tjh-2012-2

Review

DOI: 10.5505/tjh.2012.04557

Inflammatory Bowel Disease and Thrombosis İnflamatuvar Bağırsak Hastalığı ve Tromboz Ahmet Tezel1, Muzaffer Demir2 Trakya University, School of Medicine, Department of Gastroenterology, Edirne, Turkey Trakya University, School of Medicine, Department of Hematology, Edirne, Turkey

1 2

Abstract Inflammatory Bowel Disease (IBD) is a group of chronic and relapsing inflammatory disorders of the gastrointestinal system. In these cases, findings are detected in extraintestinal systems also. There is a tendency for thrombotic events in IBD, as in the other inflammatory processes. The pathogenesis of this thrombotic tendency is multidimensional, including lack of natural anticoagulants, prothrombotic media induced via the inflammatory process, long-term sedentary life style, steroid use, surgery, and catheter placement. The aim of this review was to highlight the positive relationship between IBD and thrombotic events, and the proper treatment of at-risk patients.

Key Words: Inflammatory bowel disease, Thrombosis

Özet İnflamatuvar Bağırsak Hastalıkları gastrointestinal sistemin kronik, tekrarlayıcı inflamatuvar hastalıklarıdır. Bu olgularda GİS yanında diğer sistemleri de ilgilendiren bulgular saptanır. Diğer inflamatuvar patolojilerde olduğu gibi inflamatuvar Bağırsak hastalıklarında da trombotik olaylara eğilim artmaktadır. Tromboza yatkınlığın patogenezi çok boyutludur. Doğal antikoagülanlarda eksiklik, inflamatuvar sürecin yarattığı protrombotik ortam, uzun süreli hareketsizlik, steroid kullanımı, cerrahi girişim, kateter takılması tromboz gelişiminde suçlanmıştır. Bu derlemenin amacı İBH ve trombotik olaylar arasındaki ilişkiyi klinisyenlere hatırlatmak, tromboz gelişme riski olan olgularda gerekli önlemlerin alınmasını sağlamaktır.

Anahtar Sözcükler: İnflamatuvar Bağırsak hastalığı, Tromboz Introduction Inflammatory bowel disease (IBD) is a group of disorders characterized by chronic, relapsing inflammation of the gastrointestinal system triggered by environmental factors in genetically susceptible individuals. The primary diseases that constitute IBD are ulcerative colitis (UC) and Crohn’s disease (CD). Systemic findings related to and not related to inflammatory activity may be observed in addition to gastrointestinal findings in both diseases. The etiopathogenesis of IBD is not been fully known. The genetics

of IBD remain the greatest mystery. Clinical findings vary according to periods of inflammatory activity and remission. Drugs used for treatment cause additional clinical findings and morbidity.

The strong relationship between inflammation and hemostasis affects the progression and severity of disease in many inflammatory pathologies, including IBD, atherosclerosis, and rheumatoid arthritis [1]. The tendency for thrombosis in IBD has been know since 1936. Bargen and Barker [2] reported that life-threatening thromboem-

Address for Correspondence: Ahmet TEZEL, M.D., Trakya Üniversitesi, Tıp Fakültesi, Gastroenteroloji Bilim Dalı, 22030 Edirne, Turkey Phone: +90 284 235 76 42 E-mail: atezel@trakya.edu.tr Received/Geliş tarihi : April 6, 2011 Accepted/Kabul tarihi : May 17, 2011

111

Tezel A and Demir M: Thrombosis in Inflammatory Bowel Disease

bolic events develop in UC cases and that the tendency for thrombosis might be associated with thrombocyte dysfunction or increased thromboplastin synthesis. Thereafter, other case reports and prospective studies reported the potential for thrombosis to develop in venous and arterial systems [3-7].

The present review aimed to evaluate the relationship between IBD and thrombosis. Inconsistent results, variation in study design, and insufficient clarification of the development of thrombosis in IBD complicate the issue.

Answering following questions may help understanding the relationship between IBD and thrombosis better.

1. Is there a real tendency to thrombosis in IBD? What is the magnitude of the problem?

2. With which mechanism does thrombosis develop in IBD? 3. Is there a relationship between thrombosis development and disease activity?

4. Can thrombotic pathologies be prevented?

5. Can anticoagulant agents be used in treatment of the disease?

Thrombosis tendency in IBD Thrombosis tendency is accepted to increase in IBD. Thrombosis is encountered in arterial and more commonly in venous system besides microvascular mucosal thrombosis. Thrombosis arises in deep crural veins, pulmonary circulation, less commonly in cerebrovascular system, portal vein and retinal veins [3-7]. When we analyzed the magnitude of the problem; frequency of systemic thromboembolism in IBD varies between 1-7% and reaches to 39% in some autopsy series [3,8,9]. In the study of Bernstein et al. [10] deep venous thrombosis and pulmonary embolism are three fold higher among IBD cases compared to normal population. In addition to this, detection of the fact that IBD was less frequent among patients who have hemophilia and von Willebrand disease [11,12]. This prothrombic condition was suggested to be able to play a role in pathogenesis of especially CD; multifocal microscopic ulcerations were detected even in healthy mucosa biopsies macroscopically [13].

Many factors that may lead to thrombosis are available in inflammatory bowel diseases and these factors are summarized in Table 1 [14].

Hereditary risk factors Factor V Leiden mutation, G20210A prothrombin

112

Turk J Hematol 2012; 29: 111-119

Table 1: Hereditary and acquired prothrombic risk factors in IBD [14].

• Hereditary risk factors o Factor V Leiden mutation o Prothrombin G20210A gene mutation o Others (the ones that rarely seen) • Acquired risk factors o Inflammation and acute medical conditions o Longstanding immobility o Surgical interventions o Steroid treatment o Central venous catheter insertion o Hyperhomocysteinemia o Anti-phospholipid antibodies o Others gene mutation, C677T methylenetetrahydrofolate reductase gene mutation, Factor XIII gene mutation and plasminogen activator inhibitor type 1 gene polymorphisms were hold to account in IBD and thrombophilia relationship [15]. Factor V Leiden mutation is a member of protein C natural anticoagulant system and is activated by binding thrombin to thrombomodulin on the endothelial surface (APC). APC inhibits uncontrolled thrombosis formation by inactivating factor V and VIII. Arg506 Gln point mutation on factor V gene (factor V Leiden) makes factor V resistant against inactivation by APC [14,16]. While frequency of factor V Leiden (FVL) is 2%-5% among Europeans, it was not found in native Africans, Native Americans and in Asia [17-20]. Its frequency was found as 7,9% as the results of studies carried out with healthy populations over the country [21]. FVL is the most common cause of thrombophilia and accounts for approximately 11-20% of acute venous thrombotic events [17].

IBD-FVL relationship was studied widely due to high frequency of FVL and because IBD is a prothrombotic condition. In a meta-analysis, a significant difference was not found between IBD cases and normal subjects in terms of FVL frequency [14]. However distinct results were reported in two studies. While FVL was found more frequent among CD cases compared to UC cases and healthy controls in the first one, FVL was found more frequent among UC cases compared to CD cases and healthy controls in the study of Halsam et al. [22]. These different results were tried to be explained with low number of patients and difference in geographic distribution of the mutation in meta-analysis of Papa et al. [14].

Turk J Hematol 2012; 29: 111-119

When thrombotic and non-thrombotic IBD cases were compared; Liebman et al. [19] found FVL in 36% of cases with thrombosis in their retrospective study. In the same study, they calculated IBD and FVL coincidence 23 fold greater compared to healthy subjects, risk of venous thrombosis development risk as 5-fold greater than nonthrombotic IBD cases. They suggested that FVL mutations had significant contribution on venous thrombosis development in IBD cases. The fact that venous thromboembolism risk increased in presence of FVL and especially before 45 years of age was confirmed in another study [23].

In a study reported from Turkey this year, it was stated that protein S and antithrombin III levels decreased along with protein C in active periods of both UC and CD, however no difference was reported in remission period. Additionally, activated protein C resistance was found indifferent from control group in active period and remission period. In this study, natural anticoagulant deficiency was emphasized to be able to lead to thrombophilia especially in cases in active period [24].

Prothrombin G20210A gene mutation Prothrombin (PT) is a protein synthesized from the liver with the effect of vitamin K and converted to thrombin by prothrombinase complex in the course of coagulation.

PT gene mutation develops by guanine adenine exchange at the 20210 position. PT level was found approximately 30% more in heterozygous subjects compared to healthy controls [14]. However a correlation was not found between IBD cases and PT gene mutation [9,25].

C677T methylenetetrahydrofolate reductase gene mutation and hyperhomocysteinemia Hyperhomocysteinemia is a risk factor for both arterial and venous thromboembolism. Hyperhomocysteinemia may arise as the result of a genetic defect (C677T methylenetetrahydrofolate reductase gene mutation) and also as the result of deficiency of cofactors like vitamin B12, B6 and folate [26]. Endothelial damage is in question following endothelial dysfunction and thrombocyte activation in development of hyperhomocysteinemia-related thrombosis. Homocysteine converts to homocysteine, homocysteine thiolactone and mixed disulfides via rapid auto-oxidation in plasma, strong reactives like superoxide and hydrogen peroxide and this is more prominent especially in cases with hyperhomocysteinemia.

Homocysteine thiolactone and LDL conjugate and form aggregates, this leads to foam cell formation and contrib-

Tezel A and Demir M: Thrombosis in Inflammatory Bowel Disease

utes to reactive oxygen radical development. Reactive oxygen radicals lead to endothelial damage and dysfunction, this leads to excessive platelet activation and aggregation.

Thrombosis in hyperhomocysteinemia was detected to be rich of platelets. Reactive oxygen radicals also contribute to thrombosis development by oxidizing LDL, leading to lipid peroxidation and causing proliferation in vascular smooth muscle cells [26].

Relationship between hyperhomocysteinemia and thrombosis development in IBD was researched widely.

Hyperhomocysteinemia may be genetic in origin and also develops related to deficiency of cofactors like B6, folate and B12 vitamins that are effective on homocysteine metabolism. Nutritional insufficiency, impairment in absorption and decrease in their levels due to effects of drugs like sulfasalazine may be seen in IBD [27,28]. In two studies investigating IBD and hyperhomocysteinemia coexistence, homocysteine levels were found to be significantly higher in IBD cases compared to healthy subjects however a relationship could not be found between hyperhomocysteinemia and thrombosis development in both studies [29,30].

On the other hand, C677T methylenetetrahydrofolate reductase gene mutation was also investigated as the cause of hyperhomocysteinemia in IBD and conflicting results were reported. While C677T mutation was found significantly higher in IBD cases compared to healthy individuals in two studies held in Northern Europe [9,31], there are studies reporting C677T mutation frequency in IBD as high as healthy individuals [28,32,33].

When evaluating C677T homozygosity and disease relationship, it should be kept in mind that this mutation may differ significantly according to ethnic and geographic factors. For example, while it is never seen in Africans, it was found highest among Italians and Spanish people [1820%), moderate in northern countries like Germany, Holland, Norway, Ireland 87-10%) [34]. Thus it is obvious that C677T mutation in healthy individuals and subjects with IBD would give different results in the studies held in aforementioned countries or groups.

In general, absence of a correlation between FVL, prothrombin gene mutation, C677T methylenetetrahydrofolate reductase gene mutations and IBD is not surprising. Although complex genetics of IBD has not been fully explained, association of genomic regions on chromosomes 12 and 16 with diseases was shown [35]. On the other hand, prothrombic mutations were shown to be on genes located on chromosomes 1 and 11 in the study of

113

Tezel A and Demir M: Thrombosis in Inflammatory Bowel Disease

Vecchi et al. [32]. As the result, congenital thrombophilic disorders and IBD do not take place on the same genetic basis.

IBD and Hemostasis Relationship Many factors related to the nature of the disease, metabolic outcomes and drugs might lead to different conditions in the course of IBD; they also may contribute to thrombosis formation [36].

Inflammation and inflammatory activity Chronic intestinal inflammation triggered by luminal antigens in genetically susceptible subjects may be stated as the environmental factor in IBD. We can consider different wall structures of gram negative and anaerobic bacteria, bacteria products and dietary antigens as luminal antigens. Developing immunologic events, tissue damage and repair develop in a similar manner independently from the initiating factor in intestinal inflammation. Immune, mesenchymal and epithelial cells activated in intestinal wall implement tissue damage and repair via some soluble mediators. These mediators include cytokines, arachidonic acid metabolites and growth factors. While intestinal inflammation may be controlled in healthy individuals, down regulation of inflammation is not probable in IBD cases. If antigenic stimulus continues, inflammatory response arises gradually getting strong. This property (misfortune) is responsible for chronicity and disease in IBD cases.

Many soluble mediators play an important role in pathogenesis of the disease in IBD. These may include arachidonic acid metabolites (prostaglandin E2 [PGE2], thromboxane A2 [TXA2], and leukotriene B4 [LTB4]), platelet activating factor (PAF), cytokines (IL-1, IL-2, TNF-a, IL-8, IFN-g), and intercellular adhesion molecules (ICEM-I, etc.). On the other hand, cytokines like IL-4, IL-10 and IL-13 play roles in stabilization of inflammation, growth factors like transforming growth factor - beta (TGF-b) play roles in tissue repair [36]. PAF is synthesized and released by monocytes, neutrophils, basophils, mast cells, vascular endothelial cells and epithelial cells during inflammation [36]. Biologic effects of PAF are stimulation of thrombocyte and neutrophil aggregation, chemotaxis, stimulation of eicosanoid and IL-8 synthesis, contraction of smooth muscle cells and increasing mucosal chloride secretion. In active IBD cases, increased PAF was found in ileal and colonic mucosa biopsies and in feces [37]. Chiarantini et al. [12] detected an increase in aggregation of platelets. Although statistically insignificant, hyperaggregability was reported significantly in CD and no relation-

114

Turk J Hematol 2012; 29: 111-119

ship was found between disease activity. Authors suggest that this may be related to PAF rather than TXA2 [11].

Systemic inflammation is accepted as a strong prothrombic stimulus. While inflammatory events increase procoagulant factors, they decrease natural anticoagulants and fibrinolytic activity [38]. Effects of inflammation on coagulation are summarized in Table 2.

Hemostatic changes in the course of IBD are related to activity and severity of the disease. Alterations in hemostasis were widely investigated in experimental and clinical studies. One of the mainly affected compounds is platelets and changes both in activities and numbers of the platelets are detected.

Kapsoritakis et al. [39] researched thrombopoietin (TPO) level that is a physiologic regulator of thrombopoiesis in IBD. While platelet count increases in active casesand this is used as an important indicator of inflammationnormalizing was detected in inactive cases, on the other hand, TPO level was found high independently from activity. A significant relationship could not be found between TPO level, and the platelet count, erythrocyte sedimentation rate, or C-reactive protein level. Authors reported that TPO could be related to procoagulant property of IBD besides platelet production [39]. Thrombocytosis and low volume platelets were proven to be associated with disease activity. Expression of activation proteins like P-selectin, GP53 and CD40-ligand increased both in UC and CD. Plasma CD40 ligand level was associated with prevalence of anatomic involvement. Presence of platelet aggregates was shown in mucosal biopsies of UC patients. Activation of platelets can be indicated with presence of platelet-leucocyte complexes in circulation [40].

Table 2: Effects of inflammation on hemostasis [38].

• The ones increase in inflammation o Tissue factor o Membrane procoagulant lipid o Platelet reactivity o Fibrinogen • The ones decrease-suppressed inflammation o Thrombomodulin (TM) o Endothelial cells protein C receptor (EPCR) o Shortening in APC half time o Protein Z o Vascular heparin-like molecules o Fibrinolysis ( Increase in PAI-1)

Turk J Hematol 2012; 29: 111-119

Various steps of coagulation-fibrinolytic system were analyzed in active and remission periods of IBD. In the studies, it was reported that measurement of coagulation factor level was not healthy enough because IL 6 and TNF alpha and hepatic synthesis of these proteins could increase as acute phase reactants [8,41]. Thus prothrombin fragment 1+2 (F1+2) was reported to give better outcomes as the indicator of coagulation activation, fibrin degradation products (FDP) were reported to give better outcomes as the indicator of fibrinolytic system [39].

F1+2 and FDP levels were found high as indicating activation of coagulation and fibrinolytic system independently from inflammatory activity in IBD [8, 12,41]. FDP were found significantly low in cases using corticosteroids.

Authors reported that corticosteroid usage caused risk for thrombosis development by decreasing fibrinolytic activity [41].

Another indicator of coagulation activation in IBD patients is thrombin increase. In other words, prothrombic property of the disease was proven by endogenous thrombin formation-another indicator of coagulation activation in IBD patients. That thrombin formation increased with CRP elevation or disease activity was shown with endogenous thrombin potential by Saibeni et al. Why thrombosis formation is more in active period is explained with these data [42].

As in all inflammatory events, fibrinolytic system inhibition is seen also in IBD patients. Decrease in tissue plasminogen activator (tPA)-fibrinolytic system activator- and increase in plasminogen activator inhibitor (PAI) -fibrinolytic system inhibitor- were detected [43]. Besides, frequencies of autoantibodies against compounds of coagulation system, especially phospholipids and protein S have also increased. However clinical importance of these antibodies is controversial.

Acquired risk factors Factors like longstanding immobilization, surgical intervention, corticosteroid treatment, and central venous catheter insertion considered among acquired factors are effective for thrombosis development not only in IBD but also in many other diseases. In a study carried out for detection of thrombosis risk, only corticosteroid use was found as a factor increasing thrombosis risk [9], on the other hand, in another study active illness, intestinal stenosis and fistula were reported as risk factors [23]. Age of thrombosis development was found earlier in both studies compared to non-IBD causes. Not only hospitalized patients but also patients followed up in outpatient set-

Tezel A and Demir M: Thrombosis in Inflammatory Bowel Disease

ting in active period were shown to be risky for thromboembolism. Grainge et al. [44] investigated venous thromboembolism risk between periods of inflammatory bowel disease and found that cases in active period were more risky in pre-hospitalization period compared to the patients who were hospitalized. While this risk is prominent both in episodes and chronic active cases, it is less in cases in remission. [Hazard ratio 15.8 (9.8-25.5) during episodes in outpatient setting, 9.9 (6.7-14.7) in chronic active cases, 2.2 (1.5-3.2) in cases in remission, 3.2 (1.72.3) during episodes in hospitalized cases, 2.8 (1.5-5.2) in chronic active cases, 1.7(1.1-2.9) in remission, 95% CI].

Thrombosis risk was shown to increase among IBD cases in subjects with acute medical diseases [45-47]. Using data of these multi-center randomized studies, IBD was also added to risk assessment scales used for detection of thrombosis risk in patients hospitalized due to acute medical diseases [48].

May thrombosis development be prevented in IBD? Although IBD is accepted as a prothrombic clinical condition, a treatment preventing thrombosis development is not available in daily practice due to the fact that thrombosis physiopathology could not be fully enlightened, IBD-specific risk factors could not be fully determined except for corticosteroid use. Patient education is of great importance as general measures. Prevention of longstanding immobilization, counteracting smoking, and careful monitorization of subjects who underwent surgical intervention and who were inserted catheters are recommended. Besides, pharmacologic and mechanical thromboprophylaxis should definitely be made (with low molecular weight heparin) if there is not a contraindication in patients older than 40 years who are hospitalized and stay immobilized longer than 3 days.

Heparin use in IBD Traditional treatment modalities like corticosteroids, 5-ASA/sulphasalazine, immunosuppressive drugs lead to additional morbidities in IBD and increase number of surgical interventions. In recent years, heparin use has taken place among alternative medical treatment methods with immunomodulatory drugs.

Accepting IBD as a prothrombic condition, indicating intestinal microthrombosis even in histologically normal mucosa arised the opinion to benefit from anticoagulant effect of heparin [49]. Anticoagulant effect of heparin is inhibition of factor X in presence of antithrombin in plasma and inhibiting thrombin formation [48]. However

115

Tezel A and Demir M: Thrombosis in Inflammatory Bowel Disease

Turk J Hematol 2012; 29: 111-119

Table 3: Immunomodulatory and anti-inflammatory effects of heparin [49-51].

• Makes barrier function of endothelium stronger by substituting with endogenous glycosaminoglycans inhibited by heparinase, binding to endothelial cells • Decreases neutrophil accumulation and rolling in inflammation site • Decreases endothelial ICAM-1 expression, inhibits neutrophil transmigration • Inhibits neutrophil diapedesis by inhibiting neutrophil elastase.

• Interferes with cytokines and growth factors due to negative loaded polyanionic groups.

• Contributes to angiogenesis and tissue repair.

• Substitutes with syndecan-1 (decreases in IBD) that is the necessary cofactor for binding basic fibroblast growth factor to its receptor, contributes to repair.

• Inhibits TNFά, increases TNF-α-binding protein 1.

• Inhibits NF-kB’s intranuclear translocation.

• Decreases IL-8 neutrophil connection.

• Decreases IL-6 production.

• Decreases NO production, reactive oxygen metabolites.

• Heparin-AT complex has antiinflammatory activity. heparin has immunomodulatory and anti-inflammatory effects besides well-known anticoagulant effect. These effects are summarized in Table 3. [49-51] Heparin is currently used as an alternative treatment in UC cases resistant to steroid. Three studies are available about this topic; heparin was used with an initial dose of 25.000-40.000 IV daily for 4-6 weeks, aPTT so as to be 60’’, 54%-90% remission was reported [52-54]. Some of the patients were administered subcutaneous heparin during 6 weeks-4 months and no relapses were reported after the drug had been discontinued. Heparin was tolerated well in these studies; the most frightening adverse reaction colonic bleeding was seen in 5% cases.

Törkvist et al. [55] used dalteparin sodium (low molecular weight heparin) 5000 U SC bid during 12 weeks in 12 active UC cases resistant to steroid. They obtained clinical improvement in 11 (92%) cases and complete remission in 6 (50%) cases and reported no adverse effects. Authors suggested that low molecular weight heparin could be a good alternative due to its safety.

On the other hand, in the prospective, randomized, double blind, placebo controlled, multicenter study of Bloom et al. [56] including 100 UC cases with mild or moderate activity, they reported that tinzaparin was not superior to placebo. In the meta-analysis of Shen et al. [57], both low molecular weight and standard heparin were reported not to be superior to conventional treatment and provided no additional benefits in ulcerative colitis cases.

In addition to this, while importance of biologic agents in IBD treatment is gradually increasing in recent years, use

116

of heparin and heparin derivatives for anti-inflammatory purpose has played second fiddle [58].

Conclusion The best example for interaction between hemostasis and inflammation is IBD. According to obtained experimental and clinical data, it is accepted as a medical condition that thrombosis frequency increased. Thus the fact that thromboprophylaxis is necessary especially for subjects who are planned to be hospitalized has been proven with clinical studies. Thromboprophylaxis may be done with pharmacologic and/or mechanical methods however pharmacologic methods are known to be superior.

Although the most frightening adverse effect is bleeding, frequency of bleeding has not been increased compared to placebo in cases that standard or low molecular weight heparin had been used. Besides, wound healing occurs faster due to anti-inflammatory and immunomodulatory properties of heparin molecules except for anticoagulant properties and the disease remits easily. Evaluating use of anticoagulants in IBD from this point of view would be beneficial. Heparins’, especially low molecular weight heparins’ introduction as an alternative treatment among future treatment modalities is probable.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2012; 29: 111-119

References 1. Yoshida H, Granger DN: Inflammatory bowel disease: A Paradigm for the link between coagulation and inflammation.

Inflamm Bowel Dis 2009; 15: 1245-1255 2. Bargen JA, Barker NW: Extensive arterial and venous thrombosis complicating chronic ulcerative colitis. Arch Intern Med 1936; 58: 17-31 3. Talbot RW, Heppel J, Dozois RR, Beart RW Jr: Vascular complications of inflammatory bowel disease. Mayo Clin Proc 1986; 61: 140-145 4. Johns DR: Cerebrovascular complications of inflammatory bowel disease. Am J Gastroenterol 1991; 86: 367-370 5. Keyser BJ, Hass AN: Retinal vascular diesase in ulcerative colitis. Am J Ophtalmol 1994; 118: 395-396 6. Fichera A, Cicchiello LA, Mendelson DS, Greenstein AJ, Heimann TM: Superior mesenteric vein thrombosis after colectomy for inflammatory bowel disease: A not uncommon cause of postoperative acute abdominal pain.

Dis Colon Rectum 2003; 46: 643-648 7. Ribeiro JM, Rebocho L, Lucas MB, Campos P, Victorino RM: Brachiocephalic vein thrombosis associated with Crohn’s disease. J Gastroenterol 2003; 38: 268-271 8. van Bodegraven AA, Schoorl M, Baak JP, Linskens RK, Bartels PC, Tuynman HA: Hemostatic imbalance in active quiescent ulcerative colitis. Am J Gastroenterol 2001; 96: 487-493 9. Grip O, Svensson PJ, Lindgren S: Lindgren Inflammatory bowel disease promotes venous thrombosis earlier in life.

Scand J Gastroenterol 2000; 35: 619-623 10. Bernstein CN, Blanchard JF, Houston DS, Wajda A: The incidence of deep venous thrombosis and pulmonary embolism among patients with inflammatory bowel disease: A population-based cohort study. Thromb Haemost 2001; 85: 430-434 11. Thomson NP, Wakefield AJ, Pounder RE: Inherited disorders of coagulation appear to protect against inflammatory bowel disease. Gastroenterology 1995; 108: 1011-1015 12. Chiarantini E, Valanzano R, Liotta AA, Cellai AP, Fedi S, Ilari I, Prisco D, Tonelli F, Abbate R: Hemostatic abnormalities in inflammatory bowel disease. Thromb Res 1996; 82: 137146 13. Wakefield AJ, Sawyerr AM, Dhillon AP, Pittilo RM, Rowles PM, Lewis AA, Pounder RE: Pathogenesis of Crohn’s disease: Multifocal gastrointestinal infarction. Lancet 1989; 2: 10571062 14. Papa A, Danese S, Grillo A, Gasbarrini G, Gasbarrini A: Review article: Inherited thrombophilia in inflammatory bowel disease. Am J Gastroenterol 2003; 98: 1247-1251 15. Tsiolakidou G, Koutroubakis IE: Thrombosis and inflammatory bowel disease-the role of genetic risk factors.

World J Gastroenterol 2008; 14 (28): 4440-4444

Tezel A and Demir M: Thrombosis in Inflammatory Bowel Disease

16. Bertina RM, Koeleman BP, Koster T, Rosendaal FR, Dirven RJ, de Ronde H, van der Velden PA, Reitsma PH: Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 1994; 369: 64-67 17. Selingsohn U, Lubetsky A: Genetic susceptibility to venous thrombosis. N Eng J Med 2001; 344: 1222-1231 18. Rees DC, Cox M, Clegg JB: Word distrubition of factor V Leiden. Lancet 1995; 346: 1133-1134 19. Liebman HA, Kashani N, Sutherland D, McGehee W, Kam AL: The factor V Leiden mutation increases the risk of venous thrombosis in patients with inflammatory bowel disease. Gastroenterology 1998; 11: 830-834 20. Over HH, Ulgen S, Tuğlular T, Tezel A, Avşar E, Geyik G, Başgül S, Sayhan N, Ulusoy N, Kalayci C, Tözün N: Thrombophlia and inflammatory bowel disease: Does factor V mutation have a role? Eur J Gastroenterol Hepatol 1998; 10: 827-829 21. Akar N: Factor V 1691 G-A mutation distribution in a healthy Turkish population. Turk J Hematol 2009; 26: 9-11 22. Haslam N, Standen GR, Probert CS: An investigation of the association of the factor V Leiden mutation and inflammatory bowel disease. Eur J Gastroenterol Hepatol 1999; 11: 12891291 23. Cakal B, Gokmen A, Yalinkilic M, Cakal E, Ayaz S, Nadir I, Ozin Y, Dagli U, Ulker A: Natural anticoagulant protein levels in Turkish patients with inflammatory bowel disease.

Blood Coagulation and Fibrinolysis 2010; 21: 118-121 24. Novacek G, Miehsler W, Kapiotis S, Katzenschlager R, Speiser W, Vogelsang H: Thromboembolism and resistance to activated protein C in patients with inflammatory bowel disease. Gastroenterology 1999; 94: 685-690 25. Halsam N, Standen GR, Propert CS: An investigation of the association of the prothrombin G202210A gene mutation and inflammatory bowel disease: Factor II and IBD. Inflammatory Bowel Dis 2001; 7: 133-135 26. Welch GN, Loscalzo J: Homocysteine and Atherothrombosis.

N Eng J Med 1998; 338: 1042-1050 27. Saibeni S, Cattaneo M, Vecchi M, Zighetti ML, Lecchi A, Lombardi R, Meucci G, Spina L, de Franchis R: Low vitamin B(6) levels, a risk factor for thrombosis, in inflammatory bowel disease: A role of inflammation and correlation with acute phase reactants. Am J Gastroenterol 2003; 98: 112117 28. Papa A, De Stefano V, Danese S, Chiusolo P, Persichilli S, Casorelli I, Zappacosta B, Giardina B, Gasbarrini A, Leone G, Gasbarrini G: Hyperhomocysteinemia and prevalance of polymorphisms of homocysteine metabolism-related enzymes in patiens with inflammatory bowel disease. Am J Gastroenterol 2001; 96: 2677-2682

117

Tezel A and Demir M: Thrombosis in Inflammatory Bowel Disease

29. Oldenburg B, Fijnheer R, van der Griend R, vanBergeHenegouwen GP, Koningsberger JC: Homocysteine in inflammatory bowel disease: A risk factor for thromboembolic complications? Am J Gastroenterol 2000; 95: 2825-2830 30. Romagnuolo J, Fedorak RN, Dias VC, Bamforth F, Teltscher M: Hyperhomocysteinemia and inflammatory bowel disease: Prevalance and predictors in a cross-sectional study. Am J Gastroemterol 2001; 96: 2143-2149 31. Mahmud N, Molloy A, McPartlin J, Corbally R, Whitehead AS, Scott JM, Weir DG: Increased prevalance of methylentetrahydrofolate reductase C677T variant in patients with inflammatory bowel disease, and its clinical implications. Gut 1999; 45: 389-394 32. Vecchi M, Sacchi E, Saibeni S, Meucci G, Tagliabue L, Duca F, De Franchis R: Inflammatory bowel diseases are not associated with major hereditary conditions predisposing to thrombosis. Dig Dis Sci 2000; 45: 1465-1469 33. Guédon C, Le Cam-Duchez V, Lalaude O, Ménard JF, Lerebours E, Borg JY: Prothrombotic inherited abnormalities other than factor V Leiden mutation do not play a role in venous thrombosis in inflammatory bowel disease. Am J Gastroenterol 2001; 96: 1448-1454 34. Botto LD, Yang Q: 5,10- Methyltetrahydrofolate reductase gene variants and congenital abnormalities: A HuGe review.

Am J Epidemiol 2000 ;151: 862-877 35. Gusella JF, Podolsky DK: Inflammatory bowel disease : Is it in the genes? Gastroenterology 1998; 115: 1286-1289 36. van Dullemen H, Meenan J, Stronkhorst A, Tytgat GN, van Deventer SJ: Mediators of mucosal inflammation: Implications for therapy. Scand J Gastroenterol Suppl 1997; 223: 92-98 37. Wardle TD, Hall L, Turnberg LA: Platelet activating factor: Release from colonic mucosa in patients with ulcerative colitis and its effect on colonic secretion. Gut 1996; 38: 355-361 38. Esmon CT: Inflammation and thrombosis. J Thromb Haemost 2003; 1: 1343-1348 39. Kapsoritakis AN, Potamianos SP, Sfiridaki AI, Koukourakis MI, Koutroubakis IE, Roussomoustakaki MI, Manousos ON, Kouroumalis EA: Elevated thrombopoietin levels in patients with inflammatory bowel disease. Am J Gastroenterol 2000; 95: 3478-3481 40. Pamuk GE, Vural O, Turgut B, Demir M, Umit H, Tezel A: Increased circulating platelet-neutrophil, platelet-monocyte complexes and platelet activation in patients with ulcerative colitis: A Comparative Study. Am J Hematol 2006; 81: 753759 41. Kjeldsen J, Lassen JF, Brandslund I, Schaffalitzky de Muckadell OB: Markers of coagulation and fibrinolysis as measures of disease activity in inflammatory bowel disease.

Scand J Gastroenterol 1998; 33: 637-643

118

Turk J Hematol 2012; 29: 111-119

42. Saibeni S,, Saladino V, Chantarangkul V, Villa F, Bruno S, Vecchi M, Franchis R, Sei C, Tripodi A: Increased thrombin generation in inflammatory bowel diseases. Thromb Res 2010; 125: 278-282 43. Danese S, Papa A: PAI-1 and TAFI in inflammatory bowel disease: The yin and yang of the fibrinolytic system. Eur J Gastroenterol Hepatol 2008; 20: 826-828 44. Grainge MJ, West J, Card TR: Venous thromboembolism during active disease and remission in inflammatory bowel disease: A cohort study. Lancet 2010; 375: 657-663 45. Samama MM, Cohen AT, Darmon JY, Desjardins L, Eldor A, Janbon C, Leizorovicz A, Nguyen H, Olsson CG, Turpie AG, Weisslinger N: A comparison of enoxaparin with placebo for the prevention of venous thromboembolism in acutely ill medical patients. Prophylaxis in Medical Patients with Enoxaparin Study Group. N Engl J Med 1999 ;341 (11): 793-800 46. Cohen AT, Davidson BL, Gallus AS, Lassen MR, Prins MH, Tomkowski W, Turpie AG, Egberts JF, Lensing AW; ARTEMIS Investigators: Efficacy and safety of fondaparinux for the prevention of venous thromboembolism in older acute medical patients: Randomised placebo controlled trial. BMJ 2006; 332: 325-329 47. Leizorovicz A, Cohen AT, Turpie AG, Olsson CG, Vaitkus PT, Goldhaber SZ: Randomized, placebo-controlled trial of dalteparin for the prevention of venous thromboembolism in acutely ill medical patients. Circulation 2004; 110: 874879 48. Cohen AT, Alikhan R, Arcelus JI, Bergmann JF, Haas S, Merli GJ, Spyropoulos AC, Tapson VF, Turpie AG: Assessment of venous thromboembolism risk and the benefits of thromboprophylaxis in medical patients. Thromb Haemost 2005; 94 (4): 750-759 49. Papa A, Danese S, Gasbarrini A, Gasbarrini G: Review article: potential therapeutic applications and mechanisms of action of heparin in inflammatory bowel disease. Aliment Pharmacol Ther 2000; 14: 1403-1409 50. Day R, Forbes A: Heparin, cell adhesion, and pathogenesis of inflammatory bowel disease. Lancet 1999; 354: 62-65 51. Young E: The anti-inflammatory effects of heparin and related compounds. Thrombosis Research 2008; 122: 743752 52. Gaffney PR, Doyle CT, Gaffney A, Hogan J, Hayes DP, Annis P: Paradoxical response to heparin in 10 patients with ulcerative colitis. Am J Gastroenterol 1995; 90: 220-223 53. Evans RC, Wong VS, Morris AI, Rhodes JM: Treatment of corticosteroid resistant ulcerative colitis with heparin-a report of 16 cases. Aliment Pharmacol Ther 1997; 11: 10371040

Turk J Hematol 2012; 29: 111-119

54. Folwaczny C, Wiebecke B, Loeschke K: Unfractioned heparin in the therapy of patients with highly active inflammatory bowel disease. Am J Gastroenterol 1999; 94: 1551-1555 55. Törkvist L, Thorlacius H, Sjöqvist U, Bohman L, Lapidus A, Flood L, Agren B, Raud J, Löfberg R: Low moleculer weight heparin as adjuvant therapy in active ulcerative colitis.

Aliment Pharmacol Ther 1999; 13: 1323-1328 56. Bloom S, Kiilerich S, Lassen MR, Forbes A, Leiper K, Langholz E, Irvine EJ, O’Morain C, Lowson D, Orm S: Low molecular weight heparin (tinzaparin) vs placebo in the treatment of mild to moderate active ulcerative colitis.

Aliment Pharmacol Ther 2004; 19: 871-878

Tezel A and Demir M: Thrombosis in Inflammatory Bowel Disease

57. Shen J, Ran ZH, Tong JL, Xiao SD: Meta-analysis : The utility and safety of heparin in the treatment of active ulcerative colitis. Aliment Phermacol Ther 2007; 653-663 58. Travis SP, Stange EF, Lémann M, Oresland T, Bemelman WA, Chowers Y, Colombel JF, D’Haens G, Ghosh S, Marteau P, Kruis W, Mortensen NJ, Penninckx F, Gassull M; for the European Crohn’s and Colitis Organisation (ECCO): European evidence-based consensus on the management of ulcerative colitis: Current management. J Corhn’s & Colitis 2008; 2: 24-62

119

Research Article

DOI: 10.5505/tjh.2012.60362

The Frequency and Clinical Relevance of Multidrug Resistance Protein Expression in Patients with Lymphoma Çoklu İlaç Direnci Protein İfadelerinin Lenfomalardaki Sıklık ve Klinik Önemi Eren Gündüz1, Murat Dinçer2, Güniz Yıldız1, Cengiz Bal3, Zafer Gülbaş4 Eskişehir Osmangazi University, Department of Hematology, Eskişehir, Turkey Eskişehir Acıbadem Hospital, Medical Oncology Clinic, Eskişehir, Turkey 3 Eskişehir Osmangazi University, Department of Biostatistics, Eskişehir, Turkey 4 Anadolu Health Center in Affiliation with Johns Hopkins Medicine, Bone Marrow Transplantation Center, Kocaeli, Turkey 1 2

Abstract Objective: Multidrug resistance is a cause of treatment failure in patients with malignant lymphoma; however, the frequency and clinical relevance of multidrug resistance protein expression are unclear. The present study aimed to investigate expression of the most common multidrug resistance proteins in a group of lymphoma patients.

Material and Methods: The study included 44 previously untreated lymphoma patients (non-Hodgkin’s lymphoma [n = 21], non-malignant lymphadenopathy [n = 13], and Hodgkin’s lymphoma [n = 10]). MDR1, MRP, and LRP expression was assessed via quantitative PCR of lymph node biopsy specimens.

Results: In the non-Hodgkin’s lymphoma group MDR1 was positive in 23.8% (5/21) of the patients, MRP was positive in 57.14% (12/21), and LRP was positive in 90.47% (19/21). In the non-malignant lymphadenopathy group, MDR1 was positive in 46.15% (6/13) of the patients, MRP was positive in 84.61% (11/13), and LRP was positive in 100% (13/13). In the Hodgkin’s lymphoma group MDR1 was positive in 50% (5/10) of the patients, MRP was positive in 50% (5/10), and LRP was positive in 80% (8/10). MDR1, MRP, and LRP expression did not differ between the 3 groups.

Furthermore, MDR1, MRP, and LRP expression wasn’t associated with tumor stage, response to first-line therapy, the erythrocyte sedimentation rate, or C reactive protein, beta 2 microglobulin, serum lactate dehydrogenase, and albumin levels. Additionally, survival time in the MDR1- and MRP-positive, and MDR1- and MRP-negative patients did not differ (comparison of LRP was not possible due to the small number of LRP-negative patients).

Conclusion: According to the present findings, future studies should investigate alternative pathways of multidrug resistance in order to arrive at a better understanding of treatment failure in lymphoma patients.

Key Words: Multidrug resistance, non-Hodgkin’s lymphoma, Hodgkin’s lymphoma, Survival

Address for Correspondence: Zafer Gülbaş, M.D., Anadolu Sağlık Merkezi, Kemik İliği Nakli Merkezi, Kocaeli, Turkey Phone: +90 262 678 54 68 E-mail: zafer.gulbas@anadolusaglik.org Received/Geliş tarihi : December 8, 2010 Accepted/Kabul tarihi : January 2, 2012

120

Turk J Hematol 2012; 29: 120-125

Gündüz E, et al: Multidrug Resistance Protein Expression in Lymphoma Patients

Özet Amaç: Çoklu ilaç direnci malign lenfomalarda tedavi başarısızlığının nedenlerindendir. Fakat çoklu ilaç direnci proteinlerinin sıklığı ve klinik önemiyle ilgili çelişkiler mevcuttur. Biz bu çalışmada lenfomalı hastalarımızda en sık görülen çoklu ilaç direnci proteinlerinin ifadelerini araştırdık.

Gereç ve Yöntemler: Çalışmaya daha önce tedavi almamış 44 hasta (21 non Hodgkin lenfoma, 13 malign olmayan lenfadenopati, 10 Hodgkin lenfoma) alındı. MDR1, MRP ve LRP ifadeleri lenf nodu biyopsi örneklerinde kantitatif PCR ile değerlendirildi.

Bulgular: Non Hodgkin lenfomada MDR1 %23.8 (5/21), MRP %57.14 (12/21), LRP %90.47 (19/21) pozitifti. Malign olmayan lenfadenopatili hastalarda MDR1 %46.15 (6/13), MRP %84.61 (11/13), LRP %100 (13/13) pozitifti. Hodgkin lenfomada MDR1 %50 (5/10), MRP %50 (5/10), LRP %80 (8/10) pozitifti. MDR1, MRP ve LRP ifadeleri 3 grup arasında farklı değildi. İfadeler tümör evresi, eritrosit sedimantasyon hızı, C reaktif protein, beta 2 mikroglobulin, ilk sıra tedaviye yanıt, serum laktat dehidrogenaz ve albumin düzeyiyle ilişkili değildi. MDR1 ve MRP pozitif ve negatif hastaların yaşam süreleri arasında da fark bulamadık (LRP pozitif ve negatif hastalar arası karşılaştırma yapmak az hasta sayısı nedeniyle mümkün olmadı).

Sonuç: Verilerimize göre, bu grup hastalardaki tedavi başarısızlığını aydınlatmak için gelecekte yapılacak çalışmalar çoklu ilaç direncinin alternatif yolaklarına yönlendirilebilir.

Anahtar Sözcükler: Çoklu ilaç direnci, non Hodgkin lenfoma, Hodgkin lenfoma, Yaşam süresi Introduction Multidrug resistance (MDR) refers to the resistance of tumor cells to chemotherapeutic agents of varying chemical structure and mechanisms of action [1]. Numerous mechanisms are involved in drug resistance; among them, drug efflux transporters are one of the most intensively studied and most prevalent [2,3]. Common MDR proteins include permeability related glycoprotein (P-gp), multidrug resistance-associated protein (MRP), and lung resistance-related protein (LRP) [4,5]. P-gp, also referred to as P-170, is a product of the MDR1 gene and is an ATPdependent pump capable of expelling drugs from cancer cells [6]. MRP is structurally similar to P-gp and is a member of the same transmembrane transporter superfamily [7]. LRP is a 110-kDa protein identified in a P-gp-negative MDR lung cancer cell line and functions as a major vault protein in humans [8].

Overexpression of MDR increases efflux of most lymphoma regimens from cells [9-11]. The predictive and prognostic value of MDR expression has previously been reported for multiple myeloma (MM) [12], acute myeloid leukemia (AML) [13], acute lymphoblastic leukemia (ALL) [14], and adult T-cell leukemia [15]. The MDR phenotype is also the major cause of treatment failure in patients with malignant lymphoma; however, findings regarding expression of the MDR1 gene/P-gp in malignant lymphoma patients are inconsistent [16-18].

Due to the non-clarity surrounding the frequency and clinical relevance of multidrug resistance protein expres-

sion, the present study aimed to investigate the expression of the most common MDR proteins in a group of previously untreated patients with lymphoma—specifically, whether or not these 3 multidrug resistance proteins were expressed and their impact on clinical outcome.

Materials and Methods The study included 44 previously untreated patients that were diagnosed between 2005 and 2007. The patients were divided into 3 groups, according to pathology results.

Group 1 included 21 patients diagnosed a diffuse large B-cell lymphoma (DLBCL) (n = 9), T-cell non-Hodgkin’s lymphoma (NHL) (n = 8), and mantle cell lymphoma (MCL) (n = 4). Group 2 included 13 patients diagnosed as reactive lymphadenopathy (LAP) (n = 5), granulomatous inflammation (n = 5), dermatopathic LAP (n = 1), benign mixed tumor (n = 1) and Kikuchi’s disease (n = 1). Group 3 included 10 patients diagnosed as Hodgkin’s lymphoma (HL).

Survival time was defined as the period (months) from diagnosis to death or data analysis. MDR1, MRP, and LRP expression was assessed via quantitative PCR of lymph node biopsy specimens. Only biopsy specimens clearly proven to be malignant based on flow cytometric and pathological analysis were included in the study.

Peripheral blood and lymph node biopsy specimens were obtained following provision of informed consent by the patients and approval of the study protocol by the Eskişehir Osmangazi University, School of Medicine Institutional Review Board.

121

Gündüz E, et al: Multidrug Resistance Protein Expression in Lymphoma Patients

Turk J Hematol 2012; 29: 120-125

The patients were treated with CVP, CHOP, HyperCVAD, IMVP16, DHAP, ESHAP, ABVD, and BEACOPP polychemotherapy. Patients with DLBCL and MCL also received rituximab. In all, 4 patients required radiotherapy and 4 other patients received additional peripheral stem cell transplantation (3 autologous and 1 allogeneic with reduced intensity conditioning). Response to chemotherapy was assessed according to standard criteria [19].

Tumor stage, the erythrocyte sedimentation rate, and C reactive protein, beta 2 microglobulin, serum LDH, and albumin levels were also recorded.

Detection of multidrug resistance Lymph node biopsy specimens obtained in the surgical suite were immediately taken to the laboratory in Eppendorf tubes containing RPMI1640 medium. The specimens were preserved in liquid nitrogen at –80 °C and thawed at 4 °C before RNA isolation. An mRNA Isolation Kit II (Tissue) (Roche) was used to obtain RNA from the tissue samples using a MagNA Pure instrument. cDNA was obtained using a Transcriptor First Strand cDNA Synthesis Kit (Roche). MDR1, MRP, LRP, and beta actin primary probes from TIB MOLBIOL and Light Cycler Taqman Master reaction mix were used for quantitative PCR in a Roche Light Cycler instrument. As beta actin is present in all clinical samples, it was used as an intrinsic control.

Quantitative MDR1, MRP, and LRP values were divided by the beta actin value, and the positive results were used for statistical analysis. We did not set a cut-off value and considered any level of expression as positive.

Figure 1: Figure. Survival time in the non-Hodgkin’s lymphoma, non-malignant LAP, and Hodgkin’s lymphoma groups.

Table 1: MDR1, MRP, and LRP positivity in the non-Hodgkin’s lymphoma, non-malignant LAP, and Hodgkin’s lymphoma groups.

