tjh-2011-4

Issue 4

December 2011

40 TL

ISSN 1300-7777

Volume 28

Review Article Inherited disorders in ancient Anatolian populations Yeşim Doğan Alakoç, et al.; Ankara, Turkey

Research Articles Children with β-thalassemia mutations in Şanlıurfa, Turkey Ali Ayçiçek et al.; Şanlıurfa, Turkey

Antifungal prophylaxis in stem cell transplantation Hamdi Akan; Ankara, Turkey

Biological effects of Ankaferd® Erkan Yılmaz et al.; Ankara, Turkey

Children with nutritional vitamin B12 deficiency Melike Sezgin Evim et al.; Bursa, Turkey

Oral findings of IDPF

Müjgan Güngör Hatipoglu et al.; Kütahya, Ankara, Turkey

Factor V Leiden and Budd-Chiari syndrome

Tawhida Y. Abdel Ghaffar et al.; Cairo, Egypt, Ankara, Turkey

Thrombosis in CMPD

Nur Soyer et al.; İzmir, Turkey

Cover Picture: Abbara Dr. Ali Uğur Ural

TJH-ARALIK-2011-4-crossref.indd 1

4

02.12.2011 10:13

Editor-in-Chief

International Review Board

Aytemiz Gürgey

Nejat Akar (Turkey) Görgün Akpek (USA) Serhan Alkan (USA) Çiğdem Altay (Turkey) Koen van Besien (USA) Ayhan Çavdar (Turkey) M.Sıraç Dilber (Sweden) Ahmet Doğan (USA) Peter Dreger (Germany) Thierry Facon (France) Jawed Fareed (USA) Gösta Gahrton (Sweden) Dieter Hoelzer (Germany) Marilyn Manco-Johnson (USA) Andreas Josting (Germany) Emin Kansu (Turkey) Winfried Kern (Germany) Nigel Key (USA) Korgün Koral (USA)

Associate Editors

Mutlu Arat Muzaffer Demir Reyhan Diz Küçükkaya Mehmet Ertem Hale Ören Mehmet Ali Özcan Ayşegül Ünüvar Celalettin Üstün Neşe Yaralı Akif Selim Yavuz Past Editors

Hamdi Akan Erich Frank Orhan Ulutin Senior Advisory Board

Yücel Tangün Osman İlhan Muhit Özcan

Language Editors

Corinne Can Scott Evans

Contact Information

All other inquiries should be adressed to

Editorial Correspondence should be addressed to Dr. Aytemiz Gürgey Editor-in-Chief Address: 725. Sok. Görkem Sitesi Yıldızevler No: 39/2 , 06550 Çankaya, Ankara, Turkey Phone: +90 312 438 14 60 E-mail: agurgey@hacettepe.edu.tr

TURKISH JOURNAL OF HEMATOLOGY Address: İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No:8 06550 Çankaya, Ankara/Turkey Phone: +90 312 490 98 97 Fax: +90 312 490 98 68 E-mail: info@tjh.com.tr ISSN: 1300-7777

Turkish Society of Hematology

Statistic Editor

Teoman Soysal, President Muzaffer Demir, General Secretary Hale Ören, Vice President İbrahim Haznedaroğlu, Research Secretary Fahir Özkalemkaş, Treasurer Zahit Bolaman, Member Mehmet Sönmez, Member

Mutlu Hayran Editorial Secretary

İpek Durusu Bengü Timoçin Cover Picture: Abbara

Ali Uğur Ural was born in 1960 in Turkey. He is currently working at Gülhane Military Medical Academy, Deparment of Hematology, Ankara

Abdullah Kutlar (USA) Luca Malcovati (Italy) Robert Marcus (United Kingdom) Jean Pierre Marie (France) Ghulam Mufti (UK) Gerassimos A. Pangalis (Greece) Antonio Piga (Italy) Ananda Prasad (USA) Jacob M. Rowe (Israel) Jens-Ulrich Rüffer (Germany) Norbert Schmit (Germany) Orhan Sezer (Germany) Anna Sureda (Spain) Ayalew Tefferi (USA) Nüket Tüzüner (Turkey) Catherine Verfaillie (USA) Srdan Verstovsek (USA) Claudio Viscoli (Italy)

Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish Journal of Hematology’nin Türk Hematoloji Derneği İkdisadi İşletmesi tarafından yayınlanmasına karar vermiştir.

Online Manuscript Submission http://mc.manuscriptcentral.com/tjh

Web page

www.tjh.com.tr

Sahibi

Türk Hematoloji Derneği adına Muhit Özcan

Sorumlu Yazı İşleri Müdürü Aytemiz Gürgey

Yayın ve Yönetim Yeri

Türk Hematoloji Derneği Türk Ocağı Cad. 17/6 Cağaloğlu-Eminönü-İstanbul Üç ayda bir yayınlanan uluslararası bilimsel dergidir.

Baskı: ADA Ofset Matbaacılık Tic. Ltd. Şti.

Basım Tarihi: Kasım 2011

Publisher: AVES Address: Kızılelma Cad. 5/3 34096 Fındıkzade-İstanbul-Turkey Phone: +90 212 589 00 53 Fax: +90 212 589 00 94 E-mail: info@avesyayincilik.com

A-I TJH-ARALIK-2011-4-crossref.indd 2

02.12.2011 10:13

AIMS AND SCOPE The Turkish Journal of Hematology is the regular publishing organ of the Turkish Society of Hematology. This periodical journal covers subjects on hematology. The journal is an independent, peer-reviewed international periodical, published quarterly (March, June, September and December) in English language. The Turkish Journal of Hematology is a nonprofit scientific peer reviewed journal.

Editorial Board of Turkish Journal of Hematology works under the principles of The World Association of Medical Editors (WAME), the International Council of Medical Journal Editors (ICMJE), and Committee on Publication Ethics (COPE).

The aim of the Turkish Journal Hematology is to publish original research papers of highest scientific and clinical value on hematology. Additionally, educational material, reviews on basic developments, editorial short notes, case reports, original views and letters from specialists on hematology, and hematology medicine covering their experience and comments as well as social subjects are published.

General Practitioners interested in hematology, and internal medicine specialists, are also our target audience, and we will arrange the Turkish Journal of Hematology according to their needs. The Turkish Journal of Hematology is indexed in - Science Citation Index Expanded - EMBASE - Scopus - CINAHL - Gale/Cengage Learning - EBSCO - DOAJ - ProQuest - Index Copernicus - Tübitak/Ulakbim Turkish Medical Database Subscription Information The Turkish Journal of Hematology is sent free of charge to hematologists and academicians in our country as well as to other specialists interested in hematology. All published volumes in full text can be reached free of charge through the web site www.tjh.com.tr Adress: Ilkbahar mah. Turan Güneş Bulvarı 613. sok. No: 8 Çankaya-Ankara, Turkey Telephone: +90 312 490 98 97 Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh Web page: www.tjh.com.tr E-mail: info@tjh.com.tr Permissions Requests for permission to reproduce published material should be sent to the editorial office.

Editor: Prof. Dr. Aytemiz Gürgey Adress: Ilkbahar mah. Turan Güneş Bulvarı 613. sok. No: 8 Çankaya-Ankara, Turkey Telephone: +90 312 490 98 97 Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh Web page: www.tjh.com.tr E-mail: info@tjh.com.tr Instructions for Authors Instructions for authors are published in the journal and on the web page www.tjh.com.tr Material Disclaimer The author(s) is (are) responsible from the articles published in the Turkish Journal of Hematology. The editor, editorial board and publisher do not accept any responsibility for the articles.

The journal is printed on acid-free paper.

A-II TJH-ARALIK-2011-4-crossref.indd 3

02.12.2011 10:13

INSTRUCTION TO AUTHORS The Turkish Journal of Hematology accepts invited review articles, research articles, brief reports, case reports, letters to the editor, and images in Hematology on subjects within the scope of hematology, on the condition that they have not been previously published elsewhere.

All papers are subject to editorial revision for purpose of conformity to the style adopted by the Journal. Evaluation is a double blind kind of evaluation.

Original research articles Regular Articles Maximum length for a Regular Article is 4,000 words of text. Abstracts must not exceed 300 words with subheadings; objective, material and methods, results, conclusion. Submissions are limited to a total of 7 figures/tables. References should be limited to 50. The sections of a Regular Article should include Abstract, Introduction, Material and Methods, Results, Discussion, References, Figure Legends. Editorial Board of Turkish Journal of Hematology works under the principles of The World Association of Medical Editors (WAME), the International Council of Medical Journal Editors (ICMJE), and Committee on Publication Ethics (COPE).

Brief Reports Short manuscripts definitively documenting either experimental results or informative clinical observations will be considered as brief report.

Brief Reports should not exceed 1,000 words of text not counting the abstract, figure legends, and references; abstracts must not exceed 300 words.

Review Articles Review articles should not exceed 4,000 words in length, must include an abstract of 300 words or fewer, and may not have more than 100 references.

Letters to the Editor Letters can include no more than 400 words of text, 5-10 references, and 1 figure or table. No abstract is required, but please include a brief title.

Images in Hematology Authors can submit for consideration an illustration (or, where appropriate, two or more related images) which is interesting, instructive and visually attractive, with a few lines of

explanatory text and references. The images (e.g. a clinical photograph, radiology, cytology, histology, a laboratory test) should be submitted in a digital format.

Preparation of Manuscript Each of the following sections of the manuscript should be typed on separate pages. Title Page should include (in Turkish when possible): (a) title of the article in a concise but informative style, (b) first name, middle initial, last name of each author, (c) name of department(s) and institution(s) to which the work should be attributed, (d) name and address of author responsible for correspondence for the manuscript, (e) name and address of author to whom requests for reprints should be addressed, (f) source(s) of support in the form of grants, equipments, drugs, etc., and (h) short running title of no more than 50 characters.

Authorship Each author should have participated sufficiently in the work to take public responsibility for the content. Any part of an article critical to its main conclusions must be the responsibility of at least one author. All authors’ signatures should be included in the title page.

The signed statement on absence of conflict of interests between authors is required.

Acknowledgments Acknowledge support received from individuals, organizations, grants, corporations, or any other sources. For work involving a biomedical product or potential product partially or wholly supported by corporate funding, a note must be included stating: This study was supported (in part) by research funding from (company name) to (authors’ initials). Grant support, if received, needs to be stated and the specific granting institution(s) name(s) and grant numbers provided when applicable.

Authors are expected to disclose, on the title page of their manuscripts, any commercial or other associations that might pose a conflict of interest in connection with the submitted article. All funding sources supporting the work, and institutional or corporate affiliations of the authors, should be acknowledged on the title page.

Ethics When reporting experiments on human subjects indicate whether the procedures followed were in accordance with the ethical standards of the responsible committee on human experimentation. An approval of research protocols by ethic committee in accordance with international agreements (Helsinki Declaration of 1975, revised 2002 available at http://www. wma.net/en/30publications/10policies/b3/ “Guide for the care and use of laboratory animals www.nap.edu/catalog/5140.html/) is required for experimental, clinical and drug studies.

Do not use patient names, initials, or hospital numbers, especially in any illustrative material.

Manuscripts reporting the results of experimental investigations on human subjects must include a statement to the effect that procedures had received official institutional approval. The statement on the informed consent of patients is required.

We frown upon unethical practices such as plagiarism, duplicate publication, ‘salami’ publication, and efforts to influence the review process with practices such as gifting authorship, inappropriate acknowledgements and references.

Also, authors must respect patients’ right to privacy.

Abstract and key words: The second page should include an Abstract which does not exceed 300 words. For manuscripts sent from Turkey, a title and abstract in Turkish are required. The abstract should state the purpose of the study or investigation, basic procedures, methods, main findings, specific data, statistical significance and the principal conclusions. Provide 4 to 10 key words below the abstract to assist indexers.

Use terms from the Medical Subject Headings List of Index Medicus. The text should be divided into sections with headings as follows: Objective, Materials and Methods, Results and Conclusion. Other types of articles such as case reports, reviews, perspectives and editorials will be published according to uniform requirements.

Introduction: State the purpose of the article and summarize the rationale for the study.

Materials and Methods: Describe your selection of the observational or experimental subjects clearly. Identify the methods and procedures

A-III TJH-ARALIK-2011-4-crossref.indd 4

02.12.2011 10:13

in sufficient detail to allow other workers to reproduce the results. Give references to established methods (including statistical methods), provide references and brief modified methods, give reasons for using them and evaluate their limitations. Identify all drugs and chemicals used, including generic name(s), dose(s) and route(s) of administration.

Statistics: Describe statistical methods in enough detail to enable a knowledgeable reader with access to the original data to verify the reported results. Give details about randomization, describe treatment complications, give number of observations, and specify any computer program used.

Results: Present your results in logical sequence in the text, tables and illustrations. Do not repeat in the text all the data in the tables or illustrations; emphasize or summarize only important observations.

Discussion: Emphasize the new and important aspects of the study and the conclusions that follow them. Link the conclusions with the goals of the study but avoid unqualified statements and conclusions not completely supported by your data.

References: Identify references in text, tables and legends by Arabic numerals in parentheses.

Number references consecutively in the order in which they are first mentioned in the text. The titles of the journals should be abbreviated according to the style used in Index Medicus; consult List of Journals Indexed in Index Medicus. Include among the references any papers accepted but not yet published, designating the journal and followed by “in press”.

Articles in Journals 1. List all authors Williams RL, Hilton DJ, Pease S, Wilson TA, Stewart CL, Gearing DP, Wagner EF, Metcalf D, Nicola NA, Gough NM. Myeloid leukemia inhibitory factor (LIF) maintains the developmental potential of embryonic stem cells.

Nature 1988;336:684-7.

2. Organization as author Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of syngeneic bone marrow graft without preconditioning in posthepatitis marrow aplasia. Lancet 1977;2:742-4.

3. Complete book Adams DO, Edelson PJ, Koren HS. Methods for studying mononuclear phagocytes. San Diego: Academic Press, 1981.

4. Chapter of book Smolen JE, Boxer LA. Functions of Neutrophils.

In: Williams WJ, Beutler E, Erslev AJ, Lichtman MA, eds. Hematology. 4th ed. New York: McGraw-Hill, 1991: 780-94.

5. Abstract Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin) stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).

6. Letter to the Editor Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further definition of 20q deletion in myeloid leukemia using fluorescence in situ hybridization. Blood 1994;84:2821-3.

7. CD-ROM Anderson SC, Poulsen KB, Andersüon’s electronic atlaso hematology [CD-ROM].

Philadelphia: Lippincott Williams&Wilkins: 2002.

8. Journal article on the internet Abood S. Quality improvement intititative in nursing homes: The ANA acts in an advisory role. Am J Nurs [serial on the Internet.] 2002 n [cited 2002 Aug 12]:102(6)[about 3 p.] Available from: http:/www.nursing world.org/AJN/2002/ June/Wawatch.htm.

9. Homepage/Web site Cancer-Pain.org [homepage on the Internet].

New York: Association of Cancer Online Resources, Inc.: c2000-01 [updated 2002 May 16: cited 2002 Jul 9]. Available from: hhtp:// www.cancer-pain.org/.

Tables Type each table on a separate sheet. Number tables consecutively in the order of appearance in the text and supply a brief title for each. Give each column a short or abbreviated heading. Place explanatory statistical measures of variations such as standard deviation or standard error of mean.

Be sure that each table is cited in the text.

Illustrations Figures should be professionally drawn and photographed. Please send sharp, glossy, black

and white photographic prints, usually 9 x 13 cm.

Affix a label to the back of each figure indicating the number of the figure, first author’s name and top of the figure. Type legends for illustrations double-spaced, starting on a separate page with Arabic numerals corresponding to the illustrations.

Explain the internal scale and identify method of staining.

Units of Measurement Measurements should be reported in the metric system in terms of the International System of Units (SI). Consult SI Unit Conversion Guide, New England Journal of Medicine Books 1992, when necessary.

Abbreviations and Symbols Use only standard abbreviations. Avoid abbreviations in the title and abstract. The full term for which an abbreviation stands should precede its first use in the text unless it is a standard abbreviation.

ONLINE MANUSCRIPT PROCESS

SUBMISSION

The Turkish Journal of Hematology now uses submission software powered by ScholarOne Manuscripts. The website for submissions to the Turkish Journal of Hematology is: http:// mc.manuscriptcentral.com/tjh. This system is quick and convenient for both authors and reviewers.

Manuscript Types accepted by the Turkish Journal of Hematology are: Original Article, Case Reports, Images in Hematology, Brief Reports, Letter to the Editor, Invited Review Setting up an account New users to the submission site will need to register and enter their account details before they may submit an article. Log-in or click the “Create Account” option if you are a first-time user. If you are creating a new account: After clicking on “Create Account”, enter your name and e-mail information and click “Next”.

Your e-mail information is very important.

Enter your institution and address information as appropriate, and then click “Next.”

Enter a user ID and password of your choice, and then select your area of expertise.

Click “Finish”.

A-IV TJH-ARALIK-2011-4-crossref.indd 5

02.12.2011 10:13

If you have an account, but have forgotten your log-in details, go to Password Help on the journal’s online submission system and enter your e-mail address. The system will send you an automatic user ID and a new temporary password.

Full instructions and support are available on the site and a user ID and password can be obtained on the first visit. Full support for authors is provided. Each page has a 'Get Help Now' icon on the site connecting directly to the online support system. Contact the journal administrator for any questions about submitting your manuscript to the journal (info@tjh.com.tr). For Customer Support from ScholarOne Manuscripts, click on the Get Help Now link on the top right hand corner of every screen on the site.

The electronic submission process Log-in to your author centre. Once you have logged-in, click the “Submit a Manuscript” link in the menu bar.

Enter data and answer questions as appropriate.

You may copy and paste directly from your paper. Click the "Next" button on each screen to save your work and advance to the next screen.

Upload of files: Click on the “Browse” button and locate the file on your computer.

Select the appropriate designation of each file in the drop-down menu next to the Browse button.

When you have selected all files you wish to upload, click the “Upload Files” button.

Review your submission before sending to the Journal. Click the “Submit” button when you are finished reviewing.

You can check ScholarOne Manuscripts at any time to see the status of your paper. The Journal’s Editorial Office will inform you by e-mail once a decision has been made.

Once your paper has been submitted, a ‘checklist’ will then be completed by the Editorial Assistant.

The Editorial Assistant will check to see that the paper has all required components and adheres to the author guidelines. Once the Editorial Assistant is satisfied with the paper it will be

forwarded to the Senior Editor who will assign an editor and reviewers.

The review process All papers submitted to TJH are subject to an initial review by the Editorial Office, to check that the paper is proper for TJH’s aims and scope and complies with essential requirements.

Papers sent on to peer review will be assigned to one of TJH’s Associate Editors with expertise in the relevant field. Papers are single-blind peer reviewed. All accepted manuscripts will be sent to a statistical and English Language editor before publishing.

Once papers have been reviewed, the reviewers’ comments are sent to the Editor, who will then make a preliminary decision on the paper. At this stage, based on the feedback from reviewers, manuscripts can be accepted, rejected, or revisions can be recommended.

Following initial peer-review, articles judged worthy of further consideration often require revisions. Revised manuscript generally must be received within 3 months of the date on the initial decision. Extensions must be requested from the Associate Editor at least 2 weeks before the 3-month revision deadline expires.

Otherwise Turkish Journal of Hematology will reject manuscripts which do not received within 3 months of the date on the initial revesion decision. Papers which have extensive revisions recommended will be sent out for further review (usually by the same reviewers) on their resubmission.

When a paper is finally accepted, the Technical Editor undertakes a final edit and a marked-up copy will be emailed to you to make any final adjustments.

Submission of revised papers When you are revising your paper, taking on board the reviewers’ and Editor’s feedback, please highlight all changed text in red font.

Please do not use track changes as they can make papers difficult to follow.

To submit revised papers please log into your author centre in ScholarOne Manuscripts. Your paper will be stored under ‘manuscripts with decisions’. Please click on the ‘create a revision’

link, located to the right of the paper title. A revised paper number will be created for you.

You will then need to click on the ‘continue submission’ option.

You will be taken to a submission process very similar to that for new papers. You will be able to amend any details you wish. At stage 6 (‘File upload’) please delete the file for your original paper, and upload your revised paper.

Please upload an anonymous cover letter, preferably in table format, which includes a point by point response to the feedback given in the decision email, alongside your revised paper word file.

You will then need to review your paper as a PDF, and click ‘submit’. Your paper will have the same ID number as your original paper, with an ‘R’ and a number on the end-for example, TJH-2011-0001 for an original paper, TJH-20110001.R1 for a ‘revision one’, and so on.

Please do not submit your revised paper as a new paper, as revised manuscripts are processed differently. If, when you click on ‘create a revision’, a message is shown saying that the revision option has expired, please contact the Editorial Assistant on info@tjh.com.tr to get it reactivated.

English-language editing All manuscripts are professionally edited by English language editor before publication.

Online Early Turkish Journal of Hematology published abstracts of accepted articles online in advance of their publication in a printed issue. Once an accepted article has been edited, the authors have submitted any final corrections, and all changes have been incorporated, the article will be published online.

Then, the article will receive a Digital Object Identifier (DOI number).

A Copyright transfer and conflict of interest form signed by all authors, must also be submitted by fax to +90 3124909868. Both forms can be found at the web site www.tjh.com.tr Authors of accepted manuscripts will receive electronic page proofs directly from the printer and are responsible for proofreading and checking the entire article, including tables, figures, and references. Page proofs must be returned within 48 hours to avoid delays in publication.

A-V TJH-ARALIK-2011-4-crossref.indd 6

02.12.2011 10:13

CONTENTS Review Article 257

The importance of studying inherited hematological disorders in ancient Anatolian populations Yeşim Doğan Alakoç, Nejat Akar, Ankara, Turkey

Research Articles 264

Beta-globin gene mutations in children with beta-thalassemia major from Şanlıurfa province, Turkey

Ali Ayçiçek, Ahmet Koç, Zeynep Canan Özdemir, Hasan Bilinç, Abdurrahim Koçyiğit, Fuat Dilmeç, Şanlıurfa, Turkey

269

Commentary: Tracing the footsteps of IVSI-130 G-C mutation of the human hemoglobin beta globin gene: From Şanlıurfa to Askeriye, Burdur, Turkey Çiğdem Altay, Ankara, Turkey

271

Antifungal prophylaxis in stem cell transplantation centers in Turkey

276

The effects of Ankaferd® Blood Stopper on transcription factors in HUVEC and the erythrocyte protein profile

286

Long-term outcome in children with nutritional vitamin B12 deficiency

294

Clinical investigation of oral findings in inherited disorders of platelet function

299

Factor V G1691A (Leiden) is a major etiological factor in Egyptian Budd-Chiari syndrome patients

306

Factor V G1691A (Leiden) and prothrombin G20210A gene mutation status, and thrombosis in patients with chronic myeloproliferative disorders

Hamdi Akan, Ankara, Turkey

Erkan Yılmaz, Şükrü Güleç, Didem Torun, İbrahim Celalettin Haznedaroğlu, Nejat Akar, Ankara, Turkey Melike Sezgin Evim, Şahin Erdöl, Özlem Özdemir, Birol Baytan, Adalet Meral Güneş, Bursa, Turkey Müjgan Güngör Hatipoğlu, Özden Kansu, Yahya Büyükaşık, Kütahya, Ankara, Turkey

Tawhida Y. Abdel Ghaffar, Solaf M. Elsayed, Mohamed A. Sakr, Ezzat S. Elsobky, Sara M. Abdelhakam, Said Yousuf, Yonca Eğin, Nejat Akar, Cairo, Egypt, Ankara, Turkey

Nur Soyer, Ali Şahin Küçükarslan, Fahri Şahin, Demet Çekdemir, Buket Kosova, Zuhal Eroğlu, Mahmut Töbü, Murat Tombuloğlu, Seçkin Çağırgan, Ayhan Dönmez, Filiz Vural, Güray Saydam, İzmir, Turkey

Case Reports 312

Plasmacytoid dendritic cell tumor: A case report

317

Involuntary movement in infants during vitamin B12 treatment

323

Two rare hemoglobin variants in the Çukurova Region of Turkey: Hb E-Saskatoon and Hb G-Coushatta

327

Malignant lymphoma associated with Behçet’s disease: A report of 2 cases

Füruzan Kacar Döger, Emel Dikicioğlu Çetin, Mine Hekimgil, Meltem Özdoğan Uslu, Gürhan Kadıköylü, Nazan Özsan, Ekin Şavk, Zahit Bolaman, Aydın, İzmir, Turkey Ayşe Tosun, Yusuf Ziya Aral, Emre Çeçen, Ayvaz Aydoğdu, Bilin Çetinkaya Çakmak, Aydın, Turkey Ahmet Genç, Mehmet Akif Çürük, Adıyaman, Adana, Turkey

Ahmet Deniz Meydan, Bilge Gürsel, Nilgün Özbek, Bilge Can, Bedri Kandemir, Samsun, Turkey

A-VI TJH-ARALIK-2011-4-crossref.indd 7

02.12.2011 10:13

Letters to the Editor 335

A survey of hematologists on compulsory health service in Turkey

337

Unusual presentation of adrenal lymphoma observed with PET-CT

339

Scrotal abscess extending into the inguinal canal: A rare complication of multipl myeloma

341

Double heterozygosity of the thalassemic mutations term. Cd +6 C→G and IVS-I-110 in a Greek woman: A case presentation

343

First report from Turkey of a rare frameshift mutation [codons 9/10 (+T)] in the beta-globin gene

346

First observation of hemoglobin Crete [Beta 129(H7) Ala>Pro] in the Turkish population

348

The frequency of factor V G1691A (Leiden) mutation in Iraqi Turks

350

Acute thrombotic complication of essential thrombocythemia in a young adult

352

The frequency of factor V G1691A (Leiden) mutation in the healthy Kazakh population

354

A novel 110-bp insertion in a patient with homocysteinuria

Zeynep Arzu Yeğin, Mutlu Arat, Konya, İstanbul, Turkey

Zeynep Gözde Özkan, Cüneyt Türkmen, Yasemin Şanlı, Mustafa Nuri Yenerel, Işık Adalet, İstanbul, Turkey Fuat Özkan, Bülent Altınoluk, Sefa Resim, Mustafa Eren, Nazım Kankılıç, Kahramanmaraş, Turkey

Stamatia Theodoridou, Vasilios Perifanis, Stella Kotsiopoulou, Olga Karakasidou,Vasiliki Aletra, Michael Alemayehou, Greece Ramazan Güneşaçar, M. Murat Çelik, Hatay, Turkey

Çiğdem Arslan, Selda Kahraman, Hayri Özsan, Nejat Akar, Ankara, İzmir, Turkey Arjan Esmael, Yonca Eğin, Nejat Akar, Ankara, Turkey

Selami Koçak Toprak, Sema Karakuş, Feride İffet Şahin, Ankara, Turkey Hakkı Taştan, Ankara, Turkey

Didem Torun, Talia İleri, Kaan Gündüz, Nejat Akar, Ankara, Turkey

Image in Hematology 357

Overwhelming bone marrow Leishmaniasis

Raihan Sajid, Adnan Qureshi, Karachi, Pakistan

A-VII TJH-ARALIK-2011-4-crossref.indd 8

02.12.2011 10:13

Review

257

The importance of studying inherited hematological disorders in ancient Anatolian populations Anadoludaki antik topluluklarda kalıtsal hematolojik bozuklukların çalışılmasının önemi Yeşim Doğan Alakoç1, Nejat Akar2 1Department

of Pathology, Faculty of Medicine, Ankara University, Ankara, Turkey and Technology University Hospital, Ankara, Turkey

2TOBB-Economy

Abstract Before analysis of DNA from ancient remains was possible, anthropologists studied evolution and migration patterns using data obtained from population genetic studies on modern populations combined with data obtained from morphological evaluations of ancient remains. Currently, DNA analysis of ancient populations is making a valuable contribution to these efforts. Researchers that perform ancient DNA analysis prefer to study polymorphisms on the Y chromosome or mitochondrial DNA because the results are easier to statistically evaluate. To evaluate polymorphisms on diploid genomes, which are more informative, only mutations that have been extensively examined in modern populations should be chosen. The most extensively evaluated mutations are those related to prevalent inherited disorders. As such, beta-thalassemia, sickle cell anemia, FVL mutation of globin and the factor V genes are good candidates for DNA studies in ancient populations. These mutations are common in Anatolia, host to many civilizations since the Paleolithic period. This history makes Anatolia a good place for conducting research that could enhance our understanding of human evolution and migration patterns. (Turk J Hematol 2011; 28: 257-63) Key words: DNA, population genetics, molecular anthropology, factor V G1691A (Leiden), betathalassemia, sickle cell anemia, Anatolia Received: December 16, 2010

Accepted: December 21, 2010

Özet Antik örneklerden DNA elde edilebileceğinin anlaşılmasından önce antropologlar tarih öncesi insan kalıntılarından elde ettikleri bilgilere modern topluluklardan elde edilen populasyon genetiği bulgularını da ekleyerek evrimsel süreçler ve göç yolları ile ilgili yoruma ulaşmaya çalışırlardı. Günümüzde antik topluluklar üzerinde gerçekleştirilebilen DNA analizleri antropologların bu çabasına büyük katkı sağlamaktadır. Uygulamadaki tüm güçlüklere rağmen sağlayacağı önemli bilgi nedeni ile antik DNA analizini uygulamayı seçen birçok bilimadamı istatistiksel olarak sonuçları daha rahat değerlendirildiğinden öncelikle mitokondriyal DNA ve Y kromozomu üzerindeki farklılıklara odaklanmıştır. Bu eğilimin sebebi, diploit genom üzerinde bulunan farklılıkların daha bilgilendirici olmalarına rağmen değerlendirme açısından birçok güçlüğü de beraberinde getirmesidir ve bu sorun ile başa çıkabilmek Address for Correspondence: Yeşim Doğan Alakoç M.D., Central Laboratory, Campus Rector of Ankara University, Dogol Street, Tandogan, 06100 Ankara, Turkey Phone: +90 312 222 58 26 E-mail: ydalakoc@gmail.com doi:10.5152/tjh.2011.43

TJH-ARALIK-2011-4-crossref.indd 9

02.12.2011 10:13

258

Alakoç et al.

Inherited disorders in ancient Anatolian populations

Turk J Hematol 2011; 28: 257-63

için modern topluluklarda derinlemesine analiz edilmiş mutasyonların tercih edilmesi gerekmektedir.

Günümüzde en iyi değerlendirilmiş mutasyonlar yaygın görülen belli kalıtsal bozukluklarla ilişkilendirilmiş olanlardır. Bunların içerisinde hematolojik bozukluklar ile ilişkilendirilen ve evrimsel süreçleri son derece iyi bilinen globin ve faktör V genlerinde yer alan beta talasemi, orak hücre anemisi ve FVL mutasyonları iyi adaylardır. Bu yüzden paleolitik dönemden itibaren birçok farklı kültüre evsahipliği yapan ve adı geçen mutasyonların yüksek prevalanslarda gözlendiği Anadolu, insan evrimi ve göç yollarının anlaşılması için eşsiz bir kaynak sunmaktadır. (Turk J Hematol 2011; 28: 257-63) Anahtar kelimeler: DNA, populasyon genetiği, moleküler antropoloji, Factor V, beta-thalassemia, orak hücre anemi, Anadolu Geliş tarihi: 16 Aralık 2010

Kabul tarihi: 21 Aralık 2010

Introduction After Chinese researchers showed that DNA could be preserved in ancient tissues in 1980, 2 subsequent studies were conducted: Higuchi studied Quagga (an extinct horse species) in 1984 and Paabo reported on a 2400-year-old mummy in 1985. These studies are considered the first ancient DNA studies and are acknowledged as the beginning of a new era [1-3]. Although these studies drew immediate interest in ancient DNA research among the scientific community, this novel field of study did not become popular until the advent of the polymerase chain reaction (PCR) technique towards the end of the 1980s. As the PCR technique facilitates work with DNA extracted from ancient samples and enables ancient DNA research to be systematically performed, researchers quickly became aware of the value of studying evolution based on ancient DNA [4,5]. As such, many ancient DNA studies have been conducted during the last 25 years.

Common to all ancient DNA studies is the challenge to obtain undamaged DNA due to the nature of ancient samples [6-10]. The quality of DNA in ancient samples depends on environmental factors and the duration of exposure to them. DNA extracted from ancient samples is both highly degraded and contaminated with PCR inhibitors that are abundant in soil; therefore, the results of studies based on such low-quality samples are generally received with great skepticism [11]. As such, ancient DNA laboratories must use more elaborate measures [12,13]. The development of proper procedures is important for overcoming the challenges posed by ancient DNA analysis. The design of small fragments that contain point mutations has recently gained importance because it is known that only

TJH-ARALIK-2011-4-crossref.indd 10

small fragments of approximately 200 bp can be amplified from ancient DNA. Although ancient DNA analysis is very difficult and the possibility of obtaining significant results is low, interest in ancient DNA analysis continues to increase because the knowledge gained via such analysis has become indispensable in research on ecology and evolution. It has been common practice to gather pieces of information from various fields for analysis in order to better understand migration patterns and evolutionary stages. For instance, anthropologists combine the knowledge gained from human remains and what is known about genetic polymorphisms in contemporary populations to study human history. As systematic ancient DNA analysis is now possible, data from studies on mutations in ancient human populations can make a unique contribution to the field’s knowledge base only if such mutations have been thoroughly studied in modern populations [14,15].

Human remains in biological anthropology Anthropologists study human biological evolutionary processes and examine anthropogenic differences between living populations. When a skeleton is evaluated, not only will information regarding its age and gender be discerned, but crucial knowledge regarding its dietary habits, cause of death, and health will also be determined. The knowledge gained from individual samples is then evaluated in order to reach conclusions regarding their population. Such data, along with data collected from the same archeological sites regarding the culture and religion of that particular period can be somewhat simulated. Finally, every population examined in detail is compared with another, in terms of their relationship, which helps researchers understand the dynamics of a particular period [16].

02.12.2011 10:13

Turk J Hematol 2011; 28: 257-63

An important aspect of anthropological research is the examination of the signs indicative of a skeleton’s state of health; however, this can only be determined if there are obvious signs left in bones or teeth [17-19]. When skeletal signs of morbidity are detected, its origin, its distribution within the skeleton’s group or modern populations, and the skeleton’s dietary habits can be evaluated. Moreover, if the morbidity being studied is inherited, genetic links between human populations and evolutionary pressures that have played a role in the inheritance of the mutation up to the present can also be included in the analysis.

Although it provides valuable data, evaluation of phenotypes reflected in bones is difficult for anthropologists. The most common difficulty for anthropologists is that bone pathologies may also be due to environmental conditions that trigger clinical signs. Porotic hyperostosis related to iron deficiency anemia can also occur in other types of noninherited anemias in agricultural populations in which the consumption of fat is low, but that of grain is high [20]. This is why DNA analysis is necessary for understanding whether or not a condition is inherited [21]. DNA analysis is crucial for pinpointing a disease-related mutation in an ancient population, comparing this information with that of other ancient and modern populations from the same geographic region, evaluating the genetic similarity of these populations, and for understanding the environmental pressures that played a role in preserving the mutation. Studying the spread of mutations in the past and their modern prevalence make it possible to understand how they have been subjected to natural selection and to gather data on migration patterns [15].

Molecular anthropology and inherited hematologic disorders Molecular anthropology uses anthropologic and molecular genetic data to discern the evolutionary link between ancient and modern populations, and to determine human migration patterns. For instance, examination of DNA polymorphisms is a common method used to study the history of human evolution. The entire genome has polymorphic sites, but use of polymorphism data obtained from the chromosome Y and mitochondrial DNA is preferred. Although the diploid genome provides

TJH-ARALIK-2011-4-crossref.indd 11

Alakoç et al.

Inherited disorders in ancient Anatolian populations

259

more information when interpreted accurately, as interpretation of data obtained from diploid genome studies is difficult researchers are reluctant to use diploid genome data in population genetics [22]. To facilitate interpretation of diploid genome study results it is crucial to choose mutations whose molecular genetics and evolutionary stages are well known.

According to modern genetics theory there are 5 factors that can affect gene frequency: selection, mutation, genetic drift, gene flow, and selective mating. As such, any study that aims to determine the spread of an allele should consider all 5 factors.

An allele concerning a particular situation can be among the population founders, can be independently introduced from outside the population structure after the population has been established, or can be mixed in the population structure due to genetic contact with a neighboring population. If the mutation frequently occurs in different populations, its origin can be determined by evaluating the mutation and simultaneously inherited haplotypes.

Such genetic variations as haplotypes provide valuable information for tracing migration patterns, determining an individuals’ geographic origin, and establishing connections within populations [23].

The spread of genetic variations, some of which cause genetic diseases, varies worldwide; however, some similarities can be observed in the frequency of these mutations and their haplotypes within populations that interacted during a particular period and/or shared geographic locations [24]. As such, studies on the frequency and carriage percentage of particular mutations can provide additional data concerning connections between populations [25]. Moreover, the prevalence of a specific disease-related mutation in populations can be determined and how the processes of population genetics might possibly have affected the prevalence can be examined. Haplotypes carried with a mutation are used to identify such as factors migration, genetic drift, and natural selection that affected the frequency of the mutation. Not only does haplotype analysis frequently enable the history of a mutation to be reconstructed, it also provides information about how often and when its frequency was altered, and in which populations the mutation first existed [26]. Accordingly, despite its symptoms-including the risk of mortality-the widespread

02.12.2011 10:13

260

Alakoรง et al.

Inherited disorders in ancient Anatolian populations

prevalence of a mutation can be explained by various genetic factors in different populations [27]; therefore, mutations that have been extensively studied in modern populations must also be examined in ancient populations, as they can provide useful data on genetic relationships. The mutations that appeal to research most are generally those related to certain genetic disorders and those that maintain their frequency despite their negative affects on health. Thus, beta-thalassemia, sickle cell anemia, and Factor V G1691A (Leiden) (FVL) mutations are examples of the most extensively studied mutations [28-30].

The malaria hypothesis is considered to be a crucial starting point in determining the factors that affect the prevalence of hemoglobinopathies, common and heterogeneous worldwide [26]. The geographic distribution of malaria and hemoglobinopathies overlap to a great extent. It is likely that the malaria parasite has coexisted with modern humans for ages; however, malaria is thought to have become widespread approximately 10,000 years ago in Levant and in Asia. The high prevalence of this parasite is thought to have originated with the development of agriculture.

Agricultural activities first put an end to the scarcity of food, which was the most important factor controlling population growth. Consequently, this resulted in rapid population growth and diseases replaced the scarcity of food as the primary factor controlling population growth. While creating space for agricultural activities humans destroyed vegetation and fauna, and altered the balance of the environment. This process caused many mammals to become extinct and many parasites to lose their hosts; as a result, such parasites began infecting the expanding human population [27]. In populations affected by malaria, a high frequency of hemoglobinopathies-including sickle cell anemia and thalassemia-has been noted [31,32]. It is plausible to conclude that their heterozygous carriers are resistant to malaria; however, although there is considerable geographic overlap between these mutations and malaria, in the case of beta-thalassemia the correlation is not as straightforward as in the case of sickle cell anemia [33]. Beta-thalassemia is widespread in subtropical malarial, Mediterranean, and Middle Eastern regions; however, it also exists in some non-malarial regions. As such, the existence

TJH-ARALIK-2011-4-crossref.indd 12

Turk J Hematol 2011; 28: 257-63

of another evolutionary process alongside the advantage brought by heterozygocity appears to be likely.

Another well known mutation, factor V Leiden (FVL), which increases the risk of thrombosis 80-fold when homozygotic, is a common monogenic disorder. Its worldwide distribution is highly heterogeneous and exhibits remarkable ethnic diversity. While polymorphism ranging from 1%-8.5% is present in Europeans, Jews, Israel-Arabs, and Indians, it is non-existent in African blacks, Chinese, Japanese, and indigenous South Americans [34-38].

Limited and ethnic distribution of FVL suggests that the mutation originated from a single source, most probably Europeans or Neolithic farmers along the migratory path.

During the Neolithic period about 10,000 years ago farming spread to Northern Europe from the Middle East. The distribution of FVL followed a similar pattern, suggesting that the distribution is due to Neolithic migration. Furthermore, the army of Alexander the Great is thought to have contributed to the distribution of FVL [39]. Evolutionary hypotheses regarding the distribution of FVL suggest the possibility that heterozygosity may have been a selective advantage. In the past, deaths resulting from sepsis and bleeding during pregnancy and birth accounted for 10% of all deaths. It seems highly plausible that a mutation preventing bleeding may have provided a selective advantage [40]. Haplotype analysis of FVL suggests that the founder effect may have influenced distribution of the mutation and the advent of the mutation can be traced back 21,000 years. The origin of Caucasians among which the mutation is prevalent can be traced back 40,000 years. This historical fact coincides with the claim that FVL mutation first occurred in a Caucasian ancestor 21,000 years ago [41]. A study on population genetics of the mutation shows that during the Neolithic period FVL in Europe probably spread from Anatolia (Turkey) [42].

Why Anatolia?

Anatolia, due to its favorable geographic and strategic location, has been home to numerous civilizations since the Paleolithic period [43]. Its geographic location-bridging continents-has been an important passage for numerous species, including humans. This has made Anatolia a pre-

02.12.2011 10:13

Alakoç et al.

Inherited disorders in ancient Anatolian populations

Turk J Hematol 2011; 28: 257-63

cious region for biodiversity. While Anatolia offered many advantages for its inhabitants, it was also suitable for malaria due to its wetlands. This resulted in a high frequency of beta-thalassemia and sickle cell anemia, which in turn provided protection against malarial epidemics, once a severe threat in the Mediterranean region [43-50]. FVL, another mutation that probably originated in Anatolia 21,000 years ago, is also highly prevalent in this region [44,45].

In Anatolia a number of mutations that have been extensively examined, in terms of molecular genetics and population genetics, occur frequently, offering a uniquely valuable source for identifying genetic markers in ancient populations.

Distinguishing and analyzing the layers of population history in this region in which various populations have been fighting, immigrating, trading and praying to different Gods for centuries is a challenging task. As such, molecular techniques can aid in the analysis of ancient communities; however, only a few studies have examined genetic diseases at the molecular level in ancient populations, though they reported valuable results.

In 1995 Filon performed DNA analysis of a child’s skeleton that was thought to have had porotic hyperostosis due to iron deficiency anemia and reported the existence of beta-thalassemia-related mutation. As a result, he was able to show that data related to ancient populations, which earlier could not be obtained, could be obtained via DNA experiments [21,49]. The same year Beraud-Colomb et al. extracted DNA from skeletal remains belonging to different years and evaluated various polymorphisms on the globin gene using skeletal DNA [15].

The only similar study in Anatolia was performed by our group in 2009 using 3000-year-old Urartian tooth samples excavated from a site in Anatolia. DNA samples extracted from these teeth were screened using real time PCR to detect FVL mutation and 1 of the samples, which was previously determined to be male, was heterozygotic [51,52].

Conclusion Anatolia is a fertile land suitable for agriculture and has always appealed to scientists due to the richness of its biodiversity and the vast number of its ancient populations. A significant number of histori-

TJH-ARALIK-2011-4-crossref.indd 13

261

cal excavations in this region have been performed by non-Turkish scientists, and therefore DNA analysis on ancient materials have been conducted abroad [53,54]; however, we think it is important that such results be evaluated by scientists with knowledge about the modern Anatolian population.

Mutations with a high frequency in modern populations have a heterogeneous distribution in Anatolia as well as in other parts of the world; therefore, for the study of sickle cell anemia mutation in ancient populations, excavations closer to Mersin, Tarsus, Adana, and Hatay, Anatolian regions in which the mutation currently has a high frequency, will increase the probability of identifying this mutation and make it possible to compare its frequency in ancient and modern populations. As such, additional research may provide an abundance of data on the genetic background of Anatolian populations.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

Hummel S. Ancient DNA Typing; methods, strategies and applications. Springer-Verlag Berlin Heidelberg 2003; pp. 209-11.

Higuchi R, Bowman B, Freiberger M, Ryder OA, Wilson AC. DNA sequences from the quagga, an extinct member of the horse family. Nature 1984;312:282-4. [CrossRef] Pääbo S. Molecular cloning of Ancient Egyptian mummy DNA. Nature 1985;314:644-5. [CrossRef] Wayne RK. Full of Sound and Fury; The recent history of ancient DNA. Annu Rev Ecol Syst 1999;30:457-77.

[CrossRef] Gilbert MT, Bandelt HJ, Hofreiter M, Barnes I. Assessing ancient DNA studies. Trends Ecol Evol 2005;20:541-4.

[CrossRef] Hagelberg E, Clegg JB. Isolation and characterization of DNA from archaeological bone. Proc Biol Sci 1991;244:45-50. [CrossRef] Rohland N, Hofreiter M. Ancient DNA extraction from bones and teeth. Nat Protoc 2007;2:1756-62. [CrossRef] Yang DY, Eng B, Waye JS, Dudar JC, Saunders SR. Technical note: improved DNA extraction from ancient bones using silica-based spin columns. Am J Phys Anthropol 1998;105:539-43. [CrossRef] Hanni C, Brousseau T, Laudet V, Stehelin D. Isopropanol precipitation removes PCR inhibitors from ancient bone extracts. Nucleic Acids Res 1995;23:881-2.

[CrossRef]

02.12.2011 10:13

262

Alakoç et al.

Inherited disorders in ancient Anatolian populations

10. Alakoc YD, Aka PS. “Orthograte entrance technique” to recover DNA from ancient teeth preserving the physical structure. Forensic Sci Int 2009;188:96-8. [CrossRef] 11. Meyer E, Wiese M, Bruchhaus H, Claussen M, Klein A. Extraction and amplification of authentic DNA from ancient human remains. Forensic Sci Int 2000;113: 87-90. [CrossRef] 12. Handt O, Hoss M, Krings M, Pääbo S. Ancient DNA: methodological challenges. Experientia 1994;50:524-9.

[CrossRef] 13. Yang DY, Watt K. Contamination controls when preparing archaeological remains for ancient DNA analysis. J Archaeol Sci 2005;32:331-6. [CrossRef] 14. Malmström H. Ancient DNA as a means to investigate the European Neolithic. Acta Universitatis Upsaliensis Uppsala. Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology. 323pp.

15. Beraud-Colomb E. Human beta globin gene polymorphism characterized in DNA extracted from ancient bones 12000 years old. Am J Hum Genet 1995;57: 1267-74.

16. Brothwell DR. Digging up bones: the excavation, treatment, and study of human skeletal remains. Cornell University Press, 1981.

17. Homøe P, Lynnerup N, Skovgaard LT, Rasmussen N. Estimation of otitis media in ancient populations. A study of past and present Greenlandic Inuit. J Laryngol Otol 1996;110:1114-9.

18. Stuart-Macadam P. Porotic hyperostosis: new evidence to support the anemia theory. Am J Phys Anthropol 1987;74:521-6. [CrossRef] 19. Tayles N. Anemia, genetic diseases, and malaria in prehistoric mainland Southeast Asia. Am J Phys Anthropol 1996;101:11-27. [CrossRef] 20. Weaver DS. An osteological test of changes in Subsistence and settlement patterns at Casas Grandes, Chihuahua, Mexico. American Antiquity 1981;46:361-4.

[CrossRef] 21. Filon D, Faerman M, Smith P, Oppenheim A. Sequence analysis reveals a beta-thalassaemia mutation in the DNA of skeletal remains from the archaeological site of Akhziv, Israel. Nat Genet 1995;9:365-8. [CrossRef] 22. Harding RM, Fullerton SM, Griffiths RC, Bond J, Cox MJ, Schneider JA, Moulin DS, Clegg JB. Archaic African and Asian Lineages in Genetic Ancestry of Modern Humans.

Am J Hum Genet 1997;60:772-89.

23. Oddoux C, Guillen-Navarro E, Ditivoli C, Dicave E, Cilio MR, Clayton CM, Nelson H, Sarafoglou K, McCain N, Peretz H, Seligsohn U, Luzzatto L, Nafa K, Nardi M, Karpatkin M, Aksentijevich I, Kastner D, Axelrod F, Ostrer H. Mendelian diseases among Roman Jews: implications for the origins of disease alleles. J Clin Endocrinol Metab 1999;84:4405-9. [CrossRef] 24. Collins FS. What we do and don't know about 'race', 'ethnicity', genetics and health at the dawn of the genome era. Nat Genet 2004;36:13-5. [CrossRef] 25. Shpilberg O, Peretz H, Zivelin A, Yatuv R, Chetrit A, Kulka T, Stern C, Weiss E, Seligsohn U. One of the two

TJH-ARALIK-2011-4-crossref.indd 14

Turk J Hematol 2011; 28: 257-63

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

39.

common mutations causing factor XI deficiency in Ashkenazi Jews (type II) is also prevalent in Iraqi Jews, who represent the ancient gene pool of Jews. Blood 1995;85:429-32.

Flint J, Harding RM, Clegg JB, Boyce AJ. Why are some genetic diseases common? Distinguishing selection from other processes by molecular analysis of globin gene variants. Hum Genet 1993;91:91-117.

Flint 1998. The population genetics of the heamoglobinopathies. Bailliere’s Clinical Heamotology 1998; 11:1.

Currat M, Trabuchet G, Rees D, Perrin P, Harding RM, Clegg JB, Langaney A, Excoffier L. Molecular analysis of the beta-globin gene cluster in the Niokholo Mandenka population reveals a recent origin of the beta(S) Senegal mutation. Am J Hum Genet 2002;70:207-23. [CrossRef] Fullerton SM, Harding RM, Boyce AJ, Clegg JB. Molecular and population genetic analysis of allelic sequence diversity at the human beta-globin locus.

Proc Natl Acad Sci 1994;91:1805-9. [CrossRef] Das SK, Talukder G. A review on the origin and spread of deleterious mutants of the beta globin gene in Indian Populations. Homo 2001;52:93-109. [CrossRef] Livingstone FB. Anthropological Implications of sickle cell gene distribution in West Africa. Am Anthropol 1958;60:533-62. [CrossRef] Hershkovitz I, Ring B, Speirs M, Galili E, Kislev M, Edelson G. Possible congenital hemolytic anemia in prehistoric coastal inhabitants of Israel. Am J Phys Anthropol 1991;85:7-13. [CrossRef] Charmot-Bensimon D. Human globin genes: what can we learn from their polymorphism? Bull Soc Pathol Exot 1999;92:242-8.

Hooper WC, Dilley A, Ribeiro MJA, Benson J, Austin H, Silva V, Rawlins P, Wenger NK, Evatt BL. A racial difference in the prevalence of Arg506 Gln mutation. Thromb Res 1996;81:577-81. [CrossRef] Herrmann FH, Koesling M, Schrŏder W, Altman R, Jiménez Bonilla R, Lopaciuk S, Perez-Requejo JL, Singh JR. Prevalence of factor V Leiden mutation in various populations. Genet Epidemiol 1997;14:403-11.

[CrossRef] Gregg JP, Yamane AJ, Grody WW. Prevalence of the factor V-Leiden mutation in four distinct American ethnic populations. Am J Med Genet 1997;73:334-6.

[CrossRef] Franco RF. Heterogeneous ethnic distribution of factor v leiden mutation. Genet Mol Biol 1999;22:143-5.

[CrossRef] Bauduer F, Lacombe D. Factor V Leiden, prothrombin 20210A, methylenetetrahydrofolate reductase 677T, and population genetics. Mol Genet Metab 2005;86:91-9.

[CrossRef] Pawar AR, Shetty S, Ghosh K, Mohanty D. How old is factor V Leiden mutation? Thromb Haemost 2001;86:1591-2.

02.12.2011 10:13

Turk J Hematol 2011; 28: 257-63

40. Lindqvist PG, Dahlbäck B. Carriership of Factor V Leiden and evolutionary selection advantage. Curr Med Chem 2008;15:1541-4. [CrossRef] 41. Zivelin A, Griffin JH, Xu X, Pabinger I, Samama M, Conard J, Brenner B, Eldor A, Seligsohn U. A single genetic origin for a common Caucasian risk factor for venous thrombosis. Blood 1997;89:397-402.

