Tjh 2017 3 by LookUs Scientific

Issue 3

September 2017

80 TL

ISSN 1300-7777

Volume 34

Research Articles Abnormal mRNA Expression Levels of Telomere-Binding Proteins Represent Biomarkers in Myelodysplastic Syndromes: A Case-Control Study Baoshan Liu, et al.; Tianjin, Jinan, China

Prognostic Value of miRNA-155 Expression in B-Cell Non-Hodgkin Lymphoma Ahmed M. L. Bedewy, et al.; Alexandria Governorate, Egypt

Comparative Analyses of Immunosuppressive Characteristics of Bone-Marrow, Wharton’s Jelly, and Adipose Tissue-Derived Human Mesenchymal Stem Cells Erdal Karaöz, et al.; İstanbul, Eskişehir, Turkey

The Assessment of CD56 and CD117 Expressions at the Time of the Diagnosis in Multiple Myeloma Patients Funda Ceran, et al.; Ankara, Turkey

Clinical Outcomes Related to the Use of Bendamustine Therapy for Multiple Myeloma Patients Relapsed/Refractory to Immunomodulatory Drugs and Proteasome Inhibitors Fevzi Fırat Yalnız, et al.; İstanbul, Turkey

Primary Thrombophilia in Mexico XII: Miscarriages Are More Frequent in People with Sticky Platelet Syndrome Guillermo J. Ruiz-Delgado, et al.; Puebla, Mexico

A Randomized Comparison of Hemoglobin Content-Based Versus Standard (Unit-Based) Red Blood Cell Transfusion Policy Erden Atilla, et al.; Ankara, Turkey

Cover Picture: Kuenzang Dorji et al. Microscopic Image of Leishman-Donovan Bodies

Editor-in-Chief

International Review Board

Reyhan Küçükkaya

Nejat Akar Görgün Akpek  Serhan Alkan  Çiğdem Altay  Koen van Besien  Ayhan Çavdar M. Sıraç Dilber  Ahmet Doğan  Peter Dreger  Thierry Facon Jawed Fareed  Gösta Gahrton  Dieter Hoelzer  Marilyn Manco-Johnson Andreas Josting Emin Kansu  Winfried Kern  Nigel Key  Korgün Koral Abdullah Kutlar Luca Malcovati  Robert Marcus  Jean Pierre Marie Ghulam Mufti Gerassimos A. Pangalis Antonio Piga Ananda Prasad Jacob M. Rowe Jens-Ulrich Rüffer Norbert Schmitz Orhan Sezer  Anna Sureda Ayalew Tefferi Nükhet Tüzüner Catherine Verfaillie Srdan Verstovsek Claudio Viscoli

TOBB Economy Technical University Hospital, Ankara, Turkey Maryland School of Medicine, Baltimore, USA  Cedars-Sinai Medical Center, USA  Ankara, Turkey Chicago Medical Center University, Chicago, USA Ankara, Turkey  Karolinska University, Stockholm, Sweden  Mayo Clinic Saint Marys Hospital, USA Heidelberg University, Heidelberg, Germany Lille University, Lille, France  Loyola University, Maywood, USA  Karolinska University Hospital, Stockholm, Sweden Frankfurt University, Frankfurt, Germany Colorado Health Sciences University, USA  University Hospital Cologne, Cologne, Germany  Hacettepe University, Ankara, Turkey  Albert Ludwigs University, Germany  University of North Carolina School of Medicine, NC, USA Southwestern Medical Center, Texas, USA Georgia Health Sciences University, Augusta, USA  Pavia Medical School University, Pavia, Italy  Kings College Hospital, London, UK  Pierre et Marie Curie University, Paris, France  King’s Hospital, London, UK  Athens University, Athens, Greece  Torino University, Torino, Italy  Wayne State University School of Medicine, Detroit, USA Rambam Medical Center, Haifa, Israel  University of Köln, Germany  AK St Georg, Hamburg, Germany  Memorial Şişli Hospital, İstanbul, Turkey  Santa Creu i Sant Pau Hospital, Barcelona, Spain  Mayo Clinic, Rochester, Minnesota, USA  İstanbul Cerrahpaşa University, İstanbul, Turkey  University of Minnesota, Minnesota, USA The University of Texas MD Anderson Cancer Center, Houston, USA San Martino University, Genoa, Italy

Past Editors Erich Frank Orhan Ulutin Hamdi Akan Aytemiz Gürgey

Language Editor Leslie Demir

Senior Advisory Board Yücel Tangün Osman İlhan Muhit Özcan Teoman Soysal

Editorial Office İpek Durusu Bengü Timoçin

İstanbul, Turkey rkucukkaya@hotmail.com

Associate Editors Ayşegül Ünüvar

İstanbul University, İstanbul, Turkey aysegulu@hotmail.com

Cengiz Beyan TOBB University of Economics and Technology, Ankara, Turkey cengizbeyan@hotmail.com

Hale Ören

Dokuz Eylül University, İzmir, Turkey hale.oren@deu.edu.tr

İbrahim C. Haznedaroğlu

Hacettepe University, Ankara, Turkey haznedar@yahoo.com

M. Cem Ar

İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey mcemar68@yahoo.com

Selami Koçak Toprak

Ankara University, Ankara, Turkey sktoprak@yahoo.com

Semra Paydaş

Çukurova University, Adana, Turkey sepay@cu.edu.tr

Assistant Editors A. Emre Eşkazan

İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey

Ali İrfan Emre Tekgündüz

Dr. A. Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey

Elif Ünal İnce

Ankara University, Ankara, Turkey

İnci Alacacıoğlu

Dokuz Eylül University, İzmir, Turkey

Müge Sayitoğlu

İstanbul University, İstanbul, Turkey

Nil Güler

Ondokuz Mayıs University, Samsun, Turkey

Olga Meltem Akay

Koç University, İstanbul, Turkey

Şule Ünal

Hacettepe University, Ankara, Turkey

Veysel Sabri Hançer

İstinye University, İstanbul, Turkey

Zühre Kaya

Gazi University, Ankara, Turkey

A-I

Publishing Services

Statistic Editor Hülya Ellidokuz

GALENOS PUBLISHER Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya E-mail : rkucukkaya@hotmail.com

All Inquiries Should be Addressed to TURKISH JOURNAL OF HEMATOLOGY Address Phone Fax E-mail

: İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No: 8 06550 Çankaya, Ankara / Turkey : +90 312 490 98 97 : +90 312 490 98 68  : info@tjh.com.tr

ISSN: 1300-7777

Publishing Manager Sorumlu Yazı İşleri Müdürü Güner Hayri Özsan

Management Address Yayın İdare Adresi

Publishing House / Yayınevi

Türk Hematoloji Derneği İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No: 8 06550 Çankaya, Ankara / Turkey

Molla Gürani Mah. Kaçamak Sk. No: 21, 34093 Fındıkzade, İstanbul, Turkey Tel: +90 212 621 99 25 Faks: +90 212 621 99 27 E-posta: info@galenos.com.tr Baskı: Özgün Ofset Ticaret Ltd. Şti.

Online Manuscript Submission

Yeşilce Mah. Aytekin Sk. No: 21 34418 4. Levent / İstanbul

http://mc.manuscriptcentral.com/tjh

Printing Date / Basım Tarihi 01.08.2017

Web page www.tjh.com.tr

Cover Picture

Ahmet Muzaffer Demir

Kuenzang Dorji et al., Microscopic Image of Leishman-Donovan Bodies in Bone Marrow Aspirate Smear of Patient Suffering from Unexplained Intermittent Low-Grade Fever and Cough

Üç ayda bir yayımlanan İngilizce süreli yayındır. International scientific journal published quarterly.

Bone marrow aspirate smear showing intracellular and extracellular (inset) Leishman-Donovan bodies. Leishman-Giemsa stain, 1000x.

Owner on behalf of the Turkish Society of Hematology Türk Hematoloji Derneği adına yayın sahibi

Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish Journal of Hematology’nin Türk Hematoloji Derneği İktisadi İşletmesi tarafından yayınlanmasına karar vermiştir.

A-II

AIMS AND SCOPE The Turkish Journal of Hematology is published quarterly (March, June, September, and December) by the Turkish Society of Hematology. It is an independent, non-profit peer-reviewed international English-language periodical encompassing subjects relevant to hematology. The Editorial Board of The Turkish Journal of Hematology adheres to the principles of the World Association of Medical Editors (WAME), International Council of Medical Journal Editors (ICMJE), Committee on Publication Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and Strengthening the Reporting of Observational Studies in Epidemiology (STROBE). The aim of The Turkish Journal of Hematology is to publish original hematological research of the highest scientific quality and clinical relevance. Additionally, educational material, reviews on basic developments, editorial short notes, images in hematology, and letters from hematology specialists and clinicians covering their experience and comments on hematology and related medical fields as well as social subjects are published. As of December 2015, The Turkish Journal of Hematology does not accept case reports. Important new findings or data about interesting hematological cases may be submitted as a brief report. General practitioners interested in hematology and internal medicine specialists are among our target audience, and The Turkish Journal of Hematology aims to publish according to their needs. The Turkish Journal of Hematology is indexed, as follows: - PubMed Medline - PubMed Central - Science Citation Index Expanded - EMBASE - Scopus - CINAHL - Gale/Cengage Learning - EBSCO - DOAJ - ProQuest - Index Copernicus - Tübitak/Ulakbim Turkish Medical Database - Turk Medline Impact Factor: 0.686 Open Access Policy Turkish Journal of Hematology is an Open Access journal. This journal provides immediate open access to its content on the principle that making research freely available to the public supports a greater global exchange of knowledge. Open Access Policy is based on the rules of the Budapest Open Access Initiative (BOAI) http://www.budapestopenaccessinitiative.org/. Subscription Information  The Turkish Journal of Hematology is sent free-of-charge to members of Turkish Society of Hematology and libraries in Turkey and abroad. Hematologists, other medical specialists that are interested in hematology, and academicians could subscribe for only 40 $ per printed issue. All published volumes are available in full text free-of-charge online at www. tjh.com.tr.

A-III

Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97  Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh  Web page: www.tjh.com.tr  E-mail: info@tjh.com.tr   Permissions  Requests for permission to reproduce published material should be sent to the editorial office. Editor: Professor Dr. Reyhan Küçükkaya Adress: İlkbahar Mah, Turan Günes Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey  Telephone: +90 312 490 98 97  Fax: +90 312 490 98 68  Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh  Web page: www.tjh.com.tr  E-mail: info@tjh.com.tr Publisher Galenos Yayınevi Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey Telephone : +90 212 621 99 25 Fax : +90 212 621 99 27 info@galenos.com.tr Instructions for Authors Instructions for authors are published in the journal and at www.tjh.com.tr Material Disclaimer Authors are responsible for the manuscripts they publish in The Turkish Journal of Hematology. The editor, editorial board, and publisher do not accept any responsibility for published manuscripts. If you use a table or figure (or some data in a table or figure) from another source, cite the source directly in the figure or table legend. The journal is printed on acid-free paper. Editorial Policy Following receipt of each manuscript, a checklist is completed by the Editorial Assistant. The Editorial Assistant checks that each manuscript contains all required components and adheres to the author guidelines, after which time it will be forwarded to the Editor in Chief. Following the Editor in Chief’s evaluation, each manuscript is forwarded to the Associate Editor, who in turn assigns reviewers. Generally, all manuscripts will be reviewed by at least three reviewers selected by the Associate Editor, based on their relevant expertise. Associate editor could be assigned as a reviewer along with the reviewers. After the reviewing process, all manuscripts are evaluated in the Editorial Board Meeting. Turkish Journal of Hematology’s editor and Editorial Board members are active researchers. It is possible that they would desire to submit their manuscript to the Turkish Journal of Hematology. This may be creating a conflict of interest. These manuscripts will not be evaluated by the submitting editor(s). The review process will be managed and decisions made by editor-in-chief who will act independently. In some situation, this process will be overseen by an outside independent expert in reviewing submissions from editors.

TURKISH JOURNAL OF HEMATOLOGY INSTRUCTIONS FOR AUTHORS The Turkish Journal of Hematology accepts invited review articles, research articles, brief reports, letters to the editor, and hematological images that are relevant to the scope of hematology, on the condition that they have not been previously published elsewhere. Basic science manuscripts, such as randomized, cohort, cross-sectional, and case-control studies, are given preference. All manuscripts are subject to editorial revision to ensure they conform to the style adopted by the journal. There is a double-blind reviewing system. Review articles are solicited by the Editorin-Chief. Authors wishing to submit an unsolicited review article should contact the Editor-in-Chief prior to submission in order to screen the proposed topic for relevance and priority. The Turkish Journal of Hematology does not charge any article submission or processing charges. Manuscripts should be prepared according to ICMJE guidelines (http:// www.icmje.org/). Original manuscripts require a structured abstract. Label each section of the structured abstract with the appropriate subheading (Objective, Materials and Methods, Results, and Conclusion). Letters to the editor do not require an abstract. Research or project support should be acknowledged as a footnote on the title page. Technical and other assistance should be provided on the title page. Original Manuscripts Title Page Title: The title should provide important information regarding the manuscript’s content. The title must specify that the study is a cohort study, cross-sectional study, case-control study, or randomized study (i.e. Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability of ferrous succinate tablet formulations without correction for baseline circadian changes in iron concentration in healthy Chinese male subjects: A single-dose, randomized, 2-period crossover study. Clin Ther 2011;33:2054-2059). The title page should include the authors’ names, degrees, and institutional/ professional affiliations and a short title, abbreviations, keywords, financial disclosure statement, and conflict of interest statement. If a manuscript includes authors from more than one institution, each author’s name should be followed by a superscript number that corresponds to their institution, which is listed separately. Please provide contact information for the corresponding author, including name, e-mail address, and telephone and fax numbers. Running Head: The running head should not be more than 40 characters, including spaces, and should be located at the bottom of the title page. Word Count: A word count for the manuscript, excluding abstract, acknowledgments, figure and table legends, and references, should be provided and should not exceed 2500 words. The word count for the abstract should not exceed 300 words.

A-IV

Conflict of Interest Statement: To prevent potential conflicts of interest from being overlooked, this statement must be included in each manuscript. In case there are conflicts of interest, every author should complete the ICMJE general declaration form, which can be obtained at www.icmje.org/downloads/coi_disclosure.pdf. Abstract and Keywords: The second page should include an abstract that does not exceed 300 words. For manuscripts sent by authors in Turkey, a title and abstract in Turkish are also required. As most readers read the abstract first, it is critically important. Moreover, as various electronic databases integrate only abstracts into their index, important findings should be presented in the abstract. Objective: The abstract should state the objective (the purpose of the study and hypothesis) and summarize the rationale for the study. Materials and Methods: Important methods should be written respectively. Results: Important findings and results should be provided here. Conclusion: The study’s new and important findings should be highlighted and interpreted. Other types of manuscripts, such as reviews, brief reports, and editorials, will be published according to uniform requirements. Provide 3-10 keywords below the abstract to assist indexers. Use terms from the Index Medicus Medical Subject Headings List (for randomized studies a CONSORT abstract should be provided: http:// www.consort-statement.org). Introduction: The introduction should include an overview of the relevant literature presented in summary form (one page), and whatever remains interesting, unique, problematic, relevant, or unknown about the topic must be specified. The introduction should conclude with the rationale for the study, its design, and its objective(s). Materials and Methods: Clearly describe the selection of observational or experimental participants, such as patients, laboratory animals, and controls, including inclusion and exclusion criteria and a description of the source population. Identify the methods and procedures in sufficient detail to allow other researchers to reproduce your results. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for using them and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. The section should include only information that was available at the time the plan or protocol for the study was devised (http://www.strobe-statement.org/ fileadmin/Strobe/uploads/checklists/STROBE_checklist_v4_combined. pdf). Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify

the reported results. Statistically important data should be given in the text, tables, and figures. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used. Results: Present your results in logical sequence in the text, tables, and figures. Do not present all the data provided in the tables and/or figures in the text; emphasize and/or summarize only important findings, results, and observations in the text. For clinical studies provide the number of samples, cases, and controls included in the study. Discrepancies between the planned number and obtained number of participants should be explained. Comparisons and statistically important values (i.e. p-value and confidence interval) should be provided. Discussion: This section should include a discussion of the data. New and important findings/results and the conclusions they lead to should be emphasized. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by the data. Do not repeat the findings/results in detail; important findings/ results should be compared with those of similar studies in the literature, along with a summarization. In other words, similarities or differences in the obtained findings/results with those previously reported should be discussed. Study Limitations: Limitations of the study should be detailed. In addition, an evaluation of the implications of the obtained findings/ results for future research should be outlined. Conclusion: The conclusion of the study should be highlighted. References Cite references in the text, tables, and figures with numbers in square brackets. Number references consecutively according to the order in which they first appear in the text. Journal titles should be abbreviated according to the style used in Index Medicus (consult List of Journals Indexed in Index Medicus). Include among the references any paper accepted, but not yet published, designating the journal followed by “in press”. Examples of References: 1. List all authors Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow transplantation from unrelated donors for patients with aplastic anemia after failure of immunosuppressive therapy. Blood 2006;108:1485-1491. 2. Organization as author Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of syngeneic bone marrow graft without preconditioning in post-hepatitis marrow aplasia. Lancet 1977;2:742-744.

4. Book Chapter Perutz MF. Molecular anatomy and physiology of hemoglobin. In: Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin: Genetics, Pathophysiology, Clinical Management. New York, Cambridge University Press, 2000. 5. Abstract Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin) stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract). 6. Letter to the Editor Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further definition of 20q deletion in myeloid leukemia using fluorescence in situ hybridization. Blood 1994;84:2821-2823. 7. Supplement Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant 2005;9(Suppl 7):81-86. Brief Reports Abstract length: Not to exceed 150 words. Article length: Not to exceed 1200 words. Introduction: State the purpose and summarize the rationale for the study. Materials and Methods: Clearly describe the selection of the observational or experimental participants. Identify the methods and procedures in sufficient detail. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for their use and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported findings/results. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used. Results: Present the findings/results in a logical sequence in the text, tables, and figures. Do not repeat all the findings/results in the tables and figures in the text; emphasize and/or summarize only those that are most important. Discussion: Highlight the new and important findings/results of the study and the conclusions they lead to. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by your data. Invited Review Articles Abstract length: Not to exceed 300 words.

3. Book

Article length: Not to exceed 4000 words.

Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961.

Review articles should not include more than 100 references. Reviews should include a conclusion, in which a new hypothesis or study about the

A-V

subject may be posited. Do not publish methods for literature search or level of evidence. Authors who will prepare review articles should already have published research articles on the relevant subject. The study’s new and important findings should be highlighted and interpreted in the Conclusion section. There should be a maximum of two authors for review articles. Images in Hematology Article length: Not to exceed 200 words. Authors can submit for consideration illustrations or photos that are interesting, instructive, and visually attractive, along with a few lines of explanatory text and references. Images in Hematology can include no more than 200 words of text, 5 references, and 3 figures or tables. No abstract, discussion, or conclusion is required, but please include a brief title. Letters to the Editor Article length: Not to exceed 500 words. Letters can include no more than 500 words of text, 5-10 references, and 1 figure or table. No abstract is required, but please include a brief title. Tables Supply each table in a separate file. Number tables according to the order in which they appear in the text, and supply a brief caption for each. Give each column a short or abbreviated heading. Write explanatory statistical measures of variation, such as standard deviation or standard error of mean. Be sure that each table is cited in the text. Figures Figures should be professionally drawn and/or photographed. Authors should number figures according to the order in which they appear in the text. Figures include graphs, charts, photographs, and illustrations. Each figure should be accompanied by a legend that does not exceed 50 words. Use abbreviations only if they have been introduced in the text. Authors are also required to provide the level of magnification for histological slides. Explain the internal scale and identify the staining method used. Figures should be submitted as separate files, not in the text file. Highresolution image files are not preferred for initial submission as the file sizes may be too large. The total file size of the PDF for peer review should not exceed 5 MB. Authorship Each author should have participated sufficiently in the work to assume public responsibility for the content. Any portion of a manuscript that is critical to its main conclusions must be the responsibility of at least one author. Contributor’s Statement All submissions should contain a contributor’s statement page. Each statement should contain substantial contributions to idea and design, acquisition of data, and analysis and interpretation of findings. All

A-VI

persons designated as an author should qualify for authorship, and all those that qualify should be listed. Each author should have participated sufficiently in the work to take responsibility for appropriate portions of the text. Acknowledgments Acknowledge support received from individuals, organizations, grants, corporations, and any other source. For work involving a biomedical product or potential product partially or wholly supported by corporate funding, a note stating, “This study was financially supported (in part) with funds provided by (company name) to (authors’ initials)”, must be included. Grant support, if received, needs to be stated and the specific granting institutions’ names and grant numbers provided when applicable. Authors are expected to disclose on the title page any commercial or other associations that might pose a conflict of interest in connection with the submitted manuscript. All funding sources that supported the work and the institutional and/or corporate affiliations of the authors should be acknowledged on the title page. Ethics When reporting experiments conducted with humans indicate that the procedures were in accordance with ethical standards set forth by the committee that oversees human subject research. Approval of research protocols by the relevant ethics committee, in accordance with international agreements (Helsinki Declaration of 1975, revised 2002 available at http://www.wma.net/en/30publications/10policies/b3/; “Guide for the Care and Use of Laboratory Animals” available at www. nap.edu/catalog/5140.html/), is required for all experimental, clinical, and drug studies. Patient names, initials, and hospital identification numbers should not be used. Manuscripts reporting the results of experimental investigations conducted with humans must state that the study protocol received institutional review board approval and that the participants provided informed consent. Non-compliance with scientific accuracy is not in accord with scientific ethics. Plagiarism: To re-publish, in whole or in part, the contents of another author’s publication as one’s own without providing a reference. Fabrication: To publish data and findings/results that do not exist. Duplication: Use of data from another publication, which includes republishing a manuscript in different languages. Salami slicing: To create more than one publication by dividing the results of a study unnecessarily. We disapprove of such unethical practices as plagiarism, fabrication, duplication, and salami slicing, as well as efforts to influence the review process with such practices as gifting authorship, inappropriate acknowledgments, and references. Additionally, authors must respect participants‘ right to privacy. On the other hand, short abstracts published in congress books that do not exceed 400 words and present data of preliminary research, and

those that are presented in an electronic environment, are not considered as previously published work. Authors in such a situation must declare this status on the first page of the manuscript and in the cover letter.

An extensive list of conversion factors can be found at https://www.unc. edu/~rowlett/units/. For more details, see http://www.amamanualofstyle. com/oso/public/jama/si_conversion_table.html.

(The COPE flowchart is available at http://publicationethics.org.)

Abbreviations and Symbols

We use iThenticate to screen all submissions for plagiarism before publication.

Use only standard abbreviations. Avoid abbreviations in the title and abstract. The full term for an abbreviation should precede its first use in the text, unless it is a standard abbreviation. All acronyms used in the text should be expanded at first mention, followed by the abbreviation in parentheses; thereafter the acronym only should appear in the text. Acronyms may be used in the abstract if they occur 3 or more times therein, but must be reintroduced in the body of the text. Generally, abbreviations should be limited to those defined in the AMA Manual of Style, current edition. A list of each abbreviation (and the corresponding full term) used in the manuscript must be provided on the title page.

Conditions of Publication All authors are required to affirm the following statements before their manuscript is considered: 1. The manuscript is being submitted only to The Turkish Journal of Hematology; 2. The manuscript will not be submitted elsewhere while under consideration by The Turkish Journal of Hematology; 3. The manuscript has not been published elsewhere, and should it be published in The Turkish Journal of Hematology it will not be published elsewhere without the permission of the editors (these restrictions do not apply to abstracts or to press reports for presentations at scientific meetings); 4. All authors are responsible for the manuscript’s content; 5. All authors participated in the study concept and design, analysis and interpretation of the data, and drafting or revising of the manuscript and have approved the manuscript as submitted. In addition, all authors are required to disclose any professional affiliation, financial agreement, or other involvement with any company whose product figures prominently in the submitted manuscript. Authors of accepted manuscripts will receive electronic page proofs and are responsible for proofreading and checking the entire article within two days. Failure to return the proof in two days will delay publication. If the authors cannot be reached by email or telephone within two weeks, the manuscript will be rejected and will not be published in the journal.

Copyright At the time of submission all authors will receive instructions for submitting an online copyright form. No manuscript will be considered for review until all authors have completed their copyright form. Please note, it is our practice not to accept copyright forms via fax, e-mail, or postal service unless there is a problem with the online author accounts that cannot be resolved. Every effort should be made to use the online copyright system. Corresponding authors can log in to the submission system at any time to check the status of any co-author’s copyright form. All accepted manuscripts become the permanent property of The Turkish Journal of Hematology and may not be published elsewhere, in whole or in part, without written permission.

Online Manuscript Submission Process The Turkish Journal of Hematology uses submission software powered by ScholarOne Manuscripts. The website for submissions to The Turkish Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This system is quick and convenient, both for authors and reviewers.

Setting Up an Account New users to the submission site will need to register and enter their account details before they can submit a manuscript. Log in, or click the “Create Account” button if you are a first-time user. To create a new account: After clicking the “Create Account” button, enter your name and e-mail address, and then click the “Next” button. Your e-mail address is very important. Enter your institution and address information, as appropriate, and then click the “Next” Button. Enter a user ID and password of your choice, select your area of expertise, and then click the “Finish” button. If you have an account, but have forgotten your log-in details, go to “Password Help” on the journal’s online submission system and enter your e-mail address. The system will send you an automatic user ID and a new temporary password.

Note: We cannot accept any copyright form that has been altered, revised, amended, or otherwise changed. Our original copyright form must be used as is.

Full instructions and support are available on the site, and a user ID and password can be obtained during your first visit. Full support for authors is provided. Each page has a “Get Help Now” icon that connects directly to the online support system. Contact the journal administrator with any questions about submitting your manuscript to the journal (info@tjh.com.tr). For ScholarOne Manuscripts customer support, click on the “Get Help Now” link on the top right-hand corner of every page on the site.

Units of Measurement

The Electronic Submission Process

Measurements should be reported using the metric system, according to the International System of Units (SI). Consult the SI Unit Conversion Guide, New England Journal of Medicine Books, 1992.

Log in to your author center. Once you have logged in, click the “Submit a Manuscript” link in the menu bar. Enter the appropriate data and answer the questions. You may copy and paste directly from your manuscript.

A-VII

Click the “Next” button on each screen to save your work and advance to the next screen.

Upload Files Click on the “Browse” button and locate the file on your computer. Select the appropriate designation for each file in the drop-down menu next to the “Browse” button. When you have selected all the files you want to upload, click the “Upload Files” button. Review your submission before sending to the journal. Click the “Submit” button when you are finished reviewing. You can use ScholarOne Manuscripts at any time to check the status of your submission. The journal’s editorial office will inform you by e-mail once a decision has been made. After your manuscript has been submitted, a checklist will then be completed by the Editorial Assistant. The Editorial Assistant will check that the manuscript contains all required components and adheres to the author guidelines. Once the Editorial Assistant is satisfied with the manuscript it will be forwarded to the Senior Editor, who will assign an editor and reviewers.

The Review Processs Each manuscript submitted to The Turkish Journal of Hematology is subject to an initial review by the editorial office in order to determine if it is aligned with the journal’s aims and scope and complies with essential requirements. Manuscripts sent for peer review will be assigned to one of the journal’s associate editors that has expertise relevant to the manuscript’s content. All accepted manuscripts are sent to a statistical and English language editor before publishing. Once papers have been reviewed, the reviewers’ comments are sent to the Editor, who will then make a preliminary decision on the paper. At this stage, based on the feedback from reviewers, manuscripts can be accepted or rejected, or revisions can be recommended. Following initial peer-review, articles judged worthy of further consideration often require revision. Revised manuscripts generally must be received within 3 months of the date of the initial decision. Extensions must be requested from the Associate Editor at least 2 weeks before the 3-month revision deadline expires; The Turkish Journal of Hematology will reject manuscripts that are not received within the 3-month revision deadline. Manuscripts with extensive revision recommendations will be sent for further review (usually by the same reviewers) upon their re-submission. When a manuscript is finally accepted for publication, the Technical Editor undertakes a final edit and a marked-up copy will be e-mailed to the corresponding author for review and any final adjustments.

A-VIII

Submission of Revised Papers When revising a manuscript based on the reviewers’ and Editor’s feedback, please insert all changed text in red. Please do not use track changes, as this feature can make reading difficult. To submit revised manuscripts, please log in to your author center at ScholarOne Manuscripts. Your manuscript will be stored under “Manuscripts with Decisions”. Please click on the “Create a Revision” link located to the right of the manuscript title. A revised manuscript number will be created for you; you will then need to click on the “Continue Submission” button. You will then be guided through a submission process very similar to that for new manuscripts. You will be able to amend any details you wish. At stage 6 (“File Upload”), please delete the file for your original manuscript and upload the revised version. Additionally, please upload an anonymous cover letter, preferably in table format, including a point-by-point response to the reviews’ revision recommendations. You will then need to review your paper as a PDF and click the “Submit” button. Your revised manuscript will have the same ID number as the original version, but with the addition of an R and a number at the end, for example, TJH-2011-0001 for an original and TJH-2011-0001.R1, indicating a first revision; subsequent revisions will end with R2, R3, and so on. Please do not submit a revised manuscript as a new paper, as revised manuscripts are processed differently. If you click on the “Create a Revision” button and receive a message stating that the revision option has expired, please contact the Editorial Assistant at info@tjh.com.tr to reactivate the option.

English Language Editing All manuscripts are professionally edited by an English language editor prior to publication.

Online Early The Turkish Journal of Hematology publishes abstracts of accepted manuscripts online in advance of their publication in print. Once an accepted manuscript has been edited, the authors have submitted any final corrections, and all changes have been incorporated, the manuscript will be published online. At that time the manuscript will receive a Digital Object Identifier (DOI) number. Both forms can be found at www.tjh. com.tr. Authors of accepted manuscripts will receive electronic page proofs directly from the printer and are responsible for proofreading and checking the entire manuscript, including tables, figures, and references. Page proofs must be returned within 48 hours to avoid delays in publication.

CONTENTS 200

Research Articles Abnormal mRNA Expression Levels of Telomere-Binding Proteins Represent Biomarkers in Myelodysplastic Syndromes: A Case-Control Study Baoshan Liu, Rongdi Yan, Jie Zhang, Bin Wang, Hu Sun, Xing Cui

207

Prognostic Value of miRNA-155 Expression in B-Cell Non-Hodgkin Lymphoma Ahmed M. L. Bedewy, Shereen M. Elmaghraby, Ahmed A. Shehata, Noha S. Kandil

213

Comparative Analyses of Immunosuppressive Characteristics of Bone-Marrow, Wharton’s Jelly, and Adipose Tissue-Derived Human Mesenchymal Stem Cells Erdal Karaöz, Pınar Çetinalp Demircan, Gülay Erman, Eda Güngörürler, Ayla Eker Sarıboyacı

226

The Assessment of CD56 and CD117 Expressions at the Time of the Diagnosis in Multiple Myeloma Patients Funda Ceran, Mesude Falay, Simten Dağdaş, Gülsüm Özet

233

239

Primary Thrombophilia in Mexico XII: Miscarriages Are More Frequent in People with Sticky Platelet Syndrome Guillermo J. Ruiz-Delgado, Yahveth Cantero-Fortiz, Mariana A. Mendez Huerta, Mónica Leon-Gonzalez, Ana K. Nuñez-Cortes, Andrés A. Leon-Peña, Juan Carlos Olivares-Gazca, Guillermo J. Ruiz-Argüelles

244

A Randomized Comparison of Hemoglobin Content-Based Versus Standard (Unit-Based) Red Blood Cell Transfusion Policy Erden Atilla, Selami Koçak Toprak, Sinem Civriz Bozdağ, Pervin Topçuoğlu, Önder Arslan

250

Brief Reports

254

Diagnostic Accuracy of Interleukin-6, Interleukin-8, and Interleukin-10 for Predicting Bacteremia in Children with Febrile Neutropenia Zümrüt Şahbudak Bal, Nihal Karadaş Özdemir, Semra Şen, Deniz Yılmaz Karapınar, Elif Azarsız, Şöhret Aydemir, Fadıl Vardar

258

Genotype-Phenotype Correlations of β-Thalassemia Mutations in an Azerbaijani Population Chingiz Asadov, Eldar Abdulalimov, Tahira Mammadova, Surmaya Gafarova, Yegana Guliyeva, Gunay Aliyeva

264

Images in Hematology

Phenotype Report on Patients with Congenital Factor V Deficiency in Southern Iran: Recent Ten Years’ Experience Mohammad Mostafa Safarpour, Sezaneh Haghpanah, Aidin Meshksar, Mehran Karimi

Secondary Hemophagocytic Lymphohistiocytosis in an Infant with Wolman Disease Aynur Küçükçongar Yavaş, Betül Orhaner, Pınar Genç, Nevin Kılıç, Hakan Erdoğan, Özlem Özdemir, Arzu Ekici

266

Microscopic Image of Leishman-Donovan Bodies in Bone Marrow Aspirate Smear of Patient Suffering from Unexplained Intermittent Low-Grade Fever and Cough Kuenzang Dorji, Tashi Tobgay, Rixin Jamtsho, Puja Devi Samal, Pratap Rai

268

Subcutaneous Myeloma Deposit in the Region of an Arteriovenous Fistula Petar Djuric, Aleksandar Jankovic, Zoran Milojevic, Katarina Markovic, Slavisa Sekulic, Milan Pantelic, Jelena Tosic Dragovic, Ana Bulatovic, Nada Dimkovic

A-IX

270

Letters to the Editor An Unusual Giant Leg Ulcer as a Rare Presentation of Sweet’s Syndrome in a Patient with Hairy Cell Leukemia Successfully Managed by Splenectomy Hakan Özdoğu, Mahmut Yeral, Can Boğa

272

Synchronous Nodal Involvement of Metastatic Adenocarcinoma and Classical Hodgkin’s Lymphoma Ritesh Sachdev, Shalini Goel, Ruchika K Goel, Smeeta Gajendra, Nitin Sood

274

Psychogenic Purpura Successfully Treated with Antidepressant Therapy Şeyda Çelik-Göksoy, Ayşe Kılınçaslan, İlyas Kaya

276

Systemic Mastocytosis with Associated Chronic Lymphocytic Leukemia: A Matter of Diseases or Prognostic Factors? Antonella Zagaria, Luisa Anelli, Nicoletta Coccaro, Giuseppina Tota, Claudia Brunetti, Angela Minervini, Paola Casieri, Luciana Impera, Crescenzio Francesco Minervini, Annamaria Giordano, Paola Orsini, Cosimo Cumbo, Giorgina Specchia, Francesco Albano

278

Screening of Intron 1 Inversion of the Factor VIII Gene in 130 Patients with Severe Hemophilia A from a Pakistani Cohort Azhar Sattar, Shabbir Hussain, Muhammad Ikram Ullah, Saqib Mahmood, Shahida Mohsin

280

Implementation of an ISBT 128-Compatible Medical Record System to Facilitate Traceability of Stem Cell Products Can Boğa, Erkan Maytalman, Çiğdem Gereklioğlu, Süheyl Asma, Fatih Kandemir, Pelin Aytan, Aslı Korur, Mahmut Yeral, İlknur Kozanoğlu, Hakan Özdoğu

A-X

Advisory Board of This Issue (September 2017) Ahmet Emre Eşkazan, Turkey Alphan Küpesiz, Turkey Anıl Tombak, Turkey Ayşe Çırakoğlu, Turkey Ayşen Timurağaoğlu, Turkey Aytemiz Gürgey, Turkey Bilgin Arıbaş, Turkey Bülent Eser, Turkey Burhan Ferhanoğlu, Turkey Cafer Adıgüzel, Turkey Celalettin Üstün, USA Daniel Catovsky, UK Emine Gencer, Turkey Ercüment Ovalı, Turkey Erdal İnce, Turkey Erdal Kurtoğlu, Turkey

Fatih Demirkan, Turkey Figen Atalay, Turkey Güçhan Alanoğlu, Turkey Hilal Özdağ, Turkey İdil Yenicesu, Turkey İnci Alacacıoğlu, Turkey Kaan Kavaklı, Turkey Luca Spiezia, Italy Lucia Stanciakova, Slovakia Mehmet Ali Özcan, Turkey Meral Beksaç, Turkey Mine Hekimgil, Turkey Mohammed Jaffarany, USA Müge Sayitoğlu, Turkey Nader Shakibazad, Iran Ömer Dizdar, Turkey

Parikshaa Gupta, India Peter Kubisz, Slovakia Rami Mahfouz, Lebanon Rauf Haznedar, Turkey Reyhan Küçükkaya, Turkey Ritu Gupta, India Rodney M. Camire, USA Serap Karaman, Turkey Sevgi Kalayoğlu Beşışık, Turkey Tamar Tadmor, Israel Türkan Patıroğlu, Turkey Walter J. Janse van Rensburg, South Africa Wolfgang R. Sperr, Austria Zahit Bolaman, Turkey Zehra Çoban, Turkey Zühre Kaya, Turkey

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0364 Turk J Hematol 2017;34:200-206

Abnormal mRNA Expression Levels of Telomere-Binding Proteins Represent Biomarkers in Myelodysplastic Syndromes: A Case-Control Study Miyelodisplastik Sendromda Biyobelirteç Olarak Telomer-Bağlayıcı Proteinlerine Ait Anormal mRNA Ekspresyon Düzeyleri: Olgu-Kontrol Çalışması Baoshan Liu1, Rongdi Yan2, Jie Zhang3, Bin Wang4, Hu Sun5, Xing Cui3 Tianjin Medical University General Hospital, Clinic of Traditional Chinese Medicine, Tianjin, China The Second Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Department of Respiratory Disease, Jinan, China 3 Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Department of Hematology, Jinan, China 4 Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Department of Peripheral Vascular Disease, Jinan, China 5 Shandong Institute of Traditional Chinese Medicine, Department of Pharmacology, Jinan, China 1 2

Abstract

Öz

Objective: As evidence was shown that abnormal shortening of telomeres begins to accumulate in myelodysplastic syndrome (MDS) patients, this study was conducted to determine the relationship between the mRNA expression levels of telomere-binding proteins (TRF1/TRF2/TIN2/TPP1/POT1/RAP1) and the risk level in MDS. Materials and Methods: There were 40 patients with MDS and 40 normal controls in this study. Methods including telomere content assays and quantitative reverse transcription-polymerase chain reaction were used to examine the mRNA levels of TRF1/TRF2/TIN2/ TPP1/POT1/RAP1 in patients with MDS. Results: Compared to the normal group used as a control, the mRNA expression levels of RAP1/POT1/TPP1 of the patients with MDS were decreased, whereas their levels of TRF1/TRF2 and TIN2 were increased. A positive correlation was found between the TRF1, TRF2, and TIN2 mRNA expression levels and the risk level of the International Prognostic Scoring System (IPSS) and the World Health Organization Prognostic Scoring System (WPSS) criteria; however, a negative correlation was found between RAP1/POT1/TPP1 mRNA expression levels and the risk levels of IPSS and WPSS criteria. Conclusion: Because the reduction of TRF1/TRF2/TIN2 mRNA expression and the increase of RAP1/POT1/TPP1 mRNA expression are closely related to the risk levels of the IPSS and WPSS criteria in MDS, it is thought that these telomere-binding proteins could lead to abnormal telomere length and function, which cause chromosomal abnormalities in MDS. With this evidence, we suggest that those proteins’ mRNA expressions could be used as biomarkers for the assessment of the risk degree of MDS patients. Keywords: Myelodysplastic syndromes, Telomere-binding proteins, Reverse transcription-polymerase chain reaction, International Prognostic Scoring System, World Health Organization Prognostic Scoring System

Amaç: Miyelodisplastik sendrom (MDS) hastalarında Telomerlerin anormal olarak kısalması ile ilgili kanıtlar giderek artmaktadır. Bu çalışma telomer bağlayıcı proteinlerin (TRF1/TRF2/TIN2/TPP1/POT1/ RAP1) mRNA ekspresyon düzeyleri ile MDS risk skorları arasındaki ilişkinin tespit edilmesi amacıyla yapıldı. Gereç ve Yöntemler: Bu çalışmaya 40 MDS hastası ve 40 normal kontrol dahil edildi. MDS hastalarında telomer içerik tahlilleri ve kantitatif ters transkripsiyon-polimeraz zincir reaksiyonu TRF1/TRF2/ TIN2/TPP1/POT1/RAP1 mRNA düzeylerini incelemek için kullanıldı. Bulgular: Normal grup kontrol olarak kullanıldı, MDS hastalarında RAP1/POT1/TPP1 mRNA ekspresyon düzeyleri azalmış, ancak sırasıyla TRF1/TRF2 ve TIN2 düzeyleri artmıştı. TRF1, TRF2 ve TIN2 mRNA ekspresyon düzeyleri ile Uluslararası Prognoz Skorlama Sistemi (UPSS) ve Dünya Sağlık Örgütü Prognoz Skorlama Sistemi (DPSS) arasında pozitif korelasyon tespit edildi, RAP1/POT1/TPP1 mRNA ekspresyon düzeyleri ile UPSS ve DPSS kriterleri arasında negatif bir korelasyon bulundu. Sonuç: MDS’de TRF1/TRF2/TIN2 mRNA ekspresyonunun azalması ve RAP1/POT1/TPP1 mRNA ekspresyonunun artışı ile UPSS ve DPSS kriterleri arasında yakın bir ilişki bulunması, bu telomerbağlayıcı proteinlerin MDS’de kromozomal anormalliklere sebep olabilecek anormal telomer boy ve fonksiyonları oluşmasına yol açabileceğini düşündürmektedir. Bu nedenle biz bu proteinlerin mRNA ekspresyonlarının MDS hastalarının risk değerlendirmesinde biyobelirteç olarak kullanılabileceğini düşünmekteyiz. Anahtar Sözcükler: Miyelodisplastik sendromlar, Telomer-bağlayıcı proteinler, Ters transkripsiyon-polimeraz zincir reaksiyonu, Uluslararası Prognoz Skorlama Sistemi, Dünya Sağlık Örgütü Prognoz Skorlama Sistemi

Address for Correspondence/Yazışma Adresi: Xing CUI, Ph.D, Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Department of Hematology, Jinan, China Phone : +86-13589045327 E-mail : cdz45@163.com

200

Received/Geliş tarihi: September 09, 2016 Accepted/Kabul tarihi: April 11, 2017

Liu B, et al: Myelodysplastic Syndrome’s New Biomarker

Turk J Hematol 2017;34:200-206

Introduction Chromosome stability is controlled by telomeres, which are regions of repetitive DNA sequences (TTAGGG) at the end of each chromosome regulating end-to-end fusions and recombination. The word “clock” is frequently used to describe telomeres because they can manage the cellular lifespan [1]. Many studies have indicated that telomere length will not change in >80% of tumor cells, which can make themselves immortal by expressing telomerase to sustain the telomere length [2]. Shelterin, which can regulate telomere length and protect telomere function, is an important protein-binding complex composed of telomere repeat factor-1 (TRF1) and -2 (TRF2), protection of telomeres-1 (POT1), TRF2-interacting telomeric protein (RAP1), TRF1-interacting protein 2 (TIN2), and TIN2organizing protein (TPP1). There are some similarities between TRF1 and TRF2, including their sequence and organization, and they and POT1 can influence the telomeric DNA. The promotion of genetic instability and the increasing of malignancy risk are associated with age-related decline in telomere length [3]. Evidence was shown that abnormal shortening of hematopoietic cells’ telomeres began to accumulate in patients with myelodysplastic syndrome (MDS) and researchers have found that there is a close relationship between abnormal telomere length and poor patient survival [4,5,6,7,8,9,10]. In this study, our goal was to use reverse transcriptionpolymerase chain reaction (RT-PCR) to detect the mRNA levels of telomere-binding proteins TRF1, TRF2, TIN2, TPP1, POT1, and RAP1 in MDS. We also tried to determine whether there were any relationships between the mRNA levels and the International Prognostic Scoring System (IPSS) and World Health Organization Prognostic Scoring System (WPSS) scores of patients with MDS.

Materials and Methods Patients and Controls In this study, the recorded data of 40 patients (21 men and 19 women; age range: 26-69 years old) and 40 healthy controls (23 men and 17 women; age range: 18-68 years old) from September 2011 to July 2013 were compared (Tables 1 and 2). All of the patients were diagnosed at the same hospital. Patients were divided into cases of refractory anemia (RA), refractory anemia with ringed sideroblasts (RARS), refractory cytopenias with multilineage dysplasia (RCMD), refractory anemia with excess blasts-1 (RAEB-1), and refractory anemia with excess blasts-2 (RAEB-2) based on the 2008 World Health Organization (WHO) diagnosis and classification schemes. None of them had a family history of blood disease and almost all of them presented with different levels of petechiae and fatigue. We obtained bone marrow samples from these patients and from the 40 control

subjects. As per the Declaration of Helsinki, informed consent was received from all participants and the study was authorized by the institutional review board of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine. RNA Extraction The TRIzol reagent (Invitrogen, Buenos Aires, Argentina) was used to extract the total RNA of the mononuclear cells obtained from the bone marrow of the patients and the healthy control subjects. RT-PCR was performed with 1X reverse transcription (RT) buffer (Promega, Madison, WI, USA), 200 U/µL Moloney murine leukemia virus RT (Promega), 250 ng/µL random primer (Promega), and 10 mmol/L of each dNTP (Invitrogen). The cDNA synthesis with 1 µg of the total RNA was processed in a total volume of 20 µL for 10 min at 95 °C, 60 min at 37 °C, and 10 min at 95 °C to inactivate the enzyme. The obtained cDNA was stored at -20 °C until use. Real-Time qPCR and RT Reaction We used the SmartCycler System (Cepheid, Sunnyvale, CA, USA) to test the level of the mRNAs of glyceraldehyde 3-phosphate dehydrogenase (GAPDH), TRF2, TRF1, TPP1, TIN2, and POT1 by using the real-time PCR quantification method. SuperScript III reverse transcriptase (Invitrogen) was used to detect the reverse transcriptions as previously described [11]. Afterwards, the generated cDNA was studied with the Cepheid SmartCycler (software version 2.0 c). Based on the manufacturer’s protocol, we designed the PCR primers (Table 3). RT2 Real-Time™ SYBR Green PCR Master Mix (SA BioSciences, Frederick, MD, USA) was used for the proof of gene expression. The 7500 Standard program of the 7500 Fast Real-Time PCR System (Life Technologies, Carlsbad, CA, USA) was used to perform the reactions. Cycling parameters were set as 95 °C for 10 min and then 40 cycles at 95 °C for 15 s, then annealing/extension at 60 °C for 1 min. Based on the PCR cycle number at which the fluorescence emission reached a threshold above the baseline emission, cycle threshold (Ct) values were determined. In the comparative Ct (ΔΔCt) method, we employed GAPDH as an endogenous control to identify the mRNA expression values. The mRNA levels of TRF2, TRF1, TPP1, TIN2, and POT1 were calculated by the following formula: (2 - [ΔCtx - ΔCtr] = 2 - ΔΔCt). The laboratory staff determining the telomere-binding proteins’ mRNA levels were not aware of the patients’ clinical outcomes prior to the statistical analysis. The melting curves of the GAPDH/TRF1/TRF2/ TIN2/RAP1/POT1 and TPP1 PCR products are shown in Figure 1. SPSS 19.0 was used to analyze all of the data. Differences between these data were determined by Student’s t-test with subsequent Bonferroni correction, with p<0.05 considered significant. Data are reported as mean ± standard deviation, and we also used Spearman correlation analysis. 201

Liu B, et al: Myelodysplastic Syndrome’s New Biomarker

Results Final mRNA Expression Levels in Patients with MDS Compared to Controls The median age of the normal group and the MDS group was 42.98±13.31 and 44.85±11.46 years, respectively. There was no significant difference between the median ages of these groups. The age distribution of the control group was the same as that of the patient group. The telomere-binding proteins’ mRNA levels were compared between the patients and the healthy controls (Tables 1 and 2). Analyzing these data, significant differences were found between the two groups’ mRNA expression levels of TRF1/TRF2/TIN2/RAP1/POT1 (p<0.01) and TPP1 (p<0.05). There was remarkable variation between the two groups: the mean mRNA expression levels of RAP1/POT1/TPP1 in the patients with MDS were decreased, but the mean mRNA expression levels of TRF1/TRF2/TIN2 were increased. Comparison of TRF1/TRF2/TIN2/RAP1/POT1/TPP1 mRNA Expression Levels According to IPSS and WPSS Criteria The patients in this study had the following 2008 WHO classification subtypes: RA (n=9; 22.5%), RARS (n=8; 20%), RCMD (n=10; 25%), RAEB-1 (n=10; 25%), and RAEB-2 (n=6; 15%). The TRF1/TRF2/TIN2/RAP1/POT1/TPP1 mRNA expression levels were compared with the IPSS and WPSS criteria of the same MDS patient. Combination of the risk scores for IPSS or WPSS criteria stratified the patients into four or five distinctive risk groups, respectively. We found a positive relationship between TRF1/TRF2/TIN2 mRNA expression levels and risk according to IPSS and WPSS criteria. We also found a negative association between RAP1/POT1/TPP1 mRNA expression levels and risk according to the IPSS and WPSS criteria (Figure 2).