MDR1

MRP

LRP

NHL

23.8% (5/21)

57.14% (12/21)

90.47% (19/21)

Non-Malignant LAP

46.15% (6/13)

84.61 (11/13)

100% (13/13)

50% (5/10)

50% (5/10)

80% (8/10)

HL

Statistical analysis All statistical analyses were performed using SPSS (PASW) v.18.0 for Windows software. Distribution of the variables was determined using the Shapiro Wilks test.

Parametric tests were used to analyze normally distributed data and non-parametric tests were used for data not normally distributed. The chi-square test was used for analysis of cross tables. Correlations between variables were determined by calculating Spearman’s correlation coefficients. The independent samples t-test and ANOVA were used to compare group means of normally distributed variables. Tukey’s post hoc test was used to determine different groups in ANOVA. The Kaplan Meier test was used to compare survival time between ≥2 groups. The log rank test was used to determine differences between mean survival times. P < 0.05 was considered statistically significant. Data are expressed as mean ± standard deviation (SD).

122

Results Mean age was 53.2 ± 17.5 years in the NHL patients (group 1), 41.7 ± 15.1 years in the non-malignant LAP patients (group 2), and 37.6 ± 13.7 years in the HL patients (group 3). NHL patients were older than HL patients (P < 0.05); the difference was not significant. Mean survival time was 19.69 ± 4.33 months in group 1, 42.46 ± 5.85 months in group 2, and 49.50 ± 4.69 months in group 3.

NHL patients had shorter survival than HL patients (P < 0.01), but survival time did not differ between the reactive LAP and lymphoma patients (P > 0.05) (Figure).

MDR1, MRP, and LRP positivity in the 3 groups is shown in the Table. The frequency of MDR1, MRP, and LRP positivity was significantly different between the 3 groups (P > 0.05). While examining survival time in each group separately, comparison was not possible in some groups due to the small number of negative patients (MRP

Turk J Hematol 2012; 29: 120-125

Gündüz E, et al: Multidrug Resistance Protein Expression in Lymphoma Patients

and LRP in group 2, and LRP in groups 1 and 3). When the other groups were compared (MDR1 and MRP in group 1 and 3, and MDR1 in group 2) a significant difference in survival time between the MDR1- and MRP-positive, and the MDR1- and MRP-negative patients was not observed.

In all, 5 patients in group 1 were positive for all 3 MDR proteins, 7 were positive for MRP and LRP, and 7 were positive only for LRP. In total, 6 patients in group 2 were positive for all 3 MDR proteins, 5 were positive for MRP and LRP, and 2 were positive only for LRP. Positivity for all 3 MDR proteins was observed in 3 patients in group 3 patients, whereas 1 patient was positive for MRP and LRP, 1 patient was positive only for MDR1, and 3 patients were positive only for LRP. There weren’t any significant associations between MDR1, MRP, and LRP expression, and tumor stage, response to first-line therapy, the erythrocyte sedimentation rate, or C reactive protein, beta 2 microglobulin, serum LDH and serum albumin levels.

Discussion In the present study expression of MDR1, MRP, and LRP was determined via quantitative real-time PCR (RTPCR) in patients with lymphoma and non-malignant diseases, and the association between the expression of the 3 MDR proteins, and clinical and laboratory parameters was evaluated. To the best of our knowledge this is the first study to evaluate the frequency and clinical relevance of MDR proteins in patients with malignant lymphomas (both Hodgkin’s and non-Hodgkin’s) and non-malignant diseases. In contrast to AML, studies on lymphomas and MDR are few in number and have generally focused on P-gp expression, and most included a heterogeneous patient population. Furthermore, the methods used to determine MDR expression in such studies varied widely [20]. As such, comparison of the published data is difficult. Moreover, these studies included a small number of patients, as did the present study, and therefore definitive conclusions cannot be reached.

MDR1/P-gp expression in lymphomas has been previously examined. Liu et al. [21] reported that 41.7% of 24 B-cell lymphoma patients were MDR-1/P-gp-positive (based on RT-PCR) before treatment. Pileri et al.

[22] reported that 44% of peripheral T-cell lymphoma patients and 40% of B-cell lymphoma patients were P-gppositive before treatment. Findings regarding the clinical importance of MDR1/P-gp in lymphomas are inconsistent. MDR1/P-gp was reported to be predictive of a poor response to induction chemotherapy in 2 studies [22,23], but not in 2 other studies [24,25]. Overall, research shows that 2%-30% of lymphomas express P-gp immunohis-

tochemically [22-24,26], increasing to 22%-50% when RNA-based analysis methods for detecting P-gp/MDR1 are used [24,25,27]. MDR1 expression in the present study was observed in 23.8% of non-Hodgkin’s lymphoma patients and in 50% of Hodgkin’s lymphoma patients; these percentages are similar to those previously reported.

The present study’s findings are also in agreement with studies that did observe a relationship between MDR1 expression [24,25] and poor response to induction chemotherapy.

Filipits et al. [28] reported that LRP was positive in 23% and MRP1 was positive in 44% of newly diagnosed DLBCL patients. LRP expression was associated with poor response to chemotherapy and shorter survival, which suggests that LRP is a clinically relevant drug resistance factor in DLBCL. A similar predictive and prognostic value of LRP expression was reported in patients with AML [15,29], ALL [30], MM [12], and advanced ovarian cancer [11]. Ohsawa et al. [31] reported that MRP1 was positive in 63% and LRP was positive in 68% of patients with nodal DLBCL. Huang et al. [32] observed MRP and LRP expression rates of 20.5% and 12.5%, respectively, in nasal NK/T-cell lymphoma patients. It is likely that the expression of MDR varies according to lymphoma subtype. In the present study expression of MRP and LRP was observed in 57.14% and 90.47% of NHL patients, respectively (LRP expression was higher than previously reported in Filipits [28], Oshawa [31] and Huang’s [32] studies), versus MRP and LRP in 50% of HL patients, respectively.

MRP expression was not observed to play an important role in the mechanism of drug resistance associated with a poor clinical outcome in previously untreated NHL patients [33]. Filipits et al. [28] reported that MRP1 expression had no impact on the outcome of chemotherapy or survival in patients with DLBCL, and similar findings have been observed in refractory lymphoma patients in whom MRP expression was not determined via quantitative PCR [34].

Previous studies on AML [14,29], ALL [30], and advanced ovarian cancer [11] also failed to observe any predictive or prognostic significance of MRP1 expression. Additionally, in the present study MRP and LRP expressions had no correlation with response to induction chemotherapy or survival in lymphoma patients with mixed histopathology.

In the present study there weren’t any significant correlations between MDR1, MRP, and LRP expression, and tumor stage, response to first-line therapy, the erythrocyte sedimentation rate, or C reactive protein, beta 2 microglobulin, and serum LDH and albumin levels in the NHL and HL patients. Mixed histopathology and differences in

123

Gündüz E, et al: Multidrug Resistance Protein Expression in Lymphoma Patients

treatment between the patients make it impossible to correlate the findings with clinical outcome, which is a limitation of the present study that warrants additional research.

Anti-CD20 monoclonal antibody (rituximab) has become the standard therapy for aggressive NHL and has dramatically improved treatment outcome [35]. Recent laboratory-based evidence shows that rituximab interacts with P-gp [36]; unfortunately, due to mixed histopathology and the small number of patients (n = 13) in the present study, we were unable to examine that interaction.

Non-malignant tissues expressed MDR proteins in the present study and the frequency of expression was similar in all the lymphoma patients. In fact, normal lymphocytes were reported to express MDR1/P-gp [37], but Kang et al. [9] posited that contamination of tumor samples with T-lymphocytes and monocytes does not significantly increase the level of MDR1 expression. The similarity of MDR expression between lymphoma and reactive LAP patients observed in the present study may have been due to lack of a cut-off value and considering any level of expression as positive, or that 3 patients previously reported as reactive LAP were diagnosed as NHL following rebiopsies performed during follow-up.

In conclusion, MDR1, MRP, and LRP expression was not observed to influence overall survival in NHL and HL patients. The present findings indicate that additional studies should examine alternative pathways of MDR other than MDR1/P-gp, MRP and LRP expression (apoptosis etc.) to elucidate treatment failure in this group of patients. Furthermore, the frequencies of expression observed in the present study are noteworthy, as to the best of our knowledge this is the first study to report and compare these frequencies in HL patients and non-malignant patients.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Biedler JL, Riehm H. Cellular resistance to actinomycin D in Chinese hamster cells in vitro: cross-resistance, radioautographic and cytogenetic studies. Cancer Res 1970; 30: 1174-1184.

2. Borst P, Elferink RO. Mammalian ABC transporteri in health and disease. Annu Rev Biochem 2002; 71: 537-592.

124

Turk J Hematol 2012; 29: 120-125

3. Gottesman MM, Fojo T, Bates SE. Multidrug resistance in cancer: a role of ATP dependent transporters. Nat Rev Cancer 2002; 2: 48-58.

4. Ross DD. Novel mechanisms of drug resistance in leukemia.

Leukemia 2000;14: 467-473.

5. Cho EY, Gong G, Khang SK, Kang YK, Huh J. Fine needle aspiration cytology of CD56-positive natural killer/T-cell lymphoma of soft tissue. Cancer 2002; 96: 344-350.

6. Shen DW, Cardarelli C, Hwang J, Cornwell M, Richert N, Ishii S, Pastan I, Gottesman MM. Multiple drug-resistant human KB carcinoma cells independently selected for highlevel resistance to colchicine, adriamycin or vinblastine show changes in expression of specific proteins. J Biol Chem 1986; 261: 7762-7770.

7. Kruh GD, Chan A, Myers K, Gaughan K, Miki T, Aaronson SA. Expression complementary DNA library transfer establishes mrp as a multidrug resistance gene. Cancer Res 1994; 54: 1649-1652.

8. Scheper RJ, Broxterman HJ, Scheffer GL, Kaaijk P, Dalton WS, van Heijningen TH, van Kalken CK, Slovak ML, de Vries EG, van der Valk P, J.L.M. Meijer C, HM Pinedo.

Overexpression of a M(r) 110,000 vesicular protein in nonP-glycoprotein- mediated multidrug resistance. Cancer Res 1993; 53: 1475-1479.

9. Kang YK, Zhan Z, Regis J, Alvarez M, Robey R, Meadows B, Dickstein B, Lee JS, Otsuki T, Stetler-Stevenson M, Jaffe ES, Solomon D, Wilson WH, Fojo A, Bates ES. Expression of mdr-1 in refractory lymphoma: quantitation by polymerase chain reaction and validation of assay. Blood 1995; 86: 1515-1524.

10. Cole SP, Bhardjaw G, Gerlach JH, Mackie JE, Grant CE, Almquist KC, Stewart AJ, Kurz EU, Duncan AM, Deeley RG. Overexpression of a transporter gene in a multidrugresistant human lung cancer cell line. Science 1992; 258: 1650-1654.

11. Izquierdo MA, Shoemaker RH, Flens MJ, Scheffer GL, Wu L, Prather TR, Scheper RJ. Overlapping phenotypes of multidrug resistance among panels of human cancer cell lines. Int J Cancer 1996; 65: 230-237.

12. Filipits M, Drach J, Pohl G, Schuster J, Stranzl T, Ackermann J, Königsberg R, Kaufmann H, Gisslinger H, Huber H, Ludwig H, Pirker R. Expression of the lung resistance protein predicts poor outcome in patients with multiple myeloma. Clin Cancer Res 1999; 5: 2426-2430.

13. Filipits M, Pohl G, Stranzl T, Suchomel RW, Scheper RJ, Jäger U, Geissler K, Lechner K, Pirker R. Expression of the lung resistance protein predicts poor outcome in de novo acute myeloid leukemia. Blood 1998; 91: 1508-1513.

Turk J Hematol 2012; 29: 120-125

Gündüz E, et al: Multidrug Resistance Protein Expression in Lymphoma Patients

14. Borg AG, Burgess R, Green LM, Scheper RJ, Yin JA. Overexpression of lung-resistance protein and increased P-glycoprotein function in acute myeloid leukemia cells predict a poor response to chemotherapy and reduced patient survival. Br J Haematol 1998; 103: 1083-1091.

15. Yasunami T, Wang Y, Tsuji K, Takanashi M, Yamada Y, Motoji T. Multidrug resistance protein expression of adult T-cell leukemia/lymphoma. Leuk Res 2007; 31: 465-470.

16. Yuen AR, Sikic BI. Multidrug resistance in lymphomas. J Clin Oncol 1994; 12: 2453-2459.

17. Marie JP. P-glycoprotein in adult hematologic malignancies.

Hematol Oncol Clin North Am 1995; 9: 239-249.

18. Sandor V, Wilson W, Fojo T, Bates SE. The role of MDR-1 in refractory lymphoma. Leuk Lymph 1997; 28: 23-31.

19. Cheson BD, Horning SJ, Coiffier B, Shipp MA, Fisher RI, Connors JM, Lister TA, Vose J, Grillo-López A, Hagenbeek A, Cabanillas F, Klippensten D, Hiddemann W, Castellino R, Harris NL, Armitage JO, Carter W, Hoppe R, Canellos GP. Report of an International Workshop to standardize response criteria for non-Hodgkin’s lymphomas. J Clin Oncol 1999; 17: 1244-1253.

20. Saglam A, Hayran M, Uner AH. Immunohistochemical expression of multidrug resistance proteins in mature T/NK cell lymphomas. APMIS 2008; 116: 791-800.

21. Liu Q, Ohshima K, Kikuchi M. High expression of MDR-1 gene and P-glycoprotein in initial and re-biopsy specimens of relapsed B cell lymphoma. Histopathology 2001; 38: 209-216.

22. Pileri SA, Sabattini E, Falini B, Tazzari PL, Gherlinzoni F, Michieli MG, Damiani D, Zucchini L, Gobbi M, Tsuruo T. Immunohistochemical detection of multidrug transport protein P170 in human normal tissues and malignant lymphomas. Histopathology 1991; 19: 131-140.

23. Cheng AL, Su IJ, Chen YC, Lee TC, Wang CH. Expression of P-glycoprotein and anionic glutathione S-transferase in recurrent lymphomas: the possible role of Ebstein Barr virus immunophenotypes and other predisposing factors. J Clin Oncol 1993; 11: 109-115.

24. Niehans GA, Jaszcz W, Brunetto V, Perri RT, Gajl-Peczalska K, Wick MR, Tsuruo T, Bloomfield CD. Immunohistochemical identification of P-glycoprotein in previously untreated diffuse large cell and immunoblastic lymphomas. Cancer Res 1992; 52: 3768-3775.

25. Rodriguez C, Commes T, Robert J, Rossi JF. Expression of P-glycoprotein and anionic glutathione S-transferase genes in non Hodgkin’s lymphomas. Leuk Res 1993; 17: 149-156.

26. Miller TP, Grogan TM, Dalton WS, Spier CM, Scheper RJ, Salmon SE. P-glycoprotein expression in malignant lymphoma and reversal of clinical drug resistance with chemotherapy plus high dose verapamil. J Clin Oncol 1991; 9: 17-24.

27. Goldstein LJ, Galski H, Fojo A, Willingham M, Lai SL, Gazdar A, Pirker R, Green A, Crist W, Brodeur GM. Expression of a multidrug resistance gene in human cancers. J Natl Cancer Inst 1989; 81: 116-124.

28. Filipits M, Jaeger U, Simonitsch I, Chizzali-Bonfadin C, Heinzl H, Pirker R. Clinical relevance of the lung resistance protein in diffuse large B cell lymphomas. Clin Cancer Res 2000; 6: 3417-3423.

29. Filipits M, Stranzl T, Pohl G, Heinzl H, Jäger U, Geissler K, Fonatsch C, Haas OA, Lechner K, Pirker R. Drug resistance factors in acute myeloid leukemia: a comperative analysis.

Leukemia 2000; 14: 68-76.

30. den Boer ML, Pieters R, Kazemier KM, Rottier MM, Zwaan CM, Kaspers GJ, Janka-Schaub G, Henze G, Creutzig U, Scheper RJ, Veerman AJ. Relationship between major vault protein/lung resistance protein, multidrug resistanceassociated protein, P-glycoprotein expression and drug resistance in childhood leukemia. Blood 1998; 91: 20922098.

31. Ohsawa M, Ikura Y, Fukushima H, Shirai N, Sugama Y, Suekane T, Hirayama M, Hino M, Ueda M. Immunohistochemical expression of multidrug resistance proteins as a predictor of poor response to chemotherapy and prognosis in patients with nodal diffuse large B cell lymphoma. Oncology 2005; 68: 422-431.

32. Huang WT, Huang CC, Weng SW, Eng HL. Expression of the multidrug resistance protein MRP and the lung resistance protein LRP in nasal NK/T cell lymphoma: further exploring the role of P53 and WT1 gene. Pathology 2009; 41: 127-132.

33. Li L, Su LP, Ma L, Zhao J, Zhu L, Zhou YA. Expression and significance of P-gp/mdr1 mRNA, MRP and LRP in nonHodgkin’s lymphoma. Zhonghua Zhong Liu Za Zhi 2009; 31: 199-202.

34. Zhan Z, Sandor VA, Gamelin E, Regis J, Dickstein B, Wilson W, Fojo AT, Bates SE. Expression of multidrug resistance associated protein gene in refractory lymphoma: quantitation by a validated polymerase chain reaction assay.

Blood 1997; 89: 3795-3800.

35. Coiffier B. Monoclonal antibody as therapy for malignant lymphomas. C R Biol 2006; 329:241-254.

36. Ghetie MA, Marches R, Kufert S, Vitetta ES. An anti-CD19 antibody inhibits the interaction between P-gp and CD19, causes P-gp to translocate out of lipid rafts and chemosensitizes a MDR lymphoma cell line. Blood 2004; 104:178-183.

37. Klimecki WT, Futscher BW, Grogan TM, Dalton WS. P-glycoprotein expression and function in circulating blood cells from normal volunteers. Blood 1994; 83:2451-2458.

125

Research Article

DOI: 10.5505/tjh.2012.93898

Molecular Evaluation of t(14;18)(bcl-2/IgH) Translocation in Follicular Lymphoma at Diagnosis Using Paraffin-Embedded Tissue Sections Foliküler Lenfoma Tanısında Parafine-Gömülü Dokular Kullanılarak t(14;18)(bcl-2/IgH) Translokasyonun Moleküler Yöntemler ile Değerlendirilmesi Nur Selvi1, Buket Kosova1, Mine Hekimgil3, Cumhur Gündüz1, Burçin Tezcanlı Kaymaz1, Emin Karaca4, Güray Saydam2, Murat Tombuloğlu2, Filiz Büyükkeçeci2, Seçkin Çağırgan2, Yeşim Ertan3, Nejat Topçuoğlu1 Ege University, School of Medicine, Medical Biology Department, İzmir, Turkey Ege University, School of Medicine, Hematology Department, İzmir, Turkey 3 Ege University, School of Medicine, Pathology Department, İzmir, Turkey 4 Ege University, School of Medicine, Medical Genetics Department, İzmir, Turkey 1 2

Abstract Objective: Follicular lymphoma (FL) is one of the most common lymphomas, and is characterized by t(14;18) (q32;q21) in more than 80% of patients. The aim of this study was to determine the rate of t(14;18) positivity based on the detection of mbr or mcr in paraffin-embedded tissue samples.

Material and Methods: The study included 32 paraffin-embedded tissue samples collected from 32 consecutive FL patients that were diagnosed and followed-up at our hospital between 1999 and 2006. The MBR breakpoint was identified based on real-time PCR using a LightCycler v.2.0 t(14;18) Quantification Kit (MBR), multiplex PCR, and seminested PCR. To identify the mcr breakpoint, real-time PCR was performed using specific primers and the FastStart DNA Master SYBR Green I Kit. To detect t(14;18) via fluorescence in situ hybridization (FISH) nuclei from paraffin-embedded tissue sections were extracted and used together with LSI IgH (immunoglobulin heavy chain) (spectrum green)/bcl-2 (B-cell leukemia-lymphoma 2) (spectrum orange) probes.

Results: The DNA and nuclei isolation success rate for B5 formalin-fixed, paraffin-embedded tissue sections (n = 12) was 42% and 33%, respectively, versus 95% and 60%, respectively, for 20 tissue sections fixed in formalin only. In all, 24 paraffin-embedded tissue sections were analyzed and mbr positivity was observed in the DNA of 82.14% via seminested PCR, in 53.57% via multiplex PCR, and in 28.57% via real-time PCR. We did not detect mcr rearrangement in any of the samples. In all, 15 of 16 patients (93.75%) whose nuclei were successfully isolated were observed to be t(14;18) positive via the FISH method.

Conclusion: Semi-nested PCR and FISH facilitated the genetic characterization of FL tumors. As such, FISH and PCR complement each other and are both essential for detecting t(14;18) translocation.

Key Words: Follicular lymphoma, FISH, Multiplex PCR, Semi-nested PCR Address for Correspondence: Nur Selvi, M.D., Ege Üniversitesi Tıp Fakültesi, Tıbbi Biyoloji Anabilim Dalı 35100 İzmir, Turkey Phone: +90 232 390 22 66 E-mail: nur.selvi@ege.edu.tr Received/Geliş tarihi : June 22, 2010 Accepted/Kabul tarihi : March 5, 2011

126

Turk J Hematol 2012; 29: 126-134

Selvi N, et al: Molecular Evaluation of Follicular Lymphoma

Özet Amaç: Foliküler lenfoma, lenfomalarda sıklıkla görülür ve hastaların %80 inden fazlası t(14;18) (q32;q21) translokasyonu ile karekterizedir. Bu çalışmada; 32 adet parafine gömülü doku örneğinde t(14;18) translokasyonunun tespiti için MBR ve mcr pozitifliği değerlendirildi.

Gereç ve Yöntemler: MBR kırılma noktası LightCycler t(14;18) Quantification Kit (MBR) ile gerçek zamanlı PCR, multiplex PCR, and semi-nested PCR yöntemleri kullanılarak araştırıldı. mcr kırılma bölgesi spesifik primerler kullanılarak; Fast Start DNA Master SYBR Green I kiti kullanılarak gerçek-zamanlı bir cihazı olan LightCycler’ da değerlendirildi. t(14;18) (q32;q21) translokasyonunun floresans in situ hibridizasyon (FISH) yöntemi ile tespit edilebilmesi için; parafine-gömülü doku örneklerinden nükleus izolasyonu yapıldı ve örnekler IgH/bcl-2 dual color,dual fusion translokasyon probu ile inkübe edildi.

Bulgular: B5- Formalin ile fikse edilen parafine-gömülü 12 adet doku örneğinde DNA ve nükleus izolasyonununda sırasıyla % 42 ve % 33 başarı elde edilirken, formalinle fikse edilen 20 adet doku örneğinde bu başarı sırasıyla % 95 ve % 60 e kadar yükselmiştir. DNA izolasyonu başarılı olan 24 adet parafine-gömülü doku örneğinde; MBR pozitifliği % 82.14 başarı gösterirken, multipleks PCR sonuçlarına göre başarı oranı % 53.57 ve gerçek-zamanlı PCR ile % 28.57 olarak bulunmuştur.MBR negatif örneklerde mcr yeniden düzenlenmesi çalışılmış pozitif sonuç elde edilmemiştir.

Nukleus izolasyonu başarılı olan 16 örneğin 15 inde (% 93.75) t(14;18) (q32;21) translokasyonu FISH yöntemi ile pozitif olarak bulunmuştur.

Sonuç: Sonuç olarak semi nested PCR ve FISH yöntemleri tümörün genetik karekterizasyonunun aydınlatılması için kullanılabilecek iki fonksiyonel moleküler metoddur. Bu nedenle FISH ve PCR yöntemlerinin birbirini tamamladığı ve t(14;18) translokasyonunun tespitinde oldukça önemli birer parametre olduğu düşünülmektedir.

Anahtar Sözcükler: Foliküler lenfoma, FISH, Multiplex PCR, Semi-nested PCR Introduction The t(14;18) (q32;q21) chromosomal translocation is observed in approximately 80% of all follicular lymphoma (FL) patients. FL, a sub-type of non-Hodgkin’s lymphoma (NHL), occurs in about 13% of the Indian population, versus 40% of western populations. This translocation juxtaposes the immunoglobulin heavy chain enhancer region (IgH Eµ) at 14q32 with the bcl-2 (B-cell leukemialymphoma 2) oncogene at 18q21 [1]. As a result of this translocation, there is an overexpression of the bcl-2 gene, which codes for the bcl-2 protein [2]. This protein blocks apoptosis and cell death, and its overexpression is considered an important factor related to multiple drug resistance and lack of response to chemotherapy [3]. The IgH/bcl-2 rearrangement can be detected via southern blotting—a laborious procedure—or by polymerase chain reaction (PCR), which is a very sensitive technique, especially for the detection of minimal residual disease (MRD) [4].

PCR can detect 1 circulating lymphoid cell carrying the t(14;18) translocation from among 1 x 105-1 x 106 normal cells, making it possible to detect MRD in the bone marrow or peripheral blood of FL patients [5] as a means of monitoring their response to chemotherapy (associated or not to monoclonal antibody anti-CD-20), and to allogeneic or autologous stem cell transplantation [6]. At the

molecular level, breakpoints on chromosome 14 occur within the joining region genes (JH) of the IgH locus.

Most breakpoints on chromosome 18 are clustered within a 150-base pair (bp) segment at the 3’ untranslated end of exon 3 of bcl-2, designated as the major breakpoint region (MBR) [7]. Additional breakpoints are described in 30 kb 3’ of the MBR in the minor cluster region (mcr). A third breakpoint cluster region—the 5'-bcl-2 or variant cluster region—exists on 5' of the bcl-2 gene [8].

Detection of IgH/bcl-2 fusion in FL is clinically important for establishing a diagnosis and monitoring disease progression. The aim of the present study was to compare the efficacy of PCR and fluorescence in situ hybridization (FISH) in detecting the t(14;18) (q32;q21)-IgH/bcl-2 rearrangement in paraffin-embedded tissue samples.

Methods and Materials The study included 32 paraffin-embedded tissue samples collected from 32 consecutive FL patients that were diagnosed and followed-up at our hospital between 1999 and 2006. The FL group included 19 female (55.88%) and 13 male (44.12%) FL patient with a mean age of 58 ± 06 years (range: 32-78 years). The control group included paraffin-embedded tissue samples obtained from the tonsils of 17 healthy volunteers (mean age: 42.35 ± 24.75 years).

127

Selvi N, et al: Molecular Evaluation of Follicular Lymphoma

DNA extraction from paraffin-embedded tissues Sections 25-50 µm thick were obtained from paraffin block samples. Following xylene treatment at 60 °C for 15 min, pellets were incubated for 10 min in a 50% xylene-50% ethanol mixture, and then in 100%, 70%, and 50% ethanol serials. Then, 200 µL of digestion buffer and 40 µL of proteinase K were added to the tissue pellets, followed by overnight incubation at 37 °C. Next, the pellets were incubated for 2 h at 55 °C with 20 µL of proteinase K. Following incubation for 10 min at 70 °C with 200 µL of binding buffer, the mixture was transferred into collection tubes. With the addition of isopropanol the protein contents were eliminated from the nucleic acids. Following 2 washing steps, genomic DNA was dissolved in 100 µL of elution buffer that was warmed to 70 °C in advance. A NanoDrop spectrophotometer was used to measure DNA concentrations ranging from 12.4 to 441 ng µL–1.

Turk J Hematol 2012; 29: 126-134

the LightCycler instrument. Tissue plasminogen activator (tPA) was processed as a reference gene. The kit utilized the “hot start” method using FastStart Taq polymerase, which facilitates detection of 1 t(14;18) translocationpositive cell from among 5 x 104 -1 x 105 peripheral blood mononuclear cells in less then 60 min.

MBR rearrangement analysis using multiplex PCR

LightCycler t(14;18) Quantification Kit (MBR)

All 26 DNA samples were tested for the IgH/bcl-2 rearrangement using a multiplex PCR protocol, and specific primers for the MBR and jH consensus regions (Table 1), as previously described [21]. Primer sequences and PCR conditions were based on previously described protocols optimized for genomic DNA, and were nearly identical to those used in recent studies [13,14]. PCR products were obtained in positive cases via MBR determinations ranging from approximately 100-275 bp. In addition, PCR sensitivity was documented by running positive control DNA samples (MBR control, Roche Diagnostics, Germany).

A 200-bp fragment of the t(14;18) translocation resulting from MBR breakpoints was amplified via PCR using specific primers. The amplicon was detected via fluorescence using a specific pair of hybridization probes that consisted of 2 different short oligonucleotides that hybridize to an internal sequence of the amplified fragment during the annealing phase of the amplification cycle. One probe was labeled at the 5’ end with LightCycler RED 640, and to avoid extension, was modified at the 3’-end by phosphorylation. The other probe was labeled at the 3’ end with fluorescein. Only after hybridization to the template DNA did the 2 probes come into close proximity, resulting in fluorescence resonance energy transfer (FRET) between the 2 fluorophores. During FRET, fluorescein— the donor fluorophore—was excited by the LightCycler’s light source, and some of the excitation energy was transferred to LightCycler Red 640, and then measured via

In the present study paraffin-extracted DNA from lymphoid tissue samples fixed in formalin and B5-formalin were evaluated for MBR rearrangement via multiplex PCR. The MBR determinations were analyzed in duplicate, with the first PCR run containing only the specific primers, and the second PCR run containing a multiplex of specific primers and control primers for the β-globulin gene. The β-globulin gene control product (350 bp) was used in this assay to determine the quality of the DNA and PCR conditions. The 25-µL PCR reactions contained the following reagents; 1x PCR buffer, 200 µmol L–1 of deoxynucleoside triphosphate (dNTP), 15 pmol MBR primer, 15 pmol jH primer, 2 pmol control primers, 1.25 U Taq gold, 2.0 mmol L–1 of MgCl2, and 100 ng of paraffin-extracted DNA. Amplification conditions for the MBR reactions were 10 min at 95 °C (hot start), 35 cycles at 94 °C for 1 min, 60 °C for 1 min, and 72 °C for 1 min; the final step was final

Table 1: Multiplex PCR primers used for detecting IgH/ bcl-2 rearrangement.

Gene Region

Sequence (5’ to 3’)

Orientation

Reference

TTA GAG AGT TGC TTT ACG TG

F

Crescenci et al. (9)

JH

ACC TGA GGA GAC GGT GAC

R

Williams et al. (11)

mcr

GAC TCC TTT ACG TGC TGG TAC C

F

Ngan et al. (10)

B-globin 1A

GTA CGG CTG TCA TCA CTT AGA C

F

In-house

B-globin 1B

AAA CCC AAG AGT CTT CTC TGT C

R

In-house

MBR

MBR: Major breakpoint region; mcr: minor cluster region; F: forward; R: reverse.

128

Turk J Hematol 2012; 29: 126-134

Selvi N, et al: Molecular Evaluation of Follicular Lymphoma

extension at 72 °C for 10 min, followed by hold at 4 °C. All PCR reactions were performed in a Genius thermocycler. Figure 1 shows a representative PCR gel image.

Figure 1: Representative gel photo of multiplex PCR results.

Minor band shows PCR amplification products (120-200 bp).

The band above shows the multiplex PCR strategy in which control primers were used to detect IgH/bcl-2 rearrangement. The first line represents the 50-bp DNA ladder [PUC 19 DNA/MspI (HpaII)]. Interpretation is as follows: Sample 1: MBR-negative case; samples 2 and 3: MBR-positive cases; sample 4: negative control.

Detection of MBR rearrangement in paraffinembedded tissue (semi-nested PCR) Paraffin-embedded tissue samples were analyzed for the presence of MBR rearrangement via different semi-nested PCR reactions. Each reaction utilized sense primers. We have combined the techniques which are described in two studies by Gisele et al and Einerson et al [2,21]. The list of used primers is given in Table 2. PCR reactions were conducted in duplicate in a Genius thermocycler. First we used multiplex PCR reactions and the second PCR reaction contained 2.5 µL of the first PCR product for each 25-µL reaction, 1x Taq polymerase buffer, 200 μmol dNTP, 15 pmol internal MBR and external jH [2], and 1.5 U Taq polymerase, with denaturation at 94 °C for 45 s, annealing at 66 °C for 45 s, extension at 72 °C for 30 s, and a final extension at 72 °C for 5 min. PCR results are shown in Figure 2.

Detection of mcr rearrangement The LightCycler FastStart DNA Master SYBR Green I Kit was used to detect mcr rearrangement. In combination with the LightCycler system and suitable primers, the kit facilitates highly sensitive detection and quantification of defined DNA sequences. The present study used mcr forward and Jh reverse primers [2], and modified kit procedures were employed. The list of primers is shown in Table 1.

PCR was performed according to the SYBR Green I Kit protocol. PCR products were visualized under UV light on 2% agarose gel and stained with ethidium bromide. The mcr rearrangement product ranged from 600 to 700 bp.

The positive control used for the mcr rearrangement was produced by InVivoScribe (Carlsbad, Ca, USA).

Detection of t(14;18) translocation via FISH

Figure 2: Representative gel photo of semi-nested PCR results.

The first line on the left represents the 50-bp DNA ladder (Fermentas). Sample 1: MBR-positive control (Roche Diagnostic); samples 2-9: MBR-positive samples (each sample shows the PCR amplification products [50 bp] using primers specific to the bcl-2 MBR and JH consensus; sample 10: negative control.

FISH is difficult to perform using thin sections of paraffin-embedded lymphoid tissues because of high cellularity and truncated cells interfere with accurate scoring of individual nuclei. We used Peterson et al.’s method [15] and an Insitus Biotechnologies kit for nuclei isolation; for this

Table 2: Semi-nested PCR primers used for detecting MBR rearrangement.

Gene Region

Sequence (5’ to 3’)

Orientation

Reference

External MBR

TTA GAG AGT TGC TTT ACG TG

F

Crescenci et a. (9)

ACC TGA GGA GAC GGT GAC

R

Williams et al. (11)

AGT TGC TTT ACG TGG CCT GT

F

Gisele et al. (2)

JH Internal MBR

MBR: Major breakpoint region; F: forward: R: reverse.

129

Selvi N, et al: Molecular Evaluation of Follicular Lymphoma

purpose 25-50-µ thick paraffin-embedded tissue samples were collected into microcentrifuge tubes.

Extraction of the nuclei Paraffin was dissolved in xylene at room temperature for 30 min, at 60 °C with two 10-min changes of xylene (200 µL each) in the microcentrifuge tubes. Each tissue pellet was dehydrated in 100% and then in 50% ethanol for 5 min each. Enzymatic digestion was then performed with proteinase K (0.005%) in a collagenase solution. The specimen was incubated at 37 °C for overnight.

Turk J Hematol 2012; 29: 126-134

formed with 24 (24/32) paraffin-embedded tissue samples, whereas among the 8 samples from which DNA was not successfully isolated 7 were fixed with B5-formalin and 1 was fixed with formalin. In all, PCR failed with 8 (25%) of 32 FL patients’ samples (no ß-globulin products were obtained); of the 24 samples in which PCR was successful, 19 (79%) were determined to be positive via semi-nested PCR, 10 (42%) were positive based on multiplex PCR, and 8 (33%) were positive based on the LightCycler t(14;18) Quantification Kit (mbr) using specific primers for the MBR and JH consensus regions. In total, 15 of 19 patients with

Nuclei were pelleted using microcentrifuge tubes at 6000 rpm for 5 min. For high-quality nuclei isolation, we used the Insitus Biotechnologies kit, which was designed for paraffin-embedded tissue slides and bifunctional skip dewax. Nuclei were resuspended in 200 µL of fixative (3 parts methanol and 1 part glacial acetic acid). Nuclei suspensions were stored at –20 °C. FISH probe and slide preparation One drop of fixed nuclei suspension was placed on slides and air-dried. Slides were incubated at 37 °C in 2x SSC solution for 30 min. Slides were then washed twice in bidistilled water, and then dehydrated with 70%, 85%, and 100% ethanol for 2 min each. Probe mixture (7 µL of hybridization buffer/1 µL of probe [IgH/bcl2 dual t(14;18)]/2 µL of purified water) was added to each slide and a 22 x 22-mm cover slip was placed over each hybridization site and sealed with rubber cement. The slides and probe were co-denatured in a Vysis Hybrite set at a melting temperature of 73 °C and melting time of 5 min, followed by hybridization at

Figure 3: FISH analysis of an abnormal nucleus from FL patient 10. The interphase FISH shows a 1R1G2F signal pattern. R: Red bcl-2 signals; G: green IgH signals; F: IgH/bcl-2 fusion signals.

37 °C for 16-20 h. Cover slips were removed and slides were washed for 5 min in 0.4x SSC/NP40 at 73 °C and transferred to 2x SSC/NP40 at room temperature for 30 s.

Nuclei were counterstained with 5 µL of 40-60-diamidine2-phenylindole dihydrochloride (DAPI). A Vysis LSI IgH/ bcl-2 dual color, dual fusion t(14;18) probe was used for FISH analysis of all nuclei. Cells were visualized with a fluorescent microscope (Olympus BX50) and 1000 cells were counted in each slide. Representative cells were photographed using a computer-based imaging system. Figures 3 and 4 show a positive and negative result for bcl2/ IgH rearrangement via FISH, respectively.

Results A comparison of the PCR and FISH results is shown in Table 3. In total, 26 (81.25%) of the 32 patients with MBR rearrangement were identified via FISH and/or PCR molecular methods. DNA isolation was successfully per-

130

Figure 4: FISH analysis of an abnormal nucleus from FL patient 17. The interphase FISH shows a 2R2G signal pattern. R: Red bcl-2 signals; G: green IgH signals.

Turk J Hematol 2012; 29: 126-134

Selvi N, et al: Molecular Evaluation of Follicular Lymphoma

grade I FL (79%), 2 with grade II FL (100%), and 4 of the 5 patients with grade III FL (80%) were mbr-positive. In the control group there was no MBR-rearrangement positivity.

Among the MBR-negative cases (5/24) none were mcr-positive. Among the 19 patients whose nuclei were isolated, all but 1 were t(14;18) positive based on FISH. Discussion The incidence of the t(14;18) (q32;q21)-IgH/bcl-2rearrangement in FL is 70%-95% (16;17). There is no gold

standard technique for detecting t(14;18), and a combination of conventional cytogenetics, southern blot (SB), and PCR techniques is generally used [18]. Initial molecular tests were based on SB techniques, using probes homologous to MBR and mcr sequences. SB hybridization is highly sensitivity, but is labor-intensive and time-consuming, requiring the use of radioactive isotopes and high-quality DNA, which is never obtained from paraffin-embedded biopsy specimens [19]. Recently, PCR and FISH have been used to detect IgH/bcl-2 translocation.

Table 3: Comparison of PCR and FISH results.

Patient No.

Grade

3 4 32 6 8 11 17 12 13 30 10 31 34 20 5 19 21 23 26 18 33 9 15 22 7 24 1 2

I I III I I I I I I III I III III I I I I I II I III I I I I II I I

PCR METHODS Paraffin Fixative B5-Formalin Formalin Formalin Formalin Formalin Formalin B5-Formalin Formalin Formalin Formalin Formalin Formalin B5-Formalin Formalin Formalin Formalin Formalin Formalin Formalin B5-Formalin B5-Formalin Formalin Formalin Formalin Ø Ø B5-Formalin Formalin

Real-time PCR 0.036 0.28 0.13 0.05 0.0023 0.00043 – – – – 0.11 0.00729 – – – – – – – – – – – –

F F

Multiplex PCR Results + + + + + + + + + + – – – – – – – – – – – – – –

F F

Semi-nested PCR Results + + + + + + + + + + + + + + + + + + + – – – – –

F F

FISH Abnormal (%) 90% 75% 20% 45%

60% 55% 45% 70% 75%

85% 85% 70%

55% 60% 95% 70% 80%

FISH F + + F + + – F + + + F + + F F + + + F F F + F + + + +

F: Failed; FISH: fluorescence in situ hybridization; PCR: polymerase chain reaction; +: positive; –: negative.

131

Selvi N, et al: Molecular Evaluation of Follicular Lymphoma

Turk J Hematol 2012; 29: 126-134

Molecular methods can be negatively affected by such factors as specimen age, initial tissue handling, fixative, and the paraffin-embedding process. PCR and FISH are molecular techniques commonly used in clinical laboratories to detect t(14;18) (q32;q21)-IgH/bcl-2 that lack these limitations. Both tests, however, are prone to technical failure [1]. Fixation is a significant problem for PCR and FISH. When paraffin-embedded specimens are fixed in mercuric chloride-containing fixatives such as B5-formalin, the efficiency of the DNA isolation method decreases.

In the present study the DNA and nuclei isolation rate in specimens that were fixed in B5-formalin and embedded in paraffin (n = 12) was 42% and 33%, respectively, versus 95% and 60% in the 20 samples fixed in formalin, respectively.

FISH is more sensitive than PCR because it is capable of detecting breakpoints that lie outside the regions covered

by PCR, but the success of FISH can be negatively affected by such factors as specimen age, initial tissue handling, fixative type, and the paraffin embedding process. Interphase FISH has been used to characterize hematological malignancies in bone marrow and blood samples. In particular, with fresh tissue samples interphase FISH is a useful ancillary technology that plays an important role in the differential diagnosis and classification of lymphoma [23].

Several reports of the use of FISH with paraffin-embedded lymphoma biopsy material have been recently published [14]; however, FISH is still not widely used for routine diagnosis, probably because it is perceived to be technically demanding and costly [24].

Paraffin extraction methods typically yield less than fragmented template, and mercuric chloride-containing fixatives can negatively affect DNA integrity and may hamper binding of the primer to the target sequence, often resulting in test failure [20]. In the present study the MBR positivity rate in the DNA of tissue samples was 82.14% based on semi-nested PCR, 53.57% based on multiplex PCR, and 28.57% based on real-time PCR. Among 5 MBRnegative samples that were analyzed, mcr rearrangement and mcr positivity were not detected; we think that mcr rearrangement was not observed due to DNA degradation.

However we have investigated a new method for mcr rearrangement by using SYBR Green I. and the sensitivity of the semi-nested PCR for MBR rearrangement was detected [79%]. Which is accepted as higly succesfull.

Because of its feasibility, we used FISH method in the present study on isolated individual nuclei from paraffinembedded tissue. Of the 19 specimens whose nuclei were isolated, only 1 patient had a negative result. Sarah et al. studied 5 specimens cytogenetically proven positivity of t(14;18) (q31,q21) for bcl-2 and IgH, in bone marrow from these patients and 1 normal lymph node [12]. They showed that 5 patients had t(14;18) (q31;q21) associated with reciprocal fusion of portions of bcl2 and IgH loci.

Similarly, Einerson et al. reported that DNA was successfully amplified in 42% (10/24) of B5 formalin-fixed specimens and that IgH/bcl-2 was detected via multiplex PCR in 5 (36%) of successfully amplified cases [21]. Gisele et al. reported 60% (18/30) MBR positivity in paraffinembedded tissue samples and 63% (19/30) in blood samples [2]. LightCycler t(14;18) Quantification Kit (MBR) analysis in the present study showed that 8 patients were positive, with scores ranging between 0.00759 and 0.28.

As such, semi-nested PCR was superior for the detection of MBR positivity, as compared to the other methods used in the present study. In another study on the frequency of t(14;18) in Turkish FL patients Sayhan et al. used PCR to evaluate representative tissue blocks from 67 FL patients, 12 with diffuse large B-cell lymphoma, and 11 with reactive hyperplasia. They detected t(14;18) in 46 of the 67 FL patients (68.7%) and 25% of those with diffuse large B-cell lymphoma; in the FL cases 64.2% of these break points were at the mbr region and 4.5% were at the mcr region [22].

132

In the present study nested-PCR was used to detect MBR rearrangement, as the technique is capable of detecting just 1 t(14;18)-positive cell from among 10,000 normal cells.

It is obvious that FISH is a more time-consuming technique than nested PCR. PCR is faster than other molecular methods, can be performed with poor-quality DNA, and has high sensitivity, allowing the use of archival material such as formaldehyde-fixed paraffin-embedded samples.

When the results cannot be obtained with PCR due to laboratory conditions and sample quality, FISH can be used.

Paternoster et al. reported that FISH works equally well as PCR with formalin- or B5-formalin-fixed and paraffin embedded tissue samples; however, in the presence of limitations due to specimen age and fixation methods, FISH has a higher success rate than PCR in [24of 28 samples with the ratio of 86%] [25]. Many patients with FL respond to treatment, but complete remission rates are very low. For investigated abnormalities, multiplex PCR and nested PCR results were evaluated as positive in 1 patient in the present study, whereas FISH could not show any result in remission; however, the patient relapsed 6 months following this analysis and early positivity of multiplex and nested PCR in this patient was evaluated as the early warning for the clinician in retrospective manner.

Turk J Hematol 2012; 29: 126-134

Several methods have been developed to detect IgH/ bcl-2 translocated sequences, although no single technique can detect the genetic lesions underlying deregulated bcl-2 expression in all cases of FL [19]. We have concluded that PCR and FISH methods are complementary to each other. The t(14;18)(q32;q21) chromosomal translocation induces bcl-2 protein expression in FL that is identified immunohistochemically using routine pathology diagnostic algorithms; however, a small number of cases lack bcl-2 protein expression, despite carrying the t(14;18)(q32;q21) translocation, due to somatic mutations of the translocated bcl-2 gene, which prevents epitope recognition by bcl-2 antibodies [26]. In such cases FISH and/or PCR analysis may be needed to confirm the pathologist’s diagnosis. Thus, the present study aimed to evaluate the role of these molecular techniques in the diagnosis and follow-up of FL, despite the fact that monitoring of t(14;18) in blood, bone marrow, and lymph nodes in FL patients remains controversial and further studies are needed to clarify this issue. As well known, t(14;18) (q32;q21) translocation may be seen in patients with diffuse large B-cell lymphoma with aggressive presentation, especially those with concurrent 8q24/c-MYC rearrangements; therefore, this translocation is not specific to FL. Because the majority of FL patients with advanced stage disease relapse following diagnosis due to the persistence of residual disease, FISH and/or PCR-detected IgH/bcl-2 rearrangement may be related to the original FL clone developed and detected during follow-up of these patients.

Molecular-based studies have shown that t(14;18)-bearing cells may persist in the lymph nodes of FL patients that are in complete remission [27]. Additionally, PCR-based techniques can also detect the MBR/JH fusion sequence in the blood and lymphoid tissues of healthy individuals [28,29]. It has been shown that t(14;18) is generated during early B-cell development in the bone marrow and that affected cells may mature and expand in germinal centers [30]. As such, the most reliable technique for diagnosis and follow-up of FL is histopathological plus immunohistochemical analysis, but FISH—and in some cases PCR— may be helpful in cases with negative bcl-2, CD10, and/or bcl6 immunohistochemistry results.

