an extremely rare complication of T-cell prolymphocytic leukemia (T-PLL). We describe a case of T-PLL presenting with symptomatic infiltration of the brain that was histopathologically proven by stereotactic brain biopsy. We emphasize the importance of rapid diagnosis and immediate treatment for patients presenting with CNS involvement and a history of leukemia or lymphoma. Key Words: T-cell prolymphocytic leukemia, Cerebral involvement, Central nervous system, Stereotactic biopsy Özet: Prolenfositik lösemi (PLL), genellikle B hücre tipi monoklonal lenfositlerin birikimi ile karakterize lenfoid dokunun genel malign bir hastalığıdır. Santral sinir sistemi (SSS) tutulumu T-hücreli Prolenfositik löseminin (T-PLL) çok nadir görülen bir komplikasyonudur. Biz, beyinin semptomatik infiltrasyonu ile ortaya çıkan, stereotaktik beyin biopsisi ile tanı koyulmuş T-PLL’li bir olgu sunuyoruz. Geçmişte lösemi veya lenfoma nedeni ile tedavi edilmiş ve SSS tutulumu ile başvuran hastalar için, hızlı tanı ve acil tedavinin önemini açıkladık. Anahtar Kelimeler: T-hücreli prolenfositik lösemi, Serebral tutulum, Santral sinir sistemi, Stereotaktik biyopsi

Address for Correspondence: Selçuk Göçmen, M.D., Gülhane Military Medical Academy, Haydarpaşa Training Hospital, Department of Neurosurgery, İstanbul, Turkey Phone: +90 216 542 28 15 E-mail: s_gocmen@yahoo.com Received/Geliş tarihi : February 17, 2012 Accepted/Kabul tarihi : November 06, 2012

Göçmen S, et al: T-PLL Presenting with CNS Involvement

Turk J Hematol 2014;31:75-78

Introduction Symptomatic central nervous system involvement (CNS) is a rare complication in T-cell prolymphocytic leukemia (T-PLL), although it is common in acute leukemia and non-Hodgkin’s lymphoma [1,2,3,4,5]. We report a case of T-PLL with symptomatic infiltration of the brain that was histopathologically proven with stereotactic brain biopsy. Case Report A 56-year-old man was admitted due to recent onset of severe headache. He was also noted to have multiple lymphadenopathy and hepatosplenomegaly. He had a history of T-PLL diagnosed 2 years ago. Bone marrow aspiration was a dry tap. Imprint was hypercellular and consisted of medium-sized prolymphocytes with single nuclei and basophilic cytoplasm with occasional blebs or projections. Laboratory data revealed leukocytosis (53x109/mm3) with normal values for hemoglobin (13.8 g/dL) and platelets (263x106/mm3). Differential blood count revealed 73% lymphocytes, 25% neutrophils, and 2% monocytes. In the flow cytometric examination of bone marrow, 80% of the lymphocytes were T-cells with co-expression of CD5, CD3, and CD52, as well as weak expression of CD7. No CD4, CD8, or other B cell markers were detected. β2-Microglobulin was elevated up to 2519 mg/L (normal:1310 mg/L). Direct Coombs test was negative and serum immunoglobulins were within normal limits. T lymphocytes were considered as leukemic infiltration. Lymphocytes demonstrated normal morphology. Surface marker analysis showed typical features of T-cell chronic lymphocytic leukemia (CLL) (83% of the cells CD3/CD5-positive). Biochemical profile was within normal limits. Informed consent was obtained. Bone marrow biopsy revealed hypercellular bone marrow that was totally infiltrated by immatureappearing lymphocytes with prominent nucleoli (Figure 1). Immunohistochemical analysis demonstrated CD3 expression of the infiltrating cells (Figure 2). MPO expression was scarce in the myeloid cells entrapped in the leukemic infiltrate (Figure 3).

Figure 1. Hypercellular bone marrow infiltrated by the leukemia.

Figure 2. Immunohistochemistry staining CD3 expression of the leukemic cells.

The patient was given 3 courses of systemic chemotherapy consisting of fludarabine at 30 mg/m2 daily for 3 days intravenously and cyclophosphamide at 250 mg/m2 daily for 3 days on a 28-day cycle. He achieved hematological remission with no evidence of splenomegaly and had normal complete blood count values. In the interval between the third and fourth chemotherapy, the patient, who was previously asymptomatic, was admitted to the emergency unit with confusion, dysarthria, urinary incontinence, and generalized muscle weakness. His neurological examination was otherwise unremarkable. Emergency cranial computerized tomography (CT) was done, showing an infiltrating mass lesion and a right 76

Figure 3. MPO expression in entrapped myeloid cells, while leukemic cells are negative.

Göçmen S, et al: T-PLL Presenting with CNS Involvement

temporal arachnoid cyst. Magnetic resonance imaging of the brain revealed a focal lesion in the left frontal lobe with surrounding edema (Figure 4). Finally, the diagnostic work-up was completed with cervical-thoracic-abdominal CT that did not reveal any changes with respect to the patient’s previous condition. A stereotactic brain biopsy was performed. Brain tissue was also infiltrated by leukemia, which was especially prominent in the perivascular areas (Figure 5). Unexpectedly the immunohistochemistry revealed marked expression of T-cell markers (CD3, CD5, CD7). At that time, treatment with alemtuzumab was planned; however, the patient died before treatment could be started. Discussion T-PLL is rare, representing approximately 2% of cases of mature lymphocytic leukemias in adults over the age of 30, with a median age of 65 at presentation [6]. T-PLL is an aggressive T-cell leukemia characterized by the proliferation of small to medium-sized prolymphocytes with a mature post-thymic T-cell phenotype involving the peripheral blood, bone marrow, lymph nodes, liver, spleen, and skin [6].

Turk J Hematol 2014;31:75-78

Most patients present with hepatosplenomegaly and generalized lymphadenopathy. Skin infiltration is seen in 20% of patients, with occasional serous pleural effusions [6]. Anemia and thrombocytopenia are common and the lymphocyte count is usually >100x109/L; it is >200x109/L in half of the patients [6]. Serum immunoglobulins are normal [6]. The course of the disease is aggressive, with a median survival of usually less than 1 year [2]. The disease is often refractory to conventional chemotherapy (eg., alkylating agents or CHOP regimens), and it is considered incurable [2]. Direct symptomatic invasion of the CNS by CLL is extremely rare. To date, less than 30 cases have been reported in the literature, with various initial clinical manifestations, including headaches, confusional state, cranial nerve palsies, optic neuropathy, cerebellar dysfunction, or motor deficits, most often associated with leukemic meningitis [7]. In contrast, autopsy series have reported brain or spinal cord tumoral CLL involvement in 17% to 71% of cases, but with few clinical correlations [7]. Most of the CNS involvements were asymptomatic [7]. Garderet et al. reported that all cases with CNS involvement of PLL are of B cell origin; they have not been found to be associated with T-PLL. T-PLL of CNS is treated with non-myeloablative allogeneic stem cell transplantation [2]. Non-invasive diagnostic imaging techniques are usually inadequate for diagnosis. In spite of the most recent advances in diagnostic imaging, precise histopathological diagnosis is still critical for optimum treatment of these intracranial lesions. Many non-neoplastic lesions of the CNS may be misinterpreted to be tumors due to their clinical and radiological presentation, with patients subjected to unnecessary surgical treatment, until histopathological diagnosis is established [8]. Most of these patients are best managed with medical therapy alone. Likewise, certain neoplastic processes, such as lymphoma or germinoma, respond very well to chemotherapy. Surgery is also of minimal benefit in most brain metastasis or advanced primary tumors (glioblastoma multiforme). These patients can be better served with radiation and/or chemotherapy.

Figure 4. T1-weighted image (A) and T2-weighted magnetic image (B) show a focal lesion in the left frontal lobe.

Stereotactic needle biopsy is a safe approach to establish the histopathological diagnosis for most intracranial lesions, especially for deep-seated, adjacent to eloquent areas, brain stem, or multiple small lesions [9,10,11]. Patients’ general medical condition and co-morbidities should also play a role in preferring stereotactic biopsy over open surgery [11]. Frame-based or frameless image-guided stereotactic brain biopsies were reported to have high diagnostic yields, ranging between 85% and 98% [10]. Complication rates range from 2% to 6.5%, and most complications did not result in clinically significant consequences [10].

Figure 5. Prominently perivascular leukemic infiltration in the brain.

Dammers et al. reported that frame-based and frameless image-guided stereotactic brain biopsy techniques are not different (i. e. equivalent) [12]. Reported overall morbidity rate is 6.9% and mortality rate 1.3% for frame-based 77

Turk J Hematol 2014;31:75-78

Göçmen S, et al: T-PLL Presenting with CNS Involvement

stereotactic biopsy [13]. Intracranial hemorrhage rates from 0% to 9% have been reported in the literature [13]. Framebased or frameless stereotactic brain biopsy of an intracranial lesion is a safe surgical technique with high diagnostic yield and low morbidity and mortality [10,11,12,13]. It should be the procedure of choice in establishing histopathological diagnosis and planning the extent of surgical treatment. CNS leukemia is a rapidly progressive disease with risk of dismal outcome. Treatment of CNS leukemia is by steroids, intrathecal or systemic chemotherapy, cranial irradiation, or a combination of these [14,15,16,17,18]. Nucleoside analogs and immunotargeting therapies are the most widely used types of treatment, but the results are frequently temporary. There is no standard treatment for CNS involvement of T-cell lymphoid malignancies, and generally this condition is considered incurable. Our patient had a rare presentation of relapse appearing in the CNS. Immediate and accurate histopathological diagnosis is crucial for treatment in patients presenting with CNS involvement and a history of leukemia or lymphoma. A stereotactic biopsy should also be considered for medically unstable patients and patients with inoperable CNS malignancies. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Kuwabara H, Kanamori H, Takasaki H, Takabayashi M, Yamaji S, Tomita N, Fujimaki K, Fujisawa S, Ishigatsubo Y. Involvement of central nervous system in prolymphocytoid transformation of chronic lymphocytic leukemia. Leuk Lymphoma 2003;44:1235-1237. 2. Garderet L, Bittencourt H, Kaliski A, Daniel M, Ribaud P, Socié G, Gluckman E. Treatment of T-prolymphocytic leukemia with nonmyeloablative allogeneic stem cell transplantation. Eur J Haematol 2001;66:137-139. 3. Pamuk GE, Puyan FO, Unlü E, Oztürk E, Demir M. The first case of de novo B-cell prolymphocytic leukemia with central nervous system involvement: description of an unreported complication. Leuk Res 2009;33:864-867. 4. Wang ML, Shih LY, Dunn P, Kuo MC. Meningeal involvement in B-cell chronic lymphocytic leukemia: report of two cases. J Formos Med Assoc 2000;99:775-778. 5. Brito-Babapulle F, Huang D, Lavender P, Galton D, Catovsky D. Regression of intracerebral lesions in T prolymphocytic leukaemia treated with intravenous deoxycoformycin. Eur J Haematol 1988;40:185-187.

6. Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J, Vardiman JW. WHO Classification of Tumors of Hematopoietic and Lymphoid Tissues. 4th ed. Lyon, France: IARC, 2008:270. 7. Denier C, Tertian G, Ribrag V, Lozeron P, Bilhou-Nabera C, Lazure T, Abbed K, Lacroix C, Adams D. Multifocal deficits due to leukemic meningoradiculitis in chronic lymphocytic leukemia. J Neurol Sci 2009;277:130-302. 8. Aker FV, Hakan T, Karadereler S, Erkan M. Accuracy and diagnostic yield of stereotactic biopsy in the diagnosis of brain masses: comparison of results of biopsy and resected surgical specimens. Neuropathology 2005;25:207-213. 9. Schwartz TH, Sisti MB. Stereotactic biopsy. In: Sekhar LN, Fessler RG, editors. Atlas of Neurosurgical Techniques: Brain. 1st ed. New York, Thieme, 2006;422-428. 10. Air EL, Leach JL, Warnick RE, McPherson CM. Comparing the risks of frameless stereotactic biopsy in eloquent and noneloquent regions of the brain: a retrospective review of 284 cases. J Neurosurg 2009;111:820-824. 11. Greenberg MS. Handbook of Neurosurgery. 6th ed. New York, Thieme, 2006;545. 12. Dammers R, Haitsma IK, Schouten JW, Kros JM, Avezaat CJ, Vincent AJ. Safety and efficacy of frameless and frame-based intracranial biopsy techniques. Acta Neurochir (Wien) 2008;150:23-29. 13. Kongkham PN, Knifed E, Tamber MS, Bernstein M. Complications in 622 cases of frame-based stereotactic biopsy, a decreasing procedure. Can J Neurol Sci 2008;35:7984. 14. Miller K, Budke H, Orazi A. Leukemic meningitis complicating early stage chronic lymphocytic leukemia. Arch Pathol Lab Med 1997;121:524-527. 15. Cash J, Fehir KM, Pollack MS. Meningeal involvement in early stage chronic lymphocytic leukemia. Cancer 1987;59:798-800. 16. Law IP, Blom J. Adult central nervous system leukemia: incidence and clinicopathologic features. South Med J 1976;69:1054-1057. 17. Morrison C, Shah S, Flinn IW. Leptomeningeal involvement in chronic lymphocytic leukemia. Cancer Pract 1998;6:223223-238. 18. Elliott MA, Letendre L, Li CY, Hoyer JD, Hammack JE. Chronic lymphocytic leukaemia with symptomatic diffuse central nervous system infiltration responding to therapy with systemic fludarabine. Br J Haematol 1999;104:689694.

Case Report

DOI: 10.4274/Tjh.2012.0010

Epstein-Barr Virus-Negative Post-Transplant Lymphoproliferative Diseases: Three Distinct Cases from a Single Center Epstein-Barr Virüs-Negatif Post-Transplant Lenfoproliferatif Hastalık: Tek Merkezden Üç Farklı Olgu Şule Mine Bakanay¹, Gülşah Kaygusuz2, Pervin Topçuoğlu¹, Şule Şengül3,Timur Tunçalı4, Kenan Keven3, Işınsu Kuzu2, Akın Uysal¹, Mutlu Arat¹ 1Ankara

University School of Medical, Department of Hematology, Ankara, Turkey

2Ankara

University School of Medical, Department of Pathology, Ankara, Turkey

3Ankara

University School of Medical, Department of Nephrology, Ankara, Turkey

4Ankara

University School of Medical, Department of Medical Genetics, Ankara, Turkey

Abstract: Three cases of Epstein-Barr virus (EBV)-negative post-transplant lymphoproliferative disease that occurred 6 to 8 years after renal transplantation are reported. The patients respectively had gastric mucosa-associated lymphoid tissue lymphoma, gastric diffuse large B-cell lymphoma, and atypical Burkitt lymphoma. Absence of EBV in the tissue samples was demonstrated by both in situ hybridization for EBV early RNA and polymerase chain reaction for EBV DNA. Patients were treated with reduction in immunosuppression and combined chemotherapy plus an anti-CD20 monoclonal antibody, rituximab. Despite the reduction in immunosuppression, patients had stable renal functions without loss of graft functions. The patient with atypical Burkitt lymphoma had an abnormal karyotype, did not respond to treatment completely, and died due to disease progression. The other patients are still alive and in remission 5 and 3 years after diagnosis, respectively. EBV-negative post-transplant lymphoproliferative diseases are usually late-onset and are reported to have poor prognosis. Thus, reduction in immunosuppression is usually not sufficient for treatment and more aggressive approaches like rituximab with combined chemotherapy are required. Key Words: Renal transplantation, Post-transplant lymphoproliferative disease, Lymphoma, Immunosuppression, Rituximab, Abnormal karyotype

Özet:

Böbrek naklinden 6-8 yıl sonra Epstein-Barr virus (EBV) negatif posttransplant lenfoproliferatif hastalık geliştiren 3 olgu rapor edilmektedir. Hastaların tanıları gastrik MALT lenfoma, gastrik diffüz büyük B hücreli lenfoma ve atipik-burkitt lenfoma idi. Hem EBV early RNA için yapılan in-situ hibridizasyon yöntemi hem de EBV DNA için yapılan polimeraz zincir reaksiyonu ile doku örneklerinde EBV saptanamamıştır. Hastalara immünsupresyonun azaltılması ile birlikte rituksimab içeren kombine kemoterapi protokolleri verilmiştir. İmmünsupresyonun azaltılmasına rağmen böbrek fonksiyonlarında önemli bir kayıp gözlenmemiştir. Anormal karyotipe sahip atipik Burkitt lenfomalı hasta tedaviye rağmen hastalık ilerlemesi ile erken dönemde kaybedilmiştir. Diğer hastalar hala remisyonda takip edilmektedir. EBV negatif posttransplant lenfoproliferatif hastalıkların genellikle geç başlangıçlı ve kötü prognozlu olduğu bilinmektedir. Bu hastalarda immünsupresyonun azaltılması tek başına yeterli bir tedavi olmadığı gibi rituksimab içeren kombine kemoterapilerle daha agresif tedaviler gerekli olmaktadır. Anahtar Sözcükler: Böbrek nakli, Posttransplant lenfoproliferatif hastalık, Lenfoma, İmmünsupresyon, Rituksimab, Anormal karyotip Address for Correspondence: Şule Mine Bakanay, M.D., Ankara University School of Medical, Department of Hematology, Ankara, Turkey GSM: +90 312 291 25 25/4812 E-mail: sulemine.ozturk@yahoo.com Received/Geliş tarihi : January 14, 2012 Accepted/Kabul tarihi : November 22, 2012

Bakanay MĹ&#x17E; et al: Post-Transplant Lymphproliferative Disease

Turk J Hematol 2014;31:79-83

Introduction Post-transplant lymphoproliferative diseases (PTLDs) are a heterogeneous group of diseases that develop as early or late-onset disease in solid organ or bone marrow transplant recipients with an incidence ranging between 1% and 20% [1,2]. It is reported that in renal transplant recipients PTLD is the second most common malignancy after skin cancer [3,4,5]. Pathogenesis of PTLD is not well understood. Epstein-Barr virus (EBV) infection and prolonged immunosuppression (IS) are the 2 major factors in pathogenesis. Inhibition of cytotoxic T-cell functions due to IS removes the control over EBV-infected B cells, which results in expansion of B cells, acquisition of genetic mutations, and clonal proliferation [6,7]. The highest risk of developing PTLD is within the first year after transplantation. EBV is found to be positive in 60%-80% of PTLDs and is usually associated with early-onset PTLD. However, EBVnegative PTLD is mainly late-onset [8,9,10,11,12]. Three patients who had received renal transplantation at other centers were admitted to our department, where they received the diagnosis of PTLD and were further followed. The presence of EBV could not be demonstrated in any of the samples by in situ hybridization for EBV early RNA or polymerase chain reaction (PCR) analysis of EBV DNA. Informed consent was obtained. Case Reports Case 1 A 28-year-old female patient was diagnosed with Helicobacter pylori (HP)-positive gastric mucosa-associated lymphoid tissue (MALT) lymphoma (stage IE) 6 years after receiving renal transplantation from her mother. She had been on mycophenolate mofetil, tacrolimus, and prednisolone for the last 3 years. After the diagnosis of lymphoma, the immunosuppressive therapy was modified with cessation of mycophenolate mofetil and dose reduction of tacrolimus. The patient received HP eradication therapy and was followed with endoscopic biopsies every 3 months. The HP infection was persistent and all biopsies supported the presence of a MALT lymphoma histologically. One year after the diagnosis, IgH chain clonality analysis by nested PCR revealed 2 separate clones on the polyclonal background, which was consistent with oligoclonal proliferation. The follow-up endoscopy revealed a larger ulcer and the pathology revealed MALT lymphoma invading the muscularis mucosa (Figure 1). The patient responded to combined chemotherapy with rituximab, cyclophosphamide, vincristine, and methyl prednisolone (R-CVP). Five years after diagnosis, she is being followed in complete remission. She is on prednisolone at 5 mg/day per os and tacrolimus at 2 mg/day per os, and her renal functions are stable with serum creatinine levels in the range of 1.3-1.6 mg/dL. 80

Case 2 A 31-year-old male patient presented with anemia due to chronic blood loss from the gastrointestinal tract. Endoscopic examination revealed a large ulcerated mass of the stomach. A computerized tomography (CT) scan demonstrated an 8.5x4 cm mass extending outside the stomach wall, suggesting an aggressive lymphoma, but endoscopic biopsy revealed MALT lymphoma with lambda monoclonal atypical B cell infiltration. The patient had received renal transplantation 7 years before diagnosis and had been on immunosuppressive therapy with cyclosporine A, azathioprine, and prednisolone since then. After the diagnosis of stage IE PTLD, IS drugs were tapered and stopped. Anti-HP treatment and 6 cycles of combined chemotherapy with R-CVP were administered. Prednisolone at 5 mg/day was resumed due to the deterioration of his renal functions. A CT scan of the abdomen revealed thickening of the stomach wall and perigastric lymphadenopathy. The endoscopy demonstrated the persistence of the giant ulcer in the stomach, with the biopsy revealing diffuse large B-cell lymphoma (DLBCL) (Figure 2). He was treated with total gastrectomy followed by combined chemotherapy with rituximab, cyclophosphamide, vincristine, doxorubicin, and methyl prednisolone, and he is in complete remission 3 years after diagnosis. His serum creatinine levels are in the range of 1.5-2.0 mg/dL with prednisolone at 5 mg/day every other day. Case 3 A 28-year-old male patient was admitted to the hospital with ptosis of the left eyelid, diplopia, and extreme sweating for the last few weeks. He had received a renal allograft from a living donor 8 years before. The immunosuppressive regimen consisted of azathiopurine, cyclosporine A, and prednisolone. His complete blood count revealed a white blood cell count of 11.3x109/L, hemoglobin of 15.3 g/dL, and platelet count of 49x109/L. On the peripheral blood smear, 60% of the leukocytes were atypical lymphoid cells with

Figure 1. MALT lymphoma. Small monocytoid lymphocytes and some plasma cells in the lamina propria of the gastric mucosa (1a, 1b, 1c). These cells were diffusely positive for CD20 and CD79a, forming a lymphoepithelial lesion. Kappa light chain restriction was demonstrated on neoplastic cells. Bcl10 was negative by immunohistochemistry.

Turk J Hematol 2014;31:79-83

Bakanay MĹ&#x17E; et al: Post-Transplant Lymphproliferative Disease

cytoplasmic vacuoles. Bone marrow examination revealed the diagnosis of atypical Burkitt lymphoma (aBL) (Figure 3). Flow cytometric analysis revealed that the immature cells were positive for HLA-DR and the B cell antigens CD19, CD10, cytoplasmic CD22 (+/-), surface CD22, FMC7, CD52, cytoplasmic CD79a, and surface IgM (+/-), and were negative for T-cell antigen CD5. The patient had a complex karyotype consisting of clonal trisomy X, add1 (q25), t(3;6) (q23;q23), trisomy 7, t(8;14) (q22;q32), der (10), der (11), der (16), trisomy 18, trisomy 20, and monosomy 22. Fluorescence in situ hybridization analysis revealed positive results for t(8;14), trisomy 7, and MLL gene amplification. Cerebrospinal fluid examination was negative for malignanTcells but the magnetic resonance imaging of the brain showed disease infiltration at multiple sites. The patient was treated with discontinuation of the immunosuppressive drugs and with combined chemotherapy that contained rituximab, cyclophosphamide, vincristine, dexamethasone, and L-asparaginase. Central nervous system disease was treated with 6 courses of intrathecal chemotherapy followed

Figure 2. Diffuse large B cell lymphoma diffusely infiltrating the stomach wall. There were also cells that had anaplastic features (2a, 2b). The tumor cells were positive for CD20, were partially positive for MUM-1 and Bcl-6, and had a high proliferation index of around 60% with Ki-67.

Figure 3. Atypical Burkitt lymphoma. Atypical cells infiltrating the bone marrow had large cytoplasmic vacuoles consistent with L3 morphology (3a, 3b, 3c). The cells were positively stained with CD20, CD79a, and Bcl-6, and were negative for MUM-1 and Bcl-2. The proliferation index examined by Ki67 was around 100%.

by cranial irradiation. His renal functions remained within normal ranges. There was a dramatic clinical response after cessation of IS and initiation of the chemotherapy, and the follow-up bone marrow biopsy after chemotherapy did not reveal any atypical cells. However, several weeks after discharge, he died of disease progression in the central nervous system and medullary relapse. Discussion Three patients with PTLD demonstrating distinct pathologies as well as distinct clinical properties are reported. In all patients, the PTLD occurred long after renal transplantation, and all were EBV-negative. Post-transplant lymphoproliferative diseases may occur as early-onset (â&#x2030;¤1 year) or late-onset (>1 year) disease after transplantation [9]. Studies comparing EBV-positive and EBV-negative PTLD patients have demonstrated that EBV-negative PTLD occurred later than EBV-positive PTLD [9,10,14,15,16]. The rarity and the heterogeneity of the disease have prevented large randomized studies to compare the overall survival and treatment outcomes. While some of the studies have shown significantly decreased survival of EBV-negative patients, others could not demonstrate a survival difference [3,9,10,15]. Leblond et al. reported that median survival of EBV-negative patients was significantly shorter than that of EBV-positive patients (1 month vs. 37 months) and identified EBV negativity as an adverse prognostic indicator [9]. On the other hand, Tsai et al. could not demonstrate any significant difference between EBV-positive and EBV-negative PTLD patients both in terms of response to reduction in IS and estimated 1-year overall survival (68% vs. 60% for EBV-positive and EBV-negative groups, respectively) [3]. In accordance with these reports, our cases also had different outcomes: patients 1 and 2 are still alive without disease, while patient 3 had incomplete response to therapy and poor survival. Post-transplant lymphoproliferative diseases are very heterogeneous, ranging from early lesions like infectious mononucleosis-like disease to monoclonal monomorphic diseases like malignant lymphomas. The most common type of monomorphic PTLD is DLBCL [14,15]. On the other hand, MALT lymphoma and atypical or Burkitt-like lymphoma are very rarely observed as PTLD [12,13,14]. Immunohistochemical studies demonstrate that PTLD lesions presenting as DLBCL usually express a late germinal center (CD10+/-/bcl-6+/MUM-1-/CD138-) or early postgerminal center (CD10-/bcl-6+\-/MUM-1+/CD138+) profile, but the germinal center profile is more commonly expressed in EBV-negative cases. This may suggest that EBV-negative PTLDs actually resemble the lymphomas that develop in immunocompetent hosts [7,17]. Burkitt lymphoma (BL) or aBL patients typically present with advanced-stage disease and high tumor burden with generalized lymphadenopathy and frequent bone marrow involvement. Typical BL usually has c-myc rearrangement 81

Turk J Hematol 2014;31:79-83

as a sole abnormality. Complex chromosomal abnormalities in addition to c-myc are reported in patients with aggressive B-cell lymphoma with features intermediate between DLBCL and BL, which is also referred to as aBL. In accordance with the literature, patient 3 had very aggressive disease and did not respond to the therapy well [18,19,20,21]. Helicobacter pylori can be demonstrated in the gastric mucosa in a majority of MALT lymphomas, and HP eradication with antibiotics usually results in complete regression. It is not clear whether the risk of MALT lymphoma is increased due to immunosuppression after solid organ transplantation or if it is completely due to HP infection, or both. Similar to case 1, the reported cases in the literature were all negative for EBV and positive for HP, and most developed as late-onset PTLD. They were clinically and histologically identical to conventional MALT lymphomas, which occur in immunocompetent patients [22,23]. Although most post-transplant MALT lymphomas are clinically indolent and do not require aggressive treatment, it is not known whether anti-HP therapy alone is sufficient to treat the post-transplant gastric lymphomas. Nelson et al., in their series of PTLD, reported that a single gastric PTLD that could represent a high-grade MALT lymphoma responded to only reduction in IS [11]. However, our patient did not sufficiently respond to reduction in IS and anti-HP therapy and eventually required combined chemotherapy. Reduction in IS should be the first line of approach in treatment of PTLD [3]. In the case of kidney transplantation, it is recommended that immunosuppressive therapy should be reduced to a minimum dosage and even ceased as long as the graft rejection is compatible with life. Early lesions and polymorphic PTLD have favorable response to reduction in IS alone, but the monoclonal/monomorphic forms require more aggressive treatment. During the last decade, anti-CD20 monoclonal antibody, rituximab, has become increasingly used in the treatment of CD20+ PTLD with better response rates of up to 60%-70%. Patients who do not respond to reduction in IS and rituximab can be given combined chemotherapy. However, combined chemotherapy with rituximab should be considered as first-line therapy for patients who are not suitable for reduction in IS or who have EBV-negative, late-onset aggressive disease, or for patients who have high tumor burden requiring an upfront rapid intervention [24,25,26,27,28]. In conclusion, EBV-negative PTLDs can be considered as a distinct group of PTLD resembling lymphomas of immunocompetent subjects due to late occurrence, higher proportion of monomorphic cases, and clinically more aggressive behavior. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. 82

Bakanay MĹ&#x17E; et al: Post-Transplant Lymphproliferative Disease

References 1. Penn I. Cancers complicating organ transplantation. N Engl J Med 1990;323:1767-1769. 2. Opelz G, Henderson R. Incidence of non-Hodgkin lymphoma in kidney and heart transplant recipients. Lancet 1993;342:1514-1516. 3. Tsai DE, Hardy CL, Tomaszewski JE, Kotloff RM, Oltoff KM, Somer BG, Schuster SJ, Porter DL, Montone KT, Stadtmauer EA. Reduction in immunosuppression as initial therapy for posttransplant lymphoproliferative disorder: analysis of prognostic variables and long-term follow-up of 42 adult patients. Transplantation 2001;71:1076-1088. 4. Penn I. Cancers in renal transplant recipients. Adv Ren Replace Ther 2000;7:147-156. 5. Winkelhorst JT, Brokelman WJ, Tiggeler RG, Wobbes T. Incidence and clinical course of de-novo malignancies in renal allograft recipients. Eur J Surg Oncol 2001;27:409-413. 6. Lim WH, Russ GR, Coates PT. Review of Epstein-Barr virus and post-transplant lymphoproliferative disorder post-solid organ transplantation. Nephrology (Carlton) 2006;11:355366. 7. Capello D, Rossi D, Gaidano G. Post-transplant lymphoproliferative disorders: molecular basis of disease histogenesis and pathogenesis. Hematol Oncol 2005;23:61-67. 8. Thompson MP, Kurzrock R. Epstein-Barr virus and cancer. Clin Cancer Res 2004;10:803-821. 9. Leblond V, Davi F, Charlotte F, Dorent R, Bitker MO, Sutton L, Gandjbakhch I, Binet JL, Raphael M. Posttransplant lymphoproliferative disorders not associated with EpsteinBarr virus: a distinct entity? J Clin Oncol 1998;16:2052-2059. 10. Nelson BP, Nalesnik MA, Bahler DW, Locker J, Fung JJ, Swerdlow SH. Epstein-Barr virus-negative post-transplant lymphoproliferative disorders: a distinct entity? Am J Surg Pathol 2000;24:375-385. 11. Dotti G, Fiocchi R, Motta T, Gamba A, Gotti E, Gridelli B, Borleri G, Manzoni C, Viero P, Remuzzi G, Barbui T, Rambaldi A. Epstein-Barr virus-negative lymphoproliferate disorders in long-term survivors after heart, kidney, and liver transplant. Transplantation 2000;69:827-833. 12. Jaffe ES, Harris N, Stein H, Vardiman JW (eds). WHO Classification of Neoplastic Diseases of the Hematopoietic and Lymphoid Tissues. Lyon, IARC Press, 2001. 13. Weissmann DJ, Ferry JA, Harris NL, Louis DN, Delmonico F, Spiro I. Posttransplantation lymphoproliferative disorders in solid organ recipients are predominantly aggressive tumors of host origin. Am J Clin Pathol 1995;103:748-755. 14. Knight JS, Tsodikov A, Cibrik DM, Ross CW, Kaminski MS, Blayney DW. Lymphoma after solid organ transplantation: risk, response to therapy, and survival at a transplantation center. J Clin Oncol 2009;27:3354-3362.

