Molecular Pathology 2022 by IHC001

Molecular Pathology for the FRCPath part 1 Matt Evans

Disclosures  I have received honoraria from  Agilent Technologies  Amgen  AstraZeneca  Boehringer Ingelheim  Bristol-Myers Squibb  Eli Lilly  Incyte  Merck Sharp & Dohme  Pfizer  Roche

This is only an overview of key areas!  Almost 11 hours of recorded lectures  Document covering molecular pathology matched to the curriculum

 Lots of resources! https://www.molecularpathologyuk.net/

Overview What are the key types of molecular alteration? Genomic: small variants, structural variants, copy number variants, epigenetic alterations (methylation) Non-genomic: IHC surrogates of genomic alterations, MMR IHC, PD-L1 IHC

How can we test for molecular alterations? Small variants: real-time PCR, NGS Structural variants: IHC, ISH, RT-PCR, NGS Copy number variants: IHC, ISH Non-genomic variants: MMR IHC (and MSI), PD-L1 IHC

What are the key molecular alterations in common cancers? NTRK and DPYD Non-small cell lung cancer: EGFR, BRAF, KRAS, ALK, ROS1, RET, METex14, PD-L1 Colon cancer: MMR/MSI, KRAS, NRAS, BRAF Breast cancer: HER2, Oncotype DX, PD-L1, PIK3CA High-grade ovarian cancer: BRCA, HRD Endometrial cancer: MMR, POLE Melanoma: BRAF, PD-L1

What are they key types of molecular alteration?

What are the key types of molecular alteration? Genomic alterations Small variants

Structural variants

Copy number variants

Epigenetic changes (methylation)

ROS1 A

C A

Protein

A>C substitution A

C A

G A

CGCGCGC

Promoter

CD74

Indel: C deletion + AA insertion

Translocation, rearrangement ↓ Fusion

EGFR, KRAS, NRAS, BRAF, KIT, PDGFRA, PIK3CA, BRCA

ALK, ROS1, RET, NTRK, FGFR2, sarcoma, lymphoma

Deletion, loss Amplification, gain HER2, 1p19q codeletion

No protein

TF CH3

CH3

CGCGCGC

MLH1 promoter methylation, MGMT promoter methylation

What are the key types of molecular alteration? Non-genomic alterations Immunohistochemical surrogates for genomic alterations

Mismatch repair (MMR) immunohistochemistry

PD-L1 immunohistochemistry

Small variants: BRAF V600E

Small variants in the MMR genes (usually germline)

Reflects the ability of tumour cells to evade the immune system

Structural variants: ALK, ROS1, NTRK

Methylation of the MLH1 promoter region (usually somatic)

Copy number variants: HER2

How can we test for molecular alterations?

How does pathological processing affect nucleic acids? Ischaemia Autolysis

Formalin fixation

Putrefaction

This will continue for many hours in the centre of a resection specimen if it is not opened/sliced/inflated!

C>T sequence changes

Why do we need to assess samples? Variant alleles

WT alleles

Variant allelic frequency

4 4 4 4 4

0 4 18 28 38

100% 50% 22% 13% 9%

Limit of detection for EGFR L858R: 10% The higher the neoplastic cell %, the lower the risk of missing variants

Why do we need to assess samples? Minimum neoplastic cell percentage 20% Neoplastic cell percentage 50%

Neoplastic cell percentage 5%

There is no evidence of small variants involving the EGFR, BRAF or KRAS genes. There is no evidence of structural variants involving the ALK, ROS1, RET, NTRK1, NTRK2 or NTRK3 genes. There is no evidence of MET exon 14 skipping.

Can safely say there is nothing here

This could be a false negative!

A colorectal cancer sample comprises 10% neoplastic cells. NGS testing is undertaken (minimum neoplastic cell percentage 20%). This reveals a pathogenic KRAS variant. Which is the appropriate interpretation? A. This result could represent a false positive in view of the low neoplastic cell percentage. B. Long duration of formalin fixation would bring this result into doubt. C. This result is likely to be reliable. D. It is likely that other clinically relevant variants have been missed in view of the low neoplastic cell percentage. E. This should be considered a failed test.

How can we test for genomic alterations? Small variants

Structural variants

Variant detection technologies

Immunohistochemistry

Are any of these variants of interest present in this sample?

Can I infer a structural variant from protein expression?

Copy number variants Immunohistochemistry Can I infer a CNV from protein expression?