In conclusion, we think that using both PCR and FISH can facilitate the genetic characterization of tumors. Detection of specific abnormalities in individual patiens would be helpful to develop patient-specific therapies.

Acknowledgements

Selvi N, et al: Molecular Evaluation of Follicular Lymphoma

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Nambiar M, Raghavan SC: Prevalence and analysis of t(14;18) and t(11;14) chromosomal translocations in healthy Indian population. Ann Hematol 2009, June 2 (epub ahead of print) 2. Colleoni GW, Duarte LC, Kerbauy FR, Noguti MA, Felix RS, De Oliveira JS, Figueiredo MS, Alves AC: Possible influence of the clinical stage and type of treatment in persistence of residual circulating t(14;18)-positive cells in Follicular Lymphoma Patients. Leuk Lymphoma 2004; 45 (3): 539545 3. Vaux DL, Cory S, Adams JM: Bcl-2 gene promotes haematopoiteic cell survival and cooperates with c-myc to immortalize pre B cells. Nature 1988; 335: 440-442 4. Horsman DE, Gascoyne RD, Coupland RW, Coldman AJ, Adomat SA: Comparison of cytogenetic analysis Southern analysis and polymerase chain reaction for the detection of t(14;18) in Follicular Lymphoma. Am J Clin Pathol 1995; 103: 472-478 5. Gribben JG, Neuberg D, Freedman AS, Gimmi CD, Pesek KW, Barber M, Saporito L, Woo SD, Coral F, Spector N: Detection by polymerase chain reaction of residual cells with bcl-2 translocation is associated with increase risk of the relapse after autologous bone marrow transplantation for B cell Lymphoma. Blood 1993; 81: 3449-3457 6. Peterson BA: Current treatment of follicular low-grade lymphomas. Semin Oncol 1999; 26: 2-11 7. Cleary ML, Sklar J: Nucleotide Sequence of a t(14;18) chromosomal breakpoint in follicular lymphoma and demonstration of a breakpoint -cluster region near a transcriptionally active locus on chromosome 18. Proc Natl Acad Sci USA 1985; 82: 7439-7443 8. Cleary ML, Galili N, Sklar J: Detection of a second t(14;18) breakpoint-cluster region in human follicular Lymphomas.

J Exp Med 1986; 164: 315-320 9. Crescenzi M, Seto M, Herzig GP, Weiss PD, Griffith RC, Korsmeyer SJ: Thermostabil DNA polymerase chain amplification of the t(14;18) chromosome breakpoints and detection of minimal residuel disease. Proc Natl Acad Sci USA 1988; 85: 4869-4873

This study was supported by the Ege University Medical Research Council (no. 06-TIP-006).

133

Selvi N, et al: Molecular Evaluation of Follicular Lymphoma

10. Ngan BY, Nourse J, Cleary ML: Detection of chromosomal translocation t(14;18) within the minor cluster region of bcl-2 by polymerase chain reaction and direct genomic sequencing of the enzimatically amplified DNA in follicular lymphomas. Blood 1989; 73: 1759-1762 11. Williams ME, Swerdlod SH, Meeker TC: Chromosome t(11,14) (q13;q32) breakpoints in centrocytic lymphoma are highly localized at the bcl-1 major translocation cluster.

Leukemia 1993; 7: 1437-1440 12. Paternoster SF, Brockman SR, McClure RF, Remstein ED, Kurtin PJ, Dewald GW: Anew method to extract nuclei from paraffin embedded tissue to study lymphomas using interphase fluorescence in situ hybridization. Am J Pathol 2002; 160: 1967-1972 13. Albinger-Hegyi A, Hochreutener B, Abdou MT, Hegyi I, Dours-Zimmermann MT, Kurrer MO, Heitz PU, Zimmermann DR: High fregeuency of t(14;18) translocation breakpoints outside of major breakpoint and minor cluster regions in follicular lypmhomas: Improved polymerase chain reaction protocols for their detection. Am J Pathol 2002; 160: 823-832 14. Liu J, Johnson RM, Traweek ST: Rearregement of the bcl-2 gene in follicular lymphoma: Detection by PCR in both fresh and fixed tissue samples. Diagn Mol Pathol 1993; 2: 241-247 15. Rowley JD: Chromosome studies in the non-hodgkin Lymphomas: The role of the 14;18 translocation. J Clin Oncol 1988; 6: 919-925 16. Horsman DE, Gascoyne RD, Coupland RW, Coldman AJ, Adomat SA: Comparison of cytogenetic analysis, and polymerase chain reaction for the detection of t(14;18) in follicular lymphoma. Am J Clin Pat 1995; 103: 472-478 17. Ben-Ezra J, Johnson DA, Rossi J, Cook N, Wu A: Effect of fixation on the amplification of nucleic acids from paraffinembedded material by the polymerase chain reaction. J Histochem Cytochem 1991; 39: 351-354 18. Espinet B, Bellosillo B, Melero C, Vela MC, Pedro C, Salido M, Pijuan L, Florensa L, Besses C, Serrano S, Solé F: FISH is better than BIOMED-2 PCR to detect IgH/BCL2 translocation in follicular lymphoma at diagnosis using paraffin-embedded tissue sections. Leuk Res 2008; 32 (5): 737-742 19. Peh SC, Shaminie J, Tai YC, Tan J, Gan SS: The pattern and frequency of t(14;18) translocation and immunophenotype in Asian follicular lymphoma. Histopathology 2004; 45: 501-510 20. Ventura RA, Martin-Subero JI, Jones M, McParland J, Gesk S, Mason DY, Siebert R: FISH analysis fort he detection of Lymphoma-Associated Chromosomal abnormalities in routine paraffin-embedded tissue. J Mol Diagn 2006; 8 (2): 141-151

134

Turk J Hematol 2012; 29: 126-134

21. Einerson RR, Kurtin PJ, Dayharsh GA, Kimlinger TK, Remstein ED: Fish is superior to PCR in detecting t(14;18) (q32;q21)-IgH /bcl-2 in Follicular Lymphoma using paraffin-embedded tissue samples. Am J Clin Pathol 2005; 124: 421-429 22. Bi R, Lin DM, Han YL, Lu J, Xue LY, Zheng S, Wang MR, Lü N: Application of interphase fluorescence in situ hybridization in the diagnosis of lymphoma. Zhonghua Bing Li Xue Za Zhi 2009; 38 (11): 733-738 23 Ventura RA, Martin-Subero JI, Jones M, McParland J, Gesk S, Mason DY, Siebert R: Fish Analysis for the detection of lymphoma associated chromosamal abnormalities in routine paraffin-embedded tissue. J Mol Diagn 2006; 2 (8): 141-151 24. Paternoster SF, Brockman SR, McClure RF, Remstein ED, Kurtin PJ, Dewald GW: A new method to extract nuclei from paraffin embedded tissue to study lymphomas using interphase fluorescence in situ hybridization. Am J Pathol 2002; 160: 1967-1972 25. Sayhan N, Tuzuner N, Aki H, Demir G, Berkarda B: Detection of t(14;18) in turkish follicular lymphomas using the polymerase chain reaction. Leuk Res 2000; 24 (6): 475479 26. Masir N, Campbell LJ, Jones M, Mason DY: Pseudonegative BCL2 protein expression in a t(14;18) translocation positive lymphoma cell line: A need for an alternative BCL2 antibody.

Pathology 2010; 42 (3): 212-216 27. Janikova A, Mayer J, Kren L, Smardova J, Dvorakova D, Neubauer J, Vasova I: The persistence of t(14;18)-bearing cells in lymph nodes of patients with follicular lymphoma in complete remission: The evidence for ‘a lymphoma stem cell’.Leuk Lymphoma 2009; 50 (7): 1102-1109 28. Tsimberidou AM, Jiang Y, Ford RJ, Lichtiger B, Medeiros LJ, McLaughlin P, Cabanillas F, Sarris AH: Quantitative realtime polymerase chain reaction for detection of circulating cells with t(14;18) in volunteer blood donors and patients with follicular lymphoma. Leuk Lymphoma 2002; 43: 1589-1598 29. Hirt C, Dölken G, Janz S, Rabkin CS: Distribution of t(14;18)-positive, putative lymphoma precursor cells among B-cell subsets in healthy individuals. Br J Haematol 2007; 138: 349-353 30. Belaud-Rotureau MA, Parrens M, Carrere N, Turmo M, Ferrer J, Mascarel A, Dubus P, Merlio JP: Interphase fluorescence in situ hybridization is more sensitive than BIOMED-2 polymerase chain reaction protocol in detecting IGH-BCL2 rearrangement in both fixed and frozen lymph node with follicular lymphoma. Hum Pathol 2007; 38 (2): 365-372

Research Article

DOI: 10.5152/tjh.2011.42

Conventional and Molecular Cytogenetic Analyses in Turkish Patients with Multiple Myeloma Multipl Miyelom Tanılı Türk Hastalarda Konvansiyonel ve Moleküler Sitogenetik Analizler Beyhan Durak Aras1, Olga Meltem Akay2, Gülçin Sungar1, Güney Bademci1, Vahap Aslan3, Jülide Caferler4, Muhsin Özdemir1, Oğuz Çilingir1, Sevilhan Artan1, Zafer Gülbaş2 Eskisehir Osmangazi University, Medical Faculty, Department of Medical Genetics, Eskisehir, Turkey Eskisehir Osmangazi University, Medical Faculty, Department of Hematology, Eskisehir, Turkey 3 Yunus Emre State Hospital, Department of Hematology, Eskisehir, Turkey 4 Genetiks Genetic Diagnosis Center, Istanbul, Turkey 1 2

Abstract Objective: Multiple myeloma (MM) is characterized by the accumulation and proliferation of malignant plasma cells, secreting monoclonal immunoglobulins and genetic abnormalities in MM have implications for disease progression and survival. In the present study, we investigated the frequency of chromosomal abnormalities (CA) in Turkish patients with MM, using interphase FISH and CC and evaluated the relationship between the rearrangements detected, prognosis and stage of disease.

Material and Methods: We performed conventional cytogenetic and FISH studies in 50 patients to detect chromosome anomalies associated with MM. FISH probes were used to detect 13q14, 13q34, 17p13 deletions, IGH rearrangements, and monosomy and/or trisomy of chromosomes 5, 9, and 15.

Results: CC studies could be performed in 32 of 50 cases and five patients (15.6%) showed chromosomal aberrations while 27 (84.3%) had normal karyotypes. By FISH, eighteen percent (9/50) of cases were found to be normal for all parameters evaluated. Eighty-two percent (41/50) of the patients were positive for at least one abnormality. Chromosome 13 anomalies were detected in 54% (27/50) of cases. The second most common aberration observed is chromosome 15 aberrations (50%).

Conclusion: Median survival rate was shorter in patients with one of the abnormalities including chromosome 13 aberrations, IGH rearrangements or P53 deletions. Chromosome 15 aberrations were significantly higher in patients with stage III disease (p=0.02). We conclude that FISH studies should be performed in conjunction with conventional cytogenetic analysis for prognosis in multiple myeloma patients. (Turk J Hematol doi:10.5152/tjh.2011.42)

Key Words: Cytogenetcis, Myeloma, FISH, Chromosomal aberrations

Özet Amaç: Multipl Myelom (MM) plazma hücrelerinin kemik iliğinde birikmesi, proliferasyonu ve monoklonal immunglobulin sekresyonu ile karakterize klonal bir hastalıktır. Çalışmamızda Türk MM hastalarında kromozomal anomali sıklığının Address for Correspondence: Beyhan Durak Aras, PhD, Eskişehir Osmangazi Üniversitesi Tıp Fakültesi, Tıbbi Genetik Anabilim Dalı, 26480 Eskişehir, Turkey Phone: +90 222 239 37 71 E-mail: bdurak@ogu.edu.tr Received/Geliş tarihi : October 15, 2010 Accepted/Kabul tarihi : June 13, 2011

135

Durak Aras B, et al: Genetic Analysis in Multiple Myeloma

Turk J Hematol 2012; 29: 135-142

interfaz FISH ve klasik kromozom analizi ile belirlenmesi, saptanan yeniden düzenlenmelerle hastalığın evresi ve prognozu arasındaki ilişkinin araştırılması amaçlanmıştır.

Gereç ve Yöntemler: Multipl myelom tanısı alan toplam 50 olgu klasik sitogenetik ve moleküler sitogenetik (FISH) analizleri ile değerlendirilmiştir. FISH analizi ile; 13q14, 13q32, 17p13 bölgelerindeki delesyonlar, IGH bölgesini içeren yeniden düzenlenmeler ve 5, 9, 15. kromozomların monozomi ve/veya trizomileri incelenmiştir.

Bulgular: Konvansiyonel sitogenetik analiz olguların 32 tanesinde gerçekleştirilebilmiş olup 27 olguda (%84.3) normal karyotip izlenirken 5 olguda (%15.6) kromozom aberasyonları gözlenmiştir. FISH analizinde; olguların %18 inde (9/50) değerlendirilen tüm parametreler için normal sonuç bulunmuştur. Olguların %82 sinde ise (41/50) FISH analizi ile en az bir anomali gözlenmiştir. Olguların %54’ünde (27/50) kromozom 13 aberasyonları gözlenmiştir. İkinci en sık gözlenen aberasyon % 50 oranıyla kromozom 15 aberasyonlarıdır..

Sonuç: Çalışmamızda 13. kromozom aberasyonları, IGH translokasyonları ve P53 delesyonlarından en az birini bulunduran olguların ortalama median sağ kalım sürelerinin diğerlerinden daha kısa olduğu görülmüştür. Kromozom 15 aberasyonları evre 3 ile ilişkili olduğu görülmüştür (P=0.02). Çalışmamızda elde ettiğimiz verilere göre MM lı olgularda konvansiyonel sitogenetik ve özellikle FISH yönteminin hastalığın takip ve prognozunda birlikte kullanılmasının önemli olduğunu düşünmekteyiz. (Turk J Hematol doi:10.5152/tjh.2011.42).

Anahtar Sözcükler: Sitogenetik, Myelom, FISH, Kromozomal aberasyon Introduction

Materials and Methods

Multiple myeloma (MM) is a common hematologic malignancy characterized by abnormal production of monoclonal immunoglobulin (IgG, IgA, IgM) or Bence Jones protein (free monoclonal k or λ light chains). Genetic changes have been implicated in the accumulation and uncontrolled proliferation of malignant plasma cells (PC) within the bone marrow. Among various prognostic factors in MM, cytogenetic abnormalities (CA) detected by conventional cytogenetics (CC) and FISH studies have emerged as a major independent parameter predicting the clinical outcome [1-6]. The most significant structural chromosomal changes are chromosome 1 structural aberrations, chromosome 13 abnormalities, translocations involving immunoglobulin heavy chain locus (IGH) of chromosome 14, trisomies and P53 gene deletions [1,2,5-11].

50 patients who had been diagnosed with MM were enrolled. Bone marrow (BM) samples of patients from two different Hematology Centers; were referred to our Cancer Cytogenetics Section of the Medical Genetics Department from September 2005 to January 2008. The consent forms had been signed by the patients and the study has been approved by the University Ethics Committee and therefore the study was performed in accordance with ethical standards of Helsinki Declaration.

Compared to leukemias and lymphomas, cytogenetic changes are not characteristic in MM. CA in MM patients are associated with karyotypic complexity, stage and duration of disease and response to therapy [9]. The hypoproliferative nature of clonal PCs account for the great difficulty in obtaining cytogenetic data [2,3,6,9-13]. Abnormal karyotypes have been reported in 30-50% of patients.

Karyotypes are generally complex and aneuploidy is also observed [3,5,6,9,14,15].

In the present study, we investigated the frequency of CA in Turkish patients with MM, using interphase FISH and CC. We also evaluated their relationship between clinical and laboratory features and examined their impact on overall survival.

136

Sample preperation BM samples were cultured for 24-48 hours in RPMI1640 medium (supplemented with %10 fetal calf serum and antibiotics) without mitogen stimulation and with 10µg/ml colcemid concentration. Then chromosomal slides were prepared according to standard procedures (0.075 M KCl treatment and fixation with Carnoy’s fixative) [16]. Depending on metaphase availability, 20-25 metaphase cells per sample were analyzed. The clonality criteria and the karyotypic description followed ISCN (2009) recommendations [17].

Slide pretreatment and denaturation Slides were prepared by dropping cell suspensions and then left to dry. Slides were dehydrated by the treatment of ethanol series and 0.1xSSC solution. Then the slides were treated with 2xSSC solution at 70°C and denaturated in 0.07 M NaOH solution. The slides were transferred into cold 1xSSC and then into 2xSSC solutions for 1 min. each.

Turk J Hematol 2012; 29: 135-142

Then the slides were transferred into ethanol series and air-dried before hybridization [18].

FISH analysis In the MM FISH analysis, probes for, locus specific D5S721 and D5S23 (LSI CSF1R), 9p21/CEP9 (LSI P16), D13S319 for 13q14, 13q34 (LSI13q34), CEP 15 and 17p13.1 (LSI TP53) and probes for translocation t(4;14) (p16;q32) (LSI FGFR3/IGH Dual Color, Dual Fusion Translocation Probe Set), t(11;14) (q13;q32) (LSI CCND1/ IGH Dual Color, Dual Fusion Translocation Probe Set), t(14;16)(q32;q23) (LSI IGH/ MAF Dual Color, Dual Fusion Translocation Probe Set) (Vysis, Downers Grave, IL, USA) were used. FISH was performed according to manufacturer’s specifications.

Microscopy Slides were analyzed with Olympus BX61 fluorescence microscope and images captured with a CCD camera using image analysis system (Applied Imaging). At least 200 nuclei using areas of the slides on which the cells were spread were analyzed for each probe. The cut-off points for positive values was determined for each probe from five bone-marrow samples collected from individuals with iron deficiency anemia.

The cut-off values for each probe are as following: LSI D13S319 (13q14.3), LSI 13q34, LSI P53 (17p13.1); 8%-10%, LSI CSF1R / D5S23, D5S721 Probe Set , LSI P16 (9p21)/CEP9 Probe Set, CEP 15 ; 3%-5%, LSI FGFR3/ IGH t(4;14)(p16;q32) Dual Color, Dual Fusion Translocation Probe Set, LSI IGH/ MAF t(14;16)(q32;q23) Dual Color, Dual Fusion Translocation Probe Set, LSI CCND1/ IGH t(11;14) (q13;q32) Dual Color, Dual Fusion Translocation Probe Set; 1%.

Statistical analysis Pearson correlations test was used to identify the associations of CA detected by FISH and CC and clinical features such as age, stage, C-reactive protein, β2-microglobulin and immunoglobulin type. The overall survival (OS) curves were obtained using the Kaplan-Meier method.

Results Characteristics of the patients We evaluated 50 patients with MM, including 28 men and 22 women, median age 62 years (range, 44-78 years).

Twenty-seven patients had IgG, 13 had IgA, 9 had light chain and 1 had non-secretory myeloma. At the time of enrollment, 37 patients were at Durie-Salmon stage III, 11 were at stage II and 2 were at stage I. Treatment consisted

Durak Aras B, et al: Genetic Analysis in Multiple Myeloma

of standart-dose chemotherapy in 31 patients (melphalan/ prednisone in 9 patients, vincristine/adriamycin/dexamethasone in 21 patients and vincristine/ cyclophosphamide/ melphalan/prednisone in 1 patient) and of high-dose melphalan with autologous transplantation in 19 patients (Table 1).

Conventional cytogenetics studies Among the 50 patients studied, cytogenetic study was done in 32 (64%). Twenty-seven patients (84%) had normal karyotypes and the remaining 5 had CA. FISH studies Of the 50 patients, 9 (18%) had normal results, while 41 (82%) had at least one genetic aberration. FISH results are given in Table 2.

Table 1: Patient Characteristics

Parameter Age Median (min-max) Sex Female Male Type IgG IgA Other Durie-Salmon stage I II III Treatment Standard-dose Chemotheraphy High-dose melphalan with APBSCT

Patients n=50

%

62 (44-78) 28 22

27 13 10

2 11 37

% 56 % 44

% 54 % 26 % 20

%4 % 22 % 74

31

% 62

19

% 38

Table 2: FISH Results of MM Patients

chromosome 13 aberrations P53 (17p13) deletions %54 (27/50) %20 (10/50) IGH translocations Numerical aberrations t(4;14) %4 (2/50) Chr 5 %30 (15/50) t(11;14) Chr 9 %26 (13/50) t(14;16) Chr 15 %50 (25/50)

137

Durak Aras B, et al: Genetic Analysis in Multiple Myeloma

Chromosome 13 aberrations The most frequent change in our patient group involved chromosome 13. Partial or total chromosome 13 deletions were observed in 27 of 50 (54%) patients. Ten patients had monosomy 13, 8 had D13S319 and 5 had 13q34 partial deletions. Patients no.1 and no.18 had monosomy 13 plus D13S319 locus deletion, and patients no.9 and no.34 had monosomy 13 and 13q34 locus deletion. Among the 50 patients, 5 (10%) had chromosome 13 aberration as a sole abnormality, while 22 (44%) had together with other CA.

Turk J Hematol 2012; 29: 135-142

whereas 5 patients had these aberrations as a sole abnormality and 9 had together with other CA. Hyperdiploidy Hyperdiploidy was observed in 13/50 (26%) patients

by FISH, whereas it was present in only two patients by CC. Hyperdiploid karyotype was seen with chromosome 13 aberrations in 10 patients, with both chromosome 13 aberrations and P53 deletion in 2 patients and with P53 deletion in 1 patient.

Prognostic factors and OS

t(11;14)(q13;q32): None of the patients had t(11;14) while eight had a trisomy of CCND1 (11q13).

CA in our patient group did not show any significant association with age, stage, C-reactive protein, β2-microglobulin and immunoglobulin type (p>0.05).

Among the CA, chromosome 15 aberrations were found to have a significant association with advanced stage (p=0.02). Distribution of chromosome 15 aberrations according to Durie-Salmon stages is shown in Table 3.

t(14;16)(q32;q23): None of the patients had t(14;16) while one had a deletion of MAF (16q23).

Tablo 3: Stages of disease and chromosome 15 aberrations

IGH (14q32) aberrations t(4;14)(p16;q32): 2/50 (4%) patients had t(4;14), one had a deletion of FGFR3 (4p16) and one had a trisomy of FGFR3 (4p16).

We found a deletion of IGH (14q32) by three translocation probes in one patient. Other CA accompanied IGH (14q32) aberrations.

TP53 (17p13) deletions Absence of P53 at 17p13 was detected in 10/50 (20%) patients. While one patient had P53 deletion as a sole abnormality, others had this deletion with other aberrations. Chromosome 13 anomalies were the most frequent change seen together with P53 deletion.

Stage

Chromosome 15 Aberrations + Non

1

2

0

2

2

1

10

11

3

22

15

37

Total

25

25

50

Total

Numerical aberrations Chromosome 5: Numerical aberrations of chromosome 5 were detected in 15/50 (30%) patients: 13 had trisomy and 2 had monosomy. 13 patients had trisomy 5 plus hyperdiploidy. Of 2 patients with monosomy, one had isolated monosomy while one had monosomy plus a trisomy of CCND1.

Chromosome 9: Numerical aberrations of chromosome 9 were detected in 13/50 (26%) patients: 9 had trisomy, 2 had tetrasomy, 1 had tetrasomy plus trisomy, 1 had monosomy. Chromosome 9 aberrations were seen as a part of hyperdiploidy except one patient with monosomy.

Chromosome 15: Numerical aberrations of chromosome 15 were detected in 25/50 (50%) patients: 15 had trisomy, 8 had monosomy, 1 had trisomy plus monosomy, 1 had tetrasomy plus trisomy. Chromosome 15 aberrations were seen as a part of hyperdiploidy in 11 patients

138

Figure 1: Overall survival rates of patients having at least one of the three chromosomal aberrations (chromosome 13 aberrations, IGH translocations, P53 deletion) =1 and patients having none of these aberrations=2

Turk J Hematol 2012; 29: 135-142

Durak Aras B, et al: Genetic Analysis in Multiple Myeloma

OS rates of patients having at least one of the three CA (chromosome 13 aberrations, IGH translocations and P53 deletion) with poor prognostic significance and patients having none of these aberrations were evaluated by Kaplan-Meier method. The median OS was shorter in patients having at least one of the three CA than the patients having none of these aberrations (Figure1). The median OS was 17.3±1.3 months. Patients without above-mentioned CA had a median OS of 25.7±5.2 months while log rank test showed no difference between two groups according to log rank test (p<0.001) (Figure1).

Of five patients with abnormal chromosome constitutions, three had numerical sex CA whereas two had chromosome 13 and one had chromosome 1 aberrations.

Depending on the karyotype analysis, not only monosomy 13/chromosome 13 deletions (Chang et al., Königsberg et al.) [7,21] but also chromosome 1 aberrations (Kaufmann et al. and Chang et al) [4,19] have been reported as the most frequently seen abnormalities. However, numerical gonosomal CA were the most frequent abnormality in the present study. This finding is consistent with the study by Cremer et al., Dewald et al. and Anwar et al. [1,8,9].

Discussion

FISH results showed that 41 of the 50 (82%) patients had at least one abnormality, compared with a range of 36.4-86% in the literature. This high frequency of chromosomal aberrations detected in our study might be explained by the usage of a wide variety of parameters. In contrast to previous cytogenetic studies which only evaluated chromosome 13 abnormalities, we further investigated IGH rearrangements, P53 deletion, aneuploidy of chromosomes 5, 9 and 15 in addition to chromosome 13 abnormalities [1,3-9,12,14,15,19,21,22].

Our data showed that FISH technique has an advantage over CC in respect to its application to get better results. The success rate of chromosome banding analysis in MM patients has been reported from 29.5% to 92% in the literature [1,4,7,8,12,19,20]. In the presented study, the chromosome constitutions of 32 patients (64%) could be revealed and our success rate was within the range. Of 32 patients, 5 (15.6%) had CA. The ratio of CA in MM by CC ranged between 13.6% and 55.5% in previous studies [1,4,7-9,19,21,22]. The discrepancies in the genetic changes of bone marrow reflect the low in vitro mitotic activity and different infiltration degree of plasma cells. The percentage of our patients with abnormal karyotypes is similar to previous reports as given in Table 4.

In FISH analysis of our patients, the most frequent abnormality was -13/13 deletion with a ratio of 54%. This percentage was higher because two different loci (13q14 and 13q34) were analyzed in this study instead of evaluation of the sole region 13q14. Therefore, we were able

Table 4: Comparison our cytogenetics and FISH results with the previos reports

Report (Year)

Patient Number

Cytogenetics abnormality (%)

Chang (1999) Königsberg (2000) Fonseca (2003) Kaufmann (2003) Fonseca (2003) Lloveras (2004) Chang (2004) Cremer (2005) Dewald (2005) Gutierrez (2007) Avet-Loiseau (2007) Our Results

24 89 51 118 80 53 25 100 154 260 983 50

16.6 55.5 13.6 41 28 14 28 15,62

FISH 13q-/13 (%) 41.6 44.9 54.1 36.4 54 23 44 51 54 42 48 54

IGH (%) 7.9 31.3

11q13+ (%) 2.2

55 18 64 14 29.8 36 25.8 6

46

16

P53(%)

Hiperdiploidy (%)

24.7 10.7 20 14 8.5 11 20

34 39 26

139

Durak Aras B, et al: Genetic Analysis in Multiple Myeloma

to determine the numerical and structural (deletions and/ or amplifications) abnormalities for two chromosome 13 specific regions could be detected. Fonseca, Anwar and Dewald have also analyzed these two loci in their series and the chromosome 13 abnormality rate was similar [1,9,14].

Prognostic significance of chromosome 13 abnormalities is not well known in the literature. Results of previous studies that have been concerned with this chromosome abnormality are highly diverse; chromosome 13 abnormalities were either associated with a shortened survival time or found to have an intermediate prognostic effect or had no prognostic value as a sole CA [1,11,22]. There was no significant difference between our patients having normal chromosome 13 and having chromosome 13 abnormalities as a sole genetic abnormality with respect to median survival time. Previous studies suggested that chromosome 13 abnormalities was of no prognostic value as the sole anomaly whereas it has been shown to be an important marker for poor prognosis and shorter survival time together with other CA [4-6,9,22]. In consistent with this finding, our patients having -13/13 deletion together with poor prognostic markers such as IGH rearrangements and P53 deletion had a shortened median OS (Figure 1).

Numerical aberrations of chromosome 15 was observed as the second most frequent genetic change found in 50% of the patients studied by FISH analysis. The comparison of our findings with the previous studies is given in Table 3. Twenty-two of 25 patients with chromosome 15 aberrations were at Durie-Salmon stage III, that suggested an association of chromosome 15 aberrations with an advanced stage of disease. A review of the literature yielded no data relating to an association between chromosome 15 aberrations and stage. Chromosome 15 trisomies seen as a part of hyperdiploidy were found to be a good prognostic marker [5,14,23]. Due to small number of patients with an isolated chromosome 15 aberration, we could not determine the prognostic significance of chromosome 15 aberration as a sole anomaly. Further studies with larger population are necessary to determine prognostic value of chromosome 15 aberrations.

Our patients had a lower incidence of IGH rearrangements compared to previous reports. The presented study showed that Turkish patients with MM have a different anomaly incidence if compared with the other reports (Table 4) [1-5,8,9,14,19,21,22]. The abnormality incidence of the presented study could not be compared since we could not find any data specific for Turkish patients. None of the patients had t(11;14) while 16% had

140

Turk J Hematol 2012; 29: 135-142

a trisomy of CCND1 (11q13) gene region. Frequency of CCND1 gene region anomaly differs from 2.2% to 46% in the studies which may reflect a heterogeneity of the study groups or variability of the cut-off values [5,8,9,21,22]. t(4;14) and t(14;16) are known as an unfavorable prognostic factor whereas t(11;14) has a favorable prognostic value [1,3,5,9,14]. We could not determine the prognostic significance of IGH rearrangements since only two cases had t(4;14). However, patients having -13/13 deletion plus poor prognostic markers, IGH rearrangements and P53 deletion had a shortened median OS. Frequency of P53 deletion with a ratio of 20% in our patients was similar to previous reports. P53 deletion either as a single anomaly or accompanied by t(4;14) were linked with poor prognosis in previous studies [1,5,7,9,12,14,15,21]. P53 deletion also showed a significant association with a high level of β2- microglobulin [14]. Although P53 deletion in our patient group did not show any significant association with β2- microglobulin level, patients with -13/13 deletion having at least one of the two chromosomal aberrations (IGH translocations and P53 deletion) had a shortened median OS and poor prognosis.

Ploidy abnormalities have been attributed to have prognostic significance in MM, which are accompanied by concurrent CA [3,9]. In patients with hyperdiploid MM, trisomies are more common while IGH translocations have a lower incidence. Hyperdiploidy appears to represent a positive prognostic factor, while patients that carry this abnormality have genetic heterogeneity. However, the presence of chromosome 13 deletions and/or 1q amplications and rarely IGH translocations influences prognosis negatively [5,9,15]. Pseudodiploidy is detected in 9-36% of MM patients whereas hypodiploidy is observed in 10-30% of patients. Partial or total monosomies; 13q, 14, 6q, 8, 16, sex chromosome deletions have been reported with respect to frequencies of occurence. Previous studies have revealed that IGH translocations and frequently chromosome 13 deletions are found in more than 85% of patients with hyperdiploid karyotype. High incidence of IGH translocations in these patients represent a negative prognostic factor [3,5,15]. Incidence of hyperdiploidy in our study group was lower than reported in two large series by Avet-Loiseau et al. and Fonseca et al. as given in Table 4. Avet-Loiseau et al. have noticed that 36% of patients with hyperdiploidy had chromosome 13 aberrations [3,12-14]. Hyperdiploid karyotype with chromosome 13 aberrations was seen in 92.3% of our patients, which can be explained by heterogeneity between the study cohorts

Turk J Hematol 2012; 29: 135-142

and difference in the incidence of genetic changes among Turkish patients. Hyperdiploid karyotypes are associated with good prognosis in the literature [3,5,6,9,12].

Because all of our patients with hyperdiploidy were alive at follow-up, median OS could not be estimated.

However, high survival rate of these patients might be a good prognostic indicator for MM patients. Presence of hyperdiploidy with chromosome 13 aberrations does not affect survival duration of MM patients [23]. This is further supported by our findings that hyperdiploid karyotype plus chromosome 13 aberrations showed no prognostic effect. Confirming this finding, however, requires larger studies investigating the effect of hyperdiploidy with chromosome 13 aberrations on survival rates and the role of chromosome 13 in the pathogenesis and prognosis of MM. The association of chromosome 13 abnormalities with age, stage, C-reactive protein, β2- microglobulin and immunoglobulin type have been compared in previous studies [7,21]. Königsberg et al reported that chromosome 13 aberrations were associated with a high level of β2microglobulin, which suggests a poor prognosis [21]. The study of Fonseca et al. showed that patients with chromosome 13 aberrations were in advanced stage of disease [14]. We did not find any significant association between chromosome 13 aberrations and age, stage, C-reactive protein, β2- microglobulin and immunoglobulin type in our patient group. This may be due to the small number of patients in our series. In another study by Fonseca et al., the presence of chromosome 13 aberrations plus IGH translocations were found to be higher in patients without hyperdiploidy [3,7,23]. In contrast to this finding, chromosome 13 aberrations were observed in 93% of patients with hyperdiploidy in our series.

In conclusion, we suggested that 1. CC in MM is difficult as terminally differentiated plasma cells have a low proliferation activity while FISH analysis has an advantage over CC since not only metaphases but also interphase nuclei can be analyzed and different CA can be evaluated, 2. Survival rate was shorter in patients having -13/13 deletion accompanied by poor prognostic markers, including IGH rearrangements and P53 deletions, 3. Chromosome 15 aberrations were significantly higher in advanced stages of disease which should be confirmed with further studies.

Conflict of Interest Statement

Durak Aras B, et al: Genetic Analysis in Multiple Myeloma

References 1. Dewald GW, Therneau T, Larson D, Lee YK, Fink S, Smoley S, Paternoster S, Adeyinka A, Ketterling R, Van Dake DL, Fonseca R, Kyle R: Relationship of patient survival and chromosome anomalies detected in metaphase and/ or interphase at diagnosis of myeloma. Blood 2005; 106: 3553-3558 2. Dispenzeri A, Lacy MQ, Greipp PR: Multiple Myeloma. In: Greer JP, Foerster J, Rodgers GM, Paraskevas F, Glader B, Arber DA, Means RT, eds. Wintrobe’s Clinical Hemotology.

12th ed, V:2. Philadelphia: Lippincott Williams & Wilkins 2009; 2372-2438 3. Fonseca R, Debes-Marun CS, Picken EB, Dewald GW, Bryant SC, Winkler JM, Blood E, Oken MM, Santana-Davila R, Gonzalez-Paz N, Kyle RA, Gertz MA, Dispenzieri A, Lacy MQ, Greipp PR: The current IgH translocations are highly associated with nonhyperdiploid variant multiple myeloma.

Blood 2003; 7: 2562-2567 4. Kaufmann H, Krömer E, Nösslinger T, Weltermann A, Ackermann J, Reisner R, Bernhart M, Drach J: Both chromosome 13 abnormalities by metaphase cytogenetics and deletion of 13q by interphase FISH only are prognostically relevant in multiple myeloma. Eur J Haemotol 2003; 71: 179-183 5. Tonon G: Molecular pathogenesis of multiple myeloma.

Hematol Oncol Clin N Am 2007; 21: 985-1006 6. Kapoor P, Fonseca R, Rajkumar V, Sina S, Gretz MA, Stewart K, Bergsagel L, Lacy MQ, Dingli DD, Ketterling RP, Buadi F, Kyle RA, Witzig TE, Greipp PR, Dispenzieri A, Kumar S: Evidence for cytogenetic and fluorescence in situ hybridization risk stratification of newley diagnosed multiple myeloma in the era of novel therapies. Mayo Clin Proc 2010; 6: 532-537 7. Chang H, Bouman D, Boerkoel CF, Stewart AK, Squire JA: Frequent monoallelic loss of D13S319 in multiple myeloma patients shown by interphase flourescence in situ hybridization. Leukemia 1999; 13: 105-109 8. Cremer FW, Kartal M, Hose D, Bila J, Buck I, Bellos F, Raab MS, Brough M, Moebus A, Hager HD, Goldshmidt H, Moos M, Batram CR, Jauch A: High incidence and intraclonal heterogenity of chromosome 11 aberration in patients with newly diagnosed multiple myeloma detected by multiprobe interphase FISH. Can Genet Cytogenet 2005; 161: 116-124 9. Mohamed AN, Bentley G, Bonnett ML, Zonder J, Al-Katib A: Chromosome aberrations in series of 120 multiple myeloma cases with abnormal karyotypes. Am J Hematol 2007; 82: 1080-1087

None of the authors of this paper has a conflict of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

141

Durak Aras B, et al: Genetic Analysis in Multiple Myeloma

10. Gutierrez NC, Castellanos MV, Martin ML, Mateos MV, Hernandez JM, Fernandez M, Carrera D, Rosinol L, Ribera JM, Ojanguren JM, Palomera L, Gardella S, Escoda L, Hernandez-Boluda JC, Bello JL, de la Rubia J, Lahuerta JJ, San Miguel JF: Prognostic and biological implications of genetic abnormalities in multiple myeloma undergoing autologous stem cell transplantation: t(4;14) is the most relevant adverse prognostic factor, whereas RB deletion as a unique abnormality is not associated with adverse prognosis. Leukemia 2007; 21: 143-150 11. Mohamed AN, Bentley G, Bonnett ML, Zonder J, Al-Katib A: Chromosome aberrations in a series of 120 multiple myeloma cases with abnormal karyotypes. Am J Hematol 2007; 82 (12): 1080-1087 12. Avet-Loiseau H, Attal M, Moreau P, Charbonnel C, Garban F, Hulin C, Leyvraz S, Michallet M, Yakoub-Agha I, Garderet L, Marit G, Michaux L, Voillet L, Renaud M, Grosbois B, Guillerm G, Benboubker L, Monconduit M, Thieblemont C, Casassus P, Caillot D, Stoppa AM, Sotto JJ, Wetterwald M, Dumontet C, Fuzibet JG, Azais I, Dorvaux V, Zandecki M, Bataille R, Minvielle S, Harousseau JL, Facon T, Mathiot C: Genetic abnormalities and survival in multiple myeloma: The experience of the Intergroupe Francophone du Myéloma. Blood 2007; 8: 3489-3495 13. Fabris S, Agnelli L, Mattioli M, Baldini L, Ronchetti D, Morabito F, Verdelli D, Nobili L, Intini D, Callea V, Stelitano C, Lombardi L, Neri A: Characterization of oncogene dysregulation in multiple myeloma by combined FISH and DNA microarray analyses. Genes Chromosomes Cancer 2005; 42: 117-127 14. Fonseca R, Blood E, Rue M, Harrington D, Oken MM, Kyle RA, Dewald GW, Van Ness B, Van Wier SA, Henderson KJ, Bailey RJ, Greipp PR: Clinical and biologic implications of recurrent genomic aberrations in myeloma. Blood 2003; 11: 4569-4575 15. Gutierrez NC, Garcia JL, Hernanez JM, Lumbreas E, Castellanos M, Raillo A, Mateo G, Hernandez JM, Perez S, Orfao A, San Miguel JF: Prognostic and biyologic significance of chromosomal imbalances assessed by comparative genomic hybridization in multiple myeloma. Blood 2004; 9: 2661-2666

142

Turk J Hematol 2012; 29: 135-142

16. Brach MJ, Knutsen T, Spurbeck JL, eds: The AGT Cytogenetics Laboratory Manual. 3th ed. Philadelphia: Lippincott-Raven 1997: 325-372 17. Shaffer L, Tommerup N, eds: ISCN An International System for Human Cytogenetic Nomenclature. Basel: Krager, 2009 18. Rieder H, Bonwetsch C, Janssen L, Maurer J, Janssen J, Schwartz S, Ludwig W, Gassmann W, Bartram C, Thiel E, Loffler H, Gokbuget N, Hoelzer D, Fonatsch C: High rate of chromosome abnormalities detected by fluorescence in situ hybridization using BCR and ABL probes in adult acute lymphoblastic leukemia. Leukemia 1998; 12: 1473-1481 19. Chang H, Li D, Zhuang L, Nie E, Bouman D, Stewart AK, Chun K: Detection of chromosome 13q deletions and IgH translocations in patients with multiple myeloma by FISH: Comparison with karyotipe analysis. Leuk Lymhoma 2004; 45: 965-969 20. Schmidt-Wolf IG, Glasmacher A, Hahn-Ast C , Jüttner A, Schnurr T, Cremer F, Moehler T, Goldschmid H, Busert B, Schubert R, Schwanitz G: Chromosomal aberrations in 130 patients with multiple myeloma studied by interphase FISH: Diagnotic and prognostic relevance. Cancer Genet Cytogenet 2006; 167: 20-25 21. Königsberg R, Zojer N, Ackermann J, Krömer E, Kitler H, Fritz E, Kaufmann H, Nösslinger T, Riedl L, Gisslinger H, Jaeger U, Simonitsch I, Heinz R, Ludwig H, Huber H, Drach J: Predictive role of interphase cytogenetics for survival of patients with multiple myeloma. J Clin Oncol 2000; 18 (4): 804-812 22. Lloveras E, Granada I, Zamora L, Espinet B, Florensa L, Besses C, Xandri M, Encarnacion M, Milla F, Woessner S, Sole F: Cytogenetic and fluorescence in situ hybridization studies in 69 patients with multiple myeloma and plasma cell leukemia. Cancer Genet Cytogenet 2004; 148: 71-76 23. Chng WJ, Santana-Dávila R, Van Wier SAI, Ahmann GJ, Jalal SM, Bergsagel PL, Ches MI, Trendle MC, Jacobus S, Blood E, Oken MM, Henderson K, Kyle RA, Gertz MA, Lacy MQ, Dispenzieri A, Greipp PR, Fonseca R: Prognostic factors for hyperdiploid-myeloma: Effects of chromosome 13 deletions and IgH translocations. Leukemia 2006; 20 :807-813

Research Article

DOI: 10.5505/tjh.2012.78300

Hematopoietic Stem Cell Transplantation Activity and Trends at a Pediatric Transplantation Center in Turkey During 1998-2008 1998-2008 Yılları Arasında Türkiye’de bir Pediatrik Nakil Merkezindeki Hematopoietik Kök Hücre Nakli Aktiviteleri ve Eğilimleri Volkan Hazar, Gülsün Karasu, Vedat Uygun, Mediha Akcan, Alphan Küpesiz, Akif Yeşilipek Akdeniz University, School of Medicine, Department of Pediatric Hematology, Oncology and BMT Unit, Antalya, Turkey

Abstract Objective: The aim of this study was to document hematopoietic stem cell transplantation (HSCT) activity and trends at our treatment center.

Material and Methods: Data collected over a 10-year period were retrospectively analyzed, concentrating primarily on types of HSCT, transplant-related mortality (TRM), stem cell sources, indications for HSCT, and causes of death following HSCT.

Results: In total, 222 allogeneic (allo)-HSCT (87.4%) and 32 autologous (auto)-HSCT (12.6%) procedures were performed between 1998 and 2008. Stem cells obtained from unrelated donors were used in 22.6% (50/222) of the alloHSCTs. Cord blood was the source of hematopoietic stem cells (HSC) in 12.2% of all transplants. The most common indication for allo-HSCT was hemoglobinopathy (43.2%), versus neuroblastoma (53.1%) for auto-HSCT. The TRM rate 1 year post transplantation was 18.3% ± 2.5% for all transplants, but differed according to transplantation type (23.5% ± 7.9% for auto-HSCT and 17.5% ± 2.6% for allo-HSCT). The most common cause of death 1 year post HSCT was infection (35.9%).

Conclusion: The TRM rate in the patients that underwent allo-HSCT was similar to that which has been previously reported; however, the TRM rate in the patients that underwent auto-HSCT was higher than previously reported in developed countries. The selection of these patients to be transplanted must be made attentively.

Key Words: Hematopoietic stem cell transplantation, Pediatric, Transplant-related mortality, Turkey

Özet Amaç: Bir pediatrik merkezde yapılan hematopoietik kök hücre nakil (HKHN) aktiviteleri ve yönelimleri hakkında bilgi vermektir.

Gereç ve Yöntemler: On yıllık bir zaman dilimindeki veriler geriye dönük olarak değerlendirilmiştir. Çalışmanın sonlanım noktaları olarak, gerçekleştirilen HKHN çeşitleri, nakil ilişkili ölüm hızları, kök hücre kaynakları, nakil endikasyonları ve nakil sonrası ölüm nedenleri olarak belirlenmiştir.

Address for Correspondence: Volkan Hazar, M.D., Akdeniz Üniversitesi Tıp Fakültesi, Çocuk Hematoloji/Onkoloji Bilim Dalı, Çocuk Kit Ünitesi, Antalya, Turkey Phone: +90 242 249 65 39 E-mail: hazar@akdeniz.edu.tr Received/Geliş tarihi : September 14, 2010 Accepted/Kabul tarihi : June 29, 2011

143

Hazar V, et al: Hematopoietic Stem Cell Transplantation

Turk J Hematol 2012; 29: 143-149

Bulgular: 1998-2008 zaman diliminde, 222’si (%87.4) allojeneik ve 32’si (%12.6) otolog olmak üzere toplam 254 HKHN gerçekleştirildi. Allojeneik olguların %22.6’sı akraba dışı donör kaynaklıyken, tüm nakillerin %12.2’si kordon kanı ile yapılan nakillerdi. Hemoglobinopatiler, allojeneik HKHN’lerinin en sık endikasyonu iken, otolog olgularda en sık endikasyon, nöroblastomaydı. Tüm grupta nakil ilişkili ölüm hızı %18.3±2.5 olarak saptandı. Nakil ilişkili ölüm hızı 1. yılda, otolog nakillerde %23.5±7.9 ve allojeneik nakillerde %17.5±2.6’dı. HKHN sonrasında ilk 1 yıl içindeki en sık ölüm nedeni, infeksiyonlar olarak belirlendi.

Sonuç: Nakil ilişkili ölüm hızları allojeneik grupta literatürle uyumlu bulunurken, otolog grupta yüksek bulundu. Bu hasta grubunun seçimi daha detaylı olarak yapılmalıdır.

