tjh-2012-1 by LookUs Scientific

Review

DOI: 10.5505/tjh.2012.10327

Supportive Care in Hemato-Oncology: A Review in Light of the Latest Guidelines Hemato-Onkolojide Destek Tedaviler: Son Kılavuzlar Işığında Gözden Geçirme Eren Gündüz1, Zafer Gülbaş2 Eskişehir Osmangazi University, School of Medicine, Department of Hematology, Eskişehir, Turkey Anadolu Health Center, Bone Marrow Transplantation Center, Kocaeli, Turkey

1 2

This study received no financial support. The authors have no commercial, proprietary, or financial interest in any drug, device, or equipment mentioned herein.

Abstract Recent developments in cancer therapy have resulted in increases in treatment success rates and survival. One of the basic goals of such therapy is improving patient quality of life. Chemotherapy protocols for solid or hematological malignancies-most of which include multiple agents-negatively impact patient quality of life. Additionally, there have been developments in supportive care, which seeks to ameliorate or minimize the negative effects of chemotherapy. Herein we present a review and brief summarization of some of the agents used for supportive care in cancer patients in light of the latest guidelines..

Key Words: Hematology, Supportive care, Nausea/vomiting, Anemia, Neutropenia

Özet Son yıllarda kanser tedavisi alanında sağlanan gelişmeler hastaların tedavi şanslarının artması ve yaşam sürelerinde uzama ile sonuçlanmıştır. Bu sıkıntılı tedavi sürecinde yaşam kalitesinin arttırılması temel hedeflerden biri olmalıdır. Solid ya da hematolojik maligniteler için verilen çoğu çoklu ajanlar içeren kemoterapi protokolleri hastaların yaşam kalitesini olumsuz etkiler. Bu olumsuz etkilerden hastayı kurtarmak ya da en az hasar görmesi sağlamak amacıyla yapılan destek tedavilerde de gelişmeler vardır. Bu derlemede, destek tedavi olarak verilen bu ajanlardan bazılarını en son kılavuzlar ışığında kısaca özetledik.

Anahtar Sözcükler: Hematoloji, Destek tedavi, Bulantı-kusma, Anemi, Nötropeni Introduction Supportive care aims to ameliorate the adverse effects of chemotherapy, and to prevent reductions in the chemotherapy dose and delays in its schedule. These adverse effects include nausea/vomiting, diarrhea, constipation, pain, infections, cytopenia, allergic reactions, mucositis,

osteoporosis, and neuropathy. Cancer patient quality of life increases with supportive care. The success of treatment increases along with the level of treatment compliance. Supportive care is critical in intolerant and elderly patients with multiple comorbidities. Chemotherapy and/ or radiotherapy target the disease, whereas patient quality

Address for Correspondence: Zafer Gülbaş, M.D., Anadolu Sağlık Merkezi Cumhuriyet mah. 2255 sok. No: 3, 41400 Gebze, Kocaeli, Turkey Phone: 444 42 76 E-mail: zafer.gulbas@anadolusaglik.org Received/Geliş tarihi : February 6, 2011 Accepted/Kabul tarihi : May 17, 2011

Gündüz E and Gülbaş Z: Supportive Care in Hemato-Oncology

of life is the target of supportive care. Physicians sometimes overlook developments in supportive care, as they primarily concentrate on disease-targeted therapy. Herein we present a review of supportive care in light of the latest guidelines, focusing only on nausea/vomiting, anemia, and myeloid growth factors, as each side effect of cancer treatment warrants individual attention. Chemotherapy-Induced Nausea/Vomiting Chemotherapy-induced nausea/vomiting (CINV) is a common adverse event associated with cancer treatment that occurs in 70%-80% of patients undergoing chemotherapy. CINV results in significant morbidity and negatively affects quality of life [1,2]. The risk of CINV is associated with the type of chemotherapy, and increases with age <50 years, female gender, a history of CNIV during chemotherapy, pregnancy-induced nausea/vomiting, a history of motion sickness, and anxiety [3,4]. Chemotherapeutic agents cause vomiting via activation of neurotransmitter receptors located in the chemoreceptor trigger zone, gastrointestinal tract, and vomiting center. Serotonin, substance P, and dopamine receptors are the primary neuroreceptors involved in the emetic response [5]. CINV is classified into 5 categories: acute, delayed, anticipatory, breakthrough, and refractory. Acute-onset CINV refers to nausea and/or vomiting that occurs within 24 h of chemotherapy administration [3]. Nausea and/or vomiting that develop >24 h after chemotherapy administration is known as delayed emesis [2]. Anticipatory nausea and/or vomiting occur prior to the administration of next chemotherapy; because it is a conditioned response, it can occur only after a negative past experience with chemotherapy [6]. Vomiting that occurs within 5 d of prophylactic antiemetic use or requires rescue antiemetic treatment is known as breakthrough emesis. Vomiting in response to subsequent chemotherapy cycles that follow failed prophylactic and/or rescue antiemetic treatment during previous cycles is known as refractory emesis [7]. Antiemetic Agents 1. Dopamine Receptor Antagonists Dopamine receptors are located in the chemoreceptor trigger zone and dopamine receptor antagonists primarily affect this area; however, high doses of dopamine receptor blockades result in extrapyramidal reactions, disorientation, and sedation, which limit the clinical use of such agents, including phenothiazines and butyrophenones (droperidol and haloperidol) [8].

Turk J Hematol 2012; 29: 1-9

2. Serotonin (5-HT3) Receptor Antagonists Serotonin receptors—specifically 5-HT3 receptors—are present in the central nervous system and gastrointestinal tract. First-generation 5-HT3 receptor antagonists (azasetron, dolasetron, granisetron, ondansetron, ramosetron, and tropisetron) are equally effective and toxic when used at the recommended doses, and differ only in terms of cost. The primary symptoms of their toxicity are mild headache, constipation, and occasional diarrhea. The second-generation 5-HT3 receptor antagonist palonosetron might more effectively control delayed CINV than the first-generation 5-HT3 receptor antagonists [8]. 3. Dopamine-serotonin Receptor Antagonists Metoclopramide has antiemetic properties, both at low doses as a dopamine antagonist and at high doses as a serotonin antagonist. Use of a relatively high dose (20 mg t.i.d. p.o.) may result in sedation and extrapyramidal side effects [9,10]. 4. Substance P (Neurokinin-1) Receptor Antagonists Substance P is a mammalian tachykinin in the vagal afferent neurons that innervate the brainstem nucleus tractus solitarius, which sends impulses to the vomiting center. Substance P induces vomiting and binds to neurokinin 1 (NK-1) receptors in the abdominal vagus, the nucleus tractus solitarius, and the area postrema. Compounds that block NK-1 receptors, including vofopitant, CP-122,721, CJ-11,794, fosaprepitant (L758,298), aprepitant (MK869), and casopitant, reduce emesis following cisplatin, ipecac, apomorphine, and radiation therapy [8,11]. 5. Corticosteroids Corticosteroids have been shown to be effective in the prevention of CINV, although their antiemetic mechanism of action remains unknown. The control of CINV is markedly enhanced when corticosteroids are used in combination with 5-HT3 and NK-1 receptor antagonists [12,13]. The most widely used corticosteroid antiemetic is dexamethasone [8]. 6. Olanzapine Olanzapine is an antipsychotic that blocks multiple neurotransmitters, including dopamine at the D1, D2, D3, and D4 brain receptors, serotonin at the 5-HT2a, 5-HT2c, 5-HT3, and 5-HT6 receptors, catecholamines at alpha 1 adrenergic receptors, acetylcholine at muscarinic receptors, and histamine at H1 receptors [14,15]. Common side effects are sedation, weight gain, and an association with the onset of diabetes mellitus [16-18]. Olanzapine’s anti-

Turk J Hematol 2012; 29: 1-9

Gündüz E and Gülbaş Z: Supportive Care in Hemato-Oncology

emetic property is due to its activity at multiple receptors involved in nausea and emesis [8]. 7. Gabapentin The anticonvulsant gabapentin has been reported to reduce delayed nausea in a small number of patients undergoing adjuvant chemotherapy for breast cancer; however, additional research is necessary to determine its efficacy more precisely [19]. 8. Cannabinoids Cannabinoid receptors of the CB1 type are present in the area postrema, nucleus tractus solitarius, and dorsal motor nucleus, which are key sites of emetogenic control in the brainstem. Cannabinoid CB2 receptors are present on brainstem neurons and may play a role in mediating the effects on emesis [20,21]. Dronabinol and nabilone have been approved by the US FDA for use in CINV refractory to conventional antiemetic therapy, but the role of cannabinoids in the prevention of CINV remains to be established [22]. Clinical Management of CINV

Neurokinin 1 antagonist Aprepitant 125 mg p.o. on d 1 and 80 mg d–1 p.o. on d 2-3 or Fosaprepitant 115 mg IV on d 1 only, and then aprepitant 80 mg d–1 p.o. on d 2-3 ± Lorazepam 0.5-2 mg p.o. or IV ± H2 blocker or proton pump inhibitor 2. Emesis Prevention for Moderate Emetic Risk Intravenous Chemotherapy Day 1 Serotonin (5-HT3) antagonist Dolasetron 100 mg p.o., 1.8 mg kg–1 IV, or 100 mg IV (category 1) or Granisetron 1-2 mg p.o., 1 mg b.i.d. p.o. (category 1), or 0.01 mg kg–1 (maximum: 1 mg) IV, or

All of the following recommendations are those of the National Comprehensive Cancer Network (NCCN) Practice Guidelines in Oncology v.2.2010 [23].

Ondansetron 16-24 mg p.o. or 8-12 mg (maximum: 32 mg d–1) IV (category 1)

1. Emesis Prevention For High Emetic Risk Intravenous Chemotherapy

Palonosetron 0.25 mg IV on d 1 only

Data for post-cisplatin (≥50 mg m–2) emesis prevention category 1; others are category 2A.

and

Serotonin (5-HT3) antagonist

Dexamethasone 12 mg p.o. or IV

Dolasetron 100 mg p.o. or 1.8 mg kg IV on d 1 –1

Steroid with/without

Neurokinin 1 antagonist

Granisetron 2 mg p.o., 1 mg b.i.d. p.o., or 0.01 mg kg (maximum: 1 mg) IV on d 1

–1

or Ondansetron 16-24 mg p.o. or 8-12 mg (maximum: 32 mg d–1) IV on d 1

Aprepitant 125 mg p.o. Fosaprepitant 115 mg IV on d 1 only ± Lorazepam 0.5-2 mg p.o. or IV ± H2 blocker or proton pump inhibitor

Day 2-3

Palonosetron 0.25 mg IV on d 1

Serotonin (5-HT3) antagonist monotherapy

and

Dolasetron 100 mg d–1 p.o. , 1.8 mg kg–1 IV, or 100 mg IV,

Steroid

Dexamethasone 12 mg p.o. or IV on d 1 and 8 mg d–1 p.o. on d 2-4

Granisetron 1-2 mg d–1 p.o., 1 mg b.i.d. p.o., or 0.01 mg kg–1 (maximum: 1 mg) IV

and

Gündüz E and Gülbaş Z: Supportive Care in Hemato-Oncology

Turk J Hematol 2012; 29: 1-9

Ondansetron 8 mg b.i.d. p.o., 16 mg d–1 p.o., or 8 mg (maximum: 32 mg d–1) IV or

Serotonin (5-HT3) antagonist Dolasetron 100 mg d–1 p.o., 1.8 mg kg–1 IV, or 100 mg IV

Steroid monotherapy

Granisetron 1-2 mg d–1 p.o., 1 mg b.i.d. p.o., or 0.01 mg kg–1 (maximum: 1 mg) IV

Dexamethasone 8 mg d–1 p.o. or IV

Ondansetron 16 mg d–1 p.o. or 8 mg d–1 IV

Steroid

Neurokinin 1 antagonist ± steroid Aprepitant 80 mg p.o. ± dexamethasone 8 mg d p.o. or IV –1

± Lorazepam 0.5-2 mg p.o. or IV ± H2 blocker or proton pump inhibitor 3. Emesis Prevention for Low and Minimal Emetic Risk Intravenous Chemotherapy No routine prophylaxis is recommended for minimal emetic risk intravenous chemotherapy. Dexamethasone 12 mg d–1 p.o. or IV or Metoclopramide 10-40 mg or IV, and then every 4 or 6 h or Prochlorperazine 10 mg p.o. or IV, and then every 4 or 6 h ± Lorazepam 0.5-2 mg p.o. or IV every 4 or 6 h ± H2 blocker or proton pump inhibitor 4. Breakthrough Treatment for CINV The general principle is to add 1 agent of a different class to the current regimen. Antipsychotic Haloperidol 1-2 mg p.o. every 4-6 h Olanzapine 2.5-5 mg b.i.d. p.o. (category 2B) Benzodiazepine Lorazepam 0.5-2 mg p.o. every 4 or 6 h Cannabinoid Dronabinol 5-10 mg every 3 or 6 h Nabilone 1-2 mg b.i.d. p.o. Dopamine receptor antagonist Metoclopramide 10-40 mg p.o. or IV every 4 or 6 h Phenothiazine Prochlorperazine 10 mg p.o. or IV every 4 or 6 h Promethazine 12.5-25 mg p.o. or IV every 4 h

Dexamethasone 12 mg d–1 p.o. or IV 5. Anticipatory Emesis Prevention/Treatment Alprazolam 0.5-2 mg t.i.d. p.o. beginning the night before treatment or Lorazepam 0.5-2 mg p.o. on the night before and morning of treatment Cancer and Chemotherapy-Induced Anemia Anemia is a frequent complication of cancer and occurs in 30%-90% of patients [24]. At the time of diagnosis 30%-40% of patients with non-Hodgkin’s lymphoma or Hodgkin’s lymphoma, and ≤70% of patients with multiple myeloma are anemic; rates are higher among patients with myelodysplastic syndromes. Among patients with solid cancers or lymphomas, ≤50% develop anemia following chemotherapy [25]. Anemia is a frequent cause of morbidity and might increase mortality [26]. Tumor cells activate the immune system of the host and a number of cytokines are produced. This inflammatory response affects erythropoietin production, suppresses burst-forming unit-erythroid, and colony-forming uniterythroid, and impairs iron utilization. Tumor cells may also decrease erythrocyte survival either via tumor necrosis factor or by causing erythrophagocytosis [27]. Nutritional deficiency, hemolysis, bleeding, hereditary diseases, renal insufficiency, and anemia of chronic disease can also contribute to anemia in cancer patients [28,29]. The myelosuppressive effects of chemotherapy and radiation therapy are also significant factors associated with anemia [30,31]. Anemia can be corrected by treating the underlying etiology, transfusion with packed red blood cells, or erythropoiesis stimulating agents, with or without iron supplementation. The NCCN concurs that a hemoglobin level ≤11 g dL–1 in cancer patients should be investigated. In patients with a high baseline level, a drop of ≥ 2g dL–1 should also be assessed. There are 3 general anemia categories described by the NCCN:

Turk J Hematol 2012; 29: 1-9

1. Asymptomatic anemia without significant comorbidity, for which observation and periodic reevaluation are appropriate; 2. Asymptomatic anemia with comorbidity or high risk, for which transfusion should be a consideration; 3. Symptomatic anemia, for which transfusion should be performed. If the hemoglobin level decreases following chemotherapy, transfusion may be appropriate even in the absence of symptoms or significant comorbidity [23]. Packed red blood cell (PRBC) transfusion is the only treatment option in patients that require immediate correction of anemia. Risks associated with PRBC transfusion include transfusion-related reactions, congestive heart failure, bacterial contamination, viral infections, iron overload, and an increase in thrombotic events [32]. Administration of erythropoiesis-stimulating agents (ESAs) decrease the need for PRBC transfusion in cancer patients undergoing chemotherapy [33-35]; however, there are risks associated with ESA therapy, including an increase in mortality, and an increase in tumor progression of breast cancer [36], head and neck cancer [37], cervical cancer [38], non-small cell lung cancer [39], nonmyeloid cancer [40], and lymphoid malignancy [41]. Elevated thromboembolic risk has also been associated with ESA treatment [42-44]. Hypertension/seizures and pure red cell aplasia 90% of occured with epoetin alfa have also been reported in chronic renal failure [23]. In addition to safety concerns, ESAs also have considerable impact on healthcare financial resources [45]. Historically, ESA treatment strategies were designed to achieve and maintain hemoglobin levels >12 g dL–1, decrease the need for transfusion, and improve patient quality of life [46]. In 2008 the US FDA prohibited use of ESAs in cancer patients seeking cure. Reimbursement is limited to patients with hemoglobin levels <10 g dL–1 [25]. The University of Texas MD Anderson Cancer Center mandates that following initial administration of ESAs, subsequent doses be given only to those with a hemoglobin level <11 g dL–1, leading to intermittent treatment versus the once standard continuous treatment pattern [47]. Myelodysplastic syndrome patients with low intermediate-1 IPSS risk, hemoglobin <10 g dL–1, and serum erythropoietin <500 mIU mL–1 should be considered for ESA treatment [48]. According to the package insert dosing schedule, the initial dose of epoetin alfa is 150 U kg–1 t.i.w; the dose can

Gündüz E and Gülbaş Z: Supportive Care in Hemato-Oncology

be increased to 300 U kg–1 t.i.w. if there is no response after 4 weeks. The initial dose of epoietin beta is 30,000 IU week–1 and the dose can be increased to 60,000 IU week–1 in there is no response after 4 weeks. The initial dose of darbepoetin alfa is 2.25 µg kg–1 QWK; the dose can be increased to 4.5 µg kg–1 QWK if there is no response. The dose should be adjusted individually for each patient, so as to maintain the lowest hemoglobin level sufficient to avoid red blood cell transfusion. If the hemoglobin level is such that transfusion is unnecessary or increases >1 g dL–1 in any 2 week period the epoetin alfa or epoetin beta dose should be reduced by 25%, and the darbepoetin alfa dose should be reduced by 40%. If ferritin is ≤800 ng mL–1 and transferrin saturation is <20%, IV iron supplementation should be considered along with erythropoietin therapy; however, patients with active infection should not receive IV iron therapy. IV Iron dextran 100 mg is administered over the course of 5 min QWK for 10 doses or as a 1-g infusion administered during the course of several hours. Ferric gluconate is administered as 125 mg IV over the course of 60 min QWK for 8 doses or as 200 mg IV over the course of 3-4 h repeated every 3 weeks for 5 doses. Iron sucrose is given as 200 mg IV over the course of 60 min every 2-3 weeks or as 200 mg IV over the course of 2-5 min every 1-4 weeks [23]. Myeloid Growth Factors Myelosuppression is the major dose-limiting toxicity associated with many chemotherapy regimens and can also result in chemotherapy schedule delay, compromising the effectiveness of chemotherapy [49-52]. Infections associated with neutropenia may be accompanied by sepsis and occasionally death. Severe myelosuppression is accompanied by impaired quality of life, even in the absence of fever [53]. Myeloid growth factors stimulate proliferation of neutrophil progenitors and enhance neutrophil function. The use of myeloid growth factors is designed to reduce the duration of myelosuppression and the depth of neutropenia, and decrease the likelihood of infection [54]. A meta-analysis of myeloid growth factors trials reported that there were significant reductions in severe neutropenia, neutropenic fever, and infections in patients treated for non-Hodgkin’s lymphoma and Hodgkin’s lymphoma [55]. Trials of myeloid growth factors in patients treated for acute leukemia indicate they can reduce the duration of both neutropenia and hospitalization during induction therapy; however, their benefit is modest, and remission and survival rates associated with their use are inconsistent. The concern that using myeloid growth fac-

Gündüz E and Gülbaş Z: Supportive Care in Hemato-Oncology

tors may interfere with the evaluation of remission may be dealt with delaying the start of growth factors until after the day 14 bone marrow and stopping at neutrophil recovery several days prior to performing the bone marrow biopsy to assess remission. Stimulation of leukemic cell proliferation has not been observed in clinical trials. Recruitment leukemia into cycling, making the leukemia cells more sensitive to chemotherapy, has also not demonstrated convincing evidence of clinical benefit. Thus, use of granulocyte colony-stimulating factor (G-CSF) in patients with acute leukemia should be based only on preventing neutropenic complications. During post-remission consolidation therapy the benefits may be more substantial [54,56]. The most common toxicity associated with G-CSF therapy is mild-to-moderate bone pain, which is usually effectively controlled with non-narcotic analgesics. There have also been reports of splenic rupture in patients treated with G-CSF [54]. A retrospective review reported that a high rate of bleomycin toxicity has been linked to G-CSF use in Hodgkin’s lymphoma patients receiving bleomycincontaining therapy [57]. Some patients develop allergic skin, respiratory system, and cardiovascular system reactions [58]. Primary prophylaxis is achieved via administration of myeloid growth factors during the initial chemotherapy cycle, in anticipation of the risk of neutropenic complications. The use of prophylactic myeloid growth factors is recommended for solid tumor/lymphoma patients that have ≥20% likelihood of developing fever; in patients with a 10%-20% risk of fever G-CSF should be considered if there are additional risk factors (advanced age, history of chemotherapy or radiotherapy, and pre-existing neutropenia, or tumor involvement in the bone marrow, poor performance status, and comorbidity, including renal and liver dysfunction). G-CSF should not be routinely used in patients with a <10% risk of fever. According to American Society of Clinical Oncology (ASCO) guidelines, secondary prophylaxis with G-CSF should be considered if maintaining the dose intensity is considered to be important [59-62]. Compared to its prophylactic use, there is less evidence supporting the therapeutic use of G-CSF for febrile neutropenia as an adjunct to antibiotics [63-65]. Patients with febrile neutropenia given prophylactic filgrastim or sargramostim should continue with G-CSF therapy; however, as pegfilgrastim is long acting patients given prophylactic pegfilgrastim should not be treated with additional G-CSF [66]. Currently, there is a lack of evidence sup-

Turk J Hematol 2012; 29: 1-9

porting the therapeutic use of pegfilgrastim; therefore, only filgrastim or sargramostim should be administered in the therapeutic setting. In patients that have not received prophylactic G-CSF the NCCN recommends evaluating the risk factors for infection-related complications or poor clinical outcome, including advanced age (>65 years), sepsis syndrome, severe (absolute neutrophil count <100 µL) or anticipated prolonged (>10 d) neutropenia, pneumonia, invasive fungal infection or other clinically documented infections, hospitalization, and a history of febrile neutropenia. If risk factors are present G-CSF should be considered. Myeloid growth factors currently used for the prophylaxis of febrile neutropenia and maintenance of scheduled dose delivery include filgrastim, pegfilgrastim (category 1), and sargramostim (category 2B). Filgrastim treatment is initiated within 1-3 d after the completion of chemotherapy at a dose of 5 µg·kg–1·d–1 until post nadir absolute neutrophil count (ANC) recovery is normal or near normal, according to laboratory standards. The dose may be rounded to the nearest vial site by intitution defined weight limits. Moreover, evidence exists that supports the initiation of pegfilgrastim 24 h after completion of chemotherapy, administered every 3 weeks at a dose of 6 mg for each chemotherapy cycle. Same-day administration of filgrastim or pegfilgrastim (within 24 h of the completion of chemotherapy) is not recommended [67,68] Conclusion By means of all summarized supportive care interventions we are able to better treat our patients, prolong their survival and decrease complications of cancer chemotherapy. New therapies may add new complications but supportive care is also improving. If we know the complications of our therapy we can be able to choose the suitable supportive care intervention to increase the quality of life. Supportive care must be a more essential part of main therapy in the future. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Cohen L, de Moor CA, Eisenberg P, Ming EE, Hu H: Chemotherapy-induced nausea and vomiting: Incidence and impact on patient quality of life at community oncology settings. Support Care Cancer 2007; 15: 497-503

Turk J Hematol 2012; 29: 1-9

2. Bloechl-Daum B, Deuson RR, Mavros P, Hansen M, Herrstedt J: Delayed nausea and vomiting continue to reduce patients’ quality of life after highly and moderately emetogenic chemotherapy despite antiemetic treatment. J Clin Oncol 2006; 24: 4472-4478 3. Schwartzberg L: Chemotherapy-induced nausea and vomiting: state of the art 2006. J Support Oncol 2006; 4: 3-8 4. Grunberg SM, Osoba D, Hesketh PJ, Gralla RJ, Borjeson S, Rapoport BL, du Bois A, Tonato M: Evaluation of new antiemetic agents and definition of antineoplastic agent emetogenecity-an update. Support Care Cancer 2005; 13: 80-84 5. Baker PD, Morzorati SL, Ellet ML: The pathophysiology of chemotherapy-induced nausea and vomiting. Gastroenterol Nurs 2005; 28: 469-480 6. Kris MG, Hesketh PJ, Somerfield MR, Feyer P, ClarkSnow R, Koeller JM, Morrow GR, Chinnery LW, Chesney MJ, Gralla RJ, Grunberg SM: American Society of Clinical Oncology guideline for antiemetics in oncology: Update 2006. J Clin Oncol 2006; 24: 2932-2947 7. NCCN Clinical practice guidelines in oncology; v.2.2006: Antiemesis. National Comprehensive Cancer Network (NCCN), 2006 8. Navari RM: Antiemetic control: Toward a new standard of care for emetogenic chemotherapy. Expert Opin Pharmacother 2009; 10: 629-644 9. Navari RM: Pathogenesis-based treatment of chemotherapyinduced nausea and vomiting: Two new agents. J Support Oncol 2003; 1: 89-103 10. Hesketh PJ: New treatment options for chemotherapyinduced nausea and vomiting. Support Care Cancer 2004; 12: 550-554 11. Diemunsch P, Grelot L: Potential of substance P antagonists as antiemetics. Drugs 2000; 60: 533-546 12. The Italian Group for Antiemetic Research: Dexamethasone, granisetron or both for the prevention of nausea and vomiting during chemotherapy for cancer. N Engl J Med 1995; 332: 1-5 13. Navari RM: Apprepitant: A neurokinin-1 receptor antagonist for the treatment of chemotherapy-induced nausea and vomiting. Expert Rev Anticancer Ther 2004; 4: 715-724 14. Bymaster FP, Calligaro DO, Falcone JF, Marsh RD, Moore NA, Tye NC, Seeman P, Wong DT: Radioreceptor binding profile of the atypical antipsychotic olanzapine. Neuropsychopharmacology 1996; 14: 87-96 15. Bymaster FP, Falcone JF, Bauzon D, Kennedy JS, Schenck K, DeLapp NW, Cohen ML: Potent antagonism of 5-HT3 and 5-HT6 receptors by olanzapine. Eur J Pharmacol 2001; 430: 341-349

Gündüz E and Gülbaş Z: Supportive Care in Hemato-Oncology

16. Allison DB, Casey DE: Antipsychotic-associated weight gain: A review of literature. J Clin Psychiatry 2001; 62: 22-31 17. Hale AS: Olanzapine. Br J Hosp Med 1997; 58: 442-445 18. Goldstein LE, Sporn J, Brown S, Kim H, Finkelstein J, Gaffey GK, Sachs G, Stern TA: New-onset diabetes mellitus and diabetic ketoacidosis associated with olanzapine treatment. Psychosomatics 1999; 40: 438-443 19. Guttuso T Jr, Roscoe J, Griggs J: Effect of gabapentin on nausea induced by chemotherapy in patients with breast cancer. Lancet 2003, 361: 1703-1705 20. Martin BR, Wiley JL: Mechanism of action of cannabinoids; How it may lead to treatment of cachexia, emesis and pain. J Support Oncol 2004; 2: 305-316 21. Slatin MD: Cananbinoids in the treatment of chemotherapyinduced nausea and vomiting: Beyond prevention of acute emesis. J Support Oncol 2007; 5: 1-9 22. Van Sickle MD, Duncan M, Kingsley PJ, Mouihate A, Urbani P, Mackie K, Stella N, Makriyannis A, Piomelli D, Davison JS, Marnett LJ, Di Marzo V, Pittman QJ, Patel KD, Sharkey KA: Identification and functional characterization of brainstem cannabinoid CB2 receptors. Science 2005; 310: 329-332 23. NCCN Clinical practice guidelines in oncology; v.2.2011: Antiemesis. National Comprehensive Cancer Network (NCCN), 2010 24. Knight K, Wade S, Balducci L: Prevalence and outcomes of anaemia in cancer: A systematic review of the literatue. Am J Med 2004; 116: 11-26 25. Bennett CL, McKoy JM, Henke M, Silver SM, MacDougall IC, Birgegard G, Luminari S, Casadevall N, Schellekens H, Sartor O, Lai SY, Armitage JO: Reassessments of ESAs for cancer treatment in the US and Europe. Oncology (Williston Park) 2010; 24: 260-268 26. Caro JJ, Salas M, Ward A, Goss G: Anemia as an independent prognostic factor for survival in patients with cancer: A systematic, quantitative review. Cancer 2001; 91: 22142221 27. Buck I, Morceau F, Grigorakaki C, Dicato M, Diederich M: Linking anemia to inflammation and cancer: the crucial role of TNF alfa. Biochem Pharmacol 2009; 77: 1572-1579 28. Schwartz RN: Anemia in patients with cancer: Incidence, causes, impact, management and use of treatment guidelines and protocols. Am J Health Syst Pharm 2007; 64: 5-13 29. Steensma DP: Is anemia of cancer different from chemotherapy induced anemia? J Clin Oncol 2008; 26: 1022-1024 30. Groopman JE, Itri LM: Chemotherapy induced anemia in adults: Incidence and treatment. J Natl Cancer Inst 1999; 91: 1616-1634 31. Jefferies S, Rajan B, Ashley S, Traish D, Brada M: Haematological toxicity of cranio-spinal irradiation. Radiother Oncol 1998; 48: 23-27

Gündüz E and Gülbaş Z: Supportive Care in Hemato-Oncology

32. Spivak JL, Gascon P, Ludwig H: Anemia management in oncology and hematology. Oncologist 2009; 14: 43-56 33. Littlewood TJ, Bajetta E, Nortier JW, Vercammen E, Rapoport B; Epoetin Alfa Study Group: Effects of epoetin alfa on hematologic parameters and quality of life in cancer patients receiving nonplatinum chemotherapy: Results of randomized, double blind placebo controlled trial. J Clin Oncol 2001; 19: 2865-2874 34. Vansteenkiste J, Pirker R, Masutti B, Barata F, Font A, Fiegl M, Siena S, Gateley J, Tomita D, Colowick AB, Musil J; Aranesp 980297 Study Group: Double blind, placebo controlled, randomized phase III trial of darbepoetin alfa in lung cancer patients receiving chemotherapy. J Natl Cancer Inst 2002; 94: 1211-1220 35. Bohlius J, Wilson J, Seidenfeld J, Piper M, Schwarzer G, Sandercock J, Trelle S, Weingart O, Bayliss S, Djulbegovic B, Bennett CL, Langensiepen S, Hyde C, Engert A: Recombinant human erythropoietins and cancer patients: Updated meta analysis of 57 studies including 9353 patients. J Natl Cancer Inst 2006; 98: 708-714 36. Leyland-Jones B, Semiglazov V, Pawlicki M, Pienkowski T, Tjulandin S, Manikhas G, Makhson A, Roth A, Dodwell D, Baselga J, Biakhov M, Valuckas K, Voznyi E, Liu X, Vercammen E: Maintaining normal hemoglobin levels with epoetin alfa in mainly nonanemic patients with metastatic breast cancer receiving first line chemotherapy: A survival study. J Clin Oncol 2005; 23: 5960-5972 37. Henke M, Laszig R, Rube C, Schäfer U, Haase KD, Schilcher B, Mose S, Beer KT, Burger U, Dougherty C, Frommhold H: Erythropoietin to treat head and neck cancer patients with anaemia undergoing radiotherapy: randomised, double blind, placebo controlled trial. Lancet 2003; 362: 12551260 38. Thomas G, Ali S, Hoebers FJ, Darcy KM, Rodgers WH, Patel M, Abulafia O, Lucci JA 3rd, Begg AC: Phase III trial to evaluate the efficacy of maintaining hemoglobin levels above 12.0 g/dl with erythropoietin vs above 10.0 g/dl without erythropoietin in anemic patients receiving concurrent radiation and cisplatin for cervical cancer. Gynecol Oncol 2008; 108: 317-325 39. Wright JR, Ung YC, Julian JA, Pritchard KI, Whelan TJ, Smith C, Szechtman B, Roa W, Mulroy L, Rudinskas L, Gagnon B, Okawara GS, Levine MN: Randomized, doubleblind, placebo-controlled trial of erythropoietin in non small cell lung cancer with disease related anemia. J Clin Oncol 2007; 25: 1027-1032 40. Smith RE, Jr., Aapro MS, Ludwig H, Pintér T, Smakal M, Ciuleanu TE, Chen L, Lillie T, Glaspy JA: Darbepoetin alfa fort he treatment of anemia in patients with active cancer not receiving chemotherapy or radiotherapy: results of a phase III, multicenter, randomized, double-blind, placebocontrolled study. J Clin Oncol 2008; 26: 1040-1050

Turk J Hematol 2012; 29: 1-9

41. Hedenus M, Adriansson M, San Miguel J, Kramer MH, Schipperus MR, Juvonen E, Taylor K, Belch A, Altés A, Martinelli G, Watson D, Matcham J, Rossi G, Littlewood TJ; Darbepoetin Alfa 20000161 Study Group: Efficacy and safety of darbepoetin alfa in anaemic patients with lymphoproliferative malignancies: Randomized, doubleblind, placebo-controlled study. Br J Haematol 2003; 122: 394-403 42. Heit JA, Silverstein MD, Mohr DN, Petterson TM, O’Fallon WM, Melton LJ 3rd: Risk factors for deep vein thrombosis and pulmonary embolism: A population based case control study. Arch Intern Med 2000; 160: 809-815 43. Khorana AA, Francis CW, Culakova E, Kuderer NM, Lyman GH: Thromboembolism is a leading cause of death in cancer patients receiving outpatient chemotherapy. J Thromb Haemost 2007; 5: 632-634 44. Saphner T, Torney DC, Gray R: Venous and arterial thrombosis in patients who received adjuvant therapy for breast cancer. J Clin Oncol 1991; 9: 284-294 45. Steinbrook R: Erythropoietin, the FDA and oncology. N Engl J Med 2007; 356: 2448-2451 46. Juneja V, Keegan P, Gootenberg JE, Rothmann MD, Shen YL, Lee KY, Weiss KD, Pazdur R: Continuing reassessment of the risks of erythropoiesis-stimulating agents in aptients with cancer. Clin Cancer Res 2008; 14: 3242-3247 47. Lal LS, Raju A, Miller LA, Chen H, Arbuckle R, Sansgiry SS: Impact of changes in reimbursement policies and institutional practice algorithm for utilization of eythropoietic stimulating agents on treatment patterns and costs in anemic lymphoma patients. Support Care Cancer 2010; Epub Ahead of Print 48. Santini V, Alessandrino PE, Angelucci E, Barosi G, Billio A, Di Maio M, Finelli C, Locatelli F, Marchetti M, Morra E, Musto P, Visani G, Tura S: Clinical management of myelodysplastic syndromes: update of SIE, SIES, GITMO practice guidelines. Leuk Res 2010; Epub Ahead of Print 49. Budman DR, Berry DA, Cirrincione CT, Henderson IC, Wood WC, Weiss RB, Ferree CR, Muss HB, Green MR, Norton L, Frei E 3rd: Dose and dose intensity as determinanats of outcome in the adjuvant treatment of breast cancer The Cancer and Leukemia Group B. J Natl ancer Inst 1998; 90: 1205-1211 50. Kwak LW, Halpern J, Olshen RA, Horning SJ: Prognostic significance of actual dose intensity in diffuse large cell lymphoma: Results of a tree-structured survival analysis. J Clin Oncol 1990; 8: 963-977 51. Lepage E, Gisselbrecht C, Haioun C, Sebban C, Tilly H, Bosly A, Morel P, Herbrecht R, Reyes F, Coiffier B: Prognostic significance received relative dose intensity in non-Hodgkin’s lymphoma patients: application to LNH-87 protocol The GELA. Ann Oncol 1993; 8: 651-656

Turk J Hematol 2012; 29: 1-9

52. Chang J: Chemotherapy dose reduction and delay in clinical practice: Evaluating the risk to patient outcome in adjuvant chemotherapy for breast cancer. Eur J Cancer 2000; 36: 11-14 53. Fortner BV, Houts AC, Schwartzberg LS: A prospective investigation of chemotherapy-induced neutropenia and quality of life. J Support Oncol 2006; 4: 472-478 54. Wingard JR, Elmongy M: Strategies for minimizing complications of neutropenia: prophylactic myeloid growth factors and antibiotics. Crit Rev Hematol Oncol 2009; 72: 144-154 55. Bohlius J, Reiser M, Schwarzer G, Engert A: Granulopoiesis stimulating factors to prevent adverse effects in the treatment of malignant lymphoma. Cochrane Database Syst Rev CD003189; 2004 56. Smith TJ, Khatcheressian J, Lyman GH, Ozer H, Armitage JO, Balducci L, Bennett CL, Cantor SB, Crawford J, Cross SJ, Demetri G, Desch CE, Pizzo PA, Schiffer CA, Schwartzberg L, Somerfield MR, Somlo G, Wade JC, Wade JL, Winn RJ, Wozniak AJ, Wolff AC: 2006 update of recommendations for the use of white blood cell growth factors: An evidencebased clinical practice guideline. J Clin Oncol 2006; 24: 3187-3205 57. Martin WG, Ristow KM, Habermann TM, Colgan JP, Witzig TE, Ansell SM: Bleomycin pulmonary toxicity has a negative impact on the outcome of patients with Hodgkin’s lymphoma. J Clin Oncol 2005; 23: 7614-7620 58. Tigue CC, McKoy JM, Events AM, Trifilio SM, Tallman MS, Bennett CL: Granulocyte-colony stimulating factor administration to healthy individuals and persons with chronic neutropenia or cancer: an overview of safety considerations from the Research on Adverse Drug Events and Reports Project. Bone Marrow Transplant 2007; 40: 185-192 59. Aapro MS, Cameron DA, Pettengell R, Bohlius J, Crawford J, Ellis M, Kearney N, Lyman GH, Tjan-Heijnen VC, Walewski J, Weber DC, Zielinski C; European Organisation for Research and Treatment of Cancer (EORTC) Granulocyte Colony-Stimulating Factor (G-CSF) Guidelines Working Party: EORTC guidelines for the use of granulocyte colony stimulating factor to reduce the incidence of chemotherapy induced febrile neutropenia in adult patients with lymphomas and solid tumours. Eur J Cancer 2006; 42: 2433-2453 60. Crawford J, Althaus B, Armitage J, Balducci L, Bennett C, Blayney DW, Cataland SR, Dale DC, Demetri GD, Erba HP, Foran J, Freifeld AG, Heaney ML, Htoy S, Kloth DD, Lyman GH, Messersmith WA, Michaud LB, Miyata SC, Robbins A, Tallman MS, Vadhan-Raj S, Westervelt P, Wong MK; National Comprehensive Cancer Network (NCCN): Myeloid growth factors, clinical practice guidelines in oncology. J Natl Compr Canc Netw 2007; 5: 188-202

Gündüz E and Gülbaş Z: Supportive Care in Hemato-Oncology

61. Crawford J, Dale DC, Kuderer NM, Culakova E, Poniewierski MS, Wolff D, Lyman GH: Risk and timing of neutropenic events in adult cancer patients receiving chemotherapy: the results of a prospective nationwide study of oncology practice. J Natl Compr Canc Netw 2008; 2: 109-118 62. Pagliuca A, Carrington PA, Pettengell R, Tule S, Keidan J; Haemato-Oncology Task Force of the British Committee for Standards in Haematology: Guidelines on the use of colony stimulating factors in haematological malignancies. Br J Haematol 2003; 1: 22-23 63. Clark OA, Lyman GH, Castro AA, Clark LG, Djulbegovic B: Colony stimulating factors for chemotherapy induced febriel neutropenia: A meta analysis of randomized controlled trials. J Clin Oncol 2005; 23: 4198-4214 64. Berghmans T, Paesmans M, Lafitte JJ, Mascaux C, Meert AP, Jacquy C, Burniat A, Steels E, Vallot F, Sculier JP: Therapeutic use of granulocyte and granulocyte macrophage colony stimulating factors in the febrile neuropenic cancer patients. A systematic review of the literature with meta analysis. Support Care Cancer 2002; 10: 181-188 65. Garcia-Carbonero R, Mayordomo JI, Tornamira MV, LópezBrea M, Rueda A, Guillem V, Arcediano A, Yubero A, Ribera F, Gómez C, Trés A, Pérez-Gracia JL, Lumbreras C, Hornedo J, Cortés-Funes H, Paz-Ares L: Granulocyte colony stimulating factor in the treatment of high risk febrile neutropenia: a multicenter randomized trial. J Natl Cancer Inst 2001; 93: 31-38 66. Johnston E, Crawford J, Blackwell S, Bjurstrom T, Lockbaum P, Roskos L, Yang BB, Gardner S, Miller-Messana MA, Shoemaker D, Garst J, Schwab G: Randomized dose escalation study of SD/01 compared with daily filgrastim in patients receiving chemotherapy. J Clin Oncol 2000; 18: 2522-2528 67. Vogel CL, Wojtukiewicz, MZ, Carroll RR, Tjulandin SA, Barajas-Figueroa LJ, Wiens BL, Neumann TA, Schwartzberg LS: First and subsequent cycle use of pegfilgrastim prevents febrile neutropenia in patients with breast cancer: a multicenter, double-blind, placebo controlled phase III study. J Clin Oncol 2005; 23:1178-1184 68. Green MD, Koelbl H, Baselga J, Galid A, Guillem V, Gascon P, Siena S, Lalisang RI, Samonigg H, Clemens MR, Zani V, Liang BC, Renwick J, Piccart MJ; International Pegfilgrastim 749 Study Group: A randomized double-blind multicenter phase III study of fixed dose single administration pegfilgrastim versus dailyfilgrastim in patients receiving myelosuppressive chemotherapy. Ann Oncol 2003; 14: 29-35

Research Article

DOI: 10.5505/tjh.2012.60320

The Frequency of Mutations in Exon 11 of the c-kit Gene in Patients With Leukemia Lösemili Hastalarda c-kit Geni Ekson 11 Mutasyonlarının Sıklığı Syed Rizwan Hussain1, Sunil G Babu2, Hena Naqvi1, Pradyumn Singh1, Farzana Mahdi1 Era’s Lucknow Medical College and Hospital, Lucknow, India Babasaheb Bhimrao Ambedkar University, Lucknow, India

1 2

Abstract Objective: To determine the frequency of mutations in exon 11 of the c-kit gene in patients with leukemia. Material and Methods: The study included 50 leukemia patients (31 with acute myeloid leukemia, 5 with acute lymphoblastic leukemia, 9 with chronic myeloid leukemia, and 5 with chronic lymphocytic leukemia) that underwent PCR-SSCP, followed by direct DNA sequencing. Results: In all, 28 of the leukemia patients were male and 22 were female, with a mean age of 31.88 years (range: 2-65 years). In total, 20 mutations in 19 patients were identified, including Lys550Asn, Tyr568Ser, Ile571Thr, Thr574Pro, Gln575His, Tyr578Pro, Asp579His, His580Gln, Arg586Thr, Asn587Asp, and Arg588Met, as well as novel point mutations at codons Ile563Lys, Val569Leu, Tyr570Ser, and Pro577Ser. Ile571Leu substitution was observed in 2 patients and Trp582Ser substitution was observed in 3 patients. Conclusion: The results suggest that mutations in exon 11 of the c-kit gene might be useful as molecular genetic markers for leukemia

Key Words: C-kit, Leukemia, SSCP, Mutation

Özet Amaç: Lösemili hastalarda c-kit geni ekson 11 mutasyonlarının sıklığını belirlemek. Gereç ve Yöntemler: Bu çalışma PCR-SCCP ve sonrasında direkt DNA sekanslama yapılan 50 lösemi hastası (31 akut myeloid lösemi, 5 akut lenfoblastik lösemi, 9 kronik myeloid lösemi ve 5 kronik lenfositik lösemi) hastası ile yapıldı.

Bulgular: Genel olarak lösemi hastalarının 28’i erkek ve 22’si kadındı ve ortalama yaş 31,88 (aralık: 2-65) yıldı. Toplam olarak 19 hastada Lys550Asn, Tyr568Ser, Ile571Thr, Thr574Pro, Gln575His, Tyr578Pro, Asp579His, His580Gln, Arg586Thr, Asn587Asp ve Arg588Met ve ayrıca Ile563Lys, Val569Leu, Tyr570Ser ve Pro577Ser kodonlarında yeni nokta mutasyonları olmak üzere 20 mutasyon saptandı. Ile571Leu yerine konması 2 hastada ve Trp582Ser yerine konması 3 hastada görüldü.

