tjh-2013-1

DOI: 10.4274/tjh.2012.0127

Review

Effects of Spaceflight on Cells of Bone Marrow Origin Uzay Uçuşlarının Kemik İliği Kökenli Hücreler Üzerindeki Etkileri Engin Özçivici İzmir Institute of Technology, Department of Mechanical Engineering, İzmir, Turkey

Abstract: Once only a subject for science fiction novels, plans for establishing habitation on space stations, the Moon, and distant planets now appear among the short-term goals of space agencies. This article reviews studies that present biomedical issues that appear to challenge humankind for long-term spaceflights. With particularly focus on cells of bone marrow origin, studies involving changes in bone, immune, and red blood cell populations and their functions due to extended weightlessness were reviewed. Furthermore, effects of mechanical disuse on primitive stem cells that reside in the bone marrow were also included in this review. Novel biomedical solutions using space biotechnology will be required in order to achieve the goal of space exploration without compromising the functions of bone marrow, as spaceflight appears to disrupt homeostasis for all given cell types.

Key words: Hematopoetic stem cells, Blood cells, Immunity, Stem cell physiology, Lymphocyte, Monocyte

Özet: Uzay istasyonları, Ay ve uzak gezegenlerde insan yaşantısının sürdürülmesi her ne kadar bilim kurgu romanlarının öğesi olsa da, bugün uzay ajanslarının kısa vadeli hedefleri arasında yer göstermeye başlamıştır. Bu bilimsel derleme, insanoğlunun uzun süreli uzay uçuşları sırasında karşılaştığı biyomedikal problemleri sunma hedefiyle yazılmıştır. Özellikle kemik iliği kökenli kemik, kan ve bağışıklık hücrelerine yoğunlaşılan derlemede bu hücrelerin ağırlıksız ortamda yaşadığı sayısal ve fonksiyonel değişiklikler sunulmuştur. Mekanik kuvvet yoksunluğunun sadece özelleşmiş hücrelerde değil aynı zamanda kemik iliği içinde varolan öncül kök hücrelere olan etkisi de derlemeye eklenmiştir. Özetle, uzay uçuşları kemik iliğinde bulunan bütün hücrelerin düzenini bozduğu için, uzun süreli uçuşlarının sağlıklı gerçekleşme potansiyelinin ağırlıksız ortamın yarattığı ters etkileri ortadan kaldırabilecek yenilikçi biyomedikal çözümler ve uzay teknolojilerine bağımlı olacağı öngörülmüştür.

Anahtar Sözcükler: Hematopoetik kök hücreler, Kan hücreleri, Bağışıklık, Kök hücre fizyolojisi, Lenfosit, Monosit

Introduction Space travel is among the top goals of humankind. Significant progress has been made in spaceflight technologies since the 1960s. These improvements extended the duration of space

habitation from minutes to days, months, and even years in some cases [1]. Human activity beyond the low orbit is not expected to cease, as prospective plans for long-duration space missions to the Moon and Mars are in action [2]. From a purely technical

Address for Correspondence: Engin ÖZÇİVİCİ, M.D., İzmir Institute of Technology, Department of Mechanical Engineering, İzmir, Turkey Phone: +90 232 750 67 76 E-mail: enginozcivici@iyte.edu.tr Received/Geliş tarihi : September 10, 2012 Accepted/Kabul tarihi : November 27, 2012

1

Özçivici E: Spaceflight and Bone Marrow

standpoint, the duration of a spaceflight is a problem of logistics that requires careful optimization of escape trajectories with required fuel and sustenance. However, the biological response of astronauts (and cosmonauts] to space, an environment in which spaceship crew constantly experience weightlessness, presents equally challenging and unique biomedical problems for the duration of spaceflight missions. These challenges need to be addressed for humans to travel, live, and work in space and on distant planets.

The human adaptive response to weightlessness encompasses numerous conditions that may affect the possibility of long-term flight missions [3]. These conditions include space motion sickness, cardiovascular deconditioning due to reduced blood volume, and prolonged gastrointestinal transit time. Moreover, the immune system is known to be suppressed while bacterial pathogens appear to be unaffected by, if not benefiting from, spaceflight conditions. Severe and progressive catabolism in space also affects the musculoskeletal system. Spaceship crew members progressively lose bone minerals from weight-bearing sites, increasing their susceptibility to kidney stones (nephrolithiasis] during flight as well as traumatic or non-traumatic fracture both during and after the flight mission. Loss in bone mass is also accompanied with significant losses in leg muscle volumes caused by muscle atrophy.

Mission fidelity and optimum quality of life for spaceship crew is endangered by these medical conditions. Prophylactic and/or treatment strategies to alleviate these adverse conditions are the subject of active research in space biomedicine. Furthermore, even though some of these conditions are transient and recovery is observed after returning to regular weight-bearing activities, some others may remain persistent for the crew. Given that bone turnover activity and cellular constituents of the immune system are actively regulated by progenitor/stem cells that reside in the bone marrow, adverse effects of disuse caused by weightlessness on these cells have to be analyzed carefully in order to develop strategies to improve spaceflight periods and even make it possible for spaceship crew to populate other planets or satellites. The goal of this review is to present up-to-date biomedical research addressing the response of bone marrow cells to disuse caused by loss of weight-bearing.

Turk J Hematol 2013;30:1-7

environments [8]. Based on these decisions made by corresponding cells, tissues may follow by altering their form and function. For example, individual muscle fiber (sarcomere] contractions and accumulated damage during physical exercise triggers events that eventually increase the muscle tissue mass of an athlete, a process that would make the athlete physically stronger. Conversely, because of the reduction of mechanical loads during spaceflight, spaceship crew members constantly lose bone mineral from weight-bearing sites of the skeleton [9]. This adaptive response of cells to the presence and absence of mechanical loads needs to be fully understood in order to foresee and prevent negative effects of sustained weightlessness experienced on longterm spaceflights.

Cellular Niche in the Bone Marrow Protected within a calcified cortex, bone marrow houses different types of cells from various developmental backgrounds with absolute importance to the survival of the organism. Other than the small fraction of endothelial cell lineage that primarily forms the marrow vasculature, cells in the bone marrow can be compartmentalized into 2 types with respect to their origins, as mesenchymal and hematopoietic cells.

Mesenchymal cells can mainly be found in bone, muscle, cartilage, and fat tissues, and they come from a common ancestor, the mesenchymal stem cells. In the bone marrow, mesenchymal stem cells can act as osteoprogenitors, with appropriate endocrine, paracrine, and/or autocrine signals [10]. Osteoprogenitors can drive bone formation by transforming into osteoblasts, the cells responsible for the growth, maintenance, and repair of bone tissue.

Mesenchymal stem cells were also shown to commit to the lineages of other mesenchymal tissues such as cartilage, fat, marrow stroma, liver, kidney, and muscle cells [11,12,13,14].

Mechanical Loads in Biology

Hematopoietic cells, on the other hand, are non-adherent and constitute cells of lymphoid (B cells, T cells, etc.) and myeloid (granulocytes, macrophages, megakaryocytes, etc.) origins [15].

These cells descend from a common progenitor called the hematopoietic stem cell. In the bone marrow, hematopoietic stem cells generally position (and home) themselves to the proximity of cells of mesenchymal origin [16], highlighting the communicating and regulatory behavior between mesenchymal and hematopoietic cells.

Since life has evolved in the presence of 1 g (‘g’ being Earth’s gravitational pull, which is a constant acceleration of 9.81 m/s2] for the last couple of billion years without any interruption in the gravitational field, all cells are adapted to survive and thrive in the presence of mechanical signals. Mammalian cells, similar to plant [4], fungal [5], and bacterial cells [6], can detect and adapt to mechanical forces [7]. The source of these physical forces can be both external (atmospheric pressure, sea waves, wind, etc.] and internal (weight occurring from gravity, blood pressure, interstitial fluid shear, etc.] for organisms. Since mechanical forces are omnipresent in the environment, cells can base numerous decisions about proliferation, migration, commitment, matrix synthesis, and maintenance on the mechanical inputs from their

In a healthy individual, processes such as regeneration, nutrient exchange, metabolite storage, and protection from pathogens are optimized via integrated functioning of marrow cells. Conditions that partially or completely remove mechanical loads on the bone and the bone marrow tissue, such as aging, obesity, bed rest, and spaceflight, adversely affect the marrow cell populations and their functions. Furthermore, the gross composition of the marrow irreversibly changes from red (hematopoietic) to yellow (fatty), indicating a potentially greater scale of disruption in homeostasis. It can be argued that, collectively, these alterations in bone marrow tissue may increase the incidence of morbidity and may even affect longevity for astronauts during long-duration space missions.

2

Turk J Hematol 2013;30:1-7

Bone Cells and Spaceflight Perhaps the most prominent function of mesenchymal cells in the bone marrow is to contribute to bone formation. Once adequate exogenous signals are received (biophysical and/or biochemical), mesenchymal stem cells commit to osteoblastic lineage. Lining on the calcified tissue, osteoblasts are responsible for new bone formation by attracting calcium ions [17,18]. During this mineralization phase, osteoblasts become trapped in the osteoid lacunae they had been building and transform into osteocytes, a cell type that constitutes the biggest fraction of cells within the bone tissue with important regulatory functions in bone remodeling [19,20]. Parallel to new bone tissue formation, existing bone tissue is actively resorbed by osteoclasts, a large and multinucleated cell type. Osteoclasts come from a monocytemacrophage origin, and once activated, they facilitate the resorption of the calcified tissue using extracted components with low pH, leading to a net effect of bone loss if their work is not complemented with osteoblasts [21]. Osteoblasts rapidly migrate into perfusions made by osteoclasts and initiate bone formation.

Overall, this entire coupled cycle of formation and resorption is called bone turnover. By using this dynamic turnover process, bone tissue is able to: 1] repair a damaged matrix to maintain its strength, 2] adapt to physical forces by adding more bone in the areas of high loading, and 3] act as an endocrine organ to regulate circulating Ca2+ molecules.

Several conditions that induce reduction in or absence of weight-bearing on long bones influence the coupling between bone formation and resorption, causing osteopenia and eventually osteoporosis [22]. Being either temporary or permanent, these conditions include aging, sedentary lifestyles, confined bed rest, partial paralysis, and spaceflight. During spaceflight, bone mineral is constantly being lost from the weight-bearing sites of the skeleton at an average of 2%-3% per month, accompanied by increases in urine excretion of Ca2+ and hydroxyproline expressing the net bone loss at the tissue level [9,23,24]. Some astronauts were even observed to lose up to 20% bone mass during their missions [25,26], and currently no known plateau exists for this disuseinduced bone loss occurring during spaceflight [27]. Experimental evidence shows that bone formation activity is suppressed during spaceflight at the tissue level [26,28,29], preventing the effective recovery of lost bone tissue for spaceship crew.

On the cellular level, osteoblasts show response to actual (inflight) or simulated weightlessness conditions. Osteoblast proliferation was found to be curbed during weightlessness in parallel with reduced osteoblast metabolism [30]. The inner morphology of osteoblasts is sensitive to weightlessness, as significant alterations in nucleus shape and size were observed during mechanical unloading [31]. Moreover, osteoblasts may suffer from programmed cell death during disuse, effectively reducing their number [32,33]. Other indicators suggest that osteoblasts increase the secretion of chemical factors that enhance osteoclast recruitment [34], thereby stimulating bone resorption process. While some studies did not find any correlations between weightlessness and osteoclast activity [35,36], others showed

Özçivici E: Spaceflight and Bone Marrow

increased osteoclast recruitment and pit formation during disuse [37,38]. Regardless, it is expected that osteoclastic activity be in tune with osteoblastic activity, as osteoblasts tightly control osteoclast maturation and activity [39].

Mesenchymal Stem Cells and Spaceflight Mesenchymal stem cells (MSCs), which reside in the bone marrow, are the main source of osteoprogenitors and osteoblasts.

However, these primitive cells may lose their commitment to osteogenic lineage and commit to adipogenic lineage as a result of loss in mechanical loads [40,41]. Simulated disuse was also shown to decrease the size and functionality of the marrow mesenchymal progenitor pool, thereby adversely affecting the regeneration of the bone tissue [35]. Once the marrow pool of MSCs is lost due to extended weightlessness, it may not be possible for an individual to retain healthy function once returned to regular weight-bearing conditions [41,42,43]. Because of impaired bone formation, regeneration of tissue that was lost during disuse is often slow and incomplete [44]. Since reintroduction of regular mechanical loads is not capable of fully restoring bone tissue, it is imperative for biomedical research to prevent or treat disuse-induced loss of osteogenic potential in the bone marrow, not only to prevent spaceflight mission related injury, but also to protect the quality of life beyond the mission.

Blood Cells and Spaceflight Resident hematopoietic cells in the bone marrow serve as important contributors of erythropoiesis, myelopoiesis, lymphopoiesis, and bone turnover. Evidently, the functioning of hematopoietic cells is not exempt from the adverse effects of spaceflight. Not only does the bone turnover favor catabolism for spaceship crew, but the red blood cell volume is also reduced with an apparent suppression of the immune system [3].

Coming from a myelopoietic origin, red blood cells mature from erythroblasts and have a high turnover rate as they are exposed to severe mechanical stress during circulation [45]. As a result of spaceflight, spaceship crew members lose around 15% of their red blood cell mass over the course of a few weeks, a condition known as “space anemia” [1,46,47]. The loss of red blood cell mass is due to a physiological process called neocytolysis, in which immature blood cells are selectively hemolyzed because of reductions in the plasma erythropoietin levels [48,49]. Significant reductions in the in vitro maturation of hematopoietic cells to red blood cells were also observed in response to weightlessness [50]. During spaceflight conditions, red blood cells were shown to proliferate less and appeared apoptotic, even in the presence of stimulant factors, further contributing to the “space anemia” phenotype [51].

There is strong evidence that spaceship crew members suffer from suppression of the immune system, and the magnitude of this effect may be related to the length of exposure [3].

Abnormalities in the immune system lead to compromised defense against both exogenous and endogenous pathogens, as well as reduced monitoring against aberrant host cells. Unfortunately, experimental observations to date are not conclusive due to small 3

Turk J Hematol 2013;30:1-7

Özçivici E: Spaceflight and Bone Marrow

sample size and variable response. However, observed patterns warrant further attention to clarify net effects of long-term spaceflight on the immune system in order to potentiate human habitation of the Moon, space, and distant planets.

Immune cells that are capable of phagocytosis appear to be affected by spaceflight conditions, as well. The number of polymorphonuclear leukocytes in circulation was repeatedly observed to be increased by 1.5-fold to 2-fold in both short-term and long-term flights [52,53,54,55]. Circulating monocytes were also observed to be increased in numbers after spaceflight [53,55]. However, the phagocytic capacity and oxidative burst potential of neutrophils and monocytes were both found to be significantly reduced in astronauts due to long-term spaceflights, indicating a delay in function for host defense cells against invading pathogens [56,57,58].

T lymphocytes originate from a common lymphoid progenitor (Lin-, IL-7R-, Sca-1low, c-kitlow) in the bone marrow and mature in the thymus gland to facilitate cell-based immunity [59,60]. T lymphocytes have 2 major subpopulations: helper T cells (CD4+) that direct other immune cells by secreting cytokines, and cytotoxic T cells (CD8+) that directly kill infected or cancerous cells. Previous observations suggested that the number of circulating T cells was reduced during spaceflight for both humans and rodents [52,55,61,62]. Furthermore, interleukin-2, which is a biomarker for T cell activity, was found to be decreased after spaceflight for both helper and cytotoxic T cells [52,62]. Activation response of T cells to stimulating agents such as phytohemagglutinin was also found to be diminished as a result of spaceflight [62,63].

B lymphocytes also come from the common lymphoid progenitor in the bone marrow and mediate the humoral immune response [59]. Limited data suggest that the matured B cell fraction was significantly suppressed in rodents that were exposed to spaceflight, but no functional data are available for the observed phenotype. The decrease in B cells was found to be accompanied by an increase in the natural killer cell fraction, a large and granular cell type that is responsible for surveillance of cancer cells [62].

On a side note, unlike immune cells that are apparently impaired in number and function during spaceflight, bacterial cells may not be affected at all by the weightlessness environment.

On the contrary, several strains, including Salmonella enterica and Escherichia coli, were found to benefit from spaceflight [64,65]. Bacterial resistance to antibiotics was also found to be increased [66], with records showing higher rate of mutation accumulation [67]. Unfortunately, artificial environments such as space ships contain many components in which bacteria and mold can thrive, pointing to an increased hazard rate that may be potentiated during long-term spaceflights [68]. Not only the bacterial pathogens but also the latent endogenous viruses, such as Epstein-Barr and Cytomegalovirus, were found to be reactivated during spaceflight, possibly due to the environmental stresses, increasing the risks of infection and cancer for the spaceship crew [69,70,71].

4

Hematopoietic Stem Cells and Spaceflight Accumulated evidence of the alterations in the red and white blood cell population size and functioning associated with spaceflight may have an array of contributors, including loss of mechanical loads, flight stress, diet, and nutrition. It is also entirely possible that the bone marrow stem cells that are responsible for the replenishment of blood cell types are affected by spaceflight conditions and alter the blood cell phenotype. Hematopoietic stem cells are the self-renewing source of all lymphoid and myeloid cells of an organism and they reside in the bone marrow, where the most primitive hematopoietic stem cells seek and reside in the close proximity of the osteoblasts [16]. Bone marrow-derived CD34+ cells, which are assumed to be early hematopoietic progenitors, showed reduced proliferation rate due to slower cell cycle progression when exposed to simulated weightlessness without losing their capacity for self-renewal [72]. Furthermore, CD34+ cells appeared less attracted to stromal cell-derived factor, a chemical agent that stimulates the migration of early hematopoietic cells [73,74]. Ultrastructural properties of CD34+ cells reflected this reduced chemotaxis, as expressed with reduced cytoskeletal F-actin expression [73]. Functional characteristics of early hematopoietic progenitors were also found to be affected, as observed in the altered maturation to erythrocytes, granulocytes, and macrophages [50,73].

Actual spaceflight and simulated weightlessness data from hematopoietic stem cells (HSCs) are limited compared to data from experiments involving other cell types (such as osteoblasts or T cells), as recognition of these primitive cell types in the bone marrow is a recent development [16,75]. However, HSCs are expected to be affected by weightlessness as they were shown to sense and respond to the presence of mechanical loads [76].

Another important aspect of HSC response to weightlessness is the interaction with mature osteoblasts. Osteoblasts support HSCs in vivo [77,78], and the ablation of osteoblasts in the bone marrow induces extramedullary hematopoiesis [79]. Furthermore, osteoblasts were shown to be important mediators of B cell and megakaryocyte differentiation [80,81]. During spaceflight, trabecular bone tissue that has a large surface area is lost from the distal and proximal locations of metaphyses, not only accounting for the loss of bone mass but also affecting HSC populations, as trabecular bone is an active spot for hematopoiesis. Furthermore, disuse-induced loss of trabecular bone is often accompanied by increased adipocyte accumulation in the bone marrow, a condition that can further damage the HSC functioning [82,83].

Conclusions In summary, loss of gravitational loads induces adverse effects on different cell types of bone marrow origin, including connective tissue and immune system cells. Furthermore, not only the committed functional cells but also primitive stem cells seem to be affected, jeopardizing the health of spaceship crew on long-term flight missions. This biological response to long-term loss of mechanical loads appears to be a limiting factor for human habitation beyond Earth. Certainly, scientific developments in the field of space and gravitational biology are required to fully

Turk J Hematol 2013;30:1-7

Özçivici E: Spaceflight and Bone Marrow

understand biological mechanisms that regulate the organism’s response to spaceflight. In parallel, the fields of bioengineering and space biotechnology are in search of the identification and delivery of “physiologically relevant” mechanical loads that would reconstitute homeostasis in the bone and marrow environment [84]. The replacement of mechanical loads may be in the form of repeated bouts to be applied in certain periods to protect osteoblasts, and potentially other cells of the bone marrow, from the adverse effects of spaceflight. In any case, the goal of humankind to utilize space as the final frontier is clear, and technological advances will help to boldly go where no man has gone before.

Acknowledgments This work was kindly supported by the Scientific and Technological Research Council of Turkey (111T577 and 111M604). Critical reviews from Drs. Özden Yalçın Özuysal and Gülistan Meşe from the Molecular Biology and Genetics Department of İzmir Institute of Technology are gratefully acknowledged.

References 1. Hughes-Fulford M. To infinity ... and beyond! Human spaceflight and life science. FASEB J 2011;25:2858-2864.

2. Augustine NR, Austin WM, Chyba C, Kennel CF, Bejmuk BI, Crawley EF, Lyles LL, Chiao L, Greason J, Ride SK. Seeking a human spaceflight program worthy of a great nation. Report to the President of the United States. Washington, DC: National Aeronautics and Space Administration; 2009.

3. Williams DR. The biomedical challenges of space flight. Annu Rev Med 2003;54:245-256.

4. Neel PL, Harris RW. Motion-induced inhibition of elongation and induction of dormancy in liquidambar. Science 1971;173:58-59.

5. Zhou XL, Batiza AF, Loukin SH, Palmer CP, Kung C, Saimi Y. The transient receptor potential channel on the yeast vacuole is mechanosensitive. Proc Natl Acad Sci U S A 2003;100:71057110.

6. Kruse K, Julicher F. Oscillations in cell biology. Curr Opin Cell Biol 2005;17:20-26.

7. Ingber DE. Mechanical control of tissue growth: function follows form. Proc Natl Acad Sci U S A 2005;102:1157111572.

8. Orr AW, Helmke BP, Blackman BR, Schwartz MA. Mechanisms of mechanotransduction. Dev Cell 2006;10:11-20.

9. Smith SM, Wastney ME, Morukov BV, Larina IM, Nyquist LE, Abrams SA, Taran EN, Shih CY, Nillen JL, Davis-Street JE, Rice BL, Lane HW. Calcium metabolism before, during, and after a 3-mo spaceflight: kinetic and biochemical changes. Am J Physiol 1999;277:R1-10.

10. Cooper LF, Harris CT, Bruder SP, Kowalski R, Kadiyala S. Incipient analysis of mesenchymal stem-cell-derived osteogenesis. J Dent Res 2001;80:314-320.

11. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143-147.

12. Bianco P, Robey PG. Stem cells in tissue engineering. Nature 2001;414:118-121.

13. Grompe M. Bone marrow-derived hepatocytes. Novartis Found Symp 2005;265:20-27.

14. Natsu K, Ochi M, Mochizuki Y, Hachisuka H, Yanada S, Yasunaga Y. Allogeneic bone marrow-derived mesenchymal stromal cells promote the regeneration of injured skeletal muscle without differentiation into myofibers. Tissue Eng 2004;10:1093-1112.

15. Lo CC, Scadden DT. The haematopoietic stem cell niche at a glance. J Cell Sci 2011;124:3529-3535.

16. Lo Celso C, Fleming HE, Wu JW, Zhao CX, Miake-Lye S, Fujisaki J, Côté D, Rowe DW, Lin CP, Scadden DT. Live-animal tracking of individual haematopoietic stem/progenitor cells in their niche. Nature 2009;457:92-96.

17. Kular J, Tickner J, Chim SM, Xu JK. An overview of the regulation of bone remodelling at the cellular level. Clinical Biochemistry 2012;45:863-873.

18. Lian JB, Stein GS. Development of the osteoblast phenotype: molecular mechanisms mediating osteoblast growth and differentiation. Iowa Orthop J 1995;15:118-140.

19. Dallas SL, Bonewald LF. Dynamics of the transition from osteoblast to osteocyte. Ann N Y Acad Sci 2010;1192:437-443.

20. Bonewald LF. The amazing osteocyte. J Bone Miner Res 2011;26:229-238.

21. Roodman GD. Advances in bone biology: the osteoclast.

Endocr Rev 1996;17:308-332.

22. LeBlanc AD, Schneider VS, Evans HJ, Engelbretson DA, Krebs JM. Bone mineral loss and recovery after 17 weeks of bed rest.

J Bone Miner Res 1990;5:843-850.

23. Smith SM, Wastney ME, O'Brien KO, Morukov BV, Larina IM, Abrams SA, Davis-Street JE, Oganov V, Shackelford LC. Bone markers, calcium metabolism, and calcium kinetics during extended-duration space flight on the mir space station. J Bone Miner Res 2005;20:208-218.

24. Alexandre C, Vico L. Pathophysiology of bone loss in disuse osteoporosis. Joint Bone Spine 2011;78:572-576.

25. LeBlanc A, Shackelford L, Schneider V. Future human bone research in space. Bone 1998;22(5 Suppl]:113S-116S. 26. Vico L, Collet P, Guignandon A, Lafage-Proust MH, Thomas T, Rehaillia M, Alexandre C. Effects of long-term microgravity exposure on cancellous and cortical weight-bearing bones of cosmonauts. Lancet 2000;355:1607-1611.

27. Space Medicine, Space Life Science, Aerospace Biomedicine.

United States: World Spaceflight News; 2003.

28. Collet P, Uebelhart D, Vico L, Moro L, Hartmann D, Roth M, Alexandre C. Effects of 1- and 6-month spaceflight on bone mass and biochemistry in two humans. Bone 1997;20:547-551.

5

Özçivici E: Spaceflight and Bone Marrow

29. Caillot-Augusseau A, Lafage-Proust MH, Soler C, Pernod J, Dubois F, Alexandre C. Bone formation and resorption biological markers in cosmonauts during and after a 180-day space flight (Euromir 95]. Clin Chem 1998;44:578-585.

30. Hughes-Fulford M, Lewis ML. Effects of microgravity on osteoblast growth activation. Exp Cell Res 1996;224:103-109.

31. Hughes-Fulford M, Rodenacker K, Jutting U. Reduction of anabolic signals and alteration of osteoblast nuclear morphology in microgravity. J Cell Biochem 2006;99:435-449.

32. Nakamura H, Kumei Y, Morita S, Shimokawa H, Ohya K, Shinomiya K. Suppression of osteoblastic phenotypes and modulation of pro- and anti-apoptotic features in normal human osteoblastic cells under a vector-averaged gravity condition. J Med Dent Sci 2003;50:167-176.

33. Sarkar D, Nagaya T, Koga K, Nomura Y, Gruener R, Seo H. Culture in vector-averaged gravity under clinostat rotation results in apoptosis of osteoblastic ROS 17/2.8 cells. J Bone Miner Res 2000;15:489-498.

34. Kumei Y, Shimokawa H, Katano H, Hara E, Akiyama H, Hirano M, Mukai C, Nagaoka S, Whitson PA, Sams CF. Microgravity induces prostaglandin E2 and interleukin-6 production in normal rat osteoblasts: role in bone demineralization. J Biotechnol 1996;47:313-324.

35. Basso N, Bellows CG, Heersche JN. Effect of simulated weightlessness on osteoprogenitor cell number and proliferation in young and adult rats. Bone 2005;36:173-183.

36. Dehority W, Halloran BP, Bikle DD, Curren T, Kostenuik PJ, Wronski TJ, Shen Y, Rabkin B, Bouraoui A, Morey-Holton E. Bone and hormonal changes induced by skeletal unloading in the mature male rat. Am J Physiol 1999;276:E62-E69.

37. Aguirre JI, Plotkin LI, Stewart SA, Weinstein RS, Parfitt AM, Manolagas SC, Bellido T. Osteocyte apoptosis is induced by weightlessness in mice and precedes osteoclast recruitment and bone loss. J Bone Miner Res 2006;21:605-615.

38. Sakai A, Nakamura T. Changes in trabecular bone turnover and bone marrow cell development in tail-suspended mice. J Musculoskelet Neuronal Interact 2001;1:387-392.

39. Silva I, Branco JC. Rank/Rankl/opg: literature review. Acta Reumatol Port 2011;36:209-218.

40. Zayzafoon M, Gathings WE, McDonald JM. Modeled microgravity inhibits osteogenic differentiation of human mesenchymal stem cells and increases adipogenesis.

Endocrinology 2004;145:2421-2432.

41. Ozcivici E, Luu YK, Rubin CT, Judex S. Low-level vibrations retain bone marrow’s osteogenic potential and augment recovery of trabecular bone during reambulation. PLoS ONE 2010;5:e11178.

42. Basso N, Jia Y, Bellows CG, Heersche JN. The effect of reloading on bone volume, osteoblast number, and osteoprogenitor characteristics: studies in hind limb unloaded rats. Bone 2005;37:370-378.

43. Rittweger J, Felsenberg D. Recovery of muscle atrophy and bone loss from 90 days bed rest: results from a one-year follow-up. Bone 2009;44:214-224.

6

Turk J Hematol 2013;30:1-7

44. Lang TF, LeBlanc AD, Evans HJ, Lu Y. Adaptation of the proximal femur to skeletal reloading after long-duration spaceflight. J Bone Miner Res 2006;21:1224-1230.

45. Martini F, Ober WC. Fundamentals of Anatomy & Physiology.

7th ed. San Francisco, CA: Pearson Benjamin Cummings; 2006.

46. Alfrey CP, Udden MM, Leach-Huntoon C, Driscoll T, Pickett MH. Control of red blood cell mass in spaceflight. J Appl Physiol 1996;81:98-104.

47. Rice L, Alfrey CP. The negative regulation of red cell mass by neocytolysis: physiologic and pathophysiologic manifestations.

Cell Physiol Biochem 2005;15:245-250.

48. Udden MM, Driscoll TB, Pickett MH, Leach-Huntoon CS, Alfrey CP. Decreased production of red blood cells in human subjects exposed to microgravity. J Lab Clin Med 1995;125:442-449.

49. Gunga HC, Kirsch K, Baartz F, Maillet A, Gharib C, Nalishiti W, Rich I, Rocker L. Erythropoietin under real and simulated microgravity conditions in humans. J Appl Physiol 1996;81:761-773.

50. Davis TA, Wiesmann W, Kidwell W, Cannon T, Kerns L, Serke C, Delaplaine T, Pranger A, Lee KP. Effect of spaceflight on human stem cell hematopoiesis: suppression of erythropoiesis and myelopoiesis. J Leukoc Biol 1996;60:69-76.

51. Zou LX, Cui SY, Zhong JA, Yi ZC, Sun Y, Fan YB, Zhuang FY. Simulated microgravity induce apoptosis and downregulation of erythropoietin receptor of UT-7/EPO cells. Adv Space Res 2010;46:1237-1244.

52. Crucian BE, Cubbage ML, Sams CF. Altered cytokine production by specific human peripheral blood cell subsets immediately following space flight. J Interferon Cytokine Res 2000;20:547-556.

53. Mills PJ, Meck JV, Waters WW, D’Aunno D, Ziegler MG. Peripheral leukocyte subpopulations and catecholamine levels in astronauts as a function of mission duration. Psychosom Med 2001;63:886-890.

54. Stowe RP, Sams CF, Mehta SK, Kaur I, Jones ML, Feeback DL, Pierson DL. Leukocyte subsets and neutrophil function after short-term spaceflight. J Leukoc Biol 1999;65:179-186.

55. Licato LL, Grimm EA. Multiple interleukin-2 signaling pathways differentially regulated by microgravity.

Immunopharmacology 1999;44:273-279.

56. Kaur I, Simons ER, Castro VA, Mark OC, Pierson DL. Changes in neutrophil functions in astronauts. Brain Behav Immun 2004;18:443-450.

57. Kaur I, Simons ER, Castro VA, Ott CM, Pierson DL. Changes in monocyte functions of astronauts. Brain Behav Immun 2005;19:547-554.

58. Kaur I, Simons ER, Kapadia AS, Ott CM, Pierson DL. Effect of spaceflight on ability of monocytes to respond to endotoxins of gram-negative bacteria. Clin Vaccine Immunol 2008;15:1523-1528.

59. Nagasawa T. Microenvironmental niches in the bone marrow required for B-cell development. Nat Rev Immunol 2006;6:107-116.

Turk J Hematol 2013;30:1-7

60. Lai AY, Kondo M. T and B lymphocyte differentiation from hematopoietic stem cell. Semin Immunol 2008;20:207-212.

61. Ichiki AT, Gibson LA, Jago TL, Strickland KM, Johnson DL, Lange RD, Allebban Z. Effects of spaceflight on rat peripheral blood leukocytes and bone marrow progenitor cells. J Leukoc Biol 1996;60:37-43.