Anahtar Sözcükler: Hematopoietik kök hücre nakli, Çocuk, Nakil ilişkili ölüm hızı, Türkiye Introduction Hematopoietic stem cell transplantation (HSCT) is a well-established treatment for many malignant and nonmalignant diseases [1]. The ability to successfully perform allogeneic (allo)-HSCT depends on acceptable matching between donor and recipient human leukocyte antigen (HLA) systems. Graft versus host disease (GVHD) is the most important consequence of donor and recipient mismatch. Immunosuppressive agents, such as prednisolone, methotrexate, and cyclosporine A, are used for GVHD prophylaxis. The ideal for allo-HSCT is to use a fully HLAmatched sibling donor. Cord blood (CB), in which stem cells are immunologically immature and thus require less rigorous HLA matching, can be used for HSCT when there isn’t an adequately matched donor available. Possible complications of HSCT are infection, GVHD, organ toxicity, reduced growth and fertility, secondary malignancy, and relapse or persistence of the underlying disease.

To date, there has been no large-scale study conducted in Turkey on HSCT strategies used in children. The aim of the present study was to describe the trends in HSCT activity in pediatric patients at a center in Turkey during the 10-year period of 1998-2008.

Materials and Methods Data source Data were collected from records of HSCT patients.

All transplanted patients between 01 January 1998-31 December 2008 were included. The minimal requirement of requested information for this study was patient age, gender, disease, disease stage, stem cell source, donor type, and outcome. Patient data were updated annually to as late as 31 December 2009, i.e. minimum follow-up was 1 year. Informed consent was provided by the parents/ guardians of each patient in accordance with The Declaration of Helsinki.

Definitions HSCT was defined according to European Group for Blood and Marrow Transplantation (EBMT) criteria [2].

HSCT was considered the infusion of hematopoietic stem cells with the intension to replace the recipient’s pre-transplant hematopoietic system. Delayed engraftment was defined as an absolute neutrophil count less than 0.5 x 109 L–1 at 28 d post HSCT. Graft failure (GF) was defined as the absence of donor-derived hematopoiesis. Re-infusion of allogeneic stem cells for graft failure was considered retransplant. Re-infusion of autologous stem cells for nonengraftment was considered a boost, not a transplant.

Event-free survival (EFS) was defined as the time from transplantation to the date of the last follow-up during complete remission or the first event. Events were considered resistance to transplantation, relapse or progression of primary disease, or death due to any cause. Overall survival (OS) was defined as the time from transplantation to death or the date of the last follow-up. Transplant-related mortality (TRM) was defined as death due to any cause in the absence of relapse or progression of primary disease, including infections, toxicities, and other non-relapse- or disease progression-related causes of death. An alternative donor was any non-sibling family member or unrelated donor.

Statistical analysis The mean, median, and standard deviation of numerical variables were calculated. Outcomes measured were EFS and OS, based on Kaplan-Meier estimation, and TRM and relapse rates were based on cumulative incidence curves adjusted for competing risks, as appropriate. Comparisons were made using the log-rank test. Statistical analyses were performed using SPSS v.15.0 (Inc., Chicago, IL, USA).

Results Number and characteristics of HSCTs In all, 244 first transplants were performed between

144

Turk J Hematol 2012; 29: 143-149

1998 and 2008 (allo-HSCT: n = 212 [86.9%] and autologous (auto)-HSCT: n = 32 [13.1%]). Additionally, 10 retransplants (all allo-HSCTs) were performed during the same time period a median 212 d (range: 54-1023 d) after the first transplantation. Median age of the patients was 82 months (range: 7-272 months) and 60.2% were male (Table 1).

Indications for transplantation and donor types Indications for the first HSCT are shown in Figure 1.

The most common malignant disorder indicating HSCT was acute leukemias (n = 46 [53.5%]). Most of the patients with a non-malignant disorder had hemoglobinopathy (n = 96 [60.7%]), followed by Fanconi anemia (FA) (n = 19, 12.0%). Indications for allo-HSCT (n = 54 [25.5%]) were

A SAA, Severe aplastic anemia ; FAA, Fanconi’s aplastic anemia; others, adrenoleukodystrophy (n:6), hemophagocytic lymphohistiocytosis (n:3), osteopetrosis (n:2), Hurler disease (n:2), Amegakaryocytic thrombocytopenia (n:2), Fucosidosis (n:1), Evan’s syndrome (n:1), Diamond-Blackfan syndrome (n:1)

B ALL, acute lymphoblastic leukemia ; AML, acute myeloblastic leukemia; NBL, neuroblastoma ; others, myelodysplastic syndrome (n:4), chronic myeloid leukemia (n:3), juvenile myeloid leukemia (n:3), Ewing sarcoma (n:3), medulloblastoma (n:1), rhabdomyosarcoma (n:1), non-rhabdoid soft tissue sarcoma (n:1), and germ cell tumor (n:1)

Figure 1: HSCT indications for non-malignant disorders (A) and malignant disorders (B)*

Hazar V, et al: Hematopoietic Stem Cell Transplantation

Table 1: Characteristics of patients underwent HSCT during 1998-2008.

Feature Age (months) Median (range) Mean±SD

Number (%) 82 (7-272) 91.8±60.3

Sex Female Male

97 (40) 147 (60)

HSCT type Autologous Allogeneic

32 (13) 222 (87)

HSCT number First Re-transplant

244(96) 10 (4)

Conditioning regimen for HSCT Myeloablative Non-myeloablative

246 (97) 8 (3)

Source of HSC for autoHSCT Peripheral blood Bone marrow Peripheral blood+bone marrow

25 (78) 1(3) 6 (19)

Source of HSC for alloHSCT Peripheral blood Bone marrow Peripheral blood+Bone marrow Bone marrow+Cord blood Cord blood

159 (72) 31 (14) 1(1) 7 (3) 24(10)

malignant diseases, including acute lymphoblastic leukemia (ALL) (n = 27 [12.7%]), acute myeloblastic leukemia (AML) (n = 16 [7.5%]) (3 of the AML patients underwent auto-HSCT), other malignancies (n = 11 [5.2%]), and non-malignant disorders (n = 158 [74.5%]), including hemoglobinopathy (n = 96 [45.2%]), FA (n = 19 [9.0%]), immunodeficiency (n = 16 [7.5%]), and others (n = 27 [12.7%]). Indications for auto-HSCT were neuroblastoma (n=17[53.1%]), followed by lymphomas (n =5[15.6%]).

In all, 10 patients underwent re-HSCT (hemoglobinopathy: n = 5; amegakaryocytic thrombocytopenia: n = 1; juvenile myelomonocytic leukemia: n = 1; ALL: n = 1; chronic myelocytic leukemia: n = 1; FA: n = 1). Prior to 2006, the majority of allografts (84.6%) were performed using HLA-matched sibling donors (MSD). Since 2006, there has been an increase in the number of allo-HSCTs using alternative donors (Table 2).

145

Hazar V, et al: Hematopoietic Stem Cell Transplantation

Turk J Hematol 2012; 29: 143-149

Table 2: Number of HSCT performed, by type, 1998-2008 (n=254)

Year 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 Total

Autologous 2 5 1 2 0 5 1 3 3 3 7 32

Allogeneic (all) 2 4 11 11 12 14 16 28 37 45 42 222

Source of hematopoietic stem cells Among the 32 auto-HSCTs, peripheral blood (PB) was the source of HSC in 25 (78.1%) patients, bone marrow (BM) in 1 (3.2%), and PB+BM in 6 (18.7%). Among the 222 allo-HSCTs, PB was the source of HSC in 159 (71.5%) patients, BM in 31 (14.0%), PB+BM in 1 (0.5%), BM+CB in 7 (3.1%), and CB in 24 (10.9%). The first allo-HSCT using CB was performed in 2005 and the number has increased every year since.

Outcome a. Survival At the time of analysis 172 of the patients were alive, 78 had died, and 4 had dropped out of the study. The 5-year EFS and OS was 55.7% ± 3.3% and 70.9% ± 3.3%, respectively. b. Mortality The cause of death was transplant-related in 55 (70.6%) patients, and post-HSCT relapse or recurrence (for nonmalignant diseases) in 23 (29.4%) patients. The incidence of TRM, and relapse or recurrence differed between patients that underwent allo-HSCT and auto-HSCT. TRM, and relapse or recurrence at 5 years was 24.1% ± 3.3% and 14.8% ± 2.8% in allo-HSCT patients, respectively, and 23.5% ± 7.9%, and 55.8 ± 11.6% in auto-HSCT patients, respectively (Figure 2). The cumulative incidence of TRM in all the patients during 2 consecutive periods (19982003 and 2004-2008) did not differ significantly (24.2% ± 5.5% and 23.2% ± 3.3%, p<0.05, respectively).

146

MSD 2 (100%) 4 (100%) 9 (82%) 9 (82%) 8 (67%) 13 (93%) 14 (88%) 24 (86%) 18 (49%) 25 (56%) 22 (52%) 148 (67%)

Alternative donor 0 (0%) 0 (0%) 2 (18%) 2 (18%) 4 (33%) 1 (7%) 2 (12%) 4 (14%) 19 (51%) 20 (44%) 20 (48%) 74 (33%)

Total 4 9 12 13 12 19 17 31 40 48 49 254

TRM post allo-HSCT differed according to donor type.

Among the patients that underwent HSCT from an HLAidentical sibling donor, the cumulative incidence of TRM at 100 d and 365 d post HSCT was 5.4% ± 1.9% and 11.0% ± 2.6%, respectively, versus 16.6% ± 4.4% and 31.7% ± 5.6%, respectively, among those underwent alloHSCT from an alternative donor (P < 0.001) (Figure 3).

TRM occured in 7 of the 32 patients that underwent autoHSCT; 4 due to infection, of which 1 had graft failure, and other causes (veno-occlusive disease (VOD) [n = 2] and possible cardiac toxicity [n = 1]). The primary diagnosis in the patients with TRM were as follows: neuroblastoma (n = 3), germ cell tumor (n = 1), non-Hodgkin lymphoma (n = 1), medulloblastoma (n = 1), and Ewing sarcoma (n = 1).

Discussion This is the first study to evaluate and report on the development and recent activity in the field of HSCT in pediatric patients in Turkey. Analysis of the presented 10-year data set showed that HSCT is an accepted therapy, which is increasingly used. Auto-HSCT has an important role in a range of childhood cancers, such as neuroblastoma, lymphomas, and Ewing sarcoma/PNET [1,3]. In the present study the most common indications for auto-HSCT were neuroblastoma and lymphomas, which is consistent with other reports [2,3]. The reason for neuroblastoma was the consequence of clinical trials that reported auto-HSCT is more beneficial than conventional chemotherapy in children with high-risk neuroblastomas [4,5]. The Prospective Turkish Pediatric Oncology Group Neuroblastoma National Study included a high-dose chemotherapy and

Turk J Hematol 2012; 29: 143-149

Hazar V, et al: Hematopoietic Stem Cell Transplantation

A

D

B

E

C

F

Figure 2: Main outcome of 254 children with HSCT (A: allogeneic HSCT, survival; B: allogeneic HSCT, relapse (or autologous reconstitution) incidence; C: allogeneic HSCT, TRM incidence; D: autologous HSCT, survival; E: autologous HSCT, relapse (or autologous reconstitution) incidence; F: autologous HSCT, TRM incidence)

147

Hazar V, et al: Hematopoietic Stem Cell Transplantation

Figure 3: Cumulative incidence of TRM by donor type in children receiving allogeneic HSCT.

autologous hematopoietic stem cell rescue arm for highrisk neuroblastoma patients [6]. In this context, the number of transplants for neuroblastoma patients has been increasing since 2003 at our center, which is when the National Neuroblastoma Study began.

Allogeneic transplantation is most frequently performed in children with high-risk and relapsed leukemias, myelodysplastic syndromes, aplastic anemia, congenital BM failure syndromes, beta thalassemia major, and various congenital metabolism disorders [1,7-11]. In the present study the most common indication for allo-HSCT was hemoglobinopathies, which was probably due to the high prevalence in our region [12] and referrals from other centers, followed by high-risk acute leukemias, including relapsed cases. During the study period, there was an increase in the number of allogeneic procedures using CB and stem cells from unrelated donors. CB has gradually emerged as an alternative source of hematopoietic cells for transplantation in children and adults with high-risk or advanced hematologic malignancies that do not have a suitably matched related or unrelated adult donor. This increase in the use of CB is due to favorable results in children, an increase in the availability of CB units with large cell doses, less stringent donor-recipient HLA matching, and rapid identification and acquisition of the unit.

It was reported that DFS in children following CB transplantation is similar to that following allele-matched BM transplantation [13]. The primary obstacles to successful CB transplantation are delayed myeloid and thrombocyte engraftment time, and a higher rate of graft rejection than with BM- or PB-based HSCT [14].

148

Turk J Hematol 2012; 29: 143-149

Comparison of the present data on donors used in alloHSCT with other similar international data showed that the number of transplantations from alternative donors is much higher in Australia than that in our center [15], whereas the number of transplantations from MSD at our center is similar to that in Switzerland and Eastern European countries [16, 17] and higher than that in Australia [15]. Despite the increase in the number of transplantations from the alternative donors at our center, this is not as high as that in developed counries, primarily because patients considered for transplantation do not present to our center in a timely fashion, the search for unrelated donors in Turkey cannot be completed in a timely fashion due to bureaucratic procedures, and the number of BM donors registered in Turkey has not reached the level in developed countries.

In the present study the rate of TRM in the patients that underwent allo-HSCT was comparable to that reported in other studies [15-17]. In the present studyâ&#x20AC;&#x2122;s allo-HSCT patients the primary causes of TRM were infection (43%) and GVHD (34%). Among the allo-HSCT patients, TRM during the first 5-years of the study did not differ from that during the second 5 years, during which time the number of transplantations from alternative donors substantially increased. The reason behind might be the decrease in TRM, at least, in transplantations from MSD based on experience obtained in the first 5 years. However, this was invalid for autologous transplantations, because the TRM rate in the auto-HSCT patients was much higher than acceptable thresholds. As fewer patients in the present study underwent auto-HSCT than allo-HSCT and the auto-HSCT patients were not homogeneous in respect to primary diagnosis, it is difficult associate this undesired outcome with a specific variable, such diagnosis, disease stage, or timing of transplantation. Among the patients with neuroblastoma, the most common indication for auto-HSCT (n = 17), 3 patients died due to transplantrelated causes, of which 2 died due to severe VOD even thought they had not previously received abdominal irradiation and were in first remission.

In conclusion, HSCT provided long-term survival and cured many of the patients with malignant and non-malignant disorders. The major cause of mortality was relapse of underlying conditions, which is indicative of the high-risk nature of diseases requiring HSCT. Despite the risks, we think HSCT offers the best chance of cure for many children with otherwise fatal diseases.

Turk J Hematol 2012; 29: 143-149

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Ljungman P, Bregni M, Brune M, Cornelissen J, de Witte T, Dini G, Einsele H, Gaspar HB, Gratwohl A, Passweg J, Peters C, Rocha V, Saccardi R, Schouten H, Sureda A, Tichelli A, Velardi A, Niederwieser D; European Group for Blood and Marrow Transplantation: Allogeneic and autologous transplantation for haematological diseases, solid tumours and immune disorders: Current practice in Europe 2009.

Bone Marrow Transplant 2010; 45: 219-234 2. Schmitz N, Gratwohl A, Goldman JM: Allogeneic and autologous transplantation for haematological diseases, solid tumours and immune disorders. Current practice in Europe in 1996 and proposals for an operational classification.

Accreditation Sub-Committee of the European Group for Blood and Marrow Transplantation (EBMT). Bone Marrow Transplant 1996; 17: 471-477 3. Barrett D, Fish JD, Grupp SA: Autologous and allogeneic cellular therapies for high-risk pediatric solid tumors.

Pediatr Clin North Am 2010; 57: 47-66 4. Matthay KK, Villablanca JG, Seeger RC, Stram DO, Harris RE, Ramsay NK, Swift P, Shimada H, Black CT, Brodeur GM, Gerbing RB, Reynolds CP: Treatment of high-risk neuroblastoma with intensive chemotherapy, radiotherapy, autologous bone marrow transplantation, and 13-cisretinoic acid. Children’s Cancer Group. N Engl J Med 1999; 341: 1165-1173 5. Matthay KK, Reynolds CP, Seeger RC, Shimada H, Adkins ES, Haas-Kogan D, Gerbing RB, London WB, Villablanca JG: Long-term results for children with high-risk neuroblastoma treated on a randomized trial of myeloablative therapy followed by 13-cis-retinoic acid: A children’s oncology group study. J Clin Oncol 2009; 27: 1007-1013 6. http://www.tpog.org.tr/noroblastoma2009.php 7. Copelan EA: Hematopoietic stem-cell transplantation. N Engl J Med 2006; 354: 1813-1826 8. Wayne AS, Baird K, Egeler RM: Hematopoietic stem cell transplantation for leukemia. Pediatr Clin North Am 2010; 57: 1-25

Hazar V, et al: Hematopoietic Stem Cell Transplantation

9. Mehta P, Locatelli F, Stary J, Smith FO: Bone marrow transplantation for inherited bone marrow failure syndromes. Pediatr Clin North Am 2010; 57: 147-170 10. Angelucci E, Baronciani D: Allogeneic stem cell transplantation for thalassemia major. Haematologica 2008; 93: 1780-1784 11. Boelens JJ, Prasad VK, Tolar J, Wynn RF, Peters C: Current international perspectives on hematopoietic stem cell transplantation for inherited metabolic disorders. Pediatr Clin North Am 2010; 57: 123-145 12. Bircan I, Sişli S, Güven A, Cali S, Yeğin O, Ertuğ H, Güven AG, Akar N: Hemoglobinopathies in the district of Antalya, Turkey. Pediatr Hematol Oncol 1993; 10: 289-291 13. Eapen M, Rubinstein P, Zhang MJ, Stevens C, Kurtzberg J, Scaradavou A, Loberiza FR, Champlin RE, Klein JP, Horowitz MM, Wagner JE: Outcomes of transplantation of unrelated donor umbilical cord blood and bone marrow in children with acute leukaemia: A comparison study. Lancet 2007; 369: 1947-1954 14. Fernandez MN: Improving the outcome of cord blood transplantation: Use of mobilized HSC and other cells from third party donors. Br J Haematol 2009; 147: 161-176 15. Moore AS, Shaw PJ, Hallahan AR, Carter TL, Kilo T, Nivison-Smith I, O’Brien TA, Tapp H, Teague L, Wilson SR, Tiedemann K: Haemopoietic stem cell transplantation for children in Australia and New Zealand, 1998-2006: a report on behalf of the Australasian Bone Marrow Transplant Recipient Registry and the Australian and New Zealand Children’s Haematology Oncology Group. Med J Aust 2009; 190: 121-125 16. Wachowiak J, Labopin M, Miano M, Chybicka A, Stary J, Sterba J, Masszi T, Labar B, Maschan A, Kowalczyk JR, Lange A, Holowiecki J, Kalman N, Afanassiev BV, Dini G; EBMT Paediatric Working Party: Haematopoietic stem cell transplantation in children in eastern European countries 1985-2004: development, recent activity and role of the EBMT/ESH Outreach Programme. Bone Marrow Transplant 2008; 41 Suppl 2: 112-117 17. Passweg J, Baldomero H, Chapuis B, Leibundgut K, Schanz U, Gratwohl A; Swiss Transplant Working Group Blood and Marrow Transplantation Board: Haematopoietic stem cell transplantation in Switzerland. Report from the Swiss Transplant Working Group Blood and Marrow Transplantation (STABMT) Registry 1997-2003. Swiss Med Wkly 2006; 136: 50-58

149

Research Article

DOI: 10.5505/tjh.2012.26779

Immunosuppressive Treatment in Children with Acquired Aplastic Anemia Edinsel Aplastik Anemili Çocuklarda İmmünsüpresif Tedavi Yıldız Yıldırmak, Ela Erdem, Leyla Telhan, Laliz Kepekçi Sisli Etfal Training and Research Hospital, Department of Pediatrics, İstanbul, Turkey

Abstract Objective: Immunosuppressive treatment (IST) is an alternative for children with acquired aplastic anemia (AA) that do not have HLA-matched donors. The objective of this study was to evaluate the outcome of IST in children with acquired AA.

Material and Methods: The study included 18 pediatric acquired AA patients that were retrospectively evaluated.

The patients either did not have an HLA-matched related donor or were unable to undergo transplantation within 6 months despite having an HLA-matched donor.

Results: In all, 6 of the patients were characterized as very severe AA, 6 as severe AA, and 6 as moderate AA. Mean duration of follow-up was 44.5 months. In total, 9 patients that could not be treated with equine anti-thymocyte globulin (hATG) following diagnosis received high-dose methylprednisolone treatment. Among the 6 very severe AA patients, 2 achieved complete remission (22%); the other 16 patients received hATG+cyclosporine and short-term methylprednisolone.

In total, 4 of the patients died during the first month of treatment. Of the remaining 12 patients, 3 responded to the treatment (25%). Of the 9 patients that did not respond after 3 months of treatment, 7 received a second course of immunosuppressive treatment with rabbit ATG (rATG)+cyclosporine and short-term methylprednisolone; 2 of the 7 patients responded (22%), but 5 did not respond to any treatment. Median survival among the patients was as 64 ± 8 months

Conclusion: Combination IST with ATG+cyclosporine and low-dose methylprednisolone was an effective treatment in the pediatric acquired AA patients with non-identical HLA donors. In the patients that couldn’t be treated with ATG high-dose methylprednisolone treatment was safe and effective.

Key Words: Immunosuppressive treatment, Acquired aplastic anemia, Children

Özet Amaç: İmmunsupresif tedavi (İST), HLA uyumlu vericisi olmayan edinsel aplastik anemili (AA) çocuklarda diğer bir tedavi seçeneğidir. Bu çalışmada edinsel AA’li çocuklarda İST sonuçlarının değerlendirilmesi amaçlanmıştır.

Gereç ve Yöntemler: Çalışmada 18 edinsel AA’li çocuk hasta retrospektif olarak incelendi. Tanı sırasında HLA uygun akraba içi vericisi olmayan ya da HLA uygun vericisi olmasına rağmen 6 ay içinde nakil olamayacak hastalar çalışmaya alındı.

Address for Correspondence: Yıldız Yıldırmak, M.D., Şişli Etfal Eğitim ve Araştırma Hastanesi, Çocuk Sağlığı ve Hastalıkları Anabilim Dalı, İstanbul, Turkey Phone: +90 212 219 67 50 E-mail: yyildirmak@yahoo.com Received/Geliş tarihi : July 12, 2010 Accepted/Kabul tarihi : March 5, 2011

150

Turk J Hematol 2012; 29: 150-155

Yıldırmak Y, et al: Treatment in Children with Aplastic Anemia

Bulgular: Hastaların 6’sı çok ağır AA, 6’sı ağır AA ve 6’sı da orta AA sınıfında idi. Ortalama takip süresi 44.5 ay bulundu. Tanı konulduktan sonra at kaynaklı anti-timosit globulin (hATG) temin edilemeyen 9 hastaya yüksek doz metilprednizolon tedavisi verildi. Çok ağır AA’li 6 hastanın 2’sinde (%22) tam remisyon elde edildi. Geri kalan 16 hastaya hATG+siklosporin ve kısa süreli metilprednizolon tedavisi verildi.

Tedavi uygulamasını takiben bir ay içinde dört hasta kaybedildi. Geriye kalan 12 hastanın 3’ü (%25) tedaviye cevap verdi.

Tedaviye başladıktan 3 ayın sonunda cevap alınamayan 9 hastanın 7’sine tavşan kaynaklı ATG (rATG)+siklosporin ve kısa süreli metilprednizolon ile ikinci kür İST verildi. Bu 7 hastanın 2’sinde (22%) cevap alındı, ancak 5 hasta tedaviye cevap vermedi. Ortalama yaşam süresi 64±8 ay bulundu.

Sonuç: ATG+siklosporin ve düşük doz metilprednizolon ile kombinasyon İST, HLA uygun vericisi olmayan edinsel AA’li çocuk hastalarda etkin bir tedavidir. ATG ile tedavi edilemeyen hastalarda yüksek doz metilprednizolon tedavisi güvenli ve etkilidir.

Anahtar Sözcükler: İmmunsupresif tedavi, Edinsel aplastik anemi, Çocuklar Introduction The primary treatment for acquired aplastic anemia (AA) is hematopoietic stem cell transplantation (HSCT) from HLA-matched sibling donors. The procedure has a survival rate of up to 88% to 97% [1]. Immunosuppressive therapy (IST) is an alternative to HSCT, especially in patients without an HLA-matched donor [1,2]. There are limited data available on the use of IST in pediatric patients; however, a large series of patients aged 1-50 years was analyzed by the European Group for Blood and Marrow Transplantation (EBMT), which concluded that HSCT should be the first-line treatment, especially in patients aged <10 years, those with severe AA, and those with an HLA-matched sibling donor [1,2].

Current IST options include single-dose anti-thymocyte globulin (ATG), single-dose cyclosporine (CsA), ATG+anti-lymphocyte globulin (ALG), androgens, corticosteroids, high-dose cyclophosphamide, and mycophenolate mofetil [3-5]. Moreover, the ATG+ALG combination is currently the most widely used regimen, although highdose cyclophosphamide therapy has been also reported [6]. The response rate to the combination of ATG+CsA is approximately 75% [7]. The aim of the present study was to evaluate the outcome of IST in pediatric acquired AA patients that could not undergo HSCT. Materials and Methods Inclusion criteria Patients that presented to Sisli Etfal Training and Research Hospital, Pediatric Hematology Department between 2000 and 2008 with the diagnosis of AA were analyzed retrospectively. None of the patients had a history of using medications that can cause AA and none had hepatitis or immune-mediated disorders. All the patients

included in the study had negative diepoxybutane chromosome fragility findings. Patients diagnosed as hereditary AA or those that had HLA-matched donors and underwent HSCT were excluded from the study.

Disease classification AA was classified according to severity. AA was classified as severe on the basis of bone marrow cellularity <25% and the presence of ≥2 of the following criteria: neutrophil count <0.5 x 109/L, platelet count <20 x 109/L, and reticulocyte count <20 x 109/L. In addition to the above mentioned criteria, AA was classified as very severe if the neutrophil count was <0.2 x 109/L. AA was classified as moderate in the presence of hypocellular bone marrow and any 2 of the following criteria: neutrophil count <1.0 x 109/L, platelet count <50 x 109/L, and reticulocyte count <60 x 109/L [3,4].

Following diagnosis, if ATG could not be administered, high-dose methylprednisolone (HDMP) treatment was given. HDMP treatment was administered as 30 mg/kg for 3 days, and then 20 mg/kg for 4 days; after the 1st week of treatment the dose was decreased to 10 mg/kg/day for the 2nd week, 5 mg/kg/day for the 3rd week, and 2 mg/kg/ day for the 4th week, after which time the treatment was withdrawn [8]. Patients received ATG if it was provided immediately after the diagnosis or if they did not respond to HDMP treatment (at least 1 month later after the beginning of HDMP treatment). The equine ATG (hATG) regimen was as follows: hATG 15 mg/kg for 5 days, CsA 5 mg/ kg/day for 60 days, and prednisolone 2 mg/kg/day for 10 days. Prednisolone dose was tapered to end on day 30.

Patients that did not respond to hATG after 3 months of treatment, received ATG of rabbit origin (rATG) at a dose of 3.75 mg/kg/day for 5 days and CsA was continued at

151

Yıldırmak Y, et al: Treatment in Children with Aplastic Anemia

the same dosage. Prednisolone was also used at the same dosage with hATG regimen [4,9].

Platelets were transfused when the platelet count was <20 x 109/L or when there was bleeding; erythrocyte suspension was given when the hemoglobin level was <7 g/dL and there was symptomatic anemia.

Response criteria Total response was defined as hemoglobin within agedefined normal limits, a platelet count >100 x 109/L, and a neutrophil count >1.5 x 109/L. Partial response was defined as a reticulocyte count >30 x 109/L (independent of transfusion), a platelet count >30 x 109/L, and a neutrophil count >0.5 x 109/L [10]. In patients that responded to treatment, the time required for partial and complete response was analyzed. The period from diagnosis to initiation of treatment was compared between the patients that did and did not respond to the treatment. All patients underwent bone marrow aspiration at 6 and 12 months, and then yearly after the diagnosis, so that they were evaluated for myelodysplasia, which was defined as the appearance of a new clonal disorder observed cytogenetically or characteristic morphologic changes in bone marrow examination findings.

Statistical analysis was performed using SPSS v.11.0 (Chicago, IL, U.S.A.) Descriptive statistics, including mean, median, and standard deviation, were calculated for all variables. The Mann-Whitney U test was used to compare scale variables and the survival rate was assessed via the Kaplan-Meier method.

Results The study included 18 children that underwent IST at our hospital between 2000 and 2008. Patient demographic data are shown in Table 1.

Response to IST After the diagnosis of AA, ATG could not be given to 9 patients; instead they were given HDMP treatment.

Complete response was achieved in only 2 of these 9 cases (22%), both of which had very severe AA. In total, 7 of the patients that did not respond to HDMP and 9 of patients who provided hATG received hATG, CsA, and prednisolone treatment. In all, 4 of these 16 patients died during the first month of treatment. The causes of death were infection in two patients (mucormycosis and septicemia), bleeding in one patient and ensephalopathy in the other.

Of the 12 patients that survived, 3 (25%) responded to treatment, of whom 2 had moderate AA and 1 with very severe AA. In these patients who responded, CsA was stopped after tapering in 3 months.

152

Turk J Hematol 2012; 29: 150-155

Table 1: Patient demographics.

Patient characteristics Male:female ratio Mean age at the time of diagnosis (years) Median age at the time of diagnosis (years) Disease severity at the time of diagnosis Very severe Severe Moderate Patients that received HDMP Patients that responded to treatment Number of immunotherapy courses 1 (hATG) 2 (hATG and rATG) Treatment response (to hATG and rATG ) Total response Partial response No response Early Exitus Result Alive without transfusion Alive and dependent on transfusion Early exitus Exitus after the first course Exitus after the second course

n: 18 11:7 7.9 8 6 6 6 9 2 12 7 5 7 4 7 4 4 2 1

In total, 9 patients did not respond to 3 months of treatment; 7 subsequently received a second course of IST consisting of rATG. Prednisolone treatment was repeated and the patients received CsA treatment as the same dosage for six months. Two of the unresponsive patients chose not to receive a second course of IST; they died after 6 and 15 months of follow-up due to bleeding and infection, respectively. Among the 7 patients that underwent the second course of IST, 2 had complete response (22%) (1 with moderate AA and 1 with severe AA) and the other 5 did not respond to the second course of treatment (2 with moderate AA, 2 with severe AA, and 1 with very severe AA) (Table 2). One of the unresponsive cases died due bleeding at the end of 12-months of follow-up; the other 4 cases were still being follow-up without a response at the time this report was written.

In the patients that responded to IST the time required for partial or complete response was analyzed. In the 2 patients that responded to HDMP the time for partial and complete response was 1.5 ± 0.5 months and 3.5 ± 0.5

Turk J Hematol 2012; 29: 150-155

Yıldırmak Y, et al: Treatment in Children with Aplastic Anemia

Table 2: Treatment responses according to disease severity.

Severity of disease

Treatment group

Response (n)

Response (n)

hATG+CsA (1st course)

HDMP Moderate (n = 6) Severe (n = 6) Very severe (n = 6)

Treatment group

Treatment group

Response (n)

Overall response n = 14*

rATG+CsA (2nd course)

3

-

5

2

3

1

3

3

-

3

-

3

1

1

3

2

4

1

1

-

3

2

%50

2

3

*The 4 patients that died during the first month of treatment were excluded.

17.2 months, respectively; the difference was significant (p = 0.043). The estimated survival rate was 77% in the responsive patients and the survival rate was 51% in the unresponsive patients. Mean time from diagnosis to the start of treatment was 3.8 ± 3.8 months (range: 1 month12 months); among the responsive and unresponsive patients, it was 2.6 ± 2.5 and months and 4.4 ± 4.5 months, respectively. Although the difference was significant, the patients that responded to treatment received began treatment sooner than those that were unresponsive.

Figure 1: Cumulative survival rate in 18 children with aplastic anemia treated with immunosupressive therapy.

months, respectively. Of the 3 patients that responded to hATG, partial response was obtained in 4.5 ± 0.5 months and complete response in 12 ± 1.6 months. In the patients that received rATG as a second course following hATG, partial and complete response was achieved in 3.3 ± 0.4 months and 11.3 ± 0.9 months, respectively. Patients treated with hATG became transfusion free in a mean duration of 3.7 ± 1.4 months.

Mean duration of survival in the responsive and unresponsive patients was 76.8 ± 9.8 and months and 54.8 ±

None of the patients in the present study received Granulocyte colony-stimulating factor (G-CSF). During 44.7 ± 35.2 months of follow-up none of the patients relapsed.

Median duration of survival was 64 ± 8 months (range: 6-96 months) (Figure 1), and 5-year event-free survival was 61%. None of the patients exhibited evidence of clonal evolution to MDS or AML, according to bone marrow examination findings; however, cytogenetic examination of bone marrow samples is not commonly performed at the onset of disease or in unresponsive patients because of the difficulty in obtaining a sufficient number of cells for analysis.

Discussion During the last 2 decades the use of combination IST in children with AA has increased the treatment response rate and survival time [3]. Although the peak age for the development of aplastic anemia is 15 to 25 years or older than 60 years, it also occurs in children [1]. Mean age of the patients in the present study was 7.9 ± 2.5 years.

Although the male:female ratio is reported to be 1:1, males

153

Yıldırmak Y, et al: Treatment in Children with Aplastic Anemia

predominated in the present study which was approximately 1.5:1 [1,11].

HDMP was given to 9 of our patients that could not be given ATG because of unavailability. Total response was achieved in only 2 of our patients. Patients with severe AA had higher survival rates with IST than other AA patients [10]. Recently, Huang et al. reported 73% overall response and 89.4% actuarial 5-year survival in children with severe AA that received IST [12]. Kurre et al. reported in a review that the combination of ATG/ALG+CsA yielded a response rate of 65% in 6 months and an overall response rate of 75% [14]. Despite the fact that the patients in the present study that responded to HDMP had very severe group AA, among those that responded to ATG and CsA, 3 had moderate AA, 1 had severe AA, and 1 had very severe AA. Patients that do not respond to an initial course of IST may respond to a second course of a similar or different ATG product [7]. Among the 7 patients in the present study that did not respond to the 1st course of treatment and received a 2nd course, 2 achieved total response. In all, 12 patients were treated with ATG+CsA; 5 (22%) had complete response and 7 (43%) had no response. Mean duration from the onset of treatment to remission for complete response was 12 ± 1.6 months among the patients treated with hATG and 11.3 ± 0.9 months among those that did not respond to hATG and received rATG. In addition to early and late side effects caused by the use of ATG, several studies reported early deaths due to infection [9]. In the present study 2 patients had early death due to infection; 1 had severe AA and 1 had very severe AA. In patients with severe AA the early death rate due to infection is reported to be higher than in other AA patients. In the present study the early infection-related mortality rate was 11.1% (n = 2). Zheng reported that infection-related mortality was 17% during the first 6 months of IST including hATG, CsA and prednisolone [15]. Several studies reported a relapse rate of 36% following IST in AA patients, whereas when CsA was tapered slowly the rate dropped to 10%-30% [4,16]. In the present study doses were tapered slowly, which may be why relapses were not observed. Relapses following IST have occurred as late as 10 years post treatment [1]. Mean duration of follow-up in the present study was 44.7 ± 35.2 months. We think it is important to observe patients at least 10 years inorder to access the risk of relapse.

Malignant transformation to MDS/AML is the most frequent complication of AA in patients with long-term survival; the cumulative risk is 15% in 7-8 years [7]. It

154

Turk J Hematol 2012; 29: 150-155

remains unclear if clonal disease occurs during the natural course of AA or if it is related to IST. The patients in the present study did not develop clonal disease, which may have been due to the short-term mean follow-up of 44.7 ± 35.2 months. Long-term use of G-CSF is known to increase the risk of MDS. Although G-CSF is safe for shortterm administration, Kojima et al. reported that addition of G-CSF to IST had no benefit, in terms of hematologic response, incidence of documented infection, or overall survival in children with AA and a neutrophil count >0.2 x 109L [17]. A recent review reported that although G-CSF treatment minimally increases the risk of leukemia in MDS patients and those with severe AA, a causal relationship between G-CSF treatment and risk of leukemia could not be entirely excluded [18]; therefore, we did not use G-CSF in the present study, which might explain why none of the patients developed clonal disease.

In conclusion, the overall response rate to IST in children with AA in the present study is encouraging. The response rate obtained in the present study was lower than previously reported, which may have been because 2 patients refused a second course of IST. We think that if these 2 patients received a second course of IST, a higher overall response rate would have been obtained. Children with AA should receive IST as first-line treatment if they do not have an HLA-identical sibling donor. Combined IST with ATG, CsA, and low-dose methylprednisolone was an effective treatment option for our pediatric patients without an HLA-identical donor; however, in patients that cannot be given ATG HDMP treatment can be used as an alternative to IST, as it is an inexpensive and safe treatment option.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Shimamura A, Nathan DG: Acquired aplastic anemia and pure red cell aplasia. In: Orkin SH, Nathan DG, eds. Nathan and Oski’s Hematology of Infancy and Childhood. 7th ed.

Phiadelphia: Saunders, 2009: 276-305 2. Bacigalupo A: Treatment strategies for patients with severe aplastic anemia. Bone Marrow Transplant 2008;42 Suppl 1: 42-44

Turk J Hematol 2012; 29: 150-155

3. Saracco P, Quarello P, Iori AP, Zecca M, Longoni D, Svahn J, Varotto S, Del Vecchio GC, Dufour C, Ramenghi U, Bacigalupo A, Locasciulli A: Cyclosporin A response and dependence in children with acquired aplastic anaemia: A multicentre retrospective study with long-term observation follow-up.Br J Haematol 2008; 140 (2): 197-205 4. Bacigalupo A, Bruno B, Saracco P, Di Bona E, Locasciulli A, Locatelli F, Gabbas A, Dufour C, Arcese W, Testi G, Broccia G, Carotenuto M, Coser P, Barbui T, Leoni P, Ferster A: Antilymphocyte globulin, cyclosporine, prednisolone and granulocyte colony-stimulating factor for severe aplastic anemia: An update of the GITMO/EBMT study on 100 patients. Blood 2000; 95 (6): 1931-1934 5. Scheinberg P, Nunez O, Wu C, Young NS: Treatment of severe aplastic anaemia with combined immunosuppression: anti-thymocyte globulin, cyclosporin and mycophenolate mofetil. Br J Haematol 2006; 133 (6): 606-611 6. Tisdale JF, Maciejewski JP, Nuñez O, Rosenfeld SJ, Young NS: Late complication following treatment for severe apalstic anemia with high-dose cyclophosphamide: Follow-up of a randomized trial. Blood 2002; 100: 4668-4670 7. Pongtanakul B, Das PK, Charpentier K, Dror Y: Outcome of children with aplastic anemia treated with immunosuppressive therapy. Pediatr Blood Cancer 2008; 50 (1): 52-57 8. Özsoylu Ş: High-dose intravenous methylprednisolone (HIVMP) for acquired aplastic anemia. Eur J Haematol 1988; 41 (5): 508 9. March JC: Treatment of acquired aplastic anemia.

Haematologica 2007; 92 (1): 2-5 10. Führer M, Rampf U, Baumann I, Faldum A, Niemeyer C, Janka-Schaub G, Friedrich W, Ebell W, Borkhardt A, Bender-Goetze C: Immunosuppressive therapy for aplastic anemia in children: A more severe disease predicts better survival. Blood 2005; 106 (6): 2102-2104

Yıldırmak Y, et al: Treatment in Children with Aplastic Anemia

11. Young NS, Calado RT, Scheinberg P: Current concepts in the pathophysiology and treatment of aplastic anemia.

Blood 2006; 108 (8): 2509-2519 12. Huang IA, Jaing TH, Yang CP, Hung IJ, Tsay PK, Luo CC, Sun CF: Single-Center Experience: Immunosuppressive therapy as frontline treatment for 33 children with acquired severe aplastic anemia. Pediatr Hematol Oncol 2009; 26:487-495 13. Kurre P, Johnson FL, Deeg HJ: Diagnosis and treatment of children with aplastic anemia. Pediatr Blood Cancer 2005; 45: 770-780 14. Rosenfeld S, Follmann D, Nunez O, Young NS: Antithymocyte globulin and cyclosporine for severe aplastic anemia: Association between hematologic response and long term outcome. JAMA 2003; 289: 1130-1135 15. Zheng Y, Liu Y, Chu Y: Immunosuppressive therapy for acquired severe aplastic anemia (SAA): A prospective comparison of four different regimens. Exp Hematol 2006; 34 (7): 826-831 16. Locasciulli A, Bruno B, Rambaldi A, Saracco P, Dufour C, Finelli C, Sica S, Varotto S, Arcese W, Locatelli F, Soligo D, Bacigalupo A: Treatment of severe aplastic anemia with antilymphocyte globulin, cyclosporine and two different granulocyte colony-stimulating factor regimens: A GITMO prospective randomized study. Haematologica 2004; 89 (9): 1054-1061 17. Kojima S, Matsuyama T, Kato S, Kigasawa H, Kobayashi R, Kikuta A, Sakamaki H, Ikuta K, Tsuchida M, Hoshi Y, Morishima Y, Kodera Y: Outcome of 154 patients with severe aplastic anemia who received transplants from unrelated donors: The Japan Marrow Donor Program. Blood 2002; 100 (3): 799-803 18. Beekman R, Touw IP: G-CSF and its receptor in myeloid malignancy. Blood 2010; 115 (25): 5131-5136

155

Research Article

DOI: 10.5505/tjh.2012.20280

Torque Teno Virus and Hepatitis C Virus Co-Infection in Iranian Pediatric Thalassemia Patients İranlı Pediatrik Talasemi Hastalarında Torque Teno Virüsü ve Hepatit C Virüsü Koenfeksiyonu Samin Alavi1, Ali Kord Valeshabad2, Zohreh Sharifi3, Kazem Nourbakhsh1, Mohammad Taghi Arzanian1, Masoumeh Navidinia4, Siamak Mehdizadeh Seraj2 Mofid Children’s Hospital, , Pediatric Hematology-Oncology Department, and Pediatric Infectious Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran 2 Students’ Scientific Research Center (SSRC), Tehran University of Medical Sciences, Tehran, Iran 3 Iranian Blood and Transfusion Organization, Tehran, Iran 4 Pediatric Infectious Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran 1

Abstract Objective: Torque teno virus (TTV) infects patients at risk for parenteral exposure and chronic blood transfusion, such as those with β-thalassemic. This study aimed to assess the prevalence of TTV infection and co-infection of TTV and hepatitis C virus (HCV) in pediatric thalassemia patients receiving chronic blood transfusion.

Material and Methods: The study included 90 pediatric thalassemia patients receiving chronic blood transfusion that presented to the Mofid Children’s Hospital, Tehran, Iran. The control group included 90 healthy volunteer children.

Serum TTV DNA detection via semi-nested PCR and HCV Ab were performed in all the participants. Demographic characteristics and clinical data were collected from each participant for statistical analysis.

Results: In all, 64.4% of the patients had TTV infection, versus 24.4% of the controls (P < 0.01). The thalassemia patients had a greater probability of having TTV and HCV infections than the controls, with a common OR of 5.60 (95% CI: 2.94-10.69) and 2.15 (95% CI: 1.83-2.50), respectively. In total, 17.2% (10/58) of the patients that were TTV positive were also HCV positive, whereas 6.3% (2/32) of the TTV-negative patients were anti-HCV antibody (Ab) positive (P = 0.14).

Conclusion: The prevalence of TTV and HCV infection was higher in the Iranian thalassemia patients on chronic transfusion therapy than in the controls. The high prevalence of TTV in pediatric thalassemia patients on chromic transfusion therapy may indicate the superiority of the parenteral route compared to other routs of TTV transmission.

Key Words: Thalassemia, Torque teno virus, Hepatitis C virus

Özet Amaç: Torque teno virüsü (TTV) beta talasemik hastalar gibi kronik kan transfüzyonu ve parenteral yoldan maruz kalma açısından risk altındaki hastaları enfekte eder. Bu çalışma kronik kan transfüzyonu alan pediatrik talasemi hastalarında TTV enfeksiyonu ve TTV ile hepatit C virüsü (HCV) koenfeksiyonunun prevalansını değerlendirmeyi hedeflemiştir.

Address for Correspondence: Ali Kord Valeshabad, M.D., Medical Dormitory of Tums, North Kargar Avenue 143995 Tehran, Iran Phone: +98 21 84743732 E-mail: ali_kord2006@yahoo.com Received/Geliş tarihi : May 26, 2011 Accepted/Kabul tarihi : September 27, 2011

156

Turk J Hematol 2012; 29: 156-161

Alavi S, et al: TTV-HCV Co-Infection in Thalassemia Patients

Gereç ve Yöntemler: Çalışmaya İran’da Tahran’da Mofid Çocuk Hastanesine gelen ve kronik kan transfüzyonu alan 90 pediatrik talasemi hastası dahil edilmiştir. Kontrol grubu 90 sağlıklı gönüllü çocuğu içermiştir. Tüm katılımcılarda semi-nested PCR ve HCV Ab yoluyla serum TTV DNA’sı saptaması yapılmıştır. Her katılımcıdan istatistiksel analiz için demografik özellikler ve klinik veriler toplanmıştır.

Bulgular: Genel olarak hastaların %64,4’ünde ve kontrol grubunun %24,4’ünde TTV enfeksiyonu bulunmuştur (P < 0,01). Talasemi hastalarında kontrol grubuna göre TTV ve HCV enfeksiyonu bulunması olasılığı olması daha yüksek olmuştur ve ortak risk oranı sırasıyla 5,60 (%95 GA: 2,94-10,69) ve 2,15 (%95 GA: 1,83-2,50) bulunmuştur. Toplam olarak TTV pozitif hastaların %17,2’si (10/58) HCV pozitifken TTV negatif hastaların %6,3’ü (2/32) anti HCV antikoru (Ab) pozitiftir (P = 0,14).

Sonuç: TTV ve HCV enfeksiyonu prevalansı kronik transfüzyon tedavisi alan İranlı talasemi hastalarında kontrollerden daha yüksek bulunmuştur. Kronik transfüzyon tedavisi alan pediatrik talasemi hastalarında yüksek TTV prevalansı parenteral yolun diğer TTV bulaşması yollarına göre daha sık kullanılmasına işaret edebilir.