Sonuç: Sonuçlar c-kit geni ekson 11 mutasyonlarının lösemi için moleküler genetik işaretler olarak faydalı olabileceğini düşündürmektedir. Anahtar Sözcükler: C-kit, Lösemi, SSCP, Mutasyon Address for Correspondence: Farzana MahdI, M.D., Doctor Res. 1st floor, Hardoi road, Sarfarazganj, Lucknow 226003 - India Phone: +91 522 240 81 22 E-mail: rizwan_59@rediffmail.com Received/Geliş tarihi : January 7, 2011 Accepted/Kabul tarihi : May 17, 2011

Turk J Hematol 2012; 29: 10-16

Hussain S R, et al: Detection of Mutations in Exon 11 of the c-kit gene in Leukemia

Introduction Leukemia is a heterogeneous disease characterized by hematopoietic progenitor cells that acquire genetic lesions, leading to loss of differentiation, an increase in selfrenewal, and unregulated proliferation. In 2000, approximately 256,000 children and adults worldwide developed some form of leukemia, and 209,000 died due to leukemia, which accounts for about 3% of the almost 7 million cancer-related deaths and about 0.35% of all deaths that year. A study that examined the incidence of cancer according to 16 sites of the body reported that leukemia was the 12thmost common class of neoplastic disease and the 11th most common cause of cancer-related death [1]. Leukemia is classified based on the presence of specific cytogenetic abnormalities, as well as the FrenchAmerican-British (FAB) classification of leukemic cells [2]. A number of studies suggest that c-kit—a member of the type III receptor tyrosine kinase (RTK) family is important for the development of a range of cells including hematopoietic cells, and plays a role in leukemogenesis—[3]. High-level expression of c-kit has been reported in 60%80% of acute myeloid leukemia (AML) patients [4,5] and point mutation of c-kit has been observed in 33.35%45% of AML patients [6]. Nevertheless, many of these studies were screened for c-kit mutations, only in a limited portion of the c-kit coding sequence and others were limited by small study populations. It is known that c-kit is a leukemia proto-oncogene and that activated c-kit mutations are likely to contribute to the development of leukemia in humans [7-10]. The activation sphere of the c-kit receptor has resulted in constitutive c-kit kinase activity and c-kit receptors that harbor such mutations when introduced into mammalian cells in the downstream signaling pathways lead to factorindependent growth in vitro and leukemogenesis in vivo [7,11]. The c-kit gene is a member of the type III TKR family, which includes platelet-derived growth factor receptors (PDGFRs) [12-14]. Type III TKRs share a sequence homology and a similar structure, with 5 immunoglobulin-like repeats in the extracellular domain, 1 transmembrane domain (TM), 1 juxtamembrane domain (JM), 2 intracellular tyrosine kinase domains (TK1 and TK2) divided by a kinase insert domain (KI), and 1 C-terminal domain [15]. The genomic locus that encodes the c-kit gene receptor has 21 exons, ranging from 100 bp to 300 bp [16]. Mutations in exon 11 of the c-kit gene have been reported in gastrointestinal stromal tumors, solid tumors, and germ cell tumors [17-

19]. To date, no study has reported the frequency or prevalence of mutations in exon 11 of the c-kit gene in leukemia patients in India. As such, the present study aimed to identify mutations in exon 11 of the c- kit gene in Indian patients with malignant leukemias (acute myeloid leukemia [AML], acute lymphoblastic leukemia [ALL], chronic myeloid leukemia [CML] and chronic lymphocytic leukemia [CLL]) and to determine if c-kit gene mutations could be used as molecular genetic markers for leukemia. Material and Methods Patients The study included 50 leukemia patients and 50 healthy controls. Ethical approval of the study protocol was granted by the Era’s Lucknow Medical College and Hospital Ethics Committee. Clinical data of patients as well as control samples were recorded. Blood or bone marrow samples were stained according to the Leishman stain method and the patients were classified according to FAB criteria [20] as follows: AML (n = 31); ALL (n = 5); CML (n = 9); CLL (n = 5). DNA Extraction Specimens were collected from 50 routinely processed unstained bone marrow slides and blood diagnosed as leukemic by the hospital’s hematology department and were then stored at –20 ° C. Genomic DNA was extracted according to Moskaluk et al. 1997 [21] with some modification. Lysis buffer and proteinase K (10 mg mL–1) were added to samples, followed by incubation at 55 °C for 1-2 h. Then, 10 µL of 10% SDS, 120 µL of 5M NaCl, and 300 µL of RNAse-free water were added, followed by thorough mixing and shaking. Next, 400 µL of phenol:chloroform (4:1) was added, followed by centrifugation at 15,000 rpm for 10 min at 4 °C. The supernatant was collected into a new tube. For precipitation chilled absolute alcohol was added and centrifuged at 11,000 rpm for 5 min at 4 °C. The precipitate was washed with 70% alcohol and dissolved in 100 µL of HPLC water. Polymerase Chain Reaction and Single-Strand Conformational Polymorphism Polymerase chain reaction (PCR) was performed with 25 μL of PCR reaction mixture containing 200 ng of template DNA, 10 pmol of each primer, 10 mmol L–1 of each mix dNTP, 1X reaction buffer, and 0.3 U of Taq polymerase enzyme (Fermentas, Germany) in an MJ Mini thermocycler (Bio-Rad, UK). The cycling conditions were as follows: 35 cycles of denaturation at 94 °C for 30 s, followed by annealing at 56 °C for 30 s, and extension

Hussain S R, et al: Detection of Mutations in Exon 11 of the c-kit gene in Leukemia

at 72°C for 30 s, followed by a final extension step at 72 °C for 10 min using the following primers [19]: forward: 5-ATTATTAAAAGGTGATCTATTTTTC-3; reverse: 5-ACTGTTATGTGTACCCAAAAAG-3. Single-strand conformational polymorphism analysis was performed according to Orita et al. [22] with some modifications. Samples were denatured at 94° C for 8 min, and then immediately transferred to ice. Then 15 μL of amplified PCR product was loaded along with 15 μL of denaturing dye on 8% polyacrylamide gel. The gel was run in pre-cooled 1Xx TBE buffer. The gel tank was placed in a cold room (4 °C) and run for 15 h at 140 V. The PCR product on the gel was silver stained after electrophoresis. Electrophoresis mobility shifts in the patients’ single-stranded or double stranded PCR products were detected via comparison with the controls’ PCR products that were run in adjacent lanes. Sequencing Analysis Amplicons were sequenced using an automated sequencer (ABI 3730XL DNA Analyzer, Applied Biosystems, Foster City, California, USA) and examined using FinchTV software. Amplicons with mutations were reconfirmed via sequencing in both directions and in independent second samples. Sequences were analyzed using BioEdit JustBio software. Results Among the 50 leukemia patients 28 were male and 22 were female, with a mean age of 31.88 years (range: 2-65 years). The patients were classified according to FAB criteria [20] as AML (n = 31), ALL (n = 05), CML (n = 09), and CLL (n = 05). A shift in position was noted in 39 of the 50 patient samples via native SSCP-PAGE. In 19 of the 31 AML cases 20 point mutations were observed, whereas none were detected in the ALL, CML, or CLL patients. Point mutation details are shown in Table 1. Discussion The present study is the first to report mutations in exon 11 of the c-kit gene in leukemia patients from Northern India. Previous molecular studies have reported several mutations in exon 11 in different types of tumors. Mutations in exons 9, 13, and 17 of the c-kit gene are less frequently detected than those in exon 11. These mutations are considered rare in gastrointestinal stromal tumors, with a reported frequency of <10%, but are not uncommon in hematopoietic malignancies and germ cell neoplasms [23-25]. It was reported that 65%-92% of gastrointestinal stromal tumors harbor kit-activating mutations, the majority of which are localized at the juxtamembrane region involving exon 11 [26,27].

Turk J Hematol 2012; 29: 10-16

Table 1: Point Mutations in Exon 11 of the c-kit gene

Patient no.

Leukemia Type

Nucleotide

Codon

AML

TAT→TCT

Tyr568Ser

AML

AGG→ATG

Arg588Met

AML

TGG→TCA

Trp582Ser

AML

ATA→CTA

Ile571Leu

AML

ATA→CTA

Ile571Leu

AML

AAA→AAC

Lys550Asn

AML

GTT→CTT

Val569Leu

AML

TAC→TCC

Tyr570Ser

AML

GAT→CAT

Asp579His

AML

CCT→TCC

Pro577Ser

AML

CAC→CAA

His580Gln

AML

TAT→CCT

Tyr578Pro

AML

TGG→TCA

Trp582Ser

AML

AAC→GAC

Asn587Asp

AML

ATA→AAA

Ile563Lys

AML

ATA→ACA

Ile571Thr

AML

AGA→ACA

Arg586Thr

AML

CAA→CAC

Gln575His

AML

ACA→CCA TGG→TCA

Thr574Pro Trp582Ser

The majority of exon 11 mutations are clustered within the classical hotspot region of the 50 end involving codons 550-560; however, a second hotspot at the 30 end involving codons 576-590 has been described by Antonescu et al. [28], which includes frame deletions of 1 to several codons (typically involving codons 557-560) and point mutations and internal tandem duplications (typically involving the 30 end). In the present study heterogeneous point mutations in AML patients were observed, some of which were and were not previously reported. In 19 of the 31 AML patients 20 point mutations were observed; a point mutation at Lys550Asn in 1 patient and at Ile571Leu in 2 other patients were previously reported [29-32]. Mutation at codon 582 (Trp582Tyr and Trp582His) was reported by Tae Won Kim et al. [30]

Turk J Hematol 2012; 29: 10-16

Hussain S R, et al: Detection of Mutations in Exon 11 of the c-kit gene in Leukemia

Figure 1: SSCP-PAGE analysis of exon 11 (257 bp) shows electrophoresis mobility shift on native page. Lane 1 is the control, and lanes 2-5 are patients (no shift in patient 04, and a shift in patients 09, 11, and 20).

CODON Wild Type Patient 9 Patient 11 Patient 12 Patient 13 Patient 17 Patient 18 Patient 20 Patient 21 Patient 22 Patient 23 Patient 24 Patient 27 Patient 35 Patient 39 Patient 40 Patient 43 Patient 44 Patient 45 Patient 50

550 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 591 K P M Y E V Q W K V V E E I N G N N Y V Y I D P T Q L P Y D H K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N S V Y I D P T Q L P Y D H K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y I D P T Q L P Y D H K W E F P R N M L S F K P M Y E V Q W K V V E E I N G N N Y V Y I D P T Q L P Y D H K S E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y L D P T Q L P Y D H K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y L D P T Q L P Y D H K W E F P R N R L S F N P M Y E V Q W K V V E E I N G N N Y V Y I D P T Q L P Y D H K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y L Y I D P T Q L P Y D H K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V S I D P T Q L P Y D H K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y I D P T Q L P Y H H K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y I D P T Q L S Y D H K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y I D P T Q L P Y D Q K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y I D P T Q L P P D H K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y I D P T Q L P Y D H K S E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y I D P T Q L P Y D H K W E F P R D R L S F K P M Y E V Q W K V V E E K N G N N Y V Y I D P T Q L P Y D H K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y T D P T Q L P Y D H K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y I D P T Q L P Y D H K W E F P T N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y I D P T H L P Y D H K W E F P R N R L S F K P M Y E V Q W K V V E E I N G N N Y V Y I D P P Q L P Y D H K S E F P R N R L S F

Figure 2: Amino acid sequences of exon 11 of the c-kit gene. The sequence starts at codon 550 and ends at 591. The wild-type sequence is shown above. Point mutations are shown in.

and Ying-Yong Hou et al. [17] reported Trp582Try and Trp582Gln; however, in 3 of the present studied patients there was a different substitution in the same codon in which tryptophan was replaced by serine (Trp582Ser). Mutations at codons Tyr568Asp, Ile571Thr, Thr574Tyr, Gln575Ile, Tyr578Phe, Asp579Gln, Asp579Pro, His580Leu, His580Tyr, His580Pro, Arg586Trp, Arg586Ile, Arg586Phe, Arg586Asp, Asn587Glu, Asn587Pro, Asn587His and Arg588Phe, Arg588Tyr, and Arg588Lys have been reported [17,30,29,32]; however, in the present study we observed substitution muta-

tions at Tyr568Ser, Thr574Pro, Gln575His, Tyr578Pro, Asp579His, His580Gln, Arg586Thr, Asn587Asp and Arg588Met which have not been previously reported. We also detected 4 novel point mutations—Ile563Lys, Val569Leu, Tyr570Ser, and Pro577Ser—at codons 563, 569, 570 and 577 respectively in exon 11 of the c-kit gene which have not been previously reported in any neoplasia patients. The mutations in exon 11 of the c-kit gene observed in the present study between codons 550 and 591 are in agreement with previously reported mutations in different populations (Figure 2 and Table 2).

Hussain S R, et al: Detection of Mutations in Exon 11 of the c-kit gene in Leukemia

Turk J Hematol 2012; 29: 10-16

Table 2: Comparison of Mutations in Exon 11 of the c-kit gene Identified in the Present Study and Those Previously Reported

Mutations

Novel Mutations

Mutation with different substitution

Existing Reported Mutations

References

Substitution not previously reported (present results)

Reported Substitution

TAT→TCT

Tyr568Ser

Tyr568Asp

[31]

ATA→ACA

Ile571Thr

Ile571Leu

[32]

ACA→CCA

Thr574Pro

Thr574Tyr

[17]

CAA→CAC

Gln575His

Gln575Ile

[17]

TAT→CCT

Tyr578Pro

Tyr578Phe

[30]

GAT→CAT

Asp579His

Asp579Gln Asp579Pro

[30]

CAC→CAA

His580Gln

His580Leu His580Tyr His580Pro

[17,30]

TGG→TCA

Trp582Ser

Trp582Tyr Trp582His Trp582Gln

[17,30]

Arg586Thr

Arg586Trp Arg586Ile Arg586Phe Arg586Asp

[17,30]

AAC→GAC

Asn587Asp

Asn587Glu Asn587Pro Asn587His

[17,30]

AGG→ATG

Arg588Met

Arg588Phe Arg588Tyr Arg588Lys

[17,30]

ATA→AAA

Ile563Lys

GTT→CTT

Val569Leu

TAC→TCC

Tyr570Ser

CCT→TCC

Pro577Ser

AGA→ACA

AAA→AAC

Lys550Asn

[31]

ATA→CTA

Ile571Leu

[32]

K: Lysine (Lys); P: proline (Pro); M: methionine (Met); Y: tyrosine (Tyr); E: glutamic acid (Glu); V: valine (Val); Q: glutamine (Gln); W: tryptophan (Trp); I: isoleucine (Ile); N: asparagine (Asn); G: glycine (Gly); D: aspartic acid (Asp); T: threonine (Thr); H: histidine (His); R: arginine (Arg); L: leucine (Leu); S: serine (Ser); F: phenylalanine (Phe); AML: acute myeloid leukemia; ALL: acute lymphoblastic leukemia; CML: chronic myeloid leukemia; CLL: chronic lymphocytic leukemia; PCR: polymerase chain reaction; SSCP: single-strand conformational polymorphism; PAGE: polyacrylamide gel electrophoresis ; DNA: deoxyribonucleic acid ; A: adenine; T: thymine; G: guanine; C: cytosine; n: number of samples.

Turk J Hematol 2012; 29: 10-16

Hussain S R, et al: Detection of Mutations in Exon 11 of the c-kit gene in Leukemia

In conclusion, the present study is the first to report the presence of c-kit gene mutations in Indian leukemia patients. The observed mutations in exon 11 of the c-kit gene may be involved in c-kit over expression in leukemia. These observations suggest that mutations in exon 11 of the c-kit gene might be useful molecular genetic markers for leukemia. Additional research with larger study groups may clarify the prognostic implications of these mutations, and their association with the pathogenesis and progression of myeloid malignancy. Acknowledgments This study was supported by an intramural grant from Era’s Lucknow Medical College and Hospital, Lucknow, India. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Mathers, Colin D, Cynthia Boschi-Pinto, Alan D Lopez and Christopher JL Murray: Cancer incidence, mortality and survival by site for 14 regions of the world. Global Programme on Evidence for Health Policy Discussion 2001; Paper No. 13 (World Health Organization) 2. Rowley JD: Identification of a translocation with quinacrine fluorescence in a patient with acute leukemia. Ann Genet 1973; 16: 109-112 3. Reilly JT: Class III receptor tyrosine kinases: Role in leukaemogenesis. Br J Haematol 2002; 116: 744-757 4. Reuss-Borst MA, Buhring HJ, Schmidt H, Muller CA: AML: Immunophenotypic heterogeneity and prognostic significance of c-kit expression. Leukemia 1994; 8: 258-263 5. Cole SR, Aylett GW, Harvey NL, Cambareri AC, Ashman LK: Increased expression of c-Kit or its ligand Steel Factor is not a common feature of adult acute myeloid leukaemia. Leukemia 1996; 10: 288-296 6. Higuchi M, O’Brien D, Kumaravelu P, Lenny N, Yeoh EJ, Downing JR: Expression of a conditional AML1-ETO oncogene bypasses embryonic lethality and establishes a murine model of human t(8;21) acute myeloid leukemia. Cancer Cell 2002; 1: 63-74 7. Kelly LM, Kutok JL, Williams IR, Boulton CL, Amaral SM, Curley DP, Ley TJ, Gilliland DG: PML/RARalpha and FLT3ITD induce an APL-like disease in a mouse model. Proc Natl Acad Sci USA 2002; 99: 8283-8288

8. Zhao M, Kiyoi H, Yamamoto Y, Ito M, Towatari M, Omura S, Kitamura T, Ueda R, Saito H, Naoe T: In vivo treatment of mutant FLT3-transformed murine leukemia with a tyrosine kinase inhibitor. Leukemia 2000; 14: 374-378 9. Tse KF, Novelli E, Civin CI, Bohmer FD, Small D: Inhibition of FLT3-mediated transformation by use of a tyrosine kinase inhibitor. Leukemia 2001; 15: 1001-1010 10. Levis M, Tse KF, Smith BD, Garrett E, Small D: A FLT3 tyrosine kinase inhibitor is selectively cytotoxic to acute myeloid leukemia blasts harboring FLT3 internal tandem duplication mutations. Blood 2001; 98: 885-887 11. Ihle JN, Witthuhn BA, Quelle FW, Yamamoto K, Silvennoinen O: Signaling through the hematopoietic cytokine receptors. Annu Rev Immunol 1995; 13: 369-398 12. Ullrich A, Schlessinger J: Signal transduction by receptors with tyrosine kinase activity. Cell 1990; 61: 203-212 13. Matthews W, Jordan CT, Wiegand GW, Pardoll D, Lemischka IR: A receptor tyrosine kinase specific to hematopoietic stem and progenitor cell-enriched populations. Cell 1991; 65: 1143-1152 14. Rosnet O, Schiff C, Pébusque MJ, Marchetto S, Tonnelle C, Toiron Y, Birg F, Birnbaum D: Human FLT3/FLK2 gene: cDNA cloning and expression in hematopoietic cells. Blood 1993; 82: 1110-1119 15. Yarden Y, Ullrich A: Growth factor receptor tyrosine kinase. Annu Rev Biochem 1988; 57: 443-478 16. Abu-Duhier FM, Goodeve AC, Wilson GA, Care RS, Peake IR, Reilly JT: Identification of novel FLT-3 Asp835 mutations in adult acute myeloid leukaemia. Br J Haematol 2001; 113: 983-988 17. Hou YY, Tan YS, Sun MH, Wei YK, Xu JF, Lu SH, A-Ke-Su SJ, Zhou YN, Gao F, Zheng AH, Zhang TM, Hou WZ, Wang J, Du X, Zhu XZ: C-kit gene mutation in human gastrointestinal stromal tumors. World J Gastroenterol 2004; 10: 1310-1314 18. Sihto H, Sarlomo-Rikala M, Tynninen O, Tanner M, Andersson LC, Franssila K, Nupponen NN, Joensuu H: KIT and Platelet-Derived Growth Factor Receptor Alpha Tyrosine Kinase Gene Mutations and KIT Amplifications in Human Solid Tumors. Journal of clinical oncology 2005; 23: 49-57 19. Tian Q, Frierson HF Jr, Krystal GW, Moskaluk CA: Activating c-kit Gene Mutations in Human Germ Cell Tumors. Am J Pathol 1999; 154: 1643-1647 20. Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, Gralnick HR, Sultan C: Proposals for the classification of the acute leukaemias. French-American British (FAB) co-operative group. Br J Haematol 1976; 33: 451-458 21. Moskaluk CA, Kern SE: Microdissection and Polymerase Chain Reaction Amplification of Genomic DNA from Histological Tissue Sections. Am J Pathology 1997; 150: 1547-1552

Hussain S R, et al: Detection of Mutations in Exon 11 of the c-kit gene in Leukemia

22. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T: Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphism. Proc Natl Acad Sci USA 1989; 86: 2766-2770 23. Lasota J, Corless CL, Heinrich MC, Debiec-Rychter M, Sciot R, Wardelmann E, Merkelbach-Bruse S, Schildhaus HU, Steigen SE, Stachura J, Wozniak A, Antonescu C, Daum O, Martin J, Del Muro JG, Miettinen M: Clinicopathologic profile of gastrointestinal stromal tumors (GISTs) with primary KIT exon 13 or exon 17 mutations: A multicenter study on 54 cases. Mod Pathol 2008; 21: 476-484 24. Lasota J, Wozniak A, Sarlomo-Rikala M, Rys J, Kordek R, Nassar A, Sobin LH, Miettinenet M: Mutations in exons 9 and 13 of KIT gene are rare events in gastrointestinal stromal tumors. A study of 200 cases. Am J Pathol 2000; 157: 1091-1095 25. Lux ML, Rubin BP, Biase TL, Chen J, Maclura T, Demetri G, Xiao S, Singer S, Fletcher CD, Fletcher JA: KIT extracellular and kinase domain mutations in gastrointestinal stromal tumors. Am J Pathol 2000; 156: 791-795 26. Rubin BP, Singer S, Tsao C, Duensing A, Lux ML, Ruiz R, Hibbard MK, Chen CJ, Xiao S, Tuveson DA, Demetri GD, Fletcher CD, Fletcher JA: KIT activation is a ubiquitous feature of gastrointestinal stromal tumors. Cancer Res 2001; 61: 8118-8121 27. Lasota J, Jasinski M, Sarlomo-Rikala M, Miettinenet M: Mutations in exon 11 of c-Kit occur preferentially in malignant versus benign gastrointestinal stromal tumors and do not occur in leiomyomas or leiomyosarcomas. Am J Pathol 1999; 154: 53-60

Turk J Hematol 2012; 29: 10-16

28. Antonescu CR, Sommer G, Sarran L, Tschernyavsky SJ, Riedel E, Woodruff JM, Robson M, Maki R, Brennan MF, Ladanyi M, DeMatteo RP, Besmer P: Association of KIT exon 9 mutations with nongastric primary siteand aggressive behavior: Kit mutation analysis and clinical correlates of 120 gastrointestinal stromal tumors. Clin Cancer Res 2003; 9: 3329-3337 29. Yasuoka R, Sakakura C, Shimomura K, Fujita Y, Nakanishi M, Aragane H, Hagiwara A, Bamba M, Abe T, Yamagishi H: Mutations in exon-11of the C-KIT gene in a Myogenic Tumor and a Neurogenic tumor as well as in gastrointestinal stromal tumors. Dig Surg 2003; 20: 183-191 30. Kim TW, Lee H, Kang YK, Choe MS, Ryu MH, Chang HM, Kim JS, Yook JH, Kim BS, Lee JS: Prognostic Significance of c-kit Mutation in Localized Gastrointestinal Stromal Tumors. Clin Cancer Res 2004; 10: 3076-3081 31. Taniguchi M, Nishida T, Hirota S, Isozaki K, Ito T, Nomura T, Matsuda H, Kitamura Y: Effect of c-kit mutation on prognosis of gastrointestinal stromal tumors. Cancer Res 1999; 59: 4297-4300 32. Choe YS, Kim JG, Sohn SK, Kim DH, Baek JH, Lee KB, Do YR, Kwon KY, Song HS, Lee MH, Park TI: C-kit Expression and mutations in peripheral T cell lymphomas, except for extra-nodal NK/T cell lymphomas. Leuk Lymphoma 2006; 47: 267-270

Research Article

DOI: 10.5505/tjh.2012.33602

Flow Cytometric Evaluation of Cell Cycle Regulators (Cyclins and Cyclin-Dependent Kinase Inhibitors) Expressed on Bone Marrow Cells in Patients with Chronic Myeloid Leukemia and Multiple Myeloma Kronik Miyelositer Lösemi ve Multipl Miyelom Olgularındaki Kemik İliği Kaynaklı Hücrelerde, Hücre Siklusu Düzenleyicilerinin (Siklinler ve Siklin Bağımlı Kinaz İnhibitörleri) Akım Sitometrik Olarak Değerlendirilmesi Selami K Toprak1, Klara Dalva1, Merih Kızıl Çakar1, Nazmiye Kurşun2, Meral Beksaç1 Ankara University, School of Medicine Department of Hematology, Ankara, Turkey Ankara University, School of Medicine Department of Biostatistics, Ankara, Turkey

1 2

Abstract Objective: The aim of this study was to use flow cytometry to analyze the expression of cell cycle-regulating elements with low and high proliferative signatures in patients with malignant diseases.

Material and Methods: Cyclin D, E, A, and B, and cyclin-dependent kinase inhibitor (CDKI) p16 and p21 levels were measured via flow cytometry in patients with chronic myeloid leukemia (CML) (n = 16) and multiple myeloma (MM) (n = 13), and in controls (n = 15).

Results: The distributions of the cell cycle S phase were 10, 63%, 6, 72% and 3, 59%; for CML, MM and control patients, respectively. Among all the cyclins expressed during the S phase, cyclin D expression was the lowest in the CML patients. Distribution of cyclins and CDKIs during the G2/M phase was similar in the MM and control groups, whereas cyclin expression was similar during all 3 phases in the MM and CML groups.

Conclusion: Elevated cyclin expression during cell cycle phases in the CML and MM patients was not associated with elevated CDKI expression. This finding may increase our understanding of the mechanisms involved in the etiopathogenesis of hematological malignancy.

Key Words: Chronic myeloid leukemia, Cyclin, Cyclin dependent kinase inhibitor, Flow cytometry, Multiple myeloma

Address for Correspondence: Selami Koçak TOPRAK, M.D., Ankara Üniversitesi, Tıp Fakültesi, Hematoloji Bilim Dalı, Ankara, Turkey Phone: +90 532 656 02 06 E-mail: sktoprak@yahoo.com Received/Geliş tarihi : January 11, 2011 Accepted/Kabul tarihi : April 28, 2011

Toprak S K, et al: Cyclins and Inhibitors in Hematological Malignancies

Turk J Hematol 2012; 29: 17-27

Özet Amaç: Bu çalışmanın amacı, yüksek ve düşük proliferasyon hızına sahip malign hastalıklarda, hücre siklusunu düzenleyen faktörlerin flow sitometrik olarak analiz edilmesidir. Gereç ve Yöntemler: Kronik miyelositer lösemi (KML) (n=16), Multipl Miyelom (MM) (n=13) ve kontrol (n=15) olgularında siklin D, E, A, B ve siklin bağımlı kinaz inhibitörü (SBKİ) p16, p21 düzeyleri akımsitometrik yöntemle ölçülmüş ve değerlendirilmiştir.

Bulgular: KML, MM ve kontrol olgularındaki S evresi dağılımı sırasıyla % 10, 63; % 6, 72 ve % 3, 59 olarak saptanmıştır. KML grubunda siklin D ekspresyonu, S evresindeki diğer siklinlere göre en düşük düzeyde bulunmuştur. G2/M evresinde, MM ve kontrol gruplarındaki siklin ve SBKİ düzeyleri birbirleriyle benzer saptanırken, MM ve KML gruplarının her üç evresindeki siklin ekspresyonları ise paralel bulunmuştur.

Sonuç: Kontrol grubuyla karşılaştırıldığında hasta gruplarında, siklin ekspresyonlarının artışına SBKİ düzeylerinin artışının eşlik etmediği saptanmıştır. Bu bulgu, belki de hematolojik malign hastalıkların etyopatogenezinin açıklanmasına katkıda bulunabilecektir.

Anahtar Sözcükler: Akımsitometri, Kronik miyelositer lösemi, Multipl Miyelom, Siklin, Siklin bağımlı kinaz inhibitörü

Introduction Tissue homeostasis is dependent on the perfect balance between cell proliferation and cell death [1]. Proliferation of cells occurs following consecutive events and stages. Dysregulated cell cycle control is a fundamental characteristic of cancers [2]. Normal cells only proliferate in response to developmental or other mitogenic signals that indicate a requirement for tissue growth, whereas the proliferation of cancer cells proceeds essentially unchecked [2]. An understanding of the molecular details of cell cycle regulation and checkpoint abnormalities in cancer, and how these control mechanisms can be manipulated could provide insight into potential therapeutic strategies [3]. The cell division cycle is regulated by fluctuation in cyclin-dependent kinase (CDK) and cyclin pairs activity [4]. CDK activity requires binding to regulatory subunits known as cyclins [5]. CDK-cyclin complexes include 3 interphase CDKs (CDK2, CDK4, and CDK6), a mitotic CDK (CDK1, also known as cell division control protein 2), and 4 different classes of cyclins (A-, B-, D-, and E-type cyclins) [5]. The transition of cells through the early G1 stage of the cell cycle is coordinated by the activity of CDK4 and CDK6 complexes that are formed following the mitogen-dependent expression of D-type cyclins (D1, D2, and D3) [6]. CDK4/6-type-D cyclin complexes phosphorylate and inactivate retinoblastoma family protein (pRb), resulting in the release of E2F transcription factors that control the expression of the genes required for G1/synthesis phase transition and synthesis to S phase progression [4]. Inactivation of pRb facilitates expression

of E-type cyclins that bind and activate CDK2 during the late G1 and early S phases. In reference to such studies, CDK2-cyclin A were implicated in committing a cell to the completion of S phase [7]. Despite requiring phosphorylation, CDK-cyclin complexes are kept inactivated by binding to a CDK inhibitor (CDKI). CDK activity is regulated by 2 families of inhibitors: INK4 proteins, including INK4A (p16), INK4B (p15), INK4C (p18), and INK4D (p19), and the Cip and Kip family, which is composed of p21 (Cip1), p27 (Kip1), and p57 (Kip2) [5,8]. In general, when the INK group functions in the genetic pathway containing cyclin D-CDK4/6pRb and E2F, the Cip/Kip group can inhibit CDK2 kinase and CDK4/6 [9,10]. Recent research indicates that CDK down regulation may result in defective homeostasis in specific tissues and that CDK hyperactivation may facilitate tumor development by inducing unscheduled cell division in stem and progenitor cells [5]. CDKs are targets for cancer therapy; their expression is often perturbed in cases of malignancy and their inhibition can induce apoptosis [11]. Cellular checkpoint integrity is often lost as a result of CDKI inactivation or cyclin overexpression [11]. Multiple myeloma (MM) is a malignant neoplasm that arises from plasma cells of low proliferative potential [12]. Translocations involving the immunoglobulin heavy chain region (IgH) on chromosome 14q32 are an important cytogenetic event in the pathogenesis of various B-cell lymphoid neoplasms such as MM. To date, approximately more than 20 different chromosomal partner regions that

Turk J Hematol 2012; 29: 17-27

Toprak S K, et al: Cyclins and Inhibitors in Hematological Malignancies

translocate to 14q32 have been identified in MM, of which t(11;14)(q13;q32) is the most common translocation, with a reported frequency of 15%-20% based on fluorescence in situ hybridization (FISH) and conventional cytogenetic analysis [13].

eral new molecules are now being tested—alone and in combination with imatinib—to overcome accelerated and blastic phases. Indirubin is a CDKI that has been used in traditional medicine for hundreds of years and is currently being used in clinical trials for CML [19].

Although myeloma tumors exhibit complex karyotypes, and a variety of structural and quantitative chromosomal abnormalities, these tumors are unified in their ubiquitous targeting of cyclin D genes for overexpression [14]. In all, 54% of myeloma tumors overexpress cyclin D1 (CCND1), 48% overexpress cyclin D2 (CCND2), 3% overexpress cyclin D3 (CCND3), and 8% overexpress both CCND1 and CCND2 [15]. Recently, translocation and cyclin (TC) classification of MM has been introduced; the classification is based on cyclin expression types [16]. Thus, CDK inhibitors have a potential role in the treatment of MM, including PD 0332991, a specific inhibitor of CDK4/6, and seliciclib, UCN-01, P276-00, AT7519, and RGB 286638, non-specific CDK inhibitors [12].

The aim of the present study was to use flow cytometry to analyze the expression of nuclear cell cycle-regulating elements in patients with MM and CML, diseases with a low and high proliferation signature, respectively. In normal and hematologically malignant cells partial illumination of the cell cycle—and thus the etiopathology of malignancy—can only be determined via comparison of the quantified changes in the cyclical phases of cyclins and CDKIs in healthy and malignant proliferated cells.

Chronic myeloid leukemia (CML) is a clonal myeloproliferative disorder characterized by a chromosomal translocation (9;22) (q34; q11) that produces the oncogenic Bcr-Abl fusion protein, resulting in a constitutively active tyrosine kinase with high proliferative potential [17]. Despite progress in the treatment of early-stage CML, the accelerated and blastic phases of CML remain a therapeutic challenge; therefore, novel treatment approaches are needed [17]. Few data are available concerning the expression status of such cell cycle regulators as cyclins and CDKIs in CML [18]. Recent data show that low or undetectable expression of CDKI genes is a significant marker for the active phase of the disease; therefore, sev-

Material and Methods Patients and their Characteristics Following ethics committee approval of the study protocol and obtaining written informed consent from each patient, 16 consecutive CML patients, 13 consecutive MM patients, and 15 controls were included in the study. Mean age of the CML patients (9 male and 7 female) was 44.5 ± 8.2 years (rage: 22-59 years), versus 54.5 ± 4.5 years (range: 49-66 years) in the MM patients (8 male and 5 female). Mean age of the controls (7 male and 8 female), who regardless of diagnosis had histopathologically proven normal bone marrow, was 45.8 ± 11.8 years (range: 26-71 years). Table 1 summarizes the characteristics of the patients and controls. Prognosis in the CML patients was determined according to the Sokal Index and staging of the MM patients was based on the International Staging System (ISS) (Table 1) [20,21]. Samples that were obtained for diagnoses were used in this prospective study.

Table 1: Characteristics of the Patients and Controls

Groups

Gender (M/F)

Mean age in years (range)

Stage (n)

Prognosis

BM plasma cell

Chronic: 15 Blastic: 1

Low: 0 Intermediate: 8 High: 8

CML

9/7

44.5 ± 8.2 (2259)

8/5

54.5 ± 4.5 (4966)

Stage I: 4 Stage II: 6 Stage III: 3

n = 9 (≥30%) n = 4 (<30%)

Control

7/8

45.8 ± 11.8 (26-71)

Toprak S K, et al: Cyclins and Inhibitors in Hematological Malignancies

Turk J Hematol 2012; 29: 17-27

Monoclonal Antibodies

Flow Cytometry Principle We used specific monoclonal antibodies and flow cytometry to determine cellular expression of cyclins (cyclin A, B, D, and E) and cyclin inhibitors (p16 and p21) throughout the cell cycle. Preparation of Cells Mononuclear cells (MNCs) were isolated from selected bone marrow (BM) specimens collected in tubes containing ethylene diamine tetraacetic acid (EDTA) using a density gradient (Ficoll 1.077, Biochrom KG, Berlin, Germany). Following isolation of MNCs, a cell count was performed before the cells were fixed in a methanol-free 1% formaldehyde solution for 15 min at 4 °C. Following a washing step performed with phosphate-buffered saline (PBS) containing 1% fetal calf serum (FCS, Sigma, St. Lois, USA), fixation was repeated with 80% ethanol while vortexing the cells in order to prevent the formation of aggregates. The fixed cells were kept in 80% ethanol at –20 °C until the assay was performed. Before the assay, the cells were washed with wash buffer (WB) at 400 g for 10 min, so as to remove the ethanol, and then incubated with WB containing Triton X-100 for 5 min at 4 °C in order to perforate the cells.

We used the FITC conjugates of the antibodies specific to cyclins A, B, and D, and inhibitor p16 (Pharmingen, USA) and their isotopic controls. The antibodies specific to cyclin E and inhibitor p21 were pure and labeled with a secondary antibody conjugated with FITC (GAM-FITC Pharmingen, USA) (Table 2). We used isotypic controls in order to check for unspecific binding and to set the markers during the evaluation of the results. Assay Following distribution of 100 mL of cells (106 cells tube—1) in each tube containing specific antibodies or isotypic controls, cells were incubated for 16 h at 4 °C. At the end of the first incubation secondary antibodies were added to the number 7, 8, and 9 tubes, which contained the pure antibodies, followed by incubation for 1 h at room temperature. During this period all other tubes were kept at 4 °C. Following incubation, cells were washed with 2 mL of WB (spun at 400 g for 5 min). Upon elimination of unbound material, the tubes were incubated with 0.5 mL of propidium iodide for 10 min (PI; 10 mg mL–1, Medac, Germany) in order to label cellular DNA. The tubes were maintained at 4 °C until data acquisition, which was performed within 1 h of the final incubation.

Table 2: Pipetting Scheme

Tube

Primary Antibody

GAM-FITC

PI (10 mg mL–1)

Cyclin A isotypic control-FITC

20 µL

0.5 mL

Cyclin A-FITC

20 µL

0.5 mL

Cyclin B isotypic control-FITC

20 µL

0.5 mL

Cyclin B

20 µL

0.5 mL

Cyclin D isotypic control-FITC

20 µL

0.5 mL

Cyclin D

20 µL

0.5 mL

Cyclin E isotypic control (pure)

10 µL

0.5 mL

Cyclin E (pure)

10 µL

0.5 mL

P21 (pure)

10 µL

0.5 mL

P16 isotypic control-FITC

20 µL

0.5 mL

P16-FITC

20 µL

0.5 mL

Turk J Hematol 2012; 29: 17-27

Toprak S K, et al: Cyclins and Inhibitors in Hematological Malignancies

Cell Acquisition Data acquisition was performed using a FACS Calibur flow cytometry instrument (Becton Dickinson San Jose, CA, USA) after daily checks were made using Calibrites and CENs (Chicken Erytocyte Nucleus). We collected and analyzed the data for each tube using CellQuest software. We detected and recorded signals that originated from FSC, SSC, FL1, FL2, FL2Width, and FL2Area. We also performed cell cycle analysis using ModFit software (Verity Software House, ME, USA). Analysis Before cell cycle analysis, aggregated cells were eliminated using the FL2Width-FL2Area distribution of cells. All analyses were performed in this selected single cell population. Upon the definition of G0/G1, S, and G2/M phases based on the FL2Area parameter that expressed the DNA content of the cell, the level of expression of cyclins A, B, D, and E, and inhibitors p21 and p16 was evaluated separately for each phase. We also analyzed the cell cycle phases using ModFit software, which uses a different mathematical approach to fit the FL2Area curve. Statistics Kruskal-Wallis analysis was used for comparison of cyclin and inhibitor expression levels during each phase of the cell cycle. When a statistically significant difference was established between these two patients and one control groups, the multiple comparisons test was used to investigate the each group. Apart from this, analysis of cyclin and inhibitor data was performed within each group separately depending on changes of each phase using the Wilcoxon signed-rank test. Table 3: Cell cycle Phase Distribution in the Control and Patient Groups

Phase (%) Groups G0/G1

G2/M

CML

90.01

10.63

0.74

91.80

6.72

1.73

Control

89.0

3.59

1.7

Figure: Distribution of the cell cycle phases analyzed using ModFit and CellQuest software (sample cases: A: CML; B: MM; C: control).

*(P = 0.536)

Toprak S K, et al: Cyclins and Inhibitors in Hematological Malignancies

Turk J Hematol 2012; 29: 17-27

Cell Cycle Regulators in the Patients

Results Cell Cycle Phase Evaluation

CML Patients

The distribution of the cell cycle phases based on analysis using ModFit and CellQuest software is shown in Table 3. There was a trend towards a higher percentage of cells in the S phase for the CML group, while the values were not significantly different (P = 0.536).

Expression of cyclins A, B, D, and E, and CDKIs p21 and p16 during the G0/G1 and S phases were similar in the CML patients and controls (P > 0.05); however, this was due to the similarity in the change observed from the G0/G1 to S phase in the controls. Cyclin D had the lowest level of expression of all the cyclins during the S phase, unlike in the control group (P < 0.05).

DNA analysis of the control samples showed an abundance of G0/G1 phase cells, as expected; however, the CML and MM patients had more cells in the S phase (Figure), although the number of cells in the S phase was similarly low in the MM and control groups. As the number of control cells in the G2/M phase was insufficient, cyclin and CDKI measurements could not be performed in this group.

MM Patients Distribution of cyclins during the G0/G1, S, and G2/M phases was similar in the MM and CML patients. Except for the G2/M phase, a similar pattern of cyclin and CDKI expression was observed in the controls and MM patients. Tables 4 and 5 summarize the results of the comparisons of cyclin and CDKI expression patterns during the cell cycle phases in the 2 patient groups and the control group.

Distribution of cell Cycle Regulators in the Control Group According cell Cycle Phases Comparison of the cell cycle-regulating elements cyclin A, B, D, and E, and CDKIs p16 and p21 in the control group showed that cyclin D was expressed most frequently during the G0/G1 phase; the other cyclins were present in 33% of the cells, and the cyclin E level was very low. Both CDK inhibitors (p16 and p21) were detectable, though p16 was expressed at a higher level. During the S phase all cyclins, except for cyclin E, were present in 66% of the cells. The relationship with p16 and p21 in the S phase was similar to the G0/G1 phase. No cells in the G2/M phase were detected in the control group.

Discussion The present study used flow cytometry to analyze the expression of cyclins A, B, D, and E, and CDKIs p21 and p16 in patients with CML and MM, and controls. Expression of cyclins D and E is expected in eukaryotes during the G1 phase [22]. When passing through the R checkpoint cyclin type D is expressed [23]; thus, the expression of cyclin D as the major cyclin occurs during the G0/G1 phase [24]. Comparison of the G0/G1 and S phases in the

Table 4: Percentage of Cells Expressing Cyclins and CDKIs, According to Phase

G0/G1

Cyclin A

Cyclin B

Cyclin D

Cyclin E

p21

p16

CML

21.5

85.5

28.5

26.5

67.5

Control

Cyclin A

Cyclin B

Cyclin D

Cyclin E

p21

p16

CML

45.5

10.5

36.5

76.5

Control

G2/M

Cyclin A

Cyclin B

Cyclin D

Cyclin E

p21

p16

CML

76.5

20.5

24.5

Control MM

Turk J Hematol 2012; 29: 17-27

Toprak S K, et al: Cyclins and Inhibitors in Hematological Malignancies

Table 5: Comparison of Cyclins and CDKIs Between Phases in the Patient Groups

Group

CML

Cyclin/CDKI

G0/G1-S P < 0.001

G0/G1 < S

P < 0.05

G0/G1 < G2/M

P < 0.001

G0/G1 < S

P < 0.05

G0/G1 < G2/M

P < 0.001

G0/G1 > S

P < 0.05

G0/G1 > S

G0/G1 < G2/M

p16

P < 0.05

Cyclin/CDKI

P < 0.05

G0/G1-G2/M

S-G2/M

P < 0.01

G0/G1 < S

P < 0.05

G0/G1 < G2/M

P < 0.05

G0/G1 < S

P < 0.01

G0/G1 < G2/M

P < 0.01

G0/G1 > S

P < 0.05

G0/G1 > G2/M

P < 0.05

p16

Control

G0/G1 < S

G0/G1-S

p21

Group

S-G2/M

p21

Group

G0/G1-G2/M

G0/G1 > S -

Cyclin/CDKI

G0/G1-S

P < 0.01

G0/G1 < S

P < 0.05

G0/G1 < S

P < 0.01

G0/G1 > S

p21

p16 present study showed that D-type cyclin expression was lower during the S phase (P < 0.01). According to the literature, cyclin E plays a role in the transition of cells from the G1 to S phase [25-27]. In the present study cyclin E expression in the control group during G0/G1 and S phases did not differ significantly. Flow cytometry may not be the ideal technique for differentiating early and late cell phases; thus, the finding that cyclin E expression during the S phase was similar to that during the G0/G1 phase might have been because the cells that were measured were in the early S phase. Cyclins A and B, which are referred to as mitotic cyclins, are initially produced following the start of the S phase, and then promote the subsequent phases of the cell cycle [8,28,29]. As the expression of cyclin A begins during the

P < 0.05

G0/G1 > S

late G1-early S phase, cyclin B expression occurs during the late S phase and peaks through the G2 phase [30,31]. It is well known that cyclin A is responsible from the continuation of the S phase and DNA replication at this phase, expression of cyclin B triggers the end of the G2 phase and initiation of mitosis [32-34]. In the present study, in accordance with the literature, expression of cyclins during the S phase in the control group was significantly higher than that during the G0/ G1 phase (cyclin A: P < 0.01; cyclin B: P < 0.05). As most of the cells in the control group were resting, the G2/M phase could not be observed. CDKI p16 expression in the control group was significantly higher during the G0/G1 phase than during the S phase (P < 0.05), whereas CDKI p21 did not follow this pattern.

Toprak S K, et al: Cyclins and Inhibitors in Hematological Malignancies

In the present study’s CML group expression of cyclin D, which belongs to the G1 cyclins group, was maximal during the G0/G1 phase, as expected. Cyclin D expression during the S phase was lower than that during the G0/G1 phase (P < 0.001). Based on data from the literature, cyclin D has an evident expression during the G0/G1 phase in CML, but can be higher during the later phases of the cell cycle [35-40]. Expression of the other G1 type cyclin in the present study—cyclin E—did not differ from that of cyclin D. Maximal expression of cyclin E was observed during the G0/ G1 phase, which was higher than that during the S phase (P < 0.05). In the present study cyclin E expression during the last phase was significantly lower than during the G1 phase, which is agreement with Gong et al.’s results [38]. Cyclin E expression in the present study’s CML group was comparable to that reported by Qin et al. [41]. In the present study expression of cyclin A—a mitotic cyclin—was similar in the CML and control groups. Cyclin A expression was higher during the S phase than during the G0/G1 phase (P < 0.001), and was higher during the G2/M phase than during the G0/G1 phase (P < 0.05), which is in agreement with Paterlini et al. [39]. Koeffler et al. compared the expression of cyclin A1 in normal and leukemic hematopoietic cell lines using RT-PCR and reported that this cyclin was overexpressed in the leukemic lines [42]. Kramer et al. used RT-PCR and reported that cyclin A1 was present in 84 of 113 CML patients [32]. In the present study expression of the other mitotic cyclin—cyclin B—was similar to that of cyclin A throughout the cell cycle. Cyclin B expression was significantly higher during the S phase than during the G0/G1 phase (P < 0.001), and was higher during the G2/M phase than during the G0/G1 phase (P < 0.05). Cyclin B expression during the S and G2/M phases did not differ significantly, as expected. Gorczyca et al. [31] reported cyclin B1 overexpression during the S phase fraction and in accordance with the present study although cyclin B1 expression was not observed during the S and G2/M phases in lymphocytes administered phytohemagglutinin to stimulate proliferation, its expression was high during all 3 phases in tumoral samples. In the present study cyclin B expression was observed during the first phase in the CML patients, which is similar to the results Ma et al. reported in acute leukemia patients [43]. The expression of p16 in the present study differed between the controls and patients; it occurred during both the G0/G1 and S phases in the control group, but during all 3 phases in the CML group, and its level of expression

Turk J Hematol 2012; 29: 17-27

in the CML group during the S phase was significantly higher than that in the control group (P < 0.05). When the cyclin D levels of the G0/G1 and S phases were examined, there was no statistically significant difference between the CML and control groups. In addition, while cyclin D expression was significantly higher during the G0/G1 phase than during the S phase in the CML group, expression of its inhibitor (p16) was lower during the G0/G1 phase than during the other phases, suggesting an imbalance that facilitates leukemic progression. Hirose et al. did not observe any p16 expression despite the fact that cyclin D1 and CDK4 expression was observed in 16 of the 17 lines they examined [44]. In the present study p21 was expressed at a similar level during all 3 phases in the CML patients; however, more importantly cyclin A expression was higher during the S phase in the control group than in the CML group (P < 0.01), whereas p21 expression was similar. This finding suggests another imbalance between cyclins and CDKIs that facilitates malignant cellular proliferation. Cyclin D expression in MM patients has been studied extensively [45-48]; however, findings concerning the phase during which its expression is highest are inconclusive. In some studies p16 protein was observed in mature cell lines, whereas cyclin D1 was highly expressed in immature cells [49]. Cyclin D1 expression was at its peak during the G0/ G1 phase in the present study’s MM group, as expected. Cyclin D1 expression was significantly higher during the G0/G1 phase than during the S phase in the MM group (P < 0.01), and was higher during the G0/G1 phase than during the G2/M phase (P < 0.05). Expression of cyclin D1—a G1 cyclin—during the S and G2/M phases did not differ significantly. A study by Sonoki et al. included 20 patients with plasma cell malignancies that were analyzed using the Northern blot. Cyclin D1 expression was observed in 6 of their 17 MM cases and all 3 plasma cell leukemia cases [45]. Pruneri et al. reported that the rate of cyclin D1 overexpression was 25% among 48 MM patients [46]. Hoechtlen-Vollmar et al. [50] reported cyclin D1 expression in 19 of 50 MM cases, which is similar to the present study’s findings. The researchers also reported that beta-2 microglobulin and cyclin D1 amplification can be used together to predict duration of survival. Based on the present study’s results and those previously published, cyclin D1 expression is highest during the first phase and gradually decreases during the subsequent phases. In the present study’s MM group p16 expression occurred at a similar level during all 3 phases of the cell cycle. CDKI p16 expression the in MM group was simi-

Turk J Hematol 2012; 29: 17-27

Toprak S K, et al: Cyclins and Inhibitors in Hematological Malignancies

lar to that in the control group. The level of expression of p16 did not follow the overexpression of cyclin D during the G0/G1 phase, which was another imbalance between cyclins and CDKIs. Kawano et al. compared immature myeloma cell lines with mature myeloma and normal plasma cells, and reported that p16 expression was detected in the mature myeloma cells despite the absence of cyclin D1. Cyclin D1 was the dominant protein in the immature myeloma cells, whereas p16 was primarily expressed in normal plasma cells and mature myeloma cells. According to the researchers, p16 amplification was responsible for the loss of long-term proliferation in some of the cell lines [49].

not isolate plasma cells in the MM patients and that the findings reflect changes observed in bone marrow. Cyclins and their inhibitors in the present study exhibited different properties during the cell cycle phases checkpoints in the CML and MM patients. Additionally, among the cyclins we examined during different phases of the cell cycle, despite the finding that some of them exceeded the normal range, cyclin inhibitors not associating this increase may contribute the mechanisms effective in the etiopathogenesis. In conclusion, the present findings indicate that synthetic CDKIs may be a promising new treatment for CML and MM. Acknowledgments

Although maximal expression of cyclin E occurred during the G0/G1 phase in the present study, its expression did not differ significantly between the G0/G1 and the S phases, the G0/G1 and the G2/M phases, or the S and G2/M phases. To date, cyclin E has not been observed in MM. Cyclin A expression was higher during both the S (P < 0.01) and G2/M (P < 0.05) phases than during the G0/ G1 phase for MM group.

This study was supported by the Scientific and Technological Research Council of Turkey (TUBITAK, Project no: SBAG-2205) and Turkish Academy of Sciences (TUBA).

