Molecular Pathology January 2025 by IHC001

Molecular Pathology for the FRCPath part 1

Matt Evans

Disclosures

 I have received honoraria from

 Agilent Technologies

 Amgen

 AstraZeneca

 Boehringer Ingelheim

 Bristol-Myers Squibb

 Eli Lilly

 Incyte

 Merck Sharp & Dohme

 Pfizer

 Roche

 Servier

Almost 11 hours of recorded lectures

Document covering molecular pathology matched to the curriculum

Lots of resources!

https://www.molecularpathologyuk.net/

Overview

What are the key types of molecular alteration?

Genomic: small variants, structural variants, copy number variants, epigenetic alterations (methylation)

Non-genomic: IHC surrogates of genomic alterations, MMR IHC, PD-L1 IHC

How can we test for molecular alterations?

Small variants: real-time PCR, NGS

Structural variants: IHC, ISH, RT-PCR, NGS

Copy number variants: IHC, ISH

Non-genomic variants: MMR IHC (and MSI), PD-L1 IHC

What are the key molecular alterations in common cancers?

NTRK and DPYD

Non-small cell lung cancer: EGFR, BRAF, KRAS, ALK, ROS1, RET, METex14, PD-L1

Colon cancer: MMR/MSI, KRAS, NRAS, BRAF

Breast cancer: HER2, Oncotype DX, PD-L1, PIK3CA

High-grade ovarian cancer: BRCA, HRD

Endometrial cancer: MMR, POLE

Melanoma: BRAF, PD-L1

What are they key types of molecular alteration?

What are the key types of molecular alteration?

Genomic alterations

A T A G G C C A>C substitution

A T A G G C A EGFR, KRAS, NRAS, BRAF, KIT, PDGFRA, PIK3CA, POLE, BRCA

Indel: C deletion + AA insertion

CD74

Translocation, rearrangement

Fusion

, ROS1, RET, NTRK, FGFR2, sarcoma, lymphoma

Amplification, gain Deletion, loss

What are the key types of molecular alteration?

Non-genomic alterations

Immunohistochemical surrogates for genomic alterations

Small variants: BRAF V600E

Structural variants: ALK, ROS1, NTRK

Small variants in the MMR genes (usually germline)

Methylation of the MLH1 promoter region (usually somatic)

Reflects the ability of tumour cells to evade the immune system

Copy number variants: HER2

How can we test for molecular alterations?

How does pathological processing affect nucleic acids?

This will continue for many hours in the centre of a resection specimen if it is not opened/sliced/inflated! C>T sequence changes

Why do we need to assess samples?

The higher the neoplastic cell %, the lower the risk of missing variants

Why do we need to assess samples?

Minimum neoplastic cell percentage 20%

Neoplastic cell percentage 50%

There is no evidence of small variants involving the EGFR, BRAF or KRAS genes. There is no evidence of structural variants involving the ALK, ROS1, RET, NTRK1, NTRK2 or NTRK3 genes. There is no evidence of MET exon 14 skipping.

Neoplastic cell percentage 5%

Can safely say there is nothing here This could be a false negative!

A colorectal cancer sample comprises 10% neoplastic cells. NGS testing is undertaken (minimum neoplastic cell percentage 20%). This reveals a pathogenic KRAS variant.

Which is the appropriate interpretation?

A. This result could represent a false positive in view of the low neoplastic cell percentage.

B. Long duration of formalin fixation would bring this result into doubt.

C. This result is likely to be reliable.

D. It is likely that other clinically relevant variants have been missed in view of the low neoplastic cell percentage.

E. This should be considered a failed test.

How can we test for genomic alterations?

Small variants

Variant detection technologies

Are any of these variants of interest present in this sample?

Structural variants Copy number variants Methylation

Immunohistochemistry

Can I infer a structural variant from protein expression?

Immunohistochemistry

Can I infer a CNV from protein expression?

In situ hybridisation

Real-time PCR

Sequencing

Are any variants present in this sample?

Direct sequencing

Pyrosequencing

Next-generation sequencing

Is the gene in an abnormal location?

Reverse transcription PCR

Are any of these fusions of interest present?

Next-generation sequencing

Are any fusions present?