In situ hybridisation Real-time PCR

Sequencing Are any variants present in this sample?

Is the gene in an abnormal location?

In situ hybridisation

Reverse transcription PCR

Is there more of this gene than usual?

Are any of these fusions of interest present?

Direct sequencing Pyrosequencing Next-generation sequencing

Next-generation sequencing Are any fusions present?

Next-generation sequencing Are there extra copies of this gene?

Methylation

Small variant detection Real-time PCR: the theory

Variant present ↓ Fluorescence

A T

A Variant not present ↓ No fluorescence

Fluorescence

Small variant detection Real-time PCR: the results

PCR cycle

Fluorescence

Small variant detection Real-time PCR: the results

1 2 3 4 5 6 7 8 9 PCR cycle

Small variant detection Real-time PCR: the practical side

Only specific variants detected Will miss rare variants not covered by the included probes

G60D

Multiple variants detected by a single probe Cannot discriminate the exact variant present

https://www.biocartis.com/sites/default/files/2021-03/Idylla_KRASIVD_Tech-Sheet.pdf

Small variant detection Real-time PCR: overview  Detects specific variants of interest  There is a limit to the number of variants detectable with a single test  Only feasible for genes with limited number of hotspots  Generally need one test per gene  Pros:  Fast  Low neoplastic cell percentage requirement  Small amount of DNA required (per test)

 Cons:  Will miss rare variants  If multiple genes needed, will end up consuming lots of DNA

Small variant detection Next-generation sequencing: library preparation

Flow cell binding sequence

Sequencing primer site Insert

Sample index

Small variant detection Next-generation sequencing: library preparation

Small variant detection Next-generation sequencing: read alignment Reference sequence

GAGTGATAGC GATAGC

TGAT AGC

GAG GAGT

AGT

GATAG GATA

AGT GAGTGATAGC

Small variant detection Next-generation sequencing: read alignment

Small variant detection Next-generation sequencing: overview  Massively parallel sequencing  Can assess multiple samples for multiple genes (up to whole genome)  In theory, will detect any variant in the DNA sequenced  Pros:  Should not miss variants  Can assess multiple genes in parallel  If large numbers of targets need assessing, likely to require less DNA overall

 Cons:  Slower  Higher neoplastic cell percentage requirement  Large amount of DNA required if only 1-2 targets needed  Expensive infrastructure, need skilled staff

A 57 year old female non-smoker is diagnosed with lung adenocarcinoma. It is widely metastatic and she is rapidly deteriorating. The oncologist asks for EGFR small variant testing and needs a result as quickly as possible. Which would be the most appropriate technique? A. B. C. D. E.

Immunohistochemistry Next-generation sequencing (panels) Next-generation sequencing (whole gene sequencing) Real-time PCR Fluorescence in situ hybridisation (FISH)

How can we test for genomic alterations? Small variants

Structural variants

Variant detection technologies

Immunohistochemistry

Are any of these variants of interest present in this sample?

Can I infer a structural variant from protein expression?

Copy number variants Immunohistochemistry Can I infer a CNV from protein expression?

In situ hybridisation Real-time PCR

Sequencing Are any variants present in this sample?

Is the gene in an abnormal location?

In situ hybridisation

Reverse transcription PCR

Is there more of this gene than usual?

Are any of these fusions of interest present?

Direct sequencing Pyrosequencing Next-generation sequencing

Next-generation sequencing Are any fusions present?

Next-generation sequencing Are there extra copies of this gene?

Methylation

Structural variant detection Immunohistochemistry EML4 ALK

CD74 ROS1

Others

https://jcp.bmj.com/content/75/3/145 https://www.researchgate.net/publication/ 11224272_RET_Expression_in_Papillary_Thyroid_Cancer_from_Patients_I rradiated_in_Childhood_for_Benign_Conditions

KIF5B RET

Others

Structural variant detection Immunohistochemistry: overview  Use protein expression to infer the presence of an underlying fusion  More useful for certain genes than others  Pros:  Fast  Very few tumour cells needed  Neoplastic cell percentage irrelevant  Not specific for particular fusions  Fairly robust

 Cons:  Only looks at one gene at a time (generally) – inefficient if multiple targets needed  Many markers do not have an objective definition of positivity  Sensitive to under-fixation

Structural variant detection In situ hybridisation: the theory T

Structural variant detection In situ hybridisation: the detection methods Fluorescence in situ hybridisation (FISH)