There wasn’t a significant difference in cyclin A expression between the S and G2/M phases. Urashima et al. reported that p21 had widespread expression in MM cell lines, independent of p53 [51]. They also reported that p21 expression increased following exposure to dexamethasone and downregulated by interleukin-6. During the resting period (G1 arrest) expression of p21 was significantly higher, but decreased during proliferation. Similarly, we observed an increase in cyclin A expression and a decrease in p21 expression during the S phase, as compared to the G0/G1 phase; however, in the control group cyclin A expression was significantly higher during the S phase than during the G0/G1 phase, whereas p21 expression did not differ. It can be an explanation to why proliferation is increased when compared with the controls. Expression of the other mitotic cyclin—cyclin B—was similar to that of cyclin A in the present study. Similarly, cyclin B expression was higher during the S (P < 0.05) and G2/M (P < 0.01) phases than during the G0/G1 phase, and there wasn’t a significant difference between the S and G2/M phases. The S phase fraction percentages in the CML and MM groups did not differ significantly than those in the control group. As expected, the highest S phase rate was observed in the CML group, followed by the control group, and the lowest rates were noted in the MM group, but there was no statistically significant difference. CML and MM present exhibit variable degrees of proliferation. It is noteworthy that in the present study we did

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Vermeulen K, Berneman ZN, Van Bockstaele DR: Cell cycle and apoptosis. Cell Prolif 2003; 36: 165-175 2. Nakayama KI, Nakayama K: Ubiquitin ligases: Cell-cycle control and cancer. Nat Rev Cancer 2006; 6: 369-381 3. Golias CH, Charalabopoulos A, Charalabopoulos K: Cell proliferation and cell cycle control: A mini review. Int J Clin Pract 2004; 58: 1134-1141 4. de Cárcer G, Pérez de Castro I, Malumbres M: Targeting cell cycle kinases for cancer therapy. Curr Med Chem 2007; 14: 969-985 5. Malumbres M, Barbacid M: Cell cycle, CDKs and cancer: A changing paradigm. Nat Rev Cancer 2009; 9: 153-166 6. Echalier A, Endicott JA, Noble ME: Recent developments in cyclin-dependent kinase biochemical and structural studies. Biochim Biophys Acta 2010; 1804: 511-519 7. Budirahardja Y, Gönczy P: Coupling the cell cycle to development. Development 2009; 136: 2861-2872 8. Stillman B: Cell cycle control of DNA replication. Science 1996; 274: 1659-1664 9. Hunter T, Pines J: Cyclins and cancer. Cell 1991; 66: 1071-1074 10. Sherr CJ: Cancer cell cycles. Science 1996; 274: 1672-1677 11. Dickson MA, Schwartz GK: Development of cell-cycle inhibitors for cancer therapy. Curr Oncol 2009; 16: 36-43

Toprak S K, et al: Cyclins and Inhibitors in Hematological Malignancies

12. Cirstea D, Vallet S, Raje N: Future novel single agent and combination therapies. Cancer J 2009; 15: 511-518 13. Specht K, Haralambieva E, Bink K, Kremer M, MandlWeber S, Koch I, Tomer R, Hofler H, Schuuring E, Kluin PM, Fend F, Quintanilla-Martinez L: Different mechanism of cyclin D1 overexpression in multiple myeloma revealed by fluorescence in situ hybridization and quantitative analysis of mRNA levels. Blood 2004; 104: 1120-1126 14. Tiedemann RE, Mao X, Shi CX, Zhu YX, Palmer SE, Sebag M, Marler R, Chesi M, Fonseca R, Bergsagel PL, Schimmer AD, Stewart AK: Identification of kinetin riboside as a repressor of CCND1 and CCND2 with preclinical antimyeloma activity. J Clin Invest 2008; 118: 1750-1764 15. Bergsagel PL, Kuehl WM, Zhan F, Sawyer J, Barlogie B, Shaughnessy J Jr: Cyclin D dysregulation: An early and unifying pathogenic event in multiple myeloma. Blood 2005; 106: 296-303 16. Fonseca R, Bergsagel PL, Drach J, Shaughnessy J, Gutierrez N, Stewart AK, Morgan G, Van Ness B, Chesi M, Minvielle S, Neri A, Barlogie B, Kuehl WM, Liebisch P, Davies F, ChenKiang S, Durie BGM, Carrasco R, Sezer O, Reiman T, Pilarski L, Avet-Loiseau H; International Myeloma Working Group: Molecular classification of multiple myeloma: Spotlight review. Leukemia 2009; 23: 2210-2221 17. Zang C, Liu H, Waechter M, Eucker J, Bertz J, Possinger K, Koeffler HP, Elstner E: Dual PPARalpha/gamma ligand TZD18 either alone or in combination with imatinib inhibits proliferation and induces apoptosis of human CML cell lines. Cell Cycle 2006; 5: 2237-2243 18. Cividin M, Ayrault O, Sorel N, Séité P, Brizard F, Blanchet O, Mahon FX, Guilhot F, Larsen C, Chomel JC, Brizard A: Expression of the cell cycle regulators p14(ARF) and p16(INK4a) in chronic myeloid leukemia. Leuk Res 2006; 30: 1273-1278 19. Ikeda A, Shankar DB, Watanabe M, Tamanoi F, Moore TB, Sakamoto KM: Molecular targets and the treatment of myeloid leukemia. Mol Genet Metab 2006; 88: 216-224 20. Sokal JE, Cox EB, Baccarani M, Tura S, Gomez GA, Robertson JE, Tso CY, Braun TJ, Clarkson BD, Cervantes F: Prognostic discrimination in “good-risk” chronic granulocytic leukemia. Blood 1984; 63: 789-799 21. Greipp PR, San Miguel J, Durie BG, Crowley JJ, Barlogie B, Bladé J, Boccadoro M, Child JA, Avet-Loiseau H, Kyle RA, Lahuerta JJ, Ludwig H, Morgan G, Powles R, Shimizu K, Shustik C, Sonneveld P, Tosi P, Turesson I, Westin J: International staging system for multiple myeloma. J Clin Oncol 2005; 23: 3412-3420 22. Vermeulen K, Van Bockstaele DR, Berneman ZN: The cell cycle: A review of regulation, deregulation and therapeutic targets in cancer. Cell Prolif 2003; 36: 131-149

Turk J Hematol 2012; 29: 17-27

23. Schwartz GK, Shah MA: Targeting the cell cycle: a new approach to cancer therapy. J Clin Oncol 2005; 23: 9408-9421 24. Johansson M, Persson JL: Cancer therapy: Targeting cell cycle regulators. Anticancer Agents Med Chem 2008; 8: 723-731 25. Van Dross R, Browning PJ, Pelling JC: Do truncated cyclins contribute to aberrant cyclin expression in cancer? Cell Cycle 2006; 5: 472-477 26. Ohtsubo M, Theodoras AM, Schumacher J, Roberts JM, Pagano M: Human cyclin E, a nuclear protein essential for the G1-to-S phase transition. Mol Cell Biol 1995; 15: 2612-2624 27. Baldin V, Lukas J, Marcote MJ, Pagano M, Draetta G: Cyclin D1 is a nuclear protein required for cell cycle progression in G1. Genes Dev 1993; 7: 812-821 28. Malumbres M, Barbacid M: Mammalian cyclin-dependent kinases. Trends Biochem Sci 2005; 30: 630-641 29. Zindy F, Lamas E, Chenivesse X, Sobczak J, Wang J, Fesquet D, Henglein B, Bréchot C: Cyclin A is required in S phase in normal epithelial cells. Biochem Biophys Res Commun 1992; 182: 1144-1154 30. Rosenberg AR, Zindy F, Le Deist F, Mouly H, Métézeau P, Bréchot C, Lamas E: Overexpression of human cyclin A advances entry into S phase. Oncogene 1995; 10: 1501-1509 31. Gorczyca W, Sarode V, Juan G, Melamed MR, Darzynkiewicz Z: Laser scanning cytometric analysis of cyclin B1 in primary human malignancies. Mod Pathol 1997; 10: 457-462 32. Kramer A, Hochhaus A, Saussele S, Reichert A, Willer A, Hehlmann R: Cyclin A1 is predominantly expressed in hematological malignancies with myeloid differentiation. Leukemia 1998; 12: 893-898 33. Widrow RJ, Rabinovitch PS, Cho K, Laird CD: Separation of cells at different times within G2 and mitosis by cyclin B1 flow cytometry. Cytometry 1997; 27: 250-254 34. Sánchez I, Dynlacht BD: New insights into cyclins, CDKs, and cell cycle control. Semin Cell Dev Biol 2005; 16: 311-321 35. Meshkini A, Yazdanparast R: Involvement of ERK/MAPK pathway in megakaryocytic differentiation of K562 cells induced by 3-hydrogenkwadaphnin. Toxicol In Vitro 2008; 22: 1503-1510 36. Liu AJ, Song W, Yang N, Liu YJ, Zhang GR: Cartilage polysaccharide induce apoptosis in human leukemia K562 cells. Cell Biol Toxicol 2007; 23: 465-476 37. Baldin V, Lukas J, Marcote MJ, Pagano M, Draetta G: Cyclin D1 is a nuclear protein required for cell cycle progression in G1. Genes Dev 1993; 7: 812-821

Turk J Hematol 2012; 29: 17-27

38. Gong J, Ardelt B, Traganos F, Darzynkiewicz Z: Unscheduled expression of cyclin B1 and cyclin E in several leukemic and solid tumor cell lines. Cancer Res 1994; 54: 4285-4288 39. Paterlini P, Suberville AM, Zindy F, Melle J, Sonnier M, Marie JP, Dreyfus F, Bréchot C: Cyclin A expression in human hematological malignancies: A new marker of cell proliferation. Cancer Res 1993; 53: 235-238 40. Juan G, Gong J, Traganos F, Darzynkiewicz Z: Unscheduled expression of cyclins D1 and D3 in human tumour cell lines. Cell Prolif 1996; 29: 259-266 41. Qin J, Tao D, Chen X, Feng Y, Hu J, Reed E, Li QQ, Gong J: Down-regulation of cyclin E expression by caffeine promotes cancer cell entry into the S-phase of the cell cycle. Anticancer Res 2004; 24: 2991-2995 42. Yang R, Nakamaki T, Lübbert M, Said J, Sakashita A, Freyaldenhoven BS, Spira S, Huynh V, Müller C, Koeffler HP: Cyclin A1 expression in leukemia and normal hematopoietic cells. Blood 1999; 93: 2067-2074 43. Ma WD, Xu SR, Yan YL, Guo XN, Qiao SK, Xue F, Gao XL: Expressions of cyclin B1 and p21cipl in adulte acute leukemia and their correlation. Zhongguo Shi Yan Xue Ye Xue Za Zhi 2005; 13: 751-758 44. Hirose M, Shimizu E, Nakanishi H, Shinohara A, Sone S, Kuroda Y: Expression level of G1-cyclins and cell proliferation in human cultured leukemia/lymphoma cell lines. Int J Oncol 1998; 12: 841-846 45. Sonoki T, Hata H, Kuribayashi N, Yoshida M, Harada N, Nagasaki A, Kimura T, Matsuno F, Mitsuya H, Matsuzaki H: Expression of PRAD1/cyclin D1 in plasma cell malignancy: Incidence and prognostic aspects. Br J Haematol 1999; 104: 614-617

Toprak S K, et al: Cyclins and Inhibitors in Hematological Malignancies

46. Pruneri G, Fabris S, Baldini L, Carboni N, Zagano S, Colombi MA, Ciceri G, Lombardi L, Rocchi M, Buffa R, Maiolo AT, Neri A: Immunohistochemical analysis of cyclin D1 shows deregulated expression in multiple myeloma with the t(11;14). Am J Pathol 2000; 156: 1505-1513 47. Hoyer JD, Hanson CA, Fonseca R, Greipp PR, Dewald GR, Kurtin PJ: The (11;14)(q13;q32) translocation in multiple myeloma. A morphologic and immunohistochemical study. Am J Clin Pathol 2000; 113: 831-837 48. Cook JR, Hsi ED, Worley S, Tubbs RR, Hussein M: Immunohistochemical analysis identifies two cyclin D1+ subsets of plasma cell myeloma, each associated with favorable survival. Am J Clin Pathol 2006; 125: 615-624 49. Kawano MM, Mahmoud MS, Ishikawa H: Cyclin D1 and p16INK4A are preferentially expressed in immature and mature myeloma cells, respectively. Br J Haematol 1997; 99: 131-138 50. Hoechtlen-Vollmar W, Menzel G, Bartl R, Lamerz R, Wick M, Seidel D: Amplification of cyclin D1 gene in multiple myeloma: clinical and prognostic relevance. Br J Haematol 2000; 109: 30-38 51. Urashima M, Teoh G, Chauhan D, Hoshi Y, Ogata A, Treon SP, Schlossman RL, Anderson KC: Interleukin-6 overcomes p21WAF1 upregulation and G1 growth arrest induced by dexamethasone and interferon-gamma in multiple myeloma cells. Blood 1997; 90: 279-289

Research Article

DOI: 10.5152/tjh.2011.78

The Role of Multidetector Computed Tomography in the Early Diagnosis of Invasive Pulmonary Aspergillosis in Patients with Febrile Neutropenia Undergoing Hematopoietic Stem Cell Transplantation Hematopoetik Kök Hücre Transplantasyonu Sonrası Gelişen Febril Nötropenide İnvaziv Pulmoner Aspergillozis Erken Tanısında Multidedektör Bilgisayarlı Tomografinin Rolü Nazan Çiledağ1, Kemal Arda1, Bilgin Kadri Arıbaş1, Ali Irfan Emre Tekgündüz2, Fevzi Altuntaş2 Ankara Oncology Education and Research Hospital, Department of Radiology, Ankara, Turkey Ankara Oncology Education and Research Hospital, Department of Hematology and BMT Unit, Ankara, Turkey

1 2

Abstract Objective: To evaluate vessel involvement and the role of multidetector computed tomography (MDCT) in the early diagnosis of invasive pulmonary aspergillosis (IPA) in patients with febrile neutropenia and antibiotic-resistant fever undergoing autologous bone morrow transplantation.

Material and Methods: In all, 74 pulmonary MDCT examinations in 37 consecutive hematopoietic stem cell transplantation patients with febrile neutropenia and clinically suspected IPA were retrospectively evaluated.

Results: Diagnosis of IPA was based on Fungal Infections Cooperative Group, and National Institute of Allergy and Infectious Diseases Mycoses Study Consensus Group criteria. In all, 0, 14, and 11 patients were diagnosed as proven, probable, and possible IPA, respectively. Among the 25 patients accepted as probable and possible IPA, all had pulmonary MDCT findings consistent with IPA. The remaining 12 patients were accepted as having fever of unknown origin (FUO) and had patent vessels based on MDCT findings. In the patients with probable and possible IPA, 72 focal pulmonary lesions were observed; in 41 of the 72 (57%) lesions vascular occlusion was noted and the CT halo sign was observed in 25 of these 41 (61%) lesions. Resolution of fever occurred following antifungal therapy in 19 (76%) of the 25 patients with probable and possible IPA. In all, 6 (25%) of the patients diagnosed as IPA died during follow-up. Transplant-related mortality 100 d post transplant in patients with IPA and FUO was 24% and 0%, respectively.

Conclusion: In conclusion, MDCT has a potential role in the early diagnosis of IPA via detection of vessel occlusion. Key Words: Multidetector computed tomography, Invasive pulmonary aspergillosis, Febrile neutropenia, Hematopoietic stem cell transplantation Address for Correspondence: Nazan Çiledağ, M.D., Ankara Onkoloji Eğitim ve Araştırma Hastanesi, Radyoloji Bölümü, Demetevler, Ankara, Turkey Phone: + 90 312 336 09 09-1390 E-mail: drnazangokbayrak@yahoo.com.tr Received/Geliş tarihi : June 28, 2010 Accepted/Kabul tarihi : March 5, 2011

Turk J Hematol 2012; 29: 28-33

Çiledağ N, et al: Computed Tomography in Invasive Pulmonary Aspergillosis

Özet Amaç: Otolog kemik iliği transplantasyonlu febril nötropenik ve antibiyotiğe dirençli orjini bilinmeyen hastalarda, vasküler tutulum ve invaziv pulmoner aspergillozis (İPA) erken tanısında multidedektör bilgisayarlı tomografi (MDBT)’nin rolünü değerlendirmek amaçlanmıştır.

Gereç ve Yöntemler: Orjini bilinmeyen geniş spektrumlu antibiyotiğe dirençli ateşi olan, İPA şüphesi bulunan 37 olgunun 74 pulmoner MDBT incelemesi retrospektif değerlendirildi. Bulgular: İnvaziv pulmoner aspergillozis tanısı mikrobiyolojik, radyolojik bulgularla birlikte host faktörleri değerlendirilerek konuldu. 25 olguya EORTC/MSG kriterlerine göre sırasıyla 0, 14, 11 olguya kanıtlanmış, olası, muhtemel İPA tanısı konuldu. Olası veya muhtemel İPA tanısı konan 25 olgunun MDBT’sinde İPA ile uyumlu bulgular görüldü. Ne kültürde üreme, ne de radyolojik pozitif bulgu saptanmayan 12 olguda (nedeni bilinmeyen ateş) MDBT’de vasküler yapılar patent idi. Olası/muhtemel İPA tanısı konan 25 olguda total 72 fokal pulmoner lezyon saptandı. 72 lezyonun 41’inde (%57) MDBT’de İPA’yı destekleyen vasküler oklüzyon saptandı. Olası/muhtemel İPA tanısı konan 25 olgunun 19’unda (%76) klinik düzelme, ateşin düşüşü gözlendi. İnvaziv pulmoner aspergillozis tanısı konan 6 olgu takipler sırasında kaybedildi. İnvaziv pulmoner aspergillozis ve nedeni binmeyen ateş saptanan olgularda 100 günlük takip sonrasında transplant ilişkili mortalite oranı sırasıyla %24 ve %0 idi. Sonuç: Sonuç olarak, vasküler tutulumu gösterebilmesi nedeniyle MDBT’nin İPA tanısında potansiyel rolü olduğu kanısına varıldı.

Anahtar Sözcükler: Multidedektör bilgisayarlı tomografi, İnvaziv pulmoner aspergillozis, Febril nötropeni, Hematopoetik kök hücre transplantasyonu

Introduction Fungal infection is one of the primary causes of post hematopoietic stem cell transplantation (HSCT) mortality and morbidity, despite routine prophylaxis for common pathogenic organisms and empiric treatment of febrile episodes during the early neutropenic period [1,2]. In the era of routine fluconazole prophylaxis for high-risk populations, molds-especially Aspergillus species-became the most common and life-threatening pathogenic organism, leading to fungal pneumonia in febrile neutropenic patients and causing 90% of such infections [3,4]. Early and accurate diagnosis of invasive pulmonary aspergillosis (IPA) in immunocompromised patients is the ultimate method of lowering the mortality and morbidity rates associated with the pathogen [5]. A 10-d delay in initiation of antifungal therapy nearly doubles the IPA-related mortality rate [5]. High-resolution CT visualization of the halo sign-indicative of a hemorrhagic pulmonary nodule-is an early sign of IPA with high sensitivity and specificity [6]; however, differential diagnosis of the halo sign is quite complex, as it may be observed as a result of infection with other microorganisms [(Candida spp., mucormycosis, cryptococcosis, cytomegalovirus (CMV), herpes simplex virus (HSV)] and other diseases, including Wegener granulomatosis, pulmonary metastases of hypervascular tumors, and Kaposi’s sarcoma [7,8]. Pathologic examination of nodules with the halo sign showed that the halo around a central

fungal lesion corresponded to a nodule surrounded by a rim of coagulation necrosis due to the vascular invasion that causes thrombotic occlusion and ischemic necrosis [9]. Due to limitations of these radiological findings, a few recent studies evaluated the role of multidetector computed tomographic (MDCT) angiography in the early and accurate diagnosis of IPA [10]. The primary aim of the present study was to evaluate vessel involvement and the role of multidetector computed tomography (MDCT) in the early diagnosis of invasive IPA in patients with febrile neutropenia and antibiotic-resistant fever undergoing HSCT. Material and Methods In all, 37 consecutive HSCT patients (24 male and 13 female) with a mean age of 41 ± 19 years (range: 4-68 years) and clinically suspected IPA due to febrile neutropenia and broad-spectrum antibiotic-resistant fever of unknown origin that underwent 74 pulmonary MDCT examinations between March 2009 and June 2010 were retrospectively evaluated. In total, 27 of the patients (73%) had acute leukemia, 2 (5%) had chronic leukemia, 7 (19%) had lymphoma, and 1 (3%) had multiple myeloma. The patients with acute and chronic leukemia were treated with allogeneic HSCT from 6/6 HLA-matched related donors. The other patients underwent autologous peripheral stem cell transplantation and were neutropenic

Çiledağ N, et al: Computed Tomography in Invasive Pulmonary Aspergillosis

(absolute neutrophil count <500 mm-3 for at least 11 d) following myeloablative conditioning. The conditioning regimen in the patients with acute/chronic leukemia was TBI/Cy or Bu/Cy, whereas patients with lymphoma and myeloma received BEAM and MEL200, respectively. All the HSCT patients received levofloxacin, fluconazole, acyclovir, and trimethoprim-sulfamethoxazole as primary prophylaxis. Allogeneic HSCT recipients received cyclosporin and short-term methotrexate for prophylaxis of graft versus host disease. According to our hematology/ stem cell transplantation protocol, febrile neutropenic patients that were unresponsive to broad-spectrum antibiotics (imipenem or meropenem) for 72 h were evaluated for opportunistic fungal pathogens. We adapted a similar (not the same) pre-emptive strategy pioneered by Maertens et al. [11)—serum galactomannan (GM) assay (twice weekly) and thoracic MDCT. Patients that had hemodynamic instability and/or 2 consecutive positive serum GM assays (ELISA: optical density ≥0.5), and/ or thoracic MDCT findings suggesting IPA (pulmonary nodule irrespective of the halo sign, air crescent sign, or cavitation) supported by mycological evidence of molds (presence of fungal elements indicating molds in sputum/ bronchoalveolar lavage fluid or positive culture for molds) were treated with antifungal agents. Patients with mycological evidence of Aspergillus spp. received voriconazole; all others were treated with caspofungin. Persistent or relapsing fever was not considered an indication for antifungal therapy. Once initiated, antifungal therapy was continued for 6 weeks. In patients that were unresponsive to pre-emptive antifungal treatment, MDCT was repeated; hence, it was performed more than once in some patients. Patients with renal insufficiency were excluded from the study. The study protocol was approved by Ankara oncology hospital review board and written informed consent was received from all patients. The diagnosis of IPA was based on evaluation of host factors, together with mycological and radiological findings, according to the international consensus guidelines [12]. Due to safety concerns, no patient underwent transbronchial/percutaneous lung biopsy or needle aspiration of radiologically suspected lesions, allowing histopathologic or cytopathologic examination. Pulmonary CT was performed caudocranially with an MDCT scanner (GE Medical Systems, Milwaukee, WI, USA) after administration of 100 mL of intravenous contrast media (ioversol, 350 mg mL-1 organically bound iodine, Optiray, Covidien, Tyco, USA) at a rate of 4 mL s-1. MDCT was performed with 20-s delay during breath-hold.

Turk J Hematol 2012; 29: 28-33

Scanning parameters were as follows: slice thickness: 1.25 mm; helical rotation time: 0.5 s; collimation: 1.25 mm; voltage: 120 kV; current: 120 mAs. After completion of CT scanning the reconstruction process was applied and multiplanar reconstructed (sagittal, coronal, and oblique planes) images were created. Axial images were evaluated for nodules, cavitation, and the halo sign, and then any focal pulmonary lesions observed were evaluated for vascular involvement—defined as an interruption of the vessel at the border of the focal nodular lesion in multiplanar reconstructed images—and evaluated based on the consensus of 2 radiologists. Results were correlated with clinical follow-up data, including serum galactomannan values and CT findings during a median follow-up of 93 d (range: 10-220 d). Statistical Analysis Statistical analysis was performed using SPSS v.13.0. Categorical variables are presented as numbers and percentages, and continuous variables are presented as mean ± SD or median. Results According to EORTC/MSG criteria, 0, 14, and 11 patients were diagnosed as proven, probable, and possible IPA, respectively. Sputum culture in 2 patients showed infection with Aspergillus spp. Among the 14 patients with probable IPA, 2 had Aspergillus-positive culture and 12 patients had 2 consecutive positive GM assays. These 14 patients also had pulmonary CT findings indicative of IPA. In all, 11 of the 37 patients that had both host and radiological findings suggesting IPA did not have culture or non-culture-based test results consistent with IPA (possible IPA). In the remaining 12 patients the diagnosis of IPA was excluded by any level of evidence and these patients were regarded as having fever of unknown origin

Figure 1: Contrast-enhanced MDCT axial plane maximum intensity projection image shows patent vessels.

Turk J Hematol 2012; 29: 28-33

Çiledağ N, et al: Computed Tomography in Invasive Pulmonary Aspergillosis

(FUO). All the patients with FUO had patent vessels, based on MDCT (Figure 1). Among the patients with FUO, 3 had consolidation, with strong and patent vessels in and around the consolidation, whereas the other 9 patients had no pathology based on MDCT. On the other hand, 18 (72%) of the patients that were diagnosed as probable and possible IPA had abnormal MDCT findings (Table 1). In the patients with probable and possible IPA 72 focal pulmonary lesions were detected via MDCT; the lesions ranged from 6 to 40 mm (mean: 1.7 ± 0.6 mm). In 41 of the 72 (57%) lesions vascular occlusion was noted, which was defined as an interruption of a vessel at the border of a focal lesion (without depiction of the vessel) or peripheral to the lesion (Figure 2A,B). The CT halo sign was noted in 25 of the 41 (61%) lesions. In total, 9 cavitary pulmonary nodules with a surrounding halo of ground-glass attenuation were detected using MDCT. Clinical improvement and resolution of fever was achieved following antifungal therapy in 19 (76%) of the 25 patients with probable and possible IPA. In patients with clinical deterioration, there was also progression of radiological findings based on

MDCT. In all, 6 (25%) patients that were diagnosed as IPA died during follow-up. In 3 of the 12 patients with normal MDCT findings and persistent fever MDTC was repeated and the results were again normal; there were no clinical or laboratory findings supporting the diagnosis of IPA among them. Transplant-related mortality (TRM) 100 d post transplant in the patients with IPA and FUO was 24% and 0%, respectively. Discussion IPA is one of the most serious pulmonary complications of HSCT. The incidence of IPA varies widely according to study population. The risk of proven and probable IPA among autologous transplant recipients is quite low (0.5%1%), as compared to patients undergoing allogeneic HSCT or those treated with induction chemotherapy for acute leukemia (3%-7%) [13-15]. Although rare, IPA is associated with high mortality and morbidity rates following HSCT, especially during the early neutropenic period [10,16]. The mortality rate due to IPA when treated with appropriate antifungal therapy ranges from 30% to 80% [17]. Early

Table 1: MDCt Findings and Clinical Outcomes in the Study Group

Vascular occlusion** n (%) NA

Mortality n (%) NA

Probable IPA

12 (86%)

4 (29%)

Possible IPA

6 (55%)

2 (18%)

FUO

0 (0%)

Diagnosis*

Proven IPA

NA: Not applicable. *According to EORTC/MSG criteria. **According to MDCT findings.

Figure 2: A 24-year-old male with acute myeloid leukemia. (A) Contrast-enhanced MDCT scan of the chest obtained with lung window settings shows a cavitary nodular lesion (arrow) with a peripheral halo sign. (B) Contrast-enhanced MDCT axial plane maximum intensity projection image shows interruption of the peripheral segmental pulmonary artery (arrow) at level of the pulmonary nodule.

Çiledağ N, et al: Computed Tomography in Invasive Pulmonary Aspergillosis

and accurate diagnosis of IPA is critical because initiation of specific antifungal therapy decreases the mortality rate from 80% to 30% [6]. In the present study MDCT findings in 37 HSCT patients with neutropenia and antibioticresistant FUO, and clinically suspected IPA were retrospectively evaluated via in order to detect the existence of focal pulmonary lesions, the halo sign, and vascular occlusion. Due to severe thrombocytopenia, poor clinical condition, and high risk of complications associated with invasive diagnostic procedures, diagnoses were based on clinical, microbiological, and radiological findings. A pulmonary nodule with the halo sign observed with high-resolution CT is an important and early sign of IPA; however, the halo sign is a non-specific imaging finding that may be observed in other diseases [7,8]. During the last 10 years technological progress in medical imaging has resulted in MDCT, which has many advantages over singledetector helical CT, including shorter acquisition time, greater anatomic coverage, and superior image resolution during a single breath-hold, facilitating improved patient comfort and excellent three dimensional (3D) reconstructions. All these factors substantially increase diagnostic accuracy via state-of-the-art image quality. 3D isotropic volume imaging is possible with MDCT and provides excellent anatomical imaging of the thorax, thereby significantly increasing the diagnostic yield. MDCT has resulted in a paradigm shift in vascular imaging—from conventional catheter angiography to MDCT angiography—as MDCT provides image quality that equals or surpasses that of conventional angiography. Recent advances in 3D volume rendering enable detection of occlusion of peripheral vessels at the border of a suspicious fungal lesion. Hypothetically, vasculitic change in peripheral vessels can cause occlusion of peripheral vessels. Vessel occlusion secondary to vascular invasion by IPA results in edema, which is referred to as the CT-halo sign. Sonnet el al. reported that direct detection of vessel occlusion, which was defined as an interruption of a vessel at the border of a focal nodular pulmonary lesion, is an earlier finding than the halo sign and may be useful in the early diagnoses of IPA [10]. In the present study only 61% of the patients with vascular occlusion around the pulmonary nodules had the halo sign, which is in agreement with the findings of Sonnet el al. [10], and therefore it seems logical to conclude that MDCT could be a valuable tool for the early diagnosis of IPA. As the present study’s cohort consisted of only 37 patients, it is impossible to definitively state the value of MDCT in the diagnosis of IPA based on the present findings.

Turk J Hematol 2012; 29: 28-33

According to the recently published EORTC/MSG criteria, the rate of proven/probable IPA in the present study was 38%, which is much higher than expected, and this discrepancy has several possible causes. In order to focus on a population with a high risk for IPA we included only patients with defined host factors based on EORTC/ MSG criteria. In addition to the allogeneic transplant recipients, all 8 patients that were treated with autologous HSCT had profound neutropenia for at least 11 d. Autologous HSCT patients that did not fulfill EORTC/ MSG host criteria were not included in the study. Additionally, there are some drawbacks associated with the use of serum GM-ELISA assay for the detection of IPA. Recent data show that the positive predictive value (58%-73%) of the test is not optimal [15]. In order to increase the sensitivity and safety of the pre-emptive approach we used a rather low threshold for positivity (optical density ≥0.5). Moreover, a vast majority of the patients (n = 29 [78%]) were treated with a conditioning regimen that included high-dose cyclophosphamide, which can cause false positive GM assay results [18]. In consideration of the fact that none of the present study’s patients had proven IPA and all 14 patients with probable IPA had 2 consecutive positive GM assays, the high rate of IPA observed may be an overestimation of the real picture. The diagnosis of IPA in the present study was based on evaluation of host factors, together with mycological and radiological findings, according to the international consensus guidelines [12]. The major limitation of the present study is the lack of histopathologic diagnosis of IPA, which was not performed due to safety concerns. In conclusion, MDCT shows promise as an imaging technique for accurate and early detection of vessel occlusion in HSCT patients with suspected IPA; however, additional research with larger patient populations is needed to further establish its accuracy. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Soubani AO, Miller KB, Hassoun PM: Pulmonary complications of bone marrow transplantation. Chest 1996; 109: 1066-1077 2. Krowka MJ, Rosenow EC, 3rd, Hoagland HC: Pulmonary complications of bone marrow transplantation. Chest 1985; 87: 237-246

Turk J Hematol 2012; 29: 28-33

3. Breuer R, Lossos IS, Berkman N, Or R: Pulmonary complications of bone marrow transplantation. Respir Med 1993; 87: 571-579 4. Wah TM, Moss HA, Robertson RJ, Barnard DL: Pulmonary complications following bone marrow transplantation. Br J Radiol 2003; 76: 373-379 5. Heussel CP, Kauczor HU, Heussel, Fischer B, Mildenberger P, Thelen M: Early detection of pneumonia in febrile neutropenic patients: Use of thinsection CT. AJR 1997; 169: 1347-1353 6. Blum U, Windfuhr M, Buitrago-Tellez C, Sigmund G, Herbst EW, Langer M: Invasive pulmonary aspergillosis: MRI, CT, and plain radiographic findings and their contribution for early diagnosis. Chest 1994; 106: 1156-1161 7. Primack SL, Hartman TE, Lee KS, Müller NL: Pulmonary nodules and the CT halo sign. Radiology 1994; 190: 513-515 8. Zinck SE, Leung AN, Frost M, Berry GJ, Müller NL: Pulmonary cryptococcosis: CT and pathologic findings. J Comput Assist Tomogr 2002; 26: 330-334 9. Hruban RH, Meziane MA, Zerhouni EA, Wheeler PS, Dumler JS, Hutchins GM: Radiologic-pathologic correlation of the CT halo sign in invasive pulmonary aspergillosis: Case report. J Comput Assist Tomogr 1987; 11: 534-536 10. Sonnet S, Buitrago-Tellez CH, Tamm M, Christen S, Steinbrich W: Direct Detection of Angioinvasive Pulmonary Aspergillosis in Immunosuppressed Patients: Preliminary Results with High-Resolution 16-MDCT Angiography. AJR Am j Roentgenol 2005; 185: 746-751 11. Maertens J, Theunissen K, Verhoef G, Verschakelen J, Lagrou K, Verbeken E, Wilmer A, Verhaegen J, Boogaerts M, Van Eldere J: Galactomannan and computed tomography-based preemptive antifungal therapy in neutropenic patients at high risk for invasive fungal infection: A prospective feasibility study. Clin Infect Dis 2005; 41: 1242-1250

Çiledağ N, et al: Computed Tomography in Invasive Pulmonary Aspergillosis

12. De Pauw B, Walsh TJ, Donnelly JP, Stevens DA, Edwards JE, Calandra T, Pappas PG, Maertens J, Lortholary O, Kauffman CA, Denning DW, Patterson TF, Maschmeyer G, Bille J, Dismukes WE, Herbrecht R, Hope WW, Kibbler CC, Kullberg BJ, Marr KA, Muñoz P, Odds FC, Perfect JR, Restrepo A, Ruhnke M, Segal BH, Sobel JD, Sorrell TC, Viscoli C, Wingard JR, Zaoutis T, Bennett JE; Fungal Infections Cooperative Group; National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) Consensus Group: Revised definitions of invasive fungal disease from the European Organization for Research and Treatment of Cancer/Invasive. Clin Infect Dis 2008; 46: 1813-1821 13. Jantunen E, Salonen J, Juvonen E, Koivunen E, Siitonen T, Lehtinen T, Kuittinen O, Leppä S, Anttila VJ, Itälä M, Wiklund T, Remes K, Nousiainen T: Invasive fungal infections in autologous stem cell transplant recipients: A nationwide study of 1188 transplanted patients. Eur J Haematol 2004; 73: 174-178 14. Morgan J, Wannemuehler KA, Marr KA, Hadley S, Kontoyiannis DP, Walsh TJ, Fridkin SK, Pappas PG, Warnock DW: Incidence of invasive aspergillosis following hematopoietic stem cell and solid organ transplantation: Interim results of a prospective multicenter surveillance program. Med Mycol 2005; 43: 49-58 15. British Committee for Standards in Haematology. Guidelines on the management of invasive fungal infections during therapy for haematological malignancy. (http://www.bcshguidelines.com/documents/fungal_infection_bcsh_2008. pdf; accessed on November 30; 2010) 16. Jantunen E, Ruutu P, Piilonen A, Volin L, Parkkali T, Ruutu T: Treatment and outcome of invasive Aspergillus infections in allogeneic BMT recipients. Bone Marrow Transplant 2000; 26: 759-762 17. Lin SJ, Schranz J, Teutsch SM: Aspergillosis case-fatality rate: systematic review of the literature. Clin Infect Dis 2001; 32: 358-366 18. Hashiguchi K, Niki Y, Soejima R: Cyclophosphomide induces false-positive results in detection of aspergillus antigen in urine. Chest 1994; 105: 975-976

Research Article

DOI: 10.5505/tjh.2012.29795

The Association Between HLA Class II Alleles and the Occurrence of Factor VIII Inhibitor in Thai Patients with Hemophilia A Tayland’lı Hemofili A Hastalarında, HLA Sınıf II Alleleri ve Faktör VIII İnhibitör Oluşumunun İlişkisi Oytip Nathalang1, Pramote Sriwanitchrak1, Werasak Sasanakul2, Ampaiwan Chuansumrit2 1 2

Thammasat University, Faculty of Allied Health Sciences, Department of Medical Technology, Pathumtani, Thailand Mahidol University, Faculty of Medicine, Ramathibodi Hospital, Department of Pediatrics, Bangkok, Thailand

Abstract Objective: This study aimed to investigate the association between HLA class II alleles and the occurrence of FVIII inhibitor in Thai hemophilia A patients.

Material and Methods: The distribution of HLA-DRB1 alleles and DQB1 alleles in 57 Thai hemophilia A patients and 36 blood donors as controls was determined using the PCR sequence-specific primer (PCR-SSP) method, and the association between the occurrence of factor VIII (FVIII) inhibitor and the presence of certain HLA class II alleles was investigated.

Results: The frequency of HLA-DRB1*15 was higher in the hemophilia A patients with and without FVIII inhibitor, whereas that of DRB1*14, DRB1*07, and DQB1*02 was lower in the hemophilia A patients with FVIII inhibitor, as compared to controls. Interestingly, only the frequency of DRB1*15 was significantly higher in the patients with inhibitor than in the controls (P = 0.021). Moreover, the frequency of DRB1*15 in the patients with inhibitor was higher than in those without inhibitor (P = 0.198). Conclusion: The study’s findings show that the DRB1*15 allele might have contributed to the occurrence of inhibitor in the Thai hemophilia A patients; however, additional research using larger samples and high-resolution DRB1 typing is warranted. Key Words: HLA class II alleles, FVIII inhibitor, Hemophilia A, Thais

Özet Amaç: Bu çalışmada HLA sınıf II allelleri hemofili A ile Tayland’lı hastalarda FVIII inhibitörü oluşumu ile ilişkiyi araştırmaktır. Gereç ve Yöntemler: Hemofili 57 Tayland’lı hastalarda HLA-DRB1 allelleri ve DQB1 allel dağılımı bir PCR-sıra özel astar (PCR-SSP) yöntemi ve faktör VIII (FVIII) inhibitör oluşumu arasındaki ilişki kullanılarak belirlendi ve bazı HLA klas II allelleri varlığı araştırılmıştır.

Address for Correspondence: Ampaiwan ChuansumrIt, M.D., Department of Pediatrics, Faculty of Medicine, Ramathibodi Hospital, Mahidol University, Rama VI Road, Bangkok, 10400, Thailand Phone: + 90 662 201 17 49 E-mail: raajs@mahidol.ac.th Received/Geliş tarihi : June 29, 2011 Accepted/Kabul tarihi : September 19, 2011

Turk J Hematol 2012; 29: 34-39

Nathalang O, et al: HLA class II and FVIII Inhibitor

Bulgular: HLA-DRB1 sıklığı * 15 ve FVIII inhibitörü olmayan iki hemofili hastalarında artmış iken DRB1 olanlar * 14, DRB1 * 07 ve DQB1 * 02 FVIII inhibitörleri ile hemofili hastalarında azalmıştı. İlginçtir, sadece DRB1 * 15 önemli kontrol (P = 0.021) ile karşılaştırıldığında inhibitörleri olan hastalarda artmıştır. Ayrıca, inhibitörü olan hastalarda DRB1 * 15 frekans olmayan inhibitörü (P = 0.198) olan hastalarda daha yüksek olma eğiliminde.

Sonuç: Bulgularımız DRB1 * 15 allel Tay hemofili A hastalarında inhibitör oluşumuna katkıda bulunabileceğini göstermiştir. Ancak, daha büyük bir örneklem büyüklüğü ve yüksek çözünürlüklü DRB1 yazarak garantilidir. Anahtar Sözcükler: HLA klas II allelleri, FVIII inhibitörü, Hemofili A, Thais Introduction

Material and Methods

One of the most serious complications in patients with hemophilia A is the occurrence of an inhibitor frequently, IgG4 antibodies directed against epitopes in factor VIII (FVIII). This may be induced by replacement of the missing factor via cryoprecipitate or FVIII concentrate administration. The antibody attached to FVIII will neutralize or inhibit its ability to stop bleeding. FVIII inhibitor is usually detected in one of two ways. First, the inhibitor may be discovered in asymptomatic patients via routine screening performed during a comprehensive clinical examination. Second, an inhibitor may be detected when bleeding is suddenly and unexpectedly unresponsive to treatment with FVIII. Generally, the incidence of FVIII inhibitor in hemophilia A patients with severe disease (FVIII:C <1%) and moderate disease (FVIII:C >1% to 5%) is estimated to be 20% and 33%, respectively [1-6]; however, differences in the incidence between ethnic groups might be due to genetic differences. Moreover, the lack of recognition is one of the causes of low incidence of inhibitor in economically less-developed countries.

The study included 57 hemophilia A patients from Mahidol University, Faculty of Medicine Ramathibodi Hospital, Division of Hematology, Department of Pediatrics, Bangkok, Thailand, and a control group consisting of 36 unrelated male blood donors from the National Blood Center of the Thai Red Cross Society. The study protocol was approved by the Mahidol University, Faculty of Medicine Ethics Committee and the Committee on Human Rights Related to Research Involving Humans. Informed consent was obtained from each participant and/or his parents.

It has been reported that molecular defects in the factor VIII gene and the major histocompatibility complex molecules, especially HLA class II alleles, are associated with antibody formation. An increased occurrence of FVIII inhibitor was reported in cases of severe congenital hemophilia A with HLA-DRB1*15:01, DQA1*01:02, and DQB1*06:02 alleles [8,9]. Conversely, another study reported that HLA class I alleles were not associated with the occurrence of FVIII inhibitor in patients with acquired hemophilia A, whereas DRB1*16 and DQB1*0502 were associated with a high risk of such an occurrence in hemophilia A patients with FVIII inhibitor [10]; however, the association between these alleles and FVIII inhibitor in Thai patients with hemophilia A remains unknown. As such, the present study aimed to investigate the association between HLA class II alleles and the occurrence of FVIII inhibitor in a group of Thai patients with hemophilia A.

The patients were regularly monitored for factor VIII inhibitor every 6-12 months or when clinically indicated in cases of unresponsiveness to replacement therapy. The inhibitor titer against human factor VIII clotting activity was determined via the Bethesda method [11]. A Bethesda unit (BU) level >0.6 was considered indicative of the presence of inhibitor. Moreover, genetic defect associated with hemophilia A was carried out. Inversion of intron 22 was initially determined via inverse polymerase chain reaction (PCR) [12,13]. In patients without inversion of intron 22 conformation-sensitive gel electrophoresis was used to further investigate the genetic defect [14], followed by sequencing. Genomic DNA was extracted from peripheral blood cells using the salting out technique [15]. The second exon of the DRB1 and DQB1 genes was amplified using the PCR-SSP method. Each DNA sample (100 ng µL–1) was tested using a Micro SSP Generic HLA Class II Typing Kit (One Lambda Inc., Canoga Park CA, USA). Briefly, for HLA class II low-resolution typing each DNA sample (100 ng) was amplified with 31 different primer sets optimized and dispensed into each well of a 96-well thin-walled PCR plate. The SSP-DNA reaction set was placed in a G-STORM GS1 thermal cycler (Gene Technologies Ltd., Essex, UK). The cycle parameters of the PCR program were set according to the manufacturer’s instructions. The reaction pattern was photographed and HLA alleles were assessed via

Nathalang O, et al: HLA class II and FVIII Inhibitor

Turk J Hematol 2012; 29: 34-39

analysis of the gel banding pattern using a reaction pattern typing grid. The association of the HLA class II alleles and the development of an inhibitor in Thai patients with hemophilia A was calculated using the odds ratio (OR) and 95% confidence interval (CI). The frequency of alleles in the patients and controls was compared using chi-square contingency table analysis with Yates’ correction, as well as standard P values and Fisher’s exact test. A P value <0.05 was accepted as statistically significant. Results The study included 57 male Thai hemophilia A patients with a mean age of 14.4 ± 8.9 years. The patients were divided into 2 groups: 26 patients without inhibitors and 31 patients with a high inhibitor titer ≥5 BU (n = 22), low inhibitor titer <5 BU (n = 3), and transient low inhibitor titer for <6 months (n = 6). The mean high inhibitor titer was 540.9 BU (range: 5.3-3920 BU) and the mean low titer was 3.3 BU (range: 2.9-4.2 BU), whereas the mean transient low titer was 2.0 BU (range: 1.0-3.3 BU). A molecular defect related to the factor VIII gene was observed in 35 of the 57 patients (61.4%) of which 15

were in the non-inhibitor group and 20 were in the inhibitor group. In all, 6 patients in the non-inhibitor group and 12 patients in the inhibitor group had inversion of intron 22: however, the difference in the number of patients with inversion between the patients with and without inhibitor was not statistically significant (P = 0.32). The specific mutations were investigated in the 17 patients without inversion of intron 22; 10 patients had point mutations and mutations could not be identified in the other 7 patients. Interestingly, point mutations inducing stop codon (n = 2), amino acid alteration (n = 2), and frameshift mutation (n = 1) were observed in patients without inhibitor, and point mutations inducing stop codon (n = 5) were noted in patients with inhibitor. The occurrence of stop codon in patients with inhibitor was higher than those without inhibitor (P = 0.05). The distribution of HLA-DRB1 and DQB1 alleles, according to PCR-SSP low-resolution typing, in the patients with and without inhibitor, and in the controls is shown in Tables 1 and 2. Overall, 13 DRB1 alleles were noted in the hemophilia A patients, of which DRB1*15 and DRB1*12 were the most frequent; additionally, 7 DQB1 alleles were identified. The most common DQB1 alleles in the patients

Table 1: Distribution of HLA-DRB1 Alleles in the Thai Hemophilia A Patients and Controls

DRB1 allele

Hemophilia A without inhibitor (n = 26)

Controls (n = 36)

Observed

DRB1*01

1.9

0.0

1.4

DRB1*03

3.8

1.6

6.9

DRB1*04

9.6

9.7

13.9

DRB1*07

9.6

4.8

13.9

DRB1*08

7.7

0.0

8.3

DRB1*09

9.6

9.7

4.2

DRB1*10

0.0

1.6

2.8

DRB1*11

7.7

3.2

5.6

DRB1*12

13.5

21.0

11.1

DRB1*13

1.9

8.1

5.6

DRB1*14

15.4

6.5

8.3

DRB1*15

19.2

30.6**

13.9

DRB1*16

0.0

3.2

4.2

P = 0.021; OR = 2.74; 95% CI = 1.16- 6.47.

Hemophilia A with inhibitor (n = 31)

Turk J Hematol 2012; 29: 34-39

Nathalang O, et al: HLA class II and FVIII Inhibitor

Table 2: Distribution of HLA-DQB1 Alleles in the Thai Hemophilia A Patients and Controls

DQB1 allele

Hemophilia A without inhibitor (n = 26)

Hemophilia A with inhibitor (n = 31)

Controls (n = 36)

Observed

DQB1*05

34.6

35.5

26.4

DQB1*06

13.5

16.1

15.3

DQB1*02

13.5

4.8

18.1

DQB1*03:01/:04

17.3

22.6

18.1

DQB1*03:02/:05/:07

5.8

3.2

6.9

DQB1*03:03:02/:06

9.6

11.3

8.3

DQB1*04

5.8

6.5

6.9

and controls were DQB1*05 and DQB1*06, respectively. DQB1*03 was sub-typed as DQB1*03:01/03:04, DQB1*03:02/03:05/03:07, and DQB1*03:03:02/03:06 via PCR-SSP low-resolution typing. The frequency of DRB1*15 was higher in the patients (both with and without inhibitor) than in the controls, however, statistical significance was found between patients with inhibitor and the controls (30.6% vs. 13.9%; P = 0.021; OR = 2.74; 95% CI = 1.16-6.47). The frequency of DRB1*15 in the patients with FVIII inhibitor (30.6%) was higher than that in the patients without inhibitor (19.2%), but the difference was not statistically significant (P = 0.198). On the other hand, the frequency of DRB1*14, DRB1*07, and DQB1*02 was lower in the patients with inhibitor than in those without inhibitor (P > 0.05). Discussion Both genetic and non-genetic risk factors have been implicated in the development of factor VIII inhibitor [16,17]. The molecular defects in the FVIII gene that cause a defect in translation and protein production is a primary cause of inhibitor formation. Polymorphisms associated with HLA class II molecules, interleukin-10 (IL-10), and tumor necrosis factor-a (TNF-a) also influence to the FVIII inhibitor development [18]. Immunological mechanisms in the cellular processing of peptide antigens are involved in the development of inhibitor in patients with hemophilia A. Moreover, the major histocompatibility complex phenotype is also involved in inhibitor formation [19-21].