In situ hybridisation

Is there more of this gene than usual?

Next-generation sequencing

Are there extra copies of this gene?

Small variant detection

Real-time PCR: the theory

Small variant detection

Real-time PCR: the results

Small variant detection

Real-time PCR: the results

Fluorescence

Small variant detection

Real-time PCR: the practical side

Only specific variants detected

Will miss rare variants not covered by the included probes

https://www.biocartis.com/sites/default/files/2021-03/Idylla_KRASIVD_Tech-Sheet.pdf

Multiple variants detected by a single type of fluorescence

Cannot discriminate the exact variant present

Small variant detection

Real-time PCR: overview

 Detects specific variants of interest

 There is a limit to the number of variants detectable with a single test

 Only feasible for genes with limited number of hotspots

 Generally need one test per gene

 Pros:

 Fast

 Low neoplastic cell percentage requirement

 Small amount of DNA required (per test)

 Cons:

 Will miss rare variants

 If multiple genes needed, will end up consuming lots of DNA

Small variant detection

Next-generation sequencing: library preparation

Small variant detection

Next-generation sequencing: library preparation

Small variant detection

Next-generation sequencing: read alignment

Reference sequence

GAGTGATAGC

Small variant detection

Next-generation sequencing: read alignment

Low depth/coverage (repetitive sequence?)

High depth/coverage

Small variant detection

Next-generation sequencing: overview

 Massively parallel sequencing

 Can assess multiple samples for multiple genes (up to whole genome)

 In theory, will detect any variant in the DNA sequenced

 Pros:

 Should not miss variants

 Can assess multiple genes in parallel

 If large numbers of targets need assessing, likely to require less DNA overall

 Cons:

 Slower

 Higher neoplastic cell percentage requirement

 Large amount of DNA required if only 1-2 targets needed

 Expensive infrastructure, need skilled staff

Small variant detection

Next-generation sequencing: panels

Generally higher failure rates, longer turnaround times

https://www.oncomine.com/hubfs/Downloadable%20PDFs/Genexus_Webinar_Slides.pdf

https://www.e-crt.org/upload/media/crt-2019-305-suppl1.pdf

https://www.illumina.com/content/dam/illumina/gcs/assembled-assets/marketingliterature/trusight-oncology-500-data-sheet-m-gl-00173/trusight-oncology-500-and-ht-datasheet-m-gl-00173.pdf

A 57 year old female non-smoker is diagnosed with lung adenocarcinoma. It is widely metastatic and she is rapidly deteriorating. The oncologist asks for EGFR small variant testing and needs a result as quickly as possible.

Which would be the most appropriate technique?

A. Immunohistochemistry

B. Next-generation sequencing (panels)

C. Next-generation sequencing (whole gene sequencing)

D. Real-time PCR

E. Fluorescence in situ hybridisation (FISH)

How can we test for genomic alterations?

Small variants Structural variants Copy number variants Methylation

Variant detection technologies

Are any of these variants of interest present in this sample?

Real-time PCR

Sequencing

Are any variants present in this sample?

Direct sequencing

Pyrosequencing

Next-generation sequencing

Immunohistochemistry

Can I infer a structural variant from protein expression?

Immunohistochemistry

Can I infer a CNV from protein expression?

In situ hybridisation

Is the gene in an abnormal location?

Reverse transcription PCR

Are any of these fusions of interest present?

Next-generation sequencing

Are any fusions present?

In situ hybridisation

Is there more of this gene than usual?

Next-generation sequencing

Are there extra copies of this gene?

Structural variant detection Immunohistochemistry

Others

https://jcp.bmj.com/content/75/3/145

https://www.researchgate.net/publication/11224272_RET_Expression_i

n_Papillary_Thyroid_Cancer_from_Patients_Irradiated_in_Childhood_for_ Benign_Conditions

Others

Structural variant detection

Immunohistochemistry: overview

 Use protein expression to infer the presence of an underlying fusion

 More useful for certain genes than others

 Pros:

 Fast

 Very few tumour cells needed

 Neoplastic cell percentage irrelevant

 Not specific for particular fusions

 Fairly robust

 Cons:

 Only looks at one gene at a time (generally) – inefficient if multiple targets needed