Anahtar Sözcükler: Talasemi, Torque teno virüsü, Hepatit C virüsü Introduction Patients with β-thalassemia major are prone to transfusion-related hepatitis because of chronic dependency on blood transfusion, and associated transfusion-related iron overload and transmission of viruses. Although the implementation of screening for hepatitis B and C virus (HBV and HCV) nuclear acid and antibodies has substantially reduced the incidence of transfusion-related hepatitis, a considrable proportion of thalassemia patients still have elevated liver enzymes of unknown origin [1,2]. In 1997 a novel DNA virus—transfusion-transmitted virus (TTV)— was cloned by a Japanese team from 3 patients with posttransfusion non-A-G hepatitis [3]. This non-enveloped single-stranded DNA virus was renamed Torque teno virus, a species of the genus Anelloviridae in an unassigned family that is most closely related to Circoviridae [4,5]. TTV infects patients at risk for parenteral exposure, such as those with thalassemia, hemophilia, and liver disease [6-9], but it can be found in other body fluids and secretions, including saliva, semen, stool, breast milk, and tears [10]. Recently, its routes of vertical and sexual transmission have been reported [11].

Primary epidemiological studies from the United Kingdom and Japan reported that TTV DNA was detectable in 25%-45% of patients with chronic or fulminant hepatitis of unknown origin, in 27%-68% of hemophiliacs, and in 1.9%-12% of healthy blood donors [6,7,12]. The prevalence of TTV among thalassemia patients was reported to vary from 50% to 100% in different studies and appears to be dependent upon diagnostic techniques, study sample size, and geographic distribution [13]. Even its prevalence among the general population has been reported to range from 1% in the North America to as high as 54% in Turkey

[14,15]. Despite the high prevalence of this virus among thalassemia patients, its potential role in cryptogenic or post-transfusion hepatitis is unclear, as most TTV-positive patients remain asymptomatic and those that progress to chronic liver disease are invariably co-infected with other hepatitis viruses [8]. There are a limited number of studies in Iran about the prevalence of TTV and its clinical importance in thalassemia patients. It remains unknown if TTV infection in thalassemia patients increases the incidence of co-infection with other hepatitis viruses such as hepatitis C As such, the present study aimed to determine the prevalence of TTV infection and co-infection of TTV and HCV in pediatric thalassemia patients on chronic transfusion therapy in Iran.

Materials and Methods This case-control study included all pediatric thalassemia patients on chronic transfusion therapy treated at the Mofid Children’s Hospital, Tehran, Iran, and a control group of healthy volunteer children. The patients included had presented to the orthopedic outpatient clinic due to minor injuries and without a history of prior transfusion, hepatitis, surgery, parenteral treatment, or systemic diseases. All the patients were systematically examined by pediatrics residents. Informed consent was obtained from the patients or their parents if aged <18 years. Primary screening tests, including human immunodeficiency virus (HIV), human T-cell leukemia, and hepatitis B and C were performed in all the study participants and those with any positive result were excluded. TTV DNA and anti-HCV antibody (anti-HCV Ab) testing were performed in all the participants to determine their prevalence rates.

Anti-HCV status was determined using 2nd- and 3rdgeneration assays (Ortho Diagnostic Systems, Raritan,

157

Alavi S, et al: TTV-HCV Co-Infection in Thalassemia Patients

NJ). Hepatitis B surface antigen (HBsAg) status was determined via enzyme immunoassay (EIA) (Murex, Dartford, UK; and Abbott Laboratories, Chicago, IL). HCV RNA was measured via reverse transcriptase polymerase chain reaction (RT-PCR), as previously described [16]. Demographic characteristics and clinical data, including age, gender, transfusion duration, and anti-HCV Ab and TTV DNA test results were collected from each participant for statistical analysis. The study protocol was approved by the Shahid Beheshti University of Medical Sciences Ethics Committee.

Isolation and determination of TTV DNA via PCR Semi-nested PCR was used to detect serum TTV DNA. Specifically, serum DNA purified from an equivalent of 7 μL of serum was amplified according to the following PCR protocol in a 9600 thermal cycler (Perkin-Elmer, Emeryville, CA): 1 cycle at 95 °C for 9 min; 35 cycles at 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 45 s; 1 cycle at 72 °C for 7 min. The reaction conditions were as follows: 30 pmol of each primer (sense NG059 5’-ACA GAC AGA GGA GAA GGC AAC ATG-3’, antisense NG063 5’-CTG GCA TTT TAC CAT TTC CAA AGT-3’) and 2.5 U of AmpliTaq Gold DNA polymerase (Perkin-Elmer, Norwalk, CT) in a 50-μL reaction volume. Under the same conditions the second round of PCR was performed using a semi-nested primer set (sense NG061 5’ GGC AAC ATG TTA TGGATA GAC TGG 3’, antisense NG063) for 5 μL of the amplification product. In each PCR assay 2 positive and negative controls were included. Then, the PCR products were analyzed via 2% agarose gel electrophoresis with ethidium bromide staining. Separate assays were performed for all positive samples of TTV DNA and the sequences of the PCR products were confirmed via automated sequencing on an ABI 373 sequencer (Perkin-Elmer, Foster City, CA).

NG hemi-nested PCR, using primers NG059, NG061, and NG063 [6], has been used in many studies, but has been shown to have suboptimal sensitivity [17-19].

Statistical analysis Results are reported as mean ± standard deviation (SD) for quantitative variables and percentages for categorical variables. The 2 groups were compared using Student’s t-test for continuous variables and the chi-square test (or Fisher’s exact test if required) for categorical variables. Statistical significance was based on two sided tests evaluated at the P = 0.05 level of significance. All statistical analyses were performed using SPSS v.13.0 (SPSS Inc, Chicago, IL, USA) for Windows.

158

Turk J Hematol 2012; 29: 156-161

Results In total, 121 pediatric thalassemia patients and 134 healthy controls were evaluated, and 31 of the thalassemia patients and 44 of the controls were excluded based on the study’s exclusion criteria. TTV and HCV prevalence rates were determined in 90 thalassemia patients (46 boys and 44 girls) with the mean age of 14.1 ± 5.8 years and 90 healthy controls (44 boys and 46 girls) with the mean age of 13.3 ± 6.4 years. The patient and control groups did not significantly differ in mean age (P = 0.61) or gender (P = 0.48). In all, 64.4% of the patients were TTV seropositive, versus 24.4% of the controls (P < 0.001). The thalassemia patients had a greater probability of TTV and HCV seropositivity than the controls, with a common OR of 5.60 (95% CI: 2.94-10.69, P = 0.001) and 2.15 (95% CI: 1.832.50, P = 0.001), respectively.

In the patient group a significant difference was not observed in mean age, transfusion duration, or TTV and HCV seropositivity between the boys and girls (P > 0.05).

In the control group mean age was statistically higher in the girls than in the boys (14.3 ± 6.8 years versus 11.4 ± 4.7 years (P = 0.04), whereas TTV and HCV seropositivity did not differ between genders (P > 0.05). Table 1 shows the demographic and some clinical data for the 2 groups.

In all, 58 of the patients (31 boys and 27 girls) were TTV positive and 32 (15 boys and 17 girls) were TTV negative. Age, gender, and transfusion duration did not differ significantly between the TTV-positive and TTV-negative thalassemia patients (P > 0.05). In all, 17.2% (10/58) of the TTV-positive patients had simultaneous HCV seropositivity, whereas 6.3% (2/32) of the TTV-negative patients were positive for anti-HCV Ab; the difference was not statistically significant (P = 0.14) (Table 2). Among the TTV-positive thalassemia patients, there was not a significant difference in mean age, transfusion duration, or anti-HCV Ab status between the boys and girls (P > 0.05).

Similarly, among the TTV-negative thalassemia patients, mean age, transfusion duration, and anti-HCV Ab status did not differ significantly between the boys and girls (P > 0.05) (Table 2). Table 2 shows the demographic and some clinical data for the TTV-positive and TTV-negative thalassemia patients.

Discussion The potential role and pathogenesis of TTV infection in post-transfusion hepatitis has yet to be established [20,21].

Although TTV was initially considered a new transfusiontransmitted virus in patients with acute and chronic nonA-G hepatitis, subsequent studies raised doubts about the

Turk J Hematol 2012; 29: 156-161

Alavi S, et al: TTV-HCV Co-Infection in Thalassemia Patients

Table 1: Demographic and clinical data for the 90 pediatric thalassemia patients and 90 healthy controls.

Patients Variables Age (years)

Controls

Boys (n = 46)

Girls (n = 44)

P

14.2 ± 5.5

14.0 ± 6.2

0.87

Total (n = 90)

Boys (n = 30)

Girls (n = 60)

14.1 ± 5.8 11.4 ± 4.7 14.3 ± 6.8

Transfusion duration 18.3 ± 15.9 22.6 ± 21.2 0.28 20.3 ± 18.8 (months) TTV positive 31 (67.4) 27 (61.4) 0.55 58 (64.4) (%) HCV positive 8 (17.4) 4 (9.1) 0.25 12 (13.3) (%)

P P

Total (n = 90)

0.04

13.3 ± 6.4

0.61

-

-

-

6 (20.0)

15 (25.0)

0.60

21(24.4)

0.001

0 (0.0)

0 (0.0)

-

0 (0.0)

0.001

Table 2: Demographic and clinical data for the TTV-positive and TTV-negative thalassemia patients.

TTV (+)

TTV (–)

P

Variables

Age (years) Transfusion duration (months) Anti-HCV Ab (%)

Boys (n = 31)

Girls (n = 27)

14.6 ± 5.9

14.9 ± 6.3

P

Total (n = 58)

0.85 14.7 ± 6.02

Boys (n = 15) 13.5 ± 4.7

Girls (n = 17)

P

12.6 ± 6.0 0.64

Total (n = 32) 13.0 ± 5.3

0.18

15.8 ± 13.5 25.1 ± 18.9 0.12 20.39 ± 13.7 23.6 ± 20.9 17.3 ± 15.1 0.33 20.26 ± 18.7 0.97 8 (25.8)

2 (7.4)

0.06

10 (17.2)

0 (0.0)

2 (11.8)

0.17

2 (6.3)

0.14

hypothesis that TTV infection leads to clinical manifestation in all infected patients [15]. In the present study pediatric thalassemia patients had a greater probability of TTV and HCV seropositivity than the controls, with a common OR of 5.60 (95% CI: 2.94-10.69, P = 0.001) and 2.15 (95% CI: 1.83-2.50, P = 0.001), respectively.

As previously reported [22,23], this finding may indicate the superiority of the parenteral route compared to other routes of TTV transmission. In all, 64.4% of the present study’s pediatric thalassemia patients had TTV, whereas only 24.4% of controls, which did not have a history of blood transfusion, hepatitis, parenteral treatment, or any known diseases, were TTV positive. The infected controls might have been infected via non-parenteral routes, such as saliva, semen, stool, breast milk, or tears [10].

ies by study due to differences in diagnostic techniques, study sample size, and geographic distribution [13]; even sequencing of TTV clones from thalassemia patients showed that 1 patient had multiple TTV variants [13].

Ozyürek et al. reported that 63% of Turkish thalassemia patients had the virus [15]; additionally, 73% and 69% of Italian pediatric and adult thalassemia patients, respectively, had the virus [25,26], and 73.4% of thalassemia patients in Taiwan had the virus [23]. Such variation in the prevalence of TTV infection has been noted in the general population of different countries. Epidemiological studies reported that the prevalence of TTV infection is 1% in North America [20], 10% in Europe [27], 10%-62% in South America [10], 22% in Italy, 34% in Japan [14], and 54% in Turkey [15].

Zandieh et al. reported that 57.2% of Iranian thalassemia patients and 20% of healthy controls were TTV positive [24]. The reported prevalence of TTV infection var-

Age, gender, and transfusion duration did not differ significantly between the present study’s TTV-positive and TTV-negative thalassemia patients (P > 0.05). In contrast,

159

Alavi S, et al: TTV-HCV Co-Infection in Thalassemia Patients

previous evaluation of TTV infection in 250 thalassemia patients in Ahwaz (a province in southern Iran) showed that there was a significant correlation between TTV infection, and age and history of blood transfusion [24]. The present study included pediatric thalassemia patients in Tehran and that other study included patients from southern Iran (Ahwaz); however, in addition to the difference in geographic location of the 2 study populations, they were ethnically different. It has been reported that the distribution of TTV infection varies with geographic region and country, which might account for the differences between the 2 studies’ findings [10,14,15,20,23,27].

The present study has some limitations. The presented data and results were based on TTV DNA amplification via PCR using only 1 set of primer. It is possible that other variants of TTV DNA existed in our samples that were not detectable using this set. Samples found to be positive via NG hemi-nested PCR may subsequently undergo restriction fragment length polymorphism analysis for genotype identification, but this was not applied in the present study. The clinical impacts of this virus on liver function enzymes and histopathologic changes were not assessed in all the patients and were not used in the analyses. Thus, we plan to design studies in the future to assess the clinical importance and features of TTV in thalassemia patients.

Conclusion The prevalence of TTV and HCV was higher in the pediatric thalassemia patients on chronic transfusion therapy than in the healthy controls. The high prevalence of TTV in this group of patients may indicate the superiority of the parenteral route compared to other routes of TTV transmission.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Okamoto H, Mayumi M: TT virus: virological and genomic characteristics and disease association. J Gastrenterol 2001; 36: 519-529 2. Chen BP, Rumi MG, Colombo M, Lin YH, Ramaswamy L, Luna J, Liu JK, Prati D, Mannucci PM: TT virus is present in a high frequency of Italian hemophilic patients transfused with plasma derived clotting factor concentrates. Blood 1999; 94: 4333-4336

160

Turk J Hematol 2012; 29: 156-161

3. Nishizawa T, Okamoto H, Konishi K, Yoshizawa H, Miyakawa Y, Mayumi M: A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology. Biochem Biophys Res Commun 1997; 241: 92-97 4. Hino S: TTV, a new human virus with single stranded circular DNA genome. Rev Med Virol 2002; 12: 151-158 5. Takahashi K, Ohta Y, Mishiro S: Partial ~ 2.4-kb sequence of TT virus (TTV) genome from eight japans isolates: Diagnostic and phylogenetic implications. Hepatol Res 1998; 12: 111-120 6. Okamoto H, Nishizawa T, Kato N, Ukita M, Ikeda H, Iizuka H, Miyakawa Y, Mayumi M: Molecular cloning and characterization of a novel DNA virus (TTV) associated with posttransfusion hepatitis of unknown origin. Hepatol Res 1998; 10: 1-16 7. Simmonds P, Davidson F, Lycett C, Prescott LE, MacDonald DM, Ellender J, Yap PL, Ludlam CA, Haydon GH, Gillon J, Jarvis LM: Detection of a novel DNAvirus (TTV) in blood donors and blood products. Lancet 1998; 352: 191 8. Poovorawan Y, Tangkijvanich P, Theamboonlers A, Hirsch P: Transfusion transmissible virus TTV and its putative role in the etiology of liver disease. Hepatogastroenterology 2001; 48 (37): 256-260 9. Cossart Y: TTV-A virus searching for a disease. J Clin Virol 2000; 17: 1-3 10. Matsubara H, Michitaka K, Horiike N, Yano M, Akbar SM, Torisu M, Onji M: Existence of TT virus DNA in extracellular body fluids from normal healthy Japanese subjects. Intervirology 2000; 43 (1): 16-19 11. Schröter M, Polywka S, Zöllner B, Schäfer P, Laufs R, Feucht HH: Detection of TT virus DNA and GB virus type C/Hepatitis G virus RNA in serum and breast milk: Determination of mother-to-child transmission. J Clin Microbiol 2000; 38 (2): 745-747 12. Naoumov NV, Petrova EP, Thomas MG, Williams R: Presence of a newly described human DNA virus (TTV) in patients with liver disease. Lancet 1998; 352: 195-197 13. Kondili LA, Pisani G, Beneduce F, Morace G, Gentili G, Ballati G, Rapicetta M: Prevalence of TT virus in healthy children and thalassemic pediatric and young adult patients.

J Pediatr Gastroenterol Nutr 2001; 33 (5): 629-632 14. Masia G, Ingianni A, Demelia L, Faa G, Manconi PE, Pilleri G, Ciancio A, Rizzetto M, Coppola RC: TT virus infection in Italy prevalence and genolypes in healty, subjects, viral diseases and asymptomatic infection by parenterally transmitted viruses. J Viral Hepatitis 2001; 8: 384-390

Turk J Hematol 2012; 29: 156-161

15. Ozyürek E, Ergünay K, Kuskonmaz B, Unal S, Cetin M, Ustaçelebi S, Gürgey A, Gümrük F: Transfusion-transmitted virus prevalence in Turkish patients with thalassemia.

Pediatr Hematol Oncol 2006; 23 (4): 347-353 16. Chen HL, Chang MH, Ni YH, Hsu HY, Kao JH, Chen PJ: Hepatitis G virus infection in normal and prospectively followed posttransfusion children. Pediatr Res 1997; 42: 784-787 17. Kato T, Mizokami M, Orito E, Nakano T, Tanaka Y, Ueda R, Hirashima N, Iijima Y, Kato T, Sugauchi F, Mukaide M, Shimamatsu K, Kage M, Kojiro M.: High prevalence of TT virus infection in Japanese patients with liver diseases and inblood donors. J Hepatal 1999; 31: 221-227 18. Takahashi K, Hoshino H, Ohta Y, Yoshida N, Mishiro S: Very high prevalence of TT virus (TTV) infection in general population of Japan revealed by a new set of PCR primers.

Hepato Res 1998; 12: 233-239 19. Toyoda H, Naruse M, Yokozaki S, Morita K, Nakano I, Itakura A, Okamura M, Fukuda Y, Hayakawa T: Prevalence of infection with TT virus (TTV), a novel DNA virus, in healthy Japanese subjects, newborn infants, cord blood and breast milk. J Infect 1999; 38: 198-199 20. Blejer JL, Salamone HJ: Is TT virus (TTV) a true hepatitis virus cause? Medicina (B Aires) 2000; 60: 631-638 21. Dhenain M, Boulétreau A, Bourguignon F, Poujol I, Chemin I, Fabry J, Vanhems P: The TT virus: Review of the literature.

Clin Invest Med 2000; 23 (6): 355-365

Alavi S, et al: TTV-HCV Co-Infection in Thalassemia Patients

22. Hu YW, Al-Moslih MI, Al Ali MT, Uzicanin S, Perkins H, Yi QL, Rahimi Khameneh S, Wu J, Brown EG: Clinical outcome of frequent exposure to Torque Teno virus (TTV) through blood transfusion in thalassemia patients with or without hepatitis C virus (HCV) infection. J Med Virol 2008; 80 (2): 365-371 23. Hsu HY, Ni YH, Chen HL, Kao JH, Chang MH: TT virus infection in healthy children, children after blood transfusion and children with non-A to E hepatitis or other liver diseases in Taiwan. J Med Virol 2003; 69 (1): 66-71 24. Zandieh T, Babaahmadi B, Pourfathollah A, Galedari H, Emam J, Jalalifar MA: Transfusion Transmitted virus (TTV) infection in Thalassemic patients. Iranian J Publ Health 2005; 34: 24-28 25. Sampietro M, Tavazzi D, Martinez F, et al: TT virus infection in adult B-thalassemia major patients. Hematologia 2001; 86 (1): 39-43 26. Toyoda H, Fukuda Y, Nakano I, Katano Y, Yokozaki S, Hayashi K, Ito Y, Suzuki K, Nakano H, Saito H, Takamatsu J: TT virus genotype changes frequently in multiply transfused patients with hemophilia but rarely in patients with chronic hepatitis C and in healthy subjects. Transfusion 2001; 41: 1130-1135 27. Takács M, Balog K, Tóth G, Balogh Z, Szomor KN, Brojnás J, Rusvai E, Minárovits J, Berencsi G: TT virus in Hungary: Sequence heterogeneity and mixed infections. Immunol Med Microbiol 2003; 35: 153 -157

161

Research Article

DOI: 10.5505/tjh.2012.03780

The Association Between Gene Polymorphisms and Leukocytosis with Thrombotic Complications in Patients with Essential Thrombocythemia and Polycythemia Vera Esansiyel Trombositemi ve Polisitemia Verada Gen Polimofizimleri ve Lökositozun Trombotik Komplikasyonlar ile İlişkisi Özgür Mehtap1, Elif Birtaş Ateşoğlu1, Pınar Tarkun1, Emel Gönüllü1, Hakan Keski1, Yıldıray Topçu2, Nilüfer Üzülmez3, Deniz Sünnetçi3, Abdullah Hacıhanefioğlu1 Kocaeli University, School of Medicine, Department of Hematology, Kocaeli, Turkey Kocaeli University, School of Medicine, Department of Internal Medicine, Kocaeli, Turkey 3 Kocaeli University, School of Medicine, Department of Medical Genetic, Kocaeli, Turkey 1 2

Abstract Objective: Vascular events are a common complication in patients with polycythemia vera (PV) and essential thrombocythemia (ET). This study aimed to analyze the association between PAI-1 4G/5G and ACE I/D gene polymorphisms, and leukocytosis with thrombosis in patients with PV and ET.

Material and Methods: In total, 64 patients with ET and PV were evaluated. Arterial or venous thrombosis, such as cerebral transient ischemic attack, ischemic stroke, myocardial infarction, peripheral arterial thrombosis, deep venous thrombosis, and pulmonary embolism, were defined as a vascular event. DNA samples were screened for mutations via reverse hybridization strip assay.

Results: In terms of PAI-1 gene polymorphism, the frequency of the 4G and 5G allele was 48.5% and 51.5%, respectively. The ACE allele frequency was 51.2% and 48.8% for D and I, respectively. There wasn’t an association between occurrence of vascular events and the frequency of any allele. In terms of occurrence of vascular events, there weren’t any significance differences between the patients that were carrying the ACE D/D homozygous allele to ACE I/D and those that carried the I/I allele (P = 0.93). There wasn’t a significant difference in occurrence of vascular events between the PAI-1 5G/5G homozygote allele carriers, and the 4G/5G and 4G/4G allele carriers (P = 0.97). Vascular events were significantly more common in the patients with leukocytosis (leukocyte count >10 × 109 L–1) than in those without leukocytosis (leukocyte count ≤10 × 109 L–1) (P = 0.00). Age >60 years was also a significant risk factor for occurrence of vascular events(P = 0.008).

Conclusion: PAI-1 and ACE gene polymorphisms were not considered new risk factors for thrombosis in PV and ET patients. On the other hand, leukocytosis at diagnosis was associated with the occurrence of vascular events in the patients with ET and PV. Key Words: PAI-1 4G/5G, ACE I/D, Polycythemia vera, Essential thrombocythemia, Thrombosis, Leukocytosis Address for Correspondence: Özgür Mehtap, M.D., Kocaeli Üniversitesi, Tıp Fakültesi Hastanesi, Hematoloji Servisi Kat 5 Umuttepe Kocaeli, Turkey Phone: +90 262 303 89 14 E-mail: ozgurmehtap@gmail.com Received/Geliş tarihi : February 16, 2011 Accepted/Kabul tarihi : August 10, 2011

162

Turk J Hematol 2012; 29: 162-169

Mehtap Ö, et al: Thrombotic Risks in ET and PV

Özet Amaç: Polisitemia vera (PV) ve esansiyel trombositemi (ET)’de vasküler olaylar sık görülen komplikasyonlardır. Bu çalışmada, PV, ET hastalarında PAI-1 4G/5G, ACE I/D gen polimorfizmi ile lökositoz ve bunların vasküler olaylarla ilişkisini araştırmayı amaçladık.

Gereç ve Yöntemler: PV ve ET’li 64 hasta çalışmaya alındı. Serebral geçici iskemik atak, iskemik inme, miyokard infarktüsü, periferik arteryel tromboz, derin ven trombozu ve pulmoner emboli gibi arteryel veya venöz trombozlar vasküler olay olarak tanımlanmıştır. DNA örnekleri mutasyonlar yönünden ters hibridizasyon strip testi ile araştırıldı.

Bulgular: PAI-1 gen polimorfizmine bakıldığında 4G ve 5G allel sıklığı sırası ile %48,5 ve %52,5 tespit edildi. ACE geninin D ve I sıklıkları sırası ile %51,2 ve %48,8 bulundu. Vasküler olaylar ile allel sıklıkları arasında anlamlı ilişki saptamadık. Vasküler olaylar değerlendirildiğinde, ACE D/D homozigot allel taşıyan hastalar ile ACE I/D ve I/I allel taşıyanlar arasında anlamlı fark tespit edemedik (P = 0,93). PAI-1 5G/5G homozigot allel taşıyıcıları ile 4G/5G ve 4G/4G allel taşıyıcıları karşılaştırıldığında vasküler olay görülmesi açısından anlamlı farklılık tespit edilmedi (P = 0,97).

Vasküler olayın, lökositozu (>10x109/L) olan hastalarda, lökositozu olmayanlara göre belirgin olarak daha sık görüldüğü saptandı (P = 0,00). Ayrıca tanı anındaki lökositoz varlığının vasküler olay riskini belirgin olarak arttırdığı tespit edildi (OR, 15,625[95% CI, 4,322 -56,492]). Yaşın altmıştan fazla olması vasküler olay için diğer risk faktörü olarak saptandı (P = 0,008)

Sonuç: PAI-1 ve ACE gen polimorfizmi, PV ve ET hastalarında tromboz için ek bir risk faktörü olarak kabul edilemez.

Ancak, tanı sırasında lökositoz vasküler olaylar için risk faktörüdür.

Anahtar Sözcükler: PAI-1 4G/5G, ACE I/D, Polisitemia vera, Esansiyel trombositemi, Tromboz, Lökositoz Introduction Thrombotic events, both in the arterial and venous systems, are a common complication in patients with polycythemia vera (PV) and essential thrombocythemia (ET).

About 30%-50% of patients with PV and ET suffer from these complications, and vascular mortality accounts for 35%-45% of all deaths [1-3]. Studies report that age is among the most important risk factors for thrombosis [3].

While some researchers suggest that a previous thrombotic complication is another independent and predictive factor for recurrent thrombosis, others emphasize the association between JAK2V617F mutation and thrombotic complications [4,5]. Landolfi and Carobbio reported that leukocytosis was a risk factor for thrombosis in patients with PV and ET [6,7].

The formation of thrombus depends on the balance between fibrinolytic and procoagulant systems. During fibrinolysis plasminogen is converted to plasmin, which in turn dissolves fibrin clots. This conversion is regulated by tissue plasminogen activator and plasminogen activator inhibitor-1 (PAI-1)—a serine protease inhibitor [8]. The PAI-1 gene has polymorphisms in the promoter region, in which 1 allele has a 4-guanosine sequence [4G) and the other has a 5-guanosine sequence (5G) [9]. The PAI-1 4G and 5G alleles both have a binding site for an activator of transcription; however, the 5G allele has an additional

binding site for a repressor, which leads to lower transcription rates and less PAI-1 activity than 4G allele[10].

As such, the 4G allele leads to moderately higher plasma PAI-1 levels than 5G allele and may promote pathological fibrin deposition and thrombotic events [11-12].

Rigat et al. (1990) reported a polymorphism involving the presence (insertion, I) or absence (deletion, D) of a 287-bp sequence of DNA in intron 16 of the angiotensin I-converting enzyme (ACE) gene. According to this polymorphism, 3 genotypes (I/I, I/D, and D/D) were determined. The D/D genotype has been associated with the highest plasma ACE activity, the I/D genotype with moderate ACE activity, and the I/I genotype with the low ACE activity [13]. It has been reported that individuals with the D allele—especially the DD genotype—are prone to hypertension [14-16], acute myocardial infarction (AMI) [17], and ischemic stroke [18,19].

To date, no study on PAI-1 4G/5G and ACE I/D gene polymorphism in rela­tion to the risk of thrombosis in patients with PV and ET has been published. As such, using our patient database the present study aimed to analyze the association between these polymorphisms, and age and leukocytosis with thrombosis in patents with PV and ET.

163

Mehtap Ö, et al: Thrombotic Risks in ET and PV

Materials and Methods Patients This retrospective cohort study included patients with ET and PV that were diagnosed according to WHO-2008 criteria [20]. All analyses were performed using data for 64 patients with ET and PV that were followed-up at Kocaeli University, School of Medicine, Department of Hematology, between 2005 and 2010. We collected data regarding laboratory values, and clinical features at diagnosis, and every 3 months during follow-up. Arterial or venous thrombosis, such as cerebral transient ischemic attack (TIA), ischemic stroke, AMI, peripheral arterial thrombosis (PAT), deep venous thrombosis (DVT), and pulmonary embolism (PE), were defined as a vascular event. The events of interest were thromboses that occurred as the initial manifestation of disease or during follow-up. Initial thromboses were events that occurred up to 2 years prior to diagnosis, based on the fact that 75% of thromboses indicative of PV occur during this time period [1].

Cerebral computed tomography (CT) or magnetic resonance imaging (MRI) was used to diagnose ischemic stroke and neurologic symptoms. In addition to these procedures, electrocardiography and/or increased cardiac enzymes, angiography, ultrasonography of the arms or legs, and pulmonary ventilation-perfusion scan and/ or CT were used to diagnosis TIA, AMI, PAT, DVT, and PE, respectively. Microcirculatory events, such as vascular headaches, dizziness, distal paresthesia, etc., were not considered vascular events and were not analyzed. The study was conducted in accordance with good clinical and laboratory practices, and the principles of the Declaration of Helsinki. The University of Kocaeli Ethics Committee approved the study protocol.

Genotyping DNA extraction Genomic DNA was extracted from 3 µL of peripheral blood with EDTA using the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche. Diagnostics GmbH, Germany) and was stored at 4 °C until analyzed. Quantification of the DNA concentration was performed using a NanoDrop ND-1000 spectrophotometer. The ratio of spectrophotometric measurements at 260 nm and 280 nm provided an estimate of the purity of the DNA sample.

Multiplex PCR-CVD StripAssay Isolated DNA samples were screened for mutations associated with cardiovascular disease using reverse

164

Turk J Hematol 2012; 29: 162-169

hybridization strip assay (Vienna Lab, CVD StripAssay, GMBH, Austria). This assay covers PAI-1, 4G/5G, and ACE I/D mutations. For each reaction 5 µL of DNA was added to 20 µL of PCR reaction mix containing 15 µL of amplification mix and 5 µL of diluted Taq DNA polymerase (1U).

PCR was performed in 0.2-mL tubes under the following cycling conditions: initial denaturation at 94 °C for 2 min, 35 cycles at 94 °C for 15 s, 58 °C for 30 s, 72 °C for 30 s, and a final extension step at 72 °C for 3 min. To confirm amplification, each PCR product was electrophoresed on 3% agarose gel. Finally, the amplification products were selectively hybridized to a test strip that contained allelespecific (wild type and mutant) oligonucleotide probes immobilized as an array of parallel lines.

Bound biotinylated sequences were detected using streptavidin-alkaline phosphatase and color substrates.

Hybridization was performed in an automated incubator (profiBlot T48, TECAN, Männedorf, Switzerland). For each polymorphic position, 1 of 3 possible staining patterns may be obtained: normal genotype (wild type probe only), heterozygous genotype (wild type and mutant probe), and homozygous mutant genotype (mutant probe only).

Mutation detection using real-time PCR JAK2 gene mutations were detected using a LightCycler 1.5 (Roche Diagnostics, Mannheim, Germany) and JAK2V617F LightMix Kit (TIB MOLBIOL, GmbH, Berlin, Germany), and capillary tubes. According to the manufacturer’s protocol, 20 uL of reaction containing 5 uL of genomic DNA and 15 uL of reaction mix (PCR-grade water, 25 mM Mg+2 solution, primer, probe, and enzyme mix) was prepared. Each study was carried out with negative control (5 uL of PCR-grade water) and positive controls that were available in commercial kits. Data obtained were analyzed using LightCycler v.3.5 software. Mutations were evaluated according to the status of the normal allele or the mutant, in consideration of the specific melting points (Tm).

Statistical analysis All analyses were performed using SPSS v.15.0 for Windows XP (SPSS, Chicago, IL, USA). Pearson’s chisquare and Fisher’s exact test were used to compare categorical variables. The Mann-Whitney U test was used to measure the statistical significance of the leukocyte count at diagnosis and its association with occurrence of vascular events. The relationship between vascular events and an above normal leukocyte count was evaluated using Pearson’s chi-square test. The frequency of alleles and their

Turk J Hematol 2012; 29: 162-169

Mehtap Ö, et al: Thrombotic Risks in ET and PV

significance were determined using the Mann-Whitney U test.

Table 2: Patient characteristics, according to PV and ET.

PV

P values <0.05 were considered statistically significant.

Results In total, 64 patients were evaluated. Patient characteristics are summarized in Tables 1 and Table 2. JAK2 mutation positivity did not differ significantly between the patients with and without vascular events (P = 0.374 [Pearson’s chi-square analysis]). In terms of PAI-1 gene polymorphism, the frequency of the 4G and 5G allele was 48.5% and 51.5%, respectively. The ACE allele frequency was 51.2% and 48.8%, respectively, for D and I. There wasn’t an association between occurrence of vascuTable 1: Patient characteristics.

Diagnosis: PV/ET Gender: Male/Female Mean Age in Years (range) Female Male JAK2 –/+ (%) Vascular event (%) Arterial (%) AMI (n) TIA (n) PAT (n) Ischemic stroke (n) Venous (%) DVT (n) PE (n) ACE polymorphism I/D (%) I/I (%) D/D (%) PAI-1 polymorphism 5G/5G (%) 4G/5G (%) 4G/4G (%) Leukocyte count >10 x 109 L–1 (%) ≤10 x 109 L–1 (%)

31/33 36/28 56.52 (34-80) 57.46 (34-80) 55.78 (36-76) 19/45(29.7/70.3) 29/64 (45.3) 25/64 (39.1) 12/25 3/25 3/25 7/25 4/64 (6.10) 3/4 ¼ 43/64 (67.2) 10/64 (15.6) 11/64 (17.2) 10/64 (15.6) 46/64 (71.9) 8/64 (12.5) 35/64 (54.7) 29/64 (45.3)

TIA: Cerebral transient ischemic attack; AMI: acute myocardial infarction; PAT: peripheral arterial thrombosis; DVT: deep venous thrombosis; PE: pulmonary embolism.

ACE

PAI

Vascular event Leukocyte count

ET

ins/del

n (%) 23 (35.9) 20 (31.3)

ins/ins

n (%)

5 (7.8)

5 (7.8)

del/del

n (%)

3 (4.7)

8 (12.5)

5G/5G

n (%)

6 (9.4)

4 (6.3)

4G/5G

n (%) 21 (32.8) 25 (39.1)

4G/4G

n (%)

4 (6.3)

4 (6.3)

Negative

n (%) 16 (25.0) 19 (29.7)

Positive

n (%) 15 (23.4) 14 (21.9)

≤10 x 109 L–1 n (%) 10 (15.6) 19 (29.7) >10 x 109 L–1 n (%) 21 (32.8) 14 (21.9)

lar events and any allele frequency. There wasn’t a significant difference in occurrence of vascular events between the patients that were carrying the ACE D/D homozygous allele to ACE I/D heterozygoues, and I/I homozygote allele carriers (P = 0.93) (OR = 4.67 [95% CI: 0.921-23.710]).

Analysis of PAI-1 gene polymorphisms according to vascular events showed that PAI-1 5G/5G homozygote allele carriers did not differ significantly from 4G/5G heterozygote and 4G/4G homozygote allele carriers (P = 0.97) (OR = 4.00 [95% CI: 0.777-20.595]).

The mean leukocyte count at diagnosis in patients with and without vascular events was 13.4 x 109 L–1 ± 3.9 x 109 L–1 and 9.8 x 109 L–1 ± 3.8x x 109 L–1, respectively.

Significantly more vascular events were observed in the patients with leukocytosis (leukocyte count >10 x 109 L–1) (P = 0.00) than in those without leukocytosis (leukocyte count ≤10 x 109 L–1) and the presence of leukocytosis at diagnosis was a significant risk factor for vascular events (OR = 15.625 [95% CI: 4.322-56.492]). In addition to leukocytosis, age >60 years was a significant risk factor for vascular events (P = 0.008) (OR = 4.154 [95% CI: 1.41612.184]) (Table 3).

Discussion Thrombosis in patients with PV and ET occurs in arterial, venous, or microcirculatory systems. In the present

165

Mehtap Ö, et al: Thrombotic Risks in ET and PV

Turk J Hematol 2012; 29: 162-169

Table 3: Vascular events in patients

4G/4G and 4G/5G 5G/5G I/I and I/D D/D Leukocyte ≤10 x 109 L–1 Leukocyte >10 x 109 L–1 Age <60 years Age ≥60 years

Vascular-event positive, n (%) 27 (50.0%) 2 (20.0%) 27 (50.9%) 2 (18.2%) 4 (13.8%) 29 (71.4%) 13 (20.3%) 16 (25.0%)

Vascular-event negative, n (%) 27 (50.0%) 8 (80.0%) 26 (49.1%) 9 (81.8%) 25 (86.2%) 10 (28.6%) 27 (42.2%) 8 (12.5%)

P

OR

95% CI

0.97*

4.000

0.777-20.595

0.93*

4.673

0.921-23.717

0.000**

15.621

4.322-56.492

0.008**

4.154

1.416-12.184

*Fisher’s exact test. **Pearson’s chi-square test.

study the majority of vascular complications were arterial, which is in accordance with previous reports [21]. Age above sixty years was reported to be a major risk factor for vascular complications in patients with ET and PV [3].

In accordance with the literature, patients in the present study aged >60 years had a significantly higher vascular event.

Hereditary thrombophilic states in patients with PV and ET, including factor V Leiden, prothrombin G20210A, and methylenetetrahydrofolate reductase (MTHFR) mutations, have been studied extensively [22,23); however, other polymorphisms, including PAI-1 4G/5G and ACE I/D gene mutations, haven’t been investigated in patients with PV and ET. It has been suggested that elevated plasma PAI-1 levels associated with the PAI-1 4G allele lead to a hypofibrinolytic state, which could be considered a risk factor for arterial and venous thromboses [11,12]. Data regarding the relationship between PAI-1 polymorphism and the risk for both arterial and venous thrombosis are inconsistent. Some researchers think that the PAI-1 4G allele confers an increase in the risk for stroke and myocardial infarction [24-26]. In contrast, other researchers think that the PAI-1 4G/4G genotype does not confer a risk and may even protect against cerebrovascular events [27-30].

Data regarding the association between the presence of the 4G allele and the risk for venous thrombotic episodes are also controversial. A recent meta-analysis reported an unexpected weak association between the 4G allele and the risk of venous thromboembolism, based on analysis of patients with venous thrombosis that were not included in certain risk groups with other genetic or acquired thrombophilic defects [31]. Nonetheless, this polymorphism was reported to increase the risk for venous thrombotic

166

episodes in patients with other congenital or acquired prothrombotic disorders [32-35]. Although PAI-1 levels weren’t measured in the present study, Cancelas et al. reported that the PAI-1 plasma concentration was significantly higher in patients with ET and PV than in the control group [36]. In the present study there wasn’t a correlation between PAI-1 gene polymorphism (neither 4G/4G and 5G/5G homozygosity nor 4G and 5G allele frequencies) and occurrence of vascular events in patients with PV and ET. The correlation between ACE polymorphism and vascular events, especially arterial events, has been studied.

Dilley et al. (1998) reported that patients with ACE D/D polymorphism had moderately higher risk for venous thrombosis risk than those with other genotypes (OR = 1.5 [95% CI: 0.9-2.6]). In addition, females with the ACE D/D genotype did not a have an increased risk (OR = 0.9 [95% CI: 0.5-1.9}), whereas males with the genotype had a nearly 3-fold higher risk (OR = 2.8 [95% CI: 1.26.2]) [37]. Cambien et al. reported that there was a positive association between the ACE D allele and myocardial infarction [17]. Their study included 610 patients and 733 controls, and they observed that the ACE DD genotype occurred significantly more frequently in the male patients with myocardial infarction than in the controls [17]. Their results, however, were not replicated in a large study by Agerholm-Larsen et al. that investigated the association between the ACE polymorphism and ischemic heart disease in a case-referent format (n = 10,150) and in a retrospective cohort format (n = 7263); no significant differences in the incidence of myocardial infarction or any other manifestation of ischemic heart disease between the genotype classes were noted [38].

Turk J Hematol 2012; 29: 162-169

Sayed-Tabatabaei et al. suggested that the D allele is not clinically important in the general population, but may play an important role in certain groups of patients with coronary heart disease [39]. While 2 meta-analyses reported a significant positive correlation between the D allele and ischemic stroke, [18,19], the finding was not confirmed by Zee et al. in a subsequent prospective matched case-control study [40]. The present study investigated the relationship between the ACE polymorphism and the occurrence of vascular events, and a statistically significant difference in genotype and allele frequency for ACE polymorphisms was not observed between the patients with and without vascular events.

In recent years new data concerning the pathogenesis of thrombosis in Philadelphia-chromosome negative myeloproliferative disorders have become available, including the role of leukocyte activation, and leukocyte interaction with platelets and endothelial cells. In myeloproliferative disorders neutrophils circulate in an activated state and are able to bind to platelets in a dynamic adhesive process [41-44]. This process leads to expression of tissue factors that contribute to endothelial activation and damage [45]. Published data indicate that leukocytosis a novel, powerful risk factor for thrombosis in both PV and ET [6,7]. In the present study the white blood cell count (WBC) at diagnosis was evaluated as well as its association with thrombosis. We observed that WBC levels above normal (>10 x 109 L–1) at diagnosis were associated with vascular events in the patients with ET and PV. Landolfi et al. studied patients with PV and reported that the risk of thrombosis was clearly higher in patients with a WBC >10 x 109 L–1 and significantly higher in patients with a WBC >15 x 109 L–1. In addition, they reported that leukocytosis was more strongly associated with arterial thrombosis than with venous thromboembolism [6]. Carobbio et al. examined the association between leukocytosis and thrombosis in patients with ET and reported the following: 1. Multi-variable analysis demonstrated that patients with a baseline WBC above the median had a risk of developing thrombosis approximately 2-fold greater than that in patients with a WBC below the median; 2. Cytoreductive therapy lowered the WBC during follow-up, which was associated with a reduction in its thrombogenic effect; 3. The role of the WBC in predicting thrombosis was more evident in untreated low-risk patients than in treated highrisk patients [7]. As previously mentioned, patients in the present study with vascular events had significantly higher leukocyte counts than those without a occurrence of vascular events.

Mehtap Ö, et al: Thrombotic Risks in ET and PV

The research-proven risk factors for thrombosis in patients with ET and PV are age >60 years and a history of thrombosis. The presence of either risk factor places patients in the high-risk category, indicating the need for myelosuppressive therapy [46]. In the present study we expected to find that ACE and PAI-1 gene polymorphisms would be identified as new risk factors for thrombosis; however, the findings did not support our expectations, which may have been due to the small number of patients included. On the other hand, the present findings do support the notion that an elevated WBC at diagnosis could be associated with an increased risk of vascular events in patients with ET and PV. Physicians should be aware of the potential for vascular events in patients with ET and PV that have leukocytosis. As additional data from similar studies accrue over time, patients with leukocytosis could eventually be defined as a high-risk group. In the future patients with leukocytosis might be routinely considered for cytoreductive therapy, especially those aged >60 years and those with a history of thrombosis.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Gruppo Italiano Studio Policitemia: Polycythemia vera: The natural history of 1213 patients followed for 20 years. Ann Intern Med 1995; 123: 656-664 2. Marchioli R, Finazzi G, Landolfi R, Kutti J, Gisslinger H, Patrono C, Marilus R, Villegas A, Tognoni G, Barbui T: Vascular and neoplastic risk in a large cohort of patients with polycythemia vera. J Clin Oncol 2005; 23: 2224-2232 3. Besses C, Cervantes F, Pereira A, Florensa L, Sole F, Hernandez-Boluda JC, Woessner S, Sans-Sabrafen J, Rozman C, Montserrat E: Major vascular complications in essential thrombocythemia: A study of the predictive factors in a series of 148 patients. Leukemia 1999; 13: 150-154 4. Finazzi G, Rambaldi A, Guerini V, Carobbo A, Barbui T: Risk of thrombosis in patients with essential thrombocythemia and polycythemia vera according to JAK2 V617F mutation status. Haematologica 2007; 92: 135-136 5. Vannucchi AM, Antonioli E, Guglielmelli P, Longo G, Pancrazzi A, Ponziani V, Bogani C, Ferrini PR, Rambaldi A,Guerini V, Bosi A, Barbui T: Prospective identification of high-risk polycythemia vera patients based on JAK2 V617F allele burden. Leukemia 2007; 21: 1952-1959

167

Mehtap Ö, et al: Thrombotic Risks in ET and PV

6. Landolfi R, Di Gennaro L, Barbui T, De Stefano V, Finazzi G, Marfisi R, Tognono G, Marchioli R: Leukocytosis as a major thrombotic risk factor in patients with polycythemia vera. Blood 2007; 109: 2446-2452 7. Carobbio A, Finazzi G, Guerini V, Spinelli O, Delaini F, Marchioli R, Borrelli G, Rambaldi A, Barbui T: Leukocytosis is a risk factor for thrombosis in essential thrombocythemia: interaction with treatment, standard risk factors, and JAK2 mutation status. Blood 2007; 109: 2310-2313 8. Stiko A, Hervio L, Loskutoff DJ: Plasminogen activator inhibitors. In: Colleman RW, Hirsh J, Marder VJ, Clowes AW, George JN, eds. Hemostasis and Thrombosis: Basic Principles and Clinical Practice. 4th ed. Philadelphia: Pa: Lippincott Williams and Wilkins, 2001: 975-1002 9. Dawson S, Wiman B, Hamsten A, Green F, Humphries S, Henney AM: The two allele sequences of a common polymorphism in promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem 1993; 268: 10739-10745 10. Burzotta F, Di Castelnuovo A, Amore C, D’ Orazio A, Di Bitondo R, Donati MB, Lacoviello L: 4G/5G promoter PAI-1 gene polymorphism is associated with plasmatic PAI-1 activity in Italians: A model of gene-environment interaction. Thromb Haemost 1998; 79: 354-358 11. Festa A, D’Agostino R, Rich SS, Jenny NS, Tracy RP, Haffner SM: Promoter (4G/5G) plasminogen activator inhibitor-1 genotype and plasminogen activator inhibitor-1 levels in blacks, Hispanics and non-Hispanics whites: The Insulin Resistance Atherosclerosis Study. Circulation 2003; 107: 2422-2427 12. Lane DA, Grant PJ: Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease. Blood 2000; 95: 1517-1532 13. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F: An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 1990; 86: 1343-1346 14. Agachan B, Isbir T, Yilmaz H, Akoglu E: Angiotensin converting enzyme I/D, angiotensinogen T174M-M235T and angiotensin II type 1 receptor A1166C gene polymorphisms in Turkish hypertensive patients. Exp Mol Med 2003; 35: 545-549 15. Kario K, Hoshide S, Umeda Y, Sato Y, Ikeda U, Nishiuma S, Matsuo M, Shimada K: Angiotensinogen and angiotensinconverting enzyme genotypes and day and night blood pressures in elderly Japanese hypertensives. Hypertens Res 1999; 22: 95-103 16. Giner V, Poch E, Bragulat E, Oriola J, Gonzalez D, Coca A, De La Sierra A: Renin-angiotensin system genetic polymorphisms and salt sensitivity in essential hypertension.