Chromogenic in situ hybridisation (CISH)

https://www.wicell.org/home/characterization/cgmp-testing-services/cgmp-fluorescence-in-situhybridization-fish/gmp-fluorescence-in-situ-hybridization-fish.cmsx https://www.researchgate.net/figure/Silver-in-situ-hybridization-for-a-case-of-polyCEP17-withHER2-signals-a-and-CEP17_fig1_275046947 https://www.researchgate.net/figure/HPV-ISH-Diffuse-signal-pattern-H-E-400-presents-the-ISHsignals-of-HPV-shown-by_fig1_51488619 https://www.mlo-online.com/home/article/13005291/automated-her2-testing-personalizedhealthcare-for-breast-cancer-patients-enabled-by-novel-molecular-morphology-methods

Silver in situ hybridisation (SISH)

Dual-colour dual-hapten in situ hybridisation (DDISH)

Structural variant detection FISH: interpretation

Structural variant detection FISH: interpretation 1

t(1;2)

Structural variant detection FISH: interpretation Normal

Rearranged

Structural variant detection FISH: overview  Look at the relative location of the gene of interest to identify rearrangements  Pros:  Can be fast  Neoplastic cell percentage irrelevant  Fairly robust

 Cons:  Need a good number of well-preserved tumour cells  Only looks at one gene at a time – inefficient if multiple targets needed  Subjective assessment  Rearrangements at the DNA level do not always result in targetable fusion proteins  Small-scale (e.g. intrachromosomal) rearrangements may be missed  Need fluorescence microscope, need skilled staff

Structural variant detection Reverse transcription PCR: the theory U

Structural variant detection Reverse transcription PCR: the theory

GGCCAT

ACGCGC

AAGCAA

GTGATAATAGTGCGCGTGTAAATAGCT Gene 1 Gene 2

Structural variant detection Reverse transcription PCR: the practical side

https://www.biocartis.com/sites/default/files/2021-03/ Idylla_GeneFusion-RUO_Tech-Sheet.pdf

Structural variant detection Reverse transcription PCR: overview  Much like real-time PCR  Detects specific fusions of interest  There is a limit to the number of fusions detectable with a single test  Generally need one test per gene  Pros:  Fast  Low neoplastic cell percentage requirement  Small amount of DNA required (per test)

 Cons:  Will miss rare fusions  If multiple genes needed, will end up consuming lots of RNA  Less robust than IHC/FISH

Structural variant detection Next-generation sequencing Fusion point Exon 4 ATATA…ATATAT Exon 5 CGCGC…CGCGCG ATATA…ATATATA Exon 7 TCTC…TCTCT Exon 8

Long repetitive sequence Difficult to sequence Transcription

Exon 4 Exon 5 Exon 7 Exon 8

Structural variant detection Next-generation sequencing: overview  Massively parallel sequencing  Typically use DNA for small variants and CNVs; RNA for structural variants  Can assess multiple samples for multiple genes (up to whole genome)  In theory, will detect any rearrangement in the RNA sequenced  Pros:  Should not miss fusions  Can assess multiple genes in parallel  If large numbers of targets need assessing, likely to require less RNA overall

 Cons:  Slower  Higher neoplastic cell percentage requirement  Large amount of RNA required if only 1-2 targets needed  High failure rate  Expensive infrastructure, need skilled staff

A lung adenocarcinoma is tested for ALK rearrangements using FISH. This demonstrates a rearrangement. Subsequent ALK immunohistochemistry is negative. Which of the following is most likely to be explanation for this discordance? A. The rearrangement has not given rise to a functional fusion protein B. The rearrangement has given rise to a fusion which the immunohistochemical antibody cannot detect C. Suboptimal tissue processing has given a false negative on immunohistochemistry D. The rearrangement has occurred over a short distance, giving rise to false positive result on FISH E. Non-neoplastic cells have mistakenly been assessed on FISH

How can we test for genomic alterations? Small variants

Structural variants

Variant detection technologies

Immunohistochemistry

Are any of these variants of interest present in this sample?

Can I infer a structural variant from protein expression?

Copy number variants Immunohistochemistry Can I infer a CNV from protein expression?

In situ hybridisation Real-time PCR

Sequencing Are any variants present in this sample?

Is the gene in an abnormal location?

In situ hybridisation

Reverse transcription PCR

Is there more of this gene than usual?

Are any of these fusions of interest present?