Turk J Hematol 2017;34:200-206

early event in tumor occurrence, is caused by telomere attrition [12]. Telomere length heterogeneity is seen in all of the MDS subtypes, and decreases of telomere length in MDS are often associated with leukemic transformation and the presence of complex karyotypic abnormalities [4,13]. As a six-polypeptide complex, shelterin is assembled via the binding of the double-stranded TTAGGG repeat binding proteins TRF1 and TRF2, which in turn recruit RAP1, TIN2, TPP1, and POT1 [14,15]. The telomeric DNA is bound by TRF1 and TRF2 in a sequence-specific manner. Shelterin subunits TRF1 and TRF2 are bound in a sequence-specific manner to the double-stranded telomeric DNA, generating a critical platform for recruitment of further shelterin proteins, along with other non-shelterin factors crucial for the maintenance of telomere length and structure. Both TRF1 and TRF2 have the ability to restrict or inhibit telomere elongation by downregulating telomerase [16,17,18]. In diverse eukaryotes, the single-stranded overhang is bound with POT1, and this is fundamental for the protection of chromosome ends and the regulation of telomere length. As another part of the shelterin complex, TPP1 is a binding partner of POT1. Wang and Lei reported the human POT1-TPP1 complex as a telomerase processivity factor [19]. TIN2 is an interesting central shelterin component due to the fact that it connects TPP1/POT1 to the other shelterin components, and furthermore it also stabilizes TRF1 and TRF2 on the duplex telomeric repeat

Discussion Abnormal telomere length regulation exerts a vital influence on hematological malignancies. Genomic instability, as an Table 1. The mRNA expression levels in patients with myelodysplastic syndrome compared to controls. Item

Controls

Patients with MDS

(n=40)

TRF1

0.83±0.32

1.92±0.92**

TRF2

0.66±0.49

1.98±1.09**

TIN2

0.63±0.12

1.65±0.66**

RAP1

0.70±0.24

0.45±0.30**

POT1

4.27±1.02

1.63±0.90**

TPP1

0.28±0.11

0.21±0.97*

MDS: Myelodysplastic syndrome, TRF1: telomere repeat factor-1, TRF2: telomere repeat factor-2, TIN2: TRF1-interacting protein 2, RAP1: TRF2-interacting telomeric protein, POT1: protecting telomeres-1, TPP1: POT1: protection of telomeres-1, *p<0.05, **p<0.01.

202

Figure 1. Melting curves of GAPDH (A), TRF1 (B), TRF2 (C), TIN2 (D), RAP1 (E), POT1 (F), and TPP1 (G) polymerase chain reaction products. The straight line indicates a no-template control. GAPDH: Glyceraldehyde 3-phosphate dehydrogenase, TRF1: telomere repeat factor-1, TRF2: telomere repeat factor-2, TIN2: TRF1-interacting protein 2, RAP1: TRF2-interacting telomeric protein, POT1: protecting telomeres-1, TPP1: POT1and TIN2-organizing protein.

Liu B, et al: Myelodysplastic Syndromeâ&#x20AC;&#x2122;s New Biomarker

Turk J Hematol 2017;34:200-206

Table 2. The French-American-British and World Health Organization diagnoses of patients, and the International Prognostic Scoring System and World Health Organization Prognostic Scoring System risk classification. Patient No.

Sex/Age

Karyotype

FAB

IPSS

WHO

WPSS

M/43

20q-

Low

Very low

F/44

-8

RAEB

Int-2

RAEB1

Very high

M/53

Int-1

Low

M/56

5q-

Low

Very low

F/62

Normal

RAEB

Int-1

RAEB1

High

M/66

Normal

Low

F/34

Normal

RAEB

Int-1

RAEB1

High

M/35

Normal

RAEB

Int-2

RAEB2

High

M/31

Normal

RAS

Low

RARS

Low

F/26

Int-1

RCMD

High

M/23

-Y

Int-1

Very low

M/45

-8,+9,-Y

Int-2

RCMD

High

F/49

-13p

Int-1

RCMD

High

F/51

7q-,+9

Int-2

RCMD

High

M/63

+9,-11

Int-1

RCMD

INT

F/65

Normal

Low

Very low

M/38

-5

Int-1

Low

F/37

-7

Int-2

RCMD

High

F/29

Normal

RAS

Low

RARS

Very low

M/29

Normal

RAEB

Int-2

RAEB2

High

F/49

-11

RAEB

High

RAEB2

Very high

M/44

+3q

Int-1

RCMD

INT

M/49

RAS

Int-1

RARS

Low

F/69

+13

RAEB

Int-2

RAEB1

High

M/60

Normal

Low

M/69

-7

RAEB

Int-2

RAEB1

Very high

M/28

Normal

RAS

Low

RARS

Low

F/39

Int-1

Low

M/39

RAEB

High

RAEB2

Very high

M/35

-11

Int-1

RCMD

High

M/42

5q-,+9,-11,-13

Int-2

RCMD

High

F/53

RAEB

Int-2

RAEB1

High

F/62

Normal

RAS

Low

RARS

Very low

M/52

7q-

RAEB

Int-2

RAEB1

Very high

F/41

RAEB

High

RAEB2

Very high

F/37

-7,+8,-x

RAEB

High

RAEB2

Very high

F/32

+8,-13

RAS

Int-1

RARS

INT

M/31

+9,-Y

Int-1

RCMD

INT

F/38

Normal

RAS

Low

RARS

Low

F/46

Normal

RAS

Low

RARS

Low

IPSS: International Prognostic Scoring System, WPSS: World Health Organization Prognostic Scoring System, Int: intermediate, RA: refractory anemia, RAS/RARS: RA with ringed sideroblasts, RCMD: refractory cytopenia with multilineage dysplasia, RAEB: refractory anemia with an excess of blasts, RAEB-1: refractory anemia with excess blasts-1, RAEB-2: refractory anemia with excess blasts-2.

203

Liu B, et al: Myelodysplastic Syndrome’s New Biomarker

Turk J Hematol 2017;34:200-206

Table 3. Polymerase chain reaction amplification of mitochondrial DNA genes GENE

Sequencing primers (5’ to 3’)

GenBank accession no.

Size (bp)

GAPDH

L: 5’-aggtggtctcctctgactt-3’ R: 5’-ttgctgtagccaaattcgttgt-3’

NM 002046.3

127

TRF1

L: 5’-gctgtttgtatggaaaatggc-3’ R: 5’-ccgctgccttcattagaaag-3’

NM 003218.3 Gene ID: 7013 TERF 1

238

TRF2

L: 5’-gaccttccagcagaagatgct-3’ R: 5’-gttggaggattccgtagctg-3’

NM 005652.3 Gene ID: 7014 TERF2

198

TIN2

L: 5’-ggagtttctgcgatctctgc-3’ R: 5’-gatcccgcactataggtcca-3’

NM 012461.2 Gene ID: 26277 TINF2

185

RAP1 NM 018975.3

L: 5’-cggggaaccacagaataaga-3’ R: 5’-ctcaggtgtgggtggatcat-3’

Gene ID: 54386 TERF2IP

199

POT1

L: 5’-tggaggtaccagttacggtc-3’ R: 5’-cacatagtggtgtcctctcc-3’

NR 003103.1 Gene ID: 25913 POT 1

251

TPP1

L: 5’-cccgcagagttctatctcca-3’ R: 5’-ggacagtgataggcctgcat-3’

NM 001082487.1 Gene ID: 65057 ACD

171

O: Outer primer, I: inner primer, GAPDH: glyceraldehyde 3-phosphate dehydrogenase, TRF1: telomere repeat factor-1, TRF2: telomere repeat factor-2, TIN2: TRF1-interacting protein 2, RAP1: TRF2-interacting telomeric protein, POT1: protection of telomeres-1, TPP1: POT1- and TIN2-organizing protein.

array [20]. TPP1 (previously PTOP/PIP1/TINT1) was identified as a POT1 regulator [21,22,23]. Kibe et al. [21] discovered that telomeres are protected from the repression of the ATR kinases by TPP1-bound POT1a/b. However, some phenomena remain to be understood, such as the interactions between TPP1 and other telomeric proteins, and whether or not it has any functions beyond targeting POT1 and TPP1 that are bound to both POT1 and TIN2 and whether it could tether POT1 to the TRF1 complex. As telomeres can be elongated by the decrease of PIP1 or POT1 levels with short-hairpin RNAs, researchers indicated that telomere length control may be attributed to PIP1 regulation by recruiting POT1 [22]. Studies showed that RAP1 can protect telomere length in yeast [24]. A decrease in RAP1 was found in older cells, especially in an oxidative stress environment. Another interesting study found that if the interaction of RAP1/TRF2 was blocked, the structure of shelterin could be disrupted [25]. As telomere stability and telomere length can be influenced by telomere-binding proteins [26,27,28], a number of experiments were conducted to demonstrate the crucial role of regulating the expression of telomere-binding proteins in cancer and hematological malignancies. POT1-mutated chronic lymphoid leukemia (CLL) cells have numerous telomeric and chromosomal abnormalities that implicate the causative influence of the POT1 mutations for malignant CLL cells [29]. In the early stage of CLL acquisition, telomeric deprotection is the result of 204

both telomere shortening and shelterin (TPP1/TIN2) alteration [30]. This study compared the shelterin complex protein mRNA levels of patients with MDS and healthy volunteers and investigated the relationship between these mRNA expressions and IPSS/WPSS risk in the same patients with MDS. Two vital conclusions were reached in this study. First, compared with the healthy control group, the mean RAP1/POT1/ TPP1 mRNA expression levels of the patients with MDS were significantly decreased, but the mean TRF1/TRF2/TIN2 mRNA expression levels were increased. These data correspond with previously reported telomere lengths in MDS [31,32]. Second, when the TRF1/TRF2/TIN2 mRNA expression levels increased, the risk according to the IPSS or WPSS criteria increased, and when the RAP1/POT1/TPP1 mRNA expression levels increased, the risk according to the IPSS or WPSS criteria decreased. Some significant positive correlations were found between the mRNA expression of RAP1/POT1/TPP1 and that of TRF1/TRF2/TIN2. However, there was a negative relationship between the mRNA expression of RAP1/POT1/TPP1 and that of TRF1/TRF2/TIN2. Upon comparing these results with the findings of other studies, we concluded that the expression of TRF1/TRF2/TIN2 may have a considerable role in the telomere length and dynamics of MDS and the reduction of RAP1/POT1/TPP1 expression may promote the ability of malignant clones of MDS to escape apoptosis and acquire the ability to divide without control.

Liu B, et al: Myelodysplastic Syndrome’s New Biomarker

Turk J Hematol 2017;34:200-206

Ethics Ethics Committee Approval: According to the Declaration of Helsinki, this study obtained all of the participants’ informed consent and was authorized by the institutional review board of the Affiliated Hospital of Shandong University of Traditional Chinese Medicine. All of the patients were diagnosed at one single hospital (Department of Hematology, Affiliated Hospital of Shandong University of Traditional Chinese Medicine) (SDTCM-2014-015). Informed Consent: According to the Declaration of Helsinki, this study obtained all of the participants’ informed consent. Authorship Contributions Surgical and Medical Practices: B.L., X.C., R.Y., B.W.; Concept: B.L., X.C.; Design: X.C.; Data Collection or Processing: B.L., R.Y., J.Z., B.W., H.S., X.C.; Analysis or Interpretation: B.L., H.S., X.C.; Literature Search: X.C.; Writing: B.L., X.C. These experiments were designed and performed by Xing Cui, who also completed works including obtaining bone marrow samples, analyzing data, and writing the manuscript; Baoshan Liu, Rongdi Yan, Jie Zhang, and Hu Sun obtained the samples from bone marrow and performed the experiments; Bin Wang purchased crucial new reagents and processed the experiments. The final manuscript was read and confirmed by all authors. Figure 2. Correlations between the mRNA expression levels of TRF1/TRF2/TIN2/RAP1/POT1/TPP1 and IPSS/WPSS criteria. TRF1: Telomere repeat factor-1, TRF2: telomere repeat factor-2, TIN2: TRF1-interacting protein 2, RAP1: TRF2-interacting telomeric protein, POT1: protecting telomeres-1, TPP1: POT1: protection of telomeres-1, WPSS: World Health Organization Prognostic Scoring System, IPSS: International Prognostic Scoring System.

Study Limitations We do not know the mechanism of the reduction of TRF1/ TRF2/TIN2 mRNA expression and the upregulation of RAP1/ POT1/TPP1 mRNA expression. Furthermore, how to treat these abnormal expressions and regulate the length of telomeres is an interesting question.

Conclusion After we investigated the relationship of these abnormal expressions of shelterin complex proteins and IPSS and WPSS criteria, respectively, we concluded that those proteins’ mRNA expressions could be used as biomarkers for the assessment of the risk degree of MDS patients.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Financial Disclosure: This article was supported by the China Postdoctoral Science Foundation (nos. 2012M521356 and 2013T606080), the National Natural Science Foundation of China (no: 81202839/H2902), the Natural Science Foundation of Shandong Province (no: ZR2012HQ023), the Medical science and technology development Foundation of Shandong Province, China (2014WS0431), the Jinan young star of science and technology plan (201406012).

References 1. Hayflick L. How and why we age. Exp Gerontol 1998;33:639-653. 2. Bodnar AG, Ouellette M, Frolkis M, Holt SE, Chiu CP, Morin GB, Harley CB, Shay JW, Lichtsteiner S, Wright WE. Extension of life-span by introduction of telomerase into normal human cells. Science 1998;279:349-352. 3. Artandi SE, Chang S, Lee SL, Alson S, Gottlieb GJ, Chin L, DePinho RA. Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice. Nature 2000;406:641-645. 4. Boultwood J, Fidler C, Kusec R, Rack K, Elliott PJ, Atoyebi O, Chapman R, Oscier DG, Wainscoat JS. Telomere length in myelodysplastic syndromes. Am J Hematol 1997;56:266-271. 5. Fern L, Pallis M, Ian Carter G, Seedhouse C, Russell N, Byrne J. Clonal haemopoiesis may occur after conventional chemotherapy and is

205

Liu B, et al: Myelodysplastic Syndrome’s New Biomarker

associated with accelerated telomere shortening and defects in the NQO1 pathway; possible mechanisms leading to an increased risk of t-AML/MDS. Br J Haematol 2004;126:63-71. 6. Liu Q, Zhu H, Dong J, Li H, Zhang H. Defective proliferative potential of MSCs from pediatric myelodysplastic syndrome patients is associated with cell senescence. Int J Clin Exp Pathol 2015;8:13059-13066. 7. Hwang SM, Kim SY, Kim JA, Park HS, Park SN, Im K, Kim K, Kim SM, Lee DS. Short telomere length and its correlation with gene mutations in myelodysplastic syndrome. J Hematol Oncol 2016;9:62. 8. Colla S, Ong DS, Ogoti Y, Marchesini M, Mistry NA, Clise-Dwyer K, Ang SA, Storti P, Viale A, Giuliani N, Ruisaard K, Ganan Gomez I, Bristow CA, Estecio M, Weksberg DC, Ho YW, Hu B, Genovese G, Pettazzoni P, Multani AS, Jiang S, Hua S, Ryan MC, Carugo A, Nezi L, Wei Y, Yang H, D’Anca M, Zhang L, Gaddis S, Gong T, Horner JW, Heffernan TP, Jones P, Cooper LJ, Liang H, Kantarjian H, Wang YA, Chin L, Bueso-Ramos C, Garcia-Manero G, DePinho RA. Telomere dysfunction drives aberrant hematopoietic differentiation and myelodysplastic syndrome. Cancer Cell 2015;27:644-657. 9. Sashida G, Ohyashiki JH, Nakajima A, Sumi M, Kawakubo K, Tauchi T, Ohyashiki K. Telomere dynamics in myelodysplastic syndrome determined by telomere measurement of marrow metaphases. Clin Cancer Res 2003;9:1489-1496. 10. Sieglova Z, Zilovcova S, Cermak J, Rihova H, Brezinova D, Dvorakova R, Markova M, Maaloufova J, Sajdova J, Brezinova J, Zemanova Z, Michalova K. Dynamics of telomere erosion and its association with genome instability in myelodysplastic syndromes (MDS) and acute myelogenous leukemia arising from MDS: a marker of disease prognosis? Leuk Res 2004;28:1013-1021. 11. Lee KM, Nguyen C, Ulrich AB, Pour PM, Ouellette MM. Immortalization with telomerase of the Nestin-positive cells of the human pancreas. Biochem Biophys Res Commun 2003;301:1038-1044. 12. Meeker AK, Argani P. Telomere shortening occurs early during breast tumorigenesis: a cause of chromosome destabilization underlying malignant transformation? J Mammary Gland Biol Neoplasia 2004;9:285-296. 13. Lange K, Holm L, Vang Nielsen K, Hahn A, Hofmann W, Kreipe H, Schlegelberger B, Göhring G. Telomere shortening and chromosomal instability in myelodysplastic syndromes. Genes Chromosomes Cancer 2010;49:260-269. 14. Hockemeyer D, Palm W, Wang RC, Couto SS, de Lange T. Engineered telomere degradation models dyskeratosis congenita. Genes Dev 2008;22:1773-1785. 15. Baumann P, Cech TR. POT1, the putative telomere end-binding protein in fission yeast and humans. Science 2001;292:1171-1175.

Turk J Hematol 2017;34:200-206

18. Iwano T, Tachibana M, Reth M, Shinkai Y. Importance of TRF1 for functional telomere structure. J Biol Chem 2004;279:1442-1448. 19. Wang F, Lei M. Human telomere POT1-TPP1 complex and its role in telomerase activity regulation. Methods Mol Biol 2011;735:173-187. 20. Ye JZ, Donigian JR, van Overbeek M, Loayza D, Luo Y, Krutchinsky AN, Chait BT, de Lange T. TIN2 binds TRF1 and TRF2 simultaneously and stabilizes the TRF2 complex on telomeres. J Biol Chem 2004;279:47264-47271. 21. Kibe T, Zimmermann M, de Lange T. TPP1 blocks an ATR-mediated resection mechanism at telomeres. Mol Cell 2016;61:236-246. 22. Ye JZ, Hockemeyer D, Krutchinsky AN, Loayza D, Hooper SM, Chait BT, de Lange T. POT1-interacting protein PIP1: a telomere length regulator that recruits POT1 to the TIN2/TRF1 complex. Genes Dev 2004;18:1649-1654. 23. Houghtaling BR, Cuttonaro L, Chang W, Smith S. A dynamic molecular link between the telomere length regulator TRF1 and the chromosome end protector TRF2. Curr Biol 2004;14:1621-1631. 24. Rai R, Chen Y, Lei M, Chang S. TRF2-RAP1 is required to protect telomeres from engaging in homologous recombination-mediated deletions and fusions. Nat Commun 2016;7:10881. 25. Ran X, Liu L, Yang CY, Lu J, Chen Y, Lei M, Wang S. Design of high-affinity stapled peptides to target the repressor activator protein 1 (RAP1)/telomeric repeat-binding factor 2 (TRF2) protein-protein interaction in the shelterin complex. J Med Chem 2016;59:328-334. 26. Palm W, de Lange T. How shelterin protects mammalian telomeres. Annu Rev Genet 2008;42:301-334. 27. De Boeck G, Forsyth RG, Praet M, Hogendoorn PC. Telomere-associated proteins: cross-talk between telomere maintenance and telomerelengthening mechanisms. J Pathol 2009;217:327-344. 28. Fajkus J, Simickova M, Malaska J. Tiptoeing to chromosome tips: facts, promises and perils of today’s human telomere biology. Philos Trans R Soc Lond B Biol Sci 2002;357:545-562. 29. Ramsay AJ, Quesada V, Foronda M, Conde L, Martinez-Trillos A, Villamor N, Rodriguez D, Kwarciak A, Garabaya C, Gallardo M, Lopez-Guerra M, LopezGuillermo A, Puente XS, Blasco MA, Campo E, Lopez-Otin C. POT1 mutations cause telomere dysfunction in chronic lymphocytic leukemia. Nat Genet 2013;45:526-530. 30. Augereau A, T’Kint de Roodenbeke C, Simonet T, Bauwens S, Horard B, Callanan M, Leroux D, Jallades L, Salles G, Gilson E, Poncet D. Telomeric damage in early stage of chronic lymphocytic leukemia correlates with shelterin dysregulation. Blood 2011;118:1316-1322.

16. van Steensel B, de Lange T. Control of telomere length by the human telomeric protein TRF1. Nature 1997;385:740-743.

31. Marcondes AM, Bair S, Rabinovitch PS, Gooley T, Deeg HJ, Risques R. No telomere shortening in marrow stroma from patients with MDS. Ann Hematol 2009;88:623-628.

17. Takai KK, Hooper S, Blackwood S, Gandhi R, de Lange T. In vivo stoichiometry of shelterin components. J Biol Chem 2010;285:1457-1467.

32. Gürkan E, Tanriverdi K, Başlamişli F. Telomerase activity in myelodysplastic syndromes. Leuk Res 2005;29:1131-1139.

206

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0286 Turk J Hematol 2017;34:207-212

Prognostic Value of miRNA-155 Expression in B-Cell Non-Hodgkin Lymphoma B Hücreli Hodgkin Dışı Lenfomada miRNA-155 İfadesinin Prognostik Değeri Ahmed M. L. Bedewy1, Shereen M. Elmaghraby1, Ahmed A. Shehata2, Noha S. Kandil3 Alexandria University Faculty of Medicine, Medical Research Institute, Alexandria Governorate, Egypt Alexandria University Faculty of Medicine, Department Internal Medicine, Alexandria Governorate, Egypt 3 Alexandria University Faculty of Medicine, Department Chemical Pathology, Alexandria Governorate, Egypt 1 2

Abstract

Öz

Objective: MicroRNA-155 (miRNA-155) resides within the B-cell integration cluster gene on chromosome 21. It can act either as an oncogene or as a tumor-suppressor gene, depending on the cell background in which miRNA-155 is performing its specific target gene controlling function. Therefore, the aim of this study was to investigate miRNA-155 expression in patients with B-cell nonHodgkin lymphoma (NHL) and its relation to disease prognosis in diffuse large B-cell lymphoma (DLBCL) patients.

Amaç: MikroRNA-155 (miRNA-155) 21. kromozom üzerinde B-hücresi birleşim kümesi içinde yer alır. miRNA-155 özgün hedef gen kontrolü yaptığı hücre zeminine göre onkogen veya tümor baskılayıcı gen olarak etkili olur. Bu nedenle, bu çalışmanın amacı B-hücreli Hodgkin dışı lenfoma hastalarında miRNA-155 ifadesini ve bunun yaygın büyük B hücreli lenfoma (YBBHL) olgularında hastalık prognozu ile ilişkisini araştırmaktır.

Materials and Methods: Reverse transcription-polymerase chain reaction assay was performed to evaluate the expression levels of miRNA-155 in 84 patients with newly diagnosed B-cell NHL and 15 normal controls. Results: Compared with normal controls, miRNA-155 expression was significantly upregulated in patients. Moreover, higher levels of miRNA-155 were associated with the presence of B symptoms, involvement of extranodal sites, and high Eastern Cooperative Oncology Group (ECOG) score. Higher levels of miRNA-155 in DLBCL were associated with non-germinal B-cell-like type, the presence of B symptoms, involvement of extranodal sites, and higher International Prognostic Index (IPI) and ECOG scores. Only the high IPI score and high miRNA-155 expression indicated a higher risk of lower eventfree survival using multivariate Cox regression analysis. Our data demonstrated that the expression of miRNA-155 was upregulated in newly diagnosed B-cell NHL patients. miRNA-155 is expressed at a lower level in GCB-subtype DLBCL. Low IPI score and miRNA-155 expression were predictors of longer event-free survival.

Gereç ve Yöntemler: Seksen dört yeni tanı B-hücreli Hodgkin dışı lenfoma hastasında ve 15 normal kontrolde miRNA-155 ifade düzeyini değerlendirmek için ters transkripsiyon-polimeraz zincir reaksiyonu testi kullanıldı. Bulgular: Normal kontrol ile karşılaştırıldığında hastalarda miRNA-155 ifadesi belirgin artmıştı. Ayrıca, yüksek miRNA-155 düzeyleri B semptomlarının varlığı, nodal dışı bölge tutulumu ve yüksek Doğu Kooperatifi Onkoloji Grubu (ECOG) skoru ile ilişkiliydi. YBBHL olgularında yüksek miRNA-155 düzeyleri germinal-dışı B hücre fenotipi, B semptomları, nodal dışı bölge tutulumu, yüksek Uluslararası Prognostik İndeks (IPI) ve ECOG skorları ile ilişkiliydi. Çoklu değişkenli Cox regresyon analizinde sadece yüksek IPI skoru ve yüksek miRNA-155 ifadesi düşük olaysız sağkalım riski ile ilşkili bulundu. Bulgularımız yeni tanı YBBHL olgularında miRNA-155 ifadesinin arttığını gösterdi. YBBHL’nın germinal merkez alt tipinde miRNA-155 düşük düzeyde ifade oldu. Düşük IPI skoru ve miRNA-155 ifadesi uzun olaysız sağkalım için göstergeydi.

Conclusion: Despite contradicting literature reports, the current findings suggest the potential value of miRNA-155 as a biomarker of prognosis and monitoring in B-cell NHL, and especially that of the DLBCL type.

Sonuç: Çelişkili literatüre verilerine karşın, mevcut bulgularımız miRNA-155’in prognostik bir biyobelirteç olarak başta YBBHL tipi olmak üzere B-hücreli Hodgkin dışı lenfomaların izleminde potansiyel değerine işaret etmektedir.

Keywords: MicroRNA-155, non-Hodgkin lymphoma, Prognosis

Anahtar Sözcükler: MikroRNA-155, Hodgkin dışı lenfoma, Prognoz

Address for Correspondence/Yazışma Adresi: Ahmed M. L. BEDEWY, M.D., Alexandria University Faculty of Medicine, Medical Research Institute, Alexandria Governorate, Egypt Phone : +20 100 004 0511 E-mail : dr_ahmed_bedewy@yahoo.com

Received/Geliş tarihi: July 23, 2016 Accepted/Kabul tarihi: January 31, 2017

207

Bedewy AML, et al: miRNA-155 in B-Cell Non-Hodgkin Lymphoma

Introduction B-cell lymphomas constitute a heterogeneous group of lymphoproliferative neoplasms originating from B cells with a largely unknown pathogenesis. The current classifications of B-cell lymphomas are essentially based on the recognition of characteristic genetic abnormalities that deregulate the expression of oncogenes or tumor suppressor genes [1]. B-cell non-Hodgkin lymphomas (NHLs) are derived from mature B cells and account for approximately %70-90% of lymphoid neoplasms worldwide and 4% of all new cancers each year [2]. The most common types of NHL are diffuse large B-cell lymphoma (DLBCL) and follicular lymphoma, which together represent more than 60% of all cases [3,4]. MicroRNAs (miRNAs) are small, non-coding RNA stretches that consist of approximately 22 nucleotides. miRNAs function through post-transcriptional modulation of gene expression. This occurs by miRNA specifically binding to its target miRNA, thus inhibiting its translation into polypeptide [5]. The discovery of miRNA has exposed a new layer of gene expression regulation that affects many physiological and pathological processes of life [6]. Many abnormal miRNA expression patterns are found in various human malignancies, and certain miRNAs play roles as oncogenes or tumor suppressors [7]. The role of miRNAs in B-cell lineage development was reviewed by Fernando et al. [8]. Certain miRNAs have been found to characterize various subtypes of NHL and have important roles in B-cell differentiation and lymphomagenesis [9,10,11,12]. miRNA-155 maps within the B-cell integration cluster gene on chromosome 21. It was suggested that miRNA-155 can act either as an oncogene or as a tumor-suppressor gene, depending on the type of cell in which miRNA-155 is performing its specific modulation of target gene expression [13]. However, no clinical correlation of miRNA-155 and B-cell NHL was further investigated. This work aims to investigate miRNA-155 expression in patients with B-cell NHL and its relation to treatment response and disease prognosis in DLBCL patients.

Materials and Methods Eighty-four patients with newly diagnosed histologically documented B-cell NHL, who presented to the Hematology Unit of the Internal Medicine Department of the Faculty of Medicine and the Hematology Department of the Medical Research Institute, Alexandria University, were included in the study. Informed consent was provided by all patients. The procedures followed were according to the ethical standards of the responsible committee on human experimentation (institutional and national) and with the Helsinki Declaration of 1975, as revised in 2008. Confidentiality of data was assured for all the patients. Fifteen subjects were enrolled in the study as healthy controls. History, clinical, and laboratory data of the studied B-cell NHL patients were collected, particularly age, sex, Eastern Cooperative 208

Turk J Hematol 2017;34:207-212

Oncology Group (ECOG) performance status [14], presence of B symptoms, presence of bulky disease, involvement of extranodal sites, bone marrow infiltration, Ann Arbor clinical stage [15], serum lactate dehydrogenase (LDH) level, and the International Prognostic Index (IPI) score [16] in addition to treatment response and event-free survival for 54 DLBCL patients. DLBCL patients were treated with the standard CHOP regimen [17] and their response to treatment was assessed according to standard criteria [18]. The follow-up period of these patients ranged from 12 to 30 months with a median of 18.5 months. Molecular study for the assay of miRNA-155 in patients using quantitative real-time reverse transcriptase polymerase chain reaction (RT-PCR) was performed for both patients and healthy controls. RNA Extraction Total RNA was isolated from 300 µL of cell-free serum using the mirVana™ miRNA Isolation Kit (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA was dissolved in RNase-free water. The RNA concentration and purity were quantified with the NanoDrop ND-1000 (NanoDrop, Wilmington, DE, USA) and samples were stored at -80 °C until use. RT-PCR Quantification Reverse transcription was performed using a First-Strand cDNA Synthesis Kit for miRNA (OriGene Technologies, Rockville, MD, USA) using 1 µg of extracted RNA according to the manufacturer’s instructions. Real-time PCR was performed using human miRNA-155 and U22 qSTAR miRNA primer pairs and the SensiMix SYBR Master Mix Kit (OriGene Technologies) according to the manufacturer’s instructions using the StepOne real-time PCR system (Applied Biosystems, Foster City, CA, USA). Normalization was performed with U22 small nucleolar RNA expression. The 2-ΔΔCt method was used in the analysis of PCR data. PCR efficiencies for miRNA-155 and U22 were determined and were 98.1% and 97.8%, respectively [19]. Statistical Analysis Data were fed to a computer and analyzed using IBM SPSS 20.0. Comparisons between groups for categorical variables were assessed using the chi-square test. Multivariate logistic regression was assessed to find the factors most affecting event-free survival. A plotted event-free survival curve was used. Significance of the obtained results was judged at the 5% level.

Results Compared to normal controls, miRNA-155 expression was significantly upregulated in B-cell NHL patients (p=0.034) (Figure 1). miRNA expression in patients ranged from 0 to 8.98 relative expression units (REU) with a median value of 1.235 REU. NHL patients expressing miRNA-155 at levels less than the median were assigned to the low-expression group (n=42), and

Bedewy AML, et al: miRNA-155 in B-Cell Non-Hodgkin Lymphoma

Turk J Hematol 2017;34:207-212

those with expression equal to or above the median value were assigned to the high-expression group (n=42). High miRNA-155 expression was associated with the presence of B symptoms, involvement of extranodal sites, and high ECOG performance score (Table 1). No association was found between miRNA-155 expression and age, sex, or clinical stage. Among the studied patients, 54 had DLBCL. The expression of miRNA-155 in these DLBCL patients varied from high expression in 30 patients to low expression in 24 patients. Higher expression of miRNA-155 was found in DLBCL patients who had the nongerminal B-cell type (31 cases) compared to the germinal center B-type (23 cases) (p=0.008). The presence of B symptoms, high IPI score, and high ECOG performance score were associated with higher miRNA-155 expression (p=0.002, p=0.004, and p=0.006, respectively). The expression of miRNA-155 was not associated with patients’ age (p=0.682), sex (p=0.902), serum LDH level (p=0.245), serum β2 microglobulin level (p=0.529), clinical stage (p=1.00), age-adjusted IPI score (p=0.338), extranodal involvement (p=0.088), or the response to treatment in DLBCL patients (p=0.800) (Table 2). Multivariate Cox binary logistic regression analysis was performed to evaluate the influence of the studied factors

on event-free survival among the studied DLBCL patients. Only high IPI score (odds ratio: 8.305) and high miRNA-155 expression (odds ratio: 5.916) correlated with a higher risk of lower event-free survival (p=0.043 and p=0.035, respectively) (Table 3, Figures 2 and 3).

Discussion Even though an explosion of molecular knowledge has paved the road for more precise recognition of distinct lymphoma subtypes, many patients still do not achieve satisfactory response Table 1. MicroRNA-155 expression in patients as regards the studied parameters. MicroRNA-155 expression p Low (n=42)

High (n=42)

35 (83.3%)

37 (88.1%)

7 (16.7%)

5 (11.9%)

Sex Male

28 (66.7%)

25 (59.5%)

Female

14 (33.3%)

14 (40.5%)

Lymphoma type DLBCL

24 (57.1%)

30 (71.4%)

Others

11 (26.2%) 2 (4.8%) 3 (7.1%) 2 (4.8%)

6 (14.3%) 4 (9.5%) 1 (2.4%) 1 (2.4%)

LDH serum level Normal

30 (71.4%)

27 (64.3%)

Elevated

12 (28.6%)

15 (35.7)

Age Less than 60 years

60 years and above

Follicular MCL SLL

Figure 1. Boxplot graph of microRNA expression in patients and controls.

0.533

0.498

0.434

0.483

β2 microglobulin serum level Normal 25 (59.5%)

24 (57.1%)

Elevated

17 (40.5%)

18 (42.9%)

Stage Early (I and IIA)

16 (38.1%)

14 (33.3%)

0.649

26 (61.9%) 5 (11.9%) 14 (33.3%)

28 (66.7%) 21 (50.0%) 25 (59.5%)

<0.001* 0.016*

3 (7.1%)

2 (4.8%) 13 (31.0%)

1.000 0.124

32 (76.2%)

0.004*

Late B symptoms Extranodal infiltration Bulky disease

Bone marrow 7 (16.7%) infiltration ECOG performance score 0-1 41 (97.6%)

1 (2.4%)

0.825

10 (23.8%)

Figure 2. Event-free survival of the studied patients according to the studied covariates regression model.

DLBCL: Diffuse large B-cell lymphoma, MCL: mantle cell lymphoma, SLL: small lymphocytic lymphoma, LDH: lactate dehydrogenase, ECOG: Eastern Cooperative Oncology Group.

209

Bedewy AML, et al: miRNA-155 in B-Cell Non-Hodgkin Lymphoma

Table 2. MicroRNA-155 expression as regards the studied parameters in diffuse large B-cell lymphoma cases. MicroRNA-155 expression p Low (n=24) High (n=30) Age Less than 60 years 22 (91.7%) 26 (86.7%) 60 years and above 2 (8.3%) 4 (13.3%) Sex Male 14 (58.3%) 17 (56.7%) Female 10 (41.7%) 13 (43.3%) DLBCL subtype GC 15 (62.5%) 8 (26.7%) Non-GC 9 (37.5%) 22 (73.3%) Response to first-line therapy CR 9 (37.5%) 14 (46.7%) PR 12 (50.0%) 12 (40.0 ) NR 3 (12.5%) 4 (13.3%) Achievement of CR after first-line therapy Yes 9 (37.5%) 14 (46.7%) No 15 (62.5%) 16 (53.3%) LDH serum level Normal 18 (75.0%) 18 (60.0%) Elevated 6 (25.0%) 12 (40.0%) β2 microglobulin serum level Normal 14 (58.3%) 20 (66.7%) Elevated 10 (41.7%) 10 (33.3%) IPI score Low risk 15 (62.5%) 7 (23.3%) Low-intermediate 5 (20.8%) 15 (50.0%) High-intermediate 4 (16.7%) 6 (20.0%) High risk 0 (0.0%) 2 (6.7%) IPI score 15 (62.5%) 7 (76.7%) Low High 9 (37.5%) 23 (76.7%) Age-adjusted IPI score Low risk 9 (37.5%) 6 (20.0%) Low-intermediate 8 (33.3%) 11 (36.7%) High-intermediate 7 (29.2%) 10 (33.3%) High risk 0 (0.0%) 3 (10.0%) Clinical stage Early 8 (33.3%) 10 (33.3%) Late 16 (66.7%) 20 (66.7%) B symptoms 3 (12.5%) 16 (53.35%) Extranodal infiltration 8 (33.3%) 17 (56.7%) Bulky disease 2 (8.3%) 1 (3.3%) Bone marrow 2 (8.3%) 4 (13.3%) infiltration ECOG performance score 0-1 24 (100.0%) 22 (73.3%) >1 0 (0.0%) 8 (26.7%)

0.682

0.902

0.008*

0.800

0.498

0.245

0.529

0.014*

0.004*

0.338

Turk J Hematol 2017;34:207-212

to the available standard therapies [20]. Among many players, the instinctive molecular incongruity within each NHL type and the unclear discrimination of NHL types are important factors. As such, the identification of novel prognostic biomarkers and therapeutic targets can possibly offer a better outcome for each NHL patient. miRNAs represent an important category of putative biomarkers and therapeutic targets for NHL and other cancers. miRNA-155 overexpression was reported to contribute to tumorigenesis, possibly by dysregulating the expression of members of the PI3K-AKT pathway, the transforming growth factor beta (TGFβ) pathway, and other transcriptional regulators [21,22,23]. miRNA-155 represses the SH2-domain encompassing inositol-5-phosphatase 1 (SHIP-1). SHIP-1 is a critical phosphatase that negatively down-modulates the AKT pathway. It exerts this action during normal B-cell development. Thus, sustained overexpression of miRNA-155 in B cells is thought to unblock AKT activity, favoring B-cell proliferation. In concordance with this, Gironella et al. [24] ascribed this effect of miRNA-155 to a blockade of caspase-3 activity and decreased tumor protein 53-induced nuclear protein 1 (TP53INP1), a nuclear protein capble of inducing cell cycle arrest and apoptosis through activation of caspase 3. Interestingly, in DLBCLs, miRNA-155 overabundance has been shown to induce resistance to the growth-inhibitory effects of both TGFβ1 and bone morphogenetic protein. This comes through the defective induction of p21 and the impaired cell cycle arrest caused by targeting SMAD5 [25,26]. This was supported by the work of Jiang and Aguiar [27] on DLBCL cell lines and a miRNA-155 knock-out mouse model. They demonstrated that levels of the transcription factor SMAD5 are elevated in mature B lymphocytes, which exhibit an elevated sensitivity to TGFβ1 characterized by inhibition of retinoblastoma protein (RB) phosphorylation and a significant G0/G1 cell-cycle arrest. In the present work, miRNA-155 expression was significantly upregulated in patients with newly diagnosed B-cell NHL compared to controls (p=0.034). In concordance with this,

1.000 0.002* 0.088 0.579 0.682

0.006*

Qualitative data were described using number and percent and were compared using the chi-square test, while normally quantitative data were expressed as mean ± standard deviation and compared using the Student t-test, *: Statistically significant at p≤0.05. DLBCL: Diffuse large B-cell lymphoma, MCL: mantle cell lymphoma, SLL: small lymphocytic lymphoma, LDH: lactate dehydrogenase, ECOG: Eastern Cooperative Oncology Group.

210

Figure 3. Event-free survival of the studied patients stratified by microRNA-155 expression (p=0.0035).

Bedewy AML, et al: miRNA-155 in B-Cell Non-Hodgkin Lymphoma

Turk J Hematol 2017;34:207-212

Table 3. Multivariate binary logistic regression for the studied prognostic factors as regards event-free survival. 95% Confidence interval B DLBCL subtype Stage ECOG performance score Bone marrow infiltration Bulky disease B symptoms International prognostic index Serum β2 microglobulin Serum LDH level miRNA-155 expression Achievement of complete remission After first-line therapy

-1.098 0.399 0.073 -0.124 -0.172 0.125 2.117 0.143 0.082 1.778 -0.843

Standard error 0.607 0.752 0.740 0.940 1.417 0.609 1.046 0.532 0.534 0.843 0.495

Significant 0.071 0.596 0.921 0.895 0.903 0.837 0.043* 0.788 0.878 0.035* 0.088

Odds ratio 0.334 1.490 1.076 0.883 0.842 1.133 8.305 1.153 1.085 5.916 0.430

Lower limit 0.101 0.341 0.252 0.140 0.052 0.344 1.070 0.407 0.381 1.134 0.163

Upper limit 1.097 6.508 4.587 5.573 13.531 3.737 64.482 3.271 3.091 30.864 1.135

*: Statistically significant at p≤0.05. DLBCL: Diffuse large B-cell lymphoma, LDH: lactate dehydrogenase, ECOG: Eastern Cooperative Oncology Group.

Roehle et al. [28] reported that miRNA-155 is overexpressed in follicular lymphoma and DLBCL when compared with normal lymph nodes. In addition, Shepshelovich et al. [29] and Thai et al. [30] found miRNA-155 overexpression as a frequent finding in DLBCL patients. In the present work, higher levels of miRNA-155 in patients were associated with the presence of B symptoms, involvement of extranodal sites, and high ECOG performance score (p<0.001, 0.016, and 0.004, respectively). However, miRNA-155 expression levels showed no association with sex, age, or clinical stage. In the DLBCL patients of the current series, higher levels of miRNA-155 were associated with the presence of B symptoms, involvement of extranodal sites, high IPI score, high ECOG performance score, and non-germinal B-cell type. The expression of miRNA-155 was not associated with sex, age, response to treatment, clinical stage, or serum markers (LDH and β2 microglobulin). Similar findings were reported by Malumbres et al. [10], Eis et al. [31], and Kluiver et al. [32], particularly regarding the association between miRNA-155 expression and the non-germinal center B (GCB) immunophenotype of DLBCL. Using microarray analysis of prototypic cell lines, miRNA-155 was more highly expressed in ABC-type than GCB-type cell lines and was overexpressed in de novo DLBCL (n=35), transformed DLBCL (n=14), and follicular center lymphoma cases (n=27) compared to normal B cells according to the report of Lawrie et al. [33]. On the other hand, Zhong et al. [34] reported a lack of association between miRNA-155 expression levels and sex, age, clinical stage, or extranodal involvement. The significant prognostic impact of miRNA-155 expression together with the IPI score evidenced by Cox regression analysis in the present series was interestingly in line with the report of Zhong et al. [34]. They reported that low miRNA-155 was associated with a longer 5-year progression-

free survival in de novo DLBCL cases. They found that the expression levels of miRNA-155 and IPI status were statistically significant independent indicators of prognosis (p<0.05) [28]. On the contrary, Lawrie et al. [33] reported the absence of an association between the expression of miRNA-155 and prognosis (p=0.22). However, a recent report by Due et al. [35] confirmed the independent prognostic impact of miRNA-155 in DLBCL and emphasized its potential value as a molecular tool in personalized medicine.

Conclusion Our data demonstrated that the expression of miRNA-155 was upregulated in newly diagnosed B-cell NHL patients. miRNA-155 is expressed at a higher level in ABC-type than in GCB-subtype DLBCL, suggesting that the quantiﬁcation of this miRNA may have a role in establishing the prognosis. Among the studied parameters, only low IPI score and low miRNA-155 expression were predictors of longer event-free survival. Despite the contradicting literature reports in this regard, the current findings suggest the potential value of miRNA-155 as a biomarker of prognosis and monitoring in B-cell NHL, especially for the DLBCL type. Ethics Ethics Committee Approval: The procedures followed were according to the ethical standards of the responsible committee on human experimentation (institutional and national) and with the Helsinki Declaration of 1975, as revised in 2008. Informed Consent: Informed consent was provided by all patients. Authorship Contributions Surgical and Medical Practices: A.M.L.B., S.M.E., A.A.S., N.S.K.; Concept: A.M.L.B., S.M.E., A.A.S., N.S.K.; Design: A.M.L.B., S.M.E., 211

Bedewy AML, et al: miRNA-155 in B-Cell Non-Hodgkin Lymphoma

Turk J Hematol 2017;34:207-212

A.A.S., N.S.K.; Data Collection or Processing: A.M.L.B., S.M.E., A.A.S., N.S.K.; Analysis or Interpretation: A.M.L.B., S.M.E., A.A.S., N.S.K.; Literature Search: A.M.L.B., S.M.E., A.A.S., N.S.K.; Writing: A.M.L.B., S.M.E., A.A.S., N.S.K.

19. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nat Protoc 2008;3:1101-1108.