 Many markers do not have an objective definition of positivity

 Sensitive to under-fixation

Structural variant detection

In situ hybridisation: the theory

Structural variant detection

In situ hybridisation: the detection methods

https://www.wicell.org/home/characterization/cgmp-testing-services/cgmp-fluorescence-insitu-hybridization-fish/gmp-fluorescence-in-situ-hybridization-fish.cmsx

https://www.researchgate.net/figure/Silver-in-situ-hybridization-for-a-case-of-polyCEP17-withHER2-signals-a-and-CEP17_fig1 275046947

https://www.researchgate.net/figure/HPV-ISH-Diffuse-signal-pattern-H-E-400-presents-the-ISHsignals-of-HPV-shown-by_fig1 51488619

https://www.mlo-online.com/home/article/13005291/automated-her2-testing-personalizedhealthcare-for-breast-cancer-patients-enabled-by-novel-molecular-morphology-methods

Structural variant detection FISH: interpretation

Structural variant detection

FISH: interpretation

Structural variant detection FISH: interpretation

Normal

Rearranged

Structural variant detection

FISH: overview

 Look at the relative location of the gene of interest to identify rearrangements

 Pros:

 Can be fast

 Neoplastic cell percentage irrelevant

 Fairly robust

 Cons:

 Need a good number of well-preserved tumour cells

 Only looks at one gene at a time – inefficient if multiple targets needed

 Subjective assessment

 Rearrangements at the DNA level do not always result in targetable fusion proteins

 Small-scale (e.g. intrachromosomal) rearrangements may be missed

 Need fluorescence microscope, need skilled staff

Structural variant detection Reverse transcription PCR: the theory

Structural variant detection

Reverse transcription PCR: the theory

GUGAUAAUAGUGCGCGUGUAAAUAGCU

Gene 1 Gene 2

Structural variant detection Reverse transcription PCR:

https://www.biocartis.com/sites/default/files/202103/Idylla_GeneFusion-RUO_Tech-Sheet.pdf

Structural variant detection

Reverse transcription PCR: overview

 Much like real-time PCR

 Detects specific fusions of interest

 There is a limit to the number of fusions detectable with a single test

 Generally need one test per gene

 Pros:

 Fast

 Low neoplastic cell percentage requirement

 Small amount of DNA required (per test)

 Cons:

 Will miss rare fusions

 If multiple genes needed, will end up consuming lots of RNA

 Less robust than IHC/FISH

Structural variant detection

Next-generation sequencing

Long repetitive sequence

Difficult to sequence Transcription

Structural variant detection

Next-generation sequencing: overview

 Massively parallel sequencing

 Typically use DNA for small variants and CNVs; RNA for structural variants

 Can assess multiple samples for multiple genes (up to whole genome)

 In theory, will detect any rearrangement in the RNA sequenced

 Pros:

 Should not miss fusions

 Can assess multiple genes in parallel

 If large numbers of targets need assessing, likely to require less RNA overall

 Cons:

 Slower

 Higher neoplastic cell percentage requirement

 Large amount of RNA required if only 1-2 targets needed

 High failure rate

 Expensive infrastructure, need skilled staff

A lung adenocarcinoma is tested for ALK rearrangements using FISH. This demonstrates a rearrangement. Subsequent ALK immunohistochemistry is negative.

Which of the following is most likely to be explanation for this discordance?

A. The rearrangement has not given rise to a functional fusion protein

B. The rearrangement has given rise to a fusion which the immunohistochemical antibody cannot detect

C. Suboptimal tissue processing has given a false positive on FISH

D. The rearrangement has occurred over a short distance, giving rise to false positive result on FISH

E. Non-neoplastic cells have mistakenly been assessed on FISH

How can we test for genomic alterations?

Small variants Structural variants Copy number variants Methylation

Variant detection technologies

Are any of these variants of interest present in this sample?

Real-time PCR

Sequencing

Are any variants present in this sample?

Direct sequencing

Pyrosequencing

Next-generation sequencing

Immunohistochemistry

Can I infer a structural variant from protein expression?

Immunohistochemistry

Can I infer a CNV from protein expression?

In situ hybridisation

Is the gene in an abnormal location?