42. Lucotte G, Mercier G. Population genetics of factor V Leiden in Europe. Blood Cells Mol Dis 2001;27:362-7.

[CrossRef] 43. Kuhn SL. Paleolithic Archeology in Turkey. Evol Anthropol 2002;11:198-210. [CrossRef] 44. Akar N. Factor V 1691 G-A mutation distribution in a healthy Turkish population. Turk J Hematol 2009;26:9-11.

45. Gürgey A, Mesci L. The prevalence of factor V Leiden (1691 G-->A) mutation in Turkey. Turk J Pediatr 1997;39:313-5.

46. Aksoy M, Lehmann H. Sickle-cell-thalassemia disease in South Turkey. Br Med J 1957;1:734-8. [CrossRef] 47. Koçak R, Alparslan ZN, Ağridağ G, Başlamisli F, Aksungur PD, Koltaş S. The frequency of anaemia, iron deficiency, hemoglobin S and beta thalassemia in the south of Turkey. Eur J Epidemiol 1995;11:181-4. [CrossRef] 48. Akar E, Akar N. A review of abnormal hemoglobins in Turkey. Turk J Hematol 2007;24:143-5.

TJH-ARALIK-2011-4-crossref.indd 15

Alakoç et al.

Inherited disorders in ancient Anatolian populations

263

49. Tadmouri GO, Tüzmen S, Ozçelik H, Ozer A, Baig SM, Senga EB, Başak AN. Molecular and population genetic analyses of beta-thalassemia in Turkey. Am J Hematol 1998;57:215-20. [CrossRef] 50. Aksoy M. Hemoglobinopathies in Turkey. Hemoglobin 1985;9:209-16. [CrossRef] 51. Oner R, Altay C, Gurgey A, Aksoy M, Kilinç Y, Stoming TA, Reese AL, Kutlar A, Kutlar F, Huisman TH. Betathalassemia in Turkey. Hemoglobin 1990;14:1-13.

[CrossRef] 52. Alakoc Y D, Aka PS, Eğin Y, Akar N. Factor V Leiden in an Urartian, Dating back to 1000 BC. Clin Appl Thromb Hemost 2010;16:679-83. [CrossRef] 53. Arndt A, Van Neer W, Hellemans B, Robben J, Volckaert F, Waelkens M. Roman trade relationships at Sagalassos (Turkey) elucidated by ancient DNA of fish remains. J Archaeol Sci 2003;30:1095-105. [CrossRef] 54. Jehaes E, Waelkens M, Muyldermans A, Cassiman J, Smits E, Poblome J, Lambrecht, P, Decorte R. DNA analysis of archaeological human remains from Sagalassos. In: Sagalassos V: report on the survey and excavation campaigns of 1996 and 1997. Leuven university press 2000;821-31.

02.12.2011 10:13

264

Research Article

Beta-globin gene mutations in children with beta-thalassemia major from Şanlıurfa province, Turkey Türkiye, Şanlıurfa bölgesinde talasemi majorlü çocuk hastalarda beta-globin gen mutasyonları Ali Ayçiçek1, Ahmet Koç1, Zeynep Canan Özdemir1, Hasan Bilinç2, Abdurrahim Koçyiğit2, Fuat Dilmeç3 1Department of Pediatric Hematology, Faculty of Medicine, Harran University, Şanlıurfa, Turkey 2Department of Biochemistry, Faculty of Medicine, Harran University, Şanlıurfa, Turkey 3Department of Medical Biology, Faculty of Medicine, Harran University, Şanlıurfa, Turkey

Abstract Objective: The prevalence of β-thalassemia in Şanlıurfa province, Turkey is reported to be 2.6%-3.7%, whereas nation-wide the frequency of β-thalassemia is 2%. This study aimed to identify the most frequent β-thalassemia mutations in Şanlıurfa province.

Materials and Methods: In total, 22 mutations were investigated in 115 pediatric patients with β-thalassemia using a commercially available reverse dot blot platform.

Results: The study included 60 male and 55 female patients with a mean age of 7.3±4.6 years (range: 1-17 years). In total, 76% of the patients had consanguineous parents. In all, 16 different mutations were observed in the 115 patients. IVS-1-110 (G-A) (29.1%), IVS-1-1 (G-A) (13.9%), codon 39 (C>T) (10.4%), and codon 8 (-AA) (9.1%) accounted for 62.5% of all the β-thalassemia mutations, and 6% of the patients had 2 different thalassemia mutations. According to the present results, IVS-1-110 (G>A) was the most frequent mutation observed in the patients from Şanlıurfa province, as in other geographical regions of Turkey. In addition, the following 34 compound heterozygote mutant alleles were observed; IVS-1-1 (G>A)/IVS 2.848 (n=4), codon 39 (C>T)/codon 8 (-AA) (n=2), codon 6 (-A)/IVS 1.5 (G>C) (n=2), IVS-1-110 (G>A)/IVS-1-1 (G>A) (n=2), IVS-1-110 (G>A)/codon 8 (-AA) (n=1), IVS-1-110 (G>A)/codon 39 (C>T) (n=1), IVS-1-110 (G>A)/IVS-1-6 (T>C) (n=1), IVS-1-110 (G>A)/ IVS-1-5 (G>C) (n=1), IVS-1-110 (G>A]/codon 8/9 (+G) (n=1), IVS-1-1 (G>A)/codon 39 (C>T) (n=1), and codon 8 (-AA)/IVS-1-5 (G>C) (n=1). The following β-globin gene promoter mutations were not observed; -101 (C>T), -87(C>T), -30 (T>A), codon 15 (TTG>TGA), codon 27 (G>T) Knossos, and IVS-1-116 (G>C). In all, 5 of the 115 patients (4.3%) had an unidentified mutation.

Conclusion: The present results illustrate the heterogeneity of β-thalassemia mutations in Şanlıurfa Province. The present findings may be of value for genetic counseling, and premarital and prenatal diagnosis in Şanlıurfa province. (Turk J Hematol 2011; 28: 264-8) Key words: Beta-thalassemia, mutation, Şanlıurfa, Turkey Received: January 12, 2011

Accepted: July 12, 2011

Address for Correspondence: Assoc. Prof. Ali Ayçiçek, Department of Pediatric Hematology, Faculty of Medicine, Harran University, Şanlıurfa, Turkey Phone: +90 414 318 30 00 E-mail: ayciceka@hotmail.com doi:10.5152/tjh.2011.86

TJH-ARALIK-2011-4-crossref.indd 16

02.12.2011 10:13

Ayçiçek et al.

Children with β-thalassemia mutations in Şanlıurfa, Turkey

Turk J Hematol 2011; 28: 264-8

265

Özet Amaç: Türkiye genelinde %2 olan beta-talasemi sıklığı Türkiye’nin güneydoğu bölgesinde yer alan Şanlıurfa ilinde %2.6-%3.7 arasında olduğu bulunmuştur. Bu çalışmada en sık gözlenen mutasyon tiplerini araştırdık.

Yöntem ve Gereçler: Bu çalışmada beta talasemili 115 çocuk hastada 22 adet mutasyon ticari ters dot blot seritler ile araştırıldı.

Bulgular: Vakaların 60'ı erkek 55’i kız, yaşları 2-17 (ortalama 7.3±4.6) yıl idi. 110 hastada 16 farklı mutasyon saptandı. IVS-1-110 (G-A) %29.1, IVS-1-1 (G-A) %13.9, codon 39 (C>T) %10.4, codon 8 (-AA) %9.1 en sık olarak belirlendi ve bunların vakaların %62.5’ini oluşturduğu görüldü. Türkiye’nin diğer bölgelerinde olduğu gibi IVI-1-110 (G>A) en sık saptanan mutasyon olmuştur. Çalışmada IVS1-1 (G>A)/IVS 2.848 (4 vaka), codon 39 (C>T)/codon 8 (-AA) (2), codon 6 (-A)/IVS-1-5 (G>C) (2), IVS-1-110 (G>A)/IVS-1-1 (G>A) (2), IVS-1-110 (G>A)/codon 8 (-AA) (1), IVS-1-110 (G>A)/codon 39 (C>T) (1), IVS-1-110 (G>A)/IVS-1-6 (T>C) (1), IVS-1-110 (G>A)/IVS-1-5 (G>C) (1), IVS-1-110 (G>A)/codon 8/9 (+G) (1), IVS-1-1 (G>A)/codon 39 (C>T) (1), codon 8 (-AA)/IVS-1-5 (G>C) (1) adet olmak üzere 34 mutant alelin birleşik heterozigot mutasyon oluşturduğu saptandı. -101 (C>T), -87(C>T), -30 (T>A), codon 15 (TTG>TGA), codon 27 (G>T) Knossos ve IVS-1-116 (T>G) β-globin geni promoter bölgesi mutasyonları hiç bir hastada tesbit edilmedi. 5 (%4.3) hastanın mutasyonu saptanamadı.

Sonuç: Şanlıurfa bölgesinde β-talasemi çok çeşitli mutasyonlarla ortaya çıkmaktadır. Bu sonuçlar genetik danışma ve doğum öncesi tanıda yardımcı olabilir. (Turk J Hematol 2011; 28: 271-5) Anahtar kelimeler: Beta-talasemi, mutasyon, Şanlıurfa, Türkiye Geliş tarihi: 12 Ocak 2011

Kabul tarihi: 12 Temmuz 2011

Introduction Although β-thalassemia is associated with >200 mutations, most are rare [1]. Approximately 20 common alleles constitute 80% of all known thalassemias worldwide; 3% of the world’s population carries genes for β-thalassemia. The overall frequency of β-thalassemia in Turkey is 2%, but within the country the rate differs significantly according to region. In particular areas of the country there are fewer common alleles. The highest frequencies of β-thalassemia in Turkey are observed in Antalya, Thrace (10% each), and Muğla (4.8%) [2]. The frequency of β-thalassemia in Turkey is lowest in eastern and northern Anatolia, and is moderate in southern Anatolia. β-thalassemia mutations are extremely heterogeneous [2-5]. It was reported that only 7 mutations comprise 67% of all β-thalassemia mutations [6,7].

Regional differences in the frequency of various mutations may offer clues regarding migration patterns and the ethnic background of a particular population [3,6]. It was previously reported that IVS1-110 (G-A), codon 8 (-AA), and IVS-2-1 (G>A) mutations were present in 28 of 51 patients with β-thalassemia in Şanlıurfa Province, Turkey [8]. The present study aimed to determine the prevalence of 22 mutations in 115 patients with β-thalassemia

TJH-ARALIK-2011-4-crossref.indd 17

from Şanlıurfa Province, Turkey, and which occurred most frequently.

Materials and Methods This study was conducted at Harran University, Education and Research Hospital, Pediatric Hematology outpatient clinic between March and May 2010. The study included 115 patients (60 male and 55 female) with a mean age of 7.3±4.6 years (range: 1-17 years). The Harran University Education and Research Hospital Ethics Committee approved the study protocol, and written informed consent was obtained from all the patients’ parents.

Blood samples were collected from the β-thalassemia patients into EDTA tubes and brought to the laboratory in a cold chain. The place and date of birth, and the name of each patient were recorded. Hematological analysis was performed the same day blood was collected using an automated cell counter (Cell Dyne 1700, Abbott Diagnostics).

DNA was isolated via standard phenol-chloroform extraction and ethanol precipitation, and mutation analysis of the β-globin gene was performed using a commercially available reverse dot blot platform (Beta-Globin Strip Assay, Vienna Lab, Vienna, Austria). Mutations affecting gene transcription were -101 (C>T), -87 (C>G), and -30 (T>A), frame-

02.12.2011 10:13

266

Ayçiçek et al.

Children with β-thalassemia mutations in Şanlıurfa, Turkey

shift types of premature termination (nonsense) mutation were codon 5 (-CD), codon 6 (-A), codon 6 (G>A) HbC, codon 6 (A>T) HbS, codon 8 (-AA), codon 8/9 (+G), and codon 44 (-C), substitution types were codon 15 (G>A) and codon 39 (C>T), the exon processing type of RNA splicing mutation was codon 27 (G>T) Hb Knossos, the splice junction change in the 5’ donor site was IVS-1-1 (G>A), splice consensus sequence changes in the 5’ donor site were IVS-1-5 (G>A), IVS-1-6 (T>C), and IVS-2-1 (G>A), mutations within exons that affect processing internal IVS change were IVS-1-110 (G>A) and IVS-2-745 (C>G), the splice junction change in the 3’ acceptor site was IVS-1-130 (G>C), the internal IVS change was IVS-1-116 (T>G), and the splice consensus sequence change in 3’ acceptor site was IVS-2-848 (C>A) [9].

Results In all, 22 mutations were investigated in 115 pediatric patients with β-thalassemia. Whereas 74 of patients were not related, 41 were brothers and/or sisters. In total, 16 different mutations in 208 alleles were identified, and IVS-1-110 (G-A) (29.1%), IVS-1-1 (G>A) (13.9%), codon (39 (C>T) (10.4%), and codon 8 (-AA) (9.1%) accounted for 62.5% of all the β-thalassemia mutations (Table 1). IVS-1-110 (G>A) was the most frequent mutation type in the patients from Şanlıurfa Province, as in other geographic regions of Turkey. In all, 76% of the patients had consanguineous parents; 65% of these consanguineous marriages were between first cousins. β-thalassemia mutations were homozygous in 71.3% of the patients, heterozygous in 10.4%, compound heterozygous in 4.8%, and undetermined in 9.6%.

In addition, the following 34 compound heterozygote mutant alleles were observed; IVS-1-1 (G>A)/ IVS-2-848 (n=4), codon 39 (C>T)/codon 8 (-AA) (n=2), codon 6 (-A)/IVS-1-5 (G>C) (n=2), IVS-1-110 (G>A)/IVS-1-1 (G>A) (n=2), IVS-1-110 (G>A)/ codon 8 (-AA) (n=1), IVS-1-110 (G>A)/codon 39 (C>T) (n=1), IVS-1-110 (G>A)/IVS-1-6 (T>C) (n=1), IVS-1-110 (G>A)/IVS-1-5 (G>C) (n=1), IVS1-110 (G>A)/codon 8/9 (+G) (n=1), IVS-1-1 (G>A)/ codon 39 (C>T) (n=1), and codon 8 (-AA)/IVS-1-5 (G>C) (n=1) (Table 2). The following β-thalassemia mutations were not observed; -101 (C>T), -87 (C>T), -30 (T>A), codon 15 (TTG>TGA), codon 27 (G>T) Knossos, and VS-1-116 (T>G).

TJH-ARALIK-2011-4-crossref.indd 18

Turk J Hematol 2011; 28: 264-8 Table 1. The Frequency of 22 Different β-thalassemia Mutations in 230 Alleles

Homozygote (%) Heterozygote (%) Total (%)

IVS-1-110 (G>A)

60 (26.1)

7 (3.0)

67 (29.1)

IVS-1-1 (G>A)

22 (9.6)

10 (4.3)

32 (13.9)

codon 39 (C>T)

18 (7.8)

6 (2.6)

24 (10.4)

codon 8 (-AA)

16 (7.0)

5 (2.2)

21 (9.1)

IVS-1-5 (G>C)

6 (2.6)

4 (1.7)

10 (4.3)

codon 5 (-CD)

8 (3.5)

0

8 (3.5)

codon 44 (-C)

8 (3.5)

0

8 (3.5)

IVS-1-130 (G>C)

8 (3.5)

0

8 (3.5)

codon 8/9 (+G)

4 (1.7)

3 (1.3)

7 (3.0)

IVS-1-130 (G>C)

6 (2.6)

0

6 (2.6)

0

5 (2.2)

5 (2.2)

IVS-2-745 (C>G)

4 (1.7)

0

4 (1.7)

IVS-2-848 (C>A)

0

4 (1.7)

4 (1.7)

codon 6 (-A)

0

2 (0.9)

2 (0.9)

codon 6 (G>A) HbC

0

1 (0.4)

1 (0.4)

codon 6 (A>T) HbS

0

1 (0.4)

1 (0.4)

-110 (C>T)

0

0

0

IVS-1-6 (T>C)

-87 (C>T)

0

0

0

-30 (T>A)

0

0

0

codon 15 (TTG>TGA)

0

0

0

codon 27 (G>T) Knossos 0

0

0

IVS-1-116 (T>G)

0

0

0

22 (9.6)

NA

22 (9.6)

182

48

230

Undetermined Total

Table 2. Compound Heterozygous - β-thalassemia Mutations in the 115 Pediatric Patients Mutation 1 IVS-1-1 (G>A)

Mutation 2

Frequency*

IVS-2-848

4

codon 39 (C>T)

codon 8 (-AA)

2

codon 6 (-A)

IVS-1-5 (G>C)

2

IVS-1-110 (G>A)

IVS-1-1 (G>A)

2

IVS-1-110 (G>A)

codon 8 (-AA)

1

IVS-1-110 (G>A)

codon 39 (C>T)

1

IVS-1-110 (G>A)

IVS-1-6 (T>C)

1

IVS-1-110 (G>A)

IVS-1-5 (G>C)

1

IVS-1-110 (G>A)

codon 8/9 (+G)

1

IVS-1-1 (G>A)

codon 39 (C>T)

1

codon 8 (-AA)

IVS-1-5 (G>C)

1

*Number of cases

02.12.2011 10:13

Turk J Hematol 2011; 28: 264-8

Discussion β-thalassemia is a serious medical, social, and economic problem, both for affected families and the general population. To the best of our knowledge all published studies related to β-thalassemia mutations are concerned with thalassemia carrier status [3-5], and only 2 mutations in children with β-thalassemia [8]; as such, the present study is the first to examine 22 thalassemia mutations in 115 children with β-thalassemia from Şanlıurfa Province, Turkey.

Based on a comparison of the frequency of several mutations, IVS-1-110 (G-A) is the most common mutation in Syria, Macedonia, Greece, and Bulgaria, as in the present study (29%), which is nearly half the rate previously reported for Turkey [2]. The IVS1-1 (G-A) mutation, which is highly prevalent in the Marmara and Aegean regions of Turkey, is among the 4 most common mutations in Mediterranean and Middle Eastern countries [8]; in the present study it was the 2nd most common mutation (14%).

The order of frequency for other mutations, however, is different [2,10,11]. There are some differences between the frequency of mutations observed in Şanlıurfa in the present study and that in the nearest provinces Gaziantep and Diyarbakir, e.g. the frequency of codon 39 (C>T) was 10.3%, 3.6%, and 6.4%, respectively [13].

It was reported that -30 (T>A) mutation, which is more common in eastern and southeastern Anatolia than other regions [8,12], but its frequency is similar to Iran and Syria, was not identified in any mutant allele in Şanlıurfa, a large city in southeastern Anatolia. IVS-2-1 (G>A) and codon 8 (-AA) are both β-thalassemia mutations associated with mild thalassemia, and are the 2 most common mutations in Azerbaijan [3]. Patients in the present study that had these mutations did not have mild thalassemias, and codon 8 (-AA) mutation was the 3rd most common mutation we observed. IVS-1-130 (G>C) mutations are seen exclusively in patients originating from the city of Burdur in the Mediterranean Region of Turkey and have not been reported from any other country [2].

In the present study IVS-1-130 (G>C) mutations were noted in 6 homozygous alleles. The present findings illustrate the heterogeneity of β-thalassemia mutations in Şanlıurfa Province, as in other cities in

TJH-ARALIK-2011-4-crossref.indd 19

Ayçiçek et al.

Children with β-thalassemia mutations in Şanlıurfa, Turkey

267

Turkey [2]. A broad range of mutations have been observed in Turkey, probably because of its location at the convergence of 3 continents and the subsequent influence of various ethnic groups [13]. The consanguineous marriage rate observed among the parents of the patients in the present study was 76%, which is higher than previously reported [5], whereas the prevalence of compound heterozygous β-thalassemia mutations was lower (6%).

Turkey has had a national hemoglobinopathy screening program since 2002, known as the Fight against Hereditary Blood Disease [14]. The program’s guidelines were developed for the prevention and treatment of hemoglobinopathies. It is estimated that 150-200 infants will be born with β-thalassemia annually in Turkey [15]. Özdemir et al. reported that premarital screening and prenatal diagnosis are quite successful in preventing the birth of children with thalassemia major in Muğla, Turkey [16]. During such screening 131 at-risk couples were identified and those at risk of having children with hemoglobinopathy were referred for prenatal diagnosis. In all, 75 mothers underwent prenatal diagnosis and 21 were diagnosed with beta thalassemia major; in all the cases pregnancy was terminated in Muğla [16]. Since the start of premarital screening in Muğla, there have been no new β-thalassemia major births [16]. Conversely, a study on the efficacy of premarital screening in Hatay, Turkey, showed that only 17.5% of pregnant highrisk couples underwent prenatal diagnosis, despite receiving genetic counseling [17]. These results show that effectiveness of education in the hemoglobinopathy prevention program is inefficient in some province [15]. To the best of our knowledge no study related to the effect of Turkey’s hemoglobinopathy screening program on the rate of children born with thalassemia has been published.

Controls of new thalassemic cases can be achieved in higher difficulties in Şanlıurfa Province, because of the presence of different ethnic groups that have large and young families, low socioeconomic and educational status, and as high as 65% close consanguineous and common-law marriages.

Unfortunately, many at-risk couples still discover their risk only after giving birth to an affected child.

In addition, at-risk couples find it very difficult to opt for abortion after learning that their fetus has β-thalassemia major or other severe diseases. In the

02.12.2011 10:13

268

Ayçiçek et al.

Children with β-thalassemia mutations in Şanlıurfa, Turkey

present study mean age of the patients was 7.3±4.6 years; in all, 53% of the patients were younger than 8 years and were born after Turkey’s hemoglobinopathy screening program began.

Turkey’s hemoglobinopathy screening program must take into account epidemiological and molecular data to set up the adequate strategy that sensitization and information about the disease, population screening and genetic counseling for carriers, and prenatal diagnosis for couples with affected children. In conclusion, we think that after having identified the most frequent mutations in β-thalassemia patients from Şanlıurfa Province, the frequency of premarital, preconception, and prenatal diagnosis will increase.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

4.

5.

Galanello R, Origa R. Beta-thalassemia. Orphanet J Rare Dis 2010:5:11. [CrossRef] Altay C. The Frequency and Distribution Pattern of ss-Thalassemia Mutations in Turkey. Turk J Haematol 2002;19:309-15.

Aksoy M. Hemoglobinopathies in Turkey. Hemoglobin 1985;9:209-18. [CrossRef] Arcasoy A, Cavdar AO. The incidence of thalassemia and abnormal hemoglobinopathies in Turkey. Acta Haematol 1971;45:313-7.

Altay C, Gürgey A. Distribution of hemoglobinopathies in Turkey. Report based on studies conducted at the Hacettepe Children’s Hospital and the reviews of other studies. Turk J Pediatr 1986;28:219-29.

TJH-ARALIK-2011-4-crossref.indd 20

Turk J Hematol 2011; 28: 264-8

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

Altay Ç, Basak AN. Molecular basis and prenatal diagnosis of hemoglobinopathies in Turkey. Int J Pediatr Hematol Oncol 1995;2:283-90.

Basak AN, Özçelik H, Özer A, Tolun A, Aksoy M, Agaoglu L, Ridolfi F, Ulukutlu L, Akar N, Gürgey A, Kirdar B. The molecular basis of SS-thalassemia in Turkey. Hum Genet 1992;89:315-8. [CrossRef] Dilmec F, Koc A, Akkafa F. Investigation of - SS globin gene mutations in patients with β-thalassemia in Şanlıurfa province of Turkey. Turkiye Klinikleri J Med Sci 2010;30:514-9.

Cunningham MJ, Sankaran VG, Nathan DG, Orkin SH. Classes of mutations that cause thalassemia. In: Orkin SH, Nathan DG, Ginsburg D, Look AT, Fisher DE, Lux SE eds. Hematology of Infancy and Childhood, 7th edition, Saunders, Elsevier Philadelphia, 2009:1023-33.

Kazazian HH Jr, Orkin SH, Markham AF, Chapman CR, Youssoufian H, Waber PG. Quantitation of the close association between DNA haplotypes and specific ss-thalassaemia mutations in Mediterraneans. Nature 1984;310:152-4. [CrossRef] Cao A, Galanello R. Beta-thalassemia. Genet Med 2010;12:61-76. [CrossRef] Angastiniotis M, Modell B, Englezos P, Boulyjenkov V. Prevention and control of haemoglobinopathies. Bull World Health Organ 1995;73:375-86.

Pehlivan S, Okan V, Guler E, Yilmaz M, Sever T, Cankus C, Balat O, Pehlivan M. Thalassemia mutations in Gaziantep, Turkey. African Journal of Biotechnology 2010;9;1255-8.

Canatan D, Kose MR, Ustundag M, Haznedaroglu D, Ozbas S. Hemoglobinopathy control program in Turkey.

Community Genet 2006;9:124-6. [CrossRef] Sarper N, Şenkal V, Güray F, Şahin Ö, Bayram J. Premarital hemoglobinopathy screening in Kocaeli, Turkey: a crowded industrial center on the north coast of Marmara Sea. Turk J Haematol 2009;26:62-6. Özdemir S, Timur IH, Gencer İ, Akar N. Premarital screening in Muğla region of Turkey. Turk J Hematol 2009;26:214-5.

Gali E, Polat G, Doğdu, G, Akgöl M, Parlar M, Yüregir G. Hatay ilinde evlilik öncesi hemoglobinopati sonuçlarının değerlendirilmesi. Mersin Üniversitesi Tıp Fakültesi dergisi 2001;3:305-10.

02.12.2011 10:13

Commentary

269

Tracing the footsteps of IVS-I-130 G-C mutation of the human hemoglobin beta globin gene: From Şanlıurfa to Askeriye, Burdur, Turkey İnsan hemoglobin beta globin genindeki IVS-I-130 G-C mutasyonu izlerinin takibi: Şanlıurfa'dan Askeriye'ye, Burdur, Türkiye Çiğdem Altay Honorary Member of the Turkish Academy of Sciences, Ankara, Turkey

The first report of IVS-I-130 G-C mutation was of a Turkish patient from Askeriye, a small village near Burdur in southern Turkey, which was published in 1990 [1]. Later, a Japanese patient with the mutation in a heterozygous state was reported in 1992 [2]. The mutation has subsequently been reported numerous times in patients of Askeriye ancestry from İzmir and Antalya, Turkey [1,3]. In this issue of the journal, Çiçek et al. reports on the frequency of thalassemia mutations in Şanlıurfa in southeastern Turkey [4]; they observed the IVSI-130 G-C mutation in 6 alleles (2.5%) in families without any known association to Askeriye.

It is interesting to note that Kemal Tahir mentions a fort and a field hospital in nearby Burdur during World War I in the semi-biographical novel about his father entitled, Bir Mülkiyet Kalesi, which translates as, A Fortress of Property. The place he mentions is most probably Askeriye, as Askeriye means military settlement [5]. According to the novel, during World War I, probably in 1917, a small group of people from southeastern Turkey composed of very old men and women, and young women and chil-

dren, but no young or middle aged men, settled in the houses recently deserted by the Armenians in the area (Askeriye). They all spoke Kurdish, and lived under conditions of poor sanitation, hunger, and malnourishment [5]. The young women of the group immediately began to exchange sex with the soldiers for bread. This continued for about 1 year, and then the group returned to their home in southeastern Turkey [5] in 1918, most probably leaving behind a few donors of the IVS-I-130 G-mutation, such as young women and/or their newborns.

This is only one of many stories about gene donation via population movement; however, it is well known that Anatolian history includes many east-to-west and west-to-east migrations. As such, it is difficult to conclude that the above story about thalassemia gene donation is true, however likely it may be. I advise the authors to first demonstrate via haplotype analysis that the mutations observed in Askeriye and Şanlıurfa both occurred on chromosome 11. Additionally, the story told in the novel needs to be verified by military and local city archives.

Address for Correspondence: Prof. Çiğdem Altay, Honorary Member of the Turkish Academy of Sciences, Ankara, Turkey Phone: +90 0532 421 37 20 E-mail: caltay@hacettepe.edu.tr doi:10.5152/tjh.2011.99

TJH-ARALIK-2011-4-crossref.indd 21

02.12.2011 10:13

270

Altay Ç.

IVSI-130 G-C mutation of the human hemoglobin beta globin gene

References 1.

2.

Öner R, Altay Ç, Gurgey A, Aksoy M, Kilinç Y, Stoming TA, Reese AL, Kutlar A, Kutlar F, and Huisman THJ. Beta thalassemia in Turkey. Hemoglobin 1990;14:1-13. [CrossRef] Yamamoto K, Yamamoto K, Hattori Y, Yamashiro Y, Hoshitani M, Morishita M, Ohba Y, Katahira H, Karasawa M, Omine M. Two beta-thalassemia mutations in Japan: codon 121 (GAA----TAA) and IVS-I-130 (G----C).

Hemoglobin 1992;16:295-302. [CrossRef]

TJH-ARALIK-2011-4-crossref.indd 22

3.

4.

5.

Turk J Hematol 2011; 28: 269-70

Nal N, Manguoglu AE, Sargin CF, Keser I, Kupesiz A, Yesilipek A, Luleci G. Two rare mutations in Turkey: IVS I.130(G-C) and IVS II.848(C-A). Clin Lab Haematol.

2005; 27:274-7. [CrossRef] Ayçiçek A, Koc A, Özdemir ZC, Bilinç H, Koçyiğit A, Dilmec F. β-thalassemia mutations in Sanliurfa province Turkey. 264-8.

Kemal Tahir. Bir Mülkiyet Kalesi. Istanbul: Tekin Yayınevi, 2nd ed. 1982:165-78.

02.12.2011 10:13

Research Article

271

Antifungal prophylaxis in stem cell transplantation centers in Turkey Türkiye'deki kök hücre nakli merkezlerinde antifungal profilaksi Hamdi Akan Department of Hematology, Faculty of Medicine, Ankara University, Ankara, Turkey

Abstract Objective: This study aimed to determine the current state of antifungal prophylaxis in Turkish stem cell transplantation (SCT) centers.

Materials and Methods: The were 38 active stem cell transplantation centers in Turkey, 28 of which were registered with the European Group for Blood and Marrow Transplantation (EBMT). Survey questionnaires were sent to the 28 EBMT centers in an effort to collect data on antifungal prophylaxis in different settings. In all, 24 of the centers completed the survey; 1 of the 24 centers was excluded from the study, as it was under construction at the time and was not performing transplantation.

Results: In all, 15 (65%) of the 23 centers were adult SCT centers, 7 (31%) were pediatric SCT centers, and 1 center treated both adult and pediatric patients. All centers (23/23) performed both allogeneic and autologous transplants, 20 centers performed non-myeloablative transplants, 8 performed cord blood transplants, and 7 performed unrelated transplants. Primary antifungal prophylaxis was used at all 23 centers during allogeneic transplants, whereas 18 of the 23 centers used it during every autologous transplant and 2 of the 23 centers used it during autologous transplants on a per case basis. The most common drug used for prophylaxis was fluconazole (F) (21/23), followed by itraconazole (I) (3/23), amphotericin-B (2/23), and posaconazole (1/23). Among the 23 centers, 3 reported that for allogenic transplants they changed the antifungal prophylactic in cases of graft versus host disease (GVHD), and 12 of the 23 centers reported that they changed the antifungal prophylactic in case of nearby construction. All 23 centers performed secondary prophylaxis.

Conclusion: Antifungal prophylaxis for hematopoetic SCT patients was the standard protocol in the 23 centers included in the study, usually with such azoles as F. The introduction of posaconazole in Turkey and the potential approval of voriconazole for antifungal prophylaxis will eventually alter prophylaxis practice in Turkey, which we plan to assess in the future. (Turk J Hematol 2011; 28: 271-5) Key words: Prophylaxis, antifungal, stem cell transplantation Received: February 28, 2011

Accepted: June 1, 2011

Özet Amaç: Türkiye’deki kök hücre nakli merkezlerinde antifungal profilaksi eğilimlerini anlamak için yapılan bu çalışma bir anket çalışmasıdır.

Address for Correspondence: Prof. Hamdi Akan, Department of Hematology, Faculty of Medicine, Ankara University, 06590 Ankara, Turkey Phone: +90 312 595 73 42 E-mail: akan@medicine.ankara.edu.tr doi:10.5152/tjh.2011.81

TJH-ARALIK-2011-4-crossref.indd 23

02.12.2011 10:13

272

Akan H. Antifungal prophylaxis in stem cell transplantation

Turk J Hematol 2011; 28: 271-5

Yöntem ve Gereçler: Türkiye’de çalışan 38 kök hücre nakli merkezinden EBMT’ye kayıtlı 28 merkeze anket gönderilmiş ve 24 merkezden yanıt alınmıştır. Bir merkez halen inşaat yapımı nedeni ile anketi dolduramamıştır.

Bulgular: Bu merkezlerden 15 tanesi erişkin (%65), 7 tanesi çocuk (%31) ve 1 tanesi erişkin ve çocuk nakil merkezidir. Tüm merkezler hem allogeneik, hem de otolog nakil yapmakta olup; 20 merkezde nonmyeloablatif, 8 merkezde kordon kanı ve 7 merkezde akraba dışı nakil yapılmaktadır. Tüm merkezlerde allogeneik nakillerde profilaksi yapılırken, 18/23 merkezde otolog nakillerde profilaksi yapılmaktadır. 23 merkezden 2'si ise, otolog nakilde olguya göre profilaksi vermektedir. En çok kullanılan ajan Flukonazol olup (21/23), bunu Itrakonazol (3/23), amfoterisin-B (2/23), ve posakonazol (1/23) izlemektedir. Allogeneik nakil yapılan 3 merkez Graft versus Host Hastalığı varlığında profilaksiyi değiştirmekte ve 12/23 merkez yakında inşaat olması durumunda profilaktik yaklaşımlarını değiştirmektedir. Tüm merkezler sekonder profilaksi yapmaktadır.

Sonuç: Son yıllardaki gelişmeler bu alandaki yaklaşımları değiştirecek ve Flukonazol yerine yeni triazollerin geçmesine yol açacak niteliktedir. Bu nedenle bu anket 2013 yılında yinelenerek değişim olup olmadığı anlaşılacaktır. (Turk J Hematol 2011; 28: 271-5) Anahtar kelimeler: Profilaksi, antifungal, kök hücre nakli Geliş tarihi: 28 Şubat 2011

Kabul tarihi: 01 Haziran 2011

Introduction The results of a recent survey by the Worldwide Network for Blood and Marrow Transplantation show that in 2008 more than 51,000 hematopoietic stem cell transplantations (HSCTs) were performed by 1400 teams in 72 countries. In Turkey 944 HSCTs were performed in 2010 (numbers reported by 19 European Group for Blood and Marrow Transplantation [EBMT] centers); 561 were autologous and 383 were allogeneic HSCTs, and 97 were non-myeloablative transplants.

HSCT is a lifesaving technique, especially in the treatment of hematological malignancies; however, it is associated with a high risk of infections. Fungal infections are a major problem and although they represent a small fraction of the infection spectrum, they are associated with a high risk of mortality [1-3]. In recent years new methods of treating invasive fungal infections have been developed, but they are time consuming, expensive, and have a high risk of severe side effects. Although evidence of the benefit of antifungal prophylaxis in the treatment of malign hematological diseases is weak, there is sufficient evidence of the positive effect of antifungal prophylaxis on morbidity and mortality in stem cell transplantation (SCT) [4-6].

Fluconazole (F) has been the main agent used for antifungal prophylaxis against Candida infections, but it is ineffective against Aspergillus strains, which remains a major problem due to the high rate of mortality associated with invasive aspergillosis. New drugs that are effective against both

TJH-ARALIK-2011-4-crossref.indd 24

Candida and Aspergillus have been developed; in particular, posaconazole seems to be a promising agent for stem cell transplant patients with graft versus host disease (GVHD), and many hospitals in the US and Europe regularly use this drug [6].

Posaconazole has recently been introduced to Turkey and the other candidate azole voriconazole is not indicated for prophylaxis. The present study aimed to determine the current state of antifungal prophylaxis in Turkish SCT centers. The survey will be repeated in 3 years to monitor any changes in antifungal prophylactic practice following the introduction of new antifungal drugs.

Materials and Methods A survey questionnaire was used to collect data on the type of center, type of transplants performed, drugs and doses used for antifungal prophylaxis, and prophylactic strategies. Among the 38 SCT centers in Turkey, 28 were registered with EBMT (Figure 1).

All 28 centers received the questionnaire, which was confirmed by phone, fax, or e-mail. In all, 24 centers responded to the survey; 1 of the 24 centers was excluded from the study, as it was under construction at the time and was not performing transplantation.

Results Center characteristics In all, 15 (65%) of the 23 centers were adult SCT centers, 7 (31%) were pediatric SCT centers, and 1

02.12.2011 10:13

Turk J Hematol 2011; 28: 271-5

center treated both adult and pediatric patients (Figure 2). All centers (23/23) performed both allogeneic and autologous transplants, 20 centers performed non-myeloablative transplants, 8 performed cord blood transplants, and 7 performed unrelated transplants.

Prophylaxis strategies Primary antifungal prophylaxis was used at all 23 centers during allogeneic transplantation, whereas 18 of the 23 centers used it during all autologous transplants and 2 of the 23 centers used it during autologous transplants on a per case basis. The most common drug used for prophylaxis was F (21/23), followed by itraconazole (I) (3/23), amphotericin-B (2/23), and posaconazole (1/23). For autologous transplants the most common prophylactic drug was F (18/20), followed by I (3/20), and amphotericin-B (2/20) (Table 1).

Akan H. Antifungal prophylaxis in stem cell transplantation

273

neic and 8 of the 23 autologous centers had a laminar air flow system. In all, 22 of the 23 allogeneic centers and 21 of the 23 autologous centers used HEPA filters, and 13 of the 23 allogeneic and 11 of the 23 autologous centers had positive pressure rooms.

Discussion Although the effectiveness of antifungal prophylaxis was established in the 1980s, in recent years there have been several new developments. It was clearly shown that F prophylaxis was effective in reducing the number of invasive fungal infections

Dose The median F dose was 400 mg/d for allogeneic transplants and 225 mg/d for autologous transplants.

Duration Primary prophylaxis most commonly began on d 0 (-6 and +1) and ended on d 90 (+30-180) in the absence of GVHD. In patients with GVHD, the last day of prophylaxis was d 180 (60->180). For autologous transplants prophylaxis began on d 0 (-1 and +1) and ended on d 30 (+15-180).

Change of Approach Among the 23 centers, 3 reported that for allogenic transplants they changed the antifungal prophylactic in cases of GVHD, and 12 (52%) of the 23 (52%) centers reported that they changed the antifungal prophylactic in case of nearby construction.

All 23 centers performed secondary prophylaxis and voriconazole was used most often (17.5%), followed by amphotericin-B (7.2%).

Diagnosis For diagnosis of breakthrough fungal infections 21 of the 23 centers used high-resolution computed tomography, 20 used galactomannan, 5 used b-glucan, and 1 used molecular diagnostics (PCR).

Physical measures Among the 23 centers in the study, 22 took care of the patients in private rooms, and 10 of the 23 alloge-

TJH-ARALIK-2011-4-crossref.indd 25

Figure 1. Distribution of Stem Cell Transplantation Centers 1.4%

Adult SCT

7.31%

Pediatric SCT

15.65

Adult + Pediatric SCT

Figure 2. Type of Stem Cell Transplantation Centers

Table 1. Drugs Used in Antifungal Prophylaxis Nantiful

No. of Center/Total

Allogeneic

Type of Center

Fluconazole

21/23

Allogeneic

Itraconazole

3/23

Allogeneic

Amphotericin-B

2/23

Allogeneic

Posaconazole

1/23

Autologuos

Fluconazole

18/20

Autologous

Itraconazole

3/20

Autologous

Amphotericin-B

2/20

02.12.2011 10:13

274

Akan H. Antifungal prophylaxis in stem cell transplantation

and the mortality rate in SCT patients [4,5]. These findings prompted the widespread use of F prophylaxis. The use of F led to a decrease in the number of Candida infections, which was subsequently followed by an increase in the number of Aspergillus infections [1]. The main problem was that F has no effect on Aspergillus and Aspergillus infection is associated with a very high mortality rate in SCT patients [1,2,7-9]. The need for an antifungal drug with a wider spectrum of effect led to the use of I prophylaxis in SCT, with some success; however, bioavailability and tolerability issues precluded its use as a primary agent for prophylaxis in SCT [10-12].

A study published in 2005 reported that posaconazole, a new triazole, was an effective prophylactic against GVHD in allogeneic SCT patients [6].

Subsequently, major treatment guidelines supported the use of posaconazole in SCT with an A1 level recommendation, and use of this approach continues to increase [13]. Voriconazole may also be a good alternative, as it is available in oral form and 2 recent studies reported its use resulted in decreasing the rate of invasive fungal infection, although it did not decrease the mortality rate. Furthermore, posaconazole in tablet form, rather than oral suspension, is currently under investigation. In Turkey F is the primary prophylactic drug used in SCT. Although a widespread switch to posaconazole is expected, as it was introduced to the Turkish market during the last quarter of 2010, the present study could not measure its affect on antifungal prophylactic treatment in Turkey.

All responding SCT centers are using secondary prophylaxis with voriconazole, largely due to its demonstrated effectiveness against aspergillosis and oral form. It is noteworthy that most centers rely on diagnostic measures rather than empirical approach for detecting breakthrough invasive fungal infections. The aim of the present study was to evaluate the state of antifungal prophylaxis in SCT centers in Turkey and the affect of forthcoming changes in this area will be assessed by repeating the survey in the future.

Acknowledgement This is an observational study and does not require an Ethical committee approval. My conflict of interests are summarized below: Clinical Research: MS&D, Pfizer Speaker: MS&D, Pfizer, Gilead Advisory Board: MS&D

TJH-ARALIK-2011-4-crossref.indd 26

Turk J Hematol 2011; 28: 271-5

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

Marr KA, Carter RA, Boeckh M, Martin P, Corey L. Invasive aspergillosis in allogeneic stem cell transplant recipients: changes in epidemiology and risk factors.

Blood 2002;100:4358-66. [CrossRef] Pagano L, Caira M, Nosari A, Van Lint MT, Candoni A, Offidani M, Aloisi T, Irrera G, Bonini A, Picardi M, Caramatti C, Invernizzi R, Mattei D, Melillo L, de Waure C, Reddiconto G, Fianchi L, Valentini CG, Girmenia C, Leone G, Aversa F. Fungal infections in recipients of hematopoietic stem cell transplants: results of the SEIFEM B-2004 study--Sorveglianza Epidemiologica Infezioni Fungine Nelle Emopatie Maligne. Clin Infect Dis 2007;45:1161-70. [CrossRef] Lin SJ, Schranz J, Teutsch SM. Aspergillosis case-fatality rate: systematic review of the literature. Clin Infect Dis 2001;32:358-66. [CrossRef] Goodman JL, Winston DJ, Greenfield RA, Chandrasekar PH, Fox B, Kaizer H, Shadduck RK, Shea TC, Stiff P, Friedman DJ. A controlled trial of fluconazole to prevent fungal infections in patients undergoing bone marrow transplantation. N Engl J Med 1992;326:845-51.

[CrossRef] Slavin MA, Osborne B, Adams R, Levenstein MJ, Schoch HG, Feldman AR, Meyers JD, Bowden RA..

Efficacy and safety of fluconazole prophylaxis for fungal infections after marrow transplantation--a prospective, randomized, double-blind study. J Infect Dis 1995;171:1545-52. [CrossRef] Ullmann AJ, Lipton JH, Vesole DH, Chandrasekar P, Langston A, Tarantolo SR, Greinix H, Morais de Azevedo W, Reddy V, Boparai N, Pedicone L, Patino H, Durrant S. Posaconazole or fluconazole for prophylaxis in severe graft-versus-host disease. N Engl J Med 2007;356:335-47. [CrossRef] Wingard JR, Hsu J, Hiemenz JW. Hematopoietic Stem Cell Transplantation: An Overview of Infection Risks and Epidemiology. Hematol Oncol Clin N Am 2011;25: 101-16. [CrossRef] Kontoyiannis DP, Marr KA, Park BJ, Alexander BD, Anaissie EJ, Walsh TJ, Ito J, Andes DR, Baddley JW, Brown JM, Brumble LM, Freifeld AG, Hadley S, Herwaldt LA, Kauffman CA, Knapp K, Lyon GM, Morrison VA, Papanicolaou G, Patterson TF, Perl TM, Schuster MG, Walker R, Wannemuehler KA, Wingard JR, Chiller TM, Pappas PG. Prospective surveillance for invasive fungal infections in hematopoietic stem cell transplant recipients, 2001-2006: overview of the Transplant-Associated Infection Surveillance Network (TRANSNET) Database.

Clin Infect Dis 2010;50:1091-100. [CrossRef] Martino R, Subirá M, Rovira M, Solano C, Vázquez L, Sanz GF, Urbano-Ispizua A, Brunet S, De la Cámara R; alloPBSCT Infectious/Non-infectious Complications Subcommittees of the Grupo Español de Trasplante Hematopoyético (GETH). Invasive fungal infections after allogeneic peripheral blood stem cell transplanta-

02.12.2011 10:13

Turk J Hematol 2011; 28: 271-5

tion: incidence and risk factors in 395 patients. Br J Haematol 2002;116:475-82. [CrossRef] 10. Winston DJ, Maziarz RT, Chandrasekar PH, Lazarus HM, Goldman M, Blumer JL, Leitz GJ, Territo MC. Intravenous and oral itraconazole versus intravenous and oral fluconazole for long-term antifungal prophylaxis in allogeneic hematopoietic stem-cell transplant recipients. A multicenter, randomized trial. Ann Intern Med 2003;138:705-13.

11. Harousseau JL, Dekker AW, Stamatoullas-Bastard A, Fassas A, Linkesch W, Gouveia J, De Bock R, Rovira M, Seifert WF, Joosen H, Peeters M, De Beule K. Itraconazole oral solution for primary prophylaxis of fungal infections in patients with hematological malignancy and profound neutropenia: a randomized, double-blind, double-placebo, multicenter trial comparing itraconazole and amphotericin B. Antimicrob Agents Chemother 2000;44:1887-93. [CrossRef]

TJH-ARALIK-2011-4-crossref.indd 27

Akan H. Antifungal prophylaxis in stem cell transplantation

275

12. Menichetti F, Del Favero A, Martino P, Bucaneve G, Micozzi A, Girmenia C, Barbabietola G, Pagano L, Leoni P, Specchia G, Caiozzo A, Raimondi R, Mandelli F. Itraconazole oral solution as prophylaxis for fungal infections in neutropenic patients with hematologic malignancies: a randomized, placebo-controlled, double-blind, multicenter trial. GIMEMA Infection Program.

Gruppo Italiano Malattie Ematologiche dell' Adulto.

Clin Infect Dis 1999;28:250-5. [CrossRef] 13. Freifeld AG, Bow EJ, Sepkowitz KA, Boeckh MJ, Ito JI, Mullen CA, Raad II, Rolston KV, Young JA, Wingard JR, Infectious Diseases Society of America. Clinical Practice Guideline for the Use of Antimicrobial Agents in Neutropenic Patients with Cancer: 2010 Update by the Infectious Diseases Society of America. Clin Infect Dis 2011;52:427-31. [CrossRef]

02.12.2011 10:13

276

Research Article

The effects of Ankaferd® Blood Stopper on transcription factors in HUVEC and the erythrocyte protein profile Ankaferd® Kanama Durdurucunun HUVEC’lerde transkripsiyon faktörleri ve eritrosit protein profili üzerine etkisi Erkan Yılmaz1, Şükrü Güleç2, Didem Torun1, İbrahim Celalettin Haznedaroğlu3, Nejat Akar2 1Biotechnology

Institute, Ankara University, Ankara, Turkey of Pediatric Molecular Genetics, Faculty of Medicine, Ankara University, Ankara, Turkey 3Department of Hematology, Faculty of Medicine, Hacettepe University, Ankara, Turkey 2Department

Abstract Objective: Ankaferd® Blood Stopper (ABS) is an herbal extract that has historically been used as a hemostatic agent in traditional Turkish medicine. ABS is comprised of a standardized herbal mixture of T. vulgaris, G. glabra, V. vinifera, A. officinarum, and U. dioica. ABS’s basic mechanism of action is the formation of an encapsulated protein web, which represents the focal point for vital erythrocyte masses. The hemostatic effects of ABS have been observed in vitro and in vivo. ABS was registered as a hemostatic agent for external hemorrhages and dental bleeding following phase I randomized, double-blind crossover placebo-controlled clinical research, and safety and efficacy reports. In terms of the potential use of ABS, transcription factors may be novel factors that play a role in the hemostatic and other pleiotropic effects of ABS. Materials and Methods: Hence, the present study aimed to investigate the effects of ABS on endothelium, and possible transcription factor changes in HUVEC (human umbilical vein endothelial cells) and the erythrocyte membrane profile.

ABS (5 μL and 50 μL) was administered to HUVEC (in 75 cm2; ~75% fullness) for 5 min and 15 min.

Results: ABS caused significant increases in the level of activation of the following transcription factors; AP2, AR, CRE/ATF1, CREB, E2F1-5, E2F6, EGR, GATA, HNF-1, ISRE, Myc-Max, NF-1, NFkB, p53, PPAR, SMAD 2/3, SP1, TRE/AP1, and YY1. Following erythrocyte membrane isolation, protein complexes were undissolved, but denatured. The protein complex formed was resistant to heat and detergent. Trypsin and sonication were used in order to break this complex; the complex dissolved and erythrocyte membrane proteins were released in SDS-PAGE. Conclusion: ABS established a very fast and solid protein web, and increased the level of transcription factor activation. Therefore the cellular effects of ABS could be related to different intracellular biological pathways. (Turk J Hematol 2011; 28: 276-85) Key words: Ankaferd®, endothelium, transcription factors, erythrocyte Received: August 30, 2009

Accepted: April 30, 2010

Address for Correspondence: M.D. Erkan Yılmaz, Biotechnology Institute, Ankara University, 06100 Ankara, Turkey Phone: +90 312 222 58 26 E-mail: eyilmaz@medicine.ankara.edu.tr doi:10.5152/tjh.2011.39

TJH-ARALIK-2011-4-crossref.indd 28

02.12.2011 10:13

Yılmaz et al.

Biological effects of Ankaferd®

Turk J Hematol 2011; 28: 276-85

277

Özet Amaç: Ankaferd BloodStopper® (ABS) bir bitkisel karışımıdır ve geleneksel Türk tıbbında uzun yıllardır kullanılmaktadır. ABS, T. vulgaris, G. glabra, V. vinifera, A. officinarum ve U. dioica bitkilerinin standartlaştırılmış en uygun karışımını ihtiva etmektedir. Temel etki mekanizması vital fizyolojik eritrosit birikimlerinin protein ağı yapısı oluşturmasıdır. Hemostatik etkileri in vivo ve in vitro çalışmalarda gösterilmiştir. ABS dış kanamalarda ve diş kanamalarında kontrollü klinik çalışmaları yapılmış güvenlik ve etkinlik raporları ile tescillenmiştir. Transkripsiyon faktörleri potansiyel olarak hemostatik ve diğer olası etkilerin merkezinde yer alabilir ve ABS uygulamalarından etkilenebilirler.

Yöntem ve Gereçler: Bu çalışmada, ABS’nin endotelde ve olası transkripsiyon faktörleri değişimini HUVEC’lerde (insan umbilikal ven endotelyal hücreleri) ve eritrosit membran profilleri üzerindeki etkilerinin incelenmesi amaçlanmıştır. ABS, HUVE hücrelerine (75cm2 yüzeyde; ~%75 dolulukta), 5 μL ve 50 μL hacimlerde 5 ve 15 dakika uygulanmıştır.