Although a molecular defect associated with factor VIII was observed in 35 of the 57 patients in the present study, inversion of intron 22 was observed in more of the patients with inhibitor than in those without inhibitor, as previously reported [22,23]; however, the frequency of point mutations causing stop codon in patients with inhibitor was significantly higher than in those without inhibitor, which was also previously reported [24]. Moreover, the association between HLA class II alleles and the FVIII inhibitors in Thai hemophilia patients was further investigated in this study, as recent studies have indicated that inhibitor formation depends upon an adequate T-cell response by major histocompatibility complex class II molecules to FVIII resulting from the presentation of FVIII protein antigen to T-cell receptors [18-21]. It was reported that in mild hemophilia A patients with inhibitor the frequency of DRB1*01 and DQB1*05 was slightly higher than the controls (but not significantly) [25]. A comparison of the frequency data for DRB1*15/16 in hemophilia A patients with FVIII inhibitor reported in other studies showed that DRB1*15 and DRB1*16 were high-risk alleles for inhibitor formation in patients with congenital hemophilia A and acquired hemophilia A, respectively [8-10]. The DRB1*15 allele is known to exhibit the specific surface loop peptide comprising amino acids 1706-1721 of the FVIII light chain, and is considered to be involved in FVIII inhibitor formation in patients with congenital hemophilia A that lack endogenous FVIII protein synthesis [8,26]. Because the ability to recognize and process FVIII peptides is determined by the number of HLA class II molecules in each individual. It was reported that

Nathalang O, et al: HLA class II and FVIII Inhibitor

there are as many as 13 potential recognition sequences for HLA-DRB1*1501 in FVIII, whereas there are only 2 recognition sequences for HLA-DRB1*1101 [27]. Even though HLA-DRB1*15 (17.5%), DRB1*12 (16.9%), and DRB1*09 (11.5%) were the most common in Thai blood donors [28], the frequency of the DRB1*15 allele among hemophilia A patients with inhibitors in the present study was significantly higher than in the controls. Limitations of the present study included the small number of patients enrolled, incomplete detection of molecular defects of the factor VIII gene, and the lack of exploration of the polymorphisms associated with IL-10 and TNF-a. In conclusion, the DRB1*15 allele may have contributed to inhibitor formation in Thai patients with hemophilia A. Additional comprehensive research with larger patient populations is warranted. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Acknowledgements This study was supported by the Thailand Research Fund: Senior Research Scholar 2006 (AC). References 1. Wight J, Paisley S: The epidemiology of inhibitors in haemophilia A: A systemic review. Haemophilia 2003; 9: 418-435 2. Addiego J, Kasper C, Abildgaard C, Hilgartner M, Lusher J, Glader B, Aledort L: Frequency of inhibitor development in haemophiliacs treated with low-purity factor VIII. Lancet 1993; 342: 462-464 3. Mahasandana C, Patharathienskul D, Suvatte V: Hemophilia with factor VIII and IX inhibitors, incidence, bleeding problems and management. Southeast Asian J Trop Med Public Health 1993; 24 (Suppl1): 106-112 4. Bray GL, Gomperts ED, Courter S, Gruppo R, Gordon EM, Manco-Johnson M, Shapiro A, Scheibel E, White G 3rd, Lee M: A multicenter study of recombinant factor VIII (Recombinate): Safety, efficacy, and inhibitor risk in previously untreated patients with hemophilia A. The Recombinate Study Group. Blood 1994; 83: 2428-2435 5. De Biasi R, Rocino A, Papa ML, Salerno E, Mastrullo L, De Blasi D: Incidence of factor VIII inhibitor development in hemophilia A patients treated with less pure plasma derived concentrates. Thromb Haemost 1994; 71: 544-547

Turk J Hematol 2012; 29: 34-39

6. Kavakli K, Gringeri A, Bader R, Nisil G, Polat A, Aydinok Y: Inhibitor development and substitution therapy in a developing country: Turkey. Haemophilia 1998; 4: 104-108 7. Wight J, Paisley S: The epidemiology of inhibitors in haemophilia A: A systematic review. Haemophilia 2003; 9: 418-435 8. Oldenburg J, Picard JK, Schwaab R, Brackmann HH, Tuddenham EG, Simpson E: HLA genotype of patients with severe haemophilia A due to intron 22 inversion with and without inhibitors of factor VIII. Thromb Haemost 1997; 77: 238-242 9. Hay CR, Ollier W, Pepper L, Cumming A, Keeney S, Goodeve AC, Colvin BT, Hill FG, Preston FE, Peake IR: HLA class II profile: A weak determinant of factor VIII inhibitor development in severe haemophilia A. UKHCDO Inhibitor Working Party. Thromb Haemost 1997; 77: 234-237 10. Pavlova A, Zeitler H, Scharrer I, Brackmann HH, Oldenburg J: HLA genotype in patients with acquired haemophilia A. Haemophilia 2010; 16: 107-112 11. Kasper CK, Aledort LM, Counts RB: A more uniform measurement of factor VIII inhibitors. Thromb Diath Haemorrh 1975; 34: 869-872 12. Rossetti LC, Radic CP, Larripa IB, De Brasi CD: Developing a new generation of tests for genotyping hemophilia-causative rearrangements involving int 22 h and int 1 h hotspots in the factor VIII gene. J Thromb Haemost 2008; 6: 830-836 13. Rossetti LC, Radic CP, Larripa IB, De Brasi CD: Genotyping the hemophilia inversion hotspot by use of inverse PCR. Clin Chem 2005; 51: 1154-1158 14. Williams IJ, Abuzenadah A, Winship PR, Preston FE, Dolan G, Wright J, Peake IR, Goodeve AC: Precise carrier and prenatal diagnosis in families with haemophilia A: Use of conformation sensitive gel electrophoresis for rapid mutation screening and polymorphism analysis. Thromb Haemost 1998; 79: 723-726 15. Sasanakul W, Chuansumrit A, Rurgkhum S. Udomsubpayakul U, Hathirat P: DNA extraction and amplification of 10-day, room-temperature blood samples. J Med Assoc Thai 1999; 82 (Suppl 1): 186-189 16. Astermark J, Berntorp E, White GC, Kroner BL; The MIBS Study Group: The Malmo International Brother Study (MIBS): Further support for genetic predisposition to inhibitor development. Haemophilia 2001; 7: 267-272 17. Astermark J: Basic aspects of inhibitors to factors VIII and IX and the influence of non-genetic risk factors. Haemophilia 2006; 12 (Suppl 6): 8-14 18. Pavlova A, Delev D, Lacroix-Desmazes S, Schwaab R, Mende M, Fimmers R, Astermark J, Oldenburg J: Impact of polymorphisms of the major compatibility complex class II, interleukin-10, tumor necrosis factor-alpha and cytotoxic

Turk J Hematol 2012; 29: 34-39

T-lymphocyte antigen-4 genes on inhibitor development in severe haemophilia A. J Thromb Haemost 2009; 7: 2006-2015 19. Singer ST, Addiego JE Jr, Reason DC, Lucas AH: T lymphocyte proliferative responses induced recombinant factor VIII in hemophilia A patients with inhibitors. Thromb Haemost 1996; 76: 17-22 20. Reding MT, Wu H, Krampf M, Okita DK, Diethelm-Okita BM, Christie BA, Key NS, Conti-Fine BM: Sensitization of CD4+ T cells to coagulation factor VIII: Response in congenital and acquired hemophilia patients and in healthy subjects. Thromb Haemost 2000; 84: 643-652 21. Jacquemin M, Vantomme V, Buhot C, Lavendâ&#x20AC;&#x2122;homme R, Burny W, Demotte N, Chaux P, Peerlinck K, Vermylen J, Maillere B, van der Bruggen P, Saint-Remy JM: CD4+ T-cell clones specific for wild-type factor VIII: A molecular mechanism responsible for a higher incidence of inhibitor formation in mild/moderate hemophilia A. Blood 2003; 101: 1351-1358 22. Schwaab R, Brackmann HH, Meyer C, Seehafer J, Kirchgesser M, Haack A, Olek K, Tuddenham EG, Oldenburg J: Haemophilia A mutation type determines risk of inhibitor formation. Thromb Haemost 1995; 74: 1402-1406 23. Tuddenhamn EG, McVey JH: Genetic basis of inhibitor development in haemophilia A. Haemophilia 1998; 4: 543-545 24. Antonarakis SE, Rossiter JP, Young M, Horst J, de Moerloose P, Sommer SS, Ketterling RP, Kazazian HH Jr, NĂŠgrier C, Vinciguerra C, Gitschier J, Goossens M, Girodon E, Ghanem N, Plassa F, Lavergne JM, Vidaud M, Costa JM, Laurian Y, Lin SW, Lin SR, Shen MC, Lillicrap D, Taylor SA, Windsor S, Valleix SV, Nafa K, Sultan Y, Delpech M, Vnencak-Jones CL, Phillips JA 3rd, Ljung RC, Koumbarelis E, Gialeraki A, Mandalaki T, Jenkins PV, Collins PW, Pasi KJ, Goodeve A, Peake I, Preston FE, Schwartz M, Scheibel E, Ingerslev J, Cooper DN, Millar DS, Kakkar VV, Giannelli F, Naylor JA, Tizzano EF, Baiget M, Domenech M, Altisent C, Tusell J, Beneyto M, Lorenzo JI, Gaucher C, Mazurier C, Peerlinck K, Matthijs G, Cassiman JJ, Vermylen J, Mori PG, Acquila M, Caprino D, Inaba H.: Factor VIII gene inversions in severe hemophilia A. Results of an international consortium study. Blood 1995; 86: 2206-2212

Nathalang O, et al: HLA class II and FVIII Inhibitor

25. Bril WS, MacLean PE, Kaijen PH, van den Brink EN, Lardy NM, Fijnvandraat K, Peters M, Voorberg J: HLA class II genotype and factor VIII inhibitors in mild haemophilia A patients with an Arg 593 to Cys mutation. Haemophilia 2004; 10: 509-514 26. Chicz RM, Urban RG, Gorga JC, Vignali DA, Lane WS, Strominger JL: Specificity and promiscuity among naturally processed peptides bound to HLA-DR alleles. J Exp Med 1993; 178 27-47 27. White GC 2nd, Kempton CL, Grimsley A, Nielsen B, Roberts HR: Cellular immune responses in hemophilia: Why do inhibitors develop in some, but not all hemophiliacs? J Thromb Haemost 2005; 3: 1676-1681 28. Kupatawintu P, Pheancharoen S, Srisuddee A, Tanaka H, Tadokoro K, Nathalang O: HLA-A, -B, -DR haplotype frequencies in the Thai stem cell donor registry. Tissue Antigens 2010; 75: 730-736

Research Article

DOI: 10.5505/tjh.2012.07769

The Evaluation of Fibrin Sealants and Tissue Adhesives in Oral Surgery Among Patients with Bleeding Disorders Kanama Bozukluğu Olan Hastalarda Fibrin Sealant ve Doku Yapıştırıcılarının Oral Cerrahi Uygulamalarda Kullanımının Değerlendirilmesi Gülsüm Ak1, Esra Alpkılıç Başkırt2, Esma Kürklü1, Meltem Koray1, Hakkı Tanyeri1, Bülent Zülfikar3 Istanbul University, Faculty of Dentistry, Department of Oral Surgery and Medicine , İstanbul, Turkey Hospitadent Oral and Dental Health Rehabilitation Center, Oral Surgery Department, İstanbul, Turkey 3 İstanbul University, Cerrahpaşa School of Medicine, Department of Pediatric Hematology-Oncology, İstanbul, Turkey 1 2

Abstract Objective: The aim of this study was to evaluate the efficiency of two local hemostatic agents administered with a preoperative dose of replacement therapy in patients with bleeding disorders undergoing oral surgery.

Material and Methods: The study included 21 patients that were randomly divided into 3 groups. Patients in Group 1 (n = 7) received preoperative replacement therapy and postoperative fibrin sealant applied to the surgical site. Patients in Group 2 (n = 7) received preoperative replacement therapy and postoperative tissue adhesive applied to the surgical site. Patients in Group 3 (n = 7) were given replacement therapy pre- and postoperatively.

Results: Postoperative bleeding was not observed in 17 of the 21 patients, including 5 in Group 1 (71.42%), 6 in Group 2 (85.71%), and 6 in Group 3 (85.71%). Hemorrhagic complications occurred in only 4 of the 21 patients.

Conclusion: The use of fibrin sealant and tissue adhesive was beneficial, as they reduced the level of factor concentrates used for replacement therapy and resulted in rapid hemostasis at the surgical site, facilitating the ability to perform serial surgical procedures concurrently.

Key Words: Fibrin sealants, Tissue adhesive, Tooth extraction, Hemophilia, Bleeding disorders

Özet Amaç: Bu çalışmanın amacı kanama bozukluğu olan hastalarda, oral cerrahi girişimlerde replasman tedavisinin yalnızca preoperatif dozu uygulanarak cerrahi alana lokal doku yapıştırıcı veya fibrin sealant uygulamasının hemostaz üzerindeki etkinliğini değerlendirmektir. Gereç ve Yöntemler: Kanama bozukluğu olan 21 hasta randomize olarak üç farklı gruba ayrılmıştır. Grup 1’deki hastalara (n=7) preoperatif replasman tedavisi ile fibrin sealant uygulanmıştır. Grup 2’deki hastalara (n=7) preoperatif Address for Correspondence: Esra Alpkılıç Başkırt, M.D., Hospitadent Ağız ve Diş Sağlığı Merkezi Pendik Şubesi. Bahçelievler Mah. Aydınlı Yolu Caddesi No: 26 Pendik, İstanbul, Turkey Phone: +90 216 491 30 30 E-mail: esra_alpkilic@yahoo.com Received/Geliş tarihi : August 13, 2009 Accepted/Kabul tarihi : November 22, 2010

Turk J Hematol 2012; 29: 40-47

Ak G, et al: Local Hemostatic Agents in Oral Surgery

replasman tedavisi ile doku yapıştırıcısı uygulanmıştır. Grup 3’deki hastalara preoperatif ve postoperatif replasman tedavisi uygulanmıştır.

Bulgular: Grup 1’de beş hasta (%71,42), Grup 2’de altı hasta (%85,71) ve Grup 3’de altı hasta (%85,71) olmak üzere toplam 17 hastada hiçbir postoperatif komplikasyon gözlenmemiştir. Bütün gruplardan olmak üzere sadece dört hastada hemorajik komplikasyon gözlenmiştir.

Sonuç: Bu klinik çalışmanın sonuçlarına dayanarak, fibrin sealant ve doku yapıştırıcılarının oral cerrahi işlemlerde uygulanmasının replasman tedavisinde kullanılan faktör konsantresi miktarının azaltılması ve operasyon alanında hemostaz sağlanarak aynı anda çok sayıda işlemin yapılabilmesine olanak vermesi açısından faydalı olduğu görüşündeyiz. Anahtar Sözcükler: Fibrin sealant, Doku yapıştırıcısı, Diş çekimi, Hemofili, Kanama bozukluğu Introduction Patients with bleeding disorders that require oral surgery due to hemorrhage have a high risk of prolonged or excessive bleeding. Multiple transfusions and prolonged hospitalization associated with oral surgery had previously been a necessity for this group of patients. Subsequently, the introduction of clotting factor concentrates and antifibrinolytic agents has facilitated the use of oral surgical procedures in patients with bleeding disorders [1]. Thus, various unconventional methods are used in patients with bleeding disorders, particularly the application of fibrin sealants and tissue adhesives, as adjunctive treatment or in some cases primary treatment. Fibrin sealants contain fibrinogen, factor XIII, thrombin, and aprotinin. Following application to the tooth extraction site, thrombin converts fibrinogen to an unstable fibrin clot and aprotinin prevents clot degradation [2,3]. Traditionally, fibrin sealants are used as tissue adhesive and hemostatic agent, as well as in new and creative ways, such as for cellular growth stimulation in tissue engineering [4,5]. Ethyl-2 cyanoacrylate, a rapid polymerizable liquid monomer, is a synthetic tissue adhesive for topical use. Upon application, liquid monomer formulation polymerizes instantly into a thin flexible polymer film that adheres strongly to oral tissues [6,7]; however, the mechanism by which cyanoacrylate glue generates hemostasis is unclear. The hypothesis is that the ester forms a microfilm that causes mechanical blockage that slows blood flow, providing a surface agent to activate the clotting cascade [8]. There is evidence that the film forms a porous mass that is invaded by blood with subsequent clotting within the pores of the adhesive. As such, the rationale behind the use of ethyl-2 cyanoacrylate is to hold the opposing wound edges together while also functioning as a wound dressing that enhances clot formation or as a clot stabilizer [9]. The clinical features and benefits can be altered by

adding different side chains [10]. As with fibrin sealants, tissue adhesives are widely used for oral and general surgical interventions, such as root canal treatment and embolotherapy for complex cerebral and extracerebral vascular anomalies [11]. The aim of the present study was to evaluate the hemostatic efficacy of a fibrin sealant and a tissue adhesive, with only preoperative administration of replacement therapy in patients with bleeding disorders undergoing oral surgery. Material and Methods The study included 21 patients with bleeding disorders who were referred for dental assessment. In all, 15 patients had Hemophilia A (5 had the severe type, 7 had the moderate type, and 3 had the mild type), 1 patient had Hemophilia B, and 5 patients had von Willebrand disease (vWD). The male:female ratio was 3.2:1 and mean age was 22.28 years (range: 6-40 years). Each patient underwent an initial consultation to establish a dental treatment plan. Severe dental caries, dental abscess, and prolonged retention of deciduous teeth were the indications for tooth extraction. Surgical intervention included tooth extraction, subgingival scaling, and frenectomy. Informed consent was obtained from each patient or their parents. The patients were randomly divided into 3 groups, regardless of their disease type and severity. The replacement therapy procedure was carried out in collaboration with the Department of Pediatric Hematology-Oncology (Table 1). Group 1 (n=7) received preoperative replacement therapy and postoperative fibrin sealant applied to the surgical site. Group 2 (n=7) received preoperative replacement therapy and postoperative tissue adhesive applied to the surgical site. Postoperative replacement therapy would not be given unless hemostasis was achieved in Groups 1 and 2. Group 3 (n=7) received the total dose of replacement therapy pre- and postoperatively. Oral surgical procedures were performed with minimal trauma to surrounding tissues. The distribution of patients according to

Ak G, et al: Local Hemostatic Agents in Oral Surgery

Turk J Hematol 2012; 29: 40-47

Table 1: Protocol for Hemostasis

Severe Hemophilia A/B 12h before +Day 5/7

Mild, moderate hemophilia A/B and vWD

Other (FX, XI, and XIII deficiency

Tranexamic acid 25-40mg·kg–1·d–1 (t.i.d.or q.i.d.) FVIII: 25 U kg–1 F IX: 40 U kg–1

2h before

FVIII and vWD: 20 U kg–1 F IX: 40 U kg–1

DDAVP: 0.3 µg·kg–1·dose (twice)

FVIII and vWD: 20 U kg–1 F IX: 40 U kg–1

Day 1 Day 2

FVIII: 20 U kg–1 F IX: 40 U kg–1

Day 3

FVIII: 15 U kg–1 F IX: 30 U kg–1

FFP*

DDAVP: 0.3 µg·kg–1·dose (twice)

Table 2: General Patient Characteristics and Dental Interventions Performed with Preoperative Replacement Therapy and Local Fibrin Sealant Application (Group 1)

Case

Gender

Age (years)

Disease

Dental interventions (number of teeth)

Complications

von Willebrand disease

Subgingival scaling and dental extraction (3.8)

(+)

von Willebrand disease

Dental extraction (1.6)

(–)

Hemophilia A (moderate form)

Dental extraction (1.6, 2.5, 3.6, 4.6)

(–)

Hemophilia A (severe form)

Dental extraction (5.4, 5.5, 3.6)

(–)

Hemophilia A (severe form)

Dental extraction (2.6)

(+)

Hemophilia A (moderate form)

Dental extraction (1.4,4.4)

(–)

Hemophilia A (mild form)

Dental extractions (3.5,4.5)

(–)

hematologic disease and oral surgical procedure is given in Tables 2, 3 and 4. Subgingival scaling was performed in two patients who had spontaneous gingival bleeding due to mild gingivitis. Frenectomy of the inferior labial frenulum was performed in 1 patient due to diastema between the incisors. Deciduous and permanent teeth (except for the permanent mandibular molar) were extracted after adminis-

tration of articaine HCl (40 mg mL–1) and epinephrine HCl (0.006 mg mL–1) (Ultracaine DS, Aventis), either locally or intraligamentally. Extraction of permanent mandibular molar was performed with the inferior alveolar nerve block. Teeth were extracted with minimal trauma to surrounding tissues. The socket was curetted and the extraction cavity was filled with 14x7x7 mm gelatin sponges (Gelatamp, Roeko, Germany) in all patients. Fibrin seal-

Turk J Hematol 2012; 29: 40-47

Ak G, et al: Local Hemostatic Agents in Oral Surgery

Table 3: General Patient Characteristics and Dental Interventions Performed with Preoperative Replacement Therapy and Local tissue Adhesive Application in Group 2

Case

Gender

Age (years)

Disease

Dental interventions (number of teeth)

Complications

Hemophilia A (severe form)

Dental extraction (7.4, 7.5, 8.1)

(–)

Hemophilia A (severe form)

Dental extraction (1.6, 1.4, 2.4, 2.7, 4.4, 4.5, 4.6)

(+) at the needle penetration site

Hemophilia A (mild form)

Dental extraction (1.8, 4.8)

(-)

Hemophilia A (moderate form)

Dental extraction (7.5,8.5)

(–)

von Willebrand disease

Dental extraction (4.5)

(–)

von Willebrand disease

Dental extraction (2.8)

(–)

Hemophilia A (moderate form)

Dental extraction (7.5,3.6)

(–)

Table 4: General Patient Characteristics and Dental Interventions Performed with Pre-and Postoperative Replacement Therapy in Group 3

Case

Gender

Age (years)

Disease

Dental interventions (number of teeth)

Complications

Hemophilia A (moderate form)

Frenectomy and dental extraction (7.1,7.2,8.1,8.2)

(–)

Hemophilia A (mild form)

Subgingival scaling and dental extraction (4.6)

(–)

Hemophilia B

Dental extraction (3.7)

(–)

von Willebrand disease

Dental extraction (1.5)

(–)

Hemophilia A (severe form)

Dental extraction (1.6,2.6)

(+)

Hemophilia A (moderate form)

Dental extraction (1.3)

(–)

Hemophilia A (moderate form)

Dental extraction (4.2,4.4)

(–)

ant 0.5 mL (TisseelTM Kit, Eczacıbaşı, Baxter, Turkey) was used for patients in Group 1 and tissue adhesive (0.3 ml/ cc in tubes of 3g) (Epiglu® Meyer-Haake, Germany) was used for patients in Group 2. Patients in Group 3 were not administered additional local therapy. All patients were monitored until the cessation of bleeding at the surgical site and were informed about postoperative care.

Results Patient demographics, surgical procedures, and postoperative outcomes are summarized in Tables 2, 3 and 4. A total of 21 patients with bleeding disorders underwent oral surgery for tooth extraction (44 teeth including 12 deciduous and 32 permanent), subgingival scaling (n=2),

Ak G, et al: Local Hemostatic Agents in Oral Surgery

Turk J Hematol 2012; 29: 40-47

penetration in the palatal mucosa. Tissue adhesive was applied once again and the bleeding ceased. In Group 3 mild postoperative bleeding was observed in Case 5 (severe Hemophilia A) following extraction of two teeth; complete clotting was achieved with local administration of tranexamic acid. Discussion

Figure 1: Application of fibrin sealant for gingival hemorrhage in Case 1 in Group 1.

Figure 2: Application of tissue adhesive in the extraction socket in Case 2 in Group 2.

and frenectomy (n=1). Postoperative hemostasis was achieved in 17 patients, with a success rate of 71.4% (n = 5) in Group 1, 85.7% (n=6) in Group 2, and 85.7% in Group 3 (n=6). Hemorrhagic complications occurred in only four of the 21 patients. In Group 1; Case 1 (vWD) had undergone a single tooth extraction and subgingival scaling, and Case 5 (severe Hemophilia A) had one tooth extraction. To achieve hemostasis in these patients additional replacement therapy was given postoperatively. In Group 2 Case 2 (severe Hemophilia A) had 6 teeth extracted and postoperative hemorrhage occurred only at the site of needle

The present study demonstrated the outcome of the use of fibrin sealant and tissue adhesive, with the addition of only preoperative replacement therapy to control hemorrhage in patients with bleeding disorders undergoing oral surgery. To the best of our knowledge this is the first such study, and therefore the results could not be compared to those of other studies. Hemorrhagic complications occurred in only 4 of 21 patients, of which one had vWD, two had Hemophilia A, and one had Hemophilia B. It is interesting to note that one of these patients (Case 2 from Group 2 [Hemophilia A]) had bleeding at the site of needle penetration, but not in the extraction cavity. In Group 2 preoperative replacement therapy and local application of tissue adhesive resulted in a 100% success rate. Additional postoperative replacement therapy was given to patients in Groups 1 and 2 that had postoperative bleeding despite local application of fibrin sealant or tissue adhesive. Based on the results of the present study we conclude that local application of fibrin sealant or tissue adhesive, together with preoperative replacement therapy is a reliable and efficacious procedure in patients with bleeding disorders undergoing oral surgery. In addition, the observed reduction in blood loss during and after oral surgery facilitates multiple surgical procedures during a single session of replacement therapy, providing economical and rapid patient rehabilitation. Currently available treatment options for achieving hemostasis in patients with bleeding disorders are primarily factor replacement therapy, release of endogenous factor stores, and clot stabilization [9,12]. Factor replacement therapy is the golden standard treatment for hemophilia; however, its high cost is a major disadvantage, and as such recent research has focused on local hemostatic agents, such as fibrin sealants and tissue adhesives. Satisfactory hemorrhage control with the use of these materials has been reported [12,13]. The primary benefits of these hemostatic agents are a life-saving reduction in hemorrhage caused by trauma, a reduction in factor dependency, a reduction in the cost of treatment, and rapid control of hemorrhage, which reduces patient anxiety related to uncontrollable bleeding [13]. Other features of these agents regarding availability, application, safety and complication are sum-

Turk J Hematol 2012; 29: 40-47

Ak G, et al: Local Hemostatic Agents in Oral Surgery

Table 5: Comparison of Fibrin Sealants and Tissue Adhesives

Fibrin Sealants

Tissue Adhesives

Cost

Readily available

Reduction in patient’s stress

Resolution in saliva

Viral transmission risk

Provides hemostasis without replacement therapy

Difficulty in application in moist regions

Exothermic reaction heat

Inhibitor occurrence

Residual monomer occurrence

marized in Table 5 with a comparison to each other indicating superiority. Suturing plays an important role in controlling hemorrhage, especially in patients with bleeding disorders undergoing tooth extraction. It has been suggested that when suturing is not performed (e.g. in children, as sometimes suturing is impossible due to a flat socket) saliva, due its potent fibrinolytic activity, dissolves and washes fibrin sealant away from the socket within a short time. Tongue movements also contribute to the mechanical removal of a clot from the socket [14]. A celluloid splint, as Suwannuraks suggested may prevent the tongue from scratching the inside of the socket, therefore the clot would be safe beneath the layer of the fibrin sealant [14]. On the other hand, cyanoacrylate functions well in a moist environment. Because moist environment does not interfere with the firm structure of the material, following application of tissue adhesives the enviroment need not be completely dry. Moreover, ethyl-2 cyanoacrylate—a monomer in liquid form—polymerizes in an exothermic reaction when in contact with a fluid medium, thereby forming a bond that strongly holds together the opposing edges of a wound [15]. Adhesion is achieved via attraction between the molecules of an adhesives and tissue surfaces [8]. These properties represent an advantage over fibrin sealants. Utilization of tissue adhesive functions as suturing does in providing hemostasis. Additionally, tissue adhe-

sives with their inert feature show no resolution in saliva. These advantages were observed in the present study in Group 2, which received Epiglue® Meyer-Haake tissue adhesive; saturation and complications were not observed. Nevertheless, application in highly moist surfaces is challenging because the material sets quickly when it contacts with excess liquid that is comprised of blood and/or saliva. Fibrin sealants are derived from plasma and therefore carry a similar risk of viral transmission as other similar plasma products; however, Kavaklı reported that during the last 20 years, no commercial fibrin sealant product has been reported to be responsible for viral transmission, as the result of modern viral inactivation procedures [16]. Nevertheless, it is well known that a viral infection cannot be detected during the initial incubation period of an infectious disease—a time period during which a donor is unaware of infection and laboratory serological assays are not able to detect the presence of a virus. As such, nonautologous fibrin sealants can carry a potential risk for viral transmission and homemade autologous fibrin sealants appear to be a good treatment choice; however, they are more expensive than other types of fibrin sealants. On the other hand, tissue adhesives are not associated with the risk of microbial transmission, as they are synthetic, and they exhibit bacteriostatic activity on wound surfaces and are less expensive than fibrin sealant products. Based on the limited available data, tissue adhesives appear to have several advantages. However, their potential for forming exothermic heat during polymerization and residual monomer appears as a serious disadvantage. As the polymerization chain which occurs during the recurrent or thick applications becomes longer, the risk of exothermic heat increases. In terms of cost-effectiveness, the treatment protocol in Group 2 was the best, due to the lower price of tissue adhesive (as compared tot fibrin sealant) and the lower dose of factor replacement. Patients in Groups 1 and 2 received only one dose of preoperative replacement therapy (in patients with severe and moderate-mild Hemophilia A: 25 U kg–1 and 20 U kg–1 of FVIII, respectively; in those with Hemophilia B: 40 U kg–1 of FVIX); however, patients in Group 3 also received postoperative replacement therapy on postoperative d 1-3—a total of 55 U kg–1 for each patient with Hemophilia A and 110 U kg–1 for those with Hemophilia B. As clotting factor concentrates are costly components of hemostatic therapy in patients with bleeding disorders, a reduction in their use will directly reduce the cost of therapy. In the UK it has been estimated that in terms of medication alone the cost per bleeding episode in a child of 20 kg varies from £54 to £493, and that for

Ak G, et al: Local Hemostatic Agents in Oral Surgery

an adult varies from £90 to £822.50, depending on the severity of the bleeding, and the purity, type, and quantity of FVIII used [17]. Thus, financial concerns has forced the researchers to study on ancillary therapies such as developing new techniques or hemostasis protocols that may provide an opportunity to define what would be closer to optimal replacement therapy by using lower doses. Our experience as oral surgeons indicates that there is an increased risk of hemorrhage triggered by the intense vascularization of oral tissues and iatrogenic trauma during oral surgical procedures; therefore, oral care providers that treat patients with bleeding disorders should be aware of all the measures for controlling bleeding and the principles of atraumatic surgery. The goal is “key hole” surgery and minimal interference with the attached gingiva around the teeth and periosteum, so as to minimize postoperative bleeding [19]. Choice of anesthesia is also an important issue. With the use of appropriate replacement treatment regional anesthesia can be used; however, infiltration anesthesia is safer than other methods. In addition, considering the direct relationship between emotional factors such as dental anxiety, fear of bleeding and increased fibrinolysis, which can complicate postoperative healing in patients with bleeding disorders [1], dentists should perform various methods to alleviate patient stress prior to surgery. Patients with bleeding disorders would greatly benefit from dental educational programs presented by oral care providers. The present study has some limitations, including a small patient population and groups consisting of patients with various types of bleeding disorders. As the results of this study are considered to be preliminary, additional research with larger patient populations and different study designs is necessary to further investigate and compare the efficacy of various local hemostatic agents in patients with bleeding disorders undergoing oral surgery. Conclusion Utilization of fibrin sealant or tissue adhesive, with only preoperative administration of replacement therapy in patients with bleeding disorders undergoing oral surgical procedures safely provided rapid hemostasis at the surgical site and facilitated performance of serial surgical procedures concurrently. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2012; 29: 40-47

References 1. Katz JO, Terezhalmy GT: Dental management of the patient with haemophilia. Oral Surg Oral Med Oral Pathol 1988; 66: 139-144 2. Martinowitz U, Varon D, Heim H: The role of fibrin tissue adhesives in surgery of haemophilia patients. Haemophilia 1998; 4: 443-448 3. Tock B, Drohan W, Hess J, Pusatery A, Holcomb J, Machpee M: Haemophilia and advanced fibrin sealant technologies. Haemophilia 1998; 4: 449-455 4. Sponitz WD, Prabhu R: Fibrin sealant tissue adhesivereview and update. J Long Term Eff Med Implants 2005; 15: 245-270 5. Jackson MR: Fibrin sealants in surgical practice: An overview. Am J Surg 2001; 182: 1-7 6. Narang U: Cyanoacrylate medical adhesives-a new era Colgate ORAB Soothe. N. Seal Liquid Protectant for canker sore relief. Compend Contin Educ Dent 2001; 32 : 7-11 7. Singer AJ, Thode HC: A review of the literature on octylcyanoacrylate tissue adhesive. Am J Surg 2004; 187: 238-248 8. Samuel PR, Roberts AC, Nigam A: The use of Indermil (n-buthyl cyanoacrylate) in otolaryngology and neck surgery. A preliminary report on the first 33 patients. J Laryngol Otol 1997 ; 111: 536- 540 9. Piot B, Sigaud-Fiks M, Huet P, Fressinaud E, Trossaert M, Mercier J: Management of dental extractions in patients with bleeding disorders. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2002; 93: 247-250 10. Tseng YC, Hyon SH, Ikada Y: Modification of synthesis and investigation of properties for 2-cyanoacrylates. Biomaterials 1990; 11: 73-79 11. Vinters HV, Galil KA, Lundie MJ, Kauffmann JC: The histotoxicity of cyanoacrylates. A selective review. Neuroradiology 1985; 27: 279-291 12. Johnson WT, Leary JM: Management of dental patients with bleeding disorders: Review and update. Oral Surg Oral Med Oral Pathol 1997; 66(3): 297-303 13. Zusman SP, Lustig JP, Baston I: Postextraction hemostasis in patients without reducing the dose of oral anticoagulant: The use of fibrin sealant. Quitessence Int 1992; 23: 713- 716 14. Suwannuraks M, Chuansumrit A, Sriudonporn N: The use of fibrin glue as an operative sealant in dental extraction in bleeding disorders patients. Haemophilia 1999; 5: 106-108 15. Avery BS, Ord RA: The use of butyl cyanoacrylate as tissue adhesive in maxillo-facial and cranio- facial surgery. Br J Oral Surg 1982; 20: 84-95 16. Kavaklı K: Fibrin glue and clinical impact on haemophilia care. Haemophilia 1999; 5: 392-396

Turk J Hematol 2012; 29: 40-47

17. United Kingdom Haemophilia Centre (UKHC) Directors Organisation Executive Committee Guidelines on therapeutic products to threat haemophilia and other hereditary coagulation disorders. Haemophilia 1997; 3: 63-77 18. Chandy M: Management of haemophilia with minimal factor replacement in developing countries: Role of ancillary therapy. Seminars of Thrombosis and Hemostasis 2005; 31: 501-506

Ak G, et al: Local Hemostatic Agents in Oral Surgery

19. Harrington B: Primary dental care of patients with haemophilia. Haemophilia 2000; 6: 7-12

Research Article

DOI: 10.5505/tjh.2012.02418

Rare Coagulation Disorders: A Retrospective Analysis of 156 Patients in Turkey Nadir Koagülasyon Bozuklukları: Türkiye’deki 156 Olgunun Retrospektif İncelenmesi Tunç Fışgın1, Can Balkan2, Tiraje Celkan3, Yurdanur Kılınç4, Meral Türker5, Çetin Timur6, Türkiz Gürsel7, Emin Kürekçi8, Feride Duru1, Alphan Küpesiz9, Lale Olcay10, Şebnem Yılmaz11, Ünsal Özgen12, Ayşegül Ünüvar13, Hale Ören11, Kaan Kavaklı2 Ondokuz Mayıs University, School of Medicine, Department of Pediatric Hematology, Samsun, Turkey Ege University, School of Medicine, Department of Pediatric Hematology, İzmir, Turkey 3 Istanbul University, Cerrahpaşa School of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey 4 Çukurova University, School of Medicine, Department of Pediatric Hematology, Adana, Turkey 5 Tepecik Research and Education Hospital, Department of Pediatric Hematology, İzmir, Turkey 6 Göztepe Training and Research Hospital, Department of Pediatric Hematology, İstanbul, Turkey 7 Gazi University, School of Medicine, Department of Pediatric Hematology, Ankara, Turkey 8 Gülhane Military Medical Academy, Department of Pediatric Hematology, Ankara, Turkey 9 Akdeniz University, School of Medicine, Department of Pediatric Hematology, Antalya, Turkey 10 Dr. Abdurahman Yurtarslan Oncology Training and Research Hospital, Department of Pediatric Hematology, Ankara, Turkey 11 Dokuz Eylül University, School of Medicine, Department of Pediatric Hematology, İzmir, Turkey 12 İnönü University, School of Medicine, Department of Pediatric Hematology, Malatya, Turkey 13 Istanbul University, İstanbul School of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey 1 2

Abstract Objective: To retrospectively evaluate the clinical findings, laboratory data, management, and outcome in a group of Turkish children diagnosed with rare coagulation deficiencies (RCDs) between January 1999 and June 2009.

Material and Methods: The Turkish Society of Pediatric Hematology-Hemophilia-Thrombosis-Hemostasis subcommittee designed a Microsoft Excel-based questionnaire for standardized data collection and sent it to participating institutions. Results: In total, 156 patients from 12 pediatric referral centers were included in the study. The cost common RCDs were as follows: FVII (n = 53 [34%]), FV (n = 24 [15.4%]), and FX (n = 23 [14.7%]) deficiency. The most common initial finding in the patients was epistaxis, followed by ecchymosis, and gingival bleeding.

Conclusion: Initial symptoms were mucosal bleeding, and fresh frozen plasma (FFP) and tranexamic acid were the most commonly used treatments. We think that prophylactic treatment used for hemophilia patients should be considered as an initial therapeutic option for patients with rare factor deficiencies and a severe clinical course, and for those with a factor deficiency that can lead to severe bleeding.

Key Words: Rare coagulation deficiencies, Clinical findings, Laboratory data

Address for Correspondence: Tunç Fışgın, M.D., Ondokuz Mayıs Üniversitesi, Tıp Fakültesi, Çocuk Hematoloji Bilim Dalı, 55139 Kurupelit, Samsun, Turkey Phone: +90 362 312 19 19/3658 E-mail: fisgint@yahoo.com Received/Geliş tarihi : August 20, 2010 Accepted/Kabul tarihi : January 12, 2011

Turk J Hematol 2012; 29: 48-54

Fışgın T, et al: Rare Factor Deficiency

Özet Amaç: Türkiye’de son 10 yılda nadir koagülasyon eksikliği olan çocukların klinik bulguları, laboratuvar değerleri ve tedavilerini geriye yönelik olarak değerlendirdik. Gereç ve Yöntemler: Türk Pediatrik Hematoloji Derneği, Tromboz-Hemostaz-Hemofili Alt Komitesi tarafından standardize edilmiş excel sorgulama dosyaları her merkeze gönderilerek yanıt veren merkezlerin verileri toplandı.

Bulgular: Oniki çocuk hematoloji merkezinden toplam 156 hasta bu çalışmaya alındı. Çalışmamızda en sık görülen nadir koagülasyon bozuklukları FVII (n: 53 olgu, %34), FV (n: 24 olgu, %15.4), FX (n: 23 olgu, %14.7) olarak dağılım gösterdi. Tüm nadir koagülasyon bozuklukları içinde en sık görülen başlangıç semptomları sırası ile burun kanaması, ekimoz ve diş eti kanamasıydı. Sonuç: Mukozal kanamalar ilk semptomları oluştururken, halen en sık kullanılan tedavi seçenekleri ise taze donmuş plazma ve treneksamik asitti. Ağır klinik semptomları olan ve şiddetli kanamaya neden olabilecek nadir koagülasyon bozukluklarının erken dönemlerinde de hemofili hastalarında kullandığımız proflaktik tedavinin düşünülmesi gerektiğini öneriyoruz. Anahtar Sözcükler: Nadir koagülasyon bozuklukları, Klinik ve laboratuvar veriler Introduction Rare coagulation deficiencies (RCDs) of childhood are commonly inherited in an autosomal recessive pattern, and include factor I (FI), FII, FV, FVII, FX, and FXIII deficiency [1,2]. RCDs, as the term implies, are rarely encountered. A prevalence as high as 1/20,000 was reported in populations with consanguineous marriage; however, the estimated prevalence of RCDs is 1/500,000-1/2,000,000 [1,2]. Although most RCD patients are asymptomatic, patients present with bruising, and mucosal and dermal bleeding, such as ecchymosis, epistaxis, gingival bleeding, and menorrhagia [1-5]. In addition, hemarthrosis, hematoma, and central nervous system bleeding may be seen [2,3]. The frequency and severity of bleeding in RCD patients vary, and are related to the type and level of factor deficiency. While intracerebral hemorrhagia may be mostly seen in FX and FXIII, afibrinogenemia, and FVII deficiency, musculoskeletal bleeding (hemarthrosis and hematoma) more frequently occurs in afibrinogenemia, and FX, FXI, and FXIII deficiency [2,6-8]. There are 2 treatment options for RCDs—on demand and prophylactic. On demand treatment is usually administered to RCD patients by hematologists because of the rare symptoms of bleeding, and generally includes fresh frozen plasma (FFP), epsilon-aminocaproic acid (EACA), tranexamic acid, cryoprecipitate, activated or non-activated prothrombin complex concentrates (aPCC and PCC, respectively), and recombinant factor VIIa [1-10]. Treatment strategies for RCDs are largely based on the severity and localization of bleeding. Interestingly, EACA or tranexamic acid treatment alone controlled the bleeding in almost 33% of patients with RCDs [1,2]. As such, the

present study aimed to retrospectively evaluate the clinical findings, laboratory data, management, and outcome in 156 Turkish children diagnosed with RCDs during a 10-year period. Material and Methods We retrospectively analyzed initial clinical and laboratory findings, management, and outcome data for 156 children with RCDs obtained from 12 pediatric referral centers in Turkey. The Turkish Society of Pediatric Hematology Hemophilia - Thrombosis - Hemostasis subcommittee designed a Microsoft Excel-based questionnaire for standardized data collection and sent it to the participating institutions. Ethics Committee approved the study. All children were diagnosed with an RCD between January 1999 and June 2009. RCDs were diagnosed based on bleeding history, and prolonged prothrombin time (PT) and/or activated partial thromboplastin time (APTT) and low coagulation factor level (FVII, FV, FX, FXIII, and FXI <40%, and FI <100 mg dL-1) [1-4]. Unfortunately, genetic diagnosis could have been performed in very limited patients. Patient age, medical history, clinical findings, laboratory data (factors levels), treatment, and prognosis were recorded. Demographic, laboratory, and clinical data were analyzed using descriptive statistics. Patients with the 3 most common RCDs were grouped, as follows, to compare their clinical and laboratory findings: group 1 (FVII deficiency), group 2 (FV deficiency), and group 3 (FX deficiency). Group results were compared using student’s t test and the Mann-Whitney U test. The level of statistical significance was set at P < 0.05. Statistical analysis was performed using SPSS v.13.0.

9(37,5) / 15(62,5)

24 (15,4)

23 (14.7)

16 5 (31,2) / 11 (10.3) (68,8)

15 (9.6)

13 (8.3)

FV deficiency

FX deficiency

FXIII deficiency

FI deficiency

FXI deficiency

72 3-180

1 0,03-144

12 0,1-204

9 0,1-180

30 0,1-120

72 0,1-180

11 (73,3) / 9 (60)

Echymosis, bleeding after trau., ICH

Hypermenorhea, 2 (15,3) / 5 (38,4) GB, echymosis

9 (56,2) / 5 (31,2)

6 (26) / 4 (17,3)

Epistaxis, echymosis, hematom GB, epistaxis, ICH

6 (25) / 6 (25)

13 (24.5) / 11 (20.8)

Parental consanguinity/ Positive history of family n, (%)

GB, echymosis, epistaxis

Epistaxis, GB, echymosis

Most common bleeding focus

4 (26)

FFP (78,6) Tranx (50) Cryopres (35.7) Tranx (23) aPCC (7)

4 (25)

4 (17,3)

4 (16,7)

7 (13,2)

Rate of ICH n, (%)

FFP (71,4) Trenx (35.7)

FFP (27.3) aPCC (13.6) FX (4.5)

FFP (54.2)

FFP (20.8) rFVII (15.1)

Common treatment choices (%)

1 (6,6)

2 (12,5)

4 (17,3)

2 (8,3)

1 (1,8)

Prophy laxis n, (%)

ICH and Traffic accident 2 (13)

ICH 1 (4,3)

ICH 2 (3,6)

Cause of excitus n, (%)

ICH;intracranial haemorrhagia, Tranx;Tranexamic acid, FFP; fresh frozen plasma, aPCC; activated prothrombin complex concantrates, rFVIIa; activated recombinant factor VII, Cryopres; Cryopresipitate, GB; Gingival Bleeding

8(61,5) / 5(38,5)

7(46,6) / 8(53,4)

10(43,4) / 13(56,6)

19(34,6) / 34(65,4)

Girl / Boy n, (%)

FVII 53 (34) deficiency

n=156

n (%)

Age of at diagnosis, median range (months)

Table 1: Detailed data of rare Coagulation Disorders

Fışgın T, et al: Rare Factor Deficiency Turk J Hematol 2012; 29: 48-54

Turk J Hematol 2012; 29: 48-54

Fışgın T, et al: Rare Factor Deficiency

Table 2: Comparison of the 3 Most Common RCDs (FVII, FV, and FX Deficiency)

Group 1 n = 53 FVII Deficiency

Group 2 n = 24 FV Deficiency

Group 3 n = 23 FX Deficiency

1-2 P

I-3 P

2-3 P

0.01**

0.003**

Ecchymosis (%)

20.8

33.3

0.01**

Hemarthrosis (%)

3.8

8.3

18.2

0.03**

Hematoma (%)

5.7

12.5

31.8

0.002**

Epistaxis (%)

33.3

0.04**

Subconjunctival bleeding (%)

1.9

13.6

0.039**

Family history (%)

21,2

26.1

22.7

Consanguinity (%)

26.1

27.3

On demand treatment with FFP (%)

20.8

54.2

27.3

0.003

Prophylaxis (%)

1.9

8.3

18.2

0.01**

Mortality (%)

3.8

6.7

Age at diagnosis (months)

*NS: not significant; **P < 0.05: statistically significant.