Bakanay MŞ et al: Post-Transplant Lymphproliferative Disease

15. Ghobrial IM, Habermann TM, Maurer MJ, Geyer SM, Ristow KM, Larson TS, Walker RC, Ansell SM, Macon WR, Gores GG, Stegall MD, McGregor CG. Prognostic analysis for survival in adult solid organ transplant recipients with post-transplantation lymphoproliferative disorders. J Clin Oncol 2005;23:7574-7582. 16. Nalesnik MA. Clinicopathologic features of posttransplant lymphoproliferative disorders. Ann Transplant 1997;2:3340. 17. Johnson LR, Nalesnik MA, Swerdlow SH. Impact of Epstein-Barr virus in monomorphic B-cell posttransplant lymphoproliferative disorders: a histogenetic study. Am J Surg Pathol 2006;30:1604-1612. 18. Ferrari A, Perotti D, Giardini R, Ghio L, Riva S, Massimino M. Disseminated Burkitt’s lymphoma after kidney transplantation: a case report in a boy with Drash syndrome. J Pediatr Hematol Oncol 1997;19:151-155. 19. Nathanson S, Lucidarme N, Landman-Parker J, Deschenes G. Long-term survival of renal graft complicated with Burkitt lymphoma. Pediatr Nephrol 2002;17:1066-1068. 20. Xicoy B, Ribera JM, Esteve J, Brunet S, Sanz MA, FernándezAbellán P, Feliu E. Post-transplant Burkitt’s leukemia or lymphoma. Study of five cases treated with specific intensive therapy (PETHEMA ALL-3/97 trial). Leuk Lymphoma 2003;44:1541-1543. 21. Gong JZ, Stenzel TT, Bennett ER, Lagoo AS, Dunphy CH, Moore JO, Rizzieri DA, Tepperberg JH, Papenhausen P, Buckley PJ. Burkitt lymphoma arising in organ transplant recipients: a clinicopathologic study of five cases. Am J Surg Pathol 2003;27:818-827. 22. Hsi ED, Singleton TP, Swinnen L, Dunphy CH, Alkan S. Mucosa-associated lymphoid tissue-type lymphomas occurring in post-transplantation patients. Am J Surg Pathol 2000;24:100-106.

Turk J Hematol 2014;31:79-83

23. Wotherspoon AC, Diss TC, Pan L, Singh N, Whelan J, Isaacson PG. Low grade gastric B-cell lymphoma of mucosa associated lymphoid tissue in immunocompromised patients. Histopathology 1996;28:129-134. 24. Blaes AH, Peterson BA, Bartlett N, Dunn VA. Rituximab therapy is effective for lymphoproliferative disorders after transplantation: results of a phase II 2005;104:1661-1667.

DL, Morrison posttransplant solid organ trial. Cancer

25. Choquet S, Leblond V, Herbrecht R, Socié G, Stoppa AM, Vandenberghe P, Fischer A, Morschhauser F, Salles G, Feremans W, Vilmer E, Peraldi MN, Lang P, Lebranchu Y, Oksenhendler E, Garnier JL, Lamy T, Jaccard A, Ferrant A, Offner F, Hermine O, Moreau A, Fafi-Kremer S, Morand P, Chatenoud L, Berriot-Varoqueaux N, Bergougnoux L, Milpied N. Efficacy and safety of rituximab in B-cell post-transplantation lymphoproliferative disorders: results of a prospective multicenter phase 2 study. Blood 2006;107:3053-3057. 26. Elstrom RL, Andreadis C, Aqui NA, Ahya VN, Bloom RD, Brozena SC, Olthoff KM, Schuster SJ, Nasta SD, Stadtmauer EA, Tsai DE. Treatment of PTLD with rituximab or chemotherapy. Am J Transplant 2006;6:569-576. 27. Svoboda J, Kotloff R, Tsai DE. Management of patients with post-transplant lymphoproliferative disorder: the role of rituximab. Transpl Int 2006;19:259-269. 28. Taylor AL, Bowles KM, Callaghan CJ, Wimperis JZ, Grant JW, Marcus RE, Bradley JA. Anthracycline-based chemotherapy as first-line treatment in adults with malignant posttransplant lymphoproliferative disorder after solid organ transplantation. Transplantation 2006;82:375381.

Case Report

DOI: 10.4274/Tjh.2012.0044

Serum Level of Lactate Dehydrogenase is a Useful Clinical Marker to Monitor Progressive Multiple Myeloma Diseases: A Case Report Progresif Multiple Myeloma Hastalığında Serum Laktat Dehidrogenaz Düzeyi Kullanışlı Bir Klinik Belirteçdir: Bir Olgu Sunumu Hava Üsküdar Teke1, Mustafa Başak2, Deniz Teke3, Mehmet Kanbay4 1Kayseri Education and Research Hospital, Department of Hematology, Kayseri, Turkey 2Kayseri Education and Research Hospital, Department of Internal Medicine, Kayseri, Turkey 3Kayseri Education and Research Hospital, Department of Cardiology, Kayseri, Turkey 4Kayseri Education and Research Hospital, Department of Nephrology, Kayseri, Turkey

Abstract: To follow the progression of multiple myeloma (MM) disease, serum lactate dehydrogenase (LDH) levels are as useful markers as beta-2 microglobulin and monoclonal immunoglobulin. With this study, we have presented a case of a patient with a multiple myeloma which was fulminant course, whose LDH levels were normal at the onset of diagnosis increasing as 27 times more than normal as the disease progressed and who showed the development of extramedullary plasmacytomas. The patient, an 80-yearold female, was diagnosed with stage IIIA IgA type multiple myeloma and melphalan-prednisolon (MP) treatment was started. Although the LDH levels were low during the diagnosis and chemotherapy, the LDH levels increased up to 7557 U/L following the progression and occurrence of extramedullary plasmacytomas and the patient died. During the observation of the patient with MM, if the LDH levels are abnormally high, the progression of the disease should be considered after eliminating the other causes. Bone marrow aspiration and biopsy should be examined and the progression or relapse should be shown. On the other hand, the patients with LDH levels are high should be considered to have added plasmacytomas, the whole body should be examined at an early stage before the development of clinical symptoms and early treatment should be started.

Key Words: Multiple myeloma, LDH, Prognosis Özet:

Serum laktat dehidrogenaz (LDH) düzeyleri, multiple myeloma (MM) hastalık ativitesinin takibi için beta-2 mikroglobulin ve monoklonal immunglobulin kadar kullanışlı bir markırdır. Bu yazıda tanı aşamasında LDH değerleri normal iken, takibinde LDH seviyeleri normalin 27 katı kadar artan ve ekstramedüller plazmasitom gelişen, fulminan seyirli bir multiple myeloma olgusunu sunduk. Seksen yaşındaki bayan hasta, Evre3A IgA tipi multiple myeloma tanısı konularak MP (melphalan-prednizolon) tedavisi başlanan hasta, tanı dönemi ve kemoterapi süresince LDH düzeyleri düşük seyretmesine rağmen progresyon sonrası ve kliniğe eklenen ekstramedüller plazmasitomlar ile LDH düzeyleri 7557 U/L düzeyine kadar çıkmış ve hasta fatal seyretmiştir. MM’li hastaların takibi sırasında LDH değerlerinde olan anormal yüksekliklerde diğer nedenler ekarte edildikten sonra hastalık progresyonu düşünülmelidir. Kemik iliği ve laboratuvar değerlendirmeleri ile progresyon veya nüks gösterilmelidir. LDH seviyeleri yüksek olan hastalarda ise mutlaka ilave olmuş plazmasitomların varlığı düşünülmeli, klinik bulgular gelişmeden erken dönemde tüm vücut taraması yapılmalı ve erken tedavi başlanmalıdır.

Anahtar Sözcükler: Multiple myeloma, LDH, Prognoz Address for Correspondence: Hava Üsküdar Teke M.D., Kayseri Education and Research Hospital, Department of Hematology, Kayseri, Turkey Phone: +90 352 336 88 84/1518 E-mail: havaus@yahoo.com Received/Geliş tarihi : March 28, 2012 Accepted/Kabul tarihi : November 30,2012

Teke ÜH, et al: Multiple Myeloma Lactate Dehydrogenase

Introduction Multiple myeloma is a malignant hematological disease which is characterized by monoclonal immunoglobulin production and malignant proliferation of plasma cells in bone marrow. Serum beta2-microglobulin, serum albumin, platelet count, serum creatinine and age are important markers for survival during the course of disease [1]. Moreover; among these prognostic markers, elevated LDH is correlated with beta2-microglobulin [2]. Elevated LDH levels are observed rarely at the onset of the multiple myeloma; however, as the disease progresses LDH levels increase to levels higher than those at diagnosis [3]. The median overall survival of the patients whose LDH levels are high is shorter than those patients whose LDH levels are normal [4]. As LDH gives an idea about the level of tumor mass, the increase of LDH during the course of the disease may refer to the increased levels of tumor, relapse or the existence of extra plasmacytomas [5]. With this study, we have presented a case of a patient with a multiple myeloma which was fulminant course, whose LDH levels were normal at the onset of diagnosis increasing as 27 times more than normal as the disease progressed and who showed the development of extramedullary plasmacytomas.

Turk J Hematol 2014;31:84-87

in peripheral blood smear. Ultrasonography results have showed that liver, pancreas and spleen were normal. As the patient had thrombocytopenia and bone pain, bone marrow aspiration-biopsy was examined to confirm the presence of resistance multiple myeloma. Bone marrow biopsy results have showed that plasma cells with kappa monoclonality have increased to the levels of 50%. The patient’s cerebral magnetic resonance (MR), who showed sudden loss of mass strength around the right lower extremity, was normal. Lumbar MR has showed that there has been a soft tissue mass around sacral 3-4 vertebra anterior paravertebral field and increasing numbers of tissue around the L1-L2 vertebra corpus anterior field were observed. Thoracal MR has showed that there has been soft tissue mass around T 5-9 vertebra which causes invasion in posterior units (Figure 1, Figure 2). Informed consent was obtained. Our patient’s laboratory results were given in the Graphic 1. The patient was taken for operation by neurosurgery. Following the pathology results, the patient was diagnosed with plasmacytoma. The patient was treated with weekly dexamethasone. During the dexamethasone treatment

Case Report An 80 years-old female patient. The patient, who was led to hematology policlinic following the findings of anemia (hemoglobin 8.16 gr/dl) and leucopenia (White blood cell 2.9x103/uL) with the complaints of fatigue in May 2011, had no any other disease except from hypertension. As the patient who was examined for bicytopenia had higher level of Ig A and suspicious monoclonal peak was observed in serum protein electrophoresis was evaluated. Immunofixation electrophoresis results have shown ‘IgA/k’ monoclonal band with IgA levels of 2610 mg/dl and kappa levels of 2040 mg/dl. After the patient was examined for bone marrow aspirationbiopsy and flow cytometry, in the bone marrow biopsy the patient was found to have CD38, CD138 with the level 30%, and kappa positive plasma cells. Direct radiographies did not show any lytic lesions. The levels of C-reactive protein (CRP) and LDH were normal, beta-2 microglobulin level was 8.5 mg/L. The patient was diagnosed with stage IIIA IgA type multiple myeloma and MP treatment was started. The patient’s levels of IgA and monoclonality who was treated with five cures MP decreased during the treatment. Levels of LDH did not increase. The patient was not treated with 6th cure chemotherapy because of the infection. Thorax tomography did not show any pathology related to infection. Blood culture results were negative, E. coli has grown in urine culture. The patient’s LDH levels, whose fever decreased with the treatment of antibiotics, increased. Hemolysis tests which were done because of the high LDH levels (1808 U/L) were normal and fragmentation was not observed

Figure 1. The patient plasmocytomas in the Lomber MR.

Figure 2. Plasmocytomas in the lomber, thorakal area in MR. 85

Teke ÜH, et al: Multiple Myeloma Lactate Dehydrogenase

Turk J Hematol 2014;31:84-87

the LDH levels decreased from 7557 U/L to 2000 U/L. Radiotherapy treatment was planned for the patient; however, sudden onset of dyspnea and loss of consciousness were observed with the patient. The cerebral CT results did not show any sign of hemorrhage and emboli, edema was observed. The patient, who had been observed to have diffuse lung edema following the X-ray, was put under dialysis. Afterwards, the patient died of lung edema during the dialysis. Discussion Symptoms of multiple myeloma which are caused by plasma cells in bone marrow are heterogeneous and related to tumor mass. While the most common symptom of MM is bone pain, the most common laboratory result is anemia. In our case, also, anemia was observed which is the most common symptom of MM; however, laboratory results showed leukopenia which is rarely seen. Being associated with prognosis, the levels of beta2-microglobulin, plasma cell labeling index, CRP and IL-6 are parameters with MM patients. High levels of LDH are associated with advanced disease and poor survival. At the onset of MM, high levels of LDH are seen rarely; however, as the disease advanced, the levels of LDH increase to levels higher than those at diagnosis [3]. Also in our case; at the onset of the disease, the levels of LDH were normal and the levels of LDH increased as the disease progressed. According to the research; LDH, international staging systems, performance status, age and platelet counts were shown as independent prognostic factors. The median overall survival of the patients with high and normal LDH was 15 vs. 44 months [6]. While the overall survival of the patients with MM whose LDH levels were above 250 U/L was 4 months that of the patients with lower LDH levels was 20 months [7]. Although in our case the LDH levels were low during the diagnosis and chemotherapy, the LDH levels increased to 7557 U/L following the progression and occurrence of extramedullary plasmacytomas and the patient died. LDH is a cytoplasmic enzyme and may have been observed in nearly all major organ cells. If cells lysis occurs, or cells and membranes are damaged, cytoplasmic enzymes,

such as LDH are released into the extracellular area [8]. LDH isoenzymes are present in brain, kidney, liver, lung, lymph nodes, myocardium, skeletal muscle, spleen, erythrocytes, leucocytes and also platelets and divided into 5 components [9]. LDH-3 isoenzyme is especially present in lung diseases and special tumors; LDH-4 is observed in kidney, placenta and pancreas and especially can be found high in pancreatitis. Researches have shown that total LDH, LDH-2, LDH-3 and LDH-4 isoenzymes are high with untreated leukemia patients [10]. In our case, total LDH level was found as 7557 U/L which has never occurred in the literature. Other clinical situations such as hemolytic anemia, pneumonia, pancreatitis which cause the high levels of LDH have been eliminated. LDH-3 and LDH-4 isoenzymes are found at high levels in our case. According to these results, it may be concluded that prognosis will be poor, when the total LDH, LDH-3 and LDH-4 isoenzymes are high with the patients of MM. New studies about LDH isoenzymes of the patients with MM, whose LDH levels are high, are required to confirm this hypothesis. To conclude, to follow the progression of MM disease, serum LDH levels are as useful markers as beta-2 microglobulin and monoclonal immunoglobulin. During the observation of the patient with MM, if the LDH levels are abnormally high, the progression of the disease should be considered after eliminating the other causes. Bone marrow aspiration and biopsy should be examined and the progression or relapse should be shown. On the other hand, the patients with high levels of LDH should be considered to have added plasmacytomas, the whole body should be examined at an early stage before the development of clinical symptoms and early treatment should be started. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Greipp PR, San Miguel J, Durie BG, Crowley JJ, Barlogie B, Bladé J, Boccadoro M, Child JA, Avet-Loiseau H, Kyle RA, Lahuerta JJ, Ludwig H, Morgan G, Powles R, Shimizu K, Shustik C, Sonneveld P, Tosi P, Turesson I, Westin J. International staging system for multiple myeloma. J Clin Oncol 2005;23:6281. 2. Simonsson B, Brenning G, Kallander C, Ahre A. Prognostic value of serum lactic dehydrogenase (S-LDH) in multiple myeloma. Eur J Clin Invest 1987;17:336-339.