21. Huang X, Shen Y, Liu M, Bi C, Jiang C, Iqbal J, McKeithan TW, Chan WC, Ding SJ, Fu K. Quantitative proteomics reveals that miR-155 regulates the PI3K-AKT pathway in diffuse large B-cell lymphoma. Am J Pathol 2012;181:26-33.

References 1. Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri, SA, Stein H, Thiele J, Vardiman JW. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. Lyon, IARC Press, 2008. 2. Alexander DD, Mink PJ, Adami HO, Chang ET, Cole P, Mandel JS, Trichopoulos D. The non-Hodgkin lymphomas: a review of the epidemiologic literature. Int J Cancer 2007;120(Suppl 12):1-39. 3. Chihara D, Nastoupil LJ, Williams JN, Lee P, Koff JL, Flowers CR. New insights into the epidemiology of non-Hodgkin lymphoma and implications for therapy. Expert Rev Anticancer Ther 2015;15:531-544. 4. Perry AM, Diebold J, Nathwani BN, MacLennan KA, Müller-Hermelink HK, Bast M, Boilesen E, Armitage JO, Weisenburger DD. Non-Hodgkin lymphoma in the developing world: review of 4539 cases from the International Non-Hodgkin Lymphoma Classification Project. Haematologica 2016;101:1244-1250. 5. Roth C, Rack B, Müller V, Janni W, Pantel K, Schwarzenbach H. Circulating microRNAs as blood-based markers for patients with primary and metastatic breast cancer. Breast Cancer Res 2010;12:R90. 6. Lawrie CH. MicroRNAs and lymphomagenesis: a functional review. Br J Haematol 2013;160:571-581. 7. Ling N, Gu J, Lei Z, Li M, Zhao J, Zhang HT, Li X. microRNA-155 regulates cell proliferation and invasion by targeting FOXO3a in glioma. Oncol Rep 2013;30:21112118. 8. Fernando TR, Rodriguez-Malave NI, Rao DS. MicroRNAs in B cell development and malignancy. J Hematol Oncol 2012;5:7. 9. Zhang J, Jima DD, Jacobs C, Fischer R, Gottwein E, Huang G, Lugar PL, Lagoo AS, Rizzieri DA, Friedman DR, Weinberg JB, Lipsky PE, Dave SS. Patterns of microRNA expression characterize stages of human B-cell differentiation. Blood 2009;113:4586-4594. 10. Malumbres R, Sarosiek KA, Cubedo E, Ruiz JW, Jiang X, Gascoyne RD, Tibshirani R, Lossos IS. Differentiation stage-specific expression of microRNAs in B lymphocytes and diffuse large B-cell lymphomas. Blood 2009;113:3754-3764. 11. Basso K, Sumazin P, Morozov P, Schneider C, Maute RL, Kitagawa Y, Mandelbaum J, Haddad J Jr, Chen CZ, Califano A, Dalla-Favera R. Identification of the human mature B cell miRNome. Immunity 2009;30:744-752. 12. Auer RL. The coming of age of microRNA for B cell lymphomas. Histopathology 2011;58:39-48. 13. Levati L, Alvino E, Pagani E, Arcelli D, Caporaso P, Bondanza S, Di Leva G, Ferracin M, Volinia S, Bonmassar E, Croce CM, D’Atri S. Altered expression of selected microRNAs in melanoma: antiproliferative and proapoptotic activity of miRNA-155. Int J Oncol 2009;35:393-400. 14. Oken MM, Creech RH, Tormey DC, Horton J, Davis TE, McFadden ET, Carbone PP. Toxicity and response criteria of the Eastern Cooperative Oncology Group. Am J Clin Oncol 1982;5:649-655. 15. Lister TA, Crowther D, Sutcliffe SB, Glatstein E, Canellos GP, Young RC, Rosenberg SA, Coltman CA, Tubiana M. Report of a committee convened to discuss the evaluation and staging of patients with Hodgkin’s disease: Cotswolds meeting. J Clin Oncol 1989;7:1630-1636. 16. International Non-Hodgkin’s Lymphoma Prognostic Factors Project. A predictive model for aggressive non-Hodgkin’s lymphoma. N Engl J Med 1993;329:987-994. 17. Cwynarski K, Goldstone AH. Non-Hodgkin lymphoma. In: Hoffbrand EA, Catovsky D, Tuddenham EGD, Green AR, (eds). Postgraduate Hematology, 6th ed. Oxford, Wiley-Blackwell, 2010. 18. Cheson BD, Horning SJ, Coiffier B, Shipp MA, Fisher RI, Connors JM, Lister TA, Vose J, Grillo-López A, Hagenbeek A, Cabanillas F, Klippensten D, Hiddemann W, Castellino R, Harris NL, Armitage JO, Carter W, Hoppe R, Canellos GP. Report of an international workshop to standardize response criteria for non-Hodgkin’s lymphomas. NCI Sponsored International Working Group. J Clin Oncol 1999;17:1244-1253.

212

20. Sinha R, Nastoupil L, Flowers CR. Treatment strategies for patients with diffuse large B-cell lymphoma: past, present, and future. Blood Lymphat Cancer 2012;2012:8798.

22. Cinegaglia NC, Andrade SC, Tokar T, Pinheiro M, Severino FE, Oliveira RA, Hasimoto EN, Cataneo DC, Cataneo AJ, Defaveri J, Souza CP, Marques MM, Carvalho RF, Coutinho LL, Gross JL, Rogatto SR, Lam WL, Jurisica I, Reis PP. Integrative transcriptome analysis identifies deregulated microRNA-transcription factor networks in lung adenocarcinoma. Oncotarget 2016;7:28920-28934. 23. Sandhu SK, Volinia S, Costinean S, Galasso M, Neinast R, Santhanam R, Parthun MR, Perrotti D, Marcucci G, Garzon R, Croce CM. miR-155 targets histone deacetylase 4 (HDAC4) and impairs transcriptional activity of B-cell lymphoma 6 (BCL6) in the Eµ-miR-155 transgenic mouse model. Proc Natl Acad Sci U S A 2012;109:2004720052. 24. Gironella M, Seux M, Xie MJ, Cano C, Tomasini R, Gommeaux J, Garcia S, Nowak J, Yeung ML, Jeang KT, Chaix A, Fazli L, Motoo Y, Wang Q, Rocchi P, Russo A, Gleave M, Dagorn JC, Iovanna JL, Carrier A, Pébusque MJ, Dusetti NJ. Tumor protein 53-induced nuclear protein 1 expression is repressed by miR-155, and its restoration inhibits pancreatic tumor development. Proc Natl Acad Sci U S A 2007;104:16170-16175. 25. Costinean S, Sandhu SK, Pedersen IM, Tili E, Trotta R, Perrotti D, Ciarlariello D, Neviani P, Harb J, Kauffman LR, Shidham A, Croce CM. Src homology 2 domain–containing inositol-5-phosphatase and CCAAT enhancer-binding protein β are targeted by miR-155 in B cells of Eμ-MiR-155 transgenic mice. Blood 2009;114:1374-1382. 26. Rai D, Kim SW, McKeller MR, Dahia PL, Aguiar RC. Targeting of SMAD5 links microRNA-155 to the TGF‐beta pathway and lymphomagenesis. Proc Natl Acad Sci U S A 2010;107:3111-3116. 27. Jiang D, Aguiar RC. MicroRNA-155 controls RB phosphorylation in normal and malignant B lymphocytes via the noncanonical TGF-β1/SMAD5 signaling module. Blood 2014;123:86-93. 28. Roehle A, Hoefig KP, Repsilber D, Thorns C, Ziepert M, Wesche KO, Thiere M, Loeffler M, Klapper W, Pfreundschuh M, Matolcsy A, Bernd HW, Reiniger L, Merz H, Feller AC. MicroRNA signatures characterize diffuse large B-cell lymphomas and follicular lymphomas. Br J Haematol 2008;142:732-744. 29. Shepshelovich D, Ram R, Uziel O, Kushnir M, Lithwick-Yanai G, Hoshen M, Feinmesser M, Bairey O, Lahav M. MicroRNA signature is indicative of long term prognosis in diffuse large B-cell lymphoma. Leuk Res 2015;39:632-637. 30. Thai TH, Calado DP, Casola S, Ansel KM, Xiao C, Xue Y, Murphy A, Frendewey D, Valenzuela D, Kutok JL, Schmidt-Supprian M, Rajewsky N, Yancopoulos G, Rao A, Rajewsky K. Regulation of the germinal center response by microRNA-155. Science 2007;316:604-608. 31. Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF, Lund E, Dahlberg JE. Accumulation of miR-155 and BIC RNA in human B cell lymphomas. Proc Natl Acad Sci U S A 2005;102:3627-3632. 32. Kluiver J, Poppema S, de Jong D, Blokzijl T, Harms G, Jacobs S, Kroesen BJ, van den Berg A. BIC and miR-155 are highly expressed in Hodgkin, primary mediastinal and diffuse large B cell lymphomas. J Pathol 2005;207:243-249. 33. Lawrie CH, Soneji S, Marafioti T, Cooper CD, Palazzo S, Paterson JC, Cattan H, Enver T, Mager R, Boultwood J, Wainscoat JS, Hatton CS. MicroRNA expression distinguishes between germinal center B cell-like and activated B cell-like subtypes of diffuse large B cell lymphoma. Int J Cancer 2007;121:1156-1161. 34. Zhong H, Xu L, Zhong JH, Xiao F, Liu Q, Huang HH, Chen FY. Clinical and prognostic significance of miR-155 and miR-146a expression levels in formalin-fixed/ paraffin-embedded tissue of patients with diffuse large B cell lymphoma. Exp Ther Med 2012;3:763-770. 35. Due H, Svendsen P, Bødker JS, Schmitz A, Bøgsted M, Johnsen HE, El-Galaly TC, Roug AS, Dybkær K. miR-155 as a biomarker in B-cell malignancies. Biomed Res Int 2016;2016:9513037.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0171 Turk J Hematol 2017;34:213-225

Comparative Analyses of Immunosuppressive Characteristics of Bone-Marrow, Wharton’s Jelly, and Adipose Tissue-Derived Human Mesenchymal Stem Cells Kemik İliği, Wharton Jölesi ve İnsan Yağ Doku-Kaynaklı Mezenkimal Kök Hücrelerin İmmünsüpresif Özelliklerinin Karşılaştırmalı Olarak İncelenmesi Erdal Karaöz1,2, Pınar Çetinalp Demircan3, Gülay Erman1, Eda Güngörürler1,2, Ayla Eker Sarıboyacı4 Liv Hospital, Center for Regenerative Medicine and Stem Cell Research and Manufacturing, İstanbul, Turkey İstinye University Faculty of Medicine, Department of Histology and Embryology, İstanbul, Turkey 3 Onkim Stem Cell Technologies Inc., İstanbul, Turkey 4 Eskişehir Osmangazi University Vocational Faculty of Health Services, Cellular Therapy and Stem Cell Production, Eskişehir, Turkey 1 2

Abstract

Öz

Objective: Mesenchymal stem cells (MSCs), which possess immunosuppressive characteristics on induced T-cells, were shown to be applicable in prevention and treatment of graft-versus-host disease. However, knowledge of effective cell sources is still limited. In this study, MSCs from different human tissues, i.e. bone marrow (BM), Wharton’s jelly (WJ), and adipose tissue, were isolated, and the immune suppression of stimulated T cells was analyzed comparatively. Materials and Methods: MSCs were co-cultured with phytohemagglutinin-induced T-cells with co-culture techniques with and without cell-to-cell contact. After co-culture for 24 and 96 h, the proliferation rate of T cells was estimated by carboxyfluorescein succinimidyl ester and apoptosis by annexin V/PI methods. Both T cells and MSCs were analyzed with respect to gene expressions by real-time polymerase chain reaction and their specific protein levels by ELISA. Results: The results showed that all three MSC lines significantly suppressed T-cell proliferation; BM-MSCs were most effective. Similarly, T-cell apoptosis was induced most strongly by BM-MSCs in indirect culture. In T cells, the genes in NFkB and tumor necrosis factor pathways were silenced and the caspase pathway was induced after co-culture. These results were confirmed with the measurement of protein levels, like transforming growth factor β1, IL-6, interferon-γ, interleukin (IL)-2, and tumor necrosis factor-α. Additionally, IL-17A was detected in high levels in WJ-MSC co-cultures. We showed that IL-17A-producing Tregs are the key mediators in the treatment of graft-versus-host disease. Conclusion: BM-MSCs, which have been used in clinical applications for a while, showed the greatest immunosuppressive effect compared to other MSCs. However, a promising cell source could also be WJ, which is also effective in suppression with fewer ethical concerns. We described the molecular mechanism of WJ-MSCs in allogenic transplants for the first time. Keywords: Immunoregulatory effect, Co-culture, Mesenchymal stem cells, T cells

Amaç: Mezenkimal kök hücreler (MKH), uyarılmış T hücreler üzerinde sahip oldukları bağışıklık baskılayıcı özellikleri nedeniyle günümüzde graft versus host hastalığının önlenmesi veya tedavisi amacıyla kullanılmaya başlanmıştır. Kemik iliği kaynaklı MKH’lerin yanında, farklı insan kaynaklı dokulardan elde edilen MKH’lerin de benzer özelliklere sahip olduğunu bildiren raporlar yayımlanmaya başlamıştır. Bu araştırmada, günümüzde yenileyici tıp amaçlı en çok çalışılan kaynaklar olan kemik iliği (Kİ), göbek bağı (GB) ve adipoz doku kaynaklı MKH’lerin, insan uyarılmış T hücreleri üzerine olası bağışık baskılayıcı (immünsüpressif) özelliklerini karşılaştırılmalı olarak incelenmesi amaçlandı. Gereç ve Yöntemler: Uygun yöntemler kullanılarak izole edilen insan Kİ, adipoz doku- ve GB- tohemagglutinin ile uyarılmış T hücreler hücre-hücre etkileşimi veya parakrin etkiyi gözlemlenebilecek ko-kültürler tasarlandı. Yirmi dört ve 96 saatlik ko-kültürlerin ardından, T hücre çoğalımının tespiti için karboksiflüoresein süksinimidil ester ve apoptoza yönelimi tespit için ise anneksin V/PI yöntemleri kullanıldı. Hem T hücreler hem de MKH’ler gen anlatım düzeylerini değerlendirebilmek için real-time polimeraz zincir reaksiyonu ve belirli protein seviyelerin tespiti için de ELİSA yöntemleriyle analiz edildiler. Bulgular: Bulgularımız, üç farklı kaynaktan elde ettiğimiz insan MKH’lerin içinde uyarılmış T-hücreler üzerinde hem doğrudan temas yoluyla hem de parakrin etki mekanizmalarıyla hücre çoğalımını baskılamada ve apoptoza yönlendirmede en etkili Kİ-MKH’ler olduğunu göstermiştir. Bu bulgular, transforme edici büyüme faktörü (TGF)-β, interlökin (IL)-6 , interferon (IF)-γ , interlökin 2 ve tümör nekroz faktörü (TNF)-α proteinlerinin ölçümüyle de doğrulanmıştır. Bu bulgulara ek olarak GB-MKH ko-kültürlerinde IL17A’nın arttığını ve bu sistemde IL-17A üreten Treglerin graft versus host hastalığının tedavide rol aldığını gösterdik. Sonuç: Klinikte kullanılan Kİ-MKH’lerin en etkin bağışıklık baskılayıcı etki gösterdiğini çeşitli kaynaklardan elde ettiğimiz MKH’ler ile karşılaştırarak gösterdik. Ayrıca, GB-MKH’lerin allojenik kullanımlarda altında yatan moleküler mekanizmasını ilk biz göstermiş olduk. Çalışmalarımız sonucunda kullanımında bir etik kaygı içermeyen umut vaat edici kaynak olarak, GB’yi görüyoruz. Anahtar Sözcükler: Bağışıklık baskılayıcı etki, Ko-kültür, Mezenkimal kök hücre, T hücre

Address for Correspondence/Yazışma Adresi: Erdal KARAÖZ, PhD., Liv Hospital, Center for Regenerative Medicine and Stem Cell Research and Manufacturing, İstanbul, Turkey Phone : +90 212 999 84 28 E-mail : ekaraoz@hotmail.com

Received/Geliş tarihi: May 11, 2016 Accepted/Kabul tarihi: September 09, 2016

213

Karaöz E, et al: Comparative Analyses of Immunosuppressive Characteristics of MSCs

Introduction The crucial role of mesenchymal stem cells (MSCs) in tissue function is widely known with their effect on the tissue components by paracrine and autocrine factors. Until the last decades, the self-renewal capacity and multilineage differentiation potency of these cells were the main focus for tissue regeneration applications. On the other hand, the chemical factors secreted by MSCs in different experimental conditions irrespective of antigen-specific or mitogenic stimulation could also affect the immune system by suppressing maturation of dendritic cells and the functions of T cells, B cells, and natural killer cells, as well as by inducing regulatory T (Treg) cells. Numerous reports showed that MSC-derived bone marrow (BM) [1,2,3], adipose tissue (AT) [2,4], Wharton’s jelly (WJ) [4,5,6], peripheral blood (PB) [6], cord blood [7], placenta [8], amniotic fluid [9], dental pulp [10,11,12], dental follicle (DF) [12], supernumerary tooth-derived stem cells [13], periodontal ligament [14], and even periapical lesions [12] suppress activated T-cell responses. However, the molecular mechanisms underlying these effects are still unclear and need to be explored in much greater detail; they probably require both cell-to-cell contact and a variety of cytokines and soluble factors in a paracrine manner. Studies emphasized that proliferation was mainly inhibited by a paracrine effect. However, the direct co-culture of MSCs was also demonstrated to play an important role in their apoptotic effect in our recent study [11]. In this study, it was aimed both to characterize comparatively the immunosuppressive effects of MSCs derived from three different human tissues, i.e. BM, WJ, and AT, in detail and to clarify the mechanisms underlying them.

Materials and Methods Human BM-, AT- and WJ-MSCs (hBM-, h-AT, and hWJMSCs) were isolated and then identified according to their immunophenotype by flow cytometer. MSCs were induced to differentiate in vitro. After that, in order to check the T-cell proliferation and apoptosis rate, MSCs and phytohemagglutinin (PHA)-T cells were co-cultured in both mixed lymphocyte reactions (MLR) and transwell co-cultures. Cytokine and soluble factor expressions by human MSCs (hMSCs) and PHA-T cells were analyzed by ELISA and flow cytometer to understand the paracrine effect of MSCs on PHA-T cells. After co-culture, we used the LightCycler 480 human apoptosis panel (Roche, Mannheim, Germany) to detect the apoptotic effects of MSCs on PHA-T cells and to determine which pathways are involved by real-time polymerase chain reaction (RT-PCR). Isolation of hBM-, hAT-, and hWJ-MSCs BM aspirates (2-4 mL) were obtained from the iliac crest of patients (n=10, age range: 2-7 years) with suspected idiopathic 214

Turk J Hematol 2017;34:213-225

thrombocytopenic purpura. Informed consent was received in accordance with the terms of the Ethics Committee of Kocaeli University. Flow cytometric analysis confirmed that the donors were healthy. The BM was diluted to 1:3 with PBS and layered over Histopaque-1077 (1.077 g/mL, Sigma-Aldrich, St. Louis, MO, USA) for gradient centrifugation. The low-density mononuclear cells were collected, washed twice with PBS, counted, and plated in tissue culture flasks at a density of 1.4x105 cells/cm2 in low-glucose Dulbecco’s modified Eagle medium (L-DMEM) (Invitrogen/GIBCO, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS), 100 IU/mL penicillin, and 100 mg/ mL streptomycin. The cells were incubated at 37 °C in a humid atmosphere containing 5% CO2 for 3 days. On the third day, red blood cells and other non-adherent cells were removed and fresh medium was added to allow further growth. The adherent cells were grown to 70% confluence and passaged at this stage so as not to impede their proliferative capacity. Further passaging of the cells was performed by seeding 3.0x103 cells/cm2. Human AT tissues were obtained by lipoaspiration of subcutaneous fat of the abdominal region from donors. The donors consented to the procedure and agreed with further research on the aspirated fat in accordance with the ethical guidelines of the Kocaeli University Medical Ethics Committee. To remove blood and residues, tissue samples were washed several times with Hanks’ balanced salt solution (HBSS) (Invitrogen/ GIBCO, Paisley, UK) containing 5% penicillin/streptomycin solution (Invitrogen/GIBCO, Paisley, UK) without calcium and magnesium ions. Fatty portions of the lipoaspirate samples were collected by pipette and digested in HBSS supplemented with 5 mL of 0.075% collagenase type 1 (Invitrogen/GIBCO, Grand Island, NY, USA) for 60 min in a shaking water bath at 37 °C. The digests were pipetted vigorously at 20-min intervals and dissociation was monitored microscopically. After approximately 60 min, the cell suspensions were filtered through a 70-µm cell strainer to separate single cells from debris and tissue fragments of undigested AT. Cells were re-suspended in 10 mL of L-DMEM (Invitrogen/GIBCO, Paisley, UK) supplemented with 1% penicillin/streptomycin and 10% FBS (Invitrogen/GIBCO, Paisley, UK) and were centrifuged for 8-10 min at 300 x g. Adipose cells were washed three times in culture medium. Viability of the adipose cells was determined using the trypan blue dye exclusion method and a hemocytometer. The cells isolated from eight samples were plated in separate 25-cm2 culture flasks containing L-DMEM with 100 U/mL penicillin (Invitrogen/GIBCO, Paisley, UK), 0.1 mg/mL streptomycin (Invitrogen/GIBCO, Paisley, UK), and 10% FBS. Three days after the initiation of culture, the medium was replaced with fresh medium, and subsequently it was replaced twice a week. When 70%-80% confluence was reached in the primary cell culture, the cells were treated with 0.25% trypsin-ethylenediaminetetraacetic acid (Invitrogen/

Turk J Hematol 2017;34:213-225

Karaöz E, et al: Comparative Analyses of Immunosuppressive Characteristics of MSCs

GIBCO, Paisley, UK) for 3 min. The separated cells were collected, centrifuged, and re-plated at ratios of 1:3-1:4 for subculture.

indicates adipogenic differentiation, was confirmed by Oil Red O staining.

Umbilical cords were obtained from consenting patients delivering full-term infants by Cesarean section (n=4), who faced no complications throughout pregnancy. Cords of 15 cm in length were immersed in sterile HBSS (Invitrogen/GIBCO, Paisley, UK) containing 5% penicillin/streptomycin solution (Invitrogen/GIBCO, Paisley, UK) without calcium and magnesium ions and immediately transferred to the laboratory. Arteries and vein of the cord were removed by blunt dissection, and the remaining tissue was chopped with scissors and scalpels. Enzymatic digestion was performed in HBSS supplemented with 5 mL of 0.075% collagenase type 1 (Invitrogen/GIBCO, Grand Island, NY, USA) for 30 min in a shaking water bath at 37 °C. The homogenate was centrifuged at 1500 rpm for 5 min. The cell pellet was re-suspended in the culture medium, and viable cells were counted using the trypan blue dye exclusion method and a hemocytometer.

Osteogenic Differentiation: Similarly, the cells obtained from the 3rd passage were seeded at a density of 3x103 cells/cm2 onto 6-well plates with coverslips coated with type 1 collagen. For osteogenic differentiation, L-DMEM was supplemented with 100 nM dexamethasone (Sigma-Aldrich, St. Louis, MO, USA), 0.05 µM ascorbate-2-phosphate (Sigma-Aldrich, St. Louis, MO, USA), 10 mM β-glycerophosphate (Sigma-Aldrich, St. Louis, MO, USA), 1% penicillin/streptomycin, and 10% FBS. The cells were incubated in this medium for 4 weeks. The medium was replaced twice a week. At the end of the 4th week, osteogenic differentiation was assessed with Alizarin Red S staining.

Immunophenotype Identification with Flow Cytometry Undifferentiated MSCs were subjected to flow cytometry analysis to confirm that the hBM-, hAT-, and hWJ-MSCs maintained their immunophenotypic characteristics after growth in the culture. After the 3rd passage, stem cells were harvested and re-suspended in their own culture medium at a concentration of 1x106 cells/mL. Flow cytometry was performed using a FACSCalibur flow cytometer (Becton Dickinson, San Jose, CA, USA). The data were analyzed using CellQuest software (Becton Dickinson, San Jose, CA, USA). Debris and dead cells were gated out by forward- and side-scatter profiles. Immunophenotyping of the MSCs was performed with antibodies against the following human antigens: CD3, CD4, CD5, CD7, CD8, CD10, CD11b, CD13, CD14, CD15, CD19, CD29, CD33, CD44, CD45, CD71, CD73, CD90, CD106, CD123, CD146, CD166, HLA-DR, HLA-A, HLA-B, HLA-C, and HLA-G (Becton Dickinson, San Jose, CA, USA). In Vitro Differentiation Adipogenic Differentiation: The cells obtained from the 3rd passage were seeded at a density of 3x103 cells/cm2 onto coverslips coated with type 1 collagen (Becton Dickinson, San Diego, CA, USA) in 6-well plates to induce adipogenic differentiation. The cells were cultured with the adipogenic medium, L-DMEM supplemented with 10% FBS, 0.5 mM isobutyl-methylxanthine (Sigma-Aldrich, St. Louis, MO, USA), 10-6 M dexamethasone (Sigma-Aldrich, St. Louis, MO, USA), 10 μg /mL insulin (Sigma-Aldrich, St. Louis, MO, USA), 200 µM indomethacin (Sigma-Aldrich, St. Louis, MO, USA), and 1% penicillin/streptomycin for 2 weeks. The medium was replaced twice a week. The presence of intracellular lipid droplets, which

CD3+ T-Cell Negative Immunoselection and Stimulation After the informed consent of 3 healthy male volunteers was received, PB was obtained with approval of the Ethics Board of the Medical Hospital of Kocaeli University. CD3+ T cells were isolated from PB using the RosetteSep T-cell enrichment negative immune selection cocktail (Stem Cell Technologies, Vancouver, BC, Canada). CD3+ T cells were stimulated with 10 µg/mL mitogen PHA (Invitrogen/GIBCO) for 24 h in RPMI1640 medium (Invitrogen/GIBCO) containing 10% FBS, 100 U/ mL penicillin, 0.1 mg/mL streptomycin, and 200 mM glutamax (Invitrogen/GIBCO). To measure CD3+ T-cell stimulation, PHACD3+ T cells (1x105/well) were plated in triplicate onto 96well plates and 10 µl of WST-1 (Roche Diagnostics, Mannheim, Germany) was added to each activated and non-activated (control) CD3+ T cell-containing well. The plate was incubated at 37 °C in a humid atmosphere containing 5% CO2 for 4 h. The optical density value of samples was measured with a microplate ELISA reader (Versamax, Sunnyvale, CA, USA) at a wavelength of 480 nm. Examination of CD3+ T Cells by Flow Cytometry Flow cytometry analysis was performed as described above. Immunophenotyping of CD3+ T cell was performed with surface molecule-staining antibodies against the human antigens CD3, CD4, CD8, CD45, TCR alpha beta, and TCR gamma delta. All antibodies were obtained from BD Biosciences. IF Staining of CD3+ T Cells Cells were fixed in ice-cold methanol. After permeabilizing them with 0.025% Triton X-100 (Merck, Darmstadt, Germany), the cells were incubated with 1.5% normal goat or donkey blocking serum (Santa Cruz) in PBS to suppress the nonspecific binding of immunoglobulin G. After washing, cells were incubated overnight with primary antibodies (anti-CD3, anti-CD5, antiCD8, anti-CD23, anti-CD29, and anti-CD105). After that, cells 215

Karaöz E, et al: Comparative Analyses of Immunosuppressive Characteristics of MSCs

were incubated with the appropriate FITC-labeled appropriate secondary antibodies (Santa Cruz). After washing, the cells were mounted with mounting medium containing DAPI (Santa Cruz). Co-culture Experiments In MLR and transwell co-cultures, hMSCs (3x105/well in 6-well plates) were plated 24 h before the addition of an equal number of PHA-CD3+ T cells to generate adherent monolayers in plates with RPMI-1640 medium. MSCs and PHA-CD3+ T cells (1:1) were co-cultured for 4 days. T cell proliferation (WST-1, CFSE), apoptosis (annexin V), cytokine and soluble factor expressions by hMSCs and PHA-CD3+ T cells, and Treg cell marker expressions were analyzed (flow cytometry, ELISA) in triplicate. Mixed Lymphocyte Reactions PHA-CD3+4 T cells were plated in wells alone (for controls) or on the hDP-SC for cell-to-cell interactions. In addition to the analysis referred to above, video and photographic recordings were performed. Transwell Experiments Two chambers were separated by a semipermeable membrane with a pore size of 0.4 µm (BD Biosciences). PHA-CD3+ T cells were cultured in the upper chamber of the transwell inserts. The lower chambers contained medium alone (for controls) or medium containing MSCs. In addition to the analysis referred to above, gene expression analysis was performed by real-time PCR. Detection of Apoptosis in Stimulated T Cells For flow cytometry annexin V-PI labeling, cells (2x105 cells) were labeled fluorescently for the detection of apoptotic and necrotic cells by adding 20 µl of binding buffer and 5 µL of annexin V-FITC (BD Biosciences) to each sample. Samples were mixed gently and incubated at room temperature in the dark for 15 min immediately. Before the analysis by flow cytometry, 2 µL of PI (1 mg/mL; BD Biosciences) was added to each sample. A minimum of 1x104 cells within the gated region were analyzed. The T-cell population was identified by a combination of sidescatter and forward-scatter information. Cytokine Expression Profiles of PHA-CD3+T Cells and MSCs For flow cytometry analysis, we measured the percentage of IL-6 and IL-10 expression by MSCs and IL-2, IL-6, IL-12, interferon (IFN)-γ, tumor necrosis factor (TNF)-α, CD4, CD25, and FoxP3 by PHA-CD3+ cells by flow cytometry. For ELISA, supernatants were collected from MLR and transwell co-cultures for quantitative determination of cytokine levels, including IL-2, IL-6, IFN-γ, TNF-α, and 216

Turk J Hematol 2017;34:213-225

transforming growth factor (TGF)-β. These measurements were performed by ELISA according to the manufacturer’s protocol. For quantitative gene expression analysis by real-time PCR, total RNA from MSCs and PHA-CD3+ T cells (3x106/well) was isolated using a High Pure RNA Isolation Kit (Roche Diagnostics, Germany) following the manufacturer’s instructions. After isolation, RNA quantification was measured with a Picodrop spectrophotometer (Pico100; Pico, Saffron Walden, UK). One microgram of total RNA was reverse-transcribed into cDNA using a Transcriptor High Fidelity cDNA synthesis kit (Roche Diagnostics, Germany). Equal amounts of cDNA were used for the real-time amplification of the target genes using the Universal Probe Library according to the manufacturer’s recommendations by Light Cycler 480-II (Roche Diagnostics, Germany). Primers and TaqMan® probes were designed previously and validated by the manufacturer (Roche Diagnostics, Germany). Quantification of the gene expression of IL-2, IL-6R, IL-17A, FoxP3, CD4, CD25, and IFN-γ was carried out for stimulated T cells. The expression of IL-6R, TGF-β1, IP-10, and HGF-β was measured in hMSCs. All of the quantifications were relative to the housekeeping gene hypoxanthine guanine phosphoribosyl transferase, providing a basis for the normalization of sample-to-sample differences. Apoptotic Gene Expressions in Activated T-cells after Co-culture After co-culture, we used the LightCycler 480 human apoptosis panel (Roche, Mannheim, Germany) to detect the apoptotic effects of hBM-, hAT-, and hWJ-MSCs on stimulated T cells and to determine which pathways are involved by real-time PCR (qRT-PCR). Primarily, we isolated total RNA (High Pure RNA Isolation Kit, Roche) and converted it into cDNA by reverse transcriptase (Transcriptor High Fidelity cDNA Synthesis Kit, Roche). Gene expression analyses of 84 apoptosis-related genes were performed, and we determined the alterations in pro- and anti-apoptotic genes for each cell line based on a control group (stimulated CD3+ T cells). Statistical Analysis All experiments were repeated at least three times. Data are reported as means ± standard deviations. All statistical analyses were performed using SPSS 10.0 (SPSS Inc., Chicago, IL, USA). Since we had one nominal variable and one measurement variable, and we wanted to compare the mean values of the measurement variable, we used Student’s t-test. Differences between the experimental and control groups were regarded as statistically significant when p<0.05.

Results Isolation, Culture, and Phenotype Identification of MSCs Isolated cells from hBM-MSCs (Figure 1, A1-A3), hAT-MSCs (Figure 1, B1-B3), and hWJ-MSCs (Figure 1, C1-C3) distributed

Karaöz E, et al: Comparative Analyses of Immunosuppressive Characteristics of MSCs

Turk J Hematol 2017;34:213-225

sparsely on the culture flasks displayed mostly fibroblast-like, spindle-shaped morphology during the early days of incubation. Small colonies, called colony-forming units, appeared within 9-12 days (Figure 1, A1, A2, B1, and C1). These primary cells reached monolayer confluence within 15-17 days in the later passages; most of these MSCs exhibited large, flattened, or fibroblast-like morphology (Figure 1, A3, C3, A2, C2, and B3). The surface phenotypes of these cells were found to be positive for CD11b, CD13, CD29, CD44, CD73, CD90, CD146, CD166, and HLA-A, -B, and -C and negative for CD14, CD19, CD33, CD34, CD45, CD117, and HLA-DR (Table 1). We also showed that MSCs could differentiate into adipocytes and osteoblasts (Figure 2).

Immunoregulatory Effects of hMSCs on PHA-CD3+ T Cells

Characterization and PHA Activation of CD3+ T Cells

The effects of MSCs on apoptosis of PHA-CD3+ T cells based on annexin V-PI showed that the most promising results were obtained in the co-culture allowing cell-to-cell contact in hBM, hAT, and hWJ cell lines on the 4th day (Figure 6).

We determined that 90.67% of CD3+ T cells were isolated from PB using RosetteSep (data not shown). Immunofluorescence labeling showed that CD3+ T cells presented positive staining for CD3, CD5, CD8, and IL-12 but were negative for CD23, CD29, and CD105 (Figure 3). It was shown that in PHA-activated CD3+ T cells, their morphology changed and the cells presented extensions (Figures 4A-4C). The proliferation of PHA-CD3+ T cells showed a significant difference (p<0.05) compared with inactive CD3+ T cells (control) by the WST-1 test (Figure 4D). Table 1. Immunophenotypic properties of hBM-, hAT-, and hWJ-MSCs using flow cytometry. Marker

hBM-MSCs

hAT-MSCs

hWJ-MSCs

CD11b

1.40±1.19

0.45±0.35

1.55±1.18

CD13

97.86±2.13

99,33±0,08

91.77±6.38

CD14

0.51±0.28

0,25±0,12

0.96±0.35

CD29

99.05±0.77

99.48±0.22

99.83±0.29

CD33

1.22±0.74

0.24±0.21

0.84±0.30

CD34

1.00±1.05

0.74±0.67

1.05±0.57

CD19

1.46±1.41

0.16±0.06

1.72±1.53

CD44

98.21±1.38

99.22±0.18

99.53±0.09

CD45

1.49±0.56

0.19±0,05

0.97±0.09

CD71

4.35±0.07

5.64±0.81

44.17±3.31

CD73

99.05±1.10

99.78±0.16

99.64±0.55

CD90

98.29±1.89

99.66±0.23

99.88±0.15

CD117

0.94±0.81

0.43±0.31

0.82±0.53

CD146

21.58±0.05

83.23±4.89

94.53±4.17

CD166

98.94±1.29

96.59±2.90

99.35±0.18

HLA- ABC

85.16±7.85

95.73±6.52

98.17±1.40

HLA-DR

1,92±0,02

0.11±0.04

0.99±0.57

HLA-G

5.82±0.04

7.29±1.80

31.27±0.02

hBM: Human bone marrow, hAT: human adipose tissue, hWJ: human Wharton’s jelly, MSC: mesenchymal stem cell

Suppressive Effect of hMSCs on the Proliferation of PHA-CD3+ T Cells The inhibitory effect of hMSCs on the proliferation of PHACD3+ T cells was detected by carboxyfluorescein succinimidyl ester (CFSE) (Figure 5). Comparative analyses of three cell cultures indicated that hBM-MSCs were the most effective cell type in the repression of induced T-cell proliferation. BM-MSCs also demonstrated a high level of anti-proliferative effect. Apoptotic Effects of hMSCs on PHA-CD3+ T Cells

BM-MSCs were demonstrated to have the most powerful apoptotic effect on PHA-T cells both in direct (MLR; p<0.01 day 1; p<0.001 - day 4) and indirect (transwell) co-cultures. Soluble Factors Responsible for the Immunoregulatory Effects of hMSCs For alteration of cytokine levels in MSCs and PHA-CD3+ T cells after co-culture, supernatants were analyzed by ELISA. The proinflammatory cytokines IFN-γ, TNF-α, and IL-2 were significantly

Figure 1. Isolated cells from human bone marrow- (A1-A3), human adipose tissue- (B1-B3), and human Wharton’s jellymesenchymal stem cells (MSCs) (C1-C3) distributed sparsely on the culture flasks displayed mostly fibroblast-like, spindle-shaped morphology during the early days of incubation. Small colonies (asterisks), called colony-forming units, appeared within 9-12 days (A1, A2: P0 - 9th day, B1: P0 - 12th day, C1: P0 - 12th day). These primary cells reached monolayer confluence within 15-17 days. In the later passages, most of these MSCs exhibited large, flattened, or fibroblast-like morphology (A3, C3: P3 - 3rd day, A2: P2 - 4th day, C2: P1 - 6th day, and B3: P3 - 7th day). 217

Karaöz E, et al: Comparative Analyses of Immunosuppressive Characteristics of MSCs

inhibited by MSCs in MLR and transwell experiments on day 4. There was an exception for IL-6 and TGF-β. Both were significantly increased in both experiments on day 4 after co-culture with PHA-CD3+ T cells (p<0.05, p<0.01, and p<0.001) (Figure 7).

Turk J Hematol 2017;34:213-225

expression of survival pathways and proliferation-related genes (NFKB2, REL, RELB, STAT5A-B, etc.) were significantly reduced (Figure 12D). Expression levels of caspase family member genes

Immunosuppressive Effects of hMSCs on Cytokine Levels by PHA-CD3+ T Cells The change of cytokine levels in MSCs was estimated by flow cytometry after co-culture experiments. The levels of IL-6 and IL10 were increased in MLR and transwell experiments after 4 days of co-culture with PHA-CD3+ T cells (p<0.01 and p<0.001) (Figure 8). The expression levels of Treg markers were significantly induced by hMSCs in MLR and transwell experiments on day 4 (p<0.05, p<0.01, and p<0.001) (Figure 9). By using appropriate antibodies, cells that expressed Treg markers (CD4+, CD25+, and FoxP3+) were found at a dramatically high level. These increasing levels were found to be much higher in WJ-MSCs than BM-MSCs or AT-MSCs (Figures 10 and 11). Apoptotic Gene Expressions in Activated T Cells after Co-culture When gene expressions of T cells after co-culturing with MSCs were compared with induced CD3+ T cells (Figures 12A-12E), the Figure 3. Representative panels of immunofluorescence in phytohemagglutinin (PHA)-CD3+ T cells. Fluorescence microscopy analysis of the expression of cell surface markers staining for CD3 (A), CD5 (B), and CD8 (C) was positive whereas it was negative for CD23 (D), CD29 (E), and CD105 (F) in PHA-CD3+ T cells (scale bars=50 µm).

Figure 2. Photomicrographs of the in vitro differentiation of human bone marrow- (hBM) (A, D, G), human adipose tissue (hAT)(B, E, H), and human Wharton’s jelly (hWJ)-mesenchymal stem cells (MSCs) (C, F, I) cultured in differentiation-inducing media as described in the materials and methods section. Phase-contrast microscopic appearances of the hBM- (A), hAT- (B), and hWJMSCs (C) differentiated into adipogenic lineages after 15 days and 18 days of incubation, respectively. Adipogenic differentiation was marked visually by accumulation of neutral lipid vacuoles in cultures (D, E, F) (red oil staining) (α-smooth muscle actin-green). Osteogenic differentiation of hBM- (G), hAT- (H), and hWJ-MSCs (I) after the osteogenic induction. Mineral nodules were stained positively with Alizarin Red S staining (scale bars=50 µm). 218

Figure 4. Activation of CD3+ T cells by phytohemagglutinin (PHA). Phase-contrast microscopy showing that as CD3+ T cells (A) were activated by PHA-M for 24 h, the morphologies and shapes of the cells changed, and they presented extensions (B, C). Activation of CD3+ T cells (by PHA) was determined by WST-1 (D). Increased levels of proliferation (of PHA-CD3+ T cells) were determined by WST-1 (n=3, mean ± SE, p<0.05). Activation of CD3+ T cells (by PHA) was determined by flow cytometer.

Turk J Hematol 2017;34:213-225

Karaöz E, et al: Comparative Analyses of Immunosuppressive Characteristics of MSCs

Figure 5. Inhibitory effect of human mesenchymal stem cells (hMSCs) on the proliferation of phytohemagglutinin (PHA)-CD3+ T cells as detected by carboxyfluorescein succinimidyl ester (CFSE). (A) Representative analysis of the altered rate of PHA-CD3+ T cells in the mixed lymphocyte reactions (MLR) and transwell experiments when co-cultured with hMSCs was performed by CFSE labeling at days 1 and 4. Solid purple histogram represents data of T cell-only culture, while green and pink peaks show the result of direct (MLR) and indirect (transwell) culture, respectively. (B) Comparative analyses of three cell cultures indicate that hBM-MSCs are the most effective cell type in the repression of induced T-cell proliferation. (C) Graphical representation of the cell proliferation in different cell cultures supports the results of previous data (n=3, mean ± standard deviation; Δ p<0.001). hBM: Human bone marrow, hAT: human adipose tissue, hWJ: human Wharton’s jelly.

responsible for apoptosis induction, CASP1, CASP4, CASP7, and CASP8, were increased (Figure 12B). These genes were especially significantly increased in hBM-MSCs. Caspase activity-related gene HTRA2 was significantly increased in hBM- and hWJ-MSCs (Figure 12C). Expressions of apoptosis death pathway genes FADD and FASL were significantly increased, similar to one of the death domain-including genes, LRDD (Figure 12C). We determined that TNF expressions were irregular for TNF pathwayrelated genes, which is important for apoptosis regulation. Gene expression of the TNFRSF21 gene, known as death receptor 6 (DR6), was ~18-fold increased when comparing BM with the control (Figure 12E). Curiously, apoptosis inhibitor BIRC3 (c-IAP1) expression that includes the CARD (caspase activation and recruitment domain) region was increased in hAT-MSCs. Gene expressions of BAK1 and BIK, which are pro-apoptotic members of the BCL-2 family, were upregulated and antiapoptotic member BCL-2 was downregulated. Gene expression results show that the paracrine effects of MSCs induce apoptosis in activated T cells. During this process, a decrease was observed in expression of the BCL2 and BIRC3 anti-apoptotic genes, and an increase was observed in expression of the HRK and LRDD pro-apoptotic genes and tumor-suppressor genes TP53I3

Figure 6. The effects of mesenchymal stem cells (MSCs) on apoptosis of phytohemagglutinin-CD3+ T cells based on annexin V-PI. Representative analysis of annexin V-PI-labeled stimulated T cells by flow cytometry in direct [mixed lymphocyte reactions (MLR)] (A) and indirect (transwell) (B) co-cultures with human MSCs on days 1 and 4 (n=3, mean ± standard deviation). The graphical representation of the data (C) points out the highest apoptotic levels of induced T cells in the co-culture with hBMMSCs. Noticeable apoptotic levels were detected in both direct (MLR) (Ω p<0.01-1st day; Δ p<0.001-4th day) and indirect (transwell) (Δ p<0.001-1st and 4th days) co-cultures. Interestingly, the most promising results were obtained in the co-culture allowing cell-to-cell contact in both cell lines on the 4th day. Weak but significant apoptotic effect was observed in indirect co-culture also in both cell lines (# p<0.05 and Ω p<0.01). hBM: Human bone marrow, hAT: human adipose tissue, hWJ: human Wharton’s jelly.

and PTEN. The NFKB2, REL, RELB, SOCS2, STAT1, STAT5A, and STAT5B genes and the TNF, TNFRSF1B, and TRAF1 genes were determined to have a role in the inhibition of NFKB and TNF pathways, respectively.

Discussion Due to the immunoregulatory properties of MSCs, they have begun to be used for prevention of graft-versus-host disease (GvHD) and treatment in allogenic transplantations. In this study, different 219

Karaöz E, et al: Comparative Analyses of Immunosuppressive Characteristics of MSCs

Turk J Hematol 2017;34:213-225

Figure 7. Alterations of cytokine levels in mesenchymal stem cells (MSCs) and phytohemagglutinin (PHA)-CD3+ T cells after co-culture supernatants were analyzed by ELISA. Pro-inflammatory cytokines interferon-γ, tumor necrosis factor-α, and interleukin-2 (IL-2) were inhibited significantly by MSCs in mixed lymphocyte reactions and transwell experiments on day 4. Transforming growth factor-β and IL-6 were significantly increased in both experiments on day 4 after co-culture with PHA-CD3+ T cells (n=3, mean ± standard deviation; # p<0.05; Ω p<0.01, and Δ p<0.001).

Figure 8. The change of cytokine levels in mesenchymal stem cells estimated by flow cytometry after co-culture experiments. The levels of interleukin (IL)-6 and IL-10 were increased in mixed lymphocyte reactions and transwell experiments after 4 days of co-culture with phytohemagglutinin-CD3+ T cells (n=3, mean ± standard deviation; Ω p<0.01, and Δ p<0.001). MSC sources, including BM-MSCs that are widely used in clinical applications and are the most effective cells, WJ-MSCs that are readily available tissue from umbilical cords without any ethical concerns, and AT-MSCs that are also an easily accessible source for stem cells for regenerative medicine, have been comparatively 220

analyzed for immunosuppressive effects on PHA-T cells. Direct coculture (MLR) was applied in order to evaluate cell-to-cell contact and indirect co-culture (transwell) was applied for paracrine effects. Hepatocyte growth factor-β (HGF) and TGF-β are the main mediators secreted by MSCs and they act as immunosuppressors

Turk J Hematol 2017;34:213-225

Karaöz E, et al: Comparative Analyses of Immunosuppressive Characteristics of MSCs

[1]. Furthermore, IL-6 has been defined to act as both a proinflammatory and an anti-inflammatory cytokine that inhibits T-cell proliferation and stimulates apoptosis [15,16], which may involve induction of the classical “anti-inflammatory” cytokine IL-10 [17]. In our study, we confirmed IL-10 expression by flow cytometer, and based on our data, the expression level of IL10 was significantly higher after direct contact with MSCs and PHA-T cells. We also found that productions of TGF-β1 and IL-6 were increased significantly compared to PHA-T cells. The anti-proliferative effect of MSCs is most probably a result of increased production of TGF-β1 and IL-6 in the co-culture with MSCs.