62. Gridley DS, Slater JM, Luo-Owen X, Rizvi A, Chapes SK, Stodieck LS, Ferguson VL, Pecaut MJ. Spaceflight effects on T lymphocyte distribution, function and gene expression. J Appl Physiol 2009;106:194-202.

63. Morukov B, Rykova M, Antropova E, Berendeeva T, Ponomaryov S, Larina I. T-cell immunity and cytokine production in cosmonauts after long-duration space flights.

Acta Astronautica 2011;68:739-746.

64. Nickerson CA, Ott CM, Mister SJ, Morrow BJ, Burns-Keliher L, Pierson DL. Microgravity as a novel environmental signal affecting Salmonella enterica serovar Typhimurium virulence.

Infect Immun 2000;68:3147-3152.

65. Klaus D, Simske S, Todd P, Stodieck L. Investigation of space flight effects on Escherichia coli and a proposed model of underlying physical mechanisms. Microbiology 1997;143:449-455.

66. Juergensmeyer MA, Juergensmeyer EA, Guikema JA. Long-term exposure to spaceflight conditions affects bacterial response to antibiotics. Microgravity Sci Technol 1999;12:41-47.

67. Horneck G. Impact of microgravity on radiobiological processes and efficiency of DNA repair. Mutat Res 1999;430:221-228.

68. Van Houdt R, Mijnendonckx K, Leys N. Microbial contamination monitoring and control during human space missions. Planetary Space Sci 2012;60:115-120.

69. Stowe RP, Pierson DL, Feeback DL, Barrett AD. Stress-induced reactivation of Epstein-Barr virus in astronauts.

Neuroimmunomodulation 2000;8:51-58.

70. Payne DA, Mehta SK, Tyring SK, Stowe RP, Pierson DL. Incidence of Epstein-Barr virus in astronaut saliva during spaceflight. Aviat Space Environ Med 1999;70:1211-1213.

71. Mehta SK, Stowe RP, Feiveson AH, Tyring SK, Pierson DL. Reactivation and shedding of cytomegalovirus in astronauts during spaceflight. J Infect Dis 2000;182:1761-1764.

72. Plett PA, Frankovitz SM, Abonour R, Orschell-Traycoff CM. Proliferation of human hematopoietic bone marrow cells in simulated microgravity. In Vitro Cell Dev Biol Anim 2001;37:73-78.

Özçivici E: Spaceflight and Bone Marrow

73. Plett PA, Abonour R, Frankovitz SM, Orschell CM. Impact of modeled microgravity on migration, differentiation, and cell cycle control of primitive human hematopoietic progenitor cells. Exp Hematol 2004;32:773-781.

74. Nagasawa T, Hirota S, Tachibana K, Takakura N, Nishikawa S, Kitamura Y, Yoshida N, Kikutani H, Kishimoto T. Defects of Bcell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 1996;382:635-658.

75. Kiel MJ, Yilmaz OH, Iwashita T, Yilmaz OH, Terhorst C, Morrison SJ. SLAM family receptors distinguish hematopoietic stem and progenitor cells and reveal endothelial niches for stem cells. Cell 2005;121:1109-1121.

76. Adamo L, Naveiras O, Wenzel PL, McKinney-Freeman S, Mack PJ, Gracia-Sancho J, Suchy-Dicey A, Yoshimoto M, Lensch MW, Yoder MC, Garcia-Cardena G, Daley GQ. Biomechanical forces promote embryonic haematopoiesis.

Nature 2009;459:1131-1135.

77. Calvi LM, Adams GB, Weibrecht KW, Weber JM, Olson DP, Knight MC, Martin RP, Schipani E, Divieti P, Bringhurst FR, Milner LA, Kronenberg HM, Scadden DT. Osteoblastic cells regulate the haematopoietic stem cell niche. Nature 2003;425:841-846.

78. Zhang J, Niu C, Ye L, Huang H, He X, Tong WG, Ross J, Haug J, Johnson T, Feng JQ, Harris S, Wiedemann LM, Mishina Y, Li L. Identification of the haematopoietic stem cell niche and control of the niche size. Nature 2003;425:836-841.

79. Visnjic D, Kalajzic Z, Rowe DW, Katavic V, Lorenzo J, Aguila HL. Hematopoiesis is severely altered in mice with an induced osteoblast deficiency. Blood 2004;103:3258-3264.

80. Zhu J, Garrett R, Jung Y, Zhang Y, Kim N, Wang J, Joe GJ, Hexner E, Choi Y, Taichman RS, Emerson SG. Osteoblasts support B-lymphocyte commitment and differentiation from hematopoietic stem cells. Blood 2007;109:3706-3712.

81. Cheng L, Qasba P, Vanguri P, Thiede MA. Human mesenchymal stem cells support megakaryocyte and proplatelet formation from CD34(+] hematopoietic progenitor cells. J Cell Physiol 2000;184:58-69.

82. Gimble JM, Zvonic S, Floyd ZE, Kassem M, Nuttall ME. Playing with bone and fat. J Cell Biochem 2006;98:251-266.

83. Naveiras O, Nardi V, Wenzel PL, Hauschka PV, Fahey F, Daley GQ. Bone-marrow adipocytes as negative regulators of the haematopoietic microenvironment. Nature 2009;460:259-263.

84. Ozcivici E, Luu YK, Adler B, Qin YX, Rubin J, Judex S, Rubin CT. Mechanical signals as anabolic agents in bone. Nat Rev Rheumatol 2010;6:50-59.

7

Research Article

DOI: 10.4274/tjh.65807

MPL W515L/K Mutations in Chronic Myeloproliferative Neoplasms Kronik Miyeloproliferatif Neoplazmlarda MPL W515l/K Mutasyonları Timur Selçuk Akpınar1, Veysel Sabri Hançer2, Meliha Nalçacı1, Reyhan Diz-Küçükkaya3 1İstanbul University, İstanbul Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey 2İstanbul Bilim University, Faculty of Medicine, Department of Medical Biology and Genetics, İstanbul, Turkey 3İstanbul Bilim University, Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey

Abstract: Objective: The MPL gene encodes the thrombopoietin receptor. Recently MPL mutations (MPL W515L or MPL W515K) were described in patients with essential thrombocythemia (ET) and primary (idiopathic) myelofibrosis (PMF). The prevalence and the clinical importance of these mutations are not clear. In the present study, we aimed to investigate the frequency and clinical significance of MPL W515L/K mutations in our patients with ET and PMF. Materials and Methods: A total of 77 patients (66 were diagnosed with ET and 11 with PMF) and 42 healthy controls were included in the study. Using peripheral blood samples, the presence of MPL W515L/K mutations and JAK-2 V617F mutation were analyzed by real-time polymerase chain reaction.

Results: In our study, MPL W515L/K or JAK-2 V617F mutations were not observed in healthy controls. JAK-2 V617F mutation was present in 35 patients, of whom 29 had ET (43.9%, 29/66) and 6 had PMF (54.5%, 6/11). In the patient group, MPL W515L/K mutations were found in only 2 PMF cases, and these cases were negative for JAK-2 V617F mutation.

The prevalence of MPL W515L/K mutations in the patient group was 2.6%, and the prevalence of MPL W515L/K mutations among the cases negative for the JAK-2 V617F mutation was found to be 4.8%. The 2 cases with MPL W515L/K mutations had long follow-up times (124 months and 71 months, respectively), had no thrombotic or hemorrhagic complications, and had no additional cytogenetic anomalies.

Conclusion: MPL W515L/K mutations may be helpful for identifying clonal disease in MPN patients with no established Ph chromosome or JAK-2 V617F mutation.

Key Words: MPL W515L/K mutations, JAK-2 V617F mutation, Myeloproliferative neoplasms, Essential thrombocythemia, Primary myelofibrosis

Özet: Amaç: MPL geni trombopoietin reseptörünü kodlamaktadır. Son yıllarda ET ve PMF hastalarında MPL mutasyonları tanımlanmıştır (W515L veya W515K). Bu mutasyonların sıklığı ve klinik önemi henüz net şekilde anlaşılmış değildir. Çalışmamızda, ET ve PMF hastalarında bu mutasyonların sıklığını ve klinik önemini araştırmayı amaçladık.

Address for Correspondence: Veysel Sabri HANÇER, M.D., İstanbul Bilim University, Faculty of Medicine, Department of Medical Biology and Genetics, İstanbul, Turkey GSM: +90 533 634 30 14 E-mail: vshancer@istanbul.edu.tr Received/Geliş tarihi : August 15, 2011 Accepted/Kabul tarihi : May 14, 2012

8

Turk J Hematol 2013;30:8-12

Akpınar TS, et al: MPL W515L/K Mutations in Chronic Myeloproliferative Neoplasms

Gereç ve Yöntemler: Çalışmaya toplam 77 hasta (66 ET ve 11 PMF) ve 42 sağlıklı kontrol bireyi dahil edildi. MPL W515L/K ve JAK-2 V617F mutasyon varlığı periferik kan örnekleri kullanılarak gerçek zamanlı polimeraz zincir reaksiyonu yöntemi ile analiz edildi.

Bulgular: Sağlıklı kontrol bireylerinde W515L/K veya JAK-2 V617F mutasyonu saptanmadı. 29’u ET (%43,9, 29/66) ve 6’sı PMF (%54,5, 6/11) olan 35 hastada JAK-2 V617F pozitif saptandı. MPL W515L/K mutasyonları JAK-2 V617F negatif olan yalnızca 2 PMF olgusunda pozitif saptandı. MPL W515L/K sıklığı toplam hasta grubunda %2,6, JAK-2 V617F negatif hastalarda ise %4,8 olarak hesaplandı. MPL W515L/K pozitif olan bu 2 hastada herhangi bir trombotik veya kanama komplikasyonu gelişmemiş, sitogenetik anomali saptanmamış, 124 ve 71 ay olan uzun sağkalımları hesaplanmıştır.

Sonuç: W515L/K mutasyon varlığı, JAK-2 V617F negatif olan veya Ph kromozomuna sahip olmayan MPN hastalarında klonalitenin saptanmasında yardımcı olabilir.

Anahtar Sözcükler: MPL W515L/K mutasyonları, JAK-2 V617F mutasyonu, Miyeloproliferatif neoplazmlar, Esansiyel trombositemi, Primer miyelofibroz

Introduction Myeloproliferative neoplasms (MPNs) consist of various clonal hematological diseases that are considered to develop from the hematopoietic stem cell transformation. Overproduction of mature, functional blood cells and a chronic clinical course are the main characteristics of these diseases. Chronic myeloid leukemia (CML) is a MPN that is characterized by the development of the Philadelphia (Ph) chromosome and the BCRABL fusion gene. Ph-negative MPNs are polycythemia vera (PV), essential thrombocythemia (ET), and primary (idiopathic) myelofibrosis (PMF). The basic feature of these 3 MPNs is that they show hypercellularity in the bone marrow (an increase in the erythrocyte mass in PV, an increase in the platelet number in ET, and advanced fibrosis in the bone marrow in PMF). Individuals with these conditions have a tendency toward both thrombotic and hemorrhagic complications, and are at risk for leukemic transformation [1,2].

Janus kinase-2 (JAK-2) is a cytoplasmic tyrosine kinase and has an important role in intracellular signal transduction in hematopoietic cells through the erythropoietin, thrombopoietin (TPO), interleukin-3, granulocyte colony stimulating factor, and granulocyte-macrophage colony stimulating factor receptors. In 2005, an acquired point mutation in the JAK-2 gene (JAK-2 V617F mutation) was discovered in BCR-ABL-negative MPN patients [3]. The JAK-2 V617F mutation occurs as a result of a valine-to-phenylalanine substitution at codon 617 and increases the activity of the growth factor receptor. Through sensitive methods, the presence of the JAK-2 V617F mutation was observed in 90%-95% of patients with PV, in 50%-60% of patients with ET, and in 40%-50% of patients with PMF [3,4]. In JAK-2 V617F mutation-negative-PV patients, other mutations such as JAK-2 exon-12 mutations have been found with relatively low frequency (3%) [5].

Sequence analysis of the MPL gene coding TPO receptor led to discovery of a new molecular abnormality in JAK-2 mutationnegative MPN patients. MPL mutations are located in the juxtamembrane region of the receptor. The most common MPL mutations are W515L (tryptophan-to-leucine substitution) and

W515K (tryptophan-to-lysine substitution) [6,7,8]. These mutations can be found in 0% to 10% of PMF patients and in 0% to 6% of ET cases in different series [9,10,11,12]. MPL mutations cause both cytokine-independent growth and hyper-TPO sensitivity in cell lines, primarily by means of activating JAKSTAT/ERK/Akt signal pathways. Other MPL mutations (MPL W515S, W5151A, and MPL S505N) have also been reported in cases of hereditary thrombocytosis [13].

In the present study, we aimed to investigate the frequency and clinical significance of MPL W515L/K mutations in our patients with ET and PMF. A total of 77 patients (66 with ET and 11 with PMF) and 42 healthy individuals were analyzed for MPL W515L/K mutations.

Materials and Methods Patients and Controls This study was approved by the Ethics Committee of İstanbul University, İstanbul Faculty of Medicine (No: 2009-1976) and was carried out in accordance with the principles of the Helsinki Declaration. The patient group was chosen from among cases followed by the Hematology Division. A total of 77 patients (66 with ET and 11 with PMF) who were followed between 1980 and 2010 and were diagnosed with MPN according to the World Health Organization (WHO) criteria [1], and were negative for the Ph chromosome and/or the BCR-ABL fusion gene, were included in the study. As a control group, 42 healthy individuals who worked at the hospital were analyzed. Personal background details, thrombosis history, physical examination findings, blood counts, peripheral smears, serum iron status (ferritin levels, iron, and total iron-binding capacity values), bone marrow aspiration, biopsy details, and cytogenetic analyses were screened and recorded electronically.

Methods Peripheral venous blood was taken from all subjects. The presence of the MPL W515 mutations was screened using melting curve analysis at the molecular hematology laboratory. All samples were analyzed for JAK-2 V617F mutation and MPL W515L/K mutations. Genomic DNA was isolated from peripheral venous 9

Turk J Hematol 2013;30:8-12

Akpınar TS, et al: MPL W515L/K Mutations in Chronic Myeloproliferative Neoplasms

blood leukocytes using a spin-colon DNA isolation kit (Roche Diagnostics, Mannheim, Germany). Genotyping was performed using melting curve analysis with LightCycler 2.0 (Roche Diagnostics). Specific primers and probes were designed using Primer Express 3.0 software.

For the JAK-2 V617F LightCycler assay, polymerase chain reaction (PCR) was carried out in capillaries in a total reaction volume of 20 μL containing 25 ng of genomic DNA, 200 μmol/L of dNTPs, 4 mmol/L of MgCl2, 0.1 μmol/L of forward primer (TTCCTTAGTCTTTCTTTGAAGGT), 0.5 μmol/L of reverse primer (GTGATCCTGAAACTGAATTTTCT), and 0.2 μmol/L each of the sensor (5'-ATGGAGTATGTGTCTATGGAGTATGTGTCTGTGGfluorescein-3') and anchor (5'-LCR640-ACGAGAGTAAGTA AAACTACAGGTC- phosphate-3') probes using the following PCR program: initial denaturation at 95 °C for 10 min and 45 amplification cycles at 55° C for 10 s and 72 °C for 10 s. Melting analysis was performed by denaturing at 95 °C for 30 s and cooling to 35 °C for 1 min, followed by heating at the rate of 0.1 °C/s from 35 °C to 80 °C. Melting peaks generated with the LightCycler displayed a distinct melting temperature for the wild type (60 °C) and the mutant (52 °C).

For the W515 mutations, PCR reactions included 25 ng genomic DNA, 200 μmol/L dNTP, 4 mmol/L MgCl2, 0.2 μmol/L forward primer (TGGGCCGAAGTCTGACCCTTTA), 0.5 μmol/L reverse primer (ACAGAGCGAACCAAGAATGCCTGTG), and 0.2 μmol/L anchor probe (LC640-AGGCCCAGGACGGCGT) and sensor probe (CTGCCACCTCAGCAGCAT-fluorescein-3'). The PCR procedure was performed with 45 amplification cycles of 10 min of denaturation at 95 °C, 10 s at 55 °C, and 10 s at 72 °C. Melting curve analysis was performed with 30 s of denaturation at 95 °C and 1 min of cooling at 35 °C, followed by heating to 85 °C at a speed of 0.1 °C/s. The results were evaluated by considering the melting temperature. Because the probe was designed to match the non-mutated portion (wild-type) of the target DNA, it had a higher melting temperature (62.5 °C). MPL W515 mutationpositive samples melted at a lower temperature (52.5 °C).

mutation was present in a total of 35 patients, 29 of which had ET and 6 of which had PMF. The frequency of JAK-2 V617F mutation in ET patients was 43.9%, and in PMF patients it was 54.5%.

MPL W515L/K mutation was found in 2 cases. Both cases were from the PMF group and were negative for JAK-2 V617F mutation. The prevalence of the MPL W515 L/K mutations was found to be 2.6% (2/77) in the patient group, 4.8% (2/42) in patients who were negative for JAK-2 V617F mutation, and 18.2% in the PMF group (2/11). The clinical, laboratory, and molecular characteristics of the PMF patients found to have a MPL W515 mutation are presented in Table 1.

Patient 1, a 62-year-old male patient, complained of abdominal swelling and weakness. Upon physical examination, it was determined that he had hepatomegaly extending beyond the rib curve by 6 cm and splenomegaly extending beyond the rib curve by 10 cm. The patient had known diagnoses of chronic hepatitis B infection and atrial fibrillation with no history of thrombosis. His peripheral smear revealed 3% blast cells, 2% myelocytes, 4% metamyelocytes, tear drop-shaped erythrocytes, and giant platelets (Figure 1). A bone marrow biopsy revealed hypocellular bone marrow containing dense reticulin fibers (grade 3). Hydroxyurea, warfarin, and allopurinol were used for treatment. Follow-up time was 124 months with no thrombotic or hemorrhagic complications.

In evaluating the findings obtained in the study, NCSS (Number Cruncher Statistical System) 2007 and PASS 2008 Statistical Software (Utah, USA) were used for the statistical analyses.

Results In our study, MPL W515L/K and JAK-2 V617F mutations were not found in healthy controls. In the patient group, the JAK-2 V617F

Figure 1: Dysplastic megakaryocytes with mononuclear and hypolobulated forms (hematoxylin and eosin, 400×).

Table 1: Clinical, laboratory, and molecular characteristics of two patients with MPL W515L/K mutations.

Sex, age

Diagnosis

Status of JAK-2 V617F

Status of MPL W515

Cytogenetic abnormality

Hb g/L*

WBC counts x 109/L*

Platelet counts x 109/L*

Follow-up, months*

Male, 62

PMF

Negative

Positive

Negative

125

17.6

445

124

Female, 47

PMF

Negative

Positive

Negative

107

10.9

466

115

*Initial hemogram levels are presented.

10

Turk J Hematol 2013;30:8-12

Akpınar TS, et al: MPL W515L/K Mutations in Chronic Myeloproliferative Neoplasms

cohort, the frequency of MPL W515L/K mutations was 5.3% in ET and 9.6% in PMF patients [12].

In Asian studies, however, the frequencies of MPL W515L/K mutations were not consistent. Lieu et al. [9] evaluated 88 Taiwanese patients with MPN and could not find any MPL mutations. Ruan et al. [10] analyzed 343 MPN patients negative for JAK-2 V617F mutation. They found that 3.5% of ET (7/199) and 12.5% of PMF (3/24) patients had MPL W515L/K mutations.

Figure 2: Grade 4 fibrosis shown with reticulin stain (400×).

Patient 2, a 58-year-old female patient, presented with complaint of fatigue. Physical examination revealed splenomegaly extending beyond the rib curve by 9 cm. She had no additional disease or history of thrombosis. The peripheral smear revealed erythroblastosis and tear drop-shaped erythrocytes. Hypocellular bone marrow displayed elevated levels of dense reticulin fibers, as shown in Figure 2 (grade 4). Low-dose aspirin, hydroxyurea, and folbiol were used for treatment. Follow-up time was 115 months with no complications.

Discussion The presence of MPL mutations in patients with MPN was first published by Pikman et al. in 2006 [6]. Studies including larger cohorts of patients showed different frequencies of MPL mutations in MPN patients. Pardanani et al. [7] screened MPL mutations in 1182 patients with MPN (290 with PMF, 242 with PV, 318 with ET) and other myeloid disorders (88 with myelodysplastic syndrome, 118 with CML, 126 with acute myeloid leukemia), regardless of JAK-2 V617F mutational status. They found that MPL mutations were not present in PV, myelodysplastic syndrome, CML, or acute myeloid leukemia patients; only ET and PMF patients were found to carry these mutations. The frequency of MPL mutations was found to be low in patients with PMF (5%) and ET (1%). They also reported that 6 patients had both JAK-2 V617F and MPL W515L/K mutations [7]. Beer et al. analyzed a PT-1 cohort for MPL mutations and screened for MPL mutations in 776 patients with ET [8]. MPL mutations were found in 32 patients (4.1%). One of these patients also had JAK-2 V617F mutation. They found that patients with MPL mutations had lower hemoglobin levels and higher platelet counts at diagnosis compared with patients with JAK-2 V617F mutation. They did not find any relation between MPL W515L/K mutations and thrombosis, major hemorrhage, fibrotic transformation, or disease duration [8]. Schnittger et al. [12] evaluated 869 MPN patients who were negative for JAK-2 V617F mutation. They found that 35 had MPL W515L/K mutations (26 with ET, 7 with PMF, 1 with chronic myelomonocytic leukemia, and 1 with secondary acute myeloid leukemia after PMF). In their

In our study, MPL W515L/K mutations were investigated in 77 patients who were diagnosed with ET and PMF according to the WHO criteria. Forty-two patients were negative for JAK-2 V617F mutation. We found that MPL W515L/K mutations were present in only 2 patients with PMF (18.2%), and both of those patients were negative for JAK-2 V617F mutation. These patients had no thrombotic or hemorrhagic complications and had a long disease course (124 and 115 months). In conclusion, MPL W515L/K mutations may be helpful for identifying clonal disease in MPN patients with no established Ph chromosome or JAK-2 V617F mutation. Further studies including larger cohorts of patients will help to understand the phenotypic effects of these mutations.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Tefferi A, Thiele J, Vardiman JW. The 2008 World Health Organization classification system for myeloproliferative neoplasms. Cancer 2009;115:3842-3847.

2. Vannucchi AM, Guglielmelli P, Tefferi A. Advances in understanding and management of myeloproliferative neoplasms. CA Cancer J Clin 2009;59:171-191.

3. James C, Ugo V, Le Couedic JP, Staerk J, Delhommeau F, Lacout C, Garcon L, Raslova H, Berger R, Bennaceur-Griscelli A, Villeval JL, Constantinescu SN, Casadevall N, Vainchenker W. A unique clonal JAK2 mutation leading to constitutive signaling causes polycythaemia vera. Nature 2005;434:1144-1148.

4. Kralovics R, Passamonti F, Buser AS, Teo SS, Tiedt R, Passweg JR, Tichelli A, Cazzola M, Skoda RC. A gain-of-function mutation of JAK2 in myeloproliferative disorders. N Engl J Med 2005;352:1779-1790.

5. Scott LM, Tong W, Levine RL, Scott MA, Beer PA, Stratton MR, Futreal PA, Erber WN, McMullin MF, Harrison CN, Warren AJ, Gilliland DG, Lodish HF, Green AR. JAK2 exon 12 mutations in polycythemia vera and idiopathic erythrocytosis.

N Engl J Med 2007;356:459-468.

6. Pikman Y, Lee BH, Mercher T, McDowell E, Ebert BL, Gozo M, Cuker A, Wernig G, Moore S, Galinsky I, DeAngelo DJ, Clark JJ, Lee SJ, Golub TR, Wadleigh M, Gilliland DG, Levine RL. MPLW515L is a novel somatic activating mutation in myelofibrosis with myeloid metaplasia. PloS Med 2006;3:e270.

11

Akpınar TS, et al: MPL W515L/K Mutations in Chronic Myeloproliferative Neoplasms

7. Pardanani AD, Levine RL, Lasho T, Pikman Y, Mesa R, Wadleigh M, Steensma DP, Elliott MA, Wolanskyj AP, Hogan WJ, McClure RF, Litzow MR, Gilliland DG, Tefferi A. MPL515 mutations in myeloproliferative and other myeloid disorders: a study of 1182 patients. Blood 2006;108:3472-3476.

8. Beer PA, Campbell PJ, Scott LM, Bench AJ, Erber WN, Bareford D, Wilkins BS, Reilly JT, Hasselbalch HC, Bowman R, Wheatley K, Buck G, Harrison CN, Green AR. MPL mutations in myeloproliferative disorders: analysis of the PT-1 cohort.

Blood 2008;112:141-149.

9. Lieu CH, Shen YJ, Lai WC, Tsai WH, Hsu HC. Prevalence of MPL W515L/K mutations in Taiwanese patients with Philadelphia-negative chronic myeloproliferative neoplasms.

J Chin Med Assoc 2010;73:530-532.

10. Ruan GR, Jiang B, Li LD, Niu JH, Li JL, Xie M, Qin YZ, Liu YR, Huang XJ, Chen SS. MPL W515L/K mutations in 343 Chinese adults with JAK2V617F mutation-negative chronic myeloproliferative disorders detected by a newly developed RQ-PCR based on TaqMan MGB probes. Hematol Oncol 2010;28:33-39.

12

Turk J Hematol 2013;30:8-12

11. Ma W, Zhang X, Wang X, Zhang Z, Yeh CH, Uyeji J, Albitar M. MPL mutation profile in JAK-2 mutation-negative patients with myeloproliferative disorders. Diagn Mol Pathol 2011;20:34-39.

12. Schnittger S, Bacher U, Haferlach C, Beelen D, Bojko P, Bürkle D, Dengler R, Distelrath A, Eckart M, Eckert R, Fries S, Knoblich J, Köchling G, Laubenstein HP, Petrides P, Planker M, Pihusch R, Weide R, Kern W, Haferlach T. Characterization of 35 new cases with four different MPL W515 mutations and essential thrombocytosis or primary myelofibrosis.

Haematologica 2009;94:141-144.

13. Teofili L, Giona F, Martini M, Cenci T, Guidi F, Palumbo G, Amendola A, Foa R, Larocca LM. Markers of myeloproliferative diseases in childhood polycythemia vera and essential thrombocythemia. J Clin Oncol 2007;25:1048-1053.

Research Article

DOI: 10.4274/tjh.98474

Methylation of SOCS3 in Myeloproliferative Neoplasms and Secondary Erythrocytosis/Thrombocythemia Miyeloproliferatif Neoplazmlar ve Sekonder Eritrositoz/Trombositemide SOCS3 Metilasyonu Deniz Torun1, Oral Nevruz2, Mesut Akyol3, Salih Kozan1, Muhterem Bahçe1, Şefik Güran4, Cengiz Beyan2 1Gülhane Military Medical Faculty, Department of Medical Genetics, Ankara, Turkey 2Gülhane Military Medical Faculty, Department of Hematology, Ankara, Turkey 3Gülhane Military Medical Faculty, Department of Biostatistics, Ankara, Turkey 4Gülhane Military Medical Faculty, Department of Medical Biology, Ankara, Turkey

Abstract: Objective: Myeloproliferative neoplasms (MPNs) like essential thrombocythemia (ET), polycythemia vera (PV), and primary myelofibrosis (PMF) are acquired clonal hematopoietic stem cell disorders and originate from a multipotent hematopoietic stem cell. The SOCS1 and SOCS3 genes are negative regulators of the JAK/STAT signal pathway. In this study we investigate the promoter methylation of these genes in the pathogenesis of MPNs and secondary erythrocytosis/thrombocythemia.

Materials and Methods: Promoter methylation of SOCS1 and SOCS3 genes was analyzed with methylation-specific PCR. PCR products were analyzed by agarose gel electrophoresis.

Results: No disease-specific CpG island methylation of SOCS1 was observed. Hypermethylation of the SOCS3 promoter was identified in 5 out of 19 (26.3%) PV cases, 2 out of 21 (9.5%) ET cases, 1 out of 5 (20%) PMF cases, and 9 out of 42 (21.4%) cases of secondary erythrocytosis/thrombocythemia.

Conclusion: The results revealed that promoter methylation of the SOCS3 gene suggests a possible role for SOCS3 methylation in the pathogenesis of MPNs and secondary erythrocytosis/thrombocythemia.

Key words: Myeloproliferative neoplasm, SOCS1, SOCS3, Secondary erythrocytosis/thrombocythemia Özet: Amaç: Esansiyel trombositemi (ET), polisitemia vera (PV), primer miyelofibrozis (PMF) gibi miyeloproliferatif neoplazmlar (MPN) kazanılmış klonal hematopoetik kök hücre hastalığı olup multipotent hematopoietik kök hücreden köken alırlar. SOCS1 ve SOCS3 genleri JAK/STAT sinyal yolağının negatif düzenleyicileridir. Bu çalışmada MPN ve sekonder eritrositoz/trombositemi patogenezinde bu genlerin promotor metilasyonunu incelemeyi amaçladık.

Address for Correspondence: Deniz TORUN, M.D., Gülhane Military Medical Faculty, Department of Medical Genetics, Ankara, Turkey Phone: +90 312 304 35 85 E-mail: dtorun@gata.edu.tr Received/Geliş tarihi : August 08, 2011 Accepted/Kabul tarihi : September 27, 2012

13

Torun D, et al: Effect of SOCS3 Methylation in MPNs

Turk J Hematol 2013;30:13-18

Gereç ve Yöntemler: SOCS1, SOCS3 genlerinin promotor metilasyonu, metilasyon spesififk PCR ile incelendi. PCR ürünleri agaroz jel elektroforezinde analiz edildi.

Bulgular: SOCS1 geninde CpG adacıklarında hastalıkla ilişkili metilasyon bulunamadı. 19 PV olgusunun 5’inde (%26,3), 21 ET olgusunun 2’sinde (%9,5), 5 PMF olgusunun 1’inde (%20), 42 sekonder eritrositoz/trombositemi olgusunun 9’unda (%21,4) SOCS3 promotor metilasyonu saptandı.

Sonuç: SOCS3 geni promotor metilasyonu MPN ve sekonder eritrositoz/trombositemi patogenezinde etkili olarak görünmektedir.

Anahtar Sözcükler: Miyeloproliferatif Neoplazi, SOCS1; SOCS3; Sekonder eritrositoz/trombositemi Introduction Myeloproliferative neoplasms (MPNs) are a group of diseases of the bone marrow in which excess cells are produced. They are related to, and may evolve into, myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML), although the MPNs on the whole have a much better prognosis than these conditions. The classic MPNs are polycythemia vera (PV), essential thrombocythemia (ET), primary myelofibrosis (PMF), and chronic myelogenous leukemia (CML). They were originally grouped together based on their shared phenotype of myeloproliferation [1]. All of these neoplasms are acquired clonal hematopoietic stem cell disorders, originating from a multipotent hematopoietic stem cell. Cytogenetic and/or molecular genetic analyses are mandatory for differential diagnosis. Apart from the BCR/ABL rearrangement in CML, the JAK2 and MPL mutations play a crucial role in the pathogenesis of PV, ET, and PMF [2,3].

The JAK-STAT signaling pathway transmits information from chemical signals outside the cell, through the cell membrane, and into gene promoters on the DNA in the cell nucleus, which causes DNA transcription and activity in the cell [4]. The suppressor of cytokine signaling (SOCS) proteins inhibit the cytokine signaling cascade by using the JAK/STAT pathway in a cell [5]. Expression of SOCS1 and SOCS3 genes leads to reduced JAK and STAT phosphorylation via binding of the JH1 domain and cytokine receptor of JAK, respectively [6,7,8]. Epigenetic mechanisms such as DNA methylation regulate DNA structure and gene expression in a cell. Abnormal epigenetic mechanisms take place in the development of many diseases, including cancer. Downregulation of a gene due to methylation has been demonstrated in various studies, including the SOCS1 and SOCS3 genes [9,10,11].