Results The distribution of RCDs was as follows: FVII deficiency (n = 53 [34%]), FV deficiency (n = 24 [15.4%]), FX deficiency (n = 23 [14.7%]), FXIII deficiency (n = 16 [10.3%]), FI deficiency (n = 15 [9.6%]), FXI deficiency (n = 13 [8.3%]), FXII deficiency (n = 6 [3.8%]), plasminogen deficiency (n = 3 [1.9%]), and combined FV-VII deficiency (n = 3 [1.9%]). Among all the patients, the most common initial finding was epistaxis, followed by ecchymosis, and gingival bleeding. FVII deficiency was the most common RCD (n = 53 [34%]). Median age at the time of diagnosis in the 53 patients (19 girls and 34 boys) with FVII deficiency was 72 months (range: 0.1-180 months). The most frequently observed bleeding symptoms were epistaxis, gingival bleeding, and ecchymosis, and the parental consanguinity and positive family history rates were 24.5% and 20.8%, respectively. Molecular diagnosis was performed in only 2 of the 156 patients. FFP and recombinant FVIIa (rFVIIa) were the most common treatment choices in the patients that received on demand treatment; only 1 patient received prophylactic treatment with recombinant FVIIa. The mortality rate was 3.8% (n = 2) and the cause of mortality was intracranial bleeding in both cases. Median age at the time of diagnosis was significantly higher in group 1 (72 months) than in group 2 (30

months) and group 3 (9 months). In all, 11 of the 53 patients in group 1 were treated with FFP. Recombinant FVIIa was administered to only 8 of 53 patients Despite the development of intracranial bleeding in 7 patients and Table 3: Distribution of Intracranial Bleeding

Deficient Factor

Intracranial Bleeding n (%)

Dead/Alive

FVII

7 (13%)

2/5

4 (26%)

2/4

4 (16%)

-/4

4 (17%)

1/3

FXIII

4 (25%)

-/4

FXII

1 (16%) -

-/1 -

FXI

All patients

5/19

Exitus rate in ICC

%20.8

Fışgın T, et al: Rare Factor Deficiency

2 patients died prophylaxis was started to only 1 patient after intracranial bleeding. Patient characteristics according to the type of RCD (FVII, FV, FX, FI, FXIII, and FXI deficiency) is shown in Table 1. Comparison of the 3 most common RCDs (FVII, FV, and FX deficiency; groups 1, 2, and 3, respectively) is shown in Table 2 and the distribution of intracranial bleeding according to the type of RCD is shown in Table 3. Discussion Clinical manifestations of RCDs vary from mild to severe, depending on the type of and level of factor deficiency, and underlying molecular defects [1,2]. Bleeding in patients with RCDs is generally a rare occurrence. Moreover, primarily hematologists follow-up and treat RCD patients, the management of whom is difficult due to limited experience and lack of clear treatment guidelines. Although historically only tranexamic acid and FFP were treatment options available to hematologists, currently, plasma-derived factor concentrates and recombinant factor concentrates are also available [1,2,6-12]. In countries in which consanguineous marriage is common, such as Iran, Turkey, and India, the frequency of recessively inherited coagulation deficiencies is high and the frequency of inherited deficiencies of fibrinogen, prothrombin, FV, FVII, FV+FVIII, FX, and FXIII is 3-7-fold higher in Iran than in Italy and the UK, as reported by Peyvandi et al. [13], who also reported that FXI deficiency was more frequent in the UK than expected, probably because of its population of Ashkenazi Jews. In the present study FXI deficiency was the least common RCD, as in Iran [13]. Consistent with the literature, the most common initial finding in the present study’s patients was epistaxis, followed by ecchymosis and gingival bleeding [1-4]; however, the high rate of intracranial bleeding in the patients with FI and FXIII deficiency (26% and 25%, respectively) and menorrhagia as the most frequent type of bleeding (38%) in the patients with FXI deficiency are quite remarkable findings. The diagnosis of FVII deficiency is often made during childhood, but symptoms of bleeding begin during the neonatal period in those with severe deficiency [9,11-14]. Mucosal bleeding detected most frequently in our series were in accordance with the pattern reported for FVII deficiency as epistaxis and gingival bleedings. Median age at the time of diagnosis was significantly higher in group 1 than in group 3, probably due to factor levels. 20.8% of patients in the present study were treated with FFP; rFVIIa was used in a limited number of patients (15,1%). Despite

Turk J Hematol 2012; 29: 48-54

the development of intracranial bleeding and death in seven patients, prophylaxis was initiated in only 1 patient. rFVIIa is recommended for the treatment of FVII deficiency, as the half-life of this factor is very short. Frequent use of FFP may create fluid overload; in an effort to avoid this, FFP may be administered less frequently than needed to provide adequate bleeding control. Although rFVIIa has been available in Turkey since 2003 the present results show that most of the hematologists at the institutions that participated in the study did not use this treatment option, which could have been due to its high cost. This result and very limited implementation of prophylaxis are the issues that should be thought on it. Most patients with FV deficiency present with epistaxis and mucosal bleeding, usually diagnosed before the age of 6 years; however, patients as old as 62 years with intracranial bleeding have been reported [10,15,16]. In the present study’s patients with FV deficiency mean age at the time of diagnosis was 3.5 years, and gingival and nose bleeding were the most common types of bleeding. As no recombinant or FV concentrate products are commercially unavailable, FFP or antifibrinolytic treatment was used in 50% of the present study’s patients, as previously reported [2]. Menagatti et al. reported the most frequent symptom of bleeding in patients with FX deficiency is epistaxis [17], and Peyvandi et al. reported that central nervous system bleeding, hematoma, and hemarthrosis are common [2]. It is known that more serious symptoms of bleeding occur in patients with FX deficiency than in those with other rare factor deficiencies [2,5]. In the present study the most frequently encountered symptom of bleeding was epistaxis, followed by ecchymosis, and hemarthrosis. Mean age of the patients at the time of diagnosis was significantly lower in those with FVII deficiency than in the other patients. In accordance with the literature, intramuscular bleeding and hemarthrosis occurred more frequently in the patients with FX deficiency, as compared to those with other factor deficiencies, and significantly more frequent hematoma and hemarthrosis rates compared to FVII deficient group. We observed a significantly higher rate of subconjunctival bleeding, which is a rarely observed form of bleeding, in the patients with FX deficiency than in those with FVII deficiency. In addition, the rate of prophylactic treatment was significantly higher in the patients with FX deficiency than in those with FVII deficiency. High rate of prophylaxis in FX deficiency, diagnosed at young ages with serious bleeding symptoms, is a satisfactory and acceptable approach. Anemia occurs in 19%-49% and erythrocyte transfusion is required by 10%-20% of patients with rare factor

Turk J Hematol 2012; 29: 48-54

deficiencies [1]. We did not make an inquiry for these parameters in our series. Despite the reports on post-circumcision bleeding in some series as the most frequent diagnostic finding in rare factor deficiencies it was not within the first three bleeding symptoms of our three groups (FVII, FV, FX deficiencies) [1]. Acharya et al. reported a central nervous system bleeding-related morbidity rate of 9%-22% in patients with RCDs [1]. In the present study 15% (24/156) of the patients had intracranial bleeding. Whereas intracranial bleeding was not observed in any of the patients with FXII deficiency, 26% (the highest rate) of those with FI deficiency had intracranial bleeding; despite this fact, FI concentrate was administered to only 3 patients while FFP (78%) and tranexamic acid were used more frequently as treatment options. The mortality rate due to intracranial bleeding in the present study was 3% (5/156)—2 of the patients that died had FVII deficiency, 2 had fibrinogen deficiency, and 1 had FX deficiency. Ten of the 19 patients that survived intracranial bleeding were using prophylaxis. Despite the intracranial bleeding, lack of prophylactic treatment including FFP in nearly half of the patients (9/19) makes us think that it is necessary to review our treatment options in these patients. While bleeding is expected in patients with rare factor deficiencies, the development of thrombus is rarely observed [18]. In the present study 1 patient with FXIII deficiency was hospitalized with the presumptive diagnosis of intracranial bleeding, but was eventually diagnosed as sinovenous thrombosis. The patient was heterozygous for factor V Leiden mutation and was treated successfully with low molecular weight heparin [18]. Patients with both FV and FVIII deficiency are generally diagnosed with mild or moderate mucosal bleeding [2,19]. Additionally, patients diagnosed with post circumcision bleeding or menorrhagia have been reported [21,22]. Mucosal bleedings were predominant in our 3 cases with FV-FVIII combined deficiency. A frequent finding in patients with plasminogen deficiency is conjunctivitis, which can involve the cornea [22,23]. A pseudomembrane may develop on the gums, ears, and the respiratory tract, in addition to the eyes, and hydrocephalus may accompany the clinical picture [22,23]. In accordance, the presenting complaint in 2 of the present study’s patients was ligneous conjunctivitis, and their ophthalmologic findings recurred and persisted despite intermittent surgical treatment. In conclusion, in the majority of patients with rare factor deficiencies the initial symptom was mucosal bleeding,

Fışgın T, et al: Rare Factor Deficiency

and FFP and tranexamic acid were the most commonly used therapeutic options. Difficulty diagnosing these rare factor deficiencies, especially at the molecular level, is a major problem in Turkey. Genetic diagnosis was made in only 2 of the present study’s patients (both treated at the same center) via correspondence with a center abroad. Thus, diagnosis of all the other patients was based on medical history, symptoms, and coagulation testing; therefore, nationally defining and determining the centers that could perform diagnosis of genetic studies on this issue and providing these centers with financial support seem to be the most probable resolution of this problem. Lack of specific treatment guidelines that are agreed upon by the centers is another problem. We observed that episodic treatment was initiated according to the presence of symptoms, whereas prophylaxis was used on a very limited basis even though specific recombinant products for treating the deficiencies were commercially available. We think that the prophylactic treatment we use for hemophilia patients should be considered as an initial therapeutic option for patients with rare factor deficiencies and a severe clinical course, and in those with factor deficiencies that can lead to severe bleeding. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Acharya SS, Coughlin A, Dimichele DM; North American Rare Bleeding Disorder Study Group: Rare Bleeding Disorder Registry: Deficiencies of factors II, V, VII, X, XIII, fibrinogen and dysfibrinogenemias. J Thromb Haemost 2004; 2: 248-256 2. Peyvandi F, Palla R, Menegatti M, Mannucci PM: Introduction. Rare bleeding disorders: General aspects of clinical features, diagnosis, and management. Semin Thromb Hemost 2009; 35: 349-355 3. Peyvandi F, Mannucci PM: Rare coagulation disorders. Thromb Haemost 1999; 82: 1207-1214 4. Bolton-Maggs PH, Perry DJ, Chalmers EA, Parapia LA, Wilde JT, Williams MD, Collins PW, Kitchen S, Dolan G, Mumford AD: The rare coagulation disorders-review with guidelines for management from the United Kingdom Haemophilia Centre Doctors Organisation. Haemophilia 2004; 10: 593-628

Fışgın T, et al: Rare Factor Deficiency

5. Şalcıoğlu Z, Sayılan Şen H, Aydoğan G, Akıcı F, Akçay A, Tuğcu D, Başlar Z: Rare factor deficiency; experience of 18 years. Journal of Turkish Pediatric Hematology 2008; 2: 33-38 6. Brown DL, Kouides PA: Diagnosis and treatment of inherited factor X deficiency. Haemophilia 2008; 14: 1176-1182 7. Hsieh L, Nugent D: Factor XIII deficiency. Haemophilia 2008; 14: 1190-1200 8. Acharya SS, Dimichele DM: Rare inherited disorders of fibrinogen. Haemophilia 2008; 14: 1151-1158 9. Herrmann FH, Wulff K, Auerswald G, Schulman S, Astermark J, Batorova A, Kreuz W, Pollmann H, Ruiz-Saez A, De Bosch N, Salazar-Sanchez L; Greifswald Factor FVII Deficiency Study Group: Factor VII deficiency: Clinical manifestation of 717 subjects from Europe and Latin America with mutations in the factor 7 gene. Haemophilia 2009; 15: 267-280 10. Huang JN, Koerper MA: Factor V deficiency: A concise review. Haemophilia 2008; 14: 1164-1169 11. Lapecorella M, Mariani G; International Registry on Congenital Factor VII Deficiency: Factor VII deficiency: Defining the clinical picture and optimizing therapeutic options. Haemophilia 2008; 14: 1170-1175 12. Castaman G: Propylaxis of bleeding episodes and surgical interventions in patients with rare inherited coagulation disorders. Blood Transfus 2008; 6: 39-44 13. Peyvandi F, Duga S, Akhavan S, Mannucci M: Rare coagulation deficiencies. Haemophilia 2002; 8: 308-321

Turk J Hematol 2012; 29: 48-54

14. Mariani G, Bernardi F: Factor VII Deficiency. Semin Thromb Hemost 2009; 35: 400-406 15. Yoneoka Y, Ozawa T, Saitoh A, Arai H: Emergency evacuation of expanding intracerebral haemorrhage in parahaemophilia (coagulation factor V deficiency). Acta Neurochir 1999; 141: 667-668 16. Totan M, Albayrak D: Intracranial haemorrhage due to factor V deficiency. Acta Paediatr 1999; 88: 342-343 17. Menegatti M, Peyvandi F: Factor X deficiency. Semin Thromb Hemost 2009; 35: 407-15 18. Akbalik M, Duru F, Fisgin T, Tasdemir HA, Incesu L, Albayrak D, Ozyurek E: Cerebral thrombosis associated with heterozygous factor V Leiden mutation and high lipoprotein(a) level in a girl with factor XIII deficiency. Blood Coagul Fibrinolysis 2007; 18: 371-374 19. Spreafico M, Peyvandi F: Combined FV and FVIII deficiency. Haemophilia 2008;14: 1201-1208 20. Mansouritorgabeh H, Rezaieyazdi Z, Pourfathollah AA, Rezai J, Esamaili H: Haemorrhagic symptoms in patients with combined factors V and VIII deficiency in northeastern Iran. Haemophilia 2004; 10: 271-275 21. Peyvandi F, Tuddenham EG, Akhtari AM, Lak M, Mannucci PM: Bleeding symptoms in 27 Iranian patients with the combined deficiency of factor V and factor VIII. Br J Haematol 1998; 100: 773-776 22. Mehta R, Shapiro AD: Plasminogen deficiency. Haemophilia 2008; 14: 1261-1268 23. Schuster V, Seregard S: Ligneous conjunctivitis. Surv Ophthalmol 2003; 48: 369-388

Research Article

DOI: 10.5152/tjh.2011.40

The Effects of Endothelial Protein C Receptor Gene Polymorphisms on the Plasma sEPCR Level in Venous Thrombosis Patients Endotelyal Protein C Reseptör Geni Polimorfizmlerinin Venöz Trombozlu Olgularda sEPCR Üzerindeki Etkisi Afife Karabıyık1, Erkan Yılmaz2, Yonca Eğin2, Nejat Akar2 1 2

Ankara University, Biotechnology Institute, Ankara, Turkey Ankara University, Department of Pediatric Molecular Genetics, Ankara, Turkey

Abstract Objective: The aim of this study was to investigate variations in the endothelial cell protein C receptor gene (EPCR gene) that may play a role in thrombosis and the effects of these variations on the plasma soluble endothelial cell protein C receptor (sEPCR) level in Turkish patients with venous thrombosis.

Material and Methods: This study included 111 thrombosis patients and 73 healthy controls. Following DNA extraction, PCR, SSCP, and DNA sequencing analysis of 4 exons of the EPCR gene was performed. Plasma sEPCR was measured via enzyme-linked immunosorbent assay (ELISA).

Results: In all, 3 polymorphisms were detected in exons 1-4. C3998T (SNP no: rs2069952) polymorphism was detected in intron 2 and C4678G (A1 haplotype) (SNP no: rs9574) in the 3’ untranslated region (3’UTR). There weren’t any significant differences in C3998T polymorphism between the control and patient groups. There wasn’t a significant difference in plasma sEPCR levels between both controls and patients that carried the A1 allele. A4600G substitution (A3 haplotype) (SNP no: rs867186) was observed in exon 4 and was associated with a 2.04-fold higher risk of thrombosis. A3 allele carriers had higher sEPCR levels than those without the allele. Mean sEPCR level in the patients with the homozygous A3 allele was 289 ng µL–1, versus 113.42 ng µL–1 in those with the homozygous A1 allele. Conclusion: The A1 haplotype might offer protection against thrombosis and the A3 haplotype might be associated both with elevated plasma sEPCR and elevated risk of venous thrombosis in the Turkish population. Plasma sEPCR levels were significantly higher in those that carried the A3 allele (4600A>G) (both patients and controls). Among the participants that carried the A1 allele (4678C>G), plasma sEPCR did not differ significantly.

Key Words: Thrombosis, Endothelial protein C receptor (EPCR), Soluble EPCR (sEPCR), EPCR haplotypes

Özet Amaç: Bu çalışmada, trombozda önemli bir role sahip olan EPCR genindeki varyasyonların tespit edilmesi ve bu varyasyonların Türk populasyonunda plazma sEPCR seviyeleri üzerindeki olası etkisinin incelemesi amaçlanmıştır. Gereç ve Yöntemler: Çalışmamız 111 trombozlu olgu ve 73 sağlıklı kontrol içermektedir. EPCR geninin dört ekzonu Address for Correspondence: Afife Karabıyık, M.D., Ankara Üniversitesi, Tıp Fakültesi, Pediatrik Moleküler Genetik Laboratuvarı, 06190 Cebeci, Ankara, Turkey Phone: +90 312 595 63 48/115 E-mail: afifekrbyk@gmail.com Received/Geliş tarihi : July 28, 2009 Accepted/Kabul tarihi : March 30, 2010

Karabıyık A, et al: The Effects of EPCR Polymorphisms on Thrombosis

Turk J Hematol 2012; 29: 55-62

intronlardan başlanan primerler kullanılarak PCR, SSCP ve DNA Dizi Analizi ile taranmıştır. Plazma sEPCR düzeyleri ELISA yöntemi kullanılarak ölçülmüştür.

Bulgular: Bu çalışmada, EPCR haplotipleri ile sEPCR seviyesi arasındaki ilişki incelenmiş ve EPCR geninin taranan dört ekzonunda üç farklı polimorfizm saptanmıştır. Bunlardan C3998T (rs2069952) genin 2. intronunda, A1 haplotipini oluşturan C4678G (rs9574) ise EPCR geninin 3’ UTR bölgesinde tespit edilmiştir. EPCR geninde tespit edilen diğer bir polimorfizm ise A3 haplotipini oluşturan ve ekzon 4’de yer alan A4600G (rs867186) değişimidir. A3 allelini homozigot olarak taşıyan hastalarda ortalama sEPCR seviyesi 289 ng/µl iken, A1 allelini homozigot olarak taşıyanlarda 113,42 ng/µl’dır.

Sonuç: İstatistik analizler kontrol ve hastalar arasında C3998T değişiminin tromboz riski açısından anlamlı olmadığını göstermiştir. A1 haplotipinin ise trombozdan koruyucu bir etkiye sahip olabileceği saptanmış ancak A1 (4678C>G) allelini taşıyan bireylerde sEPCR seviyesinde de anlamlı bir değişiklik saptanamamıştır. Buna karşılık A3 haplotipinin tromboz için 2.04 kat risk getirdiği ve A3 (4600A>G) alleli taşıyanların taşımayanlara göre daha yüksek sEPCR seviyesine sahip olduğu saptanmıştır. A3 haplotipi Türk populasyonunda hem trombotik riskle hem de artan sEPCR seviyesiyle ilişkilendirilebilir. Anahtar Sözcükler: Tromboz, Endotelyal protein C reseptörü (EPCR), Solubl EPCR (sEPCR), EPCR haplotipleri Introduction The protein C (PC) anticoagulant pathway is physiologically important to the regulation of coagulation. While the PC pathway plays a crucial role in controlling thrombosis, it also has anti-inflammatory functions [1-3]. The essential components of this pathway include thrombin, thrombomodulin (TM), endothelial cell PC receptor (EPCR), PC, protein S, and protease-activated receptor 1 (PAR-1).

ing the catalytic efficiency of the thrombin-TM complex [4-6]. Although EPCR is an endothelial cell-specific type I transmembrane protein, a soluble form of this receptor circulates in plasma [7-9]. EPCR is similar to molecules of the class I major histocompatibility complex, in particular the CD1-subfamily [10]. In addition to the extracellular domains, EPCR has a transmembrane domain and a very short cytoplasmic tail.

The PC pathway is a natural anticoagulation mechanism that prevents excessive thrombin generation. When Thrombin binds to TM, PC is activated about 1000 times faster than free thrombin [1]. The thrombin-TM complex activates PC. Activated PC (APC) requires protein S as a cofactor. APC limits amplification and progression of the coagulation cascade via proteolytic inactivation of factor Va (FVa) and factor FVIIIa [2]. PC activation increases approximately 20-fold in vivo when it is bound to EPCR [3].

Primary defects of the PC pathway increase the risk of venous thrombosis [10]. A metalloprotease cleaves the entire extracellular domain of EPCR from the cell membrane [11]. This cleavage results in the formation of soluble EPCR (sEPCR). sEPCR can bind both to PC and APC with an affinity similar to that of intact membrane-bound EPCR. sEPCR inhibits PC activation by competing with the membrane form of EPCR on vessel walls [9]. sEPCR also inhibits inactivation of factor Va and APC anticoagulant activity by blocking the interaction of APC and negatively charged membrane surfaces [12].

EPCR binds to PC and also APC with high affinity and promotes PC activation on endothelium by increas-

Plasma sEPCR is elevated in patients with systemic inflammatory diseases [13]. sEPCR binding to APC blocks

Figure 1: SSCP shows band pattern variation in exon 3 and the first region of exon 4.

Turk J Hematol 2012; 29: 55-62

phospholipid interaction and alters the active site of APC. Inherited defects of the PC pathway are associated with an increased tendency for venous thromboembolism (VTE) [14], whereas low plasma sEPCR (sEPCR<30 ng/ ml) appears to reduce the risk of thrombosis [15]. High plasma sEPCR (sEPCR>130 ng/ml) leads to dysfunction of EPCR-mediated coagulation [16]. The human EPCR gene is located on chromosome 20q11.2 and is composed of 4 exons and 3 introns. Exon 1 encodes the 5’ untranslated region (UTR) and the signal peptide, exons 2 and 3 encode most of the extracellular region of EPCR, and exon 4 encodes an additional 10 residues of the extracellular region of EPCR, the transmembrane domain, the cytoplasmic tail, and the 3’ UTR [15,17]. In adults, EPCR is primarily located on the endothelial cells of large blood vessels, and exists in very low numbers or is absent from the microvascular endothelium of most tissues [18]. To date, more than 92 polymorphisms and 5 diseaserelated mutations have been observed on the human

Figure 2: Restriction endonuclease analysis of C4678G polymorphism.

Karabıyık A, et al: The Effects of EPCR Polymorphisms on Thrombosis

EPCR gene [5,19,20]. Among these polymorphisms and disease-related mutations a 23-bp duplication located between intron 2 and exon 3 (g.4189_4213dup TATCCACAGTTCCTCTGACCATC according to NT_011362.10) was reported to be associated with the risk of arterial and venous thrombosis [21, 22]. A non-synonymous single nucleotide polymorphism (SNP) in exon 4, rs867186 (p.ser219gly; A4600G) (referred to as haplotype 3), is associated with elevated plasma sEPCR and causes thrombosis [23]. On the other hand, another polymorphism in the 3’ UTR of the gene, rs9574 (C4678G) (referred to as haplotype A1), does not contribute to the risk of thrombosis [19,23-25]. This allele was also reported to be associated with a reduced risk of venous thrombosis [26]. As such, the present study aimed to investigate the effect of EPCR gene polymorphisms on the plasma sEPCR level in patients with venous thrombosis and healthy controls. Material and Methods The study included 111 patients and 73 controls. The patient group included 64 females (57.6%) and 47 males (42.4%), and the control group included 48 females (65.7%) and 25 males (n34.3%). Mean age in the control group was 28.5 years, versus 26.01 years in the patient group. None of the control group participants had a personal and a family history of venous thrombosis. All participants presented to Ankara University, School of Medicine, Department of Pediatric Molecular Genetics. All the participants provided written informed consent and the study was approved by the Ankara University School of Medicine Ethics Committee. Plasma sEPCR was measured via enzyme-linked immunosorbent assay (ELISA) (Diagnostica Stago Asserachrom, Asnieres, France) [27]. DNA was isolated via proteinase K and phenol/chloroform extraction. All exons of the EPCR

Figure 3: Sequencing results for C3998T(A), C4678G(B), and A4600G(C).

Karabıyık A, et al: The Effects of EPCR Polymorphisms on Thrombosis

Turk J Hematol 2012; 29: 55-62

gene were screened using polymerase chain reaction (PCR) and the following primers that were designed in our laboratory; 5’gccccctagtaggaaatga3’ and 5’gagatgtgcccccgactc3’ for exon 1 (293 bp), 5’caggcctccaaagacttcat3’ and 5’cctactcacaggccaaggtc3’ for exon 2 (264 bp), 5’gcaccctctctgcacagtc3’ and 5’ccatccatttgtctggaacc3’ for exon 3 (384 bp), 5’ taaacgggtccctttcctct3’ and 5’ctcccctccctcaaatcttc3’ for the 1st region of exon 4 (384 bp), 5’caccagaaggtttggagtgac3’ and 5’acgcctcaggtgattctgtc3’ for the 2nd region of exon 4 (247 bp), and 5’ccatcctccaaagacagacag’ and 5’ccagaaattttgcaaagtgga3’ for the 3rd region of exon 4 (278 bp). Single strand conformation polymorphism (SSCP) was performed to determine if there was band pattern variation among the participants. SSCP was performed in 143 of the participants to detect the polymorphisms. Sequencing of the EPCR gene was performed when SSCP yielded a different band pattern (Beckman Coulter CEQ 8000, Beckman Coulter, USA). Direct sequencing of exon 4 was performed to detect A4600G mutation, whereas sequencing and RE analysis were used to detect C4678G mutation. All the participants were genotyped using 4678G to C substitution, which creates a Ddel restriction site (5’C/TNAG 3’). The samples were incubated using Ddel restriction enzyme (Fermentas UAB, Vilnius, Lithuania) at 37 °C for 16 h, and then the digestion products were electrophoresed on 3% agarose gel (Sigma, USA).

Statistical analysis was performed using TADPOLE v.2.01 for Windows. The level of statistical significance was set at P <0.05. The odds ratio (OR) and 95% confidence interval (CI) were calculated based on the logistic model. Allele frequencies were calculated via gene counting. In all these analyses the group with homozygous normal (4678 CC) served as the reference category to which risk was expressed. Results SSCP band pattern variation was noted in exons 3 and the first region of exon 4 (Figure 1). Three SNPs in exons 3 and 4 that have been previously described; (C3998T) rs2069952 [31-33], located in intron 2; (C4678G;A1 haplotype) rs9574 [31-33], located in 3’UTR and (A4600G; p.ser219gly A3 haplotype) rs867186 [31-33] located in exon 4; were observed in our control and patient groups. Restriction endonuclease analysis of C4678G polymorphism is shown in Figure 2, and sequencing results for C3998T, C4678G, and A4600G are shown in Figure 3. SSCP, on the other hand, showed that there wasn’t any band pattern variation in exon 2, or the 2nd and 3rd regions of exon 4. In the present study plasma sEPCR levels of 38-132 ng µL–1 were considered normal. sEPCR levels were significantly higher in participants (patients and controls) carrying the A3 allele. Among the participants that carried the A1 allele, plasma sEPCR did not differ sig-

Table 1: Mean Plasma sEPCR Level in the Participants with the A3 Allele (SNP no: rs867186) and A1 Allele (SNP no: rs9574) [31,32,33]

A3 Haplotype

A1 Haplotype

Controls

Patients

95% CI

4600AA

60.17 ± 28.9 ng µL–1 (n = 55)

76.62 ± 54.6 ng µL–1 (n = 75)

4600AG

160.17 ± 60.3 ng µL–1 (n = 23)

191.3 ± 76.5 ng µL–1 (n = 33)

0.93

0.63-1.39

4600GG

180ng µL–1 (n = 1)

289 ± 69.2 ng µL–1 (n = 3)

1.26

0.85-1.85

4678CC

51.72 ± 35.1 ng µL–1 (n = 15)

73.53 ± 41.1 ng µL–1 (n = 13)

4678CG

95.9487 ± 69.6 ng µL–1 (n = 39)

217.29 ± 88.9 ng µL–1 (n = 79)

1.59

1.03-2.44

4678GG

90.71 ± 57.1 ng µL–1 (n = 25)

113.42 ± 19.8 ng µL–1 (n = 19)

0.87

0.56-1.37

0.099

0.041

Turk J Hematol 2012; 29: 55-62

Karabıyık A, et al: The Effects of EPCR Polymorphisms on Thrombosis

Table 2: Distribution of C3998T Polymorphism at Intron 2 of the EPCR gene

C3998T

Controls (%)

Patients (%)

95% CI

10 (21.3%)

32 (31.7%)

19 (40.4%)

37 (36.6%)

0.6

0.24-1.49

18 (38.3%)

32 (31.7%)

0.5

0.22-1.38

39 (41.5%)

165 (62%)

55 (58.5%)

101 (38%)

0.43

0.26- 0.70

0.58 0.0009

Table 3: Distribution of C4678G Polymorphism (A1 Haplotype) at 3’UTR of the EPCR gene

C4678G

Control

Patients

95% CI

13 (17.8%)

13 (11.7%)

37 (50.6%)

79 (71.2%)

2.13

0.90-5.05

23 (31.6%)

19 (17.1%)

0.82

0.31-2.20

63 (43.1%)

105 (47.2%)

83 (56.9%)

117 (52.8%)

0.84

0.55-1.28

0.018 0.55

Table 4: Distribution of A4600G Polymorphism (A3 Haplotype) at Exon 4 of the EPCR gene

A4600G

Control

Patients

95% CI

51(69.8%)

75 (67.6%)

21(28.8%)

33 (29.7%)

1.06

0.55-2.05

1 (1.4%)

3 (2.7%)

2.04

0.20-20.15

123(84%)

183 (82.4%)

23 (16%)

39 (17.6%)

1.13

0.64-2

nificantly (Table 1). There wasn’t a significant difference between controls and patients in the genotype frequency of C3998T substitution (P = 0.58, OR = 0.5, CI = 0.221.38), indicating that the T allele was not associated with the risk of venous thrombosis (P = 0.0009, OR = 0.43, CI = 0.26-0.70). C4678G substitution was not a risk for venous thrombosis (P = 0.018, OR = 0.82, CI = 0.31-2.20); it might actually have offered protection against thrombosis. The 4600G allele was associated with a 2.04-fold increase in the risk of venous thrombosis for patient group, as compared to the control group, although the difference wasn’t statistically significant (P = 0.81, OR = 2.04, CI = 0.2020.15) (Tables 2-4). The A3 haplotype was associated with both elevated plasma sEPCR and increased risk of venous thrombosis.

0.81 0.65

Discussion Numerous variations in the EPCR gene have been reported. Any defect in the EPCR gene that leads to a reduction in receptor expression or impaired receptor function may stimulate the development of thrombosis. A 23-bp duplication of nucleotides between 4189 and 4213 at the genomic level, according to NT_011362.10 (a number of previous publications has referred this as position 4031) [28], results in an early stop codon and synthesis of a truncated protein that is not expressed on endothelial surfaces [21]. This duplication is associated with an increase in the risk of arterial and venous thrombosis [21,22]. A polymorphism in exon 4 (A3 haplotype) encodes ser-

Karabıyık A, et al: The Effects of EPCR Polymorphisms on Thrombosis

ine instead of glycine at codon position 219 (NM006404.3); this occurs in the transmembrane region of EPCR [24]. This haplotype is reported to be responsible for 86.5% of the variation in plasma sEPCR levels [15]. Several studies have examined the correlation between p.S219G polymorphism and the risk of thrombosis. Saposnik et al. reported that the incidence of p.S219G polymorphism in patients with venous thrombosis is higher than that in healthy controls [23]. Ireland et al. observed that p.S219G homozygosity was associated with a 3-fold increase in the risk of coronary heart disease [29]; however, 2 other studies did not observe a similar correlation between p.S219G polymorphism and increased risk of venous thrombosis [15,25]. In the present study another polymorphism was identified—rs9574 (haplotype A1, C4678G)—that has been reported to be associated with high levels of circulating APC and a reduction in the risk of deep venous thrombosis (DVT) [15,26]. Saposnik et al. reported that the C4678G polymorphism had no effect on the plasma sEPCR level [23]. Furthermore, Saposnik et al. studied EPCR mRNA forms in eukaryote cells and compared their expression patterns based on cell genotype. They reported that there was a statistically significant higher quantity of mRNA that encoded a protein lacking the transmembrane domain in cells carrying A3 than in non-A3 carrying cells. They also reported that this EPCR protein was indeed synthesized and secreted, and that sEPCR was generated via ADAM17 cleavage [24]. Navarro et al. reported that mean age at initial onset of thrombosis was higher in non-carriers of the rs867186 (A4600G) allele (44 ± 14 years) than in carriers (35 ± 8 years), and that the probability of not having thrombosis at age 40 years was lower in prothrombin 20210A carriers with the EPCR A4600G allele. They also reported that the presence of the A4600G allele, plasma sEPCR >147 ng mL–1, and prothrombin >129% all were associated with an increase in the risk of thrombosis. The risk of venous thromboembolism is influenced by the prothrombin level and the EPCR A3 haplotype, due to their effect on sEPCR levels [30]. Smoking, body mass index, ABO blood groups, levels of FII, FV, FVII, FIX, FX, FXI, FXII, and FXIII A and B subunits, fibrinogen, protein S, and antithrombin do not have any effect on the plasma sEPCR level [15]. The results of the present study confirm that there is a strong correlation between the A3 haplotype and elevated plasma sEPCR, as previously reported [15,23,29]. This allele also increased the risk of venous thrombosis 2-fold; however, there was a statistically significant difference between the patient and control groups, which

Turk J Hematol 2012; 29: 55-62

might have been due to the small number of participants. The role of 3’UTR in RNA stability is known; as such, EPCR 3’UTR C4678G polymorphism (rs9574) might have an important thrombotic effect , but this hypothesis must be proven by large-scale studies. Moreover, C3998T polymorphism did not have a strong correlation with venous thrombosis in the present study. The present study’s findings are in agreement with those previous published concerning sEPCR and EPCR gene haplotypes; however, additional research is needed in order to clarify the effects of EPCR gene mutations on venous thrombosis and inflammation. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. Acknowledgment This study was supported by the Turkish Society of Hematology. References 1. Esmon CT: Inflammation and the activated protein C anticoagulant pathway. Semin Thromb Hemost 2006; 32 (Suppl 1): 49-60 2. Dahlback B: Blood coagulation. Lancet 2000; 355: 1627-1632 3. Taylor FB Jr, Peer GT, Lockhart MS, Ferrell G, Esmon CT: Endothelial cell protein C receptor plays an important role in protein C activation in vivo. Blood 2001; 97: 1685-1688 4. Fukudome K, Esmon CT: Identification, cloning and regulation of a novel endothelial cell protein C/activated protein C receptor. J Biol Chem 1994; 269: 26486-26491 5. Esmon CT: The endothelial cell protein C receptor. Thromb Haemost 2000; 83: 639-643 6. Stearns-Kurosawa DJ, Kurosawa S, Mollica JS, Ferrell GL, Esmon CT: The endothelial cell protein C receptor augments protein C activation by the thrombin-thrombomodulin complex. Proc Natl Acad Sci USA 1996; 93: 10212-10216 7. Zecchina G, Bosio S, Brusa E, Rege-Cambrin G, Camaschella C: EPCR 23 bp insertion in a patient with severe progressive arterial disease: A dominant loss of function mutant in conditions of increased APC request? Br J Haematol 2002; 119 (3): 881-882 8. Esmon CT, Ding W, Yasuhiro K, Gu JM, Ferrell G, Regan LM, Stearns-Kurosawa DJ, Kurosawa S, Mather T, Laszik Z, Esmon NL: The protein C pathway: New insights. Thromb Haemost 1997; 78 (1): 70-74

Turk J Hematol 2012; 29: 55-62

9. Kurosawa S, Stearns-Kurosawa DJ, Hidari N, Esmon CT: Identification of functional endothelial protein C receptor in human plasma. J Clin Invest 1997; 100: 411-418 10. Griffin JH, Evatt B, Wideman C, Fernández JA: Anticoagulant protein C pathway defective in majority of thrombophilic patients. Blood 1993; 82: 1989-1993 11. Xu J, Qu D, Esmon NL, Esmon CT: Metalloproteolytic release of endothelial cell protein C receptor. J Biol Chem 1999; 275: 6038-6044 12. Liaw PC, Neuenschwander PF, Smirnov MD, Esmon CT: Mechanisms by which soluble endothelial cell protein C receptor modulates protein C and activated protein C function. J Biol Chem 2000; 275: 5447-5452 13. Kurosawa S, Stearns-Kurosawa DJ, Carson CW, D’Angelo A, Della Valle P, Esmon CT: Plasma levels of endothelial cell protein C receptor are elevated in patients with sepsis and systemic lupus erythematosus: Lack of correlation with thrombomodulin suggests involvement of different pathological processes. Blood 1998; 91: 725-727 14. Dahlback B: The protein C anticoagulant system: Inherited defects as basis for venous thrombosis. Thromb Res 1995; 77: 1-43 15. Uitte de Willige S, Van Marion V, Rosendaal FR, Vos HL, de Visser MC, Bertina RM: Haplotypes of the EPCR gene, plasma sEPCR levels and the risk of deep venous thrombosis. J Thromb Haemost 2004; 2: 1305-1310 16. Ulu A, Gunal D, Tiras S, Egin Y, Deda G, Akar N: EPCR gene A3 haplotype and elevated soluble endothelial protein C receptor (sEPCR) levels in Turkish pediatric stroke patients. Thromb Res 2007; 120 (1): 47-52 17. Simmonds RE, Lane DA: Structural and functional implications of the intron/exon organization of the human endothelial cell protein C/activated protein C receptor (EPCR) gene: Comparisons with the structure of CD1/ major histocompatibility complex alpha1 and alpha2 domains. Blood 1999; 94: 632-641 18. Laszik Z, Mitro A, Taylor FB Jr, Ferrell G, Esmon CT: Human protein C receptor is present primarily on endothelium of large blood vessels: Implications for the control of the protein C pathway. Circulation 1997; 96: 3633-3640 19. Medina P, Navarro S, Estellés A, Vayá A, Bertina RM, España F: Influence of the A4600G and C4678G polymorphisms in the endothelial protein C receptor (EPCR) gene on the risk of venous thromboembolism in carriers of factor V Leiden. Thromb Haemost 2005; 94 (2): 389-394 20. Franchi F, Biguzzi E, Cetin I, Facchetti F, Radaelli T, Bozzo M, Pardi G, Faioni EM: Mutations in the thrombomodulin and endothelial protein C receptor genes in women with late fetal loss. Br J Haematol 2001; 114 (3): 641-646

Karabıyık A, et al: The Effects of EPCR Polymorphisms on Thrombosis

21. Akar N, Gökdemir R, Ozel D, Akar E: Endothelial cell protein C receptor (EPCR) gene exon III, 23 bp insertion mutation in the Turkish pediatric thrombotic patients. Thromb Haemost 2002; 88 (6): 1068-1069 22. Zecchina G, Bosio S, Brusa E, Rege-Cambrin G, Camaschella C: EPCR 23 bp insertion in a patient with severe progressive arterial disease: A dominant loss of function mutant in conditions of increased APC request? Br J Haematol 2002; 119 (3): 881-882 23. Saposnik B, Reny JL, Gaussem P, Emmerich J, Aiach M, Gandrille S: A haplotype of the EPCR gene is associated with increased plasma levels of sEPCR and is a candidate risk factor for thrombosis. Blood 2003; 103: 1311-1318 24. Saposnik B, Lesteven E, Lokajczyk A, Esmon CT, Aiach M, Gandrille S: Alternative mRNA is favored by the A3 haplotype of the EPCR gene PROCR and generates a novel soluble form of EPCR in plasma. Blood 2008; 111 (7): 3442-3451 25. Medina P, Navarro S, Estellés A, Vayá A, Woodhams B, Mira Y, Villa P, Migaud-Fressart M, Ferrando F, Aznar J, Bertina RM, España F: Contribution of polymorphisms in the endothelial protein C receptor gene to soluble endothelial protein C receptor and circulating activated protein C levels, and thrombotic risks. Thromb Haemost 2004; 91: 905-911 26. Espana F, Medina P, Mira Y, Estelles A, Vaya A, Villa P, Royo M, Aznar J, Bertina RM: A new polymorphism in the 3’UTR region of the endothelial protein C receptor associated with increased levels of circulating activated proten C and decreased risk of venous thrombosis. Thromb Haemost 2001; 1: Abstract OC885 27. Yürürer D, Teber S, Deda G, Egin Y, and Akar N: The Relation Between Cytokines, Soluble Endothelial Protein C Receptor, and Factor VIII Levels in Turkish Pediatric Stroke Patients. Clin Appl Thromb Hemost 2009; 15: 545-551 28. Kendirli T, Ciftçi E, Ince E, Yurdakul E, Kansu A, Akar N: Homozygous 23-bp insertion of endothelial protein c receptor gene in a child with fatal sepsis. Pediatr Hematol Oncol 2007; 24 (3): 199-204 29. Ireland H, Konstantoulas CJ, Cooper JA, Hawe E, Humphries SE, Mather H, Goodall AH, Hogwood J, Juhan-Vague I, Yudkin JS, di Minno G, Margaglione M, Hamsten A, Miller GJ, Bauer KA, Kim YT, Stearns-Kurosawa DJ, Kurosawa S: EPCR Ser219Gly: Elevated sEPCR, prothrombin F1_2, risk for coronary heart disease, and increased sEPCR shedding in vitro. Atherosclerosis 2005; 183: 283-292 30. Navarro S, Medina P, Mira Y, Estellés A, Villa P, Ferrando F, Vayá A, Bertina RM, España F: Haplotypes of the EPCR gene, prothrombin levels and the risk of venous thrombosis in carriers of the prothrombin G20210A mutation. Haematologica 2008; 93 (6): 885-891

KarabÄąyÄąk A, et al: The Effects of EPCR Polymorphisms on Thrombosis

31. The National Center for Biotechnology Information. Available from: http://www.ncbi.nlm.nih.gov/sites/entrez?d b=snp&cmd=search&term=rs2069952 32. The National Center for Biotechnology Information. Available from: http://www.ncbi.nlm.nih.gov/sites/entrez?d b=snp&cmd=search&term=rs867186

Turk J Hematol 2012; 29: 55-62

33. The National Center for Biotechnology Information. Available from: http://www.ncbi.nlm.nih.gov/sites/ entrez?db=snp&cmd= search&term = rs9574

Case Report

DOI: 10.5152/tjh.2011.74

How Does Influenza A (H1N1) Infection Proceed in Allogeneic Stem Cell Transplantation Recipients? Influenza A (H1N1) İnfeksiyonu Allojeneik Nakil Hastalarında Nasıl Seyrediyor? Sinem Civriz Bozdağ1, Gülden Bozkurt2, Pervin Topçuoğlu1, Alpay Azap2, Muhit Özcan1, Nahide Konuk1, Önder Arslan1 1 2

Ankara University, School of Medicine, Hematology Department, Ankara, Turkey Ankara University, School of Medicine, Infectious Diseases Department, Ankara, Turkey

Abstract The clinical course of influenza A (H1N1) infection in allogeneic hematopoietic stem cell transplantation (AHSCT) recipients is not clearly known. We report 3 AHSCT recipients that were infected with influenza A (H1N1). Each of the patients had a different hematological disease and was at a different post-transplantation stages. All the patients were treated with oseltamivir, and zanamivir was switched to oseltamivir in 1 patient. All the patients survived without any complications. The course of swine flu can vary and progress with bacterial or other viral infections in immunosuppressed patients.

Key Words: H1N1, Allogeneic transplantation

Özet H1N1 virüsünün allojeneik kök hücre nakli yapılan Hematoloji hastalarında kliniği ve seyri konusunda veriler oldukça yetersizdir. Biz bu olgu serisinde, Ankara Üniversitesi Tıp Fakültesi kök hücre nakli ünitesinde allojeneik nakil yapılmış ve Influenza A/ H1N1 infeksiyonu saptanmış 3 olgumuzu tartıştık. Üç hastamızın da farklı hematolojik malignite tanıları vardı ve nakilin farklı evrelerinde olan hastalardı. Tüm hastalara oseltamivir tedavisi verildi; bir hastada zanamivir tedavisine geçilmesi gerekti. Hastaların üçü de herhangi bir komplikasyon kalmadan tam iyileşme sağlanarak taburcu edildi. Influenza A/H1N1’e bağlı grip immunsupresif hasta gruplarında farklı seyirler gösterebilmekte, bakteriyel ve viral enfeksiyonlarla birlikte seyredebilmektedir.

Anahtar Sözcükler: H1N1, Allojeneik nakil Introduction Viral infections cause morbidity and mortality in patients with hematological malignancies. The incidence and outcome of viral infections vary according to the intensity and duration of T-cell depletion. Allogeneic hematopoietic stem cell transplantation (AHSCT) recipi-

ents are highly susceptible to viral infections because of immunosuppression related to conditioning regimens, T-cell depletion, and graft versus host disease (GVHD) [1]. Influenza A (H1N1) in AHSCT recipients is associated with a wide range of symptoms. It can present with typical flu-like symptoms, such as fever, nausea, vomit-

Address for Correspondence: Sinem Civriz Bozdağ, M.D., Ankara Üniversitesi Tıp Fakültesi Hematoloji Bilim Dalı, Mamak, Ankara, Turkey Phone: +90 312 595 73 49 E-mail: scivriz@hotmail.com Received/Geliş tarihi : May 21, 2010 Accepted/Kabul tarihi : June 1, 2011

Civriz Bozdağ S, et al: H1N1 Infection

ing, diarrhea, and headache, and sometimes with atypical symptoms. Patients with malignancies can have more serious manifestations, including respiratory failure [2]. Prolongation of viral shedding has been observed in immunosuppressed patients; therefore, treatment of infection can be a major problem [3]. Oseltamivir and zanamivir have been approved for the treatment of influenza [4]. Herein we present 3 AHSCT recipients with different hematologic malignancies that were diagnosed with influenza A (H1N1) infection during different posttransplant phases. Informed consent was obtained. Case 1 A 23-year-old female acute myeloblastic leukemia (ALL) patient underwent AHSCT from an HLA fully matched cousin during her second complete remission in March 2009. She relapsed 7 months post transplantation and was admitted to the hospital with pancytopenia. A second transplantation from an alternative donor was scheduled and the patient subsequently underwent the 2nd allogeneic transplantation from another HLA fully matched cousin following the FLAMSA regimen in December 2009. Thoracic high-resolution computed tomography (HRCT) results one month before the second transplantation were normal. Paranasal tomography results were compatible with sinusitis and she was treated with levofloxacin. Three days before transplantation she had an attack of febrile neutropenia and cefaperazone-sulbactam and amikasin were initiated. Her blood culture was positive for E. coli ESBL and cefaperazone-sulbactam was replaced with imipenem. The patient had herpes labialis and valacyclovir was changed from a prophylactic dose to a treatment dose. Antifungal prophylaxis with fluconazole was replaced with posaconazole. The patent was non-febrile for 9 d, and then developed fever and cough 6 d post transplantation. PCR test results for H1N1 were positive and oseltamivir 75 mg BID was given. Posteroanterior lung X Ray showed right perihilar and paracardiac consolidation. Thoracic HRCT was repeated and the findings were consistent with fungal infection. Posaconazole was stopped and liposomal amphotericin therapy was started. The patient’s fever was controlled for 6 d, but recurred the same day that neutrophil engraftment was performed As the patient’s cough persisted at the end of 5 days oseltamivir treatment , we decided to continue 5 more days.. The patient’s attacks of fever were controlled and her cough was decreased by posttransplantation day 16.