Direct sequencing Pyrosequencing Next-generation sequencing

Next-generation sequencing Are any fusions present?

Next-generation sequencing Are there extra copies of this gene?

Methylation

Copy number variant detection Immunohistochemistry Gene amplification

Overexpression of mRNA

Overexpression of protein

Copy number variant detection Immunohistochemistry

? https://diagnostics.roche.com/global/en/products/tests/ventana-her2dual-ish-dna-probe-cocktail-assay.html

Copy number variant detection Immunohistochemistry: overview  Use protein expression to infer the presence of an underlying CNV  Only works for certain genes  Often good for ruling out amplification or confirming high-level amplification  Often struggles with grey area in between  Pros:  Fast  Few tumour cells needed  Neoplastic cell percentage irrelevant  Fairly robust

 Cons:  Only looks at one gene at a time (generally) – inefficient if multiple targets needed  Subjective – tendency to defer to an alternative technique  Sensitive to under-fixation

Copy number variant detection In situ hybridisation: normal

Mean copy number 2 Ratio 1

Copy number variant detection In situ hybridisation: amplification

Mean copy number 4 Ratio 2

Copy number variant detection In situ hybridisation: polysomy

Mean copy number 4 Ratio 1

Copy number variant detection In situ hybridisation: overview  Look at the number of copies of gene of interest, relative to reference gene  Pros:  Can be fast  Neoplastic cell percentage irrelevant  Fairly robust

 Cons:  Need a good number of well-preserved tumour cells  Only looks at one gene at a time – inefficient if multiple targets needed  Subjective assessment  (need fluorescence microscope, need skilled staff)

Non-genomic alterations Mismatch repair IHC G

C T

MSH6

MLH1

PMS2

MSH6

MSH2

Germline*

MSH2

PMS2

MLH1

Failure of one protein

CH3

Failure of heterodimer Failure of MMR system Accumulation of mutations

Microsatellite instability

Somatic* Could be somatic? Could be germline?

Likely germline

Non-genomic alterations Mismatch repair IHC MMR-proficient (pMMR)

MMR-deficient (dMMR)

Non-genomic alterations Mismatch repair IHC MLH1

PMS2

MSH2

MSH6

MLH1

PMS2

MSH2

MSH6

Colon only BRAF variant testing Possibly germline

V600E detected

V600E not detected

MLH1 promoter methylation testing

Methylated Likely somatic

Not methylated Possibly germline

Non-genomic alterations Mismatch repair IHC/microsatellite instability Maternal copy Paternal copy CG

An endometrial cancer shows the following result on MMR immunohistochemistry: MLH1

PMS2

MSH2

MSH6

Which of the following is true? A. B. C. D. E.

The patient likely has Lynch syndrome The next step is to organise referral to clinical genetics. The next step is MLH1 promoter methylation testing. The next step is BRAF V600E testing. The next step is MSI testing.

Non-genomic alterations PD-L1 IHC

PD-L1

PD-1

Non-genomic alterations PD-L1 IHC  Depending on tumour type, response to immune checkpoint inhibitors may be correlated with: Extent of PD-L1 expression

Inability to repair DNA damage e.g. MMR defects

 PD-L1 has:  Multiple assays  Multiple assessment methods (tumour cells, inflammatory cells, both)

 Depends on tumour type and drug to be prescribed

What is the ‘best’ way of identifying small variants? Oncogenes

Tumour suppressors

EGFR, BRAF, KRAS, NRAS, PIK3CA

BRCA

Real-time PCR may be viable (except for KIT, PDGFRA)

Only sequencing viable

What is the ‘best’ way of identifying small variants? Real-time PCR

Next-generation sequencing

Generally faster

Generally slower

Generally lower neoplastic cell percentage requirement

Generally higher neoplastic cell percentage requirement

Generally lower failure rate

Generally higher failure rate

Will miss rarer variants

Should detect all variants

Generally need one test for each gene of interest

Can look at dozens/hundreds of genes with no additional tissue

What is the ‘best’ way of identifying structural variants? DNA-based technologies

RNA-based technologies

FISH DNA NGS

IHC Reverse transcription PCR RNA NGS

Not all rearrangements at the DNA level make it into targetable fusion proteins

A rearrangement detected at the RNA level is more likely to give rise to a targetable fusion protein

More false positives

Fewer false positives

Lower failure rate

Higher failure rate

What is the ‘best’ way of identifying structural variants? Immunohistochemistry

FISH

Reverse transcription PCR

NGS (RNA-based)