In this study, the effects of aberrant methylation of CpG islands within the promoter region of SOCS1 and SOCS3 genes were demonstrated in the pathogenesis of PV, ET, PMF, and secondary erythrocytosis/thrombocythemia.

Materials and Methods This study was approved by the appropriate local ethics committee. Participants were ascertained according to the 2008 World Health Organization (WHO) classification system [1].

Written informed consent was obtained from all participants. A cohort of 87 patients, which included 19 cases of PV, 21 cases of ET, 5 cases of PMF, and 42 cases of secondary erythrocytosis/thrombocythemia, was enrolled to investigate the 14

role of SOCS1 and SOCS3 promoter methylation. The control group comprised 29 healthy individuals. JAK2 V617F mutation analysis was used in differential diagnosis of MPNs and secondary erythrocytosis/thrombocythemia.

Mutation Analysis of JAK2 V617F: DNAs were isolated from peripheral blood samples in each case by using the NucleoSpin Blood Kit (Macherey-Nagel, Germany). JAK2 V617F mutation was determined in RT-PCR analyses by using a kit (JAK2 Type 1 PCR System, Dr Zeydanlı, Ankara, Turkey). The PCR conditions were 95 °C for 10 min, followed by 32 cycles of 95 °C for 15 s and 60 °C for 1 min.

Methylation Analysis of SOCS1 and SOCS3 CpG Islands: Genomic DNA from patients and controls were modified with sodium bisulfite using the CpGenomeTM Fast DNA Modification Kit (Chemicon International, USA and Canada). The efficacy of bisulfite modification was assessed with methylated control samples (CpG WIZ® DAP-kinase Amplification Kit, Chemicon).

Bisulfite-modified DNA samples were amplified by methylationspecific PCR by using methylation-specific primers and unmethylation-specific primers for the promoter region of SOCS1 and SOCS3 genes, as described by Liu et al. and Fourouclas et al., respectively [10,11]. The primer sequences and their locations relative to the transcription start sites were noted as follows: SOCS1-MF 5’-TTGTTCGGAGGTCGGATTT-3’ (nt -291 to 272); SOCS1-MR 5’-ACTAAAACGCTACGAAACCG-3’ (nt -93 to 74); SOCS1-UF 5’-TTTTTTGGTGTTGTTTGGAGGTTGGATTTT-3’ (nt -301 to -272); SOCS1-UR 5’-AAAACAAAACAATAAACTA AAACACTACAAAACCA-3’ (nt -108 to -74); SOCS3-MF 5’GAGGGGTCGTTGTTAGGAAC-3’ (nt -1265); SOCS3-MR 5’ACAAAAACCGAAAAAAACGC-3’ (nt -1176); SOCS3-UNF 5’-GGAGGGGTTGTTGTTAGGAAT-3’ (nt -1266); SOCS3-UNR 5’CAAAAACAAAAACCAAAAAAAACA-3’ (nt -1175) [10,11].

Bisulfite-modified DNA samples from patients and controls were amplified by PCR reaction in a total reaction volume of 25 μL containing 1X PCR buffer (Bioron, Germany), 1.5 mM MgCl2, 0.2 mM dNTP, 0.4 pmol of each primer for SOCS1, and 1 pmol of each primer for SOCS3, using 1.5 U hot-start Taq polymerase (Bioron) on a thermal cycler (Bio-Rad, USA). The PCR conditions were 95 °C for 5 min, followed by 40 cycles of 95 °C for 30 s, 60 °C for 40 s, and 72 °C for 40 s with a final extension at 72 °C for 10 min.

PCR products were visualized using agarose gel electrophoresis.

Statistical Analysis: Statistical analysis was performed using SPSS 15.00 for Windows (SPSS Inc., Chicago, IL, USA) and Microsoft Excel 2003. The Shapiro-Wilks test was used to assess

Turk J Hematol 2013;30:13-18

Torun D, et al: Effect of SOCS3 Methylation in MPNs

normal distribution. Descriptive data are expressed as mean±standard deviation. Skewed data are shown as median and interquartile range (IQR). Chi-square (chi-square, Fisher exact, or likelihood ratio) tests were used for comparisons of JAK2 and SOCS3 among sub-groups. Categorical data are shown as numbers and percentages. The level of significance was set at p≤0.05.

Results JAK2 V617F mutation and methylation analysis of SOCS1/SOCS3 CpG islands were performed in 45 cases of MPNs, 42 cases of secondary erythrocytosis/thrombocythemia, and for 29 control individuals. Age, sex, and blood count characteristics of all patients and controls are summarized in Table 1.

JAK2 V617F mutation as observed in our series is summarized in Table 2. Seventeen out of 19 PV patients (89.5%), 11 out of 21 ET patients (52.4%),and 2 out of 5 PMF patients (40.0%) revealed

JAK2 V617F mutations. The JAK2 V617F mutation was not observed in secondary erythrocytosis/thrombocythemia patients or in the healthy control group (Table 2).

SOCS1 and SOCS3 CpG island methylation patterns of the study groups are presented in Table 2. The CpG islands analyzed in SOCS1 and SOCS3 genes were inside the promoter regions of these genes. MPN patients, secondary erythrocytosis/thrombocythemia patients, and the control group were negative for the methylation of the SOCS1 promoter region (Figure 1; Table 2). Five out of 19 PV patients, 2 out of 21 ET patients, 1 out of 5 ET patients, and 9 out of 42 secondary erythrocytosis/thrombocythemia patients revealed hypermethylation of the SOCS3 promoter region (Figure 2; Table 2). The control group was negative for the methylation of the SOCS3 promoter region. Four out of 5 PV patients and 2 out of 2 ET patients carrying methylation of the SOCS3 promoter region were concurrently positive for the JAK2 V617F mutation.

Table 1: Age, sex, and blood count characteristics of the patients and control subjects.

Primary disorder

Polycythemia vera

Essential thrombocythemia

Primary myelofibrosis

Secondary erythrocytosis/thrombocythemia

Controls

Participants Sex (n = 116)

19

21

5

42

29

WBC (×103/μL), median (IQR)

RBC (×106/μL),

Hg (g/dL), median (IQR)

Platelets (×103/μL), (IQR)

51

12.70

7.15±1.00

18.20

373.00

(31–77)

(11.60)

(1.38)

(200.50)

8F

55 (15–78)

9.55 (11.41)

6.58±0.77

17.20 (3.75)

418.00 (326.50)

13 M

42 (23–80)

8.00 (5.28)

5.13±0.54

15.00 (1.80)

799.50 (522.25)

8F

51 (30–78)

8.90 (7.08)

5.16±1.22

13.95 (2.78)

575.00 (243.50)

4M

61 (53–73)

11.23 (16.26)

4.38±1.62

10.25 (10.03)

227.00 (434.75)

1F

76 (76)

27.00 (27.00)

6.58±N/A

14.30 (14.30)

819.00 (819.00)

31 M

37 (18–78)

9.00 (9.00)

5.76 ± N/A***

18.20 (18.20)

N/A***

11 F

51 (13–76)

13.00 (13.00)

N/A***

11.60 (11.60)

840.00 (840.00)

23 M

37 (27–45)

10.45 (6.68)

5.82±0.94

18.00 (2.45)

204.00 (104.50)

6F

36 (29–42)

8.10 (4.15)

11 M

Age*

χ±sd **

4.70±0.82 13.80 (3.65)

588.00 (523.00)

*Mean **Mean±standard deviation ***Not available

15

Turk J Hematol 2013;30:13-18

Torun D, et al: Effect of SOCS3 Methylation in MPNs

Discussion

N1 M’

1M

1U

N2

Control

2M 2U

M

U

Figure 1: Methylation-specific PCR amplification of SOCS1 promoter region. U: unmethylated, M: methylated, M’: molecular weight marker (100 bp). N1-N2: unmethylated. Presence of bands in control groups indicates the efficacy of bisulfite treatment.

N1 M’

N2

N3

N4

Control

1M 1U 2M 2U 3M 3U 4M 4U M

U

Figure 2: Methylation-specific PCR amplification of SOCS3 promoter region. U: unmethylated, M: methylated, M’: molecular weight marker (100 bp). N1-N2: unmethylated, N3-N4: methylated. Presence of bands in control groups indicates the efficacy of bisulfite treatment.

Classification of MPNs was based on the clinical phenotype of these disorders and histological patterns. In recent years, many advances have occurred in the understanding and management of MPNs. Updated WHO classification of MPNs was primarily based on the proliferation capacity of the cell lines and the amount of bone marrow fibrosis. These findings were combined with clinical, laboratory, and cytogenetic/molecular genetic features [1,12].

As an acquired mutation, JAK2 V617F plays a key role in the pathogenesis of MPNs [2,13,14,15]. The JAK2 protein is a cytoplasmic tyrosine kinase and takes part in signal transduction [16]. A single amino acid substitution (valine to phenylalanine) in the JAK2 tyrosine kinase encoding gene causes uncontrolled hematopoiesis. JAK2 V617F mutation was reported in 90%-95% of PV, 50% of PMF, and 40%-50% of ET patients in the literature [17,18,19]. In our study, 89.5% of PV, 52.4% of ET, and 40.0% of PMF patients revealed JAK2 V617F mutation. These results were in line with previous reports. Secondary erythrocytosis/ thrombocythemia patients and the control group were negative for the JAK2 V617F mutation, as expected.

Epigenetic changes, which are important for transcriptional control, may cause various diseases [20]. In our series, the SOCS1 promoter region did not reveal any methylation patterns in MPN patients, secondary erythrocytosis/thrombocythemia patients, or the control group. These findings suggest that methylation of the SOCS1 promoter region does not emerge as a molecular mechanism during the progression of MPNs and secondary erythrocytosis/thrombocythemia. These results are similar to those of a previously reported study in the literature [11].

SOCS3 promoter methylation represents an important mechanism in the pathogenesis of MPNs. Recently, Fourouclas et al. reported the methylation of SOCS3 in 32.0% of patients with PMF [11]. Our results show differences in some aspects. In our study, PV (26.3%) and ET (9.5%) patients also revealed SOCS3 promoter methylation, in addition to the PMF patients.

This finding suggests that promoter methylation of the SOCS3 gene not only plays a role in the pathogenesis of PMF but also plays a key role in the pathogenesis of PV and ET.

Table 2: Frequency of JAK2 V617F and SOCS1/SOCS3 promoter methylation in the study groups.

Primary disorder

Participants (n = 116)

JAK2 V617F

SOCS1

Polycythemia vera

19

17 / 19 (89.5%)

0 / 19 (0.0%)

5 / 19 (26.3%)

4/5

Essential thrombocythemia

21

11 / 21 (52.4%)

0 / 21 (0.0%)

2 / 21 (9.5%)

2/2

Primary myelofibrosis

5

2 / 5 (40.0%)

0 / 5 (0.0%)

1 / 5 (20.0%)

Secondary erythrocytosis/thrombocythemia

42

0 / 42 (0.0%)

0 / 42 (0.0%)

9 / 42 (21.4%)

Controls

29

0 / 29 (0.0%)

0 / 29 (0.0%)

0 / 29 (0.0%)

Total

116

30

0

17

(*): JAK2 V617F and SOCS3 promoter methylation evident in the same patient.

16

SOCS3

(*)

Turk J Hematol 2013;30:13-18

Torun D, et al: Effect of SOCS3 Methylation in MPNs

We next compared the MPNs among themselves for the frequency of SOCS3 promoter methylation. SOCS3 promoter hypermethylation did not exhibit any statistical difference among PV, ET, and PMF (p>0.05). This finding suggests that SOCS3 promoter hypermethylation may be a useful finding in the definition of MPNs but cannot be used as a tool of differential diagnosis.

In this study, secondary erythrocytosis/thrombocythemia patients were also analyzed for SOCS3 promoter methylation. In this group, 9 out of 42 (21.4%) patients revealed aberrant SOCS3 promoter methylation. It seems that the agents that play a crucial role in the pathogenesis of secondary erythrocytosis/ thrombocythemia may show the effects through epigenetic changes. To our knowledge, the finding of SOCS3 promoter methylation in secondary erythrocytosis/ thrombocythemia has been revealed here for the first time in the literature, but longterm clinical and laboratory follow-up is needed to observe the effect of hypermethylation on the course of disease and whether or not the hypermethylation abates.

The coincidental association of SOCS3 promoter methylation and JAK2 V617F mutation is an important finding. Four out of 5 PV patients and 2 out of 2 ET patients carrying methylation of the SOCS3 promoter region were concurrently positive for the JAK2 V617F mutation and statistical analysis revealed that the presence/absence of JAK2 V617F mutation had no effect on the existence of SOCS3 promoter methylation (p>0.05). These findings represent the fact that promoter methylation in the SOCS3 gene and the JAK2 V617F mutation might be independent. However, this finding should be supported with SOCS3 mRNA expression studies, and clinical outcomes of the patients must be compared to establish its importance in the pathogenesis and prognosis of MPN progression.

In conclusion, SOCS3 promoter hypermethylation represents a crucial epigenetic event in the pathogenesis of MPNs and secondary erythrocytosis/thrombocythemia. For long-term clinical affects, further studies are needed.

Acknowledgment This study was supported by the Gülhane Military Medical Academy Research and Development Center, Ankara, Turkey.

References 1. Wadleigh M, Tefferi A. Classification and diagnosis of myeloproliferative neoplasms according to the 2008 World Health Organization criteria. Int J Hematol 2010;91:174-179.

2. Levine RL, Wadleigh M, Cools J, Ebert BL, Wernig G, Huntly BJ, Boggon TJ, Wlodarska I, Clark JJ, Moore S, Adelsperger J, Koo S, Lee JC, Gabriel S, Mercher T, D'Andrea A, Fröhling S, Döhner K, Marynen P, Vandenberghe P, Mesa RA, Tefferi A, Griffin JD, Eck MJ, Sellers WR, Meyerson M, Golub TR, Lee SJ, Gilliland DG. Activating mutation in the tyrosine kinase JAK2 in polycythemia vera, essential thrombocythemia, and myeloid metaplasia with myelofibrosis. Cancer Cell 2005;7:387-397.

3. Daly S, Conneally E, Langabeer SE. Identification of MPL W515L/K mutations in patients with primary myelofibrosis and essential thrombocythaemia by allele-specific polymerase chain reaction. Acta Haematol 2009;121:221-222.

4. Aaronson DS, Horvath CM. A road map for those who don’t know JAK-STAT. Science 2002;296:1653-1655.

5. Greenhalgh CJ, Hilton DJ. Negative regulation of cytokine signaling. J Leukoc Biol 2001;70:348-356.

6. Starr R, Hilton DJ. Negative regulation of the JAK/STAT pathway. Bioessays 1999;21:47-52.

7. Sasaki A, Yasukawa H, Shouda T, Kitamura T, Dikic I, Yoshimura A. CIS3/SOCS-3 suppresses erythropoietin (EPO) signaling by binding the EPO receptor and JAK2. J Biol Chem 2000;275:29338-29347.

8. Yasukawa H, Misawa H, Sakamoto H, Masuhara M, Sasaki A, Wakioka T, Ohtsuka S, Imaizumi T, Matsuda T, Ihle JN, Yoshimura A. The JAK-binding protein JAB inhibits Janus tyrosine kinase activity through binding in the activation loop.

EMBO J 1999;18:1309-1320.

9. Johan MF, Bowen DT, Frew ME, Goodeve AC, Reilly JT. Aberrant methylation of the negative regulators RASSFIA, SHP-1 and SOCS-1 in myelodysplastic syndromes and acute myeloid leukaemia. Br J Haematol 2005;129:60-65.

10. Liu TC, Lin SF, Chang JG, Yang MY, Hung SY, Chang CS. Epigenetic alteration of the SOCS1 gene in chronic myeloid leukaemia. Br J Haematol 2003;123:654-661.

11. Fourouclas N, Li J, Gilby DC, Campbell PJ, Beer PA, Boyd EM, Goodeve AC, Bareford D, Harrison CN, Reilly JT, Green AR, Bench AJ. Methylation of the suppressor of cytokine signaling 3 gene (SOCS3) in myeloproliferative disorders. Haematologica 2008;93:1635-1644.

12. Vannucchi AM, Guglielmelli P, Tefferi A. Advances in understanding and management of myeloproliferative neoplasms. CA Cancer J Clin 2009;59:171-191.

13. James C, Ugo V, Le Couédic JP, Staerk J, Delhommeau F, Lacout C, Garçon L, Raslova H, Berger R, Bennaceur-Griscelli A, Villeval JL, Constantinescu SN, Casadevall N, Vainchenker W. A unique clonal JAK2 mutation leading to constitutive signalling causes polycythaemia vera. Nature 2005;434:1144-1148.

14. Baxter EJ, Scott LM, Campbell PJ, East C, Fourouclas N, Swanton S, Vassiliou GS, Bench AJ, Boyd EM, Curtin N, Scott MA, Erber WN, Green AR; Cancer Genome Project. Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders. Lancet 2005;365:1054-1061.

15. Kralovics R, Passamonti F, Buser AS, Teo SS, Tiedt R, Passweg JR, Tichelli A, Cazzola M, Skoda RC. A gain-of-function mutation of JAK2 in myeloproliferative disorders. N Engl J Med 2005;352:1779-1790.

16. Ugo U, Marzac C, Teyssandier I, Larbret F, Lécluse Y, Debili N, Vainchenker W, Casadevall N. Multiple signaling pathways are involved in erythropoietin-independent differentiation of erythroid progenitors in polycythemia vera. Exp Hematol 2004;32:179-187.

17

Torun D, et al: Effect of SOCS3 Methylation in MPNs

17. Jones AV, Kreil S, Zoi K, Waghorn K, Curtis C, Zhang L, Score J, Seear R, Chase AJ, Grand FH, White H, Zoi C, Loukopoulos D, Terpos E, Vervessou EC, Schultheis B, Emig M, Ernst T, Lengfelder E, Hehlmann R, Hochhaus A, Oscier D, Silver RT, Reiter A, Cross NC. Widespread occurrence of the JAK2 V617F mutation in chronic myeloproliferative disorders.

Blood 2005;106:2162-2168.

18

Turk J Hematol 2013;30:13-18

18. Oh ST, Gotlib J. JAK2 V617F and beyond: role of genetics and aberrant signaling in the pathogenesis of myeloproliferative neoplasms. Expert Rev Hematol 2010;3:323-337.

19. Thiele J. Philadelphia chromosome-negative chronic myeloproliferative disease. Am J Clin Pathol 2009;132:261-280.

20. Choo KB. Epigenetics in disease and cancer. Malays J Pathol 2011;33:61-70.

Research Article

DOI: 10.4274/tjh.2012.0036

The Effectiveness of a New Hemostatic Agent (Ankaferd Blood Stopper) for the Control of Bleeding following Tooth Extraction in Hemophilia: A Controlled Clinical Trial Hemofililerde Yeni Bir Hemostatik Ajanın (Ankaferd Blood Stopper) Diş Çekimi Sonrası Kanama Kontrolüne Etkisi: Kontrollü Bir Klinik Çalışma Hakkı Oğuz Kazancıoğlu1, Onur Çakır2, Gülsüm Ak2, Bülent Zülfikar3 1Bezmialem Vakıf University, School of Dentistry, Department of Oral and Maxillofacial Surgery, İstanbul, Turkey 2İstanbul University, School of Dentistry, Department of Oral and Maxillofacial Surgery, İstanbul, Turkey 3İstanbul University, Cerrahpaşa School of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey

Abstract: Objective: To assess the hemostatic efficacy of a new local hemostatic agent, Ankaferd Blood Stopper (ABS), for the control of bleeding following tooth extraction in hemophiliacs.

Materials and Methods: Simple tooth extractions were performed in 27 hemophilia A patients. In the treatment group (n=17) local hemostasis was achieved via application of ABS to the extraction sockets, whereas in the control group (n=10) local hemostasis was achieved via direct packing with gauze.

Results: In all, 57 (21 primary and 36 permanent) teeth extractions were performed in 27 hemophilia A patients. There were no significant differences in age or factor VIII level distribution between the 2 groups (p>0.05). The most significant clinical difference between the groups was associated with the use of ABS; those in the treatment group had significantly shorter duration of bleeding (p=0.002).

Conclusion: This is the first study to evaluate the efficacy of ABS for the control of bleeding following tooth extraction in hemophiliacs. ABS can be considered an alternative local hemostatic agent for reducing clotting factor concentrates in hemophilia patients.

Key Words: Ankaferd Blood Stopper, Oral surgery, Hemophilia, Hemostasis Özet: Amaç: Yeni bir hemostatik ajan olan Ankaferd Blood Stopper (ABS)’ın hemofili hastalarında diş çekimi sonrası kanama kontrolüne etkisini değerlendirmek.

Address for Correspondence: Hakkı Oğuz KAZANCIOĞLU, M.D., Bezmialem Vakıf University, School of Dentistry, Department of Oral and Maxillofacial Surgery, İstanbul, Turkey Phone: +90 212 453 17 00 E-mail: dt_oguz@yahoo.com Received/Geliş tarihi : March 13, 2012 Accepted/Kabul tarihi : May 10, 2012

19

Turk J Hematol 2013;30:19-24

Kazancıoğlu HO, et al: Ankaferd Blood Stopper and Hemophilia

Gereç ve Yöntemler: 27 hemofili hastasının basit diş çekimleri gerçekleştirildi ve 17 hastaya ABS uygulandı. Kontrol grubunda (n=10) lokal hemostaz gaz tampon uygulanarak sağlandı. ABS ile tedavi edilen grupta (tedavi grubu) lokal hemostaz ABS’nin çekim soketine uygulanması ile sağlanmıştır.

Bulgular: 27 hemofili hastasından toplam 57 (21 süt ve 36 sürekli) diş çekimi gerçekleştirildi. Gruplar arasında yaş ve Faktör VIII seviyeleri açısından istatiksel olarak anlamlı fark bulunamamıştır (p>0,05). Gruplar arasında en önemli klinik farklılık ABS kullanımı ile ilişkilidir. ABS uygulanan grubun kanama süresi daha düşüktür (p=0,002).

Sonuç: Bu çalışma hemofili hastalarında diş çekimi sonrasında ABS’nin etkinliğini değerlendiren ilk çalışmadır. ABS hemofili hastalarında pıhtılaşma faktörü uygulama oranını azaltmak için alternatif bir hemostatik ajan olarak düşünülebilir.

Anahtar Sözcükler: Ankaferd Blood Stopper, Ağız cerrahisi, Hemofili, Hemostaz

Introduction Hemophilia is an X-linked hereditary disorder with male predominance and a frequency of approximately 1/10,000 births.

Hemophilia A occurs due to a deficiency of factor (F) VIII and hemophilia B occurs due to a deficiency of FIX [1,2]. According to factor activity, hemophilia can be classified as severe (<1% of normal), moderate (1%-5% of normal), or mild (5%-40% of normal) [1,3].

The deficient factors should be complemented with factor concentrate when hemophilia patients undergo surgical procedures. In cases of minor surgical intervention (tooth extraction, supragingival periodontal treatment) and major surgical intervention (surgical tooth extraction with complication, subgingival periodontal treatment) the desired foctor levels should be approximately >50 IU/dL and >80 IU/dL, respectively [4].

Due to the lack of hemostasis protocols, interventions to prevent bleeding are delayed, and dentists usually avoid treating hemophilia patients because of the high risk of bleeding and inadequate factor support. As a result of these conditions and inadequate preventive dentistry, tooth extractions and odontogenic cyst development are inevitable in hemophiliacs.

Conventional hemostatic agents are expected to aid a patient’s coagulation system in rapidly developing an occlusive clot via platelet adhesion, platelet activation, and blood coagulation.

Various local hemostatic agents have been used in oral and maxillofacial surgical practice. Hemostatic agents vary in effectiveness, cost, and ease of use. The ideal oral surgery hemostatic agent should be safe, well-tolerated, bacteriostatic, preformed for operator convenience, packaged, sterile, single-use, and able to remain where applied, dissolve during the first postsurgery week, and integrate with current oral surgery treatment protocols without the need for special procedures. What is needed is an absorbable hemostatic agent that can be successfully used in the treatment of major solid organ injuries and does not depend on platelet and coagulation factors for its hemostatic efficacy. To date, no hemostatic device has completely met these criteria [3,4,5].

Ankaferd Blood Stopper (ABS) (Ankaferd Health Products, Ltd., İstanbul, Turkey) is a new hemostatic agent comprising the following plant extracts: Urtica dioica (0.06 mg/mL), Vitis vinifera (0.08 mg/mL), Glycyrrhiza glabra (0.07 mg/mL), Alpinia 20

officinarum (0.07 mg/mL), and Thymus vulgaris (0.05 mg/mL).

Each of these plant extracts has some effects on the endothelium, blood cells, angiogenesis, cellular proliferation, vascular dynamics, and cell mediators. Although the basic mechanism of action of ABS remains unclear, it appears to cause the formation of an encapsulated protein network representing focal points for vital erythrocyte aggregation. The ABS-induced protein network that forms with blood cells, particularly erythrocytes, covers the primary and secondary hemostatic system without disturbing individual coagulation factors. ABS also upregulates the GATA/FOG transcription system, affecting erythroid functions and urotensin II. These data have been obtained via MALDI-TOF proteomic molecular analysis, cytometric array, transcription analysis, and scanning electron microscopy examination in in vitro and in vivo research settings [6,7,8].

Exaggerated bleeding, primarily in patients with hereditary or acquired hemorrhagic diathesis, is a challenging issue in daily dental practice; therefore, ABS may be useful for treating patients with bleeding disorders. Since the Turkish Ministry of Health authorized the use of ABS for the management of dental bleeding, ABS has been added to protocols for the prevention and treatment of prolonged hemorrhaging due to dental procedures. The present study aimed to evaluate the effects of ABS on the duration of bleeding following dental extractions in hemophiliacs. To the best of our knowledge this is the first study on the use of ABS on dental extraction sockets in hemophilia patients.

Materials and Methods Patients and Design This cross-sectional controlled clinical trial included 27 male hemophilia A patients that required dental extractions. The mean FVIII level in the patients was 2.41±2.58% (range: 0%-9%). The participants were assigned to the control group (n=10) or treatment group (n=17) regardless of disease severity. Each patient underwent an initial consultation to establish a dental treatment plan. All mild to moderate hemophilia A patients with severe dental caries, dental abscess, and prolonged retention of deciduous teeth that required tooth extraction were candidates for inclusion in the study. Patients that had any psychological disease or systemic disease, such as diabetes mellitus and hypertension, were excluded from the study.

Turk J Hematol 2013;30:19-24

Kazancıoğlu HO, et al: Ankaferd Blood Stopper and Hemophilia

In total, 32 patients met the study’s inclusion criteria; however, 3 did not agree to participate and were thereby excluded. The study began with 29 patients, but 2 were subsequently excluded because they did not follow the suggested protocol. Before dental extraction all patients received standard factor replacement therapy according to our hospital’s guidelines (Table 1). Only those in the treatment group received ABS, which was applied locally after dental extraction.

Demographic data, factor levels, duration of bleeding, dental treatments, and pre- and postoperative additional factor infusion were recorded (Table 2). The study was conducted in accordance with the Declaration of Helsinki. Before commencement of the study, written informed consent was obtained from each patient or their parents.

Each of the patients’ physicians was consulted.

All of the hemophilia patients underwent our clinic’s dental treatment protocol (Table 1). Factor replacement therapy was performed 1 h prior to tooth extraction, according to patient weight. Recombinant human factor VIIa (rFVIIa; NovoSeven®; Novo Nordisk A/S, Bagsværd, Denmark) (90 μg/kg) was administered 1 h prior to tooth extraction for bleeding control in patients who had inhibitor against factor VIII, and this procedure was applied again at hours 3 and 6 after surgery. In addition, these patients used tranexamic acid (30/mg/kg/day) orally for 5-7 days.

All extractions were performed under local anesthesia using a 2% ultracaine-DS ampule consisting of 40 mg articaine HCl and 0.006 mg/mL epinephrine HCl (Sanofi/Aventis, Germany). Patients were sent to their hematologists for postoperative factor replacement therapy and bleeding control.

All tooth extractions were performed by the same qualified oral surgeon using forceps and/or elevators. The extractions were carried out in the least traumatic way possible and the extraction sites were carefully removed. In the treatment group, local hemostasis was achieved via local application of ABS on the extraction sockets. ABS was topically applied via high-pressure homogeneous spraying into the cavity. If oozing persisted, extra doses of ABS were topically applied. In the control group, local hemostasis was achieved via direct packing with gauze.

Bleeding assessment An investigator blinded to the treatment measured the duration of bleeding in seconds, from the time bleeding started to cessation of free-flowing blood from outside the cavity, using a digital chronometer.

Postoperative care The patients were given postoperative instructions. On the day of surgery the patients were followed for hemorrhage during the first 2 h after extraction. Follow-up appointments were then scheduled for 1, 3, and 7 days after surgery. In cases of persistent bleeding, hematologists were consulted for treatment. Single and multiple (up to 4 teeth) extractions were considered low-risk interventions, and these patients were classified into a low-risk subgroup. In total, 57 (21 primary and 36 permanent) teeth extractions were performed in 27 hemophilia patients. No bleeding complications occurred during the extractions. All the surgical procedures were simple extractions that did not require elevation of a mucoperiosteal flap.

Statistical analysis Statistical analysis (descriptive and analytical) of the data was performed using MS Office Excel and SPSS v.15.0 for Windows.

The Mann-Whitney U test was used to evaluate the differences between the groups. Data are presented as percentage, mean ± SD, and median, IQR (interquartile range), where appropriate. The level of statistical significance was set at p<0.05.

Results The study included 27 hemophilia A patients. The treatment group consisted of 17 male patients with a mean FVIII level of 2.5% (range: 0%-8.7%) and mean age of 20.35±11.41 years (range: 5-46 years). The control group included 10 male patients with a mean FVIII level of 2.2% (range: 0%-9%) and mean age of 21.10±13.43 years (range: 8-42 years). There were no significant differences in age, FVIII level distribution, or FVIII consumption before and after surgery between the 2 groups (p>0.05). The most significant clinical difference between the groups was associated with the use of ABS; those in the treatment group had significantly shorter duration of bleeding (Table 3).

Local hemostasis and late bleeding were the criteria used to compare the treatment and control groups. Complete hemostasis was immediately obtained in both groups, except for 1 patient in the treatment group who had inhibitors (26 BU) against FVIII. This patient was treated with additional recombinant factor VIIa infusion. Patients in the treatment group were administered 1-2 mL of ABS; in most cases 1 mL of ABS was sufficient to control bleeding.Median duration of bleeding in the treatment group was 70 s (IQR: 55–79.5 s) versus 101 s (IQR: 77–122.5 s) in the

Table 1: Hemostasis protocol.

Preoperative

Postoperative

Time

Drug

Desired Plasma Factor Level

12 h before

Tranexamic acid

10 mg/kg/dose

1 h before

FVIII or FIX

30-40/50-60 IU/kg

Up to days 5-7; 3-4 times/day

Tranexamic acid

30-40 mg/kg/day

Every 8 hours

FVIII

15-25 IU/kg

Every 12 hours

FIX

30-50 IU/kg 21

Turk J Hematol 2013;30:19-24

Kazancıoğlu HO, et al: Ankaferd Blood Stopper and Hemophilia

control group and the difference was significant (p=0.002) (Table

Discussion

3). Late bleeding was not observed after surgery. At the last follow-

Hemophilia A is a secondary hemostasis disorder. To prevent spontaneous, traumatic, and surgical bleeding hemophilia patients require replacement of the missing clotting factor. This is especially true for hemophilia patients living in newly industrialized countries who have bad oral hygiene due to the fear

up, none of the patients had extraction socket wound infection.

Delayed wound healing was observed only in an 8-year-old patient in the control group. No allergic reactions or side effects were attributed to the use of ABS.

Table 2: Demographic, medical, and dental extraction characteristics of the hemophilia A patients.