Hypertension 2000; 35: 512-517

168

Turk J Hematol 2012; 29: 162-169

17. Cambien F, Poirier O, Lecerf L, Evans A, Cambou JP, Arveiler D, Luc G, Bard JM, Bara L, Ricard S, Tiret L, Amouyel P, Alhenc-Gelas F, Soubrier F: Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature 1992; 359: 641-644 18. Sharma P: Meta-analysis of the ACE gene in ischaemic stroke. J Neurol Neurosurg Psychiatry 1998; 64: 227-230 19. Maeda Y, Ikeda U, Ebata H, Hojo Y, Seino Y, Hayashi Y, Kuroki S, Shimada K: Angiotensin-converting enzyme gene polymorphism in hypertensive individuals with parental history of stroke. Stroke 1996; 27: 1521-1523 20. Swerdlow SH, Camp E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J, Vardiman JW: eds WHO classification of tumours of haematopoietic and lymphoid tissues. Lyon: International Agency for Research on Cancer 2008: 40-50 21. Landolfi R, Rocca B, Patrono C: Bleeding and thrombosis in myeloproliferative disorders: Mechanisms and treatment.

Critical Reviews in Oncology-Hematology 1995; 20: 203222 22. Afshar-Kharghan V, Lopez JA, Gray LA, Padilla A, Borthakur G, Roberts SC, Pruthi RK, Tefferi A: Hemostatic gene polymorphisms and the prevalence of thrombotic complications in polycythemia vera and essential thrombocythemia. Blood Coagul Fibrinolysis 2004; 15: 21-24 23. Dicato MA, Schroell B, Berchem GJ: V Leiden mutations, prothromin and methylene-tetrahydrofolate reductase are not risk factors for thromboembolic disease in essential thrombocythemia. Blood 1999; 94: 111 24. Boekholdt SM, Bijsterveld NR, Moons AHM, Levi M, Buller HR, Peters RJG: Genetic variation in coagulation and fibrinolytic proteins and their relation with acute myocardial infarction. Circulation 2001; 104: 3063-3068 25. Bang CO, Park HK, Ahn MY, Shin HK, Hwang KY, Hong SY: 4G/5G polymorphism of the plasminogen activator inhibitor-1 gene and insertion/deletion polymorphism of the tissue-type plasminogen activator gene in atherothrombotic stroke. Cerebrovasc Dis 2001; 11: 294-299 26. Wiklund PG, Nilsson L, Nilsson Ardnor S, Eriksson P, Johansson L, Stegmayr B, Hamsten A, Holmberg D, Asplund K: Plasminogen activator inhibitor-1 4G/5G polymorphism and risk of stroke. Replicated findings in two nested casecontrol studies based on independent cohorts. Stroke 2005; 36: 1661-1665 27. Roest M, Van Der Schouw YT, Banga JD, Tempelman MJ, De Groot PG, Sixma JJ, Grobbee DE: Plasminogen activator inhibitor 4G polymorphism is associated with decreased risk of cerebrovascular mortality in older women. Circulation 2000; 101: 67-70

Turk J Hematol 2012; 29: 162-169

28. Endler G, Lalouschek W, Exner M, Mitterbauer G, Haring D, Mannhalter C: The 4G/4G genotype at nucleotide position-675 in the promoter region of the plasminogen activator inhibitor 1 (PAI-1) gene is less frequent in young patients with minor stroke than in controls. Br J Haematol 2000; 110: 469-471 29. Hindorff LA, Schwartz SM, Siscovick DA, Psaty BM, Longstreth Jr WT, Reiner AP: The association of PAI-1 promoter 4G/5G insertion/deletion polymorphism with myocardial infarction and stroke in young women. J Cardiovasc Risk 2002; 9: 131-137 30. Hoekstra T, Geleijnse JM, Kluft C, Giltay EJ, Kok FJ, Schouten EG: 4G/4G genotype of PAI-1 gene is associated with reduced risk of stroke in elderly. Stroke 2003; 34: 2822-2829 31. Tsantes AE, Nikolopoulos GK, Bagos PG, Rapti E, Mantzios G, Kapsimali V, Travlou A: Association between the plasminogen activator inhibitor-1 4G/5G polymorphism and venous thrombosis: A meta-analysis. Thromb Haemost 2007; 97: 907-913 32. Segui R, Estelles A, Mira Y, Espana F, Villa P, Falco C, Vaya A, Grancha S, Ferrando F, Aznar J: PAI-1 promoter 4G/5G genotype as an additional risk factor for venous thrombosis in subjects with genetic thrombophilic defects.

Br J Haematol 2000; 111: 122-128 33. Akar N, Yilmaz E, Akar E, Avcu F, Yalcin A, Cin Sl: Effect of plasminogen activator inhibitor-1 4G/5G polymorphism in Turkish deep vein thrombotic patients within and without FV1691 G-A. Thromb Res 2000; 97: 227-230 34. Sartori MT, Danesin C, Saggiorato G, Tormene D, Simioni P,Spiezia L, Patrassi GM, Girolami A: The PAI-1 gene 4G/5G polymorphism and deep vein thrombosis in patients with inherited thrombophilia. Clin Appl Thromb/Hemost 2003; 9: 299-307 35. Tassies D, Espinosa G, Munoz-Rodriguez FJ, Freire C, Cervera R, Monteagudo J, Maragall S, Escolar G, Ingelmo M, Ordinas A, Font J, Reverter JC: The 4G/5G polymorphism of the type 1 plasminogen activator inhibitor gene and thrombosis in patients with antiphospholipid syndrome.

Arthritis Rheum 2000; 43: 2349-2358 36. Cancelas JA, García-Avello A, García-Frade LJ: High plasma levels of plasminogen activator inhibitor 1 (PAI-1) in polycythemia vera and essential thrombocythemia are associated with thrombosis. Thromb Res 1994; 75: 513-520

Mehtap Ö, et al: Thrombotic Risks in ET and PV

37. Dilley A, Austin H, Hooper WC, Lally C, Ribeiro MJ, Wenger NK, Silva V, Rawlins P, Evatt B: Relation of three genetic traits to venous thrombosis in an African-American population. Am J Epidemiol 1998; 147: 30-35 38. Agerholm-Larsen B, Nordestgaard BG, Steffensen R, Sørensen TI, Jensen G, Tybjaerg-Hansen A: ACE gene polymorphism: ischemic heart disease and longevity in 10,150 individuals.

A case-referent and retrospective cohort study based on the Copenhagen City Heart Study. Circulation 1997; 95: 23582367 39. Sayed-Tabatabaei FA, Oostra BA, Isaacs A, van Duijn CM, Witteman JC: ACE polymorphisms. Circ Res 2006; 98: 1123-1133 40. Zee RY, Ridker PM, Stampfer MJ, Hennekens CH, Lindpaintner K: Prospective evaluation of the angiotensinconverting enzyme insertion/deletion polymorphism and the risk of stroke. Circulation 1999; 99: 340-343 41. Falanga A, Marchetti M, Evangelista V, Vignoli A, Licini M, Balicco M, Manarini S, Finazzi G, Ceretti C, Barbui T: Polymorphonuclear leukocyte activation and hemostasis in patients with essential thrombocythemia and polycythemia vera. Blood 2000; 96: 4261-4266 42. Jensen MK, de Nully Brown P, Lund BV, Nielsen OJ, Hasselbalch HC: Increased circulating platelet-leukocytes aggregates in myeloproliferative disorders is correlated to previous thrombosis, platelet activation and platelet count.

Eur J Haematol 2001; 66: 143-151 43. Falanga A, Marchetti M, Vignoli A, Balducci D, Barbui T: Leukocyte-platelet interaction in patients with essential thrombocythemia and polycythemia vera. Exp Hematol 2005; 33: 523-530 44. Arellano-Rodrigo E, Alvarez-Larran A, Reverter JC, Villamor N, Colomer D, Cervantes F: Increased platelet and leukocyte activation as contributing mechanisms for thrombosis in essential thrombocythemia and correlation with the JAK2 mutational status. Haematologica 2006; 91: 169-175 45. Falanga A, Marchetti M, Barbui T, Smith CW: Pathogenesis of thrombosis in essential thrombocythemia and polycythemia vera: the role of neutrophils. Semin Hematol 2005; 42: 239247 46. Finazzi G, Barbui T: Risk-adapted therapy in essential thrombocythemia and polycythemia vera. Blood Rev 2005; 19: 243-252

169

Case Report

DOI: 10.5505/tjh.2012.37233

Successful Treatment with Propranolol in a Patient with a Segmental Hemangioma: A Case Report Segmental Hemanjiyomun Propranolol ile Başarılı Tedavisi: Bir Olgu Sunumu Serhan Küpeli1, Derya Çimen2, Begül Yağcı Küpeli3 Diyarbakır Children’s Diseases Hospital, Department of Pediatric Oncology, Diyarbakır, Turkey Diyarbakır Children’s Diseases Hospital, Department of Pediatric Cardiology, Diyarbakır, Turkey 3 Dicle University, School of Medicine, Department of Pediatric Oncology, Diyarbakır, Turkey 1 2

Abstract The treatment of hemangiomas in infancy may be associated with significant morbidity. In addition to morbidity, an objective response cannot be obtained because of the absence of targeted therapeutic options. Herein, we present an infant with a segmental hemangioma and marked glucocorticoid toxicity due to prior steroid therapy that was successfully treated with propranolol. Propranolol was tolerated well and no side effects were observed during the treatment. The only problem to occur was disease recurrence following the withdrawal of propranolol at age 13 months, which was not within the age of spontaneous regression (generally considered as >18 months).

Key Words: Hemangioma, Segmental hemangioma, Subglottic hemangioma, Propranolol

Özet Süt çocukluğu döneminde hemanjiyomların tedavisinde önemli yan etkilerle karşılaşılabilmektedir. Hedefe yönelik tedavi seçeneklerinin olmayışı nedeniyle de karşılaşılan morbiditenin yanısıra objektif cevap elde edilmesinde de güçlük çekilmektedir. Bu yazıda segmental hemanjiyomu olan ve steroid tedavisine ikincil ağır glukokortikoid toksisitesi gelişmiş bir süt çocuğunda propranolol tedavisi ile elde edilen başarılı sonuçlar sunulmuştur. Tedavi süresince propranolol iyi tolere edilmiş ve herhangi bir yan etki görülmemiştir. Hasta 13 aylık iken propranolol tedavisinin kesilmesiyle hemanjiyomda tekrarlama görülmüş ve propranolol tekrar başlanmak zorunda kalınmıştır. Hemanjiyomlarda spontan regresyon yaşının 18 aylıktan sonra olduğu düşünülmektedir.

Anahtar Sözcükler: Hemanjiyom, Segmental hemanjiyom, Subglottik hemanjiyom, Propranolol

Introduction Hemangioma is the most common tumor in infants.

Although the first-line treatment for superficial and lifethreatening hemangiomas is systemic corticosteroids, side effects limit their long-term use. Recent case reports on the Address for Correspondence: Serhan Küpeli, M.D., M.Sc. Diyarbakır Children’s Diseases Hospital Diyarbakır, Turkey Phone: +90 535 763 45 49 E-mail: serkupeli@yahoo.com Received/Geliş tarihi : September 7, 2010 Accepted/Kabul tarihi : March 5, 2011

170

successful treatment of hemangiomas with the β-blocking agent propranolol have been published [1-8]. Herein, we describe an infant with a segmental hemangioma that was successfully treated with propranolol, which was initially administered to treat tachycardia.

Turk J Hematol 2012; 29: 170-173

Küpeli S, et al: Propranolol Treatment in Segmental Hemangioma

Case Report A 5-month-old female presented with purulent discharge on the neck, red swelling on the face, and occasional attacks of dyspnea that began at age 1 month. The patient’s medical history included multiple hemangiomas on her face at birth and stridor due to a subglottic hemangioma observed via laryngoscopic examination at age 2 months. At age 3 months, she was started on methylprednisolone (MPZ) 30 mg·kg–1·d–1 by doctors at another hospital due to airway obstruction. The treatment plan at another hospital was to taper MPZ, but as the dyspnea and swelling on the face and neck recurred at the end of 2 weeks, the steroid treatment could not terminated. We have an approval from institutional ethical committee. We have a written informed consent signed by parents of the patient at the beginning of the propranonol treatment.

Physical examination showed hemangiomas on the neck, bilateral preauricular area, mandible, anterior region of the tongue, and left periorbital region (Figure 1). Cushingoid apperence and purulent discharge were observed on the ulcerated hemangioma in the cervical region. Heart rate was 180 bpm. Electrocardiogram (ECG) showed sinus tachycardia, and 1° mitral insufficiency was observed with echocardiography (ECHO). Abdominal ultrasonography, chest X-ray, and cranial MRI—performed to exclude associated multiple anomalies including PHACES syndrome— were normal. Oral propranolol 2 mg·kg–1·d–1 was started for the treatment of the hemangiomas, considering that the patient’s sinus tachycardia would benefit as well. Topical antibacterial was used for the infection on the patient’s neck and MPZ was reduced to 5 mg·kg–1·d–1.

Fifteen days after the initiation of oral propranolol treatment the family reported that the infant had no difficulty breathing and on examination we determined no purulent discharge and partial regression in hemangiomas (Figure 2). MPZ was further reduced to 3 mg·kg–1·d–1, and then tapered to half of the previous dose 1 week apart and stopped over 1 month. The propranolol dose was adjusted monthly according to the patient’s body weight.

Propranolol was withdrawn at age 13 months, as the hemangiomas on the patient’s face, neck, and tongue completely regressed, and there was no evidence of respiratory distress. The patient was brought again to hospital 15 d after the withdrawal of propranolol with dyspnea and stridor and hyperemia on previous lesions. Propranolol was started at the dose of 2 mg·kg–1·d–1 and given until age 20 months. At the time this report was written the patient was aged 22 months and symptom-free.

Figure 1: Hemangiomas and cushingoid appearance (pre-treatment).

Figure 2: Hemangiomas on the face following propranolol treatment.

Discussion Hemangiomas in infants present with a diverse spectrum of clinical features—from non-symptomatic superficial lesions to life-threatening giant masses. Symptomatic airway and visceral hemangiomas can be observed in infants with extensive facial hemangiomas. They are the most common vascular tumor of childhood, with an incidence rate of 1.1%-2.6% among full-term neonates [2].

The lesions are often invisible or very small at birth, and exhibit rapid growth during the first 3-6 months of life, followed by regression especially after the first year. Extensive cervicofacial hemangiomas can be part of PHACES syndrome, which is characterized by posterior fossa malformations, hemangiomas, arterial anomalies, coarctation of the aorta and other cardiac defects, eye abnormalities, and sternal defects.

171

Küpeli S, et al: Propranolol Treatment in Segmental Hemangioma

Systemic corticosteroids have been the mainstay of treatment for hemangiomas since 1960’s. Oral or intravenous MPZ, and prednisone are effective for shrinking hemangiomatous lesions in infants; however, the use of systemic corticosteroids is limited due to the potential for numerous side effects, including growth delay, cushingoid appearance, behavioral changes, irritability, gastrointestinal disturbance, hypertension, adrenal suppression, and compromised immunity [1]. Cushingoid appearance and delayed healing of the cervical ulcerated lesion in the present case were attributed to prolonged use of systemic MPZ. Intralesional corticosteroid injections, especially in patients with focal periocular hemangiomas, can be considered an alternative to systemic corticosteroid treatment [2]. Other treatment options include laser, surgical excision, and embolization [6]. We did not treat the presented patient with laser, interferon (IF), or chemotherapy because of the cost and side effects.

Interferon a-2a and α-2b have become therapeutic options due to their anti-angiogenic and antineoplastic effects, especially in steroid-resistant cases. Ezekowitz et al. [9] reported that 90% of their cases with life-threatening hemangiomas exhibited marked regression after receiving IF a-2a subcutaneously; however, neurologic disturbances, such as spastic diplegia and motor development impairment, limit the widespread use of IF [9]. Furthermore, fever, malaise, neutropenia, anemia, increase in liver transaminases, anorexia, weight loss, confusion, and insomnia have been reported to occur following IF administration [9]. Another limitation of IF is its high cost, as compared to other therapeutic options, especially in countries with limited financial resources. Antineoplastic agents such as vincristine and cyclophosphamide were reported to be effective in treating life-threatening hemangiomas that are corticosteroid-resistant, especially lesions associated with Kasabach-Merritt phenomenon [10-11].

The non-selective β blocker propranolol was recently reported to be effective in treating children with cutaneous or laryngotracheal hemangiomas [3-8]. Propranolol is primarily used to treat hypertension, and in pediatric cardiology it is used to treat tachycardia and arrhythmias [2].

Vasoconstriction, decreased expression of vascular endothelial growth factor and β-fibroblast growth factor genes, and triggering apoptosis in capillary endothelial cells are among propranolol’s proposed mechanisms of action in regressing hemangiomas [12,13]. Additionally, β2 receptor expression in the endothelial cells of hemangiomatous lesions was reported [13]. Due to the side effects of propranolol, including bradycardia, hypotension, broncho-

172

Turk J Hematol 2012; 29: 170-173

constriction, hyperkalemia, and reduced physiological response to hypoglycemia, it should be used cautiously in infants, and routine cardiologic assessment with ECG, ECHO, and monitorization of serum electrolytes and blood glucose levels is recommended before and during the use of propranolol [14,15]. On the other hand, the optimal duration of propranolol treatment remains problematic due to the risk of recurrence when it is withdrawn before the age of spontaneous regression (generally accepted as ≤18 months) [16]. In the presented case, propranolol was withdrawn when the patient was age 13 months and subsequently recurrence developed.

In the presented patient, we observed acute regression of hemangiomatous lesions and improvement in ulceration following the addition of propranolol to the treatment regimen. The drug was tolerated well and no side effects were observed during the treatment. In some cases, propranolol results in rapid and effective shrinkage of lesions, particularly in the subglottic region [6]. Michel and Patural [17] reported that they successfully treated an ulcerated cutaneous hemangioma with propranolol. In conclusion, propranolol may be considered a treatment option in neonatal patients with ulcerated hemangiomas, particularly in problematic regions such as the head and neck, and in those with subglottic hemangiomas.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Léauté-Labrèze C, Dumas de la Roque E, Hubiche T, Boralevi F, Thambo JB, Taïeb A: Propranolol for severe hemangiomas of infancy. N Engl J Med 2008; 358: 26492651 2. Nguyen J, Fay A: Pharmacologic therapy for periocular infantile hemangiomas: A review of the literature. Seminars in Opthalmology 2009; 24: 178-184 3. Jephson CG, Manunza F, Syed S, Mills NA, Harper J, Hartley BE: Successful treatment of isolated subglottic haemangioma with propranolol alone. Int J Pediatr Otorhinolaryngol 2009; 73: 1821-1823 4. Mousa W, Kues K, Haas E, Lauerer P, Pavlakovic H, Schön MP, Zutt M: Successful treatment of a large hemangioma with propranolol. J Dtsch Dermatol Ges 2009; 8: 184-186

Turk J Hematol 2012; 29: 170-173

5. Lawley LP, Siegfried E, Todd JL: Propranolol treatment for hemangioma of infancy: Risks and recommendations.

Pediatr Dermatol 2009; 26: 610-614 6. Denoyelle F, Leboulanger N, Enjolras O, Harris R, Roger G, Garabedian EN: Role of Propranolol in the therapeutic strategy of infantile laryngotracheal hemangioma. Int J Pediatr Otorhinolaryngol 2009; 73: 1168-1172 7. Pérez RS, Mora PC, Rodríguez JD, Sánchez FR, de Torres Jde L: Treatment of infantile hemangioma with propranolol.

Anales de Pediatria (Barc) 2010; 72: 152-154 8. Theletsane T, Redfern A, Raynham O, Harris T, Prose NS, Khumalo NP: Life-threatening infantile haemangioma: A dramatic response to propranolol. J Eur Acad Dermatol Venereol 2009; 23: 1445-1469 9. Ezekowitz RAB, Mulliken JB, Folkman J: Interferon alfa-2a therapy for life-threatening hemangiomas of infancy. N Engl J Med 1992; 326: 1456-1463 10. Perez Payarols J, Pardo Masferrer J, Gomez Bellvert C: Treatment of life-threatening infantile hemangiomas with vincristine. N Engl J Med 1995; 333: 69 11. Hurvitz SA, Hurvitz CH, Sloninsky L, Sanford MC: Successful treatment with cyclophosphamide of lifethreatening diffuse hemangiomatosis involving the liver. J Pediatr Hematol Oncol 2000; 22: 527-532

Küpeli S, et al: Propranolol Treatment in Segmental Hemangioma

12. D’Angelo G, Lee H, Weiner RI: cAMP-dependent protein kinase inhibits the mitogenic action of vascular endothelial growth factor and fibroblast growth factor in capillary endothelial cells by blocking Raf activation. J Cell Biochem 1997; 67: 353-366 13. Sommers Smith SK, Smith DM: Beta blockade induces apoptosis in cultured capillary endothelial cells. In Vitro Cell Dev Biol Anim 2002; 38: 298-304 14. Siegfried EC, Keenan WJ, Al-Jureidini S: More on propranolol for hemangiomas of infancy. N Engl J Med 2008; 359: 2846 15. Pavlakovic H, Kietz S, Lauerer P, Zutt M, Lakomek M: Hyperkalemia complicating propranolol treatment of an infantile hemangioma. Pediatrics 2010; 126: 1589-1593 16. Leboulanger N, Fayoux P, Teissier N, Cox A, Van Den Abbeele T, Carrabin L, Couloigner V, Nicollas R, Triglia JM, Ayari S, Froehlich P, Lescanne E, Marianowski R, Mom T, Mondain M, Marie JP, Roger G, Garabédian EN, Denoyelle F: Propranolol in the therapeutic strategy of infantile laryngotracheal hemangioma: A preliminary retrospective study of French experience. Int J Pediatr Otorhinolaryngol 2010; 74: 1254-1257 17. Michel JL, Patural H: Response to oral propranolol therapy for ulcerated hemangiomas in infancy. Arch Pediatr 2009; 16: 1565-1568

173

Case Report

DOI: 10.5505/tjh.2012.25932

Is Swine-origin Influenza a Predisposing Factor for Deep Vein Thrombosis?

Domuz Gribi Derin Ven Trombozu için Predispozan bir Faktör müdür?

Müge Gökçe1, Şule Ünal1, Selin Aytaç1, Ateş Kara2, Mehmet Ceyhan2, Murat Tuncer1, Fatma Gümrük1 1 2

Hacettepe University, School of Medicine, Department of Pediatric Hematology, Ankara, Turkey Hacettepe University, School of Medicine, Department of Pediatric Infectious Disease, Ankara, Turkey

Abstract Herein we report a sixteen-year-old female that developed deep vein thrombosis (DVT) while undergoing treatment for H1N1 pneumonia. To the best of our knowledge this is the first report of H1N1/09 infection complicated by DVT in an adolescent patient with no detected risk factors other than immobilization. Healthcare providers should be aware of the possibility of thrombosis in patients with swine-origin influenza, especially in those with additional risk factors.

Key Words: Children, Deep venous thrombosis, Swine-origin (pandemic) influenza

Özet Burada H1N1 enfeksiyonu için tedavi alırken, derin ven trombozu geliştiren bir olguyu sunmaktayız. Mevcut bilgilerimize gore; H1N1 enfeksiyonu sırasında - immobilizasyon dışında başka hiçbir risk faktörü olmayan - bir adölesanda tromboz gelişimi ilk defa bildirilmektedir. Domuz gribi pandemilerinde özellikle eşlik eden risk faktörleri olanlarda tromboz gelişebileceği akılda tutulmalıdır.

Anahtar Sözcükler: Çocukluk çağı, Derin ven trombozu, Domuz gribi, H1N1 pandemi Introduction Venous thromboembolism (VTE) is a multifactorial entity that arises due to variable interactions between genetic and environmental components, with an incidence among children of 0.07-0.14/10,000 [1]. The incidence of VTE in hospitalized children has been reported to be as high as 58 cases per 10,000 hospital admissions [2].

The majority of children with VTE have comorbid medical conditions. Infection, dehydration, trauma, cancer, central venous catheterization, and chemotherapy are the most common predisposing factors for the development of thrombosis in children [3]. We reported earlier that thrombosis was associated with infection in 68% of hospitalized children with thrombosis [4].

Since April 2009, H1N1 infection has been a major concern, as it has spread rapidly worldwide. Herein, we report a sixteen-year-old female that developed thrombosis in the deep femoral vein while undergoing treatment for H1N1 pneumonia.

Case A sixteen-year-old female was admitted to the hospital due to fever (41 °C), difficulty breathing, and perioral cyanosis. She had been prescribed oseltamivir phosphate (Tamiflu) for pandemic influenza A. She has cerebral palsy due to periventricular leukomalacia as a complication of premature birth, and had undergone surgery for developmental dysplasia of the left hip without thrombotic com-

Address for Correspondence: Müge Gökçe, M.D., Hacettepe Üniversitesi, Hacettepe Tıp Fakültesi, Çocuk Hematoloji Bilim Dalı, Ankara, Turkey Phone: +90 312 305 11 70 E-mail: muge.gokce@hacettepe.edu.tr Received/Geliş tarihi : July 23, 2010 Accepted/Kabul tarihi : November 22, 2010

174

Turk J Hematol 2012; 29: 174-176

plication at age 3 years. Written informed consent was obtained from the patient.

Physical examination showed tachypnea, dyspnea, and perioral cyanosis. Oxygen saturation was 57% based on pulse oximetry. Bilateral inspiratory crackles were present on auscultation. Because of her neurological condition, the arms were fully flexed, whereas her legs were extended, with no apparent difference in diameters. Deep tendon reflexes were hyperactive, the plantar response was extensor, and the remainder of the physical examination was unremarkable.

Arterial blood gas analysis indicated respiratory acidosis based on the following results: pH: 7.08; pCO2: 59.8 mmHg; pO2: 61.9 mmHg. Complete blood count was as follows: hemoglobin: 10 g dL–1; hematocrit: 31.2%; WBC count: 8.3 x 109 L–1; thrombocyte count: 318 x 109 L–1.

Liver and kidney function test results were within normal limits. Chest X-ray showed bilateral reticular infiltration. Nasopharyngeal swab for pandemic influenza was taken. Oral clarithromycin and parenteral clindamycin were added to her treatment. With oxygen support and bronchodilation treatment, the hypoxemia subsided. Polymerase chain reaction analysis for influenza virus H1N1 was positive [5]. The patient did not require mechanical ventilation support and her respiratory status improved during the next few days.

On the fifth day of the treatment her left leg appeared to be swollen and larger in diameter than the right leg.

Doppler ultrasonography showed a hyperechogenic thrombus with non-compressibility in the left deep femoral vein. Enoxaparin 1 mg kg–1 b.i.d. was initiated and detailed prothrombotic risk factor analysis was performed.

Basal activated partial thromboplastin time (aPTT) and international normalized ratio (INR) were within normal limits. The plasma fibrinogen level was 436 mg dL–1 (normal range: 200-450 mg dL–1) and thrombin time was 14 s (normal range: 12-16 s). D-dimer was 5.42 µg mL–1 (normal range: 0-0.48 µg mL–1), anti-thrombin III activity was 101% (normal range: 80%-120%), plasma protein C and protein S levels were 84% (normal range: 70%-130%) and 92% (normal range:60%-130%), respectively, and the plasma factor VIII level was 126% (normal range: 53%170%). Anticardiolipin and antiphospholipid antibodies were negative. The serum lipid profile, and lipoprotein-a and homocysteine levels were normal. Analysis for methylenetetrahydrofolate reductase (MTHFR C677T –/–), factor V Leiden, and prothrombin 20210A mutations were negative. Echocardiographic evaluation showed normal systolic and diastolic functions without intracardiac throm-

Gökçe M, et al: Deep Vein Thrombosis with Swine-flu

bus. Thoracic CT performed to investigate an associated pulmonary thromboembolism (PTE) was unremarkable.

Swelling in the patient’s left leg regressed by the 3rd day of enoxaparin treatment, and she was discharged 10 d after admission with a therapeutic antiXa level.

Discussion The pathophysiology of thrombosis is based on the presence of 3 factors: endothelial injury, hypercoagulability, and venous stasis. Damage to vessel walls prevents endothelium from inhibiting coagulation and initiating local fibrinolysis. As VTE is usually multifactorial in childhood, detailed analysis should be performed in an effort to determine the underlying etiology.

In addition to coagulation cascade activation, inflammatory response plays a role in thrombus formation via production of microparticles (MPs) that carry cell-specific molecules—proteins such as galectins [6]. Stimulation of monocytes, especially by galectin-1, leads to cell activation and tissue factor expression that triggers the coagulation pathway. Furthermore, oxygen free radicals produced during inflammation are known to induce thrombosis in microvessels via activation of platelet aggregation [7].

Infectious agents, including bacteria, viruses, and parasites, may initiate this process. A 13-year-old male that developed deep vein thrombosis (DVT) and pulmonary embolism following pneumonia caused by Mycoplasma pneumoniae was reported; however, protein S deficiency and transient lupus anticoagulant were underlying risk factors [8]. It is also known that varicella zoster infection can cause thrombosis in patients with protein S and C deficiency [9]. An 8-year-old boy that developed middle cerebral artery thrombosis as a result of Streptococcus oralis infection was reported [10].

Since being identified in Mexico City in April 2009, pandemic influenza A (H1N1) has become a significant cause of morbidity and mortality worldwide. Till 6 December 2009, 208 countries have reported laboratory-confirmed cases of pandemic influenza H1N1 to the World Health Organization (WHO) [11]. Although hospitalized children with swine-origin influenza infection are more likely to have underlying medical conditions, healthy individuals are also at risk f H1N1 infection and infection-related death. Unusual clinical presentations of H1N1 infection reported to date have included parotitis, conjunctivitis, and extensive bowel involvement with mesenteric thrombosis and hemophagocytic syndrome [12,13] The presented case developed DVT while undergoing treatment for H1N1 pneumonia. The patient did not

175

Gökçe M, et al: Deep Vein Thrombosis with Swine-flu

have any coagulation abnormality or prothrombotic risk factor other than immobilization. The patient’s history of thrombotic episodes was negative despite having cerebral palsy and having undergone surgery for hip dysplasia. The patient’s family history of thrombosis was also negative.

Detailed thrombotic risk factor analysis was performed to clarify the association between swine flu and DVT. H1N1 infection in the presented case might have triggered the formation of thrombosis because of endothelial injury in the left deep femoral vein due to previous surgery.

D-dimer elevation indicated acute thrombosis. H a r m s et al. performed autopsy on 8 patients with H1N1 infection and reported that 5 had peripheral pulmonary vascular thrombosis and all 8 had cytophagocytosis [14]. An in vitro study reported that monocytes and endothelial cells that were incubated with influenza were able to activate coagulation via endothelial dysfunction and elevated tissue factor levels [15,16]. It is known that seasonal flu vaccine reduces the risk of cardiovascular events in patients with coronary heart disease. A novel study reported that influenza vaccination is associated with a reduced risk of VTE, whereas influenza infection itself may predispose individuals to thrombus formation, especially DVT [17].

In conclusion, thrombotic events should be considered among the possible complications of H1N1 infection, and low molecular weight heparin prophylaxis might be considered in immobilized patients with H1N1 infection.

Acknowledgements Each author contributed to this report equally.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Goldenberg NA, Bernard TJ: Venous thromboembolism in children. Hematol Oncol Clin North Am 2010; 24: 151-166 2. Raffini L, Huang YS, Witmer C, Feudtner C: Dramatic increase in venous thromboembolism in children’s hospital in the United States from 2001 to 2007. Pediatrics 2009; 124: 1001-1008 3. Raffini L: Thrombophilia in children: Who to test, how, when and why? Hematology. Am Soc Hematol Educ Program 2008; 228-235 4. Gurgey A, Aslan D: Outcome of noncatheter-related thrombosis in children: Influence of underlying or coexisting factors. J Pediatr Hematol Oncol 2001; 23: 159-164

176

Turk J Hematol 2012; 29: 174-176

5. Song MK, Chang J, Hong Y, Hong S, Kim SW: Direct multiplex reverse transcription-nested PCR detection of influenza viruses without RNA purification. J Microbiol Biotechnol 2009; 19: 1470-1474 6. Diaz JA, Ramacciotti E, Wakefield TW: Do galectins play a role in venous thrombosis? A review. Thromb Res 2010; 125: 373-376 7. Jourdan A, Aguejouf O, Imbault P, Doutremepuich F, Inamo J, Doutremepuich C: Experimental thrombosis model induced by free radicals. Application to aspirin and other different substances. Thromb Res 1995; 79: 109-123 8. Graw-Panzer KD, Verma S, Rao S, Miller ST, Lee H: Venous thrombosis and pulmonary embolism in a child with pneumonia due to Mycoplasma pneumoniae. J Natl Med Assoc 2009; 101: 956-958 9. Doğan M, Açıkgöz M, Bora A, Başaranoğlu M, Oner AF: Varicella associated purpura-fulminans and multiple deep vein thromboses: A case report. J Nippon Med Sch 2009; 76: 165-168 10. Kazanci E, Oguz KK, Gurgey A, Topçu M: Streptococcus oralis as a risk factor of middle cerebral artery thrombosis. J Child Neurol 2005; 20: 611-613 11. WHO Pandemic (H1N1) 2009 update 78 12. Potter MN, Foot AB, Oakhill A: Influenza A and the virus associated haemophagocytic syndrome: Cluster of three cases in children with acute leukemia. J Clin Pathol 1991; 44: 297-299 13. Klein A, Corazza F, Demulder A, Van Beers D, Ferster A: Recurrent viral associated hemophagocytic syndrome in a child with Langerhans cell histiocytosis. J Pediatr Hematol Oncol 1999; 21: 554-556 14. Harms PW, Schmidt LA, Smith LB, Newton DW, Pletnewa MA, Walters LL, Tomlins SA, Fisher-Hubbard A, Napolitano LM, Park PK, Blalavas M, Fantone J, Myers JL, Jentzen JM: Autopsy findings in eight patients with fatal H1N1 infection.

Am J Clin Pathol 2010; 134: 27-35 15. Visseren FL, Bouwman JJ, Bouter KP, Diepersloot RJ, de Groot PH, Erkelens DW: Procoagulant activity of endothelial cells after infection with respiratory viruses.

Thromb Haemost 2000; 84: 319-324 16. Keller TT, van der Sluijs KF, de Kruif MD, Gerdes VE, Meijers JC, Florquin S, van der Poll T, van Gorp EC, Brandjes DP, Büller HR, Levi M: Effects on coagulation and fibrinolysis induced by influenza in mice with a reduced capacity to generate activated protein C and a deficiency in plasminogen activator inhibitor type 1. Circ Res 2006; 99: 1261-1269 17. Zhu T, Carcaillon L, Martinez I, Cambou JP, Kyndt X, Guillot K, Vergnes MC, Scarabin PY, Emmerich P: Association of influenza vaccination with reduced risk of venous thromboembolism. Thromb Haemost 2009; 102: 1009-1101

Case Report

DOI: 10.5505/tjh.2012.65002

Cerebellar Granulocytic Sarcoma: A Case Report Serebellar Granülositik Sarkom: Bir Olgu Sunumu Birol Baytan1, Melike Sezgin Evim1, Adalet Meral Güneş1, Hasan Kocaeli2, Şaduman Balaban3, Ender Korfalı2, Nükhet Tüzüner4 Uludağ University, School of Medicine, Department of Pediatric Hematology, Bursa, Turkey Uludağ University, School of Medicine, Department of Neurosurgery, Bursa, Turkey 3 Uludağ University, School of Medicine, Department of Pathology, Bursa, Turkey 4 İstanbul University, School of Medicine, Department of Pathology, Bursa, Turkey 1 2

Abstract Granulocytic sarcoma is a rare tumor composed of immature granulocytic cells that is usually associated with acute myelogenous leukemia. Intraparenchymal cranial localization without skull, meningeal, or bone marrow invasion is extremely rare. The mechanisms of intraparenchymal cranial localization of GS remains unknown, as only 10 cases with cerebellar granulocytic sarcoma have been previously reported. Herein, we report a four year old boy with cerebellar localization of granulocytic sarcoma.

Key Words: Children, Acute leukemia, Granulocytic sarcoma

Özet Granulositik sarkom, genellikle akut myelositer lösemiye eşlik eden immatür granülositik hücrelerden oluşan nadir bir tümördür. Kafatası, meninks ve kemik iliği tutulumu olmaksızın izole intrakranial parankimal tutulum ise çok daha nadirdir ve mekanizması henüz tam olarak bilinmemektedir. Literatürde 10 vaka bildirilmiştir. Bu raporumuzda kemik iliği tutulumu olmadan izole serebellar parankimde yer alan granülositik sarkom tartışılmıştır.

Anahtar Sözcükler: Çocuk, Akut lösemi, Granülositik sarkom Introduction Granulocytic sarcoma (GS) is a rare extramedullary solid tumor. GS, which is synonymous with chloroma, myeloblastoma, and extramedullary leukemia, is a localized tumor composed of leukemic myeloblasts and myeloid precursors. The clinical characterization of GS is classified into 4 groups: a) primary GS; b) GS at onset of acute myelogenous leukemia (AML); c) GS as an isolated recurrence of AML (new isolated focus of GS that occurs during bone marrow remission); d) GS with concurrent bone marrow relapse of AML [1-4]. The precise incidence

rate of GS is not known, although it occurs in approximately 3% of patients with leukemia [4,5]. The most common sites of involvement are bone, periosteum, soft tissue, lymph nodes, and skin; however, intraparenchymal involvement of GS in the central nervous system (CNS) is rare [6-8].

Some Turkish researchers have reported that there is an association between AML and GS [9-12]. Çavdar et al. being the first in 1971 [13]. Herein we present a patient with the unusual presentation of cerebellar parenchymal GS invasion without skull, meningeal, or bone marrow invasion after completing treatment for AML.

Address for Correspondence: Birol Baytan, M.D., Uludağ Üniversitesi, Tıp Fakültesi, Çocuk Sağlığı ve Hastalıkları Anabilim Dalı, 16059, Bursa, Turkey Phone: +90 224 442 84 00/1107 E-mail: baytanbirol@yahoo.com Received/Geliş tarihi : June 24, 2009 Accepted/Kabul tarihi : April 30, 2010

177

Baytan B, et al: Cerebellar Granulocytic Sarcoma

Turk J Hematol 2012; 29: 177-180

Case Report A 4-year-old boy was diagnosed as AML without CNS involvement in May 2008. Bone marrow aspirate showed diffuse infiltration of monoblasts (90%). Flow cytometric analysis showed that these blasts were positive for myeloperoxidase, CD15, CD33, CD13, CD14, and CD4. Based on all these findings, the diagnosis of AML, FAB subtype M5 was confirmed. Complete remission was achieved following 4 courses of the Medical Research Council (MRC) UK-AML 12 chemotherapy protocol (2. remission induction courses with cytarabine, daunorubicin, and etoposide [ADE] given for 10, 3, and 5 d, respectively, for the 1st course, and 8, 3, and 5 d, respectively, for the 2nd course, and 2 consolidation courses consisting of amsacrine, cytarabine, etoposide [MACE], and MidAC [mitoxantrone, cytarabine] and triple intrathecal chemotherapy given once after each chemotherapy courses [14]. Informed consent was obtained from patient’s family.

At the end of the re-consolidation phase of treatment the patient had frontal headache, but no fever or neurological findings. Cranial magnetic resonance imaging (MRI) performed due to the persistent headache showed a 4 x 4.5 x 5-cm mass lesion in the right cerebellar hemisphere. The lesion was hypointense on T1-weighted and hyperintense on T2-weighted MRI, and showed linear heterogeneous enhancement after administration of Gd-DTPA (Figure 1).

Left facial weakness and a slight increase in deep tendon reflexes were noted within 2 hours after cranial MRI. Neurological examination showed that the patient had aphasia, hemiparesis, papilloedema, and 3rd (III), 7th (VII), and 9th (IX) cranial nerve palsies, and he was scheduled for surgery.

During preparation for surgery the patient’s clinical condition continued to deteriorate and he became comatose,

A

B

with dilated non-reactive pupils and extensor posturing in response to painful stimuli. Because these findings suggested tonsillar herniation, the patient underwent emergency surgery and the mass was resected via right suboccipital craniotomy while in the sitting position. The mass was removed, with the exception of a small piece with a diameter of 1 cm that adhered to the brainstem and lower cranial nerves. Postoperatively the patient recovered in 2 days and regained consciousness and full physical strength. However the symptoms related to the 3rd , 7th and 9th cranial nerves improved nvolved retarded.

Cerebrospinal fluid (CSF) obtained during the surgery was acellular. Both CSF protein (15 mg dL–1) and lactate dehydrogenase (14 IU L–1) levels were within the normal range. Histopathologic examination showed that the mass was composed of undifferentiated mononuclear cells with monoblastic features (Figure 2). Immunohistochemical staining exhibited weak myeloperoxidase positivity, and strong CD34 and CD117 monoclonal antibody positivity.

The patient’s bone marrow aspiration done concurrently performed withwith cranial surgery was found in complete remission.

Two weeks after surgery, the patient received 10 doses of cranial radiotherapy (RT) with a each dose of 1200 cGy with a each dose. The the symptoms related to involved cranial nerve paralysis had improved following the cranial RT. were. As the patient’s family refused systemic chemotherapy supportive therapy was initiated. Four week later the 10th dose of RT, the patient developed widespread polypus masses on the gingiva, and renal ultrasonography performed due to abdominal pain showed hypoechoic lesions in the renal parenchyma. These findings were indicative of the dissemination of leukemia. His bone marrow aspiration done in the same time with the dissemination of leukemia

C

Figure 1: Axial (A) and sagittal (B-C) T1- and T2-weighted MRI with Gd-DTPA show the linear heterogeneously enhanced mass in the right cerebellar hemisphere.

178

Turk J Hematol 2012; 29: 177-180

Baytan B, et al: Cerebellar Granulocytic Sarcoma

number of cases have been reported, approximately 35% of patients with intracranial GS had no CSF involvement [19,20].

Figure 2: Photomicrograph shows diffuse undifferentiated mononuclear cells (hematoxylin and eosin, 100x).

was also found infiltrated. The patientâ&#x20AC;&#x2122;s clinical condition progressively declined and he died 2 months after being diagnosed as cerebellar GS. Discussion The presented case developed cerebellar GS without CSF or bone marrow involvement. Intracranial GS without meningeal or skull invasion is extremely rare; only 10 pathologically proven cases have been reported [15]. There are 3 primary explanations of the pathogenesis of GS. The first is that the leukemic nodules arise from leukostatic plugging of small cerebral vessels during the acceleration of blastic phase [16]. The second is that leukemic cells passing through the first dura, and then the subarachnoid and Virchow-Robin spaces invade the brain surface [17].

The third is that the remainders of embryonic CNS cells capable of hematopoetic differentiation could undergo malignant transformation [18].

This presented case was morphologically classified as AML M5, based on flow cytometric observation of positive myeloid markers. The level of CD4 expression was high (98%). FAB subtype M4 and M5 morphology, and the presence of myeloblasts with high-level expression of CD4 were reported to be factors that predispose to the development of GS [15]. CSF samples obtained from the patient at the time of diagnosis and during chemotherapy were acellular, with normal protein and LDH levels.

Furthermore, CSF obtained from the ventricles at the time GS was diagnosed was also acellular. Although only a small

Management of GS in the presented patient included surgical mass excision and RT. Data on GS are scarce and its optimal treatment is unclear; therefore, it should be considered a leukemic relapse site and treated as a relapse with intensive chemotherapy and RT, even though the bone marrow does not show any leukemic infiltration.

The presented patient received 10 doses of cranial RT, but as his family refused systemic chemotherapy he was given only supportive therapy. Despite the fact that GS is very radiosensitive, time to remission is reported and most patients die within 3 months [21-23]. In the presented case, 1 month after the completion of RT, leukemia was disseminated simultaneously infiltrating the gingiva, renal parenchyma, and bone marrow, and the patient died due to disseminated disease after 2 months of the diagnosis of the cerebellar GS. Conclusion GS in brain parenchyma without skull or meningeal involvement is very rare. Its mechanism of formation is still unknown. Some degree of improvement can be achieved in such patients with surgery and RT; however, the prognosis remains poor.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Byrd JC, Edenfield WJ, Shields DJ, Dawson NA: Extramedullary myeloid cell tumors in acute nonlymphocytic leukemia: A clinical review. J Clin Oncol 1995; 13: 18001816 2. Byrd JC, Edenfield WJ, Dow NS, Aylesworth C, Dawson N: Extramedullary myeloid cell tumors in myelodysplasticsyndromes: Not a true indication of impending acute myeloid leukemia. Leuk Lymphoma 1996; 21: 153-159 3. Mahendra P, Ager S, Bedlow AJ, Bloxham DM, Green AR, Marcus RE: Two unusual neurological presentations of granulocytic sarcoma in Philadelphia positive chronic myeloid leukaemia. Leuk Lymphoma 1994; 15: 351-355

179

Baytan B, et al: Cerebellar Granulocytic Sarcoma

4. Byrd JC, Weiss RB, Arthur DC, Lawrence D, Baer MR, Davey F, Trikha ES, Carroll AJ, Tantravahi R, Qumsiyeh M, Patil SR, Moore JO, Mayer RJ, Schiffer CA, Bloomfield CD: Extramedullary leukemia adversely affects hematologic complete remission rate and overall survival in patients with t(8;21)(q22;q22): Results from Cancer and Leukemia Group B 8461. J Clin Oncol 1997; 15: 466-475 5. Neiman RS, Barcos M, Berard C, Bonner H, Mann R, Rydell RE, Bennett JM: Granulocytic sarcoma: A clinic pathologic study of 61 biopsies cases. Cancer 1981; 48: 1426-1437 6. Barnett MJ, Busman WV: Granulocytic sarcoma of the brain: A case report and review of the literature. Radiology 1986; 160: 223-225 7. O’Brien J, Buckley O, Murphy C, Torreggiani WC: An unusual cause of persistent headache: Chloroma (2008: 2b).