Reverse transcription PCR

Are any of these fusions of interest present?

Next-generation sequencing

Are any fusions present?

In situ hybridisation

Is there more of this gene than usual?

Next-generation sequencing

Are there extra copies of this gene?

Copy number variant detection Immunohistochemistry

Gene amplification

Overexpression of mRNA

Overexpression of protein

Copy number variant detection Immunohistochemistry

https://diagnostics.roche.com/global/en/products/tests/ventana-her2dual-ish-dna-probe-cocktail-assay.html

Copy number variant detection

Immunohistochemistry:

overview

 Use protein expression to infer the presence of an underlying CNV

 Only works for certain genes

 Often good for ruling out amplification or confirming high-level amplification

 Often struggles with grey area in between

 Pros:

 Fast

 Few tumour cells needed

 Neoplastic cell percentage irrelevant

 Fairly robust

 Cons:

 Only looks at one gene at a time (generally) – inefficient if multiple targets needed

 Subjective – tendency to defer to an alternative technique

 Sensitive to under-fixation

Copy number variant detection

In situ hybridisation: normal

Mean copy number 2

Copy number variant detection

In situ hybridisation: amplification

Mean copy number 4

Copy number variant detection

In situ hybridisation: polysomy

Mean copy number 4

Copy number variant detection

In situ hybridisation: overview

 Look at the number of copies of gene of interest, relative to reference gene

 Pros:

 Can be fast

 Neoplastic cell percentage irrelevant

 Fairly robust

 Cons:

 Need a good number of well-preserved tumour cells

 Only looks at one gene at a time – inefficient if multiple targets needed

 Subjective assessment

 (need fluorescence microscope, need skilled staff)

Non-genomic alterations Mismatch

repair

IHC

Non-genomic alterations

Mismatch repair IHC

MMR-proficient (pMMR)

MMR-deficient (dMMR)

Non-genomic alterations

Mismatch repair IHC

BRAF variant testing V600E detected V600E not detected Possibly germline Colon only

Non-genomic alterations

Mismatch repair IHC/microsatellite instability

Maternal copy Paternal copy

An endometrial cancer shows the following result on MMR immunohistochemistry:

Which of the following is true?

A. The patient likely has Lynch syndrome

B. The next step is to organise referral to clinical genetics.

C. The next step is MLH1 promoter methylation testing.

D. The next step is BRAF V600E testing.

E. The next step is MSI testing.

Non-genomic alterations

PD-L1 IHC

Non-genomic alterations

PD-L1 IHC

PD-L1

PD-1

Non-genomic alterations

PD-L1 IHC

 Depending on tumour type, response to immune checkpoint inhibitors may be correlated with:

Extent of PD-L1 expression

 PD-L1 has:

 Multiple assays

Inability to repair DNA damage

e.g. MMR defects

 Multiple assessment methods (tumour cells, inflammatory cells, both)

 Depends on tumour type and drug to be prescribed

What is the ‘best’ way of identifying small variants?

Oncogenes

EGFR, BRAF, KRAS, NRAS, PIK3CA

Real-time PCR may be viable (except for KIT, PDGFRA)

Tumour suppressors

BRCA

Only sequencing viable

What is the ‘best’ way of identifying small variants?

Real-time PCR

Generally faster

Generally lower neoplastic cell percentage requirement

Generally lower failure rate

Will miss rarer variants

Generally need one test for each gene of interest

Next-generation sequencing

Generally slower

Generally higher neoplastic cell percentage requirement

Generally higher failure rate

Should detect all variants

Can look at dozens/hundreds of genes with no additional tissue

What is the ‘best’ way of identifying structural variants?

DNA-based technologies

FISH DNA NGS

RNA-based technologies IHC

Reverse transcription PCR RNA NGS

Not all rearrangements at the DNA level make it into targetable fusion proteins

A rearrangement detected at the RNA level is more likely to give rise to a targetable fusion protein More false positives

false positives Lower failure rate

failure rate

What is the ‘best’ way of identifying structural variants?