Group

Age

Factor Level

Duration of Bleeding (s)

Inhibitor (BU)

Extracted Teeth

Pre-op Desired Plasma Factor Level

Post-op Desired Plasma Factor Level

C1

40

1.1%

84

-

11, 12, 21, 22

50 IU/dL

30 IU/dL

C2

32

1%

98

-

15, 16, 26, 38

40 IU/dL

25 IU/dL

C3

20

9%

65

-

16, 47, 48

60 IU/dL

-------------

C4

12

7%

70

-

64

30 IU/dL

-------------

C5

10

2%

102

-

54, 64

35 IU/dL

20 IU/dL

C6

46

0%

123

-

26, 46

40 IU/dL

25 IU/dL

C7

8

0%

129

-

51, 82

35 IU/dL

20 IU/dL

C8

14

0.9%

100

-

75, 84, 85

35 IU/dL

20 IU/dL

C9

12

0.9%

110

-

65, 36

35 IU/dL

20 IU/dL

C 10

17

0.3%

122

-

27, 36

40 IU/dL

25 IU/dL

T1

38

0.9%

58

-

47, 48

40 IU/dL

25 IU/dL

T2

22

0%

72

-

63

35 IU/dL

20 IU/dL

T3

9

2%

42

-

64, 65, 75

50 IU/dL

30 IU/dL

T4

28

1%

77

-

26, 36, 46

40 IU/dL

25 IU/dL

T5

8

2%

58

-

71

50 IU/dL

30 IU/dL

T6

24

1%

52

-

17, 46

35 IU/dL

20 IU/dL

T7

8

4%

42

-

75

30 IU/dL

15 IU/dL

T8

7

3.4%

43

-

54, 62, 64

30 IU/dL

15 IU/dL

T9

19

5%

79

-

26, 36

35 IU/dL

20 IU/dL

T 10

34

2%

82

-

17

35 IU/dL

20 IU/dL

T 11

34

8.7%

80

-

15

35 IU/dL

-------------

T 12

33

6%

65

-

12, 26

40 IU/dL

-------------

T 13

5

2.7%

70

-

54, 64

30 IU/dL

15 IU/dL

T 14

23

1%

75

-

36

40 IU/dL

25 IU/dL

T 15

11

2.5%

63

-

37, 38

35 IU/dL

-------------

T 16

11

0.9%

82

1.1

64, 75

T 17

32

0%

120

26

14, 15, 16

C: Control, T: Treatment

22

Turk J Hematol 2013;30:19-24

Kazancıoğlu HO, et al: Ankaferd Blood Stopper and Hemophilia

Table 3: Age, initial Factor VIII level, Factor VIII consumption after the procedure, and the duration of bleeding variables for the patient group and the control group.

Patient n=17

Group

Age (Years) Initial Factor Level (%)

Median

IQR 1/4

IQR 3/4

Mean±SD

Median

20.3±11.4

22

8.5

32.5

21.1±13.4

18.5

11

39

0.78

2.5±2.3

2

0.9

3.7

2.2±3.1

0.9

0.1

4.5

0.28

1045

950.4

1465.8

1325±227

1121

1100.4

1502.6

0.68

70

55

79.5

100.3±22.0

101

77

122.5

0.002*

68.2±19.0

IQR 1/4

p-value

Mean±SD

Factor Consumption After the Procedure (IU/kg) (Until Day 7) 1275±278 Duration of Bleeding (s)

Control n=10 IQR 3/4

IQR: Interquartile range

of bleeding, nutritional deficiencies, and inadequate factor support. Due to the fact that hemostasis protocols cannot be used to determine a patient’s coagulation factor level, interventions to prevent bleeding are delayed. As a result of these conditions, it is necessary to employ a tooth extraction protocol for such patients.

In patients undergoing oral surgery guidelines for the management of coagulation disorders recommend not disrupting the anticoagulation regimen, providing that the level of anticoagulation is within therapeutic levels according to the international normalized ratio [9,10,11].

The literature describes various dental treatment protocols that result in a remarkable reduction in the number of bleeding episodes following oral procedures, including the use of oral antifibrinolytic agents, systemic hemostatic replacement therapy, and use of local hemostatic agents [12,13]. The primary benefits of local hemostatic agents are a life-saving reduction in hemorrhaging caused by trauma, a reduction in factor dependency, a reduction in the cost of treatment, and rapid control of hemorrhaging, which reduces patient anxiety related to uncontrollable bleeding [14]. A retrospective study that included 63 patients with von Willebrand disease reported that there was no difference in the frequency of bleeding complications following dental extraction between patients that received only local therapy with tranexamic acid and fibrin glue, and those that received either desmopressin or FVIII/von Willebrand factor concentrates [15].

Hewson et al. [11] performed 113 dental extractions in 50 patients without previous infusion of clotting factor concentrates, and they reported that there were no severe bleeding complications during a follow-up period of 8 days and that only 4 patients required repeated concentrate infusion to control bleeding. They emphasized the role of local hemostatic techniques, such as careful incision procedures, use of tranexamic acid to fill the extraction sockets and as mouthwash, and use of absorbable hemostats and resorbable sutures. Mancuso [13] also reported that minimal infusion of factor replacement in dental treatment procedures could be performed via application of local hemostatic agents.

ABS is a folkloric medicinal plant extract that has been approved for the management of dental surgery and external hemorrhaging [8,16], and it is proven to be safe, efficacious, sterile, and nontoxic [17,18,19,20,21]. Goker et al. [7] reported that the ABS-induced network formation is correlated with blood protein and red blood

cell functions. They also reported that ABS’s basic mechanism of action appears to be the formation of an encapsulated protein network that provides focal points for erythrocyte aggregation. Blood cells also aggregated and participated in the network formation, with the erythrocytes forming a mass. They also observed that plasma fibrinogen, total protein, albumin, and globulin levels decreased in response to ABS. This mechanism of ABS represents an advantage over other local hemostatic agents. Cipil et al. [17] reported that ABS had in vivo hemostatic actions that may be therapeutic for the clinical management of patients with deficient primary hemostasis.

Furthermore, they reported that ABS exhibited a hemostatic effect via modulation of platelet functions. Oner et al. [16] applied FVIII inhibitor bypass activity, cyclophosphamide, prednisolone, and then ABS to treat persistent bleeding due to circumcision in a pediatric hemophiliac with inhibitor; only ABS effectively controlled the bleeding.

Baykul et al. [22] investigated the effect of topical application of ABS on hemorrhagic diathesis in 4 patients following different dental procedures. In most of the patients ABS effectively controlled bleeding within 10-20 min following dental surgery. In the present study, ABS was observed to be an effective and safe alternative hemostatic agent. In the treatment group only 1 patient (a 32-yearold severe hemophilia A patient (0%) who had inhibitors against factor VIII (26 BU)) had prolonged postsurgical bleeding, which was stopped with reapplication of ABS and rFVIIa (hours 3 and 6). This patient had 3 teeth extracted at the same time, and ABS was applied with rFVIIa before and after extraction. We think that the bad fibrin formation was caused by the patient’s poor oral hygiene and multiple tooth extractions. No bleeding complication was observed in another patient with inhibitor (an 11-year-old severe hemophilia A patient (0.9%) (1.1 BU)). Inadequate wound healing occurred in an 8-yearold patient in the control group that had severe hemophilia A (0%).

We think that this patient’s postoperative bleeding was caused by inadequate postoperative care, because the patient did not fully comply with the study’s protocol.

In the present study, ABS significantly reduced the duration of post-oral surgery bleeding. Based on the present findings, we think that ABS is effective, safe, and easy to use. Additionally, the blood coagulation process is driven by protein agglutination and ABS stimulates formation of an encapsulated protein network that provides space for erythrocyte aggregation in the injured vascular 23

Kazancıoğlu HO, et al: Ankaferd Blood Stopper and Hemophilia

area. Furthermore, ABS also interacts with fibrinogen and other blood proteins. ABS has no effect on coagulation factor levels; therefore, ABS can be used in patients with deficient primary hemostasis and/or secondary hemostasis, including patients with disseminated intravascular coagulation [23]. In terms of cost-effectiveness, clotting factor concentrates are costly components of hemostatic therapy in patients with bleeding disorders; a reduction in their use will directly reduce the cost of therapy. Financial concerns have forced researchers to study ancillary therapies, such as new techniques or hemostasis protocols that might provide an opportunity to identify something that would be closer to optimal replacement therapy by using lower doses. In Turkey the cost of 1000 IU of FVIII and 1 mg of rFVIIa is approximately $555 and $722, respectively, whereas 1 mL of ABS cost only approximately $6.

In conclusion, to the best of our knowledge the present study is the first to evaluate the efficacy of ABS for the control of bleeding following tooth extraction in hemophilia patients. ABS was observed to effectively achieve hemostasis in the treatment group.

Additional controlled trials are needed to further evaluate the effectiveness of ABS as an alternative local hemostatic agent in hemophilia patients, without the use clotting factor concentrates.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. van Bladel ER, Roest M, de Groot PG, Schutgens RE. Upregulation of platelet activation in hemophilia A. Haematologica 2011;96:888-895.

2. Israels S, Scwertz N, Boyar R, McNicol A. Bleeding disorders: characterization, dental considerations and managements. J Can Dent Assoc 2006;72:827.

3. Gupta A, Epstein JB, Cabay RJ. Bleeding disorders of importance in dental care and related patient management. J Can Dent Assoc 2007;73:77-83.

4. Zanon E, Martinelli F, Bacci C, Zerbinati P, Girolami A. Proposal of a standard approach to dental extraction in hemophilia patients. A case-control study with good results.

Hemophilia 2000:6:533-536.

5. Karakaya K, Ucan HB, Tascılar O, Emre AU, Cakmak GK, Irkorucu O, Ankarali H, Comert M. Evaluation of a new hemostatic agent Ankaferd Blood Stopper in experimental liver laceration. J Invest Surg 2009;22:201-206.

6. Bilgili H, Kosar A, Kurt M, Onal IK, Goker H, Captug O, Shorbagi A, Turgut M, Kekilli M, Kurt OK, Kirazli S, Aksu S, Haznedaroglu IC. Hemostatic efficacy of Ankaferd Blood Stopper in a swine bleeding model. Med Princ Pract 2009;18:165-169.

7. Goker H, Haznedaroglu IC, Ercetin S, Kirazli S, Akman U, Ozturk Y, Fırat HC. Haemostatic actions of the folkloric medicinal plant extract, Ankaferd blood stopper. J Int Med Res 2008;36:163-170.

8. Baykul T, Alanoglu EG, Kocer G. Use of Ankaferd Blood Stopper as a hemostatic agent: a clinical experience. J Contemp Dent Pract 2010;11:E088-94.

24

Turk J Hematol 2013;30:19-24

9. Carter G, Goss AN, Lloyd J, Tocchetti R. Current concepts of the management of dental extractions for patients taking warfarin. Aust Dent J 2003;2:89-96.

10. Gupta A, Epstein JB, Cabay RJ. Bleeding disorders of importance in dental care and related patient management. J Can Dent Assoc 2007;73:77-83.

11. Hewson I, Makhmalbaf P, Street A, McCarthy P, Walsh M. Dental surgery with minimal factor support in the inherited bleeding disorder population at the Alfred Hospital.

Hemophilia 2011;17:185-188.

12. Brewer A, Correa MA. Guidelines for dental treatment of patients with inherited bleeding disorders. World Federation of Hemophilia 2006;40:1-9.

13. Mancuso ME, Santagostino E. Dental surgery in inherited bleeding disorders with minimal factor support: commentary.

Hemophilia 2011;17:183-184.

14. Zusman SP, Lustig JP, Baston I. Postextraction hemostasis in patients without reducing the dose of oral anticoagulant: the use of fibrin sealant. Quitessence Int 1992;23:713-716.

15. Federici AB, Sacco R, Stabile F, Carpenedo M, Zingaro E, Mannucci PM. Optimizing local therapy during oral surgery in patients with von Willebrand disease: effective results from a retrospective analysis of 63 cases. Hemophilia 2000;6:71-77.

16. Öner AF, Doğan M, Kaya A, Sal E, Bektaş MS, Yesilmen O, Ayhan H, Acikgoz M. New coagulant agent (Ankaferd Blood Stopper) for open hemorrhages in hemophilia with inhibitor.

Clin Appl Thromb Hemost 2010;16:705-707.

17. Cipil H, Kosar A, Kaya A, Uz B, Haznedaroğlu IC, Goker H, Ozdemir O, Koroglu M, Kirazli S, Firat HC. In vivo hemostatic effect of the medicinal plant extract Ankaferd blood stopper in rats pretreated with warfarin. Clin Appl Thromb Hemost 2009;15:270-276.

18. Kurt M, Disibeyaz S, Akdogan M, Sasmaz N, Aksu S, Haznedaroglu IC. Endoscopic application of Ankaferd blood stopper as a novel experimental treatment modality for upper gastrointestinal bleeding: a case report. Am J Gastroenterol 2008;103:2156-2158.

19. Ibis M, Kurt M, Onal IK, Haznedaroglu IC. Successful management of bleeding due to solitary rectal ulcer via topical application of Ankaferd blood stopper. J Altern Complement Med 2008;14:1073-1074.

20. Kurt M, Kacar S, Onal IK, Akdogan M, Haznedaroglu IC. Ankaferd blood stopper as an effective adjunctive hemostatic agent for the management of life threatening arterial bleeding of the digestive tract. Endoscopy 2008;40 Suppl 2:E262.

21. Fisgin NT, Cayci YT, Coban AY, Ozatli D, Tanyel E, Durupinar B, Tulek N. Antimicrobial activity of plant extract Ankaferd Blood Stopper®. Fitoterapia 2009;80:48-50.

22. Baykul T, Alanoglu EG, Kocer G. Use of Ankaferd Blood Stopper as a hemostatic agent: a clinical experience. J Contemp Dent Pract 2010;11:E088-94.

23. Cakarer S, Eyüpoglu E, Ozçamur Günes C, Gürkan Küseoglu B, Koçak Berberoglu H, Keskin C. Evaluation of the hemostatic effects of Ankaferd Blood Stopper during dental extractions in patients on antithrombotic therapy. Clin Appl Thromb Hemost 2013;19:96-99.

Research Article

DOI: 10.4274/tjh.2012.0001

Frequency and Risk Factors of Endocrine Complications in Turkish Children and Adolescents with Sickle Cell Anemia Orak Hücre Anemili Türk Çocuk ve Ergenlerde Endokrin Komplikasyonların Sıklığı ve Risk Faktörleri Samim Özen1, Selma Ünal2, Neslihan Erçetin3, Bahar Taşdelen4 1Mersin Maternity and Children’s Hospital, Department of Pediatric Endocrinology, Mersin, Turkey 2Mersin University Medical School, Department of Pediatric Hematology, Mersin, Turkey 3Mersin Maternity and Children’s Hospital, Biochemistry Laboratory, Mersin, Turkey 4Mersin University, Department of Biostatistics, Mersin, Turkey

Abstract: Objective: To define frequency and risk factors of abnormalities in growth, puberty, thyroid function, and bone and carbohydrate metabolisms in children and adolescents with sickle cell disease (SCD).

Materials and Methods: Endocrine problems including short stature, puberty and thyroid disorders, and carbohydrate and bone metabolisms in 50 Turkish children and adolescents with SCD were evaluated. Relationships among sex, disease type, blood transfusions, exchange and exacerbation frequency, ferritin levels, and endocrine pathologies were investigated.

Results: The mean age of the study group was 13.1±2.9 years. Weights and heights of 12 participants (24%) were below 2 standard deviations and 4 participants (8%) had malnutrition. Mean difference (±standard deviation) between bone and chronological age of patients was -1.73±1.86 years. Fifty percent of patients had at least one endocrine abnormality other than vitamin D deficiency and insufficiency. Hypergonadotropic hypogonadism in 3 patients (6%), hypogonadotropic hypogonadism in 1 female patient (2%), and small testicular volume in respect to age in 3 male patients (8.5%) were seen.

Growth hormone deficiency was detected in 1 (2%) female patient, and hypothyroidism was diagnosed in 3 patients (6%; 1 central case, 2 cases of primary hypothyroidism). At vertebral level, 5 patients (11.1%) had osteopenia and 1 patient (2.2%) had osteoporosis, while 5 patients (11.1%) had osteopenia at femur neck level. The most common endocrine abnormality was vitamin D deficiency. 25-Hydroxyvitamin D was deficient in 63.2% and insufficient in 18.4% of patients. Sex, disease type, blood transfusion frequency, exacerbation frequency, and ferritin levels were not related to endocrine pathologies. As the age was increased, standard deviation scores of femur neck bone mineral density was decreased (r =-0.56; p<0.05).

Vitamin D was lower in patients whose weights and/or heights were below -2 standard deviations from the mean (p<0.05).

Conclusion: Endocrine organ dysfunctions are commonly detected in children and adolescents with SCD, and vitamin D deficiency is the most commonly encountered endocrine disorder. Regular follow- ups of patients for endocrine complications, starting from early ages of patients, and initiation of appropriate treatments will elongate expectancy and quality of life.

Key Words: Sickle cell disease, Nutritional status, Endocrine system diseases, Children Address for Correspondence: Samim ÖZEN, M.D., Mersin Maternity and Children’s Hospital, Department of Pediatric Endocrinology, Mersin-Turkey Phone: +90 324 223 07 01 E-mail: samimozen@gmail.com Received/Geliş tarihi : April 07, 2012 Accepted/Kabul tarihi : May 10, 2012

25

Özen S, et al: Endocrine Complications in Pediatric Patients with SCD

Turk J Hematol 2013;30:25-31

Özet: Amaç: Orak hücre anemili (OHA)’li çocuk ve ergenlerde büyüme, puberte, tiroid, kemik ve karbonhidrat metabolizmazı bozuklularının sıklığı ve risk faktörlerinin belirlenmesi amaçlanmıştır.

Yöntemler: 50 OHA’li Türk çocuk ve adolesanda vücut ölçümleri yanında boy, puberte, tiroid, karbonhidrat ve kemik metabolizması bozuklarını içeren endokrin sorunlar değerlendirildi. Cinsiyet, hastalık tipi, kan transfüzyonu, exchange ve atak sıklığı, ferritin düzeyi ile endokrin patolojiler arasında ilişki araştırıldı.

Bulgular: Yaş ortalaması 13,1±2,9 yıl olan hastaların 12’sinde (%24) ağırlık ve boyu -2 standart deviasyon (SD) altında ve 4’ünde (%8) malnütrisyon bulundu. Hastaların ortalama (±SD) kemik yaşı-takvim yaşı farkı -1,73±1,86 yıl idi. Vitamin D eksikliği dışında hastaların %50’sinde en az bir endokrin bozuklukluk vardı. 3 hastada (%6) hipergonadotropik hipogonadizm, 1 kız hastada (%2) hipogonadotropik hipogonadizm, 3 erkek hastada (%8,5) ise yaşa göre testis volum küçüklüğü saptandı. 1 kız hastada (%2) büyüme hormonu eksikliği, 3 hastada (%6) hipotiroidi (1 santral, 2 primer hipotiroidi) tanısı konuldu. Vertebral düzeyde hastaların 5’inde (%11,1) osteopeni, 1’inde (%2,2) osteoporoz, femur boynu düzeyinde ise 5’inde (%11,1) osteopeni saptandı. Hastalarda en sık görülen endorin bozukluk vitamin D eksikliği idi. 25Hidroksivitamin D %63,2 hastada eksik, %18,4 hastada yetersiz bulundu. Cinsiyet, hastalık tipi, kan transfüzyonu sıklığı, atak sıklığı, ferritin düzeyi ile endokrin patolojiler arasında ilişki saptanmaz iken, yaş arttıkça femur boynu kemik mineral yoğunluğu SDS azaldığı (r=-0,56; p<0,05), ağırlık ve/veya boyu -2 SD altında olanlarda D vitamini değerinin daha düşük olduğu saptandı (p<0,05).

Sonuç: OHA’li çocuk ve ergenlerde endokrin organ bozuklukları sık görülür ve en sık endokrin sorun D vitamini eksikliğidir. Hastaların erken yaşlardan itibaren endokrin komplikasyonlar açısından düzenli olarak takip edilmesi ve uygun tedavilerin verilmesi yaşam süreleri ve yaşam kalitelerini artıracaktır.

Anahtar Sözcükler: Orak hücreli anemi, Beslenme durumu, Endokrin sistem hastalıkları, Çocuklar

Introduction Sickle cell disease (SCD) is a hemolytic anemia, characterized by abnormal hemoglobin production of autosomal recessive inheritance. SCD may lead to acute and chronic tissue ischemia and many organ dysfunctions due to intermittent small vascular obstructions [1,2]. While studies related to malnutrition, growth retardation, and pubertal development retardation were more frequently reported in pediatric patients with SCD [2,3], studies in gonadal insufficiency, thyroidal disorders, and bone metabolism were conducted with the adulthood and endocrine organ dysfunctions more frequently reported in SCD patients, especially in studies performed at adulthood [1,2,3]. The physiopathology of metabolic and endocrine disorders in these patients is not clear yet. Investigators propose that endocrine organ dysfunctions in SCD patients may be caused by iron overload due to recurrent blood transfusions or disruptions of tissue vitalization during vaso-occlusive crisis and inflammatory mediators [1,2,3]. On the other hand, as observed in other chronic diseases, malnutrition, which may negatively affect growth and development in childhood, is commonly encountered in SCD [4]. The present study aimed to determine frequency and risk factors of abnormalities in growth, development, puberty, thyroid health, and bone and carbohydrate metabolism in children and adolescents with SCD. Materials and Methods This study included 50 Turkish children and adolescents with SCD who were below 18 years of age and applied regularly to the Pediatric Hematology Department of the Medical School of Mersin 26

University and the Mersin Maternity and Children’s Hospital Department of Pediatric Endocrinology Outpatient Clinic between December 2009 and October 2011. Disease type, annual vasoocclusive and sickle crises, blood transfusion and exchange frequencies, and serum ferritin levels were obtained from the medical records; patients with fewer than 5 vaso-occlusive crises and/or sickle crises a year were defined as having “fewer attacks”, and those with 5 or more were defined as having “frequent attacks”.

Patients with fewer than 5 annual blood transfusions were defined as “less transfusion required”, and those with 5 and above were defined as “frequent transfusion required”. Endocrinological evaluations of patients were performed by the same pediatric endocrinology specialist. Height was measured using a rigid stadiometer. Weight was measured unclothed to the nearest 0.1 kg using a calibrated balance scale. Body mass index (BMI) was calculated by the formula of weight (kg) divided by height squared (m2), and standard deviation scores (SDSs) of weight, height, and BMI were also calculated for Turkish children [5]. Short stature was defined as a height SDS value below -2 standard deviations (SDs) and malnutrition was defined as a BMI SDS level below -2 SDs [5].

The pubertal status of each subject was determined using the Tanner criteria [6]. All testicular volumes were measured with a Prader orchidometer and compared with normal values [7].Threeday estimated diet records and vitamin D and calcium intake of subjects were computed.

Endocrinological Evaluation and Stimulation Test Morning fasting blood samples were obtained for serum insulin, glucose, calcium (Ca), phosphorus (P), alkaline phosphatase (ALP), 25-hydroxyvitamin D (25(OH)D), and intact

Turk J Hematol 2013;30:25-31

parathyroid hormone (iPTH) analysis. Subjects were then asked to drink a solution containing 1.75 g/kg (maximum: 75 g) of glucose, and blood samples were obtained again for 120-min glucose and insulin measurements. Serum glucose, Ca, P, and ALP levels were measured using a Beckman Coulter UniCel® automatic analyzer. Ca, P, and ALP levels were defined by the normal ranges of the kits used. A fasting blood glucose level of ≥100 mg/dL was considered impaired fasting glucose and a fasting blood glucose level of ≥126 mg/dL (7 mmol/L) was considered diabetes mellitus. In the oral glucose tolerance test, a 120-min glucose level of 140-199 mg/dL was considered impaired glucose tolerance and a 120-min glucose level of ≥200 mg/dL (11.1 mmol/L) was considered diabetes mellitus [8].

Insulin, free triiodothyronine (fT3), free thyroxine (fT4), thyroid stimulating hormone (TSH), luteinizing hormone (LH), follicle stimulating hormone (FSH), estradiol (E2), testosterone (T), growth hormone (GH), 25(OH)D, and iPTH measurements were performed by electrochemiluminescence method using the Roche® Diagnostic (Germany) Modular E-170 device and Cobas kits.

Insulin resistance (IR) using the homeostasis model assessment (HOMA) model was calculated as fasting insulin (μU/mL) × fasting glucose (mmol/L)/22.5. Insulin resistance was defined by HOMA-IR values of ≥3.16 in pubertal subjects and HOMA-IR of ≥2.67 in prepubertal subjects [9,10].

The corresponding normal values for the 2.5 and 97.5 percentiles of fT3, fT4, and TSH were 2.0-4.4 pg/mL, 0.93-1.7 ng/dL, and 0.27-4.2 μIU/mL, respectively. TSH insufficiency was diagnosed by fT4 of less than 0.8 ng/dL in combination with a normal or below normal TSH level and thyrotropin-releasing hormone (7 μg/kg) test. Normal values for LH, FSH, E2, and T were evaluated according to pubertal stages. Hypogonadotropic hypogonadism was suspected when both LH and FSH responses to LH-RH stimulation (100 μg/m2) were flat in patients of pubertal age. Basal and stimulated levels of TSH, prolactin (PRL), FSH, and LH were determined at sequential time points (15, 30, 60, and 90 min after stimulation). Pharmacological GH stimulation was tested by insulin tolerance test and levodopa. A peak value below 10 ng/mL in 2 tests was regarded as confirmatory for the diagnosis of GH deficiency [11].

Özen S, et al: Endocrine Complications in Pediatric Patients with SCD

radiography. The bone mineral density (BMD; g/cm2) of the lumbar spine and femoral neck was measured with dual energy X-ray absorptiometry (Hologic QDR 4500A Fan Beam X-ray Bone Densitometer, Hologic, Bedford, MA, USA). Z scores of measured values were calculated according to the standards of Turkish children developed by Goksen et al. [14]. Patients with Z scores according to age, sex, and height between -1 and -2 were accepted as osteopenic and those at and below -2 were accepted as osteoporotic [15].

The authors confirmed in writing that they had complied with the World Medical Association Declaration of Helsinki regarding ethical conduct of research involving human subjects and/or animals. The study was approved by the local ethics board and informed consent was obtained from the families of all patients.

Statistics Study data were analyzed using SPSS for Windows 15.0 (SPSS Inc., Chicago, IL, USA). Frequency tables for categorical variables and descriptive statistics for numerical variables were applied.

Given the cross-tabulation statistics between groups, level of significance was detected by chi-square test. In numerical comparisons, the t-test was used in normally distributed variables, whereas the Mann-Whitney U test was used for abnormally distributed variables. The Spearman correlation coefficient was calculated to test abnormally distributed variables. Statistical significance was accepted as p<0.05.

Results A total of 50 patients, who had mean age of 13.1±2.9 years (range: 4.3-17.8 years) and comprised 15 females (30%) and 35 males (70%), were enrolled in the study. Five patients were younger than 10 years of age. Descriptive information of the patients is presented in Table 1.

While 30 of the patients (60%) had HbSS anemia, 20 of them had the Hb S-beta type. Attack frequencies were “fewer attacks” Table 1: Descriptive information of the study group.

Characteristics

Serum 25(OH)D levels of ≥75 nmol/L (30 ng/mL) were defined as normal, 50-75 nmol/L (20-30 ng/mL) as insufficient, and <50 nmol/L (20 ng/mL) as deficient [10]. The normal range for iPTH levels was 10-65 pg/mL according to the kit’s manual, and therefore iPTH levels above 65 pg/mL were considered as indicative of hyperparathyroidism. In order to avoid any seasonal differences, all measurements of 25(OH)D and iPTH were performed in the summer. Serum ferritin levels of 500 ng/mL and above were defined as “high”.

Sex

Bone age was determined by same pediatric endocrinologist using a left-wrist radiograph and was assessed according to the method of Greulich and Pyle [13]. The difference between bone age and calendar age (ΔBACA) was defined by subtracting the chronological age from the bone age at the time of wrist

n (%) Female

15 (30)

Male

35 (70)

Age, years (mean±SD)

13.1±2.9

Weight, kg (mean±SD)

39.85±11.07

Weight, SDS (mean±SD)

-1.02±1.04

Height, cm (mean±SD)

147.25±15.27

Height, SDS (mean±SD)

-1.03±1.38

BMI, kg/m2 (mean±SD)

17.93±3.05

BMI, SDS (mean±SD)

-0.41±1.14

BMI: body mass index, SDS: standard deviation score, SD: standard deviation.

27

Turk J Hematol 2013;30:25-31

Özen S, et al: Endocrine Complications in Pediatric Patients with SCD

in 29 patients (58%) and “frequent attacks” in 21 patients (42%), whereas blood transfusions were required “less” in 37 patients (74%) and “more frequently” in 13 patients (26%). While 16 patients (32%) had exchange requirements, 15 patients (30%) received regular chelating treatment. With a mean serum ferritin level of 510.9±817 g/mL, the serum ferritin level of 15 patients (30%) was 500 ng/mL or above. Serum ferritin level was higher than 1000 ng/mL only in 4 patients. There were no cardiac or liver disorders in patients due to iron accumulation.

respectively. A girl of 15 years and 8 months with hypogonadotropic hypogonadism had no breast development or menarche. In this patient, peak LH level was detected as 0.4 mIU/mL, the basal E2 level was 13.1 pg/mL, and other pituitary hormone levels and pituitary magnetic resonance imaging (MRI) were normal. Three (8.5%) male patients also had small testes.

These patients were 8, 10.5, and 11.5 years old. In these patients, both testicular volumes were below 2 mL and peak LH values were detected as 2.0, 2.1, and 1.6 mIU/mL, respectively.

SDS values of weight, height, and BMI of cases were 1.02±1.04, -1.03±1.38, and -0.41±1.14, respectively. The mean difference (±SD) between bone and chronological age (ΔBACA) of patients was -1.73±1.86 years. In 12 (24%) patients (4 females, 8 males), weight and height values were below -2 SDS. Among those patients, 7 were prepubertal (stage 1) and 5 were pubertal (Tanner stage of 2 or greater), and the mean age was 11.5±3.5 years old. ΔBACA SDS was -1.92±1.01 years in these patients.

Four patients (8%) had malnutrition.

GH deficiency was detected in 1 (2%) female patient (13 years old, Tanner stage 2, bone age of 8 years and 10 months). Her weight and height SDSs were -1.3 and -3.2, respectively. In this patient, serum insulin-like growth factor-1 (IGF-1) level was 35 ng/dL (below -2 SD), peak GH values were 2.4 and 1.5 ng/mL in 2 different GH stimulation tests, and pituitary MRI was normal.

The endocrine complication frequency of the patients was 50% (25 complications in 50 patients), with at least 1 endocrine organ dysfunction in 18 patients, 2 different complications in 2 patients, and 3 different complications in 1 patient. Detected pubertal abnormalities were hypergonadotropic hypogonadism in 3 patients (2 females and 1 male; 6%) and hypogonadotropic hypogonadism in 1 female patient (2%). The 3 hypergonadotropic patients were 15.2 (female), 14.5 (female), and 16.5 (male) years old with no breast development in the girls. The male patient had no secondary sexual characteristics and both testicular volumes were 2 mL. Basal LH levels were 51.2 and 63.4 mIU/mL (normal: 0.1-12 mIU/mL) and E2 levels were below 12 pg/mL (normal: 25345 pg/mL) in the girls. In the male patient with hypergonadotropic hypogonadism, basal LH and testosterone levels were 75.1 mIU/mL (normal: 02.-5 mIU/mL) and 4.2 ng/dL (normal: 100-320 ng/dL),

Hypothyroidism was detected in 3 patients (1 central and 2 primary hypothyroidism). Central hypothyroidism was detected in a 15.9-year-old male. His weight, height, and pubertal status (Tanner stage 5) were normal. He had low fT4 (0.72 ng/dL) and normal TSH (1.0 μIU/mL) levels. In this patient, TRH test showed TSH insufficiency (basal and peak TSH levels: 1.3 μIU/mL and 4.55 μIU/mL, respectively).