Fast Few cells needed Should cover all fusions Robust Easy to implement

Can be fast Works with low neoplastic cell percentage

Fast Works with low neoplastic cell percentage Low DNA requirement

Should not miss fusions Can assess multiple genes in parallel Lower RNA requirements if multiple targets assessed

May not work for some genes One gene per stain Questionable definitions of positivity

Needs decent number of cells One gene at a time Subjective May identify non-productive rearrangements May miss small-scale rearrangements

Misses rare fusions Generally one gene per reaction Higher failure rate than IHC/FISH

Slower High neoplastic cell percentage requirement High failure rate Expensive

What are the key molecular alterations in common cancers?

What are the key molecular alterations in common cancers?  Non-small cell lung cancer  Colon cancer  Breast cancer  High-grade ovarian cancer  Endometrial cancer  Melanoma

NTRK structural variants  NTRK1, NTRK2, NTRK3  A patient with a solid tumour harbouring an NTRK rearrangement and who has no ‘satisfactory’ treatment options is eligible for targeted therapy, irrespective of histological tumour type Secretory carcinoma of breast Secretory carcinoma of salivary gland Infantile fibrosarcoma Congenital mesoblastic nephroma

‘Wild-type’ GIST Spitzoid neoplasms Papillary thyroid carcinoma (esp. paediatric) Paediatric gliomas

Common cancers

DPYD variants  5-fluoruracil and capecitabine are mostly degraded by DPD  3-5% European populations have variants in DPYD which reduce metabolism  Prone to more severe (possibly fatal) side-effects  DPYD testing advised prior to treatment:  Dose reduction  Alternative regimen

 Mostly GI, HPB, breast and head & neck  Testing almost always organised by clinicians on blood

Rare/very rare in squamous cell carcinomas

Molecular testing in non-small cell lung cancer EGFR small variant

PCR or sequencing (10-15%)

Sensitive to TKIs

BRAF V600 small variant

PCR or sequencing (<5%)

Sensitive to BRAF/MEK inhibitors

KRAS G12C small variant

PCR or sequencing (10-15%)

Sensitive to KRAS G12C inhibitors

ALK structural variant

IHC, FISH or sequencing (2-3%)

Sensitive to TKIs

ROS1 structural variant

FISH or sequencing, ?IHC screening (1-2%)

Sensitive to TKIs

NTRK structural variant

FISH or sequencing, ?IHC screening (1%)

Sensitive to TKIs

RET structural variant

FISH or sequencing (1-2%)

Sensitive to TKIs

MET exon 14 skipping variant

PCR or sequencing (3-4%)

Sensitive to TKIs

PD-L1 expression

IHC (25% low positive, 30% high positive)

Sensitive to immune checkpoint inhibitors

EGFR small variants in NSCLC  More common in females, non-/light smokers, especially of (South) East Asian heritage, with adenocarcinomas  L858R and exon 19 deletions commonest and associated with strong sensitivity to anti-EGFR TKIs  Exon 20 insertions and T790M associated with resistance  Patients invariably become resistant after around a year  Depending on the TKI given, may be important to test for acquisition of secondary T790M variant  Repeat biopsy or plasma testing  May prompt change to a different TKI

MET exon 14 skipping variant in NSCLC Exon 12

Exon 13

Exon 14

Exon 15

Exon 16

Transcription and translation Exon 12

Exon 13

Exon 14

Exon 15

MET METprotein proteinaccumulation degradation

Exon 16

PD-L1 expression in NSCLC TPS <1% Pembrolizumab + chemo

TPS 1-49% Pembrolizumab + chemo

TPS ≥50% Pembrolizumab

A 55 year old man (performance status 1) is diagnosed with widely metastatic lung adenocarcinoma. Molecular testing identifies an ALK structural variant. No alterations are identified in EGFR, BRAF, KRAS, ROS1, RET, NTRK or MET. PD-L1 TPS is 100%. Which is the most appropriate first-line treatment? A. B. C. D. E.