IP-10 is a member of the ELR family of α-chemokines [19,20]. In recent years, this chemokine was found to be important for suppression of PHA-T cells by MSCs. In our study, the gene expression level of IP-10 was increased after the indirect

We analyzed the hallmark cytokines produced in these cocultures by ELISA in order to evaluate the effect of MSCs on development. We found that both IFN-γ and TNF-a production was inhibited in the presence of MSCs. In several studies, MSCs have been demonstrated to inhibit the expression of T helper-1 pro-inflammatory cytokines [18]. In this study, we demonstrated that gene expressions of IL-2, IL12, and IFN-γ were inhibited in MLR and transwell co-culture systems. In support of this, TGF-β1 and IL-10 inhibit T-cell proliferation by suppressing IL-2, IFN-γ, and TNF-α production. We tried to confirm our suggestion with the KEGG pathway analysis tool. We showed that IL-6, IL-2, IL-12, IFN-γ, and TNF-α are key mediators for GvHD and allograft rejection (Picture 1).

Picture 1. Key mediators of graft-versus-host disease and allograft rejection are confirmed by KEGG pathway analysis. IFN: Interferon, IL: interleukin, IgG: immunoglobulin g, TCR: T cell receptor MHC: major histocompatibility complex, TNF: tumor necrosis factor.

Figure 9. The immunoregulatory effects of mesenchymal stem cells (MSC) on the expression of pro-inflammatory cytokines (A-E) and Treg markers (F-H) in phytohemagglutinin-CD3+ T cells. The expression levels of Treg markers were significantly induced by human MSCs in mixed lymphocyte reactions and transwell experiments on day 4 (n=3, mean ± standard deviation, # p<0.05, Ω p<0.01, and Δ p<0.001). 221

Karaöz E, et al: Comparative Analyses of Immunosuppressive Characteristics of MSCs

Turk J Hematol 2017;34:213-225

Figure 10. The level of cytokines and growth factors in mesenchymal stem cells was altered after co-culture (# p<0.05, Ω p<0.01, and Δ p<0.001). co-culture of BM-MSCs and WJ-MSCs. This finding seems compatible with the CFSE experiments, in which we detected an anti-proliferation effect of MSCs on PHA-T cells. In programmed cell death, the caspase pathway plays an important role. For instance, CASP1 plays a central role in the initiation of caspase family activation. The upregulation of this gene further triggers the level of other caspases. Finally, the programmed cell death process continues irreversibly with increased levels of CASP7. In our study, some major effectors of apoptosis such as CASP1, CASP4, CASP7, and CASP8 were upregulated in PHA-T cells. This effect was higher when BMMSCs were co-cultured with PHA-T cells.

according to disease or phenotype. IL-10 and TNF were given as seed genes, which means they might be the main cause of GvHD on a molecular scale. Analysis results were consistent with our findings: we demonstrated that immunosuppressive cytokines were increased in co-cultures and in the tool’s predictions TGF-β and IL-6 were related to GvHD. Apoptotic genes were also upregulated and again this tool confirmed our results, showing the relation of the caspase family, HTRA2, LRDD, and TNFRSF21, with GvHD (Picture 2).

Consistent with these results, caspase activity-related proapoptotic genes HTRA2 and LRDD (also known as PIDD) were significantly upregulated in both BM-MSC and WJ-MSC cocultures on PHA-T cells (Figure 12C). Gene expression of the TNFRSF21 gene that is known as death receptor 6 (DR6) was ~18-fold increased when comparing the co-cultures with BM-MSCs and PHA-T cells (Figure 12E). In addition, we found that expressions of survival pathways and proliferation-related genes NFKB2, REL, and STAT5A-B were significantly downregulated (Figure 12D). We also analyzed differentially expressed genes according to our apoptosis panel and GvHD with the Phenolyzer phenotypebased gene analyzer tool [21]. This tool compares 4 different databases and gives seed gene and predicted gene lists 222

Picture 2. Tumor necrosis factor and interleukin (IL)-10 are represented as seed genes for graft-versus-host disease (GvDH). The correlation of differentially expressed genes in the apoptosis panel was described. The importance of IL-17A and FOXP3 for GvDH was confirmed by four different databases [21]. TNF: Tumor necrosis factor.

Turk J Hematol 2017;34:213-225

Karaöz E, et al: Comparative Analyses of Immunosuppressive Characteristics of MSCs

Figure 11. The alteration of gene expression levels of cytokines (interferon-γ, interleukin (IL)-17, IL-2, and IL-6R) and Treg markers (CD4, CD25, and FoxP3) in mesenchymal stem cells after co-culture with stimulated T cells (# p<0.05, Ω p<0.01, and Δ p<0.001). One of the most important findings of our study is the correlation of IL-17A level and Tregs. IL-17A, a pleiotropic proinflammatory cytokine produced by Th17 T-helper cells, was initially described as an important mediator for neutrophil induction and maturation during inflammatory responses [22]. We detected the increasing of CD4+ CD25+ FoxP3+ Tregs by flow cytometer parallel to significant upregulation of IL-17A in gene expression in PHA-T cells after indirect co-cultures with WJ-MSCs. In other words, we think that IL-17A is required by CD4+ CD25+ Tregs to sustain an immunosuppressive response. IL-17A-producing T-cells may open up a new path for prevention and treatment of GvHD.

PHA-T cells and WJ-MSCs. In addition to these results, antiapoptotic genes such as BCL-2 and BIRC3 were downregulated in the PHA-T cells after co-culture.

Our data have indicated additional important findings for WJMSCs. Pro-apoptotic genes such as BCL2L10, BAK1, and BIK were upregulated and expressions of apoptosis death pathway genes FADD and FASL significantly increased in co-culture of

Conclusion

We identified genes that were differentially expressed in WJ-MSC co-cultures in order to confirm our findings. We detected that apoptotic genes BAK1, BIK FADD, and FSLG and anti-apoptotic gene BCL2 are related to GvHD. Additionally, we analyzed IL-17, which we think has potential for treatment of GvHD, and FoxP3, one of the Treg markers. We demonstrated that IL-17 is related to disease and FoxP3 is directly in interaction with both seed genes for GvHD (Picture 2).

In conclusion, our results have demonstrated that BM-MSCs, which are still the most preferable source in clinics, are highly 223

Karaöz E, et al: Comparative Analyses of Immunosuppressive Characteristics of MSCs

Turk J Hematol 2017;34:213-225

PHA-T cells, although cell-to-cell contact is needed to show their apoptotic effect. Acknowledgments This work was supported by the Turkish Society of Hematology. We thank Zehra Seda Ünal and Alparslan Okçu for their excellent technical assistance. Ethics Ethics Committee Approval: The donors consented with the procedure and agreed with further research of aspirated fat in accordance with the ethical guidelines of the Kocaeli University Medical Ethics Committee. Informed Consent: It was received. Authorship Contributions Surgical and Medical Practices: E.K., P.Ç.D., G.E., E.G., A.E.S.; Concept: E.K., P.Ç.D., G.E., E.G., A.E.S.; Design: E.K., P.Ç.D., G.E., E.G., A.E.S.; Data Collection or Processing: E.K., P.Ç.D., G.E., E.G., A.E.S.; Analysis or Interpretation: E.K., P.Ç.D., G.E., E.G., A.E.S.; Literature Search: E.K., P.Ç.D., G.E., E.G., A.E.S.; Writing: E.K., P.Ç.D., G.E., E.G., A.E.S. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References Figure 12. Estimation of apoptotic gene expressions in activated T cells after co-culture with human bone marrow-, human adipose tissue-, and human Wharton’s jelly-mesenchymal stem cells (MSCs). The downregulation of JAK-STAT-related pathways was observed in cells after co-culture (A, D, E). Upstream of the caspase-linked apoptotic pathway and related genes, HTRA2, FADD, and FASLG, were induced in T cells by co-culture with human MSCs (B, C). effective. Having said that, WJ-MSCs, readily available tissue from WJ without any ethical concerns, could be an alternative source for clinical use; they might especially be a very effective therapeutic for preventing allograft rejection and in GvHD treatment. WJ is being used for allogenic transplants in the clinic. We demonstrate the molecular mechanism underlying the cause of treatment. We have determined that AT-MSCs, an easily accessible source for stem cells for rejuvenating and regenerative medicine, have the weakest immunosuppressive activity when compared to BM-MSCs and WJ-MSCs. Additionally, MSCs show their anti-proliferative effects by the paracrine mechanism on 224

1. Di Nicola M, Carlo-Stella C, Magni M, Milanesi M, Longoni PD, Matteucci P, Grisanti S, Gianni AM. Human bone marrow stromal cells suppress T-lymphocyte proliferation induced by cellular or nonspecific mitogenic stimuli. Blood 2002;99:3838-3843. 2. Inoue S, Popp FC, Koehl GE, Piso P, Schlitt HJ, Geissler EK, Dahlke MH. Immunomodulatory effects of mesenchymal stem cells in a rat organ transplant model. Transplantation 2006;81:1589-1595. 3. Bocelli-Tyndall C, Bracci L, Schaeren S, Feder-Mengus C, Barbero A, Tyndall A, Spagnoli GC. Human bone marrow mesenchymal stem cells and chondrocytes promote and/or suppress the in vitro proliferation of lymphocytes stimulated by interleukins 2, 7 and 15. Ann Rheum Dis 2009;68:1352-1359. 4. Yoo KH, Jang IK, Lee MW, Kim HE, Yang MS, Eom Y, Lee JE, Kim YJ, Yang SK, Jung HL, Sung KW, Kim CW, Koo HH. Comparison of immunomodulatory properties of mesenchymal stem cells derived from adult human tissues. Cell Immunol 2009;259:150-156. 5. Valencic E, Piscianz E, Andolina M, Ventura A, Tommasini A. The immunosuppressive effect of Wharton’s jelly stromal cells depends on the timing of their licensing and on lymphocyte activation. Cytotherapy 2010;12:154-160. 6. Najar M, Rouas R, Raicevic G, Boufker HI, Lewalle P, Meuleman N, Bron D, Toungouz M, Martiat P, Lagneaux L. Mesenchymal stromal cells promote or suppress the proliferation of T lymphocytes from cord blood and peripheral blood: the importance of low cell ratio and role of interleukin-6. Cytotherapy 2009;11:570-583.

Turk J Hematol 2017;34:213-225

Karaöz E, et al: Comparative Analyses of Immunosuppressive Characteristics of MSCs

7. Cutler AJ, Limbani V, Girdlestone J, Navarrete CV. Umbilical cord-derived mesenchymal stromal cells modulate monocyte function to suppress T cell proliferation. J Immunol 2010;185:6617-6623.

14. Wada N, Menicanin D, Shi S, Bartold PM, Gronthos S. Immunomodulatory properties of human periodontal ligament stem cells. J Cell Physiol 2009;219:667-676.

8. Li C, Zhang W, Jiang X, Mao N. Human-placenta-derived mesenchymal stem cells inhibit proliferation and function of allogeneic immune cells. Cell Tissue Res 2007;330:437-446.

15. Svobodova E, Krulova M, Zajicova A, Pokorna K, Prochazkova J, Trosan P, Holan V. The role of mouse mesenchymal stem cells in differentiation of naive T-cells into anti-inflammatory regulatory T-cell or proinflammatory helper T-cell 17 population. Stem Cells Dev 2011;21:901-910.

9. De Coppi P, Bartsch G Jr, Siddiqui MM, Xu T, Santos CC, Perin L, Mostoslavsky G, Serre AC, Snyder EY, Yoo JJ, Furth ME, Soker S, Atala A. Isolation of amniotic stem cell lines with potential for therapy. Nat Biotechnol 2007;25:100-106. 10. Pierdomenico L, Bonsi L, Calvitti M, Rondelli D, Arpinati M, Chirumbolo G, Becchetti E, Marchionni C, Alviano F, Fossati V, Staffolani N, Franchina M, Grossi A, Bagnara GP. Multipotent mesenchymal stem cells with immunosuppressive activity can be easily isolated from dental pulp. Transplantation 2005;80:836-842. 11. Demircan PC, Sariboyaci AE, Unal ZS, Gacar G, Subasi C, Karaoz E. Immunoregulatory effects of human dental pulp-derived stem cells on T cells: comparison of transwell co-culture and mixed lymphocyte reaction. Cytotherapy 2011;13:1205-1220. 12. Dokić J, Tomić S, Cerović S, Todorović V, Rudolf R, Colić M. Characterization and immunosuppressive properties of mesenchymal stem cells from periapical lesions. J Clin Periodontol 2012;39:807-816. 13. Makino Y, Yamaza H, Akiyama K, Ma L, Hoshino Y, Nonaka K, Terada Y, Kukita T, Shi S, Yamaza T. Immune therapeutic potential of stem cells from human supernumerary teeth. J Dent Res 2013;92:609-615.

16. Bifari F, Lisi V, Mimiola E, Pasini A, Krampera M. Immune modulation by mesenchymal stem cells. Transfus Med Hemother 2008;35:194-204. 17. Hegde S, Pahne J, Smola-Hess S. Novel immunosuppressive properties of interleukin-6 in dendritic cells: inhibition of NF-κB binding activity and CCR7 expression. FASEB J 2004;18:1439-1441. 18. Prasanna SJ, Gopalakrishnan D, Shankar SR, Vasandan AB. Pro-inflammatory cytokines, IFNnes, IFNy cytokines, IFNcytokines, IFN, IFNnes, IFNNIFN of NF-κB binding activimesenchymal stem cells differentially. PLoS One 2010;5:e9016. 19. Farber JM. Mig and IP-10: CXC chemokines that target lymphocytes. J Leukoc Biol 1997;61:246-257. 20. Loetscher M, Gerber B, Loetscher P, Jones SA, Piali L, Clark-Lewis I, Baggiolini M, Moser B. Chemokine receptor specific for IP10 and mig: structure, function, and expression in activated T-lymphocytes. J Exp Med 1996;184:963-969. 21. Yang H, Robinson PN, Wang K. Phenolyzer: phenotype-based prioritization of candidate genes for human diseases. Nat Methods 2015;12:841-843. 22. Cunnusamy K, Chen PW, Niederkorn JY. IL-17A-dependent CD4+CD25+ regulatory T cells promote immune privilege of corneal allografts. J Immunol 2011;186:6737-6745.

225

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0394 Turk J Hematol 2017;34:226-232

The Assessment of CD56 and CD117 Expressions at the Time of the Diagnosis in Multiple Myeloma Patients Multipl Miyeloma Hastalarında Tanı Sırasında CD56 ve CD117 Ekspresyonlarının Değerlendirilmesi Funda Ceran, Mesude Falay, Simten Dağdaş, Gülsüm Özet Ankara Numune Training and Research Hospital, Clinic of Hematology, Ankara, Turkey

Abstract

Öz

Objective: The purpose of this study is to investigate the relationship between the CD56 and CD117 expressions and the clinical and laboratory findings in multiple myeloma (MM) patients.

Amaç: Bu çalışmanın amacı multipl miyeloma (MM) hastalarında CD56 ve CD117 ekspresyonları ile klinik ve laboratuvar bulguları arasındaki ilişkiyi araştırmaktır.

Materials and Methods: Analyses of multiparametric flow cytometry data obtained from the diagnostic bone marrow aspirations of a total of 34 newly diagnosed MM patients were assessed retrospectively. CD56 and CD117 expressions of the patients were compared with their stages and clinical parameters. The staging was performed according to the International Staging System (ISS).

Gereç ve Yöntemler: Yeni tanı toplam 34 MM hastasının kemik iliği aspirasyon örneklerinde çalışılan multiparametrik flow sitometri analizleri retrospektif olarak değerlendirildi. Hastaların CD56 ve CD117 ekspresyonları hastalık evreleri ve klinik parametreleri ile karşılaştırıldı. Evreleme, Uluslararası Evreleme Sistemi (ISS)’ne göre gerçekleştirildi.

Results: Of the patients, 58.8% had ISS stage 1-2 MM while 41.2% had stage 3 MM. The number of CD56-positive patients was 29, whereas the number of CD117-positive patients was 13. There was no statistical difference between the CD56 and CD117 expressions and extramedullary involvement and lytic bone lesions. The median beta-2 microglobulin level was higher in the CD117-negative group (p=0.047). CD56 and CD117 expression levels were found to be lower in advanced-stage patients than in early-stage ones (p=0.026 and p=0.017). The lactate dehydrogenase (LDH) levels were high in advanced-stage patients, and an inverse relationship was found between LDH level and CD117 expression. Conclusion: Our findings that the CD56 and CD117 expression levels are lower in advanced stages than earlier stages and that LDH level and CD117 expression have an inverse relationship in patients with newly diagnosed MM suggest that CD56 and CD117 expressions may be prognostic markers for MM.

Bulgular: Hastaların %58,8’i ISS evre 1-2 MM iken, %41,2’si evre 3 MM’ydi. CD56 pozitif hasta sayısı 29, CD117 pozitif hasta sayısı 13’tü. CD56 ve CD117 ekspresyonları ile ekstramedüller tutulum ve litik kemik lezyonları arasında istatistiksel fark yoktu. Ortalama beta-2 mikroglobulin düzeyi, CD117 negatif grupta daha yüksekti (p=0,047). İleri evre hastalarda CD56 ve CD117 ekspresyon düzeyleri erken evre hastalara kıyasla daha düşük bulundu (p=0,026 ve p=0,017). İleri evre hastalarda laktat dehidrogenaz (LDH) düzeyleri yüksekti ve LDH düzeyi ile CD117 ekspresyonu arasında ters bir ilişki saptandı. Sonuç: Yeni tanı MM hastalarında ileri evrelerde CD56 ve CD117 ekspresyon düzeylerinin erken evre olanlardan daha düşük olması ve LDH düzeyi ile CD117 ekspresyonunun bulduğumuz ters ilişkisi, CD56 ve CD117 ekspresyonlarının MM için prognostik belirteç olabileceğini düşündürmektedir. Anahtar Sözcükler: CD56, CD117, Akım sitometri, Multipl miyeloma

Keywords: CD56, CD117, Flow cytometry, Multiple myeloma

Address for Correspondence/Yazışma Adresi: Funda CERAN, M.D., Ankara Numune Training and Research Hospital, Clinic of Hematology, Ankara, Turkey Phone : +90 312 508 46 25 / +90 505 390 00 04 E-mail : ceranf@gmail.com

226

Received/Geliş tarihi: October 02, 2016 Accepted/Kabul tarihi: March 07, 2017

Ceran F, et al: CD56 and CD117 Expressions in Multiple Myeloma

Turk J Hematol 2017;34:226-232

Introduction Multiple myeloma (MM) is a clonal hematologic malignancy that occurs as a result of the accumulation of malignant plasma cells in the bone marrow. Apart from the fact that conventional morphologic examination is essential in the diagnosis of MM and the assessment of response to therapy, the importance of multiparametric flow cytometry (MFC) in MM is growing. Its limited use in MM can be attributed to several factors such as sampling differences, the loss of plasma cells during analysis, adherence to the tubes, and the use of initial aspiratory samples in morphological assessment [1,2,3]. MFC is a valuable tool in distinguishing malignant plasma cell populations from the reactive/normal ones in samples. Aberrant immunophenotyping is assistive in the identification of these populations and available in most myeloma cases. It can also be used in the follow-up of minimal residual diseases (MRDs) [4,5]. MFC is a rapid, sensitive, and reliable method in the identification of clonality and aberrant antigenic expressions. It is possible to analyze both surface and intracytoplasmic antigens simultaneously, and it depicts quantitative results. It is better than immunohistochemical examination [1,2]. The European Myeloma Network reports the required antibodies in the panel as CD38, CD138, CD19, CD45, CD56, CD20, CD117, CD28, and CD27 and recommends that gating, which is of the utmost importance, be carried out according to CD38, CD138, and/or CD45 antibodies. CD19 is negative, CD56 is positive or negative, and CD38 is positive in malignant plasma cells [1,4,6]. Among the aberrant antigenic expressions, there may be antigens such as CD56, CD117, CD19, CD27, CD28, and CD33 [1,2,3,4,5,6,7]. In recent years, some of them have gained increasing attention with regard to their effects as adhesion molecules and their relations with the microenvironment. They are also becoming specific targets for curative treatments. There are studies that assess the relationship between MM prognosis and immunophenotype [8,9,10,11,12]. In our study, the relationship between the CD56 and CD117 aberrant expressions in malignant plasma cells in MM patients at the time of diagnosis and clinical and laboratory parameters were retrospectively assessed.

Materials and Methods A total of 34 MM patients, whose bone marrow aspiration samples were analyzed by MFC immunophenotyping at the time of diagnosis, were assessed retrospectively. The conventional cytogenetic analyses for del 13q, del 17p, and immunoglobulin H (IgH) translocations with fluorescence in situ hybridization were assessed. Written consent and local ethics committee approval were received. Ethylenediaminetetraacetic acid tubes were used for the bone marrow samples whereas polystyrene tubes were used for the test samples. Beckman Coulter (BC) (Brea, CA, USA) phosphate-

buffered saline OptiLyse solution was utilized in order to wash the cells and to keep the erythrocytes away. The monoclonal antibodies (MoAb), which were used in marking, were obtained from BC. CD45 phycoerythrin-cyanine 5 (PC5), CD19 phycoerythrin-Texas red (ECD), CD38 phycoerythrin (PE), CD138 fluorescein isothiocyanate (FITC), CD10 PE, CD20 PC5, CD117 ECD, CD56 PE, cytoplasmic kappa FITC, and cytoplasmic lambda PE MoAb were used and four-color analysis was applied. Bone marrow samples (100 µL) were put into polystyrene tubes and 20 µL of MoAb was added. Upon 20 min of incubation in the dark, the samples were washed. Isotopic control was applied for each analysis. Acquisition was done in the FC500 BC machine with at least 50,000 cell counts. CD38+ and CD138+ cells were gated and analyzed in the CXP program. Antigen expressions were accepted as positive when they were >20%. Statistical Analysis Statistical analysis was performed with SPSS 20 software. Normal data distributions were assessed with the Shapiro-Wilk test. The comparison of two groups of numeric variables was made with the t-test and Mann-Whitney U test. The chi-square test and Fisher’s exact test were used in the comparison of categorical data. The relationship among numerical variables was investigated with Pearson and Spearman correlation analyses. Stepwise multivariate logistic regression analysis was used in the identification of the independent predictors that could affect the numeric CD56 negativity, CD117 negativity, and stage 3 risks.

Results The clinical features and the demographic data of the patients at the time of diagnosis (Table 1) and overall antigen expressions (Figure 1) are provided below. The plasma cell rate assessed morphologically in the bone marrow aspiration samples was higher than that of the samples used for MFC. The rate of the patients with stage 1-2 MM was 58.8% and the rate of those with stage 3 MM was 42.2%. Plasmacytoma was present in 14.7% of the patients. The distribution of the MM subtypes according to CD56 and CD117 expressions are shown in Figure 2. CD56-negative patients had a lower average age than those with positive CD56 (50.2±14.1 and 62±10.3 years, p=0.0032). CD56-positive patients were more often at stage 1-2 (65.5%), whereas negative ones were more often at stage 3 (80%). While the rate of the patients with light-chain immunoglobulin type was higher in the CD56-negative group (60% vs. 27.6%), the IgG and A types were higher in the CD56-positive group (respectively 20% vs. 48.3%, 0% vs. 24.1%, p=0.027), and there was no difference between kappa and lambda lightchain types (p=0.732). No relationship was found between the 227

Ceran F, et al: CD56 and CD117 Expressions in Multiple Myeloma

Table 1. The clinical characteristics of the patients (n=34). Characteristics

Age Sex Female Male Stage 1-2 3 Immunoglobulin (Ig) subtype Light-chain Lambda Kappa G Lambda Kappa A Lambda Kappa Nonsecretory Lambda Kappa Light-chain types Lambda Kappa Plasmacytoma No Yes B2M (mg/dL) Hemoglobin (g/dL) CRP (mg/L) Platelets (x103/µL) Neutrophils (x103/µL) Sedimentation (mm/h) LDH (U/L) Creatinine (mg/dL) Plasma cells in bone marrow Aspiration (%) Plasma cells in MFC (%) CD56 Negative Positive CD117 Negative Positive CD56 and CD117 Double-negative Double-positive Lytic bone lesion

Median (minimum-maximum), Mean ± SD, number (%) 60.3±11.5 20 (58.8) 14 (41.2) 20 (58.8) 14 (41.2) 11 (32.4) 6 (55.0) 5 (45.0) 15 (44.1) 5 (33.3) 10 (66.7) 7 (20.6) 5 (71.4) 2 (28.6) 1 (2.9) 1 (100) 16 (47.1) 18 (52.9) 29 (85.3) 5 (14.7) 4.7 (2.3-36.0) 9.4±3.2 5.9 (0.5-114) 208 (44-364) 3.025 (1.3-7.8) 71 (7-130) 185 (103-490) 1.2 (0.6-10.6) 50 (8-90) 16.5 (3-80)

existence of plasmacytoma and CD56 expression, which may derive from the small number of patients (p=0.717). The beta2 microglobulin (B2M), C-reactive protein (CRP), creatinine, and sedimentation levels were higher in the CD56-negative group when compared with the positive group. The plasma cell rate of the CD56-negative group was higher in MFC; the rate of lytic lesions was lower than in the positive group, but that was not statistically significant. The rate of patients with stage 1-2 MM was 76.9% in the CD117-positive group whereas the rate of those with stage 3 MM was 23.1%; however, this was not statistically significant (p=0.153). Though there was not a statistically significant difference among the immunoglobulin subtypes (p=0.271), the light-chain type was seen more often in the CD117-negative group while the IgG and A types were seen more often in the CD117-positive group. There was no difference between kappa and lambda light-chain types. The median B2M level was significantly higher in the CD117-negative group than the positive one at 6.3 vs. 3.5, respectively (p=0.047). The plasma cell rates identified in MFC were not different (p=0.365). Though the lytic lesion rates were higher in the CD117-negative group (47.6% vs. 23%), no statistical difference was observed (p=0.286). The distribution of the demographic and clinical findings of the patients according to CD56 and CD117 expressions are shown in Table 2. Stages 1 and 2 MM were more common in doublepositive patients, whereas B2M was lower (p=0.01); the platelet number was higher (p=0.039) and the creatinine level was lower (p=0.041). There were three double-negative patients, and the bone marrow plasma cell rate for all of them was ≥50%. Two

Figure 1. The number of positive antigen expressions in patients with multiple myeloma (n=34).

5 (14.7) 29 (85.3) 21 (61.8) 13 (38.2) 3 (8.8) 11 (32.4) 13 (38.2)

MFC: Multiparametric flow cytometry, LDH: lactate dehydrogenase, CRP: C-reactive protein, SD: standard deviation.

228

Turk J Hematol 2017;34:226-232

Figure 2. Multiple myeloma subtypes according to CD56 and CD117 expressions.

Ceran F, et al: CD56 and CD117 Expressions in Multiple Myeloma

Turk J Hematol 2017;34:226-232

Table 2. The distribution of the demographic and clinical findings of the patients according to CD56 and CD117 expressions. CD56

Age

CD117

Negative

Positive

(n=5)

(n=29)

50.2±14.1

62±10.3

p 0.032*

Sex 0.627

Negative

Positive

(n=21)

(n=13)

61.6±10.3

58.2±13.5

0.403

14 (66.7)

6 (46.2)

0.296

7 (33.3)

7 (53.8)

10 (47.6)

10 (76.9)

11 (52.4)

3 (23.1)

10 (47.6)

6 (46.2)

11 (52.4)

7 (53.8)

Female

2 (40)

18 (62.1)

Male

3 (60)

11 (37.9)

1-2

1 (20)

19 (65.5)

4 (80.0)

10 (34.5)

Lambda

2 (40.0)

14 (48.3)

Kappa

3 (60.0)

15 (51.7)

IgG (mg/dL)

4178

5220 (476-9314)

0.487

4910 (2375-9314)

4907 (476-8690)

0.908

IgA (mg/dL)

6450 (1690-8550)

5451 (3810-7093)

0.989

IgM (mg/dL)

20 (19-113)

40 (4-103)

0.644

39 (4-93)

40 (7-113)

0.887

4 (80)

25 (86.2)

0.717

17 (81.0)

12 (92.3)

0.627

Yes

1 (20)

4 (13.8)

4 (19.0)

1 (7.7)

B2M (mg/L)

8.3 (3-16.5)

4.3 (2.3-36.0)

0.368

6.3 (2.3-36)

3.5 (2.5-30.5)

0.047*

Hemoglobin (g/dL)

9.9±2.3

9.3±3.4

0.695

9.7±2.2

8.8±2.9

0.312

CRP (mg/L)

12 (0.6-114)

5.9 (0.5-90)

0.481

6 (0.5-48.5)

5 (0.5-114)

0.607

Platelets (x10 /µL)

137 (44-280)

213 (76-364)

0.158

193 (44-354)

280 (76-364)

0.108

Neutrophils (x10 /µL)

2.35 (1.5-5.9)

3.065 (1.3-7.8)

0.231

3.03 (1.77-7.8)

3.02 (1.3-6.7)

0.863

Sedimentation (mm/h)

74 (13-130)

68 (7-120)

0.903

67 (10-120)

74 (7-130)

0.859

LDH (U/L)

185 (162-220)

185.5 (103-490)

0.817

185 (132-490)

174 (103-220)

0.160

Creatinine (g/dL)

5.3 (0.8-9.4)

1.2 (0.6-10.6)

0.125

1.3 (0.7-8.5)

1.2 (0.6-10.6)

0.394

Albumin (g/dL)

29 (4-42)

34 (24-51)

0.394

34 (4-51)

34 (24-49)

0.986

Plasma cells in MFC (%)

20 (3-29)

15 (3-80)

0.961

15 (3-40)

20 (3-80)

0.365

Plasma cells in bone Marrow aspiration (%)

50 (10-70)

50 (8-90)

0.788

50 (8-90)

50 (10-90)

0.748

4 (80.0)

17 (58.6)

0.682

11 (52.4)

10 (76.9)

0.286

Yes

1 (20)

12 (41.4)

10 (47.6)

3 (23.1)

Stage 0.028*

0.153

Light-chain types 0.732

0.934

Plasmacytoma

Lytic lesion

The numeric variables are shown as the average with standard deviation and the median (minimum-maximum). The categorical variables are numerically shown (%). *p<0.05 was accepted as statistically significant. B2M: Beta-2 microglobulin, LDH: lactate dehydrogenase, CRP: C-rective protein, MFC: multiparametric flow cytometry.

of them were at stage 3. IgH translocation was found in one patient [t (11;14)]. The light-chain type was more common in advanced-stage MM. The median lactate dehydrogenase (LDH) level was higher (p=0.037). CD56 and CD117 expression levels were lower in advanced-stage MM than in early-stage MM (p=0.026 and p=0.017, respectively). A negative correlation was observed among CD117 and both hemoglobin (p=0.023, r=-0.389) and LDH levels (p=0.048, r=-0.381). A positive correlation was found between the plasma cell percentage

in MFC and both the plasma cell percentage in bone marrow aspiration (Figure 3) and CRP (respectively p=0.001, r=0.553; p=0.007, r=0.452), whereas a negative one was detected between the plasma cell percentage in MFC and the platelet number (p=0.048, r=-0.341). Cytogenetic analysis was performed for 21 patients. There was del 13q in 2 patients, del 17p in one patient, and IgH heavychain mutation in one patient [t (11; 14)]. The patient with 229

Ceran F, et al: CD56 and CD117 Expressions in Multiple Myeloma

Figure 3. The plasma cells (%) in multiparametric flow cytometry and the plasma cells (%) in the bone marrow aspiration. del 17p was CD117-negative. One of the patients who were detected with del 13q was CD117-positive while the other one was CD117-negative. The patient with t(11,14) was both CD56and CD117-negative. However, statistical analysis could not be conducted due to the small number of patients. Six of the assessed patients were lost (17.64%). Three of these patients were CD117-negative.

Discussion The features of the antigenic profiles of malignant cells are beneficial in both the diagnosis and the identification of the prognostic markers in different hematologic diseases. During the last decade considerable evolvement of MFC has led to studies that report some aberrant expressions of different markers in most of the plasma cell malignancies. The expression of these markers is typically used in the discrimination of malignant plasma cells from benign ones. The immunophenotyping of plasma cells in MM does not differ whether the patient received therapy or not, but an immunophenotypic shift can be seen in those that were treated with targeted therapy [13]. Current risk stratification systems in MM mainly depend on the cytogenetic/ molecular findings, but they do not include any parameter concerning aberrant antigenic expressions. MFC is more sensitive than immunohistochemical analyses in identifying aberrant antigenic expressions. The main applications of MFC in MM are assessment of MM progression from monoclonal gammopathy of undetermined significance (MGUS), follow-up of MRDs, and detection of the prognostic markers and identification of new treatment goals for MM [1,2,3,6,7,8,12,14,15,16,17,18,19,20, 21, 22,23]. 230

Turk J Hematol 2017;34:226-232

CD56 is a neural cell adhesion molecule (NCAM) related to the axon growth in normal embryogenesis. It is expressed in most of the malignant plasma cells (about 70%-80%) and its deficiency may be related to an aggressive disease [9,10,21,23]. CD117 is an essential hematopoietic growth factor receptor with tyrosine kinase activity. It cannot be expressed by normal plasma cells. It is observed to be positive in approximately 33% of MM patients [8,24,25,26]. In this study, the CD56 and CD117 expressions in 34 newly diagnosed MM patients were retrospectively assessed. The light-chain type was found to be more common in the CD56-negative patients, whereas the IgG and IgA types of MM were more in the CD56-positive group. Pan et al. [26] found similar results recently, but there was no difference between CD56-positive and -negative patients with regard to kappa and lambda light-chain types. Similarly, Van Camp et al. [27] showed that the lambda light-chain type was more common in CD56-negative patients. Previously, Sahara et al. [28] showed that thrombocytopenia, renal failure, and increase in B2M level were more common in CD56-negative MM cases. We found that creatinine and B2M levels were higher and platelet number was lower in the CD56-negative group (respectively p=0.125, p=0.158, and p=0.368), but these differences did not reach statistical significance. The relationship between CD56 expression and the existence of lytic lesions was assessed. Although there were fewer lytic lesions in the CD56-negative group (p=0.682), there was no statistical difference between these groups. CD56 expression is considered to have a role in lytic lesion generation by leading to a decrease in osteoblast functions. Osteoblasts also express CD56. Thus, the NCAM-NCAM interactions between the plasma cells and stromal and osteoblastic cells result in a decrease in bone matrix production [10,20,29]. Lytic lesions can be seen at lower rates despite the fact that there are more bone marrow plasma cell infiltrations. Extramedullary involvements are more common in CD56-negative patients due to the fact that CD56 is a marker related to the fixation of the plasma cells to the stromal structure, and an inverse relationship was found between CD56 expression and the plasma cells in circulation [28]. The rate of the existence of extramedullary involvement in our study was parallel to literature reports; nevertheless, no relationship was observed between this rate and CD56 expression (p=0.717). If the sample size were larger, a more meaningful result could be obtained. CD117 expression has been shown to be decreased during the progression from MGUS to the advanced stage of MM [8,24]. CD117 positivity is considered to have a relationship with good prognosis [8,11,12,26,30]. In a recent study, Pan et al. [26] found a relationship between CD117 positivity and longer overall survival. They also detected that overall survival has a relationship with CD56, stage, and B2M.

Ceran F, et al: CD56 and CD117 Expressions in Multiple Myeloma

Turk J Hematol 2017;34:226-232

In accordance with the literature [8,12], B2M level was found to be lower in the CD117-positive group (p=0.047). As an increased B2M level is accepted as a key indicator for advanced stage, this finding showed a relationship between CD117 negativity and advanced stage. In agreement with previous reports [12,31], CD117 expression was found to be lower in advanced-stage MM (p=0.017). Shin et al. [31] showed a relationship between advanced-stage MM and CD117 negativity. In our study, an inverse relationship was observed between CD117 expression levels and LDH levels (p=0.048, r=-0.381). The decrease in CD117 expression may support the increase in LDH levels in advanced stages. This could suggest disease progression and may be a sign of poor prognosis. The CD56 expression level was found to be lower in advanced-stage MM, like CD117 expression levels (p=0.026). In previous studies, during the progression from MGUS to symptomatic myeloma and approaching advancedstage MM, CD56 and CD117 expression levels were shown to be decreased [7,8]. This can be explained as a result of features of CD56 and CD117, which might act as adhesion and anchor molecules. These features might be effective in the homing of malignant plasma cells and the limiting of the disease. This may result from the association of these markers with the microenvironment. Therefore, low expression levels can lead to the spreading of plasma cells, progression of the disease, advanced stages, and poor prognosis [26]. We think that our study reflects this progression. Prognosis studies in MM include cytogenetic analyses. In particular, CD117 negativity is in relation with the high-risk karyotype and IgH heavy-chain mutations. In our study, CD117 was also negative in a patient with del 17p and one in two patients with del 13q among the patients for whom cytogenetic analyses were performed. In the patient with IgH mutation, both CD56 and CD117 were negative. Pozdnyakova et al. [32] revealed a relationship between poor cytogenetic features and CD56 and CD117 negativity in their studies. CD117 negativity was observed especially more often with poor cytogenetic features. They suggested that more information about the cytogenetic analyses can be obtained when the expressions of these two markers are assessed in patients for whom cytogenetic analyses cannot be applied. In the study of Mateo et al., [12] a relationship was shown between CD117 negativity and both IgH translocations and del 13q.

Conclusion There were several limitations of this study. The major limitation was that it was a single-center retrospective study and the patient population was relatively small. Since it was a retrospective study, there were some missing cytogenetic data in the patient records.

In conclusion, the lower levels of CD56 and CD117 expressions in advanced-stage disease and also the inverse relationship between LDH level and CD117 expression may support the importance of these expressions as prognostic markers in MM. We think other MoAb that show different aberrant antigenic expressions in addition to CD56 and CD117 should be added to MFC panels and further studies are required to evaluate cytogenetic features together. Ethics Ethics Committee Approval: The study protocol was approved by the Ankara Numune Training and Research Hospital Ethics Committee. Informed consent: It was received. Authorship Contributions Concept: F.C., S.D., G.Ö.; Design: F.C., M.F.; Data Collection or Processing: F.C., M.F.; Analysis or Interpretation: F.C., M.F., S.D., G.Ö.; Literature Search: F.C.; Writing: F.C., S.D., G.Ö. Conflict of interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Rawstron AC, Orfao A, Beksac M, Bezdickova L, Brooimans RA, Bumbea H, Dalva K, Fuhler G, Gratama J, Hose D, Kovarova L, Lioznov M, Mateo G, Morilla R, Mylin AK, Omede P, Pellat-Deceunynck C, Perez Andres M, Petrucci M, Ruggeri M, Rymkiewicz G, Schmitz A, Schreder M, Seynaeve C, Spacek M, de Tute RM, Van Valckenborgh E, Weston-Bell N, Owen RG, San Miguel JF, Sonneveld P, Johnsen HE; European Myeloma Network. Report of the European Myeloma Network on multiparametric flow cytometry in multiple myeloma and related disorders. Haematologica 2008;93:431-438. 2. Kumar S, Kimlinger T, Morice W. Immunophenotyping in multiple myeloma and related plasma cell disorders. Best Pract Res Clin Haematol 2010;23:433451. 3. Johnsen HE, Bøgsted M, Klausen TW, Gimsing P, Schmitz A, Kjaersgaard E, Damgaard T, Voss P, Knudsen LM, Mylin AK, Nielsen JL, Björkstrand B, Gruber A, Lenhoff S, Remes K, Dahl IM, Fogd K, Dybkaer K; Nordic Myeloma Study (NMSG); Myeloma Stem Cell Network (MSCNET). Multiparametric flow cytometry profiling of neoplastic plasma cells in multiple myeloma. Cytometry B Clin Cytom 2010;78:338-347. 4. Lin P, Owens R, Tricot G, Wilson CS. Flow cytometric immunophenotypic analysis of 306 cases of multiple myeloma. Am J Clin Pathol 2004;121:482488. 5. Robillard N, Wuilleme S, Moreau P, Bene MC. Immunophenotype of normal and myelomatous plasma-cell subsets. Front Immunol 2014;5:137. 6. Frebet E, Abraham J, Genevieve F, Lepelley P, Daliphard S, Bardet V, Amsellem S, Guy J, Mullier F, Durrieu F, Venon MD, Leleu X, Jaccard A, Faucher JL, Bene MC, Feuillard J; GEIL Groupe d’Etude Immunologique des Leucémies Study Group. A GEIL flow cytometry consensus proposal for quantification of plasma cells: application to differential diagnosis between MGUS and myeloma. Cytometry B Clin Cytom 2011;80:176-185. 7. Paiva B, Almeida J, Perez-Andres M, Mateo G, Lopez A, Rasillo A, Vidriales MB, Lopez-Berges MC, Miguel JF, Orfao A. Utility of flow cytometry immunophenotyping in multiple myeloma and other clonal plasma cellrelated disorders. Cytometry B Clin Cytom 2010;78:239-252.

231

Ceran F, et al: CD56 and CD117 Expressions in Multiple Myeloma

8. Bataille R, Pellat-Deceunynck C, Robillard N, Avet-Loiseau H, Harousseau JL, Moreau P. CD117 (c-kit) is aberrantly expressed in a subset of MGUS and multiple myeloma with unexpectedly good prognosis. Leuk Res 2008;32:379-382. 9. Sahara N, Takeshita A. Prognostic significance of surface markers expressed in multiple myeloma: CD56 and other antigens. Leuk Lymphoma 2004;45:61-65. 10. Kraj M, Sokolowska U, Kopec-Szlezak J, Poglod R, Kruk B, Wozniak J, Szpila T. Clinicopathological correlates of plasma cell CD56 (NCAM) expression in multiple myeloma. Leuk Lymphoma 2008;49:298-305. 11. Shim H, Ha JH, Lee H, Sohn JY, Kim HJ, Eom HS, Kong SY. Expression of myeloid antigen in neoplastic plasma cells is related to adverse prognosis in patients with multiple myeloma. Biomed Res Int 2014;2014:893243. 12. Mateo G, Montalbán MA, Vidriales MB, Lahuerta JJ, Mateos MV, Gutiérrez N, Rosiñol L, Montejano L, Bladé J, Martínez R, de la Rubia J, Diaz-Mediavilla J, Sureda A, Ribera JM, Ojanguren JM, de Arriba F, Palomera L, Terol MJ, Orfao A, San Miguel JF; PETHEMA Study Group; GEM Study Group. Prognostic value of immunophenotyping in multiple myeloma: a study by the PETHEMA/GEM cooperative study groups on patients uniformly treated with high-dose therapy. J Clin Oncol 2008;26:2737-2744. 13. Cao W, Goolsby CL, Nelson BP, Singhal S, Mehta J, Peterson LC. Instability of immunophenotype in plasma cell myeloma. Am J Clin Pathol 2008;129:926933. 14. Jeong TD, Park CJ, Shim H, Jang S, Chi HS, Yoon DH, Kim DY, Lee JH, Suh C, Lee KH. Simplified flow cytometric immunophenotyping panel for multiple myeloma, CD56/CD19/CD138(CD38)/CD45, to differentiate neoplastic myeloma cells from reactive plasma cells. Korean J Hematol 2012;47:260266. 15. Tembhare PR, Yuan CM, Venzon D, Braylan R, Korde N, Manasanch E, Zuchlinsky D, Calvo K, Kurlander R, Bhutani M, Tageja N, Maric I, Mulquin M, Roschewski M, Kwok M, Liewehr D, Landgren O, Stetler-Stevenson M. Flow cytometric differentiation of abnormal and normal plasma cells in the bone marrow in patients with multiple myeloma and its precursor diseases. Leuk Res 2014;38:371-376. 16. Sezer O, Heider U, Zavrski I, Possinger K. Differentiation of monoclonal gammopathy of undetermined significance and multiple myeloma using flow cytometric characteristics of plasma cells. Haematologica 2001;86:837-843. 17. Rawstron AC, Child JA, de Tute RM, Davies FE, Gregory WM, Bell SE, Szubert AJ, Navarro-Coy N, Drayson MT, Feyler S, Ross FM, Cook G, Jackson GH, Morgan GJ, Owen RG. Minimal residual disease assessed by multiparameter flow cytometry in multiple myeloma: impact on outcome in the Medical Research Council Myeloma IX Study. J Clin Oncol 2013;31:2540-2547. 18. Gupta R, Bhaskar A, Kumar L, Sharma A, Jain P. Flow cytometric immunophenotyping and minimal residual disease analysis in multiple myeloma. Am J Clin Pathol 2009;132:728-732. 19. Perez-Persona E, Vidriales MB, Mateo G, Garcia-Sanz R, Mateos MV, de Coca AG, Galende J, Martin-Nunez G, Alonso JM, de Las Heras N, Hernandez JM, Martin A, Lopez-Berges C, Orfao A, San Miguel JF. New criteria to identify risk of progression in monoclonal gammopathy of uncertain significance and smoldering multiple myeloma based on multiparameter flow cytometry analysis of bone marrow plasma cells. Blood 2007;110:2586-2592.