In the evaluation of 45 patients whose BMD values were measured, L1-L4 BMD Z score was 0.47±1.33 SD and femur neck BMD Z score was 0.54±1.16 SD. At the vertebral level, 5 patients (11.1%) had osteopenia and 1 had (2.2%) osteoporosis, whereas at the femoral level, osteopenia was detected in 5 patients (11.1%) (Table 2). Average daily vitamin D and calcium intakes in all patients were calculated as 232.12±110.21 IU and 685.34±324.12 mg, respectively. Average daily vitamin D and calcium intakes of patients with osteopenia and/or osteoporosis, which were calculated as 168.11±91.12 IU and 456.32±198.76 mg, respectively, were statistically significantly low (P=0.032 and

Table 2: Distribution of endocrine problems and complications in patients with SCD. Complications

n (female/male)

%

24 (11/13)

63.1

Vitamin D insufficiency

7 (4/3)

18.4

Osteopenia

10 (6/4)

22.7

1 (M)

2.2

Vitamin D deficiency

Osteoporosis Hypothyroidism

Central

1 (F)

Primary

2 (1/1)

Hypergonadotropic

3 (2/1)

Hypogonadotropic

1 (F)

8

Testis atrophy and hypoplasia

3 (M)

8.5

Growth hormone deficiency

1 (F)

2

3 (1/2)

6

Hypogonadism

Insulin resistance (fasting) 28

6

Turk J Hematol 2013;30:25-31

Özen S, et al: Endocrine Complications in Pediatric Patients with SCD

P = 0.043, respectively). Ca, P, and ALP values were within normal limits in all cases. Vitamin D and iPTH levels were assessed in 38 patients. The detected mean 25(OH)D level (19.31±9.68 ng/mL) was very low. For 25(OH)D, 63.1% (n=24) of patients had deficiency and 18.4% (n = 7) had insufficiency (Table 2). The mean iPTH level was 44.4±17.4 pg/mL in the study group.

However, in 18.4% (7/38) of patients, the parathormone level was high (mean iPTH level: 76.8±10.1 pg/mL). Mean iPTH level in vitamin D deficient and insufficient subjects was higher compared to those with normal vitamin D status (47.01±12.91 vs.

36.24±11.25, p=0.026).

No diabetes was detected in patients, but fasting insulin resistance was detected in 3 patients (6%). There was no correlation among sex, disease type, blood transfusion, exchange and attack frequency, ferritin level, and endocrine pathologies.

However, femur neck BMD SDS decreased as age increased (r =-0.56, p<0.05), and vitamin D values were lower in patients who had weight and/or height below -2 SD (p<0.05).

Discussion Endocrine dysfunction in hematological diseases like thalassemia and SCD, which progresses with hemolysis and iron storage, can be encountered commonly and at early ages. The physiopathology of endocrine organ pathology is not still clear in patients with SCD. However, iron storage due to recurrent and frequent transfusions, or ischemia due to vaso-occlusive crises and inflammatory mediators during ischemia, are proposed as reasons for endocrine dysfunction [1,2,3]. In the present study, growth, puberty, thyroid problems, and bone and carbohydrate metabolism disorders were evaluated.

Growth retardation is the most commonly encountered endocrine disorder in patients with SCD. In previous studies, height, weight, and BMI values were demonstrated to be prominently lower in patients with SCD when compared to healthy controls [16,17]. Growth retardation in these patients may be related to factors like nutritional disorders [18], chronic inflammatory process, hypermetabolism in bone marrow [19,20], and hypogonadism [2,3]. In recent studies, it was found that abnormalities in GH-insulin-like growth factor-1 and IGF-1 binding protein 3 axis may cause growth retardation in patients with SCD, in whom growth is normal at birth but starts to retard after 1-2 years of age [21,22]. In a study conducted of 102 cases, heights of 54% of sickle cell anemia patients were reported to be lower than -2 SD [23]. In another study, growth retardation was reported in 24% of 76 patients with SCD [24]. When body measurements were evaluated according to Turkish children’s standards in our study, weight (-1.02±1.04) and height (-1.03±1.38) SDS values were below the mean standards. Weight and height values were below -2 SD in 12 patients (24%), and 4 patients (8%) had malnutrition. Bone ages in the study group were prominently retarded (ΔBACA SDS: -1.73±1.86 years). In a 13-year-old female patient, severe short stature (height SDS: -4.3), low IGF-1 level (35 ng/dL, below -2 SD), retarded bone age (8 years and 10 months), and GH deficiency were detected.

In 4 patients (8%) in our study group, hypogonadism was confirmed by LH-RH test along with clinical appearance. Etiology of hypogonadism in patients with SCD is not clear yet. However, reasons like primary testicular/ovarian insufficiency, hypothalamic and/or pituitary dysfunction, zinc deficiency, and constitutional pubertal retardation may be responsible [2,3,25]. Three (2 females and 1 males) out of our 4 hypogonadal patients had hypergonadotropic hypogonadism, and 1 female patient had hypogonadotropic hypogonadism. Three male patients of prepubertal age also had small testes. Both testicular volumes were below 2 mL in these patients. We have been following these patients in our pediatric endocrine outpatient clinic for pubertal status.

Hypothyroidism was detected in 3 patients (6%; 2 patients had primary and 1 patient had central) in our study group. The etiology of thyroid dysfunction in SCD is not clear; however, most affected patients have received multiple transfusions consistent with severe iron overload. Autopsy reports in some patients have shown significant iron deposition in the thyroid gland, suggesting that the etiology of the primary thyroid failure might well be transfusional hemosiderosis and subsequent cellular damage to the thyroid gland [2]. The reports of thyroid assessment in patients with SCD have been inconsistent. Abnormal thyroid function studies have been reported in patients with SCD [26,27].

Stimulation with TSH-releasing hormone showed increases in TSH that were significantly greater in SCD compared with controls and thus were suggestive of primary thyroid failure [28].

Out of 38 patients whose 25(OH)D levels were measured, 24 (63.1%) had vitamin D deficiency, 7 (18.4%) had vitamin D insufficiency, and iPTH was high in 18.4% (n=7/38). Serum iPTH levels of subjects in the vitamin D deficient and insufficient groups were statistically significantly higher than those of subjects in the vitamin D sufficient group. This might be an important finding, as a high iPTH level is an indirect indicator of vitamin D deficiency. Otherwise, low calcium intake can influence serum iPTH levels even in patients with vitamin D sufficiency [12]. In our study, there was no correlation between iPTH levels and daily calcium intake. Further large-scale studies are required to draw the final conclusion on this topic. There are increasing data demonstrating low serum levels of vitamin D among HbSS children, possibly linked to decreased dietary intake and in some cases to seasonal variability in food intake [29]. Buison et al. [29] and Rovner et al. [30] reported low levels of serum 25(OH)D in children (65% and 90%, respectively) with sickle cell anemia HbSS compared with their age-matched and racially matched peers. In our study, vitamin D deficiency in children and adolescents with SCD was detected at rates higher than that of the general Turkish population (43.8%) as reported by Hatun et al. [31]. Daily vitamin D intake was insufficient for patients in our study (232.12±110.21 IU). Vitamin D deficiency in children and adolescents with SCD can result from causes like sedentary lifestyle due to chronic disease, chronic inflammation, and hypermetabolic status along with malnutrition and insufficient intake [2,3,32]. Among 44 patients who were evaluated for BMD, 10 patients (22.7%) had osteopenia and 1 (2.2%) had 29

Özen S, et al: Endocrine Complications in Pediatric Patients with SCD

osteoporosis. Low BMD has been reported in male and female children and adults with SCD. In a study of 32 adults with SCD (mean age of 34 years), 72% had low BMD at 1 or more anatomic sites and 40% were classified as osteoporotic [33]. Markers of bone formation are elevated whereas bone resorption is decreased in children with SCD compared with healthy children [34].

Additional mechanisms and risk factors for osteopenia in SCD include delayed puberty and low accrual of peak bone mass, bone microinfarcts resulting from repeated sickle crises, chronic illness with immobilization, and calcium, vitamin D, and other nutritional deficiencies [35,36]. In our study, average daily vitamin D and calcium intakes of patients with osteopenia and/or osteoporosis were statistically significantly lower than those without BMD disorders (p=0.032 and p=0.043, respectively).

There was no relationship among crisis frequency, chelating treatment, transfusion anamnesis, and osteopenia/osteoporosis.

Considering these results, we conclude that vitamin D intake disorder is most likely responsible for osteopenia/osteoporosis development in our patient population.

Although none of the patients who were evaluated by oral glucose tolerance test had diabetes or impaired glucose tolerance, fasting insulin resistance was detected in 3 patients (6%). A report from the Multi-Center Study of Iron Overload, a 5-year prospective study in Canada, the United States, and the United Kingdom, reported that diabetes mellitus affects 2% of patients with SCD. In logistic regression analysis, the strongest predictor of diabetes was the length of time since patients had started receiving transfusions.

After adjusting for diagnosis (e.g., SCD and thalassemia) and serum ferritin levels in the model, both duration and age at which the subject began chronic transfusion remained significant. The analysis revealed that for every 10 years of transfusion use, transfused subjects with SCD had 2.5 times greater odds of diabetes [27]. In our study, BMI values of the 3 patients with insulin resistance were above 85%. None of the patients with normal weight had insulin resistance. We did not observe any insulin resistance or diabetes, because our study was conducted during childhood.

In conclusion, endocrine organ dysfunctions are commonly encountered in children and adolescents with SCD, and vitamin D deficiency is the most commonly encountered endocrine disorder. Regular follow-ups of patients for endocrine complications starting at early ages and initiation of appropriate treatments will elongate expectancy and quality of life.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Rees DC, Williams TN, Gladwin MT. Sickle-cell disease.

Lancet 2010;376:2018-2031.

2. Smiley D, Dagogo-Jack S, Umpierrez G. Therapy insight: metabolic and endocrine disorders in sickle cell disease. Nat Clin Pract Endocrinol Metab 2008;4:102-109.

30

Turk J Hematol 2013;30:25-31

3. el-Hazmi MA, Bahakim HM, al-Fawaz I. Endocrine functions in sickle cell anaemia patients. J Trop Pediatr 1992;38:307-313.

4. Al-Saqladi AW, Cipolotti R, Fijnvandraat K, Brabin BJ. Growth and nutritional status of children with homozygous sickle cell disease. Ann Trop Paediatr 2008;28:165-189.

5. Neyzi O, Binyıldız P, Alp H. Ist Tıp Fak Mec (Suppl) 1978;41:74.

6. Tanner JM. Recording adolescent physical changes: Tanner system. Del Med J 1973;45:84-88.

7. Goede J, Hack WW, Sijstermans K, van der Voort-Doedens LM, Van der Ploeg T, Meij-de Vries A, Delemarre-van de Waal HA. Normative values for testicular volume measured by ultrasonography in a normal population from infancy to adolescence. Horm Res Paediatr 2011;76:56-54.

8. Alemzadeh R, Rising R, Lifshitz F. Obesity in children. In: Lifshitz F (ed). Pediatric Endocrinology, 5th ed. New York, Informa Healthcare, 2007:1-52.

9. Keskin M, Kurtoglu S, Kendirci M, Atabek ME, Yazici C. Homeostasis model assessment is more reliable than the fasting glucose/insulin ratio and quantitative insulin sensitivity check index for assessing insulin resistance among obese children and adolescents. Pediatrics 2005;115:e500-503.

10. Kurtoğlu S, Hatipoğlu N, Mazıcıoğlu M, Kendirici M, Keskin M, Kondolot M. Insulin resistance in obese children and adolescents: HOMA-IR cut-off levels in the prepubertal and pubertal periods.

J Clin Res Pediatr Endocrinol 2010;2:100-106.

11. Carrillo AA, Bao Y. Hormonal dynamic tests and genetic tests used in pediatric endocrinology. In: Lifshitz F (ed). Pediatric Endocrinology, 5th ed. New York, Informa Heath Care, 2007:737-767.

12. Holick MF. Vitamin D deficiency. N Engl J Med 2007;357:266-281.

13. Greulich WW, Pyle SI. Radiographic Atlas of Skeletal Development of the Hand and Wrist, 2nd ed. Stanford, Stanford University Press, 1958.

14. Goksen D, Darcan S, Coker M, Kose T. Bone mineral density of healthy Turkish children and adolescents. J Clin Densitom 2006;9:84-90.

15. Plotkin H, Lifshitz F. Rickets and osteoporosis In: Lifshitz F (ed). Pediatric Endocrinology, 5th ed. New York, Informa Heath Care, 2007;531-557.

16. Barden EM, Kawchak DA, Ohene-Frempong K, Stallings VA, Zemel BS. Body composition in children with sickle cell disease. Am J Clin Nutr 2002;76:218-225.

17. Thomas PW, Singhal A, Hemmings-Kelly M, Serjeant GR. Height and weight reference curves for homozygous sickle cell disease. Arch Dis Child 2000;82:204-208.

18. Prasad AS. Malnutrition in sickle cell disease patients. Am J Clin Nutr 1997;66:423-424.

19. Hibbert JM, Creary MS, Gee BE, Buchanan ID, Quarshie A, Hsu LL. Erythropoiesis and myocardial energy requirements contribute to the hypermetabolism of childhood sickle cell anemia. J Pediatr Gastroenterol Nutr 2006;43:680-687.

Turk J Hematol 2013;30:25-31

Özen S, et al: Endocrine Complications in Pediatric Patients with SCD

20. Akohoue SA, Shankar S, Milne GL, Morrow J, Chen KY, Ajayi WU, Buchowski MS. Energy expenditure, inflammation, and oxidative stress in steady-state adolescents with sickle cell anemia. Pediatr Res 2007;61:233-238.

28. Parshad O, Stevens MC, Hudson C, Rosenthal J, Melville GN, Dunn DT, Serjeant GR. Abnormal thyroid hormone and thyrotropin levels in homozygous sickle cell disease. Clin Lab Haematol 1989;11:309-315.

21. Collett-Solberg PF, Fleenor D, Schultz WH, Ware RE. Short stature in children with sickle cell anemia correlates with alterations in the IGF-I axis. J Pediatr Endocrinol Metab 2007;20:211-218.

29. Buison AM, Kawchak DA, Schall J, Ohene-Frempong K, Stallings VA, Zemel BS. Low vitamin D status in children with sickle cell disease. J Pediatr 2004;145:622-627.

22. Soliman AT, el Banna N, alSalmi I, De Silva V, Craig A, Asfour M. Growth hormone secretion and circulating insulin-like growth factor-I (IGF-I) and IGF binding protein-3 concentrations in children with sickle cell disease. Metabolism 1997;46:1241-1245.

23. Al-Saqladi AW, Bin-Gadeen HA, Brabin BJ. Growth in children and adolescents with sickle cell disease in Yemen. Ann Trop Paediatr 2010;30:287-298.

24. Cipolotti R, Caskey MF, Franco RP, Mello EV, Dal Fabbro AL, Gurgel RQ, Cuevas LE. Childhood and adolescent growth of patients with sickle cell disease in Aracaju, Sergipe, north-east Brazil. Ann Trop Paediatr 2000;20:109-113.

25. Soliman AT, elZalabany M, Amer M, Ansari BM. Growth and pubertal development in transfusion-dependent children and adolescents with thalassaemia major and sickle cell disease: a comparative study. J Trop Pediatr 1999;45:23-30.

26. Phillips G Jr, Becker B, Keller VA, Hartman J 4th.

Hypothyroidism in adults with sickle cell anemia. Am J Med 1992;92:567-570.

27. Fung EB, Harmatz PR, Lee PD, Milet M, Bellevue R, Jeng MR, Kalinyak KA, Hudes M, Bhatia S, Vichinsky EP; Multi-Centre Study of Iron Overload Research Group. Increased prevalence of iron-overload associated endocrinopathy in thalassaemia versus sickle cell disease. Br J Haematol 2006;135:574-582.

30. Rovner AJ, Stallings VA, Kawchak DA, Schall JI, OheneFrempong K, Zemel BS. High risk of vitamin D deficiency in children with sickle cell disease. J Am Diet Assoc 2008;108:1512-1516.

31. Hatun S, Islam O, Cizmecioglu F, Kara B, Babaoglu K, Berk F, Gokalp AS. Subclinical vitamin D deficiency is increased in adolescent girls who wear concealing clothing. J Nutr 2005;135:218-222.

32. Hyacinth HI, Gee BE, Hibbert JM. The role of nutrition in sickle cell disease. Nutr Metab Insights 2010;3:57-67.

33. Miller RG, Segal JB, Ashar BH, Leung S, Ahmed S, Siddique S, Rice T, Lanzkron S. High prevalence and correlates of low bone mineral density in young adults with sickle cell disease.

Am J Hematol 2006;81:236-241.

34. Fung EB, Kawchak DA, Zemel BS, Rovner AJ, Ohene-Frempong K, Stallings VA. Markers of bone turnover are associated with growth and development in young subjects with sickle cell anemia. Pediatr Blood Cancer 2007;50:620-623.

35. Lal A, Fung EB, Pakbaz Z, Hackney-Stephens E, Vichinsky EP. Bone mineral density in children with sickle cell anemia.

Pediatr Blood Cancer 2006;47:901-906.

36. Almeida A, Roberts I. Bone involvement in sickle cell disease.

Br J Haematol 2005;129:482-490.

31

Research Article

DOI: 10.4274/tjh.2012.0059

Antiphospholipid Antibodies and Systemic Scleroderma Antifosfolipid Antikorlar ve Sistemik Skleroderma Awa Oumar Touré1, Fatimata Ly2, Abibatou Sall1, Alassane Diatta3, Macoura Gadji1, Moussa Seck1, Blaise Faye1, Tandakha Dieye1, Saliou Diop1 1laboratoire d’hématologie; Université Cheikh Anta Diop de Dakar (UCAD) 2Service de dermatologie UCAD 3Laboratoire de biochimie UCAD

Abstract: Objective: Antiphospholipid antibodies (APLs) could be associated with an increased risk of vascular pathologies in systemic scleroderma. The aim of our study was to search for APLs in patients affected by systemic scleroderma and to evaluate their involvement in the clinical manifestations of this disease.

Materials and Methods: We conducted a cross-sectional descriptive study, from January 2009 until August 2010, with patients received at the Department of Dermatology (Dakar, Senegal). Blood samples were taken at the hematology laboratory and were analyzed for the presence of APLs. Results: Forty patients were recruited. Various types of either isolated or associated APLs were found in 23 patients, i.e.

57.5% of the study population. The most frequently encountered antibody was IgG anti-β2 GPI (37.5% of the patients), followed by anticardiolipins (17.5%) and lupus anticoagulants (5%). No statistically significant association of positive antiphospholipid-related tests to any of the scleroderma complications could be demonstrated.

Conclusion: A high proportion of patients showing association of systemic scleroderma and APLs suggests the presence of a morbid correlation between these 2 pathologies. It would be useful to follow a cohort of patients affected by systemic scleroderma in order to monitor vascular complications following confirmation of the presence of antiphospholipid syndrome.

Key Words: Antiphospholipids, Systemic scleroderma, Complication, Senegal Özet: Amaç: Antifosfolipid antikorlar (AA) sistemik sklerodermada görülen damarsal patolojiler açısından artmış risk oluşturabilir. Çalışmamızın amacı sistemik skleroderma hastalarında AA tayini yapılması ve hastalığın klinik özellikleri üzerinde bu antikorların etkisinin değerlendirilmesidir.

Yöntemler: Ocak 2009 ile Ağustos 2010 tarihleri arasında Dermatoloji Kliniğine (Dakar, Senagal) başvuran hastalar arasında kesitsel betimleyici bir çalışma planladık. Hastaların kan örnekleri hematoloji laboratuvarında alındı ve AA varlığı açısından incelendi.

Address for Correspondence: Awa Oumar TOURÉ, M.D., Laboratoire d’hématologie; Université Cheikh Anta Diop de Dakar (UCAD) Phone: +221-776398350 E-mail: awaoumar2000@yahoo.fr Received/Geliş tarihi : May 07, 2012 Accepted/Kabul tarihi : September 28, 2012

32

Turk J Hematol 2013;30:32-36

Touré AO, et al: Antiphospholipid Antibodies and Systemic Scleroderma

Bulgular: Kırk hasta çalışmaya dahil edildi. Çalışma popülasyonundan 23 hastada (%57,5) izole ve birden fazla AA tespit edildi. En sık rastlanan antikor IgG anti-β2 GPI idi (%37,5), bunu sırasıyla antikardiyolipinler (%17,5) ve lupus antikoagülanı (%5) izlemekteydi. Skleroderma ile ilgili herhangi bir komplikasyon ile pozitif antifosfolipid testler arasında pozitif anlamlı bir ilişki gösterilemedi.

Sonuç: Skleroderma ve AA birlikteliğinin yüksek oranda bulunması, bu iki patoloji arasında morbid bir korelasyon varlığını düşündürmektedir. Sistemik skleroderma tanısı olan hastaların antifosfolipid sendrom varlığı tespit edilmesi sonrasında damarsal komplikasyonlar açısından takip edilmeleri yararlı olacaktır.

Anahtar Sözcükler: Antifosfolipidler, Sistemik skleroderma, Komplikasyon, Senegal

Introduction Antiphospholipid antibodies (APLs) are a family of antibodies against phospholipids, against the proteins that bind the phospholipids (also referred to as cofactors), or against both of these; they can have a pathogenic effect by interfering with the membrane phospholipids of the endothelial cells and the platelets, or with the phospholipids involved in the coagulation cascade.

The most clinically important APLs are the lupus anticoagulant, the anticardiolipin antibodies, and anti-β2 GPI. These antibodies are either isolated or, most commonly, are associated with an autoimmune disease, in particular systemic lupus, systemic scleroderma (SS), and antiphospholipid syndrome.

SS is an autoimmune disease with vascular involvement characterized by microangiopathy, endothelial injury, and diffuse sclerosis of unexplained mechanism. The vascular component is best exemplified by Raynaud’s phenomenon, the most frequent manifestation of SS. The APLs are thought to be associated with an increased risk of vascular pathologies in SS [1].

The aim of our study was to look for APLs in patients affected

by SS and to evaluate their involvement in the clinical manifestations of this systemic disease Materials and Methods We conducted a cross-sectional descriptive study from January 2009 until August 2010.

The patients were recruited from the Department of Dermatology and the analyses were carried out at the hematology laboratory of the Aristide Le Dantec Hospital.

Inclusion criteria were as follows: • Patients presenting with typical skin manifestations (tightness, thickening, and/or non-pitting induration of the skin affecting the face, neck, torso, and proximal portions of the upper and lower extremities) or with the presence of at least 2 of the following: sclerodactyly, stellate pulp scars or ulceration of the fingertips, or bilateral pulmonary fibrosis, mainly at the lung bases.

• Patients with mixed connective tissue disease associating SS with dermatomyositis, Sharp syndrome, or Gougerot-Sjögren syndrome.

• Patient’s willingness to participate in the study.

Once the diagnosis had been made by the dermatologist, the patient was sent to the laboratory for the required samples to be taken.

Physical examination, blood analyses, and imaging as required were done to screen the patients for disease-related cutaneous (Raynaud’s phenomenon, cutaneous sclerosis, hypochromic spots, skin calcinosis, stellate scars, ulcerations, chronic ulcers), cardiovascular (loud S2), pleuropulmonary (interstitial lung disease, chronic fibrosis, pulmonary arterial hypertension), and gastrointestinal (dysphagia, signs of intestinal malabsorption) signs and symptoms.

The following biological parameters were analyzed: • Activated partial thromboplastin time (aPTT) was examined using the chronometric technique with a compact STA analyzer from Diagnostica Stago Laboratories (France). The aPTT was considered to be prolonged when the ratio of the patient’s time to control time was greater than 1.2. We then performed an aPTT mixing test and selected all samples without correction for lupus anticoagulant screening.

• The anticardiolipin and the anti-β2 glycoprotein IgG/IgM antibody levels were measured by ELISA using the ASSERACHROM APA IgM and IgG and ASSERACHROM antiβ2GP IgG and IgM reagents from Diagnostica Stago Laboratories.

All values above 40 UPL/mL were accepted as positive.

• The lupus anticoagulant (screening and confirmation) was tested via the chronometric method on the compact STA analyzer using the following reagents from Diagnostica Stago Laboratories: STA STACLOT DRVV screen and STA STACLOT DRVV confirm.

The clotting time (CT) determination of the plasma samples was carried out immediately after blood sampling. The final result was expressed as: Screen ratio = screen CT of the plasma to be tested / screen CT of the reference pool.

The result was accepted as abnormal if the screen ratio was higher than 1.2 and the presence of lupus anticoagulant was suspected. In suspected cases, a second CT determination (confirmatory CT) was done. Confirmation ratio was calculated (=confirm CT plasma to be tested / confirm CT of reference pool).

Thereafter, the normalized ratio was computed using the following formula: Normalized ratio = screen ratio / confirm ratio.

A normalized ratio of equal to or higher than 1.2 confirmed the presence of lupus anticoagulant.

Recording and statistical analysis of the data was done using version 3.5.1 (2008) of the Epi Info software. Fischer’s test was used to compare the data. P values of less than 0.05 were accepted as statistically significant.

33

Turk J Hematol 2013;30:32-36

Touré AO, et al: Antiphospholipid Antibodies and Systemic Scleroderma

Table 1: Epidemiological and clinical variables.

Variables

Number of cases

Percentage (%)

18 years < age < 45 years

28

69

Female

29

72

Unemployed

23

57.5

1 year < disease’s period of evolution < 2 years

21

54

Raynaud’s phenomenon

39

97.5

Hypochromic maculae

38

94.7

Sclerodactyly

28

71

Cutaneous ulcerations

15

38

Pulmonary hypertension

5

28

Results Overall Results • Epidemiological and Clinical Findings Forty patients were recruited during the study period out of a total of 19,340 hospitalized patients, thus corresponding to a hospital prevalence of 2.07‰ for SS. The median age of these patients was 41 years, with a range of 18 and 68 years and a male-to-female sex ratio of 0.38.

The most common presenting symptom was hypochromic skin macula (100% of the patients), which was associated with cutaneous sclerosis in 92% of the cases. Patients were usually diagnosed at least 1 year after emergence of the symptoms.

Some patients also presented with vascular events such as venous or arterial thrombosis (cutaneous thrombosis, pulmonary embolism) and hypertension.

Physical examination and imaging studies revealed Raynaud’s phenomenon, stellate scars, sclerodactyly, pulmonary fibrosis, pulmonary hypertension, and cardiac arrhythmias in a majority of patients (Table 1).

• Laboratory Findings Seven patients (17.5%) had a prolonged aPTT, which was not corrected by the addition of normal plasma.

Various types of isolated or associated APLs were found and confirmed at least 12 weeks later in 23 patients, i.e. 57.5% of the study population.

The most frequently encountered antibody was anti-β2 GPI (50% of the patients), followed by anticardiolipins (17.5%) and lupus anticoagulants (5%). o Anti-β2 GPI Fifteen patients had IgG and 13 had IgM. Eight patients had both isotypes. o Anticardiolipins IgG and IgM anticardiolipins were detected in 7 and 2 patients, respectively.

34

Table 2: Summary of biological results.

Variables

Number of cases

Percentage (%)

Prolonged aPTT

7

17.5

Presence of antiphospholipids

23

57.5

IgG anti-β2 GPI

15

37.5

IgM anti-β2 GPI

13

32.5

IgG anticardiolipins

7

17.5

IgM anticardiolipins

2

5

Lupus anticoagulant

2

5

o Lupus anticoagulant The presence of lupus anticoagulant was confirmed in 2 patients (Table 2).

Eight patients had at least 2 types of APLs (anticardiolipin or lupus anticoagulant associated with anti-β2 GPI). Two of them developed pulmonary hypertension and 2 others developed cutaneous ulcerations.

• Analytical results With uncorrected mixing study, 90% of patients were not carriers of APLs. Three of the 4 patients with a family history of venous thromboembolism had APLs; however, the correlation was insignificant.

The presence of APLs indicated a tendency for some of the SS complications, in particular Raynaud’s phenomenon, cutaneous ulcerations, and pulmonary hypertension. However, the correlation remained insignificant (Table 3).

Turk J Hematol 2013;30:32-36

Touré AO, et al: Antiphospholipid Antibodies and Systemic Scleroderma

Table 3: Correlation between antiphospholipids and scleroderma complications.

Complications

Antiphospholipids (number of cases)

Fisher’s test

Present

Absent

P

Raynaud’s phenomenon

16

4

0.89

Stellate scars

17

3

0.72

Dysphagia

17

1

0.34

Ulcerations

13

0

0.17

Pulmonary hypertension

7

1

0.51

Pulmonary fibrosis

6

2

0.30

Acrosclerosis

22

8

0.26

Venous thrombosis

3

1

0.20

Discussion The APLs are autoantibodies, which are thought to be responsible for a real autoimmune pathology: the primary antiphospholipid syndrome described by Hughes in 1987 [2].

These APLs can also occur in the context of other autoimmune diseases having the secondary antiphospholipid syndrome [2].

Lupus anticoagulant was first defined in patients with systemic lupus erythematosus as an inhibitor of coagulation leading paradoxically to thrombosis.

Since then, immunoenzymology has led, and still leads, to the discovery of new APLs. Those considered to be pathogenic, according to the last consensus conference held in Sydney [3], are the lupus anticoagulant, anti-β2 GPI, and anticardiolipins.

Numerous studies have shown that antiphospholipids are associated with autoimmune diseases [4,5,6,7]. SS, a rare autoimmune disease [8], has vascular complications that are occasionally similar to those encountered with the antiphospholipid syndrome.

Over a period of 8 months, we screened 40 SS patients for the presence of APLs. The patients were mainly young women (mean age: 41 years, sex ratio: 0.38). Unlike in the Caucasian population [8], where the onset of disease occurs at advanced ages, the median age of occurrence in our cohort, being 41 years, was in line with that found in Morocco and in sub-Saharan Africa [9].

The disparity between the significance of different types of antiphospholipids encountered does not allow a reliable comparison to be made among the limited studies performed on this subject.

Overall, we found a 57.5% prevalence of APLs, which is considerably higher than that previously found in Italy by Picillo et al. [10] and in Japan by Ihn et al. [11]. These discrepancies could be explained by the low level of sensitivity and specificity of the techniques used during the 1990s.

It was only towards the mid-2000s that research, including that of the present authors, specifically began to address the different types of APLs. Anticardiolipins, mainly IgG, were found in significant quantities in 17.5% of our patients. This frequency, similar to that found in France by Marie et al. [6], is lower than that found by Ihn et al. in Japan [11] and by Picillo et al. in Europe [10].

As for anti-β2 GPIs, their prevalence in our study population was close to that observed in Japan, but greater than that found in the Caucasian population.

The lupus anticoagulant is considered by some authors to be associated with an increased risk of venous or arterial thrombosis [12].

Despite limitations associated with our work (low number of patients, lack of comparison with a healthy population), we may say that 57.5% of patients affected by SS had at least one type of APL. The presence of APLs has been reported to be associated with certain complications of scleroderma: glomerular nephropathy [5,7], cutaneous ulcerations [6], pulmonary hypertension [6], deep venous thrombosis [13], and pulmonary fibrosis [1]. As a result of the small number of studied cases, we were not able to find a significant difference between carrier and non-carrier patients.

As in previous studies, we did not find a statistically significant relationship between the presence of APLs and the occurrence of scleroderma complications. However, the high proportion of patients showing association of SS and APLs suggests the presence of a morbid correlation between these 2 pathologies. It would be interesting to follow a large cohort of patients affected by SS in order to search for vascular complications, following the confirmed presence of antiphospholipid syndrome.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

35

Touré AO, et al: Antiphospholipid Antibodies and Systemic Scleroderma

References 1. Leite Pd, de Carvalho JF. Systemic sclerosis sine scleroderma associated with antiphospholipid syndrome. Rheumatol Int 2010;32:3265-3268.

2. Cuadrado MJ, Hughes GR. Hughes (antiphospholipid) syndrome clinical features. Rheum Dis Clin North Am 2001;27:507-524.

3. Miyakis S, Lockshin MD, Atsumi T, Branch DW, Brey RL, Cervera R, Derksen RH, DE Groot PG, Koike T, Meroni PL, Reber G, Shoenfeld Y, Tincani A, Vlachoyiannopoulos PG, Krilis SA. International consensus statement on an update of the classification criteria for definite antiphospholipid syndrome (APS). J Thromb Haemost 2006;4:295-306.