Turk J Hematol 2012; 29: 63-66

Case 2 A 26-year-old male ALL patient underwent AHSCT from an unrelated donor during his second complete remission in July 2009. He did not have acute or chronic GVHD, but did have cytomegalovirus infection twice in 6 months, which was treated with ganciclovir. His immunosuppressive treatment was withdrawn 4 months post transplantation. As he had a history of disseminated fungal infection (Trichosporon) during chemotherapy, he continued to take voriconazole throughout the post-transplantation period. Antifungal therapy was stopped 2 months after the cessation of immunosuppressive therapy. The patient had pancytopenia for 6 months and was admitted to the hospital in January 2010 with fever and cough. Piperacillin-tazobactam, oseltamivir, and voriconazole were started concomitantly. Posteroanterior lung X Ray showed reticulonodular infiltration in both lungs. PCR test results for H1N1 were positive. Oseltamivir 75mg BID was started with piperacillin-tazobactam and voriconazole. Thoracic HRCT showed ground glass density and a nodular appearance, which was considered indicative of viral and fungal pneumonia. Oseltamivir was withdrawn on d 6 of the treatment because of the patient’s fever persistence, and the development of anxiety, sinus tachycardia. Zanamivir was switched with oseltamivir for an additional 5 d, and then withdrawn. Sputum culture at the admission to the hospital, showed proliferation of Acinetobacter junii and the antibiotics were continued, according to the antibiogram. Piperacillin-tazobactam was replaced with imipenem and tigecycline.. The patient’s fever persisted and antifungal therapy was continued. Sputum cultures during the antibiotic and antifungal therapies were found positive for enterococcus and Stenotrophomonas maltophilia.The day after the results of bronchoalveolar lavage (BAL) was performed and the same pathogens were noted in the BAL culture. The patient’s fever was controlled using ciprofloxacin. The patient’s cytomegalovirus titer increased after resolution of fever. Gancyclovir was prescribed for two weeks until the negativity of CMV titer was achieved. Case 3 A 35-year-old male patient underwent AHSCT from an HLA fully matched sibling in November 2008, following autologous transplantation due to refractory Hodgkin’s disease. He had stable disease for 8 months after AHSCT. He was diagnosed as zona zoster at the end of 8 th month and treated with acyclovir treatment. PET/CT control at the ninth month was consistent with progressive disease,

Turk J Hematol 2012; 29: 63-66

chemotherapy was planned. Three days after the PET/CT control he was admitted to the hospital with fever, cough, and anorexia. PCR test results for H1N1 were positive. Posteroanterior lung X Ray was normal. Oseltamivir, 75 mg BID, piperacillin, and tazobactam were started 2 d after the onset of the fever and cough. The patientâ&#x20AC;&#x2122;s fever resolved during d 1 of the treatment and oseltamivir was withdrawn after 5 d of treatment. Discussion Patients with hematological diseases and AHSCT recipients are highly susceptible to influenza A (H1N1). Several studies investigated the clinical spectrum of influenza A (H1N1) infection in AHSCT recipients [5,6]; fever and cough are the most common symptoms. All the presented patients had fever and cough at the time of presentation; case 2 had more severe respiratory symptoms than cases 1 and 3. Viruses such as influenza can cause symptoms following contact with an infected person, but none of the presented patients reported such contact. The H1N1 virus most commonly affects individuals aged <25 years, such as the presented patients, but the HINI-associated mortality is higher among those aged 25-49 years. All the presented patients survived H1N1 infection. The use of antiviral agents is not recommended for healthy individuals, unless symptoms persist >48 h. Nonetheless, treatment should be initiated in transplantation recipients regardless of the duration of symptoms. Early administration of oseltamivir improves outcome [4]. Oseltamivir was initiated with 48 h of fever in cases 2 and 3, and after the 2nd attack of fever and cough in case 1. Antibacterial treatment was administered to the 3 presented patients and altered according to culture results. Cases 1 and 2 had influenza A infection concomitant with fungal and bacterial infections. Cases 1 and 2 were treated for fungal and viral infection, respectively. Each of the presented patients was at a different post-transplantation phase. The optimal dose of oseltamivir is a contentious issue that requires additional study. The presented patients were treated with oseltamivir 75 mg b.i.d., as they did not have gastrointestinal malabsorption due to chemotherapy or GVHD; however it is feasible to use higher doses in cases of high viral load and gastrointestinal absorption problems [4]. During the treatment of Case2 oseltamivir was switched to zanamivir due to the sinus tachycardia, anxiety side effects . There is no consensus concerning the optimal duration of oseltamivir treatment. As the symptoms in case 1 and 2 could not be controlled, treatment

Civriz BozdaÄ&#x; S, et al: H1N1 Infection

was administered for 10 d, but case 3 received oseltamivir for only 5 d. The only way to prevented H1N1 infection is vaccination [7]. Post-transplantation immunosuppression remains a major problem for the immunogenicity of the H1N1 vaccine [8,9]. None of the presented patients had been vaccinated. The suspicion of our population about the effects and side effects of the vaccine was a problem to get over. In conclusion, based on our experience with the presented AHSCT patients with influenza A (H1N1) infection, we think that AHSCT patients may be highly susceptible to influenza, independent of the post-transplantation phase. All the presented patients received antiviral treatment and survived. The incidence and mortality has to be assessed in survey reports with large number of patients. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Whimbey E, Elting LS, Couch RB, et al: Influenza A virus infections among hospitalized adult bone marrow transplant recipients. Bone Marrow Transplant 1994; 13 (4): 437-440 2. Kharfan Dabaja MA, Velez A, Richards K, Greene J, Field T, Sandin R: Influenza A/pandemic 2009/H1N1in the setting of allogeneic hematopoietic stem cell transplantation: A potentially catastrophic problem in a vulnerable population. Int J Hematol 2010; 91 (1): 124-127 3. Weinstock DM, Gubareva LV, Zuccotti G: Prolonged shedding of multidrug resistant Influenza A virus in an immuncomprimised patient. N Eng J Med 2003; 348: 867-868 4. Casper C, Englund J, Boeckh M: How I treat influenza in patients with hematologic malignancies. Blood 2010; 115 (7): 1331-1342 5. Hajjar LA, Mauad T, Galas FR, Kumar A, da Silva LF, Dolhnikoff M, Trielli T, Almeida JP, Borsato MR, Abdalla E, Pierrot L, Filho RK, Auler JO Jr, Saldiva PH, Hoff PM: Severe novel Influenza A (H1N1) infection in cancer patients. Ann Oncol 2010; 21 (12): 2333-2341 6. Redelman-Sidi G, Sepkowitz KA, Huang CK, Park S, Stiles J, Eagan J, Perlin DS, Pamer EG, Kamboj M: 2009 H1N1 infection in cancer patients and hematopoietic stem cell transplant recipients. J Infect 2010; 60: 257-263

Civriz Bozdağ S, et al: H1N1 Infection

7. Avetisyan G, Aschan J, Hassan M, Ljungman P: Evaluation of immune responses to seasonal influenza vaccination in healthy volunteers and in patients after stem cell transplantation. Transplantation 2008; 86 (2): 257-263 8. Engelhard D,Nagler A,Hardan I: Antibody response to a two dose regimen of influenza vaccine in allogeneic T cell depleted and autologus BMT recipients. Bone Marrow Transplant 1993; 11: 1-5

Turk J Hematol 2012; 29: 63-66

9. Yalçın SS, Kondolot M, Albayrak N, Altaş AB, Karacan Y, Kuşkonmaz B, Aksu S, Cetin M, Göker H, Yurdakök K, Uçkan D: Serological response to influenza vaccine after hematopoetic stem cell transplantation. Ann Hematol 2010; 89 (9): 913-918 10. Ditschkowski M, Elmaagacli AH, Beelen DW: H1N1 in allogeneic stem cell recipients: Courses of infection and influence of vaccination on graft versus host disease. Ann Hematol 2011; 90 (1): 117-118

Case Report

DOI: 10.5505/tjh.2012.80947

H1N1-Associated Encephalitis in a Child with Acute Myeloblastic Leukemia and Bacteremia due to Klebsiella Pneumoniae Akut Miyeloblastik Lösemili bir Çocukta H1N1 İlişkili Ensefalit ve Klebsiella Pneumonia’ya Bağlı Bakteriyemi Lale Olcay1, Seda Öztürkmen1, Zafer Bıçakçı1, Arzu Akyay1, Gülşen İskender2, Kamuran Türker Sayılır2, Nil Çetin3, Saadet Dikmen Menteş4, Özlem Kapusuz4, Mehmet Ertem5 Dr A.Y. Ankara Oncology Training and Research Hospital, Department of Pediatric Hematology, Ankara, Turkey Dr A.Y. Ankara Oncology Training and Research Hospital, Department of Infectious Diseases, Ankara, Turkey 3 Dr A.Y. Ankara Oncology Training and Research Hospital, Department of Neurology, Ankara, Turkey 4 Dr A.Y. Ankara Oncology Training and Research Hospital, Department of Anesthesia, Ankara, Turkey 5 Ankara University, School of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Ankara, Turkey 1 2

Abstract Herein we present a neutropenic 16-year-old female with acute myeloblastic leukemia that developed recurrent generalized seizures while receiving antimicrobial therapy (including oseltamivir) due to pneumonia, bacteremia of Klebsiella pneumoniae, and H1N1 infection. The patient’s seizures were controlled using assisted ventilation. Electroencephalography showed that the patient had encephalopathy. Cranial computed tomography (CT), magnetic resonance imaging (MRI), and MRI angiography findings were normal. The patient fully recovered without sequelae. This case indicates that during pandemics of influenza-like diseases H1N1 infection should always be a consideration.

Key Words: H1N1, Encephalitis, Acute myeloblastic leukemia

Özet Burada, pnömoni, Klebsiella pneumonia bakteriyemisi ve H1N1 enfeksiyonu nedenleri ile antimikrobiyal tedavi (oseltamivir dahil) almakta iken tekrarlayıcıç jeneralize nöbetler geçiren ve nötropenik olan, 16 yaşında, akut miyeloblastik lösemili bir kız olguyu sunmaktayız. Hastanın nöbetleri, yardımlı ventilasyon ile kontrol edilebildi. Elektroensefalografi ensefalopati ile uyumlu olarak saptandı. Bilgisayarlı beyin tomografisi, magnetik rezonans görüntüleme (MRG), MRG anjiografi normal bulundu. Hasta sekelsiz, tamamen iyileşti. Bu olgu, influenza-benzeri hastalıkların pandemileri sırasında H1N1’in daima akılda tutulması gerektiğini vurgulamaktadır.

Anahtar Sözcükler: H1N1, Ensefalit, Akut miyeloblastik lösemi

Address for Correspondence: Lale Olcay, M.D., S.B. Dr Abdurrahman Yurtaslan Ankara Onkoloji Eğitim ve Araştırma Hastanesi, Çocuk Hematolojisi Bölümü, Demetevler 06200 Ankara, Turkey Phone: +90 312 336 09 09/7448 E-mail: laleolcay@hotmail.com.tr Received/Geliş tarihi : September 10, 2010 Accepted/Kabul tarihi : March 5, 2011

Olcay L, et al: H1N1-Associated Encephalitis in Leukemia

Introduction On 11 June 2009 the World Health Organization (WHO) announced the first pandemic of the 21st century, which was caused by a novel influenza A virus (H1N1). Immunosuppressed individuals and those with hematological disorders have a high risk of H1N1-associated complications [1]. Herein we present a patient with leukemia and H1N1 infection that developed encephalitis while having febrile neutropenia and bacteremia due to Klebsiella pneumoniae. Case Report A 16-year-old female with acute myeloblastic leukemia (M4) was started the AML-BFM-2004 chemotherapy protocol on October 02, 2009, which resulted in bone marrow remission on the 15th day of therapy. After receiving the second induction therapy (November 10-13, 2009), she developed febrile neutropenia (November 21, 2009). At that time her physical examination was normal, other than partial alopecia, nasal discharge, and excessive tearing. Chest X-ray was normal and occipitomental (Waters’ view) X-ray was consistent with sinusitis. After taking blood, urine, oropharynx and stool cultures, cefoperazone-sulbactam and amikacin were started; prophylactic trimethoprim-sulfamethoxazole was continued (5 mg/kg of trimethoprim). 72 h later the patient’s fever persisted and teicoplanin was added to the treatment. Based on the suspicion of 2009 H1N1 infection, a nasopharyngeal swab specimen was obtained, oseltamivir (2x75 mg d–1) was added empirically, and the patient was quarantined. No bacteria grew in urine culture, oropharynx culture revealed normal throat flora, and stool culture was negative for Salmonella shigella species. Blood culture was positive for Klebsiella pneumoniae ESBL, which was sensitive to imipenem; therefore, cefoperazone-sulbactam was withdrawn and imipenem was administered. On the sixth day of fever crepitant rales were heard in the patient’s basal lung fields. High-resolution computed tomography (HRCT) showed infiltration of scattered nodular lesions in the bilateral basal and right medium lung fields. Galactomannan was negative. The dosage of trimethoprim-sulfamethoxazole was increased (20 mg kg–1 of trimethoprim) and clarithromycin was added to the treatment regimen. On November 28, 2009, the patient had a generalized tonic-clonic seizure that lasted nearly 3 min, after which cardiopulmonary arrest developed, when she was on imipenem, oseltamivir, amikacin, teicoplanin, tri-

Turk J Hematol 2012; 29: 67-71

methoprim-sulfamethoxazole (high dose), clarithromycin therapies, for 3,3,7,4,1,1 days respectively. Cardiopulmonary resuscitation was implemented. She then had consecutive generalized tonic-clonic seizures that could not be controlled using midazolam or phenytoin; therefore, she was intubated; thiopentone sodium was administered under assisted ventilation and the patient was deeply sedated with propofol (2 mg/kg/hour) in Intensive Care Unit (ICU). On November 28, 2009, her Hb was 126 g L–1, WBC was 0.9 x 109 L–1, absolute neutrophil count (ANC) was 0.06 x 109 mm–3, and PLT count was 27.7 x 109 L–1. Biochemistry (glucose, sodium, potassium, BUN, creatinine, uric acid, calcium, phosphor, and liver enzymes) was normal. Cranial CT was normal. Phenytoin (5 mg·kg–1·d–1) and total parenteral nutrition were started on November 28, 2009. Nasal and pharyngeal swab specimens obtained on November 26,2009 were positive for H1N1, based on real-time (RT)-PCR. The patient’s fever did not recur since November 29, 2009 and she was extubated. Her neurologic examination after she was extubated showed that she had confusion, dysphasia, generalized hypotonia, diminished deep tendon reflexes, and no nuchal rigidity. ‘Electroencephalography (EEG) showed parieto-occipital alpha at 9-10 Hz and 4-5 Hz theta slow waves, which was compatible with mild encephalopathy’ Cranial magnetic resonance imaging (MRI) and cranial MRI angiography were normal. Due to new-onset seizures, altered consciousness, immunocompromised state, and ongoing thrombocytopenia, we decided against lumber puncture, just after she was extubated [2]. Coagulation screening test results were normal; ANA, anti-DNA, and anticardiolipin antibodies were negative. Cerebrospinal fluid was drawn on December 15, 2009 when her general condition was improved and chemotherapy was resumed, and had a protein value of 0.3 g L—1 (normal range: 0.15-0.5 g L—1) and glucose of 50 mg dL—1, without any cells in the cytospin slide. The patient’s pneumoniae recovered clinically and radiologically by December 15, 2009. Dysphasia and generalized hyponia resolved gradually by January 1, 2010. The patient’s follow-up EEG taken on February 3, 2010 was normal. Phenytoin was stopped on February 3, 2010. After consolidation therapy (December 15-20,2009), the patient received allogeneic stem cell transplantation from a full-matched sibling (March 2, 2010). As of November

Turk J Hematol 2012; 29: 67-71

Olcay L, et al: H1N1-Associated Encephalitis in Leukemia

1, 2011, the patient had a Karnofsky score of 100% for 20 months without recurrence of neurologic deficit.

All patients received oseltamivir with/without acyclovir or antibiotics.

Discussion

The 2 of the reported cases whose EEG findings were consistent with encephalopathy were on the first day of oseltamivir when neurological complications developed. [4,12].

A patient with acute neurological complications associated with H1N1 infection was reported to have laboratory-confirmed H1N1 infection of the respiratory tract and associated seizures, and encephalopathy or encephalitis within 5 d of the onset of influenza-like symptoms, without evidence of an alternative etiology. Encephalopathy was defined as altered mental status lasting >24 h [3,4] and encephalitis was defined as encephalopathy plus ≥2 of the following: fever >38 °C, focal neurological signs, CSF pleocytosis, EEG findings indicative of encephalitis, and abnormal neuroimaging indicative of infection or inflammation [3]. As such, the presented neutropenic patient fulfilled the criteria of encephalitis associated with flu-like symptoms, which were attributed to H1N1 superimposed with bacteremia due to Klebsiella pneumoniae. Recovery of encephalopathy despite withdrawal of imipenem eliminates the diagnosis of imipenem-associated encephalopathy [4,5]. To the best of our knowledge the literature contains no evidence of a higher incidence of neuropsychiatric adverse events (NPAEs) in patients treated with oseltamivir—an antiviral used to treat influenza—than in those that receive a placebo or no antiviral treatment; therefore, we think that encephalitis in the presented patient was likely to have been caused by H1N1, which is consistent with reports stating that the risk of NPAEs in influenza patients is significantly higher than in the general population, [6,7]. [3] although the incidence of H1N1-associated encephalopathy is as low as 0.89% (3 out of 336 cases) [3] and 7% [4] In our review of 25 cases of H1N1-associated encephalopathy/encephalitis, only 3 (12%) were adults while the rest (88%) were children. None of the reported cases had an underlying disease, and the time from the onset of respiratory symptoms to the onset of neurological symptoms was 1-4 d.[8-22] In our literature review, CSF findings in the reported cases were unremarkable, except pleocytosis with/without mild elevation in the protein level in seven cases with H1N1-associated encephalopathy/encephalitis out of 25 [8,12,14-16,20,21] and we found only one case with elevated CSF pressure [8]. In each case, though, the H1N1 virus was isolated from nasopharyngeal swab specimens via enzyme immunoassay and or PCR, none of the CSF specimens yielded H1N1 virus, except for Sanchez-Torrent’s [17] case in which lumbar puncture was traumatic.

Two adults progressed to encephalitis lethargica [8,14] and 4 children to acute necrotizing encephalopathy, [16,19,21,22] while other reported cases presented with encephalomyelitis,[10] meningoencephalitis,[9] or pseudobulbar palsy,[11] with accompaniment of severe intracranial hypertension.[18] While CT or MRI findings were normal in patients that recovered quickly (2-7 d),[12,13,15,17,20] those with a complicated course [8,10,14,16,18,19,21] had radiological abnormalities, including unilateral or bilateral hyperintense signals in T2-weighted MRI images of thalamus, perirolandic area, basal nuclei, cerebellum, brainstem, medulla and cervical cord with [16,18] without [8-11,14,19,21] findings of increased intracranial pressure. The MRI findings were observed to have completely or slightly reversed in follow-up images.[11,21] These reversible lesions were attributed to the transient development of intramyelinic edema, resulting in a transient decrease in the diffusion of the lesions—a common finding in cases with radiological abnormalities.[11] In our literature review full recovery was attained in 72% of patients, [4,9-13,15,17,18,20] while 16,6% required assisted ventilation,[10,13,18] as did the presented patient. Few patients had extrapyramidal and/or pyramidal sequelae due to the progression to encephalitis lethargica [8,14] (8%) and acute necrotizing encephalopathy (8%),[16,21] or following severe encephalopathy (4%). [10] Two patients with acute necrotizing encephalopathy were reported to progress to brain death. [19,22] The differences between the presented patient and those previously reported are that the presented case was immunodeficient, her neurological findings resolved gradually over a longer period of time (30 d vs. 2-7 d) than those with a benign course and no radiological findings, which may have been due to hypoxia following cardiopulmonary arrest, and that encephalitis did not pursue a complicated course like in those with encephalitis lethargica or ANE, even though she was immunodeficient. Mutation in the gene Ran-binding 2 (RANBP2) have been shown to be associated with familial or recurrent influenza-associated acute encephalopathy/encephalitis

Olcay L, et al: H1N1-Associated Encephalitis in Leukemia

[23]. Hence there are reported cases with familial [20] or recurrent [11] H1N1-associated encephalopathy/encephalitis. Proinflammatory cytokines play a role in the etiology of H1N1-associated encephalopathy/encephalitis.via inducing vascular endothelial injury and increasing blood-brain barrier (BBB) permeability, which enables them to penetrate into the central nervous system (CNS) through a damaged BBB, induce apoptosis of neurons and glia, and activate elevated glial release of cytokines, thereby inducing brain edema and damage [19,24] Cytokine storm may also contribute to apoptosis of liver cells, metabolic disorders, and coagulopathy [16]. In the presented patient the underlying febrile neutropenia may have contributed to the development of encephalopathy via an increase in cytokines. In contrast, the absence of a significant inflammatory response in CSF or lesion enhancement on MRI, [25] and the absence of elevated cytokines in CSF [11] raises questions about the primary role of cytokine hypersecretion in the etiology of H1N1-associated encephalopathy/encephalitis. Although the H1N1 virus proliferates in microglia and astrocytes, inducing apoptosis, and cytopathic and proinflammatory cytokine production in vitro, [24] viral antigen or viral nucleic acid have rarely been detected in CSF or neural tissue, [17,25] suggesting that influenza rarely produces true neuroinvasive disease [26]. Systemic vascular abnormalities [18] and cerebral arteritis [27] were also suggested to play a role in the etiology of H1N1-associated encephalopathy/encephalitis. Yet, the underlying mechanisms of influenza-associated neurological illness remains unclear [25]. In the presented patient CT, MRI, and MRI angiography findings ruled out bleeding or thromboemboli. Progressive recovery of her mental status without any intrathecal chemotherapy, and normal CSF findings 15 d later during chemotherapy ruled out CNS leukemia as well. Pulmonary infection in the presented patient may have been aggravated by the superimposition of H1N1 to Klebsiella pneumoniae, as previously reported [28]. In conclusion, the presented case indicates that during pandemics of influenza-like diseases, epidemic viruses like H1N1 should always be a consideration in the etiology of seizures in leukemic patients with febrile neutropenia, and that early initiation of treatment of H1N1 infection has the potential to reduce the associated morbidity and mortality rates. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/

Turk J Hematol 2012; 29: 67-71

or affiliations relevant to the subject matter or materials included. References 1. Chang LY, Shih SR, Shao PL, Huang DT, Huang LM: Novel swine-origin influenza virus A (H1N1): The first pandemic of the 21st century. J Formos Med Assoc 2009; 108: 526-532 2. Tunkel AR: Approach to the patient with central nervous system infection. In : Mandell GL, Bennett JE, Dolin R, editors. Mandell, Douglas and Bennettâ&#x20AC;&#x2122;s Principles and Practice of Infectious Diseases. Philadelphia: Elsevier Churchill Livingstone; 2010; 1183-1188 3. The Centers for Disease Control and Prevention: Neurologic complications associated with novel influenza A (H1N1) virus infection in children-Dallas, Texas, May 2009. MMWR Morb Mortal Wkly Rep 2009; 58: 773-778 4. Larcombe PJ, Moloney SE, Schmidt PA: Pandemic (H1N1) 2009: A clinical spectrum in the general paediatric population. Arch Dis Child 2011; 96: 96-98 5. Finkelsztejn A, Cabral L, Bragatti JA, Silva AV, Schuh AF: Imipenem-associated encephalopathy: Alert to physicians. Arq Neuro-Psiquiatr 2010; 68 (1): 137-139 6. Toovey S, Rayner C, Prinssen E, Chu T, Donner B, Thakrar B, Dutkowski R, Hoffmann G, Breidenbach A, Lindemann L, Carey E, Boak L, Gieschke R, Sacks S, Solsky J, Small I, Reddy D: Assessment of neuropsychiatric adverse events in influenza patients treated with oseltamivir. Drug Saf 2008; 31: 1097-1114 7. Smith JR, Sacks S: Incidence of neuropsychiatric adverse events in ifluenza patients treated with oseltamivir or no antiviral treatment. Int J Clin Pract 2009; 63: 596-605 8. Chen YC, Lo CP, Chang TP: Novel influenza A (H1N1)associated encephalopathy / encephalitis with severe neurological sequelae and unique image features. A case report. J Neurol Sci 2010; 298: 110-113 9. Haktanir A: MR imaging in novel influenza A (H1N1)associated meningoencephalitis. AJNR 2010; 31: 394-395 10. Webster RI, Hazelton B, Suleiman J, Macartney K, Kesson A, Dale RC: Severe encephalopathy with swine origin influenza A H1N1 infection in childhood: Case reports. Neurology 2010; 74: 1077-1078 11. Iwata A, Matsubara K, Nigami H, Kamimura K, Fukaya T: Reversible splenial lesion associated with novel influenza A (H1N1) viral infection. Pediatr Neurol 2010; 42: 447-450 12. Choi SY, Jang SH, Kim JO, Ihm CH, Lee MS, Yoon SJ: Novel swine-origin influenza A (H1N1) viral encephalitis. Yonsei Med J 2010; 51: 291-292

Turk J Hematol 2012; 29: 67-71

13. Deindl P, Varnholt V: Correspondence (letter to the editor): Neurological complications. Dtsch Arztebl Int 2010; 106: 229-230 14. Gadoth A, Aizenstein O, Mosek A: Influenza A/H1N1 encephalitis. Neurology 2010; 75: 666-667 15. Samuel N, Attias O, Tatour S, Brik R: Novel influenza A (H1N1) and acute encephalitis in a child. IMAJ 2010; 12: 446-447 16. Ormitti F, Ventura E, Summa A, Picetti E, Crisi G: Acute necrotizing encephalopathy in a child during the 2009 influenza A (H1N1) pandemia: MR imaging in diagnosis and follow-up. Am J Neuroradiol 2010; 31: 396-400 17. Sánchez-Torrent L, Triviño-Rodriguez M, Suero-Toledano P, Claret-Teruel G, Muñoz-Almagro C, Martínez-Sánchez L, Jordán-García I, Garcia-Garcia JJ: Novel influenza A (H1N1) encephalitis in a 3-month-old infant. Infection 2010; 38: 227-229 18. Citerio G, Sala F, Patruno A, Gori A, Grioni D, Rossi M, Giussani C, Grimaldi M: Influenza A (H1N1) encephalitis with severe intracranial hypertension. Minerva Anestesiol 2010; 76: 459-462 19. Lyon JB, Remigio C, Milligan T, Deline C: Acute necrotizing encephalopathy in a child with H1N1 influenza infection. Pediatr Radiol 2010; 40: 200-205 20. Gonzalez BE, Brust DG: Novel influenza A (H1N1) presenting as an acute febrile encephalopathy in a mother and daughter. Clin Infect Dis 2009; 49: 1966-1967

Olcay L, et al: H1N1-Associated Encephalitis in Leukemia

21. Fujimoto Y, Shibata M, Tsuyuki M, Okada M, Tsuzuki K: Influenza A virüs encephalopathy with symmetrical thalamic lesions. Eur J Pediatr 2000; 159: 319-321 22. Martin A, Reade EP: Acute necrotizing encephalopathy progressing to brain death in a pediatric patient with novel influenza A (H1N1) infection. Clin Infect Dis 2010; 50 (8): 50-52 23. Wang GF, Li W, Li K: Acute encephalopathy and encephalitis caused by influenza virüs infection. Curr Opin Neurol 2010; 23: 305-311 24. Wang G, Zhang J, Li W, Xin G, Su Y, Gao Y, Zhang H, Lin G, Jiao X, Li K: Apoptosis and proinflammatory cytokine responses of primary mouse microglia and astrocytes induced by human H1N1 and avian H5N1 influenza viruses. Cell Mol Immunol 2008; 5: 113-120 25. Sejvar JJ, Uyeki TM: Neurologic complications of 2009 influenza A (H1N1): Heightened attention on an ongoing question. Neurology 2010: 74: 1020-1021 26. Gupta RK: Are neuroimaging findings in novel influenza A (H1N1) infection really novel? Am J Neuroradiol 2010; 31: 393 27. Yamashita S, Kouzaki Y, Kawano R, Tokunaga M, Uchino M: Acute ophthalmoparesis accompanied with influenza A infection. Inter Med 2008; 47: 1627-1629 28. Morens DM, Taubenberger JK, Fauci AS: Predominant role of bacterial pneumonia as a cause of death in pandemic influenza: Implications for pandemic influenza preparedness. J Infect Dis 2008; 198: 962-970

Case Report

DOI: 10.5505/tjh.2012.37801

Hydrops Fetalis due to Kell Alloimmunization: A Perinatal Approach to a Rare Case Kell Alloimmunizasyonuna Bağlı Gelişen Hidrops Fetalis Olgusu: Nadir Görülen bir Olguya Perinatal Yaklaşım Arzu Akdağ, Ömer Erdeve, Nurdan Uraş, Yavuz Şimşek, Uğur Dilmen Zekai Tahir Burak Maternity and Teaching Hospital, Ankara, Turkey

Abstract Objective: While routine administration of rhesus (Rh) immunoglobulin has significantly reduced the incidence of Rh alloimmunization, maternal alloimmunization to other red cell antigens remains a contributor to perinatal morbidity and mortality. Although the Kell antigen is seen on the red cells of only 9% of the general population, attention to Kell antibodies continues to increase.

Case Report: A case of fetal hydrops was sonographically detected at 30 weeks of gestation. Antenatal tests to evaluate the fetus’s condition clearly showed that the level of hemolytic disease was critical and the baby was delivered prematurely due to fetal distress. The combination of anemia, reticulocytopenia, hydrops fetalis, and a positive indirect Coombs test suggested Kell isoimmunization. The baby was successfully treated with exchange transfusion of Kellnegative packed red cells, and was discharged on postnatal d 30.

Conclusion: The presented case of hydrops fetalis was due Kell alloimmunization that was detected during the postnatal period, and thus we plan to discuss the perinatal approach to Kell immunization.

Key Words: Hydrops fetalis, Anemia, Kell alloimmunization, Newborn

Özet Amaç: Günümüzde Rhesus (Rh) immunoglobulinin yaygın olarak uygulanması RhD alloimmünizasyon insidansında azalmaya neden olurken RhD dışındaki eritrosit antijenleri ile maternal alloimmunizasyon perinatal morbidite ve mortaliteye yol açmaya devam etmektedir. Kell antijeni toplumda yalnızca %9 oranında bulunmasına rağmen bu antijene bağlı alloimmunizasyon günümüzde ön plana çıkmaya başlamıştır.

Olgu Sunumu: Hastamız 30. gebelik haftasında antenatal fetal hidrops tanısı almıştı. Fetal durumu değerlendirmeye yönelik antenatal testler kritik düzeyde hemolitik hastalığı gösterdi, ancak hasta fetal distres nedeniyle prematüre olarak doğurtuldu. Anemi, retikülositopeni, hidrops fetalis ve pozitif indirekt Coombs testi Kell izoimmunizasyonunu düşündürdü. Postnatal dönemde Kell-negatif eritrosit süspansiyonu ile kan değişimi uygulanan hasta postnatal 30.gün şifa ile taburcu edildi.

Address for Correspondence: Arzu AkdaĞ, M.D., Dr. Zekai Tahir Burak Kadın Sağlığı Eğitim ve Araştırma Hastanesi, Talatpaşa Bulvarı, Hamamönü, Ankara, Turkey Phone: +90 505 782 39 60 E-mail: arzuakdag@hotmail.com Received/Geliş tarihi : November 23, 2010 Accepted/Kabul tarihi : June 29, 2011

Turk J Hematol 2012; 29: 72-75

Akdağ A, et al: Hydrops Fetalis due to Kell Alloimmunization

Sonuç: Bu makalede, Kell izoimmunizasyonuna bağlı geliştiğini postnatal dönemde saptadığımız bir hidrops fetalis olgusu sunularak Kell immunizasyonuna perinatal yaklaşımın tartışılması planlandı. Bu durum fetusun antijen negatif uygun kan ile başarılı bir şekilde tedavi edilmesine olanak sağlayacaktır.

Anahtar Sözcükler: Hidrops fetalis, Kell uygunsuzluğu, Anemi, Yenidoğan Introduction Hydrops fetalis is the excessive accumulation of fluid in the subcutaneous tissues and serous cavities of fetuses and neonates. The first cases described were associated with Rhesus (Rh) alloimmunization. While routine administration of Rh immunoglobulin has significantly reduced the incidence of this type of alloimmunization, maternal alloimmunization to other red cell antigens remains a contributor to perinatal morbidity and mortality. Although the Kell antigen is seen on the red cells of only 9% of the general population, attention to Kell antibodies continues to increase. As a possible factor associated with fetal anemia in the case of Kell alloimmunization is suppression of erythropoiesis, reticulocyte and normoblast counts are inappropriately low for the degree of fetal anemia in fetuses and neonates. Herein we describe a preterm neonate with hydrops fetalis due to Kell isoimmunization that was detected during the postnatal period, and discuss the perinatal approach to this rare condition. Case Report A male neonate was delivered via cesarean section after 32 weeks and 5 days of gestation to a 24-year-old gravida 3, para 2 mother. The patient’s 1st and 5th min APGAR scores were 3 and 6, respectively. The newborn required intubation and ventilation support due to respiratory distress that developed after immediately following birth and was admitted to the neonatal intensive care unit. Routine ultrasonographic examination at 30 weeks of gestation showed fetal ascites and cardiomegaly, and fetal echocardiography confirmed myocardial hypertrophy. Doppler measurement of the middle cerebral artery (MCA) was performed for the prediction of fetal anemia and the peak systolic velocity (PSV) was significantly elevated (60 cm s–1). Several tests were performed to determine the etiology of the fetal anemia during the pregnancy. The mother’s blood group was AB Rh(+); therefore, Rh and ABO incompatibility were eliminated as the cause of hydrops. IgM antibody against parvovirus B19 (the etiological agent of anemia) was negative. The mother’s obstetric history included normal full-term delivery of a healthy male 4 years earlier, and dilation and curettage (D&C) two years

ago. The mother had never received a blood transfusion; her and her family’s medical history were otherwise unremarkable. Physical examination of the neonate neonate immediately following birth showed marked pallor and gross skin edema. He weighed 2600 g, his respiratory rate was 72 breaths min–1 with retractions, and vesicular breath sounds were audible. A grade 2/6 systolic murmur was heard and abdominal distention was noted due to massive ascites. The liver and spleen were palpable 2 cm and 1 cm below the costal margins, respectively. Initial complete blood count findings were as follows: white blood cell count: 12,600/ mm3; hemoglobin level: 4 g /dL1; hematocrit: 12%; platelet count: 240,000 /mm3; reticulocyte count: 2%. Biochemical analyses performed at birth showed that the albumin level was 2.45 g /dL1 (normal range: 3.5-5 g/ dL1). We investigated the etiology of anemia. Sickle cell test, hemoglobin electrophoresis results, and the glucose-6-phosphate dehydrogenase enzyme level were normal. Echocardiography was normal. The combination of anemia, reticulocytopenia, and hydrops fetalis was thought to be consistent with Kell isoimmunization. A special request was sent to the blood bank to screen for uncommon rare blood groups and non-D antibodies. The patient’s Kell antigen was positive, his mother’s was negative, and the maternal serum indirect Coombs test was positive; therefore, the diagnosis of Kell isoimmunization was confirmed. Due to severe anemia, the patient underwent exchange transfusion with ABpositive, Kell-negative packed red cells on postnatal d 1; he received transfusion of an additional unit of packed red cells with compatible AB-positive and Kell-negative cross matching on postnatal d 3. Throughout the newborn’s hospitalization hyperbilirubinemia was not observed. The patient was then managed conservatively and was discharged in stable condition on postnatal d 30. Discussion More than 50 different red-cell antigens are associated with hemolytic disease of the fetus and newborn (HDFN), but most cases of severe fetal disease are caused by antiRhD, anti-RhC, and anti-Kell (K1) [1]. Alloimmunization to RhD erythrocyte antigen has historically been the most

Akdağ A, et al: Hydrops Fetalis due to Kell Alloimmunization

common etiology of severe HDFN; however, this type of alloimmunization is becoming rare in developed countries as a result of routine prophylaxis with anti-D IgG. Nonetheless, HDFN continues to cause fetal morbidity and mortality and attention to other more rare blood group antibodies for which immune prophylaxis is unavailable continues to increase. In the presented patient hydrops fetalis due to severe anemia was associated with maternal Kell alloimmunization. Maternal anti-K is the second most common alloantibody (anti-D is the first) and accounts for 10%-15% of all patients with antibody-mediated severe hemolytic anemia [2]. Currently, the rate of hemolytic disease related to Kell antibodies is increasing, but the cause for this increase remains unknown. Previous blood transfusion is thought to be an etiological cause of their sensitization, as 66% of women with Kell antibodies have a history of transfusion in the absence of routine Kell antibody screening prior to transfusion [3]. At least 8 different antigens of the 24-member Kell red-cell antigen system have been associated with HDFN. The most common of these are Kell (k, K1) and Cellano (k, K2). The K1 antigen is found on the red cells of 9% of the general population, and virtually all antigen-positive individuals being heterozygous. These gene frequencies are associated with a 5% risk of an affected fetus in Kell-alloimmunized pregnancies. One study reported that maternal anti-K was observed in 459 pregnancies; 20 fetuses among the 459 pregnancies with maternal anti-K were affected. In all, 4 of the 20 affected fetuses with hydrops died—3 in utero and 1 during the neonatal period. [4]. McKenna et al. studied 156 pregnancies in 134 women with anti-K1 antibodies. In all, 8 infants (5%) were severely affected, 6 of which received intrauterine transfusion; there were 3 fetal deaths. An additional 13 infants (8%) were affected with mild HDFN [3]. The clinical features of anti-K HDFN differ from those of the classical form of the disease caused by anti-D. As the severity of intrauterine disease may not correlate with maternal serum antibody titers, the utility of antibody titers in monitoring K-antigen-sensitized pregnancies is limited [4,5]. A critical maternal indirect Coombs titer of ≥8 is considered the threshold for suspicion of fetal anemia and close monitoring of these fetuses is recommended. Prediction of the severity of anti-K disease based on amniotic fluid bilirubin levels obtained from serial amniocentesis is not possible because anti-K HDFN is associated with lower concentrations of amniotic fluid bilirubin than antiD HDFN [6,7]. Postnatal hyperbilirubinemia is not significant in newborns with hemolytic disease caused by anti-K.

Turk J Hematol 2012; 29: 72-75

There are fewer numbers of circulating reticulocytes and normoblasts in fetuses and newborns with anti-K disease than in fetuses with anti-D HDFN [7]. Reticulocytosis and erythroblastosis occur at lower rates in fetuses with anti-K disease than in those with anti-D HDFN [7]. These observations suggest that the pathogenesis of HDFN caused by anti-K differs from that due to anti-D. The body of in vitro and in vivo evidence suggests that fetal anemia in cases of Kell sensitization is secondary to 2 mechanisms: red cell destruction (less common) and suppression of erythropoiesis (more common) [7,8]. This also leads to fetal anemia in the absence of a concomitant increase in bilirubin breakdown products, thus leading to relatively normal delta OD450 values. In the presented patient reticulocyte and normoblast counts were low, which is consistent with Kell isoimmunization, whereas maternal antibody levels were unexpectedly very high. The presented patient’s negative direct Coombs test indicated that erythroid suppression, rather than hemolysis was the predominant mechanism responsible for fetal anemia secondary to maternal Kell alloimmunization. Serial PSV measurement in the fetal MCA can be used to assess fetal anemia after 16-18 weeks of gestation; a value >1.5 MoMs indicates the need for cordocentesis and possible intrauterine blood transfusion with Kell-negative packed red cells [9,10]. In the presented case MCA Doppler measurement showed that the PSV was critically high level; however, before further testing could be performed the patient was delivered prematurely due to fetal distress. The neonate was treated postnatally with exchange transfusion and neonatal anemia significantly improved following transfusion with Kell-negative blood. Conclusion Anti-Kell alloimmunization is a potentially serious cause of fetal anemia. In such cases antenatal treatment may help prevent fetal and neonatal complications. Furthermore, we highlight the importance of irregular antibody screening for women with significant obstetric history and fetal hydrops. Lastly, use of Kell-negative blood for transfusion in all females during childhood and throughout their reproductive years should further reduce the incidence of Kell-alloimmunization. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2012; 29: 72-75

References 1. Moise KJ: Fetal anemia due to non-Rhesus-D red-cell alloimmunisation. Semin Fetal Neonatal Med 2008; 13: 207-214 2. Vaughan JI, Warwick R, Welch CR, Letsky EA: Anti-Kell in pregnancy. Br J Obstet Gynaecol 1991; 98: 944-945 3. McKenna DS, Nagaraja HN, Oâ&#x20AC;&#x2122;Shaughnessy R: Management of pregnancies complicated by anti-Kell isoimmunization. Obstet Gynecol 1999; 93: 667-673 4. Bowman JM, Pollock JM, Manning FA, Harman CR, Menticoglou S: Maternal Kell blood group alloimmunization. Obstet Gynecol 1992; 79: 239-244 5. van Wamelen DJ, Klumper FJ, de Haas M, Meerman RH, van Kamp IL, Oepkes D: Obstetric history and antibody titer in estimating severity of Kell alloimmunization in pregnancy. Obstet Gynecol 2007; 109: 1093-1098 6. Berkowitz RL, Beyth Y, Sadovsky E: Death in utero due to Kell sensitization without excessive elevation of the delta OD450 value in amniotic fluid. Obstet Gynecol 1982; 60: 746-749

AkdaÄ&#x; A, et al: Hydrops Fetalis due to Kell Alloimmunization

7. Weiner CP, Widness JA: Decreased fetal erythropoiesis and hemolysis in Kell hemolytic anemia. Am J Obstet Gynecol 1996; 174: 547-551 8. Vaughan JI, Manning M, Warwick RM, Letsky EA, Murray NA, Roberts IA: Inhibition of erythroid progenitor cells by anti-Kell antibodies in fetal alloimmune anemia. N Engl J Med 1998; 338: 798-803 9. Van Dongen H, Klumper FJ, Sikkel E, Vandenbussche FP, Oepkes D: Non-invasive tests to predict fetal anemia in Kellalloimmunized pregnancies. Ultrasound Obstet Gynecol 2005; 25: 341-345 10. Rimon E, Peltz R, Gamzu R, Yagel S, Feldman B, Chayen B, Achiron R, Lipitz S: Management of Kell isoimmunizationevaluation of a Doppler-guided approach. Ultrasound Obstet Gynecol 2006; 28: 814-820

Case Report

DOI: 10.5152/tjh.2011.16

Mercury Toxicity: A Family Case Report Civa Zehirlenmesi: Bir Aile Olgu Sunumu Rahşan Yıldırım1, Fuat Erdem1, Mehmet Gündoğdu1, Yusuf Bilen1, Ebru Koca2, Yalçın Yıllıkoğlu3, Yaşar Nuri Şahin4 Atatürk University, School of Medicine, Department of Internal Medicine, Division of Hematology, Erzurum, Turkey Erzurum Region Education and Research Hospital, Department of Hematology, Erzurum, Turkey 3 Atatürk University, School of Medicine, Department of Neurology, Erzurum, Turkey 4 Atatürk University, School of Medicine, Department of Biochemistry, Erzurum, Turkey 1 2

Abstract Background: Environmental pollution exposes humans to toxic substances. Herein we present 5 family members aged 20-54 years that were poisoned by liquid mercury. Case Reports: Case 1 presented to our clinic with cough, fever, and night sweats. The patient had neutropenia, anemia, and pneumonia, rapidly developed acute respiratory distress syndrome (ARDS), and died on day 4 of hospitalization. Her WBC count was 0.4 × 10³ mm-3 (normal range: 4.3-10.3 × 103 mm-3) and Hb was 10.8 g dL–1 (normal range: 11.516.0 g dL–1). Case 2 presented with bicytopenia; the leukocyte count was 1.3 × 103 mm-3 (normal range: 4.3-10.3 × 103 mm-3) and the PLT count was 88 × 103 mm-3 (normal range: 150-400 × 103 mm-3). Cases 2 and 3 had toxic peripheral neuropathy. The PLT count in case 3 was 123 × 103 mm-3 (normal range: 150-400 × 103 mm-3). Cases 4 and 5 presented with fatigue and headache; these 2 patients did not have positive findings, apart from high levels of mercury in the blood. We have written informed consent.

Conclusion: We think that heavy metal exposure—although rare—should be considered in patients that present with numerous symptoms involving multiple systems, including the cardiovascular, respiratory, and neurological systems. The present report is unique in that in describes mercury poisoning in 5 members of the same family.

Key Words: Mercury intoxication, Family

Özet Giriş: Çevresel kirlilik insanları zehirli maddelere maruz bırakır. Biz, civa ile zehirlenen, yaşları 20-54 arasında olan aynı aileden 5 olguyu sunduk.

Olgular: Olgu 1; kliniğimize öksürük, ateş ve gece terlemesi ile başvurdu. Nötropeni, anemi ve pnömonisi olan hastada hızlı bir şekilde akut respiratuar distress sendromu (ARDS) gelişti ve hastaneye yatışının 4. gününde öldü. Hastanın WBC sayısı 0.4 × 103 mm-3 (normal sınır: 4.3-10.3 × 103 mm–3) ve Hb değeri 10.8 g dL–1 (normal sınır: 11.5-16.0 g dL–1) idi. Olgu 2; bisitopeni ile başvurdu, lökosit sayısı 1.3 × 103 mm-3 (normal sınır: 4.3-10.3 × 103 mm-3) ve trombosit sayısı 88 × 103 mm–3 (normal sınır: 150-400 × 103 mm–3) idi. Olgu 2 ve 3’te toksik periferik nöropati tespit edildi. Olgu 3’te trombosit sayısı 123 × 103 mm-3 (normal sınır: 150-400 × 103 mm-3) idi. Olgu 4 ve 5 halsizlik ve başağrısı ile başvurdu, kandaki yüksek civa seviyeleri dışında bu iki hastada herhangi bir pozitif bulguya rastlanmadı.

Address for Correspondence: Rahşan Yıldırım, M.D., Atatürk Üniversitesi, Tıp Fakültesi, Yakutiye Araştırma Hastanesi, İç Hastalıkları Anabilim Dalı 25100 Erzurum, Turkey Phone: +90 442 231 71 95 E-mail: rahsan.yildiri@hotmail.com Received/Geliş tarihi : October 26, 2010 Accepted/Kabul tarihi : March 23, 2011

Turk J Hematol 2012; 29: 76-79

Yıldırım R, et al: Mercury Toxicity: A Family Case Report

Sonuç: Biz, kardiyovasküler, solunum ve nörolojik sistem gibi birçok sistemi tutan ve çeşitli semptomlar ile başvuran hastalarda oldukça nadir olsa da ağır metal maruziyetinin değerlendirilmesi gerektiğini düşünüyoruz. Sunulan rapor, aynı ailenin 5 bireyinde civa zehirlenmesi tespit edilmesi sebebi ile tektir.