232

Turk J Hematol 2017;34:226-232

20. Bataille R, Jego G, Robillard N, Barille-Nion S, Harousseau JL, Moreau P, Amiot M, Pellat-Deceunynck C. The phenotype of normal, reactive and malignant plasma cells. Identification of “many and multiple myelomas” and of new targets for myeloma therapy. Haematologica 2006;91:12341240. 21. Chang H, Samiee S, Yi QL. Prognostic relevance of CD56 expression in multiple myeloma: a study including 107 cases treated with high-dose melphalan-based chemotherapy and autologous stem cell transplant. Leuk Lymphoma 2006;47:43-47. 22. Montero JC, Lopez-Perez R, San Miguel JF, Pandiella A. Expression of c-Kit isoforms in multiple myeloma: differences in signaling and drug sensitivity. Haematologica 2008;93:851-859. 23. Harrington AM, Hari P, Kroft SH. Utility of CD56 immunohistochemical studies in follow-up of plasma cell myeloma. Am J Clin Pathol 2009;132:6066. 24. Ocqueteau M, Orfao A, Garcia-Sanz R, Almeida J, Gonzalez M, San Miguel JF. Expression of the CD117 antigen (c-Kit) on normal and myelomatous plasma cells. Br J Haematol 1996;95:489-493. 25. Kraj M, Poglod R, Kopec-Szlezak J, Sokolowska U, Wozniak J, Kruk B. C-kit receptor (CD117) expression on plasma cells in monoclonal gammopathies. Leuk Lymphoma 2004;45:2281-2289. 26. Pan Y, Wang H, Tao Q, Zhang C, Yang D, Qin H, Xiong S, Tao L, Wu F, Zhang J, Zhai Z. Absence of both CD56 and CD117 expression on malignant plasma cells is related with a poor prognosis in patients with newly diagnosed multiple myeloma. Leuk Res 2016;40:77-82. 27. Van Camp B, Durie BG, Spier C, De Waele M, Van Riet I, Vela E, Frutiger Y, Richter L, Grogan TM. Plasma cells in multiple myeloma express a natural killer cell-associated antigen: CD56 (NKH-1; Leu-19). Blood 1990;76:377382. 28. Sahara N, Takeshita A, Shigeno K, Fujisawa S, Takeshita K, Naito K, Ihara M, Ono T, Tamashima S, Nara K, Ohnishi K, Ohno R. Clinicopathological and prognostic characteristics of CD56-negative multiple myeloma. Br J Haematol 2002;117:882-885. 29. Ely SA, Knowles DM. Expression of CD56/neural cell adhesion molecule correlates with the presence of lytic bone lesions in multiple myeloma and distinguishes myeloma from monoclonal gammopathy of undetermined significance and lymphomas with plasmacytoid differentiation. Am J Pathol 2002;160:1293-1299. 30. Schmidt-Hieber M, Perez-Andres M, Paiva B, Flores-Montero J, Perez JJ, Gutierrez NC, Vidriales MB, Matarraz S, San Miguel JF, Orfao A. CD117 expression in gammopathies is associated with an altered maturation of the myeloid and lymphoid hematopoietic cell compartments and favorable disease features. Haematologica 2011;96:328-332. 31. Shin SY, Lee ST, Kim HJ, Kim SJ, Kim K, Kang ES, Kim SH. Antigen expression patterns of plasma cell myeloma: an association of cytogenetic abnormality and International Staging System (ISS) for myeloma. J Clin Lab Anal 2015;29:505-510. 32. Pozdnyakova O, Morgan EA, Li B, Shahsafaei A, Dorfman DM. Patterns of expression of CD56 and CD117 on neoplastic plasma cells and association with genetically distinct subtypes of plasma cell myeloma. Leuk Lymphoma 2012;53:1905-1910.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0397 Turk J Hematol 2017;34:233-238

Clinical Outcomes Related to the Use of Bendamustine Therapy for Multiple Myeloma Patients Relapsed/Refractory to Immunomodulatory Drugs and Proteasome Inhibitors İmmünomodülatuvar İlaçlar ve Proteazom İnhibitörlerine Dirençli Multipl Miyelom Hastalarında Bendamustin Tedavi Etkinliği Fevzi Fırat Yalnız1, Nihan Akkoç2, Ayşe Salihoğlu1, M. Cem Ar1, Şeniz Öngören1, A. Emre Eşkazan1, Teoman Soysal1, Yıldız Aydın1 İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, İstanbul, Turkey

1 2

Abstract

Öz

Objective: Multiple myeloma patients who are relapsed or refractory to both proteasome inhibitors (PIs) and immunomodulatory drugs (IMiDs) have been reported to have poor outcomes. Bendamustine has been reported to have an antitumor effect in newly diagnosed as well as relapsed/refractory multiple myeloma (RRMM). The aim of this retrospective study was to evaluate the efficacy of bendamustine therapy in heavily pretreated MM patients who were refractory to PIs and IMiDs.

Amaç: Proteazom inhibitörleri (PIs) ve immünomodülatuvar ilaçlar (IMiDs) içeren tedavi rejimlerine relaps refrakter multipl miyelom (RRMM) hastalarının prognozu oldukça kötüdür. Bendamustin yeni tanı almış ve RRMM hastalarında etkinliği bildirilmiş bir ajandır. Bu retrospektif çalışmanın amacı, öncesinde yoğun tedavi almış, PIs ve IMiDs tedavilerine RRMM hastalarında bendamustin tedavi etkinliğinin ortaya konmasıdır.

Materials and Methods: Nineteen RRMM patients treated either with bendamustine and steroids (n=13) or a combination of bendamustine with novel drugs (n=6) were included. The median number of previous treatment lines was 5 (minimum-maximum: 3-8) and median time from diagnosis was 6 years (minimum-maximum: 1-16). All of the patients were resistant to at least one of the IMiDs and one of the PIs. Bendamustine was given at doses ranging from 90 mg/m2 to 120 mg/ m2 on days 1 and 2 of 28-day cycles. Results: A median of 2 (minimum-maximum: 1-8) treatment cycles was administered per patient. The toxicity of bendamustine was mild and mostly of hematological origin. No complete remission was achieved. There was partial remission and stable disease in 21% and 11% of the patients, respectively. Sixty-eight percent of patients had progressive disease. The median progression-free survival and overall survival was 2 and 4 months, respectively. Conclusion: Bendamustine therapy was well tolerated but showed limited anti-myeloma activity in heavily pretreated patients who were refractory to IMiDs and PIs.

Gereç ve Yöntemler: On dokuz RRMM hastasına bendamustin steroid (n=13) veya diğer ajanlarla kombine (n=6) edilerek verildi. Hastaların bendamustin tedavisi öncesi almış oldukları ortanca tedavi sayısı 5 (minimum-maksimum: 3-8), MM tanısından itibaren geçen zaman ortanca 6 yıl (minimum-maksimum: 1-16) olarak tespit edildi. Çalışmaya dahil edilmiş tüm hastalar en az bir IMiDs ve bir PIs dirençli idi. Bendamustin 90 mg/m2-120 mg/m2 dozlarında 28 günlük tedavi sikluslarının 1. ve 2. günlerinde verildi. Bulgular: Hastalar ortanca 2 (minimum-maksimum: 1-8) siklüs tedavi aldı. Bendamustin kaynaklı toksisite hafif ve genel olarak hematolojik orjinli tespit edildi. Hiçbir hastada tam remisyona elde edilemedi. Hastaların %21 ve %11’inde sırası ile kısmi remisyon ve stabil hastalık safhasına ulaşıldı. Hastaların %68’inde hastalık progresyonu saptandı. Ortanca progresyonsuz sağkalım ve genel sağkalım sırası ile 2 ve 4 ay olarak tespit edildi. Sonuç: IMiDs ve PIs dirençli hastalarda bendamustin tedavisi iyi tolere edilmesine rağmen kısıtlı anti-miyelom aktivitesi göstermiştir. Anahtar Sözcükler: Multipl miyelom, Relaps refrakter, Bendamustin

Keywords: Multiple myeloma, Relapse refractory, Bendamustine

Address for Correspondence/Yazışma Adresi: Fevzi Fırat YALNIZ, M.D., İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey Phone : +90 212 414 30 00 (22074) E-mail : ffiratyalniz@gmail.com

Received/Geliş tarihi: October 06, 2016 Accepted/Kabul tarihi: March 07, 2017

233

Yalnız FF, et al: Bendamustine in Refractory Myeloma Patients

Introduction Multiple myeloma (MM) is the second most common hematological malignancy, accounting for an estimated 1% of all cancers [1]. Introduction of high-dose chemotherapy followed by stem cell rescue and novel treatment modalities such as immunomodulatory drug (IMiD) agents and proteasome inhibitors (PIs) over the past 20 years have led to improved survival rates in patients with MM [2,3]. Recently, the United States Food and Drug Administration approved two monoclonal antibodies indicated for the treatment of MM, which will further help improve the response and survival rates in relapsed refractory multiple myeloma (RRMM). Despite advances in its treatment, MM is still considered to be an incurable disease. For patients who relapse after treatment with novel agents therapeutic strategies are inadequate and usually result in a dismal prognosis. While some salvage treatments exist, patients may not respond to them or may be unable to tolerate them due to toxicities. Bendamustine is a nitrogen mustard-based alkylating agent shown to be effective in the treatment of various hematologic malignancies. It can be safely administered to patients both with mild to moderate renal insufficiency and moderate hepatic insufficiency [4,5]. Bendamustine has been used for more than a decade for the treatment of MM, either as the sole therapy or in combination with steroids and other chemotherapeutics including novel agents [6]. Considerable efficacy has been reported in newly diagnosed as well as RR patients [7,8]. In this retrospective analysis we tried to explore the real-life effectiveness and safety of bendamustine in heavily pretreated MM patients refractory to IMiDs and PIs.

Materials and Methods Patients were identified by reviewing the medical records at the Hematology Department of Cerrahpaşa Medical Faculty, İstanbul University. This retrospective study included 19 patients who were RR to at least one of the IMiDs (thalidomide and lenalidomide) and one of the PIs (carfilzomib and bortezomib). Patient characteristics before bendamustine treatment are shown in Table 1. Bendamustine was given either with steroids (n=13) or in combination with novel agents (n=6) between January 2012 and May 2015 (Table 1). Bendamustine dosage varied from 90 mg/m2 to 120 mg/m2 and it was administered intravenously on days 1 and 2 of a 28-day cycle as per the protocol described in previous studies [9,10,11]. Bendamustine was combined with lenalidomide and dexamethasone in three patients and with thalidomide and bortezomib in one patient each, respectively. 234

Turk J Hematol 2017;34:233-238

Dexamethasone was given at up to 160 mg per cycle as tolerated. Patients received cotrimoxazole, acyclovir, and fluconazole prophylaxis during treatment. Treatment response was assessed according to the International Myeloma Working Group Consensus Statement for the management, treatment, and supportive care of patients with myeloma [7]. Overall response rate (ORR) was defined to include complete response, very good partial response, partial response (PR), and minimal response. Overall survival (OS) was calculated as the time from the first day of the bendamustine cycle to death or last patient contact. Progression-free survival (PFS) was defined as the time from bendamustine administration to the date at which criteria for progression were met or death, whichever occurred first. Adverse events were recorded and categorized based on the Common Technology Criteria for Adverse Events Version 4.0 (CTCAE). Time-to-event analysis was performed using the Kaplan-Meier method (JMP v Pro 12).

Results Nineteen RRMM patients were included in the study. The median age was 62 years (minimum-maximum: 38-83) and there were 12 males (63%). Patients were heavily pretreated with a median number of 5 (minimum-maximum: 3-8) previous lines of therapy. The median time from diagnosis was 6 years (minimum-maximum: 1-16). All included patients had progressed under their last treatment regimen and had been exposed to all effective drugs available in the country prior to treatment with bendamustine. Patients were not given a fixed number of bendamustine cycles. Treatment was discontinued in the case of considerable toxicity or ineffectiveness (disease progression). Following a median of 2 (minimum-maximum: 1-8) treatment cycles, 4 patients showed PR (21%) and 2 patients had stable disease (11%), while in the rest of the patients the disease progressed (68%) (Table 1). Median PFS was 59 days (minimummaximum: 14-425) (Figure 1) and OS was 120 days (minimummaximum: 31-456) (Figure 2). Eight patients died during the first 2 months of treatment due to disease progression. Only eight of the patients were able to receive 3 or more cycles of bendamustine while in the rest of the cases treatment had to be discontinued due to disease progression. Median OS for patients treated with ≥3 and <3 cycles of bendamustine was 274 and 59 days, respectively (Figure 3). Bendamustine was well tolerated in patients who received it combined with steroids or with novel agents (IMiDs and PIs). The most commonly observed grade 3-4 adverse events included mild to moderate hematological toxicities. Among them, 12 (55%) patients had neutropenia, 5 (23%) patients had

Male

Female

Male

Female

Male

Female

Male

Female

Male

Female

Age

IgA L

IgG K

IgA K

IgG K

IgG L

IgA K

IgG K

IgA K

IgG K

IgG L

IgG K

MM subtype

D-S stage

ISS stage B-Dex-Vel

Treatment regimen

B-Dex

VAD, ASCT, Vel/Dex, DT-PACE, Len/Dex, Thal/Dex, Carfilzomib/Dex, Pom/Dex Vel/Dex, Len/Dex, Carfilzomib/Dex

B-Dex

B-Dex-Len

B-Dex

B-Thal

B-Dex

B-Dex-Len

B-Dex

RT, VAD, ASCT, VCD, Thal/Dex, Len/Dex

VAD, ASCT, Eto/Cyc, Vel/Dex, Len/Dex

VAD, ASCT, VCD, Thal/Dex, Len/Dex

VAD, Thal/Dex, Vel/Dex, ASCT, Len/Dex

MP, TP, Vel/Dex, Len/Dex

VAD, MPT, Vel/Dex, Len/Dex, Cyc/Eto

MPT, Len/Dex, VCD, Carfilzomib/Dex

VAD, VCD, Len/Dex

VMP, Thal/Dex, Len/Dex, Carfilzomib/Dex

Vel/Dex, Thal/Dex, Len/Dex, Carfilzomib/Dex

VMP, Vel/Dex, Len/Dex, Carfilzomib/Dex

Mel/Dex, Thal/Dex, Vel/Dex, Len/Dex

VAD, Vel/Dex, Len/Dex

VAD, Vel/Dex, ASCT, Len/Dex, Carfilzomib/Dex

VAD, ASCT, Thal/Dex, Len/Dex, Carfilzomib/Dex

VAD, ASCT, Thal/Dex, VCD, Len/Dex, Cyc/Eto, Mel/Dex B-Thal

VAD, ASCT, Vel/Dex, Len/Dex, Carfilzomib/Dex

Previous treatment regimens

Treatment cycles

Response

365

182

181

304

425

123

PFS, days

212

456

182

181

182

243

304

120

425

335

Dead

Alive

Dead

Alive

Dead

Alive

Dead

OS, Last days status

MM: Multiple myeloma, K: kappa; L: lambda, D-S: Durie-Salmon, ISS: International Scoring System, VAD: vincristine/adriamycin/dexamethasone, ASCT: autologous stem cell transplantation, Vel: Velcade, Pom: pomalidomide, Len: lenalidomide, Dex: dexamethasone, Thal: thalidomide, Cyc: cyclophosphamide, Eto: etoposide, Mel: melphalan, VMP: Velcade/melphalan/prednisolone, RT: radiotherapy, B: bendamustine, SD: stable disease, PD: progressive disease, MPT: melphalan/prednisone/thalidomide, VCD: Velcade/cyclophosphamide/dexamethasone, PR: partial response, PFS: progression-free survival, OS: overall survival.

Sex

Patient no.

Table 1. Baseline characteristics and bendamustine treatment outcomes.

Turk J Hematol 2017;34:233-238 YalnÄ±z FF, et al: Bendamustine in Refractory Myeloma Patients

235

YalnÄąz FF, et al: Bendamustine in Refractory Myeloma Patients

Turk J Hematol 2017;34:233-238

Table 2. Treatment-related adverse events. Adverse event

Grade 3-4 side effects (n)*

Anemia

Neutropenia

Thrombocytopenia

Infection

Nausea

*Common Technology Criteria for Adverse Events (CTCAE) Version 4.0.

Figure 1. Progression-free survival.

Figure 2. Overall survival.

Figure 3. Overall survival based on treatment cycles. thrombocytopenia, and 2 (9%) patients had anemia. Apart from hematological toxicities, 2 (10%) patients developed lower respiratory tract infections of bacterial origin (CTCAE grades 3 and 4). Those patients were hospitalized and treated successfully with intravenous antibiotics. Treatment-related CTCAE grade 3-4 toxicities are summarized in Table 2.

Discussion MM patients who are RR to treatment with IMiDs and bortezomib have been reported to have poor outcomes. 236

According to a recent International Myeloma Working Group study, the median OS and PFS of patients refractory to IMiDs and bortezomib were found to be 9 and 5 months, respectively [12]. Options are very limited for those who become resistant to these agents and the vast majority of these patients are unable to tolerate most regimens due to toxicities. Bendamustine could be an option for these patients because of its low toxicity profile. Several clinical studies have demonstrated the effectiveness of bendamustine combined with novel agents in the first-line therapy of MM [13,14,15]. However, published data on bendamustine as monotherapy or in combination with steroids in the treatment of RRMM are limited. Michael et al. [10] in their retrospective analysis looked at the outcomes of RRMM patients (n=39) who were treated with bendamustine as a sole therapy or in combination with steroids. They reported an ORR of 36%, with median event-free survival (EFS) and OS of 7 and 17 months, respectively. In another retrospective study Damaj et al. [11] found an ORR of 30%. Median PFS and OS for the entire cohort were 9.3 and 12.4 months, respectively. An ORR of 59% was reported by StĂśhr et al. [16] in heavily treated RRMM patients with a median OS of 17 months and an EFS of 7 months. Recently, Musto et al. [17] published results on 78 MM patients, most of whom were refractory to IMiDs and bortezomib. The ORR was 29%. We present here a retrospective analysis of patients with RRMM who had been exposed to and were RR to PIs and IMiDs. Unlike our study, in former studies, not all patients had been previously exposed and were refractory to IMiDs and PIs. All of our patients were refractory to their last therapy and all of the patients had been heavily pretreated with all available agents. Furthermore, 5 of them were double-PI and double-IMiD refractory. Bendamustine was considered as a final option for our patients. A median of 2 (minimum-maximum: 1-8) treatment cycles were administered per patient. The therapy was well tolerated and the most common side effect was neutropenia (Table 2). Bendamustine generally has a favorable toxicity profile with moderate hematological events. Although it has been used for more than a decade for the treatment of myeloma, only a small number of studies reporting

Turk J Hematol 2017;34:233-238

its efficacy and safety in different settings and combinations have emerged. A phase II trial defined a dose of 90 mg/m2 on days 1 and 4 as the maximum tolerated dose of bendamustine when used in combination with bortezomib [18]. In another study, the maximum tolerated dose was not reached with 75 mg/m2 on days 1 and 2 when combined with lenalidomide at 25 mg on days 1 to 21 [19]. In our study, 6 patients were given bendamustine in combination with novel agents (Table 1). Bendamustine at 90 mg/m2 on days 1 and 2 of a 28-day cycle was the preferred treatment protocol when administered in combination with the aforementioned novel agents. Twelve of our patients had grade 3-4 neutropenia. Although the efficacy achieved with combinations of bendamustine and other agents is promising, the overlapping myelosuppressive effects of these agents may be problematic. However, there are no clear dosage adjustment recommendations available and due to our small patient size we cannot present a firm conclusion in this regard. Response rates in our cohort of patients were not as high as was reported in earlier studies. However, patients who could receive 3 or more cycles of bendamustine showed an OS advantage over the patients who were given less than 3 cycles. Nevertheless, statistical comparisons could not be performed due to the small patient numbers. Results of patients with ≥3 cycles were comparable to the best supportive care results in the literature (Figure 3).

Conclusion Small sample size and the retrospective nature of the study were the two main limitations of our study. Furthermore, cytogenetic profile data of most of the subjects were not available, which is an important issue when evaluating refractoriness to treatment. We think that the main contribution of our study to the current literature is showing the efficacy of bendamustine in heavily pretreated MM patients who were refractory to both IMiDs and PIs. In conclusion, previous studies have shown the efficacy of bendamustine treatment either as monotherapy or combined with novel agents in newly diagnosed MM patients. In RR settings, novel agent-naive patients were also shown to be responsive to bendamustine therapy [16,17]. However, we did not observe a benefit of bendamustine treatment in patients who were refractory to IMiDs and PIs. It is important to reiterate that our sample size does not permit us to make a precise statement. However, based on our experience with this relatively small number of patients, there is no clear recommendation to be made for the use of bendamustine in IMiD- and PI-resistant heavily pretreated MM patients. Such patients should be encouraged to participate in clinical trials evaluating new approaches. Ethics Ethics Committee Approval: Retrospective study.

Yalnız FF, et al: Bendamustine in Refractory Myeloma Patients

Authorship Contributions Concept: F.F.Y., M.C.A.; Design: T.S., Y.A.; Data Collection or Processing: N.A., A.S.; Analysis or Interpretation: F.F.Y., E.E.; Literature Search: Ş.Ö.; Writing: F.F.Y. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Smith A, Howell D, Patmore R, Jack A, Roman E. Incidence of haematological malignancy by sub-type: a report from the Haematological Malignancy Research Network. Br J Cancer 2011;105:1684-1692. 2. Grosicki S, Barchnicka A, Jurczyszyn A, Grosicka A. Bortezomib for the treatment of multiple myeloma. Expert Rev Hematol 2014;7:173-185. 3. Kurtin SE, Bilotti E. Novel agents for the treatment of multiple myeloma: proteasome inhibitors and immunomodulatory agents. J Adv Pract Oncol 2013;4:307-321. 4. Gentile M, Recchia AG, Mazzone C, Vigna E, Martino M, Morabito L, Lucia E, Bossio S, De Stefano L, Granata T, Palummo A, Morabito F. An old drug with a new future: bendamustine in multiple myeloma. Expert Opin Pharmacother 2013;14:2263-2280. 5. McCloskey JK, Broome CM, Cheson BD. Safe and effective treatment of aggressive non-Hodgkin lymphoma with rituximab and bendamustine in patients with severe liver impairment. Clin Adv Hematol Oncol 2013;11:184-188. 6. Palumbo A, Offidani M, Patriarca F, Petrucci MT, Cavo M. Bendamustine for the treatment of multiple myeloma in first-line and relapsed-refractory settings: a review of clinical trial data. Leuk Lymphoma 2015;56:559-567. 7. Ludwig H, Kasparu H, Leitgeb C, Rauch E, Linkesch W, Zojer N, Greil R, Seebacher A, Pour L, Weißmann A, Adam Z. Bendamustine-bortezomibdexamethasone is an active and well-tolerated regimen in patients with relapsed or refractory multiple myeloma. Blood 2014;123:985-991. 8. Pönisch W, Bourgeois M, Moll B, Heyn S, Jäkel N, Wagner I, Rohrberg R, Hurtz HJ, Schmalfeld M, Aßmann M, Edelmann T, Mohren M, Hoffmann FA, Becker C, Schwarzer A, Schönfelder U, Zehrfeld T, Hensel G, Löschcke K, Krahl R, Ali HA, Niederwieser D. Combined bendamustine, prednisone and bortezomib (BPV) in patients with relapsed or refractory multiple myeloma. J Cancer Res Clin Oncol 2013;139:499-508. 9. Knop S, Straka C, Haen M, Schwedes R, Hebart H, Einsele H. The efficacy and toxicity of bendamustine in recurrent multiple myeloma after high-dose chemotherapy. Haematologica 2005;90:1287-1288. 10. Michael M, Bruns I, Bölke E, Zohren F, Czibere A, Safaian NN, Neumann F, Haas R, Kobbe G, Fenk R. Bendamustine in patients with relapsed or refractory multiple myeloma. Eur J Med Res 2010;15:13-19. 11. Damaj G, Malard F, Hulin C, Caillot D, Garidi R, Royer B, Marit G, Stoppa AM, Banos A, Morineau N, Moreau P, Fitoussi O, Tiab M, Moreau P. Efficacy of bendamustine in relapsed/refractory myeloma patients: results from the French compassionate use program. Leuk Lymphoma 2012;53:632-634. 12. Kumar SK, Lee JH, Lahuerta JJ, Morgan G, Richardson PG, Crowley J, Haessler J, Feather J, Hoering A, Moreau P, LeLeu X, Hulin C, Klein SK, Sonneveld P, Siegel D, Bladé J, Goldschmidt H, Jagannath S, Miguel JS, Orlowski R, Palumbo A, Sezer O, Rajkumar SV, Durie BG; International Myeloma Working Group. Risk of progression and survival in multiple myeloma relapsing after therapy with IMiDs and bortezomib: a multicenter international myeloma working group study. Leukemia 2012;26:149-157. 13. Pönisch W, Mitrou PS, Merkle K, Herold M, Assmann M, Wilhelm G, Dachselt K, Richter P, Schirmer V, Schulze A, Subert R, Harksel B, Grobe N, Stelzer E, Schulze M, Bittrich A, Freund M, Pasold R, Friedrich T, Helbig W, Niederwieser D; East German Study Group of Hematology and Oncology (OSHO). Treatment of bendamustine and prednisone in patients with newly

237

Yalnız FF, et al: Bendamustine in Refractory Myeloma Patients

diagnosed multiple myeloma results in superior complete response rate, prolonged time to treatment failure and improved quality of life compared to treatment with melphalan and prednisone--a randomized phase III study of the East German Study Group of Hematology and Oncology (OSHO). J Cancer Res Clin Oncol 2006;132:205-212. 14. Pönisch W, Holzvogt B, Plötze M, Andrea M, Bourgeois M, Heyn S, Zehrfeld T, Hammerschmidt D, Schwarz M, Edelmann T, Becker C, Hoffmann FA, Schwarzer A, Kreibich U, Gutsche K, Reifenrath K, Winkelmann C, Krahl R, Remane Y, Hennig E, Schliwa T, Lindner T, Kaiser T, Vucinic V, Behre G, Niederwieser D. Bendamustine and prednisone in combination with bortezomib (BPV) in the treatment of patients with newly diagnosed/ untreated multiple myeloma. J Cancer Res Clin Oncol 2014;140:1947-1956. 15. Zwickl H, Zwickl-Traxler E, Pecherstorfer M. A single-center retrospective analysis of first-line therapy of multiple myeloma with bendamustinebortezomib-dexamethasone. Leuk Lymphoma 2016;57:2065-2070. 16. Stöhr E, Schmeel FC, Schmeel LC, Hänel M, Schmidt-Wolf IG; German Refractory Myeloma Study Group. Bendamustine in heavily pre-treated patients with relapsed or refractory multiple myeloma. J Cancer Res Clin Oncol 2015;141:2205-2212.

238

Turk J Hematol 2017;34:233-238

17. Musto P, Fraticelli VL, Mansueto G, Madonna E, Nozza A, Andriani A, Mussetti A, Ballanti S, Bongarzoni V, Baraldi A, Patriarca F, Vincelli D, Falcone A, Derudas D, Califano C, Zambello R, Mele G, Fragasso A, Baldini L, Storti S. Bendamustine in relapsed/refractory multiple myeloma: the “reallife” side of the moon. Leuk Lymphoma 2015;56:1510-1513. 18. Berenson JR, Yellin O, Bessudo A, Boccia RV, Noga SJ, Gravenor DS, PatelDonnelly D, Siegel RS, Kewalramani T, Gorak EJ, Nassir Y, Swift RA, Mayo D. Phase I/II trial assessing bendamustine plus bortezomib combination therapy for the treatment of patients with relapsed or refractory multiple myeloma. Br J Haematol 2013;160:321-330. 19. Pönisch W, Heyn S, Beck J, Wagner I, Mohren M, Hoffmann FA, Lange T, Schmalfeld M, Zehrfeld T, Schwarzer A, Winkelmann C, Edelmann T, Röhrborn R, Hebenstreit K, Al-Ali HK, Jäkel N, Niederwieser D. Lenalidomide, bendamustine and prednisolone exhibits a favourable safety and efficacy profile in relapsed or refractory multiple myeloma: final results of a phase 1 clinical trial OSHO - 077. Br J Haematol 2013;162:202-209.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0411 Turk J Hematol 2017;34:239-243

Primary Thrombophilia in Mexico XII: Miscarriages Are More Frequent in People with Sticky Platelet Syndrome Meksika XII’de Primer Trombofili: Yapışkan Trombosit Sendromlu İnsanlarda Düşükler Daha Sık Görülmektedir Guillermo J. Ruiz-Delgado1,4, Yahveth Cantero-Fortiz2, Mariana A. Mendez-Huerta3,4, Mónica Leon-Gonzalez1,3, Ana K. Nuñez-Cortes1,5, Andrés A. Leon-Peña1,5, Juan Carlos Olivares-Gazca1,3, Guillermo J. Ruiz-Argüelles1,4 Centro de Hematología y Medicina Interna de Puebla, Puebla, Mexico Universidad de las Américas Puebla, Puebla, Mexico 3 Universidad Popular Autónoma del Estado de Puebla, Puebla, Mexico 4 Laboratorios Clínicos de Puebla, Puebla, Mexico 5 Benemérita Universidad Autónoma de Puebla, Puebla, Mexico 1 2

Abstract

Öz

Objective: Sticky platelet syndrome (SPS) is an inherited condition that leads to arterial and venous thrombosis. There is scant information about the association between SPS and obstetric complications. This study aimed to assess the relationship between SPS and fetal loss at a single institution.

Amaç: Yapışkan trombosit sendromu (YTS), arteriyel ve venöz tromboza yol açan kalıtsal bir durumdur. YTS ve obstetrik komplikasyonlar arasındaki ilişki konusunda az bilgi vardır. Bu çalışma, tek bir merkezde YTS ve fetal kayıp arasındaki ilişkiyi değerlendirmeyi amaçlamıştır.

Materials and Methods: The obstetric histories of all consecutive female patients prospectively studied in a 324-month period at a single institution with a history of thrombosis and a clinical marker of primary thrombophilia were reviewed. Results: Between 1989 and 2016, 268 consecutive patients with a clinical marker of primary thrombophilia and a history of arterial or venous thrombosis were studied; of these, 108 were female patients. Within this subset of thrombophilic females, 77 (71%) had been pregnant at some point. Twenty-eight of these 77 patients (37%) had had a spontaneous abortion and 24 of those (86%) were found to have SPS. On the other hand, in a subset of 73 female patients with SPS who had been pregnant, 32% had miscarriages. These figures are significantly higher than the prevalence of spontaneous abortions in the general Mexican population of pregnant women, which is 12%13% (chi-square: 7.47; p=0.0063). Accordingly, the relative risk of having a miscarriage is 2.66 times higher in female patients with SPS than in the general population (p=0.0014). Conclusion: In Mexico, female patients with SPS experience significantly more spontaneous abortions than the general population. Since the treatment of SPS is simple and effective and could in turn prevent adverse obstetric outcomes, its investigation in women treated for obstetric complications may be useful and deserves further research.

Gereç ve Yöntemler: Tek bir merkezde, 324 aylık periyotta prospektif olarak incelenen, klinik belirteç olarak tromboz öyküsü ve primer trombofilisi olan kadın hastaların obstetrik hikayeleri gözden geçirilmiştir. Bulgular: 1989 ile 2016 yılları arasında primer trombofili ve arteriyal veya venöz tromboz öyküsü olan 268 hasta çalışmaya alındı; bunlardan 108’i kadın hastalardı. Trombofilik bireylerin bir alt grubunda 77 (%71) kadın bir noktada hamile kaldı. Bu 77 hastanın 28’inde (%37) spontan düşük görüldü ve bunların 24’ünde (%86) YTS bulundu. Öte yandan, YTS’li 73 gebe kadın hastanın %32’lik bir kısmında düşük görüldü. Bu rakamlar, genel Meksika popülasyonundaki gebe kadınlardaki spontan düşüklerin prevalansından %12-%13 (ki-kare: 7,47; p=0,0063) daha yüksektir. Buna göre, düşük yapma göreceli riski YTS’li kadın hastalarda, genel nüfusa göre 2,66 kat daha fazladır (p=0,0014). Sonuç: Meksika’da YTS’li kadın hastalarda genel popülasyondan çok daha fazla spontan düşük görülmektedir.YTS’nin tedavisi basit ve etkilidir ve olumsuz obstetrik sonuçları önleyebilir. Bu nedenle obstetrik komplikasyonlar nedeniyle tedavi gören kadınlarda araştırılması faydalı olabilir ve daha fazla araştırma yapmayı hak eder. Anahtar Sözcükler: Yapışkan trombosit sendromu, Trombofili, Düşükler

Keywords: Sticky platelet syndrome, Thrombophilia, Miscarriages

Address for Correspondence/Yazışma Adresi: Guillermo J. RUIZ-ARGUELLES, M.D., Centro de Hematología y Medicina Interna de Puebla, Puebla, Mexico Phone : 011 52 222 243 8100 E-mail : gruiz1@clinicaruiz.com

Received/Geliş tarihi: October 19, 2016 Accepted/Kabul tarihi: February 07, 2017

239

Ruiz-Delgado GJ, et al: Miscarriages in Sticky Platelet Syndrome

Introduction Sticky platelet syndrome (SPS) was first described by Holliday et al. [1] at the 9th Conference on Stroke and Cerebral Circulation in Arizona in 1983. Since then, we and others have found that SPS is a common cause of arterial and venous thrombosis [2,3,4,5,6 ,7,8,9,10,11,12,13,14,15,16,17]. SPS is the second most common hereditary thrombophilic condition after resistance to activated protein C and the most common thrombophilia associated with arterial thrombosis, with an incidence of 21% [3,4,5]. In Mexico, we have found that SPS is the second most frequent cause of hereditary thrombophilia, only surpassed by the 677 mutation in the MTHFR gene [4,5,17]. SPS is also the second most common thrombophilic condition that causes recurrent spontaneous abortions or fetal loss syndrome [18,19,20]. The diagnosis and classification of SPS relies on platelet aggregometry tests employing appropriate dilutions of two platelet aggregation inducers: adenosine diphosphate (ADP) and epinephrine [1,2,3,4,5,6]. In this study, we have assessed the relationship between SPS in female patients and their obstetric histories, focusing on the history of miscarriages.

Materials and Methods Patients During a 324-month period, all consecutive mestizo Mexican patients referred to our center by physicians from different parts of the country were prospectively enrolled if they had one of the following clinical markers related to a primary hypercoagulable state [6,7,8,9,10,11]: a) thrombosis at age younger than 40 years; b) family history of thrombosis (first-degree relatives); c) recurrent thrombosis without apparent triggering factors; d) thrombosis at uncommon anatomic locations; or e) resistance to conventional antithrombotic therapy. Patients with overt malignancy, puerperium, pregnancy, use of oral contraceptives, or other conditions related to secondary thrombophilia were excluded. All patients had experienced at least one event of venous or arterial thrombosis as confirmed by either phlebography or Doppler; no surgery or trauma patients were included. The operational definition of “mestizo” given by Pons-Estel et al. [21] was employed to select patients as individuals born in Latin America who had both Amerindian and white ancestors. Informed consent was received from all the patients included in the study; the research was authorized by the Ethics and Human Research Subject Protection Committees of Clinica RUIZ. Spontaneous abortion or miscarriage was defined as a previous clinically recognized pregnancy loss as stated in the patient’s medical records. Analytical Methods The following tests were done at least 3 months after the vasoocclusive episode and patients were tested without the effect of anticoagulants or antiplatelets for at least 12 h. 240

Turk J Hematol 2017;34:239-243

For the assessment of SPS, we employed the procedure described by Mammen [4]: blood samples were drawn between 8:30 and 10:30 am via clean venipuncture with 19- or 21-gauge needles. After the venipuncture, the tourniquet was released and the first 5 mL was discarded. Then 18 mL of blood was aspirated into a 20-mL syringe containing 2 mL of 3.8% sodium citrate solution. The anticoagulated blood was centrifuged immediately for 10 min at 100 x g at room temperature to obtain plateletrich plasma (PRP). After this, approximately one-half of the PRP was centrifuged a second time at 2000 x g for 20 min at room temperature to obtain platelet-poor plasma (PPP). In order to assess aggregation, the PRP was diluted with the PPP to achieve a platelet count of 200x109/L. Platelet aggregation function was evaluated with an aggregometer (Model 500 CA, ChronoLog Corporation, Havertown, PA, USA), employing the original technique as described by Born and Cross [22]. Changes in optical density were recorded on a ChronoLog recorder (Model 703). While keeping the temperature (37 °C) and stirrer speed constant, aggregation was induced by exposure to three concentrations of ADP (2.34, 1.17, and 0.58 µM) and three concentrations of epinephrine (11, 1.1, and 0.55 µM) (final concentration in the PRP cuvette). We defined maximal aggregation as 100% light transmission, calibrated for each specimen. For each case normal controls were also studied. The cutoff points to define abnormal response for platelet aggregation with ADP exposure at 2.34, 1.17, and 0.58 µM were established as 55%, 36%, and 12%, respectively. The cutoff points to define abnormal response for platelet aggregation with epinephrine exposure at 11, 1.1, and 0.55 µM were established as 80%, 27%, and 20%, respectively. The presence of at least two abnormally high measurements out of the total six led to the diagnosis of SPS. The activated protein C resistance (aPCR) phenotype was assessed using the ProC Global test kit (Siemens Healthcare Diagnostic Products GmbH, Marburg, Germany): aPCR was determined by the quantification of the increase in activated partial thromboplastin time in response to activated protein C using factor V-deficient plasma [8]. Coagulation protein C, coagulation protein S, antithrombin III, plasminogen, tissue-type plasminogen activator activity, plasminogen activator inhibitor activity, plasminogen activator inhibitor type, immunoglobulin G (IgG) and IgM isotypes of antiphospholipid antibodies, and lupus anticoagulants were also tested as was previously described [8]. For factor V gene mutations, a polymerase chain reaction (PCR)based analysis for the factor V p.506R>Q (Leiden) mutation was performed according to the method of Zöller and Dahlbäck [23]. A region of the factor V gene from nucleotide 1690 to nucleotide 1692 of codon 506 was amplified by PCR and then subjected to digestion with MnII restriction endonuclease. The restriction pattern was studied by electrophoresis on a 4.5%

Turk J Hematol 2017;34:239-243

polyacrylamide gel. The used oligonucleotides were those described by Bick [3]. To investigate the factor V HR2 haplotype, exon 13 was amplified with primer pair F5 13-1 and F5 13-2 [24]. The polymorphism p.1299H>R, which forms a part of allele R2, was then observed by restriction analysis with RsaI [9]. For detection of the p.306R>T (Cambridge) mutation, exon 7 of the factor V gene was amplified using primers F5 7-1 and F5 7-2 [25]. The mutation was determined by restriction analysis with BstNI. For the factor V gene Hong Kong mutation (p.306R>G), the 241bp amplification product achieved for detection of the factor V Cambridge mutation was digested with HpaII according to Chan et al. [26]. For the factor V gene Liverpool mutation (p.359I>T), exon 8 of the factor V gene was amplified using primers F5 8-1 and F5 8-2 [9]. The amplification product achieved for the identification of the factor V Liverpool mutation was digested with BsrI according to Mumford et al. [27]. Identification of transition c.677C>T of the 5,10-methylenetetrahydrofolate-reductase (MTHFR) gene was performed based on the procedure originally described by Kluijtmans et al. [28]. A fragment of the MTHFR gene from nucleotide 598 to nucleotide 705 was amplified. To establish the genotype, the amplicon was treated with HinfI. Homocysteine levels were not assessed. A-PCR-based analysis for the c.20210G>A polymorphism in the 3â&#x20AC;&#x2122;-untranslated region of the prothrombin gene was performed as described by Poort et al. [29]. By PCR, a section of the prothrombin gene from nucleotide 19889 to nucleotide 20212 was amplified. In this process, a mutation is introduced by one of the primers that generates a HindIII restriction site along with the G>A mutation. An aliquot of the amplified product was therefore digested with HindIII restriction endonuclease. Statistical Analysis Statistical analyses were performed using the chi-square test while comparing categorical variables. For all analyses, p<0.05 was used to indicate statistical significance.

Ruiz-Delgado GJ, et al: Miscarriages in Sticky Platelet Syndrome

one spontaneous abortion. Within the group of patients who had experienced spontaneous abortion, the prevalence of SPS was 86% (24 out of 28); the remaining four patients who had experienced abortion were found to be heterozygous for the 677C>T mutation of the MTHFR gene. In the subset of female patients who had been pregnant and had no abortions, the prevalence of SPS was 63% (31 out of 49) and the prevalence of the 677C>T mutation of the MTHFR gene was 37% (18 of 49). It is clear that the prevalence of SPS in patients who had been pregnant and had had a miscarriage is higher (86% versus 63%) and it is also higher than the prevalence of SPS in the general population (86% versus 15%). On the other hand, in a subset of 73 female patients with SPS who had experienced a pregnancy, 23 (32%) had lost their pregnancies: 14 patients had had an abortion, 5 had had two abortions, and 4 had had three or more abortions. These data are significantly different from those observed in the general Mexican pregnant population, in which 12%-13% of pregnancies end in a spontaneous abortion [30] (chi-square: 7.47, p=0.006), and they indicate that the relative risk of having a miscarriage is 2.66 times higher in Mexican female patients with SPS than in the general population (p=0.001) (Figure 1). Other causes of fetal loss were not found in the files of the patients. Table 1 shows the outgoing data of the thrombophilic studies done in the 23 patients with SPS who had experienced at least one miscarriage. It is interesting that 9/23 displayed the MTHFR gene mutation and that 7 additionally had antiphospholipid antibodies, the prevalence of the MTHFR gene being lower in this subset of patients than that previously reported by us in both thrombophilic individuals and the general population.

Discussion Pregnant women may experience a variety of adverse obstetric events, such as preeclampsia, placental abruption, fetal growth

Results A total of 268 consecutive Mexican mestizo patients were prospectively enrolled in this study following their referral to our clinic by physicians from various parts of the country based upon the criteria described above. In addition to having a clinical marker of primary thrombophilia as previously explained, all of them had suffered at least one event of venous thrombosis as confirmed by either phlebography or Doppler, and they were not receiving antiplatelet drugs in the previous 12 h; accordingly, all of these individuals were patients with primary and/or secondary thrombophilic conditions [6,17]. From this group, a subset of 108 thrombophilic female patients was selected for further analysis; of these, 77 (71%) had been pregnant at some time, and within that subset, 28 (37%) had experienced at least

Figure 1. Twenty-three of 73 (32%) female patients with sticky platelet syndrome experienced an abortion at some time. Fourteen patients had one abortion, 5 had two, and 4 had three or more. SPS: Sticky platelet syndrome.

241

Ruiz-Delgado GJ, et al: Miscarriages in Sticky Platelet Syndrome

Turk J Hematol 2017;34:239-243

retardation, and pregnancy loss, and these may be related to alterations in placental perfusion. The low pressure and turbulent flow pattern of circulation at the placenta, along with changes in hypercoagulability during this period, may also predispose women to thrombosis [31]. While the association between venous or arterial thromboembolism and inherited thrombophilias is widely recognized, no definitive relationship between adverse pregnancy outcomes and inherited thrombophilias has been successfully proven to date. It is possible that some hypercoagulable states may predispose individuals to arterial thrombosis, which can then result in uteroplacental thrombosis and obstetric complications. In a retrospective review of 351 women evaluated for recurrent pregnancy loss, Bick and Hoppensteadt [18] identified SPS in 64 of them (18%). Other authors have also shown increased prevalence of obstetric complications in patients with SPS [18,19,31]. For example, our group demonstrated that, in the general Mexican population, the prevalence of SPS and the 677 mutation in the MTHFR gene is 15% and 79%, respectively [16,17].

In Mexico, 12%-13% of pregnancies in the general population end in a spontaneous abortion [31]; this figure is significantly lower than that which we have found in the group of patients with SPS (32%; chi-square: 7.47, p=0.006). In turn, the relative risk of having a miscarriage is 2.66 times higher in female patients with SPS than in the general population (p=0.001).

Conclusion Our study was not intended to address the prevalence of SPS in pregnant women. The figures presented here suggest that this inherited condition may be related to obstetric complications, and SPS accordingly may be developing as an etiology for adverse pregnancy outcomes. However, there is a shortage of literature on this syndrome in the pregnant population. Since the treatment of SPS is simple, cheap, and highly effective, employing aspirin and/or other antiplatelet drugs [13,16], the investigation of SPS in women treated for obstetric complications may be useful and deserves further research. The appropriate use of aspirin and/or other antiplatelet drugs

Table 1. Salient features of the thrombophilia studies of the 23 female patients with sticky platelet syndrome who experienced an abortion. Patient

Age at diagnosis of SPS

Number of abortions

SPS type

MTHFR

FII

aPCR

A-TIII

aPLA

FV: Factor V gene Leiden mutation, MTHFR: methylenetetrahydrofolate reductase gene mutation, FII: prothrombin gene mutation, aPCR: activated protein C resistance phenotype, PS: protein S deficiency, AT-III: antithrombin III deficiency, aPLA: antiphospholipid antibodies.

242

Turk J Hematol 2017;34:239-243

during the pregnancy of patients with SPS could result in the prevention of adverse pregnancy outcomes. Ethics Ethics Committee Approval: The research was authorized by the Ethics and Human Research Subject Protection Committees of Clinica RUIZ.

Ruiz-Delgado GJ, et al: Miscarriages in Sticky Platelet Syndrome

13. Velázquez-Sánchez-de-Cima S, Zamora-Ortiz G, Hernández-Reyes J, Vargas-Espinosa J, García-Chávez J, Rosales-Padrón J, Ruiz-Delgado GJ, Ruiz-Argüelles A, Ruiz-Argüelles GJ. Primary thrombophilia in México X: a prospective study of the treatment of the sticky platelet syndrome. Clin Appl Thromb Hemost 2015;21:91-95. 14. Césarman-Maus G, Villa R, Kubisz P, González-Ramírez M, Ruiz-Delgado GJ, Ruiz-Argüelles GJ. El síndrome de plaquetas pegajosas. Rev Hematol Mex 2013;14:149-153. 15. Ruiz-Argüelles GJ. Comment on sticky platelet syndrome. Semin Thromb Hemost 2014;40:273.

Informed Consent: Informed consent was obtained from all the patients included.

16. Kubisz P, Ruiz-Argüelles GJ, Stasko J, Holly P, Ruiz-Delgado GJ. Sticky platelet syndrome: history and future perspectives. Semin Thromb Hemost 2014;40:526-534.

Authorship Contributions

17. Ruiz-Argüelles GJ, López-Martínez B, Valdés-Tapia P, Gómez-Rangel JD, Reyes-Núñez V, Garcés-Eisele J. Primary thrombophilia in Mexico V: a comprehensive prospective study indicates that most cases are multifactorial. Am J Hematol 2005;78:21-26.

Surgical and Medical Practices: G.J.R.D., G.J.R.; Concept: G.J.R.D., G.J.R.A.; Design: G.J.R.D.; Data Collection or Processing: M.A.M.H., Y.C.; Analysis or Interpretation: Y.C.F., M.L.G., A.A.L.P., A.K.N.C.; Literature Search: Y.C.F., M.A.M.H., A.K.N.C., J.C.O.G.; Writing: Y.C.F., A.K.N.C., J.C.O.G. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Holliday PL, Mammen E, Gilroy J. Sticky platelet syndrome and cerebral infarction in young adults. In: Ninth International Joint Conference on Stroke and Cerebral Circulation; Phoenix, AZ, USA, 1983. 2. Mammen EF, Barnhart MI, Selik NR, Gilroy J, Klepach GL. Sticky platelet syndrome: a congenital platelet abnormality predisposing to thrombosis? Folia Haematol Int Mag Klin Morphol Blutforsch 1988;115:361-365. 3. Bick RL. Sticky platelet syndrome: a common cause of unexplained arterial and venous thrombosis. Clin Appl Thromb Hemost 1998;4:77-81. 4. Mammen EF. Ten years’ experience with the “sticky platelet syndrome”. Clin Appl Thromb Hemost 1995;1:66-72. 5. Mammen EF. Sticky platelet syndrome. Sem Thromb Hemostasis 1999;25:361-365. 6. Ruiz-Argüelles GJ, López-Martínez B, Cruz-Cruz D, Esparza-Silva L, ReyesAulis MB. Primary thrombophilia in Mexico III. A prospective study of the sticky platelet syndrome. Clin Appl Thromb Hemost 2002;8:273-277. 7. Ruiz-Argüelles GJ, Ruiz-Delgado GJ, López-Martínez B. The sticky platelet syndrome: a frequent but unrecognized cause of thrombophilia. Rev Invest Clin 2002;54:394-396.