4. Touré AO, Doupa D, Diop S, Kane A, Kane A, Ka MM, Dieye T, Thiam D, Diakhate L. Relation lupus-anticorps antiphospholipides et cardiopathie lupique. Ann Biol Clin 2006;64:231-235.

5. Wielosz E, Dryglewska M, Majdan M. Antiphospholipid antibodies and kidney involvement in patients with systemic sclerosis. Clin Rheumatol 2009;28:955-959.

6. Marie I, Jouen F, Hellot MF, Levesque H. Anticardiolipin and anti-β2 glycoprotein I antibodies and lupus-like anticoagulant: prevalence and significance in systemic sclerosis. Br J Dermatol 2008;158:141-144.

36

Turk J Hematol 2013;30:32-36

7. Ames PR. Antiphospholipid antibodies in systemic sclerosis: a double oxidative hit? Clin Rheumatol 2009;28:881-882.

8. Barnes J, Mayes MD. Epidemiology of systemic sclerosis: incidence, prevalence, survival, risk factor, malignancy and environmental triggers. Curr Opin Rheumatol 2012;24:165-170.

9. Adelowo OO, Oguntona S. Scleroderma (systemic sclerosis) among Nigerians. Clin Rheumatol 2009;28:1121-1125.

10. Picillo U, Migliaresi S, Marcialis MR, Ferruzzi AM, Tirri G. Clinical significance of anticardiolipin antibodies in patients with systemic sclerosis. Autoimmunity 1995;20:1-7.

11. Ihn H, Sato S, Fujimoto M, Kikuchi K, Igarashi A, Soma Y, Tamaki K, Takehara K. Measurement of anticardiolipin antibodies by ELISA using β2-glycoprotein I (β2-GPI) in systemic sclerosis. Clin Exp Immunol 1996;105:475-479.

12. Galli M, Reber G, de Moerloose P, de Groot PG. Invitation to a debate on the serological criteria that define the antiphospholipid syndrome. J Thromb Haemost 2008;6:399-401.

13. Gupta R, Thabah MM, Gupta S, Shankar S, Kumar A. Clinical significance of antiphospholipid antibodies in Indian scleroderma patients. Rheumatol Int 2009;30:277-279.

Research Article

DOI: 10.4274/tjh.01488

Endothelial Protein C Receptor and Pediatric Arterial Stroke Endotelyal Protein C Reseptörü ve Pediatrik Arteriyel İnme Nejat Akar1, Afife Karabıyık1, Gülhis Deda2 1Ankara University, School of Medicine, Department of Pediatric Molecular Genetics, Ankara, Turkey 1Ankara University, School of Medicine, Department of Pediatric Neurology, Ankara, Turkey

Abstract: Objective: The aim of this study was to investigate the endothelial protein C receptor (EPCR) gene A3 haplotype and plasma soluble EPCR (sEPCR) levels in Turkish pediatric arterial stroke patients.

Materials and Methods: We analyzed 44 pediatric arterial stroke patients and 75 healthy controls. Following DNA isolation, genotyping of the A3 haplotype was determined via PCR and RFLP. Additionally, fasting sEPCR levels were determined via ELISA. Results: There wasn’t a significant difference in the sEPCR level between the control and patient groups, although the sEPCR level was higher in the patient group. We didn’t observe a difference in the distribution of the CC and CG/GG genotypes between the control and patient groups.

Conclusion: Further study on sEPCR levels at the onset of pediatric stroke is needed in order to reach a more definitive conclusion.

Key Words: EPCR, A3, sEPCR, Pediatric stroke Özet: Amaç: Çalışmanın amacı, Türk populasyonundaki pediatrik arteriyel inme hastalarındaki Endotelyal Protein C Reseptörü (EPCR) geni A3 Haplotipi ve plazma solubl EPCR (sEPCR) seviyesinin araştırılmasıdır.

Yöntemler: Bu çalışmayla 44 pediatrik arteriyel inme hastası ve 75 sağlıklı kontrol analiz edildi. DNA izolasyonunu takiben, PCR ve RFLP yöntemleri kullanılarak A3 haplotipi genotiplendirilmesi yapıldı ve ELISA aracılığıyla da sEPCR seviyeleri saptandı.

Bulgular: Sağlıklı kontrol ve hasta grubu arasında sEPCR seviyesi açısından istatistiksel olarak anlamlı bir fark bulunmamasına ragmen, pediatrik arteriyel inme hastalarına ait grupta sEPCR seviyesi daha yüksek saptanmıştır.

Sonuç: Daha etkili bir sonuca varabilmek için pediatrik inmede plazma EPCR seviyelerinin araştırılacağı çalışmalara ihtiyaç vardır

Anahtar Sözcükler: EPCR, A3, sEPCR, Pediatrik inme

Address for Correspondence: Afife KARABIYIK, M.D. Ankara University, School of Medicine, Department of Pediatric Molecular Genetics, Ankara, Turkey Phone: +90 312 595 63 48/115 E-mail: afifekrbyk@gmail.com Received/Geliş tarihi : February 22, 2011 Accepted/Kabul tarihi : September 19, 2011

37

Turk J Hematol 2013;30:37-39

Akar N, et al: Endothelial Protein C Receptor and Pediatric Arterial Stroke

Introduction Although stroke is a rare event in childhood, it constitutes approximately 33% of all pediatric thrombosis cases [1]. Stroke results in significant long-term morbidity and mortality in children. Various prothrombotic disorders, particularly those affecting the physiological anticoagulant system, are associated with the risk of stroke [2]. Active protein C (APC) is a major natural anticoagulant that limits the progression of the coagulation cascade via photolytic degradation of factor Va (FVa) and factor VIIIa (FVIIIa). Endothelial protein C receptor (EPCR) contributes to the interaction between thrombin-thrombomodulin and PC, and in this way this complex increases activation of PC [3].

PC activation is enhanced approximately 20-fold in vivo when PC is bound to EPCR [4]. EPCR is not only a 46-kDa endothelial cell-specific type-I transmembrane protein, it also has a soluble form circulating in plasma [5,6]. The extracellular domain of EPCR is cleaved with a metalloprotease and the cleavage results in the formation of soluble EPCR (sEPCR) [7]. EPCR plays a role in regulating coagulation and inflammation. sEPCR binds to PC and APC with the same affinity as transmembrane EPCR [8].

Furthermore, sEPCR inhibits the anti-inflammatory, profibrinolytic, and anticoagulant effects of APC. Elevated sEPCR is a risk factor for thrombosis [9]. EPCR is primarily expressed in the endothelium of large blood vessel [10].

EPCR is involved in numerous hemostatic, vascular, and immunological actions [8,11,12,13]. To date, >90 polymorphisms and 5 mutations of the human EPCR gene have been reported [14,15,16]. The EPCR A3 haplotype in exon 4, rs867186 (p.ser219gly; A4600G) is associated with increased plasma levels of sEPCR and thrombosis [17,18]. There is a strong association between the A3 haplotype and an elevated sEPCR level; an elevated sEPCR level might increase the risk of pediatric stroke [12]. The aim of the present study was to investigate the EPCR gene A3 haplotype and plasma sEPCR level in Turkish pediatric arterial stroke patients.

Materials and Methods The study included 44 pediatric arterial stroke patients (20 girls 24 boys) and 75 healthy controls (51 girls and 24 boys) that had never had thrombosis. Patients with perinatal strokes were excluded. All of the patients in the patient group had arterial, large vessel stroke. The control and patient groups were selected from among the data in our DNA bank for the period 1998-2011. Mean age in the control group was 29.4 years (because of the contents of our DNA bank) and mean age in patient group is 5.57 years.

The control group was selected from among a group aged >18 years of age with no history of stroke.

Measurement of plasma sEPCR in the patient group was performed 6 months after the first episode of stroke. Pediatric stroke patients with neonatal onset were evaluated for sEPCR after the age of 1 year [12]. Informed consent was obtained from the all the patients or their parents. The study protocol was approved by the Ethics Committee [13]. sEPCR levels were measured via enzymelinked immunosorbent assay (ELISA) (Diagnostica Stago

Asserachrom sEPCR, Asnieres-France). sEPCR levels 38-132 ng μL– 1 were accepted as normal, according to our laboratory’s standards.

Genomic DNA was extracted and the frequency of the EPCR gene A3 haplotype 1651 C-G was screened via PCR using the primers 5′-GCTGAAATTTTGTATTCTGTCC-3′ and 5′CCAGTATAATGGCTACATTTTACC-3′, and annealing at 54 °C. C1651G substitution creates a Eco91 I restriction site. The 293-bp PCR products were incubated using Eco91 I restriction enzyme (Fermentas, Lithuania) at 37 °C for 16 h, and then the digested products were electrophoresed on 3% agarose gel (Sigma, USA).

Additionally, sequencing of this region of the gene was performed (Beckman Coulter CEQ 8000, Beckman Coulter, USA).

Results The chi-square test, Student’s t test, Fisher's exact test, and P values were used for statistical analysis. Comparison of continuous variables between the patients and controls was based on Student's t test. The relationship between sEPCR and the A3 haplotype was determined using both Pearson’s and Spearman’s rank correlation analysis. The chi-square test was used to compare the observed frequencies using the Hardy-Weinberg equilibrium prediction. Statistical significance was set at p<0.05.

The frequency of the EPCR gene A3 haplotype (rs867186, C1651G, p.ser219gly) was determined (Table 1). There wasn’t a significant difference in the sEPCR level between the controls (n=75; mean sEPCR: 110.3±68.0) and patients (n=44; mean sEPCR: 90.8±62.6) (p> 0.05). In all, 34 of the pediatric arterial stroke patients carried 1651CC (mean sEPCR: 80.0±25.0), and 10 carried CG (CI = 0.67 [0.2-1.6]) and GG (CI = 4.7 [0.18-119]) (mean sEPCR: 213.3±67.5). There was a comparatively significant difference at the patient group in terms of their sEPCR levels and together with the A3 haplotype of the EPCR gene (p<0.0001).

Patients with the CG/GG genotype had higher plasma sEPCR levels than those with the CC genotype. Similarly, the mean sEPCR level in controls with the 1651CG/GG genotype (n=21; mean sEPCR: 60.1±28.8) was significantly higher than in those with 1651CC (n =54; mean sEPCR: 161.0±62.8) (p=0.000). Although there wasn’t a significant difference in the distribution of the CC and CG/GG genotypes in the patient or control groups according to the chisquare test and Fisher’s exact test (p>0.05), the correlation between distribution of the sEPCR level and A3 haplotype, and the CC and CG/GG genotypes was significant (p= 0.01) based on Pearson’s and Spearman’s correlation analysis (Table 1).

Discussion Several EPCR gene variations are accepted as risk factors for the development of thrombosis, because they cause a reduction in receptor expression or loss of receptor function. One such variation is a polymorphism referred to as haplotype 3. The EPCR A3 haplotype encodes serine instead of glycine at codon 219, which is located in the transmembrane region of EPCR [19]. One study reported that among patients with venous thrombosis the incidence of this polymorphism was higher than in healthy individuals [17]. On the other hand, individuals carrying the 38

Turk J Hematol 2013;30:37-39

Akar N, et al: Endothelial Protein C Receptor and Pediatric Arterial Stroke

Table 1: Distribution of the A3 haplotype and the mean sEPCR level in the control and patient groups.

A3 haplotype

Controls (n = 75)

Patients (n = 44)

Odds Ratio (CI)

P

CC

54

34

1

CG

21

9

0.67 (0.2-1.6)

0.6

GG

–

1

4.7 (0.18-119)

0.2

110.3±68.0

90.8±62.6

mean sEPCR

homozygous A3 haplotype have a 3-fold greater risk of coronary heart disease [18] and venous thrombosis [9]. The EPCR A3 haplotype is responsible for 86.5% of the variation in the sEPCR level that was generated via ADAM17 cleavage [9,19].

In the present study there wasn’t a significant difference in the sEPCR level between the control and patient groups, although the sEPCR level was higher in the patient group. Furthermore, CG/GG genotype carriers had higher plasma sEPCR levels than carriers of the CC genotype in both the patient and control groups. We did not observed a difference in the distribution of the CC and CG/GG genotypes between the control and patient groups.

Further study on sEPCR levels at the onset of pediatric stroke is needed in order to reach a more definitive conclusion. As pediatric stroke is rare and its diagnosis at the onset of clinical symptoms is difficult, we think it would be beneficial to analyze sEPCR levels in adult stroke patients, as such data are lacking.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Akar N. Molecular approach to Turkish pediatric stroke patients. Turk J Hematol 2002;19:245-253.

2. Riela AR, Roach ES. Etiology of stroke in children. J Child Neurol 1993;8:201-220.

3. Mosnier LO, Zlokovic BV, Griffin JH. The cytoprotective protein C pathway. Blood 2007;109:3161-3172.

4. Taylor FB Jr, Peer GT, Lockhart MS, Ferrell G, Esmon CT. Endothelial cell protein C receptor plays an important role in protein C activation in vivo. Blood 2001;97:1685-1688.

5. Zecchina G, Bosio S, Brusa E, Rege-Cambrin G, Camaschella C. EPCR 23 bp insertion in a patient with severe progressive arterial disease: a dominant loss of function mutant in conditions of increased APC request? Br J Haematol 2002;119:881-882.

6. Kurosawa S, Stearns-Kurosawa DJ, Hidari N, Esmon CT. Identification of functional endothelial protein C receptor in human plasma. J Clin Invest 1997;100:411–418.

7. Xu J, Qu D, Esmon NL, Esmon CT. Metalloproteolytic release of endothelial cell protein C receptor. J Biol Chem 1999;275:6038-6044.

8. Esmon CT. The endothelial protein C receptor. Curr Opin Hematol 2006;13:382-385.

>0.05

9. Uitte de Willige S, Van Marion V, Rosendaal FR, Vos HL, de Visser MC, Bertina RM. Haplotypes of the EPCR gene, plasma sEPCR levels and the risk of deep venous thrombosis. J Thromb Haemost 2004;2:1305-1310.

10. Laszik Z, Mitro A, Taylor FB Jr, Ferrell G, Esmon CT. Human protein C receptor is present primarily on endothelium of large blood vessels: implications for the control of the protein C pathway. Circulation 1997;96:3633-3640.

11. Akar N, Gökdemir R, Ozel D, Akar E. Endothelial cell protein c receptor (EPCR) gene exon iii, 23 bp insertion mutation in the Turkish pediatric thrombotic patients. Thromb Haemost 2002;88:1068-1069.

12. Ulu A, Gunal D, Tiras S, Egin Y, Deda G, Akar N. EPCR gene A3 haplotype and elevated soluble endothelial protein c receptor (sEPCR) levels in Turkish pediatric stroke patients.

Thromb Res 2007;120:47-52.

13. Yürürer D, Teber S, Deda G, Egin Y, Akar N. The Relation Between Cytokines, Soluble Endothelial Protein C Receptor, and Factor VIII Levels in Turkish Pediatric Stroke Patients. Clin Appl Thromb Hemost 2009;15:545-551.

14. Esmon CT. The endothelial cell protein C receptor. Thromb Haemost 2000;83:639-643.

15. Medina P, Navarro S, Estellés A, Vayá A, Bertina RM, España F. Influence of the A4600G and C4678G polymorphisms in the endothelial protein C receptor (EPCR) gene on the risk of venous thromboembolism in carriers of factor V Leiden.

Thromb Haemost 2005;94:389-394.

16. Franchi F, Biguzzi E, Cetin I, Facchetti F, Radaelli T, Bozzo M, Pardi G, Faioni EM. Mutations in the thrombomodulin and endothelial protein C receptor genes in women with late fetal loss. Br J Haematol 2001;114:641-646.

17. Saposnik B, Reny JL, Gaussem P, Emmerich J, Aiach M, Gandrille S. A haplotype of the EPCR gene is associated with increased plasma levels of sEPCR and is a candidate risk factor for thrombosis. Blood 2004;103:1311-1318.

18. Karabıyık A, Yılmaz E, Egin Y, Akar N. The effects of Endothelial Protein C Receptor Gene Polymorphisms on sEPCR levels in Venous Thrombotic Patients. Turk J Hematol 2012;29:55-62.

19. Saposnik B, Lesteven E, Lokajczyk A, Esmon CT, Aiach M, Gandrille S. Alternative mRNA is favored by the A3 haplotype of the EPCR gene PROCR and generates a novel soluble form of EPCR in plasma. Blood 2008;111:3442-3451.

39

Research Article

DOI: 10.4274/tjh.2011.0020

The Prevalence of von Willebrand Disease and Significance of in Vitro Bleeding Time (PFA-100) in von Willebrand Disease Screening in the İzmir Region İzmir Bölgesindeki von Willebrand Hastalığı Prevalansı ve von Willebrand Hastalığı Taramasında (PFA-100) in Vitro Kanama Zamanının Önemi Fatih Şap1, Tülay Kavaklı2, Kaan Kavaklı3, Ceyhun Dizdarer4 1Konya Training and Research Hospital, Department of Pediatrics, Konya, Turkey 2Dr. Behçet Uz Children’s Research and Training Hospital, Department of Pediatrics, İzmir, Turkey 3Ege University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey 4Dr. Behçet Uz Children’s Research and Training Hospital, Department of Pediatric Endocrinology, İzmir, Turkey

Abstract: Objective: von Willebrand disease (vWD) is the most common hereditary bleeding disorder. The purpose of this investigation was to determine the prevalence of vWD among adolescents in İzmir and to assess the sensitivity and specificity of PFA-100 as a screening method in detecting this disease.

Material and Methods: Our study was conducted on adolescents in the city of İzmir between October 2006 and March 2007. A total of approximately 1500 high school students between 14 and 19 years of age were planned to be included in the investigation. Survey forms prepared for assessing hemorrhagic diathesis were completed by 1339 individuals (512 males, 827 females). The necessary laboratory tests were performed after having obtained written informed consent from 40 individuals suspected to have hemorrhagic diathesis.

Results: Based on the von Willebrand factor antigen (vWF:Ag) and ristocetin cofactor activity (vWF:RCo) levels and bleeding symptoms, vWD type-1 was diagnosed in 14 individuals (4 males, 10 females; prevalence: 1.04%). The most common bleeding symptom in these patients was found to be epistaxis (10/14). Screening with PFA-100 revealed prolongation in both cartridges (Col/ADP and Col/Epi) in 3 of the 14 patients. PFA-100 was determined to exhibit 21.4% sensitivity and 100% specificity in the diagnosis of vWD.

Conclusion: The PFA-100 device was found to have high specificity but to have exhibited low sensitivity. Therefore, its utilization as a screening test may be problematic in patients with mild type-1 vWD. Specific tests (vWF:RCo, vWF:Ag) are required for the definite diagnosis of vWD. However, further studies with a large number of patients are needed.

Key Words: von Willebrand disease, Prevalence, PFA-100, Sensitivity, Specificity

Address for Correspondence: Fatih ŞAP, M.D. Konya Training and Research Hospital, Department of Pediatrics, Konya, Turkey Phone: +90 332 323 67 09 E-mail: fatihsap@gmail.com Received/Geliş tarihi : Jun 09, 2012 Accepted/Kabul tarihi : Jun 18, 2012

40

Turk J Hematol 2013;30:40-47

Şap F, et al: PFA-100 and Screening of von Willebrand Disease

Özet: Amaç: von Willebrand hastalığı (vWH) en sık kalıtsal kanama bozukluğudur. Bu çalışmanın amacı, İzmir’de adolesanlarda vWH’nın sıklığını saptamak ve tarama yöntemi olarak PFA-100’ün bu hastalığı saptamada duyarlılık ve özgüllüğünü belirlemektir.

Gereç ve Yöntemler: Çalışmamız İzmir İli’nde adolesanlarda Ekim 2006-Mart 2007 tarihleri arasında yapıldı. Yaşları 14-19 arasında olan yaklaşık 1500 lise öğrencisinin çalışmaya dahil edilmesi planlandı. Kanama diyatezini sorgulamaya yönelik hazırlanan anket formlarının cevapları 1339 (512 erkek, 827 kız) bireyden geri toplanabildi. Muhtemel kanama diyatezi olduğu düşünülen 40 bireyden yazılı onam formları alınarak gerekli laboratuvar testleri alındı.

Bulgular: von Willebrand faktör antijen (vWF:Ag) ve ristosetin kofaktör aktivite (vWF:RCo) düzeyi ve kanama semptomları esas alınarak 14 bireyde (4 erkek, 10 kız) von Willebrand Hastalığı tip-1 tespit edildi (prevalans %1,04). Bu hastalarda saptanan en sık kanama semptomunun burun kanaması olduğu (10/14) görüldü. PFA-100 ile yapılan taramada ise 14 hastadan 3’ünde iki kartuşta da (Col/ADP ve Col/Epi) uzama görüldü. PFA-100’ün von Willebrand Hastalığı’nı saptamadaki duyarlılığı %21,4 ve özgüllüğü %100 olarak bulundu.

Sonuç: Sonuç olarak PFA-100 cihazı yüksek oranda özgül olmakla birlikte düşük oranda duyarlı bulunmuştur. Hafif tip-1 vWH için tarama testi olarak kullanılması sorun yaratabilir. von Willebrand hastalığının mutlak tanısı için spesifik testler (vWF:RCo, vWF:Ag) gerekmektedir. Ancak daha fazla hastayı içeren ileri çalışmalara ihtiyaç vardır.

Anahtar Sözcükler: von Willebrand hastalığı, Prevalans, PFA-100, Sensitivite, Spesifite Introduction von Willebrand disease (vWD) is an autosomal hereditary bleeding disorder associated with a quantitative or qualitative defect of von Willebrand factor (vWF) [1]. The vWF is responsible for transport and stabilization of factor VIII (FVIII), in addition to provision of adhesion of platelets to the endothelium. A serious deficiency or a structural defect of vWF leads to secondary FVIII deficiency and causes bleeding diathesis [1,2]. The disease is classified as type-1 in cases with a decreased amount of vWF (quantitative deficiency), as type-2 (qualitative defect) in cases with a structural defect of vWF, and as type-3 in cases with no vWF protein or function [1,2]. Type-1 vWD, the most common form of the disease, is characterized by quantitative deficiency of vWF and presence of mild bleeding episodes in the patient and also in family member [3]. vWD is the most common hereditary bleeding disorder and its incidence in the community has been reported as 1%-2% in western literature [2]. It was first described in 1926 by Dr. Eric von Willebrand from Finland as a disease differentiated from hemophilia based on the clinical findings [4]. In 3 separate investigations conducted in Turkey, the prevalence was found to be 0.7% in the Ankara region [5], 0.44% in the İzmir region [6], and 0.9% in the Edirne region [7].

The history is critical in the diagnosis of the disease and most patients present with mucocutaneous bleeding symptoms.

Persistent bruises, epistaxis, mucosal bleeding, prolonged bleeding following tonsillectomy and tooth extractions, prolonged menstrual bleeding, and spontaneous gastrointestinal system bleedings are indicative of this disease [1,2,8,9].

Determination of a decrease in ristocetin cofactor activity (vWF:RCo), clinical symptoms related to bleeding, and family history are diagnostic for vWD. In type-3 vWD, prolonged bleeding time and prolonged activated partial thromboplastin

time (aPTT) are typical. On the other hand, these tests are usually normal in type-1 vWD. Therefore, it is not possible to exclude the diagnosis of vWD with normal screening test results [2].

It is possible to evaluate the bleeding time, both in vitro and in vivo. The in vivo method is outdated, difficult to apply, and less sensitive when compared to the in vitro method (PFA-100). The PFA-100 (Platelet Function Analyzer) device measures the bleeding time based on the closure time [10,11]. This test is a useful screening method for evaluation of vWD and various acquired or congenital intrinsic platelet function disorders. Since the in vitro method is less invasive, is repeatable, has a certain standard for interpretation of results, and is superior to the in vivo method in terms of sensitivity and specificity, it is the preferred method in practice [10].

In this study, our purpose was to determine the prevalence of vWD among adolescents in the city of İzmir and to evaluate the sensitivity and specificity of PFA-100 as a screening method for this disease.

Materials and Methods This investigation was conducted among adolescents attending 3 different high schools in the Konak District of İzmir during the period between October 2006 and March 2007. Approximately 1500 high school students between 14 and 19 years of age were planned to be enrolled. A survey form (Supplement 1) [6] containing 8 questions was distributed to be completed by students and their families. With the survey form, the presence of bleeding symptoms and quality, frequency, and severity of these symptoms (if any) were investigated among the adolescents and their families.

A total of 1339 survey forms were completed and returned and these were evaluated by a specialist physician experienced in the field of pediatric hematology. Acceptance of significant bleeding symptoms in terms of vWD was designated according to the criteria recommended by the International Thrombosis and Hemostasis 41

Şap F, et al: PFA-100 and Screening of von Willebrand Disease

Society (ISTH). The diagnosis of patients with vWD was established with decrement of vWF:RCo and/or vWF antigen (vWF:Ag), presence of meaningful bleeding symptoms, and also similar symptoms in at least one family member according to ISTH criteria [3]. In 40 individuals suspected to have hemorrhagic diathesis (9 males, 22.5%; 31 females, 77.5%), blood samples were obtained for further evaluations. The blood samples were examined for complete blood count (Sysmex XT-2000i hemocounter, Japan) and prothrombin time (PT)/aPTT/fibrinogen (STA Compact, Diagnostica Stago, France) values in the hematology laboratory of Dr. Behçet Uz Children’s Hospital; the samples of individuals with no approved certificates of blood group were examined in the blood center of Dr. Behçet Uz Children’s Hospital. PFA-100 (In vitro Bleeding Time, Dade Behring, Germany), vWF:Ag (Sysmex CA1500), and vWF:RCo (Biodata platelet aggregation device, USA) levels were evaluated at the hemostasis laboratory of Ege University Medical School’s Department of Pediatric Hematology. The normal lower limit value of vWF:Ag was accepted as 65% and the normal value for vWF:RCo was accepted as over 50%, but for individuals with the O blood group, the lower limit for vWF:RCo was considered as 45%. Our laboratory normal reference ranges in healthy controls and also data of the laboratory company indicated these ranges. Recent studies revealed that people with blood group O normally had lower levels in vWF tests than non-O individuals [12,13]. In a prior study, the closure time was determined as 71176 s for collagen epinephrine closure time (Col/Epi) and 70-169 s for collagen adenosine diphosphate closure time (Col/ADP) [10].

However, we used our laboratory normal reference ranges, such as 85-165 s for Col/Epi and 71-118 s for Col/ADP. The diagnosis of vWD was confirmed by bleeding symptoms, in addition to low levels of vWF:RCo and/or vWF:Ag and presence of a family history of bleeding. Furthermore, PFA-100 screening was performed in patients suspected to have hemorrhagic diathesis and the sensitivity and specificity of this method were investigated among vWD patients.

The study was commenced after having obtained approval from the local ethics committee and appropriate written consent from the İzmir City Board of Health and Ministry of Education.

Informed consent forms were obtained from the parents of individuals subjected to blood sample analysis.

Statistics: In this investigation, the Student t-test, the Fisher exact test, and the Pearson correlation and chi-square tests were utilized. P-values of less than 0.05 were regarded as significant; in the evaluation of correlations, negative or positive correlation rates among values with a significant P-value were calculated.

Results The survey forms were distributed among 1400 students, but the number of completed and returned forms was 1339 (512 males, 38.2%; 827 females, 61.8%). Among these students, 115 individuals were regarded as significant in terms of hemorrhagic diathesis. Upon reevaluation of the symptoms, 46 students were considered as having insignificant symptoms and these 42

Turk J Hematol 2013;30:40-47

individuals were excluded from the study; no contact was possible with 20 students. Among the remaining 49 individuals, 40 students (9 males, 31 females) gave consent for further blood tests; hence, blood samples were obtained from these individuals. The mean age of the 40 individuals was 15.9 years (minimum: 14 years, maximum: 19 years, SD: ±1.16). No thrombocytopenia was encountered in any of the cases, but mild anemia was present in 5 individuals. Furthermore, PT, aPTT, and fibrinogen levels were determined to be within normal limits.

In 2 individuals, both vWF:Ag and vWF:RCo levels were found to be low, and in 12 individuals, only the vWF:RCo level was determined to be decreased. In 2 students, vWF:RCo exhibited values close to limits like 45%, but evaluation of the blood groups revealed no individuals with blood group O. In vWD, the vWF:RCo value is regarded as the gold standard diagnostic method; therefore, 14 of the 40 suspected patient (4 males, 10 females) were determined to have type-1 vWD. No significant difference was found between the group diagnosed as vWD (14 individuals) and individuals with no disease (26 individuals) according to the results of the blood tests, in terms of age and gender distribution (p=0.77, p=0.70, respectively).

Upon evaluation of the bleeding symptoms of 14 cases of vWD, the most frequent symptom was epistaxis in 10 patients (71%). The following symptoms were found in addition to epistaxis: easy bruising of skin in 2 of our patients (14%), prolonged bleeding following mucocutaneous surgery in 1 patient (7%), more than 7 days of menstrual bleeding in 2 of the 10 female patients (20%), prolonged bleeding in superficial lacerations in 6 patients (42%), and prolonged bleeding following tooth extraction in 2 patients (14%). In our male patients, no history of prolonged bleeding was found following circumcision.

Serious or deep (intramuscular, intraarticular, intracranial, etc.) bleeding symptoms were not observed in any of our patients. The bleeding symptoms and PFA-100 and vWF levels of the cases of vWD are presented in Table 1. Upon evaluation of all bleeding symptoms in our patients and comparison in terms of the presence of similar symptoms in the family history, no significant difference was found between vWD patients and the group with no disease (p>0.05).

Based on vWF:Ag and vWF:RCo, 14 of the 40 suspected cases were diagnosed as type-1 vWD. Hence, the prevalence of type-1 vWD was determined as 1.04% (14/1339). The PFA-100 test was performed with 2 separate cartridges containing epinephrine and ADP. In the PFA-100 analysis, prolongation in both cartridges (Col/Epi-Col/ADP) was observed in 3 patients who had been diagnosed with type-1 vWD. In another group of 3 cases, single prolongation was detected in the in vitro bleeding time (Col/Epi).

In 2 of these 3 individuals with single prolongation (Col/Epi), administration of a drug with an effect of prolongation of bleeding time was present; the other patient with single prolongation (Col/Epi) was diagnosed with type-1 vWD. When dual prolongation was accepted as significant, including individuals who had received drugs causing prolonged bleeding time, the

Turk J Hematol 2013;30:40-47

Şap F, et al: PFA-100 and Screening of von Willebrand Disease

Table 1: Laboratory and clinical findings of the patients diagnosed with type-1 von Willebrand disease.

Patients

Age

Sex

Symptoms Epistaxis Prolonged bleeding after superficial lacerations Epistaxis, prolonged bleeding after superficial lacerations Prolonged bleeding after superficial lacerations Menorrhagia Epistaxis Epistaxis Epistaxis, menorrhagia Epistaxis, easy bruising Epistaxis, prolonged bleeding after mucocutaneous surgery Prolonged bleeding after superficial lacerations, prolonged bleeding after tooth extraction Epistaxis, easy bruising, prolonged bleeding after superficial lacerations Epistaxis, prolonged bleeding after superficial lacerations, prolonged bleeding after tooth extraction Epistaxis

1 2

16 years 15 years

Female Female

3

15 years

Female

4

15 years

Female

5 6 7 8 9 10

15 years 14 years 16 years 14 years 16 years 15 years

Female Male Male Female Female Female

11

18 years

Male

12

15 years

Female

13

16 years

Female

14

17 years

Male

vWF:Ag (%)

vWF:RCo(%)

Col/Epi(s)

Col/ADP(s)

89.90 88.00

39.00 23.00

205 120

170 86

74.60

12.50

152

98

92.50

45.00

177

84

111.40 116.60 147.10 82.50 50.30 72.20

39.00 39.00 23.00 12.50 12.50 45.00

143 105 101 156 229 134

63 84 76 109 134 96

92.50

39.00

131

75

108.50

33.00

136

89

54.50

12.00

234

119

77.90

23.00

135

80

Col/ADP: collagen/adenosine diphosphate, Col/Epi: collagen/epinephrine, vWF:Ag: von Willebrand factor antigen, vWF:RCo: ristocetin cofactor activity.

sensitivity was 21.4%, the specificity was 100%, the positive prediction value (PV+) was 100%, and the negative prediction value (PV−) was 70.3% at a 95% confidence interval; when individuals receiving drugs were excluded, the sensitivity, specificity, and PV+ values did not change at the 95% confidence interval, but the PV− was determined as 67.6% (Table 2).