Graphic 1. Our patient’s laboratory results. 86

3. Dimopoulus MA, Barlogie B, Smith TL, Alexanian R. High serum lactate dehydrogenase level as a marker for drug resistance and short survival in multiple myeloma. Ann Intern Med 1991;115:931-935.

Teke ÜH, et al: Multiple Myeloma Lactate Dehydrogenase

Turk J Hematol 2014;31:84-87

4. Gkotzamandou M, Kastritis E, Gavriatopoulou MR, Nikitas N, Gika D, Mparmparousi D, Matsouka C, Terpos E, Dimopoulos MA. Increased serum lactate dehydrogenase should be included among the variables that define veryhigh-risk multiple myeloma. Clin Lymphoma Myeloma Leuk 2011;11:409-412.

7. Suguro M, Kanda Y, Yamamato R, Chizuka A, Hamaki T, Matsuyama T, Takezako N, Miwa A, Togawa A. High serum lactate dehyrdogenase level predicts short survival after vincristine-doxorubicin, dexamethasone (VAD) salvage for refractory multiple myeloma. Am J Hematol 2000;65:132135.

5. Sanal SM, Yaylacı M, Mangold KA, Pantazis CG. Extensive extramedullary disease in myeloma. An uncommon variant with features of poor prognosis and dedifferentiation. Cancer 1996;77:1298-1302.

8. Drent M, Cobben NAM, Hnderson RF, Wouters EFM, Diejen-Visser M. Usefulness of lactate dehyrogenase and its isoenzymes as indicators of lung damage or inflammation. Eur Respir J 1996;9:1736-1742.

6. Terpos E, Katodritou E, Roussou M, Pouli A, Michalis E, Delimopasi S, Parcharidou A, Kartasis Z, Zomas A, Symeonidis A, Viniou NA, Anagnostopoulos N, Economopoulos T, Zervas K, Dimipoulos MA. High serum lactate dehydrogenase adds prognostic value to the international myeloma staging system even in the era of novel agents. Eur J Haematol 2010;85;114-119.

9. Lott JA, Nemensanszky E. Lactate dehydrogenase. In: Lott JA, Wolf PL, eds. Clinical Enzymology, a case-orianted Aprroach 1987. p. 213-244. 10. Patel PS, Adhvaryu SG, Balar DB. Serum lactate dehydrogenase and its isoenzymes in leukemia patients: possible role in diagnosis and treatment monitoring. Neoplasma 1994;41:55-59.

Case Report

DOI: 10.4274/Tjh.2012.0106

Isolated Granulocytic Sarcoma of the Breast after Allogeneic Stem Cell Transplantation: A Rare Involvement Also Detected by 18FDG-PET/CT Allogeneik Kök Hücre Nakli Sonrası Memede İzole Granülositik Sarkom: 18FDG-PET/CT ile de Saptanan Nadir Bir Tutulum Eren Gündüz1, Meltem Olga Akay1, Mustafa Karagülle1, İlknur Sivrikoz Ak2 1Eskişehir 2Eskişehir

Osmangazi University School of Medicine, Department of Hematology, Eskişehir, Turkey Osmangazi University School of Medicine, Nuclear Medicine, Eskişehir, Turkey

Abstract: Granulocytic sarcoma is a tumor consisting of myeloid blasts with or without maturation that occurs at an anatomical site other than bone marrow. Most frequently affected sites are skin, lymph nodes, gastrointestinal tract, bone, soft tissue and testes. AML may manifest as granulocytic sarcoma at diagnosis or relapse. Although it has been considered to be rare relapse as granulocytic sarcoma after stem cell transplantation is being increasingly reported. However it is rare without bone marrow involvement and in AML M6 subtype. Breast is also a rare involvement. We report a 30-year-old woman with AML M6 relapsed 16 months after allogeneic stem cell transplantation as a granulocytic sarcoma in right breast without bone marrow involvement. She was treated with systemic chemotherapy but died of sepsis. 18FDG-PET/CT images were also obtained and detected lesions other than detected by breast ultrasound. The incidence of granulocytic sarcoma may increase if suspected or new diagnostic modalities are performed. Key Words: Granulocytic sarcoma, Breast, Stem cell transplantation, 18FDG-PET/CT

Özet:

Granülositik sarkom matürasyonlu ve matürasyonsuz miyeloid blastlardan oluşan ve kemik iliği dışındaki anatomik bölgelerde yerleşen bir tümördür. En sık etkilenen bölgeler cilt, lenf nodları, gastrointestinal sistem, kemik, yumuşak doku ve testistir. AML tanı ya da relaps anında granülositik sarkom olarak ortaya çıkabilir. Nadir olduğu düşünülmekle birlikte kök hücre nakli sonrası granülositik sarkom olarak relaps giderek artan biçimde bildirilmektedir. Fakat kemik iliği tutulumu olmaksızın ve AML M6 alt tipinde nadirdir. Yazımızda AML M6 tanısıyla takip edilen ve allogeneik kök hücre naklinden 16 ay sonra kemik iliği tutulumu olmaksızın sağ memede granülositik sarkom şeklinde relaps görülen 30 yaşındaki kadın hastayı sunduk. Hastaya sistemik kemoterapi verildi ancak sepsis nedeniyle kaybedildi. 18FDG-PET/CT görüntülerinde meme ultrasonunda saptanmayan lezyonlar izlendi. Şüphe edildiği takdirde ya da yeni tanı modaliteleri kullanıldığında granülositik sarkom insidansının artabileceği kanaatindeyiz. Anahtar Sözcükler: Granülositik sarkom, Meme, Kök hücre nakli, 18FDG-PET/CT

Address for Correspondence: Eren GÜndÜz, M.D., Eskişehir Osmangazi University School of Medicine, Department of Hematology, Eskişehir, Turkey Phone: +90 222 239 84 66 E-mail: erengunduz@hotmail.com Received/Geliş tarihi : August 10, 2012 Accepted/Kabul tarihi : October 19, 2012

G端nd端z E, et al: Granulocytic Sarcoma of the Breast

Introduction Allogeneic hematopoietic stem cell transplantation (allo SCT) decreases relapse risk and improves survival in unfavorable-risk acute myeloid leukemia (AML) patients [1]. Some patients with advanced AML can also achieve long-term survival [2]. Transplant-related mortality has decreased, but relapse after transplantation has emerged as the principle cause of treatment failure [3]. Extramedullary (EM) relapse of AML occurs in 5% to 7% of allo SCT recipients and accounts for 7% to 46% of total relapses [4]. AML M6 represents less than 5% of AML cases and its EM presentation is extremely rare [5,6,7]. We report a case of AML FrenchAmerican-British (FAB) classification type M6 with relapse 16 months after allo SCT as a granulocytic sarcoma in the right breast without bone marrow involvement. 18Fluorodeoxy-glucose positron emission tomography (18FDG-PET)/ computed tomography (CT) images were also obtained as a tool for detection of EM relapse of AML. Informed consent was obtained.

Turk J Hematol 2014;31:88-91

approximately 33-mm irregular mass with heterogeneous internal echo suggesting carcinoma of the breast. She underwent an excisional biopsy and the diagnosis was granulocytic sarcoma. Bone marrow aspiration and biopsy revealed no involvement. Chimerism was still of the full donor type. 18FDG-PET/CT was performed after biopsy. The time between 18FDG-PET/CT and the biopsy was 32 days. There were 2 focal lesions with moderate metabolic activity (standardized uptake value maximum [SUV max] of 3.6) in the upper inner quadrant of the right breast (Figure 1). CT images alone were not definitive. Since the time between 18FDG-PET/CT and the biopsy was 32 days and the margin of the hyperactive lesions were regular, the nuclear medicine physician concluded that the lesions were not related with postoperative changes but that they were true masses. In May 2012 she was given high-dose ara-C, etoposide, and idarubicin combination chemotherapy again. Invasive aspergillosis developed despite posaconazole prophylaxis and she died of sepsis 25 days after chemotherapy.

Case Report

Discussion

In December 2009, a 30-year-old woman was referred to our hospital because of pancytopenia, and a diagnosis of AML M6 type was made. At the time of diagnosis hemoglobin was 93 g/L, white blood cell count was 1.5x109/L, and platelet count was 60x109/L. Biochemical tests other than lactate dehydrogenase (LDH) level were normal (LDH: 485 U/L, range: 240-480). Blasts in the bone marrow aspirate were negative for CD56. Cytogenetic analysis showed normal karyotype. EM leukemia was not demonstrated. She was treated with idarubicin at 12 mg/m2/day intravenously (iv) on days 1-3 and cytarabine (ara-C) at 100 mg/m2/day iv on days 1-7. Since complete remission (CR) was not detected, a second course of the same therapy was given. After achieving CR, consolidation therapy with ara-C at 3 g/m2/day iv on days 1.3 and 5 was administered. A bone marrow aspiration was performed in August 2010 because of thrombocytopenia. The result was compatible with AML relapse and she received ara-C at 6 g/m2/day iv on days 1, 3, 5, and 7; etoposide at 75 mg/m2/day iv on days 1-7; and idarubicin at 12 mg/m2/day iv on days 1-3.

Recent studies have suggested that EM relapse accounts for a significant proportion of relapses after allo SCT and is particularly associated with the induction of graft-versusleukemia (GVL) effect [4]. Younger age, EM involvement before SCT, advanced disease at SCT, unfavorable cytogenetics, and M4 and M5 FAB subtypes are factors

In November 2010 the patient underwent an allo SCT from her human leukocyte antigen (HLA)-matched brother after a conditioning regimen of busulfan (16 mg/ kg) and cyclophosphamide (120 mg/kg). Graft-versus-host disease (GVHD) prophylaxis consisted of cyclosporine and cyclophosphamide at 50 mg/kg/day on days 3 and 4. Full donor chimerism was obtained on day 28. Acute hepatic GVHD disappeared with methyl prednisolone therapy. Chronic GVHD confined to skin was treated with mycophenolate mofetil. In April 2012 she was admitted with a palpable mass in the right breast. The breast ultrasound showed an

Figure 1. The patient was scanned by an integrated PET/ CT camera (one hour after the administration of 465 MBq FDG), which consists of a 6-slice CT gantry integrated on a LSO based full ring PET scanner (Siemens Biograph 6, IL, Chicago, USA). MIP PET, CT and fusion PET/CT images were obtained. There were 2 focal lesions with moderate metabolic activity (SUV max of 3.6) in the upper inner quadrant of the right breast. 89

Turk J Hematol 2014;31:88-91

Gündüz E, et al: Granulocytic Sarcoma of the Breast

reported to be associated with EM relapse after SCT [8,9]. The significance of chromosomal abnormalities such as t(8;21) and inv (16), CD56 expression in leukemic cells, T-cell depletion of grafts, stem cell sources, HLA disparities, kinetics of T-cell chimerism, and the preventive role of total body irradiation remains unclear [4]. None of the reported factors except younger age were recognized in our patient, and so further studies are needed to clarify the role of other factors in EM relapse.

In conclusion, the prognosis of patients who develop EM relapse after allo SCT remains poor. The number of EM relapses will be increasing as the number of transplant patients increases. Transplant physicians should be aware of EM relapses and the diagnosis should be made as early as possible. New diagnostic modalities such as 18FDG-PET/ CT for early diagnosis and new agents may improve clinical outcome.

The median time from SCT to EM relapse has been reported as 10 to 17 months [8,10,11]. This time was 16 months in our patient. Lee et al. [12] indicated that the GVL effect associated with an occurrence of GVHD is less effective in preventing an EM relapse than a bone marrow relapse. This seems also true for our patient because acute hepatic and chronic skin GVHD granulocytic sarcoma occurred without bone marrow involvement. Unfortunately, we were unable to evaluate the occurrence of bone marrow relapse because the patient died early.

The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Since the diagnosis of EM relapse is often delayed, new diagnostic modalities such as 18FDG-PET/CT are discussed with several limitations. This method can identify new extramedullary manifestations that were not clinically detectable, but it should be applied not just during diagnosis but also for the assessment of treatment response and for detecting recurrence [13]. Reported 18FDG uptake ranges between SUVmax 2.6 and 9.7 [14]. The SUVmax was 3.6 in our patient. Although the breast ultrasound showed just one mass and 18FDG-PET/CT was performed after excisional biopsy, two different lesions were detected by 18FDGPET/CT. This seems to be an advantage because masses that cannot be demonstrated with conventional methods can be seen in 18FDG-PET/CT, and this is an important issue, especially for isolated EM relapses. Unfortunately, ultrasound is known to be a user-dependant method and we did not use any more specific methods like magnetic resonance imaging. Although local therapy, including surgical excision and radiotherapy, can offer long-term survival for some patients, most patients develop systemic relapse. Thus, systemic or combined modality therapy should be considered, particularly in patients with good performance status [10]. Donor lymphocyte infusion (DLI) has limited efficacy [14] and a second transplant often results in repeated relapse [15]. Our patient’s performance was good enough for combined modality treatment and we planned systemic chemotherapy followed by DLI. The combination was chosen as the one that we managed best before transplantation. However, the patient died of sepsis after chemotherapy although she tolerated the same combination well before transplantation. This may be because the combination has become more toxic after the effects of allo SCT and its complications. 90

Conflict of Interest Statement

References 1. Koreth J, Schlenk R, Kopecky KJ, Honda S, Sierra J, Djulbegovic BJ, Wadleigh M, DeAngelo DJ, Stone RM, Sakamaki H, Appelbaum FR, Döhner H, Antin JH, Soiffer RJ, Cutler C. Allogeneic stem cell transplantation for acute myeloid leukemia in first complete remission: systematic review and meta-analysis of prospective clinical trials. JAMA 2009;301:2349-2361. 2. Duval M, Klein JP, He W, Cahn JY, Cairo M, Camitta BM, Kamble R, Copelan E, de Lima M, Gupta V, Keating A, Lazarus HM, Litzow MR, Marks DI, Maziarz RT, Rizzieri DA, Schiller G, Schultz KR, Tallman MS, Weisdorf D. Hematopoietic stem cell transplantation for acute leukemia in relapse or primary induction failure. J Clin Oncol 2010;28:3730-3738. 3. Pavletic SZ, Kumar S, Mohty M, de Lima M, Foran JM, Pasquini M, Zhang MJ, Giralt S, Bishop MR, Weisdorf D. NCI First International Workshop on the Biology, Prevention and Treatment Relapse after Allogeneic Hematopoietic Stem Cell Transplantation: Report from the Committee on the Epidemiology and Natural History of Relapse Following Allogeneic Cell Transplantation. Biol Blood Marrow Transplant 2010;16:871-890. 4. Yoshihara S, Ando T, Ogawa H. Extramedullary relapse of acute myeloid leukemia after allogeneic hematopoietic stem cell transplantation: an easily overlooked but significant pattern of relapse. Biol Blood Marrow Transplant 2012;18:1800-1807. 5. Kasyan A, Medeiros LJ, Zuo Z, Santos FP, Ravandi-Kashani F, Miranda R, Vadhan-Raj S, Koeppen H, Bueso-Ramos CE. Acute erythroid leukemia as defined in the World Health Organization classification is a rare and pathogenetically heterogeneous disease. Mod Pathol 2010;23:1113-1126. 6. Keifer J, Zaino R, Ballard JO. Erythroleukemic infiltration of a lymph node: use of hemoglobin immunohistochemical techniques in diagnosis. Hum Pathol 1984:15:1090-1093. 7. Wang HY, Huang LJ, Liu Z, Garcia R, Li S, Galliani CA. Erythroblastic sarcoma presenting as bilateral ovarian masses in an infant with pure erythroid leukemia. Hum Pathol 2011;42:749-758.