Chemotherapy Immune checkpoint inhibitor therapy Tyrosine kinase inhibitor therapy Combined chemotherapy and immune checkpoint inhibitor therapy Surgery

All cases at diagnosis

Molecular testing in colorectal cancer MMR expression MSI testing

IHC MSI testing (15-20%)

Lynch syndrome, better prognosis, sensitive to immune checkpoint inhibitors

KRAS variant

PCR or sequencing (30-50%)

Resistant to anti-EGFR therapy

NRAS variant

PCR or sequencing (5%)

Resistant to anti-EGFR therapy

PCR or sequencing (10-15%)

Resistant to anti-EGFR therapy, poor prognosis, sensitive to MEK inhibitors

BRAF V600E variant

A 64 year old woman (performance status 0) is diagnosed with metastatic colorectal cancer. Molecular testing reveals no alterations in KRAS, NRAS or BRAF. MMR protein expression is preserved. Which is the most appropriate first-line treatment? A. B. C. D. E.

Tyrosine kinase inhibitor therapy Chemotherapy Surgery Chemotherapy with anti-EGFR monoclonal antibodies Immune checkpoint inhibitor therapy

All cases at diagnosis

Molecular testing in breast cancer HER2 amplification

IHC+/-ISH or ISH (20%)

Sensitive to anti-HER2 therapy

Oncotype DX (ER+ HER2- only)

Commercial assay

Predicts recurrence risk

PD-L1 expression (TNBC only)

IHC

Sensitive to immune checkpoint inhibitors

PIK3CA small variant (ER+, HER2- only)

PCR or sequencing (30-40%)

Sensitive to PI3K inhibitors

HER2 amplification testing in breast cancer 0/1+

https://www.spandidos-publications.com/ol/14/5/5265?text=fulltext https://diagnostics.roche.com/global/en/products/tests/ventana-her2dual-ish-dna-probe-cocktail-assay.html

Oncotype DX testing in breast cancer  Early-stage ER+ HER2 Intermediate risk of recurrence post-surgery  Gene expression profile assay  Gives risk of recurrence postsurgery to help establish riskbenefit balance of adjuvant chemotherapy https://www.oncotypeiq.com/en-CA/breast-cancer/healthcareprofessionals/oncotype-dx-breast-recurrence-score/interpreting-theresults

Molecular testing in high-grade ovarian cancer Tumour BRCA1/BRCA2 variant

Sequencing (10-25%)

Sensitive to PARP inhibitors

HRD testing

Commercial assay (50%)

Sensitive to PARP inhibitors + bevacizumab

Requires explicit consent, should be done in parallel with germline BRCA1/BRCA2 testing on blood

What is homologous recombination deficiency (HRD)?

BRCA1

BRCA2

PARP

BRCA2

Cancers

PARP

Cancer cell death ‘Synthetic lethality’

How can we test for HRD? Option 1: Look for the causes

Others

BRCA1 promoter methylation

BRCA1 variant

BRCA2 variant

BRCA2 promoter methylation

Others

Homologous recombination deficiency (HRD) Inability to repair double strand DNA breaks

Telomeric allelic imbalance

Large scale state transitions

Loss of heterozygosity

HRD testing

Option 2: Look for the effects

A 71 year old woman (performance status 1) is diagnosed with stage IV primary peritoneal high-grade serous carcinoma. HRD testing on tumour tissue returns the following result: Genomic instability score: 66 (HRD present) Tumour BRCA1/BRCA2: No pathogenic variants detected Which is the correct interpretation? A. B. C. D. E.

This patient requires further testing to assess for a germline BRCA1/BRCA2 variant This patient is not eligible for PARP inhibitors A tumour BRCA1 or BRCA2 pathogenic variant has been missed HRD testing is not appropriate in primary peritoneal carcinomas A germline BRCA1/BRCA2 variant is exceptionally unlikely in a patient of this age

All cases at diagnosis

Molecular testing in endometrial cancer MMR expression

IHC (15-20%)

Lynch syndrome, likely better prognosis, sensitive to immune checkpoint inhibitors

POLE small variant

Sequencing (10%)

More indolent behaviour

A 53 year old woman is diagnosed with poorly differentiated endometrial carcinoma. It shows loss of MSH2 and MSH6 on MMR immunohistochemistry. Which is the correct interpretation? A. B. C. D. E.