Bulgular: Transkripsiyon faktörlerinden AP2, AR, CRE/ATF1, CREB, E2F1-5, E2F6, EGR, GATA, HNF-1, ISRE, Myc-Max, NF-1, NFkB, p53, PPAR, SMAD 2/3, SP1, TRE/AP1, YY1’in aktivasyonlarında artış gözlenmiştir. Kandan eritrosit membranı izolasyonundan sonra, protein komplekslerinin denatürasyona rağmen çözünmemiş halde kalmaktadır ve bu kompleksler sıcaklığa ve deterjana dayanıklıdır. Sonikasyon ve tripsin muamelesinden sonra bu kompleksin ayrıştığı ve eritrosit membran proteinlerinin ortaya çıktığı SDS-PAGE’de gözlemlenmiştir.

Sonuç: Sonuçlar gözönüne alındığında hemostatik ajan ankaferd’in kanamaları durdururken çok hızlı ve sağlam bir ağ oluşturmaktadır ve uygulandığı bölgedeki hücrelerin içinde de etkili olup transkripsiyon faktörleri seviyelerini de etkileyerek birçok biyolojik mekanizmalar üzerinde etkili olabilir.

(Turk J Hematol 2011; 28: 276-85)

Anahtar kelimeler: Ankaferd®, endotel, transkripsiyon faktörleri, eritrosit Geliş tarihi: 30 Ağustos 2009

Kabul tarihi: 30 Nisan 2010

Introduction Ankaferd® Blood Stopper (ABS) is comprised of a standardized herbal mixture of Thymus vulgaris, Glycyrrhiza glabra, Vitis vinifera, Alpinia officinarum, and Urtica dioica. Each of these herbs has an effect on endothelium, blood cells, angiogenesis, cell proliferation, vascular dynamics, and molecular mediators [1,2]. ABS has been historically used as a hemostatic agent in traditional Turkish medicine [3,4]. ABS’s basic mechanism of action is the formation of an encapsulated protein network that provides a focal point for vital erythrocyte aggregation [1,2]. ABS-induced protein network formation with blood cells, particularly erythrocytes, is involved in the physiological primary and secondary hemostatic systems without an unbalanced activation of individual coagulation factors. This unique mechanism is an advantage of ABS, as compared to other hemostatic agents. Exposure to ABS in in the topical endothelial injury area provides a physiological hemostatic effect, together with tissue oxygenation, but without prothrombotic pathological activation of any clotting factor [1,2,5,6]. ABS causes encapsulated protein web formation, which induces erythrocyte aggregation via the interactions of fibrinogen gamma and red blood cells [1].

TJH-ARALIK-2011-4-crossref.indd 29

There are distinct and important molecular components of the ABS-induced hemostatic network.

Vital erythroid aggregation occurs with spectrinankyrin and actin proteins on the membranes of red blood cells. Essential erythroid proteins (ankyrin recurrent and FYVE bundle-containing protein 1, spectrin alpha, actin depolymerizing factor, LIM bundle and actin-binding subunit 1 isoform a, LIM bundle and actin-binding subunit 1 isoform b, NADP-dependent malic enzyme, NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, mitochondrial NADP (+)-dependent malic enzyme 3, ribulose bisphosphate carboxylase large chain, and maturase K) and the required ATP bioenergy (ATP synthase, ATP synthase beta subunit, ATP synthase alpha subunit, ATP-binding protein C12, TP synthase H+ transporter protein, ADF, and alpha-1, 2-glycosyltransferase ALG10-A) are included in the ABS protein library [7]. The physiological protein profile of red blood cell membranes (Figure 1) and the ABS protein library are similar [7]; therefore, vital erythroid aggregation is crucial to the ABS-induced hemostatic network.

ABS is a hemostatic agent that can be used effectively in clinical practice to control external bleeding, dental and periodontal hemorrhaging, dermal bleed-

02.12.2011 10:13

278

Yılmaz et al.

Biological effects of Ankaferd®

Turk J Hematol 2011; 28: 276-85

ing, and/or superficial mucosal blood leakage [8-11].

The hemostatic effects of ABS have been observed in vitro and in vivo [12-18]. Use of ABS as a hemostatic agent in external hemorrhages and in dental treatment in humans provided the first data showing that ABS was safe and effective in humans [9]. A phase I randomized, double-blind crossover placebo-controlled clinical study performed with healthy volunteers reported that topical ABS usage was safe [20].

In terms of the potential use of ABS, transcription factors [21-23] may be novel factors that play a role in the hemostatic and other pleiotropic effects of ABS. Hence, the present study aimed to investigate the effects of ABS on endothelium, and possible transcription factor changes in HUVEC (human umbilical vein endothelial cells) and the erythrocyte membrane profile. We also intended to observe the interrelationships between protein profile of ABS and the ABS-induced bond forming structures between red blood cells.

Materials and Methods The production, control, and analyses methods of ABS have been previously described [20]. ABS is available in 3 pharmaceutical forms: ampoule, pad, and spray: 1. Ankaferd® Blood Stopper 2-mL ampoule 2. Ankaferd® Blood Stopper pad · 2.5×7 cm (3 mL) · 5×7.5 cm (10 mL) · 20×20 cm (100 mL) 3. Ankaferd® Blood Stopper spray · 5 mL · 10 mL · 25 mL · 50 mL · 200 mL The quantities of the active ingredients in each pharmaceutical form are shown in Tables 1 and 2.

The effects of ABS on transcription factors and the erythrocyte protein profile in HUVEC endothelium were examined. ABS (5 μL and 50 μL) was administered to HUVEC (cellular properties; in 75 cm2; ~75% fullness) for 5 min and 15 min.

Nucleus isolation of HUVEC was performed using a nuclear extraction kit (Marligen Biosciences, USA) and the level of activity of the following transcription Table 2. Ingredients in the Spray Form of ABS Active ingredient

This figure was originally published in Blood. Low, P. S. Blood 2009; 113: 5372-3 © The American Society of Hematology (with permission)

Urtica dioica1

0.06

Vitis vinifera2

0.08

Glycrrhiza glabra2

0.09

Alpinia officinarum2

0.14

Thymus 1Dried

Figure 1. The red blood cell membrane and and its proteins

Quantity (mg/mL)

vulgaris3

root extract,

0.10

2dried

leaf extract,

3dried

grass extract

Table 1. Ingredients in the Ampoule and Pad Forms of ABS Active ingredient Quantity (mg)

Ampoule

2 mL

Pad 2.5×7 cm (3 mL)

5×7.5 cm (10 mL)

20×20 cm (100 mL)

Urtica dioica1

0.12

0.18

0.6

6

Vitis vinifera2

0.16

0.24

0.8

8

glabra2

0.18

0.27

0.9

9

officinarum2

0.14

0.21

0.7

7

0.10

0.15

0.5

5

Glycrrhiza Alpinia

Thymus

vulgaris3

1Dried root extract, 2dried leaf extract, 3dried grass extract

TJH-ARALIK-2011-4-crossref.indd 30

02.12.2011 10:13

Yılmaz et al.

Biological effects of Ankaferd®

Turk J Hematol 2011; 28: 276-85

factors was determined using a multiplex transcription factor profiling kit (20-plex) (Marligen Biosciences, USA) and examined (Luminex 100, Marligen Biosciences, USA) according to the manufacturer’s instructions; AP2 (activating protein 2), AR (androgen receptor), CRE-ATF1 (cyclic AMP response element or activating transcription factor 1), CREB (cyclic AMP response element-binding protein), E2F1-5, E2F6, EGR (early growth response), GATA (globulin transcription factor), HNF1 (hepatocyte nuclear factor-1), ISRE (interferon (IFN)-stimulated response element), Myc-Max, NF1 (nuclear factor-1), NF-κB (nuclear factor kappa B), p53 (protein 53 or tumor protein 53), PPAR (peroxisome proliferator-activated receptor), SMAD2/3, SP1, TRE/AP1 (TPA response element/activating protein 1), and YY1 (Yin Yang 1).

Two independent experiments were performed in duplicate with SD when indicated.

In order to examine the erythrocyte protein web 10 mL of human blood was eluted, according to density gradients (Ficoll analysis solution d=1.077).

The erythrocytes were washed 3 times with PBS and ABS was administered in doses of 25 μL/mL, 50 μL/mL, and 150 μL/mL. Erythrocyte membrane isolation was performed and examined in 10% SDSPAGE.

Results Interestingly, it is microscopically observed that the endothelial cells arised from the plastic surface Transcription Factor Profile After Anakafer® Treatment

45

UT 5ul 5dk 5ul 15dk 50ul 5dk 50ul 15dk

40 35

Fol

30 25 20 15 10 5 F1

F4 HN

HN

R

GA TA

EG

5

E2 F6

EB

1

1E2 F

CR

AR

E/ AT F

CR

AP

2

0

Figure 2. Transcription Factor Profile After Ankaferd® Treatment

TJH-ARALIK-2011-4-crossref.indd 31

279

and adhered to each other upon the ABS application to the HUVEC. In response to low dose ABS (5 μL) treatment for 15 min, all of the transcription factors reached to the highest level of activity, but at the higher dose (50 μL) the activation level is not further enhanced. The level of activation of the following transcription factors increased significantly in response to ABS; AP2, AR, CRE-ATF1, CREB, E2F1-5, E2F6, EGR, GATA, HNF1, ISRE, Myc-Max, NF1, NF-κB, p53, PPAR, SMAD2/3, SP1, TRE/AP1, and YY1 (Figures 2 and 3 indicate the increments of the transcription factors and the dose and exposure time of ABS).

During the ABS administration to the erythrocyte suspension, being dose-dependent also, cellular adhesions to each other were observed. Likewise, cellular unifications formed in different dosages were having different sizes of pellets. Following the erythrocyte membrane isolation, protein complexes were undissolved, but denatured. The protein complex that formed was resistant to heat (100°C) and detergent. Trypsin and sonication were used in order to break this complex; the complex dissolved and erythrocyte membrane proteins were released in SDS-PAGE (Figures 4 and 5).

Discussion The present study investigated the effects of ABS on transcription factors and the erythrocyte protein profile in HUVEC endothelium. ABS effectively stopped bleeding due to rapid formation of a complex between the cells and because the bond formed within the complex was very strong. We think that ABS is very effective at low doses (5 μL) not only outside cells, but inside as well, and can affect many molecular mechanisms in endothelial cells. The level of activity of the transcription factors investigated in the present study (AP2, AR, CREATF1, CREB, E2F1-5, E2F6, EGR, GATA, HNF1, ISRE, Myc-Max, NF1, NF-κB, p53, PPAR, SMAD2/3, SP1, TRE/AP1, and YY1) significantly increased in response to ABS (Figures 2 and 3). These transcription factors regulate a wide variety of biological functions, including hemostasis, infection, cellular proliferation, and inflammation (Table 3).

Numerous studies reported the hemostatic effects of topical ABS in the animals with normal [10,12,14,16-18] and defective hemostasis [15,24],

02.12.2011 10:13

280

Yılmaz et al.

Biological effects of Ankaferd®

Turk J Hematol 2011; 28: 276-85

25

UT 5ul 5dk 5ul 15dk 50ul 5dk 50ul 15dk

20

Fold

15

10

5

0 ISRE

Myc-Max

NF-1

NFkB

p53

PPAR

SMAD 2/3

SP1

TRE/AP1

YY1

Figure 3. Transcription Factor Profile After Ankaferd® Treatment 1

2

3

4

5

A-spectrin B-spectrin Band 3

Actin

Figure 4. Microscopic View of Erythrocytes Following ABS Treatment

and have set the preclinical stage for the development of this hemostatic product. The effects of ABS on hemostatic parameters have also been searched [2,6,25]. When added to plasma or serum ABS induced rapid formation of a protein network and erythrocyte aggregation. The levels of coagulation factors II, V, VII, VIII, IX, X, XI, and XIII were not affected by the administration of ABS. Plasma fibrinogen activity and antigen levels decreased following the administration of ABS, along with an increase in thrombin time. Total protein, albumin, and globulin levels decreased after administration of ABS. The

TJH-ARALIK-2011-4-crossref.indd 32

G6PD

Figure 5. Sds-Page of Abs-Treated Erythrocytes. Lanes 1-4: Trypsin and Sonication After Heat (100°C) and Detergent Treatment. Lane 5: Erythrocyte Membrane Proteins Treated with Heat and Detergent

researchers suggested that ABS stimulates the formation of an encapsulated protein network that provides a focal point for erythrocyte aggregation [2,6,25].

The short-term hematological and biochemical safety of oral systemic ABS in rabbits have been reported [13]. Acute mucosal toxicity, hematotoxicity, hepatotoxicity, nephrotoxicity, and biochemical

02.12.2011 10:13

Turk J Hematol 2011; 28: 276-85

Yılmaz et al.

Biological effects of Ankaferd®

281

Table 3. Selected Functions of the Studied Transcription Factors in HUVEC That Were Affected by ABS Transcription factor

Selected Functions

AP2

AP2 is a critical regulator of gene expression during embryogenesis, and has been implicated in tumorigenesis [19,36,37].

AR

AR is a member of the nuclear receptor superfamily, members of which function as ligand-inducible transcription factors that mediate expression of target genes in response to ligands specific to each receptor, including steroids, retinoids, vitamin D, and thyroid hormone [38].

CRE-ATF1

CRE-ATF1 is a transcriptional activator, and one of many transcription factors that bind a consensus sequence (5’-TGACGTCA) [39].

CREB

The CREB assay detects transcription factors that are responsive to intracellular levels of cyclic AMP. The CREB-binding element is an important indicator of signals propagated by hormones, growth factors, and neurotransmitters. CREB-binding proteins also function in growth factor-dependent cell survival, glucose homeostasis, and in learning and memory [40].

E2F1-5, E2F6

E2F is a group of genes that codifies a family of transcription factors (TF) in higher eukaryotes. Three of them are activators: E2F1, E2F2, and E2F3a. Six others act as suppressors: E2F3b and E2F4-8. All are involved in cell cycle regulation and DNA synthesis in mammalian cells. E2Fs as TFs bind to the TTTCGCGC consensus binding site in the target promoter sequence [41].

EGR

Four members of the EGR family are well known: Egr1 (ZNF225, ZIF268, NGFI-A, Krox-24); Egr2 (Krox-20); Egr3; Egr4 (NGFI-C). EGR-1 and EGR-2 encode nuclear proteins with zinc finger DNA-binding domains and immediate-early genes in T-cell activation, and can regulate transcription synergistically with NF-ATc. A correlation between EGR proteins and Wilms' tumors has been reported [42,43].

GATA

The GATA site 5’-TCAGATAAGA-3’ binds GATA transcription factors. GATA transcription factors are transcriptional activators that function via different genes in many different cell and tissue types. There are at least 6 forms of GATA protein. GATA regulates erythroid differentiation, promotes production of erythroid proteins such as spectrin, and is important to the health of red blood cells interacting with urotensin II. [44]

HNF1

Hepatocyte nuclear factors (HNFs) are a group of phylogenetically unrelated transcription factors that regulate the transcription of a diverse group of genes into proteins. These proteins include blood clotting factors, and enzymes and transporters involved in glucose, cholesterol, and fatty acid transport and metabolism [45,46].

ISRE

ISRE is known to induce MHC class I expression in response to IFNs, as well as a region comprising site α/enhancer B, which significantly stimulates constitutive transcription of HLA class I genes. Tumor cells are thought to escape immune surveillance by T cells via suppressing expression of major histocompatibility complex (MHC) class I molecules at their cell surface. ISRE acts as an anti-tumor molecule via acting on this mechanism [47].

Myc-Max

The Myc-Max site 5’-ACCACGTGGT-3’ binds c-Myc/Max heterodimers. Different transcription factors from the bHLH-ZIP class of proteins can form homo- or heterodimers and bind to the Myc-Max site to regulate genes associated with the cell cycle. Activation of myc genes are associated with cancer and there is much evidence that myc plays a major role in the pathogenesis of Burkkitt’s lymphoma [48].

NF1

The core nuclear factor-1 (NF-1/CTF-1) binding site 5’-TGGNNNNNNGCCAA-3’ binds to proteins of the NF-1 family. NF-1 proteins are transcriptional activators that directly interact with TFIIB and facilitate assembly of basal transcription complexes. NF-1 is expressed in a wide variety of cell types, with the exception of B-cells and T-cells. Chick embryo fibroblasts that over-express NF-1 proteins are resistant to transformation by the nuclear oncogenes jun, fos, junD, myc, and qin, but are readily transformed by cytoplasmic oncogenes such as src, raf, ras, and fps [49].

NF-κB

Complexes comprising homo- or heterodimers of proteins from the NFκB or rel family bind to the NFκB site (5’-AGGGGACTTTCCCA-3’). Transcription factors of the Rel NFκB family are ubiquitous in cells and are activated in response to signals that lead to cell growth, differentiation, inflammation, and apoptosis. NFκB proteins are connected to various signaling pathways that affect important biological responses, which has made them a high priority as pharmaceutical targets [50].

p53 (protein 53 or p53 is important in multi-cellular organisms, regulating the cell cycle and thus such functions as a tumor tumor protein 53) suppression. As such, p53 has been described as the guardian of the genome, the guardian angel gene, and

the master watchman, referring to its role in conserving stability by preventing genome mutation [51].

TJH-ARALIK-2011-4-crossref.indd 33

02.12.2011 10:13

282

Yılmaz et al.

Biological effects of Ankaferd®

Turk J Hematol 2011; 28: 276-85

PPAR

The PPAR site, also known as the peroxisome proliferation response element (PPRE), 5’-TGACCTTGACCT-3’ binds transcription factors from the PPAR family as homo- and heterodimers. Three PPAR isotypes-PPARalpha, PPAR-beta/delta, and PPAR-gamma-have been identified. PPARs have a DNA-binding domain and a ligand-binding domain with specificity for prostanoids, fatty acids, fibrates, and thiazolidinediones. Once activated by ligand binding, PPARs bind to DNA at the peroxisome proliferator response elements (PPREs) within genes and modulate transcription. PPARs display differential tissue distribution with PPAR-alpha and PPAR-gamma, playing a role in the pathogenesis of chronic diseases such as diabetes, obesity, and atherosclerosis. There is substantial evidence that different ligands may determine the specificity of PPARs interaction with particular co-activators, and drugs such as hypolipidemic fibrates and insulin-sensitizing thiazolidinediones (pioglitazone and rosiglitazone) have been developed to modulate their activity [52].

SMAD2/3

SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation [53,54].

SP1

Sp1 is a human transcription factor involved in gene expression in the early development of an organism.

SP1 contains a zinc finger protein motif, with which it binds directly to DNA and enhances gene transcription. Sp1 interacts with ATF7IP, ATF7IP2, POGZ, HCFC1, AATF, and PHC2 [55,56].

TRE/AP1

AP1 mediates gene regulation in response to many different physiological and pathological stimuli, including cytokines, growth factors, stress signals, and bacterial and viral infections, as well as oncogenic stimuli. The most widely studied AP1 complex is a c-Jun/c-Fos heterodimer. Studies on genetically modified mice and cells have highlighted the crucial role AP1 plays in a variety of cellular events involved in normal development and neoplastic transformation causing cancer. AP1-binding proteins are targets being considered by the pharmaceutical industry [57,58].

YY1

YY1 plays a fundamental role in normal biologic processes, such as embryogenesis, differentiation, replication, and cellular proliferation. As YY1 expression and function are known to be intimately associated with progression through phases of the cell cycle, the physiologic significance of YY1 activity has recently been applied to models of tumor biology [59].

toxicity were not observed during the short-term (7 days) follow-up period [13]. Use of ABS as a hemostatic agent in external hemorrhages and in dental treatment in humans provided the first data showing that ABS was safe and effective in humans [9]. A phase I double-blind, randomized crossover, placebo-controlled clinical study with a 5-d washout period between the crossover periods that included healthy volunteers reported that ABS was safe [20]. Physiological cell-based coagulation was clinically managed using topical ABS to prevent and treat bleeding associated with many clinicopathological states [10,18,26-28]. Erythrocyte masses are critical in the ABS-induced hemostatic protein network (Figures 4 and 5). Proteins on the cytoplasmic surface of erythrocyte membranes, including spectrin and actin, are thought to comprise the red cell cytoskeleton. Actin added to erythrocyte ghosts selectively associated with a component at the cytoplasmic surface of the membrane, and actin binding occurred via stimulation of actin polymerization (Figure 1). Haznedaroglu et al. [29] proposed that, platelets are not directly affected, but leukocyte activation is evident following the ABS exposure to whole blood according to the ultrastructural scanning electron microscopic

TJH-ARALIK-2011-4-crossref.indd 34

(SEM) morphological analyses [29]. Further investigations are needed to elucidate that vital issue since cellular hemostasis is a critical component of ABS hemostatic effects.

In the present study, GATA activity significantly increased following the administration of ABS. GATA regulates erythroid differentiation, promotes production of erythroid proteins such as spectrin, and is important to the health of red blood cells (Table 1).

The in vitro antibacterial activity of ABS was evaluated against 26 indicator strains, including gram-positive and gram-negative bacteria, using the agar diffusion method, and was observed to be effective against all strains [30,31]. Nisin, a food preservative bacteriocin used as a control, was inactive against gram-negative strains. In addition to its high inhibitor activity against various pathogens, and gram-positive and gram-negative bacteria, ABS was more stable than nisin at various temperatures and in the presence of enzymes. The antimicrobial activity of ABS was tested against many pathogens, including A. baumannii, E. coli, K. pneumonia, P. aeruginosa, Enterobacter spp., Stenotrophomonas maltophilia, MRSA, methicillin-resistant coagulase

02.12.2011 10:13

Yılmaz et al.

Biological effects of Ankaferd®

Turk J Hematol 2011; 28: 276-85

negative Staphylococcus, vancomycin-susceptible Enterococcus, and VRE, and was noted to be active against all the isolates, with zones of inhibition between 10 and 18 mm in diameter [32]. In addition to ABS’s hemostatic effects in hemorrhagic wound healing, its antimicrobial property can also be beneficial, and ABS has the potential to protect against various types bacterial pathogens [31,32]. In the present study, ABS upregulated numerous transcription factors (Figures 2 and 3) in endothelial cells that play a role in the process of infection and inflammation in response to a wide variety of pathogens and in wound healing, including AR, ISRE, EGR, HNF1, NF-κB, PPAR, SMAD2/3, and YY1 (Table 3). There may be a relationship between transcription factor activation and anti-infective activities of ABS. therefore, those data in our study represent true basis to further search the ‘mechanism of action’ of Ankaferd against distinct pathogens and wound healing as described in previous in vitro studies [30-32].

There are several hypotheses such as decreased angiogenesis, increased apoptosis, and interactions with tumor hemostasis that attempt to account for ABS’s mechanism of action on tumor tissue [8,33-35].

The hemostatic action of ABS is correlated with a reduction in tumor neo-angiogenesis. Topical ABS administration to gastrointestinal neoplastic tissue resulted in the control of bleeding and decreased tumor vascularization in rectal and gastric cancers [26]. Moreover, there is a close relationship between coagulation factor expression and solid tumor progression, via mechanisms other than angiogenesis.

In the present study ABS significantly increased the level of activity of the following transcription factors; AP2, AR, CRE-ATF1, CREB, E2F1-5, E2F6, EGR, ISRE, Myc-Max, NF1, NF-κB, p53, PPAR, SMAD2/3, SP1, TRE/AP1, and YY1. These regulator molecules affect distinct steps of cellular proliferation, such as cell cycle regulation, angiogenesis, signal transduction, apoptosis, inflammation, acute phase reaction, and immunity, and several metabolic molecular pathways (Table 3). In vivo preclinical models will be designed to elucidate the effects of ABS on neoplastic tissue, as described in previous in vitro studies [33,34] and in vivo studies on bleeding tumors [8,35].

The pleiotropic effects of ABS on vascular endothelium, blood cells, angiogenesis, cellular proliferation, vascular dynamics, and cellular mediators are being investigated to determine the potential

TJH-ARALIK-2011-4-crossref.indd 35

283

role of ABS in many pathological states, including neoplastic disorders, infectious diseases, and inflammation. Our observations in this report about the cellular effects of Ankaferd may shed further light on that perspective.

Acknowledgement We are grateful to Fiona Coats, PhD., VicePresident of Marligen Biosciences, Inc. USA, and N. Levent Gucluer of Hemakim AS, Turkey for generously supplying transcription assays.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

Goker H, Haznedaroglu IC, Ercetin S, Kirazli S, Akman U, Ozturk Y, Firat CH. Haemostatic actions of the folkloric medicinal plant extract, Ankaferd Blood Stopper.

Blood 2007;110:53be.

2. Goker H, Haznedaroglu IC, Ercetin S, Kirazli S, Akman U, Ozturk Y, Firat HC. Haemostatic actions of the folkloric medicinal plant extract ankaferd blood Stoper. J Int Med Res 2008;36:163-70.

3. Haznedaroglu IC. Time to take a healthier view of history. Nature 1998;396:108. [CrossRef] 4. Uçar Albayrak C, Calişkan U, Haznedaroglu IC, Goker H. Haemostatic actions of the folkloric medicinal plant extract Ankaferd Blood Stopper Response. J Int Med Res 2008;36:1448-9.

5. Akar N, Demiralp DO, Haznedaroglu IC, Goker H. Functional Proteomics of Ankaferd Blood Stopper. ASH Annual Meeting Abstracts 2008;112:4103.

6. Aydin S. Haemostatic actions of the folkloric medicinal plant extract Ankaferd Blood Stopper. J Int Med Res 2009;37:279.

7. Demiralp DO, Haznedaroglu IC, Akar N. Functional Proteomics of Ankaferd Blood Stopper. Turkish Journal of Hematology 2010;27:70-7. [CrossRef] 8. Arslan S, Haznedaroglu IC, Oz B, Goker H. Endobronchial application of Ankaferd blood stopper to control profuse lung bleeding leading to hypoxemia and hemodynamic instability. Respiratory Medicine 2009;2:144-6.

9. Erçetin S, Haznedaroğlu IC, Kurt M, Onal IK, Aktaş A, Kekilli M, Göker H, Özdemir O, Kirazlı S, Fırat HC. Safety and efficacy of Ankaferd BloodStopper® in dental surgery and bleeding. UHOD Int J Hematol Oncol 2010;20:1-5.

10. Koray M, Ergun S, Saruhanoglu A, Tanyeri H. Use of a new local haemostatic agent Ankaferd blood stoper

02.12.2011 10:13

284

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

Yılmaz et al.

Biological effects of Ankaferd®

after surgical excision of eruption cyst: a case report.

Int J Oral Maxillofac Surg 2009;38:558. [CrossRef] Kurt M, Kacar S, Onal IK, Akdogan M, Haznedaroglu IC. Ankaferd Blood Stopper as an effective adjunctive hemostatic agent for the management of life-threatening arterial bleeding of the digestive tract. Endoscopy 2008;40:262. [CrossRef] Akgül T, Huri E, Ayyıldız A, Üstün H, Germiyanoğlu C. The histopathological effects of Ankaferd BloodStopper®, a local medical plant extract, in mice penile fracture model: An experimental study. UHOD Int J Hematol Oncol 2009;19:159-65.

Bilgili H, Captug O, Kosar A, Kurt M, Kekilli M, Shorbagi A, Kurt OK, Ozdemir O, Goker H, Haznedaroglu IC. Oral systemic administration of Ankaferd blood stopper has no short-term toxicity in an in vivo rabbit experimental model. Clin Appl Thromb Hemost 2010;16:533-6. [CrossRef] Bilgili H, Kosar A, Kurt M, Onal IK, Goker H, Captug O, Shorbagi A, Turgut M, Kekilli M, Kurt OK, Kirazli S, Aksu S, Haznedaroglu IC. Hemostatic Efficacy of Ankaferd Blood Stopper (R) in a Swine Bleeding Model. Med Princ Pract 2009;18:165-9. [CrossRef] Cipil HS, Kosar A, Kaya A, Uz B, Haznedaroglu IC, Goker H, Ozdemir O, Koroglu M, Kirazli S, Firat HC. In vivo hemostatic effect of the medicinal plant extract Ankaferd Blood Stopper in rats pretreated with warfarin. Clin Appl Thromb Hemost 2009;15:270-6. [CrossRef] Huri E, Akgul T, Ayyildiz A, Ustun H, Germiyanoglu C. Hemostatic role of a folkloric medicinal plant extract in a rat partial nephrectomy model: controlled experimental trial. J Urol 2009;181:2349-54. [CrossRef] Huri E, Akgül T, Ayyıldız A, Üstün H, Germiyanoğlu C. The evaluation of the blood stopping effect of Ankaferd Bloodstopper® in major renal trauma: An animal experimentation. UHOD Int J Hematol Oncol 2010;20:206-11.

Karakaya K, Ucan HB, Tascilar O, Emre AU, Cakmak GK, Irkorucu O, Ankarali H, Comert M. Evaluation of a new hemostatic agent Ankaferd Blood Stopper in experimental liver laceration. J Invest Surg 2009;22:201-6. [CrossRef] Epstein RJ. Human Molecular Biology. Cambridge: Cambridge University Press 2003;85-95.

Firat HC, Ozdemir O, Kosar A, Goker H, Haznedaroglu IC. Annual Review of Ankaferd 08-09. 2009, İstanbul: Naviga Publications 13-9.

Kumar D, Weatherall D. Genomics and Clinical Medicine (Oxford Monographs on Medical Genetics).

Oxford University Press. 2004 Oxford 31-44.

Stamatoyannopoulos G, Majerus PW, Perlmutter RM, Varmus H. The Molecular Basis of Blood Disease (3rd Edition). 2001, Philadelphia: W.B. Saunders, 81-102.

Watson JD, Baker TA, Bell SP, Gann A, Levine M, Losick R. Molecular Biology of the Gene (5th Edition). 2004, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press 2004;347-77.

Kosar A, Cipil HS, Kaya A, Uz B, Haznedaroglu IC, Goker H, Ozdemir O, Ercetin S, Kirazli S, Firat HC. The

TJH-ARALIK-2011-4-crossref.indd 36

Turk J Hematol 2011; 28: 276-85

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

efficacy of Ankaferd Blood Stopper in antithrombotic drug-induced primary and secondary hemostatic abnormalities of a rat-bleeding model. Blood Coagul Fibrinolysis 2009;20:185-90. [CrossRef] Ucar Albayrak C, Caliskan U, Haznedaroglu IC, Goker H. Haemostatic actions of the folkloric medicinal plant extract Ankaferd Blood Stopper. J Int Med Res 2008;36:1447-8.

Kurt M, Akdogan M, Onal IK, Kekilli M, Arhan M, Aksu S, Kurt OK, Haznedaroglu IC. Endoscopic topical application of Ankaferd Blood Stopper for neoplastic gastrointestinal bleeding: a retrospective analysis. Dig Liver Dis 2010;42:196-9. [CrossRef] Kurt M, Disibeyaz S, Akdogan M, Sasmaz N, Aksu S, Haznedaroglu IC. Endoscopic application of Ankaferd blood stopper as a novel experimental treatment modality for upper gastrointestinal bleeding: A case report. Am J Gastroenterol 2008;103:2156-8. [CrossRef] Kurt M, Oztas E, Kuran S, Onal IK, Kekilli M, Haznedaroglu IC. Tandem oral, rectal, and nasal administrations of Ankaferd Blood Stopper to control profuse bleeding leading to hemodynamic instability.

Am J Emerg Med 2009;27:631. [CrossRef] Haznedaroglu BZ, Haznedaroglu IC, Walker SL, Bilgili H, Goker H, Kosar A, Aktas A, Captug O, Kurt M, Ozdemir O, Kirazli S, Firat HC. Ultrastructural and Morphological Analyses of the In Vitro and In Vivo Hemostatic Effects of Ankaferd Blood Stopper. Clin Appl Thromb Hemost 2010;16:446-53. [CrossRef] Akkoc N, Akceik M, Haznedaroglu I, Goker H, Aksu S, Kirazli S, Firat H. In vitro anti-bacterial activities of ankaferd blood stopper. Int J Lab Hematol 2008;30:95.

Akkoc N, Akcelik M, Haznedaroglu IC, Goker H, Turgut M, Aksu S, Kirazli S, Firat HC. In Vitro Anti-Bacterial Activities of Ankaferd Medicinal Plant Extract. Turkiye Klinikleri Tip Bilimleri Dergisi 2009;29:410-5.

Fisgin NT, Cayci YT, Coban AY, Ozatli D, Tanyel E, Durupinar B, Tulek N. Antimicrobial activity of plant extract Ankaferd Blood Stopper. Fitoterapia 2009;80:48-50. [CrossRef] Goker H, Cetinkaya D, Kilic E, Haznedaroglu IC, Kirazli S, Firat H. Anti-cancer activity of ankaferd blood stoper on osteosarcom (SAOS-2) cell lines in vitro, in Ankaferd: Scientific perspectives and basic-clinical data., G.H. Haznedaroglu I.C., Ozdemir O, Kosar A, Firat H, Editor.

2008, Naviga Publications: İstanbul:109.

Goker H, Kilic E, Cetinkaya D, Buyukasik Y, Aksu S, Turgut M, Haznedaroglu I, Anti-cancer activity of Ankaferd on human colon cancer (CACO-2) in vitro, in Ankaferd: Scientific Perspectives and Basic-Clinical Data, I.C. Haznedaroglu, et al., Editors. 2008, Naviga Publications: Istanbul:108.

Turhan N, Kurt M, Shorbagi A, Akdogan M, Haznedaroglu IC. Topical Ankaferd Blood Stopper administration to bleeding gastrointestinal carcinomas decreases tumor vascularization. Am J Gastroenterol 2009;10:2874-7. [CrossRef] Bar-Eli M. Role of AP-2 in tumor growth and metastasis of human melanoma. Cancer Metastasis Rev 1999;18:377-85. [CrossRef]

02.12.2011 10:13

Turk J Hematol 2011; 28: 276-85

37. Winger Q, Huang J, Auman HJ, Lewandoski M, Williams T. Analysis of transcription factor AP-2 expression and function during mouse preimplantation development. Biol Reprod 2006;75:324-33. [CrossRef] 38. Gruber R, Czerwenka K, Wolf F, Ho GM, Willheim M, Peterlik M. Expression of the vitamin D receptor, of estrogen and thyroid hormone receptor alpha- and beta-isoforms, and of the androgen receptor in cultures of native mouse bone marrow and of stromal/ osteoblastic cells. Bone 1999;24:465-73. [CrossRef] 39. Karpinski BA, Morle GD, Huggenvik J, Uhler MD, Leiden JM. Molecular cloning of human CREB-2: an ATF/CREB transcription factor that can negatively regulate transcription from the cAMP response element.

Proc Natl Acad Sci U S A 1992;89:4820-4. [CrossRef] 40. Mayr B, Montminy M. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat Rev Mol Cell Biol 2001;2:599-609. [CrossRef] 41. Chen HZ, Tsai SY, Leone G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer 2009;9:785-97. [CrossRef] 42. McMahon SB, Monroe JG. The role of early growth response gene 1 (egr-1) in regulation of the immune response. J Leukoc Biol 1996;60:159-66.

43. Scharnhorst V, Menke AL, Attema J, Haneveld JK, Riteco N, van Steenbrugge GJ, van der Eb AJ, Jochemsen AG. EGR-1 enhances tumor growth and modulates the effect of the Wilms' tumor 1 gene products on tumorigenicity. Oncogene 2000;19:791-800. [CrossRef] 44. Boulanger L, Sabatino DE, Wong EY, Cline AP, Garrett LJ, Garbarz M, Dhermy D, Bodine DM, Gallagher PG. Erythroid expression of the human alpha-spectrin gene promoter is mediated by GATA-1- and NF-E2- binding proteins. J Biol Chem 2002;277:41563-70. [CrossRef] 45. Pontoglio M. Hepatocyte nuclear factor 1, a transcription factor at the crossroads of glucose homeostasis.

J Am Soc Nephrol 2000;11:140-3.

46. Spek CA, Lannoy VJ, Lemaigre FP, Rousseau GG, Bertina RM, Reitsma PH. Type I protein C deficiency caused by disruption of a hepatocyte nuclear factor (HNF)-6/HNF-1 binding site in the human protein C gene promoter. J Biol Chem 1998;273:10168-73.

[CrossRef]

TJH-ARALIK-2011-4-crossref.indd 37

YÄąlmaz et al.

Biological effects of AnkaferdÂŽ

285

47. Gobin SJ, van den Elsen PJ. Transcriptional regulation of the MHC class Ib genes HLA-E, HLA-F, and HLA-G. Hum Immunol 2000;61:1102-7. [CrossRef] 48. Li Z, Van Calcar S, Qu C, Cavenee WK, Zhang MQ, Ren B. A global transcriptional regulatory role for c-Myc in Burkitt's lymphoma cells. Proc Natl Acad Sci USA 2003;100:8164-9. [CrossRef] 49. Shapira S, Barkan B, Friedman E, Kloog Y, Stein R. The tumor suppressor neurofibromin confers sensitivity to apoptosis by Ras-dependent and Ras-independent pathways. Cell Death Differ 2007;14:895-906.

50. Pasparakis M. Regulation of tissue homeostasis by NF-kappaB signalling: implications for inflammatory diseases. Nat Rev Immunol 2009;9:778-88. [CrossRef] 51. Strachan T, Read AP, Human molecular genetics 2.

1999, New York: Wiley.

52. Seda O, Sedova L. Peroxisome proliferator-activated receptors as molecular targets in relation to obesity and type 2 diabetes. Pharmacogenomics 2007;8:587-96.

[CrossRef] 53. Hill CS. Nucleocytoplasmic shuttling of Smad proteins.

Cell Res 2009;19:36-46. [CrossRef] 54. Ross S, Hill CS. How the Smads regulate transcription.

Int J Biochem Cell Biol 2008;40:383-408. [CrossRef] 55. Cook T, Gebelein B, Urrutia R. Sp1 and its likes: biochemical and functional predictions for a growing family of zinc finger transcription factors. Ann NY Acad Sci 1999;880:94-102. [CrossRef] 56. Zhao C, Meng A. Sp1-like transcription factors are regulators of embryonic development in vertebrates. Dev Growth Differ 2005;47:201-11. [CrossRef] 57. Bernstein LR, Ben-Ari ET, Simek SL, Colburn NH. Gene regulation and genetic susceptibility to neoplastic transformation: AP-1 and p80 expression in JB6 cells.

Environ Health Perspect 1991;93:111-9. [CrossRef] 58. Hess J, Angel P, Schorpp-Kistner M. AP-1 subunits: quarrel and harmony among siblings. J Cell Sci 2004;117:5965-73. [CrossRef] 59. Gordon S, Akopyan G, Garban H, Bonavida B. Transcription factor YY1: structure, function, and therapeutic implications in cancer biology. Oncogene 2006;25:1125-42. [CrossRef]

02.12.2011 10:13

286

Research Article

Long-term outcome in children with nutritional vitamin B12 deficiency Nutrisyonel vitamin B12 eksikliği olan çocuklarda uzun dönem sonuçlar Melike Sezgin Evim1, Şahin Erdöl2, Özlem Özdemir3, Birol Baytan1, Adalet Meral Güneş1 1Department

of Pediatric Hematology, Faculty of Medicine, Uludağ University, Bursa, Turkey of Pediatrics, Faculty of Medicine, Uludağ University, Bursa, Turkey 3Department of Pediatric Neurology, Faculty of Medicine, Uludağ University, Bursa, Turkey 2Department

Abstract Objective: Vitamin B12 deficiency is frequently observed in developing countries. Herein we report the long-term clinical and laboratory outcomes in 45 children presented with various symptoms of vitamin B12 deficiency.

Materials and Methods: Symptoms and physical findings, and percentiles for weight, height, and head circumference at presentation were recorded. The educational level of the patients’ mothers, vitamin B12 deficiency-related diseases and family income data were collected. Complete blood count, serum vitamin B12, folate, iron, iron binding capacity and ferritin, and plasma homocysteine levels were recorded measured at presentation. The patients were treated with vitamin B12, as follows: 1 mg/d IM for 1 week, followed by 1 mg IM QWK for 2 weeks, and then monthly 1mg injections. Patients were neurologically and hematologically re-evaluated after treatment. The visual evoked potential (VEP) test was used to examine the integrity and function of the visual pathway. Brainstem evoked potential (BAEP) responses were used to analyze auditory function. Neuromotor development was assessed using Denver II Development Screening Test.

Results: The mean age of 20 male and 25 female patients was 5.6±5.9 years (range: 1.4 months-17 years).

The most common symptoms at presentation were weakness, failure to thrive, and hematologic manifestations (pallor, petechiae, ecchymosis). Abnormal neurologic findings at presentation were observed in 20% of the patients, and were more commonly observed in those <2 years. VEP, BAEP, and Denver II Development tests were performed in 66% of the patients one year after vitamin B12 replacement was started. VEP and BAEP interval prolongation was observed in 37% and 17% of the cases, respectively.

Denver II Development Test results showed developmental delay in 20% of the patients tested.

Conclusion: All the patients achieved full hematologic recovery within 1 month of treatment onset.

Neurological symptoms resolved following B12 administration; however, during long-term follow-up ranged from 17% to 37% of the tested patients had persistent VEP; BERA, and Denver II abnormalities. Neurological symptoms resolved following B12 administration; however, during long-term followup 33% of the patients had persistent VEP, BERA, and Denver II abnormalities. As such, clinicians should continue to follow-up such patients even after hematologic and clinical improvement are obtained in order to assess their neurologic status. (Turk J Hematol 2011; 28: 286-93) Key words: Vitamin B12 deficiency, children, neurologic outcome Received: October 23, 2010

Accepted: May 17, 2011

Address for Correspondence: M.D. Melike Sezgin Evim, Department of Pediatric Hematology, Faculty of Medicine, Uludağ University, Bursa, Turkey Phone: +90 224 295 05 47 E-mail: melikevim@yahoo.com doi:10.5152/tjh.2011.82

TJH-ARALIK-2011-4-crossref.indd 38

02.12.2011 10:13

Evim et al.

Children with nutritional vitamin B12 deficiency

Turk J Hematol 2011; 28: 286-93

287

Özet Amaç: Vitamin B12 eksikliği gelişmekte olan ülkelerde sık görülür. B12 eksikliğinin değişik yakınmaları ile gelen 45 çocuğun uzun dönem laboratuar ve klinik bulgularını bildirdik.

Yöntemler ve Gereçler: Başvuru anındaki yakınma ve muayene bulguları, kilo, boy ve baş çevresi persentilleri not edildi. Annenin eğitim düzeyi, eşlik eden hastalıklar ve aile geliri sorgulandı. Tanıdaki tam kan sayımı, serum vitamin B12, folat, demir, demir bağlama kapasitesi, ferritin ve plazma homosistein seviyeleri kaydedildi. Tedavi için B12 intramüsküler olarak ilk hafta her gün, sonra iki hafta boyunca haftada bir, takiben aylık verildi. Tedaviden sonra hastalar nörolojik ve hematolojik bulgular için tekrar değerlendirildi. Görsel uyarılmış potansiyel (VEP), görsel yolların fonksiyonlarını ve bütünlüğünü değerlendirmede kullanıldı. Beyin sapı uyarılmış işitsel cevapları (BAEP), işitsel fonksiyonları değerlendirmek için kullanıldı, Nöromotor gelişim, Denver II gelişim tarama testi ile değerlendirildi.

Bulgular: Ortalama yaş ve cinsiyet oranı sırasıyla 5.6±5.9 yıl (1.4 ay -17 yıl), 20 erkek/25 kız idi. En sık yakınmalar halsizlik, gelişme geriliği ve hematolojik yakınmalardı. Baş vuruda anormal nörolojik bulgular tüm vakaların %20’sinde görüldü. Bu bulgular iki yaştan küçük çocuklarda daha sıktı. B12 tedavisinden bir yıl sonra VEP, BERA ve Denver II gelişim testi vakaların %66’sına yapıldı. VEP ve BERA’da uzama sırasıyla vakaların %37 ve %17’sinde gösterildi. Denver II gelişim testi %20 hastada gecikmiş bulundu.

Sonuç: Tüm çocuklarda birinci ayda tam hematolojik düzelme sağlandı. Baş vuruda nörolojik bulgular iki yaş altında daha sık görüldü. Bu bulgular B12 tedavisi ile geriledi. Buna karşın uzun dönem sonuçlarda VEP, BERA ve Denver II testinde bozukluk test yapılan olguların %17'si ile %37'si arasında değişen oranda devam ediyordu. Bu nedenle klinisyenler bu çocukları hematolojik ve klinik düzelme olsa bile nörolojik prognoz açısından uzun vadeli izlemeli ve değerlendirmelidir. (Turk J Hematol 2011; 28: 286-93) Anahtar kelimeler: Vitamin B12 eksikliği, çocuk, nörolojik sonuçlar Geliş tarihi: 23 Ekim 2010

Kabul tarihi: 17 Mayıs 2011

Introduction Vitamin B12 deficiency is usually observed in developing countries and poor dietary intake is the most frequent cause. Vitamin B12 is important for DNA synthesis and neurologic functions.The vitamin B12 deficiency negatively affects bone marrow, gastrointestinal and central nervous systems [1,2].

Most children with vitamin B12 deficiency present with non-specific manifestations, such as pallor, failure to thrive, developmental delay, weakness, and irritability [2,3]. Hematological manifestations completely resolve following vitamin B12 supplementation, but neurologic findings may persist [4]; therefore, early diagnosis and treatment are important. Herein we present 45 children treated for various symptoms of vitamin B12 deficiency, and their long-term clinical and laboratory outcomes.

Materials and Methods Clinical and laboratory findings in 45 children treated for vitamin B12 deficiency between January 1996 and December 2009 were retrospectively evaluated. Symptoms and physical findings, and percentiles for weight, height, and head circumference at presentation were recorded. The level of

TJH-ARALIK-2011-4-crossref.indd 39

educational of the patients’ mothers, vitamin B12 deficiency-related diseases, and family income data were collected. Daily intake of vitamin B12 and folate in the patients and their breast-feeding mothers were evaluated based on reports of their diets during the previous week [5]. Growth retardation (short height and low weight) were defined as below the third percentile.

Complete blood count, serum vitamin B12, folate, iron, iron binding capacity and ferritin, and plasma homocysteine levels were recorded measured at presentation. Vitamin B12 absorption testing could not be performed in any of the patients. Routine urinary analysis was performed to test for proteinuria.

Anemia, thrombocytopenia, and leukopenia were defined as follows: hemoglobin level <12 g/dL, thrombocyte level <150,000 mm, and leukocyte count <4500 mm, respectively. Low-level vitamin B12, folate, and ferritin was accepted as 200 pg/mL, 3 ng/mL, and 20 pg/mL, respectively. Plasma homocysteine levels >12 g/dL were considered as high.

Peripheral blood smear screening for macrocytosis and hypersegmentation was performed. Hemoglobin electrophoresis was used to rule out the thalassemia trait in children with an MCV <85 fL. The patients were treated with vitamin B12, as follows: 1 mg /d IM for 1 week, followed by 1 mg IM QWK for 2 weeks, and then monthly 1 mg injec-

02.12.2011 10:13

288

Evim et al.

Children with nutritional vitamin B12 deficiency

tions. Iron supplementation of 6 mg kg/d was given to the patients with iron deficiency. Complete blood count, serum vitamin B12, folate, and plasma homocysteine were measured after 1 and 6 months of treatment. Neuromotor development in the patients was re-evaluated using the Denver II Development Screening Test 1 year after treatment started. Visual evoked potential (VEP) and brain stem evoked potential (BAEP) response testing were performed to determine the integrity and function of the visual pathway, and auditory function, respectively.

Statistical calculations were performed using SPSS for Windows v.16.0. Normal distribution was tested using the Shapiro-Wilk test. The MannWhitney U test was used to compare the iron deficient patients and those without iron deficiency.

The Wilcoxon test was used to compare pre- and post-treatment findings. The chi-square test was used for categorical variables. Statistical significance was accepted as p<0.05. The study protocol was approved by the Uludağ University Ethics Committee.

Results Mean age at presentation of the 20 male and 25 female patients was 5.6±5.9 years (range: 1.4 months-17 years). Mean follow-up was 46±36 months (range: 10-150 months). The most common symptoms were weakness, failure to thrive, and hematologic manifestations (pallor, petechiae, ecchymosis)., followed by gastrointestinal and neurologic symptoms (Table 1). Both the patients and their breast-feeding mothers had low dietary intake of vitamin B12. (Among the 22 patients aged <2 years, 19 were breastfed and/or had supplementary food. The rest (n=3) were on normal diet. Only one patient in our case series (older than 2 years) was on special diet for phenylketonuria. Proteinuria was associated in 4 (8.8%) out of 45 patients and their ages ranged from 1 to 6 years (mean: 3.6±2.4 years). In addition, 6 (13.3%) out of 45 patients had vitamin B12 deficiency-related diseases, including cerebral palsy (CP) (n=2), short gut syndrome (n=1), operated duodenal atresia (n=1), celiac disease (n=1), and phenylketonuria (n=1). They were older than 2 years.

Only 15% of the patients’ mothers had a level of education above primary school. In all, 80% (n=36) of the patients’ families had a monthly income pro-

TJH-ARALIK-2011-4-crossref.indd 40

Turk J Hematol 2011; 28: 286-93

viding the threshold, as defined in a recent report by the Turkish Statistical Institute [6].

In all, 10 (22%) of the patients had height and weight below the 3rd percentile at presentation, of which only 2 had a comorbid disease (CP); height and weight in the 8 children without a comorbid disease were normal (>3rd percentile) after receiving treatment for 1 year. Serum B12, folate, and plasma homocysteine levels are shown in the Figure 1. In all, 8 patients (19%) had serum B12 and folate levels Table 1. Patients' Symptoms and Physical Findings at Presentation

Symptoms Physical Findings (<2 years/ (<2 years/ ≥2 years) ≥2 years)

General (Total)

31 (69%)

10 (22%)

5/19

-

Weakness Failure to thrive

5/2

5/5

23 (51%)

42 (93%)

Pallor

10/6

20/18

Petechiae-Ecchymosis

4/3

3/1

12 (27%)

9 (20%)

Oral ulcer

2/2

2/2

Vomiting

4/1

-

Pain on abdomen

1/2

-

-

3/2

Neurologic (Total)

8 (18%)

9 (20%)

Seizure

4/None

-

Paresthesia on legs

None/1

-

No head control/no walking

3/None

-

Neuromotor retardation

-

3/None*

Hypotonia

-

4/None

Microcephaly

-

1/1

Hematologic (Total)

Gastrointestinal (Total)

Hepatosplenomegaly

*Patients with CP (n=2) were excluded

Low Vit B12, Folate High Homocysteine 7.2% (n=3)

Only Low Vit B12 7.2% (n=3) Only High Homocysteine 19% (n=8)

Low Vit B12, High Homocysteine 66.6% (n=28) Figure 1. Distribution of Patients According to Serum B12, Folate, and Plasma Homocysteine Levels *The results of transfused patients (n=3) were excluded

02.12.2011 10:13

Evim et al.

Children with nutritional vitamin B12 deficiency

Turk J Hematol 2011; 28: 286-93

within the normal range; however, their plasma homocysteine levels were high. The serum vitamin B12 level was low in 15 (79%) of the 19 breastfeeding mothers.

Of all the patients (n=45), 20 (44%) had only anemia, whereas 12 (27%) had bicytopenia and 10 (22%) had pancytopenia. In all, 3 patients had a normal hemoglobin level due to recent erythrocyte transfusion and their hematologic and serologic findings were excluded from the study’s analysis. In total, 8 out of 45 patient (19%) had iron deficiency anemia and normal hemoglobin electrophoresis findings; none of these 8 patients had another comorbid disease or neurologic symptoms at presentation. Hematologic findings in the patients are shown in Table 2.

Hematologic findings in all the patients improved significantly after the 1st and 6th months of treatment (Table 3); however, patients without iron deficiency

289

had significantly greater hematologic recovery after the 1st month of treatment than the iron-deficient patients (Table 4).