Fast

Few cells needed

Should cover all fusions

Robust

Easy to implement

May not work for some genes

One gene per stain

Questionable definitions of positivity

Can be fast

Works with low neoplastic cell percentage

Needs decent number of cells

One gene at a time

Subjective

May identify non-productive rearrangements

May miss small-scale rearrangements

Fast Works with low neoplastic cell percentage

Low DNA requirement

Should not miss fusions

Can assess multiple genes in parallel

Lower RNA requirements if multiple targets assessed

Misses rare fusions

Generally one gene per reaction

Higher failure rate than IHC/FISH Slower

High neoplastic cell percentage requirement

High failure rate

Expensive

What

are the key molecular alterations in common cancers?

What are the key molecular alterations in common cancers?

 Non-small cell lung cancer

 Colon cancer

 Breast cancer

 High-grade ovarian cancer

 Endometrial cancer  Melanoma

NTRK structural variants

 NTRK1, NTRK2, NTRK3

 A patient with a solid tumour harbouring an NTRK rearrangement and who has no ‘satisfactory’ treatment options is eligible for targeted therapy, irrespective of histological tumour type

Secretory carcinoma of breast

Secretory carcinoma of salivary gland

Infantile fibrosarcoma

Congenital mesoblastic nephroma

‘Wild-type’ GIST

Spitzoid neoplasms

Papillary thyroid carcinoma (esp. paediatric)

Paediatric gliomas

Common cancers

Molecular testing in non-small cell lung cancer

EGFR small variant

BRAF V600 small variant

PCR or sequencing (10-15%)

Sensitive to TKIs

Sensitive to BRAF/MEK inhibitors PCR or sequencing (<5%)

KRAS G12C small variant

ALK structural variant

Sensitive to TKIs IHC, FISH or sequencing (2-3%)

ROS1 structural variant Sensitive to TKIs

or sequencing, ?IHC screening (1-2%)

NTRK structural variant Sensitive to TKIs

Sensitive to KRAS G12C inhibitors PCR or sequencing (10-15%) RET structural variant Sensitive to TKIs

or sequencing, ?IHC screening (1%)

or sequencing (1-2%)

exon 14 skipping variant Sensitive to TKIs

or sequencing (3-4%)

Sensitive to immune checkpoint inhibitors

EGFR small variants in NSCLC

 More common in females, non-/light smokers, especially of (South)

East Asian heritage, with adenocarcinomas

 L858R and exon 19 deletions commonest and associated with strong sensitivity to anti-EGFR TKIs

 T790M associated with resistance

 Patients invariably become resistant after around a year

 Depending on the TKI given, may be important to test for acquisition of secondary T790M variant

 Repeat biopsy or plasma testing

 May prompt change to a different TKI

MET exon 14 skipping variant in NSCLC

PD-L1 expression in NSCLC

A 55 year old man (performance status 1) is diagnosed with widely metastatic lung adenocarcinoma. Molecular testing identifies an ALK rearrangement. No alterations are identified in EGFR, BRAF, KRAS, ROS1, RET, NTRK or MET. PD-L1 TPS is 100%.

Which is the most appropriate first-line treatment?

A. Chemotherapy

B. Immune checkpoint inhibitor therapy

C. Tyrosine kinase inhibitor therapy

D. Combined chemotherapy and immune checkpoint inhibitor therapy

E. Surgery

Molecular testing in colorectal cancer

MMR expression

MSI testing

KRAS variant

NRAS variant

BRAF V600E variant

IHC

MSI testing (15-20%)

PCR or sequencing (30-50%)

PCR or sequencing (5%)

PCR or sequencing (10-15%)

Lynch syndrome, better prognosis, sensitive to immune checkpoint inhibitors

Resistant to anti-EGFR therapy

Resistant to anti-EGFR therapy, poor prognosis, sensitive to MEK inhibitors

A 64 year old woman (performance status 0) is diagnosed with metastatic colorectal cancer. Molecular testing reveals no alterations in KRAS, NRAS or BRAF. MMR protein expression is preserved.

Which is the most appropriate first-line treatment?