18. Bick RL, Hoppensteadt D. Recurrent miscarriage syndrome due to blood coagulation protein/platelet defects: a review and update. Clin Appl Thromb Hemost 2005;11:1-13. 19. Bick RL, Laughlin HR, Cohen BM, Staub AJ, Madden J, Toofanian A. Fetal wastage syndrome due to blood protein/platelet defects: results of prevalence studies and treatment outcome with low-dose heparin and lowdose aspirin. Clin Appl Thromb Hemost 1995;1:286-292. 20. Bick RL. Recurrent miscarriage syndrome due to blood coagulation protein/platelet defects: prevalence, treatment and outcome results. DRW Metroplex Recurrent Miscarriage Syndrome Cooperative Group. Clin Appl Thromb Hemost 2000;6:115-125. 21. Pons-Estel BA, Catoggio LJ, Cardiel MH, Soriano ER, Gentiletti S, Villa AR, Abadi I, Caeiro F, Alvarellos A, Alarcón-Segovia D; Grupo Latinoamericano de Estudio de Lupus. The GLADEL multinational Latin American prospective inception cohort of 1,214 patients with systemic lupus erythematosus. Ethnic and disease heterogeneity among “Hispanics”. Medicine 2004;83:1-17. 22. Born GVR, Cross MJ. The aggregation of blood platelets. J Physiol 1963;168:178-183. 23. Zöller B, Dahlbäck B. Linkage between inherited resistance to activated protein C and factor V gene mutation in venous thrombosis. Lancet 1994;343:1536-1538. 24. Lunghi B, Castoldi E, Mingozzi F, Bernardi F. A new factor V gene polymorphism (His 1254 Arg) present in subjects of African origin mimics the R2 polymorphism (His 1299 Arg). Blood 1998;91:364-365. 25. van Wijk R, Nieuwnhuis K, van der Berg M, Huizinga EG, van der Meijden BB, Kraaijenhagen RJ, van Solinge WW. Five novel mutations in the gene for the human blood coagulation factor V associated with type I factor V deficiency. Blood 2001;98:358-367. 26. Chan WP, Lee CK, Kwong YL, Lam CK, Liang R. A novel mutation of Arg306 of factor V gene in Hong Kong Chinese. Blood 1998;91:1135-1139.

8. Ruiz-Argüelles GJ, López-Martínez B, Valdés-Tapia P, Gómez-Rangel JD, Reyes-Núñez V, Garcés-Eisele J. Primary thrombophilia in Mexico. V. A comprehensive prospective study indicates that most cases are multifactorial. Am J Hematol 2005;78:21-26.

27. Mumford AD, McVey JH, Morse CV, Gómez K, Steen M, Norstrom EA, Tuddenham EG, Dahlback B, Bolton-Maggs PH. Factor V I359T: a novel mutation associated with thrombosis and resistance to activated protein C. Br J Haematol 2003;123:496-501.

9. Ruiz-Argüelles GJ, González-Carrillo ML, Estrada-Gómez R, Valdés-Tapia P, Parra-Ortega I, Porras-Juárez A. Primary thrombophilia in México. VI: Lack of statistical association among the inherited thrombophilic conditions. Gac Med Mex 2007;143:317-322.

28. Kluijtmans LA, van den Heuvel LP, Boers GH, Frosst P, Stevens EM, van Oost BA, den Heijer M, Trijbels FJ, Rozen R, Blom HJ. Molecular genetic analysis in mild hyperhomocysteinemia: a common mutation in the methylenetetrahydrofolate reductase gene is a genetic risk factor for cardiovascular disease. Am J Hum Genet 1996;58:35-41.

10. Ruiz-Argüelles GJ, Urdaneta CA, García JC, Delgado-Ruiz GJ. Primary thrombophilia in México VIII: description of five kindreds of familial sticky platelet syndrome phenotype. Rev Hematol Mex 2011;12:73-78. 11. Ruiz-Argüelles GJ, Garcés-Eisele J, Camacho-Alarcón C, Reyes-Nuñez V, Moncada-González B, Valdés-Tapia P, León-Montes N, Ruiz-Delgado GJ. Primary thrombophilia in Mexico IX: the glycoprotein IIIa PLA1/ A2 polymorphism is not associated with the sticky platelet syndrome phenotype. Clin Appl Thromb Hemost 2013;19:689-692. 12. Moncada B, Ruíz-Argüelles GJ, Castillo-Martínez C. The sticky platelet syndrome. Hematology 2013;18:230-232.

29. Poort SR, Rosendaal FR, Reitsma PH, Bertina RM. A common genetic variation in the 3´-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood 1996;88:3698-3703. 30. Fernández-Cantón, Gutiérrez-Trujillo, Viguri-Uribe R. La mortalidad materna y el aborto en México. Bol Med Hosp Infant Mex 2012;69:77-80. 31. Sokol J, Biringer K, Skerenova M, Stasko J, Kubisz P, Danko J. Different models of inheritance in selected genes in patients with sticky platelet syndrome and fetal loss. Semin Thromb Hemost 2015;41:330-335.

243

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0365 Turk J Hematol 2017;34:244-249

A Randomized Comparison of Hemoglobin Content-Based Versus Standard (Unit-Based) Red Blood Cell Transfusion Policy Hemoglobin İçeriğine Dayalı Transfüzyon ile Standart Eritrosit Süspansiyonu Transfüzyon Etkinliğinin Karşılaştırılması Erden Atilla, Selami Koçak Toprak, Sinem Civriz Bozdağ, Pervin Topçuoğlu, Önder Arslan Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey

Abstract

Öz

Objective: The hemoglobin (Hb) content of packed red blood cells (pRBCs) differs in standard volume units. The pRBC transfusions are based on the number of units routinely. We aimed to use pRBCs according to total Hb content and compare the rates of achieving the target Hb concentration levels with the current transfusion practice.

Amaç: Eritrosit süspansiyonu (ES) ünitelerinin hacimleri standart kriterlerle belirlenmişse de hemoglobin (Hb) içerikleri farklıdır. Halen klinikteki standart transfüzyon uygulamaları, ES’lerin ünite sayısına dayanmaktadır. Bu çalışma ile Hb içeriğine dayalı transfüzyon ile standart ES transfüzyonunun etkinliğinin karşılaştırılması amaçlanmıştır. Gereç ve Yöntemler: Çalışmaya dahil edilen 89 hastanın (55 erkek; 34 kadın) ortanca yaşı 46’dır (aralık, 19-75). Çalışmada 92’si Hb içeriğine dayalı transfüzyon (çalışma grubu), 86’sı standart transfüzyon (kontrol grubu) olarak randomize edilen toplam 178 transfüzyon epizodu; 51 hasta için 1, 38 hasta için ≥2 epizotta değerlendirilmiştir (ortanca 3; aralık, 1-7). Uygun olan ES’ler, kan bankamızda kullanılan Hemosoft İşletim Sistemi kullanılarak belirlenmiştir. Çalışma kolunda, gerekli ünite sayısını ES-Hb konsantrasyonuna göre belirlemek amacıyla: alıcının boy, güncel kilo, güncel ve hedef Hb verileri ile alıcı için gerekli Hb miktarı hesaplanmıştır. Stokta doğru Hb konsantrasyonunda ES bulunamayanlarda aynen kontrol kolunda olduğu gibi, klinisyenin istediği sayıda ES ünitesi gönderilmiştir. Bulgular: Çalışma kolunda toplam 192 ünite ES transfüzyonu istemine karşılık Hb konsantrasyonuna göre uygun 38 ünite ES transfüzyonu gerçekleşmiş ve ES ünite miktarında %19,8 (38/192) oranında azalma gösterilmiştir. Uygun Hb içeriğinde ES ünitesi bulma ihtimalinin; düşük kilolu, kısa boylu hastalarda daha yüksek ve kan bankası ES stok sayısı ile doğru orantılı olduğu bulunmuştur. Transfüzyon yapılan ES ünitelerindeki Hb konsantrasyonları, çalışma grubunda kontrol grubuna göre daha yüksek olarak tespit edilmiştir. Hedeflenen Hb değerine ulaşma oranları; kontrol ve çalışma (p=0,125), uygun ünite bulunan ve bulunamayan (p=0,325), kontrol ve uygun ünite bulunamayan (p=0,438) gruplarda istatistiksel olarak benzer bulunmuştur. ES ünitelerinin raf ömürleri ile hedef Hb düzeylerine ulaşma arasındaki ilişki gruplar arasında benzer olarak saptanmıştır (p=0,782). Sonuç: Çalışmamız sonucunda açıkça görülmüştür ki Hb içeriğine dayalı transfüzyon ile standart ES transfüzyonlarının etkinlikleri benzerdir. Hb içeriğine dayalı transfüzyonlar ile kullanılan ES ünite sayısı azaltılabilir. Anahtar Sözcükler: Kan içeriği, Kan ürünlerini işleme, Verici, Transfüzyon Stratejisi

Materials and Methods: Eighty-nine patients (55 males and 34 females) with median age of 46 years (range: 19-75) were enrolled, and of 178 transfusion episodes, 92 were randomized to the Hb content based-study group and 86 to the unit-based control group. Fifty-one patients were evaluated by 1 and rest of the patients by ≥2 episodes (median: 3; range: 1-7). Suitable pRBCs were detected by the Hemosoft Blood Banking Management & Information System. In the Hb content-based study group, to reduce the number of units, the required Hb was calculated by recipients’ height, weight, and Hb levels. When no appropriate units could be found within the inventory, the actual ordered number of units was sent to clinics, as was done for the control group. Results: In the study group totally, 38 units of pRBCs were transfused with a reduction of 19.8% (38/192) from the original order. The success of finding the matched Hb content was statistically increased with low weight and height and high pRBC storage. The Hb content of transfused pRBC units was significantly higher in the study group than the control group. The ratio of achieving the target Hb level was statistically similar in the control and study group (p=0.125), the successful and unsuccessful group (p=0.325), and the control and unsuccessful group (p=0.438). The relation between the shelf-life of the pRBC units and the rate of achieving the target Hb level was found to be similar between groups (p=0.782). Conclusion: The number of pRBC transfusions can be minimized since we clearly demonstrated that the efficacy of Hb content-based transfusion is similar to that of unit-based transfusion. Keywords: Blood components, Blood processing, Donors, Transfusion strategy

Address for Correspondence/Yazışma Adresi: Erden ATİLLA, M.D., Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey Phone : +90 312 595 73 49 E-mail : erdenatilla@gmail.com

244

Received/Geliş tarihi: October 25, 2015 Accepted/Kabul tarihi: February 04, 2016

Turk J Hematol 2017;34:244-249

Introduction Currently, packed red blood cell (pRBC) concentrates are the major blood components transfused in routine medical practice. Despite numerous reliable scientific and physiological data, indications for pRBC transfusion are controversial. The decision to transfuse RBCs is based on the patient’s pulmonary, cardiovascular, and cerebrovascular statuses and expected duration of anemia [1]. Each unit of whole blood (WB) or pRBCs contains enough hemoglobin (Hb) to raise the Hb concentration of an average-sized adult by approximately 1 g/ dL. Unfortunately, the total Hb content of the units does not represent homogeneity due to different Hb concentration levels of donors, Hb losses during component preparation processes (buffy coat isolation, leukofiltration), and storage. Although it has generally been accepted for many years that pRBC transfusions should be based on the Hb content of the product, instead of units, for practical reasons this has been implemented in few studies [2,3]. By using a computer program, Hemosoft, in a randomized study, we aimed to use pRBCs according to their total Hb content in order to decrease the number of units and to compare the rates of achieving the target Hb concentration levels with the current transfusion practice.

Materials and Methods The present study was carried out as a prospective, randomized, open-label clinical study at the Hematology Clinic and Stem Cell Transplantation Unit and the Blood Banks of Ankara University between October 2010 and February 2011. The study protocol was approved by the Ankara University Faculty of Medicine Ethics Committee and written and signed informed consent was provided by all participants. The Hemosoft Blood Banking Management & Information System (version 2.0) used as part of this study is a newly developed in-house software system. It fulfills all American Association of Blood Banks and British Committee for Standardization in Haematology guidelines for blood-bank computing and information technologies [4]. A total of 89 consecutive patients were included in the study. A total of 364 pRBCs were ordered in 178 transfusion episodes. The median age and male-to-female ratio were 46 years (minimum: 19, maximum: 75) and 55:34, respectively. Patients’ diagnoses were acute leukemia in 44 cases (27 acute myeloblastic leukemia, 13 acute lymphoblastic leukemia, 3 acute myeloblastic leukemia secondary to myelodysplastic syndrome, and 1 acute lymphoblastic transformation of chronic myeloid leukemia), lymphoproliferative disease in 17 (8 non-Hodgkin’s lymphoma, 2 Hodgkin’s lymphoma, 6 chronic lymphocytic leukemia, and 1 hairy cell leukemia), plasma cell disorders in 11 (10 multiple

Atilla E, et al: Hemoglobin Content-Based Transfusion

myeloma and 1 Waldenström’s macroglobulinemia), bone marrow failure in 15 (12 myelodysplastic syndrome, 2 aplastic anemia, and 1 paroxysmal nocturnal hemoglobinuria), sickle cell anemia in 1, and solid tumor in 1. The transfusion policy was based on symptoms of anemia rather than low Hb levels. Patients with acute blood loss who required emergent blood component transfusions, those with autoimmune hemolytic anemia, and those younger than 18 years old were excluded from the study. Initial assessment of donor Hb concentration was obtained by finger-stick puncture as part of the routine procedure at the donor sessions. A calibrated HemoCue hemoglobinometer (Hemo Control, EKF Diagnostics, Poland) was used for Hb determination. Hb lower cut-offs for women and men were respectively 12.5 and 13.5 g/dL. The upper cut-off limit for the Hb level was 18 g/dL. The WB collections were drawn into 450-mL triple bags with a standardized volume of 63 mL of citrate-phosphate-dextrose solution (Kansuk, Turkey). A salineadenine-glucose-mannitol solution (100 mL; Kansuk, Turkey) was added to the RBC bag after the extraction of 200-250 mL of residual plasma by centrifugation from WB. The volumes of WB collected during phlebotomy and the pretransfusion Hb values of the donors were all recorded with Hemosoft as part of routine procedure. All units were leukoreduced by leukocyte filters (Pall, UK) in the laboratory before transfusion. Total Hb content of each pRBC unit in the inventory was calculated as “donor Hb level x 450 mL” automatically in Hemosoft. Clinicians were asked to provide the height, actual body weight (ABW), and actual and target Hb level of each patient during pRBC orders. In the Hb content-based study group, based on the formula using total blood volume (TBV), Hemosoft directly calculated the Hb quantity required to achieve the target Hb and scanned the Hb contents of RBC units in the inventory: total Hb required to achieve targeted Hb (g) = (targeted Hb actual Hb) g/dL x TBV. Using this approach, the goal was to find the best pRBCs from the inventory to decrease the number of units. When no appropriate units could be found within the inventory, the actual ordered number of units was sent to the clinics, as was done for the control group. Posttransfusion Hb level was checked 2 h after transfusion in both groups by using peripheral venous blood samples (Coulter STKS, USA). Statistical Analysis Numerical variables were given as medians and distributions, which were compared with the nonparametric Mann-Whitney U test and the Kruskal-Wallis method. Nominal variables were compared by cross-table method using the chi-square test. P<0.05 was assumed to be statistically significant. SPSS 15.0 for Windows (SPSS Inc., Chicago, IL, USA) was used. 245

Atilla E, et al: Hemoglobin Content-Based Transfusion

Turk J Hematol 2017;34:244-249

Results A total of 178 transfusion episodes occurred in 89 patients, which were randomized into a control group (unit-based, n=86) and a study group (Hb content-based, n=92). The recipients within both groups had similar age, sex, body mass index, height, Hb level before transfusion, and targeted Hb level (Table 1). Fifty-one patients were evaluated for only 1 transfusion episode whereas 38 patients had 2 or more episodes (median of 3, ranging from 1 to 7). The patientsâ&#x20AC;&#x2122; ABWs and heights were also similar between the cohorts with 1 and â&#x2030;Ľ2 episodes (p=0.413 and p=0.956). The clinicians requested a total of 364 units of pRBCs within 178 transfusion episodes (n=170, 2 units per episode; n=8, 3 units per episode). Eighty-four of the 92 episodes in the study group were a 2-unit order and 8 were a 3-unit order. The rate of finding Hb content-matched pRBCs was 41.3% (38/92) and the rate of saving pRBC units was 19.8% (38/192) in the study group. In the case of no Hb content-matched units found in the study group, two pRBC units were given as ordered in the 54 episodes, respectively. All patients received two pRBC units in 86 transfusion episodes as requested by the clinician in the control group. The probability of finding Hb content-matched pRBC units was significantly higher in females and patients with lower body weight and shorter heights in the study group (p<0.0001) (Table 2). The rates of achieving targeted Hb levels were not different between the study and the control groups, nor between patients who successfully received Hb contentmatched pRBCs and those not in the study group (Figure 1).

The median Hb level of the donors was 15.6 g/dL (minimum: 12.6, maximum 17.9 g/dL) and median Hb content of the products was 70.2 g (minimum: 56.7, maximum: 80.6 g). The Hb content of transfused pRBC units was significantly higher in the study group than the control group (p<0.0001) (Table 3). There was a positive correlation between the rate of achieving targeted Hb level and Hb content of each pRBC unit in both the study and control groups (p=0.001). This correlation was significantly marked in patients who successfully received Hb content-matched pRBCs in the study group (p=0.042). The shelf-lives of pRBCs were similar in both the study and control groups (p=0.281) (Table 3). When we compared the shelf-life of %

Figure 1. Comparison of rates of achieving targeted hemoglobin level.

Table 1. Characteristics of the patients in study and control groups. Parameters

Study group (n=92)

Control group (n=86)

Median age, years (minimum-maximum)

47 (19-73)

43.5 (19-75)

0.447

Sex (M/F)

53/39

56/30

0.335

Median body weight, kg (minimum-maximum)

70.5 (35-101)

66 (30-90)

0.413

Median height, cm (minimum-maximum)

171 (143-190)

170 (143-190)

0.956

Median pretransfusion Hb, g/dL (minimum-maximum)

7.2 (5.1-10.2)

7.2 (4.8-7.9)

0.657

Median targeted Hb, g/dL (minimum-maximum)

9.3 (7.4-12.2)

9.2 (6.8-9.9)

0.984

M: Male, F: female, Hb: hemoglobin.

Table 2. Comparison of successful versus unsuccessful matches in the study group. Parameters

Successfully matched

Unsuccessfully matched

(41.3%, n=38)

(58.7%, n=54)

Median age, years (minimum-maximum)

47 (21-71)

47 (19-73)

0.96

Sex (M/F)

13/25

40/14

<0.0001

Median body weight, kg (minimum-maximum)

54 (35-93)

72.5 (50-101)

<0.0001

Median height, cm (minimum-maximum)

162 (143-186)

175 (155-190)

<0.0001

Median pretransfusion Hb, g/dL (minimum-maximum)

7.3 (6.4-10.2)

7.3 (5.4-7.9)

0.4

Median targeted Hb, g/dL (minimum-maximum)

9.3 (8.4-12.2)

9.3 (7.4-9.9)

0.9

M: Male, F: female, Hb: hemoglobin.

246

Atilla E, et al: Hemoglobin Content-Based Transfusion

Turk J Hematol 2017;34:244-249

pRBCs in the successfully Hb content-matched group and those not in the study group, we found no statistical difference (median of 6.5 days vs. 4 days, p=0.963). There was no correlation between the shelf-life of the pRBCs and the rate of achieving the targeted Hb level after the transfusion in the patients who successfully received Hb content-matched pRBCs (p=0.782). The inventory distribution of pRBC units according to blood

groups is given in Table 4. We found that the pRBC inventory size was larger in patients who successfully received Hb contentmatched pRBCs than those who were not in the study group (77 units vs. 41 units, p=0.029) (Table 4). It was estimated that there should be a median of 93 units of pRBCs (33-180 units) in the blood bank inventory in order to transfuse Hb content-matched pRBCs with a success rate of 50%.

Table 3. Comparison of shelf-life and hemoglobin contents of units within study and control groups. Parameters

Study group (n=92)

Control group (n=86)

Successfully matched (n=38)

Unsuccessfully matched (n=54)

Median donor Hb, g/dL (minimum-maximum)*

17.2 (13.8-33.5)

31.1 (28.4-33.8)

30.6 (26.6-35.9)

<0.0001

Median total Hb of the units, g (minimum-maximum)

77.6 (62.1-159.6)

139.1 (59.4-153.9)

137.0 (70.7-161.6)

<0.0001

Median shelf-life, days (minimum-maximum)

6.5 (1-13)

4 (1-29)

5 (1-29)

0.281

0.963

*: Total donor hemoglobin concentrations are stated for transfusion episodes in which totally 2 units of packed red blood cells were given. Hb: Hemoglobin.

Table 4. The inventory distribution of packed red blood cell units according to blood groups. Transfusion episodes

Blood group

Number of units requested

Median number of units in inventory

Study group: Successfully matched

Total A+ B+ AB+ O+ ABO-

84 29 5 2 25 4 0 19

77 (27-149)

Study group: Unsuccessfully matched

Total A+ B+ AB+ O+ ABO-

108 50 18 6 12 14 4 4

41 (8-124)

Control group

Total A+ B+ AB+ O+ ABO-

172 58 20 12 48 20 0 14

55 (9-137)

247

Atilla E, et al: Hemoglobin Content-Based Transfusion

Discussion The Hb content of pRBC units not being standardized can lead to the clinician’s irrelevance in terms of the number of units ordered. The factors responsible for this variation are the donor’s Hb concentration, loss of Hb during the preparation process, and shelf-life before transfusion [3,5]. To have a final standardized unit, different approaches have been used, such as apheresis devices for multicomponent collection. Depending on the donor’s Hb level and TBV, it is possible to collect either one or two units without exceeding 13% of any donor’s TBV, provided that the collected volume of blood in each unit is less than the current standard, which would allow reasonable use of the donor population. Two-unit blood collections may reduce donor exposure in transfusion. Applying a standard at 45 g of Hb per unit was found to permit the collection of maximum Hb and plasma in an evaluated population of Scandinavian donors [6]. An apheresis device was modified to facilitate the combined collection of a unit (250 mL) of RBCs and a high-volume unit (475 mL) of plasma [7]. The apheresis procedure was acceptable and well tolerated by donors, but the Hb content of the units differed with respect to Hb concentration of the donors. In our study, the Hb amount of the donor (minimum: 12.6, maximum: 17.9 g/dL) and the Hb content of pRBCs (minimum: 56.7, maximum: 80.6 g) also varied by 50%. The Hb content of transfused pRBCs was demonstrated to be significantly different in the study and control groups (p<0.0001) (Table 3). Holme et al. [8] stated that pRBC units collected by apheresis demonstrated low variability in volume of RBC mass collected and showed similar RBC properties as compared to manually collected ones after processing and 42 days of storage. Because the disposable kits for apheresis are currently more expensive than multiplebag systems used for manual blood separation, Gilcher et al. [9] proposed an alternative approach for standardized units with a collection device by which a controlled volume of blood could be mixed in a specified proportion of anticoagulant. According to the donor’s predonation Hb concentration, this device would allow the collection of a volume of blood that contains the targeted RBC Hb mass. Finally, better-standardized RBC content, not depending on generation technique, helps to improve the accurate dosage used necessary for the recipient. In the present study, the efficiency of transfusion was evaluated by the rates of achieving targeted Hb levels. The rates of achieving targeted Hb were not statistically different in the control and study groups (p=0.125) (Figure 1). Rates of achieving targeted Hb were similar in patients who successfully received Hb content-matched pRBCs and who did not (47.4% vs. 59.3%, p=0.325) (Figure 1). Rates of achieving targeted Hb levels were similar in the control group and the patients who did not receive Hb content-matched pRBCs in the study group (p=0.438) (Figure 1). Thus, we showed that transfusion policy based on number of units used in routine applications has similar efficiency to that of transfusion based on the product’s Hb content. 248

Turk J Hematol 2017;34:244-249

In the pilot study of Arslan et al. [2] in 2004 including 51 patients, it was demonstrated that transfusion policy based on Hb content reached target Hb levels with fewer numbers of transfusion units. Different from our current study, all patients were included with only one transfusion episode, with their rate of finding pRBC suspensions containing appropriate Hb content being 62.7% (32/51), and the rate of savings in transfused units was calculated as 30% (72 U/104 U) [2]. In our study, these rates were 41.3% (38/92) and 19.8% (38 U/192 U), respectively (Table 2). As a result, similar to the previous study of our team, it was shown that transfusion policy based on Hb content can lead to the saving of pRBC units. In the study group, the subgroup that successfully received Hb content-matched pRBCs had a female predominance, lower ABW, and shorter stature (Table 2). These findings lead to our conclusion that for recipients with smaller body surface area, the chance of finding products with appropriate Hb content is higher. Our results also confirm the findings of Reikvam et al. [10]. The aim of their study was to evaluate whether the Hb increment in the patient can be predicted from the Hb dose transfused and their success rate was closely linked to the patient’s weight. In addition, both studies determined that the Hb content of transfused products was closely related to the reaching of target Hb levels. In the present study, we determined that the major limitation of transfusion based on Hb content was finding pRBCs with appropriate Hb content. Because of this obstacle, limited numbers of transfusion episodes could be evaluated in both our studies and other publications. It is a fact that the increase in the rate of products with appropriate Hb content would increase the success of applications. Thus, we determined that the total number of pRBCs in the inventory, the height of the recipient, and the recipient’s current body weight are important parameters. It is known that inventory size is an important factor for finding the products with appropriate Hb content [3]. In the study of Arslan et al. [2], the relation between the inventory size at the time of request and the finding of the appropriate unit was not significant. However, in the present study, we found that pRBC inventory size was larger for the subgroup of patients who successfully received Hb contentmatched pRBCs than those who did not in the study group (77 units vs. 41 units, p=0.025) (Table 4). Thus, we calculated that in order to achieve 50% success, the median pRBC units available in the inventory should be 93 (minimum: 33, maximum: 180). Shelf-life is known as an important factor for the viability of the product. During ex vivo storage, red cells undergo changes affecting function and viability [11]. In the Red-Cell Storage Duration Study trial, researchers showed in 1098 patients that RBCs stored for 10 days or less were not superior to those with 21 days of duration in terms of Multiple Organ Dysfunction

Atilla E, et al: Hemoglobin Content-Based Transfusion

Turk J Hematol 2017;34:244-249

Score [12]. In the present study, shelf-life of the study and control groups was compared with similar results (p=0.281) (Table 3). In addition, shelf-life had no effect on targeted Hb after transfusion (p=0.782).

Conclusion We clearly demonstrated in the present study that the number of pRBC transfusions could be minimized by the rational use of the Hb content of the units. The subgroup that successfully received Hb content-matched pRBCs had female predominance, lower ABW, and shorter stature. Upon evaluation of the efficacy of transfusions based on Hb content of pRBC units, the success of this method related to reaching target Hb levels after transfusion was similar to the standard method based on clinicians’ orders. We indicated that the blood center’s inventory size was important for finding pRBC suspensions with sufficient Hb contents. Although the total number of patients who will benefit from this approach seems to be limited, it allows us to use units with high Hb contents rationally by using a computer system.

Ö.A.; Analysis or Interpretation: E.A., S.K.T., S.C.B., P.T., Ö.A.; Literature Search: E.A., S.K.T., S.C.B., P.T., Ö.A.; Writing: E.A., S.K.T., S.C.B., P.T., Ö.A. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Klein HG, Spahn DR, Carson JL. Red blood cell transfusion in clinical practice. Lancet 2007;370:415-426. 2. Arslan O, Toprak S, Arat M, Kayalak Y. Hb content-based transfusion policy successfully reduces the number of RBC units transfused. Transfusion 2004;44:485-488. 3. Gorlin JB, Cable R. What is a unit? Transfusion 2000;40:263-265. 4. Arslan O. Hemosoft, a new software for blood bank and apheresis management. Transfus Apher Sci 2004;30:193-196. 5. Högman CF, Meryman HT. Red blood cells intended for transfusion: quality criteria revisited. Transfusion 2006;46:137-142. 6. Högman CF, Knutson F. Standardized units of RBCs: is it time for implementation? Transfusion 2000;40:330-334.

Acknowledgment

7. Knutson F, Rider J, Franck V, Joie M, Högman CF, Pamphilon D. A new apheresis procedure for the preparation of high-quality red cells and plasma. Transfusion 1999;39:565-571.

Special thanks to the Serpil Akdağ Ankara University Medical School Blood Bank employees.

8. Holme S, Elfath MD, Whitley P. Evaluation of in vivo and in vitro quality of apheresis-collected RBC stored for 42 days. Vox Sang 1998;75:212-217.

Ethics

9. Gilcher RO, Smith JW, Chammas J. Automated whole blood collection. Transfusion 1997;37(Suppl):12S.

Ethics Committee Approval: The study protocol was approved by the Ankara University Faculty of Medicine Ethics Committee.

10. Reikvam H, Prowse C, Roddie H, Heddle NM, Hervig T; BEST collaborative. A pilot study of the possibility and the feasibility of haemoglobin dosing with red blood cells transfusion. Vox Sang 2010;99:71-76.

Informed Consent: Signed informed consent was provided by all participants. Authorship Contributions Surgical and Medical Practices: E.A., S.K.T., S.C.B., P.T., Ö.A.; Concept: E.A., S.K.T., S.C.B., P.T., Ö.A.; Design: E.A., S.K.T., S.C.B., P.T., Ö.A.; Data Collection or Processing: E.A., S.K.T., S.C.B., P.T.,

11. Van de Watering L. Red cell storage and prognosis. Vox Sang 2011;100:3645. 12. Steiner ME, Ness PM, Assmann SF, Triulzi DJ, Sloan SR, Delaney M, Granger S, Bennett-Guerrero E, Blajchman MA, Scavo V, Carson JL, Levy JH, Whitman G, D’Andrea P, Pulkrabek S, Ortel TL, Bornikova L, Raife T, Puca KE, Kaufman RM, Nuttall GA, Young PP, Youssef S, Engelman R, Greilich PE, Miles R, Josephson CD, Bracey A, Cooke R, McCullough J, Hunsaker R, Uhl L, McFarland JG, Park Y, Cushing MM, Klodell CT, Karanam R, Roberts PR, Dyke C, Hod EA, Stowell CP. Effects of red-cell storage duration on patients undergoing cardiac surgery. N Eng J Med 2015;372:1419-1429.

249

BRIEF REPORT DOI: 10.4274/tjh.2016.0448 Turk J Hematol 2017;34:250-253

Phenotype Report on Patients with Congenital Factor V Deficiency in Southern Iran: Recent Ten Years’ Experience Güney İran’daki Konjenital Faktör V Eksikliği Olan Hastaların Fenotip Özelliklerinin Bildirimi: Son On Yıllık Deneyim Mohammad Mostafa Safarpour, Sezaneh Haghpanah, Aidin Meshksar, Mehran Karimi Shiraz University of Medical Sciences, Hematology Research Center, Shiraz, Iran

Abstract

Öz

This study aimed to investigate clinical symptoms in patients with congenital factor V (FV) deficiency and the relationship between phenotype and factor activity level. Thirteen patients with congenital FV deficiency were investigated and the factor activity level and first clinical presentations were studied for each patient. The most common first signs and symptoms were post-surgery, post-partum, post-circumcision, and post-traumatic bleeding (30.76%), followed by easy bruising in 23.10% of the patients. The median age at the onset of clinical signs was 18 (range: 1-53) years. Patients were categorized into two groups of major and minor bleeding based on their first clinical bleeding symptoms. There was not a significant difference between the two groups with regard to factor activity level, age at diagnosis, prothrombin time, partial thromboplastin time, and international normalized ratio (p>0.05). There is a discrepancy between plasma FV activity level and the severity of clinical presentations.

Bu çalışma konjenital faktör V (FV) eksikliği olan hastalarda görülen klinik semptomları ve fenotipik özellikler ile faktör aktivite düzeyleri arasındaki ilişkiyi araştırmayı amaçlamıştır. Konjenital FV eksikliği olan on üç hasta incelenmiş ve faktör aktivite düzeyi ile ilk klinik başvuru özellikleri her bir hasta için irdelenmiştir. En sık görülen ilk belirti ve bulgular cerrahi, doğum, sünnet ve travma sonrası gelişen kanama (%30,76) ve bunları takiben hastaların %23,1’inde görülen kolay morarmaydı. Klinik bulguların ortaya çıktığı ortanca yaş 18 idi (aralık: 1-53 yaş). Hastalar ilk klinik belirtilerine göre majör ve minör kanama grubu olarak ikiye ayrıldı. Her iki grup arasında faktör aktivite düzeyi, tanı yaşı, protrombin zamanı, parsiyel tromboplastin zamanı ve uluslararası normalleştirilmiş oran açısından anlamlı bir farklılık yoktu (p>0,05). Plazma FV aktivite düzeyleri ve klinik başvuru şiddeti arasında bir tutarsızlık olduğu görüldü.

Keywords: Congenital, Factor V deficiency, Phenotype, Rare bleeding disorders

Anahtar Sözcükler: Konjenital, Faktör V eksikliği, Fenotip, Nadir kanama bozuklukları

Introduction Factor V (FV) is a 330-kDa glycoprotein that is synthesized in the liver and then released into the blood circulation. Eighty percent of the factor is found in the plasma and the remainder in platelets. Activated FV plays a role as the cofactor of activated factor X (FX) in prothrombin activation and improves the formation of thrombin [1]. The gene that encodes FV consists of 25 exons and 24 introns on 1q23 [2]. In addition to the liver, megakaryocytes can produce FV, but the origin of platelets’ FV is the plasma pool. Plasma FV enters the megakaryocytes in the bone marrow and is stored in the α-granules, and then several changes occur that make FV

different from the plasma form structurally and functionally. Platelet FV activation is enhanced by activated FXa or thrombin after exposure on the platelet surface and it resists activated protein C-catalyzed inactivation [3]. Plasma levels of tissue factor inhibitor are significantly decreased in FV-deficient plasma, which causes improved thrombin generation, especially at very low FV levels (<2%) [2]. Congenital FV deficiency is one of the rare bleeding disorders with the prevalence of 1 in 1,000,000 people and an autosomal recessive inheritance pattern [1]. Consanguinity is seen among the families of the patients affected by FV deficiency [2]. FV deficiency may lead to mild or severe bleeding and presents

Address for Correspondence/Yazışma Adresi: Mehran KARİMİ, M.D., Shiraz University of Medical Sciences, Hematology Research Center, Shiraz, Iran Phone : +987 136 473 239 E-mail : karimim@sums.ac.ir

250

Received/Geliş tarihi: November 21, 2016 Accepted/Kabul tarihi: March 06, 2017

Turk J Hematol 2017;34:250-253

with bruising, epistaxis, etc. as well as hemarthrosis and intracranial hemorrhage (ICH) in severe forms [4]. Heterozygous FV deficiency is difficult to diagnose because it does not cause any increase in bleeding risk or significant prolongation of coagulation tests [5]. Acquired FV deficiency is a rare condition that occurs postoperation, post-partum, and following specific autoimmune disorders and malignancies [2]. Severe bleeding manifestations are usually limited to the patients with factor level of less than 1%, but it seems that there is no clear-cut relationship between the plasma factor activity level and the phenotype. Some FV-deficient patients are completely asymptomatic for several years in spite of their undetectable plasma FV levels [6]. Fresh frozen plasma (FFP) is used as a remedy of congenital FV deficiency. Although FV concentrate was recently developed by Kedrion Company, Italy (www.kedrion.com/productdevelopment), it is still not Food and Drug Administrationapproved. It seems that both Octaplas (solvent/detergenttreated pooled plasma) and Octaplas TP (Octaplas and FP24 (plasma frozen within 24 h), melted and stored for 5 days) can improve the EXTEM clotting time results equally and are alternative treatments to FFP in FV-deficient patients [7]. Our aim in this study is to evaluate phenotype findings in patients with congenital FV deficiency and any probable relationship between the factor level in plasma and the severity of symptoms of patients in southern Iran.

Materials and Methods Patients A cross-sectional study was conducted at the Shiraz Hemophilia Center, Shiraz, southern Iran, from February to May 2015. Peripheral citrated blood (10-15 mL) of 13 affected individuals was collected after the diagnosis of FV deficiency in accordance with the Helsinki Declaration. Seven patients were the offspring of consanguineous marriages (patient numbers 2, 4, 5, 7, 8, 10, and 11). Cases 7 and 8 were relatives (brother and sister). The father and sister of case 10 were also affected. Informed consent was received from all individuals. The Ethics Committee of Shiraz University of Medical Sciences approved the study. A questionnaire was designed to collect all demographic data of patients including age, sex, factor activity level, type of bleeding, and treatment. Coagulant Activity FV activity was measured at the clinical laboratory of the Hemostasis and Thrombosis Genetic Center using one-stage assays (HemosIL kits, Instrumentation Laboratory Company,

Safarpour MM, et al: Phenotype Report on Congenital Factor V Deficiency

Milan, Italy) and IL 9000 (Instrumentation Laboratory Company). FVIII activity was also measured in all patients to rule out combined FV and FVIII deficiency. Based on the bleeding types, patients were divided into two groups: major bleeding (defined as hemarthrosis, gastrointestinal bleeding, posttraumatic and post-surgery bleeding, any other bleeding events causing decreased hemoglobin level at least 2 g/dL or more from baseline, and ICH) and minor bleeding (defined as epistaxis, gingival bleeding, hematoma, post-trauma or post-surgery bleeding causing decreased hemoglobin level of less than 2 g/ dL from baseline, and easy bruising). Viral hepatitis status (HCV, HIV, and HBV) and inhibitor levels of all patients were checked every 6 months and biochemistry tests including liver function tests were performed annually. Statistical Analysis Data were analyzed with SPSS 21 (IBM Corp., Armonk, NY, USA). Descriptive data were presented as median and interquartile range (IQR). Quantitative data were compared between the two groups of patients by Mann-Whitney test. P<0.05 was considered statistically significant.

Results Phenotype Analysis Clinical and laboratory findings of patients with congenital FV deficiency are presented in Table 1. The median age of the patients was 18 years (IQR=30 years), ranging from 1 to 53 years old, with a male-to-female ratio of 9:4. The median factor activity level was 4% (IQR=4%) and none of the patients had inhibitor abnormalities. All the patients had been on ondemand therapy with FFP (10-15 mL/kg) except one patient developing ICH who had been on prophylaxis with 15 mL/kg FFP twice a week with no major bleeding after administration. All the patients had negative viral markers and normal FVIII activity levels and liver function tests. The most common first signs and symptoms were post-surgery, post-partum, post-circumcision, and post-traumatic bleeding (30.76%), followed by easy bruising in 23.10% of the patients. Two patients (15.38%) presented with ICH, one of whom died. Two other patients (15.38%) were cases of post-dental extraction and gingival bleeding. One (7.69%) patient was detected during pre-operation laboratory data evaluation and another one (7.69%) had epistaxis. Patients were categorized into two groups of major (n=7) and minor (n=6) bleeding based on the first clinical bleeding symptoms. Table 2 summarizes the comparison of age and laboratory data between the two groups of patients with major and minor bleeding. There was no statistically significant difference between the two groups with regard to factor 251

Safarpour MM, et al: Phenotype Report on Congenital Factor V Deficiency

Turk J Hematol 2017;34:250-253

Table 1. Clinical and laboratory findings of patients with congenital factor V deficiency. Number

Sex

Age (years)

Onset clinical sign

FV:C%

PT (s)

INR

PTT (s)

Post-traumatic bleeding

2.61

Post-surgery bleeding

1.98

Pre-op lab. data evaluation

2.8

29.5

2.82

Epistaxis

20.7

49.6

Gingival bleeding

2.5

Easy bruising

0.5

1.98

Easy bruising

2.7

Easy bruising

1.5

Post-circumcision bleeding

15.8

1.48

36.2

Post-dental extraction

14.9

15.6

1.46

61.7

Post-partum bleeding

ICH

0.5

2.17

ICH

20.8

1.73

44.8

M: Male, F: female, FV: factor V, PT: prothrombin time, INR: international normalized ratio, PTT: partial thromboplastin time, ICH: intracranial hemorrhage.

Table 2. Comparison of age and laboratory data between the two groups of patients based on first clinical bleeding symptom. Major bleeding n=7

Minor bleeding n=6

Median

IQR

Median

IQR

p-value

Age

0.565

FV:C%

4.0

6.0

3.4

2.9

0.828

6.2

20.8

4.4

0.519

INR

1.98

0.69

2.24

0.88

0.283

PTT

21.7

16.1

0.352

FV: Factor V, PT: prothrombin time, INR: international normalized ratio, PTT: partial thromboplastin time, IQR: interquartile range.

activity level, age at diagnosis, prothrombin time (PT), partial thromboplastin time (PTT), or international normalized ratio (p>0.05).

Discussion Despite the fact that congenital FV deficiency is a rare bleeding disorder, a decent amount of information is now available about the phenotype and clinical presentations of the disease due to several studies on this issue. Our study showed wide heterogeneity in patients with congenital FV deficiency. Due to this heterogeneity, complete screening of FV deficiency phenotypes and determination of a probable relationship among phenotype, age at first clinical presentation, and plasma FV level is needed. The relationship between phenotype and plasma FV levels has not been clearly identified yet. Our study showed no significant association between the plasma factor activity level and the phenotype of our patients. The variability in phenotype is possibly due to differences in the genetic background, such as pleomorphism of mutations in the same gene [8]. The cause of this discrepancy is largely unknown; however, different 252

investigations and studies suggest that platelets may play a significant role. Tissue factor inhibitor plasma levels are also decreased in FV-deficient patients, which causes considerably enhanced thrombin generation at very low FV levels of less than 2% [2]. On the other hand, combined FV and FVIII deficiency should be considered in the event of prolongation of both PT and PTT [9], which was ruled out here by normal FVIII levels in all affected patients. Clinical presentation of FV deficiency has a range of mild to severe bleeding that is unrelated to factor level. Diagnosis is based on the measurement of plasma factor level and prolonged PT and activated PTT [2]. Residual intraplatelets FV contribution can also be assessed by whole-blood rotation thromboelastometry [10,11]. In accordance with the previous reports, our study showed that post-traumatic bleeding, easy bruising, and epistaxis are common symptoms among the patients who suffer from congenital FV deficiency. According to the occurrence of severe symptoms such as ICH in these patients (patient numbers 12

Turk J Hematol 2017;34:250-253

and 13), it seems that a prophylaxis regimen is mandatory in patients with severe symptoms or severe deficiency of factor activity level. No relationship between factor activity level and phenotype of the disease was found. The best option for treatment of these patients is factor concentrate, which was not available at our center; as such, FFP was the only optional management. However, we did not see any viral hepatitis, confirming the safety of FFP in our region.

Conclusion Our study identified that there is no relationship between the plasma factor level and phenotypes of the patients. Therefore, the factor activity level cannot be used to predict the clinical presentation severity. This means that efforts should be focused on the early diagnosis of the disorder to perform prophylactic approaches in severe cases and administer the best methods of treatment to prevent major complications. However, our sample size was small and further studies with larger sample sizes are suggested to confirm these findings. Authorship Contributions Surgical and Medical Practices: M.M.S. S.H., A.M., M.K.; Concept: M.M.S., S.H., A.M., M.K.; Design: M.M.S., S.H., A.M., M.K.; Data Collection or Processing: M.M.S., S.H., A.M., M.K.,; Analysis or Interpretation: M.M.S., S.H., A.M., M.K.; Literature Search: M.M.S., S.H., A.M., M.K.; Writing: M.M.S., S.H., A.M., M.K. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships,

Safarpour MM, et al: Phenotype Report on Congenital Factor V Deficiency

and/or affiliations relevant to the subject matter or materials included.

References 1. Huang J, Koerper MA. Factor V deficiency: a concise review. Haemophilia 2008;14:1164-1169. 2. Duckers C, Simioni P, Rosing J, Castoldi E. Advances in understanding the bleeding diathesis in factor V deficiency. Br J Haematol 2009;146:17-26. 3. Duckers C, Simioni P, Spiezia L, Radu C, Dabrilli P, Gavasso S, Rosing J, Castoldi E. Residual platelet factor V ensures thrombin generation in patients with severe congenital factor V deficiency and mild bleeding symptoms. Blood 2010;115:879-886. 4. Owren P. Parahaemophilia: haemorrhagic diathesis due to absence of a previously unknown clotting factor. Lancet 1947;249:446-448. 5. Thalji N, Camire RM. Parahemophilia: new insights into factor V deficiency. Semin Thromb Hemost 2013;39:607-612. 6. Duckers C, Simioni P, Spiezia L, Radu C, Gavasso S, Rosing J, Castoldi E. Low plasma levels of tissue factor pathway inhibitor in patients with congenital factor V deficiency. Blood 2008;112:3615-3623. 7. Cushing MM, Asmis L, Calabia C, Rand JH, Haas T. Efficacy of solvent/ detergent plasma after storage at 2-8 °C for 5 days in comparison to other plasma products to improve factor V levels in factor V deficient plasma. Transfus Apher Sci 2016;55:114-119. 8. Beutler E. Discrepancies between genotype and phenotype in hematology: an important frontier. Blood 2001;98:2597-2602. 9. Karimi M, Cairo A, Safarpour MM, Haghpanah S, Ekramzadeh M, Afrasiabi A, Shahriari M, Menegatti M. Genotype and phenotype report on patients with combined deficiency of factor V and factor VIII in Iran. Blood Coagul Fibrinolysis 2014;25:360-363. 10. Castoldi E, Rosing J. Thrombin generation tests. Thromb Res 2011;127(Suppl 3):21-25. 11. Spiezia L, Radu C, Campello E, Bulato C, Bertini D, Barillari G, De Angelis V, Pradella P, Zanon E, Simioni P. Whole blood rotation thromboelastometry (ROTEM®) in nine severe factor V deficient patients and evaluation of the role of intraplatelets factor V. Haemophilia 2012;18:463-468.

253

BRIEF REPORT DOI: 10.4274/tjh.2016.0434 Turk J Hematol 2017;34:254-257

Diagnostic Accuracy of Interleukin-6, Interleukin-8, and Interleukin-10 for Predicting Bacteremia in Children with Febrile Neutropenia Febril Nötropenili Çocuklarda Bakteriyemiyi Öngörmede İnterlökin-6, İnterlökin-8, İnterlökin-10’un Tanısal Doğruluğu Zümrüt Şahbudak Bal1, Nihal Karadaş Özdemir2, Semra Şen1, Deniz Yılmaz Karapınar2, Elif Azarsız3, Şöhret Aydemir4, Fadıl Vardar1 Ege University Faculty of Medicine, Department of Pediatrics, Division of Infectious Disease, İzmir, Turkey Ege University Faculty of Medicine, Department of Pediatrics, Division of Hematology, İzmir, Turkey 3 Ege University Faculty of Medicine, Department of Pediatrics, Division of Immunology, İzmir, Turkey 4 Ege University Faculty of Medicine, Department of Clinical Microbiology and Infectious Disease, İzmir, Turkey 1 2

Abstract

Öz

Despite improvements in diagnosis and treatment, infections are still a major cause of morbidity and mortality in children with febrile neutropenia. In the majority of febrile episodes, the source of infection cannot be defined. In this study, we aimed to identify the earlier predictors of bacteremia/fungemia and a useful cytokine to identify the source of infection and to discriminate the patients with culture-confirmed bacterial/fungal infection. The most sensitive cytokine was interleukin (IL)-10 and the most specific was IL-8 in predicting culture-confirmed cases. IL-8 had greater sensitivity and specificity in determination of gram-negative bacterial infections with a higher negative predictive value; therefore, IL-8 can be used particularly to rule out gram-negative bacterial infections. IL-6, IL8, and IL-10 circulating levels were shown to be higher in cases of infection. Further studies are needed to recommend a routine practice for predicting culture-confirmed bacterial infections.