Gündüz E, et al: Granulocytic Sarcoma of the Breast

8. Lee KH, Lee JH, Choi SJ, Lee JH, Kim S, Seol M, Lee YS, Kim WK, Seo EJ, Park CJ, Chi HS, Lee JS. Bone marrow vs extramedullary relapse of acute leukemia after allogeneic hematopoietic cell transplantation: risk factors and clinical course. Bone Marrow Transplant 2003;32:835-842. 9. Porter DL, Alyea EP, Antin JH, DeLima M, Estey E, Falkenburgh JH, Hardy N, Kroeger N, Leis J, Levine J, Maloney DG, Peggs K, Rowe JM, Wayne AS, Giralt S, Bishop MR, van Beslen K. NCI First International Workshop on the Biology, Prevention and Treatment of Relapse after Allogeneic Hematopoietic Stem Cell Transplantation: Report from the Committee on Treatment of Relapse after Allogeneic Hematopoietic Stem Cell Transplantation. Biol Bone Marrow Transplant 2010;16:1467-1503. 10. Solh M, DeFor TE, Weisdorf DJ, Kaufman DS. Extramedullary relapse of acute myelogenous leukemia after allogeneic hematopoietic stem cell transplantation: better prognosis than systemic relapse. Biol Blood Marrow Transplant 2012;18:106-112.

Turk J Hematol 2014;31:88-91

11. Cunningham I. Extramedullary sites of leukemia relapse after transplant. Leuk Lymphoma 2006;47:1745-1767. 12. Lee JH, Choi SJ, Lee JH, Seol M, Lee YS, Ryu SG, Park CJ, Chi HS, Lee MS, Yun S, Lee JS, Lee KH. Anti-leukemic effect of graft versus host disease on bone marrow and extramedullary relapses in acute leukemia. Haematologica 2005;90:1380-1388. 13. Stölzel F, Röllig C, Radke J, Mohr B, Platzbecker U, Bornhauser M, Paulus T, Ehninger G, Zöphel K, Schaich M. 18FDG-PET/ CT for detection of extramedullary acute myeloid leukemia. Haematologica 2011;96:1552-1556. 14. Kolb HJ. Graft versus leukemia effects of transplantation and donor lymphocytes. Blood 2008;112:4371-4383. 15. Yoshihara S, Ikegame K, Kaida K, Taniguchi K, Kato R, Inoue T, Fujioka T, Tamaki H, Okada M, Soma T, Ogawa H. Incidence of extramedullary relapse after haploidentical SCT for advanced AML/myelodysplastic syndrome. Bone Marrow Transplant 2012;47:669-676.

DOI: 10.4274/Tjh.2013.0180

Letter to the Editor

Chronic Myeloid Leukemia as a Secondary Malignancy Following Treatment of Diffuse Large B-Cell Lymphoma Yaygın Büyük B hücreli Lenfoma Tedavisi Sonrası Sekonder Malignite Olarak Kronik Myeloid Lösemi Itır Şirinoğlu Demiriz1, Emre Tekgündüz1, Sinem Civriz Bozdağ1, Fevzi Altuntaş2 1Ankara 2

Oncology Hospital, Department of Hematology and Stem Cell Transplantation Unit, Ankara, Turkey

Ankara Oncology Education and Research Hospital, Ankara, Turkey

To the Editor, Philadelphia (Ph) chromosome (t(9; 22)(q34; q11))positive chronic myeloid leukemia (CML) occurring as a secondary malignancy in patients who were treated for non-Hodgkin lymphoma (NHL) is very rare [1,2]. The association between B-cell–derived lymphoid neoplasias and myeloproliferative disorders is not clear [1]. Until now, CML has been reported after treatment for Hodgkin disease (HD), hairy cell leukemia, or chronic lymphocytic leukemia (CLL). It is not clear whether development of CML as a secondary malignancy represents a therapy-induced complication or possibly a genetic susceptibility to malignancy in which the host may be able to bear 2 different clonal malignanT-cells [3,4]. There is also a possibility that the 2 malignant clones derive from a common malignant stem cell [4]. A 45-year-old female was admitted to our hospital in July 2006. An undifferentiated malignant tumor was detected following upper gastrointestinal system endoscopy. Biopsy revealed a high-grade, CD20-positive malignant lymphoma. The general surgery department performed a near-total gastrectomy for the mass lesion, of 8x6 cm in size. She was referred to our hematology clinic with a diagnosis of diffuse large B-cell lymphoma (DLBCL). Computerized tomography scans, bone marrow aspiration, and biopsy results revealed Ann Arbor stage IEB disease with a normal karyotype, and

fluorescence in situ hybridization (FISH) analysis results were negative for t(8,14) and t(14,18). Informed consent was obtained. Six courses of R-CHOP chemotherapy were completed in December 2006 with achievement of complete remission (CR). She was followed in CR until December 2010, at which point the patient presented with leukocytosis and thrombocytosis (white blood cell count: 61.5x109/L, neutrophils: 5.1x109/L, hemoglobin: 12.7 gr/dL,platelet count: 754x109/L). Physical examination was normal. Peripheral blood smear showed leukoerythroblastosis and mild basophilia with 32% metamyelocytes and 21% myelocytes. Bone marrow aspiration and biopsy revealed hypercellular bone marrow and myeloid hyperplasia (M/E: 6/1), and 1.4% basophilia, but no blastic infiltration or fibrosis. FISH analysis showed 93% Ph chromosome positivity, whereas JAK-2 mutation was not detected. She was diagnosed with CML in the chronic phase. Her Sokal score was 0.73 (low) and imatinib mesylate therapy at 400 mg/day was initiated in January 2011. Complete hematological response was achieved in March 2011, followed by complete cytogenetic and major molecular responses in June 2011. She is still being followed in our outpatient clinic with major molecular response. Primary DLBCLs are aggressive tumors accounting for approximately 40% of all B-cell malignancies. Up to 40% of

Address for Correspondence: Itır Şİrİnoğlu Demİrİz, M.D., Ankara Oncology Hospital, Department of Hematology and Stem Cell Transplantation Unit, Ankara, Turkey Phone: +90 312 336 09 09 E-mail: dritir@hotmail.com Received/Geliş tarihi : May 23, 2013 Accepted/Kabul tarihi : August 5, 2013

Demiriz ŞI: Chronic Myeloid Leukemia as a Secondary Malignancy Following Treatment of Diffuse Large B-Cell Lymphoma

Turk J Hematol 2014;31:92-94

Table 1. Reported cases of CML developing after NHL.

Case

Reference

Therapy received for NHL

Latency CML phase (months)

Survival (months)

Auerbach et al. [14]

Cy+VCR+ADR+RT

Chronic

Whang-Peng et al. [10]

COP

Chronic

Cazzola et al. [12]

COP +RT

Chronic

Mele et al. [11]

CTX+VCR+RT

Lymphoid blast crisis

Bolaños-Meade et al. [7]

CHL+PDN

Chronic

Breccia et al. [13]

Various CT regimens+RT

228

Chronic

Present case

R-CHOP

Chronic

24+

CHL: chlorambucil; Cy: cyclophosphamide, VCR: vincristine, ADR: adriamycin, RT: radiotherapy, COP: cyclophosphamide-vincristine-prednisolone, PDN: prednisolone, CT: chemotherapy, R-CHOP: rituximab-cyclophosphamide-anthracycline-vincristine-prednisolone.

the masses are extranodal. The most common extranodal site is the stomach. Patients who have been treated for NHL have an increased risk of developing secondary malignancies, including acute myeloid leukemia, CLL, and solid tumors of various types. Epidemiologic studies performed in large series have shown the possibility of secondary CML occurrence in cases of HD, NHL, and various solid tumors [5,6,7,8,9]. Usually, the median latency of time between the 2 diseases was 60 months, and the majority of the patients were diagnosed with CML in the chronic phase. Secondary CML characteristics were similar to those of de novo cases in a series by Bauduer et al. [5]; however, another report suggested a lower incidence of splenomegaly and hyperleukocytosis associated with therapy-related CML. Whang-Peng et al. [10] reported secondary leukemia in patients with different types of malignancies. CML was observed in 8 patients. In 1 patient, CML developed after treatment for NHL. The remaining patients had cancer of the breast, CLL, HD, or acute lymphoblastic leukemia. Several explanations appear possible for the occurrence of CML in DLBCL. CML is a disease of the pluripotent stem cells that involves not only myeloid but also lymphoid cell compartments. First, the cytostatic drugs used in treatment of DLBCL may be directly involved in the pathogenesis of CML. Second, therapy-induced immune dysregulation, such as radiotherapy, may contribute to the evolution of CML. Third, theoretically but not yet proven, the neoplastic transformation of a progenitor cell, capable of differentiation into either lymphoid or myeloid cell lines, might lead to the association of lymphoproliferative and myeloproliferative disorders. Therefore, it might have been likely that the Bcrabl rearrangement was present in the DLBCL cells [2]. Secondary CML patients receiving treatment for NHL that have been reported so far are presented in Table 1. In

all patients, prior chemotherapy and/or radiotherapy and latency time between the 2 diseases strongly suggested the secondary nature of CML [7,10,11,12,13,14]. On the other hand, this case report implies that patients treated for NHL require close follow-up for years after completing therapy. In conclusion, patients with lymphoproliferative malignancies like DLBCL can present many years later after successful treatment of their disease with a clonal myeloproliferative disease like CML. Molecularly targeted therapy with tyrosine kinase inhibitors seems to be effective and well tolerated in patients with secondary CML. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Key Words: Lymphoma, Chronic myeloid leukemia, Secondary malignancy Anahtar Kelimeler: Lenfoma, Kronik myeloid lösemi, Sekonder malignite References 1. Alsop S, Sanger WG, Elenitoba-Johnson KS, Lim MS. Chronic myeloid leukemia as a secondary malignancy after ALK-positive anaplastic large cell lymphoma. Hum Pathol 2007;38:1576-1580. 2. Specchia G, Buquicchio C, Albano F, Liso A, Pannunzio A, Mestice A, Rizzi R, Pastore D, Liso V. Non-treatment-related chronic myeloid leukemia as a second malignancy. Leuk Res 2004;28:115-119. 3. Ramanarayanan J, Dunford LM, Baer MR, Sait SN, Lawrence W, McCarthy PL. Chronic myeloid leukemia after treatment of lymphoid malignancies: response to imatinib mesylate and favorable outcomes in three patients. Leuk Res 2006;30:701-705. 93

Turk J Hematol 2014;31:92-94

Demiriz ŞI: Chronic Myeloid Leukemia as a Secondary Malignancy Following Treatment of Diffuse Large B-Cell Lymphoma

4. Maher VE, Gill L, Townes PL, Wallace JE, Savas L, Woda BA, Ansell JE. Simultaneous chronic lymphocytic leukemia and chronic myelogenous leukemia. Evidence of a separate stem cell origin. Cancer 1993;71:1993-1997.

10. Whang-Peng J, Young RC, Lee EC, Longo DL, Schechter GP, DeVita VT. Cytogenetic studies in patients with secondary leukemia/dysmyelopoietic syndrome after different treatment modalities. Blood 1988;71:403-414.

5. Bauduer F, Ducout L, Dastugue N, Marolleau JP. Chronic myeloid leukemia as a secondary neoplasm after anti-cancer radiotherapy: a report of three cases and a brief review of the literature. Leuk Lymphoma 2002;43:1057-1060.

11. Mele L, Pagano L, Equitani F, Chiusolo P, Rossi E, Zini G, Teofili L, Leone G. Lymphoid blastic crisis in Philadelphia chromosome positive chronic granulocytic leukemia following high-grade non-Hodgkin’s lymphoma. A case report and review of literature. Haematologica 2000;85:544547.

6. Zahra K, Ben Fredj W, Ben Youssef Y, Zaghouani H, Chebchoub I, Zaier M, Badreddine S, Braham N, Sennana H, Khelif A. Chronic myeloid leukemia as a secondary malignancy after lymphoma in a child. A case report and review of the literature. Onkologie 2012;35:690-693. 7. Bolaños-Meade J, Sarkodee-Adoo C, Khanwani SL. CML after treatment for lymphoid malignancy: therapy-related CML or coincidence? Am J Hematol 2002;71:139. 8. Verhoef GEG, Demuynck H, Stul MS, Cassiman JJ. Philadelphia chromosome-positive chronic myelogenous leukemia in treated Hodgkin’s disease. Cancer Genet Cytogenet 1990;49:171-176. 9. Boivin IF, O’Brien K. Solid cancer risk after treatment of Hodgkin’s disease. Cancer 1988;61:2541-2546.

12. Cazzola M, Bergamaschi G, Melazzini M, Ponchio L, Rosti V, Molinari E. Chronic myelogenous leukemia following radiotherapy and chemotherapy for non-Hodgkin lymphoma. Haematologica 1990;75:477-479. 13. Breccia M, Martelli M, Cannella L, Russo E, Finolezzi E, Stefanizzi C, Levi A, Frustaci A, Alimena G. Rituximab associated to imatinib for coexisting therapy-related chronic myeloid leukaemia and relapsed non-Hodgkin lymphoma. Leuk Res 2008;32:353-355. 14. Auerbach HE, Stelmach T, LaGuette JG, Glick JH, Kant JA, Nowell PC. Secondary Ph-positive CML with a minority monosomy 7 clone. Cancer Genet Cytogen 1987;28:173178.

DOI: 10.4274/Tjh.2013.0247

Letter to Editor

Acute Myocardial Infarction after First Dose of Rituximab Infusion İlk Doz Rituksimab İnfüzyonu Sonrasında Gelişen Akut Miyokard İnfarktüsü Ajay Gogia, Sachin Khurana, Raja Paramanik B. R. A. Institute Rotary Cancer Hospital, All India Institute of Medical Sciences, Department of Medical Oncology, New Delhi, India

To the Editor, Rituximab (anti-CD20) is a chimeric monoclonal antibody and is commonly used in treatment of various lymphomas and nonmalignant immune disorders. Infusion reactions are common following rituximab administration. Cardiotoxicity with rituximab is less frequent, but occasionally arrhythmia is reported. We report here an acute myocardial infarction following the first rituximab infusion for the treatment of splenic lymphoma with villous lymphocytes (SLVL). A previously healthy 65-year-old male presented to our hospital in May 2013 with a 6-month history of fatigue and a feeling of fullness over the left side of his abdomen. Clinical examination revealed ECOG performance status of 1 at the time of first visit, mild pallor, and massive splenomegaly (12 cm below the costal margin). His hemogram showed a hemoglobin level of 10.5 g/dL, total leukocyte count of 3.4x109/L, and platelet count of 50x109/L. Peripheral blood smear examination showed normochromic normocytic anemia and leucopenia with normal differential count. Renal and liver functions were within normal limits. Coomb’s test results were negative and there were no features of hemolysis. Electrocardiogram and 2D echo results were normal. Further diagnostic and staging workup including bone marrow biopsy, touch, and imaging revealed stage IV splenic lymphoma with villous lymphocytes. It was planned to start BR (bendamustine and rituximab) combination

chemo/immunotherapy, in which rituximab was the initial therapy. Rituximab was administered as per standard prescribing recommendations with acetaminophen, diphenhydramine, and steroids. The patient complained of uneasiness and sweating for a few minutes after 5 min of controlled infusion. Electrocardiogram revealed ST elevation in inferior leads, which did not subside even after stopping the rituximab infusion. The troponin T level was elevated. The patient was shifted to the coronary care unit (CCU) and angiography showed a complete thrombotic occlusion of the right coronary artery, in the absence of abnormalities in the other coronary arteries. Angioplasty was done and he was discharged from the CCU after 2 days in stable condition. Rituximab is generally well tolerated if given with adequate premedication. Grade 1/2 infusion-related drug reactions are well known, which include fever, chills, hypotension, and dyspnea; pretreatment with acetaminophen, antihistamines, and, on occasion, corticosteroids minimizes these symptoms. Cardiovascular toxicities described with rituximab include tachycardia, hypotension, hypertension, hypoxemia, arrhythmias, bradycardia, and atrial fibrillation. Myocardial infarction as a complication of rituximab infusion is listed in the package insert but is not clearly described in the literature [1]. Myocardial infarction after rituximab infusion is extremely rare and was described in only 4 cases of lymphoid malignancy (Table 1) and 2 cases of immune-

Address for Correspondence: Ajay GogIa M.D., B. R. A. Institute Rotary Cancer Hospital, All India Institute of Medical Sciences, Department of Medical Oncology, New Delhi, India E-mail: ajaygogia@gmail.com Received/Geliş tarihi Accepted/Kabul tarihi

: July 12, 2013 : September 04, 2013

Gogia A, et al: Acute Myocardial Infarction after First Dose of Rituximab Infusion

Turk J Hematol 2014;31:95-96

Table 1. Patients with acute myocardial infarction after first infusion of rituximab in lymphoid malignancies.