Eur Radiol 2008; 18: 1071-1072 8. Aki H, Baslar Z, Uygun N, Ozguroglu M, Tuzuner N: Primary granulocytic sarcoma of the urinary bladder: Case report and review of the literature. Urology 2002; 60: 345 9. Cavdar AO, Arcasoy A, Babacan E, Gözdaşoğlu S, Topuz U, Fraumeni JF Jr: Ocular granulocytic sarcoma (chloroma) with acute myelomonocytic leukemia in Turkish children.

Cancer 1978; 41(4): 1606-1609 10. Cavdar AO, Babacan E, Gözdaşoğlu S, Kilicturgay K, Arcasoy A, Cin S, Ertem U, Erten J: High risk subgroup of acute myelomonocytic leukemia (AMML) with orbito-ocular granulocytic sarcoma (OOGS) in Turkish children. Retrospective analysis of clinical, hematological, ultrastructural and therapeutical findings of thirty-three OOGS. Acta Haematol 1989; 81: 80-85 11. Cavdar AO, Babacan E, Gözdasoglu S, Yavuz G, Unal E, Pamir A: T-lymphocyte sub-populations in orbito-ocular granulocytic sarcoma (OOGS) and acute myelocytic leukemia (AML): A preliminary study. Med Oncol Tumor Pharmacother 1993; 10: 113-115 12. Hiçsönmez G, Cetin M, Tuncer AM, Yenicesu I, Aslan D, Ozyürek E, Unal S: Children with acute myeloblastic leukemia presenting with extramedullary infiltration: The effects of high-dose steroid treatment. Leuk Res 2004; 28: 25-34 13. Cavdar AO, Gözdasoğlu S, Arcasoy A, Demirağ B: Chloramalike ocular manifestations in Turkish children with acute myelomonocytic leukaemia. Lancet 1971; 1: 680-682

180

Turk J Hematol 2012; 29: 177-180

14. Gale RE, Hills R, Kottaridis PD, Srirangan S, Wheatley K, Burnett AK, Linch DC: No evidence that FLT3 status should be considered as an indicator for transplantation in acute myeloid leukemia (AML): An analysis of 1135 patients, excluding acute promyelocytic leukemia, from the UK MRC AML10 and 12 trials. Blood 2005; 106: 3658-3665 15. Suzer T, Colakoglu N, Cirak B, Keskin A, Coskun E, Tahta K: Intracerebellar granulocytic sarcoma complicating acute myelogenous leukemia: A case report and review of the literature. J Clin Neurosci 2004; 11: 914-917 16. Saper CB, Jarowski CI: Leukemic infiltration of the cerebellum in acute myelomonocytic leukemia. Neurology 1982; 32: 77-80 17. Azzarelli B, Roessmann U: Pathogenesis of central nervous system infiltration in acute leukemia. Arch Pathol Lab Med 1977;101: 203-205 18. Ho DM, Wong TT, Guo WY, Chang KP, Yen SH: Primary cerebellar extramedullary myeloid cell tumor mimicking oligodendroglioma. Acta Neuropathol 1997; 94: 398-402 19. Psiachou-Leonard E, Paterakis G, Stefanaki K, MikrakiChristou V, Haidas S: Cerebellar granulocytic sarcoma in an infant with CD56+ acute monoblastic leukemia. Leuk Res 2001; 25: 1019-1021 20. Struhal W, Oberndorfer S, Lahrmann H, Lindeck-Pozza E, Hess B, Nussgruber V, Pöhnl R, Dobner T, Grisold W: Myeloid sarcoma in the central nervous system: Case report and review of the literature. Acta Clin Croat 2008; 47: 19-24 21. Tobelem G, Jacquillat C, Chastang C, Auclerc MF, Lechevallier T, Weil M, Daniel MT, Flandrin G, Harrousseau JL, Schaison G, Boiron M, Bernard J: Acute monoblastic leukemia: a clinical and biologic study of 74 cases. Blood 1980; 55: 71-76 22. Dusenbery KE, Howells WB, Arthur DC, Alonzo T, Lee JW, Kobrinsky N, Barnard DR, Wells RJ, Buckley JD, Lange BJ, Woods WG: Extramedullary leukemia in children with newly diagnosed acute myeloid leukemia: A report from the Children’s Cancer Group. J Pediatr Hematol Oncol 2003; 25: 760-768 23. Jenkin RD, Al-Shabanah M, Al-Nasser A, El-Solh H, Aur R, Al Sudairy R, Mustafa MM, Al Fawaz I, Gray A, da Cunha M, Ayas M, Al Mahr M, Kofide A, Mahgoub AN, Rifai S, Belgaumi A, Al Jefri A, Al Musa A, Sabbah R: Extramedullary myeloid tumors in children: The limited value of local treatment. J Pediatr Hematol Oncol 2000; 22: 34-40

Case Report

DOI: 10.5505/tjh.2012.65002

Cerebellar Granulocytic Sarcoma: A Case Report Serebellar Granülositik Sarkom: Bir Olgu Sunumu Birol Baytan1, Melike Sezgin Evim1, Adalet Meral Güneş1, Hasan Kocaeli2, Şaduman Balaban3, Ender Korfalı2, Nükhet Tüzüner4 Uludağ University, School of Medicine, Department of Pediatric Hematology, Bursa, Turkey Uludağ University, School of Medicine, Department of Neurosurgery, Bursa, Turkey 3 Uludağ University, School of Medicine, Department of Pathology, Bursa, Turkey 4 İstanbul University, School of Medicine, Department of Pathology, Bursa, Turkey 1 2

Abstract Granulocytic sarcoma is a rare tumor composed of immature granulocytic cells that is usually associated with acute myelogenous leukemia. Intraparenchymal cranial localization without skull, meningeal, or bone marrow invasion is extremely rare. The mechanisms of intraparenchymal cranial localization of GS remains unknown, as only 10 cases with cerebellar granulocytic sarcoma have been previously reported. Herein, we report a four year old boy with cerebellar localization of granulocytic sarcoma.

Key Words: Children, Acute leukemia, Granulocytic sarcoma

Özet Granulositik sarkom, genellikle akut myelositer lösemiye eşlik eden immatür granülositik hücrelerden oluşan nadir bir tümördür. Kafatası, meninks ve kemik iliği tutulumu olmaksızın izole intrakranial parankimal tutulum ise çok daha nadirdir ve mekanizması henüz tam olarak bilinmemektedir. Literatürde 10 vaka bildirilmiştir. Bu raporumuzda kemik iliği tutulumu olmadan izole serebellar parankimde yer alan granülositik sarkom tartışılmıştır.

Anahtar Sözcükler: Çocuk, Akut lösemi, Granülositik sarkom Introduction Granulocytic sarcoma (GS) is a rare extramedullary solid tumor. GS, which is synonymous with chloroma, myeloblastoma, and extramedullary leukemia, is a localized tumor composed of leukemic myeloblasts and myeloid precursors. The clinical characterization of GS is classified into 4 groups: a) primary GS; b) GS at onset of acute myelogenous leukemia (AML); c) GS as an isolated recurrence of AML (new isolated focus of GS that occurs during bone marrow remission); d) GS with concurrent bone marrow relapse of AML [1-4]. The precise incidence

rate of GS is not known, although it occurs in approximately 3% of patients with leukemia [4,5]. The most common sites of involvement are bone, periosteum, soft tissue, lymph nodes, and skin; however, intraparenchymal involvement of GS in the central nervous system (CNS) is rare [6-8].

Some Turkish researchers have reported that there is an association between AML and GS [9-12]. Çavdar et al. being the first in 1971 [13]. Herein we present a patient with the unusual presentation of cerebellar parenchymal GS invasion without skull, meningeal, or bone marrow invasion after completing treatment for AML.

Address for Correspondence: Birol Baytan, M.D., Uludağ Üniversitesi, Tıp Fakültesi, Çocuk Sağlığı ve Hastalıkları Anabilim Dalı, 16059, Bursa, Turkey Phone: +90 224 442 84 00/1107 E-mail: baytanbirol@yahoo.com Received/Geliş tarihi : June 24, 2009 Accepted/Kabul tarihi : April 30, 2010

177

Baytan B, et al: Cerebellar Granulocytic Sarcoma

Turk J Hematol 2012; 29: 177-180

Case Report A 4-year-old boy was diagnosed as AML without CNS involvement in May 2008. Bone marrow aspirate showed diffuse infiltration of monoblasts (90%). Flow cytometric analysis showed that these blasts were positive for myeloperoxidase, CD15, CD33, CD13, CD14, and CD4. Based on all these findings, the diagnosis of AML, FAB subtype M5 was confirmed. Complete remission was achieved following 4 courses of the Medical Research Council (MRC) UK-AML 12 chemotherapy protocol (2. remission induction courses with cytarabine, daunorubicin, and etoposide [ADE] given for 10, 3, and 5 d, respectively, for the 1st course, and 8, 3, and 5 d, respectively, for the 2nd course, and 2 consolidation courses consisting of amsacrine, cytarabine, etoposide [MACE], and MidAC [mitoxantrone, cytarabine] and triple intrathecal chemotherapy given once after each chemotherapy courses [14]. Informed consent was obtained from patient’s family.

At the end of the re-consolidation phase of treatment the patient had frontal headache, but no fever or neurological findings. Cranial magnetic resonance imaging (MRI) performed due to the persistent headache showed a 4 x 4.5 x 5-cm mass lesion in the right cerebellar hemisphere. The lesion was hypointense on T1-weighted and hyperintense on T2-weighted MRI, and showed linear heterogeneous enhancement after administration of Gd-DTPA (Figure 1).

Left facial weakness and a slight increase in deep tendon reflexes were noted within 2 hours after cranial MRI. Neurological examination showed that the patient had aphasia, hemiparesis, papilloedema, and 3rd (III), 7th (VII), and 9th (IX) cranial nerve palsies, and he was scheduled for surgery.

During preparation for surgery the patient’s clinical condition continued to deteriorate and he became comatose,

A

B

with dilated non-reactive pupils and extensor posturing in response to painful stimuli. Because these findings suggested tonsillar herniation, the patient underwent emergency surgery and the mass was resected via right suboccipital craniotomy while in the sitting position. The mass was removed, with the exception of a small piece with a diameter of 1 cm that adhered to the brainstem and lower cranial nerves. Postoperatively the patient recovered in 2 days and regained consciousness and full physical strength. However the symptoms related to the 3rd , 7th and 9th cranial nerves improved nvolved retarded.

Cerebrospinal fluid (CSF) obtained during the surgery was acellular. Both CSF protein (15 mg dL–1) and lactate dehydrogenase (14 IU L–1) levels were within the normal range. Histopathologic examination showed that the mass was composed of undifferentiated mononuclear cells with monoblastic features (Figure 2). Immunohistochemical staining exhibited weak myeloperoxidase positivity, and strong CD34 and CD117 monoclonal antibody positivity.

The patient’s bone marrow aspiration done concurrently performed withwith cranial surgery was found in complete remission.

Two weeks after surgery, the patient received 10 doses of cranial radiotherapy (RT) with a each dose of 1200 cGy with a each dose. The the symptoms related to involved cranial nerve paralysis had improved following the cranial RT. were. As the patient’s family refused systemic chemotherapy supportive therapy was initiated. Four week later the 10th dose of RT, the patient developed widespread polypus masses on the gingiva, and renal ultrasonography performed due to abdominal pain showed hypoechoic lesions in the renal parenchyma. These findings were indicative of the dissemination of leukemia. His bone marrow aspiration done in the same time with the dissemination of leukemia

C

Figure 1: Axial (A) and sagittal (B-C) T1- and T2-weighted MRI with Gd-DTPA show the linear heterogeneously enhanced mass in the right cerebellar hemisphere.

178

Turk J Hematol 2012; 29: 177-180

Baytan B, et al: Cerebellar Granulocytic Sarcoma

number of cases have been reported, approximately 35% of patients with intracranial GS had no CSF involvement [19,20].

Figure 2: Photomicrograph shows diffuse undifferentiated mononuclear cells (hematoxylin and eosin, 100x).

was also found infiltrated. The patientâ&#x20AC;&#x2122;s clinical condition progressively declined and he died 2 months after being diagnosed as cerebellar GS. Discussion The presented case developed cerebellar GS without CSF or bone marrow involvement. Intracranial GS without meningeal or skull invasion is extremely rare; only 10 pathologically proven cases have been reported [15]. There are 3 primary explanations of the pathogenesis of GS. The first is that the leukemic nodules arise from leukostatic plugging of small cerebral vessels during the acceleration of blastic phase [16]. The second is that leukemic cells passing through the first dura, and then the subarachnoid and Virchow-Robin spaces invade the brain surface [17].

The third is that the remainders of embryonic CNS cells capable of hematopoetic differentiation could undergo malignant transformation [18].

This presented case was morphologically classified as AML M5, based on flow cytometric observation of positive myeloid markers. The level of CD4 expression was high (98%). FAB subtype M4 and M5 morphology, and the presence of myeloblasts with high-level expression of CD4 were reported to be factors that predispose to the development of GS [15]. CSF samples obtained from the patient at the time of diagnosis and during chemotherapy were acellular, with normal protein and LDH levels.

Furthermore, CSF obtained from the ventricles at the time GS was diagnosed was also acellular. Although only a small

Management of GS in the presented patient included surgical mass excision and RT. Data on GS are scarce and its optimal treatment is unclear; therefore, it should be considered a leukemic relapse site and treated as a relapse with intensive chemotherapy and RT, even though the bone marrow does not show any leukemic infiltration.

The presented patient received 10 doses of cranial RT, but as his family refused systemic chemotherapy he was given only supportive therapy. Despite the fact that GS is very radiosensitive, time to remission is reported and most patients die within 3 months [21-23]. In the presented case, 1 month after the completion of RT, leukemia was disseminated simultaneously infiltrating the gingiva, renal parenchyma, and bone marrow, and the patient died due to disseminated disease after 2 months of the diagnosis of the cerebellar GS. Conclusion GS in brain parenchyma without skull or meningeal involvement is very rare. Its mechanism of formation is still unknown. Some degree of improvement can be achieved in such patients with surgery and RT; however, the prognosis remains poor.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Byrd JC, Edenfield WJ, Shields DJ, Dawson NA: Extramedullary myeloid cell tumors in acute nonlymphocytic leukemia: A clinical review. J Clin Oncol 1995; 13: 18001816 2. Byrd JC, Edenfield WJ, Dow NS, Aylesworth C, Dawson N: Extramedullary myeloid cell tumors in myelodysplasticsyndromes: Not a true indication of impending acute myeloid leukemia. Leuk Lymphoma 1996; 21: 153-159 3. Mahendra P, Ager S, Bedlow AJ, Bloxham DM, Green AR, Marcus RE: Two unusual neurological presentations of granulocytic sarcoma in Philadelphia positive chronic myeloid leukaemia. Leuk Lymphoma 1994; 15: 351-355

179

Baytan B, et al: Cerebellar Granulocytic Sarcoma

4. Byrd JC, Weiss RB, Arthur DC, Lawrence D, Baer MR, Davey F, Trikha ES, Carroll AJ, Tantravahi R, Qumsiyeh M, Patil SR, Moore JO, Mayer RJ, Schiffer CA, Bloomfield CD: Extramedullary leukemia adversely affects hematologic complete remission rate and overall survival in patients with t(8;21)(q22;q22): Results from Cancer and Leukemia Group B 8461. J Clin Oncol 1997; 15: 466-475 5. Neiman RS, Barcos M, Berard C, Bonner H, Mann R, Rydell RE, Bennett JM: Granulocytic sarcoma: A clinic pathologic study of 61 biopsies cases. Cancer 1981; 48: 1426-1437 6. Barnett MJ, Busman WV: Granulocytic sarcoma of the brain: A case report and review of the literature. Radiology 1986; 160: 223-225 7. O’Brien J, Buckley O, Murphy C, Torreggiani WC: An unusual cause of persistent headache: Chloroma (2008: 2b).

Eur Radiol 2008; 18: 1071-1072 8. Aki H, Baslar Z, Uygun N, Ozguroglu M, Tuzuner N: Primary granulocytic sarcoma of the urinary bladder: Case report and review of the literature. Urology 2002; 60: 345 9. Cavdar AO, Arcasoy A, Babacan E, Gözdaşoğlu S, Topuz U, Fraumeni JF Jr: Ocular granulocytic sarcoma (chloroma) with acute myelomonocytic leukemia in Turkish children.

Cancer 1978; 41(4): 1606-1609 10. Cavdar AO, Babacan E, Gözdaşoğlu S, Kilicturgay K, Arcasoy A, Cin S, Ertem U, Erten J: High risk subgroup of acute myelomonocytic leukemia (AMML) with orbito-ocular granulocytic sarcoma (OOGS) in Turkish children. Retrospective analysis of clinical, hematological, ultrastructural and therapeutical findings of thirty-three OOGS. Acta Haematol 1989; 81: 80-85 11. Cavdar AO, Babacan E, Gözdasoglu S, Yavuz G, Unal E, Pamir A: T-lymphocyte sub-populations in orbito-ocular granulocytic sarcoma (OOGS) and acute myelocytic leukemia (AML): A preliminary study. Med Oncol Tumor Pharmacother 1993; 10: 113-115 12. Hiçsönmez G, Cetin M, Tuncer AM, Yenicesu I, Aslan D, Ozyürek E, Unal S: Children with acute myeloblastic leukemia presenting with extramedullary infiltration: The effects of high-dose steroid treatment. Leuk Res 2004; 28: 25-34 13. Cavdar AO, Gözdasoğlu S, Arcasoy A, Demirağ B: Chloramalike ocular manifestations in Turkish children with acute myelomonocytic leukaemia. Lancet 1971; 1: 680-682

180

Turk J Hematol 2012; 29: 177-180

14. Gale RE, Hills R, Kottaridis PD, Srirangan S, Wheatley K, Burnett AK, Linch DC: No evidence that FLT3 status should be considered as an indicator for transplantation in acute myeloid leukemia (AML): An analysis of 1135 patients, excluding acute promyelocytic leukemia, from the UK MRC AML10 and 12 trials. Blood 2005; 106: 3658-3665 15. Suzer T, Colakoglu N, Cirak B, Keskin A, Coskun E, Tahta K: Intracerebellar granulocytic sarcoma complicating acute myelogenous leukemia: A case report and review of the literature. J Clin Neurosci 2004; 11: 914-917 16. Saper CB, Jarowski CI: Leukemic infiltration of the cerebellum in acute myelomonocytic leukemia. Neurology 1982; 32: 77-80 17. Azzarelli B, Roessmann U: Pathogenesis of central nervous system infiltration in acute leukemia. Arch Pathol Lab Med 1977;101: 203-205 18. Ho DM, Wong TT, Guo WY, Chang KP, Yen SH: Primary cerebellar extramedullary myeloid cell tumor mimicking oligodendroglioma. Acta Neuropathol 1997; 94: 398-402 19. Psiachou-Leonard E, Paterakis G, Stefanaki K, MikrakiChristou V, Haidas S: Cerebellar granulocytic sarcoma in an infant with CD56+ acute monoblastic leukemia. Leuk Res 2001; 25: 1019-1021 20. Struhal W, Oberndorfer S, Lahrmann H, Lindeck-Pozza E, Hess B, Nussgruber V, Pöhnl R, Dobner T, Grisold W: Myeloid sarcoma in the central nervous system: Case report and review of the literature. Acta Clin Croat 2008; 47: 19-24 21. Tobelem G, Jacquillat C, Chastang C, Auclerc MF, Lechevallier T, Weil M, Daniel MT, Flandrin G, Harrousseau JL, Schaison G, Boiron M, Bernard J: Acute monoblastic leukemia: a clinical and biologic study of 74 cases. Blood 1980; 55: 71-76 22. Dusenbery KE, Howells WB, Arthur DC, Alonzo T, Lee JW, Kobrinsky N, Barnard DR, Wells RJ, Buckley JD, Lange BJ, Woods WG: Extramedullary leukemia in children with newly diagnosed acute myeloid leukemia: A report from the Children’s Cancer Group. J Pediatr Hematol Oncol 2003; 25: 760-768 23. Jenkin RD, Al-Shabanah M, Al-Nasser A, El-Solh H, Aur R, Al Sudairy R, Mustafa MM, Al Fawaz I, Gray A, da Cunha M, Ayas M, Al Mahr M, Kofide A, Mahgoub AN, Rifai S, Belgaumi A, Al Jefri A, Al Musa A, Sabbah R: Extramedullary myeloid tumors in children: The limited value of local treatment. J Pediatr Hematol Oncol 2000; 22: 34-40

Case Report

DOI: 10.5505/tjh.2012.72623

Unilateral Exudative Retinal Detachment as the Sole Presentation of Relapsing Acute Lymphoblastic Leukemia Relaps Akut Lenfoblastik Lösemide Tek Bulgu Olarak Unilateral Eksudatif Retina Dekolmanı Fatih Mehmet Azık1, Arsen Akıncı1, Tülin Revide Şaylı1, Vildan Kosan Çulha1, Kuddusi Teberik2, Mehmet Yasin Teke2, Fatih Gürbüz1 Diskapi Children’s Hospital, Department of Pediatric Hematology, Ankara, Turkey Ulucanlar Eye Hospital, Ankara, Turkey

1 2

Abstract Ocular findings are rarely the initial symptom of leukemia, although up to 90% of all leukemia patients have fundus changes during the course of the disease. Herein we report a relapsing acute lymphoblastic leukemia patient with the sole presentation of sudden visual loss and exudative retinal detachment. An 8-year-old boy with acute lymphoblastic leukemia developed sudden visual loss during his first remission period. Bullous retinal detachment with total afferent pupillary defect was observed. Orbital magnetic resonance imaging revealed an intraocular mass lesion; simultaneously obtained bone marrow and cerebrospinal fluid samples showed no evidence of leukemic cells. Following local irradiation, and systemic and intrathecal chemotherapy the mass disappeared. Local irradiation, and systemic and intrathecal chemotherapy effectively controlled the isolated ocular relapse of acute lymphoblastic leukemia and eliminated the need for enucleation.

Key Words: Acute lymphoblastic leukemia, Exudative retinal detachment, Relapse

Özet Löseminin seyrinde fundus değişiklikleri tüm hastaların %90’ında görülmesine rağmen, lösemide göz tutulumu nadiren ilk bulgu olarak karşımıza çıkar. Burada, ani görme kaybı ve eksudatif retina dekolmanının akut lenfoblastik lösemili bir olguda relapsın ilk bulgusu olarak saptandığını bildiriyoruz. Sekiz yaşında akut lenfoblastik lösemi tanısı alan bir erkek çocukta birinci remisyon döneminde ani görme kaybı gelişti. Total afferent pupiller defekt ile birlikte büllöz retina dekolmanı tespit edildi. Orbital manyetik rezonans görüntüleme ile intraokuler kitle lezyonu olduğu belirlendi.

Eş zamanlı yapılan kemik iliği ve beyin omurilik sıvısı incelemelerinde lösemik tutulum saptanmadı. Lokal radyoterapi sonrası sistemik ve intratekal kemoterapi uygulandı, kitlede rezolusyon gelişti. Sonuç olarak, akut lenfoblastik lösemide görülebilen izole göz relapsının kontrol altına alınmasında lokal radyoterapi, sistemik ve intratekal kemoterapinin etkili olduğunu ve enükleasyon gereksinimini ortadan kaldırdığını belirtiyoruz.

Anahtar Sözcükler: Akut lenfoblastik lösemi, Eksudatif retina dekolmanı, Relaps

Address for Correspondence: Fatih Mehmet AzIk, M.D., Kurtdereli Sok. Dışkapı, Ankara, Turkey Phone: +90 312 317 99 89 E-mail: mfatihazik@yahoo.com Received/Geliş tarihi : January 24, 2009 Accepted/Kabul tarihi : October 20, 2009

181

AzÄąk FM, et al: Exudative Retinal Detachment and ALL

Introduction Ocular symptoms in leukemia patients may be due to the direct effect of leukemic cells on ocular tissues or secondary to such disease-related complications as anemia, thrombocytopenia, and hyperviscosity syndrome [1].

Acute leukemias are associated with eye involvement more commonly than chronic leukemias [2]. The choroid and retina are the most common sites of leukemic involvement [3], and leukemic involvement in the iris, ciliary body, optic nerve, and conjunctiva, as well as leukemic hypopyon have also been reported [4,5]. Herein we report a relapsing acute lymphoblastic leukemia (ALL) patient with unilateral sudden visual loss and exudative retinal detachment as the sole presentation, as well as a discussion of the outcome following local irradiation, and systemic and intrathecal chemotherapy.

Turk J Hematol 2012; 29: 181-184

pressure was within normal limits in both eyes. Slit-lamp examination showed bullous exudative retinal detachment in the left eye and a completely normal right eye (Figure 1).

Ocular ultrasonographic examination showed total retinal detachment and a mass lesion that completely filled the bulbus oculi. Hyperechoic lesions indicative of calcification were not noted. Orbital magnetic resonance imaging (MRI) showed a 2 x 1.5-cm mass lesion with irregular borders that completely filled the bulbus oculi (Figure 2).

Bone marrow and CSF examinations were normal. The

Case An 8-year-old boy diagnosed as pre-B ALL [flow cytometry; CD 10 (%92), CD 19 (%96), CD 20 (%86), CD22 (%80)] was treated according to the St. Jude Total XIII high-risk (HR) protocol. Cerebral spinal fluid (CSF) was normal. According to the treatment protocol, due to the risk of central nervous system relapse radiotherapy (RT) was not administered. During the 97th week of treatment (27 months after the diagnosis) the patient developed unilateral sudden visual loss during his first remission period.

His best-corrected visual acuity was 10/10 in the right eye, whereas light perception was absent in the left eye.

Color vision could not be evaluated in the left eye and was 12/12 in the right eye. There was total afferent pupillary defect in the left eye. Eye movements were full. Intraocular

Figure 1: Slit-lamp photograph of the left eye at presentation shows exudative retinal detachment.

182

Figure 2: Orbital MRI shows a 2 x 1.5-cm mass lesion with irregular borders completely filling the bulbus oculi.

Figure 3: MRI shows crescent-shaped fibrotic tissue in the posterior region of the left bulbus oculi, which was considered calcification without evidence of a mass.

Turk J Hematol 2012; 29: 181-184

mass in the bulbus oculi was considered as ocular relapse, though it was not biopsy proven.

As soon as ocular relapse was diagnosed, re-induction therapy was initiated according to the St. Jude Total XIII-HR protocol [6]. The patient received orbital RT at a dose of 2340 cGy in 10 fractions. Follow-up orbital MRI showed crescent-shaped fibrotic tissue at the posterior region of the left bulbus oculi, which was considered calcification, but there was no evidence of a mass related with ocular relapse (Figure 3). Although his visual capacity didn`t recover, the patient remained in remission for 18 months following ocular relapse. Extramedullary relapse treatment was continued, according to the St. Jude Total XIII-HR protocol. I had written informed consent and there is no conflict of interest related to manuscript Discussion Ocular involvement in children with ALL, which is typically bilateral, is usually observed with concomitant central nervous system and/or bone marrow relapse [7,8].

Improved leukemia therapies for children have resulted in prolonged remission; even with extramedullary relapses in the most common ones (bone marrow, testes, brain, and spinal cord). Ocular symptoms of ALL may be more striking than systemic symptoms, and may be the primary reason for presentation at the time of initial diagnosis.

Nonetheless, exudative retinal detachment as the sole presentation of relapsing ALL in the absence of concomitant central nervous system and/or bone marrow relapse is unusual, and only 3 such cases have been reported [9-11].

The differential diagnosis in leukemic patients with exudative retinal detachment includes central serous choroidopathy, uveal effusion syndrome, choroidal neovascularization, Haradaâ&#x20AC;&#x2122;s syndrome, congenital optic disc pits, choroidal melanoma, and severe intraocular hypotony [12]. All of the possibilities which were mentioned above, excluded in the present case due to age, patient history and ophthalmologic examination findings.

Primack et al. reported a 3.5-year-old boy with a history of ALL that presented with total retinal detachment during a period of remission. Painful glaucoma that was unresponsive to medical therapy necessitated enucleation.

Histopathologic examination showed leukemic infiltration of the retina and optic nerve. The child remained leukemia-free for 3 years following systemic and intrathecal chemotherapy, and craniospinal RT. This was the first reported case of relapsing ALL with retinal detachment as the sole presentation [11].

AzÄąk FM, et al: Exudative Retinal Detachment and ALL

Schmiegelow et al. reported a 17-year-old female ALL patient with serous retinal detachment and choroidal hemorrhagic infiltration as the presenting signs of relapse, without concurrent bone marrow or central nervous system involvement 1 year after cessation of therapy. No malignant cells were observed in subretinal fluid obtained during choroidal biopsy performed via sclerotomy. She was treated with prednisone, topical corticosteroid, and atropine, which resulted in normalization of vision and clinical findings; however, retinal detachment and choroidal infiltration recurred 5 months later. Pars plana vitrectomy and retinotomy were performed to remove subretinal tissue, which showed that there was leukemic infiltration in the choroid and concurrent bone marrow relapse [13].

The presented patient is the fourth reported case of exudative retinal detachment as the sole presenting sign of relapsing ALL in the absence of concomitant systemic involvement. We did not confirm the presence of leukemic cells in the patientâ&#x20AC;&#x2122;s bulbus oculi, because we did not obtain a biopsy specimen due to technical difficulties. We did observe a new growing mass in the bulbus oculi via ultrasonography and MRI, and considered the findings as leukemic relapse. As a general rule, newly observed growing mass lesions are regarded as metastasis in cancer patients unless proved otherwise. The mass in the presented patient responded to local irradiation, and systemic and intrathecal chemotherapy. The mass disappeared, leaving behind crescent-shaped fibrotic tissue in the bulbus oculi. This response confirmed the diagnosis of the mass as leukemic infiltration. There are different therapeutic options for leukemic infiltration of the bulbus oculi in ALL patients; evisceration, enucleation, local RT, and systemic chemotherapy are methods that can be combined, according to each patient (9-11,13,14) In conclusion, local irradiation, and systemic and intrathecal chemotherapy effectively controlled the isolated ocular relapse of ALL in the presented case, and eliminated the necessity for enucleation.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

183

AzÄąk FM, et al: Exudative Retinal Detachment and ALL

References 1. Allen RA, Straatsma BR: Ocular involvement in leukemia and allied disorders. Arch Ophthalmol 1961; 66: 490-508 2. Martin B: Infiltration of the iris in chronic lymphatic leukemia. Br J Ophthalmol 1968; 52: 781-785 3. Robb RM, Ervin LD, Sallan SE: An autopsy study of eye involvement in acute leukemia of childhood. Med Pediatr Oncol 1979; 6: 171-177 4. Fonken HA, Ellis PP: Leukemic infiltrates in the iris. Arch Ophthalmol 1966; 76: 32-36 5. Abramson DH, Wachtel A, Watson CW, Jereb B, Wollner N: Leukemic hypopyon. J Pediatr Ophthalmol Strabismus 1981; 18: 42-44 6. Pui CH, Sandlund JT, Pei D, Campana D, Rivera GK, Ribeiro RC, Rubnitz JE, Razzouk BI, Howard SC, Hudson MM, Cheng C, Kun LE, Raimondi SC, Behm FG, Downing JR, Relling MV, Evans WE: Improved outcome for children with acute lymphoblastic leukemia: Results of Total Therapy Study XIIIB at St Jude Childrenâ&#x20AC;&#x2122;s Research Hospital. Blood 2004; 104: 2690-2696 7. Ridgway EW, Jaffe N, Walton DS: Leukemic ophthalmopathy in children. Cancer 1976; 38: 1744-1749

184

Turk J Hematol 2012; 29: 181-184

8. Ninane J, Taylor D, Day S: The eye as a sanctuary in acute lymphoblastic leukaemia. Lancet 1980; 1: 452-453 9. Stewart MW, Gitter KA, Cohen G: Acute leukemia presenting as a unilateral exudative retinal detachment. Retina 1989; 9: 110-114 10. Tang RA, Vila-Coro AA, Wall S, Frankel LS: Case report.

Acute leukemia presenting as a retinal pigment epithelium detachment. Arch Ophthalmol 1988; 106: 21-22 11. Primack JD, Smith ME, Tychsen L: Retinal detachment in a child as the first sign of leukemic relapse: Histopathology, MRI findings, treatment, and tumor-free follow up. J Pediatr Ophthalmol Strabismus 1995; 32: 253-256 12. Watzke RC: Acquired macular disease. In: Duane TD, ed.

Clinical Ophthalmology. 1th ed. New York: Harper & Row Publishers Inc, 1979: 2-11 13. Schmiegelow K, Scherfig E, Prause JU, Jensen OA: Isolated leukemic choroidal relapse in a child with acute lymphoblastic leukemia one year off therapy, diagnosed through transvitreal retino-choroidal biopsy. Acta Ophthalmol 1988; 66: 33-37 14. Birinci H, Albayrak D, Oge I, Kaman A: Ocular involvement in childhood acute lymphoblastic leukemia. J Pediatr Ophthalmol Strabismus 2001; 38: 242-244

Letter to the Editor

DOI: 10.5505/tjh.2012.44712

A Novel Homozygous Nucleotide Deletion in the JAK2 Gene in a Pediatric Patient with B-cell Precursor Acute Lymphoblastic Leukemia Öncü B Hücreli Çocukluk Çağı Lösemisinde JAK2 Geninde İlk Kez Tanımlanan Homozigot Delesyon Dilara Fatma Akın1, Emel Akkaya1, A. Emin Kürekçi1, Çiğdem Arslan2, Üstün Ezer1, Nejat Akar2 LOSEV Foundation for Children with Leukemia, Ankara, Turkey Ankara University, Department of Pediatric Genetics, Ankara, Turkey

1 2

To the Editor, Janus kinase 2 (JAK2) is a protein tyrosine kinase that transduces cellular signals through the Janus kinase signal transducer and an activator of transcription pathways (JAK-STAT), which mediates cell growth, differentiation, apoptosis, transformation, and other fundamental cell functions, and is active in both normal hematopoiesis and hematological malignancies. Tyrosine kinase protein mutations are important in the development of malignant processes. JAK2 mutations have been identified in myeloproliferative disorders, of which exon 14 V617F mutation is the most common. Other novel mutations were identified in exon 12, which is located at the proximal region of the gene. These reported mutations impair the organization of JAK2 kinase activity [1-4]. Herein, we report a novel homozygous “G” deletion at exon 12 of the JAK2 gene in a pediatric patient with acute lymphoblastic leukemia (ALL).

Case A 20-month-old male patient with persistent high fever, cough, and diarrhea was admitted to the hospital. Physical examination was normal, except for hepatomegaly.

Complete blood count showed pancytopenia with 40% lymphoblasts in his peripheral blood smear. Bone marrow

smear examination showed L1-type diffuse lymphoblastic infiltration. Precursor B-cell ALL was the final diagnosis based on flow cytometric analysis; there were no additional cytogenetic aberrations. Chromosomal analysis showed that the patient was 46 XY. The ALL Berlin-FrankfurtMunster (ALL-BFM 95) standard-risk protocol was initiated. During the treatment there were no problems and the first remission was achieved on the 33rd d of chemotherapy. At the time this manuscript was written, the patient was still in first remission and continuing maintenance therapy.

Blood samples were obtained from the patient and his mother at admission and remission, and the phenolchloroform method was used to extract DNA. Written informed consent was obtained from the parents of patient.

Using primers f5’CTCCTCTTTGGAGCAATTCA3’ and r5’TATCGCAACTCCCAAGTTCTC3’ we amplified and sequenced exon 12 of the JAK2 gene (Beckman Coulter, USA). All sequencing reactions were performed twice, using 2 different PCR products. Sequencing of the exon at admission showed that a homozygous “G” deletion at nt 2078 (in genomic seq./nt 1584 in c-DNA seq.) resulted in substitution of arginine (AGG) with serine (AGC) in codon 528 (Figures 1 and 2) (ref Seq; ENSG00000096968). In all, we scanned 14 patients with ALL.

Address for Correspondence: Dilara Fatma AKIN, M.S. Reşit Galip Caddesi, Ilkadım Sokak, No: 14 Gaziosmanpasa, Ankara, Turkey Phone: +90 536 302 68 16 E-mail: dilara2684@hotmail.com Received/Geliş tarihi : April 14, 2011 Accepted/Kabul tarihi : September 19, 2011

185

Akın DF, et al: Novel Deletion in the JAK2 Gene

Turk J Hematol 2012; 29: 185-187

was first reported in a Down syndrome patient associated with B-cell precursor ALL [7]. Moreover it was recently reported that CRLF2 gene rearrangements were strongly associated with JAK2 mutations [10].

The diagnosis of B-cell precursor ALL in the presented case warrants comprehensive mutational screening of the entire JAK2 gene coding exon in patients with this type of ALL. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Figure 1: Sequencing analysis of exon 12 of the JAK2 gene in the presented case at admission shows deletion of 1584 del G.

Figure 2: Sequencing analysis of exon 12 of the JAK2 gene in the presented case while in remission.

The observed substitution was a novel change. We did not observe “G” deletion in the patient during remission or in his mother. A Western blot showing a truncated protein would have significantly strengthened our report; however, serum sample at admission was unavailable.

The observed mutation affecting the amino acid sequence and disturbing the regulation of JAK2 kinase activity may be a factor expected to cause extreme sensitivity to erythropoietin. Although it was reported that JAK2 V617F mutation is absent in childhood ALL, rare mutations have been reported, especially in Down syndrome patients with acute leukemia [4-9]. A 5-base deletion in the region

186

References 1. Butcher CM, Hahn U, To LB, Gecz J, Wilkins EJ, Scott HS, Bardy PG, D’Andrea RJ: Two novel JAK-2 exon 12 mutations in JAK2V617F- negative polycythemia vera patients. Leukemia 2008; 22: 870-873 2. Pardanani AD, Levine RL, Lasho T, Pikman Y, Mesa RA, Wadleigh M: Prevalence and clinicopathologic correlates of JAK-2 exon 12 mutations in JAK2V617F-negative polycythemia vera. Leukemia 2007; 28: 1-4 3. Laughlin TS, Moliterno AR, Stein BL, Rothberg PG: Detection of exon 12 Mutations in the JAK2 gene: Enhanced analytical sensitivity using clamped PCR and nucleotide sequencing. J Mol Diagn 2010; 12 (3): 278-282 4. Jeong GE, Kim HS, Kim SM, Lee HL, Yoo JN: Absence of JAK-2 exon 12 mutation in acute leukemias. Acta Haematol 2008; 119: 38-39 5. Sulong S, Case M, Minto L, Wilkins B, Hall A, Irving J: The V617F mutation in JAK2 is not found in childhood acute lymphoblastic leukemia. Brit J Haematol 2005; 130: 964-965 6. Kratz CP, Böll S, Kontny U, Schrappe M, Niemeyer CM, Stanulla M: Mutational screen reveals a novel JAK2 mutation, L611S, in a child with acute lymphoblastic leukemia. Leukemia 2006; 20 (2): 381-383 7. Malinge S, Ben-Abdelali R, Settegrana C, Radford-Weiss I, Debre M, Beldjord K, Macintyre EA, Villeval JL, Vainchenker W, Berger R, Bernard OA, Delabesse E, Penard-Lacronique V: Novel activating JAK2 mutation in a patient with Down syndrome and B-cell precursor acute lymphoblastic leukemia. Blood 2007; 109 (5): 2202-2204

Turk J Hematol 2012; 29: 185-187

8. Bercovich D, Ganmore I, Scott LM, Wainreb G, Birger Y, Elimelech A, Shochat C, Cazzaniga G, Biondi A, Basso G, Cario G, Schrappe M, Stanulla M, Strehl S, Haas OA, Mann G, Binder V, Borkhardt A, Kempski H, Trka J, Bielorei B, Avigad S, Stark B, Smith O, Dastugue N, Bourquin JP, Tal NB, Green AR, Izraeli S: Mutations of JAK2 in acute lymphoblastic leukaemias associated with Downâ&#x20AC;&#x2122;s syndrome. Lancet 2008; 372 (9648): 1484-1492 9. Kearney L, Gonzalez De Castro D, Yeung J, Procter J, Horsley SW, Eguchi-Ishimae M, Bateman CM, Anderson K, Chaplin T, Young BD, Harrison CJ, Kempski H, So CW, Ford AM, Greaves M: Specific JAK2 mutation (JAK2R683) and multiple gene deletions in Down syndrome acute lymphoblastic leukemia. Blood 2009; 113 (3): 646-648

AkÄąn DF, et al: Novel Deletion in the JAK2 Gene

10. Harvey RC, Mullighan CG, Chen IM, Wharton W, Mikhail FM, Carroll AJ, Kang H, Liu W, Dobbin KK, Smith MA, Carroll WL, Devidas M, Bowman WP, Camitta BM, Reaman GH, Hunger SP, Downing JR, Willman CL: Rearrangement of CRLF2 is associated with mutation of JAK kinases, alteration of IKZF1, Hispanic/Latino ethnicity and a poor outcome in pediatric B-progenitor acute lymphoblastic leukemia. Blood 2010; 115 (26): 5312-5321

187

Letter to the Editor

DOI: 10.5505/tjh.2012.80008

Successful Treatment of Refractory Diamond-Blackfan Anemia Using Metoclopramide and Prednisolone Tedaviye Dirençli Diamond-Blackfan Anemisinin Metoklopramid ve Prednizolon ile Başarılı Tedavisi Barış Malbora, Zekai Avcı, Namık Özbek Baskent University, School of Medicine, Department of Pediatric Hematology, Ankara, Turkey

To the Editor, Diamond-Blackfan anemia (DBA) is a rare congenital hypoplastic anemia characterized by severe normochromic-macrocytic anemia, reticulocytopenia, a decrease in the number or absence of bone marrow erythroid precursor cells, and normal megakaryocytic and granulocytic differentiation [1-4]. Herein we report the successful treatment of steroid-refractory DBA in a 10-month-old male using prednisolone plus metoclopramide.

The patient was referred to our hospital for evaluation of severe anemia. The first indication of severe anemia occurred 2 months earlier. He received red blood cell transfusion at that time. Physical examination at admission to our hospital showed the infant was pale. Laboratory findings were as follows: hemoglobin (Hb) level: 4.5 g dL–1; mean corpuscular volume (MCV): 73 fL; red cell distribution width: 21.6%; reticulocyte count: 0.44%; white blood cell count: 14.9 x 109 L–1; platelet count: 391 x 109 L–1. Hypochromic microcytic erythrocytes, normochromic erythrocytes, macrocytic erythrocytes, and normal platelets were also noted. Biochemical and urine analyses were normal. Hb electrophoresis showed an elevated HbA2 level in the patient (4.1%) and in his father (4.3%), which was compatible with the β-thalassemia trait. The patient’s red cell adenosine deaminase level (1321 IU L–1) was high (reference: 788 IU L–1). Bone marrow aspiration biopsy showed decreased erythropoiesis, with normal myeloid precursors and megakaryocytes.

The patient was given prednisolone 2 mg· kg–1·d–1 for 1 month, but did not respond, and was then treated with a tapered regimen of high-dose methylprednisolone (30 mg· kg–1·d–1 for 3 d, followed by 20 mg· kg–1·d–1 for 4 d), and again no improvement was observed. The patient received red blood cell transfusion twice during corticosteroid therapy to treat severe anemia. Due to resistance to steroid treatment, we initiated metoclopramide 0.3 mg·kg–1·d–1 (3 times daily). On the day 28 of metoclopramide therapy the patient’s Hb level increased to 10.7 g dL–1. Steroid treatment was reduced, and then withdrawn after metoclopromide therapy was initiated. The patient’s Hb level was 5.5 g dL–1 and his reticulocyte count was 2.4% after 6 months of metoclopromide treatment. Pulse steroid was given, the steroid dose was reduced to 1 mg·kg–1·d–1, and the metoclopromide dose was increased to 0.5 mg·kg–1·d–1. Metoclopramide was decreased to 0.2 mg·kg–1·d–1 (twice daily administration) and steroid was decreased to 0.25 mg·kg– 1 –1 ·d after 2 years of treatment. At the time this report was prepared the patient had been receiving metoclopramide without steroids for 7 months, and his Hb level was within normal limits (Figure 1).

Several medications have been used to treat both steroid-dependent and steroid-refractory DBA patients [1,4].

Metoclopramide induces prolactin release, which improves erythropoiesis indirectly—possibly mediated via bone marrow microenvironmental cells released by the pituitary gland [5,6]. Recently, metoclopramide has been shown to be an effective therapy for DBA [5,6,8]. Abkowitz et al. [5]

Address for Correspondence: Barış Malbora, M.D., Başkent Üniversitesi Tıp Fakültesi, Çocuk Hematoloji Bilim Dalı, Ankara, Turkey Phone: +90 312 212 68 68 E-mail: barismalbora@gmail.com Received/Geliş tarihi : April 17, 2011 Accepted/Kabul tarihi : November 14, 2011

191

Malbora B, et al: Refractory Diamond-Blackfan Anemia and Metoclopramide

Turk J Hematol 2012; 29: 191-192

Conflict of Interest Statement None of the authors have any conflicts of interest, including specific financial interests, relationships, and/ or affiliations, relevant to the subject matter or materials included in this manuscript.

References

Figure 1: The patientâ&#x20AC;&#x2122;s hemoglobin values and the drugs he was administered.

PS: Pulse steroid; RBCT: red blood cell transfusion.

reported that a DBA patient of theirs with pure red cell aplasia transiently improved during pregnancy and lactation. This improvement was associated with an increase in the secretion of prolactin. Following this index case, other researchers used metoclopramide to treat 9 patients with DBA that were refractory to other therapies, and 3 of them responded. Metoclopramide was successfully used in the presented patient, who did not respond to treatment with standard-dose and high-dose methylprednisolone.

The adverse effects of metoclopramide include agitation, fatigue, headache, extrapyramidal reactions, and hyperprolactinemia. It was reported that hyperprolactinemia has a carcinogenic effect in rodents and humans; it also increases the risk of breast cancer in pre- and post-menopausal women. Nonetheless, the relationship between hyperprolactinemia and prostate cancer is not as strong as its relationship with breast cancer [9]. The relationship between the serum prolactin level and cancer has not been established in childhood, which necessitates further research. Treatment with metoclopramide was effective in the presented patient. Because this agent is relatively inexpensive and safe for patients with DBA that are refractory to steroids, we think that metoclopramide can be considered a drug of choice for patients with DBA. Acknowledgement Oral and written informed consent was obtained from the patientâ&#x20AC;&#x2122;s parent. The present case report protocol conformed to the principles outlined in the Declaration of Helsinki (1975) and later revisions, and was approved by the Baskent University, School of Medicine Ethics Committee, Ankara, Turkey.