Tanı ve tedavideki gelişmelere rağmen, febril nötropenili çocuklarda enfeksiyonlar morbidite ve mortalitenin önemli bir nedenidir. Febril nötropeni epizodlarının çoğunluğunda enfeksiyon odağı belirlenememektedir. Bu çalışmada, enfeksiyon odağını ve kültürle kanıtlanmış bakteriyel ve fungal enfeksiyonlarını belirlemede daha erken belirteçler bulunması amaçlanmıştır. Kültür ile kanıtlanmış enfeksiyonları belirlemede en hassas sitokin interlökin (IL)-10 ve en özgül sitokin IL-8’dir. Gram-negatif bakteriyel enfeksiyonları belirlemede en hassas ve özgül sitokin IL-8’dir ve IL-8’in negatif prediktif değerinin yüksek olması nedeniyle, özellikle gram-negatif bakteriyel enfeksiyonları dışlamada kullanılabilir. IL-6, IL-8, IL-10’un kan düzeyleri enfeksiyon durumunda daha yüksek saptanmıştır. Sitokinlerin kültür ile kanıtlanmış enfeksiyonları belirlemede rutin kullanımını önermek için gelecekte yapılacak çalışmalara ihtiyaç vardır.

Keywords: Febrile neutropenia, IL-6, IL-8, IL-10, Bacteremia

Anahtar Sözcükler: Febril nötropeni, IL-6, IL-8, IL-10, Bakteriyemi

Introduction In the last few decades, more advanced treatment methods such as myelosuppressive therapy, immunotherapy, and transplantation of hematopoietic stem cells have significantly increased the survival rate of oncologic patients. The development of sepsis and septic shock may be rapid and fatal; therefore, invasive infections require timely and adequate treatment [1]. This study was conducted prospectively to evaluate the potential of

interleukin (IL)-6, IL-8, and IL-10 for predicting bacteremia and to compare the levels of IL-6, IL-8, and IL-10 between patients during infection and patients after treatment.

Materials and Methods Thirty-eight patients (18 females, 20 males) with acute lymphoblastic leukemia (ALL) and acute myeloblastic leukemia (AML) developed 59 febrile neutropenia episodes between June 2014 and March 2015 in this prospective study at the Division

Address for Correspondence/Yazışma Adresi: Zümrüt ŞAHBUDAK BAL, M.D., Ege University Faculty of Medicine, Department of Pediatrics, Division of Infectious Disease, İzmir, Turkey Phone : +90 505 442 31 92 E-mail : z.sahbudak@gmail.com

254

Received/Geliş tarihi: November 04, 2016 Accepted/Kabul tarihi: January 31, 2017

Şahbudak Bal Z, et al: IL-6, IL-8, and IL-10 for Predicting Bacteremia

Turk J Hematol 2017;34:254-257

of Pediatric Hematology of Ege University Hospital. The median age of the patients was 92.1 months, ranging between 13 and 216 months. Febrile neutropenia was defined according to international guidelines [2]. Medical records were collected including age, sex, diagnosis, and most recent chemotherapy. Laboratory findings, including complete blood count, C-reactive protein (CRP), and bacterial and fungal cultures, were also recorded. Serum samples for analyses of IL-6, IL-8, and IL10 levels in the blood were collected at the onset (0-24 h) of febrile neutropenia and when patients were afebrile at 72 h after treatment. Serum samples of at least 1 mL were stored at -20 °C until the completion of the study. Levels of IL-6 (ab46042, determination range 1.56-50 pg/mL), IL-8 (ab100575, determination range 0.8-600 pg/mL), and IL-10 (ab46059, determination range 1.56-50 pg/mL) in serum samples were measured using ELISA kits from Abcam (Cambridge, MA, USA) and results were expressed in standardized concentrations using reagents provided with these kits. Statistical Analysis Statistical analyses were performed using MedCalc for Windows (version 15.2, MedCalc Software, Mariakerke, Belgium) and SPSS for Windows (version 22.0, IBM Corp., Armonk, NY, USA). Numerical data were expressed as median (25th-75th percentile). Mann-Whitney U and Wilcoxon tests were used for intervariable analysis. Comparisons were referred to as statistically significant at p<0.05. A receiver operating characteristics (ROC) curve was used to determine a cut-off level for the markers; sensitivity and specificity were assessed as equally significant. This study had the permission of the Ethics Board of Ege University (ethical decision number: 13-4.1/12) and written consent was received from all enrolled patients or their parents.

Results A total of 59 febrile neutropenia episodes were recorded during the study period. Of the 59 febrile neutropenia episodes,

14 (23.7%) episodes were microbiologically documented by positive blood cultures. The blood cultures revealed grampositive microorganisms in 5 episodes (5 coagulase-negative Staphylococcus cases), gram-negative microorganismsin 8 episodes (3 Klebsiella pneumoniae, 3 Escherichia coli, and 2 Pseudomonas aeruginosa), and Candida parapsilosis in 1 episode. To compare the values of the groups with and without culture-confirmed infection, ROC curves demonstrating the values of sensitivity, specificity, positive predictive value, and negative predictive value (NPV) for IL-6, IL-8, IL-10, and CRP (Table 1) and the area under the curve (AUC) are shown in Figure 1. The AUC values are summarized in Table 2. In the comparison of the levels of the cytokines, IL-6, IL-10, and CRP were statistically higher in patients with infection than the post-treatment values (Table 3).

Discussion In patients with chemotherapy-induced neutropenia, early markers are needed to distinguish the patients at high risk for bacterial or fungal infections that occur independently of the underlying disease. Castagnola et al. [1] evaluated 614 febrile

Figure 1. ROC curves of interleukin (IL)-6, IL-8, IL-10, and C-reactive protein in predicting bacteremia. CRP: C-reactive protein.

Table 1. Sensitivity, specificity, positive predictive value, and negative predictive value for interleukin (IL)-6, IL-8, IL-10, and C-reactive protein. Cut-off value

Gram-negative Bacteremia (n=9)

Sensitivity (%)

Specificity (%)

PPV

NPV

Youden’s index

IL-6 ≥98.8 pg/mL

62.5

70.5

92.3

0.3867

IL-8 ≥61.3 pg/mL

87.5

74.5

97.4

0.6486

IL-10 ≥47.93 pg/mL

62.5

74.4

29.4

92.9

0.4467

CRP ≥4 mg/dL

87.5

21.2

0.3787

All bacteremia (n=14)

IL-6 ≥98.8 pg/mL

71.1

81.1

0.2211

IL-8 ≥61.3 pg/mL

64.1

75.6

87.2

0.3984

IL-10 ≥5.04 pg/mL

92.9

44.4

34.2

95.2

0.3730

CRP ≥4 mg/dL

78.6

33.3

0.2857

PPV: Positive predictive value, NPV: negative predictive value, CRP: C-reactive protein, IL: interleukin.

255

Şahbudak Bal Z, et al: IL-6, IL-8, and IL-10 for Predicting Bacteremia

neutropenia episodes and the rate of fever of unknown origin (FUO) was 79%. Kallio et al. [3] evaluated 66 adult patients and reported that CRP, pro-calcitonin, and IL-8 levels were statistically higher in the infection group with 32% sensitivity and 90% specificity for IL-8. IL-8 demonstrated great sensitivity and specificity, particularly in gram-negative bacterial infections, in this study. Miedema et al. [4] reported 52 febrile neutropenic episodes in 32 children; IL-8 was significantly higher in patients with bacteremia and they also determined that the median level of IL-8 was significantly higher in bacteremia caused by gram-negative bacteria than gram-positive bacteria (678 vs.140 ng/L). Similarly, IL-8 demonstrated great sensitivity and specificity particularly in gram-negative bacterial infections in this study. However, IL-8 showed weaker sensitivity when all gram-negative and gram-positive infections were included and this could be a result of the small number of febrile neutropenia episodes included. Urbonas et al. [5] evaluated 61 febrile neutropenia episodes of 37 pediatric patients and reported similar sensitivity and specificity for IL-6 (81%, 75%) and IL-8 (67%, 84%), respectively, but on the second day the sensitivity levels for IL-6 and IL-8 were lower (65%, 61%) than the first day while the specificity values were greater (78%, 89%) for both IL-6 and IL-8, respectively. In this study, sensitivity was found to be lower for IL-6 and IL-8 but both IL-6 and IL-8 had similar specificity. In contrast, IL-10 had 92.9% sensitivity for detecting Table 2. Interleukin (IL)-6, IL-8, IL-10, and C-reactive protein as predictors for bacteremia and gram-negative bacteremia/fungemia (results from receiver operating curve analysis).

AUC (95% CI)

p-value

IL-6

0.590 (0.454-0.716)

IL-8

0.656 (0.521-0.775)

IL-10

0.725 (0.593-0.833)

0.003

CRP

0.610 (0.473-0.735)

All bacteremia (n=14)

Gram-negative bacteremia/fungemia (n=9) IL-6

0.627 (0.491-0.749)

IL-8

0.772(0.645-0.871)

0.008

IL-10

0.712 (0.580-0.823)

0.04

CRP

0.686 (0.551-0.801)

IL: Interleukin, CRP: C-reactive protein, AUC: Area under the curve, CI: confidence interval, NS: nonsignificant.

Turk J Hematol 2017;34:254-257

patients with microbiologically documented infection and the NPV was 95.2; therefore, IL-10 may be a useful marker for ruling out culture-confirmed infection. Vänskä et al. [6] illustrated the potential role of IL-10 to predict a high risk of complications at the onset of neutropenic fever due to the highest NPV. As they suggested, the AUC demonstrated the best discriminatory power for IL-10 and showed the highest sensitivity for detecting bacterial infections in this study. Fleischhack et al. [7] suggested that CRP, IL-8, and IL-6 may be less useful than procalcitonin in neutropenic cancer patients, but they only compared gram-negative bacteremia and FUO as primary endpoints. In our study, when only gram-negative bacterial infections were considered, IL-8 was the best marker in discrimination and showed the highest sensitivity and specificity. IL-8 may be useful in detecting gram-negative bacterial infections. Miedema et al. [8] evaluated 43 pediatric patients as having bacterial infection or not and found that IL-8 was superior to CRP and procalcitonin. IL-8 was more sensitive in predicting bacterial infection at the onset of febrile neutropenia. In our study, we found that IL-8 was a strong predictive marker for bacteremia, particularly for gram-negative bacteremia, as compared to IL-6 and CRP. On the other hand, IL-10 showed greater sensitivity among culture-confirmed bacterial infections. Diepold et al. [9] found that IL-6 was the best predictor of bacteremia and severe bacterial infection with high sensitivity and specificity (90% and 85%, respectively). In contrast, our data demonstrated better sensitivity and specificity for IL-8 and IL-10 than IL-6. De Bont et al. [10] reported that IL-6, IL-8, and CRP were significantly higher in patients with gram-negative bacteremia than patients with gram-positive bacteremia, and our data also showed that IL-8 and IL-10 were good at detecting gramnegative bacteremia. The strengths of this study are it’s prospective design, the relative homogeneity of the patients, and the chance to compare the levels of cytokines during infection and after treatment in the same patients. On the other hand, the current study had limitations including the small number of febrile neutropenia episodes and the lack of the study of genetic polymorphisms.

Table 3. Comparison of the interleukin (IL)-6, IL-8, IL-10, and C-reactive protein levels during infection and after treatment.

0-24 h median (25P-75P)1

Control median (25P-75P)

p-value

IL-6 pg/mL

73.8 (30.2-121.1)

8.1 (5.6-16.2)

<0.001

IL-8 pg/mL

42.1 (2.1-69.4)

25.2 (13.6-62.3)

IL-10 pg/mL

14.6 (2.1-50)

3.1 (1.4-9.7

<0.001

CRP mg/dL

3.8 (0.97-6.6)

1.1 (0.5-2.7)

0.001

1: Interquartile range (25th percentile-75th percentile), NS: nonsignificant, IL: interleukin, CRP: C-reactive protein.

256

Turk J Hematol 2017;34:254-257

The number of neutropenic fever episodes encountered was relatively low and further studies including larger numbers of patients are needed.

Conclusion The most sensitive cytokine was IL-10 and the most specific was IL-8 in predicting culture-confirmed infections. IL-8 had greater sensitivity and specificity in determination of gramnegative bacterial infections and a higher NPV; therefore, IL-8 may be used particularly to rule out gram-negative bacterial infections. IL-6, IL-8, and IL-10 circulating levels were shown to be higher during infection and further larger studies are needed to confirm these findings. Authorship Contributions Surgical and Medical Practices: Z.Ş.B. N.K.Ö., D.Y.K.; Concept: Z.Ş.B.; Design: Z.Ş.B.; Data Collection or Processing: Z.Ş.B., N.K.Ö., S.Ş.; Analysis or Interpretation: Z.Ş.B., E.A., Ş.A., F.V.; Literature Search: Z.Ş.B.; Writing: Z.Ş.B. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Castagnola E, Fontana V, Caviglia I, Caruso S, Faraci M, Fioredda F, Garrè ML, Moroni C, Conte M, Losurdo G, Scuderi F, Bandettini R, Tomà P, Viscoli C, Haupt R. A prospective study on the epidemiology of febrile episodes during chemotherapy-induced neutropenia in children with cancer or after hemopoietic stem cell transplantation. Clin Infect Dis 2007;45:1296-1304.

Şahbudak Bal Z, et al: IL-6, IL-8, and IL-10 for Predicting Bacteremia

2. Freifeld AG, Bow EJ, Sepkowitz KA, Boeckh MJ, Ito JI, Mullen CA, Raad II, Rolston KV, Young JA, Wingard JR; Infectious Diseases Society of America. Clinical practice guideline for the use of antimicrobial agents in neutropenic patients with cancer: 2010 update by the Infectious Diseases Society of America. Clin Infect Dis 2011;52:e56-93. 3. Kallio R, Surcel HM, Bloigu A, Syrjälä H. C-reactive protein, procalcitonin and interleukin-8 in the primary diagnosis of infections in cancer patients. Eur J Cancer 2000;36:889-894. 4. Miedema KG, Vermont CL, Ball LM, de Bont ES, Kamps WA, van Tol MJ, Jol-van der Zijde CM, Tissing WJ. The diagnostic value of interleukin-8 for the detection of bacteremia in pediatric hematopoietic stem cell recipients with febrile neutropenia. Transplantation 2014;98:e80-81. 5. Urbonas V, Eidukaitė A, Tamulienė I. The diagnostic value of interleukin-6 and interleukin-8 for early prediction of bacteremia and sepsis in children with febrile neutropenia and cancer. J Pediatr Hematol Oncol 2012;34:122127. 6. Vänskä M, Koivula I, Jantunen E, Hämäläinen S, Purhonen AK, Pulkki K, Juutilainen A. IL-10 combined with procalcitonin improves early prediction of complications of febrile neutropenia in hematological patients. Cytokine 2012;60:787-792. 7. Fleischhack G, Kambeck I, Cipic D, Hasan C, Bode U. Procalcitonin in paediatric cancer patients: its diagnostic relevance is superior to that of C-reactive protein, interleukin 6, interleukin 8, soluble interleukin 2 receptor and soluble tumour necrosis factor receptor II. Br J Haematol 2000;111:1093-1102. 8. Miedema KG, de Bont ES, Elferink RF, van Vliet MJ, Nijhuis CS, Kamps WA, Tissing WJ. The diagnostic value of CRP, IL-8, PCT, and sTREM-1 in the detection of bacterial infections in pediatric oncology patients with febrile neutropenia. Support Care Cancer 2011;19:1593-1600. 9. Diepold M, Noellke P, Duffner U, Kontny U, Berner R. Performance of interleukin-6 and interleukin-8 serum levels in pediatric oncology patients with neutropenia and fever for the assessment of low-risk. BMC Infect Dis 2008;8:28. 10. de Bont ES, Vellenga E, Swaanenburg JC, Fidler V, Visser-van Brummen PJ, Kamps WA. Plasma IL-8 and IL-6 levels can be used to define a group with low risk of septicaemia among cancer patients with fever and neutropenia. Br J Haematol 1999;107:375-380.

257

BRIEF REPORT DOI: 10.4274/tjh.2016.0427 Turk J Hematol 2017;34:258-263

Genotype-Phenotype Correlations of β-Thalassemia Mutations in an Azerbaijani Population Azerbaycan Popülasyonunda β-Talasemi Mutasyonlarının Genotip-Fenotip Korelasyonları Chingiz Asadov, Eldar Abdulalimov, Tahira Mammadova, Surmaya Gafarova, Yegana Guliyeva, Gunay Aliyeva Department of Hereditary Pathology of the Erythrocyte System, Institute of Hematology and Transfusiology, Baku, Azerbaijan

Abstract

Öz

β-Thalassemia is the most common inherited disorder in Azerbaijan. The aim of our study was to reveal genotype-to-phenotype correlations of the most common β-thalassemia mutations in an Azerbaijani population. Patients with codon 8 (-AA), IVS-I-6 (T>C), and IVS-II-1 (G>A) mutations, which are reportedly the most common β-globin gene mutations among the local population, were tested for hematologic parameters. Fifty-five previously tested patients with known genotypes were included in the study. Hematologic indices and hemoglobin fractions were tested in order to reveal the phenotypic manifestation of the mutations. The results obtained indicate that clinical presentation varies between different β-globin gene mutations: individuals with IVS-I-6 (T>C) mutations showed milder presentation than those with codon 8 (-AA) and IVS-II-1 (G>A), which is associated with the molecular basis of the mutations. These data can be of assistance to predict clinical presentation and select the best possible therapeutic approach via early genotype identification.

β-Talasemi Azerbaycan’da görülen en sık kalıtsal hastalıktır. Çalışmamızın amacı Azerbaycan popülasyonunda en sık görülen β-talasemi mutasyonlarının genotip-fenotip korelasyonlarının ortaya çıkarılmasıydı. Yerel popülasyonda en sık görülen β-globin gen mutasyonları olan kodon 8 (-AA), IVS-I-6 (T>C) ve IVS-II-1 (G>A) mutasyonlarını taşıyan hastalar hematolojik parametreler açısından değerlendirildi. Daha önceden test edilmiş ve genotipik özellikleri bilinen 55 hasta çalışmaya dahil edildi. Mutasyonların fenotipik manifestasyonlarının gösterilmesi için hematolojik indeksler ve hemoglobin fraksiyonlarına bakıldı. Sonuçlar farklı β-globin gen mutasyonları arasında klinik başvuru açısından farklılıklar olduğunu göstermekteydi: IVS-I-6 (T>C) mutasyonu olan bireylerde hastalık kodon 8 (-AA) ve IVS-II-1 (G>A) mutasyonu olanlara göre daha hafif seyretmekteydi. Erken genotipik tanımlama klinik başvuru özelliklerinin tahmin edilmesine ve hastalara en iyi terapötik yaklaşımların uygulanmasına yardımcı olabilir.

Keywords: Thalassemia, Sickle/β-thalassemia, Codon, Genotype, Phenotype

Anahtar Sözcükler: Talasemi, Orak/b talasemi, Kodon, Genotip, Fenotip

Introduction Hereditary hemoglobinopathies are the most common monogenic diseases. It is estimated that the frequency of carriers is 5.2% among the world population and there are over 330,000 births with hemoglobin disorders annually, of which 17% are thalassemias [1,2]. There are more than 200 mutations associated with β-thalassemias, and the spectrum and frequency of mutations varies significantly even in different regions of a single country [3,4]. Azerbaijan is one of the countries with the highest prevalence of thalassemias [5]. The frequency of carriers of β-thalassemia genes varies

in different regions of the country from 0% to 17%, with a mean of 8.7% [6]. Structural hemoglobinopathies like sickle hemoglobin (HbS), HbD, HbC, and HbE are also detected in Azerbaijan and can be co-inherited with β-thalassemia [7,8]. β-Thalassemia is known for its extremely diverse clinical manifestations. It can be expressed mildly without a need for treatment, or in a severe form observed as profound anemia, hepatosplenomegaly, and significant deteriorations in bones that can be lethal during childhood if not treated appropriately [9,10]. Therefore, determination of factors causing such a diverse clinical presentation has clinical significance, and the major reason for such diversity is the variety of mutations

Address for Correspondence/Yazışma Adresi: Chingiz ASADOV, M.D., Department of Hereditary Pathology of the Erythrocyte System, Institute of Hematology and Transfusiology, Baku, Azerbaijan Phone : +90 532 325 10 65 E-mail : asadovchingiz@gmail.com

258

Received/Geliş tarihi: October 31, 2016 Accepted/Kabul tarihi: January 24, 2017

Asadov C, et al: β-Thalassemia Mutations in Azerbaijan

Turk J Hematol 2017;34:258-263

[11,12,13,14,15,16]. A number of studies revealed genotypeto-phenotype correlations of β-thalassemia mutations in various populations [17,18,19], and we hereby report the first one conducted in an Azerbaijani population. Recent studies reported 22 mutations of β-thalassemia in Azerbaijan, and it was found that the most common mutations among the Azerbaijani population are codon 8 (-AA), IVS-I-6 (T>C), and IVS-II-1 (G>A) [7,20,21]. The aim of our study was to investigate phenotypic manifestations of these three mutations by studying their hematologic parameters and clinical presentation in heterozygous, homozygous, and compound forms. Our data will reveal the genotype-to-phenotype correlation of each mutation, providing a better prediction of the clinical manifestation of the disease by early genotype identification.

Materials and Methods

comparably lower RBC and higher MCV and MCH mean values. Based on this pattern of hematologic data, it can be concluded that IVS-I-6 presents a milder phenotype compared to codon 8 and IVS-II-1 mutations. The considerably lower hemoglobin level of one of the IVS-I-6 heterozygous patients was related to concomitant iron deficiency (No. 18; Hb=7.7 g/dL). No statistically significant difference was obtained between codon 8 and IVS-II-1 mutations (p>0.05). The data of homozygous individuals were also observed to correlate with the type of the mutation (Table 2). Statistically significant between-group differences (p<0.05) were observed for MCV, MCH, and MCHC. Contrary to the heterozygous individuals, lower mean values of these parameters were observed in the group of homozygous IVS-I-6 patients, possibly due to their less frequent transfusions, compared to codon 8 and IVS-II-1 patients.

Fifty-five patients with known genotypes were included in the study. There were 23 heterozygous, 23 homozygous, 2 compound heterozygous, and 7 sickle β-thalassemia patients. Patients were chosen randomly; newly diagnosed transfusion-naïve patients as well as those already receiving therapy were included in the study. However, testing of hematologic parameters was done prior to transfusion. Written informed consent was obtained. Blood samples were collected into ethylenediaminetetraacetic acid-containing tubes. Evaluations of red blood cell (RBC) count, hemoglobin concentration, hematocrit, mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), and mean corpuscular hemoglobin concentration (MCHC) were performed with a Sysmex XT2000i hematology analyzer (Sysmex, Kobe, Japan). All samples were tested for hemoglobin fractions by acetate-cellulose electrophoresis and high-performance liquid chromatography via the VARIANT IITM Hemoglobin Testing System (Bio-Rad Laboratories, Hercules, CA, USA). DNA amplification was performed on a C-1000 thermocycler (Bio-Rad). Detection of mutations by reverse dot-blot hybridization [11] was performed with commercial test kits (β-Globin StripAssay Kit, ViennaLab Cat. No. 4-130, ViennaLab Diagnostics, Vienna, Austria) according to the manufacturer’s instructions. One-way ANOVA followed by Tukey’s honestly significant difference test was used to analyze between-group differences.

Table 3 presents the data of 7 patients with sickle β-thalassemia who have A>T substitution in the 6th codon (sickle cell mutation) together with codon 8 (-AA) mutation. RBC count, hematocrit, and erythrocyte indices (MCV, MCH, MCHC) were decreased and abnormal HbS was observed in all cases. The pattern of HbA2 and fetal hemoglobin was similar to that of the milder IVS-I-6 mutation, differing significantly from the other two (p<0.05). All patients were receiving recombinant erythropoietin and hydroxyurea therapy [22].

Results

Knowledge of the molecular basis of the mutations elucidates the diversity of clinical presentations. β0-Mutations apparently have more severe clinical presentation, causing thalassemia major in the homozygous state, whereas β+-mutations are observed as milder cases of thalassemia intermedia. The same pattern was more clearly observed in heterozygous individuals with IVS-I-6 β+-mutation presenting comparably milder phenotypes (Table 1).

Hematologic data of heterozygous individuals are presented in Table 1. The classical β-thalassemia carrier pattern of increased RBC count and low hemoglobin and erythrocyte indices (MCV, MCH, and MCHC) was observed in almost all patients. Increased HbA2 concentrations and fetal hemoglobin within the normal range (<2%) were observed in most cases. There was a statistically significant difference (p<0.05) in RBC, MCV, and MCH parameters of IVS-I-6 patients compared to the groups with codon 8 and IVS-II-1. The former was associated with

Discussion From the chosen most common mutations of the Azerbaijani population, codon 8 (-AA) and IVS-II-1 are β0-mutations with complete absence of β-globin chain production, whereas IVS-I-6 is a β+-mutation, which is known to show decreased synthesis of β-globin protein. Codon 8 (-AA) is an RNA translation mutation located at the exon. Deletion of 2 adenine nucleotides at the 8th codon (AAG-lysine) causes a frameshift mutation leading to an early termination at codon 21 (TGA). The new modified beta 8 (-AA) peptide does not function as a β-globin protein ending in β0-thalassemia. IVS-II-1 (G>A) and IVS-I-6 (T>C) are both RNA processing mutations located in the introns. The former is located in the splice junctions, causing impaired RNA processing, which ends in β+-thalassemia.

Our findings are mainly in concordance with the previous reports [3,23,24]. Hematologic parameters and clinical presentation 259

Asadov C, et al: β-Thalassemia Mutations in Azerbaijan

Turk J Hematol 2017;34:258-263

Table 1. Hematologic data of heterozygous β-thalassemia patients. RBCs

HCT

MCV

MCH

MCHC

HbA2

HbF

(x10 /L )

(g/dL)

(%)

(fL)

(pg)

(g/dL)

(%)

F M M F F F M M F M F M M M

6.27 8.80 7.70 6.36 4.58 5.20 7.06 7.20 5.63 6.32 4.82 6.38 5.62 6.55

11.2 11.1 13.9 11.5 8.8 9.9 12.2 12.7 10.1 12.9 9.5 10.7 9.3 12.0

37.8 37.7 47.1 39.7 30.0 30.6 41.5 41.8 34.4 44.4 30.1 36.2 31.2 40.0

60.3 63.6 61.2 62.4 65.5 58.8 58.8 58.1 61.1 70.3 62.4 56.7 55.5 61.1

17.9 18.7 18.1 18.1 19.2 17.1 17.3 17.6 17.9 20.4 19.7 16.8 16.5 18.3

29.6 29.7 29.5 29.0 29.3 29.1 29.4 30.4 29.4 29.1 31.6 29.6 28.8 30.0

5.0 5.3 4.8 5.3 3.3 4.4 4.7 4.4 5.2 4.0 3.5 4.3 4.0 4.4

2.9 3.2 0.9 1.9 10.7 0.9 0.5 1.1 0.8 0.9 2.4 1.6 2.7 2.8

31 23 21 20

M M F F

5.09 5.28 5.22 3.37

10.6 13.2 10.6 7.7

36.6 44.2 36.7 27.4

71.9 70.4 70.3 81.3

20.8 21 20.3 22.8

29 29.9 28.9 28.1

3.2 3.4 4.3 4.2

0.72 0.69 1.20 1.80

49 36 17 23 21

M M M F M

6.23 7.37 6.43 5.96 6.44

11.8 12.5 11.8 10.2 11.4

39.6 40.3 37.8 34.1 39.3

63.6 54.7 58.9 59.9 61.0

18.9 17.0 18.4 17.9 17.7

29.8 31.0 31.1 29.9 29.0

5.2 6.2 5.2 5.1 5.0

1.2 1.0 0.9 1.4 1.0

Mutation*

Age

Sex

1 2 3 4 5 6 7 8 9 10 11 12 13 14

Cd 8 Cd 8 Cd 8 Cd 8 Cd 8 Cd 8 Cd 8 Cd 8 Cd 8 Cd 8 Cd 8 Cd 8 Cd 8 Cd 8

3 2 30 20 22 6 20 18 21 34 26 18 13 25

15 16 17 18

IVS-I-6 IVS-I-6 IVS-I-6 IVS-I-6

19 20 21 22 23

IVS-II-1 IVS-II-1 IVS-II-1 IVS-II-1 IVS-II-1

Based on the transfusions, HbF levels were found to be low in CD8 and IVS2-1 because the patients had thalassemia major. RBC: Red blood cells, Hb: hemoglobin, HCT: hematocrit, MCV: mean corpuscular volume, MCH: mean corpuscular hemoglobin, MCHC: mean corpuscular hemoglobin concentration, HbA2: hemoglobin A2, HbF: fetal hemoglobin. *Data include codon 8 (-AA), IVS-I-6 (T>C), and IVS-II-1 (G>A) β-globin gene mutations.

260

Asadov C, et al: β-Thalassemia Mutations in Azerbaijan

Turk J Hematol 2017;34:258-263

Table 2. Hematologic data of homozygous and compound heterozygous β-thalassemia patients. N.

Mutation*

Sex-age

RBCs (x1012/L)

Hb (g/ dL)

HCT (%)

MCV (fL)

MCH (pg)

MCHC (g/dL)

HbA2 (%)

HbF (%)

Clinical diagnosis

Cd 8

M-14

3.57

8.9

29.6

82.9

24.9

30.1

1.4

77.2

Cd 8

F-21

4.50

8.5

27.4

60.9

18.9

31.0

1.7

76.6

Cd 8

M-24

3.68

7.1

25.0

67.9

19.3

28.4

2.5

79.3

Cd 8

M-1

4.90

9.7

30.8

62.9

19.8

31.5

2.0

55.0

Cd 8

M-1

4.37

8.9

29.1

66.6

20.4

30.6

2.0

61.4

Cd 8

M-26

3.92

9.9

33.6

85.7

25.3

29.5

1.8

47.4

Cd 8

F-2

4.41

8.6

28.0

63.5

19.5

30.7

1.5

70.9

Cd 8

M-5

2.65

5.6

19.6

74.0

21.1

28.6

1.7

58.4

Cd 8

F-2

3.39

6.7

22.7

67.0

19.8

29.5

3.2

54.0

Cd 8/ IVS-I-6

F-1

3.7

6.8

23.5

63.5

18.4

28.9

1.6

27.7

Cd 8/ IVS-II-1

M-26

5.02

9.4

33.4

66.5

18.7

28.1

3.8

45.7

IVS-I-6

F-41

5.27

7.9

27.9

52.9

15.0

28.3

7.3

5.4

IVS-I-6

M-46

4.91

7.5

27.3

55.6

15.3

27.5

8.4

6.5

IVS-I-6

M-19

5.58

8.3

28.8

51.6

14.9

28.8

4.4

9.9

IVS-I-6

M-12

4.46

7.8

25.2

56.5

17.5

31.0

6.0

5.2

IVS-I-6

M-50

3.19

6.3

25.2

79.0

19.7

25.0

5.0

12.6

IVS-I-6

F-20

4.05

7.2

25.5

63.0

17.8

28.2

3.8

14.7

IVS-I-6

M-30

3.47

6.3

22.1

63.7

18.2

28.5

3.2

16.3

IVS-I-6

M-52

3.30

5.1

17.9

54.2

15.5

28.5

5.0

24.0

IVS-II-1

M-52

4.29

9.6

30.4

70.9

22.4

31.6

2.0

59.7

IVS-II-1

M-31

2.16

5.8

20.1

93.1

26.9

28.9

1.5

67.0

IVS-II-1

F-42

3.25

6.9

24.2

74.5

21.2

28.5

1.8

79.2

IVS-II-1

M-7

4.06

8.9

27.5

67.7

21.9

32.4

1.8

63.2

IVS-II-1

F-33

1.83

5.0

15.6

85.2

27.3

32.1

2.4

21.6

IVS-II-1

M-25

4.38

9.3

30.6

69.9

21.2

30.4

3.9

62.5

RBCs: Red blood cells, Hb: hemoglobin, HCT: hematocrit, MCV: mean corpuscular volume, MCH: mean corpuscular hemoglobin, MCHC: mean corpuscular hemoglobin concentration, HbA2: hemoglobin A2, HbF: fetal hemoglobin, TM: thalassemia major, TI: thalassemia intermedia. *Data include codon 8 (-AA), IVS-I-6 (T>C), and IVS-II-1 (G>A) β-globin gene mutations.

261

Asadov C, et al: β-Thalassemia Mutations in Azerbaijan

Turk J Hematol 2017;34:258-263

Table 3. Hematologic data of sickle cell β-thalassemia patients with codon 8 (-AA) mutation. RBCs

(x1012/L)

(g/dL)

MCV

MCH

MCHC

HbA2

HbF

HbS

(fL)

(pg)

(g/dL)

(%)

4.20

8.3

26.5

63.1

19.8

31.3

5.7

8.7

76.3

3.69

8.1

25.6

65.8

20.8

31.6

5.3

12.1

71.1

3.86

8.3

28.1

72.8

21.5

29.5

2.9

7.6

84.0

5.67

11.8

37.9

66.8

20.8

31.1

3.9

7.6

76.1

4.29

8.4

27.1

63.2

19.6

31.0

5.2

10.0

73.0

4.31

7.6

26.9

62.4

17.6

28.3

5.8

6.9

74.0

3.78

7.9

25.9

68.5

20.9

30.5

6.1

7.0

75.0

Age

Sex

HCT (%)

correlate with the type of the mutation, considering the fact that the phenotypic manifestation of each mutation is directly related to its molecular basis. Nevertheless, concomitant diseases and non-genetic factors can also influence the clinical presentation of the disease, e.g., concomitant iron deficiency can considerably change hematologic parameters.

Conclusion

3. Hardison RC, Chui DH, Giardine B, Riemer C, Patrinos GP, Anagnou N, Miller W, Wajcman H. HbVar: a relational database of human hemoglobin variants and thalassemia mutations at the globin gen server. Hum Mutat 2002;19:225-233. 4. Weatherall DJ. The inherited diseases of hemoglobin are an emerging global health burden. Blood 2010;115:4331-4336. 5. Kuliev AM, Rasulov IM, Dadasheva T, Schwarz EI, Rosatelli C, Saba L, Meloni A, Gemidjioglu E, Petrou M, Modell B. Thalassaemia in Azerbaijan. J Med Genet 1994;31:209-212. 6. Rustamov RSh, Gaibov NT, Akhmedova Alu, Gulieva NM. Incidence of hereditary hemoglobinopathies in Azerbaijan. Probl Gematol Pereliv Krovi 1981;9:12-16.

Our study revealed genotype-to-phenotype correlations of the most prevalent β-thalassemia mutations of the Azerbaijani population. According to our data, hematologic parameters and consequently the clinical presentation are closely related to the type of the mutation, especially in homozygous patients. Our findings can provide a better prediction of clinical manifestation by early identification of the type of the β-thalassemia mutations.

10. Galanello R, Origa R. Beta-thalassemia. Orphanet J Rare Dis 2010;5:11.

Authorship Contributions

11. Weatherall DJ. Phenotype-genotype relationships in monogenic disease: lessons from the thalassaemias. Nat Rev Genet 2001;2:245-255.

Surgical and Medical Practices: T.M., E.A.; Concept: C.A.; Design: C.A., T.M., E.A.; Data Collection or Processing: E.A., S.G., Y.G.; Analysis or Interpretation: C.A., T.M., E.A., G.A.; Literature Search: C.A., G.A.; Writing: C.A., T.M., G.A.

12. Sankaran VG, Lettre G, Orkin SH, Hirschhorn JN. Modifier genes in Mendelian disorders: the example of hemoglobin disorders. Ann NY Acad Sci 2010;1214:47-56.

14. Bianco I, Cappabianca MP, Foglietta E, Lerone M, Deidda G, Morlupi L, Grisanti P, Ponzini D, Rinaldi S, Graziani B. Silent thalassemias: genotypes and phenotypes. Haematologica 1997;82:269-280.

7. Gadzhiev EG, Rustamov RSh, Asadov ChD, Mamedova TA, Dzhafarov FM, Kulieva ED. Heterozygote carrier state of hemoglobin S in Azerbaijan. Gematol Transfuziol 1991;7:16-18. 8. Shirinova EA, Akhundova AM, Tokarev luN, Khollan S, Selen’i Iu. Hemoglobin E in the Azerbaijan population. Probl Gematol Pereliv Krovi 1981;9:51-53. 9. Weatherall D, Clegg J. The Thalassemia Syndromes, 3rd ed. Oxford, WileyBlackwell, 1981.

13. Rund D, Filon D, Strauss N, Rachmilewitz EA, Oppenheim A. Mean corpuscular volume of heterozygotes for beta-thalassemia correlates with the severity of mutations. Blood 1992;79:238-243.

15. Danjou F, Anni F, Galanello R. Beta-thalassemia: from genotype to phenotype. Haematologica 2011;96:1573-1575. 16. Galanello R, Perseu L, Satta S, Demartis FR, Campus S. Phenotype-genotype correlation in β-thalassemia. Thalas Rep 2011;1:6.

References 1. Modell B, Darlison M. Global epidemiology of haemoglobin disorders and derived service indicators. Bull World Health Organ 2008;86:480-487. 2. Weatherall DJ. Genetic variation and susceptibility to infection: the red cell and malaria. Br J Haematol 2008;141:276-286.

262

17. Sahu PK, Pati SS, Mishra SK. Genotype-phenotype correlation of β-thalassemia spectrum of mutations in an Indian population. Hematol Rep 2012;4:9. 18. Maryami F, Azarkeivan A, Fallah MS, Zeinali S. A large cohort study of genotype and phenotype correlations of beta-thalassemia in Iranian population. Int J Hematol-Oncol Stem Cell Res 2015;9:198-202.

Turk J Hematol 2017;34:258-263

19. Rund D, Oron-Karni V, Filon D, Goldfarb A, Rachmilewitz, Oppenheim A. Genetic analysis of β-thalassemia intermedia in Israel: diversity of mechanisms and unpredictability of phenotype. Am J Hematol 1997;54:16-22. 20. Asadov CD, Abdulalimov ER, Mammadova TA, Qafarova SN, Guliyeva YJ, Tuli A, Çürük MA. Identification of two rare β-globin gene mutations in a patient with β-thalassemia intermedia from Azerbaijan. Hemoglobin 2013;37:291-296. 21. Cürük MA, Yüregir GT, Asadov CD, Dadasova T, Gu LH, Baysal E, Gu YC, Ribeiro ML, Huisman TH. Molecular characterization of β-thalassemia in Azerbaijan. Hum Genet 1992;90:417-419. 22. Asadov CD, Hasanova M, Alimirzoeva Z, Mammadova TA. Clinical application

Asadov C, et al: β-Thalassemia Mutations in Azerbaijan of recombinant erythropoietin and hydroxyurea in S/β-thalassemia. J Eurasia 2011;2:56-60. 23. Efremov DG, Dimovski AJ, Baysal E, Ye Z, Adekile AD, Ribeiro ML, Schiliro G, Altay C, Gürgey A, Efremov GD, Huisman TH. Possible factors influencing the haemoglobin and fetal haemoglobin levels in patients with β-thalassaemia due to a homozygosity for the IVS-I-6 (T→C) mutation. Br J Haematol 1994;86:824-830. 24. Dimovski AJ, Adekile AD, Divoky V, Baysal E, Huisman TH. Polymorphic pattern of the (AT)x(T)y motif at -530 5′ to the β-globin gene in over 40 patients homozygous for various β-thalassemia mutations. Am J Hematol 1994;45:51-57.

263

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.2015.0454 Turk J Hematol 2017;34:264-265

Secondary Hemophagocytic Lymphohistiocytosis in an Infant with Wolman Disease Wolman Hastalığı Olan Bir Bebekte Gelişen İkincil Hemafagositik Lenfohistiyositozis Aynur Küçükçongar Yavaş1, Betül Orhaner2, Pınar Genç3, Nevin Kılıç3, Hakan Erdoğan4, Özlem Özdemir5, Arzu Ekici5 Şevket Yılmaz Training and Research Hospital, Clinic of Pediatric Metabolism, Bursa, Turkey Şevket Yılmaz Training and Research Hospital, Clinic of Pediatric Hematology, Bursa, Turkey 3 Şevket Yılmaz Training and Research Hospital, Clinic of Pediatrics, Bursa, Turkey 4 Şevket Yılmaz Training and Research Hospital, Clinic of Pediatric Nephrology, Bursa, Turkey 5 Şevket Yılmaz Training and Research Hospital, Clinic of Pediatric Neurology, Bursa, Turkey 1 2

Figure 1. Two-month-old female patient with Wolman disease, showing abdominal distension.

Figure 2. Hemophagocytosis in the bone marrow of our patient.

A 2-month-old girl presented with vomiting, fever, failure to thrive, and diarrhea. She was born to consanguineous parents. She was irritable and pale and she had hepatosplenomegaly (Figure 1). Her weight and height were below the 3rd percentile. Initial hemoglobin count was 7.6 g/dL, white blood cell count was 12x109/L, platelet count was 92x109/L, triglyceride level was 361 mg/dL (reference range: 40-150 mg/dL), and ferritin level was

>1650 ng/mL. According to bone marrow aspiration, numerous examples of hemophagocytosis were observed (Figure 2). She was diagnosed with hemophagocytic lymphohistiocytosis (HLH) because of prolonged fever, organomegaly, bicytopenia, high levels of ferritin, and bone marrow findings. Enzymatic analyses were performed for lipid storage disorders. The lysosomal acid lipase (LAL) activity was <0.02 nmol/punch/h (reference range:

Address for Correspondence/Yazışma Adresi: Aynur KÜÇÜKÇONGAR YAVAŞ, M.D., Şevket Yılmaz Training and Research Hospital, Clinic of Pediatric Metabolism, Bursa, Turkey Phone : +90 535 572 57 41 E-mail : aynurcon@yahoo.com

264

Received/Geliş tarihi: December 31, 2015 Accepted/Kabul tarihi: March 16, 2016

Küçükçongar Yavaş A, et al: Hemophagocytosis and Wolman Disease

Turk J Hematol 2017;34:264-265

0.07-2.3 nmol/punch/h). Based on reduced LAL activity, she was diagnosed with Wolman disease. Although treatment and supportive therapy were applied, the patient died 1 month later. Exon 4 heterozygous variation was found at the LIPA gene location c:260G>T (GGC>GTC), p.Gly87Val. Sequence analysis of all coding regions of the LIPA gene presented heterozygote NM_000235(LIPA_vENST00000336233):c.260G>T(p.Gly87Val) variation in both parents. This variation was reported as a disease-causing variant by Pagani et al. [1]. It was discussed in cases of Wolman disease that the pathophysiological role of cholesteryl ester induces inflammasome activation in macrophages, leading to secondary HLH [2]. Keywords: Wolman disease, lymphohistiocytosis, Hemophagocytosis

Hemophagocytic

Anahtar Sözcükler: Wolman lenfohistiyositozis, Hemofagositoz

hastalığı,

Hemafagositik

Informed Consent: It was received from the parents. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Pagani F, Garcia R, Pariyarath R, Stuani C, Gridelli B, Paone G, Baralle FE. Expression of lysosomal acid lipase mutants detected in three patients with cholesteryl ester storage disease. Hum Mol Genet 1996;5:1611-1617. 2. Taurisano R, Maiorana A, De Benedetti F, Dionisi-Vici C, Boldrini R, Deodato F. Wolman disease associated with hemophagocytic lymphohistiocytosis: attempts for an explanation. Eur J Pediatr 2014;173:1391-1394.

265

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.2016.0285 Turk J Hematol 2017;34:266-267

Microscopic Image of Leishman-Donovan Bodies in Bone Marrow Aspirate Smear of Patient Suffering from Unexplained Intermittent Low-Grade Fever and Cough Açıklanamayan Aralıklı Düşük Dereceli Ateş ve Öksürükten Yakınan Hastanın Kemik İliği Aspirasyonu Yaymasındaki Leishman-Donovan Cisimlerinin Mikroskobik Görüntüsü Kuenzang Dorji1, Tashi Tobgay1, Rixin Jamtsho2, Puja Devi Samal1, Pratap Rai1 Jigme Dorji Wangchuck National Referral Hospital, Clinic of Pathology and Laboratory Medicine, Hematology Unit, Thimphu, Bhutan Ministry of Health, Quality Assurance Standardizing Division, Thimphu, Bhutan

1 2

Figure 1. Bone marrow aspirate smear showing intracellular and extracellular (inset) Leishman-Donovan bodies. Leishman-Giemsa stain, 1000x.

A 24-year-old male from Wangdue Phodrang district, Bhutan, presented with a history of unexplained intermittent low-grade fever and cough for 8 months. He also complained of weight loss, abdominal discomfort, and one episode of hemoptysis and convulsion. He was a cow herder by profession. A computed

tomography scan showed hepatosplenomegaly (liver: 22 cm, spleen: 27 cm) with mesenteric lymphadenopathy. Biochemical evaluation showed elevated alkaline phosphatase (1096 IU/L), lactate dehydrogenase (330 IU/L), and C-reactive protein (40.8 mg/dL) and reverse albumin/globulin ratio. Complete

Address for Correspondence/Yazışma Adresi: Kuenzang DORJI, M.D., Jigme Dorji Wangchuck National Referral Hospital, Clinic of Pathology and Laboratory Medicine, Hematology Unit, Thimphu, Bhutan Phone : +975 173 050 77 E-mail : kdorji@rcbajo.gov.bt

266

Received/Geliş tarihi: July 22, 2016 Accepted/Kabul tarihi: September 06, 2016

Turk J Hematol 2017;34:266-267

blood count showed pancytopenia confirmed by peripheral smear. In addition, left shift of neutrophils and giant platelets were observed. Erythrocyte sedimentation rate (26 mm/h) was increased. Prothrombin time (20 s) and activated partial thromboplastin time (51 s) were prolonged. The bone marrow aspirate smear revealed intracellular and extracellular LeishmanDonovan bodies (Figure 1). In view of clinical and laboratory features, a diagnosis of visceral leishmaniasis was made [1,2,3]. However, the results of the standart devation BIOLINE Leishmania Ab rapid test kit (Standard Diagnostics Inc., Korea) directed against the rK39 antigen were negative. As per the protocol of the Government of India, parasitological diagnosis is the gold standard, which was observed in the bone marrow in this case. Serological diagnosis, which can be 95% sensitive and specific, is used for supportive evidence and fieldwork. Keywords: Leishman-Donovan body, Bone marrow aspirate smear, Microscopic image

Dorji K, et al: Microscopic Image of Leishman-Donovan Bodies

Anahtar Sözcükler: Leishman-Donovan cismi, Kemik iliği aspirasyonu yayması, Mikroskobik görüntü Informed Consent: Was obtained from the patient. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Varma N, Naseem S. Hematologic changes in visceral leishmaniasis/kala azar. Indian J Hematol Blood Transfus 2010;26:78-82. 2. Chakrabarti S, Sarkar S, Goswami BK, Sarkar N, Das S. Clinico-hematological profile of visceral leishmaniasis among immunocompetent patients. Southeast Asian J Trop Med Public Health 2013;44:143-149. 3. Sarkari B, Naraki T, Ghatee MA, Abdolahi KS, Davami MH. Visceral leishmaniasis in southwestern Iran: a retrospective clinico-hematological analysis of 380 consecutive hospitalized cases (1999-2014). PLoS ONE 2016;11:e0150406.