Abnormal neurologic findings at presentation were observed in 9 (20%) of the patients. Cases with CP were excluded from this data since it is difficult to make a definitive distinction of their neurologic findings. None of the 9 patients had iron deficiency anemia. I Eight of these children were younger than 2 years old (Table 1). Additionally, 4 of these 8 children presented with convulsions and were successfully treated with vitamin B12 and anticonvulsants. Neuromotor retardation and hypotonia were observed in 7 patients and all had a good response to vitamin B12 treatment. All 8 patients aged <2 years with abnormal neurologic findings underwent cranial MRI; cerebral atrophy and secondary external hydrocephaly were observed in 5 of them.

Table 2. Patients' Hematologic Findings at the Time of Presentation, According to Iron Status

Patients with Iron Deficiency n=8 (19%)

Patients without Iron Deficiency n=34 (81%)

p

3/5

18/16

>0.05

Age (years)

3.7 (0.33-17)

1.45 (0.12-16)

>0.05

Hemoglobin (g/dL)

7.2 (4.5-8.7)

7.7 (4.3-12)

>0.05

MCV (fL)

78.1 (59.5-80)

98.2 (83-114)

<0.001

8650 (2400-17200)

5565 (1100-19000)

>0.05

Female/Male

Leukocyte

(mm3)

Thrombocyte

(mm3)

111,000 (158.00-380.000)

195,000 (43.000-401.000)

>0.05

Vitamin B12 (pg/mL)

115 (34-1000)

150 (31-755)

>0.05

Folate (ng/mL)

6.2 (3.2-22.8)

15 (1.1-27)

<0.05

Homocysteine (g/dL)

12.3 (6.9-68.6)

19.5 (2-106)

>0.05

Ferritin (pg/mL)

7 (3-13)

39.5 (18-848)

<0.001

Growth Retardation

4 (50%)

6 (17.6%)

0.075

Values were given as median (range), *The results of transfused patients (n=3) were excluded

Table 3. Patients' Hematologic Findings at Diagnosis, and After 1 and 6 Months of Treatment Time

Hb±S (range)

MCV±SD (range)

Vitamin B12±SD (range)

Folate±SD (range)

H±SD (range)

Admission

8.1±2.7 (4.3-15.5)

93.2±12.8 (59.5-115)

206.6±185.6 (31-1000)

13.1±7.6 (1.1-27)

26.4±23.3 (2-106)

1 month

12.3±2.4 (10.1-14.5)

90±5 (85-96)

400±150 (243-568)

15.2±6.1 (8-22)

10.4±6.3 (4-18)

6 month

14.6±2.2 (12.1-15.9)

88±4 (84-93)

800±100 (678-942)

16.3±4.2 (11-25)

6.1±2.3 (4-9)

Pa

<0.001

<0.001

<0.001

>0.05

<0.001

Pb

<0.001

<0.001

<0.001

>0.05

<0.001

Pa: Presentation and 1st month of treatment; Pb: presentation and 6th month of treatment, SD: Standard deviation; H: homocysteine

TJH-ARALIK-2011-4-crossref.indd 41

02.12.2011 10:13

290

Evim et al.

Children with nutritional vitamin B12 deficiency

Turk J Hematol 2011; 28: 286-93

Table 4. Treatment Response of the Patients, According to İron Status* Patients with Iron Deficiency Patients without Iron Deficiency

n=8 n=34

TP1 TP2 P TP1 TP2 P Hb (g/dL)

7.2

9.2

<0.05

7.7

11.1

<0.001

MCV(fL)

78.1

82

>0.05

98.2

87

<0.001

Vitamin B12 (pg/mL)

115

565

<0.05

150

482

<0.001

Folate (ng/mL)

6.2

14

>0.05

15

19.5

>0.05

Homocysteine (g/dL)

12.3

5.6

<0.05

19.5

5.5

<0.001

Values are given as median, TP1: At presentation; TP2: after 1 month of treatment, *The results of transfused patients (n=3) were excluded

During vitamin B12 treatment 4 patients developed myoclonus and tremors; these involuntary movements resolved in 2 patients with clonazepam, whereas piracetam was added to the treatment in the other 2 patients Involuntary movements in them resolved as well. VEP, BAEP, and Denver II Development tests were performed in 30 (66%) of the patients between treatment months 9 and 15 (mean: 11.9±1.88 months). VEP and BAEP intervals were prolonged in 11 (37%) and 5 (17%) of the patients, respectively. Denver II Development Test results showed developmental delay in 6 (20%) of the patients (Table 5).

Discussion The most common manifestations of vitamin B12 deficiency observed in the present study were weakness and failure to thrive. Hematologic, gastrointestinal, and neurologic symptoms were observed in 51%, 27%, and 18% of the patients, respectively.

Poor dietary intake is reported to be the most common cause of vitamin B12 deficiency [1]; however, Altay et al. had reported a series containing 36 children from Turkey with selective vitamin B12 malabsorption [7]. Unfortunately, we were unable to perform absorption tests in the present study. The necessity of using radioactively labeled compounds makes these tests extremely difficult to perform [8].

An alternative approach for evaluating vitamin B12 absorption is measurement of vitamin B12 saturated-transcobalamin (holo-TC) [9]. Bor et al. [10] reported that the diagnostic sensitivity and specificity of holo-TC measurement was 100% and 92%, respectively. In the present study only 4 (8.8%) patients <6 years of age had proteinuria; as vitamin B12 absorption testing was not available, we could only assume that these 4 patients might have had

TJH-ARALIK-2011-4-crossref.indd 42

Table 5. VEP, BAEP, and Denver II Findings VEP

BAEP

Denver II

Abnormal

n=30

11 (37%)

5 (17%)

6 (20%)

Normal

19 (63%)

25 (83%)

24 (80%)

*Patients with CP (n=2) were excluded

Imerslund-Gräsbeck syndrome. Altay et al. [7] observed proteinuria in 78% of children with Imerslund-Gräsbeck syndrome, all of who were younger than those without proteinuria. All of the patients with proteinuria in the present study were <6 years old. All of the patients in the present study and their breast-feeding mothers had low dietary intake of vitamin B12 and 79% of the breast-feeding mothers had low-level serum B12. Based on the present study’s data, we think that poor dietary intake resulted in the observed vitamin B12 deficiency.

Consumption of meat and dairy products in Turkey has decreased during the last 2 decades due to economic crisis [11] and is lower than that in developed countries [12]. In fact, in the present study, 80% of the patients’ families were in low socioeconomic status. The incidence of vitamin B12 deficiency in Turkish pregnant women ranges from 48.8% to 80.9% [13,14]. Koc et al. [15] reported that the incidence of vitamin B12 deficiency in Turkish infants and their mothers was 72% and 41%, respectively. Based on such data, vitamin B12 deficiency is an important problem in Turkey and infants born to deficient mothers are at high risk for developing manifestations of vitamin B12 deficiency. Therefore, nutritional and educational programs are required in Turkey, especially for pregnant and lactating women.

Hematologic findings in patients with vitamin B12 deficiency vary from anemia to pancytopenia [16].

Macrocytosis is not a common finding. MCV does

02.12.2011 10:13

Turk J Hematol 2011; 28: 286-93

not increase when vitamin B12 deficiency is associated with iron deficiency or the thalassemia trait [16,17]. Although none of the patients in the present study had the thalassemia trait, Sayli et al. [18] reported Imerslund-Gräsbeck syndrome coexisting with the beta-thalassemia trait in a Turkish study population. In the present study 44% of the patients had only anemia, whereas 27% had bicytopenia, and 22% had pancytopenia, which resolved after 1 and 6 months of treatment, respectively (p<0.001).

Additionally, 8 (19%) of the patients also had iron deficiency anemia, with an MCV <85 fL. The diagnosis of vitamin B12 deficiency is based on lowlevel serum vitamin B12 (usually <200 pg/mL), along with clinical evidence of disease [18]. In the present study 81% of the patients had low-level serum vitamin B12; however, it has been reported that patients with clinical signs of vitamin B12 deficiency can have a normal serum vitamin B12 level [19,20]. A study that included 406 patients with vitamin B12 deficiency reported that 98.4% had elevated serum methylmalonic acid (MMA) and 95.9% had elevated serum homocysteine [21]. Other reports suggest that the sensitivity and specificity of the serum B12 assay are significantly lower than previously thought [20, 22-25]. We were unable to measure serum MMA in the present study; however, plasma homocysteine was high in 91% of the patients. In addition, the diagnosis of vitamin B12 deficiency was confirmed in 8 (19%) of the patients based only on a high plasma homocysteine level.

In the present study more patients <2 years of age presented with neurologic symptoms than those aged ≥2 years (p<0.05). Numerous case reports have reported neurologic symptoms in patients with vitamin B12 deficiency in infants [26-30] and 2 large series from Turkey reported various neurologic symptoms in infants [31,32]. These findings might be due to the fact that myelinization of the central nervous system is incomplete and ongoing during the first 2 years of life. Although the mechanism of neurologic symptoms in B12 deficiency is not fully known, delayed myelination, neurotrophic and neurotoxic cytokine imbalance, and accumulation of lactate in brain cells have been proposed [33].

Seizure was the first symptom of vitamin B12 deficiency in 4 (9%) of the present study’s patients; their EEGs were dysrhythmic with epileptic abnormalities. Several studies reported an association

TJH-ARALIK-2011-4-crossref.indd 43

Evim et al.

Children with nutritional vitamin B12 deficiency

291

between vitamin B12 deficiency and EEG abnormalities [34]. Cranial MRI in 5 of the present study’s 8 patients aged <2 years that presented with abnormal neurologic findings showed cerebral atrophy.

Cortical atrophy, thinning of the corpus callosum, and retarded myelination have been reported as neuroradiological imaging findings in patients with vitamin B12 deficiency [35,36]. In the present study 4 patients developed involuntary movements during vitamin B12 treatment; it has been reported that such movements rarely occur during vitamin B12 treatment [37,38], although its mechanism is not fully known.

The patients in the present study recovered in response to vitamin B12 treatment from the following symptoms: pallor, petechiae, ecchymosis, failure to thrive, anorexia, vomiting, hypotonia, apathy, seizures, and neuromotor retardation. Hematologic indices and biochemical parameters returned to normal shortly after the start of vitamin B12 treatment; however, the patients with iron deficiency had slow improvement than those without iron deficiency (p<0.05, p<0.001 respectively), even though their initial hemoglobin and serum vitamin B12 levels were similar (Table 4). We think that welldesigned controlled studies with large patient populations could yield valuable data concerning the relationship between vitamin B12 deficiency and iron deficiency.

In the present study VEP and BAEP intervals were prolonged and Denver II Development Test results showed developmental delay in 33% of the patients after 12 months of treatment. Although we were not able to perform these tests prior to treatment, we think these abnormalities were the result of vitamin B12 deficiency, as there were no other obvious disorders that could explain the findings.

Abnormal VEP results were previously reported in cobalamin deficiency [39]. Despite dramatic hematologic and clinical improvement following vitamin B12 treatment, pediatric patients may suffer cognitive and developmental retardation [4]. The longterm prognosis of vitamin B12 deficiency depends on the severity and duration of deficiency. Delayed diagnosis (made after 1 year of age) is associated with permanent neurologic abnormality [40,41].

In conclusion, in the present study neurologic manifestations of vitamin B12 deficiency occurred in more of the patients aged <2 years than in those

02.12.2011 10:13

292

Evim et al.

Children with nutritional vitamin B12 deficiency

aged ≥2 years. In the long-term outcome, patients ranged from 17% to 37% tested for neurologic abnormalities had persistent developmental and myelination delays. As such, clinicians must followup pediatric patients with vitamin B12 deficiency after hematologic and clinical improvements are observed in order to assess their neurologic status.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

Stabler SP, Allen RH. Vitamin B12 deficiency as a worldwide problem. Annu Rev Nutr 2004;24:299-326.

[CrossRef] Rasmussen SA, Fernhoff PM, Scanlon KS. Vitamin B12 deficieny children and adolecents. J Pediatr 2001;138:10-7. [CrossRef] Goraya JS. Vitamin B12 deficiency in childhood and adolescence. J Pediatr 2002;140:636. [CrossRef] Graham SM, Arvela OM, Wise GA. Long-term neurological consequences of nutritional VB12 deficiency in infants. J Pediatr 1992;121:710-4. [CrossRef] Baysal A. Beslenme. Folik asit ve B12. 4.baskı. Ankara: Hacettepe yayınları;1983. 199-205.

Ensari S. Türkiye İstatistik Kurumunun Yoksulluk Analizleri Üzerine. Maliye Finans Yazıları 2010;87:9-15.

Altay C, Cetin M, Gümrük F, Irken G, Yetgin S, Laleli Y. Familial selective vitamin B12 malabsorption (Imerslund-Gräsbeck syndrome) in a pool of Turkish patients. Pediatr Hematol Oncol 1995;12:19-28.

[CrossRef] Schilling RF. Intrinsic factor studies II. The effect of gastric juice on the urinary excretion of radioactivity after the oral administration of radioactive vitamin B12.

J Lab Clin Med 1953;42:860-6.

Bor MV, Nexø E, Hvas AM. Holo-transcobalamin concentration and transcobalamin saturation reflect recent vitamin B12 absorption better than does serum vitamin B12. Clin Chem 2004;50:1043-9. [CrossRef] Bor MV, Cetin M, Aytaç S, Altay C, Nexo E. Nonradioactive vitamin B12 absorption test evaluated in controls and in patients with inherited malabsorption of vitamin B12. Clin Chem 2005;51:2151-5. [CrossRef] Sarigedik U. Turkey livestock and products annual.

USDA Foreign Agricultural Service GAIN Report.

2006;5:55-7.

Koc A, Uzunlu V, Bayaner A. Turkish agricultural projection 2000-2010. Agricultural Eco res Inst, Ministry Agriculture Rural Affairs. 2001;1:34.

Ackurt F, Wetherilt H, Loker M, Hacibekiroglu M. Biochemical assessment of nutritional status in pre-

TJH-ARALIK-2011-4-crossref.indd 44

Turk J Hematol 2011; 28: 286-93

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

and post-natal Turkish women and outcome of pregnancy. Eur J Clin Nutr 1995;49:613-22.

Harma M, Yurtseven Ş, Koç A Demir N. Şanlıurfa ilinde gebe kadınların B12 ve folik asit serum düzeyleri.

Jinekoloji ve Obstetrik Dergisi. 2003;17:212-7.

Koc A, Kocyigit A, Soran M, Demir N, Sevinc E, Erel O, Mil Z. High frequency of maternal vitamin B12 deficiency as an important cause of infantile vitamin B12 deficiency in Sanliurfa Province of Turkey. Eur J Nutr 2006;45:291-7. [CrossRef] Andrès E, Affenberger S, Zimmer J, Vinzio S, Grosu D, Pistol G, Maloisel F, Weitten T, Kaltenbach G, Blicklé JF. Current hematological findings in cobalamin deficiency. A study of 201 consecutive patients with documented cobalamin deficiency. Clin Lab Haematol 2006;28:50-6. [CrossRef] Bay A, Öner AF, Nalbantoğlu Ö, Demirtaş M, Açıkgöz M. Megaloblastik anemili 45 olgunun klinik ve hematolojik yönden değerlendirilmesi. Van Tıp Dergisi 2006;13:46-8.

Saylı TR, Başak AN, Gümrük F, Gürgey A, Altay C. Imerslund-Gräsbeck syndrome coexisting with betathalassemia trait. Pediatr Hematol Oncol 1994;11:223-5.

[CrossRef] Wickramasinghe N. Diagnosis of megaloblastic anaemias. Blood Reviews 2006;20:299-318. [CrossRef] Lindenbaum J, Savage DG, Stabler SP, Allen RH. Diagnosis of cobalamin deficiency: II. Relative sensitivities of serum cobalamin, methylmalonic acid, and total homocysteine concentrations. Am J Hematol 1990;34:99-107. [CrossRef] Savage DG, Lindenbaum J, Stabler SP, Allen RH. Sensitivity of serum methylmalonic acid and total homocysteine derterminations for diagnosing cobalamin and folate deficiencies. Am J Med 1994;96:239-46. [CrossRef] Healton EB, Savage DG, Brust JC, Garrett TJ, Lindenbaum J. Neurologic aspects of cobalamin deficiency. Medicine (Baltimore) 1991;70:229-45. [CrossRef] Lindenbaum J, Healton EB, Savage DG, Brust JC, Garrett TJ, Podell ER, Marcell PD, Stabler SP, Allen RH. Neuropsychiatric disorders caused by cobalamin deficiency in the absence of anemia or macrocytosis. N Engl J Med 1988;318:1720-8. [CrossRef] Metz J, Bell AH, Flicker L, Bottiglieri T, Ibrahim J, Seal E, Schultz D, Savoia H, McGrath KM. The significance of subnormal serum vitamin B12 concentration in older people: a case control study. J Am Geriatr Soc 1996;44:1355-61.

Stabler SP, Allen RH, Savage DG, Lindenbaum J. Clinical spectrum and diagnosis of cobalamin deficiency. Blood 1990;76:871-81.

Chalouhi C, Faesch S, Anthonie-Milhomme MC, Fulla Y, Dulac O, Cheron G. Neurological concequences of vitamin B12 deficiency and its treatment. Pediatr Emerg Care 2008;24:538-41. [CrossRef] Weis R, Fogelman Y, Bennett M. Severe B12 deficiency in an infant associated with a maternal deficiency and a strict vegetarian diet. J Padiatr Hematol Oncol 2004;26:270-1. [CrossRef]

02.12.2011 10:13

Turk J Hematol 2011; 28: 286-93

28. Casella EB, Valente M, de Navarro JM, Kok F. Vitamin B12 deficiency in infancy as a cause of developmental regression. Brain Dev 2005;27:592-4. [CrossRef] 29. Garewal G, Narang A, Das KC. Infantile tremor syndrome: a vitamin B12 deficiency syndrome in infants. J Trop Pediatr 1988;34:174-8.

30. Kalayci O, Cetin M, Kirel B, Ozdirim E, Yetgin S, Aysun S, Gurgey A. Neurologic findings of vitamin B12 deficiency: presentation of 7 cases. Turk J Pediatr 1996;38:67-72.

31. Zengin E, Sarper N, Caki Kiliç S. Clinical manifestations of infants with nutritional vitamin B deficiency due to maternal dietary deficiency. Acta Paediatr 2009;98: 98-102. [CrossRef] 32. Incecik F, Hergüner MO, Altunbaşak S, Leblebisatan G. Neurologic findings of nutritional vitamin B12 deficiency in children.Turk J Pediatr 2010;52:17-21.

33. Dror DK, Allen LH. Effect of vitamin B12 deficiency on neurodevelopment in infants: current knowledge and possible mechanisms. Nutr Rev 2008;66:250-5.

[CrossRef] 34. Biancheri R, Cerone R, Rossi A, Schiaffino MC, Caruso U, Minniti G, Perrone MV, Tortori-Donati P, Veneselli E. Early-onset cobalamin C/D deficiency: epilepsy and electroencephalographic features.

Epilepsia 2002;43:616-22. [CrossRef]

TJH-ARALIK-2011-4-crossref.indd 45

Evim et al.

Children with nutritional vitamin B12 deficiency

293

35. Biancheri R, Cerone R, Schiaffino MC, Caruso U, Veneselli E, Perone MV, Rossi A, Gatti R. Cobalamin (Cbl) C/D deficiency: clinical, neurophysiological and neuroradiologic findings in 14 cases. Neuropediatrics 2001;32:14-22. [CrossRef] 36. Rossi A, Cerone R, Biancheri R, Gatti R, Schiaffino MC, Fonda C, Zammarchi E, Tortori-Donati P. Early-onset combined methylmalonic aciduria and homocystinuria: neuroradiologic findings. AJNR Am J Neuroradiol 2001;22:554-63.

37. Benbir G, Uysal S, Saltik S, Zeybek CA, Aydın A, Dervent A, Yalcınkaya C. Seizures during treatment of Vitamin B 12 deficiency. Seizure 2007;16:69-73. [CrossRef] 38. Ozdemir O, Baytan B, Gunes AM, Okan M. Involuntary movements during vitamin B12 treatment. J Child Neurol 2010;25:227-30. [CrossRef] 39. Krumholz A, Weiss HD, Goldstein PJ, Harris KC. Evoked responses in vitamin B12 deficiency. Ann Neurol 1981;9:407-9. [CrossRef] 40. von Schenck U, Bender-Götze C, Koletzko B. Persistence of neurological damage induced by dietary vitamin B-12 deficiency in infancy. Arch Dis Child 1997;77:137-9. [CrossRef] 41. Pearson AG, Turner AJ. Folate-dependent 1-carbon transfer to biogenic amines mediated by methylenetetrahydrofolate reductase. Nature 1975;258:173-4. [CrossRef]

02.12.2011 10:13

294

Research Article

Clinical investigation of oral findings in inherited disorders of platelet function Herediter trombosit fonksiyon bozukluğu olan hastalarda görülen oral bulgularının klinik olarak incelenmesi Müjgan Güngör Hatipoğlu1, Özden Kansu2, Yahya Büyükaşık3 1Department

of Oral Diagnosis and Radiology, Dental Clinic, Dumlupinar University, Research and Training Hospital, Kütahya, Turkey 2Department of Oral Diagnosis and Radiology, Faculty of Dentistry, Hacettepe University, Ankara, Turkey 3Department of Hematology, Faculty of Medicine, Hacettepe University, Ankara, Turkey

Abstract Objective: Bleeding disorders are a very important health problem due to the associated high risk of hemorrhage during dental procedures. The present study aimed to investigate oral manifestations of inherited disorders of platelet function (IDPF).

Materials and Methods: The study included 20 IDPF patients (mean age: 31.90±10.71 years) and 40 healthy controls (mean age: 31.63±9.07 years). Tooth brushing habits, level of education, and clinical index scores (Simplified Oral Hygiene Index [OHI-S], Decayed Missing Filled Teeth Index [DMFT] index, probing depth [PD] index, Gingival Bleeding Index [GBI], and Community Periodontal Index [CPI]) were recorded.

Results: There weren’t any significant differences between the 2 groups with respect to tooth brushing habit, level of education level, OHI-S, DMFT index, or CPI (p>0.05), whereas significant differences in PD index and GBI were observed between the groups (p<0.05).

Conclusion: The present study’s findings show that IDPF has a negative effect on periodontal tissues.

(Turk J Hematol 2011; 28: 294-8)

Key words: Blood platelet disorders, thrombocytopathy, gingival hemorrhage, periodontal diseases, oral hygiene, dental caries Received: March 3, 2009

Accepted: April 30, 2010

Özet Amaç: Diş hekimliğinde uygulanan işlemler sırasında kanama, kanama problemi olan hastalarda oldukça önemlidir. Bu çalışmada Herediter Trombosit Fonksiyon Bozukluğu (HTFB) olan hastaların ağız bulguları değerlendirilmiştir.

Address for Correspondence: Assist. Prof. Müjgan Güngör Hatipoğlu, Department of Oral Diagnosis and Radiology, Dental Clinic, Dumlupinar University, Research and Training Hospital, 43270 Kütahya, Turkey Phone: +90 274 265 20 31 Fax: +90 274 265 22 77 E-mail: mujgan121@yahoo.com doi:10.5152/tjh.2011.83

TJH-ARALIK-2011-4-crossref.indd 46

02.12.2011 10:14

Hatipoglu et al.

Oral findings of IDPF

Turk J Hematol 2011; 28: 294-8

295

Yöntem ve Gereçler: Çalışmamıza HTFB olan 20 hasta (31.90±10.71) ve 40 sağlıklı kontrol (31.63± 9.07) alınmıştır. Diş fırçalama alışkanlıkları, eğitim seviyeleri ve klinik indeksler; Modifiye Oral Hijyen İndeksi (OHI-S), Çürük indeksi (DMF-T), cep derinliği (PD), diş eti kanama indeksi (GBI) ve Genel Periodantal indeks (CPI) kaydedildi.

Bulgular: Gruplar arasında, diş fırçalama alışkanlıkları, eğitim seviyesi, OHI-S, DMF-T ve CPI sonuçları için istatistiksel olarak anlamlı bir farklılık bulunmadı (p>0.05). PD, GBI sonuçları ise iki grup arasında istatistiksel olarak anlamlı bulundu (p<0.05).

Sonuç: Bu çalışmada HTFB’nin periodontal dokuları etkilediği görülmüştür.

(Turk J Hematol 2011; 28: 294-8)

Anahtar kelimeler: Trombosit hastalıkları, trombositopatiler, dişeti kanaması, periodontal hastalık, oral hijyen, diş çürükleri Geliş tarihi: 03 Mart 2009

Kabul tarihi: 30 Nisan 2010

Introduction Platelet function disorders are uncommon causes of bleeding disorders treated by hematologists. Inherited disorders of platelet function (IDPF) are diverse and include defects in platelet adhesion, aggregation, secretion, and platelet procoagulant activity. Clarification of the abnormal platelet mechanism in such patients has provided invaluable insights concerning the key aspects of platelet physiology and hemostasis. IDPF patients at all times must be made aware of the importance of oral health. Based on anatomical location, bleeding in the oral cavity can be life threatening. The frequency of oral findings in IDPF patients is not precisely known; however, oral bleeding in related diseases can occur in ≤70% of patients [1-7].

Materials and Methods The present study included patients that were referred to the Department of Oral Diagnosis and Radiology by our hospital’s hematology department. The Hacettepe University Ethics Committee approved the study protocol and written informed consent was obtained from each participant. In all, 20 IDPF patients and 40 healthy controls were included in the study. The 20 patients (5 male and 15 female) had a mean age of 31.90±10.71 years (range: 19-52 years) and were diagnosed with IDPF (Table 1). The control group consisted of 40 systemically healthy age- and gender-matched individuals (10 male and 30 female) with a mean age of 31.63±9.07 years (range: 18-51 years) that presented to our clinics for routine care.

TJH-ARALIK-2011-4-crossref.indd 47

All the participants were examined while in the supine position in a dental chair under standard lighting conditions. Data collected via clinical oral examinations included the Simplified Oral Hygiene Index (OHI-S), Decayed Missing Filled Teeth (DMFT) index, Probing Depth (PD) index, and Gingival Bleeding Index (GBI) [8-11]. Periodontal status was evaluated using the Community Periodontal Index (CPI) [12]. These indexes were used to identify periodontal disease, dental caries activity, and oral hygiene status. One dentist performed all clinical oral examinations.

Table 1. Distribution of IDPF Patients

Disease

Age (years)

Gender

1 von Willebrand Disease

31

F

2 Hermansky-Pudlak Syndrome

25

M

3 von Willebrand Disease

50

M

4 Platelet-release reaction defects

25

F

5 Hermansky-Pudlak Syndrome

29

M

6 von Willebrand Disease

54

M

7 von Willebrand Disease

22

F

8 Grey Platelet Syndrome

23

F

9 Grey Platelet Syndrome

28

F

10 von Willebrand Disease

34

F

11 von Willebrand Disease

22

F

12 von Willebrand Disease

38

F

13 Platelet-release reaction defects

22

F

14 von Willebrand Disease

43

F

15 Platelet-release reaction defects

37

F

16 Platelet-release reaction defects

32

F

17 Glanzmann Thrombasthenia

46

F

18 von Willebrand Disease

21

M

19 Hermansky-Pudlak Syndrome

47

F

20 von Willebrand Disease

45

F

02.12.2011 10:14

296

Hatipoglu et al.

Oral findings of IDPF

Turk J Hematol 2011; 28: 294-8

Table 2. Tooth Brushing Habits and Level of Education Tooth Brushing Habit

Elementary School n

High School n

University n

Total n

8 (30.8%)

8 (30.8%)

10 (38.5%)

26 (100%)

Twice daily/regular

5 (14.7%)

7 (20.6%)

22 (64.7%)

34 (100%)

Total

13 (21.7%)

15 (25%)

32 (53.3%)

60 (100%)

Once daily/irregular

Values are given as median, TP1: At presentation; TP2: after 1 month of treatment, *The results of transfused patients (n=3) were excluded

Statistical analysis Data were analyzed using SPSS for Windows v.11.0 (SPSS Inc., Chicago, IL. USA). The Mann Whitney U test was used for group comparisons.

Differences in qualitative data were evaluated using the chi-square and Fischer exact tests. Correlations between variables were evaluated using Spearman’s correlation coefficient.

Results There wasn’t a significant difference in tooth brushing habits (p>0.05) or level of education between the 2 groups (p>0.05) (Table 2).

Additionally, there wasn’t a significant difference in OHI-S, DMFT index, or CPI scores between the groups (p>0.05) (Table 3). PD index and GBI scores were higher in the patient group than in the control group (p<0.05) (Table 3), and CPI scores in the patient and control groups differed significantly (p<0.05)-the patients had more sites with a PD ≥6mm (CPI Score 4) and more patients bled during probing (CPI score 1) (Table 3). There was a significant correlation between PD index and GBI scores in the patient group (p<0.05), whereas mean PD index and GBI scores were significantly correlated with CPI score in both groups (p<0.05) (Table 4).

Discussion Undiagnosed hematologic disorders are an important health problem that dentists must be aware of. It was reported that some patients are diagnosed following oral symptoms and complications that occur during and after dental treatment [13-15,18]. Case reports have described submucosal hemorrhaging, gingival bleeding, petechiae, ecchymosis, and hematomas in patients with IDPF [15-21].

Tooth brushing habits are affected by age, gender, level of education level, parental level of education, and fear of bleeding. Koivusilta et al. [22] and

TJH-ARALIK-2011-4-crossref.indd 48

Table 3. Clinical Parameters Parameter

Patients Group (n=20)

Control Group (n=40)

DMF-T index

8.60±3.83

8.33±5.36

PD index

2.37±0.74

1.96±0.46

OHI-S

1.23±0.54

1.67±0.48

Score 0

0/20 (0%)

1/40 (2.5%)

Score 1

3/20 (15%)

1/40 (2.5%)

Score 2

5/20 (25%)

22/40 (55%)

Score 3

6/20 (30%)

11/40 (27.5%)

Score 4

6/20 (30%)

5/40 (12.5%)

CPI Score

p<0.05 (two- tailed)

Honkala et al. [23] reported that tooth brushing habits improved as the level of education increased.

Although not statistically significant, there was a positive correlation between tooth brushing habits and level of education in the present study’s patient group.

DMFT index scores were reported to be lower in the children with hemophilia than the controls [24-25]. DMFT index scores were similar in MielnicBlaszcak et al.’s [26] 2 study groups. In the present study DMFT index scores did not differ between the patients and controls. Mielnic-Blaszcak et al. [26] evaluated bacterial dental plaque in children with congenital hemorrhagic diatheses and observed that the level of oral hygiene was lower in the patients than in the healthy children. In the present study the level of oral hygiene was similar in both groups.

Mean PD index and GBI scores were significantly correlated in the patient group and were higher than those in the control group. Moreover, more patients had CPI score 1 and score 4 than did controls. These findings indicate that gingival inflammation were more frequent and PD index scores were higher in the patients than the controls.

Periodontal health is important in patients with bleeding disorders because inflamed gingiva is at

02.12.2011 10:14

Hatipoglu et al.

Oral findings of IDPF

Turk J Hematol 2011; 28: 294-8

297

Table 4. Correlation Between CPI and PD İndex Scores, and Between PD İndex and GBI Scores

Mean PD index r

CPI p

r

p

Patient group

Mean PD

-

-

0.527

0.017

Mean GBI

0.605

0.005

0.485

0.030

Control group

Mean PD

-

-

0.469

0.002

Mean GBI

0.302

0.059

0.336

0.034

Spearman’s correlation analysis, p<0.05 (two- tailed)

risk of bleeding. Good oral health reduced the incidence of unnecessary bleeding in patients with bleeding disorders [15]. In the present study the level of oral hygiene was similar in both groups. An interesting finding is that the patients had deeper pocket depth and higher levels of gingival inflammation than the controls. The present study’s findings show that the incidence of periodontal inflammation was higher in the patients than in the healthy controls. The findings also show that both groups had poor oral hygiene; however, PD index and GBI scores were significantly higher in the study group than the control group. Our results supposed that IDPF affects periodontal tissues negatively. Alterations in platelet functions which result a with delayed or impaired wound healing may also contribute on these negative effects [27].

Conclusion Regular oral-dental examination can play an important role in the diagnosis and screening of hematologic disorders. We think that patients with bleeding disorders should be examined regularly by dental specialists and that oral hygiene educational programming may benefit such patients. More comprehensive studies are needed in order to reach a more definite conclusion on the relation between periodontal health and IDPF. Determination of the effect of bacterial dental plaque on gingiva and oral wound healing (saliva, bacterial products, tissue interaction, etc.) in IDPF patients requires additional research.

Acknowledgement This study was presented as a poster presentation at the IADR/CED & ID Divisional Meeting in Thessaloniki Greece, 26-29 September 2007.

TJH-ARALIK-2011-4-crossref.indd 49

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

George JN. Platelets. The Lancet 2000;355:1531-9.

[CrossRef] 2. Ziv O, Ragni MV. Bleeding manifestations in males with von Willebrand disease. Haemophilia 2004;10:162-8.

[CrossRef] 3. Quiroga T, Goycoolea M, Panes O, Aranda E, Martinez C, Belmont S, Munoz B, Zuniga P, Pereira J, Mezzano D. High prevalence of bleeders of unknown cause among patients with inherited mucocutaneous bleeding. A prospective study of 80 patients and 299 controls.

Haematologica 2007;92:357-65. [CrossRef] 4. Toogeh G, Sharifian R, Lak M, Safaee R, Artoni A, Peyvandi F. Presentation and pattern of symptoms in 382 patients with Glanzmann Thrombasthenia in Iran.

Am J Hematol 2004;77:198-9. [CrossRef] 5. Lak M, Peyvandi F, Mannucci PM. Clinical manifestations and complications of childbirth and replacement therapy in 385 Iranian patients with type 3 von Willebrand disease. Br J Haematol 2000;111:1236-9. [CrossRef] 6. Wray D, Dagg JH. Diseases of the Blood and Bloodforming Organs. In: Jones JH, Mason DK eds Oral Manifestation of Systemic Disease. London: WB Saunders Company, 1980:262-96.

7. Catalano PM. Platelet and Vascular Disorders, In: Rose LF, Kaye D, eds. İnternal Medicine for Dentistry.

St.Louis: Mosby Company, 1990:346-74.

8. Greene JC, Vermillion JR. The Simplified Oral Hygiene Index. J Am Dent Assoc 1964;68:7-13.

9. Greene JC. The Oral Hygiene Index--development and uses. J Periodontol 1967;38:625-37.

10. World Health Organization "Oral Health Surveys - Basic methods", 4th Ed. Geneva 1997:39-44. (published on the website http://www.whocollab.od.mah.se/expl/ orhsurvey97.html) 11. Ainamo J, Bay I. Problems and proposals for recording plaque and gingivitis. Int Dent J 1975;25:229-35.

12. World Health Organization "Oral Health Surveys - Basic methods", 4th Ed. Geneva 1997: 36 - 38. (published on

02.12.2011 10:14

298

13.

14.

15.

16.

17.

18.

19.

Hatipoglu et al.

Oral findings of IDPF

the website http://www.whocollab.od.mah.se/expl/ orhcpitn97.html) Gupta A, Epstein JB, Cabay RJ. Bleeding disorders of importance in dental care and related patient management. J Can Dent Assoc 2007;73:77-83.

Ghom AG. Textbook of Oral Medicine. New Delhi: Jaypee Brothers Medical Publisher, 2005.

Toygar HU, Guzeldemir E. Excessive gingival bleeding in two patients with Glanzmann thrombasthenia. J Periodontol 2007;78:1154-8. [CrossRef] Songra AK, Darbar UR. Post-extraction bleeding--an aid to diagnosis? Case report. Aust Dent J 1998;43:242-3.

[CrossRef] Zakrzewska J. Gingival bleeding as a manifestation of von Willebrand's disease. A review of the literature and management. Br Dent J 1983;155:157-60. [CrossRef] Keila S, Kaufman A, Itckowitch D. Uncontrolled bleeding during endodontic treatment as the first symptoms for diagnosing von Willebrand's disease. A case report.

Oral Surg Oral Med Oral Pathol 1990;69:243-6.

[CrossRef] Fernandes Gomes M, De Melo RM, Plens G, Pontes EM, Silva MM, Da Rocha JC. Surgical and clinical management of a patient with Glanzmann thrombasthenia: a case report. Quintessence Int 2004;35:617-20.

TJH-ARALIK-2011-4-crossref.indd 50

Turk J Hematol 2011; 28: 294-8

20. Kantarci A, Cebeci I, Firatli E, Atamer T, Tuncer O. Periodontal management of Glanzmann's thrombasthenia: report of 3 cases. J Periodontol 1996;67:816-20.

21. Nixon KC, Keys DW, Brown G. Oral management of Glanzmann's thrombasthenia. A case report. J Periodontol 1975;46:364-7.

22. Koivusilta L, Honkala S, Honkala E, Rimpelä A. Toothbrushing as part of the adolescent lifestyle predicts education level. J Dent Res 2003;82:361-6.

[CrossRef] 23. Honkala E, Rajala M, Rimpelä M. Oral hygiene habits among adolescents in Finland. Community Dent Oral Epidemiol 1981;9:61-8. [CrossRef] 24. Boyd D, Kinirons M. Dental caries experience of children with haemophilia in Northern Ireland. Int J Paediatr Dent 1997;7:149-53. [CrossRef] 25. Sonbol H, Pelargidou M, Lucas VS, Gelbier MJ, Mason C, Roberts GJ. Dental health indices and caries-related microflora in children with severe haemophilia.

Haemophilia 2001;7:468-74. [CrossRef] 26. Mielnik-Blaszczak M. Evaluation of dentition status and oral hygiene in Polish children and adolescents with congenital haemorrhagic diatheses. Int J Paediatr Dent 1999;9:99-103. [CrossRef] 27. Klinger MH. Inflammation. In: Michelson AD eds Platelet. Boston: Academic Press, 2002: 459-67.

02.12.2011 10:14

Research Article

299

Factor V G1691A (Leiden) is a major etiological factor in Egyptian Budd-Chiari syndrome patients Mısır’lı Budd-Chiari sendromlu hastalarda Faktör G1691A Leiden major bir etyolojik faktördür Tawhida Y. Abdel Ghaffar1,2, Solaf M. Elsayed 1,2,3, Mohamed A. Sakr4, Ezzat S. Elsobky 2,3, Sara M. Abdelhakam4, Said Yousuf5, Yonca Eğin6, Nejat Akar6 1Yassin

Abdelghaffar Charity Center for Liver Disease and Research, Cairo, Egypt Shams University, Children’s Hospital, Cairo, Egypt 3Department of Medical Genetics Center Ain Shams University, Cairo, Egypt 4Department of Tropical Medicine, Ain Shams University, Cairo, Egypt 5Department of Hematology, Ain Shams University, Cairo, Egypt 6Department of Pediatric Molecular Genetics, Faculty of Medicine, Ankara University, Ankara, Turkey 2Ain

Abstract Objective: Budd-Chiari syndrome is a multifactorial disease in which several prothrombotic disorders may predispose patients to the development of thrombosis at this uncommon location (hepatic veins).

The aim of this study was to determine the prevalence and characteristics of inherited thrombophilia in Egyptian Budd-Chiari syndrome patients.

Materials and Methods: The study included 47 Budd-Chiari syndrome patients (20 children and 27 adults). Genotyping of Factor V G1691A (Leiden), prothrombin G20210A (PT), and methylenetetrahydrofolate reductase C677T were performed using real-time PCR and fluorescence melting curve detection analysis.

Results: Factor V Leiden was observed in 29 patients (61.7%). It is the only factor that caused BuddChiari syndrome in 18 of the patients and in 5 of the patients with inferior vena cava involvement.

Myeloproliferative disease was noted in 12 (25.5%) patients, antiphospholipid syndrome in 5 (10.6%), and Behcet’s disease in 3 (6.4%). Interestingly, 3 of the children with Budd-Chiari syndrome had lipid storage disease.

Conclusion: Factor V Leiden was a major etiological factor in Egyptian Budd-Chiari syndrome patients, which may have been related to the high frequency of this mutation in the study region. Factor V Leiden was also a strong thrombophilic factor and the leading cause of inferior vena cava thrombosis in these patients. Lipid storage disease should be included as a risk factor for Budd-Chiari syndrome.

(Turk J Hematol 2011; 28: 299-305)

Key words: Budd-Chiari syndrome, thrombophilia, Factor V Leiden, prothrombin, methylenetetrahydrofolate, Niemann-Pick, Gaucher, Behcet’s syndrome, thrombosis Received: January 13, 2011

Accepted: May 20, 2011

Address for Correspondence: Assoc. Prof. Solaf M. Elsayed, Medical Genetics Center, 27A Baghdad Street, Korba, 11341 Cairo, Egypt Phone: +202 241 51 999 E-mail: elsayed683@yahoo.com doi:10.5152/tjh.2011.84

TJH-ARALIK-2011-4-crossref.indd 51

02.12.2011 10:14

300

Ghaffar et al.

Factor V Leiden and Budd-Chiari syndrome

Turk J Hematol 2011; 28: 299-305

Özet Amaç: Budd-Chiari sendromunun etyolojisinde çok farklı nedenler rol oynayabilir. Farklı protrombotik bozukluklar, bu sendromun oluşmasına yol açabilir. Bu çalışmada Mısır’lı Budd Chiari Sendromu tanısı almış hastalarda trombofilik nedenlerin sıklığıyla hastaların özelliklerinin karşılaştırılması amaçlanmıştır.

Yöntemler ve Gereçler: Çalışmaya 20 çocuk ve 27 erişkin olmak üzere 47 hasta dahil edilmiştir. Faktör V Leiden G1691A, Prothrombin G20210A and methylenetetrahydrofolate reductase C677T genotiplemeleri gerçek zamanlı polimeraz zincir reaksiyon (PZR) yöntemi kullanılarak gerçekleştirilmiştir. FV Leiden toplam 29 hastada (%61.7) saptanmış olup, daha once yapılan çalışmalara göre yüksek bir orandır. 18 hastada Budd Chiari sendromu oluşması için tek etyolojik neden olarak göze çarpmaktadır.

Myeloproliferatif hastalık sadece 12 (%25.5), antifosfolipid sendromu 5 (%10.6), ve Behçet hastalığı 3 (%6.4) hastada saptanmıştır. İlginç olan 3 çocukta lipid depo hastalıkların da belirlenmiş olmasıdır.

Sonuç: Faktör V Leiden'ın Budd Chiarinin oluşmasındaki temel etyolojik faktörlerden biri olarak göze çarpmaktadır. Bu ise mutasyonun Mısır toplumunda yüksek oranda bulunmasına bağlanabilir. Lipid depo hastalıklarının da Budd Chiari için risk faktörü olarak dahil edilmesi gerekmektedir.

(Turk J Hematol 2011; 28: 299-305)

Anahtar kelimeler: Budd- Chiari sendromu, thrombofili, Factor V Leiden, prothrombin, methylenetetrahydrofolate, Niemann-Pick, gaucher, Behçet sendromu, thromboz Geliş tarihi: 13 Ocak 2011

Kabul tarihi: 20 Mayıs 2011

Introduction Budd-Chiari syndrome (BCS) is characterized by obstruction of the hepatic venous outflow tract in the absence of right-sided heart failure and constrictive pericarditis [1]. Clinical manifestations include abdominal pain, ascites, and liver and spleen enlargement, as well as dilatation of the subcutaneous veins of the trunk in patients with longstanding inferior vena cava (IVC) obstruction [2].

Primary BCS is a multifactorial disease in which several prothrombotic disorders may predispose patients to the development of thrombosis at this uncommon location (hepatic veins) [3]. The prevalence and cause of BCS vary by geographic region [3,4]. Thromboses are prominent etiological factor in the West, while webs are more common etiology in the East and in Japan [5,6]. In Turkey, Behcet’s disease and hydatid disease are more common etiologies [7]. Inherited thrombophilia was reported to be a major risk factor in 31% of BCS patients [8].

Factor V G1691A (Leiden) (FVL) is considered the most common inherited risk factor [9] and the second most frequent etiologic factor (following polycythemia vera [PV]) for BCS [10]. The frequency of prothrombin (PT) G20210A mutation igreater in southern Europe than in northern Europe, and is rare in the Middle East and Africa [11].

Hyperhomocysteinemia and homozygous methylenetetrahydrofolate reductase MTHFR C677T mutation were reported to be important risk factors for BCS [12].

TJH-ARALIK-2011-4-crossref.indd 52

To the best of our knowledge the prevalence and effects of these factors in Egyptian BCS patients have not been reported, and few data exist on children with BCS. The aim of the present study was to determine the prevalence and characteristics of inherited thrombophilia in both pediatric and adult Egyptian BCS patients.

Materials and Methods The study included 47 consecutive patients (23 male and 24 female) diagnosed as BCS between January 2008 and January 2010 at Ain Shams University, Tropical Medicine Clinic, and Yassin Abdel Ghaffar Charity Center for Liver Disease and Research, both of which are major tertiary referral centers. BCS was diagnosed based on partial or complete obstruction of hepatic outflow documented via appropriate abdominal radiographic imaging (diagnostic criteria). Patients with veno-occlusive disease and those with hepatic outflow obstruction caused by congestive heart failure were excluded (exclusion criteria) from participating in the study.

The 47 patients were divided into group 1 (children, n=20) and group 2 (adults, n=27). All the patients were treated by ≥1 of the authors. The control group included 130 healthy adult and children Egyptian volunteers. Mean age of controls was 31.9 years (median: 29 years). Controls with a family history of thrombosis were excluded. Genotyping of FVL G1691A, prothrombin G20210A, and MTHFR

02.12.2011 10:14

Turk J Hematol 2011; 28: 299-305

C677T was performed in all the controls. The study protocol was approved by the ethical committee of both Yassin Abdelghaffar Charity Center for Liver Diseases and Research and Ain Shams University.

An informed consent was obtained from the adult patients and controls, and from the parents of the pediatric patients. Medical history and family history of spontaneous deep venous thrombosis and acquired risk factors for BCS, such as use of oral contraceptive pills and pregnancy, were recorded for each patient.

Protein C, protein S, and antithrombin III levels, lupus anticoagulant, and anticardiolipin antibodies were measured in all the patients for detection of antiphospholipid syndrome (APL). Patients with heterozygous JAK2 V617F mutation were diagnosed as myeloproliferative disease (MPD). Diagnosis of Niemann-Pick disease (NPD) was based on low acid sphingomyelinase activity (<5% of normal) in isolated leukocytes and Gaucher disease (GD) was diagnosed based on low β- glucocerebrosidase activity (<5% of normal) in isolated leukocytes.

DNA was isolated using a Magna Pure Automatic Isolation System (Roche Diagnostics, Indianapolis, USA). Genotyping of FVL G1691A, prothrombin G20210A, and MTHFR C677 was performed via realtime PCR and fluorescence melting curve detection analysis using a Light Cycler System (Roche Diagnostics, Manheim, Germany); primers were obtained from TIB MOLBION (Berlin, Germany).

Statistical methods SPSS for Windows v.13.0 (SPSS Inc, USA) was used for data entry and analysis. All numeric variables are expressed as mean±standard deviation (SD). Comparison of variables between groups was performed using Student’s t test and the MannWhitney U test was used for normal and nonparametric variables. The chi-square (χ2) test was used to compare the frequency of qualitative variables between groups. Spearman’s correlation test was used to determine the correlation between nonparametric variables. For all tests a p value <0.05 was considered statistically significant [13].

Results Patient characteristics are shown in Table 1.

Ascites was significantly more common in the adult

TJH-ARALIK-2011-4-crossref.indd 53

Ghaffar et al.

Factor V Leiden and Budd-Chiari syndrome

301

patients, whereas dilated abdominal veins were significantly more common in the pediatric patients.

Medical history and family history of spontaneous deep venous thrombosis were negative in all the patients. BCS was not associated with pregnancy or use of oral contraceptive pills in any of the adult female patients. Inherited thrombophilia mutations (FVL and PT) were noted in 30 (63.8%) patients (29 with FVL and 1 with PT). The frequency of FVL was significantly higher in the BCS patients (no significant difference between pediatric and adult patients) than in the controls (Table 2). Furthermore, FVL was the only etiological factor for BCS in 18 of the patients (Table 3). None of the patients had protein C, protein S, or antithrombin III deficiency. All patients with MPD had heterozygous JAK2 V617F mutation.

Comparison of the patients with and without inherited thrombophilia mutations showed that dilated abdominal veins, ascites, and encephalopathy were more common in the patients with mutations, whereas jaundice was more common in those without mutations, although the differences were not statistically significant. Hepatic vein thrombosis was observed in 33 patients (70.2%), IVC thrombosis was observed in only 3 patients (6.4%), and both were observed in 11 patients (23.4%). IVC involvement was observed in 14 patients (29.8%), 45% of which were children (9/20); FVL mutation was noted in 50% of these 14 patients (n=7) (Table 4).

Discussion The present study shows that FVL was a major etiological factor for thrombosis in Egyptian BCS patients; 61.7% of patients in the present study had FVL, as compared to previous reports of 26%-36% on different poulations [1,14]. This might have been due the high frequency of FVL in the study region [15]. In Egyptian children, FVL was previously reported to be the most common factor in Egyptian children with portal vein thrombosis, although to a lesser extent (30%) [16]. This may be explained to the difference in the site of thrombosis (hepatic veins versus portal veins). In the present study, FVL alone (without other acquired factors) caused BCS in 18 of the patients and in 50% of patients with IVC involvement (as not all patients with BCS have IVC involvement), which contradicts the notion that is a relatively weak thrombotic factor and the assump-

02.12.2011 10:14

302

Ghaffar et al.

Factor V Leiden and Budd-Chiari syndrome

Turk J Hematol 2011; 28: 299-305

Table 1. Patient Characteristics

Gender: Male/female

Children (n=20)

Adults (n=27)

P

12/8

11/16

0.244

12.6±5.5

30.7±6.9

0.001

Acute/subacute

42.1

25.9

0.209

Chronic

57.9

74.1

Abdominal pain

63.2

77.8

0.331

Abdominal distension

68.4

96.3

0.15

Jaundice

10.5

14.8

1.0

Accidental

5.5

3.7

Others*

0.0

7.4

Hepatomegaly

84.2

88.9

0.68

Splenomegaly

52.6

44.4

0.765

Mean age at presentation (years) Presentation (%)

Presenting symptoms (%)

Physical examination results (%)

Jaundice

21.1

22.2

1.0

Ascites

57.9

92.3

0.01

Dilated abdominal veins

52.6

14.8

0.009

LL edema

13.3

7.4

0.608

Encephalopathy

5.5

11.1

1.0

GIT bleeding

5.5

3.7

1.0

Total Bilirubin (mg, %)

3.8±8.7

2.5±2.1

0.445

Direct bilirubin (mg, %)

2.3±5.9

1.1±0.9

0.227

ALT (xN)

2.1±3.4

2.3±2.3

0.842

AST (xN)

2.8±3.9

2.8±4.5

1.0

INR

1.6±0.6

1.3±0.2

0.29

Albumin (g/dL)

3.3±0.7

3.4±0.6

0.072

Regressive

17.6

25

0.602

Stable

52.9

37.5

Progressive

11.8

25

Death

17.6

12.5

Laboratory results (mean±SD)

Course (%)

*Others: GIT bleeding, LL edema, xN: multiple of normal

tion that other essential factors must be present to cause thrombosis.

Another interesting finding of the present study is that 3 of the BCS patients had lipid storage disease (2 patients had GD and 1 had NPD), of which only one with GD had FVL. There is only one report of BCS in Gaucher disease patients [17] and no report of BCS in NPD patients. A possible explanation of hepatic vein obstruction in these patients is arterial thickening or narrowing secondary to swelling of the medial and intimal smooth-muscle cells which is supported by the autopsy findings in these patients [18].

TJH-ARALIK-2011-4-crossref.indd 54

On the other hand, in this study, only 1 patient had PT mutation, which is in agreement with previous reports indicating that this mutation is not a prominent etiological factor in BCS patients [1,19].

In the present study MTHFR C677T occurred more frequently in the adult patients than both children and controls, whereas homozygosity of this mutation occurred less frequently in the adult patients than in the controls, which indicates that it is not a strong thrombotic factor unless augmented by another acquired or hereditary risk factor. JAK2 V617F mutation-positive MPD was observed in only

02.12.2011 10:14

Ghaffar et al.