Reference

Age Sex Diagnosis

Cardiac enzymes

Outcome

Armitage et al. [2]

Chronic lymphocytic leukemia

Increased

Recovered

Armitage et al. [2]

Burkitt lymphoma

Increased

Recovered

Armitage et al. [2]

Burkitt-like lymphoma

Increased

Died

Arunprasath et al. [3]

Diffuse large B-cell lymphoma

Increased

Recovered

Present case

Splenic lymphoma with villous lymphocytes

Increased

Recovered

mediated disorders [2,3,4]. The proposed mechanism for Acute Coronary syndrome following rituximab infusion is the release of cytokines, which cause vasoconstriction, platelet activation, and/or rupture of atherosclerotic plaque [5]. In our case it is likely that the patient had preexisting vulnerable plaque in light of his advanced age as a risk factor. Meticulous screening for ischemic heart disease may be necessary in high-risk subsets before starting rituximab therapy. Awareness of this complication is important to minimize the risk of treatment-related morbidity. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Key Words: Myocardial infarction after rituximab Anahtar Kelimeler: Rituximab’den sonra myokard infarktı

References 1. Genentech. Rituxan® (Rituximab) [Prescribing Information]. South San Francisco, CA, USA: Genentech; 2001. 2. Armitage JD, Montero C, Benner A, Armitage JO, Bociek G. Acute coronary syndromes complicating the first infusion of rituximab. Clin Lymphoma Myeloma 2008;8:253-255. 3. Arunprasath P, Gobu P, Dubashi B, Satheesh S, Balachander J. Rituximab induced myocardial infarction: a fatal drug reaction. J Cancer Res Ther 2011;7:346-348. 4. van Sijl AM, van der Weele W, Nurmohamed MT. Myocardial infarction after rituximab treatment for rheumatoid arthritis: is there a link? Curr Pharm Des 2013 [Epub ahead of print]. 5. Winkler U, Jensen M, Manzke O. Cytokine-release syndrome in patients with B-cell chronic lymphocytic leukemia and high lymphocyte counts after treatment with an anti-CD20 monoclonal antibody (rituximab, IDEC-C2B8). Blood 1999;94:2217-2224.

DOI: 10.4274/TJH.2012.0202

Letter to the Editor

An Updated Review of Abnormal Hemoglobins in the Turkish Population Anormal Hemoglobinlerin Türk Popülasyonunda Güncellenmesi Nejat Akar TOBB-ETU Hospital, Ankara, Turkey

To the Editor, Two previous reviews by Altay and Akar concerning the “Abnormal Hemoglobins in Turkey” appeared in the journal several years ago [1,2]. Since then, several other variants have been reported in both international and national journals. The aim of this mini-review was to compile the newly published abnormal hemoglobins in the Turkish population since these two previous papers [1,2]. During the last five years, several variants, each belonging to one family, confirmed with DNA sequencing were reported (Table 1) [3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20, 21,22]. Two further new variants (Hb İzmir and Hb Edirne) was reported in Turkish population for the first time [18,21]. It is interesting that although almost six decades had passed since the first determination of a hemoglobin variant, there are still reports on hemoglobin variants mainly related to clinical and genetic counselling. Altay and Akar pointed out that the exact number of subjects having abnormal hemoglobins in Turkish population is not known due to the absence of a national registry system for these conditions [1,2]. So a national registry system collecting clinical and molecular data is needed. This aim can be achieved under the auspices of the Turkish Hematology Association. Conflict of Interest Statement The author of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Key Words: Hemoglobin, Variant, Hemoglobinopathy Anahtar Kelimeler: Hemoglobin, Varyant, Hemoglobinopati

Table 1. Abnormal hemoglobin variants in the Turkish population published since 2007. a. Variants of the alpha chain (single base changes) Hb Adana alpha 2(59)(E8)Gly-->Asp Hb Westeinde [α125(H8)Leu→Gln combined with α2 IVS-I (-5 nt) deletion Hb Q-Iran [a 75 (EF4) Asp-His] b. Variants of the beta chain (single base changes) Hb South Florida [beta 1(NA1) Val>Met Hb Yaizu [beta 79(EF3) Asp>Asn] Hb Sarrebourg [β131(H9)Gln→Arg, CAG>CGG] Hb Crete [Beta129(H7) Ala>Pro] Hb Izmir [β86(F2)Ala→Val, GCC>GTC Hb E Saskatoon (B22 Glu-Lys) Hb Ernz [β123(H1) Thr>Asn] Hb D Punjab [B121 Glu-Gln] Hb Beograd [B121 Glu-Val] Hb G-Coushatta [B22 (B4) Glu-Ala] Hb M Saskatoon (ß63 (E7) His>Tyr(C-T)) c. Variants of the delta chain (single base changes) Hb Noah Mehmet Oeztuerk delta143 (H21) His-->Tyr Hb A2 Yialousa (D82 C-T Ala28Ser) d. Abnormal hemoglobin variants that have been Reported in compound heterozygote state with thalassemia or sickle cell Hb Ernz [β123(H1) Thr>Asn]

Address for Correspondence: Nejat Akar, M.D., TOBB-ETU Hospital, Ankara, Turkey E-mail: nejatakar@hotmail.com Received/Geliş tarihi : December 20, 2012 Accepted/Kabul tarihi : January 10, 2013

Akar N: An Update Review of Abnormal Hemoglobins in Turkish Population

Turk J Hematol 2014;31:97-98

References 1. Altay Ç. Abnormal hemoglobins in Turkey. Turk J Hematol 2002;19:63-74. 2. Akar E, Akar N. A review of abnormal hemoglobins in Turkey. Turk J Hematol 2007;24:143-145 3. Atalay A, Koyuncu H, Köseler A, Ozkan A, Atalay EO.Hb Beograd [beta121(GH4)Glu-->Val, GAA-->GTA] in the Turkish population. Hemoglobin 2007;31:491-493. 4. Atalay EO, Atalay A, Ustel E, Yildiz S, Oztürk O, Köseler A, Bahadir A.Genetic origin of Hb D-Los Angeles [beta121(GH4) Glu-->Gln, GAA-->CAA] according to the beta-globin gene cluster haplotypes. Hemoglobin 2007;31:387-391. 5. Bissé E, Schaeffer C, Hovasse A, Preisler-Adams S, Epting T, Baumstark M, Van Dorsselaer A, Horst J, Wieland H.Haemoglobin Noah Mehmet Oeztuerk (alpha(2) delta(2)143 (H21)His-->Tyr: A novel delta-chain variant in the 2,3-DPG binding site. J Chromatogr B Analyt Technol Biomed Life Sci 2008;871:55-59. 6. Koseler A, Bahadır A, Koyuncu H, Atalay A, Atalay AO. First observation of Hb D-Ouled Rabah [beta19(B1)Asn>Lys] in the Turkish population. Turk J Hematol 2008;25:51-53. 7. Atalay EO, Atalay A, Koyuncu H, Oztürk O, Köseler A, Ozkan A, Demirtepe S. Rare hemoglobin variant Hb Yaizu observed in Turkey. Med Princ Pract 2008;17:321-324. 8. Kaufmann JO, Phylipsen M, Neven C, Huisman W, van Delft P, Bakker-Verweij M, Arkesteijn SG, Harteveld CL, Giordano PC. Hb St. Truiden [’68(E17)Asn’His] and Hb Westeinde [’125(H8)Leu’Gln]: two new abnormalities of the α2globin gene. Hemoglobin 2010;34:439-444. 9. Keser I, Yeşilipek A, Canatan D, Lülec G. Abnormal hemoglobins associated with the beta-globin gene in Antalya province, Turkey. Turk J M Sci 2010:40:127-131. 10. Köseler A, Koyuncu A, Öztürk O, Bahadır A, Demirtepe S, Atalay A. First observation of Hb Tunis [beta124(H2) Pro>Ser] in Turkey. Turk J Hematol 2010;27:120-122. 11. Curuk MA, Cavusoglu AÇ, Arıcan H, Uzuncan N, Karaca B. Hb Sarrebourg [β131(H9)Gln→Arg, CAG>CGG] in Turkey. Hemoglobin 2010;34:572-575.

12. Zur B, Hildesheim A, Ludwig M, Stoffel-Wagner BA. First report on Hb Q-Iran in association with alpha-thalassemia in a case of spinal ischemia. Clin Lab 2011;57:221-224. 13. Arslan C, Kahraman S, Özsan H, Akar N. First observation of hemoglobin Crete [Beta129(H7) Ala>Pro] in the Turkish population |. Turk J Hematol 2011;28:346-347. 14. Genç A, Çürük MA. Two rare hemoglobin variants in the Çukurova Region of Turkey: Hb E-Saskatoon and Hb G-Coushatta. Turk J Hematol 2011;28:323-326. 15. Akar N, Arslan Ç, Kürekçi E. First Observation of Hemoglobin M Saskatoon (ß63 (E7) His>Tyr(C-T)) in the Iraqi Population Turk J Hematol 2012:36;287-288. 16. Köseler A, Atalay A, Atalay E Ö. HbA2-Yokoshima (delta 25(B7)Gly >Asp) and Hb A2-Yialousa (delta 27(B9)Ala>Ser) in Turkey. Turk J Hematol 2012:36;289-290. 17. Genc A, Tastemir Korkmaz D, Urhan Kucuk M, Rencuzogullari E, Atakur S, Bayram S, Onderci M, Koc T, Aslan S, Mutalip A, Faruk M, Sevgiler Y, Tuncdemir A. Prevalence of beta-thalassemia trait and abnormal hemoglobins in the province of Adıyaman, Turkey. Pediatr Hematol Oncol. 2012 ;29:620-3. 18. Celebiler A, Aksoy D, Ocakcı S, Karaca B.A new hemoglobin Variant: Hb Izmir [beta’86(F2)Ala’Val, GCC>GTC; HBB:c.260C>T. Hemoglobin 2012;36:474-479. 19. Gunesacar R, Celik MM, Ozturk OH, Celik M, Tümer C, Celik T. Investigation of the clinical and hematological significance of the first observed hemoglobin Ernz variant [β123(H1) Thr>Asn] in the Turkish population. Turk J Med Sci 2012;42(Suppl 2):1471-1475. 20. Aslanger AD, Akbulut A, Tokgöz G, Türkmen S, Yararbaş K. First Observation of Hb South Florida [beta 1(NA1) Val>Met] in Turkey Turk J Hematol 2013;37:223-224. 21. Tabakçıoğlu K, Demir M. Hb-Edirne: A NewdChain Variant: [d53 (D4)Asp> His; HBD c. 160G>C]. Hemoglobin, 2013. 22. Durmaz AA, Akin H, Ekmekci AY, Onay H, Durmaz B, Cogulu O, Aydinok Y, Ozkinay F.A severe alpha thalassemia case compound heterozygous for Hb Adana in alpha1 gene and 20.5 kb double gene deletion. J Pediatr Hematol Oncol. 2009 ;31(8):592-4.

DOI: 10.4274/Tjh.2013.0207

Letter to the Editor

Lenalidomide-Induced Pure Red Cell Aplasia Lenalidomid ile Uyarılmış Eritroid Dizi Aplazisi Tuphan Kanti Dolai, Shyamali Dutta, Prakas Kumar Mandal, Sandeep Saha, Maitreyee Bhattacharyya NRS Medical College and Hospital, Department of Hematology, Kolkata, India

To the Editor, Pure red cell aplasia (PRCA) is a bone marrow failure disorder. Several drugs have been reported as having induced PRCA, but lenalidomide-induced PRCA is rarely reported. Here we present a patient with myelodysplastic syndrome (MDS) who developed PRCA after treatment with lenalidomide. A 47-year-old male presented with a history of weakness with effort intolerance for 5 months. Examination showed pallor and mild splenomegaly. Blood count showed Hb level of 86 g/L, total WBC count of 5.2x109/L, normal differential counts, and platelet count of 223x109/L. MCV was 101 fL and reticulocyte count was 1%. Serum chemistries were normal. Bone marrow aspiration and biopsy results showed mild hypercellularity with evidence of megaloblastic erythropoiesis and dyserythropoiesis. Cytogenetics showed loss of the Y chromosome. Iron stores were normal. Serum B12, folic acid, and serum ferritin levels were normal. Tests for antinuclear antibodies, HIV-1 and HIV-2 antibodies, hepatitis B surface antigen, and anti-hepatitis C virus were negative. Expressions of CD55 and CD59 on granulocytes were in the normal range. He received vitamin B12 with no success. With the diagnosis of MDS with refractory anemia, he was started on lenalidomide at 5 mg daily. In the next 3 weeks, he presented with severe weakness and the Hb level dropped to 53 g/L with normal WBC and platelets. Reticulocyte count was <1%. Concentrated RBCs were transfused and he was re-evaluated. A repeat bone marrow aspiration and biopsy revealed severely depressed erythropoiesis (erythroid precursors of <5%) and dysplastic megakaryocytes. Parvovirus antibody (IgM) was negative. As there were no other inciting factors for

PRCA, we stopped the lenalidomide. Oral prednisolone at 1 mg/kg was started and given for 8 weeks, with which Hb levels returned to the pre-PRCA range. Repeated aspiration showed normal erythropoiesis with dyserythropoiesis. Steroids were tapered over the next 2 months and the patient is still under follow-up and doing well, with Hb levels ranging between 80 and 95 g/L without transfusion support. Informed consent was obtained. Here we report a patient with MDS who was treated with lenalidomide and developed PRCA, which improved with withdrawal of the drug and treatment with corticosteroids. In the literature to date, only one case has been reported of lenalidomide-induced PRCA [1]. Re-challenging the patient with lenalidomide might have given additional evidence about this phenomenon, but this was not justifiable. The most common offensive drugs are erythropoietin, phenytoin, isoniazid, azathioprine, and zidovudine [2]. The pathogenesis of development of drug-induced PRCA is unknown; it may be due to direct effects of the drug per se, induction of autoimmunity, or specific inhibitory effects on DNA synthesis, probably at the step of deoxyribonucleotide formation [3]. Although there are no guidelines for the management of drug-induced PRCA, discontinuation and steroids may be of benefit [4]. Key Words: Lenalidomide, PRCA, MSD Anahtar Kelimeler: Lenalidomid, PRCA, MDS Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Address for Correspondence: Tuphan Kanti DolaI, M.D., NRS Medical College and Hospital, Department of Hematology, Kolkata, India Phone: +91 3322266118 E-mail: tkdolai@hotmail.com Received/Geliş tarihi : June 14, 2013 Accepted/Kabul tarihi : August 19, 2013

Turk J Hematol 2014;31:99-100

Dolai KT, et al: Lenalidomide-Induced PRCA

References 1. Raza A, Reeves JA, Feldman EJ, Dewald GW, Bennett JM, Deeg HJ, Dreisbach L, Schiffer CA, Stone RM, Greenberg PL, Curtin PT, Klimek VM, Shammo JM, Thomas D, Knight RD, Schmidt M, Wride K, Zeldis JB, List AF. Phase 2 study of lenalidomide in transfusion-dependent, low-risk, and intermediate-1â&#x20AC;&#x201C;risk myelodysplastic syndromes with karyotypes other than deletion 5q. Blood 2008;111:86-93.