The MMR result suggests a diagnosis of serous carcinoma MLH1 promoter methylation testing is required This patient has Lynch syndrome This tumour is likely to respond to immune checkpoint inhibitors This tumour is more likely to behave aggressively

Molecular testing in melanoma BRAF V600 small variant

PCR or sequencing (50%)

Sensitive to BRAF/MEK inhibitors

PD-L1 expression

IHC

Determines immune checkpoint inhibitor selection

A 67 year old woman is diagnosed with widely metastatic melanoma, with no evidence of a primary cutaneous lesion. Molecular testing reveals a BRAF V600D variant. PD-L1 immunohistochemistry is negative (TPS 0%). Which is the correct interpretation? A. This patient’s first treatment option should be chemotherapy B. This patient should not receive immune checkpoint inhibitors C. This patient would only be eligible for BRAF/MEK inhibitors if the tumour harboured a V600E variant D. Detection of a BRAF variant makes a cutaneous origin likely E. This patient is eligible for monoclonal antibody therapy

Summary What are the key types of molecular alteration? Genomic: small variants, structural variants, copy number variants, epigenetic alterations (methylation) Non-genomic: IHC surrogates of genomic alterations, MMR IHC, PD-L1 IHC

This is only an overview of key areas!  Almost 11 hours of recorded lectures  Document covering molecular pathology matched to the curriculum

 Lots of resources! https://www.molecularpathologyuk.net/

Practice questions

A 79 year old man is diagnosed with metastatic melanoma. Which of the following set of targets is the oncologist most likely to request? A. BRAF, NRAS and KIT small variant, and PD-L1 immunohistochemistry B. EGFR, BRAF and KRAS small variant, ALK, ROS1, RET, NTRK small variant, MET exon 14 skipping, and PD-L1 immunohistochemistry NSCLC C. KRAS, NRAS and BRAF small variant Colon D. HRD testing Ovary E. KIT and PDGFRA small variant, and NTRK structural variant

GIST

A 65 year old female never-smoker is diagnosed with metastatic lung adenocarcinoma. Performance status is 0 and she is well. Molecular testing reveals an EGFR exon 19 deletion. No clinically relevant variations were detected in the BRAF, KRAS, ALK, ROS1, RET, NTRK or MET genes. PD-L1 tumour proportion score was 0%. What is the most appropriate initial treatment? A. B. C. D. E.

The EGFR variant should be targeted as a priority

Chemotherapy Metastatic lung cancer does generally no undergo surgery Surgery Palliative radiotherapy would only be an option for symptomatic relief Radiotherapy PD-L1 is low; actionable genomic alterations should be the priority Immunotherapy Tyrosine kinase inhibitor therapy

A 76 year old man presents with metastatic melanoma. He has extensive brain metastatic disease and is rapidly deteriorating on ITU. The oncologist tells you that they need to know as quickly as possible whether the patient will be eligible for targeted therapy. Which would be the most appropriate technique? A. B. C. D. E.

This is used to look for structural or copy number variants

Fluorescence in situ hybridisation (FISH) Real-time PCR A good option, but would take longer Next-generation sequencing (NGS) Used to assess gene expression levels RNA microarray As per FISH Dual-colour dual-hapten in situ hybridisation (DDISH)

A 65 year old man is diagnosed with caecal adenocarcinoma. MLH1 promoter methylation testing is performed; this demonstrates evidence of MLH1 promoter methylation. Which is the most likely outcome? A. B. C. D. E.

Expression of the MLH1 gene is likely to be reduced. MLH1 expression is likely to be preserved on IHC. Expression of both MLH1 and PMS2 is likely to be reduced/lost. PMS2 expression is likely to be preserved on IHC. There is likely to be a small variant in the MLH1 gene. This essentially This patient requires assessment by clinical genetics. excludes a germline mechanism.

A 63 year old woman is diagnosed with ductal carcinoma NST. HER2 expression is graded as 3+ on immunohistochemistry. Identify the best descriptor of HER2. A. B. C. D. E.

DNA repair protein MMR and BRCA proteins Immune checkpoint PD-L1 Receptor tyrosine kinase Like EGFR, ALK, ROS1, RET, TRK Steroid hormone receptor ER and PR Transcription factor MYC

A 66 year old man undergoes mediastinal lymph node excision. Histology demonstrates a lymph node with a tiny focus of subcapsular metastatic adenocarcinoma. Molecular testing needs to be undertaken. Which of the following is most likely to improve the quality of testing. A. B. C. D. E.

This will increase the amount of DNA/RNA but still only a tiny amount will be tumour

Cut a 10 µm section rather than the usual 5 µm Perform macrodissection Would help, but never done in clinical practice Direct sequencing has high neoplastic cell percentage Perform microdissection requirements, so this would be a bad option Use direct (Sanger) sequencing Extraction should always be from freshly cut sections wherever possible Use a stained section for DNA extraction

Thank you