Factor V Leiden and Budd-Chiari syndrome

Turk J Hematol 2011; 28: 299-305

303

Table 2. Distribution of FVL, PT, and MTHFR Gene Mutations

n

FVL

PT

MTHFR

G/A (%)

A/A (%)

G/A (%)

C/T (%)

T/T (%)

Children

20

10 (50)

3 (15)

0 (0)

6 (30)

1 (5)

Adults

27

14 (51.9)

2 (7.4)

1 (3.7)

13 (48.1)

1 (3.7)

Controls*

130

18 (13.8)

0 (0)

0 (0)

23 (25.5)

7 (7.8)

*MTHFR was done to only 90 controls

Table 3. The Prevalence of Major Risk Factors in the BCS Patients Risk factor

FVL

Children (n)

Adults (n)

Total (%)

Alone

10

8

18 (38.3)

With other risk factors

3

8

11 (23.4)

PT mutation

Alone

0

1

1 (2.1)

MPD

Alone

1

6

7 (14.9)

With FVL

1

4

5 (10.6)

Alone

1

0

1 (2.1)

With FVL

1

3

4 (8.5)

Alone

1

1

2 (4.2)

With FVL

0

1

1 (2.1)

Alone

2

0

2(4.2)

With FVL

1

0

1 (2.1)

2

3

5 (10.6)

APL

Behcet disease

Lipid storage disease

No factor detected

APS: Antiphospholipid syndrome; FVL: factor V Leiden; MPD: myeloproliferative disease; NP: Niemann-Pick disease

Table 4. The Prevalence of Major Risk Factors in the BCS Patients with IVC İnvolvement

n

Total(%)

FVL

Alone

5

5 (35.7)

With other risk factors

2

2 (14.3)

MPD

Alone

2

2 (14.3)

APL

Alone

1

2 (14.3)

With FVL

1

Behcet disease Alone

1

With FVL

1

NPD

Alone

1

1 (7.1)

2

2 (14.3)

No apparent factor

2 (14.3)

APS: Antiphospholipid syndrome; FVL: factor V Leiden; MPD: myeloproliferative disease; NP: Niemann-Pick disease

25.5% of the present study’s patients, which is a lower frequency than previously reported in BCS [20,21]. Acquired factors, including Behcet’s disease, were noted in 7.4% of the presented adult patients, which is similar to the frequency reported in Turkey (9%) [7], a country which has a long historical background with Egypt; among these patients, 1 had pure involvement of the hepatic veins without IVC involvement, which is a rare finding [22].

TJH-ARALIK-2011-4-crossref.indd 55

In the present study the male to female patient ratio was close to one (1.04:1); which is consistent with that reported by the European Network for Vascular Disorders of the Liver [23].

In conclusion, FVL (independently causing hypercoagulopathy or as a cofactor in different disease states) was a prominent etiological factor for BCS in our Egyptian patient population, most likely due to the prevalence of this mutation in the study region [15]. It was a strong thrombophilic factor and the leading cause of IVC thrombosis in the presented BCS patients, which is in contrast with PT and MTHFR, both of which had little effect on thrombosis in the BCS patients. Lipid storage disease may be considered a risk factor for BCS. Appropriate risk assessment should include complete thrombophilia screening in patients with BCS, even in the presence of overt acquired thrombotic risk factors.

Author Contributions TYA: Diagnosis and follow-up of the pediatric BCS patients, writing the manuscript, and interpretation of data.

02.12.2011 10:14

304

Ghaffar et al.

Factor V Leiden and Budd-Chiari syndrome

SME: Diagnosis and follow-up of the pediatric BCS patients, writing the manuscript, and interpretation of data.

MAS: Diagnosis and follow-up of the adult BCS patients, and writing the manuscript.

ESE: Interpretation of genetic test results and writing the manuscript.

SMA: Diagnosis and follow-up of the adults BCS patients.

SY: Diagnosis and follow-up of the adult patients with BCS, especially those with MPD. YE: Molecular analysis.

NA: Molecular analysis, interpretation of the results, and writing the manuscript.

Conflict of Interest Statement None of the authors of this paper has a conflict of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2011; 28: 299-305

8.

9.

10.

11.

12.

References 1.

2.

3.

4.

5.

6.

7.

Janssen HL, Garcia-Pagan JC, Elias E, Mentha G, Hadengue A, Valla DC, European Group for the Study of Vascular Disorders of the Liver. Budd-Chiari syndrome: a review by an expert panel. J Hepatol 2003;38:364-71.

[CrossRef] Dilawari JB, Bambery P, Chawla Y, Kaur U, Bhusnurmath SR, Malhotra HS, Sood GK, Mitra SK, Khanna SK, Walia BS. Hepatic outflow obstruction (Budd-Chiari syndrome).

Experience with 177 patients and a review of the literature. Medicine (Baltimore) 1994;73:21-36. [CrossRef] Janssen HL, Meinardi JR, Vleggaar FP, van Uum SH, Haagsma EB, van Der Meer FJ, van Hattum J, Chamuleau RA, Adang RP, Vandenbroucke JP, van Hoek B, Rosendaal FR. Factor V Leiden mutation, prothrombin gene mutation, and deficiencies in coagulation inhibitors associated with Budd-Chiari syndrome and portal vein thrombosis: results of a case-control study. Blood 2000;96:2364-8.

Deltenre P, Denninger MH, Hillaire S, Guillin MC, Casadevall N, Briere J, Erlinger S, Valla DC. Factor V Leiden related Budd-Chiari syndrome. Gut 2001;48:264-8. [CrossRef] Mohanty D, Shetty S, Ghosh K, Pawar A, Abraham P. Hereditary thrombophilia as a cause of Budd-Chiari syndrome: a study from Western India. Hepatology 2001;34:666-70. [CrossRef] Okuda H, Yamagata H, Obata H, Iwata H, Sasaki R, Imai F, Okudaira M, Ohbu M, Okuda K. Epidemiological and clinical features of Budd-Chiari syndrome in Japan. J Hepatol 1995;22:1-9. [CrossRef] Uskudar O, Akdogan M, Sasmaz N, Yilmaz S, Tola M, Sahin B. Etiology and portal vein thrombosis in Budd-

TJH-ARALIK-2011-4-crossref.indd 56

13.

14.

15.

16.

17.

18.

19.

Chiari syndrome. World J Gastroenterol 2008;14:2858-62.

[CrossRef] Rajani R, Melin T, Björnsson E, Broomé U, Sangfelt P, Danielsson A, Gustavsson A, Grip O, Svensson H, Lööf L, Wallerstedt S, Almer SH. Budd-Chiari syndrome in Sweden: epidemiology, clinical characteristics and survival - an 18-year experience. Liver Int 2009;29:253-9.

[CrossRef] Mahmoud AEA, Elias E, Beauchamp N, Wilde JT. Prevalence of the factor V Leiden mutation in hepatic and portal vein thrombosis. Gut 1997;40:798-800.

[CrossRef] Minnema MC, Janssen HL, Niermeijer P, de Man RA. Budd-Chiari syndrome: combination of genetic defects and the use of oral contraceptives leading to hypercoagulability. J Hepatol 2000;33:509-12.

[CrossRef] Rosendaal FR, Doggen CJ, Zivelin A, Arruda VR, Aiach M, Siscovick DS, Hillarp A, Watzke HH, Bernardi F, Cumming AM, Preston FE, Reitsma PH. Geoegraphic distribution of the 20210 G to A prothrombin variant.

Thromb Haemost 1998;79:706-8.

Li X-M, Wei YF, Hao HL, He LS, Li JD, Mei B, Wang SY, Wang C, Wang JX, Zhu JZ, Liang JQ. Hyperhomocysteinemia and the MTHFR C677T mutation in Budd-Chiari syndrome. Am J Hematol 2002;71:11-4. [CrossRef] Daniel WW. Biostatistics: A foundation for analysis in the health sciences, 6th edition. John Wiley and sons, Inc., New York, 1995.

Dutta AK, Chacko A, George B, Joseph JA, Nair SC, Mathews V. Risk factors of thrombosis in abdominal veins. World J Gastroenterol 2008;28:4518-22.

[CrossRef] Ulu A, Elsobky E, Elsayed M, Yıldız Z, Tekin M, Akar N. Frequency of five thrombophilic polymorphisms in the Egyptian population. Turk J Hematol 2006;23:100-3.

El-Karaksy H, El-Koofy N, El-Hawary M, Mostafa A, Aziz M, El-Shabrawi M, Mohsen NA, Kotb M, El-Raziky M, El-Sonoon MA, A-Kader H. Prevalence of factor V Leiden mutation and other hereditary thrombophilic factors in Egyptian children with portal vein thrombosis: results of a single-center case-control study. Ann Hematol 2004;83:712-5. [CrossRef] Haliloglu M, Hoffer FA, Haight AE, Cunningham JM. Budd-Chiari syndrome caused by Gaucher's disease.

Pediatr Radiol 1999;29:908-10. [CrossRef] Ishii H, Takahashi T, Toyono M, Tamura M, Harada K, Yoshida M, Nishikawa Y, Enomoto K, Takada G. Acid sphingomyelinase deficiency: cardiac dysfunction and characteristic findings of the coronary arteries. J Inherit Metab Dis 2006;29:232-4. [CrossRef] Lin GL, Xu PQ, Qi H, Lian JH, Zheng H, Dang XW. Relations of Budd-Chiari syndrome to prothrombin gene mutation. Hepatobiliary Pancreat Dis Int 2004;3:214-8.

02.12.2011 10:14

Turk J Hematol 2011; 28: 299-305

20. Primignani M, Barosi G, Bergamaschi G, Gianelli U, Fabris F, Reati R, Dell'Era A, Bucciarelli P, Mannucci PM. Role of the JAK2 mutation in the diagnosis of chronic myeloproliferative disorders in splanchnic vein thrombosis. Hepatology 2006;44:1528-34. [CrossRef] 21. Patel RK, Lea NC, Heneghan MA, Westwood NB, Milojkovic D, Thanigaikumar M, Yallop D, Arya R, Pagliuca A, Gäken J, Wendon J, Heaton ND, Mufti GJ. Prevalence of the activating JAK2 tyrosine kinase mutation V617F in the Budd-Chiari syndrome. Gastroenterology 2006;130:2031-8. [CrossRef]

TJH-ARALIK-2011-4-crossref.indd 57

Ghaffar et al.

Factor V Leiden and Budd-Chiari syndrome

305

22. Bayraktar Y, Balkanci F, Bayraktar M, Calguneri M. BuddChiari syndrome: a common complication of Behcetâ&#x20AC;&#x2122;s disease. Am J Gastroenterol 1997;92:858-62.

23. Darwish Murad S, Plessier A, Hernandez-Guerra M, Fabris F, Eapen CE, Bahr MJ, Trebicka J, Morard I, Lasser L, Heller J, Hadengue A, Langlet P, Miranda H, Primignani M, Elias E, Leebeek FW, Rosendaal FR, Garcia-Pagan JC, Valla DC, Janssen HL; EN-Vie (European Network for Vascular Disorders of the Liver). Etiology, management, and outcome of the Budd-Chiari syndrome. Ann Intern Med 2009;151:167-75.

02.12.2011 10:14

306

Research Article

Factor V G1691A (Leiden) and prothrombin G20210A gene mutation status, and thrombosis in patients with chronic myeloproliferative disorders Kronik myeloproliferatif hastalık tanılı hastalarda Factor V 1691A (Leiden) ve protrombin G20210A gen mutasyonu ve tromboz Nur Soyer1, Ali Şahin Küçükarslan2, Fahri Şahin1, Demet Çekdemir1, Buket Kosova2, Zuhal Eroğlu2, Mahmut Töbü1, Murat Tombuloğlu1, Seçkin Çağırgan1, Ayhan Dönmez1, Filiz Vural1, Güray Saydam1 1Department 2Department

of Hematology, Faculty of Medicine, Ege University, İzmir, Turkey of Medical Biology, Faculty of Medicine, Ege University, İzmir, Turkey

Abstract Objective: The aim of this study was to examine Factor V G1691A (Leiden) (FVL) and prothrombin G20210A (PT) gene mutation status, and their relationship with thrombosis in patients with chronic myeloproliferative disorders (CMPDs).

Materials and Methods: The study included 160 patients with a CMPD that were regularly followed-up between 1993 and 2009. FVL and PT mutation status was established based on blood samples analyzed via PCR using specific primers.

Results: The frequency of FVL and PT mutation was 12.5% and 4.4%, respectively. In total, 27 episodes of thrombosis occurred in 24 (15%) of the patients, and there wasn’t an association between the observed thrombotic events, and FVL or PT mutations. Hepatic vein thrombosis was noted in 3 patients that had FVL mutation, of which 1 also had PT mutation.

Conclusion: We did not observe a relationship between thrombosis, and FVL or PT mutations in CMPD patients; however, 3 of the patients that had hepatic vein thrombosis also had FVL mutation.

Larger studies are needed to more clearly determine if all CMPD patients with hepatic vein thrombosis need be investigated for FVL and PT mutation. (Turk J Hematol 2011; 28: 306-11) Key words: Chronic myeloproliferative disorders, factor V Leiden mutation, prothrombin gene mutation, thrombosis Received: September 20, 2010

Accepted: March 05, 2011

Özet Amaç: Bu çalışmanın amacı, kronik myeloproliferatif hastalık (KMPH) tanılı hastalarda Factor V G1691A (Leiden) (FVL) ve protrombin (PT) gen mutasyonu durumunu ve bunların trombotik komplikasyonlarla ilişkisini değerlendirmektir.

Address for Correspondence: Assoc. Prof. Güray Saydam, Department of Hematology, Faculty of Medicine, Ege University, İzmir, Turkey Phone: +90 532 556 61 28 E-mail: guray.saydam@ege.edu.tr doi:10.5152/tjh.2011.85

TJH-ARALIK-2011-4-crossref.indd 58

02.12.2011 10:14

Soyer et al.

Thrombosis in CMPD

Turk J Hematol 2011; 28: 306-11

307

Yöntemler ve Gereçler: 1993-2009 yılları arasında düzenli olarak takip edilen 160 KMPH hastası çalışmaya alındı. FVL ve PT mutasyon durumunu saptamak için kan örnekleri toplandı ve spesifik primerler kullanılarak PCR ile değerlendirildi.

Bulgular: FVL ve PT mutasyonu sıklığı sırasıyla %12.5 ve %4.4 olarak bulundu. 24 hastada (%15) toplam 27 tromboz atağı saptandı ve bu mutasyonlarla tromboz gelişimi arasında herhangi bir ilişki gösterilemedi. FVL mutasyonu olan hastaların 3’ünde hepatik ven trombozu saptandı ve 3 hastanın 1’inde PT mutasyonu da vardı.

Sonuç: TKMPH’lı hastalarda FVL ve PT mutasyonu ile tromboz arasında herhangi bir ilişki gösterilemedi. Ancak, biz FVL mutasyonu olan hepatik ven trombozlu 3 KMPH hastası saptadık. Hepatik ven trombozlu tüm KMPH hastalarında FVL ve PT mutasyonu bakılmasına gerek olup olmadığını saptamak için büyük çalışmalara ihtiyaç olduğu gözükmektedir. (Turk J Hematol 2011; 28: 306-11) Anahtar kelimeler: Kronik myeloproliferatif hastalıklar, Faktör V Leiden mutasyonu, protrombin gen mutasyonu, tromboz Geliş tarihi: 20 Eylül 2010

Kabul tarihi: 05 Mart 2011

Introduction Arterial and venous thrombosis are common causes of morbidity and mortality in patients with chronic myeloproliferative disorders (CMPDs).

Generally, thrombotic events are more frequently reported than bleeding complications in patients with essential thrombocythemia (ET) and polycythemia vera (PV) at the time of diagnosis and during follow-up [1]. The frequency of thrombotic events in patients with idiopathic myelofibrosis (IMF) was reported to be 7.2%-11.6% [2,3].

Factor V G1691A (Leiden) (FVL) and prothrombin 20210A (PT) gene mutations are the most common genetic anomalies factors in patients with venous thromboembolism. The frequency of FVL ranges from 1.4% in Italy to 7% in Greece [4]. In the general Caucasian population the prevalence of the PT 20210A allele is 2% showing difference according to geographic variation approximately 2%, with some geographic variation [5]. The prevalence of FVL and PT mutation in Turkey was reported to be 7.4%-10.8% and 2.6%, respectively [6-10], which differs from the reported incidence of FVL and PT mutation in patients with ET and PV [11-13]. To the best of our knowledge the frequency of FVL and PT mutation in patients with IMF has not been reported. Furthermore, the relationship between thrombophilic factors such as FVL and protrombine mutations thrombophilic factors and the occurrence of thrombosis in patients entering this study these patients remains unclear. As such, the present study aimed to determine the FVL and PT mutation status, and the relationship between these mutations and thrombosis in patients with CMPDs.

TJH-ARALIK-2011-4-crossref.indd 59

Materials and Methods The study included 160 CMPD patients that were regularly follow-up at our hematology department between January 1993 and September 2009.

Diagnosis of CMPDs was based on the criteria accepted at the time the patients presented (PSVSG14). All patients were informed about the study and provided written informed consent, and the Ege University Local Ethics Committee approved the study protocol.

Blood samples (3 mL of peripheral blood) were collected into tubes containing EDTA) between February 2008 and September 2009. Patient data were collected at the time of sample collection based on the patient files, and included date of diagnosis, occurrence of arterial and venous thrombosis, symptoms, and complete blood count and other laboratory measurements at the time of diagnosis.

We used the blood samples to identify FVL G1691A and PT 20210A gene mutations. Genomic DNA was extracted from peripheral leukocytes using the High Pure PCR Template Preparation Kit (Roche Applied Science). In brief, 200 µL of DNA binding buffer (6 M guanidine-HCl, 10 mM urea, 10 mM Tris-HCl, and 20% Triton X-100 [pH 4.4]) and 40 µL of proteinase K were added to 200 µL of EDTAcontaining blood. The mixture containing proteinase K was incubated for 10 min at 72°C, and then 100 µL of isopropanol was added to the mixture samples, which were placed in filter tubes containing glass fiber (in order to bind DNA) and centrifuged at 8000 rpm. The DNA that bound to the filter tubes was washed twice with buffer (20 mM NaCl

02.12.2011 10:14

308

Soyer et al.

Thrombosis in CMPD

Turk J Hematol 2011; 28: 306-11

and 2 mM Tris-HCl [pH 7.5]). Warm elution buffer (10 mM Tris [pH 8.5]) was then added to the DNAbound filter tubes, which were then centrifuged at 8000 rpm to collect DNA. DNA solutions obtained with this procedure were directly available for FVL and PT mutation analysis, which was performed according to the manufacturer’s instructions.

The presence of FVL G1691A and PT G20210A mutation was analyzed using commercially available Light Cycler FVL and PT mutation detection kits (Roche Applied Science). Wild type and mutated alleles were identified using the specific melting temperature (Tm) of the resulting amplicons. Tm values for FVL were 65°C for the wild type allele and 57°C for the G1691A allele, and for PT 60°C for the wild type allele and 49°C for the G20210A allele.

Statistical analysis Statistical analysis of the data was performed with using SPSS v.12.0 for Windows (SPSS Inc, Chicago, III). Fisher’s exact test was used to determine the significance of the difference between categorical variables (arterial and venous thrombosis, FVL and PT mutation, diagnostic subgroups). P values <0.05 were accepted as statistically significant.

As at the time of presentation the patients’ symptoms were quite varied, symptoms were classified based on systems. The patients’ symptoms are shown in Table 2.

In total, 27 episodes of thrombosis occurred in 24 (15%) of the 160 patients, and included 12 arterial and 15 venous episodes. Hepatic vein thrombosis was noted in 3 patients with FVL mutation, of which and 1 also had PT mutation. In all, 7 patients had portal vein thrombosis, none of which had FVL or PT mutation. The frequency of arterial and venous thrombotic events did not differ between patient diagnostic subgroups (p>0.05). Whereas 16 (18.2%) thrombotic events were documented in 88 patients with ET, 7 (14.5%) thrombotic events were recorded in 48 patients with PV. In all, 2 thrombotic events (13.3%) occurred in 1 of the 15 patients with IMF, which were not associated with any thrombophilic factors. FVL and PT gene mutations were noted in 20 (12.5%) and 7 (4.4%) of the 160 CMPD patients, Table 2. Frequency of Symptoms

Results Among the 160 CMPD patients, 88 (55%) had ET, 48 (30%) had PV, 15 (9.3%) had IMF, and 9 (5.7%) had an unclassified CMPD. Median age of the patients (88 males and 77 females) was 59 years (range: 21-88 years). Patient characteristics are presented in Table 1.

Symptoms

n

%

Thrombocytosis based on routine CBC

64

40

Neurologic symptoms

24

15

Polycythemia based on routine CBC

18

11.3

Gastrointestinal symptoms

16

10

Hematologic symptoms

9

5.6

Systemic symptoms

8

5

Others

8

5

Ruddy cyanosis

5

3.1

Cardiovascular and pulmonary symptoms

3

1.9

Pruritus

3

1.9

Visual symptoms

2

1.2

Table 1. Patient Characteristics Characteristics

Total

ET

PV

IMF

Unclassified CMPD

n

160

88

48

15

9

59 (21-88)*

57 (21-88)*

59.5 (24-82)*

60 (32-80)*

62 (36-75)*

83

49

29

9

6

Age (years) Male Female Months since diagnosis Hematocrit (%)

77

39

19

6

3

31.5 (5-282)*

27 (5-160)*

42.5 (5-282)*

25 (5-147)*

24 (15-136)*

44 (20-70)*

40.05 (26-51.7)*

57.55 (34.1-70)*

36 (20-52.9)*

47.8 (38-57)*

Platelet count (×109/L)

758 (88-2819)*

963 (115-2819)*

473.5 (95-1380)*

356 (88-1250)*

564 (138- 1436)*

White blood cell count (×109/L)

11.4 (3.15-73)*

10.2 (4.87-35)*

13 (7.13-40.2)*

13.2 (3.15-73)*

14.8 (4.82-44.4)*

5.5 (2-22)*

16 (2-46)*

ESR (mm/h) LDH (/UL)

6 (2-61)*

9 (2-61)*

419 (131-2841)*

400 (131-991)*

407.5 (134- 2201)* 1026 (638-2841)*

2.5 (2-7)* 440 (244-1180)*

*Median (range)

TJH-ARALIK-2011-4-crossref.indd 60

02.12.2011 10:14

Soyer et al.

Thrombosis in CMPD

Turk J Hematol 2011; 28: 306-11

respectively. All the observed mutations were heterozygous (Table 3). In total, 5 (21%) of the 24 patients with thrombosis had FVL mutation, of which 1 also had PT gene mutation. There wasnâ&#x20AC;&#x2122;t an association between thrombosis, and FVL or PT mutation carriership (p>0.05).

The clinical characteristics of the patients (age, erythrocyte sedimentation rate [ESR], leukocyte count, hematocrit, platelet count, and lactate dehydrogenize [LDH]) with and without FVL mutation did not differ (p>0.05), nor did those of the patients with and without PT gene mutation (p>0.05).

Arterial and venous thrombotic events were not associated with the presence of FVL or PT gene mutation (p>0.05).

Discussion Thrombotic events during the clinical course of CMPDs cause morbidity and mortality. Prevention of these events is among the primary goals of the treatment of CMPDs. In addition, hereditary thrombophilic factors are the most important cause of venous thrombosis. It remains unclear if there is a relationship between these factors and thrombotic events in CMPD. The present study examined the frequency of FVL and PT mutation in CMPD patients, as well as the relationship between FVL and PT mutation, and arterial and venous thrombotic events.

The frequency of thrombotic events in the patients with ET and PV (18.2% and 14.5%, respectively) was similar to that previously reported (11%29.4% and 13%-38.6%, respectively) [1,15]. In all, 2 (13.3%) thrombotic events occurred in 1 of the 15 patients with IMF in the present study. A retrospective study reported that 11 of 26 patients with IMF had arterial or venous thrombosis [13,14,16].

Cervantes et al. reported that 31 (20%) thrombotic events occurred in 18 of 155 IMF patients [2]. Barbui

309

et al. assessed the frequency of major cardiovascular events in 707 patients with IMF; fatal and nonfatal thrombosis occurred in 51 (7.2%) of the patients [3], although among the IMF patients in the present study the rate was (6.6%) slightly lower. It was reported that arterial events are very common at the time of diagnosis in PV and ET patients, but we observed similar frequencies of arterial and venous events in ET (8% and 10.2%) and PV (8.3% and 6.2%) patients [17-20].

In the present study the frequency of FVL mutation was 12.5%, which is (7.4%-10.8) slightly higher than previously reported [6,7,10]. The frequency of PT mutation was 4.4% in the present study-2-fold greater than in the general population [5,8,9]. While the frequency of these mutations in the present study was higher than previously reported, a relationship between thrombosis, and these mutations in patients with ET, PV, and IMF was not observed. A large retrospective study reported that the frequency of FVL mutation in PV and ET patients was similar to that in the general population and that the mutation was strongly associated with venous thrombotic events prior to and at the time of diagnosis and relapse [11]. Another study reported that there was an increase in the risk of thromboembolic events in patients with ET and PV due to PT mutation [21]. In contrast, some studies reported that there wasnâ&#x20AC;&#x2122;t a significant association between thrombosis and hereditary thrombophilic factors in CMPD patients [12,13]. Although leukocytosis is a risk factor for thrombosis in patients with PV and ET [19,20,22,23], the role of hereditary thrombophilic factors for etiology of thrombosis in those disorders remains unclear.

All patients in the present study with hepatic vein thrombosis had FVL mutation carriership, of which 1 also had PT mutation; however, none of patients with portal vein thrombosis had a thrombophilic mutation. FVL and PT mutations were observed in

Table 3. Frequency of Thrombotic Events and Gene Mutations

Factor V Prothrombin

Leiden 20210A

Total thrombotic events

Venous thrombotic events

Arterial thrombotic events

CMPD Patients (n=160)

20 (12.5%)

7 (4.4%)

27 (16.9%)

15 (9.4%)

12 (7.5%)

ET (n=88)

13 (14.7%)

3 (3.4%)

16 (18.2%)

9 (10.2%)

7 (7.9%)

PV (n=48)

4 (8.3%)

3 (6.25%)

7 (14.5%)

3 (6.25%)

4 (8.3%)

IMF (n=15)

2 (13.3%)

1 (6.6%)

2 (13.3%)

2 (13.3%)

0 (0%)

Unclassified CMPD (n=9)

1 (11.1%)

0 (0%)

2 (22.2%)

1 (11.1%)

1 (11.1%)

TJH-ARALIK-2011-4-crossref.indd 61

02.12.2011 10:14

310

Soyer et al.

Thrombosis in CMPD

25.6%-26.4% and 0%-4.7% of patients with Budd Chiari syndrome, and in 6.06%-7.6% and 0%-3.2% of patients with portal vein thrombosis, respectively [24,25]. Furthermore, the prevalence of a latent CMPD in patients with hepatic or portal vein thrombosis was estimated to range between 40% and 60% [26,27].

In conclusion, even though there wasn’t a relationship between thrombosis, and FVL or PT mutation in the present study’s patients with ET, PV, and PMF, 3 CMPD patients with hepatic vein thrombosis had FVL mutation. Additional large-scale studies are needed to more clearly determine if all CMPD patients with hepatic vein thrombosis should be investigated for FVL and PT mutation.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

4.

5.

6.

7.

8.

9.

Elliott MA, Tefferi A. Thrombosis and haemorrhage in polycythaemia vera and essential thrombocythaemia.

Br J Haematol 2005;128:275-90. [CrossRef] Cervantes F, Alvarez-Larrán A, Arellano-Rodrigo E, Granell M, Domingo A, Montserrat E. Frequency and risk factors for thrombosis in idiopathic myelofibrosis: analysis in a series of 155 patients from a single institution. Leukemia 2006;20:55-60. [CrossRef] Barbui T, Carobbio A, Cervantes F, Vannucchi AM, Guglielmelli P, Antonioli E, Alvarez-Larrán A, Rambaldi A, Finazzi G, Barosi G. Thrombosis in primary myelofibrosis: incidence and risk factors. Blood 2010;115:778-82.

[CrossRef] Bauduer F, Lacombe D. Factor V Leiden, prothrombin 20210A, methylenetetrahydrofolate reductase 677T, and population genetics. Mol Genet Metab 2005;86:91-9.

[CrossRef] Vicente V, González-Conejero R, Rivera J, Corral J. The prothrombin gene variant 20210A in venous and arterial thromboembolism. Haematologica 1999;84:356-62.

Gurgey A, Mesci L, Renda Y, Olcay L, Kocak N, Erdem G. Factor V Q 506 mutation in children with thrombosis. Am J Hematol 1996;53:37-9. [CrossRef] Akar N, Akar E, Dalgin G, Sözüöz A, Omürlü K, Cin S. Frequency of Factor V (1691 G --> A) mutation in Turkish population. Thromb Haemost 1997;78:1527-8.

Akar N, Misirlioglu M, Akar E, Avcu F, Yalçin A, Sözüöz A. Prothrombin gene 20210 G-A mutation in the Turkish population. Am J Hematol 1998;58:249. [CrossRef] Gürgey A, Hicsönmez G, Parlak H, Balta G, Celiker A.

TJH-ARALIK-2011-4-crossref.indd 62

Turk J Hematol 2011; 28: 306-11

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

Prothrombin gene 20210 G-A mutation in Turkish patients with thrombosis. Am J Hematol 1998;59:79-80.

Akar N. Factor V 1691 G-A mutation distribution in a healthy Turkish population. Turk J Hematol 2009;26:9-11.

Ruggeri M, Gisslinger H, Tosetto A, Rintelen C, Mannhalter C, Pabinger I, Heis N, Castaman G, Missiaglia E, Lechner K, Rodeghiero F. Factor V Leiden mutation carriership and venous thromboembolism in polycythemia vera and essential thrombocythemia.

Am J Hematol 2002;71:1-6. [CrossRef] Afshar-Kharghan V, López JA, Gray LA, Padilla A, Borthakur G, Roberts SC, Pruthi RK, Tefferi A. Hemostatic gene polymorphisms and the prevalence of thrombotic complications in polycythemia vera and essential thrombocythemia. Blood Coagul Fibrinolysis 2004;15:21-4. [CrossRef] Amitrano L, Guardascione MA, Ames PR, Margaglione M, Antinolfi I, Iannaccone L, Annunziata M, Ferrara F, Brancaccio V, Balzano A. Thrombophilic genotypes, natural anticoagulants, and plasma homocysteine in myeloproliferative disorders: relationship with splanchnic vein thrombosis and arterial disease. Am J Hematol 2003;72:75-81. [CrossRef] Murphy S. Diagnostic criteria and prognosis in polycythemia vera and essential thrombocythemia. Semin Hematol 1999;36:9-13.

Landolfi R, Di Gennaro L, Falanga A. Thrombosis in myeloproliferative disorders: pathogenetic facts and speculation. Leukemia 2008;22:2020-8. [CrossRef] Marchioli R, Finazzi G, Landolfi R, Kutti J, Gisslinger H, Patrono C, Marilus R, Villegas A, Tognoni G, Barbui T. Vascular and neoplastic risk in a large cohort of patients with polycythemia vera. J Clin Oncol 2005;23:2224-32. [CrossRef] Gangat N, Strand J, Li CY, Wu W, Pardanani A, Tefferi A. Leucocytosis in polycythaemia vera predicts both inferior survival and leukaemic transformation. Br J Haematol 2007;138:354-8. [CrossRef] Campbell PJ, Scott LM, Buck G, Wheatley K, East CL, Marsden JT, Duffy A, Boyd EM, Bench AJ, Scott MA, Vassiliou GS, Milligan DW, Smith SR, Erber WN, Bareford D, Wilkins BS, Reilly JT, Harrison CN, Green AR; United Kingdom Myeloproliferative Disorders Study Group; Medical Research Council Adult Leukaemia Working Party; Australasian Leukaemia and Lymphoma Group. Definition of subtypes of essential thrombocythaemia and relation to polycythaemia vera based on JAK2 V617F mutation status: a prospective study. Lancet 2005; 366:1945-53. [CrossRef] Carobbio A, Finazzi G, Guerini V, Spinelli O, Delaini F, Marchioli R, Borrelli G, Rambaldi A, Barbui T. Leukocytosis is a risk factor for thrombosis in essential thrombocythemia: interaction with treatment, standard risk factors and Jak2 mutation status. Blood 2007;109:2310-3. [CrossRef] Landolfi R, Di Gennaro L, Barbui T, De Stefano V, Finazzi G, Marfisi R, Tognoni G, Marchioli R; European Collaboration on Low-Dose Aspirin in Polycythemia Vera (ECLAP). Leukocytosis as a major thrombotic risk

02.12.2011 10:14

Turk J Hematol 2011; 28: 306-11

21.

22.

23.

24.

factor in patients with polycythemia vera. Blood 2007;109:2446-52. [CrossRef] Gisslinger H, MĂźllner M, Pabinger I, Heis-Vahidi-Fard N, Gisslinger B, Brichta A, Bachleitner-Hofmann T, Mannhalter C. Mutation of the prothrombin gene and thrombotic events in patients with polycythemia vera or essential thrombocythemia: a cohort study.

Haematologica 2005;90:408-10.

Carobbio A, Antonioli E, Guglielmelli P, Vannucchi AM, Delaini F, Guerini V, Finazzi G, Rambaldi A, Barbui T. Leukocytosis and risk stratification assessment in essential thrombocythemia. J Clin Oncol 2008;26:2732-6.

[CrossRef] Wolanskyj AP, Schwager SM, McClure RF, Larson DR, Tefferi A. Essential thrombocythemia beyond the first decade: life expectancy, long-term complication rates, and prognostic factors. Mayo Clin Proc 2006;81:159-66.

[CrossRef] Mohanty D, Shetty S, Ghosh K, Pawar A, Abraham P. Hereditary thrombophilia as a cause of Budd-Chiari

TJH-ARALIK-2011-4-crossref.indd 63

Soyer et al.

Thrombosis in CMPD

311

syndrome: a study from Western India. Hepatology 2001;34:666-70. [CrossRef] 25. Janssen HL, Meinardi JR, Vleggaar FP, van Uum SH, Haagsma EB, van Der Meer FJ, van Hattum J, Chamuleau RA, Adang RP, Vandenbroucke JP, van Hoek B, Rosendaal FR. Factor V Leiden mutation, prothrombin gene mutation and deficiencies in coagulation inhibitors associated with Budd-Chiari syndrome and portal vein thrombosis: results of a case-control study. Blood 2000;96:2364-8.

26. Chait Y, Condat B, Cazals-Hatem D, Rufat P, Atmani S, Chaoui D, Guilmin F, Kiladjian JJ, Plessier A, Denninger MH, Casadevall N, Valla D, Brière JB. Relevance of the criteria commonly used to diagnose myeloproliferative disorder in patients with splanchnic thrombosis. Br J Haematol 2005;129:553-60. [CrossRef] 27. Briere JB. Budd-Chiari Sindrome and Portal Vein Thrombosis associated with myeloproliferative disorders: diagnosis and management. Semin Thromb Haemost 2006;32:208-18. [CrossRef]

02.12.2011 10:14

312

Case Report

Plasmacytoid dendritic cell tumor: A case report Plasmasitoid dendritik hücreli tumor: Bir olgu sunumu Füruzan Kacar Döger1, Emel Dikicioğlu Çetin1, Mine Hekimgil2, Meltem Özdoğan Uslu3, Gürhan Kadıköylü4, Nazan Özsan2, Ekin Şavk3, Zahit Bolaman4 1Department

of Pathology, Faculty of Medicine, Adnan Menderes University, Aydın, Turkey of Pathology, Faculty of Medicine, Ege University, İzmir, Turkey 3Department of Dermatology, Faculty of Medicine, Adnan Menderes University, Aydın, Turkey 4Deptartment of Hematology, Faculty of Medicine, Adnan Menderes University, Aydın, Turkey 2Department

Abstract A 62-year-old man presented with a painless eruption on his arms and trunk. Physical examination showed 2 well-demarcated erythematous plaques on the anterior trunk and 6 purple-red papules on the back and upper extremities. Blood chemistry and computed tomography results were normal.

Herein we describe a patient with plasmacytoid dendritic cell neoplasm in the absence of systemic symptoms. (Turk J Hematol 2011; 28: 312-6) Key words: Cutaneous lymphoma, NK-cell lymphoma, hematodermic lymphoma, plasmacytoid dendritic cell neoplasm Received: May 13, 2009

Accepted: April 30, 2010

Özet Altmış iki yaşında erkek hasta gövdesinde ve kollarındaki ağrısız erupsiyon şikayetleri ile başvurdu.

Fizik muyane de gövdesinin ön kısmında iyi sınırlı eritamatous plak, üst ekstremite ve sırtında mor kırmızı papuller saptandı. Kan biyokimyası ve tomografisi olağandı. Burada, sistemik bulgusu olmayan plasmasitoid dendritik hücreli neoplasmı olan bir hastayı sunduk (Turk J Hematol 2011; 28: 312-6) Anahtar kelimeler: Kutanöz lenfoma, NK hücreli lenfoma, hematodermik lenfoma, plasmasitoid dendritik hücreli neoplazi Geliş tarihi: 13 Mayıs 2009

Kabul tarihi: 30 Nisan 2010

Address for Correspondence: Assoc. Prof. Füruzan Kacar Döger, Department of Pathology, Faculty of Medicine, Adnan Menderes University, 00910 Aydın, Turkey Phone: +90 532 795 80 66 E-mail: fdoger@adu.edu.tr doi:10.5152/tjh.2011.87

TJH-ARALIK-2011-4-crossref.indd 64

02.12.2011 10:14

Döger et al.

Plasmacytoid dendritic cell tumor

Turk J Hematol 2011; 28: 312-6

Introduction According to the WHO 2008 classification of lymphoid malignancies, plasmacytoid dendritic cell tumor-a rare non-Hodgkin’s lymphoma (NHL)-was formerly defined as blastic NK-cell lymphoma in the WHO 2001 classification and as CD4+/CD56+ hematodermic neoplasm in the European Organization of Research and Treatment of Cancer 2005 classification of cutaneous lymphoma [1-10]. Plasmacytoid dendritic cell tumors generally occur in middle-aged and elderly men; the skin is usually the first site of presentation in 90% of patients [1,4]. Additionally, there is a high incidence of lymph node and bone marrow involvement [1,9,11,12]. The tumor is characterized by a monotonous infiltrate of mediumsized cells with fine chromatin, resembling a lymphoblast. The overlying epidermis is not affected and there is a well-preserved grenz zone. Prognosis is poor and overall survival is <2 years [11-14].

Case Report A 62-year-old male presented to Adnan Menderes University Hospital, Department of Dermatology with painless eruptions on his arms and trunk that began 5 months earlier (Figure 1). Physical examination showed 2 well-demarcated erythematous plaques (4×10 cm and 4×5 cm) on the anterior

a

313

trunk of the body, and 6 purple-red papules (0.3-0.5cm) on the back and upper extremities. Palpation of the liver and spleen was normal. The right axillary lymph node measured 4×3 cm. Written informed consent was obtained from the patient.

The patient’s hematological parameters were as follows: Hb: 13.1 g/dL; Hct: 40%; RBC count: 4.45×106 mm3; WBC count: 9.9×103 mm3; Plt count: 289×103 mm3. The erythrocyte sedimentation rate and C-reactive protein were 48 mm/h and 11 mg/L (normal range: 0-6 mg/L), respectively. Peripheral blood smear, biochemical parameters, and bone marrow aspiration and biopsy were normal. Computed tomography of the cervix, thorax, abdomen, pelvis, and nasal cavity were normal, with the exception of the right axillary lymph node.

A punch biopsy was performed for definitive diagnosis. Histopathological examination of the biopsy specimen showed tumor infiltration in the dermis. The infiltrate was monotonous, involving the dermis and sometimes the subcutaneous tissue, and was composed of atypical medium-sized mononuclear cells with finely dispersed chromatin.

The tumor consisted of medium-large blastoid-like cells. The epidermis was intact with a grenz zone (Figure 2). There are many mitotic figures. On the other hand, signs associated with a poor prognosis, such as necrosis and/or angioinvasion, were not observed; nor were inflammatory cells.

b

Figure 1a-b. Erythematous Nodules on the Patient’s Chest (a) and Multiple Papules and Nodules on His Back and Arms (b) at Presentation

TJH-ARALIK-2011-4-crossref.indd 65

02.12.2011 10:14

314

Döger et al.

Plasmacytoid dendritic cell tumor

Turk J Hematol 2011; 28: 312-6

Discussion

The tumor cells stained positive for CD56 (Figure 3), CD4, and CD123, but did not stain with myeloperoxidase (MPO), TdT, CD34, CD20, CD3, CD5, CD 79, CD30, Cyclin D1, chromogranin, S100, or EBER. On the basis of the histopathologic findings, the patient was diagnosed as plasmacytoid dendritic cell neoplasm. The patient was stage IA-E, based on the Ann-Arbor staging system. CHOP (cyclophosphamide, adriamycin, vincristine, and prednisone) combination chemotherapy was administered as four 21-d courses [14]. After the first chemotherapy course the skin lesions regressed and lymphadenopathy disappeared (Figure 4a and b). During 2 years of follow-up skin lesions and bone marrow involvement did not recur.

Plasmacytoid dendritic cell tumors typical present with widespread purplish dermal nodules or tumors.

These lesions are usually located on the trunk; however, the extremities, head, and neck can be involved.

Most patients also have extracutaneous manifestations at presentation [1,4,5,10]. Plasmacytoid dendritic cell tumors were formerly categorized as blastic NK-cell lymphoma because of CD56 expression [1-3,6,7,11,13]. Moreover, CD4 expression is positive, but CD2, CD3, and CD7 expression is usually negative. While CD68 is negative or slightly positive, TdT and CD34 may be positive in some cases, but evidence of T-cell receptor (TCR) gene rearrangement

Figure 2. Intact Epidermis with A Grenz Zone (H&E, 200×)

Figure 3. Tumor Cells with Strong Positive CD56 Staining (CD56, 200×)

a

b

Figure 4 a-b. Regression of the Patient’s Lesions Following Chemotherapy

TJH-ARALIK-2011-4-crossref.indd 66

02.12.2011 10:14

DĂśger et al.

Plasmacytoid dendritic cell tumor

Turk J Hematol 2011; 28: 312-6

is absent [4,13]. While there is no tumor formation in the nasal cavity, skin tumors accompanied by enlargement of lymph nodes are frequently observed.

No correlation with the Epstein-Barr virus has been reported.

Between 1994 and 2007 there were 121 reported cases of plasmacytoid dendritic cell neoplasm).

The presented patient had painless cutaneous eruptions and lymphadenopathy. Skin biopsy of these lesions showed neoplastic infiltration of the dermis with a grenz zone. Additionally, there was a high mitotic rate. Neoplastic cells were atypical and had a blastic appearance. Histologically, the lymphomas showed no significant epidermotropism. Immunohistochemical staining was very typical for plasmacytoid dendritic cell neoplasm.

Although the blastic cytological appearance and CD56 expression initially suggested that NK-cells were the origin of this type of lymphoma, more recent studies reported that the cells express CD123 and TCL1, suggesting a plasmacytoid dendritic cell origin [2,6,7,9-11].

Currently, although no characteristic cutaneous manifestations are known and no consensus on the treatment of plasmacytoid dendritic cell tumors exists, aggressive chemotherapy regimens are recommended. Anthracycline-based chemotherapies, such as the CHOP and hyper-CVAD regimens, may be effective, whereas high-dose chemotherapy and autologous stem cell transplantation may be appropriate in some selected cases [3,5,8-11,13]. The presented patient received the CHOP chemotherapy regimen, and after the first course the patientâ&#x20AC;&#x2122;s skin lesions regressed and lymphadenopathy disappeared. During 2 years of follow- skin lesions and bone marrow involvement did not recur.

In conclusion, plasmacytoid dendritic cell tumors are a rare form of cutaneous malignant lymphoma.

This neoplasm has an aggressive course and rapid development of disseminated disease in the majority of patients. Definitive pathological diagnosis is essential for proper treatment and a good prognosis. Future research should focus on the characterization of this lymphoma and the establishment of effective treatment modalities.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, rela-

TJH-ARALIK-2011-4-crossref.indd 67

315

tionships, and/or affiliations relevant to the subject matter or materials included.

References 1.

Chan JKC, Jaffe ES, Ralfikiaer E. Blastic NK-cell lymphoma. In: Jaffe ES, Harris N, Stein H, et al, editors. Pathology and genetics of tumors of hematopoietic and lymphoid tissues. Lyon, France: IARC Press 2001;214-5.

2. Slater N. The new World Health Organization-European Organization for Research and Treatment of Cancer classification for cutaneous lymphomas: a practical marriage of two giants. Br J Dermatol 2005;153:874-80.

[CrossRef] 3. Leitenberger JJ, Berthelot CN, Polder KD, Pro B, McLaughlin P, Jones D, Duvic M. J CD4+ CD56+ hematodermic/plasmacytoid dendritic cell tumor with response to pralatrexate. J Am Acad Dermatol 2008;58:480-4. [CrossRef] 4. Akasaka E, Mabuchi T, Umezawa Y, Iwashita K, Ohta Y, Matsuyama T, Ozawa A. A case of blastic NK-cell lymphoma. Int J Dermatol 2007;46:722-6. [CrossRef] 5. Bayerl MG, Rakozy CK, Mohamed AN, Vo TD, Long M, Eilender D, Palutke M. Blastic natural killer cell lymphoma/leukemia: a report of seven cases. Am J Clin Pathol 2002;117:41-50.

6. Herling M, Jones D. CD4+ CD56+ hematodermic tumor: the features of an evolving entity and its relationship to dendritic cells. Am J Clin Pathol 2007;127:687-700. [CrossRef] 7. Garnache-Ottou F, Feuillard J, Sass P. Plasmacytoid dendritic cell leukemia/lymphoma: towards a well defined entity? Br J Haematol 2007;136:539-48. [CrossRef] 8. Petrella T, Bagot M, Willemze R, Beylot-Barry M, Vergier B, Delaunay M, Meijer CJ, Courville P, Joly P, Grange F, De Muret A, Machet L, Dompmartin A, Bosq J, Durlach A, Bernard P, Dalac S, Dechelotte P, D'Incan M, Wechsler J, Teitell MA. Blastic NK-cell lymphomas (agranular CD4+CD56+ hematodermic neoplasms): a review. Am J Clin Pathol 2005;123:662-75. [CrossRef] 9. Khoury JD, Medeiros LJ, Manning JT, Sulak LE, BuesoRamos C, Jones D. CD56(+) TdT(+) blastic natural killer cell tumor of the skin: a primitive systemic malignancy related to myelomonocytic leukemia. Cancer 2002;94:2401-8. [CrossRef] 10. Ng AP, Lade S, Rutherford T, McCormack C, Prince HM, Westerman DA. Primary cutaneous CD4+/CD56+ hematodermic neoplasm (blastic NK-cell lymphoma): a report of five cases. Hametologica 2006;91:143-4.

11. Niakosari F, Sur M. Agranular CD4+/CD56+ hematodermic neoplasm: a distinct entity described in the recent World Health Organization-European Organization for Research and Treatment of Cancer classification for cutaneous lymphomas. Arch Pathol Lab Med 2007;131:149-51.

12. Suzuki R, Nakamura S, Suzumiya J, Ichimura K, Ichikawa M, Ogata K, Kura Y, Aikawa K, Teshima H,

02.12.2011 10:14

316

Dรถger et al.

Plasmacytoid dendritic cell tumor

Sako M, Kojima H, Nishio M, Yoshino T, Sugimori H, Kawa K, Oshimi K; NK-cell Tumor Study Group. Blastic natural killer cell lymphoma/leukemia (CD56-positive blastic tumor): prognostication and categorization according to anatomic sites of involvement. Cancer 2005;1:1022-31. [CrossRef] 13. Ascani S, Massone C, Ferrara G, Rongioletti F, Papini M, Pileri S, Cerroni L. CD4- negative variant of CD4+/CD56+

TJH-ARALIK-2011-4-crossref.indd 68

Turk J Hematol 2011; 28: 312-6

hematodermic neoplasm; description of three cases.

J Cutan Pathol 2008;35:911-5. [CrossRef] 14. Yamada O, Ichikawa M, Okamoto T, Park C, Motoji T, Mizoguchi H, Shibuya A. Killer T-cell induction in patients with blastic natural killer cell lymphoma/leukaemia: implications for successful treatment and possible therapeutic strategies. Br J Haematol 2001;113:153-60.

[CrossRef]

02.12.2011 10:14

Case Report

317

Involuntary movement in infants during vitamin B12 treatment Süt çocuklarında vitamin B12 tedavisi sırasında gelişen istemsiz hareketler Ayşe Tosun1, Yusuf Ziya Aral2, Emre Çeçen3, Ayvaz Aydoğdu4, Bilin Çetinkaya Çakmak4 1Department

of Pediatric Neurology, Faculty of Medicine, Adnan Menderes University, Aydın, Turkey of Pediatric Hematology, Faculty of Medicine, Adnan Menderes University, Aydın, Turkey 3Department of Pediatric Oncology, Faculty of Medicine, Adnan Menderes University, Aydın, Turkey 4Department of Pediatrics, Faculty of Medicine, Adnan Menderes University, Aydın, Turkey 2Department

Abstract Megaloblastic anemia is rare in infants and is generally due to vitamin B12 (cobalamin) deficiency in the mother. Neurologic symptoms of vitamin B12 deficiency include irritability, failure to thrive, hypotonia, and developmental regression/delay. Herein we present 2 infants with vitamin B12 that developed movement disorder 5 d after initiation of vitamin B12 treatment. Symptoms included tremor and myoclonus, involving in particular the face, tongue, and hands. Clinical findings in infants associated with vitamin B12 deficiency vary, and temporary involuntary movement can be observed during vitamin B12 therapy. (Turk J Hematol 2011; 28: 317-22) Key words: Involuntary movement, vitamin B12 deficiency, infant Received: June 11, 2010

Accepted: October 19, 2010

Özet Süt çocuklarında megaloblastik anemi nadirdir ve genellikle annelerdeki vitamin B12 eksikliğinin bir sonucudur. Kobalamin eksikliğinin nörolojik semptomları huzursuzluk, büyüme geriliği, hipotoni ve nörogelişimsel becerilerde gerileme/gecikmeyi içerir. Bu makalede kobalamin tedavisinin 5. gününde özellikle dil, yüz, elleri içine alan tremor ve miyoklonus gibi istemsiz hareketler gelişen, kobalamin eksikliği olan, iki süt çocuğu sunuldu. Süt çocuklarında kobalamin eksikliği farklı klinik bulgularla karşımıza gelebilir ve tedavisi sırasında geçici istemsiz hareketler görülebilir. (Turk J Hematol 2011; 28: 317-22) Anahtar kelimeler: İstemsiz hareketler, B12 vitamini eksikliği, süt çocuğu Geliş tarihi: 11 Haziran 2010

Kabul tarihi: 19 Ekim 2010

Address for Correspondence: Assoc. Prof. Ayşe Tosun, Department of Pediatric Neurology, Faculty of Medicine, Adnan Menderes University, 09100 Aydın, Turkey Phone: +90 256 444 12 56-1371 E-mail: aysetosun2000@yahoo.com doi:10.5152/tjh.2011.18

TJH-ARALIK-2011-4-crossref.indd 69

02.12.2011 10:14

318

Tosun et al.

Involuntary movement due to vitamin B12 treatment

Introduction Nutritional megaloblastic anemia is a rare disorder in infants and is generally due to vitamin B12 (cobalamin) deficiency in the mother. Vitamin B12 is an essential vitamin and must be obtained from animal-derived nutrients, such as meat, fish, eggs, milk, and meat. During pregnancy, vitamin B12 passes from the placenta to the fetus via active transport and is stored in the fetus’ liver. In infants born with a sufficient quantity of stored vitamin B12, vitamin B12 deficiency is rare; however, in developing countries vitamin B12 deficiency is common in infants born to mothers with pernicious anemia, those on a strict vegetarian diet, and those that are malnourished [1-3].