267

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.2016.0335 Turk J Hematol 2017;34:268-269

Subcutaneous Myeloma Deposit in the Region of an Arteriovenous Fistula Arteriyovenöz Fistül Bölgesinde Deri Altı Miyelom Birikimi Petar Djuric1, Aleksandar Jankovic1, Zoran Milojevic2, Katarina Markovic2, Slavisa Sekulic3, Milan Pantelic4, Jelena Tosic Dragovic1, Ana Bulatovic1, Nada Dimkovic1,5 Zvezdara University Medical Center, Department of Nephrology, Belgrade, Serbia Zvezdara University Medical Center, Department of Hematology, Belgrade, Serbia 3 Zvezdara University Medical Center, Department of Surgery, Belgrade, Serbia 4 Zvezdara University Medical Center, Department of Radiology, Belgrade, Serbia 5 Belgrade of University Faculty of Medicine, Department of Nephrology, Belgrade, Serbia 1 2

Figure 1. Local finding on the skin of the left forearm: note that the entire circumference of the forearm was affected by tumorlike changes.

A 78-year-old male was hospitalized in October 2013 due to renal failure. Soon thereafter, light-chain deposition disease was confirmed (lambda type DSSS IIIA, ISS III). A high-dose DEXA protocol was introduced and he received 11 protocols during the following 12 months. In October 2014 he commenced maintenance hemodialysis (HD) via a distal arteriovenous fistula (AVF). In March 2015 he noticed swelling of the fistula region. Although the AVF was functional, local findings on the skin deteriorated within 1 month (Figure 1). Multislice computer tomography demonstrated highly vascularized tumor-like changes originating from the AVF (Figure 2). The patient underwent aspiration biopsy of the skin and more than 10% lymphoplasmacytic cells were found by microscopy. The finding

Figure 2. Multislice computer tomography angiography of the arteriovenous fistula. was confirmed by histology (Figure 3). A PET scan was not available. At that time, he was very frail and no specific therapy was recommended by the hematologist. The patient died within 3 weeks. Presentation of extramedullary subcutaneous light-chain deposition surrounding an AVF may be a potential link between light-chain deposition disease and augmented circulation, thus giving a preferential site for tumor growth [1]. Hematogenous spread (metastasis) to the AVF region is plausible considering the intact adjacent bone and repeated trauma of the multiple cannulation of the AVF. Such repeated trauma gives a good environment for tumor seeding. Our conclusion is that patients

Address for Correspondence/Yazışma Adresi: Petar DJURIC, M.D., Zvezdara University Medical Center, Department of Nephrology, Belgrade, Serbia Phone : +381 653 720 046 E-mail : djuricmed@gmail.com

268

Received/Geliş tarihi: August 19, 2016 Accepted/Kabul tarihi: December 21, 2016

Turk J Hematol 2017;34:268-269

Djuric P, et al: Subcutaneous Myeloma Deposit in the Region of an Arteriovenous Fistula

with light-chain deposition disease and end-stage renal disease may be considered for peritoneal dialysis instead of HD. Keywords: Distal arteriovenous fistula, Multislice computer tomography, Hemodialysis Anahtar Sözcükler: Distal arteriyovenöz fistül, Çok kesitli bilgisayarlı tomografi, Hemodiyaliz Informed Consent: Was obtained from the patient. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References Figure 3. Histology of the affected skin: multiple lymphoplasmacytic cells.

1. Boshell D, Sabharwal R, Keen R, Coleman P, Vladica P, Roger SD. Fistula dysfunction secondary to a subcutaneous myelomatous deposit. Nephrol Dial Transplant 2005;20:2827-2829.

269

LETTERS TO THE EDITOR Turk J Hematol 2017;34:270-281

An Unusual Giant Leg Ulcer as a Rare Presentation of Sweet’s Syndrome in a Patient with Hairy Cell Leukemia Successfully Managed by Splenectomy Tüylü Hücreli Lösemisi Olan Bir Hastada Splenektomi ile Başarılı Bir Şekilde Yönetilen Sweet’s Sendromunun Nadir Bir Bulgusu Alışılmışın Dışında Dev Bacak Ülseri Hakan Özdoğu, Mahmut Yeral, Can Boğa Başkent University Faculty of Medicine, Department of Hematology, Ankara, Turkey

To the Editor, A 56-year-old male patient who was known to be diagnosed with hairy cell leukemia (HCL) and went into remission with cladribine 7 years ago was admitted to our clinic due to anemia and a leg ulcer. One month before his admission, the patient developed weakness and exertional dyspnea. On his admission, relapsed leukemia with a giant ulcer with irregular borders on the anterior side of the left thigh, present for the past 20 days, was diagnosed (Figure 1A). At the time of admission, hemoglobin was 7.6 g/ dL and platelet count was 39x109/L. The leukocyte count was 1.4x109/L with a dominance of lymphocytes (76%). Microscopic examination of the marrow and immunophenotyping of lymphocytes revealed HCL with characteristic morphology and positivity of hairy cell markers like CD25, CD103, and CD11c. Infiltration rate with hairy cells was 80%. Meanwhile, no environmental causes of an ulcer like an accident, drug use, or chemical exposure were identified. The bacterial culture taken from the ulcerous surface was negative. Microscopic examination of the skin biopsy showed hyperkeratosis, parakeratosis, acanthosis, edema, spongiosis, necrotic keratinocytes, eosinophil and neutrophil exocytosis in the epidermis, and a dense inflammatory infiltration extending into the subdermal layer. The inflammatory infiltrate was composed of eosinophil polymorphs and neutrophil polymorphs. Skin biopsy findings were consistent with Sweet’s syndrome (Figure 1B). While cladribine and pentostatin are known as first treatment options for relapsed/refractory HCL, there is not a consensus about the use of rituximab in those cases [1]. Therefore, our patient underwent splenectomy. The ulcer healed rapidly and hematological parameters improved within weeks after the splenectomy (Figure 1C). The post-splenectomy complete blood count revealed hemoglobin of 11 g/dL, leukocyte count of 270

8.6x109/L with 60% lymphocytes, and platelet count of 153x109/L. Three months after the splenectomy, when the leg ulcer had healed completely, the patient could receive cladribine (0.1 mg/ kg/day continuous infusion for 7 days) successfully to treat the disease. Flow cytometric analysis yielded negative minimal residual disease in the bone marrow after cladribine. He remains leukemia-free at 24 months of follow-up.

Figure 1. A) A giant ulcer greater than 20 cm in size with an irregular margin and tender and hyperemic skin changes arising adjacent to the ulcer. B) Photomicrograph reveals the histopathologic details of the skin biopsy. The inflammatory infiltration was dense and extended to the subdermis (A). There was edema, spongiosis, and neutrophil and eosinophil infiltration of the epidermis (B). Dermal infiltration was composed of eosinophil polymorphs and neutrophil polymorphs (C). Microabscess formation was observed (D) [A: Hematoxylin and eosin (H&E), 40x, B: H&E, 200x, C: H&E, 200x, D: H&E, 200x]. C) Significant improvement of leg ulcer 2 months after splenectomy.

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:270-281

The giant leg ulcer in the presented case was uncommon and seemed dramatic. In the involved skin, the absence of leukemic infiltration, evidence of an infection, or vasculitis pointed towards Sweet’s syndrome with typical histological findings.

Keywords: Hairy cell leukemia, Splenectomy, Sweet’s syndrome

Several studies have indicated a link between HCL and Sweet’s syndrome [2,3]. Although the immunological mechanism is not completely defined for Sweet’s syndrome, a chemoattractive substance released from leukemic cells may play a role in developing neutrophilic tissue infiltration. These substances can be attributed to IL-8, leukocyte function antigen, or gamma interferon [2,3,4]. For this reason, for complete healing, this lesion required resolution of the underlying leukemia. Naturally, the patient was at high risk of infection and tissue damage because of the ulcer, so he could not receive cladribine for the treatment of HCL. Splenectomy was applied to control the leukemic burden. This procedure provided leukemia control without using any chemotherapeutic drugs. The leukemia went into hematological remission and the ulcer size gradually decreased within a few months.

Splenectomy is a historical treatment approach in HCL [5]. This treatment nonetheless may still be utilized in patients with relapsed or refractory disease. The rational for splenectomy is the minimizing of tumor burden. In addition, it has been reported that splenectomy may lead to a decrease in the level of some chemokines or cytokines [6,7]. The mechanisms mentioned above might be responsible for controlling Sweet’s syndrome following splenectomy. In conclusion, this case reminds us that uncommon manifestations may develop in HCL. If so, to control those abnormalities, it may be necessary to return to historic treatment strategies in situations limiting chemotherapy.

Anahtar Sözcükler: Saçlı hücreli lösemi, Splenektomi, Sweet’s sendromu

References 1. Robak T, Matutes E, Catovsky D, Zinzani PL, Buske C; ESMO Guidelines Committee. Hairy cell leukaemia: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol 2015;26(Suppl 5):100-107. 2. Paydas S. Sweet’s syndrome: a revisit for hematologists and oncologists. Crit Rev Oncol Hematol 2013;86:85-95. 3. Levy RM, Junkins-Hopkins JM, Turchi JJ, James WD. Sweet syndrome as the presenting symptom of relapsed hairy cell leukemia. Arch Dermatol 2002;138:1551-1554. 4. Surovy AM, Pelivani N, Hegyi I, Buettiker U, Beltraminelli H, Borradori L. Giant cellulitis-like Sweet syndrome, a new variant of neutrophilic dermatosis. JAMA Dermatol 2013;149:79-83. 5. Habermann TM, Rai K. Historical treatments of in hairy cell leukemia, splenectomy and interferon: past and current uses. Leuk Lymphoma 2011;52(Suppl 2):18-20. 6. Theodorou GL, Mouzaki A, Tsiftsis D, Apostolopoulou A, Mougiou A, Theodori E, Vagianos C, Karakantza M. Effect of non-operative management (NOM) of splenic rupture versus splenectomy on the distribution of peripheral blood lymphocyte populations and cytokine production by T cells. Clin Exp Immunol 2007;150:429-436. 7. Miniello S, Cristallo G, Testini M, Balzanelli MG, Marzaioli R, Venezia P, Lissidini G, Petrozza D, Nacchiero M. Postsplenectomy type-1 hypersensitivity response: a correlation between IL-4 and IgE serum levels. Immunopharmacol Immunotoxicol 2008;30:71-77.

Address for Correspondence/Yazışma Adresi: Mahmut YERAL, M.D., Başkent University Faculty of Medicine, Department of Hematology, Ankara, Turkey Phone : +90 322 327 27 27 / 2164 E-mail : mahmutyeral@yahoo.com

Received/Geliş tarihi: October 22, 2016 Accepted/Kabul tarihi: February 28, 2017 DOI: 10.4274/tjh.2016.0416

271

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:270-281

Synchronous Nodal Involvement of Metastatic Adenocarcinoma and Classical Hodgkin’s Lymphoma Metastatik Adenokarsinom ve Klasik Hodgkin Lenfomanın Eş Zamanlı Nodal Tutulumu Ritesh Sachdev1, Shalini Goel1, Ruchika K Goel1, Smeeta Gajendra1, Nitin Sood2 Medanta The Medicity Hospital, Lab Medicine and Transfusion Medicine, Departments of Pathology, Gurgaon, India Medanta The Medicity Hospital, Clinic of Medical Oncology and Hematology, Gurgaon, India

1 2

To the Editor, The cervical lymph nodes (LNs), along with being the primary site of lymphomas, are also the draining sites for malignancies of the gastrointestinal tract, breasts, lungs, etc. Hodgkin’s disease also most commonly affects the cervical and axillary LNs. We, in the era of modern techniques for diagnosing malignancies, stress the fact that a diligent histopathological examination of the background lymphoid tissue is important to exclude a coexistent lymphoma, particularly after a metastasis is found. A 55-year-old hypertensive male presented with significant weight loss and vague epigastric fullness for the past month. On examination, splenomegaly (13.4 cm) and multiple left level IV and V cervical LNs measuring between 1 and 1.5 cm were noted. Investigations revealed anemia (73 g/L) with thrombocytopenia (120x109/L). Peripheral smear showed a leukoerythroblastic blood picture, for which bone marrow (BM) examination was advised. The BM aspirate was hemodiluted; however, a BM biopsy showed diffuse infiltration by acini and cords of signet ring cells with abundant mucinous cytoplasm and eccentric nuclei (Figures 1A and 1B), which were positive for cytokeratin (Figure 1C, 200x) and Alcian blue/periodic acid-Schiff staining (Figure 1D). The surrounding area showed desmoplasia with normal marrow elements. Diagnosis of metastatic adenocarcinoma, possibly primarily from the gastrointestinal tract, was given and radiological studies were advised. Positron emission tomography-computed tomography revealed multiple hypermetabolic enlarged LNs in the left posterior cervical, level IV, supraclavicular region. The liver was enlarged with a small hypermetabolic hypodense area noted in segment VI. The spleen was enlarged with multiple hypermetabolic ill-defined areas (Figure 1E). Upper GI endoscopy showed scalloped folds in D2 with diverticula near the papillary opening. A duodenal biopsy was done, which confirmed the diagnosis of mucinous adenocarcinoma. Due to significant fluorodeoxyglucose (FDG)-avid lymphadenopathy, a left cervical excision biopsy was done. Histopathology of the LN revealed complete effacement of the lymph nodal architecture (Figures 2A and 2B) with 272

thickened fibrous septa. The lymphoid nodules revealed the presence of numerous Reed-Sternberg (RS) cells surrounded by a monomorphic population of large cells with multiple intravascular tumor deposits predominantly in the periphery of the LN. The intravascular tumor deposits were positive for cytokeratin (Figure 2C). The RS cells stained positive for CD30 (Figure 2D) and CD15 (Figure 2E) and negative for CD20, CD3, and CD45. A diagnosis of a collision tumor comprising classical Hodgkin’s lymphoma and metastatic adenocarcinoma was made. A collision tumor is defined as the concurrence of two histologically and topographically different neoplasms in one organ with little intermingling between the two neoplasms and without areas of transition between the abutting separate

Figure 1. Bone marrow biopsy showing diffuse infiltration of the marrow spaces by acini and cords of signet ring cells with abundant mucinous cytoplasm (A, 100x; B, 400x); positive for cytokeratin immunostaining (C, 200x) and Alcian blue/periodic acid-Schiff (D, 200x). PET/CT revealed multiple fluorodeoxyglucose -avid hypermetabolic-enlarged lymph nodes with splenomegaly (E).

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:270-281

the literature with medullary carcinoma of thyroid and colon carcinoma [4,5]. This case highlights the underlying synchronous nodal involvement of two divergent neoplastic populations. The need to look carefully at the background lymphoid population, particularly after a metastasis is found, is also emphasized. Keywords: Hodgkin’s lymphoma, Metastatic adenocarcinoma, Reed-Sternberg cells, PET/CT Anahtar Sözcükler: Hodgkin lenfoma, adenokarsinom, Reed-Sternberg hücreleri, PET/BT

Figure 2. Histopathology of the lymph node showing complete effacement of lymph nodal architecture with presence of numerous Reed-Sternberg cells along with multiple intravascular tumor deposits (A, 100x; B, 400x). The intravascular tumor deposits were positive for cytokeratin immunostaining (C, 400x). The RS cells stained positive for CD30 (D, 400x) and CD15 (E, 400x). primaries. It occurs when two separate carcinomas metastasize to the same LN or when carcinoma metastasizes to the LNs that contain malignant lymphoma [1]. The etiopathology of these tumors is such that they are either a chance association or they share a common etiopathogenesis. It has been postulated previously that this can be the result of two simultaneously operating different processes, such as continuous proliferative stimulation and the presence of a common oncogenic factor such as Epstein-Barr virus [2]. Collision tumors with Hodgkin’s lymphoma as one component and solid organ malignancies as the other have been described in the literature, including metastases from breast and gastric carcinoma [1,3]. Synchronous tumors with Hodgkin’s lymphoma have been documented in

Metastatik

References 1. Tillawi IS. Collision tumor-concurrent involvement of Virchow’s lymph node by Hodgkin’s disease and metastatic gastric adenocarcinoma. A Troisier’s sign and more? Saudi Med J 2007;28:778-782. 2. Sakuma K, Uozaki H, Chong JM, Hironaka M, Sudo M, Ushiku T, Nagai H, Fukayama M. Cancer risk to the gastric corpus in Japanese, its correlation with interleukin-1β gene polymorphism (+3953*T) and Epstein-Barr virus infection. Int J Cancer 2005;115:93-97. 3. Allal AS, Weintraub J, Remadi S, Abele R. Concurrent interfollicular Hodgkin’s disease and metastatic breast carcinoma in lymph nodes. Pathol Int 1996;46:787-790. 4. Quilon JM, Day S, Lasker JC. Synchronous tumors: Hodgkin disease presenting in mesenteric lymph nodes from a right hemicolectomy for colon carcinoma. South Med J 2004;97:1133-1135. 5. Acosta-Ortega J, Montalbán-Romero S, García-Solano J, Sánchez-Sánchez C, Pérez-Guillermo M. Simultaneous medullary carcinoma of the thyroid gland and Hodgkin’s lymphoma in bilateral lymph nodes of the neck: a potential pitfall in fine-needle aspiration cytology. Diagn Cytopathol 2004;31:255-258.

Address for Correspondence/Yazışma Adresi: Ritesh SACHDEV, M.D., Received/Geliş tarihi: December 09, 2016 Medanta The Medicity Hospital, Lab Medicine and Transfusion Medicine, Departments of Pathology, Gurgaon, India Accepted/Kabul tarihi: April 04, 2017 Phone : +91 981 183 6806 E-mail : sachdev05@gmail.com DOI: 10.4274/tjh.2016.0478 ©Copyright 2017 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

273

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:270-281

Psychogenic Purpura Successfully Treated with Antidepressant Therapy Antidepresan Tedavi ile İyileşen Psikojenik Purpura Şeyda Çelik-Göksoy, Ayşe Kılınçaslan, İlyas Kaya İstanbul University Faculty of Medicine, Department of Child and Adolescent Psychiatry, İstanbul, Turkey

To the Editor, Psychogenic purpura (PP) or Gardner-Diamond syndrome is a very rare condition characterized by spontaneous, recurrent, and painful edematous skin lesions progressing to ecchymoses [1]. Bleeding from the nose, gastrointestinal organs, kidneys, and uterus has also been reported [2]. PP is commonly regarded as an autoimmune vasculopathy with sensitization to phosphatidylserine, a component of erythrocyte membranes [3]. Development of the lesions generally follows minor physical trauma and/or emotional distress, and they are often accompanied by certain psychiatric conditions [4]. However, it is still unclear how stress influences the physiological processes and changes the immune reactivity so that organisms react with the formation of erythrocyte autoantibodies [1]. Here we present a case associated with depression and sexual abuse. A 15-year-old female was referred with complaints of recurrent ecchymotic bruising over her cheeks and chin (Figure 1). The lesions started with a burning sensation, severe right-sided hemi-headache, and nausea. Afterwards, reddish discoloration progressing to ecchymoses within a couple of hours appeared. The lesions became less painful and disappeared spontaneously within a week. The painful ecchymotic bruises started 5 years ago, after sexual abuse by a neighbor involving cuddling, kissing, and fondling. It occurred once, it was kept secret, and the family moved to a new house. The lesions occurred 3 months after the assault and they were not associated with physical trauma or drug use. They recurred periodically at intervals of 3-4 months, but sometimes more frequently (i.e. once in 15-20 days). There was no personal or family history of bleeding. The systemic examination was unremarkable. Exhaustive laboratory investigations and hematological examinations, including complete blood count with differential liver function, prothrombin time, activated partial thromboplastin time, fibrinogen, von Willebrand factor, and platelet aggregation tests yielded results within normal limits. A direct Coombs test was negative and erythrocyte and platelet morphologies, platelet clustering, and complete

274

urinalysis were normal. Rheumatological examinations, including erythrocyte sedimentation rate, rheumatoid factor, C-reactive protein, and lupus anticoagulant, were within normal limits. A skin biopsy specimen of an ecchymotic plaque showed extravasated red blood cells throughout the dermis with no inflammatory infiltration. In the psychiatric examination, she reported depressive mood, anhedonia, hopelessness, and concentration problems. She disclosed being sexually abused (i.e. kissing and fondling with no sexual intercourse) by her father from the age of 12. She had mild suicidal thoughts but described no plans or prior attempts. She reported her worries about her mother’s medical problems and the future. She obtained a score of 28 on the Beck Depression Inventory (BDI) and 41 on the self-report Screen for Child Anxiety Related Disorders (SCARED). The diagnosis of PP was confirmed upon seeing a typical ecchymotic lesion 7 h after the intradermal injection of autologous erythrocytes [4].

Figure 1. Ecchymotic lesions at the time of referral (4th day).

Figure 2. Recurrence of the lesions after cessation of the antidepressant (early on the 2nd day).

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:270-281

An investigation was launched by Child Protection Services and she was assigned to stay in a residential unit for 2 weeks. Meanwhile, her father moved away and she returned home to live with the rest of her family under the supervision of Child Protection Services. Antidepressant treatment with escitalopram at 5 mg/day was started and increased to 10 mg/day. Her suicidal thoughts and depressive symptoms decreased. She started sports and drawing. She stopped her medication in the fifth month. However, another episode occurred after 4 weeks (Figure 2). This time, previous symptoms were accompanied by hemoptysis. Laboratory investigations, bronchoscopy, and thoracic computerized tomography revealed no abnormality and there was no obvious stressor to trigger the episode. However, psychiatric examination revealed subclinical depressive symptoms. She used escitalopram for 2 years, which was stopped after complete resolution of her depression (BDI: 8, SCARED: 14). She had no other episodes, neither under antidepressant therapy nor in the 12-month drug-free period.

escitalopram treated both the PP and depression. This case was presented to highlight the importance of psychiatric treatment in such cases.

Cases presented in the literature commonly give information about the clinical features and differential diagnosis of PP. However, the treatment and follow-up of cases are rarely described [5]. This adolescent had many typical episodes of PP associated with emotional distress and depression. The cessation of the sexual abuse and antidepressant therapy with

3. Miranda JV, Vagner B. Gardner-Diamond’s syndrome: literature review. Int J Collab Res Intern Med Public Health 2012;4:268-275.

Keywords: Psychogenic purpura, Gardner-Diamond syndrome, Antidepressant, Adolescent Anahtar Sözcükler: Psikojenik purpura, Gardner-Diamond sendromu, Antidepresan, Adölesan Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Ivanov OL, Lvov AN, Michenko AV, Künzel J, Mayser P, Gieler U. Autoerythrocyte sensitization syndrome (Gardner-Diamond syndrome): review of the literature. J Eur Acad Dermatol Venereol 2009;23:499-504. 2. Özyıldırım İ, Yücel B, Aktan M. Psychogenic purpura with hematuria and sexual pain disorder: a case report. Turk Psikiyatri Derg 2010;21:85-89.

4. Jafferany M, Bhattacharya G. Psychogenic purpura (Gardner-Diamond syndrome). Prim Care Companion CNS Disord 2015;17:10.4088/PCC.14br01697. 5. Okur M, Turan H, Ozkan A, Güneş C, Kocabay K. An extremely rare cause of bruising in children: autoerythrocyte sensitization syndrome. Turk J Hematol 2012;29:201-203.

This case was presented in poster format at the 8th International Congress on Psychopharmacology & 4th International Symposium on Child and Adolescent Psychopharmacology, Antalya, Turkey, 2016. Address for Correspondence/Yazışma Adresi: Ayşe KILINÇASLAN M.D., Received/Geliş tarihi: December 31, 2016 İstanbul University Faculty of Medicine, Department of Child and Adolescent Psychiatry, İstanbul, Turkey Accepted/Kabul tarihi: March 06, 2016 Phone : +90 537 645 15 15 E-mail : ayse.ka@windowslive.com DOI: 10.4274/tjh.2016.0505 ©Copyright 2017 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

275

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:270-281

Systemic Mastocytosis with Associated Chronic Lymphocytic Leukemia: A Matter of Diseases or Prognostic Factors? Kronik Lenfositik Lösemi ile Birlikte Seyreden Sistemik Mastositoz: Hastalık Nedeni ile mi Prognostik Etki mi? Antonella Zagaria, Luisa Anelli, Nicoletta Coccaro, Giuseppina Tota, Claudia Brunetti, Angela Minervini, Paola Casieri, Luciana Impera, Crescenzio Francesco Minervini, Annamaria Giordano, Paola Orsini, Cosimo Cumbo, Giorgina Specchia, Francesco Albano Bari University Faculty of Medicine, Department of Emergency and Organ Transplantation, Bari, Italy

To the Editor, Systemic mastocytosis (SM) is a clonal disorder characterized by the accumulation of abnormal mast cells in various tissues and by a broad range of diseases, ranging from indolent to advanced systemic pathology. In 2016, the World Health Organization revised the SM classification into seven distinct variants [1]; among them is SM with an associated hematological neoplasm (SM-AHN), accounting for approximately 40% of all SM cases [2]. Usually the AHN is an aggressive neoplasm that can be challenging to diagnose either because the mast cell infiltrate can be subtle and difficult to identify or because the mast cell infiltrate can be prominent, thus obscuring the underlying AHN. Frequently the AHN is represented by a myeloid neoplasm, whereas the observation of an association between SM and lymphoproliferative diseases is uncommon. In particular, chronic lymphocytic leukemia (CLL) in the context of SM-AHN has been rarely reported [2,3,4,5,6] (Table 1). Here, we describe a new case of SM with associated CLL, in which the cytological features of the two neoplasias were evident in bone marrow aspirate; moreover, in this case molecular analysis specific for SM was performed. A 65-year-old female patient presented with 9 lymphocytosis (leukocytes, 66x10 cells/L; lymphocyte absolute count, 63x109 cells/L; hemoglobin level, 12.1 g/dL; platelets,

243x109 cells/L). Physical examination revealed no abnormalities. Peripheral blood smear analysis demonstrated the presence of ~90% small mature lymphocytes together with smear cells (Gumprecht shadows). Flow cytometry analysis of the lymphocyte population showed positive staining for anti-CD5, CD19, CD23, and CD20 antibodies and a k-type light chain restriction. The bone marrow aspirate appeared hypercellular due to the infiltration of lymphoid cells, which were morphologically similar to those in the peripheral blood and accounted for at least 70% of all nucleated marrow cells. Moreover, morphologic analysis showed the presence of at least 10% of mast cells, mainly characterized by a fusiform cytoplasm (Figure 1). Bone marrow biopsy confirmed the lymphocyte infiltration associated with the presence of atypical mast cells (CD117+, tryptase+, CD2+, CD25+); multifocal mast cell aggregates (>15 mast cells) were frequently observed in perivascular and paratrabecular bone marrow locations. The tryptase level was 64.5 ng/mL. Total body computed tomography revealed no abnormalities. Conventional cytogenetics showed a normal karyotype, i.e. 46,XX [20], whereas fluorescent in situ hybridization, performed with probes specific for chromosomal aberrations associated with CLL, revealed the presence of del(13) (q14) and no alterations at the 17p13, 11q22, and 12q13 loci. IGVH was not mutated. Molecular analysis revealed the KIT D816V mutation, whereas SRSF2, ASXL1, and JAK2 V617F were

Table 1. Main characteristics of prior reported SM-CLL cases. Sex/Age

KIT D816V

Karyotype

Treatment

Outcome

Reference

Normal

None

[2]

del(11)(q14) del(13)(q14)

None

[2]

Female/56

del(13)(q14)

FCR + MUD AHSCT

CLL in CR

[3]

SM persistence Male/48

del(11)(q14)

FCR + alemtuzumab

CLL in CR

Imatinib

SM persistence

[4]

Male/36

None

SM and CLL stable 12 months after the diagnosis

[5]

Female/69

[6]

NR: Not reported, FCR: fludarabine, cyclophosphamide, rituximab; MUD AHSCT: matched unrelated donor allogeneic hematopoietic stem cell transplantation, CR: complete remission, CLL: chronic lymphocytic leukemia, SM: systemic mastocytosis.

276

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:270-281

Acknowledgment This work was supported by “Associazione Italiana Contro Le Leucemie (Ail)-Bari”. Keywords: Systemic mastocytosis, Systemic mastocytosis with an associated hematological neoplasm, Chronic lymphocytic leukemia, KIT D816V Anahtar Sözcükler: Sistemik mastositoz, Hematolojik malignite ile seyreden sistemik mastositozis, Kronik lenfositik lösemi, KIT D816V Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM, Bloomfield CD, Cazzola M, Vardiman JW. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood 2016;127:2391-2405. 2. Wang SA, Hutchinson L, Tang G, Chen SS, Miron PM, Huh YO, Jones DM, Bueso-Ramos C, Verstovsek S, Medeiros LJ, Miranda RN. Systemic mastocytosis with associated clonal hematological non-mast cell lineage disease: clinical significance and comparison of chromosomal abnormalities in SM and AHNMD components. Am J Hematol 2013;88:219-224.

Figure 1. Systemic mastocytosis with an associated hematological neoplasm bone marrow aspirate. Atypical mastocytes with spindle nucleus and granules spread throughout the plentiful basophilic cytoplasm. The mastocytes are located in the context of bone marrow rich in mature lymphocytes. not altered. Based upon these findings, the patient was diagnosed with SM (the major criterion and 3 minor criteria) with associated CLL (Rai 0, Binet A stage). Since neither of the two diseases showed signs of activity it was decided to choose a “watch and wait” strategy, and 1 year after the diagnosis the SM-AHN remains stable (lymphocyte absolute count, 92x109 cells/L; tryptase level, 67 ng/mL) and the patient is doing well. Reportedly, SM-AHN has a poor prognosis with a median survival of less than 2-4 years [7]. Given the low frequency of CLL in the context of SM-AHN, it is very difficult to draw general prognostic considerations for this entity, but recently it was published that advanced SM patients bearing SRSF2 and/or ASXL1 mutations have a poor prognosis [8,9]. Note that among the SM patients reported in those two studies there was not a case associated with CLL. In conclusion, we suggest that the stable course of SM-AHN may derive from the concurrence of the positive prognostic factors that characterize the two diseases in our patient.

3. Du S, Rashidi HH, Le DT, Kipps TJ, Broome HE, Wang HY. Systemic mastocytosis in association with chronic lymphocytic leukemia and plasma cell myeloma. Int J Clin Exp Pathol 2010;3:448-457. 4. Ault P, Lynn A, Tam CS, Medeiros LJ, Keating MJ. Systemic mastocytosis in association with chronic lymphocytic leukemia: a rare diagnosis. Leuk Res 2007;31:1755-1758. 5. Sanz MA, Valcárcel D, Sureda A, Muñoz L, Espinosa I, Nomdedeu J, Sierra J. Systemic mast cell disease associated with B-chronic lymphocytic leukemia. Haematologica 2001;86:1106-1107. 6. Horny HP, Sotlar K, Stellmacher F, Valent P, Grabbe J. An unusual case of systemic mastocytosis associated with chronic lymphocytic leukaemia (SMCLL). J Clin Pathol 2006;59:264-268. 7. Pardanani A. Systemic mastocytosis in adults: 2017 update on diagnosis, risk stratification and management. Am J Hematol 2017;91:1146-1159. 8. Jawhar M, Schwaab J, Hausmann D, Clemens J, Naumann N, Henzler T, Horny HP, Sotlar K, Schoenberg SO, Cross NC, Fabarius A, Hofmann WK, Valent P, Metzgeroth G, Reiter A. Splenomegaly, elevated alkaline phosphatase and mutations in the SRSF2/ASXL1/RUNX1 gene panel are strong adverse prognostic markers in patients with systemic mastocytosis. Leukemia 2016;30:2342-2350. 9. Jawhar M, Schwaab J, Schnittger S, Meggendorfer M, Pfirrmann M, Sotlar K, Horny HP, Metzgeroth G, Kluger S, Naumann N, Haferlach C, Haferlach T, Valent P, Hofmann WK, Fabarius A, Cross NC, Reiter A. Additional mutations in SRSF2, ASXL1 and/or RUNX1 identify a high-risk group of patients with KIT D816V+ advanced systemic mastocytosis. Leukemia 2016;30:136-143.

Address for Correspondence/Yazışma Adresi: Francesco ALBANO, M.D. Bari University Faculty of Medicine, Department of Emergency and Organ Transplantation, Bari, Italy Phone : +39 (0)80-547 8031 E-mail : francesco.albano@uniba.it

Received/Geliş tarihi: January 13, 2017 Accepted/Kabul tarihi: March 28, 2017 DOI: 10.4274/tjh.2017.0014

277

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:270-281

Screening of Intron 1 Inversion of the Factor VIII Gene in 130 Patients with Severe Hemophilia A from a Pakistani Cohort Faktör VIII Geni İntron 1 İnversiyonunun 130 Pakistan’lı Ağır Hemofili A Hasta Grubunda Taranması Azhar Sattar1, Shabbir Hussain2, Muhammad Ikram Ullah3, Saqib Mahmood4, Shahida Mohsin1 University of Health Sciences Faculty of Medicine, Department of Hematology, Lahore, Pakistan University of Health Sciences Faculty of Medicine, Department of Biochemistry, Lahore, Pakistan 3 Quaid-i-Azam University Faculty of Biological Sciences, Department of Biochemistry, Islamabad, Pakistan 4 University of Health Sciences of Medicine, Department of Human Genetics and Molecular Biology, Lahore, Pakistan 1 2

To the Editor, Hemophilia A (HA) is an X-linked bleeding disorder caused by diverse mutations in the factor VIII (FVIII) gene [1]. The causative mutations of the FVIII gene in severe hemophilia are very heterogeneous and spontaneous [2]. Inversion error in intron 1 occurs during male gametogenesis [3]. The incidence of FVIII mutations has been reported to vary in intron 1 (1%-5%) and intron 22 (50%) in people with hemophilia. Inversion mutations are responsible in 40%-60% cases of severe HA. Previous studies suggested that the prevalence of intron 1 inversion is variable, ranging from 1% to 5% in different countries [2,4]. The aim of this study was to investigate the prevalence of FVIII intron 1 inversion in patients with severe HA in Pakistan by polymerase chain reaction (PCR). According to the published data, this is the first report from a Pakistani population about the screening of intron 1 of the FVIII gene. We selected 130 unrelated/sporadic severe HA patients referred to the Hemophilia Welfare Society of Pakistan after receiving ethical approval from the University of Health Sciences, Lahore, Pakistan. PCR amplification of genomic DNA was performed by using specific sets of primers as given in Table 1. The PCR reactions were conducted in 25-µL PCR reaction tubes. In the first step, initial denaturation of DNA was performed at 95 °C for 5 min. The second step consisted of 30 cycles of denaturation and annealing at temperatures of 94 °C and 5865 °C for 1 min for each step and an extension at 72 °C for 2 min (according to the optimum annealing temperature of the primer, as given in Table 1). The third step consisted of final extension at 72 °C for 5 min. After amplification, products were resolved on 2% agarose gel with a 1-kb DNA ladder (GeneGauge, Caisson Laboratories) and visualized by UV transilluminator (Gel Doc EZ System, Bio-Rad). Interpretation of the gel bands was done according to standard band resolution. Molecular analysis of inv1 of the FVIII gene in 130 patients 278

with severe HA showed positive inversion only in 1 HA case with a frequency of 0.77% in our population. The mother of the patient was a carrier of the intron 1 inversion (Figure 1). The inversion-positive child had a familial HA history, with a typical band pattern in each reaction. At the age of 1 year, the child was diagnosed with hemophilia after excessive bleeding during a circumcision procedure. Factor VIII-C was 0.8 with no history of inhibitor against factor VIII. Previously, various studies explored the frequency of inv1 of FVIII in different people with Table 1. Primer sequences and their amplification conditions. No.

Primer

Sequence 5’→3’

Tm (°C)

HA-9F

GTTGTTGGGAATGGTTACGG

58.4

Int1h-2F

GGCAGGGATCTTGTTGGTAAA

59.4

HA-9cR

CTAGCTTGAGCTCCCTGTGG

62.5

Int1h-2R

TGGGTGATATAAGCTGCTGAGCTA

Figure 1. Molecular analysis of intron 1 inversion of the factor VIII gene in hemophilia A patients. A) The top panel shows normal results and the lower panel shows the patients with inversion. Diagram of normal DNA (top) and inversion (bottom) showing the location and orientation of relevant sequences as well as polymerase chain reaction primers and reactions (thin bars). B) Amplification of Int1h-1 using 9cR, 9F, and Int1h-2F primers (lanes 1, 2, and 3) and Int1h-2 using Int1h-2F, Int1h-2R, and 9F primers (lanes 4, 5, and 6). Control and inversion are males while the carrier is female.

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:270-281

hemophilia through PCR methods [1,5]. The frequency of inv1 reported in different populations is quite variable at 1.7% for the Italian population [6], 5.1% in the Spanish population [7], and about 8% in patients of Indian origin [2]. However, inv1 was not identified in 104 Hungarian patients with severe HA [8]. Intron 1 inversion is considered to be an important molecular factor, alteration of which may result in severe HA. Our results (0.77%) clearly indicated the variability between populations and confirm that inv1 is much less frequent than inv22. Keywords: Hemophilia A, FVIII gene, Intron 1, Polymerase chain reaction, Pakistan Anahtar Sözcükler: Hemofili A, FVIII geni, İntron 1, Polimeraz zincirleme reaksiyonu, Pakistan Conflict of Interest: The authors declare no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included. Financial Disclosure: This research was assisted in part by the University of Health Sciences, Lahore, Pakistan.

References 1. Guo Z, Yang L, Qin X, Liu X, Zhang Y. Spectrum of molecular defects in 216 Chinese families with hemophilia A. Clin Appl Thromb Hemost 2017. [Epub ahead of print]. 2. Pinto P, Ghosh K, Shetty S. F8 gene mutation profile in Indian hemophilia A patients: identification of 23 novel mutations and factor VIII inhibitor risk association. Mutat Res 2016;786:27-33. 3. Bowen DJ. Haemophilia A and haemophilia B: molecular insights. Mol Pathol 2002;55:1-18. 4. Sanna V, Ceglia C, Tarsitano M, Lombardo B, Coppola A, Zarrilli F, Castaldo G, Di Minno G. Aberrant F8 gene intron 1 inversion with concomitant duplication and deletion in a severe hemophilia a patient from southern Italy. J Thromb Haemost 2013;11:195-197. 5. Bagnall RD, Giannelli F, Green PM. Int22h-related inversions causing hemophilia A: a novel insight into their origin and a new more discriminant PCR test for their detection. J Thromb Haemost 2006;4:591-598. 6. Salviato R, Belvini D, Radossi P, Tagariello G. Factor VIII gene intron 1 inversion: lower than expected prevalence in Italian haemophiliac severe patients. Haemophilia 2004;10:194-196. 7. Tizzano EF, Cornet M, Baiget M. Inversion of intron 1 of the factor VIII gene for direct molecular diagnosis of hemophilia A. Haematologica 2003;88:118-120. 8. Andrikovics H, Klein I, Bors A, Nemes L, Marosi A, Váradi A, Tordai A. Analysis of large structural changes of the factor VIII gene, involving intron 1 and 22, in severe hemophilia A. Haematologica 2003;88:778-784.

Address for Correspondence/Yazışma Adresi: Azhar SATTAR, M.D., University of Health Sciences Faculty of Medicine, Department of Hematology, Lahore, Pakistan E-mail : milaya500@gmail.com

Received/Geliş tarihi: January 30, 2017 Accepted/Kabul tarihi: March 14, 2017 DOI: 10.4274/tjh.2017.0031

279

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:270-281

Implementation of an ISBT 128-Compatible Medical Record System to Facilitate Traceability of Stem Cell Products Kök Hücre Ürünlerinin İzlenebilirliğini Kolaylaştırmak için ISBT 128 Uyumlu Tıbbi Kayıt Sisteminin Uygulanması Can Boğa1, Erkan Maytalman1, Çiğdem Gereklioğlu2, Süheyl Asma2, Fatih Kandemir1, Pelin Aytan1, Aslı Korur2, Mahmut Yeral1, İlknur Kozanoğlu3, Hakan Özdoğu1 Başkent University Faculty of Medicine, Department of Hematology, Ankara, Turkey Başkent University Faculty of Medicine, Department of Family Medicine, Ankara, Turkey 3 Başkent University Faculty of Medicine, Department of Physiology, Ankara, Turkey 1 2

To the Editor, The Foundation for the Accreditation of Cellular Therapy and the Joint Accreditation Committee-ISCT & EBMT (FACT-JACIE) demands the tracking of stem cell products, beginning from the harvesting of the product from the patient or donor and continuing until the time of use in stem cell transplantation centers [1]. Relevant follow-up stages for stem cell product bags and vials include harvesting, portioning, transportation, acceptance at the cell processing unit, processing, storage, recycling, release, acceptance at the clinical unit, infusion, and recall at the cellular processing unit [1,2,3,4]. Information Standard for Blood and Transplant (ISBT) 128 provides unique identification and traceability of stem cell products using an international coding system [5]. Although this system is required to be implemented in accredited centers, many centers could not yet begin using this system. Sufficient data are not available in the literature about whether this system has facilitated workflow or not. This study was planned in order to investigate the feasibility of the ISBT 128 coding system. This is a single-center, cross-sectional, and prospective study conducted at a JACIE-accredited center between January 2012 and December 2016. Cellular therapy production codes beginning with ‘S’ were checked against the International Council for Commonality in Blood Banking Automation registry and unique identifiers for patient, donor, and stem cell products were produced. The class, modifier, and additives for the product were defined using the terminology table [6]. ISBT-compatible software (Turunç v.0.2, Teknik Media, Adana, Turkey) was used as the medical recording system. The function and the continuity of the system were evaluated every 15 days. Time to reach the data of the stem cell product at a certain time between harvesting and infusion/disposal and system implementation problems were evaluated. For this purpose, cell product characteristics were evaluated at every stage for 20 randomly selected products. 280

A total of 2703 records belonging to 467 patients/donors were analyzed. The distribution of record numbers according to stages of the cellular product’s journey were 712 for cell collection, 1460 for cell processing, 2 for recall of the product, and 561 for disposal of the product. A sample of a final allogeneic label is shown in Figure 1. The biohazard mark and a written warning regarding infectious agents were placed correctly on the labels

Figure 1. Bar code denotes donation identification number (upper left), blood group (upper right), collection (or production) date and time (middle), product code (lower left), and expiration date and time (lower right). The biohazard mark was placed correctly on the labels of products that were detected to pose infection risks.

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:270-281

of the infection-positive products. The time to reach data of cell content, portion number, storage location of bags, and storage location of vials were 6.1±1.1 s, 5.3±1 s, 6.4±0.9 s, and 6.4±0.9 s, respectively. No deviation from quarantine procedure was identified. Only three label production errors were detected (0.097%). No torn labels were produced.

and/or affiliations relevant to the subject matter or materials included.

The coding system was seen to facilitate workflow by enabling communication between transplant units. Labels that were structured in accordance with ISBT 128 could be produced at appropriate stages [7,8]. Almost no mix-up error being found in our study is a striking result to ensure the safety and reliability of the system.

2. American Association of Tissue Banks, American Red Cross, American Society for Blood and Marrow Transplantation, American Society for Apheresis, America’s Blood Centers, Foundation for the Accreditation of Cellular Therapy, ICCBBA Inc., International Society for Cellular Therapy, National Marrow Donor Program. Circular of Information for the Use of Cellular Therapy Products. Bethesda, AABB, 2005.

The ISBT 128 system was found to be effective for traceability of stem cell products during their journey from harvesting to infusion/disposal and it facilitates the workflow in clinical practice in transplant and cellular therapy centers.

References 1. International Standards for Hematopoietic Cellular Therapy Product Collection, Processing, and Administration. FACT-JACIE Hematopoietic Cellular Therapy Accreditation Manual. 6th ed. Omaha, FACT-JACIE, 2015.

3. American Association of Blood. Standards for Cellular Therapy Product Standards, 2nd Edition. Bethesda, AABB, 2007. 4. Distler PB. ISBT 128: An internationally standardized means to label cellular therapy products. Pharmaceuticals Policy and Law 2007;9:421-430. 5. Distler P. ISBT 128: a global information standard. Cell Tissue Bank 2010;11:365-373.

Keywords: Hematopoietic stem and progenitor cells, Stem cell mobilization, Apheresis, ISBT 128, JACIE, Labeling, Traceability

6. International Council for Commonality in Blood Banking Automation. ISBT 128 Standard: Product Coding-Bounded Lists and Definitions, Version 3.3.x. Redlands, ICCBBA, 2007.

Anahtar Sözcükler: Hematopoietik stem ve progenitor hücreler, Stem hücre mobilizasyonu, Aferez, ISBT 128, JACIE, Etiketleme, Takip edilebilirlik

7. Strong DM, Shinozaki N. Coding and traceability for cells, tissues and organs for transplantation. Cell Tissue Bank 2010;11:305-323.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships,

8. Ashford P, Distler P, Gee A, Lankester A, Larsson S, Feller I, Loper K, Pamphilon D, Poston L, Rabe F, Slaper-Cortenbach I, Szczepiorkowski Z, Warkentin P; International Cellular Therapy Coding and Labeling Advisory Group. ISBT 128 implementation plan for cellular therapy products. J Clin Apher 2007;22:258-264.

Address for Correspondence/Yazışma Adresi: Can BOĞA, M.D., Başkent University Faculty of Medicine, Department of Hematology, Ankara, Turkey Phone : +90 322 327 27 27-2162 E-mail : drcanboga@hotmail.com

Received/Geliş tarihi: February 27, 2017 Accepted/Kabul tarihi: April 13, 2017 DOI: 10.4274/tjh.2017.0081

281