Anahtar Sözcükler: Civa zehirlenmesi, Aile Introduction Mercury exists in 2 forms—organic and inorganic— both of which are hazardous to human health [1]. Mercury is the only metal that is a liquid at room temperature [2]. Organic liquid mercury is dangerous, especially to children, as it can easily be found in the environment [1]. The components of mercury are lipophilic—they readily penetrate cell membranes and accumulate in several organs, and exhibit toxic activity in numerous systems, including the urinary, central nervous, endocrine, and gastrointestinal systems [3]. Methylmercury, the soluble form of mercury, is neurotoxic [1]. Reports of mercury intoxication vary according to the type of mercury, type of exposure, duration of exposure, and individual sensitivity [4,5]. Herein we present 5 family members aged 20-54 years that were poisoned by liquid mercury and presented with varying symptoms. Case 1 A 54-year-old female presented to our clinic with fever, cough, night sweats, weight loss, and pain in the extremities, all of which began 10 d earlier. Two weeks earlier, the youngest son of the family came home with an unknown putty-like substance he obtained from his school’s science lab, which was subsequently determined to be mercury. The mercury spilled on the floor of the house and 2 weeks later the mother cleaned it up and poured it down the sink; as such, the family was exposed via inhalation and/or dermal contact during a 2-week period. The results of physical examination in case 1 were as follows: temperature: 39.2 °C (axillary); blood pressure: 130/80 mmHg (brachial); pulse rate: 120 bpm (radial and rhythmic); respiratory rate: 25 min–1; O2 saturation at room temperature based on pulse oximetry: 88%. Examination of the head, neck, and abdomen, and cardiovascular and neurological systems was unremarkable. Pulmonary auscultation showed bilateral inspiratory rales in the lower zones. Whole blood analysis results were as follows, with normal ranges in parentheses: leukocyte count: 0.4 x 106 L–1 (4.3-10.3 x 106 L–1); Hb: 10.8 g dL–1 (11.5-16.0 g dL–1); thrombocyte count: 173 x 109 L–1 (150-400 x109 L–1); MCV: 79 fL (80-100 fL); erythrocyte sedimenta-

tion rate: 120 mm h–1 (0-20 mm h–1). Serum biochemistry parameters were as follows, with normal ranges in parentheses: creatinine kinase: 574 U L–1 (<145 U L–1); aspartate aminotransferase: 30 U L–1 (<31 U L–1); alanine aminotransferase: 37 U L–1 (<34 U L–1); albumin: 1.9 g dL–1 (3.5-5.2 g dL–1); BUN: 44 mg dL–1 (6-22 mg dL–1); creatinine: 2.0 mg dL–1 (0.6-1.09 mg dL–1); Na: 132 mmol L–1 (135-145 mmol L–1); potassium: 2.5 mmol L–1 (normal range: 3.5-5.5 mmol L–1); lactate dehydrogenase: 349 IU L–1 (150-450 IU L–1); C-reactive protein: 19.9 mg L–1 (0-0.5 mg L–1). Other parameters were within the normal range. Posteroanterior (PA) chest radiography showed a bilateral non-homogenous density increase in the basals. The blood mercury level was 518 μg dL–1 and the urea mercury level was 180 µg dL–1 (normal range: 0-10 μg dL–1, in accord with the hospital laboratory reference). The blood mercury level was measured via the hydride method using an atomic absorption machine. In addition to chelation treatment with British anti-Lewisite (BAL) (2.5 mg kg–1) and N-acetyl cysteine (NAC), antibiotherapy and granulocyte colony-stimulating factors (GCSF) were administered. The patient’s general condition deteriorated on day 2 of hospitalization and her respiratory rate increased to 35 min–1. Arterial blood gas analysis showed severe hypoxemia. Her P O2/FiO2 was <200 mmHg. Follow-up PA radiography showed a progressive increase in bilateral density, as compared to the previous radiograph. Considering acute respiratory distress syndrome (ARDS), the patient was connected to a mechanical ventilator. The patient developed cardiac arrest and died on day 2 of mechanical ventilation. Autopsy was not performed because the patient’s firstdegree relatives did not consent. The next 4 cases [2-5] presented with varying symptoms 1 week after case 1. All 5 cases were relatives living in the same house. Case 1 was the mother, case 2 was a son of case 1, case 3 was a daughter-in-law, and cases 4 and 5 were daughters of case 1. Case 2 A 29-year-old male presented to our clinic with headache, gingival pain, and numbness in the arms and legs.

Yıldırım R, et al: Mercury Toxicity: A Family Case Report

There were no relevant findings noted during examination of all systems. Whole blood analysis results were as follows, with normal ranges in parentheses: leukocyte count: 1.3 L–1 (4.3-10.3 x 106 L–1); Hb 13.6 dL–1 (11.5-16.0 g dL–1); PLT count: 88 x 109 L–1 (150-400 x 109 L–1); MCV: 85 fL (80-100 fL). The erythrocyte sedimentation rate was 45 mm h–1 (normal range: 0-20 mm h–1). Serum biochemistry parameters were as follows, with normal ranges in parentheses: aspartate aminotransferase 49 L–1 (<31 U L–1); alanine aminotransferase 103 L–1 (<34 U L–1). Other parameters were within the normal range. Blood and urea mercury levels were high—54.4 μg dL–1 (normal range: 0-10 μg dL–1) and 140 μg dL–1, respectively. Electromyography (EMG) was performed due to severe numbness in the extremities, and showed rare fibrillation potentials and dense fasciculation muscle potentials in the distal muscles. These findings were considered indicative of toxic neuropathy. In addition to chelation treatment, GCSF, gabapentin, and vitamin B complex were also administered. On day 12 of hospitalization the patient’s leukocyte and PLT counts, and liver function were normal and a marked decrease in extremity numbness was noted. The patient was prescribed gabapentin and vitamin B complex, and then discharged. Case 3 A 22-year-old female presented to our clinic with headache, gingival pain, and numbness in the arms and legs that began 1 week earlier. There were no relevant findings noted during examination of all systems. Whole blood analysis results were as follows, with normal ranges in parentheses: leukocyte count: 5 L–1 (4.3-10.3 x 106 L–1); Hb: 10.6 dL–1 (11.5-16.0 g dL–1); PLT count: 123 x 109 L–1 (150-400 x 109 L–1); MCV: 83 fL (80-100 fL). Biochemical liver and kidney function tests were normal. The blood mercury level was 12.99 μg dL–1 (normal range: 0-10 μg dL–1). EMG showed rare fibrillation potentials and dense fasciculation muscle potentials in the distal muscles. These findings were considered indicative of toxic neuropathy. Chelation treatment, gabapentin, and vitamin B complex were administered. On day 10 of hospitalization the patient’s Hb and PLT levels were normal. The patient’s symptoms subsided and she was discharged with a prescription for gabapentin and vitamin B complex. Cases 4 and 5 A 20-year-old female (case 4) and 23-year-old female (case 5) presented to our clinic with fatigue and headache. There were no relevant findings noted during examination of all systems. Whole blood analysis and biochemical tests were normal. Blood mercury levels were high—51 μg dL–1

Turk J Hematol 2012; 29: 76-79

and 43 μg dL–1 (normal range: 0-10 μg dL–1), respectively. EMG was normal. Chelation treatment was administered. Both patients were discharged without any symptoms of disease. Discussion Mercury is a liquid element that is easily vaporized and inhaled at room temperature [6]. Acute inhalation of mercury vapors can lead to pneumonia, ARDS, progressive pulmonary fibrosis, and death. In addition, elemental (metallic) mercury can easily enter systemic circulation directly via the skin or inhalation of mercury vapors via the alveoli [7]. Universally, chelating agents, including dimercaptosuccinic acid (DMSA), dimercaprol (BAL), and 2,3-dimercaptopropane-1-sulphonate (DMPS), are used to treat mercury intoxication [1]. The presented family case included 5 members with elemental mercury intoxication due to inhalation of vapors and/or dermal contact. Case 1 suffered the most extensive exposure, and as such her clinical presentation was the most severe and she died. Clinical presentation in the other 4 cases was less severe, as they were exposed to a lesser degree. The literature contains reports of mercury poisonings that occurred in hospitals, homes, and schools due to broken thermometers, sphygmomanometers, and barometers containing mercury [8,9]. Mercury poisoning was diagnosed in 3 students that were examined due to hypertension; 2 of the students had rash, peripheral neuropathy, mild and moderate proteinuria, and central nervous system involvement [10]. Case 1 in the present study presented with febrile neutropenia and pneumonia, and she rapidly progressed to ARDS, and then died. Cases 2 and 3 had toxic peripheral neuropathy, which was confirmed via EMG. EMG findings in case 4 were normal and EMG could not be performed in case 5 due to technical reasons. GCSF was used to treat cases 1 and 2 due to neutropenia. Neutropenia in case 2 resolved with chelation treatment and GCSF within 10 d, but in case 1 (with more severe exposure) the disease progressed and she died. Anemia and thrombocytopenia were noted in case 3. With normal levels of leukocyte, ferritin, and vitamin B12, laboratory findings returned to normal values with chelation treatment. Clinical symptoms in all 5 cases were confirmed to be due to mercury exposure based on urea and/or whole blood analysis. Mercury quickly evaporates and pollutes the air we breathe. Glass mercury thermometers can break in the mouth, causing the inhalation and/or ingestion of mercury. Proper disposal of fluorescent light bulbs, which also contain mercury, and mercury thermometers is essential;

Turk J Hematol 2012; 29: 76-79

they shouldn’t simply be put out with the trash—in fact most cities and towns have ordinances prohibiting such disposal. The proper authorities must handle any spill using appropriate mercury decontamination kits and procedures. The presented study reported the varying clinical presentation of 5 family members exposed to liquid mercury via dermal contact and/or inhalation. Although a rare occurrence, we think that heavy metal exposure should be considered in patients that present with numerous symptoms involving multiple systems, including the skin, and cardiovascular, respiratory, and neurological systems. This family case report is unique in that it included 5 members of the same family. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Caravati EM, Erdman AR, Christianson G, Nelson LS, Woolf AD, Booze LL, Cobaugh DJ, Chyka PA, Scharman EJ, Manoguerra AS, Troutman WG; American Association of Poison Control Centers: Elemental mercury exposure: An evidence-based consensus guideline for out-of-hospital management. Clin Toxicol (Phila) 2008; 46: 1-21 2. Young J: Mercury In: Goldfrank LR editor. Goldfrank’s toxicology emergencies. Vol 74 New York: McGraw-Hill 1994; 1051-1062

Yıldırım R, et al: Mercury Toxicity: A Family Case Report

3. Nielsen JB, Andersen O: Methyl mercuric chloride toxicokinetics in mice. I: Effects of strain, sex, route of administration and dose. Pharmacol Toxicol 1991; 68: 201-207 4. Gosselin RE, Smith RP, Hodge HC. Mercury: Clinical Toxicology of Commercial Products, Section III, Therapeutic Index, 5th edn. Baltimore. Williams & Wilkins 1984; 262-271 5. Dales LG: The neurotoxicity of alkyl mercury compounds. Am J Med 1972; 53: 219-232 6. Taueg C, Sanfillipo DJ, Rowens B: Acute and chronic poisoning from residential exposures to elemtental mercuryMichigan 1989-1990. J Toxicol Clin Toxicol 1992; 30 (1): 63-67 7. Ford MD: Metals and Metalloids: Mercury. In Emergency Medicine: A Comprehensive Study Guide. 5th edition. Edited by: Tintinalli JE, Kelen GD, Stapczynski JS. Newyork, McGraw Hill 1999; 1191-1193 8. Koyun M, Akman S, Guven AG: Mercury intoxication resulting from school barometers in three unrelated adolescents. Eur J Pediatr 2004; 163: 131-134 9. Michaeli-Yossef Y, Berkovitch M, Goldman M: Mercury intoxication in a 2-year-old girl: A diagnostic challenge for the physician. Pediatr Nephrol 2007; 22: 903-906 10. Aschner M, Aschner JL: Mercury nenrotoxicity: Mechanisms of blood-brain barrier transport. Neurosci Biobehav Rev 1990; 14: 169-176

Letter to the Editor

DOI: 10.5505/tjh.2012.98360

Pancytopenia: An Etiological Profile Pansitopeni: Bir Etiyolojik Profil Vandana Raphael, Yookarin Khonglah, Biswajit Dey, Priyanka Gogoi, Ashim Bhuyan North Eastern Indira Gandhi Regional Institute of Health and Medical Sciences, Shillong, Meghalaya, India

To the Editor, Pancytopenia is the deficiency of all 3 cellular elements of blood, resulting in anemia, leucopenia, and thrombocytopenia. Pancytopenia may arise due to a number of disease processes that vary according to population, age, nutritional status, and the prevalence of infections [1]. Pancytopenia is a common hematological condition of varied etiology; however, only a few studies

on pancytopenia from the northeastern region of India have been published [2]. We analyzed the clinical details, hematological profile, and bone marrow findings in 80 patients that fulfilled the diagnostic criteria for pancytopenia between January 2007 and December 2009 in order to discern its etiology. The results of ancillary tests performed to confirm the etiology were also recorded The frequency of symptoms

Table 1: Etiological Profile of Pancytopenia

Diagnoses Megaloblastic anemia Dimorphic anemia Aplastic/Hypoplastic anemia Acute leukemia Hypersplenism due to portal hypertension Hypersplenism (NOS) Malaria Myelodysplastic syndrome (MDS) Myelofibrosis Enteric fever Kala azar (leishmaniasis) Systemic lupus erythematosus (SLE) Undiagnosed Total

Adults (>18 years) (n = 59)

Children (1-18 years) (n = 21)

Total number of patients (n = 80)

30 5 3 2 5 4 4 2 1 1 1 1 59

3 2 4 4 1 2 1 1 1 2 21

33 7 7 6 6 6 5 3 1 1 1 1 3 80

41.2 8.7 8.7 7.5 7.5 7.5 6.2 3.7 1.2 1.2 1.2 1.2 3.7 100

Address for Correspondence: Vandana Raphael, M.D., Neigrihms, Prof & HOD, Department of Pathology, Mawdiangdiang 793018 Shillong, Meghalaya, India Phone: +90 91 943 670 74 42 E-mail: raphaellyngdoh@gmail.com Received/GeliĹ&#x; tarihi : November 19, 2010 Accepted/Kabul tarihi : May 3, 2011

Turk J Hematol 2012; 29: 80-81

at presentation varied among the 80 patients, as follows: pallor (100%), fever (42.5%), splenomegaly (27.5%), hepatomegaly (25%), and bleeding (23.7%). Patients that were receiving chemotherapy for cancer were excluded from the study. Mean age of the patients was 30 years (range: 1-79 years) and the male:female ratio was 1:1.2. Megaloblastic anemia in adults and acute leukemia with aplastic/hypoplastic anemia in children were the most common causes (Table 1), as previously reported [3,4]. Pancytopenia is a common hematological condition encountered in clinical practice and has an extensive differential diagnosis. It should be suspected on clinical grounds in patients that present with unexplained anemia, fever, and a tendency to bleed. Bone marrow aspiration supported by biochemical investigation of such nutritional factors as serum iron, ferritin, vitamin B12, and folate levels, antinuclear antibodies, and serological tests for HIV and enteric fever will facilitate a correct diagnosis. Although it is not necessary to perform trephine biopsy in every case, it is of paramount importance in cases of aplastic anemia, which results in a dry tap. As such, routine bone marrow aspiration in every suspected case of pancytopenia is essential for diagnosis. Several studies conducted on mainland India on the etiology of pancytopenia in adults and children have been published [1,3,5]. The present study was conducted in Meghalaya, a region of India in which the tribal population constitutes 85% of the total population and a traditional daily diet of rice, meat, fermented food, and green leafy vegetables is still followed, unlike in other regions of India. Dairy products and pulses are not part of the daily diet in the study region. Alcohol, fermented betel nuts,

Raphael V, et al: Pancytopenia: An Etiological Profile

and tobacco are consumed by both men and women, irrespective of rural or urban habitation, level of income, and level of education [6]. In addition, malaria is endemic in the region. As such, the present study highlights the varied etiological pattern of pancytopenia in a region of northeastern India. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Gupta V, Tripathi S, Tilak V, Bhatia BD: A clinicohaematological profile of pancytopenia in children. Trop Doct 2008; 38: 241-243 2. Devi PM, Laishram RS, Sharma PS, Singh AM, Singh MK, Singh YM: Clinico-hematological profile of pancytopenia in Manipur, India. Kuwait Med J 2008; 40: 221-224 3. Bhatnagar SK, Chandra J, Narayan S, Sharma S, Varinder Singh, Dutta AK: Pancytopenia in children: Etiological profile. J Trop Pediatr 2005; 51: 236-239 4. Savage DG, Allen RH, Gangaidzo IT, Levy LM, Gwanzura C, Moyo A, Mudenge B, Kiire C, Mukiibi J, Stabler SP, Lindenbaum J: Pancytopenia in Zimbabwe. Am J Med Sci 1999; 317: 22-32 5. Kapur D, Agarwal KN, Agarwal DK: Nutritional anaemia and its control. Indian J Pediatr 2002; 69: 607-616 6. Murugkar AD, Pal PP: Food consumption pattern of the tribals of Meghalaya and its relation with socio-economic factors. Indian J Nutr Dietet 2005; 42 (2): 71-80

Letter to the Editor

DOI: 10.5505/tjh.2012.62533

Flow Cytometry: A Rapid and Robust Adjuvant Technique for Pathological Diagnosis Akım Sitometrisi: Patolojik Tanıda Hızlı ve Sağlam Adjuvan Bir Teknik Monica Jain1, Anil Handoo1, Dharma R Choudhary2, Atul Bhasin3 Dr B L Kapur Memorial Hospital, Department of Hematology, New Delhi, India Dr B L Kapur Memorial Hospital, Department of Clinical Hematology, New Delhi, India 3 Dr B L Kapur Memorial Hospital, Department of Internal Medicine, New Delhi, India 1 2

To the Editor, Flow cytometry is a powerful technique for correlating multiple characteristics of single cells. A series of 2 cases are described to illustrate the pivotal role of this technique in routine hematological diagnosis. Case 1 An 18-year-old male presented with a 10-d history of fever, sore throat, and hepatospleenomegaly. CBC revealed leukocytosis (19,000 mm–3), 71% atypical lymphoid cells with nuclei showing opened-up chromatin and a moderate quantity of cytoplasm mimicking lymphoblast/lymphoma cells, and an Hb of 11g dL–1 and PLT of 145,000 mm–3. Immunophenotyping was performed using CD45, CD19, CD3, CD5, CD7, CD4, CD8, CD38, CD56, kappa, and lambda light chains. Gating was performed using forward-side scatter and CD45-side scatter. A single large cluster observed in the lymphocyte region of the SSC/CD45 side scatter showed a high level of CD45 expression and was composed predominantly of T-cells (CD3+) with moderately high CD38 positivity (T-cell activation marker). Nothing abnormal with respect to T-cell markers (CD3/CD5/CD7) was noted. Reversal of the CD4:CD8 ratio (0.1) was also noted. CD19, kappa, lambda, and CD56 expression was not observed. Immu-

Address for Correspondence: Monica JaIn, M.D., Delhi State Cancer Institute, Dilshaad Garden, Delhi 95 Delhi, India Phone: +90 956 039 01 10 E-mail: drmonica123@gmail.com Received/Geliş tarihi : December 13, 2010 Accepted/Kabul tarihi : September 27, 2011

nophenotyping results suggested non-neoplastic proliferation of lymphocytes—primarily involving a T-cell component with an inverted CD4:CD8 ratio, which could also be a manifestation of immunosuppressive states and viral infections, e.g. EBV, CMV, and HIV [1]. EBV IgM was positive (17.58 U mL–1) (normal: < 8.00 U mL–1) and HIV antibody testing was negative; thus, the diagnosis of infectious mononucleosis was confirmed. Case 2 A 57-year-old female that was followed-up for multiple myeloma presented with severe pain around the rib cage. CBC showed hemoglobin-7.2g/dL and platelets-80 X 103/ µL with an occasional atypical lymphoid cell. Bone marrow aspirate was hemodilute, and showed large bizarre cells with prominent nucleoli. Immunophenotyping of bone marrow aspirate was performed using CD45, CD19, CD56, and CD38 (a limited panel of markers was used due to financial constraints). Gating was performed using forward-side scatter, CD45-side scatter, and CD19-SSC. Bone marrow showed a cell cluster comprising ~15% events in monocyte region of the FSC/SSC dot plot. A CD45/SSC dot plot showed dim CD45 expression with moderate SSC expression; the cells were CD19 negative, and exhibited high-level CD38 and variable CD56 expression. The morphology and immunophenotypic profile were consistent with relapsed multiple myeloma.

Turk J Hematol 2012; 29: 82-84

Figure 1: Morphology of cells.

Flow cytometric immunophenotyping remains an indispensable tool for the diagnosis, classification, staging, and monitoring of hematologic neoplasms. It is a rapid and robust adjuvant technique for the diagnosis of hematolymphoid neoplasms, and can be easily performed using peripheral blood or bone marrow aspirate material for diagnostic confirmation. Reactive lymphocytosis is common in children with viral infections; however, when circulating lymphocytes are large and have atypical features their immature and uniform appearance indicate the possibility of a hematolymphoid neoplasm. In such instances peripheral blood flow cytometry is an important tool for excluding neoplastic pathology without subjecting patients to the procedure of Bone marrow. Aspiration/biopsy. Research has shown that acute infectious mononucleosis is characterized by an activated CD8+ T-cell population and antigenic down regulation of CD7, and or CD5, in addition to a decrease in B-cells and the CD4:CD8 ratio [2]. Case 1 had ≈94% T-cells with a CD4:CD8 ratio of 0.1; however, nothing abnormal related to CD5 or CD7 was noted. Most cases of plasma cell dyscrasia are diagnosed without Flow cytometry; however, it may be useful in certain patients with hematologic abnormalities and an elevated level of plasma cells in the bone marrow and without specific clinical manifestations [3]. Flow cytometry may also be helpful in the differential diagnosis of unusual cases of Multiple Myeloma [4]. Case 2 had been followed-up for multiple myeloma and the bone marrow aspirate exhibited abnormal bizarre lymphoplasmacytic cells. Immunofixation electrophoresis showed only a faint band in the early gamma-region. Normal immunoglobulins were also noted in the IgG and kappa lanes; therefore, flow cytometry was performed in

Jain M, et al: Flow Cytometry for Pathological Diagnosis

order to rule out any other secondary malignancy [5]. Normal plasma cells are polyclonal and exhibit high-level CD38 and CD19, and variable CD45 expression, but no CD56 expression. In contrast, malignant plasma cells are monoclonal and exhibit lower levels of CD38 expression; CD45 is generally expressed at a low level, and CD19 is undetectable, whereas CD56 expression is high [6]. CD38 is a non-specific marker that can be observed on activated T-cells and B-cells. CD138 gating identifies a much more homogeneous population of myeloma cells than does CD38 gating. Thus, the combination of CD38 and CD138 is superior to CD38 alone for identifying CD45+ myeloma [7]. Due to financial constraints a single tube with 4 markers was used in case 2, which showed low-level CD45, high-level CD38, variable CD56, and no CD19 expression. In conclusion, flow cytometric immunophenotyping is a powerful and rapid technique for correlating multiple phenotypic characteristics of single cells. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Almeida M, Cordero M, Almeida J, López A, Orfao A: CD38 on peripheral blood cells: The value of measuring CD38 expression on CD8 T-cells in patients receiving highly active anti-retroviral therapy. Clinical and Applied Immunology Reviews, 2002; 2 (6): 307-320 2. Milena Karcheva, Lukanov TZ, Gecheva S, Slavcheva V, Veleva G, Nachev R: Infectious Mononucleosis - diagnostic potentials. Journal of IMAB - Annual Proceeding (Scientific Papers) 2008, book 1 3. Braylan RC: Impact of flow cytometry on the diagnosis and characterization of lymphomas, chronic lymphoproliferative disorders and plasma cell neoplasias. Cytometry A 2004; 58: 57-61 4. Rawstron AC, Orfao A, Beksac M, Bezdickova L, Brooimans RA, Bumbea H, Dalva K, Fuhler G, Gratama J, Hose D, Kovarova L, Lioznov M, Mateo G, Morilla R, Mylin AK, Omedé P, Pellat-Deceunynck C, Perez Andres M, Petrucci M, Ruggeri M, Rymkiewicz G, Schmitz A, Schreder M, Seynaeve C, Spacek M, de Tute RM, Van Valckenborgh E, Weston-Bell N, Owen RG, San Miguel JF, Sonneveld P, Johnsen HE; European Myeloma Network: Report of the European Myeloma Network on multiparametric flow cytometry in multiple myeloma and related disorders. Haematologica 2008; 93 (3): 431-438

Jain M, et al: Flow Cytometry for Pathological Diagnosis

5. Erikci AA, Ozturk A, Tekgunduz E, Sayan O: Acute myeloid leukemia complicating multiple myeloma: A case successfully treated with etoposide, thioguanine and cytarabine. Clin Lymphoma Myeloma 2009; 9 (4): 14-15 6. Kawano MM, Mihara K, Tsujimoto T, Huang N, Kuramoto A: A new phenotypic classification of bone marrow plasmacytosis. Int J Hematol 1995; 61: 179-188

Turk J Hematol 2012; 29: 82-84

7. Lin P, Owens R, Tricot G, Wilson CS: Flow Cytometric Immunophenotypic Analysis of 306 Cases of Multiple Myeloma. Am J Clin Pathol 2004; 121: 482-488

Letter to the Editor

DOI: 10.5505/tjh.2012.21704

Corneal Epithelial Microcysts due to High-Dose Cytarabine Administration in a Pediatric Acute Myeloid Leukemia Patient Pediatrik Akut Miyeloid Lösemili Hastada Yüksek Doz Sitarabin Uygulamasına Bağlı Korneal Epitel Mikrokistler Tuba Hilkay Karapınar1, Salih Gözmen1, Özlem Tüfekçi1, Şebnem Yılmaz1, Zeynep Özbek2, Melih Parlak2, Gülersu İrken1, Hale Ören1 Dokuz Eylul University, School of Medicine, Department of Pediatric Hematology, Balcova, Izmir, Turkey Dokuz Eylul University, School of Medicine, Department of Ophthalmology, Balcova, Izmir, Turkey

1 2

To the Editor, Over the past 2 decades the advent of new therapeutic strategies has led to remarkable progress in the treatment of acute myeloid leukemia (AML) [1]; however, some serious side effects of treatment may be clinically apparent [2]. An 8-year-old boy was diagnosed as AML and started on AML-BFM 2004 therapy in August 2009. There were no important side effects observed until the initiation of hAM block treatment (1 g m–2 of cytarabine every 12 h on d 1-3 and 10 mg·m–2·d–1 of mitoxantrone on d 3). We have written informed consent. On d 6 of hAM block treatment the patient complained of a burning sensation in his eyes and photophobia. Ophthalmologic consultation showed bilateral multiple diffuse corneal epithelial microcysts and mild superficial punctate epitheliopathy (Figure 1). The remainder of the ophthalmologic examination was normal. Conservative management with topical artificial teardrops and followup was planned. The patient’s ophthalmologic complaints reduced in severity within 5 d and the corneal findings decreased and disappeared within 3 weeks.

The patient’s next block treatment was HAE block and consisted of a higher dose of cytarabine (3 g m–2 every 12 h on d 1-3) than did the haM block treatment (1 g m–2 cytarabine), and also included 125 mg·m–2·d–1 of etoposide on d 2-5. High-dose cytarabine (1 g 100 mL–1 concentration in 5% dextrose) was given for 3 h this time. Topical artificial tears were continued every 2 h together with artificial tear gel b.i.d. Photophophia and the burning sensation in the patient’s eyes recurred, but resolved 3 d after drug cessation. Systemic medications may reach the cornea via the tear film, aqueous humor, or limbal vasculature [3]. Corneal changes may result in reduced visual acuity, photophobia, and ocular irritation—symptoms that typically resolve following drug cessation. Ocular side effects of systemic medications are often dose-related and transient. High doses of systemic drugs may lead to progressive lenticular changes as well as irreversible retinal toxicity [3]. Cytarabine is a cell cycle-specific (S phase) antimetabolite that inhibits DNA synthesis. Cytarabine exerts its greatest effect on rapidly dividing cells, and may be toxic

Address for Correspondence: Tuba Hilkay Karapınar, M.D., Dokuz Eylül Üniversitesi, Tıp Fakültesi, 35140, Balcova, İzmir, Turkey Phone: +90 232 412 48 88 E-mail: thkarapinar@yahoo.com Received/Geliş tarihi : November 25, 2010 Accepted/Kabul tarihi : March 28, 2011

Hilkay KarapÄąnar T, et al: Cytarabine Depositions on the Cornea

Figure 1: Photograph depicting multiple corneal epithelial microcysts.

to the corneal epithelium, despite its use as a topical agent [2]. Systemic use at high doses may also produce corneal and conjunctival epithelial toxicity, with conjunctival hyperemia, punctate keratopathy, and corneal epithelial microcysts [4]. Histopathologic examination shows profound degeneration of the rapidly dividing basal epithelial cells, which leads to formation of epithelial microcysts. Cytarabine may be administered intravenously or intrathecally, with ocular symptoms typically developing within 1 week of initiation. Cytarabine penetrates the blood-brain barrier following intravenous injection and may affect the cornea via both the aqueous humor and tears. Visual symptoms include tearing, photophobia, foreign body sensation, pain, and reduced visual acuity [4]. It is suggested that ocular toxicity results from the inhibition of corneal epithelial DNA synthesis, and is related to both drug dosage and duration of use [5]. We presented a case of corneal epithelial microcysts associated with high-dose cytarabine treatment. Clinicians should consider corneal epithelial microcysts in patients that experience tearing, photophobia, pain, and reduced visual acuity following cytarabine treatment. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2012; 29: 85-86

Figure 2: Photograph shows clear cornea 1 month after the treatment.

References 1. Kaspers GJ, Zwaan CM: Pediatric acute myeloid leukemia: Towards high-quality cure of all patients. Haematologica 2007; 92: 1519-1532 2. Oeffinger KC, Nathan PC, Kremer LCM: Challenges after curative treatment for childhood cancer and long term follow up of survivors. Hematol Oncol Clin N Am 2010; 24: 129-149 3. Hollander DA, Aldave AJ: Drug-induced corneal complications. Curr Op Ophtalmol 2004; 15: 541-548 4. Hopen G, Mondino BJ, Jhonson BL, Chervenick PA: Corneal toxicity with systemic cytarabine. Am J Ophthalmol 1981; 91: 500-504 5. Ritch PS, Hansen RM, Heuer DK: Ocular toxicity from highdose cytosine arabinoside. Cancer 1983; 51: 430-432

Letter to the Editor

DOI: 10.5505/tjh.2012.49091

Blood Donation: Survey Results Kan Bağışı: Anket Sonuçları Gürsel Ersan1, Fatma Liv1, Şükran Köse2 1 2

İzmir Tepecik Education and Research Hospital, Blood Center, İzmir, Turkey İzmir Tepecik Education and Research Hospital, Department of Infectious Diseases and Clinical Microbiology, İzmir, Turkey

To the Editor, A survey of 1735 blood centers (131) and hospitals (1604) in the US showed that blood collection rate per thousand US population of donor age between 18 and 65 years decreased from 85.6 (total number of collections, 13.890) in 2004 compared to 88.0 (total number of collections, 14.259) in 2001 (2.7 % decrease). As blood utilization increases with the advent of more complex therapeutic interventions, blood collection centers are finding it difficult to maintain an adequate blood inventory because the availability of blood for transfusion is dependent on volunteer donors [1]. In the US approximately 40% of the adult population is eligible to donate blood, but just 5% about 5% do so [2]. Moreover, only 3.5% of the age-eligible population donates blood in Australia. Donation anxiety due to a previous blood donation experience might be a major predictor of a donor’s future intention not to donate blood. Providing easy access to donation sites, overcoming time demands (such as scheduling appoinments for donation hours) and feeling confident for the procedure, more flexible donation hours, and increasing the number of sites where donation take place have positively influenced blood donation intentions [3]. The present study aimed to determine blood donors’ perceptions of the blood donation experience, behavioural and affective attitudes toward donation, and demographic characteristics that may influence their intention to donate blood in the future. A self-administered questionnaire was used to collect data on the level of education, level of knowledge about blood donation, affective, and psychological components

on blood donation decision emotional status, assessments of the physical condition of the blood donation center, treatment of donors by the staff who provide the technical and administrative oversight of blood donation, and the adequacy of informations provided in the blood Table 1: Donor Demographic Characteristics, Educational Status, and Monthly Income

Donors Age (years) 18-30 31-40 41-50 51-65 Gender Female Male Level of Education Primary school High school University Monthly Income (€) <250 250-500 500-750 >750

760 780 320 140

38 39 16 7

120 1880

6 94

940 700 360

47 35 18

380 820 480 320

19 41 24 16

Address for Correspondence: Gürsel Ersan, M.D., İzmir Tepecik Eğitim ve Araştırma Hastanesi, Kan Merkezi Yenişehir, Konak, İzmir, Turkey Phone: +90 232 469 69 69 E-mail: ersangursel@gmail.com Received/Geliş tarihi : March 8, 2011 Accepted/Kabul tarihi : August 3, 2011

Ersan G, et al: Results of a Questionnaire About Blood Donation

donation form, satisfaction with the pre-donation physical examination, intend to return to the same center for future donations preference of the center for future, and perceptions of blood donation from 2000 first-time and repeat blood donors. The survey results show that more males than females donated blood, which may have been due to a prevalence of iron deficiency anemia among Turkish females resulting in ineligibility for donation or to inadequecy of women socialization in our country to participate in blood donation organizations. The Table 1 shows the donors’ demographic characteristics, distribution according to level of education, and regular monthly income. Increasing awareness of the importance of blood donation via education increased the number of volunteer donors that were more educated in developed countries. In the present study altruism was commonly (75%) reported as the reason for donating blood, as previously reported [3]. The belief of acquiring merit in God’s sight rated secondly (17 %), and lastly self-health issues perceived as “Blood donation is good for my health” (14%) determined donation intentions [4-9]. We think that increasing the sites where blood donation take place and improving the accessibility to these centers, implementation of educational programs designed to increase the awareness of blood donation among target populations (e.g. women), coping with the concerns about discomfort and fear of the donation experience, and creating attractive incentives for future donation might positively influence the rate of blood donation. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2012; 29: 87-88

References 1. Nguyen DD, Devita DA, Hirschler NV, Murphy EL: Blood donor satisfaction and intention of future donation. Transfusion 2008; 48 (4): 742-748 2. France JL, France CR, Himawan LK: A path analysis of intention to redonate among experienced blood donors: An extension of the theory of planned behavior. Transfusion 2007; 47 (6): 1006-1013 3. Masser BM, White KM, Hyde MK, Terry DJ, Robinson NG: Predicting blood donation intentions and behavior among Australian blood donors: Testing an extended theory of planned behavior model. Transfusion 2009; 49 (2): 320-329 4. Lemmens KP, Abraham C, Hoekstra T, Ruiter RA, De Kort WL, Brug J, Schaalma HP: Why don’t young people volunteer to give blood? An investigation of the correlates of donation intentions among young nondonors. Transfusion 2005; 45 (6): 945-955 5. Wu Y, Glynn SA, Schreiber GB, Wright DJ, Lo A, Murphy EL, Kleinman SH, Garratty G; Retrovirus Epidemiology Donor Study (REDS) Group: First-time blood donors: Demographic trends. Transfusion 2001; 41 (3): 360-364 6. Ownby HE, Kong F, Watanabe K, Tu Y, Nass CC: Analysis of donor return behavior. Retrovirus Epidemiology Donor Study. Transfusion 1999; 39 (10): 1128-1135 7. Gillespie TW, Hillyer CD: Blood donors and factors impacting the blood donation decision. Transfus Med Rev 2002; 16 (2): 115-130 8. France CR, France JL, Wissel ME, Kowalsky JM, Bolinger EM, Huckins JL: Enhancing blood donation intentions using multimedia donor education materials. Transfusion 2011; 51 (8): 1796-1801 9. Cevizci S, Erginoz E, Yuceokur A: Gönüllü Kan Bağışçılığı ve Kan Verme Davranışını Etkileyen Faktörler. Turkiye Klinikleri J Cardiovasc Sci 2010; 22 (1): 85-92

Letter to the Editor

DOI: 10.5152/tjh.2011.47

Endothelial Protein C Receptor gene Expression in a Female with Homozygous EPCR gene 23-bp Insertion Homozigot EPCR 23-baz çifti Insersiyona Sahip Kadın Bireyde Endotelyal Protein C Reseptörü Gen Ekspresyon Seviyesi Afife Karabıyık, Nejat Akar Ankara University, School of Medicine, Department of Pediatric Molecular Genetics, Ankara, Turkey

To the Editor, Endothelial protein C receptor (EPCR) is an essential component of the protein C (PC) anticoagulant pathway and is important for regulation of coagulation [1-3]. EPCR has a transmembrane domain, extracellular domains, and a very short cytoplasmic tail, and is primarily localized on the endothelial cells of large blood vessels. The human EPCR gene is located on chromosome 20q11.2, and has 4 exons and 3 introns [4,5]. EPCR has both an endothelial cell-specific transmembrane form and a soluble form that arises via metalloprotease cleavage [6]. To date, several polymorphisms and mutations— including a 23-bp insertion—have been reported on the human EPCR gene. The EPCR gene 23-bp insertion TATCCACAGTTCCTCTGACCATC is located between intron 2 and exon 3 (nt4031), and is related to thrombotic risk and myocardial infarction [7-10]. Exons 2 and 3 encode most of the extracellular region of the EPCR gene [5]. This insertion of 23 nucleotides preceding the insertion point (nt4031) introduces a frameshift and premature stop that deletes the entire alpha 2 domain of the gene [10]. The truncated protein results in absence of the cytoplasmic tail, transmembrane domain, and part of the extracellular domain. As such, this mutation is probably a good model for an EPCR null-allele.

Homozygous null mice embryos died prior to embryonic d 10.5, and it was reported that EPCR is essential for normal embryonic development and plays a key role in preventing thrombosis at the maternal-embryonic interface [11,12]. The homozygous state of EPCR gene 23-bp insertion is very rare, and we only reported it once before in a 8-month-old boy with sepsis [13]. Herein we report a 25-year-old female with homozygous 23-bp insertion of the EPCR gene. The patient had experienced abortus twice, and then gave birth following antiplatelet (aspirin) therapy. She was referred for evaluation of thrombotic risk factors to us. The family history was negative for thrombotic disease. Informed consent was provided by the patient. Her DNA was examined for factor V 1691 and prothrombin 20210 mutations, and she carried normal alleles. Factor VIII, factor IX, protein C, antithrombin, protein S, homocysteine, and lipoprotein (a) levels were normal. Plasma sEPCR was 227 ng mL–1 (38-132 ng mL–1), which was measured via enzymelinked immunosorbent assay (ELISA) (Diagnostica Stago Asserachrom sEPCR, Asnieres-France). EPCR gene exon 3 amplification was performed using primers 5’-ACACCTGGCACCCTCTCT-3’ and 5’CATCCTTCAGGTCCATCC-3’ at an annealing temperature of 58 °C. To detect the 23-bp insertion the PCR product was electrophoresed in 3% agarose gel and stained with ethidium bromide. The patient

Address for Correspondence: Afife Karabıyık, M.D., Suadiye Cad. 38/3 06190 Yenimahalle, Ankara, Turkey Phone: +90 312 595 63 48/115 E-mail: afifekrbyk@gmail.com Received/Geliş tarihi : November 12, 2010 Accepted/Kabul tarihi : January 12, 2011

Karabıyık A and Akar N: EPCR Expression and Homozygous 23-bp Insertion

Turk J Hematol 2012; 29: 89-91

alive, but also gave birth to a healthy child. As the patient had abortus twice, we think that homozygous 23-bp insertion might affect the fetus negatively by causing hypercoagulability. There is a strong association between anti-EPCR autoantibodies and the risk of fetal death. High levels of IgM and IgG anti-EPCR in humans are associated with a high risk of a first episode of fetal death [14]. EPCR gene 23-bp insertion in women with fetal loss is more prevalent than in women that have given birth to ≥1 healthy baby and have no history of late fetal death [11]. The data obtained in the presented case show that 23-bp homozygous mutation of the EPCR gene in humans is compatible with life. Additional research—including cases with homozygous 23-bp insertion mutations—is needed to clarify the possible effects of the insertion. Conflict of Interest Statement Figure 1: The EPCR mRNA level in the patient (1.7-fold higher) and control.

was homozygous for the EPCR gene 23-bp insertion mutation, and her father, mother, and child were heterozygous for the insertion. RNA was isolated from blood samples obtained from the index case and a control, and then the level of expression of EPCR mRNA was determined (Roche Light Cycler 1.5, Basel, Switzerland), following RNA isolation and cDNA synthesis (Roche, Switzerland). Quantitative realtime (RT)-PCR was used to measure gene expression using EPCR-specific fluorescent marked UPL probes (Probe 50) and primers (EPCRF 5’-GTAGCCAAGACGCCT-3’, EPCRR 5’-GATAGGGGTCGCGGA-3’) (Roche, Switzerland). The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) housekeeping gene was used for normalization of EPCR gene expression data. All experiments were performed twice. Statistical analysis of the results was performed using two-way ANOVA (GraphPad Prism v.5.00, GraphPad Software, San Diego, California, USA, http:// www.graphpad.com). The patient’s EPCR mRNA level was 1.7-fold higher than that of the control, as shown in the Figure 1. Because of the premature stop of the EPCR protein, which was due to the 23-bp homozygous insertion, her EPCR expression level could be higher than the control that has normal EPCR gene 23-bp mutation allele. This can be explained by the EPCR protein requirement. Disruption of the EPCR gene in mice leads to early embryonic death [12]. The presented case is not only

The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Esmon CT: The protein C pathway. Chest 2003; 124 (3 Suppl): 26-32 2. Nagai M, Terao S, Yilmaz G, Yilmaz CE, Esmon CT, Watanabe E, Granger DN: Roles of inflammation and the activated protein C pathway in the brain edema associated with cerebral venous sinus thrombosis. Stroke 2010; 41 (1): 147-152 3. Taylor FB Jr, Peer GT, Lockhart MS, Ferrell G, Esmon CT: Endothelial cell protein C receptor plays an important role in protein C activation in vivo. Blood 2001; 97; 1685-1688 4. Nayak RC, Sen P, Ghosh S, Gopalakrishnan R, Esmon CT, Pendurthi UR, Rao LV: Endothelial cell protein C receptor cellular localization and trafficking: Potential functional implications. Blood 2009; 114 (9): 1974-1986 5. Simmonds RE, Lane DA: Structural and functional implications of the intron / exon organization of the human endothelial cell protein C / activated protein C receptor (EPCR) gene: Comparisons with the structure of CD1 / major histocompatibility complex alpha1 and alpha2 domains. Blood 1999; 94: 632-641 6. Kurosawa S, Stearns-Kurosawa DJ, Hidari N, Esmon CT: Identification of functional endothelial protein C receptor in human plasma. J Clin Invest 1997; 100: 411-418 7. Akar N, Gökdemir R, Ozel D, Akar E: Endothelial cell protein C receptor (EPCR) gene exon III, 23 bp insertion mutation in the Turkish pediatric thrombotic patients. Thromb Haemost 2002; 88 (6): 1068-1069

Turk J Hematol 2012; 29: 89-91

8. Karabıyık A, Yılmaz E, Egin Y, Akar N: The effects of Endothelial Protein C Receptor Gene Polymorphisms on sEPCR levels in Venous Thrombotic Patients. Turk J Hematol 2010 (in press) 9. Zecchina G, Bosio S, Brusa E, Rege-Cambrin G, Camaschella C: EPCR 23 bp insertion in a patient with severe progressive arterial disease: A dominant loss of function mutant in conditions of increased APC request? Br J Haematol 2002; 119 (3): 881-882 10. Biguzzi E, Merati G, Liaw PC, Bucciarelli P, Oganesyan N, Qu D, Gu JM, Fetiveau R, Esmon CT, Manucci PM, Faioni EM: A 23 bp insertion in the endothelial protein C receptor (EPCR) gene impairs EPCR function. Thromb Haemost 2001; 86: 945-948 11. Franchi F, Biguzzi E, Cetin I, Facchetti F, Radaelli T, Bozzo M, Pardi G, Faioni EM: Mutations in the thrombomodulin and endothelial protein C receptor genes in women with late fetal loss. Brit J Haemat 2001; 114: 641-646

Karabıyık A and Akar N: EPCR Expression and Homozygous 23-bp Insertion

12. Gu JM, Crawley JT, Ferrell G, Zhang F, Li W, Esmon NL, Esmon CT: Disruption of the endothelial cell protein C receptor gene in mice causes placental thrombosis and early embryonic lethality. J Biol Chem 2002; 277: 43335-43343 13. Kendirli T, Ciftçi E, Ince E, Yurdakul E, Kansu A, Akar N: Homozygous 23-bp insertion of endothelial protein c receptor gene in a child with fatal sepsis. Pediatr Hematol Oncol 2007; 24 (3): 199-204 14. Hurtado V, Montes R, Gris JC, Bertolaccini ML, Alonso A, Martínez-González MA, Khamashta MA, Fukudome K, Lane DA, Hermida J: Autoantibodies against EPCR are found in antiphospholipid syndrome and are a risk factor for fetal death. Blood 2004; 104 (5): 1369-1374

Letter to the Editor

DOI: 10.5505/tjh.2012.26539

Rituximab Therapy for Refractory Autoimmune Thrombocytopenia in Patients with Systemic Lupus Erythematosus Sistemik Lupus Eritematozus’lu Refrakter Otoimmun Trombositopenili Hastada Rituximab Tedavisi Didem Atay1, Gülyüz Öztürk2, Sema Anak2, Ömer Devecioğlu2, Ayşegül Ünüvar2, Zeynep Karakaş2, Leyla Ağaoğlu2 Okmeydani Education and Research Hospital, Department of Pediatric Hematology and Oncology, İstanbul, Turkey Istanbul University, Istanbul School of Medicine, Department of Pediatric Hematology, Oncology, BMT, İstanbul, Turkey

1 2

To the Editor, Systemic lupus erythematosus (SLE) and autoimmune polyendocrinopathy are characterized by autoantibodies against a variety of target organs. Traditional treatment strategies for immune cytopenias include global immunosuppression that targets both the humoral and cell-mediated arms of the immune system. B-cells play an important role in the pathogenesis of many autoimmune diseases. Targeted depletion of B-lymphocytes is an alternative treatment approach for autoimmune disorders. Rituximab—a chimeric, human IgG1K monoclonal antibody—is specific for the CD20 antigen and can selectively deplete B-cells via antibody-dependent cell-mediated cytotoxicity, complement-mediated cytotoxicity, and inhibition of cell proliferation with direct induction of B-cell apoptosis. Several studies have shown the efficacy and safety of rituximab in the treatment of autoimmune disorders [1-5]. Herein we describe a 16-year-old male with SLE-associated hemophagocytic syndrome (HPS), autoimmune hemolytic anemia (AIHA), and thrombocytopenia (AITP), as well as recurrent profound thrombocytopenia refractory to glucocorticosteroids, intravenous immune globulin (IVIG) therapy, mycophenolate mofetil (MMF), and plasmapheresis. Four years after initially presenting with SLE,

the patient was admitted to our hematology department with severe thrombocytopenia and anemia; the hemoglobin level was 8.5 g dL–1, the white blood cell count (WBC) was 5000 mm–3, and the platelet (PLT) count was 3000 mm–3. Poikilocytosis, anisocytosis, schistocytosis, spherocytosis, target cells, and few thrombocytes were observed in the blood smear. Lactate dehydrogenase was elevated (446 U L–1) and the reticulocyte count was 1.07%. Direct antiglobulin test was 1(+) for complement (C3d) and IgG. C3 and C4 levels were decreased to 0,26 g/l and <0,10 g/l. Antinuclear antibodies and anti-double stranded DNA antibodies were noted. Urinalysis showed urinary protein excretion of 2 g d–1. Renal biopsy could not be performed because of thrombocytopenia. Bone marrow aspiration showed elevated histiocytes with evidence of hemophagocytosis. The patient was therefore diagnosed as SLE-associated HPS, AIHA, and AITP, and was treated with IVIG (0.4 g·kg–1·d–1 for 5 d) and methylprednisolone (1 m g·kg–1·d–1), but severe thrombocytopenia persisted (PLT count: 7000 mm–3). Pulse steroid (1 g d–1 dieb. alt.) and plasmapheresis (6 times) were administered, but the patient did not respond (PLT count: 8000 mm–3). With MMF therapy (400 mg m–2 b.i.d.) the PLT count increased to 163,000 mm–3, but decreased again to 1000 mm–3 after 3 months. Despite

Address for Correspondence: Didem Atay, M.D., Kartaltepe Mahallesi Dost Sokak Motif Apt. No: 5 D: 11 34414 Bakırköy, İstanbul, Turkey Phone: +90 212 221 77 77/5740 E-mail: didematay@hotmail.com Received/Geliş tarihi : July 5, 2011 Accepted/Kabul tarihi : September 19, 2011

Turk J Hematol 2012; 29: 92-93

Atay D, et al: Rituximab Therapy for Refractory Autoimmune Thrombocytopenia

repeated high-dose steroid and IVIG treatment together with MMF, a permanent response was not achieved. Chronic corticosteroid treatment subsequently led to growth retardation, osteoporosis, hypertension, glaucoma, and myopathy. Due to the side effects of corticosteroids a slow tapering of oral steroids was started. Only two weeks later, he relapsed again with severe thrombocytopenia. After written informed consent was obtained from the family, rituximab 375 mg m–2 QWK was started (in total, 4 doses). Chlorpheniramine (0.02 mg kg–1 i.v.) and paracetamol (10 mg kg–1 p.o.) were administered 15 min prior to each rituximab infusion. This was well tolerated and the PLT count recovered to 240,000 mm–3 after 4 weeks of the treatment (10,500 mm–3 after 1 week, 84,000 mm–3 after 2 week, and 80,000 mm–3 after 3 weeks (Table 1). At the time this manuscript was written the patient had been in remission for 49 months. The patient exhibited slow regeneration of peripheral B-cells (total number of CD19 and 20 cells)—although with subnormal counts—49 months after treatment, and he was being maintained on a regimen of MMF and methylprednisolone for lupus nephritis. The patient did not require immunoglobulin substitution due to rituximab therapy. To date, infectious complications have not been observed. The efficiency of rituximab in patients with childhoodonset SLE and severe autoimmune cytopenia has been reported in a variety of series and case reports [6-8]. The drug was generally well tolerated; most children with AIHA or AITP remained disease-free. Treatment-related toxicity is primarily due to infusion-related events. In the presented case rituximab therapy was successful in treating autoimmune cytopenias, but SLE remained active, as lupus nephritis and cutaneous lupus. As such, the persistence of rituximab’s effectiveness in treating SLE remains unclear. In conclusion, rituximab therapy shows promise as an alternative to intensive immunosuppressive therapy Table 1: Hemoglobin and Thrombocyte Levels During Rituximab Therapy Week