Comparison of the group diagnosed with disease (n = 14) and the group with no disease (n = 26) with a history of hemorrhagic diathesis revealed significantly different values for vWF:Ag, vWF:RCo, Col/Epi, and Col/ADP (p<0.05) (Table 3).

Discussion In the past, vWD was generally not well known in Turkey.

There are still some problems in respect to laboratory diagnosis and classification, in spite of the fact that awareness of the disease has increased lately. However, the incidence of vWD is quite high (1%-2%) [2]. Some recent articles have indicated that evaluation by in vitro bleeding time (PFA-100) is logical, since vWD plays a role in the primary hemostasis mechanism [14,15,16]. This test is argued to be more sensitive when compared to the in vivo (Ivy) method [10,14,17,18,19].

43

Turk J Hematol 2013;30:40-47

Şap F, et al: PFA-100 and Screening of von Willebrand Disease

Table 2: Sensitivity, specificity, and predictive values of PFA-100 to detect vWD with both cartridges (Col/Epi & Col/ADP).

Patients who used drugs leading to prolongation of bleeding time (3 patients) If included (n = 40)

If not included (n=37)

Sensitivity

21.4%

21.4%

Specificity

100%

100%

PV+

100%

100%

PV–

70.3%

67.6%

Table 3: von Willebrand factor and in vitro bleeding time values of all symptomatic children.

Without vWD (n=26)

With vWD (n=14)

P

vWF antigen (%)

111.21±23.97

89.89±25.38

0.012

vWF:RCo (%)

84.92±26.39

28.39±12.82

0.000

PFA-100 (Col/Epi) (s)

125.42±29.30

154.14±42.30

0.016

PFA-100 (Col/ADP) (s)

75.69±8.41

97.36±28.03

0.013

vWF: von Willebrand factor, vWF:RCo: ristocetin cofactor activity, With vWD: symptomatic children with von Willebrand disease, Without vWD: symptomatic children without vWD.

Various investigations have been conducted on the prevalence of vWD in Turkey and around the world. Rodeghiero et al. [20] and Werner et al. [21] determined the prevalence of vWD as 0.82% and 1.3%, respectively. In Turkey, 3 separate prevalence investigations were conducted in the Ankara, İzmir, and Edirne regions and the prevalences were found to be 0.7%, 0.44%, and 0.9%, respectively [5,6,7].

Since vWF is an acute phase reactant, the possibility of false negative results during stress or infection has been considered an issue. Low vWF activity was determined in 14 patients (10 females, 4 males). Among these individuals, vWF:Ag was <65% in only 2 of the cases. Furthermore, 2 patients with vWF:RCo values closer to the limits had blood groups other than O. Since we were unable to determine the blood group in some cases, no comparison was performed between O and other blood groups in terms of vWF levels. Since vWD patients diagnosed in our investigation were individuals with no serious bleeding symptoms, the diagnosis in all of our cases was confirmed as mild type-1 vWD. Therefore, the prevalence of vWD based on our results was determined as 1.04% (14/1339). In a recent study, the ratio of vWF:RCo to vWF:Ag was found to be unreliable in differentiating severe type-1 vWD from type-2 vWD [22].

Therefore, this parameter was not used in our study.

The most common symptom observed among our patients was epistaxis (71.4%). Similarly, in previous studies conducted in İzmir and Edirne, epistaxis was again the leading symptom [6,7].

The second most frequent symptom in our cases was prolonged bleeding following superficial abrasions. In previous studies [6,7], 44

the second most common symptom was determined as easy bruising. The fact that these investigations were conducted on primary school children, who are frequently exposed to trauma, explains the cause of easy bruising. However, Sidonio et al. [23] reported that a personal or family bleeding history at presentation and the presence of 2 or more bleeding symptoms were not found to be predictive of vWD, low vWF, or nonspecific defective platelet aggregation. They also revealed that qualitative assessment of bleeding symptoms alone was not worthwhile in children. In contrast, Tosetto et al. [24] reported that the usage of quantitative bleeding assessment tools contributes to the evaluation of patients with suspected mild bleeding disorders.

Although PFA-100 is more sensitive in determining the serious types of vWD (severe type-1, type-2, and type-3), it has been found to be prolonged in a number of type-1 vWD patients.

Nevertheless, it may be found to be normal in mild type-1 vWD cases, or prolongation may be seen in the Col/Epi cartridge only [14,17]. In our study, prolongation was determined in the Col/Epi cartridge in 6 patients, and in 3 of these individuals, prolongation was also observed in the Col/ADP cartridge. In other words, dual prolongation was present in 3 patients and these individuals were diagnosed with type-1 vWD. Therefore, the sensitivity of PFA-100 in diagnosing vWD was determined as 21.4% (3/14). When dual prolongation is accepted as significant, including individuals who had received drugs causing prolonged bleeding time, the sensitivity was 21.4%, the specificity was 100%, the PV+ was 100%, and the PV− was 70.3% at a 95% confidence interval; when individuals receiving drugs were excluded, the sensitivity,

Turk J Hematol 2013;30:40-47

specificity, and PV+ values did not change at the 95% confidence interval, but the PV− was determined as 67.6%. With these results, our false positive rates were zero, but the false negative rates were found to be high (78.5%; 11/14). According to these values, the PFA-100 seems to be insufficient in screening for mildly symptomatic vWD, and the sensitivity value was much

Şap F, et al: PFA-100 and Screening of von Willebrand Disease

lower than expected when compared to other studies [10,12,14,15,17,18,19,25]. Additionally, in an unselected population, authors revealed PFA-100 to be useful to exclude vWD; however they could not be sure whether it might replace the specific vWF tests in patients with significant mucocutaneous bleeding symptoms [26].

Supplement 1. Bleeding questionnaire [taken Supplement 1. Bleeding tendencytendency questionnaire form [taken fromform reference 6]. from reference 6].

Sex: Girl Boy

Birth date:…./…./…….

1) a) Is there often purpleness and/or bruising on your child’s body?

If yes, which of these are true about the purpleness and bruises?

These occur after trauma, but disappear in a short time.

Sometimes these occur without any reason, or if trauma is the reason, they do not disappear easily. b) Are there any similar symptoms and signs in your immediate family and consanguineous members?

If yes, who is he/she?

2) a) Has your child ever had tooth extraction?

If yes, was there any bleeding problem after tooth extraction?

If yes, when did it begin?

Which of these are true about the bleeding?

Bleeding easily ceased.

Bleeding lasted a long time; intervention was needed. b) Is there any bleeding problem after tooth extraction in your immediate family and consanguineous members?

If yes, who is he/she?

3) a) Does your child suffer from prolonged bleeding after cuts of the skin?

No, he does not; bleeding stops easily.

Yes, he does; bleeding takes more time to stop.

We never had such an experience. b) Is there any symptomatic prolonged bleeding in your immediate family and consanguineous members?

If yes, who is he/she?

4) a) Is epistaxis seen in your child?

If yes, how often does it occur?

Once a week 1-2 times in a month Once in 2-3 months Once a year Does epistaxis cease easily?

Was there any need to go to a doctor or an emergency service for this reason? b) Is there epistaxis in your immediate family and consanguineous members or their children?

If yes, who is he/she?

5) a) If your child is a boy, has he been circumcised?

If yes, were there any bleeding problems with circumcision? b) Is there any symptomatic prolonged bleeding after circumcision in your immediate family and consanguineous members?

If yes, who is he?

Yes No Yes Yes Yes

No No No

Yes No Yes No

Yes No Yes No Yes No

Yes

No

Yes No

Yes No Yes No Yes No Yes No Yes No Yes

No

6) If your child is a girl, does she menstruate?

If yes, how many days does it last?

3 days 3-5 days 5-7 days More than 7 days 7) Has your child been operated on for any reason?

If yes, what kind of operation?

If yes, were there any bleeding problems during or after operation?

8) Are there any family members diagnosed with hemophilia or other bleeding disorders?

If yes, who is he/she? And what is the diagnosis?

Yes No Yes No Yes No

45

Şap F, et al: PFA-100 and Screening of von Willebrand Disease

Comparison of the group diagnosed with disease and the group with no disease among 40 cases with a history of hemorrhagic diathesis revealed significantly different values for vWF:Ag, vWF:RCo, Col/Epi, and Col/ADP. In other words, although most of the individuals had normal PFA-100 values in spite of being diagnosed as vWD patients, the values were found to be prolonged when compared to the group with no disease.

In conclusion, the prevalence of vWD among adolescents in the Aegean region of Turkey was determined as 1.04%. The in vitro bleeding time (PFA-100) test can be considered a worthwhile addition to any hemostasis laboratory involved in vWD investigation. The low sensitivity of this screening method may lead to the overlooking of certain patients with mild type-1 vWD. However, severe forms of vWD (severe type-1, type-2, and type3) can be easily detected with PFA-100. Therefore, specific vWF tests (vWF:RCo, vWF:Ag) are definitely required for confirmation of the diagnosis in patients with mildly symptomatic vWD. However, the number of patients in the present study was low to give an exact conclusion for the PFA-100 test. Further studies including more patients are needed.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Lillicrap D, Dean J, Blanchette VS. von Willebrand disease. In: Lilleyman J, Hann I, Blanchette V (eds). Pediatric Hematology.

2nd ed. Philadelphia, Churchill Livingstone, 2000;601-609.

2. Montgomery RR, Scott JP. Hemorrhagic and thrombotic diseases. In: Behrman RE, Kliegman RM, Jenson HB (eds).

Nelson Textbook of Pediatrics. 17th ed. Philadelphia, Saunders, 2004;1651-674.

3. Sadler JE, Rodeghiero F; ISTH SSC Subcommittee on von Willebrand Factor. Provisional criteria for the diagnosis of VWD type 1. J Thromb Haemost 2005;3:775-777.

4. Lillicrap D. The basic science, diagnosis and clinical management of von Willebrand disease. World Federation of Hemophilia (WFH) 2004; revised 2008;35:1-12.

5. Gürsel T, Bumin Ç, Özaltın S. von Willebrand hastalığının prevelansı. Doğa-Turk J Med Sci 1992;16:324-330.

6. Yılmaz D, Karapınar B, Yeniay BS, Balkan C, Bilenoğlu B, Kavaklı K. İzmir’de von Willebrand Hastalığı sıklığını belirlemeye yönelik epidemiyolojik çalışma. Ege Pediatri Bülteni 2005;12:151-159.

7. Kundak T, Demir M. Edirne ili merkez köylerinde von Willebrand hastalığı sıklığının saptanması. Trakya Ü.T.F. İç Hastalıkları A.D. Tez Çalışması 2004:1-55 (in Turkish, thesis).

8. Gürsel T, Kavaklı K, Aktuğlu G. Hemofili ve von Willebrand Hastalığında Tanı ve Tedavi. Türk Hematoloji Derneği Hemofili Alt Komitesi Rehberi, İstanbul 1999;2-5. (in Turkish).

46

Turk J Hematol 2013;30:40-47

9. Laffan M, Brown SA, Collins PW, Cumming AM, Hill FG, Keeling D, Peake IR, Pasi KJ. The diagnosis of von Willebrand disease: a guideline from the UK Haemophilia Centre Doctors’ Organization. Haemophilia 2004;10:199-217.

10. Cariappa R, Wilhite TR, Parvin CA, Luchtman-Jones L. Comparison of PFA-100 and bleeding time testing in pediatric patients with suspected hemorrhagic problems. J Pediatr Hematol Oncol 2003;25:474-479.

11. Wuillemin WA, Gasser Ka, Zeerleder SS, Lämmle B. Evaluation of a Platelet Function Analyser (PFA-100) in patients with a bleeding tendency. Swiss Med Wkly 2002;132:443-448.

12. Chen YC, Yang L, Cheng SN, Hu SH, Chao TY. von Willebrand disease: a clinical and laboratory study of sixtyfive patients. Ann Hematol 2011;90:1183-1190.

13. Akin M, Balkan C, Karapinar DY, Kavakli K. The influence of the ABO blood type on the distribution of von Willebrand factor in healthy children with no bleeding symptoms. Clin Appl Thromb Hemost 2012;18:316-319.

14. Franchini M. The platelet-function analyzer (PFA-100) for evaluating primary hemostasis. Hematology 2005;10:177-181.

15. Philipp CS, Miller CH, Faiz A, Dilley A, Michaels LA, Ayers C, Bachmann G, Dowling N, Saidi P. Screening women with menorrhagia for underlying bleeding disorders: the utility of the platelet function analyser and bleeding time. Haemophilia 2005;11:497-503.

16. Buyukasik Y, Karakus S, Goker H, Haznedaroglu IC, Ozatli D, Sayinalp N, Ozcebe OI, Dundar SV, Kirazli S. Rational use of the PFA-100 device for screening of platelet function disorders and von Willebrand disease. Blood Coagul Fibrinolysis 2002;13:349-353.

17. Dean JA, Blanchette VS, Carcao MD, Stain AM, Sparling CR, Siekmann J, Turecek PL, Lillicrap D, Rand ML. von Willebrand disease in a pediatric-based population--comparison of type 1 diagnostic criteria and use of the PFA-100 and a von Willebrand factor/collagen-binding assay. Thromb Haemost 2000;84:401-409.

18. Fressinaud E, Veyradier A, Truchaud F, Martin I, BoyerNeumann C, Trossaert M, Meyer D. Screening for von Willebrand disease with a new analyzer using high shear stress: a study of 60 cases. Blood 1998;91:1325-1331.

19. Nitu-Whalley IC, Lee CA, Brown SA, Riddell A, Hermans C. The role of the platelet function analyser (PFA-100) in the characterization of patients with von Willebrand’s disease and its relationships with von Willebrand factor and the ABO blood group. Haemophilia 2003;9:298-302.

20. Rodeghiero F, Castaman G, Dini E. Epidemiological investigation of the prevalence of von Willebrand’s disease.

Blood 1987;69:454-459.

21. Werner EJ, Broxson EH, Tucker EL, Giroux DS, Shults J, Abshire TC. Prevalence of von Willebrand disease in children: a multiethnic study. J Pediatr 1993;123:893-898.

Turk J Hematol 2013;30:40-47

22. Akin M, Kavakli K. Laboratory diagnosis and management of von Willebrand disease in Turkey: Izmir experience. Semin Thromb Hemost 2011;37:581-586.

23. Sidonio RF Jr, Gunawardena S, Shaw PH, Ragni M. Predictors of von Willebrand disease in children. Pediatr Blood Cancer 2012;58:736-740.

24. Tosetto A, Castaman G, Plug I, Rodeghiero F, Eikenboom J. Prospective evaluation of the clinical utility of quantitative bleeding severity assessment in patients referred for hemostatic evaluation. J Thromb Haemost 2011;9:11431148.

Ĺ&#x17E;ap F, et al: PFA-100 and Screening of von Willebrand Disease

25. Podda GM, Bucciarelli P, Lussana F, Lecchi A, Cattaneo M. Usefulness of PFA-100 testing in the diagnostic screening of patients with suspected abnormalities of hemostasis: comparison with the bleeding time. J Thromb Haemost 2007;5:2393-2398.

26. Castaman G, Tosetto A, Goodeve A, Federici AB, Lethagen S, Budde U, Batlle J, Meyer D, Mazurier C, Goudemand J, Eikenboom J, Schneppenheim R, Ingerslev J, Habart D, Hill F, Peake I, Rodeghiero F. The impact of bleeding history, von Willebrand factor and PFA-100(ÂŽ) on the diagnosis of type 1 von Willebrand disease: results from the European study MCMDM-1VWD. Br J Haematol 2010;151:245-251.

47

Research Article

DOI: 10.5152/tjh.2011.79

Sticky Platelet Syndrome in Patients with Uninduced Venous Thrombosis Uyarılmamış Venöz Tromboz Hastalarında Yapışkan Trombosit Sendromu Emre Tekgündüz1, Muzaffer Demir2, Alev Akyol Erikçi3, Seval Akpınar2, Erman Öztürk4, Onur Kırkızlar2 1Ankara Oncology Education and Research Hospital, Department of Hematology and Bone Marrow Transplantation Unit, Ankara, Turkey 2Trakya University, School of Medicine, Department of Internal Medicine, Division of Hematology, Edirne, Turkey 3Gülhane Military Medical School, Haydarpaşa Training Hospital, Department of Hematology, İstanbul, Turkey 4Göztepe Education and Research Hospital, Department of Hematology, İstanbul, Turkey

Abstract: Objective: Sticky platelet syndrome (SPS) is a common autosomal dominant inherited platelet disorder. SPS is characterized by platelet hyperreactivity and is associated with arterial and venous thrombosis. The aim of this study was to determine the role of SPS in patients with uninduced venous thrombosis.

Material and Methods: The study included 28 patients (15 male and 13 female) with uninduced venous thrombosis.

SPS was defined according to Mammen’s aggregation method, which is described in detail elsewhere.

Results: According to the defined ranges for platelet hyperreactivity, 3 (50%) patients, 2 (33%), and 1 (17%) (n =6 [21%]) with a confirmed diagnosis were classified as type II, I, and III SPS, respectively. In 1 patient SPS was the only hereditary abnormality noted. The other 5 patients carried other inherited coagulation defects, in addition to SPS. Conclusion: The present findings indicate that the prevalence of SPS was 21% in the patients with uninduced venous thrombosis. We therefore suggest that SPS should be considered in the differential diagnosis of such cases.

Key Words: Venous thrombosis, Blood platelet disorders, Platelet aggregation, Platelet function tests Özet: Amaç: Yapışkan trombosit sendromu (YTS) trombosit hiperreaktivitesi ile karakterize sık rastlanan, otozomal baskın kalıtımlı, arteryel ve venöz tromboz ile ilişkili bir trombosit hastalığıdır. Bu çalışmanın temel amacı uyarılmamış venöz tromboz ile başvuran hastalarda YTS’nin rolünün belirlenmesidir.

Gereç ve Yöntemler: YTS’nin tanımlanmasında daha önce Mammen tarafından tanımlanmış olan agregasyon metodu kullanılmış ve çalışmaya uyarılmamış venöz trombozu olan 28 hasta (15 erkek ve 13 kadın) dahil edilmiştir.

Bulgular: Kendi normal değerlerimizi kullanarak trombosit hiperreaktivitesini değerlendirdiğimizde üç hasta (%50) tip II, iki hasta (%33) tip I ve bir hasta (%17) tip III YTS (toplam 6; %21) olarak sınıflandı. Bir hastada YTS saptanan tek kalıtsal bozukluktu. Beş hastada YTS’ye ek kalıtsal koagülasyon bozuklukları saptandı.

Address for Correspondence: Emre TEKGÜNDÜZ, M.D. Ankara Oncology Education and Research Hospital, Department of Hematology and Bone Marrow Transplantation Unit, Ankara, Turkey Gsm: +90 532 434 76 56 E-mail: emretekgunduz@yahoo.com Received/Geliş tarihi : April 24, 2011 Accepted/Kabul tarihi : August 10, 2011

48

Turk J Hematol 2013;30:48-52

Tekgündüz E, et al: SPS in Patients with Venous Thrombosis

Sonuç: Sonuçlarımız uyarılmamış venöz tromboz olgularında YTS sıklığının %21 olduğunu ve YTS’nin bu hasta grubunun ayırıcı tanısında düşünülmesi gerektiğini göstermektedir.

Anahtar Sözcükler: Venöz tromboz, Kan trombosit bozuklukları, Trombosit agregasyonu, Trombosit fonksiyon testleri

Introduction Worldwide, venous thrombosis is a serious health problem associated with morbidity and mortality. In order to plan the longterm management and duration of anticoagulant therapy it is crucial to identify the underlying cause of thrombosis whenever possible. In about 50% of patients that present with venous thrombosis a hereditary or acquired coagulation defect, or a platelet disorder is present [1]. Sticky platelet syndrome (SPS) is a common hereditary platelet disorder with autosomal dominant inheritance. SPS is characterized by increased in vitro platelet hyperreactivity to adenosine diphosphate (ADP) and/or epinephrine (EPI) [2,3]. Patients with SPS present with arterial and/or venous thrombosis in various vascular beds. The diagnosis is based on platelet aggregation studies and in most patients it is easily treated with 100 mg/d aspirin.

Although the first patient with SPS was reported in 1983 [4], many physicians remain unfamiliar with this platelet defect and do not consider SPS when screening for thrombophilic risk factors in patients with unprovoked thrombosis. The present study we aimed to determine the role of SPS in patients that present with uninduced venous thrombosis.

Materials and Methods Study population The study was conducted between September 2006 and March 2009. During this period we consecutively enrolled all patients with unprovoked venous thrombosis that presented to our hematology outpatient clinic for etiological evaluation. The inclusion criteria were as follows: history of thrombosis ≥3 months prior to study entry; no other arterial/venous thromboembolic events during the 3 months prior to study entry; cessation of smoking ≥2 weeks before SPS evaluation; no use of any drug for ≥2 weeks, such as aspirin or non-steroidal antiinflammatory drugs that interfere with platelet function; absence of any signs/symptoms indicative of an infection or inflammatory disease on the day of SPS evaluation; willing to participate.

The study was conducted in accordance with the Declaration of Helsinki and written informed consent was provided by all participants. The study protocol was approved by the Trakya University School of Medicine Ethics Review Board.

Study protocol All patients with venous thrombosis that presented to our outpatient clinic for etiological work-up were evaluated via detailed history, physical examination, and appropriate laboratory testing for the presence of common acquired hypercoagulable

states, including surgery, trauma, immobility, malignancy, pregnancy, hormone replacement therapy, catheter-induced thrombosis, nephrotic syndrome, myeloproliferative disorders.

Detailed imaging studies and invasive assessments for the detection of occult cancer were not performed. Consecutive patients without an identifiable cause for thrombosis were included in the study.

Aggregation studies were performed following overnight fasting and within 3 h of phlebotomy. Blood samples were drawn at 9.00 am after 15 min of resting. After the first 2 mL was discarded, blood was aspirated with a 19-gauge butterfly needle into a 20-mL syringe containing 2 mL of 3.2% sodium citrate solution. Platelet-rich (PRP) and -poor (PPP) plasma were obtained via centrifugation of anti-coagulated blood for 10 min at 100 g and 2000 g, respectively. PRP was mixed with PPP at appropriate volumes to obtain a standardized platelet count of 250,000 mm3; the stir bar speed was set at 1200 rpm.

SPS was defined according the method described by Mammen [2]. In brief, we pipetted 500 µL of PRP into a siliconized cuvette and placed another cuvette containing 500 µL of PPP into a blank chamber. We used 3 different ADP and EPI solutions as agonists.

The final agonist concentrations in the testing chamber for ADP (Chrono-Par®) and EPI (Chrono-Par®) were 2.34 µM, 1.17 µM, and 0.58 µM, and 11 µM, 1.1 µM, and 0.55 µM, respectively.

Aggregation reactions were recorded for 10 min after addition of agonists using a lumi-aggregometer (Chronolog®). The aggregation responses were recorded as aggregation percentage, with 100% being complete aggregation and 0% being no aggregation.

All participants were also screened for common inherited coagulation defects. Protein C and S, antithrombin activity, homocysteine levels, and the presence of antiphospholipid antibodies, activated protein C resistance (APCR), and prothrombin G20210A mutation were analyzed via standard methods, as described elsewhere [5]. Patients exhibiting APCR were assessed for factor V Leiden (FVL) mutation.

Definition of SPS Standard criteria were used for the diagnosis and classification of SPS [2]. Normal aggregation responses in our laboratory were previously defined as part of another study (in review). Normal ranges of platelet aggregation were set as 10th-90th percentile values of healthy controls. History of thrombosis is a sine qua non criterion for SPS diagnosis. Apart from a history of thrombosis, hyperaggregable responses to ≥2 of the 6 agonist concentrations (ADP: 2.34, 1.17, and 0.58 µM; EPI: 11, 1.1, and 0.55 µM) confirmed the diagnosis of SPS. On the other hand, platelet 49

Turk J Hematol 2013;30:48-52

Tekgündüz E, et al: SPS in Patients with Venous Thrombosis

hyperreactivity to only 1 concentration of ADP or EPI was accepted as suggestive of SPS. Suggestive cases were then reclassified as confirmed SPS if repeat testing was abnormal.

Patients with abnormal responses to both reagents were classified as type I SPS, and patients with a hyperaggregable response to only ADP or EPI were classified as type II and III SPS, respectively.

Results Patient demographic and clinical features are summarized in Table 1. The study included 15 male and 13 female patients with

a median age of 39 years (range: 21-63 years) and 45 years (range: 29-60 years), respectively. In all, 5 (18%) patients were diagnosed as retinal vein thrombosis (RVT), 9 (28.5%) patients had pulmonary embolism (PE), 14 (50%) had deep vein thrombosis (DVT), and 1 (3.5%) patient had DVT complicated by PE. The most common genetic blood coagulation defect was FVL mutation. In total, 15 (54%) patients had FVL mutation. In 7 patients an inherited coagulation defect was not observed,whereas 2 patients had >1 hereditary coagulation defect contributing to thrombosis.

Table 1: Study population demographic and clinical data.

Patient

Age (years)

Gender

Diagnosis

Co-pathology

SPS

1

51

M

RVT

-

Confirmed-Type I

2

51

M

PE

HCY

N

3

40

M

DVT

FVL-homo

N

4

48

M

RVT

FVL-hetero

Confirmed-Type II

5

45

F

PE

FVL-hetero

Confirmed-Type I

6

36

M

DVT

FVL-hetero

Confirmed-Type II

7

36

M

DVT/PE

FVL-hetero

Suggestive/ADP 0.58

8

53

F

DVT

FVL-hetero

Confirmed-Type II

9

21

M

DVT

-

N

10

41

F

PE

PTHR- hetero

Suggestive/EPI 0.55

11

48

F

RVT

-

Suggestive/ADP 0.58

12

53

F

DVT

AT; FVL-hetero

Confirmed-Type III

13

27

M

DVT

FVL-hetero

N

14

32

M

DVT

-

N

15

31

F

DVT

HCY

N

16

30

M

DVT

FVL-hetero

N

17

63

M

RVT

AT

N

18

30

M

DVT

PC

N

19

39

M

DVT

FVL-hetero

Suggestive/EPI0.55

20

29

F

PE

FVL-homo

N

21

53

F

RVT

-

N

22

37

F

PE

PTHR-hetero

Suggestive/ADP0.58

23

60

F

DVT

-

N

24

52

M

DVT

-

N

25

35

F

PE

HCY

N

26

48

F

PE

PC, APA

Suggestive/ADP0.58

27

55

M

PE

FVL-hetero

N

28

37

F

DVT

FVL-hetero

N

APA: Antiphospholipid antibodies; DVT: deep vein thrombosis; FVL-hetero: factor V Leiden heterozygous; FVL-homo: factor V Leiden homozygous; HYC: homocysteinemia; N: normal; PC: protein C deficiency; PTHR-hetero: prothrombin G20210A heterozygous; PE: pulmonary embolism; RVT: retinal vascular thrombosis; -: no identifiable genetic defect could be demonstrated

50

Turk J Hematol 2013;30:48-52

Tekgündüz E, et al: SPS in Patients with Venous Thrombosis

Table 2: Normal aggregation ranges in our laboratory.

Agonist

Aggregation (%)

EPI 11 µM

21-94

EPI 1.1 µM

12-93

EPI 0.55 µM

6-85

ADP 2.34 µM

23-85

ADP 1.17 µM

6-61

ADP 0.58 µM

2-14

Normal aggregation response limits for SPS in our laboratory were determined during a previous study using blood samples obtained from 49 healthy controls, as mentioned above (Table 2).

Six patients (21.5%) with a confirmed diagnosis of SPS and 6 (21.5%) with a suggestive diagnosis were identified accordingly. In total, 16 patients (57%) tested negative for SPS. Of the 6 patients with a confirmed diagnosis of SPS, 3 (50%), 2 (33%), and 1 (17%) were classified as type II, I, and III SPS, respectively. SPS was the sole hereditary thrombophilic abnormality in 1 of the patients with a confirmed diagnosis of SPS; the remaining 5 patients had other inherited coagulation defects, in addition to SPS. Discussion Venous thrombosis, due to its short- and long-term consequences, is a major health concern. As Virchow posited about 150 years ago, complex interaction of vascular stasis, hypercoagulability, and endothelial injury results in thrombosis at various locations. Based on history, physical examination, and modern laboratory techniques, a clinical condition, or a hereditary or acquired coagulation/platelet defect is the cause of venous thrombosis in nearly 80% of patients with venous thrombosis [2].

In general practice patients with the following conditions are candidates for evaluation of hereditary thrombophilia: unexplained venous thrombosis, VTE before age 50 years, family history of VTE, recurrent thrombosis, and thrombosis at unusual sites. Patients with the aforementioned conditions are frequently screened for the presence of APCR, prothrombin gene mutation, antiphospholipid antibodies, hyperhomocysteinemia, and protein C and S, and antithrombin deficiency; however, SPS is not routinely included in screening for thrombophilia. As SPS is a common disorder that can be effectively treated with 100 mg/d aspirin, it should be considered in the differential diagnosis of patients with unexplained venous or arterial thrombosis.

As compared to hereditary coagulation defects, data on the role of SPS in arterial or venous thrombosis is scarce. Apart from venous thrombosis, SPS has been associated with various other clinical entities, including acute coronary syndrome with normal coronary angiography findings [6], transient ischemic attack [2], recurrent miscarriage syndrome [7], peripheral arterial microembolism [8], ischemic optic neuropathy [9,10] and post-

transplant thromboembolic events [11,12]. The prevalence of SPS in patients with thrombosis varies with the location of involved vessels and study population. Among 599 consecutive patients with a new arterial or venous thrombotic attack, the prevalence of SPS was 20.5% [13]. Another study that included 159 patients with unexplained venous/ arterial thrombosis reported that the prevalence of SPS among those with retinal and deep vein thrombosis was 50% and 14%, respectively [2]. A study from Mexico that included 46 consecutive patients with unexplained thrombosis reported that 48% of the study cohort had SPS [14].

If we consider only a confirmed diagnosis of SPS, 40% (2/5) and 17% (4/23) of the present study’s patients that presented with RVT and DVT/PE had SPS, respectively; these results are in agreement with those of the studies mentioned above. As 6 of the present study’s patients with suggestive SPS refused to be retested, exclusion or confirmation of SPS in those patients was not possible, and they were considered suggestive cases.

Another important finding of the present study is that among the patients with a confirmed diagnosis of SPS (n= 6), SPS was the sole thrombotic abnormality in only 1 patient (17% [3.5% of the entire study cohort]); in the other 5 patients SPS coexisted with other well known hereditary coagulation defects, which is similar to previous studies that reported that 83% [14] and 33% [15] of patients with SPS presented with additional congenital prothrombotic conditions.

We are well aware that the present patient cohort is too small for inferring definitive conclusions about the role of SPS in patients with unexplained venous thrombosis. The present study included only patients that presented with DVT, PE, and RVT; patients with thrombosis in other locations were not included. Furthermore, selection bias cannot be discounted, as we screened for SPS in patients that presented to our outpatient clinic. Venous thromboembolism is a multifactorial disorder. As the majority of our patients with confirmed diagnosis of SPS had other well known thrombophilic conditions, SPS in these patients should be interpreted as a contributing factor for development of thrombosis. Bearing these limitations in mind, the present study’s findings do provide some insight into the role of SPS in patients with unprovoked venous thrombosis in Turkey, and as such, physicians should be aware of this common inherited platelet defect that is presumed to lead to arterial and venous thrombosis. The present findings show that the prevalence of SPS in the patients that presented with uninduced thrombosis was high and that SPS should therefore be considered when screening for thrombophilia in such patients.

Conflict of Interest Statement None of the authors has any conflicts of interest, including specific financial interests, relationships, and/or affiliations, relevant to the subject matter or materials included in this manuscript.

References 1. Bick RL. Introduction to thrombosis: Proficient and costeffective approaches to thrombosis. Hematol Oncol Clin N Am 2003;17:1-8.