192

1. Flygare J, Karlsson S: Diamond-Blackfan anemia: Erythropoiesis lost in translation. Blood 2007; 109 (8): 3152- 3154 2. Lipton JM, Atsidaftos E, Zyskind I, Vlachos A: Improving clinical care and elucidating the pathophysiology of Diamond Blackfan anemia: An update from the Diamond Blackfan Anemia Registry. Pediatr Blood Cancer 2006; 46: 558-564 3. Da Costa L, Willig TN, Fixler J, Mohandas N, Tchernia G: Diamond-Blackfan Anemia. Curr Opin Pediatr 2001; 13: 10-15 4. Willig TN, Gazda H, Sieff CA: Diamond-Blackfan anemia.

Curr Opin Hematol 2000; 7 (2): 85-94 5. Abkowitz JL, Schaison G, Boulad F, Brown DL, Buchanan GR, Johnson CA, Murray JC, Sabo KM: Response of Diamond-Blackfan Anemia to metoclopramide: Evidence for a role for prolactin in erythropoiesis. Blood 2002; 100: 2687-2691 6. Akiyama M, Yanagisawa T, Yuza Y, Yokoi K, Ariga M, Fujisawa K, Hoshi Y, Eto Y: Successful treatment of Diamond-Blackfan Anemia with metoclopramide. Am J Hematol 2005;78:295-298 7. Diamond LK, Blackfan KD: Hypoplastic anemia. Am J Dis Child 1938; 56: 464-467 8. Nawel G, Fethi M, Kouki R, Mohamed B: Successful treatment of Diamond Blackfan anemia with metoclopramide. J Pediatr Hematol Oncol 2007; 29 (10): 728 9. Harvey PW, Everett DJ, Springall CJ: Adverse effects of prolactin in rodents and humans: Breast and prostate cancer. J Psychopharmacol 2008; 22: 20-27

Letter to the Editor

DOI: 10.5505/tjh.2012.02360

Percutaneous Vertebroplasty for Osteoporotic Vertebral Fracture in a Patient with Sickle Cell Disease Osteoporotik Vertebral Fraktürü olan Orak Hücreli Anemili bir Hastada Perkutan Verebroplasti Mahmut Yeral1, Levent Oğuzkurt2, Can Boğa1, Hakan Özdoğu1 Başkent University, School of Medicine, Department of Hematology, Ankara, Turkey Başkent University, School of Medicine, Department of Radiology, Ankara, Turkey

1 2

To the Editor, Percutaneous vertebroplasty (PVP) is a procedure in which bone cement is injected into vertebrae under fluoroscopic guidance. It was reported to be effective and safe for the treatment of back pain due to compression fractures of the spine [1,2]. As PVP has been successfully used to treat compression fractures of the spine in patients with malignant and non-malignant hematologic diseases, we thought that it might also be beneficial for patients with sickle cell disease (SCD) that have vertebral compression fractures.

from the vertebral corpus was not observed, which was confirmed via CT (Figure 1).

Using a visual analog scale (VAS) we assessed the patient’s functional status and quality of life pre PVP, and 1 week, 1 month, and 6 months post PVP (Table 1) [3].

During the first post-PVP week the patient was able to perform daily activities with only mild pain. No limitations in her movements were observed, but she did occasionally

A 22-year-old female with homozygous SCD was admitted to hospital due to severe waist and back pain that had limited her ambulation for the previous 6 months, and she has been bedridden for a month. Physical examination showed tenderness localized to the back and waist regions.

Computed tomography (CT) of the vertebrae showed compression fractures at L3, L4, and L5. The compression fracture at L4 was more severe During the first week of hospitalization, non-steroidal anti-inflammatory drugs (NSAIDs) and opioid analgesics were ineffective for sustained pain relief. PVP was performed on d 8 of hospitalization because her symptoms didn’t improve Under fluoroscopic guidance, an 15-guage needle was advanced to the vertebral body of L4, and then that of L3 via a transpedicular approach. Cement was injected into L3 (3 mL) and L4 (2.5 mL). Cement leakage

Figure 1: Post-PVP lateral radiogram of the 2 vertebrae shows complete filling of both vertebral bodies with cement. Cement leakage was not observed from the posterior part of either vertebral body.

Address for Correspondence: Mahmut Yeral, M.D., Department of Hematology, Baskent University Adana Teaching and Medical Research Center, Yüregir Adana, Turkey Phone: +90 322 327 27 27 / 2164 E-mail: mahmutyeral@yahoo.com Received/Geliş tarihi : August 3, 2011 Accepted/Kabul tarihi : November 25, 2011

193

Yeral M, et al: Percutaneous Vertebroplasty in Sickle Cell Disease

Table 1: Quality of life quality and functional status pre and post PVP.

Variable Pain score Ambulation ADL

Pre PVP 10 5 5

1 week 1 month 6 months post post PVP post PVP PVP 2 1 1 2 2 2 2 2 2

Visual analog scale: 1: no pain; 10: the most severe pain.

Ambulation was evaluated using a 5-point Likert-type scale: 1: normal, painless; 2: normal, painful; 3: limited, painful; 4: chair dependent; 5: bedridden.

Activity of Daily Life (ADL) was evaluated using a 5-point Liker-type scale: 1: painless performance of ADL; 2: mildly painful performance of ADL; 3: moderately painful performance of ADL; 4: severely painful performance of ADL; 5: inability to perform ADL due to pain (3).

require NSAIDs for pain relief (VAS: 2; ambulation score 2). Pain score was 1 and ambulation score was 2 at 1month and 6 months post PVP. Vertebral fracture in the presented patient negatively affected her quality of life. Due to the risk of thrombosis and acute chest syndrome, the patient had to become ambulatory as soon as possible, thus PVP was performed.

The patient experienced pain relief and was ambulatory 24 h post PVP. The patient was followed-up closely for possible complications, as to the best of our knowledge she was the first SCD patient to undergo the procedure.

194

Turk J Hematol 2012; 29: 193-194

The patient had no complications during or after the procedure.

In conclusion, although more experience is required for more definitive assessment, based on the presented case, PVP seems to be feasible and effective for rapid pain relief and increasing mobility in SCD patients that have vertebral fractures.

Written informed consent was optained from the patient to undergo the procedure and for publication of her case.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Peh WC, Gilula LA: Percutaneous vertebroplasty: Indications, contraindications and technique. Br J Radiol 2003; 76: 69-75 2. Mathis JM: Percutaneous vertebroplasty: Complication avoidance and technique optimization. Am J Neuroradiol 2003; 24: 1697-706 3. Evans AJ, Jensen ME, Kip KE, DeNardo AJ, Lawler GJ, Negin GA, Remley KB, Boutin SM, Dunnagan SA: Pain reduction and improvement in functional mobility after percutaneous polymethylmethacrylate vertebroplasty retrospective report of 245 cases. Radiology 2003; 226: 366-72

Letter to the Editor

DOI: 10.5505/tjh.2012.52296

Carbamazepine-induced Red Blood Cell Aplasia: A Case Report Karbamazepine Bağlı Kırmızı Kan Hücresi Aplazisi: Bir Olgu Sunumu Halit Özkaya, Gökhan Aydemir, Abdullah Barış Akcan, Mustafa Kul, Ferhan Karademir, Seçil Aydınöz, Selami Süleymanoğlu Gata Haydarpaşa Teaching Hospital, Department of Pediatrics, Uskudar, Istanbul, Turkey

To the Editor, A 2-year-old boy developed pure red cell aplasia (PRCA) during carbamazepine (CBZ) therapy. There was no history of prolonged or profuse bleeding after cuts or injury, and no bleeding from any sites of the body, petechiae, ecchymosis, or bruising. His family history of hematological disorders was negative. The child had been receiving CBZ therapy at a daily dose of 10 mg kg–1 for the last 6 months due to generalized tonic clonic seizures.

One month before starting CBZ the boy’s complete blood count was analyzed due to anorexia and the findings were normal.

The boy was 2 years old when he was admitted to our hospital due to lower respiratory tract infection and severe anemia was then noted . On physical examination he was pale and showed no signs of lymphadenopathy, hepatosplenomegaly, jaundice, or petechiae. Rhonchi and crackles were noted on auscultation of the lungs. The patient was diagnosed as pneumonia and 2nd-generation cephalosporin treatment was initiated. The patient’s laboratory findings on admission were as follows: red blood cell count: 150 x 104 L–1; white blood cell count: 11,000 L–1; hemoglobin concentration: 4.5 g dL–1; hematocrit: 13%; platelet count: 156 x 104 L–1; reticulocytes: 0.2%; MCV: 75 fL; MCH: 22.1 pg; MCHC: 28.1 g/dL. The serum iron level was 60 g dL–1 and total iron binding capacity was 250 g dL–1. Hepatitis B antigen was negative, whereas antibodies were positive. Direct and indirect Coombs test results

were negative. Serum ferritin, vitamin B12, folic acid, and bilirubin were all within the normal range. The patient’s serum CBZ concentration was 6 μg mL–1.

Analysis of bone marrow aspirate showed cellular marrow with normal granulopoiesis and megakaryocytopoiesis, but the almost complete absence of erythroid precursor cells. The possibility of CBZ-induced PRCA was considered and CBZ was withdrawn on d 2 of hospitalization.

The patient required transfusion of packed red cells. Two weeks after CBZ was withdrawn the patient had a rapid reticulocyte response. Analysis of bone marrow aspirate during the recovery phase showed normal erythropoiesis and a myeloid:erythroid ratio of 1:1. PRCA resolved following discontinuation of CBZ. The patient’s serial hemogram results are shown in the Table 1.

Although the hematological toxicity of CBZ is well documented, isolated cessation of red cell production is uncommon [1]. Most of the known adverse effects of CBZ are usually transient and dose-related; however, hematological side effects are the most serious and are often not dose-related [2,3]. PRCA is an uncommon complication of CBZ therapy [4-8]. PRCA exists in several forms, and the most common is an acute self-limited condition [10] that is secondary to virus- and drug-induced impairment of erythroid progenitor cells [9,11]. Acquired PRCA in childhood is classified as primary or secondary. Most cases of childhood primary acquired PRCA include transient erythroblastopenia of childhood (TEC). The causes of secondary acquired PRCA include infections, autoimmune

Address for Correspondence: Abdullah Barış Akcan, M.D., GATA Haydarpaşa Eğitim Hastanesi, Tibbiye Cd, Üsküdar, 34668 İstanbul, Turkey Phone: +90 216 542 20 20 E-mail: barisakc@hotmail.com Received/Geliş tarihi : January 16, 2011 Accepted/Kabul tarihi : May 3, 2011

195

Özkaya H, et al: Carbamazepine-induced Red Blood Cell Aplasia

Turk J Hematol 2012; 29: 195-196

Table 1: The patient’s serial hemogram results.

At presentation Hemoglobin (g dL–1) WBC count (L–1) Polymorphs (peripheral blood smear)% Lymphocytes (peripheral blood smear)% Platelets (L–1) RBC (L–1) MCV (fL–1) MCH (pg) MCHC (g/dL) RDW ( %) Reticulocyte %

4.5 11,000 70 30 156 x 104 150 x 104 75 22.1 28.1 14 2% (corrected 0.2%)

Post blood transfusion

2 weeks after stopping CBZ

7.5 5400 55 45 200 x 104 250 x 104 74 28 30 15

11 7500 38 62 300 x 104 375 x 104 75 30 32 18 4% (corrected 1%)

MCV: Mean corpuscular volume; MCH: mean corpuscular hemoglobin; MCHC: mean corpuscular hemoglobin concentration; RDW: red cell distribution width.

reactions, tumors, drugs, and toxins [3]. Viral causes of PRCA are parvovirus B19, hepatitis virus (hepatitis A and C), Epstein-Barr virus, cytomegalovirus,varicella-zoster virus, human immunodeficiency virus. In the presented patient PRCA was not induced by a virus. Some antiepileptic drugs have been implicated in the development of PRCA, including diphenylhydantoin, sodium valproate, and CBZ. The exact mechanism of erythropoietic suppression exerted by these drugs remains unclear.

This presented case shows that hematological toxicity can occur in response to CBZ treatment, indicating that patient’s treated with CBZ must be monitored closely and regularly; in such patients any decrease in the hemoglobin level requires careful monitoring for the sudden development of serious anemia.

Conflict of Interest Statement None of the authors have any conflicts of interest, including specific financial interests, relationships, and/ or affiliations, relevant to the subject matter or materials included in this manuscript. Informed consent for publication was obtained from the patient’s parents.

References 1. Sobotka JL, Alexander B, Cook BL: A review of carbamazepine’s hematologic reactions and monitoring recommendations. DICP 1990; 24 (12): 1214-1219

196

2. Dessypris EN: The biology of pure red cell aplasia. Semin Hematol 1991; 28: 275-284 3. Marwaha RK, Bansal D, Trehan A, Marwaha N, Varma N: Clinico-haematological profile of pure red cell aplasia in children. J Trop Pediatr 2002; 48 (2): 113-116 4. Djaldetti M, Blay A, Bergman M, Salman H, Bessler H: Pure red cell aplasia-a rare disease with multiple causes. Biomed Pharmacother 2003; 57 (8): 326-332 5. Yamamoto M, Suzuki N, Hatakeyama N, Kubo N, Tachi N, Kanno H, Fujii H, Tsutsumi H: Carbamazepine-induced hemolytic and aplastic crises associated with reduced glutathione peroxidase activity of erythrocytes. Int J Hematol 2007; 86 (4): 325-328 6. Buitendag DJ: Pure red-cell aplasia associated with carbamazepine. A case report. S Afr Med J 1990; 78 (4): 214-215 7. Dessypris EN: Aplastic anemia and pure red cell aplasia.

Curr Opin Hematol 1994; 1 (2): 157-161 8. Medberry CA 3rd, Pappas AA, Ackerman BH: Carbamazepine and erythroid arrest. Drug Intell Clin Pharm 1987; 21 (5): 439-441 9. Sawada K, Hirokawa M, Fujishima N: Diagnosis and management of acquired pure red cell aplasia. Hematol Oncol Clin North Am 2009; 23 (2): 249-259 10. Sawada K, Fujishima N, Hirokawa M: Acquired pure red cell aplasia: Updated review of treatment. Br J Haematol 2008; 142 (4): 505-514 11. Zimmer J, Regele D, de la Salle H: Pure red-cell aplasia. N Engl J Med 1999; 340 (25): 2004-2005

Letter to the Editor

DOI: 10.5505/tjh.2012.68725

Postpartum Acquired Hemophilia Factor VIII Inhibitors and Response to Therapy Doğum Sonrası Kazanılmış Faktör VIII İnhibitörü ve Steroid Tedavisi Volkan Karakuş1, Mustafa Çelik2, Dilek Soysal1, Bahriye Payzın3 Atatürk Research and Training Hospital, Departments of Internal Medicine 1st Division, Izmir, Turkey Atatürk Research and Training Hospital, Departments of Gastroenterology, Izmir, Turkey 3 Atatürk Research and Training Hospital, Departments of Hematology, Izmir, Turkey 1 2

To the Editor, Postpartum-acquired hemophilia A is a rare and potentially severe complication of pregnancy caused by an autoantibody against factor VIII [1]. Acquired factor VIII deficiency is associated with autoimmune conditions, neoplastic diseases, drug hypersensitivity, and pregnancy.

A retrospective study analyzed 51 published cases of postpartum factor VIII inhibitors, with regard to the outcome according to treatment [2]. The annual incidence of acquired hemophilia is 0.2-1/1,000,000 and it is difficult to diagnose. Most patients present with major hemorrhage and the mortality rate is about 22% [3-5].

A 20-year-old female in the postpartum period presented to the hospital with vaginal hemorrhage that had begun 20 d earlier. Examination of the patient showed that there were no obstetrical or gynecologic pathologies, or acute or chronic diseases causing the hemorrhage. The patient’s laboratory data are summarized in the Table 1.

The patient’s activated partial thromboplastin time (APTT) was 68.4 s. A mixing study using a 50:50 mixture of the patient’s plasma and control plasma showed no correction suggesting the presence of an inhibitor. The patient’s factor VIII inhibitor level was 2.5 BU mL–1 (normal: <0.6 BU mL– 1 ). Fresh frozen plasma (174 units), factor VIII (1 unit of VIII:C kg–1 for every 2 percentage point increase in plasma VIII:C), and recombinant FVIIa (Novo-Seven 90 µg kg–1 IV bolus injection, and then the same dose every 3 h for 1

d) was administered; active bleeding was controlled after 2 d of the treatment.

Intravenous immunoglobulin (IVIG, 400 mg kg–1 for 5 d) and IV methylprednisolone (60 mg d–1 for 1 week) was given (as recommended) to eliminate the inhibitor [6]. At follow-up 7 d after the initiation of treatment the patient was clinically stable with a normal aPTT. Methylprednisolone was initiated at 50 mg d–1 8 d after the start of the initial treatment, and was then gradually tapered and stopped over the course of 6 weeks. The patient was discharged from the hospital 15 days after treatment was initiated.

Factor VIII inhibitor was 0.55 BU 4 weeks after delivery.

The patient’s postpartum hemorrhage was attributed to the presence of acquired factor VIII inhibitor.

Factor VIII inhibitor can be seen in healthy pregnant women without a history of bleeding. Prolonged aPTT and normal PTT is the hallmark of laboratory diagnosis.

The objectives of therapy are control of bleeding and elimination of the inhibitor [5,7]. Treatment strategies to control active bleeding include the use of factor VIII concentrates, activated prothrombin complex concentrates (anti-inhibitor coagulant complex, Feiba, Autoplex T), and recombinant human factor VIIa [6,8,9]. Elimination of factor VIII inhibitor requires the use of immunosuppressive modalities. A prospective randomized trial evaluated the efficacy of prednisone and cyclophosphamide alone, and the combination of both

Address for Correspondence: Volkan Karakuş, M.D., İzmir Atatürk Eğitim ve Araştırma Hastanesi, İç Hastalıkları Kliniği, İzmir, Turkey Phone: +90 232 243 43 43 E-mail: dr_v_karakus@yahoo.com Received/Geliş tarihi : January 14, 2011 Accepted/Kabul tarihi : April 18, 2011

197

Karakuş V, et al: Factor VIII Inhibitors in Acquired Hemophilia

Turk J Hematol 2012; 29: 197-198

Table 1: The patient’s laboratory findings.

Laboratory tests

Patient’s Value

Normal Value

aPTT

68.4 s

25.1-34.7 s

PTT

11.4 s

9.4-14.0 s

International normalized ratio

0.91

0.8-1.2

262,000 mm

130-400 mm–3

Factor VIII rate

0.55%

70%-150%

Factor IX rate

103.9%

70%-120%

von Willebrand factor

89.5%

50%-160%

2.5 BU mL–1

<0.6 BU mL–1

Platelet count

–3

Factor VIII inhibitor level drugs in 31 non-hemophilic patients with factor VIII antibodies. All patients initially received prednisone (1 mg·kg–1·d–1 p.o.) for 3 weeks and the antibody disappeared in 10 of the 31 participants (32%) during the initial course of prednisone [10]. Another option for the treatment of acquired factor VIII inhibitors is administration of IVIG [11]. Written informed consent was obtained from the patient for publication.

Acquired hemophilia A is a rare and often fatal disorder.

Because of difficulties and misdiagnosis delays in diagnosis and treatment are common. As such, whenever acquired hemophilia A—with or without bleeding is suspected immediate consultation with a hemophilia experienced in the management of inhibitors should be initiated.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Delgado J, Jimenez-Yuste V, Hernandez-Navarro F, Villar A: Acquired haemophilia: Review and meta-analysis focused on therapy and prognostic factors. Br J Haematol 2003; 121 (1): 21-35 2. Hauser I, Schneider B, Lechner K: Post-partum factor VIII inhibitors. A review of the literature with special reference to the value of steroid and immunosuppressive treatment.

Thromb Haemost 1995; 73 (1): 1-5

198

3. Franchini M: Postpartum acquired factor VIII inhibitors.

Am J Hematol 2006; 81: 768-773 4. Shobeiri SA, West EC, Kahn MJ, Nolan TE: Postpartum acquired hemophilia (Factor VIII inhibitor): A case report and review of the literature. Obstet Gynecol Surv 2000; 55 (12): 729-737 5. Baudo F, de Cataldo F: Acquired factor VIII inhibitors in pregnancy: Data from the Italian Haemophilia Register relevant to clinical practice.BJOG 2003; 110: 311-314 6. Hay CRM, Brown S, Collins PW, Keeling DM, Liesner R: The diagnosis and management of factor VIII and IX inhibitors:a guideline from the United Kingdom Haemophilia Centre Doctors Organisation. Br J Haematol 2006; 133: 591-605 7. Huang Y W, Saidi P, Philipp C: Acquired factor VIII inhibitors in non-haemophiliac patients: Clinical experience of 15 cases. Haemophilia 2004; 10: 713-721 8. Franchini M, Gandini G, Di Paolantonio T, Mariani G: Acquired hemophilia A: A concise review. Am J Hematol 2005; 80 (1): 55-63 9. Lusher JM: Recombinant factor VIIa (NovoSeven) in the treatment of internal bleeding in patients with factor VIII and IX inhibitors. Haemostasis 1996; 26 (1): 124-130 10. Green D, Rademaker AW, Brit E: A prospective, randomized trial of prednisone and cyclophosphamide in the treatment of patients with factor VIII autoantibodies. Thromb Haemost 1993; 70 (5): 753-757 11. Schwartz RS, Gabriel DA, Aledort LM, Green D, Kessler CM: A prospective study of treatment of acquired (autoimmune) factor VIII inhibitors with high-dose intravenous gammaglobulin. Blood 1995; 86 (2): 797-804

Letter to the Editor

DOI: 10.5505/tjh.2012.78055

Successful Treatment of Autoimmune Hemolytic Anemia with Steroid, IVIg, and Plasmapheresis in a Haploidentical Transplant Recipient Haploidentik Transplant Alıcısında Otoimmün Hemolitik Aneminin Steroid, IVIg ve Plazmaferez ile Başarılı Tedavisi Burak Uz1, Evren Özdemir2, Salih Aksu1, Tülay Karaağaç Akyol3, Roy Jones4 Hacettepe University, School of Medicine, Department of Hematology, Ankara, Turkey Hacettepe University, School of Medicine, Department of Oncology, Ankara, Turkey 3 Hacettepe University, School of Medicine, Blood Bank and Apheresis Unit, Ankara, Turkey 4 The University of Texas, MD Anderson Cancer Center, Department of Stem Cell Transplantation, Houston, Texas, USA 1 2

To the Editor, Autoimmune hemolytic anemia (AIHA) is a rare, but clinically significant complication following hematopoietic stem cell transplantation (HSCT). It is characterized by hemolysis due to antibodies produced by the donor’s immune system against donor red cell antigens. The 3-year cumulative incidence of AIHA is 4.44% in adults; however, 75% of patients develop AIHA during the first post-HSCT year [1]. AIHA after allogeneic HSCT has been associated with a variety of conditions, including chronic graft-versus-host disease (GVHD) [2], T-cell depletion [3], and unrelated donor transplants [4]. HSCT from unrelated donors and the development of chronic extensive GVHD were the only independent factors associated with AIHA [1]; however, the incidence of and risk factors for AIHA, as well as its prognosis and response to treatment remain unclear.

A 56-year-old male was diagnosed with high-risk acute myelogenous leukemia in April 2008. He was administered 8 cycles of chemotherapy, including idarubicin, cytosine arabinoside (ara-C), and sorafenib, and achieved complete remission. He remained in remission for 17 months, and then relapsed. He was treated with ara-C, and clofarabine, and achieved complete remission for the second time.

He received a haploidentical (70% matched) bone marrow transplant (BMT) from his son on 03 March 2010, following conditioning with fludarabine, melphalan, and thiotepa, at the MD Anderson Cancer Center. GVHD prophylaxis was tacrolimus 1 mg p.o. twice daily and mycophenolate mofetil 1000 mg p.o. daily.

Stem cell infusion was uneventful, except for mild hypotension. The patient had mild veno-occlusive disease of the liver that eventually resolved, and several (4-5) episodes of CMV viremia, but no evident GVHD throughout his course. His blood type was A–, but the donor (son) was A+. The patient underwent bone marrow biopsy 3 months after transplantation, which showed 1% blasts and no flow cytometric evidence of relapse. Post-transplant microsatellite polymorphism was compatible with successful engraftment. No chimerism was observed. On post-transplant day 208 he presented with septic/hypotensive shock, and was supported with broad-spectrum antibiotics and intravenous fluids. He did not require mechanical ventilation or vasopressor therapy; however, deep anemia was noted (Hb: 3.8 g dL–1) and most of the RBC units cross-matched for transfusion appeared to be incompatible. It was noted that the patient’s blood group had converted to A+, suggesting full erythroid donor chimerism. AIHA was diag-

Address for Correspondence: Burak UZ, M.D., Hacettepe Üniversitesi Tıp Fakültesi, Hematoloji Bilim Dalı, Altındağ, Ankara, Turkey Phone: +90 312 305 15 36 E-mail: burakuz78@gmail.com Received/Geliş tarihi : August 10, 2011 Accepted/Kabul tarihi : October 25, 2011

199

Uz B, et al: Autoimmune Hemolytic Anemia and Plasmapheresis

Turk J Hematol 2012; 29: 199-200

Table 1: The patient’s laboratory results upon admission, after each plasmapheresis, and upon discharge.

Normal Upon After 1st After 2nd After 3rd After 4th Upon range admission plasmapheresis plasmapheresis plasmapheresis plasmapheresis discharge Hb (g dL–1)

13.6-17.2

3.8

3.2

9.4

8.3

8.4

8.5

WBC (x 103 μL–1)

4.3-10.3

14.8

18

13,9

9,9

12.6

11

Plt (x 103 μL–1) 156-373

192

229

148

97

112

120

Ret (%)

0.6-2.6

4.3

N/A

N/A

N/A

4.97

N/A

LDH (U L–1)

240-480

489

N/A

916

652

630

471

I. Bil (g dL–1)

0.1-0.9

1.54

N/A

1,22

1,05

0.75

0.50

Haptoglobin (mg mL–1)

36-195

<5.83

N/A

N/A

N/A

16.5

17.6

DAT

negative

positive

positive

positive

positive

N/A

N/A

IAT

negative

negative

negative

negative

negative

N/A

N/A

Hb: hemoglobin; WBC: white blood cell; Plt: platelet; Ret: reticulocyte; LDH: lactate dehydrogenase; I. Bil: indirect bilirubin; N/A: not available; DAT: direct antiglobulin test; IAT: indirect antiglobulin test.

nosed, based on fulfillment of all of the following criteria: positive direct antiglobulin test (DAT), negative indirect antiglobulin test (IAT), clinical and laboratory evidence of hemolysis (Table 1), and exclusion of other causes of immune hemolytic anemia.

Methylprednisolone 1 mg kg–1 (60 mg d–1) IV was initiated. Plasmapheresis with fresh frozen plasma (FFP) was performed (median exchange volume: 3014 mL) for 4 days. After the 1st, 2nd, and 3rd plasmapheresis, DAT was positive and IAT was negative (Table 1). The reactives for the DAT test were polyspesific for IgG and C3d. Unfortunately, the patient’s Hb value fell to 3.2 g dL–1 at that time (Table 1). IV immunoglobulin (IVIg) 25 g d–1 was administered the same day as the 2nd and 3rd plasmapheresis (after apheresis). Methylprednisolone was tapered to 40 mg d–1 on the fifth treatment day. As a result, the patient received 17 units of RBC, plasmapheresis 4 times, and IVIg twice during the course of treatment. Two weeks later AIHA was in control without RBC transfusion and the patient was discharged with an Hb value of 8.5 g dL–1 (Table 1). Methylprednisolone was tapered off within a month. Written informed consent was obtained from the patient.

Sanz et al. reported that most patients receive steroids as a primary treatment for AIHA and that the majority of cases do not respond [1]. Based on the response in the presented patient, plasmapheresis in addition to IVIg and corticosteroid should be considered a viable alternative

200

treatment option in patients with AIHA that develops during the post-transplant period.

Conflict of Interest Statement The authors have no conflicts of interest, including specific financial interests, relationships, and/or affiliations, relevant to the subject matter or materials included.

References 1. Sanz J, Arriaga F, Montesinos P, Orti G, Lorenzo I, Cantero S, Puig N, Moscardó F, de la Rubia J, Sanz G, Sanz MA: Autoimmune hemolytic anemia following allogeneic hematopoietic stem cell transplantation in adult patients.

Bone Marrow Transplant 2007; 39: 555-561 2. Graze PR, Gale RP: Chronic graft versus host disease: A syndrome of disordered immunity. Am J Med 1979; 66: 611-620 3. Drobyski WR, Potluri J, Sauer D, Gottschall JL: Autoimmune hemolytic anemia following T cell-depleted allogeneic bone marrow transplantation. Bone Marrow Transplant 1996; 17: 1093-1099 4. O’Brien TA, Eastlund T, Peters Ch, Neglia JP, Defor T, Ramsay NK, Scott Baker K: Autoimmune haemolytic anaemia complicating haematopoietic cell transplantation in paediatric patients: High incidente and significant mortality in unrelated donor transplants for non-malignant diseases.

Br J Haematol 2004; 127: 67-75

Letter to the Editor

DOI: 10.5505/tjh.2012.67878

An Extremely Rare Cause of Bruising in Children: Autoerythrocyte Sensitization Syndrome Çocuklarda Çok Nadir bir Morluk Nedeni: Otoeritrosit Sensitizasyon Sendromu Mesut Okur1, Hakan Turan2, Aybars Özkan3, Cemalettin Güneş1, Kenan Kocabay1 Düzce University, School of Medicine, Department of Pediatrics, Düzce, Turkey Düzce University, School of Medicine, Department of Dermatology, Düzce, Turkey 3 Düzce University, School of Medicine, Department of Pediatric Surgery, Düzce, Turkey 1 2

To the Editor, Autoerythrocyte sensitization syndrome (ASS)—also known as Gardner-Diamond syndrome—is an autoimmune vasculopathy associated with sensitization to phosphatidylserine, a phosphoglyceride of red blood cell membranes [1]. The syndrome was first described in 1955

by Gardner and Diamond in 4 female patients [2]. ASS is typically seen in adult females; however, pediatric and male patients have also been described [2-4]. The disease usually develops after psychic stress. It is characterized by development of painful edematous skin lesions that progress to ecchymoses during the following 24 h [5]. The diagnosis of ASS is confirmed via an autoerythrocyte sensitization test [2]. Herein we report ASS in a previously healthy 7-year-old boy.

The patient presented to the emergency department with spontaneous onset of acute pruritic, painful, edematous ecchymosis on both lower extremities. According to anamnesis, the lesions began as painful edematous plaques, and eventually became purplish. History of trauma and infection was negative. The patient was not taking any medications and his medical history was unremarkable. The patient’s mother had a history of recurrent spontaneous bruising lesions similar to those observed in the patient. Physical examination showed that his vital signs were within normal limits. His weight and height

were in the 50th and 75th percentile, respectively, for his age group.

Red and purple, slightly firm, irregularly shaped ecchymotic patches varying in size were observed below the knees of both legs (Figure 1). Other systemic examinations were normal. The complete blood count and differential were normal. The erythrocyte sedimentation rate was 8 mm h–1 and C-reactive protein was negative. Coagulation studies showed that the prothrombin time, partial thromboplastin time, bleeding time, factor VIII, fibrinogen, D-dimer, anti-thrombin III, protein C, and S levels were normal. Antinuclear antibodies, anti-double-stranded DNA, anticardiolipin antibodies, lupus anti-coagulant, and Coombs’ tests were negative. Hepatitis A, B, and C, toxoplasma, rubella, and cytomegalovirus serology findings were negative. Histopathological examination showed normal epidermis and mild edema, extravascular erythrocytes, and non-specific inflammatory cell infiltration in the dermis. There was no evidence of vasculitis (Figure 2).

Written informed consent was obtained from the patients’ parents.

We intradermally injected 0.1 mL of the patient’s own red blood cells into his right forearm and there was only a mild reaction to the test. No medications were given to the patient, except for a single dose of dexamethasone and pheniramine, which were administered upon admission to

Address for Correspondence: Mesut Okur, M.D., Düzce Üniversitesi Kampüsü Konuralp Yerleşkesi, Tıp Fakültesi Hastanesi, Çocuk Sağlığı ve Hastalıkları Anabilim Dalı, 81620, Düzce, Turkey Phone: +90 380 542 13 90 E-mail: mesutokur@duzce.edu.tr Received/Geliş tarihi : June 27, 2011 Accepted/Kabul tarihi : October 6, 2011

201

Okur M, et al: Autoerythrocyte Sensitization Syndrome

Turk J Hematol 2012; 29: 201-203

Figure 1: Normal epidermis and mild edema, extravascular erythrocytes, and nonspesific inflammatory cell infiltration in dermis.

Figure 2: Red and purple-colored, slightly infiltrated, geographic patterned ecchymotic patches in various sizes on below-knee region.

hospital. The patient was given bed rest. On d 5 of hospitalization the rashes became pale and over the course of the next 5 d disappeared completely. The patient was then discharged and knowledge was given that this benign disorder would recur especially due to stresses to his parents.

No dermal findings or patient complaints were noted at the 10-d post-discharge follow-up.

The most common histological features of ASS are erythrocyte extravasations, dermal edema, and perivascular inflammation [10]. As in the presented patient, there are no specific laboratory anomalies in ASS patients.

Hematological parameters, including hemoglobin, hematocrit, platelet count, peripheral smear, erythrocyte sedimentation rate, electrolytes, bleeding time, prothrombin, thrombin, and partial thromboplastin time, and coagulation factors are usually within normal limits. Laboratory signs of systemic disorders are absent. A reliable diagnostic test for ASS consists of intracutaneous injection of 1 mL of 80% suspension of washed erythrocytes obtained from the patient [2]. Ratnoff reported that the skin test was positive in only 59% of patients tested in his series [7]. The skin test may also be negative in pediatric cases [3]. The presented patient had only a mild reaction to the ASS skin test.

ASS is a chronic, unexplained syndrome that presents with puzzling signs and symptoms [6]. ASS is characterized by painful ecchymotic lesions and is most commonly observed in women experiencing emotional stress or psychiatric disorders [2]. Although ASS is seen usually in adult women, pediatric cases have been reported [3,6].

In the majority of cases the lesions appear when patients experience severe emotional stress [7,8]. This disorder was named as psychogenic purpura based on its association with psychiatric disturbance in the majority of patients [9]. It should be noted, though, that some patients do not have any specific psychopathological syndrome. The presented patient was introverted and shy. Bruises on his legs appeared 1 d after having an argument with his mother and father.

ASS lesions are characterized by sudden onset, pain, swelling, bleeding, and variable size, and can occur on the skin of any part of the body [8]. The lesions vary in size from 1-2 cm in diameter to involvement of an entire limb.

The lesions typically occur on the extremities and rarely on less accessible locations, such as the back. The lesions are preceded by parasthesia or pain [5]. The lesions are recurrent, usually resolving within a period of 2 weeks [7].

202

A large number of pharmacologic agents and intervention have been used to treat ASS, including antihistamines, albumin infusions, corticosteroids, chemotherapy, antidepressants, hormones, vitamin C, and splenectomy [11]; however, none has proved to be of significant benefit in controlling the manifestations of the disease [11]. No medical treatment was administered to the presented patient, other than a single dose of steroid and antihistaminic upon admittance to the hospital. The patientâ&#x20AC;&#x2122;s bruises, pain, and swelling disappeared completely during 10 d of bed rest.

The prognosis of ASS is good and no deaths have been reported due to this syndrome or its complications [5,7].

In some individuals the syndrome may remit for months

Turk J Hematol 2012; 29: 201-203

or years and recur at a time of severe emotional stress [7]. In the majority of patients, relapses may occur in the future after the lesions resolved. However, remissions even may be stable for many years. In fact, in the presence of specific histological changes, positive intracutaneous test results, psychic disorder, onset of lesions associated with stress, and the absence of hematological disorders or systemic diseases, it is not difficult to diagnose ASS. In conclusion, ASS is a rare syndrome most typically observed in adult females with psychological disturbances, but it is important to be aware that ASS can also occur in children. Despite the severe presentation of the disease, prognosis is fairly good. ASS should be considered in the differential diagnosis of purpura and ecchymosis in children.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Boxley JD, Wilkinson DS: Autoerythrocyte sensitization (painful bruising) syndrome. Proc R Soc Med 1971; 64: 1196-1197 2. Gardner FH, Diamond LK: Autoerythrocyte sensitization; a form of purpura producing painful bruising following autosensitization to red blood cells in certain women. Blood 1955; 10: 675-690

Okur M, et al: Autoerythrocyte Sensitization Syndrome

3. Campbell AN, Freedman MH, McClure PD: Autoerythrocyte sensitization. J Pediatr 1983; 103: 157-160 4. Ingber A, Alcalay J, Feuerman EJ: Autoerythrocyte sensitization (Gardner-Diamond syndrome) in men: A case report and review of the literature. Postgrad Med J 1985; 61: 823-826 5. Hersle K, Mobacken H: Autoerythrocyte sensitization syndrome (painful bruising syndrome). Report of two cases and review of the literatre. Br J Dermatol 1969; 81: 574-587 6. Meeder R, Bannister S: Gardner-Diamond syndrome: Difficulties in the management of patients with unexplained medical symptoms. Paediatr Child Health 2006; 11: 416-419 7. Ratnoff OD: Psychogenic purpura (autoerythrocyte sensitization): An unsolved dilemma. Am J Med 1989; 87: 16N-21N 8. Tomec RJ, Walsh M, Garcia JC, Jordan PK: Diagnosis of autoerythrocyte sensitization syndrome in the emergency department. Ann Emerg Med 1989; 18: 780-782 9. Ratnoff OD, Agle DP: Psychogenic purpura: A re-evaluation of the syndrome of autoerythrocyte sensitization. Medicine (Baltimore) 1968; 47: 475-500 10. Black PH, Garbutt LD: Stress, inflammation and cardiovascular disease. J Psychosom Res 2002; 52: 1-23 11. Vun YY, Muir J: Periodic painful purpura: Fact or factitious?

Australas J Dermatol 2004; 45: 58-63

203

Letter to the Editor

DOI: 10.5152/tjh.2011.45

First Observation of MTHFR 678 C-A (Ala222Ala) Single Nucleotide Polymorphism MTHFR C678A (Ala222Ala) Tek Nükleotid Değişiminin İlk Kez Saptanması Yonca Eğin, Nejat Akar Ankara University, School of Medicine, Department of Pediatric Molecular Genetics, Ankara, Turkey

To the Editor, The enzyme methylenetetrahydrofolate reductase (MTHFR) plays a key role in folate metabolism. MTHFR catalyses NADPH-linked reduction of N5,10-methylenetetrahydrofolate to N5-methylene tetrahydrofolate. The MTHFR gene exhibits 2 common genetic polymorphisms (C677T and A1298C). The MTHFR 677 C to T substitution converts alanine to a valine residue, resulting in a thermolabile enzyme [1]. A reduction in MTHFR activity leads to an elevated plasma homocysteine level, which has been implicated as a risk factor for vascular and thromboembolic disease [2-4].

Real-time polymerase chain reaction (RT-PCR) facilitates quantification of polymorphic DNA regions and genotyping of single nucleotide polymorphisms (SNPs), including MTHFR C677T base substitution. The system is optimized to detect the difference in the Tm of the mutant and the wild-type allele using commercially available primers and hybridization probes [5]. Recently, MTHFR C685G (Iso225Val) and G679A (Asp223Asn) mutations other than the common MTHFR C677T were reported based on different melting points and RT-PCR [6], with an allele frequency of 1 in 3000-4000 samples [5].

A male patient’s DNA was isolated using a MagnaPure automatic isolation system (Roche Diagnostics, Indianapolis, USA). Genotyping of the MTHFR C677T polymorphism was performed via RT-PCR and fluorescence melting curve detection analysis using a LightCycler sys-

tem (Roche Diagnostics, Manheim, Germany). Written informed consent was provided by the patient.

The PCR product was purified using a Wizard SV PCR clean-up system (Promega, Madison, WI, USA), and sequenced using a CEQ Dye Terminator Cycle sequencing kit and a CSQ 8000 genetic analysis system (Beckman Coulter, Brea, CA, USA). Nucleotide changes were confirmed via a new PCR reaction, followed by sequencing analysis The patient had an unusual RT-PCR analysis melting point profile. The patient’s DNA was further analyzed via DNA sequencing, which showed a nucleotide change at 678 C>A that does not lead to an amino acid change (AlaAla). This polymorphism was not previously reported. Retrospectively, 4100 samples from our laboratory’s archives were analyzed, but none of these samples had an MTHFR 678C-A change.

Research has shown that worldwide there is great variation in the prevalence of the MTHFR 677C-T mutation [2,7,8]. Several laboratory techniques are used to detect MTHFR C677T; the most common and reliable technique is melting point analysis, which can differentiate variants that lie within the region of the target probe. Differences in the base composition and nucleotide position affect Tm in wild-type and target mutations. Variants with Tm shifts of 2-5 °C are easily visualized during experiments, as was the case of MTHFR and other thrombophilia genes [5,9,10].

Address for Correspondence: Yonca Eğin, M.D., Ankara Üniversitesi Tıp Fakültesi, Pediatrik Moleküler Genetik Bilim Dalı, Dikimevi, 06100, Ankara, Turkey Phone: +90 312 595 63 48 E-mail: yonca_egin@yahoo.com Received/Geliş tarihi : May 26, 2010 Accepted/Kabul tarihi : June 17, 2010

204

Turk J Hematol 2012; 29: 204-205

In the present study we reported a new heterozygous MTHFR gene polymorphism (678 C>A), with an unusual melting point profile. Although rare, the finding of MTHFR 678C>A polymorphism indicates that this might be technically important, as it may lead to erroneous reporting.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Frosst P, Blom HJ, Milos R, Goyette P, Sheppard CA, Matthews RG, Boers GJ, den Heijer M, Kluijtmans LA, Van den Heuvel LP, Rozen R: A candidate genetic risk factor for vascular disease: A common mutation in methylenetetrahydrofolate reductase. Nature Genet 1995; 10: 111-113 2. Guba SC, Fink LM, Fonseca V: Hyperhomocysteinemia.

An emerging and important risk factor for thromboembolic and cardiovascular disease. Am J Clin Pathol 1996; 106: 709-722 3. Clarke R, Daly L, Robinson K, Naughten E, Cahalane S, Fowler B, Graham I: Hyperhomocysteinemia: an independent risk factor for vascular disease. N Eng J Med 1991; 324: 1149-1155

Eğin Y and Akar N: MTHFR 678 C-A (Ala222Ala) Change

4. Boers GH, Smals AG, Trijbels FJ, Fowler B, Bakkeren JA, Schoonderwaldt HC, Kleijer WJ, Kloppenborg PW: Heterozygosity for homocystinuria in premature peripheral and cerebral occlusive arterial disease. N Engl J Med 1985; 313: 709-715 5. Lyon E: Discovering rare variants by use of melting temperature shifts seen in melting curve analysis. Clin Chem 2005; 51: 1331-1332 6. Erali M, Schmidt B, Lyon E, Wittwer C: Evaluation of electronic microarrays for genotyping factor V, factor II and MTHFR. Clin Chem 2003; 49: 732-739 7. Schneider JA, Rees DC, Liu YT, Clegg JB: Worldwide distribution of a common methylenetetrahydrofolate reductase mutation. Am J Hum Genet 1998; 62: 1258-1260 8. Bourouba R, Houcher B, Djabi F, Egin Y, Akar N: The Prevalence of Methylenetetrahydrofolate Reductase 677 C-T, Factor V 1691 G-A, and Prothrombin 20210 G-A Mutations in Healthy Populations in Sétif, Algeria. Clin Appl Thromb Hemost 2009; 15 (5): 529-534 9. Ozdag H, Egin Y, Akar N: Prothrombin gene 20209 C >T along with the first description of a homozygous polymorphism at the 3’ downstream region +4 C >T in the Turkish population. Lab Hematol 2006; 12 (3): 131-133 10. Mahadevan MS, Benson PV: Factor V Null Mutation Affecting the Roche Light Cycler Factor V Leiden Assay.

Clin Chem 2005; 51: 1533-1535

205

Images in Hematology

DOI: 10.5505/tjh.2012.72324

Myeloma Cells with Auer Rod-like Inclusions Auer Çubuğu Benzeri İnklüzyonlara Sahip Myeloma Hücreleri Abbas Hashim Abdulsalam1, Fatin Mohammed Al-yassin2 Al-Yarmouk Teaching Hospital, Teaching Laboratories Department, Hematology Unit, Baghdad, Iraq Baghdad Medical City, Teaching Laboratories, Hematology Department, Baghdad, Iraq

1 2

Myeloma cells with Auer-rod like inclusions Analysis of bone marrow aspirate obtained from a 47-year-old female that presented with backache showed that she had IgG-κ-type multiple myeloma and renal impairment. FBC showed the following: Hb: 100 g L–1; Hct: 0.34 l/l; WBC: 9.5 x 109 L–1; platelet count: 194 x 109 L–1; differential count: normal.

The presented image showings heavily granulated myeloma cells, some with Auer rod-like inclusions. Auer rod-like inclusions in myeloma are composed of crystallized lysosomal enzyme depositions. They are distinguished from intracytoplasmic immunoglobulin crystals.

The factors that predispose to Auer rod-like inclusions in myeloma are unknown; however, in all reported cases paraprotein was of the kappa type. [1]

Written informed consent was obtained from the patient.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Reference 1. Hutter G, Nowak D, Blau IW, Thiel E: Auer rod like intracytoplasmic inclusions in multiple myeloma. A case report and review of literature. Int J Lab Hematol 2009; 31: 236-240

Figure 1: Heavily granulated myeloma cells, some with Auer rod-like granules.

Address for Correspondence: Abbas Hashim Abdulsalam, M.D., Al-Yarmouk Teaching Hospital 964 Baghdad, Iraq Phone: +90 964 7904 188690 E-mail: dr.abbas77@yahoo.com Received/Geliş tarihi : March 21, 2011 Accepted/Kabul tarihi : May 3, 2011

206