Hemoglobin level (g dL–1)

Thrombocyte level (mm–3)

8.8

10,500

8.6

84,000

8.0

80,000

8.0

240,000

and splenectomy in children with autoimmune cytopenias that are resistant to first-line therapy and cyclosporin/ MMF. In cases of the recurrence of thrombocytopenia or anemia, a second treatment course is feasible and may successfully control the disease. Additional research is necessary to better understand the role of rituximab in this patient population. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Kazkaz H, Isenberg D: Anti B cell therapy (rituximab) in the treatment of autoimmune diseases. Curr Opin Pharmacol. 2004; 4(4):398-402 Review. 2. Mantadakis E, Danilatou V, Stiakaki E, Kalmanti M: Rituximab for refractory Evans syndrome and other immune-mediated hematologic diseases. Am J Hematol 2004; 77 (3): 303-310 3. Zecca M, Nobili B, Ramenghi U, Perrotta S, Amendola G, Rosito P, Jankovic M, Pierani P, De Stefano P, Bonora MR, Locatelli F: Rituximab for the treatment of refractory autoimmune hemolytic anemia in children. Blood 2003; 101: 3857-3861 4. Rao A, Kelly M, Musselman M, Ramadas J, Wilson D, Grossman W, Shenoy S: Safety, efficacy and immune reconstitution after rituximab therapy in pediatric patients with chronic or refractory hematologic autoimmune cytopenias. Pediatr Blood Cancer 2008; 50: 822-825 5. Bennett CM, Rogers ZR, Kinnamon DD, Bussel JB, Mahoney DH, Abshire TC, Sawaf H, Moore TB, Loh ML, Glader BE, McCarthy MC, Mueller BU, Olson TA, Lorenzana AN, Mentzer WC, Buchanan GR, Feldman HA, Neufeld EJ: Prospective phase 1/2 study of rituximab in childhood and adolescent chronic immune thrombocytopenic purpura. Blood 2006; 107: 2639-2642 6. Robak T: Monoclonal antibodies in the treatment of autoimmune cytopenias. Eur J Haematol 2004; 72: 79-88 7. Kumar S, Benseler SM, Allen MK, Silverman ED: B-cell depletion for autoimmune thrombocytopenia and autoimmune hemolytic anemia in pediatric systemic lupus erythematosus. Pediatrics 2009; 123 (1): 159-163 8. Willems M, Haddad E, Niaudet P, Koné-Paut I, Bensman A, Cochat P, Deschênes G, Fakhouri F, Leblanc T, Llanas B, Loirat C, Pillet P, Ranchin B, Salomon R, Ulinski T, BaderMeunier B; French Pediatric-Onset SLE Study Group: Rituximab therapy for childhood-onset systemic lupus erythematosus. J Pediatr 2006; 148 (5): 623-627

Letter to the Editor

DOI: 10.5505/tjh.2012.59244

Early Profound Secondary Autoimmune Thrombocytopenia Induced by Clopidogrel in a Patient with a Coronary Artery Stent Koroner Arter Stent Hastasında Klopidogrel İlişkili Erken Derin Otoimmün Trombositopeni Volkan Karakuş1, Burak Deveci1, Erdal Kurtoğlu1, Şakir Arslan2 Antalya Research and Training Hospital, Department of Hematology, Antalya, Turkey Antalya Research and Training Hospital, Department of Cardiology, Antalya, Turkey

1 2

To the Editor, Clopidogrel in combination with aspirin is commonly used for the prevention of thrombosis in patients with coronary artery stents [1]. Moreover, since being introduced clopidogrel has proven to be very safe, tolerable, and efficacious [2]. Indications for clopidogrel use are expanding, and include reduction of such cardiovascular events as myocardial infarction and stroke in appropriate patients. As the use of clopidogrel increases, uncommon side effects are encountered more frequently [3]. Autoimmune thrombocytopenia is an extremely rare adverse effect of clopidogrel therapy [4]. We report a case of autoimmune thrombocytopenia related to standard clopidogrel treatment in a patient 2 days after coronary stenting. A 63-year-old male presented with acute inferior myocardial infarction, which was treated with primary stenting; heparin was administered periprocedurally. The patient was given aspirin (300 mg d–1 p.o.) and clopidogrel (75 mg d–1 p.o.), and 2 days later he developed diffuse petechiae that prompted evaluation. Physical examination did not reveal any signs of splenomegaly. Laboratory findings were as follows: platelet count: 7 x 109 L–1; hemoglobin: 13.4 g dL–1; leukocyte count: 4.7 x 109 L–1. Peripheral blood smear showed severe thrombocytopenia without microangiopathic changes. The lactate dehydrogenase

Address for Correspondence: Volkan Karakuş, M.D., Antalya Eğitim ve Araştırma Hastanesi, Hematoloji Kliniği, Antalya, Turkey Phone: +90 505 765 67 78 E-mail: dr_v_karakus@yahoo.com Received/Geliş tarihi : July 12, 2011 Accepted/Kabul tarihi : October 6, 2011

level, prothrombin time, and activated partial thromboplastin time were normal. The diagnosis of clopidogrelassociated autoimmune thrombocytopenic purpura was suspected. Clopidogrel and aspirin were discontinued at the time of application. Intravenous methylprednisolone (1 g) was given daily. A total of 2 units of platelets were transfused in the first day of treatment. The patient responded in the third day of high dose steroid therapy, with stabilization of the platelet count (45 x 109 L–1) and no new petechiae. According to the guidelines of The American Society of Hematology, bone marrow biopsy and aspiration were not performed because bone marrow examination is not recommended in cases of isolated thrombocytopenia highly suspicious for the diagnoses of immune thrombocytopenic purpura [5]. Aspirin was subsequently resumed in the third day of high dose steroid therapy and high dose steroid discontinued then oral methylprednisolone 1mg/kg was administered. 6 days later the platelet count was 132 x 109 L–1 while on oral steroid therapy Written informed consent was obtained from the patient for publication. Thrombocytopenia is a rare, but dangerous adverse effect of clopidogrel, and encompasses thrombotic thrombocytopenic purpura (TTP), isolated thrombocytopenia,

Turk J Hematol 2012; 29: 94-95

KarakuĹ&#x; V, et al: Early Profound Secondary Autoimmune Thrombocytopenia Induced by Clopidogrel

and autoimmune thrombocytopenia [2]. Autoimmune thrombocytopenic purpura is an immune regulation disorder in which autoantibodies cause platelet destruction [6]. Treatment targets the prevention of splenic platelet destruction, using such medications as corticosteroids, intravenous immunoglobulin, and azathioprine. Splenectomy is indicated when medical therapy fails [3]. The presented patient responded to high-dose steroid treatment. The patientâ&#x20AC;&#x2122;s response to steroid therapy confirmed an autoimmune etiology, which together with the time frame suggested it was unlikely to have been related to heparin. Careful monitoring for hematologic adverse effects following clopidogrel use is essential for prompt diagnosis and treatment of this potentially life-threatening complication. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Li JJ, Xu B, Yang YJ, Chen JL, Qiao SB, Ma WH, Qin XW, Yao M, Liu HB, Wu YJ, Yuan JQ, Chen J, You SJ, Dai J, Xia R, Gao RL: Is there delayed restenosis in patients with coronary artery disease treated with sirolimus-eluting stent? Coron Artery Dis 2007; 18: 293-298 2. Guo YL, Li JJ, Yuan JQ, Qin XW, Zheng X, Mu CW, Hua YH: Profound thrombocytopenia induced by clopidogrel with a prior history of long-term safe administration. World J Cardiol 2010; 2 (6): 160-162 3. Best PJ, Mathew V, Markovic SN: Clopidogrel-associated autoimmune thrombocytopenic purpura. Catheter Cardiovasc Interv 2004; 62 (3): 339-340 4. Balamuthusamy S, Arora R: Hematologic adverse effects of clopidogrel. Am J Therap 2007; 14 (1): 106-112 5. Neunert C, Lim W, Crowther M, Cohen A, Solberg L, Crowther MA: The American Society of Hematology 2011 evidence-based practice guideline for immune thrombocytopenia. Blood 2011; 117 (16): 4190-4207 6. Karpatkin S: Autoimmune (idiopathic) thrombocytopenic purpura. Lancet 1997; 24 (9064): 1531-1536

Letter to the Editor

DOI: 10.5505/tjh.2012.48751

The Incidence of Alpha-Thalassemia in Iraqi Turks Irak'lı Türklerde Alfa-Talassemi Sıklığı Duran Canatan Hemoglobinopathy Diagnosis Center of Mediterrenaean Blood Diseases Foundation, Antalya, Turkey

To the Editor, I read the article on the “The incidence of alpha-thalassemia in Iraqi Turks”. Esmale et al showed that 8 of the 83 participants were diagnosed with alpha-thalassemia an incidence rate of 9.6% and particularly 3.7 kb deletion in Iraqi Turkmens [1]. Although the incidence studies of alpha thalassemia in Turkey are rare, more frequently hemoglobin H disease has been observed in south of Turkey, The molecular basis of Hb H disease was studied and mutations - α3.7, -α4.2, -MED-I and - α 20.5 were found to be responsible for the disease [2,3]. The frequency of alpha-thalassemia was 3.6% among Turkish newborns in a study that employed globin gene mapping analysis of DNA [4]. In our study, in 13 out of 205 cord blood samples alpha-thalassemia was found 6.3%. There was mistake at incidence so hat we improved with erratum [5]. The incidence of β-thalassemia trait was very high level, the incidence of α-thalassemia trait was also found high level (6.3%) in Antalya district. We are observing a lot of uncertain couples with alpha thalassemia in premarital screening tests in hemoglobinopathy diagnosis center of in Antalya, it needs molecular diagnostic test to all of them. As conclusion, the incidence of alpha-thalassemia was much higher in the Iraqi Turks in the present study than that reported in studies from Turkey. It needs more molecular diagnostic studies in especially adults in Turkey. Address for Correspondence: Duran Canatan, M.D., Güllük Cd. Antelsan İş Merkezi 8/3 07050 Antalya, Turkey Phone: +90 242 243 20 20/21 E-mail: dcanatan@superonline.com Received/Geliş tarihi : August 25, 2011 Accepted/Kabul tarihi : August 26, 2011

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Esmael A, Öztürk A, Akar N: The incidence of alphathalassemia in Iraqi Turks.Turk J Haematol 2011; 28: 235-236 2. Oner C, Gürgey A, Oner R, Balkan H, Gümrük F, Baysal E, Altay C: The molecular basis of Hb H disease in Turkey. Hemoglobin 1997; 21: 41-51 3. Taştan AÖ, Canatan D, Başak AN: A search for the α-thal-2 determinants -α3.7 and -α4.2 in the newborns from Antalya district of Turkey: Cord blood study using the PCR method. Balkan Journal of Medical Genetics 1999; 2: 23-25 4. Fei YJ, Kutlar F, Harris HF 2nd, Wilson MM, Milana A, Sciacca P, Schiliro G, Masala B, Manca L, Altay C: A search for anomalies in the zeta, alpha, beta and gamma globin gene arrangements in normal black, Italian, Turkish, and Spanish newborns. Hemoglobin 1989; 13: 45-65 5. Canatan D, Oğuz N, Güvendik İ, Yıldırım S: The Incidence of Alpha-Thalassemia in Antalya-Turkey. Turk J Haematol 2002; 19: 433-434

Letter to the Editor

DOI: 10.5505/tjh.2012.26918

ABO and Rh Blood Group Distribution in Kayseri Province, Turkey Kayseri İlinde ABO ve Rh Kan Grupları Dağılımı Yasemin Altuner Torun1, Leyla Gül Kaynar2, Çigdem Karakükcü3, Mehmet Yay2, Fatih Kurnaz2, Hasan Mutlu1, Mustafa Çetin2, Bülent Eser2 State Educational and Research Hospital, Transfusion Center, Kayseri, Turkey Erciyes University, School of Medicine, Department of Hematology, Kayseri, Turkey 3 State Educational and Research Hospital, Department of Biochemistry, Kayseri, Turkey 1 2

To the Editor, Today, there are more than 600 antigenic structures among the 30 defined blood groups [1]. The ABO system was first described by Landsteiner in 1900, and remains the most important in the management of tissue and blood transfusion. Indeed, the Rh system has the most important antigen D structure and is the most widely used prior to transfusion [1,2]. It has been shown that the frequency of ABO blood groups differs between populations [1,3]. Determination of the frequency of blood groups in a particular region facilitates timely provision of blood and blood products. There are many studies on the distribution of blood groups in Turkey [4-10]; however, none have considered Kayseri Province, a densely populated city in central Anatolia. As such, the present study aimed to determine the frequency of blood group types in Kayseri Province in order to facilitate to reach the appropriate blood type . Blood samples obtained from 86,797 individuals that presented to blood banks run by Erciyes University, School of Medicine, State Educational and Research Hospital, between January 2008 and September 2010 were retrospectively analyzed. ABO group types and Rh specificity of the blood samples were determined using a DiaMed-ID Micro Typing System (DiaMed AG, Switzerland) via gel centrifugation. Among the participants,

45,134 (52%) were female and 41,663 (48%) were male. In all, 88.2% (n = 76,580) of the blood samples were Rhpositive and 11.8% (n = 10,217) were Rh negative. The frequency of A, O, B, and AB blood group types was 44% (n = 38,253), 33.3% (n = 28,904), 16.2% (n = 14,031), and 6.5% (n = 5609), respectively. The frequency of ABO and Rh blood groups is shown in Figure 1. ABO blood groups are determined based on a locus on chromosome 9¾the Rh gene is on the first chromosome [1]. The Rh system is clinically as important as the ABO system because of its role in hemolytic diseases in newborns and in transfusion incompatibility [1]. ABO and Rh blood groups usually exhibit ethnic and regional differences [1,3]. The present findings show that the frequency of A, B, O, and AB blood group types in Kayseri is in accordance with that in the general Turkish population. In total, 44% of the blood samples analyzed in the present study were blood group A, which is similar to the frequency in other central Anatolian cities, including Konya, Eskişehir, and Ankara [4-6]. The frequency of the O blood group in Turkey is reported to be between 30.8% and 41.2%. In the present study the frequency of the O blood group was 33.3%, which is the same as in the Turkish cities Denizli and Diyarbakır [7,8], and the frequency of the B type blood group in the present study was 16.2%, which is similar to that in Eskişehir

Address for Correspondence: Yasemin Altuner Torun, M.D., Kayseri Eğitim ve Araştırma Hastanesi, Transfüzyon Merkezi, Kayseri, Turkey Phone: +90 533 938 52 82 E-mail: yaseminaltuner@yahoo.com Received/Geliş tarihi : May 5, 2011 Accepted/Kabul tarihi : August 26, 2011

Altuner Torun Y, et al: ABO and Rh Blood Group Distribution

and Denizli [4,7]. In Turkey the highest frequency of the B blood group is in Şanlıurfa (21.25%) and the lowest frequency is in Malatya (11.4%) [9]. The AB blood group has a frequency in Turkey of 6%-9.2%, which is similar to the 6.5% observed in the present study. The frequency of Rh-negative individuals varies enormously between ethnic groups. For example, 17% of Brits are Rh negative, versus 0.5% of Japanese;3 however, the frequency of Rh negative in Turkey is nearly 15%, which is similar to that in Asia and Europe [1,2]. In the present study the Rh positivity rate was 88.2%, whereas other studies conducted in Turkey reported that the Rh positivity rate was 90.8% in Gaziantep, 89% in Malatya, 89.1% in Diyarbakır, and 89.9% in Denizli [8-10]. In conclusion, the frequency of the ABO and Rh blood groups observed in Kayseri Province in the present study differs from that in other Turkish cities, but is similar to that in the general Turkish population. This could be due to the fact that Kayseri Province is located in the center of Turkey. In recent years Kayseri has experienced the influx of a high number or migrants coming from other regions of Turkey (especially the south and east) due an increase in the number of industrial jobs. According to Turkish nationwide population statistics (Türkiye İstatistik Kurumu) for 2008-2009, 28,831 people migrated to Kayseri¾a migration rate of 1.86%. It is critically important that blood banks know the distribution of blood group types in their region. We think that the present study’s findings, as those from studies conducted in other Turkish cities, will contribute to the Turkish blood type database and, most importantly, will facilitate easy access to appropriate blood types, as needed.

Turk J Hematol 2012; 29: 97-98

References 1. Lialiaris T, Digkas E, Kareli D, Pouliliou S, Asimakopoulos B, Pagonopoulou O, Simopoulou M: Distribution of ABO and Rh blood groups in Greece: An update. Int J Immunogenet 2011; 38: 1-5 2. Daniels GL, Cartron JP, Fletcher A, Garratty G, Henry S, Jørgensen J, Judd WJ, Levene C, Lin M, Lomas-Francis C, Moulds JJ, Moulds JM, Moulds M, Overbeeke M, Reid ME, Rouger P, Scott M, Sistonen P, Smart E, Tani Y, Wendel S, Zelinski T: International Society of Blood Transfusion Committee on terminology for red cell surface antigens: Vancouver Report. Vox Sang 2003; 84:244-247 3. Akbay T, Demiröz P, Güney C: Türkiyede kan gruplarının coğrafi bölgelere göre dagılımı. GATA Bült 1989; 31: 391-402 4. Dilek İ, Demir C, Bay A,Akdeniz H, Öner AF: ABO and Rh blood groups frequency in men and women living in eastern Turkey. UHOD 2006; 1: 23-26 5. Demirağ N, Öz AY, Akın M: Blood groups distribution of Konya city and comparison to Turkey and Estern Cyprus. İç Anadolu Tıp Dergisi 1993; 3: 68-71 6. Ergin A, Yardımcı S: Distribution of ABO and Rh blood groups in Turkey. Ankara Üni Tıp Fak Mec 1993; 46: 527-533 7. Isık Balcı Y, Ovet G, Covut IE, Goncu F, Yılmaz F: ABO and Rh Blood Groups Frequency in Denizli Province. UHOD 2010; 20: 103-105 8. Temiz H, Altıntaş A, Gül K: Distrubition of ABO and Rh Blood Groups in Diyarbakır. UHOD 2008; 4: 235-237 9. Yakıncı C, Durmaz Y, Şahin: Malatya Yöresinde ABO ve Rh Kan Gruplarının Dağılımı. Turgut Özal Tıp Merkezi Dergisi 1995; 2: 277-279 10. Coşkun Y: “ABO” “Rh” distribution of blood groups in Gaziantep region. Gaziantep Üniversitesi Tıp Fakültesi Dergisi 1990; 1: 13-18

Letter to the Editor

DOI: 10.5505/tjh.2012.91069

Did the Proband Have Thalassemia Intermedia or Severe Thalassemia Trait? Ağır Talasemi Taşıyıcılığı mı? Talasemi İntermedia mı? Şinasi Özsoylu Retired Professor of Pediatrics, Hematology, and Hepatology, Ankara, Turkey

To the Editor, I enjoyed reading Bilgen et al.’s case report, The effect of HBB: (c*+96T>C (3’UTR+1570 T>C) on the mild β-thalassemia intermedia pheonotype, in the recent issue of the Journal (2011; 28: 219-222). I congratulate the authors for exploring at the molecular level at least one of the thalassemia minima that fits well with the present clinical thalassemia nomenclature. Based on their clinical description, I would not consider the proband as thalassemia intermedia, as until 20 years of age he did not require blood transfusions [1]. The mother had thalassemia trait, the father had thalassemia minima, and the proband clinically had severe thalassemia trait, as he had mild hepatosplenomegaly and was compound heterozygote (thalassemia trait[+] and carrier of HBB: C*+9,6 T>C mutation). I would like to suggest the following arbitrarily modified nomenclature for clinical thalassemia syndromes: Thalassemia major (according to transfusion requirement): a) Severe: transfusion interval less than 1 month; b) Moderate: transfusion interval more than 1 month. Thalassemia intermedia (according to transfusion requirement): a) Moderate: transfusion interval less than 1 year; b) Mild: transfusion interval more than 1 year.

Thalassemia trait: a) Severe: with mild hepatosplenomegaly; b) Mild: without hepatosplenomegaly; Thalassemia minima: absence of clinical and hematological findings. Sincerely Şinasi Özsoylu, MD Retired Professor of Pediatrics, Hematology, and Hepatology Honorary Fellow of the American Academy of Pediatrics since 1995 Honorary Member of the American Pediatric Society since 1993

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Bilgen T, Canatan D, Arıkan Y, Yeşilipek A, Keser İ. The effect of HBB: c.*+96T>C (3’UTR +1570 T>C) on the mild b-thalassemia intermedia phenotype. 2011; 28: 219-222 2. Özsoylu Ş: Thalassemia trait as thalassemia intermedia. Am J Hematol 2001; 67: 218 (letter)

Address for Correspondence: Şinasi ÖZSOYLU, M.D., Beysukent Altınşehir Sitesi No:30, Ankara, Turkey Phone: +90 312 235 41 88 E-mail: sinasiozsoylu@hotmail.com Received/Geliş tarihi : November 14, 2011 Accepted/Kabul tarihi : November 14, 2011

Özsoylu Ş: Did the Proband Have Thalassemia Intermedia or Severe Thalassemia Trait?

Reply First of all we thank Professor Dr. Özsoylu for his contribution and interest in our report. Intermedia is a beta thalassemia group characterized by severity varying from thalassemia major to asymptomatic carriers. It seems that according to clinical classification it is possible to describe our patient as severe thalassemia trait rather than mild thalassemia intermedia. On the other hand, the primary reason we consider our patient as thalassemia intermedia is that he is compound heterozygous for 3’UTR+1570 T>C and Cod 8(-AA) beta-globin gene mutations. We think mild thalassemia intermedia is the appropriate description of our patient, considering that he has two different mutations on his 2 different copies of the beta globin gene, as well as mild phenotypic findings. We think that the description of severe thalassemia trait is more suitable for patients with only 1 beta globin gene mutation with clinical findings in addition to the thalassemia minor phenotype. Again, we appreciate your letter, as it afforded us the opportunity to explain in greater detail our rationale for the use of genetic data in addition to clinical criteria in the classification of thalassemias. Sincerely, Türker Bilgen, PhD. Department of Medical Biology and Genetics, Faculty of Medicine, Akdeniz University, Antalya, Turkey

100

Turk J Hematol 2012; 29: 99-100

Letter to the Editor

DOI: 10.5505/tjh.2012.83713

Thrombosis and Risk Factors: A Comment Tromboz ve Risk Faktörleri: Bir Yorum Selami Koçak Toprak1, Yunus Kasım Terzi2, Feride Şahin2 1 2

Baskent University, Department of Hematology, Ankara, Turkey Baskent University, Department of Medical Genetics, Ankara, Turkey

To the Editor, We read with great interest the recent publication by Akar related to thrombosis and risk factors, in which he reached in conclusion that in case of need only homocysteine (Hcy) levels should be routinely analyzed and not the 5, 10-methylenetetrahydrofolate reductase (MTHFR) 677 T polymorphism [1]. The methylation of Hcy to methionine is catalyzed by the MTHFR enzyme. As far as is known, genetic deficiency of MTHFR is one cause leading to increased plasma Hcy levels [2]. But, it should not be forgotten that Hcy rises in many acquired and genetic conditions (Table) [3]. There are three main indications for determining plasma total Hcy: (a) to diagnose homocystinuria; (b) to identify individuals with or at risk of developing cobalamin or folate deficiency; (c) to assess total Hcy as a risk factor for cardiovascular and other disorders [4]. There is an involved question in this point: Is increased plasma total Hcy level related to both venous and arterial occlusive disease? And, if is it true, are polymorphism and mutation of MTHFR directly playing a role to augment the level of Hcy for cardiovascular disease (CVD)? As reviewed elsewhere, moderately increased plasma Hcy is associated with venous and arterial occlusion [5]. Moreover, as it is known, the presence of MTHFR 677C→T polymorphism is a strong risk factor for increased plasma Hcy level but not for CVD [4]. In a metaanalysis including 11.162 CVD cases and 12.758 controls, with high Hcy levels in a state of low folate levels, the TT genotype was associated with a 16% increase in coronary heart disease risk [6]. Concordantly, previous studies had shown that the MTHFR

677C→T polymorphism is only associated with high Hcy levels or increased CVD risk in a setting of low folate status [6]. Hence, at higher dietary intakes of folate, the effect of the MTHFR 677C→T genotype has no adverse effect on plasma Hcy levels or on subsequent risk of CVD. The results support the hypothesis that impaired folate metabolism, resulting in high Hcy concentrations, plays a causal role in the occurrence of CVD. In view of cost effectiveness, do not investigate routinely MTHFR 677C→T polymorphism in the general or CVD population seems to be reasonable, but the other mutations of MTHFR could be still influential for high plasma Hcy levels. In conclusion, even if some researchers contradict, provided that folate status is adequate, there is little clinical value of screening for MTHFR 677C→T genotype in the general population for prediction of venous and arterial occlusive disorders and high Hcy levels of course. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Address for Correspondence: Selami Koçak Toprak, M.D., Fevzi Çakmak Caddesi 5. Sokak No: 48 Kat: 1, 06490 Bahçelievler, Ankara, Turkey Phone: +90 532 656 02 06 E-mail: sktoprak@yahoo.com Received/Geliş tarihi : July 18, 2011 Accepted/Kabul tarihi : July 22, 2011

101

Toprak S K, et al: Thrombotic Risk Factors: A Comment

Turk J Hematol 2012; 29: 101-103

Table 1: Causes of Elevated Homocysteine Levels

CAUSES Vitamin deficiency Cobalamin deficiency Folate deficiency Disease Renal failure Posttransplantation Hypothyroidism Acute lymphocytic leukemia Drugs and toxins Alcohol abuse Methotrexate and other antifols Cyclosporine A Nitrous oxide toxicity Genetic disorders Cystathionine β-synthase deficiency Homozygous state Heterozygous state Hereditary disorders of cobalamin Metabolism, transport, or absorption Hereditary disorders of folate Metabolism, transport, or absorption Methylene tetrahydrofolate reductase polymorphisms (homozygous C677T or A1298C mutations) Physiologic and lifestyle factors Male sex Aging Coffee drinking Smoking

EFFECT Mild to severe Mild to severe Mild to moderate Mild to moderate Mild Mild Mild to severe Mild to severe Mild Mild to severe Severe Mild or none Mild to severe Mild to severe Mild or none Mild Mild Mild Mild

Modified from Carmel R. Megaloblastic Anemias: Disorders of Impaired DNA Synthesis. In: Greer JP, Foerster J, Rodgers GM, Paraskevas F, Glader B, Arber DA, Means RT Jr, eds. Wintrobe’s Clinical Hematology. 12th ed. Philadelphia: Lippincott Williams & Wilkins, 2009: 1143-72.

References 1. Akar N. Thrombosis and risk factors. Turk J Hematol 2010; 27:318-9. 2. Yilmaz H, Isbir S, Agachan B, Ergen A, Farsak B, Isbir T. C677T mutation of methylenetetrahydrofolate reductase gene and serum homocysteine levels in Turkish patients with coronary artery disease. Cell Biochem Funct. 2006; 24:87-90. 3. Carmel R. Megaloblastic Anemias: Disorders of Impaired DNA Synthesis. In: Greer JP, Foerster J, Rodgers GM, Paraskevas F, Glader B, Arber DA, Means RT Jr, eds. Wintrobe’s Clinical Hematology. 12th ed. Philadelphia: Lippincott Williams & Wilkins, 2009: 1143-72.

102

4. Refsum H, Smith AD, Ueland PM, Nexo E, Clarke R, McPartlin J, Johnston C, Engbaek F, Schneede J, McPartlin C, Scott JM. Facts and recommendations about total homocysteine determinations: an expert opinion. Clin Chem 2004; 50(1):3-32. 5. Refsum H, Ueland PM, Nygård O, Vollset SE. Homocysteine and cardiovascular disease. Annu Rev Med. 1998; 49:31-62. 6. Klerk M, Verhoef P, Clarke R, Blom HJ, Kok FJ, Schouten EG; MTHFR Studies Collaboration Group. MTHFR 677C->T polymorphism and risk of coronary heart disease: a meta-analysis. JAMA. 2002;288(16):2023-31.

Turk J Hematol 2012; 29: 101-103

Reply Thrombosis and Risk Factors I read the comment of Toprak et al. on my letter to the Editor appeared in a recent issue of the journal with great interest [1]. They pointed a missing point in my letter and then focused on the effect of folate metabolism on homocysteine and metihelenetetrahydrofolate gene polymorphism at 677 C to T extensively [1] I would like to express my thanks to Toprak et al. giving a chance to explain my view on this matter once more. As it is well known that there is a continuing debate on homocysteine metabolism, MTHFR SNP’s and folate metabolism and there are several published reviews on this subject not reaching to a conclusion. Recently we reported that MTHFR 677 T has an influence on Hcy levels in Turkish population. But also we found another possible MTHFR gene haplotype, which does not have an effect on Hcy levels [2]. Furthermore, there are also rare novel SNPs published within the MTHFR 677 region with an allele frequency of 1 in 3000-4000 sample, including MTHFR 678 C-A (Ala222Ala) in Turkish population [3-5] which may lead to erroneous technical reporting.

Toprak S K, et al: Thrombotic Risk Factors: A Comment

References 1. Akar N: Thrombosis and risk factors. Turk J Hematol 2010: 27 (4) : 318-319 2. Koç YL, Akar N: Single nucleotide polymorphisms that affect homocysteine levels in Turkish population. Clin Appl Thromb Hemost 2009; 15: 701-704 3. Lyon E: Discovering rare variants by use of melting temperature shifts seen in melting curve analysis. Clin Chem 2005; 51: 1331-1332 4. Erali M, Schmidt B, Lyon E, Wittwer C: Evaluation of electronic microarrays for genotyping factor V, factor II, and MTHFR. Clin Chem 2003; 49: 732-739 5. Eğin Y, Akar N: First observation of MTHFR 678 C-A (Ala222Ala) single nucleotide polymorphism. Turk J Hematol 2011 (DOI: 10.5152/tjh.2011.45) 6. Akar N, Akar E, Misirlioğlu M, Avcu F, Yalçin A, Cin S: Search for genetic factors favoring thrombosis in Turkish population. Thromb Res 1998; 92 (2): 79-82

Nejat Akar TOBB Economy and Technology University Hospital, Ankara, Turkey

Since our first publication on homocysteine related gene polymorphisms in Turkish population in 1998 [6], and the others following the first paper, I reached to a conclusion that without determining homocysteine levels, analyzing MTHFR 677C-T solely at the DNA level is unnecessary, not cost effective and does not have any clinical value especially in Turkish population. So, only homocysteine levels should be routinely analyzed and not the MTHFR 677 T SNP alone. If any cause of high homocysteine levels could not be found, then MTHFR 677 T analysis can be performed.

103

Letter to the Editor

DOI: 10.5505/tjh.2012.10170

About Methemoglobinemia Methemoglobinemia Hakkında Şinasi Özsoylu Retired Professor of Pediatrics, Hematology, and Hepatology, Ankara, Turkey

To the Editor, I enjoyed reading Mutlu et. al’s paper entitled “Acquired methemoglobinemia in infants” in the recent issue of the Journal (2011;28:131-134). I would like to add to this well written article that we have also reported acquired methemoglobinemia cases with administration of cytanest in puerperal women with G6PD deficiency and infants in whom erythrocyte cytochrome 65 reductase was assoyed [1-4], which is the main enzyme for methemoglobin reductase in erythrocytes as mentioned by the authors. In addition, hereditary methemoglobinemias due to NADH dependent cytochrome reductase (NADH dependent methemoglobine reductase = NADH dependent diaphorase) deficiency, which was assayed only by us so far in Turkey with probable dominant inheritance and Hemoglobin M cases were reported on several journals [5-11]. On this occassion I also would like to emphasize that methylenblue (1-2 mg/kg in 1% solution; in higher concentration and doses causes and or increases methemoglobinemia) should be preferred in acquired as well as hereditary enzymopenic methemoglobinemias, since it is effective within minutes with corrected oxygen dissociation curve. It was also used orally (2-5 mg/kg/day) in our enzymopenic methemoglobinemia patients successfully. To my suprise, it was found effective within 12 to 16 hours in the authors 2 patients. I also would like to point out that congenital cyanosis was recently reported in a baby with mutant fetal hemoglobin (gama chain mutation) with dominant inheritance

Address for Correspondence: Şinasi ÖZSOYLU, M.D., Beysukent Altınşehir Sitesi No:30, Ankara, Turkey Phone: +90 312 235 41 88 E-mail: sinasiozsoylu@hotmail.com Received/Geliş tarihi : September 13, 2011 Accepted/Kabul tarihi : September 13, 2011

104

due to decreased oxygen affinity without methemoglobinemia [12]. Şinasi Özsoylu, MD Retired Professor of Pediatrics, Hematology, and Hepatology Honorary Fellow of the American Academy of Pediatrics since 1995 Honorary Member of the American Pediatric Society since 1993

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Mutlu M, Erduran E, Aslan Y. Süt çocuklarında edinsel methemoglobinemi. Turk J Hematol 2011;28:131-134. 2. Özsoylu Ş. About methemoglobinemia. J Pediatr Gastroenterol 1988;7: 302-302 3. Özsoylu Ş. Methemoglobinemia following metachloprimide. Eur J Pediatr 1988;148:172 4. Özsoylu Ş. Acquired methemoglobinemia. Acta Paediatr 2004;93:1129 5. Özsoylu Ş. Akkiz methemoglobinemi. Çocuk Sağlığı ve Hast. Dergisi 2005;48:365 (in Turkish) 6. Özsoylu Ş. Methemoglobinemi Çocuk sağ ve Hastalıkları Dergisi 1966;9:44-52.(in Turkish)

Turk J Hematol 2012; 29: 104-105

7. Özsoylu Ş. Hereditary methemoglobinemic cyanosis due to diaphorase deficiency in three successive generation. Acta Haematol 1967;37:276-283 8. Özsoylu Ş. Congenital methemoglobinemia due to diaphorase deficiency with mental retardation. Acta Haematol 1972;47:175-181 9. Özsoylu Ş.Congenital methemoglobinemia due to hemoglobin M. Acta Haematol 1972;47:225-232 10. Özsoylu Ş. Congenital enzymopenic meeethemogloinemia. Acta Haematol 1981;66:271 11. Özsoylu Ş. Congenital methemoglobinemia and mental retardation. Blood 1986;65: 795 12. Özsoylu Ş. Cytochrome b5 reductase deficiency and mental retardation. Am J Hematol 1993;43:243-244 13. Crowly MA, Mollan TL, Abdulmalek OY, et al. A Hemoglobin variant associated with cyanosis and anemia. New Engl J Med 2011;364: 1837-1843

Özsoylu Ş: About Methemoglobinemia

Reply We are thankful to Dr. Özsoylu for his valuable comments. In our cases, two neonates (methemoglobin levels 30.4% and 26.8%) were treated with methylene blue intravenously, cyanosis resolved in a few hours with application of methylen blue but methemoglobin levels decreased to less than 5% at 12 and 16 hours later. In medical literature, similar results have been reported. Bender and Neuhaus [1] reported a case (methemoglobin level 24%) treated with ascorbic acid and methylene blue, methemoglobin concentration normalized twenty-four hours later. Bouziri et al. [2] reported an infant (methemoglobin level 50.6%) was treated with methylene blue intravenously and methemoglobin levels decreased to 9.8% twenty-four hours later. Ergül et al. [3] reported two infants (methemoglobin levels 49.6% and 37.7%) were treated with methylene blue intravenously and methemoglobin levels decreased to 2.5% at 12 hours later and in other case, methemoglobin levels decreased to 8% at 4 hours later. Mehmet Mutlu Department of Pediatrics, Faculty of Medicine, Karadeniz Technical University, Trabzon, Turkey

References 1. Bender P, Neuhaus H: Toxic methemoglobinemia. Dtsch Med Wochenschr 2011; 136: 762-764 2. Bouziri A, Khaldi A, Menif K, Ben Jaballah N: Unusual cause of severe toxic methemoglobinemia in an infant: A case report. Int J Emerg Med 2010; 3: 57-59 3. Ergül Y, Nişli K, Kalkandelen S, Dindar A: Acute cyanosis after transcatheter balloon valvuloplasty: Toxic methemoglobinemia due to local prilocaine use. Turk Kardiyol Dern Ars 2011; 39: 64-67

105

Images in Hematology

DOI: 10.5505/tjh.2012.38233

Primary Pleural Diffuse Large B-cell non-Hodgkin’s Lymphoma Diagnosed via [18F]-2-Fluoro-Deoxy-DGlucose Positron Emission Tomography /Computed Tomography F-18 [18F]-2-Fluoro-Deoxy-D-Glucose Positron Emisyon Tomografi / Bilgisayarlı Tomografi’de Primer Plevral Diffüz Büyük B Hücreli Non Hodking’s Lenfoma İlknur Ak Sivrikoz1, Zafer Gülbaş2 Eskişehir Osmangazi University, School of Medicine, Department of Nuclear Medicine, Eskişehir, Turkey Eskişehir Osmangazi University, School of Medicine, Department of Hematology, Eskişehir, Turkey

1 2

Primary pleural lymphoma is a rare entity. We report a 64-year-old-man with primary malignant lymphoma arising in the pleura with no history of persistent pyothorax. Chest computed tomography scan (CT) showed left pleural effusion with thickening of the parietal pleura. There were no intrapulmonary or mediastinal abnormalities. Analysis of pleural effusion did not detect empyema, tuberculosis, mycobacterium species, or mycelium. Initially, malignant mesothelioma was suspected, but it could not be diagnosed by cytological examination of pleural fluid. Flow cytometric analysis of pleural fluid showed cytomorphologic and immunophenotypic evidence of diffuse B cell Non Hodgkin’s Lymphoma (NHL) (Figure 1). [18F]2-fluoro-deoxy-D-glucose (F-18 FDG) positron emission tomography/computed tomography (PET/CT) scan revealed a diffuse F-18 FDG uptake on thickened costal and diaphragmatic parietal pleura in left hemithotax indicating pleural involvement (Figure 2).Pathological and immunohistochemical (with CEA, LCA, CD20, CD3) examination of the pleural lesion obtained by pleural biopsy revealed that it was B-cell of the diffuse large cell type of NHL aris-

ing from the pleura . We have written informed consent and no conflict of interest. Malignant lymphoma arising in the pleura are rare, comprising 2.4% of the primary chest wall tumors, and most pleural lymphomas develop in association with preceding long-standing pleural disease such as long-standing chronic tuberculous pyothorax or artificial pneumothorax for lung tuberculosis. As a mechanism for pleural lymphoma, it had been suspected that there was chronic stimulation of B-cells in the pleural cavity such as that in long-standing chronic pleural disease, because it was reported that the most common malignant lymphoma arising in the pleura was B-cell non-Hodgkin’s lymphoma of the diffuse large cell type histologically [1-7]. Human herpesvirus type 8 (HHV8), also known as Kaposi’s sarcoma-associated herpesvirus, is a human gamma herpesvirus that underlies the pathogenesis of Kaposi’s sarcoma, primary effusion lymphoma and multicentric Castleman’s disease. Therefore, Kaposi Sarcoma and Multicentric Castleman’s Disease should be considered in the differential diagnosis [8].

Address for Correspondence: İlknur Ak Sivrikoz, M.D., Eskişehir Osmangazi Üniversitesi, Tıp Fakültesi, Nükleer Tıp Anabilim Dalı, 26480 Eskişehir, Turkey Phone: +90 222 239 29 79 E-mail: ilknur_ak@yahoo.com Received/Geliş tarihi : June 11, 2010 Accepted/Kabul tarihi : September 7, 2010

106

Turk J Hematol 2012; 29: 106-108

Sivrikoz İ A and Gülbaş Z: Primary Pleural NHL Diagnosed via F-18 FDG

Figure 1: Flow cytometric analysis of pleural fluid confirmed the B-cell nonHodgkin’s lymphoma. CD20 positive and CD19 positive cells are 87% and %84 of the cells, respectively. Anti kappa + CD19 expression is negative. Anti lambda + CD19 positive cells are 78% of the cells.

Figure 2: The patient was imaged using an integrated PET/CT camera (1hour after the administration of 465 MBq FDG), which is consists of a 6-slice CT gantry integrated on a LSO based full ring PET scanner (Siemens Biograph 6, IL, Chicago, USA). MIP PET, CT and fusion PET/CT images show a diffuse F-18 FDG uptake with a maximum standard uptake value (SUVmax) of 4.2 on thickened mediastinal, costal and diaphragmatic pleura in left hemithotax indicating pleural involvement. There is no additional focus suggesting lymphomatous disease.

107

Sivrikoz İ A and Gülbaş Z: Primary Pleural NHL Diagnosed via F-18 FDG

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included. References 1. Hekimgil M, Soydan S, Yakut BD, Ertan Y: The Differential Diagnosis of Lymphocyte-rich Classical Hodgkin’s Lymphoma and Lymphocyte Predominant Hodgkin’s Lymphoma Using the R.E.A.L. Criteria. An Immunohistochemical Study on 45 Cases. Turk J Hematol 2000; 17 (4): 163-170 2. Iuchi K, Ichimiya A, Akashi A, Mizuta T, Lee YE, Tada H, Mori T, Sawamura K, Lee YS, Furuse K: Non-Hodgkin’s lymphoma of the pleural cavity developing from longstanding pyothorax. Cancer 1987; 60: 1771-1775 3. Iuchi K, Aozasa K, Yamamoto S, Mori T, Tajima K, Minato K, Mukai K, Komatsu H, Tagaki T, Kobashi: NonHodgkin’s lymphoma of the pleural cavity developing from longstanding pyothorax: Summary of clinical and pathological findings in thirty-seven cases. Jpn J Clin Oncol 1989; 19: 249-257

108

Turk J Hematol 2012; 29: 106-108

4. Lui PC, Ng WK, Yam LY, Wong WW, Tai YP: Pyothoraxassociated large B-cell lymphoma: case report with emphasis on the potential diagnostic challenge. Hong Kong Med J 2002; 8 (5): 359-362 5. Kawahara K, Sasada S, Nagano T, Suzuki H, Kobayashi M, Matsui K, Takata K, Yoshino T, Michida T, Iwasaki T: Pleural MALT lymphoma diagnosed on thoracoscopic resection under local anesthesia using an insulation-tipped diathermic knife. Pathol Int 2008; 58 (4): 253-256 6. Kono Y, Funada H, Urata K, Yosimura S, Kotani Y, Satouti M, Negoro S, Takada Y: A case of malignant lymphoma diagnosed by thoracoscopy with local anesthesia. Nihon Kokyuki Gakkai Zasshi 2005; 43 (10): 622-625 7. Oikonomou A, Giatromanolaki A, Margaritis D, Froudarakis M, Prassopoulos P: Primary pleural lymphoma: Plaque-like thickening of the pleura. Jpn J Radiol 2010; 28 (1): 62-65 8. Ferry JA, Sohani AR, Longtine JA, Schwartz RA, Harris NL: HHV8-positive, EBV-positive Hodgkin lymphoma-like large B-cell lymphoma and HHV8-positive intravascular large B-cell lymphoma. Mod Pathol 2009; 22 (5): 618-626

Images in Hematology

DOI: 10.5505/tjh.2012.93685

Bullous Cutaneous Eruption due to Extravasation of Acyclovir in an Adolescent with Acute Lymphoblastic Leukemia Akut Lenfoblastik Lösemili Bir Adolesanda Asiklovirin Damar Dışına Sızmasına Bağlı Büllöz Cilt Erüpsiyonu Abdurrahman Sarıca Dr Abdurrahman Yurtaslan Oncology Education and Research Hospital, Ankara, Turkey

A 14-year-old-girl undergoing treatment with the BFM TRALL 2000 protocol (MRG) because of early pre-B-cell acute lymphoblastic leukemia (ALL) developed chicken pox on the 33rd d of remission induction. As such, chemotherapy was withdrawn and the patient was quarantined. Acyclovir (1500 mg·m–2·d–1 in three divided doses) was then administered in 100 mL of 0.9% sodium chloride, as 1-h intravenous infusions. On the 9th d of acyclovir therapy 10 min after infusion of the 27th dose started the patient complained of the sensation of minor pain and burning in the region of Intracath catheter insertion, and developed slight erythema with irregular boundaries in the same region. The infusion line was checked for patency by gently withdrawing blood before, which showed that the line was patent, and then infusion was continued, but at a slower rate. The line’s patency was checked frequently and remained patent. The patient no longer experienced the sensation of pain and burning, and the erythema improved slightly; however, at the end of the infusion (the 65th min) a solitary, bullous painless eruption 1 x 1 cm in diameter was observed on the tract of the vein, 10 cm distal of the Intracath insertion (Figures 1 and 2). Without any medical intervention the lesion subsided in 8 h and disappeared completely in 24 h, leaving behind a residual scar lesion.

The known adverse dermatological effects of acyclovir, including erythema, inflammation, and phlebitis at the site of intravenous infusion, occur in ≤16% of patients, presumably due to the alkaline nature of the solution (reconstituted acyclovir has a pH of 10-11) [1]. It is a known irritant to venous and soft tissue if extravasated [2].We think that both the erythema and bullous eruption in the presented case were signs of subcutaneous acyclovir extravasation, despite the fact that we frequently checked the line and were confident of its patency. Frequent venipuncture of the same veins and use of chemotherapeutic agents in oncology patients may render their veins fragile and susceptible to the irritant effects of drugs. As such, sensation of pain and burning in oncology patients should be considered a reliable sign of extravasation even when good blood return is observed. Nonetheless, cutaneous vesicular eruption following intravenous acyclovir administration is rare [1]. It was reported that cutaneous vesicular eruptions developed not only at the site of injection, but far from it [3] and proximal to it [1]. Moreover, bullous eruptions were also reported following topical and oral acyclovir administration [1]; therefore, rather than extravasation of acyclovir solution, an immunoallergic pattern in the presence of histological leukocytoclastic vasculitis is an etiological consideration [3].

Address for Correspondence: Abdurrahman Sarıca, M.D., S.B. Dr. Abdurrahman Yurtaslan Onkoloji Eğitim ve Araştırma Hastanesi, Demetevler, Yenimahalle, Ankara, Turkey Phone: +90 312 336 09 09/70 42 E-mail: apocan1981@hotmail.com Received/Geliş tarihi : February 26, 2009 Accepted/Kabul tarihi : September 1, 2009

109

SarÄąca A: Extravasation of Acyclovir

Turk J Hematol 2012; 29:109-110

The presented case shows that the irritant effects of acyclovir should always be a consideration, especially in oncology patients, and that the development of new vesicular eruptions during acyclovir therapy should not always be considered progression of herpes infection. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Acknowledgement I thank Lale Olcay, MD for kindly revising the manuscript. References 1. Buck ML, Vittone SB, Zaglul HF: Vesicular eruptions following acyclovir administration. Ann Pharmacother 1993;27: 1458-1459 2. De Souza BA, Shibu M: Painless acyclovir extravasation injury in a diabetic. Br J Plast Surg 2002; 55 (3): 264 3. Armingaud P, Arsac P, Kerdraon R, Esteve E: Localized bullous eruption after intravenous injection of aciclovir:Â Toxic or immunoallergic mechanism? Ann Dermatol Venereol 2000; 127: 496-498

Figure 1-4: Cutaneous vesicular eruption on the forearm of the patient which developed after acyclovir injection.

110