Although clinical findings show that vitamin B12 deficiency can be tolerated by adults for many years due to their endogenous reserve, in infants it may produce symptoms 2-12 months following birth due to an inadequate hepatic reserve [1-6]. Patients with vitamin B12 deficiency present with hematological, neurological, and psychiatric symptoms, which are more commonly observed in adults.

Nevertheless, severe neurological problems, in addition to anemia, may be observed in infants that are fed no animal-derived nutrients, but only breast milk [1,6].

Vitamin B12 deficiency causes fatigue, restlessness, vomiting, difficulty swallowing solid food, and delay or regression of growth and development.

Severe neurological findings, such as hypotonia, apathy, decreased eye contact, involuntary movement, seizure, lethargy, and coma, have been reported [1,3,4,7,8]. A delay in the diagnosis and treatment of vitamin B12 deficiency can lead to irreversible psychomotor retardation and neurological damage. Herein we present 2 male infants with severe vitamin B12 deficiency that presented with hematologic, neurologic, and typical cranial magnetic resonance imaging (MRI) findings, as well as involuntary movement during vitamin B12 therapy.

Case 1 A 6-month-old male that was fed only breast milk presented to our hospital with a chronic cough and dyspnea. He was born full term, weighing 3770 gram after an uncomplicated pregnancy and delivery.

TJH-ARALIK-2011-4-crossref.indd 70

Turk J Hematol 2011; 28: 317-22

He was able to control his head at age 2 months. His mother had been treated for iron deficiency anemia during the pregnancy.

The patient’s weight was in the 50th-75th percentile, and height and head circumference were in the 25th-50th percentile. At presentation he was pale and anxious, and had respiratory distress and hepatomegaly. He did not establish eye contact, lacked head control, and was not able to sit without support. Muscle strength was low and reflexes were brisk. Complete blood count results were as follows: macrocytic anemia; hemoglobin (Hb) level: 4.9 g/dL; white blood cell (WBC) count: 2800 mm3; platelet (PLT) count: 95,000 mm3; mean corpuscular volume (MCV): 102 fL; red blood cell distribution width (RDW): 21.6%. Peripheral blood smear showed anisocytosis, macrocytosis, poikilocytosis, single and double (few) sets of platelets, and hypersegmented neutrophils (few).

Routine urine analysis was normal. Serum immunoglobulin G (IgG) was 3.29 g/L (normal: 7-16 g/L), IgA was <0.24 g/L (normal: 0.7-4 g/L), and IgM was 0.405 g/L (normal: 0.4-2.3 g/L). Biochemical profile and thyroid function tests, and serum iron, ferritin, and folate levels were normal. Serum vitamin B12 was 56.51 pg/mL (normal: 197-866 pg/mL). Bone marrow examination was performed due to pancytopenia and megaloblastic changes were observed.

Cranial MRI showed atrophy in the frontoparietal cortex and interhemispheric regions, with dilatation in the ventricles (Figure 1a and b). Plasma homocysteine and methylmalonic acid levels were not determined, as they are not routinely measured in our hospital. Additionally, the patient’s mother has maintained a vegetarian diet. The mother’s serum ferritin and vitamin B12 levels were low (6 ng/mL and 150 pg/mL, respectively); proteinuria was not observed.

The patient was diagnosed as nutritional megaloblastic anemia due to inadequate intake of vitamin B12, and parenteral vitamin B12 treatment (10 µg/d for 2 days, then 100 µg/d for 2 days, followed by 1000 µg/d for 1 week) was started. Following administration of 1 unit of erythrocyte suspension for tachycardia and severe anemia. On the 5th d of treatment generalized tremors and myoclonus were observed in the patient’s hands, feet, tongue, and lips; therefore, the patient underwent electroencephalogram (EEG) examination and the results were normal.

02.12.2011 10:14

Turk J Hematol 2011; 28: 317-22

Tosun et al.

Involuntary movement due to vitamin B12 treatment

319

Figure 1. Coronal T1-Weighted Cranial MRI Shows Bilateral Atrophy in the Frontoparietal Region and Dilatation in the Ventricles

Oral piracetam therapy was initiated (40mg/kg/ day) and on the 7th d of therapy, and myoclonus and tremor disappeared. Pirasetam treatment was interrupted after 3 weeks. One month after the therapy began the patient’s anemia improved, he could control his head and sit without support, and was more interested in his environment. At 18 months of age his neurologic development, Ig levels, serum vitamin B12 level, and complete blood count were normal.

Case 2 A 13-month-old male presented to our hospital with fatigue, weakness, recurrent bronchiolitis, and megaloblastic anemia. He was born weighing 3300 g following an uneventful pregnancy. He was able to control his head at age 3 months. Upon presentation he was still primarily fed breast milk and was vomiting when fed animal-based nutrients, such as eggs, milk, and meat. Family history was unremarkable. The patient’s weight and head circumference were in the 10th-25th percentile and his height was in the 25th-50th percentile.

At presentation he was pale and anxious. Cardiac examination showed a 1/6 systolic murmur in the mesocardial area. Muscle strength and tonus were

TJH-ARALIK-2011-4-crossref.indd 71

normal, and deep tendon reflexes were normoactive. He could not sit without support. There was developmental delay, including rough motor (sitting, crawling, walking), thin motor (grasping objects), speech (no significant words), and social (apathetic, doesn’t smile, poor eye contact).

Complete blood count results were as follows: Hb level: 8.3 g/dL; WBC count: 23,500 mm3; PLT count: 146,000 mm3; MCV: 104 fL; RDW: 23.5%. Peripheral blood smear showed hypochromia, anisocytosis, and macrocytosis. Routine urinalysis was normal.

Serum vitamin B12 was low (140 pg/mL) and other biochemical profiles (thyroid function tests, and serum electrolyte, iron, ferritin, and folate levels) were normal. Serum IgM was low (0.3 g/L) (normal: 0.4-2.3 g/L) and the others immunoglobulin were normal. Plasma homocysteine and methylmalonic acid levels were not determined, as they are not routinely measured in our hospital. Cranial MRI showed atrophy in the frontoparietal region and dilatation in the ventricles (Figure 2). Although the complete blood count parameters in the mother and father were normal, their serum vitamin B12 levels were 150 and 188 pg/mL, respectively. The parents did not have proteinuria. The patient’s mother has maintained a vegetarian diet for many years.

02.12.2011 10:14

320

Tosun et al.

Involuntary movement due to vitamin B12 treatment

Figure 2. Axial T1-Weighted Cranial MRI Shows Severe Bilateral Cortical Frontoparietal Atrophy and Ventricular Dilatation

The patient was diagnosed as megaloblastic anemia due to inadequate B12 intake, and subcutaneous vitamin B12 treatment (100 µg/d for 1 week and then 100 µg/d every other day for 2 weeks, then 100 µg/d twice a week for 1 week, followed by 100 µg once a week for 4 weeks) was started. On the 5th d of treatment tremors and myoclonus began in the patient’s right wrist, and in both hands, arms, and legs. His EEG was normal. We thought that the involuntary movements were due to vitamin B12 therapy, and therefore added piracetam (40mg/kg/ day) to the treatment regimen. During the first week of the new treatment regimen tremors and myoclonus disappeared by gradually decreasing and ended 6th day. Pirasetam treatment was interrupted after 3 weeks. At the 6-month follow-up the patient’s neurologic examination results and serum vitamin B12 level were normal. Informed consents were obtained from the patients.

Discussion Patients with vitamin B12 deficiency usually have clinical findings related to the central nervous system, such as developmental delay, microcephaly, hypotonia, lethargy, irritability, involuntary movement, and seizures, 2-12 months after birth.

TJH-ARALIK-2011-4-crossref.indd 72

Turk J Hematol 2011; 28: 317-22

Involuntary movements, such as tremor and myoclonus, can be the first clinical symptoms of vitamin B12 deficiency or can appear several days after the start of vitamin B12 therapy. The duration of movement disorder is 10-30 d. The severity, nature, and timing of movement disorder are highly variable [1,4,7].

Jadhav et al. [9] first described nutritional vitamin B12 deficiency in 6 Indian infants aged 6-12 months that presented with megaloblastic anemia, psychomotor regression, and hyper pigmentation of the skin. Grech et al. [10] were the first to describe temporary involuntary movements in a 3-month-old patient with congenital transcobalamin deficiency on the 4th day of parenteral vitamin B12 treatment. Chandra et al. [11] reported that coarse tremors that occurred initially in the hands and feet gradually became generalized in 6 of 51 megaloblastic anemia patients treated with vitamin B12. Ozer et al. [12] reported 2 vitamin B12deficient Turkish infants that were fed only breast milk and presented with fatigue, anemia, and developmental delay. Involuntary movements of the tongue, face, hands, and legs, such as tremor and myoclonus, appeared in both patients a few days after treatment with intramuscular vitamin B12.

Their neurologic symptoms improved after initiating clonazepam treatment. Özdemir et al. [13] and Avcı et al. [14] reported involuntary movements, including tremor and irregular shaking movements, during vitamin B12 treatment. The movements disappeared following clonazepam/piracetam/biperiden hydrochloride therapy.

In accordance with the literature, the 2 presented cases were breastfed. In case 1 rough motor development regression, such as head control, and in case 2 developmental delay, such as sitting, crawling, grasping, and speaking, were observed.

Although the 2 cases received different doses of vitamin B12, on the 5th d of treatment both patients had tremors and myoclonus, and both responded to piracetam treatment within 1 week.

It is not clear how vitamin B12 deficiency causes neurological symptoms. Some studies have shown that congenital anomalies in homocysteine remethylation or an abnormality in the methionine synthetase reaction leads to neurological symptoms [3,15].

Grattan-Smith et al. [4] suggested that movement disorder in such cases is due to hyper activation of

02.12.2011 10:14

Tosun et al.

Involuntary movement due to vitamin B12 treatment

Turk J Hematol 2011; 28: 317-22

metabolic pathways that contain vitamin B12, and temporary vitamin B12 or folate metabolism imbalance. Changes in the plasma concentration of various amino acids were observed in response to vitamin B12 treatment. Although it has been proposed that hyperglycinemia is responsible for the involuntary movement observed in response to vitamin B12 treatment [7], it was also reported that glycine levels were normal [11].

It was reported that EEG results in patients with seizures due to vitamin B12 deficiency were abnormal, whereas normal EEG results were observed in patients with tremors and myoclonus [1,12,13,16]. As such, it was reported that use of antiepileptics was unnecessary and useless in patients with involuntary movements [1,10,16]. It is thought that involuntary movements is self-restricted and there is no consensus on the use of antiepileptic treatment [7,10].

Cerebral atrophy and retarded myelination based on cranial MRI have been reported in many cases of infantile vitamin B12 deficiency [1,4,5,12-14,17].

Cranial MRI in the 2 presented cases showed atrophy in the frontoparietal cortex and interhemispheric region, and dilatation in the ventricles secondary to the observed atrophy. Data concerning the longterm prognosis of neurological symptoms due to vitamin B12 deficiency are inadequate. Although hematological symptoms varying from megaloblastic anemia to pancytopenia can be cured, neurological symptoms may persist [4,16,18]. Some studies reported no improvement in verbal or psychomotor ability despite vitamin B12 treatment, which suggests that neurological impairment may be irreversible if the diagnosis is delayed beyond 12 months [18,19]. Monagle et al. [19] reported that 2 of 6 patients with vitamin B12 deficiency were followed-up for long-term neurological sequelae, and von Schenk et al. [2] reviewed 25 patients with vitamin B12 deficiency reported in the literature and observed that 6 of the patients diagnosed at a mean age of 10 months had normal development at follow-up, while 6 others diagnosed at a mean age of 13 months had persistent developmental delay. In a study performed in the southeastern region of Turkey, psychomotor retardation was observed in all 33 patients with nutritional vitamin B12 deficiency. Eleven patients have been followed. Whereas the repeated developmental screening test results

TJH-ARALIK-2011-4-crossref.indd 73

321

were normal in 6 patients who diagnosed <18 months, psychomotor retardation was persistent in 5 patients who diagnosed >18 months were continued the follow-up. [18]. Neurological development in a patient reported by Avci et al. [14] was near normal following vitamin B12 treatment, whereas in the 2 presented cases neurological development was normal.

C3, IgG, and IgM levels were low in mice with vitamin B12 deficiency [20]. Avci et al. [14] reported a patient with IgG and IgM deficiency that recovered following vitamin B12 treatment. Case 1, who presented due to frequently recurrent infections, had low IgG and IgA levels, and an IgM level at the lower limit of normal, whereas case 2 had low-level IgM. A clear decision could not be made whether low Ig levels are related to vitamin B12 deficiency or transient hypogammaglobulinemia of infancy. In our case, serum Ig levels normalized after vitamin B12 treatment, so within it was related with vitamin B12 deficiency.

In conclusion, children born with an insufficient vitamin B12 reserve can have vitamin B12 deficiency and such patients present with various clinical findings. Early diagnosis can prevent the occurrence of irreversible neurological damage in such patients.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

4.

Casella EB, Valente M, de Navarro JM, Kok F. Vitamin B12 deficiency in infancy as a cause of developmental regression. Brain Dev 2005;27:592-4. [CrossRef] von Schenck U, der-Gotze C, Koletzko B. Persistence of neurological damage induced by dietary vitamin B-12 deficiency in infancy. Arch Dis Child 1997;77:137-9.

[CrossRef] Dror DK, Allen LH. Effect of vitamin B12 deficiency on neurodevelopment in infants: current knowledge and possible mechanisms. Nutr Rev 2008;66:250-5.

[CrossRef] Grattan-Smith PJ, Wilcken B, Procopis PG, Wise GA. The neurological syndrome of infantile cobalamin deficiency: developmental regression and involuntary movements. Mov Disord 1997;12:39-46. [CrossRef]

02.12.2011 10:14

322 5.

6.

7.

8.

9.

10.

11.

12.

13.

Tosun et al.

Involuntary movement due to vitamin B12 treatment

Rasmussen SA, Fernhoff PM, Scanlon KS. Vitamin B12 deficiency in children and adolescents. J Pediatr 2001;1381:10-7. [CrossRef] Vry MS, Haerter K, Kastrup O, Gizewski E, Frings M, Maschke M. Vitamine-B12-deficiency causing isolated and partially reversible leukoencephalopathy. J Neurol 2005;252:980-2. [CrossRef] Emery ES, Homans AC, Colletti RB. Vitamin B12 deficiency: a cause of abnormal movements in infants.

Pediatrics 1997;99:255-6. [CrossRef] Graham SM, Arvela OM, Wise GA. Long-term neurologic consequences of nutritional vitamin B12 deficiency in infants. J Pediatr 1992;121:710-4. [CrossRef] Jadhav M, Webb JK, Vaishnava S, Baker SJ. Vitamin B12 deficiency in Indian infants. A clinical syndrome.

Lancet 1962;2:903-7. [CrossRef] Grech V, Vella C, Mercieca V. Temporary myoclonus with treatment of congenital transcobalamin 2 deficiency. Pediatr Neurol 2001;24:75-6. [CrossRef] Chandra J, Jain V, Narayan S, Sharma S, Singh V, Batra S, Dutta AK. Tremors and thrombocytosis during treatment of megaloblastic anaemia. Ann Trop Paediatr 2006;26:101-5. [CrossRef] Ozer EA, Turker M, Bakiler AR, Yaprak I, Ozturk C. Involuntary movements in infantile cobalamin deficiency appearing after treatment. Pediatr Neurol 2001;25:81-3. [CrossRef] Ozdemir O, Baytan B, Gunes AM, Okan M. Involuntary movements during vitamin B12 treatment. J Child Neurol 2010;25:227-30. [CrossRef]

TJH-ARALIK-2011-4-crossref.indd 74

Turk J Hematol 2011; 28: 317-22

14. Avci Z, Turul T, Aysun S, Ünal I. Involuntary movements and magnetic resonance imaging findings in infantile cobalamine (vitamin B12) deficiency. Pediatrics.

2003;112:684-6. [CrossRef] 15. Hall CA. Function of vitamin B12 in the central nervous system as revealed by congenital defects. Am J Hematol 1990;34:121-7. [CrossRef] 16. Benbir G, Uysal S, Saltik S, Zeybek Aktuglu C, Aydin A, Dervent A, Yalcinkaya C. Seizures during treatment of Vitamin B12 deficiency. Seizure 2007;16:69-73.

[CrossRef] 17. Smolka V, Bekarek V, Hlidkova E, Hlídková E, Bucil J, Mayerová D, Skopková Z, Adam T, Hrubá E, Kozich V, Buriánková L, Saligová J, Buncová M, Zeman J. Metabolic complications and neurologic manifestations of vitamin B12 deficiency in children of vegetarian mothers. Cas Lek Cesk 2001;140:732-5.

18. Katar S, Nuri OM, Yaramis A, Ecer S. Nutritional megaloblastic anemia in young Turkish children is associated with vitamin B-12 deficiency and psychomotor retardation. J Pediatr Hematol Oncol 2006;28:559-62.

[CrossRef] 19. Monagle PT, Tauro GP. Infantile megaloblastosis secondary to maternal vitamin B12 deficiency. Clin Lab Haematol 1997;19:23-5. [CrossRef] 20. Funada U, Wada M, Kawata T, Mori K, Tamai H, Isshiki T, Onoda J, Tanaka N, Tadokoro T, Maekawa A. Vitamin B-12-deficiency affects immunoglobulin production and cytokine levels in mice. Int J Vitam Nutr Res 2001;71:60-5. [CrossRef]

02.12.2011 10:14

Case Report

323

Two rare hemoglobin variants in the Çukurova Region of Turkey: Hb E-Saskatoon and Hb G-Coushatta Türkiye'nin Çukurova bölgesinde görülen iki nadir hemoglobin: Hemoglobin E-Saskatoon ve Hb G-Coushatta Ahmet Genç1, Mehmet Akif Çürük2 1Vocational

School of Health Services, Adıyaman University, Adıyaman, Turkey of Biochemistry, Faculty of Medicine, Çukurova University, Adana, Turkey

2Department

Abstract Hb E-Saskatoon and Hb G-Coushatta are rare hemoglobin variants that are not a health problem.

Herein we present a Turkish woman that was diagnosed as homozygous Hb E-Saskatoon (only the second such case reported from Turkey) and a Turkish boy diagnosed as heterozygote Hb E-Saskatoon.

Additionally, 2 Turkish sisters diagnosed as heterozygote Hb G-Coushatta are presented.

(Turk J Hematol 2011; 28: 323-6)

Key words: Hb E-Saskatoon, Hb G-Coushatta Received: July 31, 2009

Accepted: January 25, 2010

Özet Hb E-Saskatoon ve Hb G-Coushatta herhangi bir sağlık sorununa yol açmayan nadir görülen iki hemoglobin varyantıdır. Hb E-Saskatoon vakası Türkiye’de rapor edilmiş ikinci homozigot vakadır. Bu çalışmada, bir homozigot ve bir heterozigot Hb E-Saskatoon tanımlanmıştır. Başka bir olgu da iki kız kardeş heterozigot Hb G-Coushatta olduğu belirlenmiştir. (Turk J Hematol 2011; 28: 323-6) Anahtar kelimeler: Hb E-Saskatoon, Hb G-Coushatta Geliş tarihi: 31 Temmuz 2009

Kabul tarihi: 25 Ocak 2010

Address for Correspondence: Asst. Prof. Ahmet Genç, Vocational School of Health Services, Adıyaman University, 02040 Adıyaman, Turkey Phone: +90 535 597 22 92 E-mail: agenc@adiyaman.edu.tr doi:10.5152/tjh.2011.88

TJH-ARALIK-2011-4-crossref.indd 75

02.12.2011 10:14

324

Genç et al.

Hb E-Saskatoon and Hb G-Coushatta in Çukurova

Turk J Hematol 2011; 28: 323-6

Introduction

Materials and Methods

Hb E-Saskatoon [β22(B4); AAG→AAA (Glu→Lys)] has been known since 1967 when it was described in a Canadian woman of Scottish origin was found to carry the variant [1-4]. Since then, this variant has been reported in Scotland, Spain, Japan, Greece and Turkey [1-10]. This variant and Hb E (β26; Glu→Lys) has the same electrophoretic properties on both acidic and basic electrophoretic fields.

While Hb E is thalassemic abnormal hemoglobin, carrier and homozygous Hb E-Saskatoon do not cause any clinical symptoms [1-11].

Hb G-Coushatta [β22(B4); AAG→ACG (Glu→Ala)] was first identified in American Coushatta Indians; it has also been found in Thai, Korea, Algeria, Thailand, China, Japan and Turkey [9,12-14]. there were also previously reported cases of Hb G-Coushatta from different regions of Turkey. This variant was previously reported in Kastamonu from Dincol et al. and also Hb G-Coushatta has also been reported in Denizli and Muğla [9,13,15].

We reported two cases of carrier Hb E-Saskatoon one of the cases was found homozygous and the other case heterozygous for Hb E-Saskatoon. In another case, two sisters were found heterozygous for Hb G-Coushatta.

A C G T

Informed consent was obtained from each patient and blood samples, with EDTA as anticoagulant, were taken for hematological and hemoglobin analysis. Hematological data were determined in an automatic cell counter (Coulter T180). Hemoglobin variants were firstly characterized by cellulose acetate electrophoresis [16]. HPLC (Agilent 1100) was used for quantification and separation of abnormal hemoglobin, Hb A2 and Hb F. DNA was isolated from peripheral white blood cell by the method of Ponca et al. [17] ARMS was especially used for the identification of common mutations (Hb S, Hb C, Hb E and Hb D) found in Cukurova [18]. Sequence analysis was applied to the cases that could not be determined by the ARMS method [19].

Results We report one case of Turkish women that were found to homozygous Hb E-Saskatoon (Figure 1A) and one case of heterozygous for this abnormal hemoglobin who are living in Adana (Figure 1B).

Hematological parameters of simple Hb E-Saskatoon heterozygous are found within normal limits and the abnormal hemoglobin is found 36.74% of total hemoglobin (Table 1).

A C G T

A C G T

T T Var G — A A -C Glu→Ala G — T A Asp G —

T Var T G — A A Cd22 Glu→Lys A-G — T Cd21 Asp A G — Cd23

A

B

Cd23

Cd22

Cd21

C

Figure 1. Direct DNA Sequence Analysis of the β Gene Showing the Sense Strand in the Vicinity of Codon 22 A. Homozygous Hb E-Saskatoon [β22(B4); AAG→AAA (Glu→Lys)] B. Heterozygous Hb E-Saskatoon C. Heterozygous HbG-Coushatta [β22 (B4); AAG→ACG (Glu→Ala)]

TJH-ARALIK-2011-4-crossref.indd 76

02.12.2011 10:14

Genç et al.

Hb E-Saskatoon and Hb G-Coushatta in Çukurova

Turk J Hematol 2011; 28: 323-6

325

Table 1. Hematological Data of Hb E-Saskatoon and Hb G-Coushatta Name Surname

RBC (×1012/L)

Hb (g/dL)

Hct (%)

MCV (fL)

MCH (pg)

MCHC Hb† (g/dL) Hb A2

HPLC Hb F Hb X*

Genotype

A. S.

5.99

15.1

44.6

74.5

25.3

33.9

AE

2.90

1.20

36.74

AE-Saskatoon

S.A.

4.28

12.4

36.3

84.9

29.0

34.1

EE

2.65

-

81.07

EE-Saskatoon

T. B.

4.46

11.0

34.1

76.5

24.7

32.3

AS

3.32

8.99

37.72

AG-Coushatta

Z. B.

4.64

12.5

38.2

82.4

26.9

32.7

AS

3.72

0.6

40.94

AG-Coushatta

*Percent of abnormal hemoglobin, †Hemoglobin electrophoresis

Discussion Hb E is more common in Çukurova region, southern of Turkey with a frequency of 0.16-2.4% and this variant is thalassemic, microcytosis and hypochromi [5,11]. A percentage of this hemoglobin is lower than Hb E-Saskatoon. Hb E-Saskatoon was present in 3 unrelated families living Antalya, Aksaray, and Kayseri. One of the subjects was founded with a homozygote Hb E-Saskatoon [5,11].

In Hb E-Saskatoon, the glutamate residue at position 22 (B4) of the β-globin chain, situated on the external surface of the molecule is replaced by lysine [2]. This substitution results in a change of the molecular charge without affecting its stability, solubility and functional properties [2,4]. Hb E-Saskatoon does not cause any major hematological problem in homozygous or in compound heterozygous states with β-thalassemia [5,6]. The only case of homozygosity described so far showed a moderate phenotype expression. The association of Hb E-Saskatoon with β-thalassemia (β+) does not clinically present any additional risk [1,2,5,6].

The homozygous condition for Hb E-Saskatoon has previously been defined by Birben et al. in Turkey [5]. They reported that homozygous of Hb E-Saskatoon was very mild without any changes in red cell indices. Gürgey et al. indicated that compounds mild [IVSI-6 (T→C)] and severe [IVSI-110 (G→A)] β-thalassemia mutations with Hb E-Saskatoon result mild hematological pathology [5,6]. Identification of Hb E-Saskatoon is important to differentiate from thalassemic variant (Hb E), because of compound heterozygous Hb E and β-thalassemia show like β-thalassemia major.

Also, there were previously reported cases of heterozygous Hb G-Coushatta from different regions of Turkey [9-11,13,15]. Hb G-Coushatta migrates slightly anodic to Hb S in alkaline pH electrophore-

TJH-ARALIK-2011-4-crossref.indd 77

sis and it has not caused any clinical and hematological abnormalities [9,14]. In this study, we found two cases of heterozygous Hb G-Coushatta from Kayseri, who are sisters (Figure 1C). Heterozygous of this variant was found not anemic and percentage of this hemoglobin was found 37-40% of total hemoglobin when separated with HPLC (Table 1). It is important to differentiate from Hb S. Acknowledgement This project was supported by a Çukurova University research grant (TF2005YL2).

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

4.

5.

6.

Theodoridou S, Vyzantiadis TA, Theodoridis T, Tantanasis T, Karababa P, Loutradi A, Manitsa A. Hemoglobin E-Saskatoon and pregnancy: Report of two cases. J Gynaecol Res 2006;32:346-8. [CrossRef] Ropero P, Murga MJ, González FA, Polo M, Benavente C, Salvador M, Villegas A. The first case of Hb E-Saskatoon associated with Hb Lepore-Baltimore found in Spain. Hemoglobin 2005;29:215-9. [CrossRef] Theodoridou S, Plata E, Karaba P, Loutradi A, Vyzantiadis T, Manitsa A. The first case of a compound heterozygosity for Hb E-Saskatoon and Hb S. Haemotologica 2003;88:33.

Igarashi Y, Matsuzaki S, Kanou N, Inami S, Nakamura T, Kasai K, Fushitani K. The first case of Hb E-Saskatoon [alpha2 beta(2)22(B4)Glu→Lys] in a Japanese male in Asia. Hemoglobin 1995;19:403-6. [CrossRef] Birben E, Oner R, Oner C, Gümrük F, Gürgey A, Altay C. Homozygosity for Hb E-Saskatoon [beta22(B4)Glu→Lys] in a Turkish patient. Hemoglobin 2001;25:409-15.

[CrossRef] Gurgey A, Sipahioglu M, Aksoy M. Compound heterozygosity for Hb E-Saskatoon or alpha 2 beta 2(22)(B4) Glu→Lys and beta-thalassemia type IVS-I-6 (T→C).

Hemoglobin 1990;14:449-51. [CrossRef]

02.12.2011 10:14

326 7.

8.

9.

10.

11.

12.

13.

14.

Genç et al.

Hb E-Saskatoon and Hb G-Coushatta in Çukurova

Prozorova-Zamani V, Ozsoylu S, Aksoy M, Headlee MG, Lam H, Wilson JB, Altay C, Huisman TH. Hb E and Hb E-like variants in individuals from Turkey. Hemoglobin 1981;5:743-8. [CrossRef] Gonzalez Redondo JM, Sicilia A, Murga MJ, Kutlar A, Wilson JB, Huisman TH. Hb E-Saskatoon or alpha 2 beta 2(22)(B4)Glu→Lys in a Spanish Family.

Hemoglobin 1987;11:35-8. [CrossRef] Dinçol G, Dinçol K, Erdem S. Hb G-Coushatta or alpha 2 beta 222(B4)Glu→Ala in a Turkish male. Hemoglobin 1989;13:75-7. [CrossRef] Sözmen M, Uysal Z, Akar N. Hb G-Coushatta (a2B2 22(B4) GLU-ALA) in a Turkish Family. Tr J Med Science 1990;14:512.

Altay C. Anormal hemoglobins in Turkey. Turk J Hematol 2002;19:63-74.

Itchayanan D, Svasti J, Srisomsap C, Winichagoon P, Fucharoen S. Hb G-Coushatta [beta22(B4)Glu→Ala] in Thailand. Hemoglobin 1999;23:69-72. [CrossRef] Yenice S, Kemahli S, Bilenoglu O, Gul O, Akar E, Basak N, Akar N. Two rare hemoglobin variants in the Turkish population [Hb G-Coushatta (beta 22(B4)Glu→Ala and Hb J Iran (beta 77(EF1) His→Asp)]. Turk J Haematol 2000;17:27-8.

Chinchang W, Viprakasit V. Further identification of Hb

TJH-ARALIK-2011-4-crossref.indd 78

Turk J Hematol 2011; 28: 323-6

15.

16.

17.

18.

19.

G-Coushatta [beta22(B4)Glu→Ala (GAA→GCA)] in Thailand by the polymerase chain reaction-singlestrand conformation polymorphism technique and by amplification refractory mutation system-polymerase chain reaction. Hemoglobin 2007;31:93-9. [CrossRef] Atalay EO, Koyuncu H, Turgut B, Atalay A, Yildiz S, Bahadir A, Köseler A. High incidence of Hb D-Los Angeles [beta121(GH4)Glu→Gln] in Denizli Province, Aegean region of Turkey. Hemoglobin 2005;29:307-10.

[CrossRef] Huisman TH, Jonxis JHP. The hemoglobinopathies, techniques of identification. New York: Marcel Dekker Inc 1977.

Poncz M, Solowiejczyk D, Harpel B, Mory Y, Schwartz E, Surrey S. Construction of human gene libraries from small amounts of peripheral blood. Analysis of betalike globin genes. Hemoglobin 1982;6:27-36. [CrossRef] Newton CR, Graham A, Heptinstall LE, Powell SJ, Summers C, Kalsheker N, Smith JC, Markham AF. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res 1989;17:2503-16. [CrossRef] Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain terminating inhibitors. Proc Natl Acad Sci USA 1977;74:5463-7. [CrossRef]

02.12.2011 10:14

Case Report

327

Malignant lymphoma associated with Behçet’s disease: A report of 2 cases Aynı hastada Behçet hastalığı ve malign lenfoma birlikteliği: İki olgu sunumu

Ahmet Deniz Meydan1, Bilge Gürsel1, Nilgün Özbek1, Bilge Can2, Bedri Kandemir2 1Department 2Department

of Radiation Oncology, Faculty of Medicine, Ondokuz Mayıs University, Samsun, Turkey of Pathology, Faculty of Medicine, Ondokuz Mayıs University, Samsun, Turkey

Abstract Herein we report 2 cases of malignant lymphoma associated with Behçet’s disease. Case 1, a 53-yearold man, was diagnosed as Behçet’s disease at the age of 26 years, and was treated with cyclophosphamide and prednisolone. At 45 years of age, bilateral enlarged lymph nodes were observed in the patient’s neck. Evaluation of a lymph node biopsy specimen showed Hodgkin’s disease and chemotherapy was administered. Due to disease recurrence 7 years later, chemotherapy and radiotherapy were administered. Case 2, a 67-year-old male, was diagnosed as Behçet’s disease at age 44 years and began colchicine treatment. At 60 years of age a mass in his left tonsillar fossa was noted.

Evaluation of a left tonsil biopsy specimen showed malignant lymphoma. Radiotherapy and chemotherapy were subsequently administered. At the time this report was written both patients were disease-free. Malignant lymphoma associated with Behçet’s disease is rare-only 17 cases have been published. In addition to the presented cases, the literature regarding malignant lymphoma associated with Behçet’s disease is reviewed. (Turk J Hematol 2011; 28: 327-34) Key words: Behçet’s disease, malignant lymphoma, radiotherapy, morbidity Received: August 25, 2010

Accepted: March 5, 2011

Özet Bu yazıda, Behçet hastalığı ile birlikte bulunan iki malign lenfoma olgusu sunulmuştur. Elli üç yaşındaki ilk olguya 26 yaşında Behçet hastalığı tanısı konmuş ve üç yıl siklofosfamid ve prednizolon ile tedavi edilmiştir. Kırk beş yaşında boyunda lenf nodları tespit edilmiştir. Lenf nodu biyopsisi sonucu Hodgkin hastalığı tanısı konmuş ve kemoterapi uygulanmıştır. Yedi yıl sonra hastalık relapsı nedeniyle kemoterapi ve radyoterapi uygulanmıştır. Altmış yedi yaşındaki ikinci olguya 23 yıl önce Behçet hastalığı tanısı konmuş ve kolsişin başlanmıştır. Altmış yaşında sol tonsiller fossada kitle saptanmıştır.

Sol tonsilden alınan biyopsi sonucu malign lenfoma tanısı konmuş, radyoterapi ve kemoterapi uygulanmıştır. Her iki hasta da lenfoma açısından hastalıksız izlenmektedir. Aynı hastada bu iki farklı Address for Correspondence: Assist. Prof. Ahmet Deniz Meydan, Department of Radiation Oncology, Faculty of Medicine, Ondokuz Mayıs University, 55139 Samsun, Turkey Phone: +90 362 312 19 19/2232 E-mail: admeydan@omu.edu.tr doi:10.5152/tjh.2011.90

TJH-ARALIK-2011-4-crossref.indd 79

02.12.2011 10:14

328

Meydan et al.

Malignant lymphoma and Behçet’s disease

Turk J Hematol 2011; 28: 327-34

hastalığın birlikteliği nadirdir. Literatürde bu birliktelik sedece 17 olguda bildirilmiştir. Sunulan olgular bazında, Behçet hastalığı ve malign lenfomanın olası ilişkisi konusunda literatür gözden geçirilmiştir. (Turk J Hematol 2011; 28: 327-34) Anahtar kelimeler: Behçet hastalığı, malign lenfoma, radyoterapi, morbidite Geliş tarihi: 25 Ağustos 2010

Kabul tarihi: 05 Mart 2011

Introduction Behçet’s disease (BD) was first described by Dr. Hulusi Behçet in 1937 as a triad of recurrent aphthous ulceration of oral and genital mucosa, and relapsing hypopyon uveitis [1]. It is now recognized as a multisystem inflammatory disorder characterized by vasculitis [2]. Although the exact etiology of BD is unknown, some genetic, immunologic, and infectious factors are suspected in the pathogenesis [3]. The treatment of BD is empirical and usually includes systemic corticosteroids, and immunosuppressive and/or cytotoxic agents [4].

The literature contains few reports of the coexistence of malignant disease in BD patients-to date only 96 cases (excluding myelodysplastic syndromes) have been reported, of which 17 are lymphoid malignancy [5-19]. Malignant transformation in BD might be due to the autoimmune nature of BD, triggering infectious agents, or the drugs used for the management of BD.

Case Reports Case 1 A 53-year-old male patient was diagnosed as uveitis in 1979 (at the age of 26 years), due to hazy vision and impaired visual acuity; periorbital steroid injections were subsequently administered. Six months following the diagnosis of uveitis, recurrent oral and genital aphthous ulcers, and papulopustular skin lesions on the nape of the neck, back, and chest were observed; therefore, the patient was subsequently diagnosed as BD and treated with cyclophosphamide and prednisolone for 3 years.

In February 1998, bilateral enlargement of multiple lymph nodes in the neck was noted. Evaluation of the cervical lymph node biopsy specimen showed nodular lymphocyte-predominant Hodgkin’s disease (HD) (Figure 1). Computed tomography (CT) of the thorax and abdomen were normal, and bone

TJH-ARALIK-2011-4-crossref.indd 80

marrow aspiration was negative. Based on the diagnosis of stage II-B HD, vincristine, epirubicine, etoposide, and prednisolone (VEEP) combination chemotherapy was administered by the medical oncology department.

During the course of chemotherapy both the number and frequency of oral lesions increased.

Following 8 courses of chemotherapy the patient achieved complete remission and was followed-up.

In August 2005 the patient was restaged due to the observation of enlarged lymph nodes in the right axilla. Thoracic CT showed multiple enlarged lymph nodes in the right axilla and left supraclavicular fossa. Abdominopelvic CT was considered normal.

Four courses of doxorubicin, bleomycin, vinblastin, and dacarbazine (ABVD) combination chemotherapy were administered, and complete remission was achieved.

The patient presented to our department for the first time in December 2005 for consolidative radiotherapy (RT). The lower neck, bilateral infrasupraclavicular fossa, bilateral axilla, and upper mediastinum were irradiated with cobalt 60 photons using a Theratron 780 C cobalt linear accelerator (Best Theratronics LTD., Ontario, Canada). A total dose of 30.6 Gy was delivered in fractions of 1.8 Gy/d. During and after the RT no early toxicity associated with RT was observed, except for grade 1 hyperemia of the skin and dysphagia. Interestingly, the patient complained of a burning sensation at the irradiated region a few weeks after the completion of RT, but physical examination was unremarkable. One week later the burning sensation spontaneously abated. At the time this report was written the patient had been followed-up diseasefree for 4 years post RT and late toxicity associated with RT was not observed. The patient has complete vision loss in the right eye and stable partial vision loss in the left eye associated with BD. Oral and genital ulcers erupt every 2-3 weeks, and disappear 2-3 d later.

02.12.2011 10:14

Turk J Hematol 2011; 28: 327-34

Case 2 A 67-year-old male patient was first diagnosed as BD at age 44 years due to uveitis in the right eye, oral aphthous ulcers, scrotal ulcers, and pseudo follicular skin lesions that erupted once a week. As such, the patient was treated with colchicine. In February 2002 the patient complained of swelling on the left side of his neck and difficulty swallowing. CT of the head and neck showed a mass lesion in the left tonsillar fossa and multiple enlarged lymph nodes in the left cervical region. A biopsy specimen obtained from the left tonsil was evaluated as high-grade malignant lymphoma, diffuse large B-cell-type (Figure 2). CT of the thorax and abdomen, and bone marrow aspiration were negative.

The patient presented to our department for the first time in September 2002 for RT. The Waldeyer field and bilateral neck were irradiated with cobalt 60 photons using a Theratron 780 C cobalt linear accelerator (Best Theratronics LTD., Ontario, Canada). A total dose of 45 Gy was delivered in fractions of 1.8 Gy d–1. During and after RT no early toxicity associated with RT was observed, except for grade 1 hyperemia of the skin, mucositis, and dysphagia. Following RT, 4 courses of cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP) combination chemotherapy were administered. At the time this report was written the patient had been followed-up disease-free for 7 years post RT and no late toxicity associated with RT was observed, except for grade 1 xerostomia. The patient has not used colchicine since 2003 and has complete vision loss in the right eye associated with BD. Oral and genital ulcers erupt every 2-3 d, and disappear 2-3 d later.

Discussion BD is a chronic, relapsing multisystem connective tissue disorder characterized by vasculitis in the mucocutaneous, ocular, gastrointestinal, respiratory, neurologic, urogenital, articular, and cardiovascular systems [20]. Other connective tissue disorders, including Sjögren’s syndrome, dermatomyositis, rheumatoid arthritis, and systemic lupus erythematosus, are known to be associated with malignancy [21-23], and this association has been further

TJH-ARALIK-2011-4-crossref.indd 81

Meydan et al.

Malignant lymphoma and Behçet’s disease

329

Figure 1. Microscopic Appearance of Mononuclear Hodgkin’s Cells (Arrows) Infiltrating the Paracortical Lymphoid Tissue Between the Follicular Region (H&E, 200×)

Figure 2. Microscopic Appearance of Tonsil Infiltrated By Malignant Lymphoma (H&E, 200×)

supported by recent epidemiologic research.

Nevertheless, the worldwide prevalence of BD and the possible association between malignant diseases and BD remain unclear. Only 96 cases of malignancy associated with BD have been reported; 63 cases had solid organ tumors, 16 cases had hematological malignancies, and 17 cases had lymphoid malignancies [5-19] (Table 1).

BD is one of the most common forms of vasculitis in the Turkish population; the reported prevalence varies from 80/100,000 to 370/100,000 [4].

Cengiz et al. [13] reported 400 BD patients during a 13-year period; malignancy developed in 13 (3.25%) patients, 2 (0.5%) of which had malignant lymphoma. A study that included 387 BD patients from

02.12.2011 10:14

330

Meydan et al.

Malignant lymphoma and Behçet’s disease

Turk J Hematol 2011; 28: 327-34

Table 1. Reported Cases of Malignant Lymphoma Associated with Behçet’s Disease No. Author Age Therapy

(year) (years)/sex for BD

1

Kaneko et al.

32/F (1974) [5]

Period Histology between BD and lymphoma

PSL, - indomethacin

2 Houston et al.

59/F 5 years

(1978) [6]

3 Moulongeut-Michau 31/M colchicine 13 years

et al. (1990) [7]

4

5

Kawamoto et al. 43/M PSL 1 years (1992) [9]

6

Abe et al.

43/F NSAID 15 years (1993) [10]

7

Yamamoto el al.

45/M (1997) [11]

8

Houman et al.

37/F (2001) [12]

RT

Cerebellum

HD, mixed cellularity

Liver, spleen, neck, etc.

colchicine, CPA, cyclosporin

Large B cell

10

Cengiz et al.

42/F (2001) [13]

11

Katsura et al.

49/M (2003) [14]

Skin

Diffuse large B cell

Diffuse large cell

Cengiz et al.

47/M CPA, indomethacin 7 years (2001) [13]

12 Kural-Seyahi et al. 49/M

(2003) [15]

Diffuse lymphocytic lymphoma

colchicine, 19 years betamethasone

9

Diffuse mixed cell

PSL, colchicine, 1 years Cytotoxic T cell cyclosporin Chlorambucil/ 20 years azathioprine or CPA

Neck lymph nodes Small intestine

perirenal, positive orbital, esophagus

High-grade lymphoma

Ono et al.

75/F PSL, colchicine 17 years Diffuse B cell (2005) [16]

Cerebrum, ileum

14

Chelly et al.

40/M PSL, azathioprine 2 years (2008) [17]

cutaneous

Gamma delta T cell

15

Souabni et al.

32/M (2008) [18]

colchicine, indomethacin, PSL, dapsone

14 years

Large B cell

16

Ahn et al.

39/F (2010) [19]

PSL, colchicine, cyclosporin, azathiopririne

19 months

Gastric MALToma

17

Ahn et al.

18/F (2010) [19]

PSL, colchicine, 46 months cyclosporin, azathiopririne

19

Present case

64/M

colchicine

20 years

RT, 40 Gy

Lymph nodes

13

18 Present case 53/M PSL, CPA 19 years

RT

Gastric lymphoma

HD, nodular sclerosing

colchicine, 8 years indomethacin

Radiotherapy

RT

Small lymphocytic B Cell

2.5 years

EBV

Nasal malignant lymphoma

Angiocentric lymphoma (helper T-cell)

Harada et al.

43/F colchicine 9 months (1992) [8] positive

Sites of involvement

Right tonsil

negative

positive

RT, 50 Gy

RT, 45 Gy

Stomach

Extranodal NK-T cell lymphoma HD, nodular lymphocytepredominance Diffuse large B cell

Neck, right axilla negative

Left tonsil

negative

RT, 30.6 Gy

RT, 45 Gy

BD: Behçet’s disease; HD: Hodgkin’s disease; M: male; F: female; PSL: prednisolone; NSAID: non-steroidal anti-inflammatory drug; CPA: cyclophosphamide

Turkey reported that 8 (2.06%) patients developed malignancy during 20 years of follow-up, 1 (0.51%) of which was diagnosed as malignant lymphoma [15]. Between 1992 and 2007, 440 patients with malignant lymphoma presented to our department, of which only 2 (0.45%) were previously diagnosed with BD.

TJH-ARALIK-2011-4-crossref.indd 82

Case 1 is only the third case of HD associated with BD to be reported. The previously reported cases of HD associated with BD were mixed cellularity type (n=1) and nodular sclerosing type (n=1) [9,13], whereas the histopathological subtype was nodular lymphocyte predominant in case 1. The previous mixed cellularity-type case was treated

02.12.2011 10:14

Turk J Hematol 2011; 28: 327-34

with prednisolone only, and the previous nodular sclerosing-type case was treated with cyclophosphamide and indometacin for BD, whereas case 1 was treated with prednisolone and cyclophosphamide.

Previous reports of malignant lymphoma associated with BD are mostly extranodal, whereas only 2 cases had nodal involvement [11,13]. Case 2 is considered by us to be the 16th reported case of malignant lymphoma associated with BD and only the 2nd case of tonsil involvement; the treatment for BD in this patient was colchicine.

The pathogenesis of BD remains to be discerned, although infectious, immunologic, and genetic factors have been implicated [20]. The pathophysiology of BD is considered to involve excess function of neutrophils, vascular damage associated with thrombus formation, and lymphocyte dysfunction [24]. The major immunologic features of BD are increased T-cell and B-cell response to heat-shock proteins, increased neutrophil activity, and alteration in cytokine levels [4]. Additionally, helper T-cells and macrophages are known to exhibit immunological dysfunction, as well as neutrophils [10]. Development of malignancy in autoimmune diseases and vasculitides could be related to immune regulation abnormality, T-cell deficiency, or over proliferation of B-cells, which may trigger the malignant transformation of cells [20]. Moreover, the above-mentioned immunological features of BD might be associated with the development of malignancy.

All BD cases are devoid of any documented cause of lymphoid malignancy, other than the possibility of drug-induced etiology, the immunological features of BD, or immune system stimulation via an infectious agent. Several genetic diseases, and environmental and infectious agents have been associated with the development of lymphoma [25]. The frequency of non-Hodgkin’s lymphoma is much higher in immunocompromised patients [26]. Patients with autoimmune and chronic inflammatory disorders have an increased risk for the development of non-Hodgkin’s lymphoma [27]. In non-Hodgkin’s lymphoma, as in BD, disturbances in T-cell compartment and T-cell dysfunctionincluding low autologous mixed lymphocyte reaction-have been reported [10]; therefore, between

TJH-ARALIK-2011-4-crossref.indd 83

Meydan et al.

Malignant lymphoma and Behçet’s disease

331

BD and development of lymphoma may be a relationship. Cohort studies and meta-analyses show that non-Hodgkin’s lymphoma is more common in patients with autoimmune diseases, especially those with Sjögren’s syndrome, systemic lupus erythematosus, and rheumatoid arthritis, than in the general population; however, such data are not available for BD [27,28]. Immunosuppressive agents are thought to be involved in the pathophysiology of malignancy [29]. Numerous studies have implicated the use of immunosuppressive agents, such as chlorambucil, cyclophosphamide, and colchicine, in the etiology of lymphoma transformation in BD. Previous research reports that there is a significantly elevated risk of lymphoma in association with use of non-steroidal anti-inflammatory drugs, corticosteroids, and other immunosuppressants [30].

Steroids inhibit the activation and growth of T-cells, and reduce the number of peripheral lymphocytes. Steroids also inhibit B-cell maturation at an early stage by inhibiting interaction between monocytes and T-cells [16]. The exact mechanism of the steroid function is not known, but all steroid characteristics might be related to late onset malignant lymphoma [16]. Colchicine is usually prescribed for mucocutaneous disease, arthritis, and genital ulcers [4]; this drug suppresses phagocytosis and emigration of white blood cells, and inhibits chemotactic responses of neutrophils to chemotactic cytokines [16]. Sauabni et al. [18] also attributed lymphoma transformation to the mutagenic effect of colchicine in animals. Long-term administration of colchicine in patients with BD may induce malignant lymphoma. Cyclophosphamide is usually used to treat BD patients that are unresponsive to other therapies [4]. Long-term treatment of autoimmune disease patients with alkylating agents (e.g. cyclophosphamide) might result in secondary neoplastic disease; therapy-related myelodysplasia/acute myeloid leukemias are a well-known consequence, yet therapy-related lymphomas are less well-known in patients with autoimmune disease [31]. The period between the onset of BD and malignant lymphoma varies from 9 months to 20 years, and immunosuppressive agents and steroids have not been administered in all reported cases (Table 1).

Moreover, following transplantation and treatment

02.12.2011 10:14

332

Meydan et al.

Malignant lymphoma and Behçet’s disease

of collagen disease with immunosuppressive drugs, most malignancies arise within 6 months [16].

Thus, it is difficult to discern if the effects of immunosuppressive agents used in the treatment or the underlying immune mechanism are responsible for the association between BD and malignant lymphoma.

Immune system stimulation via an infectious agent has been suggested to play a role in the pathogenesis of BD [4]. Infectious agents are also implicated in the pathogenesis of Hodgkin’s and non-Hodgkin’s lymphoma [25,32]. Epstein-Barr virus (EBV) infection is associated with neoplastic proliferation in immunosuppressed transplant recipients [33]. Of the 15 cases of malignant lymphoma associated with BD previously reported, 3 of the 4 that were tested for EBV infection were positive [8,14,18]. In the presented cases, immunohistochemical staining on paraffin tissues did not indicate the presence of EBV (anti-EBV/LMP Ab-1, ms-1458, Thermo Fisher Scientific, Pittsburgh, PA).

Moreover, EBV infection is associated, in particular, with mixed cellularity-type HD [32]; Only 1 previously reported case of HD associated with BD was mixed cellularity-type.

Another point is use of radiation for the treatment of malignancy in BD. Numerous studies report that CVD predisposes patients to increased toxicity from therapeutic irradiation [34-38]; however, considering the effects of RT in patients with BD, the literature is lacking sufficient data, as there are only a few reports on the use of radiation in BD patients. In a part of these reports, the authors had not been referred to radiation toxicity [16,18,20,39]. Lowdose total lymphoid irradiation treatment in 5 patients with intractable BD was reported; no morbidity related to irradiation occurred, presumably because of the relatively low doses used [13].

Strohal et al. [40] reported a BD patient treated with a combination of chemotherapy and 40-Gy of radiation administered to the heart, and cervical and mediastinal lymph nodes for treatment of comorbid multicentric Castleman’s disease. The researcher reported that the treatment was welltolerated, but did not discuss radiation toxicity.

Cengiz et al. [13] treated 6 BD patients with RT due to malignant disease, and reported that there wasn’t an increase in the incidence or severity of acute

TJH-ARALIK-2011-4-crossref.indd 84

Turk J Hematol 2011; 28: 327-34

radiation morbidity. In all, 3 of the 6 patients (1 with HD, 1 with a malignant mesenchymal tumor, and 1 with ureteral fibrosis) developed late radiation reactions, including brachial plexopathy and dermal necrosis. Recently, Chargari et al. [41] reported adjuvant whole-breast RT for left breast ductal carcinoma in situ in a patient with quiescent BD. At a dose of 44 Gy acute grade 3 radioepithelitis occurred, which necessitated cessation of RT. The researchers reported that the radiation-induced vascular lesions were similar to the vasculitis observed in BD. In the presented cases we did not observe an increase in the severity of acute or late reactions related to irradiation, perhaps because of the relatively low total doses administered.

Malignant lymphoma associated with BD is very rare. For the development of lymphoid malignancy in BD or, to establish an association between these 2 diseases, the roles of immunologic factors or, drugs used for the treatment or, infectious agent are not clear yet. Due to the above-mentioned disturbances or, indeterminate other factors, there may be an association between BD and malignant lymphoma, but this may also be a hazardous coincidence. Based on all available data, it is difficult to conclude that RT increases the incidence and severity of radiation reactions in BD patients; however, doses exceeding 40 Gy, especially in patients with active BD, should be administered with caution.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

Behcet H. Uber rezidivierende aphtose, durch ein virus verursachte Geschewure am Mund, am Auge und an den genitelian. Dermatol Wschr 1937;105:1152-7.