A. Tyrosine kinase inhibitor therapy

B. Chemotherapy

C. Surgery

D. Chemotherapy with anti-EGFR monoclonal antibodies

E. Immune checkpoint inhibitor therapy

Molecular testing in breast cancer

HER2 amplification

Sensitive to anti-HER2 therapy IHC+/-ISH or ISH (20%)

Oncotype DX

(ER+ HER2- only) Predicts recurrence risk Commercial assay

PD-L1 expression (TNBC only)

PIK3CA small variant (ER+, HER2- only)

Sensitive to immune checkpoint inhibitors IHC

Sensitive to PI3K inhibitors PCR or sequencing (30-40%)

HER2 amplification testing in breast cancer

https://www.spandidos-publications.com/ol/14/5/5265?text=fulltext https://diagnostics.roche.com/global/en/products/tests/ventana-her2dual-ish-dna-probe-cocktail-assay.html 0/1+

Oncotype DX testing in breast cancer

https://www.oncotypeiq.com/en-CA/breast-cancer/healthcareprofessionals/oncotype-dx-breast-recurrence-score/interpreting-theresults

 Early-stage ER+ HER2-

 Intermediate risk of recurrence post-surgery  Gene expression profile assay  Gives risk of recurrence postsurgery to help establish riskbenefit balance of adjuvant chemotherapy

Molecular testing in high-grade ovarian cancer

Tumour BRCA1/BRCA2 variant

HRD testing

Sequencing (10-25%)

Sensitive to PARP inhibitors

Sensitive to PARP inhibitors + bevacizumab Commercial assay (50%)

Should be done in parallel with germline BRCA1/BRCA2 testing on blood

What is homologous recombination deficiency (HRD)?

How can we test for HRD?

Option 1: Look for the causes

Homologous recombination deficiency (HRD)

Inability to repair double strand DNA breaks

Option 2: Look for the effects

A 71 year old woman (performance status 1) is diagnosed with stage IV primary peritoneal high-grade serous carcinoma. HRD testing on tumour tissue returns the following result:

Genomic instability score: 66 (HRD present)

Tumour BRCA1/BRCA2: No pathogenic variants detected

Which is the correct interpretation?

A. This patient requires further testing to assess for a germline BRCA1/BRCA2 variant

B. This patient is not eligible for PARP inhibitors

C. A tumour BRCA1 or BRCA2 pathogenic variant has been missed

D. HRD testing is not appropriate in primary peritoneal carcinomas

E. A germline BRCA1/BRCA2 variant is exceptionally unlikely in a patient of this age

Molecular testing in endometrial cancer

MMR expression

POLE small variant

More indolent behaviour, lack of benefit from adjuvant therapy Sequencing (10%) All cases at diagnosis

Lynch syndrome, likely better prognosis, sensitive to immune checkpoint inhibitors IHC (15-20%)

A 53 year old woman is diagnosed with poorly differentiated endometrial carcinoma. It shows loss of MSH2 and MSH6 on MMR immunohistochemistry.

Which is the correct interpretation?

A. The MMR result suggests a diagnosis of serous carcinoma

B. MLH1 promoter methylation testing is required

C. This patient has Lynch syndrome

D. This tumour is likely to respond to immune checkpoint inhibitors

E. This tumour is more likely to behave aggressively

Molecular testing in melanoma

BRAF V600 small variant

PD-L1 expression

Sensitive to BRAF/MEK inhibitors

Determines immune checkpoint inhibitor selection PCR or sequencing (50%)

A 67 year old woman is diagnosed with widely metastatic melanoma, with no evidence of a primary cutaneous lesion. Molecular testing reveals a BRAF V600D variant. PD-L1 immunohistochemistry is negative (TPS 0%).

Which is the correct interpretation?

A. This patient’s first treatment option should be chemotherapy

B. This patient should not receive immune checkpoint inhibitors

C. This patient would only be eligible for BRAF/MEK inhibitors if the tumour harboured a V600E variant

D. Detection of a BRAF variant makes a cutaneous origin likely

E. This patient is eligible for monoclonal antibody therapy

Summary

What are the key types of molecular alteration?

Genomic: small variants, structural variants, copy number variants, epigenetic alterations (methylation)

Non-genomic: IHC surrogates of genomic alterations, MMR IHC, PD-L1 IHC

How can we test for molecular alterations?