100

2. Thompson DF, Gales MA. Drug induced pure red cell aplasia. Pharmacotherapy 1996;16:1002-1008. 3. Fisch P, Handgretinger R, Schaefer HE. Pure red cell aplasia. Br J Haematol 2000;111:1010-1022. 4. Ammus SS, Yunis AA. Acquired pure red cell aplasia. Am J Hematol 1987;24:311-326.

DOI: 10.4274/Tjh.2013.0279

Letter to the Editor

Early Postnatal Hemorrhagic Shock Due to Intraabdominal Hemorrhage in a Newborn with Severe Hemophilia A Yenidoğan Döneminde Intraabdominal Kanama ile Erken Postnatal Hemorajik Şoka Neden Olan Hemofili A Vakası Sara Erol1, Banu Aydın1, Dilek Dilli1, Barış Malbora2, Serdar Beken1, Hasibe Gökçe Çınar3, Ayşegül Zenciroğlu1, Nurullah Okumuş1 1Dr.

Sami Ulus Maternity and Children Training and Research Hospital, Neonatal Intensive Care Unit, Ankara, Turkey Sami Ulus Maternity and Children Training and Research Hospital, Pediatric Hematology Unit, Ankara, Turkey 3Dr. Sami Ulus Maternity and Children Training and Research Hospital, Pediatric Radiology Unit, Ankara, Turkey 2Dr.

To the Editor, Hemophilia A, which is an X-linked recessive disorder, is one of the most common causes of congenital bleeding diathesis in newborns. Four hemophilic newborns with liver hematoma have been reported in the literature [1,2,3]. Herein, we present a newborn with hemophilia A who presented with hemorrhagic shock at the 8th hour of life subsequent to hematoma of the liver. A male infant weighing 3025 g was born via normal vaginal delivery at 39 weeks. He was the first child of a 23-year-old mother. The birth was uneventful and the mother did not have any trauma history. Although the baby was normal at birth, he had severe respiratory distress at the 8th hour of life. On examination, the patient was pale and had poor capillary refill. He had bilateral cephalohematomas of about 3x2.5x2.5 cm in size in the parieto-occipital regions. Ecchymosis was noted on the scrotum and in the left inguinal regions. The parents were found to be firstdegree cousins and family history revealed a maternal uncle with a diagnosis of hemophilia A. Laboratory investigation revealed a hemoglobin 8.5 g/dL, hematocrit 24.8%, leukocyte count 15000/mm3, platelet count 117000/mm3, the prothrombin time was 18 s, international normalized

ratiowas 1.6, and activated partial thromboplastin time was 81 s. Further tests showed a factor VIII level of 0.2%. Abdominal ultrasound showed subcapsular hematoma of 40x30 mm on the posterior right lobe of the liver (Figure 1). Erythrocyte and fresh frozen plasma transfusions were made. He received an injection of vitamin K and continuous recombinant factor VIII infusion. Serial ultrasonographies showed that the size of the liver hematoma was significantly decreased. The patient was discharged from the hospital at 18 days of life and is currently on weekly recombinant factor VIII prophylaxis. Informed consent was obtained. In severe hemophilia A (in which the level of factor VIII activity is less than 1.0% of normal), spontaneous bleeding

Figure 1. A) Hematoma located on posterior segment of the right liver lobe. B) Hypoechoic cystic lesion located on posterior segment of the right liver lobe on axial plane. C) Control ultrasonography revealed hypoechoic hematoma in the subhepatic region.

Address for Correspondence: Serdar Beken, M.D., Dr. Sami Ulus Maternity and Children Training and Research Hospital, Neonatal Intensive Care Unit, Ankara, Turkey Gsm: +90 532 671 31 96 E-mail: serbeken@yahoo.com Received/Geliş tarihi : August 19, 2013 Accepted/Kabul tarihi : September 4, 2013

101

Turk J Hematol 2014;31:101-102

into the joints, soft tissues, and vital organs is frequent [4]. In our patient, the factor VIII level was 0.2% when checked at the 36th hour of life, and he had multiple hematomas without trauma. This situation might be due to birth trauma invaginal delivery. The optimal mode of delivery for a fetus at risk of hemophilia remains the subject of debate due to continuing uncertainty regarding the risk of intracranial and extracranial bleeding; opinions and recommendations vary [5]. Liver hematoma is uncommon in newborns. It has been reported in fetuses and low-birth-weight infants, and it is frequently an autopsy finding [6]. This condition is generally associated with trauma, coagulopathies, hypoxia, sepsis, maternal disease such as preeclampsia, drugs, and placental lesions [7]. In the previous literature, 4 patients were described with presentation of liver hematoma and all were successfully treated with factor VIII concentrates [1,2,3]. Finally, hemophilia may be present with vital organ bleeding in the newborn period. Any neonate with unexplained bleeding, and especially males, should be investigated for hemophilia. Early diagnosis and treatment can be life-saving. Key Words: Newborn, Liver, Hemorrhage, Hemophilia A,

Postnatal hemorrhagic shock, Bleeding

Anahtar Kelimeler: Yenidoğan, Karaciğer, Hemoraji, Hemofili A, Kanama Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

102

Erol S, et al: Newborn Diagnosed with Hemophilia

References 1. Le Pommelet C, Durand P, Laurian Y, Devictor D. Haemophilia A: two cases showing unusual features at birth. Haemophilia 1998;4:122-125. 2. Hamilton M, French W, Rhymes N, Collins P. Liver haemorrhage in haemophilia--a case report and review of the literature. Haemophilia 2006;12:441-443. 3. Anjay MA, Sasidharan CK, Anoop P. Hepatic subcapsular hematoma: two neonates with disparate presentations. Pediatr Neonatol 2012;53:144-146. 4. Bolton-Maggs PH, Pasi KJ. Haemophilias A and B. Lancet 2003;361:1801-1809. 5. Dunkley SM, Russell SJ, Rowell JA, Barnes CD, Baker RI, Sarson MI, Street AM. Australian Haemophilia Centre Directors’ Organisation. A consensus statement on the management of pregnancy and delivery in women who are carriers of or have bleeding disorders. Med J Aust 2009;191:460-463. 6. Singer DB, Neave C, Oyer C, Pinar H. Hepatic subcapsularhaematomas in fetuses and neonatal infants. Pediatr Dev Pathol 1999;2:215-220. 7. Shankaran S, Elias E, Ilagan N. Subcapsular hemorrhage of the liver in the very low birthweight infant. Acta Paediatr Scand 1991;80:616-619.

DOI: 10.4274/Tjh.2013.0218

Letter to the Editor

Severe Adenovirus Infection Associated with Hemophagocytic Lymphohistiocytosis Ağır Adenovirüs Enfeksiyonu ile İlişkili Hemofagositik Lenfohistiyositoz Ferda Özbay Hoşnut1, Figen Özçay1, Barış Malbora2, Şamil Hızlı3, Namık Özbek4 1Başkent

University Faculty of Medicine, Department of Pediatric Gastroenterology, Hepatology, and Nutrition, Ankara, Turkey Sami Ulus Research and Training Hospital of Women’s and Children’s Health and Diseases, Ankara, Turkey 3Dr. Sami Ulus Research and Training Hospital of Women’s and Children’s Health and Diseases, Department of Pediatric Gastroenterology, Hepatology, and Nutrition, Ankara, Turkey 4Başkent University Faculty of Medicine, Department of Pediatric Hematology, Ankara, Turkey 2Dr.

To the Editor, In healthy children adenoviral infection causes a benign, self-limited illness [1]. However, in immunocompromised patients, adenovirus can cause fulminant or disseminated disease such as colitis, pneumonitis, pancreatitis, nephritis, encephalitis, and hemophagocytic lymphohistiocytosis (HLH) [1,2]. Herein, we report the clinical course and the treatment of an infant who had no history of immune defects, familial HLH, or malignant disease and suffered from adenoviral pneumonia with progressive clinical deterioration due to onset of virus-associated HLH. In the literature there are few reports about adenovirus-associated HLH in healthy children. A previously healthy 11-month-old boy was admitted to a state hospital with fever and cough. His chest roentgenogram showed bilateral pneumonic infiltrates. The child was treated with ceftriaxone and amikacin but the pneumonia progressively worsened. Therefore, on the fifth day, his antibiotic therapy was changed to imipenem, amikacin, and vancomycin. The same day, a generalized myoclonic seizure was observed. The seizure was controlled by phenytoin. His liver function test results were elevated and the coagulation profile was deranged. Subsequently he was admitted to our hospital.

On admission, he was confused. There was no response to verbal stimulus but he did respond to localized painful stimulus. His body temperature was 38.9 °C. He was tachypneic with retractions. Coarse crackles were audible in the right hemithorax, and in the left hemithorax, bronchial breathing was heard. The liver was enlarged 5 cm below the right subcostal margin. His spleen was 2 cm below the left subcostal margin. Complete blood count findings were as follows: hemoglobin, 7.1 g/dL; red blood cell distribution width, 18.3%; mean corpuscular volume, 68 fL; mean corpuscular hemoglobin, 18.9 pg; mean corpuscular hemoglobin concentration, 321.5 g/L; leukocyte count, 4.05x109/L; absolute neutrophil count, 1.5x109/L; and platelet count, 79.4x109/L. Microcytic hypochromic anemia was shown in the peripheral blood smear examination. His reticulocyte count and vitamin B12 and folate levels were normal. His direct Coombs test results were negative. Fibrinogen levels were 209 mg/dL (reference range: 200-400). Biochemical findings revealed aspartate aminotransferase level of 641 U/L (reference range: 0-40), alanine aminotransferase of 219 U/L (reference range: 0-41), ferritin of 1820 ng/mL (reference level: 20), and triglyceride of 373 mg/dL (reference range: 35-110). Informed consent was obtained.

Address for Correspondence: Barış Malbora, M.D., Dr. Sami Ulus Research and Training Hospital of Women’s and Children’s Health and Diseases, Ankara, Turkey Phone: +90 312 305 60 00 E-mail: barismalbora@gmail.com Received/Geliş tarihi : June 27, 2013 Accepted/Kabul tarihi : July 08, 2013

103

Turk J Hematol 2014;31:103-105

Chest computerized tomography demonstrated pleural effusion in the left hemithorax and bilateral consolidation. In diagnostic thoracentesis there were no visible pathologic findings. Serologies for chlamydial pneumonia, mycoplasma pneumonia, and respiratory syncytial virus were all negative. On the first day of admission, a localized myoclonic seizure was observed in his right arm. The patient required calciummagnesium therapy because of his low levels of serum calcium and magnesium. Cerebrospinal fluid test showed that the protein and glucose levels were in the normal range with no pleocytosis. Bone marrow aspiration revealed increased numbers of histiocytes and hemophagocytosis (Figure 1). The serum study was positive for anti-adenovirus IgM and IgG. Adenovirus positivity was detected in the serum at 1.3x105 copies/mL by a very sensitive, commercially available realtime PCR assay. These findings indicated that the patient had developed HLH, associated with primary adenovirus infection. Intravenous immunoglobulin (IVIG) was given for 2 days (0.5 g/kg/day). After the second dose of IVIG therapy, his general condition improved. Within 3 days, fever and hepatosplenomegaly disappeared and transaminase levels returned to the normal range. Complete blood count revealed hemoglobin of 10.2 g/dL, leukocyte count of 8.35x109/L, absolute neutrophil count of 3.8x109/L, and platelet count of 151.2x109/L on day 21 of hospitalization. After 24 days, the patient was discharged without any problems. He is currently 27 months old and has no problems. On the tests done to enlighten the etiology of microcytosis, he was diagnosed as iron deficiency anemia. Ferrous sulphate therapy was started with a proper dosing. Although many viruses, such as the Epstein-Barr virus, human immunodeficiency virus, parvovirus, and hepatitis viruses, have been reported to cause infection-associated HLH, severe hemophagocytosis due to acute adenovirus infection is unusual [3]. There have been a limited number of case reports describing adenovirus pneumonia

Hoşnut ÖF, et al: Severe Adenovirus Infection and HLH

complicated with HLH [2,4,5,6]. In these reports, adenoviral pneumonia with HLH was successfully treated with IVIG and clarithromycin, dexamethasone and cyclosporine, or pulse methylprednisolone [2,4,6]. Antiviral treatment with cidofovir or ribavirin in adenovirus infections is being increasingly used, especially in immunocompromised patients; however, the efficacy of these drugs is not established [7,8]. We chose IVIG therapy for treatment of HLH in our patient. Because virus-associated HLH is rare, no certain treatment protocols have been described, and the role of IVIG in the treatment of HLH is unclear [3]. However, several studies have shown the beneficial effect of IVIG. Chen et al. [9] noted remission in only 2 of 9 children with virus-associated HLH treated with IVIG alone. Similarly, Goulder et al. [10] reported a 1-year-old boy with virusassociated HLH successfully treated with IVIG. In our patient, progressive deterioration was reversed into marked improvement after IVIG, suggesting the therapeutic benefit of this treatment. In our patient we were able to control infection-associated HLH with IVIG administration. We wanted to emphasize this good clinical and hematologic response. In conclusion, when a patient suffering from adenovirus is seen with prolonged fever unresponsive to antibiotics, hepatosplenomegaly, and cytopenias, HLH should be considered in the differential diagnosis. Key Words: Acquired hemophagocytic

lymphohistiocytosis, Intravenous immunoglobulin, Adenovirus-associated hemophagocytic lymphohistiocytosis Anahtar Kelimeler: Edinsel hemofagositik lenfohistiyositoz, İntravenöz immunoglobulin, Adenovirus ilişkili hemofagositik lenfohistiyositoz Authors’ Contributions All authors planned and performed experiments and collaboratively wrote the manuscript. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Hough R, Chetwood A, Sinfield R, Welch J, Vora A. Fatal adenovirus hepatitis during standard chemotherapy for childhood acute lymphoblastic leukemia. J Pediatr Hematol Oncol 2005;27:67-72.

Figure 1. Wright staining of a bone marrow smear shows hemophagocytosis. 104

2. Seidel MG, Kastner U, Minkov M, Gadner H. IVIG treatment of adenovirus infection-associated macrophage activation syndrome in a two-year-old boy: case report and review of the literature. Pediatr Hematol Oncol 2003;20:445-451.

HoĹ&#x;nut Ă&#x2013;F, et al: Severe Adenovirus Infection and HLH

3. Fisman DN. Hemophagocytic syndromes and infection. Emerg Infect Dis 2000;6:601-608. 4. Takahashi I, Takahashi T, Tsuchida S, Mikami T, Saito H, Hatazawa C, Takada G. Pulse methylprednisolone therapy in type 3 adenovirus pneumonia with hypercytokinemia. Tohoku J Exp Med 2006;209:69-73. 5. Mistchenko AS, Diez RA, Mariani AL, Robaldo J, Maffey AF, Bayley-Bustamante G, Grinstein S. Cytokines in adenoviral disease in children: association of interleukin-6, interleukin-8, and tumor necrosis factor alpha levels with clinical outcome. J Pediatr 1994;124:714-720. 6. Morimoto A, Teramura T, Asazuma Y, Mukoyama A, Imashuku S. Hemophagocytic syndrome associated with severe adenoviral pneumonia: usefulness of real-time polymerase chain reaction for diagnosis. Int J Hematol 2003;77:295-298.

Turk J Hematol 2014;31:103-105

7. Doan ML, Mallory GB, Kaplan SL, Dishop MK, Schecter MG, McKenzie ED, Heinle JS, Elidemir O. Treatment of adenovirus pneumonia with cidofovir in pediatric lung transplant recipients. J Heart Lung Transplant 2007;26:883889. 8. Gavin PJ, Katz BZ. Intravenous ribavirin treatment for severe adenovirus disease in immunocompromised children. Pediatrics 2002;110;119. 9. Chen CJ, Huang YC, Jaing TH, Hung IJ, Yang CP, Chang LY, Lin TY. Hemophagocytic syndrome: a review of 18 pediatric cases. J Microbiol Immunol Infect 2004;37:157-163. 10. Goulder P, Seward D, Hatton C. Intravenous immunoglobulin in virus associated haemophagocytic syndrome. Arch Dis Child 1990;65:1275-1277.