Koç Y, Güllü I, Akpek G, Akpolat T, Kansu E, Kiraz S, Batman F, Kansu T, Balkanci F, Akkaya S. Vascular involvement in Behcet’s Disease. J Rheumatol 1992;19:402-10.

Zierhut M, Mizuki N, Ohno S, Inoko H, Gül A, Onoé K, Isogai E. Immunology and functional genomics of Behçet’s disease. Cell Mol Life Sci 2003;60: 1903-22. [CrossRef]

02.12.2011 10:14

Turk J Hematol 2011; 28: 327-34

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

Al-Otaibi LM, Porter SR, Poate TWJ. Behçet’s disease: a rewiev. J Dent Res 2005;84:2009-22. [CrossRef] Kaneko H, Hojo Y, Nakajima H, Okamura A, Fukase M, Katano A. Behçet syndrome associated with nasal malignant lymphoma – report of an autopsy case. Acta Pathol Jpn 1974;24:141-50.

Houston KA, O’duffy JD, McDuffie FC. Behçet’s disease associated with a lymphoproliferative disorder, mixed cryoglobulinemia, and an immune complex mediated vasculitis. J Rheumatol 1978;5:217-23.

Moulonguet-Michau I, Blanc F, Cavalier Balloy B, Price P, Flaqeul B, Civatte J. Angiocentric lymphoma in Behçet’s disease. Ann Dermatol Venereol 1990;117: 885-7.

Harada K, Ohtsuru K, Nakayama K, Takagi S, Sugiata Y, Torigoe R. Intracranial primary malignant lymphoma following Behcet’s disease–case report. No To Shinkei 1992;44:1029-33.

Kawamoto S, Terada H, Niikura H, Kumasaka T, Saiki S. Hodgkin’s Disease associated with Behçet’s disease.

Rinsho Ketsueki 1992;33:211-5.

Abe T, Yachi A, Yabana T, Ishii Y, Tosaka M, Yoshida Y, Yonezawa K, Ono A, Ikeda N, Matsuya M, Hayashi T, Tokunoh T, Yawata A, Sasaki S, Aoki S, Sugiyama T. Gastric non-Hodgkin’s lymphoma associated with Behçet’s disease. Am Intern Med 1993;32:663-7.

[CrossRef] Yamamoto T, Tamura M, Hamauzu T, Nakayama A, Kawasugi K, Kamakura M, Kinoshita T, Kuyama Y, Yamanaka M, Wang LM, Sanaka M, Mineshita S. Intestinal Behçet’s disease associated with non-Hogkin’s lymphoma. J Gastroenterol 1997;32:241-5.

[CrossRef] Houman MH, Ben Ghorbel I, B’Chir-Hamzaoui S, Lamloum M, Kchir N, Miled M. Intestinal lymphoma associated with Behçet’s disease. Ann Med Interne (Paris) 2001;152:415-8.

Cengiz M, Altundag MK, Zorlu AF, Güllü IH, Ozyar E, Atahan IL. Malignancy in Behcet’s disease: a report of 13 cases and review of the literature. Clin Rheumatol 2001;20:239-44. [CrossRef] Katsura Y, Suzukawa K, Kojima H, Yoshida C, Shimizu S, Mukai H, Hasegawa Y, Imagawa S, Mori N, Nagasawa T. Cytotoxic T-cell lymphoma arising in Behçet’s disease. Int J Hematol 2003;77:282-5. [CrossRef] Kural-Seyahi E, Fresko I, Seyahi N, Ozyazgan Y, Mat C, Hamuryudan V, Yurdakul S, Yazici H. The long-term mortality and morbidity of Behçet Syndrome. A 2-decade outcome survey of 387 patients folloved at dedicated center. Medicine (Baltimore) 2003;82:60-76.

[CrossRef] Ono Y, Yamada M, Kawamura T, Ito J, Kanayama S, Katayama Y, Okusawa E. Central Nervous System Malignant Lymphoma associated with Behçet’s disease. Neurol Med Chir 2005;45:586-90. [CrossRef] Chelly I, Limaïem F, Mekni A, Bellil S, Bellil K, Ghorbel IB, Haouet S, Zitouna M, Kchir N. Cutaneous gammadelta T-cell lymphoma arising in the setting of Behcet’s disease. Pathologica 2008;100:166-9.

TJH-ARALIK-2011-4-crossref.indd 85

Meydan et al.

Malignant lymphoma and Behçet’s disease

333

18. Souabni L, Elleuch M, Amira C, Sellami S. Malignant lymphoma of the tonsil in a patient with Behçet’s disease. Joint Bone Spine 2008;75:616-61. [CrossRef] 19. Ahn JK, Oh AJ, Lee J, Koh EM, Cha HS. Behcet’s disease associated with malignancy in Korea: a single center experience. Rheumatol Int 2010;30:831-5. [CrossRef] 20. Kaklamani VG, Tzonou A, Kaklamanis PG. Behçet’s disease associated with malignancies. Report of two cases and review of the literature. Clin Exp Rheumatol 2005;23:35-41.

21. Black KA, Zilko PJ, Dawkins RL, Armstrong BK, Mastaglia GL. Cancer in connective tissue disease.

Arthritis Rheum 1982;25:1130-3. [CrossRef] 22. Barnes BE. Dermatomyositis and malignacy: a review of the literature. Ann Intern Med 1976;84:68-76.

23. Canoso JJ, Cohen AS. Malignancy in a series of 70 patients with SLE. Arthritis Rheum 1974;17:383-8.

[CrossRef] 24. Sakane T, Takeno M, Suzuki N, Inaba G. Behcet’s disease. N Engl J Med 1999;342:1284-91. [CrossRef] 25. Prosnitz LR, Ng A. Non-Hodgkins lymphoma. In: Halperin EC, Perez Ca, Brady LW, eds. Principles and Practice of Radiation Oncology. 5th ed. Philadelphia: Lippincott Williams and Wilkins, 2008:1739-65.

26. Gotschalk S, Rooney CM, Heslop HE. Post-transplant lymphoproliferative disorders. Annu Rev Med 2005;56:29-44. [CrossRef] 27. Zintzaras E, Voulgarelis M, Moutsopoulos HM. The risk of lymphoma development in autoimmune diseases a meta-analysis. Arch Intern Med 2005;165:2337-44.

[CrossRef] 28. Martin DN, Mikhail IS, Landgren O. Autoimmunity and hematologic malignancies: associations and mechanism. Leuk Lymphoma 2009;50:541-50. [CrossRef] 29. Celik I, Altundağ K, Erman M, Baltali E. Cyclophosphamide-associated carcinoma of urinary bladder in Behcet’s disease. Nephron 1999;81:239.

30. Chang ET, Smedby KE, Hjalgrim H, Schöllkopf C, Porwit-MacDonald A, Sundström C, Tani E, d'Amore F, Melbye M, Adami HO, Glimelius B. Medication use and risk of non-Hodgkin’s lymphoma. Am J Epidemiol 2005;162:965-74. [CrossRef] 31. Au WY, Ma ES, Choy C, Chung LP, Fung TK, Liang R, Kwong YL. Therapy-related lymphomas in patients with autoimmune diseases after treatment with disease-modifying anti-rheumatic drugs. Am J Hematol 2006;81:5-11. [CrossRef] 32. Hoppe RT. Hodgkin Lymphoma. In: Halperin EC, Perez Ca, Brady LW, eds. Principles and Practice of Radiation Oncology. 5th ed. Philadelphia: Lippincott Williams and Wilkins, 2008:1721-38.

33. Hsieh WS, Lemas MV, Ambinder RF. The biology of Epstein-Barr virus in post-transplant lymphoproliferative disease. Transpl Infect Dis 1999;1:204-12. [CrossRef] 34. Morris MM, Powell SN. Irradiation in the setting of collagen vascular disease: acute and late complications. J Clin Oncol 1997;15:2728-35.

35. De Neayer B, De Meerleer G, Braems S, Vakaet L, Huys J. Collagen vascular diseases and radiation therapy:a critical review. Int J Radiat Oncol Biol Phys 1998;44:975-80.

02.12.2011 10:14

334

Meydan et al.

Malignant lymphoma and Behçet’s disease

36. Ross JG, Hussey DH, Mayr NA, Davis CS. Acute and late reactions to radiation therapy in patient with collagen vascular disease. Cancer 1993;71:3744-52. [CrossRef] 37. Varga J, Haustein UF, Creech RH, Dwyer JP, Jimenez SA. Exaggerated radiation induce fibrosis in patients with systemic sclerosis. JAMA 1991;265:3292-5. [CrossRef] 38. Phan C, Mindrum M, Silverman C. Matched-control retrospective study of the acute and late complications in patients with collagen vascular diseases treated with radiation therapy. Cancer J 2003;9:461-6. [CrossRef] 39. Satolli F, Venturi C, Vescovi V, Morrone P, De Panfilis G. Merkel-cell carcinoma in Behçet's disease. Acta Derm

TJH-ARALIK-2011-4-crossref.indd 86

Turk J Hematol 2011; 28: 327-34

Venereol 2005;85:79. [CrossRef] 40. Strohal R, Tschachler E, Breyer S, Uthman A, Simonitsch I, Tratting S, Scheithauer W, Stingl G, Kornek GV. Reactivation of Behçet’s disease in the course of multicentric HHV8-positive Castleman’s disease: longterm complete remission by a combined chemo/radiation and interferon-α therapy regimen. Br J Haematol 1998;103:788-90. [CrossRef] 41. Chargari C, Kirova YM, Fourquet A, Campana F. Severe acute radiation-related skin toxicity in a breast cancer patient with Behçet’s disease. Radiother Oncol 2009;91:139. [CrossRef]

02.12.2011 10:14

Letter to the Editor

335

A survey of hematologists on compulsory health service in Turkey Türkiye’de zorunlu hizmet görevi yapan hematoloji uzmanlarına yönelik bir anket çalışması Zeynep Arzu Yeğin1, Mutlu Arat2 1Department 2Department

of Hematology, Konya Education and Research Hospital, Konya, Turkey of Hematology, İstanbul Bilim University, İstanbul, Turkey

To the Editor The quality of health care is closely related to the level of physician job satisfaction, which depends on several factors, including working conditions, income, hospital resources and workload [1-3]. Compulsory health service was instituted by the Turkish Ministry of Health in 2005 (www.saglik.gov.tr), which is a postgraduate program that requires practitioners and specialists to work 300-600 days in underserved regions of the country.

This nationwide survey was conducted in 2010 by the Turkish Hematology Society in order to investigate lifestyle, working conditions, and job satisfaction among hematologists fulfilling their compulsory health service. The survey included 2 sections for collecting social and professional data. The primary results of the survey are detailed in the Table.

In all, 15 hematologists (male/female: 9/6; age range: 33-40 years; married/single: 11/4) from 11 cities (Adana, Ankara, Antakya, Bursa, Diyarbakır, Erzurum, Gaziantep, İstanbul, Konya, Şanlıurfa, and Trabzon) were asked to complete a 33-item electronic survey comprised of general questions con-

cerning the social and professional circumstances in the region in which they were working.

Social and financial dissatisfaction rate among the respondents were reported to be 40% and 60% respectively. The overall job satisfaction rate was 66.7%. Among the 15 respondents, 6 (40%) were confronted with verbal/physical violence by patients and/or coworkers at least once. This is a remarkable issue which might represent a common fact for a particular group of physicians working in similar conditions. Additionally, 26.7% of the respondents experienced social adaptation problems.

Consequently, job dissatisfaction among the hematologists should not be underestimated as it might cause an adverse impact on patient care as well. In consideration of inappropriate physical conditions and inadequate diagnostic resources, approximately 45% of patients are directed to larger centers, which is not consistent with the primary goal of compulsory health service.

The respondents were asked to evaluate the quality of hospital resources. The main defects were notified in laboratories, blood banks, and histopathology departments. As a result, hematologists

Address for Correspondence: Dr. Zeynep Arzu Yeğin, Department of Hematology, Konya Education and Research Hospital, Konya, Turkey Phone: +90 332 323 67 09 E-mail: zeyneparzuyegin@gmail.com doi:10.5152/tjh.2011.91

TJH-ARALIK-2011-4-crossref.indd 87

02.12.2011 10:14

336

YeÄ&#x;in et al.

A survey for hematologists

Turk J Hematol 2011; 28: 335-6

Table 1. The Primary Social and Professional Problems Reported

by Hematologists Social/Professional Problems

Frequency [n (%)] (n=15)

Insufficient laboratory resources

14 (93.3%)

Insufficient blood bank resources

13 (86.7%)

Insufficient histopathologic evaluation

13 (86.7%)

Difficulty with academic productivity

12 (80%)

Difficulty referring patients to other hospitals 7 (46.7%) Exposure to verbal/physical violence

6 (40%)

Social dissatisfaction

6 (40%)

Difficulty communicating with patients due to language diversity

5 (33.3%)

Difficulty attending scientific activities

5 (33.3%)

seemed to treat predominantly benign hematologic disorders like iron deficiency anemia. This primary step health service with inadequate clinical practice and scientific efficiency causes a professional deterioration that decreases the scientific productivity as well. Optimum working conditions should be adjusted in order to overcome this obstacle.

In conclusion, the results of our survey highlight the main social and professional problems experi-

TJH-ARALIK-2011-4-crossref.indd 88

enced by Turkish hematologists performing compulsory health service. Hematologists would display a better performance in patient care and academic course underneath more favorable infrastructure and working conditions. Strategies are urgently needed to ensure job satisfaction among hematologists on compulsory heath service.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

Wada K, Arimatsu M, Higashi T, Yoshikawa T, Oda S, Taniguchi H, Kawashima M, Aizawa Y. Physician job satisfaction and working conditions in Japan. J Occup Health 2009;51:261-6. [CrossRef] Deshpande SP, DeMello J. An empirical investigation of factors influencing career satisfaction of primary care physicians. J Am Board Fam Med 2010;23:762-9.

[CrossRef] Magnavita N, Fileni A, Bergamaschi A. Satisfaction at work among radiologists. Radiol Med 2009;114:1330-44.

[CrossRef]

02.12.2011 10:14

Letter to the Editor

337

Unusual presentation of adrenal lymphoma observed with PET-CT Adrenal lenfomanın PET-BT’deki ilginç görünümü Zeynep Gözde Özkan1, Cüneyt Türkmen1, Yasemin Şanlı1, Mustafa Nuri Yenerel2, Işık Adalet1 1Department 2Department

of Nuclear Medicine, İstanbul Medical Faculty, İstanbul University, İstanbul, Turkey of Hematology, İstanbul Medical Faculty, İstanbul University, İstanbul, Turkey

To the Editor, Lymphoma presenting with enlarged adrenal glands is not common. According to the literature, most adrenal lymphomas do not have extra-adrenal sites. We examined a 47-year-old male patient because of abdominal pain-an unusual presentation of adrenal lymphoma. Following ultrasonographic examination that showed bilateral massively enlarged adrenal glands, the patient underwent F-18 FDG PETCT. Written informed consent was obtained from the patient prior to PET-CT examination.

PET-CT showed bilateral enlarged adrenal glands (right: 67×55 mm; left: 28×68 mm) and increased FDG uptake (SUVmax: 27-25) (Figure 1a). Additional foci of increased FDG accumulations were observed, as follows: in the millimetric parenchymal nodule on the middle lobe and in the parenchyma (with groundglass density) on the lower lobe of the right lung (Figure 1b); in pleural surfaces on the right hemithorax (Figure 1c); in peripancreatic and para-aortic lymph nodes in the abdomen-the largest of which was 3 cm in diameter (Figure 1d); in the right caput humeri and in the corpus of 4. lumbar vertebra

(Figure 1e). All of these uptakes were in the range of malignant disease. CT-guided biopsy of the right adrenal gland showed diffuse large B cell lymphoma, which is the most common type of adrenal lymphoma.

Most patients with adrenal lymphoma present with bilateral enlarged adrenal masses, without evidence of extra-adrenal spread [1,2]. Although some patients have extra-adrenal involvement [3-5], the presented patient had highly disseminated disease.

The presence of multiple extranodal sites in lymphoma patients at presentation is associated with poor prognosis [4]. Generally, the response to chemotherapy is not good in such patients [5]. After the presented patient completed 3 cycles of R-CHOP chemotherapy, PET-CT showed that all previous hypermetabolic foci were normalized (Figure 2a-c) and that there were new foci of uptake in the interhemispheric area, in the frontal and right temporal lobes of the cerebrum (Figure 2d), in various vertebral bodies (Figure 2e), and in the intramedullary space between 1. and 2 lumbar vertebrae (Figure 2f).

Patients with adrenal lymphoma have a tendency for late central nervous system involvement, as the

Address for Correspondence: M.D. Zeynep Gözde Özkan, Konaklar Mah. Söğüt Sok. Koza Sitesi 8. Blok D: 23 4. Levent 34330 İstanbul, Turkey Phone: +90 212 270 29 70 E-mail: zgozdeozkan@yahoo.com doi:10.5152/tjh.2011.92

TJH-ARALIK-2011-4-crossref.indd 89

02.12.2011 10:14

338

Özkan et al.

Adrenal lymphoma observed with PET-CT

Turk J Hematol 2011; 28: 337-8

a

a

b b

c c

d d

e

e f

Figure 1. PET-CT Which Was Taken During the Evaluation Process of Bilateral Enlarged Adrenal Glands of the Patient

Figure 2. PET-CT of the Patient After 3 Cycles of R-CHOP Chemotherapy

presented patient did [2]. Despite all treatment efforts, patients usually die within 1 year [5]. After follow-up PET-CT the presented patient was scheduled to continue receiving chemotherapy; however, pulmonary Pneumocystis jiroveci infection was subsequently diagnosed and following antibiotic therapy the patient died due to fungal superinfection without having received additional chemotherapy.

The presented patient had an unusual presentation of adrenal lymphoma with multiple, extra-adrenal involvement at the time of diagnosis and expected onset of the disease. The patient developed new sites of disease, including the central nervous system, while undergoing chemotherapy and died after 6 months from the diagnosis of his disease.

ships, and/or affiliations relevant to the subject matter or materials included.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relation-

5.

TJH-ARALIK-2011-4-crossref.indd 90

References 1.

2.

3.

4.

Kumar R, Xiu Y, Mavi A, El-Haddad G, Zhuang H, Alavi A. FDG-PET imaging in primary bilateral adrenal lymhoma:A case report and review of the literature.

Clin Nucl Med 2005;30:222-30. [CrossRef] Wang J, Sun H, Bai R, Gao S, Li Y. 18F-FDG PET/CT images in primary adrenal lymphoma. European Journal of Radiology Extra 2008;68:83-7. [CrossRef] Brink I, Schneider B, Hoegerle S. Enormous bilateral adrenal uptake of F-18 FDG caused by non-Hodgkin’s lymphoma. Clin Nucl Med 2002;27:739-40. [CrossRef] Singh D, Sharma A, Mohanti BK, Thulkar S, Bahadur S, Sharma SC, Gupta SD. Multiple extranodal sites at presentation in non-Hodgkin’s lymphoma. Am J Hematol 2003;74:75-7. [CrossRef] Barbaros U, Erbil Y, Bozbora A, Deveci U, Özarmağan S, Kapran Y. Primary adrenal lymphoma presenting as bilateral adrenal masses. The Endocrinologist 2006;16:75-6. [CrossRef]

02.12.2011 10:14

Letter to the Editor

339

Scrotal abscess extending into the inguinal canal: A rare complication of multipl myeloma İnguinal kanala uzanım gösteren skrotal abse: Multipl miyelomun nadir bir komplikasyonu Fuat Özkan1, Bülent Altınoluk2, Sefa Resim2, Mustafa Eren2, Nazım Kankılıç2 1Department 2Department

of Radiology, Faculty of Medicine, Kahramanmaraş Sütçü İmam University, Kahramanmaraş, Turkey of Urology, Faculty of Medicine, Kahramanmaraş Sütçü İmam University, Kahramanmaraş, Turkey

To the Editor, Infectious complications play a major role in the course of multiple myeloma and often lead to death [1,2]. We report a rare case of multiple myeloma with a scrotal abscess extending into the inguinal region 1 month after completing the first cycle of chemotherapy.

A 52-year-old male with multiple myeloma presented to our emergency department due to abrupt swelling of the right side of his scrotum. Genitourinary examination showed a mass on the right side of the scrotum. The area was mildly erythematous and the mass extended into the right groin. Scrotal skin necrosis and decubitus ulcers were not noted.

Complete blood count results were as follows: white blood cell count: 15.4×109/L (with 93% segmented neutrophils); Hb: 11 g/dL; Hct: 33.4 %.

Biochemical blood test results were normal.

Scrotal ultrasonography showed a large fluid collection involving the right scrotal sac that extended into the right inguinal canal. In order to observe the extent of the collection the patient underwent computed tomography (CT), which showed a 13×6×7-

cm collection of fluid that contained multiple pockets of gas that was consistent with an abscess extending into the right inguinal canal (Figure 1a).

Sagittal reformatting of the image showed an expansile lytic lesion at the L5 vertebra with pathological features consistent with plasmacytoma (Figure 1).

Upon surgical exploration, a large abscess cavity was observed with pus tracking up to the right inguinal region. A wound culture specimen obtained from the abscess cavity grew Escherichia coli.

Infectious complications are the major cause of morbidity and mortality in patients with multiple myeloma [3]. The tendency for major bacterial infections is reported to be greater during the first 2 months following initiation of chemotherapy [2].

The presented patient finished his first cycle of chemotherapy 1 month before presenting with a scrotal abscess. Although the patient’s sonographic findings were compatible with a scrotal abscess, CT was performed to exclude the possibility that an intra-abdominal infection migrated to the scrotum and caused the scrotal abscess. The literature contains several reports indicating that intra-abdominal infections, such as perforated appendicitis and spontaneous bacterial peritonitis, can extend into

Address for Correspondence: Assist. Prof. Fuat Özkan, Department of Radiology, Faculty of Medicine, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş, Turkey Phone: +90 344 221 14 31 E-mail: drfozkan@yahoo.com doi:10.5152/tjh.2011.93

TJH-ARALIK-2011-4-crossref.indd 91

02.12.2011 10:14

340

Özkan et al.

Chronic eosinophilic leukemia with blurred vision

Turk J Hematol 2011; 28: 339-40

tion, and CT may be diagnostically beneficial in such cases.

Written informed consent was obtained from the patient.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

Figure 1. Figure. Coronal (a) Reformatted CT Image Shows a Complex Fluid and Gas Collection Extending From the Scrotum (Thick arrow) Into the Inguinal Canal (Thin Arrow). Sagittal Plane View (b) Shows an Expansile Lytic Lesion at the L5 Vertebral Body, with Associated Plasmacytoma (Open Arrow) and Scrotal Abscess (Solid Arrow)

the dependent scrotum via a patent processes vaginalis [4,5].

In conclusion, to the best of our knowledge this is the first case report of a scrotal abscess extending into the inguinal canal as a complication of multiple myeloma. Scrotal abscess should be considered a rare complication, particularly during periods when multiple myeloma patients are susceptible to infec-

TJH-ARALIK-2011-4-crossref.indd 92

2.

3.

4.

5.

Hartley-Brown MA, Sullivan DM, Baz R. State-of-the-Art Management of Complications of Myeloma and Its Treatment. Adv Hematol 2010;2010:343089.

Kalambokis GN, Christou L, Tsianos EV. Multiple myeloma presenting with an acute bacterial infection.

Int J Lab Hematol 2009;31:375-83. [CrossRef] Bladé J, Rosiñol L. Complications of multiple myeloma. Hematol Oncol Clin North Am 2007;21:1231-46.

[CrossRef] Mansoor K, Samujh R, Alalayet YF. Scrotal abscess with a rare cause. J Indian Assoc Pediatr Surg 2009;14:119-20.

[CrossRef] Graf H, Luger A, Pfluger H, Syre G, Gebhart W. Fournier gangrene: a rare complication of multiple myeloma.

Hautarzt 1983;34:289-91.

02.12.2011 10:14

Letter to the Editor

341

Double heterozygosity of the thalassemic mutations term. Cd +6 C→G and IVS-I-110 in a Greek woman: A case presentation Yunan bir kadında çift heterozigozit talasemik mutasyonlar terimi Cd +6 C → G ve IVS-I-110: Bir olgu sunumu Stamatia Theodoridou, Vasilios Perifanis, Stella Kotsiopoulou, Olga Karakasidou, Vasiliki Aletra, Michael Alemayehou Haemoglobinopathy Prevention Unit, Hippokration Hospital of Thessaloniki, Greece

To the Editor The phenotypic and molecular diversity of compound heterozygosity for thalassemic genes in Greece is extensive. The interaction of silent and classic β-thalassemia results in the clinical phenotype of thalassemia intermedia.

We report the clinical and hematological findings in an 18-year-old female referred to our hemoglobinopathy prevention unit that was observed to be compound heterozygote for the β-thalassemia mutations termination Cd +6 C→G and IVS-I-110.

Her parents were heterozygous for 1 of the 2 thalassemia genes. Termination Cd +6 C→G in the 3’ untranslated region (3’UTR of the β-globin gene (+1480 C→G) mutation is very rare and was previously reported in only a few Greek families [1,2].

The young woman had been followed-up since childhood for anemia, prior to the definitive characterization of her β genotype. Her clinical phenotype was mild, with anemia and slight splenomegaly, but without jaundice or the need for transfusion. Her

growth and development as a child were satisfactory. Hematological data of the propositus were as follows: Hb: 8.2 g/dL; Hct: 25.2%; MCV: 60.4 fL; MCH: 19.5 g/dL; RBC: 4180×103 μL. Her ferritin level was 27 ng/mL and HPLC hemoglobin variant analysis showed Ηb A2 was 6.6% and Hb F was <2%.

Microscopic examination of a stained peripheral blood smear showed severe anisocytosis, microcytosis, and basophilic stippling. No erythroblasts were noted. Written informed consent was obtained from the patient.

Hematological findings in the mother were as follows: Hb: 12.2 g/dL; Hct: 38.1%; MCV: 67 fL; MCH: 21 g/dL; RBC: 5690×103 μL; Ηb A2: 5%; Hb F: <2%.

Her father’s hematological data were within normal limits (with the exception of an Ηb A2 level of 3.4%), as follows: Hb: 14.9 g/dL; Hct: 45.3%; MCV: 87 fL; MCH: 28.6 g/dL; RBC: 5190×103 μL Molecular examination showed that the mother carried the typical β-thalassemia mutation ΙVSI-110, which is the most common β-thalassemia mutation in the Greek population [3] and the father carried

Address for Correspondence: M.D. Stamatia Theodoridou, Haemoglobinopathy Prevention Unit, Hippokration Hospital of Thessaloniki, Greece Phone: 2310892819 E-mail: hmesogiaki@ippokratio.gr doi:10.5152/tjh.2011.94

TJH-ARALIK-2011-4-crossref.indd 93

02.12.2011 10:14

342

Theodoridou et al.

Double heterozygosity term Cd +6 C→G/ΙVSI-110

the rare β-thalassemia (++) silent mutation termination Cd +6 C→G. Previously reported data show that the C→G mutation at position 6 3' to the termination codon is a mild β-thalassaemia mutation that causes a slight reduction in the level of β-globin mRNA and β-globin chain synthesis. In accordance with the literature, hematological findings in the heterozygous father with this mutation were within the normal range, except for a slightly elevated Hb A2 level. As reported by Maragoudaki et al. [2], heterozygotes for the mutation +1480 C→G have normal red cell indices, morphology, and osmotic fragility. Hb A2 and F values are within the normal range and globin-chain synthesis is slightly unbalanced. They also reported 5 cases of compound heterozygosity for +1480 C→G and ΙVSI-110 that had the mild clinical phenotype; their hemoglobin levels varied from 8 to 10.5 g/dL and Hb F ranged between 2.6% and 10.3%.

In conclusion, the clinical phenotype of the combination of the 2 mutations is a mild disease with a non-transfusion-dependent thalassemia intermedia phenotype. According to the literature [1] the C→G mutation at position 6 3' is characterized by a slight decrease in the stability of mRNA, which becomes clinically important only when beta chain synthesis in trans is severely decreased or completely elimi-

TJH-ARALIK-2011-4-crossref.indd 94

Turk J Hematol 2011; 28: 341-2

nated. Identification of such combinations is important for the genetic counseling of couples at risk in countries such as Greece, in which the high frequency of hemoglobinopathies has a major impact on public health.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

Jankovic L, Dimovski AJ, Kollia P, Karageorga M, Loukopoulos D, Huisman YH. A C----G mutation at nt position 6 3’ to the termination codon may be the cause of a silent beta-thalassemia. Int J Hematol 1991;54:289-93.

Maragoudaki E, Vrettou C, Kanavakis E, TraegerSynodinos J, Metaxoton-Mavrommati A, Kattamis C. Molecular, haematological and clinical studies of a silent β-gene C-G mutation at 6bp 3’ to the termination codon (+1480 C-G) in twelve Greek families. Br J Haematol 1998;103:45-51. [CrossRef] Boussiou M, Karababa Ph, Sinopoulou K, Tsaftaridis P, Plata E, Loutradi-Anagnostou A. The molecular heterogeneity of beta-thalassemia in Greece. Blood Cells Mol Dis 2008;40:317-9. [CrossRef]

02.12.2011 10:14

Letter to the Editor

343

First report from Turkey of a rare frameshift mutation [codons 9/10 (+T)] in the beta-globin gene Türkiye’de beta globin geninde nadir olarak gözlenen ilk çerçeve kayması mutasyonu [codons 9/10 (+T)] raporu Ramazan Güneşaçar1, M. Murat Çelik2 1Department 2Department

of Medical Biology and Genetics, Faculty of Medicine, Mustafa Kemal University, Hatay, Turkey of Internal Medicine, Faculty of Medicine, Mustafa Kemal University, Hatay, Turkey

To the Editor, Beta-thalassemia (β-thal) is one of the most common autosomal recessive single gene disorders worldwide [1]. At least 200 different mutations in the β-globin gene that result in the β-thal minor and major phenotypes have been described [2,3]. The incidence of β-thal is high in Mediterranean regions, Iran, India, The Arabian Peninsula, Southeast Asia, and Turkey [4]. β-thal is characterized by point mutations, small deletions, or insertions that result in a decrease in or lack of expression of the β-globin chain, and each ethnic group or population has its own set of common mutations. In Turkey β-thal is common and 12 mutations accounted for 83.3% of 1500 unrelated cases with homozygous β-thal [5]; the remaining mutations were rare or newly identified. To date, at least 39 nucleotide insertions in 3 exons of the β-globin gene that result in a modified C-terminal sequence of the β-globin protein have been reported (http://globin.bx.psu.edu/cgi-bin/

hbvar/query_vars3). Codon 9/10 (+T) insertion mutation was first described in a Greek family by Wave et al. in 1994 [6], followed by the report of an Iranian patient of Kurdish origin by Rahimi et al [7].

Herein we present a 30-year-old Arab male with the β-thal trait living in Hatay, Turkey that had β-globin gene codon 9/10 (+T) frameshift mutation, which was noted during premarital genetic screening. To the best of our knowledge this is the first case reported from Turkey and only the third case worldwide.

In our laboratory where molecular testing for the premarital screening of thalassemia mutations are routinely performed, we encountered a case of a 30 year-old male meeting the diagnostic criteria of β-thal trait. After written informed consent, the patient accepted to undergo mutation analysis and laboratory tests.

Genetic analysis showed a frameshift mutationan insertion of T between codons 9 and 10 in the first exon of the β-globin gene. Hematological data

Address for Correspondence: Assoc. Prof. Ramazan Güneşaçar, Department of Medical Biology and Genetics, Faculty of Medicine, Kahramanmaraş Sütçü İmam University, Kahramanmaraş, Turkey Phone: +90 506 307 92 90 E-mail: rgunesacar@hotmail.com doi:10.5152/tjh.2011.95

TJH-ARALIK-2011-4-crossref.indd 95

02.12.2011 10:14

344

Güneşaçar et al.

Codon 9/10(+T) mutation in the β-globin gene

were obtained via an automated cell counter and routine methodology. Red cell lysates were analyzed using high-performance liquid chromatography (HPLC). Hemoglobin species assay via HPLC showed the following: Hb A: 86.8%; Hb A2: 4.7%; Hb F: 1.0%. Complete blood count findings were as follows: Hb: 12.3 g/dL; Hct: 39.0%; MCV: 62.2 fL (low), MCH: 19.6 pg (low); MCHC: 31.5 g/dL (low)-red blood cell count, white blood cell count, and platelet count were as follows; 5.2 million/mm3, 6200/mm3, 255000/mm3, respectively. Iron status, serum ferritin, and other hematological indices were normal. DNA was isolated from whole blood samples in EDTA using a commercially available DNA extraction kit (RTA Lab, Ltd., Sti, Turkey).

Regions of the β-globin gene were sequenced using an ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA., USA), according to the manufacturer's instructions, and the sequence reaction was analyzed using an ABIPRISM 310 genetic analyzer (Applied Biosystems, Foster City, California, USA). The mutation was confirmed via sequencing of the anti-sense DNA strand, which was performed twice (Figure 1).

Genetic defects that result in β-thal are primarily point mutations, rather than gene deletions or insertions. The mutations result in defects in transcription, RNA splicing and modification, translation via frameshifts, and nonsense codons that produce highly unstable β-globin, which cannot be utilized.

Codon 9/10 (+T) is a rare mutation in the β-globin gene and was first described in a Greek family with β-thal, and then in an Iranian of Kurdish origin. The present case had the β-thal trait, is the first case reported from Turkey, and is only the third case worldwide. The insertion of a thymine nucleotide between codons 9 and 10 in exon 1 in the β-globin gene causes a reading frameshift from this point, leading to an in-frame stop codon at codon 22. The insertion of a T nucleotide in exon 1 alters the protein structure due to a reading frameshift and the formation of a stop codon in position 22. The resulting truncated protein is completely inactivated because of the premature termination of translation at codon 22, instead of at codon 147. A similar frameshift mutation in the β-globin gene [codon 9/10 (+G)] was observed in a patient of Turkish origin by Aulehla-Scholz et al. [8]. Codon 9/10 (+G) and codon 9/10 (+T) mutations are similar, but dif-

TJH-ARALIK-2011-4-crossref.indd 96

Turk J Hematol 2011; 28: 343-5

Thymine insertion (GCC) Codon 10

(TCT) Codon 9 151

153

155

157

159

161

163

165

167

Figure 1. Sequence Electropherogram Showing a Frameshift Mutation Due to a Thymine Insertion Between Codons 9 and 10 in Exon 1 of Beta Globin Gene

fer in terms of nucleotide insertion. The presented case had thymine insertion between the codon 9 and codon 10 regions, whereas the case reported

by Aulehla-Scholz et al. had guanine insertion between codon 9 and codon 10. β-thal mutations are very heterogeneous and at least 40 different mutations are common in Turkey.

This molecular heterogeneity might be due to the historical migration of individuals from non-Mediterranean regions to Turkey. β-thal mutations are usually population specific and each ethnic group has distinct common mutations. Research on different populations indicated that 4-6 mutations account for 90%-95% of β-thal chromosomes in any given ethnic group. The prevalence of a limited number of mutations in such populations has

02.12.2011 10:14

Güneşaçar et al.

Codon 9/10 (+T) mutation in the β-globin gene

Turk J Hematol 2011; 28: 343-5

facilitated molecular testing using primer-specific amplification or reverse dot blot hybridization, with a set of sequence-specific primers or probes for the frequently occurring β-thal mutations. In Turkey, β-thal mutations are very heterogeneous and the above-mentioned techniques are not sufficient for detecting rare or unknown mutations; therefore, direct DNA sequence analysis of the β-globin gene could prove to be extremely useful for prenatal diagnosis and carrier identification.

Detection of rare β-thal mutations may also be useful for establishing a national mutation database and in genetic counseling.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

Altay C, Basak AN. Molecular basis and prenatal diagnosis of hemoglobinopathies in Turkey. Int J Pediatr Hematol Oncol 1995;2:283-90.

TJH-ARALIK-2011-4-crossref.indd 97

2.

3.

4.

5.

6.

7.

8.

345

Hardison RC, Chui DHK, Giardine B, Riemer C, Patrinos GP, Anagnou N, Miller W, Wajcman H. HbVar: a relation database of human hemoglobin variants and thalassemia mutations at the globin gene server. Hum Mutat 2002;19:225-33. [CrossRef] Patrinos GP, Giardine B, Riemer C, Miller W, Chui DHK, Anagnou DP, Wajcman H, Hardison RC. Improvement in HbVar human hemoglobin variants and thalassemia mutations for population and sequence variation studies. Nucleic Acids Res 2004;32:537-41. [CrossRef] Cavdar AO, Arcasoy A. The incidence of ß-thalassemia and abnormal hemoglobins in Turkey. Acta Haematol 1971;45:312-8. [CrossRef] Basak AN. The molecular pathology of B-thalassemia in Turkey: The Bogazici University experience.

Hemoglobin 2007;31:233-41. [CrossRef] Waye JS, Eng B, Oliveri NF, Chui DH. Identification of a novel beta O-thalassaemia mutation in a Greek family and subsequent prenatal diagnosis. Prenatal Diag 1994;14:929-32. [CrossRef] Rahimi Z, Muniz A, Parsian A. Detection of responsible mutations for beta thalassemia in the Kermanshah Province of Iran using PCR-based techniques. Mol Biol Rep 2010;37:149-50. [CrossRef] Aulehla-Scholz C, Basaran S, Agaoglu L, Arcasoy A, Holzgreve W, Miny P, Ridolfi F, Horst J. Molecular basis of beta-thalassemia in Turkey: detection of rare mutations by direct sequencing. Hum Genet 1990;84:195-7. [CrossRef]

02.12.2011 10:14

346

Letter to the Editor

First observation of hemoglobin Crete [Beta129(H7) Ala>Pro] in the Turkish population Türk populasyonunda ilk gözlemlenen hemoglobin Crete [Beta129(H7)Ala>Pro] Çiğdem Arslan1, Selda Kahraman2, Hayri Özsan2, Nejat Akar1 1Department 2Department

of Pediatric Genetics, Faculty of Medicine, Ankara University, Ankara, Turkey of Hematology, Faculty of Medicine, Dokuz Eylül University, İzmir, Turkey

To the Editor, Hemoglobin (Hb) Crete [β129 (H7) Ala>Pro] is a rare hemoglobin variant that was first reported in a Greek family living in USA, and then from Greece [1-4]. It was reported in combination with beta thalassemia and delta-beta-thalassemia [2], and also in a homozygous state [4]; however, this is the first report of Hb Crete in the Turkish population [5,6].

Herein we describe a 50-year-old Turkish man living in İzmir with Hb Crete. His family emigrated from Crete, Greece when he was 4 years old. He presented to the hospital with weight loss and hepatosplenomegaly. His routine hematological analysis results are shown in the Table 1. HPLC chromatography showed 1 abnormal band with 56.9% variance. Thoracoabdominal tomography showed hepatosplenomegaly and several multiple nodular lesions. Following posterolateral thoracotomy and paravertebral nodular excision, the histopathological diagnosis of the nodules was extramedullary hematopoiesis. Subsequently, the patient underwent splenectomy. We have the informed consent of the patient.

PCR amplification of the β-globin gene was performed using primers F:5’-GGTT GGCCAATCTACT CCCAGGAG-3’ and R:5’-GCTCACTCAGTGTGGCAA AG-3’ for exon 1-exon 2. For exon 3, PCR amplification was performed first with the primers F:5’CAATGTATCATGCCTCTTTGCACC-3’ and R:5’GAGTCAAGGCTGA GAG ATAC AGGA-3’ for a 861bp fragment, and then 5’-TGCATATAAAT TGTAACTGAT-3’ and 5’-CACT GACCTCCCACAT TCCC-3’ primers were used for nested amplification. Direct automated sequencing of the all amplified regions of the β-globin gene was performed using an automatic sequencer (Beckmann Coulter, USA), and 2 different sets of PCR reactions with forward and reverse amplification were performed. The third exon amplification showed the variant as a missense mutation at codon 129 G change to C that leads to alanine substitution to proline, which was previously described as Hb Crete (Figure 1). Moreover, β-globin 5’ UTR + 20 (C-T) change was observed, indicating a combination with beta thalassemia.

There are several reported 5’ UTR mutations of the β-globin gene that cause the β-thalassemia

Address for Correspondence: Prof. Dr. Nejat Akar, Department of Pediatric Genetics, Faculty of Medicine, Ankara University, Ankara, Turkey Phone: +90 312 241 39 80 E-mail: akar@medicine.ankara.edu.tr doi:10.5152/tjh.2011.48

TJH-ARALIK-2011-4-crossref.indd 98

02.12.2011 10:14

Arslan et al.

Hemoglobin crete in the Turkish population

Turk J Hematol 2011; 28: 346-7

200 210 220 200 210 G T G C A GG C T G C C T A T CAG A A A G T G G T G T G CA GG C T G C C T A T CA G A A A G T G G T

347

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References A

1.

B

Figure 1. Automatic DNA sequencing data for the Hb Crete patient.

Ais the normal sequence, B is the Hb Crete sequence

2.

Table 1. Hematological and Hemoglobin Composition Data For the HB Crete Carrier Hb

RBC

MCV

MCH

MCHC

RDW

RET

14.7

7.09

65.4

20.8

31.7

14.5

2.5

intermedia clinical phenotype or a combination with another abnormal Hb [7]. The presented patient had erythrocytosis, which was described previously and may be due to high oxygen affinity/ normal Bohr effect of Hb Crete [1], and may also account for the extramedullary foci observed in our patient.

We reported the first observation of Hb Crete in the Turkish population in combination with β-thalassemia. The presented patient was living in İzmir, on the Aegean coast of Turkey. Large numbers of Cretan Turks emigrated to İzmir at the beginning of the 20th century. Detection of Hb Crete in the Turkish population might be evidence of this historical event.

TJH-ARALIK-2011-4-crossref.indd 99

3.

4.

5.

6.

7.

Huismann THJ, Carver MFH, Efremov GDA. Syllabus of hemoglobin variants. The Sickle Cell Anemia Foundation. 2nd ed. GA, USA: Augusta, 1998.

Maniatis A, Bousios T, Nagel RL, Balazs T, Ueda Y, Bookchin RM, Maniatis GM. Hemoglobin Crete (beta 129 ala leads to pro): a new high-affinity variant interacting with beta o -and delta beta o -thalassemia.

Blood 1979;54:54-63.

Christopoulou G, Tserga A, Patrinos GP, Papadakis MN. Molecular characterization and diagnosis of Hb Crete [beta129(H7)Ala-->Pro]. Hemoglobin 2004;28:339-42.

[CrossRef] Papassotiriou I, Traeger-Synodinos J, Marden MC, Kister J, Liapi D, Prome D, Stamoulakatou A, Wajcman H, Kanavakis E. The homozygous state for Hb Crete [beta129 (H7) Ala-->Pro] is associated with a complex phenotype including erythrocytosis and functional anemia. Blood Cells Mol Dis 2005;34:229-34. [CrossRef] Altay C. Abnormal Hemoglobins in Turkey. Turk J Haematol 2002;19:63-74.

Akar E, Akar N. A review of abnormal hemoglobins in Turkey. Turk J Hematol 2007:24;2-3.

Oner R, Oner C, Birben E, Sözen M, Gümrük F, Gürgey A, Altay C. beta-Thalassaemia intermedia in a Turkish girl: homozygosity for G-->A substitution at +22 relative to the beta-globin cap site. Br J Haematol 2001;115:90-4. [CrossRef]

02.12.2011 10:14

348

Letter to the Editor

The frequency of Factor V G1691A (Leiden) mutation in Iraqi Turks Irak Türklerinde Faktör V G1691A (Leiden) mutasyon sıklığı Arjan Esmael, Yonca Eğin, Nejat Akar Department of Pediatric Molecular Genetics, Faculty of Medicine, Ankara University, Ankara, Turkey

To the Editor, Factor V Leiden (FVL) mutation (G1691A) is a risk factor for the development of venous thromboembolic disorders. Hereditary disorders that predispose to thrombosis include antithrombin, protein C, and protein S deficiency, as well as such hereditary defects as Factor V G1691A (Leiden) (FVL) and prothrombin G20210A mutation [1,2]. FVL causes activated protein C resistance and is the most common thrombophilic mutation worldwide [3,4]; however, to the best of our knowledge the frequency of FVL in Iraqi Turks has not been reported.

Iraqi Turks currently live primarily in northern Iraq and are descendants of the Oghuz Turks that originated in Central Asia. The study group included 84 unrelated Iraqi Turks from northern Iraq; 40 from Kirkuk, 20 from Mosul, 10 from Arbil, 10 from Baghdad, and 4 from the Diala and Tikrit regions.

Following the receipt of informed consent from all the participants, blood samples were collected into tubes containing EDTA and transferred To the laboratory, and then DNA was extracted from peripheral blood leukocytes according to the phenol-chloroform method. The prevalence of FVL was determined using real-time PCR (RT-PCR), as previously described [5]. In all, 4 (4.8%) of the 84 participants

were diagnosed as FVL carriers and the frequency of FVL was 0.0238% among Turks living in Iraq.

Several studies on FVL mutation in the Turkish population have been published and the prevalences reported ranged from 4% to 12.2% [6]. The prevalence of FVL among Turkish Cypriots was reported as 12.2% versus 7.9% in Turkey [6,7]. The prevalence of FVL is 3%-10% in Europeans, but FVL mutation is rare in East and Southeast Asians [3,4].

The present study’s results show that the prevalence of FVL in Iraqi Turks is similar to that in the general Caucasian population.

Acknowledgement I am grateful to Professor Nejat Akar, MD and Yonca Eğin for analyzing the samples.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

Bertina RM, Koeleman BP, Koster T, Rosendaal FR, Dirven RJ, de Ronde H, van der Velden PA, Reitsma PH. Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 1994;369:64-7.

Address for Correspondence: Prof. Dr. Nejat Akar, Department of Pediatric Molecular Genetics, Faculty of Medicine, Ankara University, Ankara, Turkey Phone: +90 312 595 63 48 E-mail: akar@medicine.ankara.edu.tr doi:10.5152/tjh.2011.46

TJH-ARALIK-2011-4-crossref.indd 100

02.12.2011 10:14

Esmael et al.

FVL mutation in Iraqi Turks

Turk J Hematol 2011; 28: 348-9

2.

3.

4.

Poort SR, Rosendaal FR, Reitsma PH, Bertina RM. A common genetic variation in the 3â&#x20AC;&#x2122;- untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood 1996;88:3698-703.

Rees DC, Cox M Clegg JB. World distribution of factor V Leiden. Lancet 1995;346:1133-4.

Lucotte G, Mercier G. Population genetics of factor V Leiden in Europe. Blood Cells Mol Dis 2001;27:362-7.

TJH-ARALIK-2011-4-crossref.indd 101

5.

6.

7.

349

Lay MJ, Wittwer CT. Real-time fluorescence genotyping of factor V Leiden during rapid-cycle PCR. Clin Chem 1997;43:2262-7.

Akar N. Factor V 1691 G-A mutation distribution in healthy Turkish population. Turk J Hematol 2009;26: 9-11.

Akar N, Akar E, DalgÄąn G, Sozuoz A, Omurlu K, Cin S. Frequency of factor V (1691GA) mutation in Turkish population. Thromb Haemost 1997;78:1527-8.

02.12.2011 10:14

350

Letter to the Editor

Acute thrombotic complication of essential thrombocythemia in a young adult Esansiyel trombositeminin genç erişkindeki akut trombotik komplikasyonu Selami Koçak Toprak1, Sema Karakuş1, Feride İffet Şahin2 1Department 2Department

of Hematology, Faculty of Medicine, Başkent University, Ankara, Turkey of Medical Genetics, Faculty of Medicine, Başkent University, Ankara, Turkey

To the Editor, We read with great interest the recent publication by Arıkan et al. on central retinal artery occlusion (CRAO) in a newly diagnosed patient with essential thrombocythemia (ET), and their conclusion that ET is among the underlying hematologic disorders in patients with CRAO [1]. ET is a myeloproliferative disorder associated with an increase in abnormal platelets that causes both hemorrhagic and thrombotic pathology. Some of its systemic complications include deep vein thrombosis, pulmonary emboli, myocardial infarcts, and renal vessel thrombosis [2]. We would like to share our experience concerning the causative relationship between ET and CRAO. A 29-year-old male presented with acute visual loss in his right eye. Upon examination his right eye visual acuity (VA) was counting fingers at 0.5 m and the relative afferent pupillary defect was positive in the same eye. Fundus examination revealed retinal edema and a cherry-red spot appearance of the

macula with narrowed vessels, which were compatible with the diagnosis of CRAO. Ocular massage, anterior chamber paracentesis, and systemic therapy with a carbonic anhydrase inhibitor and mannitol were initiated. At presentation the patient’s routine laboratory test results were normal, except for thrombocytosis (platelet count: 1.278×109/L); following this result, the patient was referred to our clinic.

The patient had a history of diabetes mellitus type 1 (controlled with insulin). The patient’s platelet count was 1.324×109/L, which was in accordance with the peripheral blood smear that showed an increase in the number of platelets and clumps, and bone marrow biopsy showed an increase in the number of megakaryocytes. The white blood cell count was 11.6×109/L and hemoglobin was 15.5 g/dL. Physical and ultrasonographic examination showed splenomegaly. Hematological results for prothrombin time, partial thromboplastin time, fibrinogen, antithrombin III, protein C, protein S, activated protein C resistance, lupus anticoagulant, antinuclear antibody, and the erythrocyte sedimentation rate

Address for Correspondence: M.D. Selami Koçak Toprak, Department of Hematology, Faculty of Medicine, Başkent University, Ankara, Turkey Phone: +90 532 656 02 06 E-mail: sktoprak@yahoo.com doi:10.5152/tjh.2011.70

TJH-ARALIK-2011-4-crossref.indd 102

02.12.2011 10:14

Turk J Hematol 2011; 28: 350-1

Toprak et al.

Acute thrombotic complication of essential thrombocythemia

were unremarkable. The homocysteine level was 17.9 (normal range: 5.4-16.2 µmol/L). Factor V Leiden 1691 G>A and factor II 20210 G>A were normal.

Conventional cytogenetic analysis of a bone marrow specimen was normal. The patient was heterozygous for JAK2 V617F mutation, based on real time PCR analysis. The final diagnosis of ET was then established. Therapeutic thrombopheresis was performed once, followed by low-dose acetyl salicylic acid and hydroxyurea treatment. At the 1-month follow-up the patient’s platelet count was within the normal range, but his VA had not improved completely. Maintenance therapy was planned for the appropriate dose and duration.

ET is associated with systemic and ocular thrombotic and embolic complications. The risk for thrombosis is highest in patients with a history of thrombosis and in those aged >60 years [3].

Although ET is primarily considered a disorder of middle-advanced age, it has been observed in children and young adults; however, the actual risk for thrombosis in young patients has not been clearly established [4]. We think that this complication should be kept in mind, especially in young adult patients with acute visual loss.

TJH-ARALIK-2011-4-crossref.indd 103

351

Ethical Consideration Written informed consent was obtained from the patient.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1.

2.

3.

4.

Arıkan G, Saatci AO, Kahraman S, Pişkin Ö, Men S, Ündar B. Central retinal artery occlusion as the presenting sign of essential thrombocythemia. Turk J Hematol 2011;28:146-8. [CrossRef] Strassman I, Silverstone BZ, Seelenfreund MH, Sheer A, Berson D. Essential thrombocythemia: a rare case of central retinal artery occlusion. Metab Pediatr Syst Ophthalmol 1991;14:18-20.