Small variants: real-time PCR, NGS

Structural variants: IHC, ISH, RT-PCR, NGS

Copy number variants: IHC, ISH

Non-genomic variants: MMR IHC (and MSI), PD-L1 IHC

What are the key molecular alterations in common cancers?

NTRK

Non-small cell lung cancer: EGFR, BRAF, KRAS, ALK, ROS1, RET, METex14, PD-L1

Colon cancer: MMR/MSI, KRAS, NRAS, BRAF

Breast cancer: HER2, Oncotype DX, PD-L1, PIK3CA

High-grade ovarian cancer: BRCA1/2, HRD

Endometrial cancer: MMR, POLE

Melanoma: BRAF, PD-L1

Almost 11 hours of recorded lectures

Document covering molecular pathology matched to the curriculum

Lots of resources!

https://www.molecularpathologyuk.net/

Practice questions

A 79 year old man is diagnosed with metastatic melanoma. Which of the following set of targets is the oncologist most likely to request?

A. BRAF, NRAS and KIT small variant, and PD-L1

immunohistochemistry

B. EGFR, BRAF and KRAS small variant, ALK, ROS1, RET, NTRK small variant, MET exon 14 skipping, and PD-L1 immunohistochemistry

C. KRAS, NRAS and BRAF small variant

D. HRD testing

E. KIT and PDGFRA small variant, and NTRK structural variant

A 65 year old female never-smoker is diagnosed with metastatic lung adenocarcinoma. Performance status is 0 and she is well. Molecular testing reveals an EGFR exon 19 deletion. No clinically relevant variations were detected in the BRAF, KRAS, ALK, ROS1, RET, NTRK or MET genes.

PD-L1 tumour proportion score was 0%.

What is the most appropriate initial treatment?

A. Chemotherapy

B. Surgery

The EGFR variant should be targeted as a priority

Metastatic lung cancer does generally no undergo surgery

C. Radiotherapy

Palliative radiotherapy would only be an option for symptomatic relief

D. Immunotherapy

PD-L1 is low; actionable genomic alterations should be the priority

E. Tyrosine kinase inhibitor therapy

A 76 year old man presents with metastatic melanoma. He has extensive brain metastatic disease and is rapidly deteriorating on ITU. The oncologist tells you that they need to know as quickly as possible whether the patient will be eligible for targeted therapy.

Which would be the most appropriate technique?

A. Fluorescence in situ hybridisation (FISH)

B. Real-time PCR

C. Next-generation sequencing (NGS)

D. RNA microarray

This is used to look for structural or copy number variants

A good option, but would take longer

Used to assess gene expression levels

E. Dual-colour dual-hapten in situ hybridisation (DDISH)

As per FISH

A 65 year old man is diagnosed with caecal adenocarcinoma. MLH1 promoter methylation testing is performed; this demonstrates evidence of MLH1 promoter methylation.

Which is the most likely outcome?

A. Expression of the MLH1 gene is likely to be reduced.

B. MLH1 expression is likely to be preserved on IHC.

C. PMS2 expression is likely to be preserved on IHC.

Expression of both MLH1 and PMS2 is likely to be reduced/lost.

D. There is likely to be a small variant in the MLH1 gene.

E. This patient requires assessment by clinical genetics.

This essentially excludes a germline mechanism.

A 63 year old woman is diagnosed with ductal carcinoma NST. HER2 expression is graded as 3+ on immunohistochemistry.

Identify the best descriptor of HER2.

A. DNA repair protein

B. Immune checkpoint

C. Receptor tyrosine kinase

and BRCA proteins

D. Steroid hormone receptor

E. Transcription factor

A 66 year old man undergoes mediastinal lymph node excision.

Histology demonstrates a lymph node with a tiny focus of subcapsular metastatic adenocarcinoma. Molecular testing needs to be undertaken.

Which of the following is most likely to improve the quality of results obtained.

A. Cut a 10 µm section rather than the usual 5 µm

B. Perform macrodissection

C. Perform microdissection

This will increase the amount of DNA/RNA but still only a tiny amount will be tumour

Would help, but never done in clinical practice

D. Use direct (Sanger) sequencing

Direct sequencing has high neoplastic cell percentage requirements, so this would be a bad option

E. Use a stained section for DNA extraction

Extraction should always be from freshly cut sections wherever possible