105

Images in Hematology

DOI: 10.4274/Tjh.012.0194

Image- 1A. Morphology in Hematology

Cystinosis: Diagnostic Role of Bone Marrow Examination Sistinozis: Kemik İliği İncelemesinin Tanısal Rolü

Figure 1. Widespread deposition of crystals in bone marrow fragment.

The patient was a 1.5-year-old boy who presented with growth failure, inability to walk, polyuria, and polydipsia. On physical examination, he had fair skin and blond hair. He did not have organomegaly. Ophthalmologic examination by an ophthalmologist was normal. Hypophosphatemia, hypovitaminosis D, mild acidosis, glucosuria, proteinuria, and generalized aminoaciduria were found upon laboratory studies. He underwent bone marrow aspiration that revealed increased numbers of macrophages containing polygonal crystals. Severe and widespread deposition of crystals in bone marrow particles (Figure 1) was observed, which was pathognomonic for cystinosis. Cystinosis is a rare autosomal recessive disorder caused by a defect in cystine transport outside the lysosomes, leading to accumulation of cystine crystals in various organs including the kidneys, liver, eyes, and brain [1]. It has 3 forms and infantile nephrophatic cystinosis is the most common and most severe type. Clinical manifestations of this variant include polyuria, polydipsia, dehydration, acidosis, rickets, and failure to thrive due to tubular dysfunction and Fanconi’s syndrome [1,2]. The diagnosis is made by observing corneal cystine crystals and/ or measuring the cystine content of leukocytes [1]; however, typical crystals in the bone marrow are diagnostic. Early diagnosis and treatment of these patients can prevent kidney function impairment and other complications secondary to deposition of cystine crystals in various tissues. Informed consent was obtained. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Key words: Cystinosis, Bone marrow, Examination Anahtar Kelimeler: Sistinozis, Kemik iliği, İnceleme

Shahla Ansari, Ghasem Miri-Aliabad, Yousefian Saeed Tehran University of Medical Sciences, Department of Pediatric Hematology-Oncology, Tehran, Iran

Address for Correspondence: Miri-Aliabad Ghasem, M.D., Tehran University of Medical Sciences, Department of Pediatric Hematology-Oncology, Tehran, Iran Phone: +982123046411 E-mail: gh_miri@yahoo.com Received/Geliş tarihi : December 12, 2012 Accepted/Kabul tarihi : January 28, 2013

106

References 1. Gahl WA, Thoene JG, Schneider JA. Cystinosis. N Engl J Med 2002;347:111-121. 2. Gebrail F, Knapp M, Perrotta G, Cualing H. Crystalline histiocytosis in hereditary cystinosis. Arch Pathol Lab Med 2002;126:1135.

Images in Hematology

DOI: 10.4274/Tjh.2012.0170

Image-1B. Morphology in Hematology

Deviation from Normal Values of Leukocyte and Erythroblast Parameters in Complete Blood Count is a Messenger for Platelet Abnormalities Tam Kan Sayımında Lökosit ve Eritroblast Parametrelerinin Normal Değerlerden Sapması Trombosit Anormallikleri için bir Habercidir

Automated blood cell counters have undergone a formidable technological evolution owing to the introduction of new physical principles for cellular analysis and the progressive evolution of software [1,2]. The results have been an improvement in analytical efficiency and an increase in information provided with new parameters. A 61-year-old male patient had the diagnosis of diffuse large B-cell lymphoma 6 years ago, and after chemotherapy, he was still in remission. He was hospitalized for high fever, fatigue, acute renal failure, and bibasilar crepitant rales. Complete blood count measured with a Beckman Coulter LH 780 hematology analyzer revealed an uncorrected leukocyte count (UWBC) of 63.5x109/L, leukocyte count (WBC) of 22.1x109/L, erythroblast count (NRBC) of 21.4x109/L, and platelet count of 197x109/L (Figure 1). Upon peripheral blood smear examination, we detected 5% neutrophils, 22% band forms, 61% metamyelocytes, 5% myelocytes, 1% promyelocytes, 2% myeloblasts, 2% lymphocytes, and 2% eosinophils. We also detected rare erythroblasts and large platelets with profuse platelet clumps (Figures 2 ). Routine biochemical analysis revealed high fasting glucose, blood urea nitrogen, creatinine, serum glutamic oxaloacetic transaminase, alkaline phosphatase, direct and indirect bilirubin, albumin, and lactate dehydrogenase. The erythrocyte sedimentation rate was 100 mm/h, and serum ferritin was 2944 ng/mL. High-resolution computed tomography of the thorax revealed bilateral diffuse infiltrations, nodular opacities, right pleural effusion, and mediastinal lymphadenopathies. Clarithromycin and imipenem/cilastatin were administered

Figure 1. Complete blood count.

Cengiz Beyan, Kürşat Kaptan Gülhane Military Medical Academy, Department of Hematology, Ankara, Turkey

Address for Correspondence: Cengiz BEYAN, M.D., Gülhane Military Medical Academy, Department of Hematology, Ankara, Turkey Phone: +90 312 304 41 03 E-mail: cengizbeyan@hotmail.com; cbeyan@gata.edu.tr Received/Geliş tarihi : November 08, 2012 Accepted/Kabul tarihi : January 21, 2013

Figure 2. Peripheral smear. Large platelets with profuse platelet clumps are noteworthy. 107

Turk J Hematol 2014;31:107-108

for a probable diagnosis of pneumonia. Bone marrow examination revealed myeloid hyperplasia but nothing else significant. No endobronchial mass was detected in bronchoscopy, but mucopurulent secretion was present in the right upper and lower lobes. Biopsy reports showed nonneoplastic bronchial mucosa epithelium. Sputum, blood, and urine cultures; sputum mycobacterial examination; and serum galactomannan antigen were all negative. After the general condition, fever, acute renal failure, signs, and symptoms were relieved, the patient was discharged. Informed consent was obtained. When we subtracted the WBC and NRBC from the UWBC (=20.0x109/L), a significanT-cell group was composed of big platelets. It is probable that this ratio was higher than calculated. Rare erythroblasts in the peripheral blood smear with high NRBC values support the idea of large platelets as cellular origin. In fact, the peripheral blood smear revealed large, profuse platelet clumps, contradictory to the platelet count. We conclude that complete blood counts should be examined

108

Beyan C, et al: Images in Hematology

carefully; despite the essential role of automation in the modern hematology laboratory, microscopic control of pathologic samples (i. e. peripheral blood smear) remains indispensable, so much so that in certain cases, it alone is diagnostic. Key words: Blood cell count, Blood platelets, Blood platelet disorders, Peripheral blood smear Anahtar Kelimeler: Kan hücresi sayımı, Kan trombositleri, Kan trombosit bozuklukları, Periferik kan yayması References 1. Briggs C. Quality counts: new parameters in blood cell counting. Int J Lab Hematol 2009;31:277-297. 2. Zandecki M, Genevieve F, Gerard J, Godon A. Spurious counts and spurious results on haematology analysers: a review. Part II: white blood cells, red blood cells, haemoglobin, red cell indices and reticulocytes. Int J Lab Hematol 2007;29:21-41.

MRI in Hematology

DOI: 10.4274/Tjh.2012.0191

Image-2.MRI in Hematology

Intrathecal MethotrexateInduced Posterior Reversible Encephalopathy Syndrome (PRES) İntratekal Metotreksat İlişkili Posterior Reversible Ensefalopati Sendromu (PRES)

Posterior reversible encephalopathy syndrome (PRES) is an acute neuroradiological diagnosis presenting with headache, vomiting, seizure, abnormalities of the mental status, and visual disturbances associated with a breakdown in cerebral vasculature regulation. It has a unique neuroradiological pattern of symmetrical parietooccipital vasogenic edema [1]. The most common causes of this syndrome are sudden arterial hypertension, preeclampsia, eclampsia, uremia, immunosuppressive drugs, and cancer chemotherapies such as cyclosporine, tacrolimus, L-asparaginase, vincristine, gemcitabine, cytarabine, and cisplatin, typically used in cases of hematopoietic malignancies [2,3,4,5,6,7]. Intrathecal methotrexate-induced PRES in an adult is exceedingly rare [8]. A 43-year-old woman was admitted to gynecology with metrorrhagia. Cervical cancer was diagnosed and radical hysterectomy with lymph node dissection was performed. Final pathology and immunohistochemical analyses revealed B-cell phenotype malign lymphoma, which is consistent with Burkitt lymphoma. A chemotherapy treatment protocol with R-Hyper CVAD, consisting of rituximab, cyclophosphamide, vincristine, adriamycin, and dexamethasone plus 12 mg of intrathecal methotrexate without preservative, was then started. Twelve days after chemotherapy she had severe analgesic-irresponsive headache, nausea, motor agitation, and cooperation failure. Her vital signs and laboratory findings were normal. Cranial computed tomography revealed hypodense areas due to edema in the bilateral cerebral hemispheres, predominantly in the posterior regions. Magnetic resonance imaging (MRI) of the brain showed

Figure 1a. MRI FLAIR images show bilateral multiple subcortical and cortical hyperintense lesions.

Tülay Güler1, Özden Yener Çakmak1, Selami Koçak Toprak2, Seda Kibaroğlu1, Ufuk Can1 1Başkent University School of Medicine, Department of

Neurology, Ankara, Turkey

2Başkent University School of Medicine, Department of

Hematology, Ankara, Turkey

Address for Correspondence: Tülay Güler, M.D., Başkent University School of Medicine, Department of Neurology, Ankara, Turkey Phone: +90 312 212 68 68 E-mail: drtulis@yahoo.com Received/Geliş tarihi : December 04, 2012 Accepted/Kabul tarihi : February 18, 2013

Figure 1b. MRI images 3 weeks after developing PRES revealed significant improvement. 109

Güler T, et al: MRI in Hematology

Turk J Hematol 2014;31:109-110

multiple confluent hyperintense lesions in T2-weighted and fluid-attenuated inverse recovery (FLAIR) sequences (Figure 1a), with no contrast enhancement in T1-weighted sequences. PRES was diagnosed and she was admitted to the intensive care unit (ICU) because of decreased alertness and agitation. Intrathecal methotrexate treatment was discontinued. On the second day in the ICU her blood pressure rose and was then normalized by diltiazem infusion. On the third day in the ICU, myoclonic jerks were seen in all extremities. Levetiracetam was started. Myoclonic symptoms were no longer observed. After treatment she had no neurological symptoms. Three weeks later, cranial MRI showed significantly improved brain lesions (Figure 1b). The 6-month follow-up was uneventful. Informed consent was obtained. During chemotherapy for hematopoietic malignancies, possible causes of neurological symptoms (cerebrovascular disease, metabolic disturbances, neoplasia, and infections) must be excluded by clinical, biological, and imaging findings. During chemotherapy, various types of anticancer drugs are administered, and it is difficult to identify which drug induces PRES. In our case, intrathecal methotrexate treatment was stopped, and the patient’s symptoms were relieved and did not reoccur while her treatment was continued with other anticancer drugs. In treatment, the causal factor must be discontinued. The treatment of overdose of intrathecal methotrexate is dilution and removal from the cerebrospinal fluid with specific antidotal therapy. Leucovorin and anti-inflammatory agents are useful [9]. Although PRES is usually reversible with patient recovery and resolution of the imaging findings, it might be recurrent or result in permanent damage [10,11]. Key words: Posterior reversible encephalopathy syndrome (PRES), Methotrexate, Magnetic resonance imaging, Fluidattenuated inversion recovery Anahtar Kelimeler: Arka geri dönüşümlü ensefalopati sendromu (PRES), Ensefalopati, Metotreksat, Manyetik rezonans görüntüleme, Sıvı zayıflatılmış dönüşüm kazanımı (FLAIR) References 1. Hinchey J, Chaves C, Appignani B, Breen J, Pao L, Wang A, Pessin MS, Lamy C, Mas JL, Caplan LR. A reversible posterior leukoencephalopathy syndrome. N Engl J Med 1996;334:494500.

110

2. Bartynski WS. Posterior reversible encephalopathy syndrome, part 1: fundamental imaging and clinical features. AJNR Am J Neuroradiol 2008;29:1036-1042. 3. Bartynski WS. Posterior reversible encephalopathy syndrome, part 2: controversies surrounding pathophysiology of vasogenic edema. AJNR Am J Neuroradiol 2008;29:1043-1049. 4. Bartynski WS, Zeigler ZR, Shadduck RK, Lister J. Pretransplantation conditioning influence on the occurrence of cyclosporine or FK-506 neurotoxicity in allogeneic bone marrow transplantation. AJNR Am J Neuroradiol 2004;25:261269. 5. Burnett MM, Hess CP, Roberts JP, Bass NM, Douglas VC, Josephson SA. Presentation of reversible posterior leukoencephalopathy syndrome in patients on calcineurin inhibitors. Clin Neurol Neurosurg 2010;112:886-891. 6. Russell MT, Nassif AS, Cacayorin ED, Awwad E, Perman W, Dunphy F. Gemcitabine-associated posterior reversible encephalopathy syndrome: MR imaging and MR spectroscopy findings. Magn Reson Imaging 2001;19:129-132. 7. Tsukamoto S, Takeuchi M, Kawajiri C, Tanaka S, Nagao Y, Sugita Y, Yamazaki A, Kawaguchi T, Muto T, Sakai S, Takeda Y, Ohwada C, Sakaida E, Shimizu N, Yokote K, Iseki T, Nakaseko C. Posterior reversible encephalopathy syndrome in an adult patient with acute lymphoblastic leukemia after remission induction chemotherapy. Int J Hematol 2012;95:204-208. 8. Aradillas E, Arora R, Gasperino J. Methotrexate-induced posterior reversible encephalopathy syndrome. J Clin Pharm Ther 2011;36:529-536. 9. Vezmar S, Becker A, Bode U, Jaehde U. Biochemical and clinical aspects of methotrexate neurotoxicity. Chemotherapy 2003;49:92-104. 10. Hagemann G, Ugur T, Witte OW, Fitzek C. Recurrent posterior reversible encephalopathy syndrome (PRES). J Hum Hypertens 2004;18:287-289. 11. Antunes NL, Small TN, George D, Boulad F, Lis E. Posterior leukoencephalopathy syndrome may not be reversible. Pediatr Neurol 1999;20:241-243.

Advisory Board of This Issue (March 2014) Ahmet Emre Eşkazan, Turkey Ana Boban, Croatia Aytemiz Gürgey, Turkey Barbara Bain, United Kingdom Bülent Kantarcıoğlu, Turkey Çağlar Berk, Turkey Can Boğa, Turkey Dilber Talia İleri, Turkey Edit Bardi, Hungary Elif Ünal, Turkey Engin Kelkitli, Turkey Engin Özcivici, Turkey Fatih Mehmet Azık, Turkey Fatih Mehmet Erdur, Turkey Feride Duru, Turkey Feridun Acar, Turkey

Ferit Avcu, Turkey Friedrich Stölzel, Germany Giorgia Saccullo, Italy Güldane Seval Cengiz, Turkey Gülderen Yanıkkaya Demirel, Turkey Güray Saydam, Turkey Hamdi Akan, Turkey Hava Teke, Turkey Hülya Ellidokuz, Turkey Lale Olcay, Turkey Mehmet Ali Erkurt, Turkey Mehmet Yılmaz, Turkey Meryem Albayrak, Turkey Mualla Çetin, Turkey Muhlis Cem Ar, Turkey

Mustafa Pehlivan, Turkey Muzaffer Demir, Turkey Muzaffer Keklik, Turkey Nurcan Arat, Turkey Olga Meltem Akay, Turkey Reyhan Diz Küçükkaya, Turkey Şule Ünal, Turkey Tülay Kansu, Turkey Tunç Fışgın, Turkey Türkan Patıroğlu, Turkey Ülker Koçak, Turkey Utpal Chaudhuri, India Yeşim Aydınok, Turkey Yi Le, USA Zeynep Gözde Özkan, Turkey