Tefferi A, Murphy S. Current opinion in essential thrombocythemia: pathogenesis, diagnosis, and management. Blood Rev 2001;15:121-31. [CrossRef] Randi ML, Rossi C, Fabris F, Girolami A. Essential thrombocythemia in young adults: major thrombotic complications and complications during pregnancy--a followup study in 68 patients. Clin Appl Thromb Hemost 2000;6:31-5. [CrossRef]

02.12.2011 10:14

352

Letter to the Editor

The frequency of factor V G1691A (Leiden) mutation in the healthy Kazakh population Sağlıklı Kazak popülasyonunda faktör V G1691A (Leiden) mutasyon sıklığı Hakkı Taştan Department of Biology, Faculty of Science, Gazi University, Ankara, Turkey

To the Editor, Factor V G1691A (Leiden) (FVL) is an autosomal dominant mutation that causes activated protein C (APC) resistance, which results in hypercoagulation disorders [1]. The mutation is unevenly distributed, ranging from non-existent in Africa, America, Asia, and Australia, to an incidence as high as 15% in some regions of Europe [2,3].

Kazakhs emerged as a unique ethno-linguistic group during the 13th century AD [4], after invading the region that is now modern Kazakhstan. At that time, many tribes of Turkish and Mongolian origin inhabited the region [4,5]. The Kazakh ethnic identity, which was distinguishable by its distinctive Kipchak Turkish dialect, emerged in this complex sociocultural environment [4]; however, the Kazakhs did not form a unified Khanate like other Turkishspeaking groups. Instead, during the 15th and 16th centuries they subdivided into 3 major tribal confederations: the Greater, Middle, and Lesser (Hordes) [4,6]. This division likely occurred via already existing tribal lines, and marked a political, as well as geographical split.

The frequency of FVL in Europe is 3%-10%. It is rare in East and Southeast Asia, occurs with a 12%

frequency in such neighboring countries as Azerbaijan and Kyrgyzstan [7-9], and has a frequency of 3.1% in western Iran [10]. The best of my knowledge the frequency of FVL in the Kazakh population has not been reported. The present study included 69 healthy Kazakh individuals. All the participants provided informed consent. Blood samples were collected into EDTA-containing tubes and then DNA was extracted from peripheral blood leukocytes. FVL analysis was performed via realtime PCR (RT-PCR), as previously described [11]. In all, 3 (4.3%) of the 69 participants were heterozygous for FVL and the frequency of FVL was 0.02% among the Kazakh population. The data obtained show that the frequency of FVL in Kazakhs is similar to that in the general Caucasian population.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Acknowledgement I am grateful to Professor Nejat Akar, MD and Yonca Eğin for analyzing the samples.

Address for Correspondence: Assoc. Prof. Hakkı Taştan, Department of Biology, Faculty of Science, Gazi University, Ankara, Turkey Phone: +90 312 202 13 98 E-mail: hakkitastan@gazi.edu.tr doi:10.5152/tjh.2011.96

TJH-ARALIK-2011-4-crossref.indd 104

02.12.2011 10:14

HakkÄą TaĹ&#x;tan FVL mutation in Kazakh population

Turk J Hematol 2011; 28: 352-3

References 1.

2.

3.

4.

5.

6.

Perry DJ, Pasi KJ. Resistence to activated protein C and Factor V leiden. QJM 1997;90:379-85. [CrossRef] Akar N. Factor V 1691 G-A mutation distribution in a healthy Turkish population. Turk J Hematol 2009;26:9-11.

Rees DC, Cox M, Clegg JB. World distribution of factor V Leiden. Lancet 1995;346:1133-4. [CrossRef] Golden PB. An introduction to the history of the Turkic peoples: ethnogenesis and state- formation in Medieval and Early Modern Eurasia and the Middle East.

Wiesbaden press. 1992.

Gokcumen O, Dulik MC, Pai AA, Zhadanov SI, Rubinstein S, Osipova LP, Andreenkov OV, Tabikhanova LE, Gubina MA, Labuda D, Schurr TG. Genetic variation in the enigmatic Altaian Kazakhs of South-Central Russia: insights into Turkic population history. American J Physic Anthropol 2008;136:278-93. [CrossRef] Soucek S. A history of inner Asia. Cambridge: Cambridge University Press. 2000.

TJH-ARALIK-2011-4-crossref.indd 105

353

7.

Lucotte G, Mercier G. Population genetics of factor V Leiden in Europe. Blood Cells Mol Dis 2001;27:362-7. [CrossRef] 8. Gurgey A, Kudayarov DK, Tuncer M, Parlak H, Altay C. The factor V Leiden and prothrombin G20210A mutations in Kirghiz population. Thromb Haemost 2000;84:356.

9. Gurgey A, Rustemov R, Parlak H, Balta G. Prevalence of factor V Leiden and methylenetetrahydrofolate reductase C677T mutations in Azerbaijan. Thromb Haemost 1998;80:520-1.

10. Rahimi Z, Nomani H, Mozafari H, Vaisi-Raygani A, Madani H, Malek-Khosravi S, Parsian A. Factor V G1691A, prothrombin G20210A and methylenetetrahydrofolate reductase polymorphism C677T are not associated with coronary artery disease and type 2 diabetes mellitus in western Iran. Blood coagulation and Fibrinolysis 2009;20:252-6. [CrossRef] 11. Lay MJ, Wittwer CT. Real-time fluorescence genotyping of factor V Leiden during rapid-cycle PCR. Clin Chem 1997;43:2262-5.

02.12.2011 10:14

354

Letter to the Editor

A novel 110-bp insertion in a patient with homocysteinuria Homosistinürili bir hastada ilk kez tanımlanan 110 BÇ'lik insersiyon Didem Torun1, Talia İleri2, Kaan Gündüz3, Nejat Akar1 1Department

of Pediatric Genetics, Faculty of Medicine, Ankara University, Ankara, Turkey of Pediatric Hematology, Faculty of Medicine, Ankara University, Ankara, Turkey 3Department of Ophthalmology, Faculty of Medicine, Ankara University, Ankara, Turkey 2Department

To the Editor, Homocysteinuria is an inherited recessive disorder caused by cystathionine beta-synthase (CBS) deficiency that has a wide spectrum of clinical manifestations, including ocular lens dislocation, skeletal disproportion, osteoporosis, vascular thrombosis, and central nervous system dysfunction [1]. The CBS enzyme catalyzes the synthesis of cystathionine from homocysteine and serine in the methionine pathway.

This results in accumulation of homocysteine and methionine in plasma, leading to excretion of excessive urinary homocysteine. CBS deficiency has a worldwide incidence of 1/344,000 live births (range: 1/58,000-1/1000 live births) [2].

Human CBS is located in the cytoplasm of cells and is composed of 4 identical 63-kDa subunits. The CBS gene is located on the long (q) arm of chromosome 21 at position 22.3, encodes a protein consisting of 551 amino acids, and has 16 exons [3]. Herein we report a patient with homocysteinuria that was a carrier of compound heterozygote mutations in the CBS gene, 1 of which is novel, and a discussion of the clinical and molecular findings.

A 14-year-old boy was referred to our hospital for evaluation of ocular symptoms that began approximately 1 year earlier. He was the first born of non-consanguineous parents that had lost 1 fetus. Family history of neurologic and thromboembolic disease was negative. Pregnancy and delivery were uneventful. The proband had neuromotor developmental delay. At the age of 10 years he had a clonic seizure of the left side. He had a marfanoid face and neurological examination showed left-sided central facial palsy, and mild left hemiparesis. Complete blood count results were normal. Cranial CT showed an area of low attenuation in the left frontoparietal region consistent with infarction. Prothrombotic work-up results were as follows: serum methionine level: 4.7 mg / dL (normal: 0.09-0.6 mg/dL); free homocysteine concentration: 50 mmol/L (normal: <12.5 mmol/L); urine homocysteine concentration: 360 mmol/L (normal: 5-15 mmol/L). The patient was diagnosed as homocysteinuria, and hydroxy cobalamin injections, vitamin B6, acetyl-salicylic acid, and a low-methionine diet were started and maintained.

Address for Correspondence: M.D. Didem Torun, Department of Pediatric Genetics, Faculty of Medicine, Ankara University, Ankara, Turkey Phone: +90 543 415 36 10 E-mail: didemtorun@gmail.com doi:10.5152/tjh.2011.44

TJH-ARALIK-2011-4-crossref.indd 106

02.12.2011 10:14

Turk J Hematol 2011; 28: 354-6

Ophthalmological examination showed bilateral lens subluxation, bilateral cataracts, and secondary glaucoma. The patient underwent cataract extraction in both eyes via phacoemulsification.

Both eyes were treated with topical anti-glaucoma drops. Additionally, the right eye underwent diode laser cyclophotocoagulation with normalization of intraocular pressure without any drops at the 1-year follow-up. Intraocular pressure in the left eye remained normal with topical anti-glaucoma drops.

Written consent was provided by the patient’s parents. Following DNA extraction, all the exons of the CBS gene were screened via sequencing. Exon 8 of the CBS gene was amplified using 2 primer sets (F: 5’ CTGAACATTTAGGTCATTACC 3’; R: 5’ TTT CACACGTTTTCCCTGC 3’) under standard PCR conditions, with an annealing temperature of 57°C. PCR showed a 598-bp amplified product, which was cleaned using a DNA purification kit (Metis, Turkey).

Then, the sample was sequenced using a DNA sequencer (Beckman Coulter DNA sequencer, USA). Direct PCR analysis and sequencing showed a 110-bp insertion at exon 8 in the CBS gene (Figures 1 and 2). A novel 110-bp insertion starting at nt 855 up to 965 ending with a new amino acid formation was determined. In exon 8 the serine amino acid coded

by TCC was altered to tryptophan (TGG) due to the 110-bp insertion. Additionally, a missense mutation at exon 8 in the CBS gene was also noted, which caused a T-C transition at base pair 833, resulting in an amino acid change from isoleucine to threonine (Figure 3). 833 T>C (p.I1278T) was previously described (HGMD_CM990350).

Discussion We described a 14-year-old patient with homocysteinuria due to 2 mutations in the CBS gene in a compound heterozygous state. The novel 110-bp insertion mutation at the intron-exon junction of the 5’ end of exon 8 affected the splicing site. An 844ins68 polymorphism was previously reported at this localization [4]. Previous research has shown that 844ins68 insertion in the CBS gene has a heterogeneous distribution in human populations. The effect of 844ins68 on homocysteine metabolism and its thrombotic effect remain speculative. The

TJH-ARALIK-2011-4-crossref.indd 107

Torun et al.

A 110-bp insertion in a homocysteinuria patient

1

2

3

4

5

355

6 7

708 bp 598 bp

Figure 1. Agarose Gel Electrophoretic Analysis of the 110-bp Heterozygous Insertion at Exon 8 in the CBS Gene. Band 1 is the DNA Marker (ØX174 HaeIII, Fermentas), and Bands 2-6 are DNA Samples for the Control. Band 7 is The Patient’s PCR

210 220 230 A A G G GT T G G G TC TC T C G C T G A GCC T

Figure 2. Starting Point of the 110-bp Insertion at Exon 8 in the CBS Gene

T G

190 190 C A G A T C A T T G G G G T G G A

Figure 3. CBS Gene 833 T>C Transition at Exon 8

frequency of this polymorphism is 5.9% in the Turkish population [5]. The novel 110-bp insertion observed in the presented case shows that this region of the CBS gene may be a hot spot for mutations; the observed mutation and the 844ins68 variant do not overlap. In conclusion, 110-bp insertion plays an important role in homocysteine-related diseases.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

02.12.2011 10:14

356

Torun et al.

A 110-bp insertion in a homocysteinuria patient

References 1.

2.

Kaur M, Kabra M, Das GP, Suri M, Verma IC. Clinical and biochemical studies in homocystinuria. Indian Pediatr 1995;32:1067-75.

Kraus JP, Janosík M, Kozich V, Mandell R, Shih V, Sperandeo MP, Sebastio G, de Franchis R, Andria G, Kluijtmans LA, Blom H, Boers GH, Gordon RB, Kamoun P, Tsai MY, Kruger WD, Koch HG, Ohura T, Gaustadnes M. Cystathionine Beta-Synthase Mutations In Homocystinuria. Hum Mutat 1999;13:362-75. [CrossRef]

TJH-ARALIK-2011-4-crossref.indd 108

Turk J Hematol 2011; 28: 354-6

3.

4.

5.

Münke M, Kraus JP, Ohura T, Francke U. The gene for cystathionine beta synthase (CBS) maps to the subtelomeric region on human chromosome 21q and to proximal mouse chromosome 17. Am J Hum Genet 1988;42:550-9.

Tsai MY, Bignell M, Schwichtenberg K, Hanson NQ. High prevalence of a mutation in the cystathionine beta-Synthase gene. Am J Hum Genet 1996;59;1262-7.

Akar N, Akar E, Mısırlıoğlu M, Avcu F, Yalçın A, Cin Ş.

Search For Genetic Factors Favoring Thrombosis in Turkish Population. Thromb Res 1998;92;79-82.

[CrossRef]

02.12.2011 10:14

Images in Hematology

357

Overwhelming bone marrow Leishmaniasis Kemik iliğinde yoğun Leishmaniasis Raihan Sajid, Adnan Qureshi Department of Pathology and Microbiology, Aga Khan University, Karachi, Pakistan

Visceral Leishmaniasis (kala-azar) is caused by the intracellular parasitic organism Leishmania donovani and is transmitted by the bite of an infected sandfly Phlebotomus argentipes. Clinical manifestations of advanced disease usually include constitutional symptoms, such as prolonged fever, anorexia, weight loss, and marked enlargement of the spleen and liver, with varying degrees of pancytopenia [1].

Pakistan is a tropical country situated in the north-west region of South Asia; all of its neighboring countries are endemic for Leishmaniasis, including China, Afghanistan, Iran, and India [2-4].

Leishmaniasis was first reported from Pakistan in 1960 [5]. Initially, it was limited to the northern mountainous region, but currently it is widespread throughout the country with several endemic foci of varying climatic and geographic conditions [6].

Herein we present a 22-year-old female from Hyderabad, Sindh Province, Pakistan that was referred to our laboratory for bone marrow exanimation due to pyrexia of unknown origin. She had fever with chills and rigors that began 2 months earlier, which did not respond to treatment with antimalarials and multiple antibiotics. At presentation she had massive splenomegaly and marked pallor.

Complete blood count showed the following: pancytopenia with hypochromic microcytic anemia; hemoglobin: 7.1 g/dL; hematocrit: 21.8%; MCV: 72.5 fL; MCH: 23.8 pg; MCHC: 29.7%; total white cell

count: 1.5×109/L; absolute neutrophil count: 0.4×109/L; platelet count: 48×109/L. Peripheral blood smear did not show a leukoerythroblastic reaction or the presence of abnormal cells. Bone marrow examination showed hypercellular marrow and massive infestation with the amastigote form of Leishmania donovani in the bone marrow macrophages and in some granulocytes. Written informed consent was obtained from the patient.

The visceral form of Leishmaniasis can be fatal if not treated in a timely fashion and stibogluconate (sodium antimony gluconate) is the drug of choice.

Recently, other agents have become available for the treatment of new and resistant cases of visceral Leishmaniasis, including pentamidine isethionate, amphotericin B, miltefosine, and paramomycin [1].

The presented patient received anti-leishmanial treatment with sodium antimony gluconate 20 mg/ kg/d for 14 d. She began to exhibit improvement within 3 d and was clinically cured after the full course of therapy. She was last followed-up 1 month after completion of the treatment and was asymptomatic and healthy.

Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Address for Correspondence: Asst. Prof. Raihan Sajid, Department of Pathology and Microbiology, Aga Khan University, Karachi, Pakistan Phone: 0092214861306 E-mail: raihan.sajid@aku.edu doi:10.5152/tjh.2011.97

TJH-ARALIK-2011-4-crossref.indd 109

02.12.2011 10:14

358

Sajid et al.

Overwhelming bone marrow Leishmaniasis

Turk J Hematol 2011; 28: 357-8

References 1.

2.

3.

4.

5.

6.

Figure 1. Visceral Leishmaniasis

TJH-ARALIK-2011-4-crossref.indd 110

Bhattacharya SK, Sur D, Karbwang J. Childhood visceral Leishmaniasis. Indian J Med Res. 2006;123:353-6.

Hewitt S, Reyburn H, Ashford R, Rowland M. Anthroponotic cutaneous Leishmaniasis in Kabul, Afghanistan: vertical distribution of cases in apartment blocks. Trans Roy Soc Trop Med Hyg 1998;92:273-4. [CrossRef] Dogra J. Cutaneous Leishmaniasis in India: Evaluation of oral drugs (dapsone vs itraconazole). Eur J Dermatol 1992;2:568-9.

Momeni AZ. Amin Javaheri M. Clinical picture of cutaneous Leishmaniasis in Isphahan, Iran. Int J Dermatol 1994;33:260-5. [CrossRef] Ahmad N, Burney MI, Wazir Y. A preliminary report on the study of kalaazar in Baltistan (West Pakistan). Pak Arm Force Med J 1960;10:1-10.

Yasnzai MM, Iqbal J, Kakar JK et al. Leishmaniasis in Pakistan: revisited. J Coll Physicians Surg Pak 1996;6:70-5.

02.12.2011 10:14

Advisory Board of This Issue (December 2011) Ahmet Öztürk, Turkey

Fahir Özkalemkaş, Turkey

Namık Özbek, Turkey

Akif Yeşilipek, Turkey

Fatma Gümrük, Turkey

Nejat Akar, Turkey

Ali Uğur Ural, Turkey

Güray Saydam, Turkey

Önder Yaman, Turkey

Alpay Azap, Turkey

Hakan Göker, Turkey

Reyhan Diz Küçükkaya, Turkey

Ayşen Timurağaoğlu, Turkey

Hale Ören, Turkey

Reyhan Öner, Turkey

Aytemiz Gürgey, Turkey

Hayri Özsan, Turkey

Rıdvan Ali, Turkey

Barış Kuşkonmaz, Turkey

Hülya Kayserili, Turkey

Semra Paydaş, Turkey

Burhan Turgut, Turkey

İbrahim Haznedaroğlu, Turkey

Tiraje Çelkan, Turkey

Cengiz Beyan, Turkey

Jawed Fareed, USA

Türkiz Gürsel, Turkey

Çiğdem Altay, Turkey

Mualla Çetin, Turkey

Ülker Koçak, Turkey

Duran Canatan, Turkey

Mustafa Nuri Yenerel, Turkey

Yurdanur Kılınç, Turkey

Ebru Koca, Turkey

Mutlu Arat, Turkey

Yusuf Baran, Turkey

Emel Özyürek, Turkey

Muzaffer Demir, Turkey

Zahit Bolaman, Turkey

TJH-ARALIK-2011-4-crossref.indd 111

02.12.2011 10:14

Announcements 10-13 December 2011 53rd ASH Annual Meeting and Exposition San Diego, USA 23-25 December 2011 Practical Basic Hematology Laboratory Course 1 2012 BMT Tandem Meetings 01.02.2012 -05.02.2012 San Diego, California http://bmt.confex.com/tandem/2012/webprogram/start.html ASH- 53rd Annual Meeting of the American Society of Hematology 10.12.2011 - 13.12.2011 San Diego, USA http://www.hematology.org/Meetings/Annual-Meeting/ 7. Bone Marrow Transplantation and Stem Cell Therapies Congress 08.03.2012-10.03.2012 Antalya, Turkey EBMT 2012 - 38th Annual Meeting of the European Group for Blood and Marrow Transplantation 01.04.2012 - 04.04.2012 Geneva, Switzerland http://www.congrex.ch/ebmt2012 ISH - 34th World Congress of the International Society of Hematology 25.04.2012 - 28.04.2012 Cancun, Mexico http://www.hematology2012.com/en/inicio.aspx

TJH-ARALIK-2011-4-crossref.indd 112

ASCO - 2012 Annual Meeting of the American Society of Clinical Oncology 01.06.2012 - 05.06.2012 Chicago, IL, USA http://www.asco.org/ASCOv2/Meetings/ Calendar+of+Events 18th Annual ISCT Meeting 05.06.2012 -08.06.2012 Seattle, WA, USA http://www.celltherapysociety.org/index.php/meetings-events ISSCR 11th Annual Meeting 13.06.2012- 16.06.2012 Yokohama Japan http://www.isscr.org/meetings/ EHA - 17th Congress of the Hematology Association 14.06.2012 - 17.06.2012 Amsterdam, the Netherlands http://www.ehaweb.org/Congress/Future-Congresses ESMO - 37th European Society of Medical Oncology 28.09.2012 - 02.10.2012 Vienna, Austria http://www.esmo.org/events/vienna-2012-congress.html SIOP - 44th Congress of the International Society of Paediatric Oncology 05.10.2012 - 08.10.2012 London, England http://www.siop2012.org/ ASH - Annual Meeting 07.12.2012 - 12.12.2012 Atlanta, GA, USA http://www.intercom.de/kongresse/index.html

02.12.2011 10:14

28th Volume Index 28. Cilt Dizini SUBJECT INDEX - KONU DİZİNİ March 2011 - December 2011 Mart 2011 - Aralık 2011 Acquired Hemophagocytic Lymphohistiocytosis (HLH) Brucellosis / Brusella, 68 Pancytopenia / Pansitopeni, 68 Hemophagocytosis / Hemofagositoz, 68 Acquired hemophagocytic lymphohistiocytosis / Edinsel hemofagositik lenfohistiositoz, 125 Infection-related HLH / Enfeksiyon ilişkili HLH, 125 Perforin / Perforin, 125 A91V mutation / A91V mutasyonu, 125 TNF- α / TNF- α, 125 Polymorphism / Polimorfizmi, 125 Acute Leukemia “Arbitrary” criterion for the diagnosis of acute leukemia / Akut lösemi tanısına yönelik “rastgele” kriter, 149 Acute Lymphoblastic Leukemias (ALL) Non-Hodgkin’s lymphoma / Non-Hodgkin lenfoma, 52 Leukemia / Lösemi, 52 Tumor lysis syndrome / Tümör lizis sendromu, 52 Hyperuricemia / Hiperürisemi, 52 Children / Çocuklar, 52 Methotrexate / Metotreksat, 63 Intrathecal / İntratekal, 63 Overdose / Yüksek doz, 63 Treatment / Tedavi, 63 Aeromonas sobria bacteriemia in an acute lymphoblastic leukemia case in remission / Remisyondaki akut lenfoblastik lösemi olgusunda Aeromonas sobria bakteriyemisi, 79 Adult acute lymphoblastic leukemia / Erişkin akut lenfoblastik lösemi, 176 Complete remission / Tam remisyon, 176 Karyotype / Karyotip, 176 Overall survival / Genel sağkalım, 176 Acute Myeloblastic Leukemia (AML) AML / AML, 103 hTERC / hTERC, 103 FISH / FISH, 103 ALL / ALL, 142 AML / AML, 142 Cup-like blast / Cup-like blast, 142 FLT3 ITD / FLT3 ITD, 142

TJH-ARALIK-2011-4-crossref.indd 113

Allogeneic Leukocytes Blood transfusions / Kan transfüzyonları, 160 Transfusion-related immunomodulation / Transfüzyon ile ilişkili immünomodülasyon, 160 Leukodepletion / Lökodeplesyon, 160 Infections / Enfeksiyonlar, 160 Mortality / Mortalite, 160 Cardiac surgery / Kardiyak cerrahisi, 160 Alpha thalassemia The incidence of alpha-thalassemia in Iraqi Turks / Irak Türklerinde alfa-talasemi sıklığı, 235 Antiphospholipid Antibody Syndrome Antiphospholipid syndrome / Antifosfolipid sendrom, 213 ADAMTS-13 / ADAMTS-13, 213 Gene expression / Gen ekspresyonu, 213 Autoimmune Blood Disease CTLA-4 A49G polymorphism and autoimmune blood disease: A comment / CTLA-4 A49G polimorfizmi ve otoimmün kan hastalığı: Bir yorum, 247 Autoimmune Hemolytic Anemia Critical care medicine / Kritik hasta tıbbı, 135 Therapeutic embolization / Terapötik embolizasyon, 135 Hemolytic anemia / hemolitik anemi, 135 Autoimmune hemolytic anemia / Otoimmün hemolitik anemi, 198 Evans syndrome / Evans sendromu, 198 Childhood / Çocukluk çağı, 198 Autoimmune lymphoproliferative syndrome / Otoimmün lenfoproliferatif sendrom, 198 Partial splenic embolization versus splenectomy for the management of autoimmune hemolytic anemia: A response / Otoimmün hemolitik anemi tedavisinde splenektomiye karşılık kısmi splenik embolizasyon: Bir yanıt, 250 Blood Transfusion Iron deficiency anemia / Demir eksikliği anemisi, 42 Total peroxide / Total peroksit, 42 Total antioxidant capacity / Total antioksidan kapasite, 42 Oxidative stres / Oksidatif stres, 42

02.12.2011 10:14

Chronic Lymphocytic Leukemia (CLL) CLL / KLL, 86 Genetics / Genetik, 86 Poor-risk / Yüksek risk, 86 Treatment / Tedavi, 86 Allogeneic stem cell transplantation / Allogeneik kök hücre transplantasyonu, 86 Chronic Myeloid Leukemia (CML) Chronic myeloid leukemia (CML) / Kronik myeloid lösemi (KML), 186 Variant Ph chromosome / Varyant Philadelphia kromozomu, 186 Cytogenetics / Sitogenetik, 186 Fluorescence in situ hybridization (FISH) / Floresan in situ hibridizasyon (FISH), 186 Imatinib / İmatinib, 232 Chronic myelocytic leukemia / Kronik miyeloid lösemi, 232 Non-Hodgkin’s lymphoma / Non-Hodgkin lenfoma, 232 Cytogenetics Adult acute lymphoblastic leukemia / Erişkin akut lenfoblastik lösemi, 176 Complete remission / Tam remisyon, 176 Karyotype / Karyotip, 176 Overall survival / Genel sağkalım, 176 Disorders of Platelets X-linked thrombocytopenia / X’e bağlı trombositopeni, 139 Wiskott-Aldrich syndrome / Wiskott Aldrich sendromu, 139 WASP gene / WASP geni, 139 Central retinal artery occlusion as the presenting sign of essential thrombocythemia / Eansiyel trombositeminin başvuru belirtisi olarak santral retinal arter tıkanıklığı, 146

Factor V Leiden / Faktör V Leiden, 299 Prothrombin / Prothrombin, 299 Methylenetetrahydrofolate / Methylenetetrahydrofolate, 299 Niemann-Pick / Niemann-Pick, 299 Gaucher / Gaucher, 299 Behcet’s syndrome / Behçet sendromu, 299 Thrombosis / Tromboz, 299 Chronic myeloproliferative disorders / Kronik myeloproliferatif hastalıklar, 306 Factor V Leiden mutation / Faktör V Leiden mutasyonu, 306 Prothrombin gene mutation / Protrombin gen mutasyonu, 306 Thrombosis / Tromboz, 306 The frequency of factor V G1691A (Leiden) mutation in Iraqi Turks / Irak Türklerinde faktör V G1691A (Leiden) mutasyon sıklığı, 348 The frequency of factor V G1691A (Leiden) mutation in the healthy Kazakh population / Sağlıklı Kazak popülasyonunda faktör V G1691A (Leiden) mutasyon sıklığı, 352 Febril Neutropenia Neutropenia / Nötropeni, 193 Fever / Ateş, 193 Emergency department / Acil servis, 193 Chemotherapy / Kemoterapi, 193 Hematogone Hematogones in the bone marrow of a child with Rubella virusassociated immune thrombocytopenic purpura concomitant with iron deficiency anemia / Demir eksikliği anemisine eşlik eden Rubella virüsüne bağlı immune trombositopenik purpuralı bir çocuğun kemik iliğindeki hematogonlar, 155 Hepatit C Iron deficiency anemia / Demir eksikliği anemisi, 42 Total peroxide / Total peroksit, 42 Total antioxidant capacity / Total antioksidan kapasite, 42 Oxidative stres / Oksidatif stres, 42

Eosinophilic Leukemia A chronic eosinophilic leukemia patient presenting with blurred vision / Bulanık görmeyle başvuran kronik eozinofilik lösemi hastası, 239 Scrotal abscess extending into the inguinal canal: A rare complication Hereditary Spherocytosis of multipl myeloma / İnguinal kanala uzanım gösteren skrotal abse: Interaction between hereditary spherocytosis and the betaMultipl miyelomun nadir bir komplikasyonu, 339 thalassemia trait: A case report / Kalıtsal sferositoz ve beta-talasemi taşıyıcılığı arasındaki etkileşim: Olgu sunumu, 153 Essential Thrombocythemia Acute thrombotic complication of essential thrombocythemia in a Immun Thrombocytopenic Purpura (ITP) young adult / Esansiyel trombositeminin genç erişkindeki akut Paclitaxel therapy and immune thrombocytopenic purpura: trombotik komplikasyonu, 350 Coincidence or association? / Paclitaxel tedavisi ve immun trombositopeni: Rastlantı mı, ilişki mi?, 151 Factor V Leiden Mutation Idiopathic thrombocytopenic purpura / İdiopatik trombositopenik Soluble endothelial protein C receptor (sEPCR) / sEPCR, 27 purpura, 170 Factor VIII / Factor VIII, 27 Childhood / Çocukluk çağı, 170 Healthy infants / Sağlıklı süt çocukları, 27 TNF- α / TNF- α, 170 Thrombosis / Tromboz, 27 TGF- β1 / TGF- β1, 170 Budd-Chiari syndrome / Budd- Chiari sendromu, 299 Polymorphism / Polimorfizm, 170 Thrombophilia / Thrombofili, 299

TJH-ARALIK-2011-4-crossref.indd 114

02.12.2011 10:14

Inherited Hematological Disorders DNA / DNA, 257 Population genetics / Populasyon genetiği, 257 Molecular anthropology / Moleküler antropoloji, 257 Factor V / Factor V, 257 Beta-thalassemia / Beta-thalassemia, 257 Sickle cell anemia / Orak hücre anemi, 257 Anatolia / Anadolu, 257 Inherited Platelet Disorders Blood platelet disorders / Trombosit hastalıkları, 294 Thrombocytopathy / Trombositopatiler, 294 Gingival hemorrhage / Dişeti kanaması, 294 Periodontal diseases / Periodontal hastalık, 294 Oral hygiene / Oral hijyen, 294 Dental caries / Diş çürükleri, 294 Iron deficiency Virology / Viroloji, 47 Transfusion / Transfüzyon, 47 Thalassemia / Talasemi, 47 Cytopenia associated with iron deficiency anemia and iron therapy: A report of two cases / Demir eksikliği anemisi ve demir tedavisi ile ilişkili sitopeni: İki olgu sunumu, 243 Iron deficiency anemia and total antioxidant capacity / Demir eksikliği anemisi ve toplam antioksidan kapasitesi, 248 Decreased erythrocyte catalase level in iron deficiency / Demir eksikliğinde eritrosit katalaz seviyesinin azalması, 249 A rare cause of iron deficiency anemia in a child: Lithobezoar / Çocuklarda demir eksikliği anemisinin nadir bir sebebi: Litobezoar, 252 An unusual cause of iron deficiency anemia in a healthy man: Hijamah / Sağlıklı bir erkekte demir eksikliği anemisinin nadir görülen bir nedeni: Hijamah, 254 Leishmania Overwhelming bone marrow Leishmaniasis / Kemik iliğinde yoğun Leishmaniasis, 357 Lymphocyte NK activity / NK aktivitesi, 33 Cord blood lymphocytes / Kordon kanı lenfositleri, 33 Flow cytometry / Flow sitometri, 33 Lymphomas Lymphoma / Lenfoma, 15 B-cell / B hücreleri, 15 Apoptosis / Apoptosis, 15 Proliferation / Proliferasyon, 15 Methylation / Metilasyon, 15 Non-Hodgkin’s lymphoma / Non-Hodgkin lenfoma, 52 Leukemia / Lösemi, 52 Tumor lysis syndrome / Tümör lizis sendromu, 52 Hyperuricemia / Hiperürisemi, 52

TJH-ARALIK-2011-4-crossref.indd 115

Children / Çocuklar, 52 A child with primary gastric lymphoma and cavernous sinus involvement / Primer mide lenfoması olan bir çocukta kavernöz sinüs tutulumu, 72 Imatinib / İmatinib, 232 Chronic myelocytic leukemia / Kronik miyeloid lösemi, 232 Non-Hodgkin’s lymphoma / Non-Hodgkin lenfoma, 232 Non-Hodgkin’s lymphoma in a hemophilic patient with a traumatic hematoma / Travmatik hematomu olan hemofilik hastada nonHodgkin lenfoma, 237 Behçet’s disease / Behçet hastalığı, 327 Malignant lymphoma / Malign lenfoma, 327 Radiotherapy / Radyoterapi, 327 Morbidity / Morbidite, 327 Unusual presentation of adrenal lymphoma observed with PET-CT / Adrenal lenfomanın PET-BT’deki ilginç görünümü, 337 Methemoglobinemia Methemoglobinemia / Methemoglobinemi, 131 Infant / İnfant, 131 Local anesthetics / Lokal anestezikler, 131 Sepsis / Sepsis, 131 Molecular Hematology Chronic myeloid leukemia / Kronik miyeloid lösemi, 97 Imatinib resistance / Imatinib direnci, 97 Mutation / Mutasyon, 97 dHPLC / dHPLC, 97 AML / AML, 103 hTERC / hTERC, 103 FISH / FISH, 103 Sickle cell disease / Orak hücre anemisi, 115 Nitric oxide / Nitrik oksit, 115 Nitric oxide synthase / Nitrik oksit sentetaz, 115 Gingival crevicular fluid / Dişeti oluğu sıvısı, 115 Gingiva / Dişeti, 115 Idiopathic thrombocytopenic purpura / İdiopatik trombositopenik purpura, 170 Childhood / Çocukluk çağı, 170 TNF- α / TNF- α, 170 TGF- β1 / TGF- β1, 170 Polymorphism / Polimorfizm, 170 A novel 110-bp insertion in a patient with homocysteinuria / Homosistinürili bir hastada ilk kez tanımlanan 110 BÇ’lik insersiyon, 354 Multiple Myeloma T Regulatory cells / T Regülatör hücreler, 107 Multiple myeloma / Multipl miyelom, 107 Autologous bone marrow transplantation / Otolog kemik iliği transplantasyonu, 107 CD200 / CD200, 107 Programmed death-1 / Programlı ölüm-1, 107

02.12.2011 10:14

Multiple myeloma with multilobated plasma cell nuclei / Çok çekirdekli plazma hücreli Multipl Miyelom, 158

Overdose / Yüksek doz, 63 Treatment / Tedavi, 63

Neoplasia Hematologic malignancies / Hematolojik malignitiler, 1 Leukemia / Lösemi, 1 Proteomics / Proteomiks, 1 Protein profiling / Protein profilleme, 1

Pharmacotherapeutics ARA-C associated pulmonary toxicity / ARA-C ilişkili akciğer toksisitesi, 81 Bleeding / Ankaferd, 206 Cardiovascular surgery / Kardiyovasküler cerrahi, 206 Hemostasis / Hemostaz, 206 Accidental intrathecal methotrexate overdose / İntratekal yüksek doz metotreksatın yanlışlıkla uygulanması, 245 Ankaferd® / Ankaferd®, 276 Endothelium / Endotel, 276 Transcription factors / Transkripsiyon faktörleri, 276 Erythrocyte / Eritrosit, 276

Other The association between calcium dobesilate and pancytopenia in type 2 diabetes: A case report / Tip 2 diyabet hastasında kalsiyum dobesilat ile pansitopeni ilişkisi: Bir olgu sunumu, 77 A survey of hematologists on compulsory health service in Turkey / Türkiye’de zorunlu hizmet görevi yapan hematoloji uzmanlarına yönelik bir anket çalışması, 335 Other Hemoglobinopathies Feasibility of four discriminant functions for identifying hemoglobin E disorders: Experience in 114 Thai pregnant subjects / Hemoglobin E bozukluklarını tanımlama için dört diskriminant fonksiyonun fizibilitesi: 114 Taylandlı hamile üzerinde deneyim, 75 Hb E-Saskatoon / Hb E-Saskatoon, 323 Hb G-Coushatta / Hb G-Coushatta, 323 First observation of hemoglobin Crete [Beta129(H7) Ala>Pro] in the Turkish population / Türk populasyonunda ilk gözlemlenen hemoglobin Crete [Beta129(H7)Ala>Pro], 344 Other Plasma Cell Dyscrasias Extramedullary / Ekstramedüller, 228 Plasmacytoma / Plazmasitom, 228 Mediastinal / Mediastinal, 228 Radiotherapy / Radyoterapi, 228 Blood platelet disorders / Trombosit hastalıkları, 312 Thrombocytopathy / Trombositopatiler, 312 Gingival hemorrhage / Dişeti kanaması, 312 Periodontal diseases / Periodontal hastalık, 312 Oral hygiene / Oral hijyen, 312 Dental caries / Diş çürükleri, 312 Other Therapies Bleeding / Ankaferd, 206 Cardiovascular surgery / Kardiyovasküler cerrahi, 206 Hemostasis / Hemostaz, 206 Paroxysmal Nocturnal Hemoglobinuria (PNH) Paroxysmal nocturnal hemoglobinuria / Paroksismal noktürnal hemoglobinüri, 223 Eculizumab / Ekulizumab, 223 Complement / Kompleman, 223 Hemolytic episode / Hemolitik atak, 223 Pediatric Hematologic Malignancies Methotrexate / Metotreksat, 63 Intrathecal / İntratekal, 63

TJH-ARALIK-2011-4-crossref.indd 116

Prothrombin Chronic myeloproliferative disorders / Kronik myeloproliferatif hastalıklar, 306 Factor V Leiden mutation / Faktör V Leiden mutasyonu, 306 Prothrombin gene mutation / Protrombin gen mutasyonu, 306 Thrombosis / Tromboz, 306 Sickle Cell Disease Sickle cell disease / Orak hücre anemisi, 115 Nitric oxide / Nitrik oksit, 115 Nitric oxide synthase / Nitrik oksit sentetaz, 115 Gingival crevicular fluid / Dişeti oluğu sıvısı, 115 Gingiva / Dişeti, 115 Stem Cell Transplation T Regulatory cells / T Regülatör hücreler, 107 Multiple myeloma / Multipl miyelom, 107 Autologous bone marrow transplantation / Otolog kemik iliği transplantasyonu, 107 CD200 / CD200, 107 Programmed death-1 / Programlı ölüm-1, 107 Prophylaxis / Profilaksi, 271 Antifungal / Antifungal, 271 Stem cell transplantation / Kök hücre nakli, 271 Storage Diseases Niemann-Pick disease / Niemann-Pick hastalığı, 84 Thalassemia Double heterozygosity of the thalassemic mutations term. Cd +6 C→G and IVS-I-110 in a Greek woman: A case presentation / Yunan bir kadında çift heterozigozit talasemik mutasyonlar terimi Cd +6 C → G ve IVS-I-110: Bir olgu sunumu, 341 (+T)] in the beta-globin gene / Türkiye’de beta globin geninde nadir olarak gözlenen ilk çerçeve kayması mutasyonu [codons 9/10 (+T)] raporu, 344

02.12.2011 10:14

Thrombosis Acute thrombotic complication of essential thrombocythemia in a young adult / Esansiyel trombositeminin genç erişkindeki akut trombotik komplikasyonu, 350 Thrombotic Disorders The frequency of FV G1691A and PT G20210A mutations in an Albanian population / Arnavut popülasyonunda FV G1691A ve PT G20210A mutasyonu sıklığı, 241 Vitamin B12 Deficiency Vitamin B12 deficiency / Vitamin B12 eksikliği, 286 Children / Çocuk, 286 Neurologic outcome / Nörolojik sonuçlar, 286 Involuntary movement / İstemsiz hareketler, 317 Vitamin B12 deficiency / B12 vitamini eksikliği, 317 Infant / Süt çocuğu, 317 Wiskott-Aldrich Syndrome X-linked thrombocytopenia / X’e bağlı trombositopeni, 139 Wiskott-Aldrich syndrome / Wiskott Aldrich sendromu, 139 WASP gene / WASP geni, 139 Beta thalassemia Iron deficiency anemia / Demir eksikliği anemisi, 42 Total peroxide / Total peroksit, 42

TJH-ARALIK-2011-4-crossref.indd 117

Total antioxidant capacity / Total antioksidan kapasite, 42 Oxidative stres / Oksidatif stres, 42 Virology / Viroloji, 47 Transfusion / Transfüzyon, 47 Thalassemia / Talasemi, 47 Extramedullary hematopoiesis / Ekstramedüller hematopoez, 60 PET CT / PET CT, 60 SUV max / SUV max, 60 Interaction between hereditary spherocytosis and the betathalassemia trait: A case report / Kalıtsal sferositoz ve beta-talasemi taşıyıcılığı arasındaki etkileşim: Olgu sunumu, 153 Mild β-thalassemia intermedia / Ilımlı tip beta-talasemi intermedia, 219 β-globin gene / Beta-globin geni, 219 HBB:c.*+96T>C / HBB:c.*+96T>C, 219 Beta-thalassemia / Beta-talasemi, 264 Mutation / Mutasyon, 264 Şanlıurfa / Şanlıurfa, 264 Turkey / Türkiye, 264 Tracing the footsteps of IVSI-130 G-C mutation of the human hemoglobin beta globin gene: From Şanlıurfa to Askeriye, Burdur, Turkey / İnsan hemoglobin beta globin genindeki IVSI-130 G-C mutasyonu izlerinin takibi: Şanlıurfa'dan Askeriye'ye, Burdur, Türkiye, 269

02.12.2011 10:14

28th Volume Index 28. Cilt Dizini AUTHOR INDEX - YAZAR DİZİNİ March 2011 - December 2011 Mart 2011 - Aralık 2011 Sara M. Abdelhakam, 299 Abbas Hashim Abdulsalam, 149 Işık Adalet, 335 Hamdi Akan, 271 Nejat Akar, 27, 170, 235, 241, 257, 276, 299, 346, 348, 354 Nilgün Akdeniz, 33 Elif Akdoğan, 254 Remzi Adnan Akdoğan, 254 Salih Aksu, 223 Esin Aktaş, 33 Safiye Aktaş, 107 Michael Alemayehou, 339 Vasiliki Aletra, 339 Kamelia V. Alexandrova, 176 Klodian Allajalebeu, 241 Suleimman Ahmad Al-Sweedan, 42 Çiğdem Altay, 125, 269 Bülent Altınoluk, 341 Yasemin Altuner Torun, 72, 252 Fevzi Altuntaş, 151 Khitam Amer, 42 Ruksan Anarat, 115 Muhlis Cem Ar, 186 Yusuf Ziya Aral, 317 Mutlu Arat, 339 Gül Arıkan, 146 Yunus Arıkan, 219 Çiğdem Arslan, 346 Şerife Hülya Arslan, 151 Mehmet Aslan, 47 Yakup Aslan, 131 A. Avni Atay, 241 Halil Ateş, 107 Ali Ayçiçek, 264 Gülden Aydoğ, 206 Ayvaz Aydoğdu, 317 Meltem Aylı, 77 Fatih Mehmet Azık, 170 Nebil Bal, 115

TJH-ARALIK-2011-4-crossref.indd 118

Günay Balta, 125 Vivek Bansal, 228 Yusuf Baran, 1 Faruk Barlık, 155 Sevgi Başkan, 27 Ali Bay, 139 Birol Baytan, 52, 286 Ritu Bhutani, 228 Türker Bilgen, 219 Sema Bilgiç, 33 Yavuz M. Bilgin, 160 Hasan Bilinç, 264 Elif Birtaş Ateşoğlu, 142 Can Boğa, 115 Zahit Bolaman, 312 Meltem Bor, 243 Berna Bozkurt Duman, 232 Anneke Brand, 160 Tuğçe Bulakbaşı Balcı, 103 Yahya Büyükaşık, 223, 294 Bilge Can, 327 Duran Canatan, 219 Vildan Caner, 15 Tiraje Celkan, 84, 237, 243 Aylin Cesur, 77 Mustafa Cesur, 77 Richa Chauhan, 153 Woong Gil Choi, 193 Seçkin Çağırgam, 306 Suar Çakı Kılıç, 198 Suzin Çatal, 97 Emre Çeçen, 317 Demet Çekdemir, 306 Hakim Çelik, 47 M. Murat Çelik, 344 Mualla Çetin, 125 Bilin Çetinkaya Çakmak, 317 Ayşe Çırakoğlu, 186 Eren Çimen, 125 Ümit Çobanoğlu, 158

Mehmet Akif Çürük, 323 Metin Demirkaya, 52 Günnur Deniz, 33 Ayhan Deviren, 186 Emel Dikicioğlu Çetin, 312 Fuat Dilmeç, 264 Nadya E. Dimitrova, 176 Ivanka I. Dimova, 176 Reyhan Diz Küçükkaya, 213 Yeşim Doğan Alakoç, 257 Ayhan Dönmez, 306 Peter Dreger, 86 Ahmet Candan Durak, 72 Feride Duru, 155 Mine Durusu Tanrıöver, 135 Ender Düzcan, 15 Füsun Düzcan, 15 Didem Efendioğlu, 125 Yonca Eğin, 27, 17, 241, 299, 348 Hüseyin Atakan Ekiz, 1 Solaf M. Elsayed, 299 Ezzat S. Elsobky, 299 Gonca Erbaş, 81 Ayşe Erbay, 63 Yücel Erbilgin, 97 Ayşe Pınar Erçetin, 107 Ela Erdem, 68 Elçin Erdoğan, 79 Şahin Erdöl, 286 Erol Erduran, 131 Mustafa Eren, 286 Begüm Ergan Arsava, 135 Ülkü Ergene, 239 Melek Ergin, 232 Ayşe Betül Ergül, 252 Nergiz Erkut, 158 Zuhal Eroğlu, 306 Sibel Ertek, 77 Gaye Erten, 33 Arjan Esmael, 235, 348

Ahmet Emre Eşkazan, 97, 186 Sema Aylan Gelen, 198 Ahmet Genç, 323 Tawhida Y. Abdel Ghaffar, 299 Hakan Göker, 206, 223 Gülfiliz Gönlüşen, 60 Emel Gönüllü, 142 Şükrü Güleç, 276 Hüseyin Gülen, 63 Fatma Gümrük, 125 Nurşen Günaydın, 68 Kaan Gündüz, 354 Adalet Meral Güneş, 52, 286 Ramazan Güneşaçar, 344 Müjgan Güngör Hatipoğlu, 294 Aytemiz Gürgey, 125 Bilge Gürsel, 327 Esra Güzeldemir, 115 Abdullah Hacıhanefioğlu, 142 Seniha Hacıhanefioğlu, 186 Hazem Haddad, 42 Evgueniy A. Hadjiev, 176 Veysel Sabri Hançer, 213 Özden Hatırnaz, 97 Wail Hayajneh, 42 İbrahim C. Haznedaroğlu, 206, 223, 276 Mine Hekimgil, 15, 312 Kenichi Honma, 139 Mehmet Horoz, 47 Talia İleri, 170, 354 Gül İlhan, 79 Kohsuke İmai, 139 Said Jaradat, 42 Füruzan Kacar Döger, 312 Gürhan Kadıköylü, 312 Selda Kahraman, 146, 346 Bedri Kandemir, 327 Nazım Kankılıç, 339 Özden Kansu, 294

02.12.2011 10:14

Yasemin Karacan, 223 Nedim Karagenç, 15 Olga Karakasidou, 341 Sema Karakuş, 79, 352 Musa Karakükçü, 350 Serap Karaman, 84 Elif Kazancı, 63 Rejin Kebudi, 243 İbrahim Keser, 219 Hakan Keski, 142 Hoon Kim, 193 Kyung Hwan Kim, 193 Ahmet Koç, 264 Abdurrahman Koçyiğit, 264 Buket Kosova, 306 Vildan Koşan Çulha, 170 Stella Kotsiopoulou, 341 Gaurav Kumar, 228 Meltem Kurt Yüksel, 151 Dilhan Kuru, 186 Ali Şahin Küçükarslan, 306 Göksel Leblebisatan, 139 Moon Hee Lee, 193 Joo Han Lim, 193 Sonal Jain Malhotra, 153 Fabienne Mc Clanahan, 86 Anurag Mehta, 228 Özgür Mehtap, 142 Süleyman Men, 146 Ahmet Deniz Meydan, 327 Noriko Mitsuiki, 139 Mehmet Mutlu, 131 Shigeaki Nonoyama, 139 Osamu Ohara, 139

TJH-ARALIK-2011-4-crossref.indd 119

Emel Okulu, 170 Hamza Okur, 125 Şeniz Öngören, 186 Demircan Özbalcı, 239 Namık Özbek, 245 Nilgün Özbek, 327 Uğur Özbek, 97 Mehmet Ali Özcan, 107 Osman İlhami Özcebe, 223 Mehmet Akif Özdemir, 72 Nihal Özdemir, 237, 243 Özlem Özdemir, 286 Zeynep Canan Özdemir, 264 Meltem Özdoğan Uslu, 312 Özge Özer, 103 Fuat Özkan, 339 Zeynep Gözde Özkan, 337 Hayri Özsan, 346 Nazan Özsan, 15, 312 Şinasi Özsoylu, 249 Ayşenur Öztürk, 235 Sertan Özyalçın, 206 Emel Özyürek, 155, 245 Nara Paritpokee, 75 Türkan Patıroğlu, 72, 252 Semra Paydaş, 60, 232 Vasilios Perifanis, 341 Bora Peynircioğlu, 135 Özden Pişkin, 107, 146 Adnan Qureshi, 357 Sefa Resim, 339 Ali Osman Saatci, 146 Raihan Sajid, 357 Mohamed A. Sakr, 299

Özoğul Sargın, 60 Nazan Sarper, 198 Güray Saydam, 306 Nilgün Sayınalp, 223 Betül Sevinir, 52 Melike Sezgin Evim, 286 Jai Sharma, 228 Sunita Sharma, 153 Dong Wun Shin, 193 Arpana Shukla, 228 Surinder Solanki, 228 Nur Soyer, 306 Teoman Soysal, 97, 186 Mehmet Sönmez, 158 Jamsai Suwansaksri, 75 Fahri Şahin, 306 Feride İffet Şahin, 103, 350 Yasemin Şanlı, 337 Gülşan Şanlı-Mohamed, 1 Ekin Şavk, 312 Nilay Şen Türk, 15 Filiz Şimşek Orhon, 27 Yelda Tarkan Argüden, 186 Hakkı Taştan, 352 Fatma Tekin, 223 Mustafa Tekin, 241 Stamatia Theodoridou, 341 Murat Tombuloğlu, 306 Draga I. Toncheva, 176 Ayşegül Topal Sarıkaya, 213 Arzu Topeli İskit, 135 Selami Koçak Toprak, 250, 350 Didem Torun, 276, 354 Edip Torun, 72, 252 Ayşe Tosun, 317

Mahmut Töbü, 306 Nilüfer N. Turan, 206 Taylan Turan, 1 Nur Hilal Turgut, 107 Emine Türkan, 237 Cüneyt Türkmen, 337 Gülsan Türköz Sucak, 81 Betül Ulukol, 27 A. Tulga Ulus, 206 Fatma Ulus, 206 Hilal Uslu Toygar, 115 Zümrüt Uysal, 170 Burak Uz, 223 Birsen Ülkü, 186 Şule Ünal, 125 Bülent Ündar, 146 Ümmügül Üyetürk, 151 Milena Georgieva Velizarova, 176 Canan Vergin, 63 Filiz Vural, 306 Viroj Wiwanitkit, 75, 247, 248 Münci Yağcı, 81 Harun Yazgan, 239 Zeynep Arzu Yegin, 81, 337 Mustafa Nuri Yenerel, 337 Akif Yeşilipek, 219 Yıldız Yıldırmak, 68 İnci Yıldız, 243 Erkan Yılmaz, 276 Şükriye Yılmaz, 186 Zerrin Yılmaz, 103 Said Yousuf, 299 Ayşe Yurt, 237 Zeynep Filiz Zadeoğluları, 107 Emine Zengin, 198

02.12.2011 10:14