51

Tekgündüz E, et al: SPS in Patients with Venous Thrombosis

2. Bick RL. Sticky platelet syndrome: a common cause of unexplained arterial and venous thrombosis. Clin Appl Thromb Hemost 1998;4:77-81.

3. Mammen EF. Ten Years’ Experience with the “Sticky Platelet Syndrome”. Clin Appl Thromb Hemost 1995;1:66-72.

4. Holiday PL, Mammen E, Gilroy J. Sticky platelet syndrome and cerebral infarction in young adults. Presented at the Ninth International Joint Conference on Stroke and Cerebral Circulation; 1983 (abstract). Phoenix, Arizona. Circulation 1983 (suppl).

5. Bick RL, Jakway J, Baker WF. Deep vein thrombosis: prevalence of etiologic factors and results of management in 100 consecutive patients. Sem Thromb Hemost 1992;18:267-274.

6. Rubenfire M, Blevins RD, Barnhart MI, Housholder S, Selik N, Mammen EF. Platelet hyperaggregability in patients with chest pain and normal coronary arteries. Am J Cardiol 1986;57:657-660.

7. Bick RL, Hoppensteadt D. Recurrent miscarriage syndrome and infertility due to blood coagulation protein/platelet defects: a review and update. Clin Appl Thromb Hemost 2005;11:1-13.

8. Sand M, Mann B, Bechara FG, Sand D. Sticky platelet syndrome type II presenting with arteriel microemboli in the fingers. Throm Res 2009;124:244.

52

Turk J Hematol 2013;30:48-52

9. Mears KA, Van Stavern GP. Bilateral simultaneous anterior ischemic optic neuropathy associated with sticky platelet syndrome. Br J Ophthalmol 2009;93:885-886.

10. Randhawa S, Van Stavern GP. Sticky platelet syndrome and anterior ischemic optic neuropathy. Clin Experiment Ophthalmol 2007;35:779-781.

11. Mühlfeld AS, Ketteler M, Schwamborn K, Eitner F, Schneider B, Gladziwa U, Knüchel R, Floege J. Sticky platelet syndrome: an underrecognized cause of graft dysfunction and thromboembolic complications in renal transplant recipients.

Am J Transplant 2007;7:1865-1868.

12. El-Amm JM, Andersen J, Gruber SA. Sticky platelet syndrome: a manageable risk factor for posttransplant thromboembolic events. Am J Transplant 2008;8:465.

13. Bick RL, Fareed J. Sticky Platelet Syndrome: The Clinical Spectrum of Thrombosis. Blood 2005; 106: (abstract#4138) 14. Ruiz-Arguelles JG, Lopez-Martinez B, Valdes-Tapia P, GomezRangel JD, Reyes-Nunez V, Garces-Eisele J. Primary thrombophilia in Mexico. V. A comprehensive prospective study indicates that most cases are multifactorial. Am J Hematol 2005;78:21-26.

15. Frenkel EP, Mammen EF. Sticky platelet syndrome and thrombocytemia. Hematol Oncol Clin N Am 2003;17:63-83.

Research Article

DOI: 10.4274/tjh.2011.0015

Can Sex Be Determined from a Blood Smear?

Kan Yaymasından Cinsiyet Belirlenebilir mi?

Mohamed Brahimi1, Affaf Adda1, Hassiba Lazreg1, Hadjer Beliali2, Soufi Osmani2, Mohamed Amine Bekadja2, 1EHU "1er Novembre 1954" - Hemobiology, Oran, Algeria 2EHU "1er Novembre 1954" - Hematology and Cell Therapy, Oran, Algeria

Abstract: Objective: Originally, this blind study was designed to check whether blood smears constitute reliable tools to determine sex.

However, when we analyzed our data some interesting findings immerged and in this paper we try to highlight them.

Material and Methods: 74 blood smears (35 women and 39 men) have been performed and then stained. 200 polynuclearneutrophils were examined for nuclear appendages and classified into four groups: neutrophils with form A, B or C appendages and neutrophils without any appendage.The difference (A-C) was calculated for each slide. The “cytologic sex” was defined as a male in case of a negative value and as a female otherwise.

Results: Neutrophils bear the same amount of appendages in both genders (p=0.37). But the number of form A is greater in females (p<0.0001) and form C is much more frequent in males (p<0.0001), that is why, the difference A-C is the best way to differentiate between both sexes.The distribution histogram of A-C in women shows a multimodal histogram contrary to men’s graphwhich is a bell-shaped curve. The menstrual cycle was incriminated in this feature.

Conclusion: Blood smear is a reliable tool to determine gender.

Key Words: Gender, Nuclear appendages, Polymorphonuclear neutrophils, Blood Smear, May-Grünwald-Giemsa stain

Özet: Amaç: Orijinal olarak planlanmış bu kör çalışmanın amacı çevre kan yayması incelemesi ile cinsiyet belirlemesinin yapılıp yapılamayacağını tespit etmek. Elimizdeki bulguları incelediğimizde bazı ilginç sonuçlar ortaya çıkmıştır; bu çalışmada onları vurgulamak istiyoruz.

Gereç ve Yöntemler: 74 çevre kan yayması (35 kadın; 39 erkek) hazırlandı. 200 nötrofil çekirdek ilave uzantısı açısından incelendi ve dört gruba ayrıldı: A, B, C tarzında çekirdek ilave uzantısı olanlar ve hiç çekirdek ilave uzantısı olmayanlar. Her çevre kan yaymasındaki çekirdek ilave uzantısı şekillerindeki (A-C) tarzındaki farklılıklar sayısal olarak tespit edildi. Eğer hesaplanan değer negatif ise ‘sitolojik cinsiyet’ erkek olarak tanımlandı, diğer durumlarda ise kadın olarak tanımlandı.

Bulgular: Nötrofiller her iki cinsiyette de aynı miktarda çekirdek ilave uzantısı taşımaktaydı (p=0,37). Fakat A şekli kadınlarda (p<0,0001); C sekli ise erkeklerde daha sık gözlendi (p<0,0001). O yüzden A-C histogramının dağılımı kadınlarda multimodal histogram seklindeyken, erkeklerdeki dağılım grafiği çan-eğrisi seklindeydi. Bu farklılıktan menstrüel durum sorumlu tutuldu.

Sonuç: Çevre kan yayması incelemesi cinsiyet tayininde güvenilir bir yöntemdir.

Anahtar Kelimeler: Cinsiyet, Çekirdek ilave uzantısı, Çevre kan yayması, May-Grunwald-Giemsa boyaması, Parçalı nötrofil

Address for Correspondence: Mohamed BRAHİMİ, MD EHU – Hemobiology 269 Hai Ennakhla CANASTEL Oran 31132, Algeria GSM: +213 771485739 E-mail: bmw73dz@yahoo.fr Received/Geliş tarihi : March 11, 2012 Accepted/Kabul tarihi : July 25, 2012

53

Turk J Hematol 2013;30:53-57

Brahimi M, et al: Can Sex Be Determined from a Blood Smear?

Introduction Each time granulocytes are described in a hematology atlas book, nuclear appendages are mentioned [1,2]. Some polymorphonuclear neutrophils contain a small chromatin mass (1.5 μm) appended to one of their nucleus lobes. To date, their nature has remained uncertain. According to some authors, these appendages are assumed to be constituted of sex chromatin derived from heterochromatin proportions of the XX chromosome complex [3,4].

However, some published data demonstrated that the frequencies and the distribution of these appendages were not influenced by sex only, but also by many other factors such as hormones, granulocytes metabolism, cell proliferation, and age [5].

Originally, this blind study was designed to check whether blood smears constitute reliable tools to determine sex. However, when we analyzed our data some interesting findings emerged, and in this paper, we try to highlight them.

Materials and Methods Blood Samples and Preparation of Smears Seventy-four blood samples, from 35 women and 39 men, were haphazardly selected from the thousands of tubes submitted to us for complete blood counts. All of these samples belonged to patients hospitalized in our establishment regardless of their illness or their treatment. The ages of the studied patients varied from 16 to 80 years old.

All venous blood specimens were collected into tubes containing ethylenediaminetetraacetic acid (K2 or K3EDTA). Thin air-dried blood smears were made, labeled only by their tube number, and then stained manually with May-Grünwald-Giemsa stain.

Student’s t-test was performed in order to assess the difference between data for both sexes. Error boxes (mean±2 standard deviation error bars) with data swarm were plotted in order to compare men’s and women’s data. A difference (A – C) distribution histogram was used to compare the distribution curves in both sexes.

Results The Student’s t-test results are represented in Table 1, which shows that neutrophils bear the same amount of appendages in both sexes. However, the number of form A appendages is greater in females (p<0.0001) and form C is much more frequent in males (p<0.0001); this is why the difference of A – C is the best way to differentiate between the sexes.

Figures 2A-2C show error boxes with data swarm of a single parameter. They show that form A is more frequent in women than in men, whereas form C is much more frequent in men and there is no difference in form B frequencies in the sexes.

The error box of the sum (A + B + C) shows that there is no significant difference in the proportion of neutrophils bearing appendages (Figure 2D).

Figure 2E shows that the difference of A – C is the best way to differentiate between the sexes, whereby A – C gives a positive value in all females and a negative value in all males except for 2. The difference (A – C) was equal to +2 in 1 man and +7 in another. These later were considered as odd cases.

Figure 3 represents percentages of subjects versus A – C value curves in both sexes. The men’s histogram looks like a bell-shaped curve whereas the women’s is a multimodal curve.

Table 1 and Figure 2E show that the A – C difference is the best way to differentiate between the sexes (t=16.1 and M* – M§ = 10.94), comparing counts of forms A and C.

Slide Examination The smears were examined under light microscopy by one of the authors in a blinded manner in order to determine “cytologic sex” for each sample. The slides were entirely scanned with 100× oil-immersion lens for abnormal nucleated cells such as blast cells, normoblasts, or immature granulocytes and, if any were found, the samples were excluded from the study.

A total of 200 polynuclear neutrophils were examined for nuclear appendages and classified into 4 groups: neutrophils with form A, B, or C appendages and neutrophils without any appendages. Figure 1 shows the different forms of appendages.

The difference of A–C was calculated for each slide. The “cytologic sex” was defined as male in the case of a negative value and as female otherwise.

Statistical Methods For statistical evaluation, an online calculator and free graphing software were used [6].

54

Figure 1: Different forms of appendages (arrow): A) form A (drumstick), B) form B (sessile nodules), C) and D) form C (C: tag and D: hook).

Turk J Hematol 2013;30:53-57

Brahimi M, et al: Can Sex Be Determined from a Blood Smear?

Discussion Davidson and Smith were the first to identify the peculiar nucleus projections in neutrophils and define their relationship with sex chromatin of the cells [7]. The nomenclature used in this study is derived from Kosenow’s formula [8]. Thus, drumsticks are called “form A”: these are stalked, round-headed appendages of chromatin, 1.5 μm in diameter, attached to a nucleus lobe with a thin stem (Figure 1A) [9]. Sessile nodules, or “form B”, were described by Davidson and Smith as having the appearance of drumsticks but being devoid of any stem (Figure 1B) [9]. Leukocytes with other pedunculated nuclear projections, which are easily distinguished from small lobes and forms A and B, such as clubs and hooks, are designated as “form C” (Figures 1C and 1D) [10].

In our study, the leukocytes of both sexes bore nearly the same frequency of appendages (Table 1), but t-tests showed that numbers

of form A were greater in females than in males. These results are in agreement with those reported in the literature and confirm the fact that drumstick count is certainly related to sex [7,9].

Briggs declared that drumsticks are never seen in male leukocytes [9], but this notion is in contradiction with our findings and those of many other investigators. In our series, in accordance with the findings of others, 30 men out of 39 had drumsticks in 0.5% to 2% of their polymorphs [5,11].

Tomonaga et al. examined 50 men’s blood smears; they found that the frequency of form A varied from 0 to 6 per 1000 polynuclear neutrophils [11]. Gonzalez et al. studied 38 blood smears of newborns (19 males and 19 females) and declared that a great number of “small drumsticks” was found in smears from newborns that were subsequently identified as males [5].

This might be due to the fact that the form A seen in male leukocytes are not “true drumsticks”. Mukherjee and San Sebastian named these male form A projections “drumstick-like” [12]. That is because their structures are similar to typical drumsticks in shape but generally smaller in size.

Confirmation of the inactive X chromosome in the drumstick and the Y chromosome in the drumstick-like chromosome has been provided by fluorescence in situ hybridization [2,13,14]. Females with an isochromosome of the long arms of the X chromosome have larger and more frequent drumsticks, whereas females with deletions from the X chromosome have smaller drumsticks [1,15].

Wondergem and Ossenkoppele reported, in March of 2011, the case of a woman with a myelodysplastic syndrome– myeloproliferative disorder. The presence of double drumsticks (2 drumsticks in 1 cell) prompted a cytogenetic study that showed 47, XXX anomaly [16].

Figure 2: Error boxes (means ± 2 standard deviation error bars) with data swarm. Each dot represents a subject. The left bar represents the women’s data and the right the men’s data. Error bars are centered on the mean of the distribution range and demonstrate an interval of 2 standard deviations of the mean.

As one can see from our data, the incidence of A appendages varies widely from one woman to another (from 2 to 14 drumsticks per 200 neutrophils) (Figure 2A). These variations had been reported under different circumstances: during the menstrual cycle, after the administration of adrenocorticotropic hormone and insulin, with senility, and with cachexia [5].

The majority of investigators believe that “sessile nodules” are as equally sex-specific as drumsticks, but they are more difficult to recognize since they might mingle with the nucleus during a manual spreading of the blood film [1,2,9]. Because of this, only form A is considered for sex diagnosis.

In this study, the t-test did not show any significant difference in the frequency of form B between men and women. This might be due to the fact that some drumsticks, hooks, and tags could be partially hidden underneath the nucleus membrane, which would let them look like sessile nodules.

Figure 3: Distribution histogram of the difference of A – C. The solid curve represents men’s data and the dashed curve represents women’s data.

Many authors consider that only drumsticks are related to the sex chromatin [2,7,9], but if we analyze the series of Tomonaga et al., it can be seen that form C is more frequent in male smears than in female, which is in agreement with our data (Table 1, Figure 2C) [11]. Student’s t-test shows that form C is of equal sex diagnostic significance as form A (Table 1).

55

Turk J Hematol 2013;30:53-57

Brahimi M, et al: Can Sex Be Determined from a Blood Smear?

Table 1: Frequency of each nuclear appendage of neutrophils and sex difference.

Form of appendage

Fameles (35 cases) Min.

Max.

Mean*

Males (39 cases) S.D.

Min.

Max.

Sex difference (t-Test) §

Mean

S.D.

M** M§

t

p

From A

2

14

7.49

3.42

0

7

1.72

1.45

5.77

9.61

<0.0001

From B

2

20

13.8

4.6

2

25

15,9

5,51

-2.1

-1.79

0.78

From C

0

3

1.06

1.08

0

11

6.23

2.53

-5.17

-11.2

<0.0001

Total (A+B+C)

6

35

22.3

7.49

5

35

23.9

6.96

-1.6

-0.91

0,37

Difference (A-C)

2

13

6.43

3.09

-9

7

-4.51

2.74

10.94

16.1

<0.0001

Mean* and Mean§: Frequency is expressed as number per 200 neutrophils, S.D.: Standart Deviation, Min: Minmum, Max: Maximum

It had been reported that an increase in the incidence of small clubs and hooks (form C) could be observed after intensive androgen treatment in humans and animals [17,18]. Méhes studied the blood smears of female patients receiving chronic androgen therapy for mammary carcinoma and compared them with those of untreated controls [10]. The incidence of form C proved to be higher in the androgen-treated patients. He also described a blood smear of a woman with an androgen-producing tumor of the adrenal gland, where 24% of the neutrophils had 1 or more “C” nuclear projections. After the removal of the tumor, the incidence of form C decreased to 8% [10]. These observations prove that the increase in the number of nuclear C appendages might be a manifestation of a high androgen level in men, too.

All of these arguments suggest that the difference in A – C gives a positive value in females and a negative value in males. All subjects followed this rule, except for 2 men who were erroneously classified as females by cytology. One of them had no form C appendages and 7 form A appendages, and the other had 1 form C and 3 form A. These were designated as odd cases.

As was mentioned above, appendage counts fluctuate during menstrual cycle for form A and with androgen level for form C. The distribution histogram of A – C in women shows a multimodal histogram contrary to the men’s graph, which is a bell-shaped curve (Figure 3). This might be due to the overlapping of several groups of females during different phases of the menstrual cycle, whereas men constitute a single population. This notion must be confirmed with further investigations, such as repeating and comparing blood smears of some females in different phases of the menstrual cycle.

We would like to end our discussion with this mysterious and unanswered question: Why do some few neutrophils bear appendages while others do not?

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

56

References 1. Bain BJ. Blood Cells (A Practical Guide). 4th ed. London, UK, Blackwell Publishing, 2006.

2. Greer JP, Foerster J, Rodgers GM, Paraskevas F, Glader B, Arber DA, Means RT. Wintrobe’s Clinical Hematology. 12th ed. Philadelphia, PA, USA, Lippincott Williams & Wilkins, 2009.

3. Magliulo E, Crouch BG, De Vries MJ. The sex-linked drumstick appendage frequency as a marker for bone marrow transplantation in monkeys. Blood 1963;21:620-625.

4. Passarge E. Color Atlas of Genetics. 3rd ed. Stuttgart, Germany, Thieme, 2007.

5. Gonzalez CH, Mendes FT, Saldanha PH. Sex chromatin in normal newborns during the first two weeks of life: a blind study. Rev Brasil Genet 1978;4:263-278.

6. URL:http://www.physics.csbsju.edu/stats/t-test_bulk_ form.html 7. Davidson WM, Smith DR. A morphological sex difference in the polymorphonuclear neutrophil leucocytes. Brit Med J 1954;2:6.

8. Kosenow W, Scupin R. Geschlechtsbestimmung auf Grund morphologischer Leukocytenmerkmale. Klin Wochenschr 1956;34:51-53.

9. Briggs DK. The individuality of nuclear chromatin with particular reference to polymorphonuclear neutrophil leukocytes. Blood 1958;13:986-1000.

10. Méhes K. Brief note nuclear projections in neutrophils. Blood 1966;28:598-601.

11. Tomonaga M, Matsuura G, Watanabe B, Kamochi Y, Ozono N. Leukocyte drumsticks in chronic granulocytic leukemia and related disorders. Blood 1961;18:581-591.

12. Mukherjee AB, San Sebastian J. Letter to editor. Brit Med J 1975;1:207.

Turk J Hematol 2013;30:53-57

13. Mukherjee AB, Parsa NZ. Determination of sex chromosomal constitution and chromosomal origin of drumsticks, drumstick-like and other nuclear bodies in human blood cells at interphase by fluorescence in situ hybridization.

Chromosoma 1990;99:432-435.

14. Hochstenbach PF, Scheres JM, Hustinx TW, Wieringa B. Demonstration of x chromatin in drumstick-like nuclear appendages of leukocytes by in situ hybridization on blood smears. Histochemistry 1986;84:383-386.

15. Davidson WM. Inherited variations in leukocytes. Semin Haematol 1968;5:255-274.

Brahimi M, et al: Can Sex Be Determined from a Blood Smear?

16. Wondergem MJ, Ossenkoppele GJ. Genotyping by morphology… Blood 2011;117:2566.

17. Méhes K, Jobst K. Hormonkezelés hatasa a patkany neutrophil leukocytainak nemi chromatinformaira [Hormonotherapy effect on rat neutrophil leukocytes chromatin sex]. Morph 1g Orv Szle 1962;2:34.

18. Zsifkovits S, Méhes K, Jobst K. Effect of sexual maturation and castration on the sex chromatin pattern in the male rat. Nature 1959;184:1239.

57

Case Report

DOI: 10.4274/tjh.2011.0047

Central Nervous System Involvement of Epstein Barr Virus Associated Lymphoproliferative Disorder in a Child with Acute Lymphoblastic Leukemia: Successful Treatment with Rituximab and Interferon-Alpha Akut Lenfoblastik Lösemili bir Çocukta EBV İlişkili Lenfoproliferatif Hastalığın Santral Sinir Sistemi Tutulumu: Rituximab ve İnterferon Alfa ile Başarılı Tedavi Berna Atabay, Meral Türker, Can Öztürk, Sümer Sütçüoğlu, Haldun Öniz, Esra Arun Özer Tepecik Training and Research Hospital, Department of Pediatrics Clinic, İzmir, Turkey

Abstract: Central nervous system (CNS) involvement of Epstein-Barr virus (EBV)-associated lymphoproliferative disease is a rare and serious complication in children with leukemia. Although rituximab therapy seems to be promising in these cases, persistent hypogammaglobulinemia may appear after treatment due to complete depletion of normal B lymphocytes in the peripheral blood. Here we report isolated CNS involvement of EBV-associated lymphoproliferative disorder in a 4year-old boy with acute leukemia. The patient was treated with rituximab and interferon alpha; however, persistent hypogammaglobulinemia developed as a complication. Given the rarity of the complication in children receiving these agents, our experience with such a case may be helpful to others.

Keywords: Epstein-Barr virus, Lymphoproliferative disorder, Rituximab, Children, Leukemia

Özet: Santral sinir sisteminin EBV ilişkili lenfoproliferatif hastalığı nadir bir durum olup, çocukluk çağı lösemilerinin ciddi bir komplikasyonudur. Bu olgularda rituximab tedavisi faydalı olmakla birlikte, periferik kanda normal B lenfositlerinin tam kaybı sonucunda persistan hipogamaglobulinemi ortaya çıkabilmektedir. Burada akut lösemili 4 yaşında bir erkek çocukta, EBV ilişkili lenfoproliferatif hastalığın izole santral sinir sistemi tutulumu sunulmaktadır. Hasta rituximab ve alfa interferon ile tedavi edilmiş, ancak komplikasyon olarak persistan hipogamaglobulinemi gelişmiştir. Bu ilaçları kullanan çocuklarda nadir görülen bir komplikasyon olması nedeniyle, bu olgu ile elde ettiğimiz deneyimin diğerlerine yardımcı olacağını düşünmekteyiz.

Anahtar Sözcükler: Epstein-Barr virus, Lenfoproliferatif hastalık, Rituximab, Çocuk, Lösemi

Address for Correspondence: Esra ARUN ÖZER, M.D., Tepecik Training and Research Hospital, Department of Pediatrics Clinic, İzmir, Turkey Phone: +90 232 469 69 69 E-mail: eozer@deu.edu.tr Received/Geliş tarihi : December 21, 2011 Accepted/Kabul tarihi : May 21, 2012

58

Turk J Hematol 2013;30:58-62

Özer E, et al: EBV-Associated Lymphoproliferative Disorder

Introduction Epstein-Barr virus (EBV)-associated lymphoproliferative disorder (LPD) is a severe and fatal complication of patients with immune deficiency [1]. The clinical picture of EBV-associated LPD is quite variable, and isolated central nervous system (CNS) involvement is rare. There are scanty data in the literature concerning the management of this disorder. Rituximab is a monoclonal antibody against CD20-positive B cells and is widely used in EBV-related lymphomas and diseases [2].

Here we report isolated CNS involvement of EBV-associated LPD in a 4-year-old boy with acute leukemia. The patient was treated with rituximab; however, hypogammaglobulinemia developed as a complication. Given the rarity of the complication in children receiving this agent, our experience with such a case may be helpful to others.

Case Report A 4-year-old boy was referred to our hospital in February 2007 for the treatment of biphenotypic acute leukemia. There was no family history of immunodeficiency, fatal infectious mononucleosis, or lymphomas. At the time of diagnosis he had no blasts in the cerebrospinal fluid (CSF) examination. The bone marrow aspirate confirmed the diagnosis of biphenotypic acute leukemia. His initial diagnostic flow cytometry results were: CD45, 72.5%; CD34, 71.8%; CD19, 77.9%; CD10, 72.5%; CD22, 69.4%; CD7, 15.8%; CD33, 72.7%; CD13, 76.3%; CD3, 13.3%; CD2, 18.8%; CD15, 4.7%; CD117, 4.1%; MPO, 10.3%; TdT, 42.7%; CD10+CD19, 71.6%. Cytogenetic analysis of his bone marrow was normal. His serum immunoglobulin levels were: IgA, 83 mg/dL (normal value: 14-159 mg/dL); IgM, 161 mg/dL (normal value: 43-207 mg/dL); and IgG, 1150 mg/dL (normal value: 345-1236 mg/dL). Lymphocyte subsets were not calculated initially. EBV serology was positive for viral capsid antigen (VCA) IgG, negative for VCA IgM, and consistent with a prior EBV infection. The patient was enrolled in a BerlinFrankfurt-Munster–derived protocol [3]. Complete remission was attained after induction and was maintained with consolidation.

Maintenance therapy was initiated in October 2007, consisting of daily 6-mercaptopurine and weekly methotrexate administered orally on an outpatient basis. No cranial irradiation was administered. On the second month of maintenance therapy, the patient presented with a 3-day history of fever, malaise, and sore throat. Physical examination was unremarkable except for high fever (39 °C) and whitish tonsillar exudate. Maintenance therapy was ceased and systemic antibiotic therapy was administered. Three days after therapy, the patient was better and afebrile.

After 3 weeks, the patient presented with vomiting, diarrhea, and high fever (39 °C). Physical examination was normal. Laboratory tests showed hemoglobin of 9.4 g/dL, white blood cell count of 2 × 109/L with 43% segmented neutrophils, 3% bands (absolute neutrophil count of 860/μL), 4% eosinophils, 16% monocytes, and 34% lymphocytes. Blood biochemical profile and chest X-ray were normal. The child was admitted to the hospital for antibiotic therapy.

On the 10th day of hospitalization, he presented with left hemiparesis and central facial paresis. Brain magnetic resonance imaging (MRI) revealed 2 masses located in the periventricular area (Figure 1A). Bone marrow aspirate and CSF examination were not suggestive of a leukemic relapse. Thorax and abdomen computerized tomography (CT) were unremarkable. Serum EBV VCA IgM and IgG were positive, whereas anti-Epstein-Barr nuclear antigen IgM and p22 antigen were negative. Human immunodeficiency virus and cytomegalovirus serology were also negative. Serum immunoglobulin levels were normal. The stereotactic brain biopsy showed an atypical lymphoid infiltrate composed predominantly of CD79a-positive B cells involving brain parenchyma with a prominent perivascular distribution. The infiltrate was negative for CD10, CD34, TdT, MPO, CD117, and lysozyme. The biopsy was positive for EBV-encoded small nonpolyadenylated RNAs by in situ hybridization test. The patient was diagnosed with localized EBV-associated LPD and administered weekly anti-CD20 monoclonal antibody (rituximab, 375 mg/m2) for 4 weeks and alpha-interferon 3 times per week (3 × 106 units/m2) for 6 months due to the infiltration of CD20-positive B cells. The therapy was well tolerated and the patient’s neurologic condition did not show deterioration. After therapy serum immunoglobulin levels were low (IgG, 200 mg/dL; IgM, 8 mg/dL; and IgA, <6 mg/dL). The lymphocyte subset panel was normal (CD19, 12%; CD20, 18%; CD3, 76%; CD4, 28%; CD8, 4%; and CD16+56, 15%). The patient was administered monthly intravenous immunoglobulin at 0.5 g/kg to achieve at least 500 mg/dL IgG levels. After 2 months of therapy, the patient’s neurological signs had disappeared. Cranial MRI showed complete resolution of the masses (Figure 1B).

For the subsequent 3 years of follow-up, the patient received no chemotherapy. The disease is in remission but intravenous immunoglobulin therapy is still given every 4 or 6 weeks because of IgG deficiency.

Discussion EBV-associated LPD is an uncommon and often fatal complication of patients with inherited or acquired immune deficiency [4]. Its clinical presentation is marked by serologic

A

B

Figure 1: A) MRI of the brain showing 2 huge masses in the periventricular area. Mild brain edema was seen around the lesion. B) MRI showed complete resolution of the masses after treatment.

59

Turk J Hematol 2013;30:58-62

Özer E, et al: EBV-Associated Lymphoproliferative Disorder

evidence of active EBV proliferation, attributable either to a primary EBV infection or the reactivation of a latent infection.

There are 10 cases of EBV-associated LPD in children with acute leukemia previously reported [5,6,7,8,9,10,11,12]. Of those, 2 cases were presented with CNS involvement. The age at diagnosis of the cases ranged between 3 to 16, and 3 patients died. Most of the patients treated by Bernard et al. received supportive therapy, whereas only one patient was given rituximab [5]. Despite good response to the therapy, that patient died with relapsed leukemia after 6 months. Incidence of brain involvement is more common in cases with EBV besides acute lymphoblastic leukemia [13].

Different treatments for EBV-associated LPD have been proposed. Therapies have targets including the decrease of immunosuppression and improvement of immune function, or the removal of the lymphoproliferative lesion. Another strategy is to eliminate EBV-infected B cells with chemotherapy or antiviral drugs or with the infusion of polyclonal donor-derived T cells specific for EBV proteins in the bone marrow of transplant recipients [14]. Recently the use of monoclonal anti-B cell antibodies has been proposed because of the expression of these antigens on the surface of EBV-transformed B cells [5,15].

Our patient received rituximab because the infiltration consisted predominantly of CD20-positive B cells. His neurological signs disappeared and cranial MRI showed complete resolution of

the masses. Since rituximab targets normal B cells as well as neoplastic B cells, almost complete depletion of normal B lymphocytes in the peripheral blood is observed for an average of 6 to 9 months after starting the therapy [16,17,18]. However, hypogammaglobulinemia related to B cell depletion after rituximab treatment is not usually problematic and is not associated with any clinical morbidity. Recently a prolonged hypogammaglobulinemia was reported in some patients receiving the therapy as an adjuvant to autologous stem cell transplantation [19,20]. Additionally in most cases, the level of hypogammaglobulinemia is mild, although it sometimes persists for over 2 years. Irie et al. [21] reported a 60year-old woman diagnosed with follicular lymphoma who received rituximab therapy. She developed hypogammaglobulinemia persisting for 6 years. Nishio et al. [22] analyzed the phenotypes of B cells in patients receiving rituximab and showed that recovery of memory B cells was delayed and naive B cells failed to differentiate into memory cells or plasma cells upon stimulation with SAC, IL-2, IL-10, and CD40L in vitro. In addition, they reported that FC-gamma-RIII-alpha gene polymorphism was related to the immunoglobulin level. We think that the naive B cells of our patient also failed to differentiate into memory B cells or plasma cells.

Although the reason for B cell differentiation arrest is still unclear, there are 2 possible explanations for this phenomenon.

Table 1: Clinical data of the published cases with acute leukemia that had development of EBV-associated lymphoproliferative disorder.

Age

Sex

Involvement site

Treatment

Outcome

Reference

9 years

Male

Lymph node, liver, spleen

Prednisone, supportive therapy Exitus

Look AT, 1981 [14]

4.5 years

Male

Ileum, lung, tonsil, trachea, eyelid

Supportive therapy

Exitus

Hardy C, 1984 [1]

4 years

Female

Lung

Acyclovir

Recovered

Joncas JH, 1990 [15]

4 years

Male

Ileum, liver

Radiotherapy, surgery

Recovered

Joncas JH, 1990 [15]

3 years

Female

CNS

Chemotherapy, radiotherapy

Recovered

Rohrlich P, 1993 [16]

7 years

Male

Lung

Steroid, chemotherapy, alpha-INF

Recovered

Perkkiö M, 1997 [17]

6 years

Male

Liver, spleen, kidney, lung

IFN, IVIG, acyclovir

Recovered

Mustafa MM, 1997 [18]

15 years

Female

Ileum, liver, spleen, kidney

Rituximab

Recovered, but 6 months later died of relapsed leukemia

Bernard F, 2000 [4]

16 years

Male

Ileum, liver

IVIG, acyclovir

Recovered

Pondarre C, 2000 [19]

6 years

Male

Lymph node, CNS, liver

IVIG, acyclovir, surgery

Recovered

Drury S, 2000 [20]

CNS: central nervous system, IFN: interferon, IVIG: intravenous immunoglobulin.

60

Turk J Hematol 2013;30:58-62

Özer E, et al: EBV-Associated Lymphoproliferative Disorder

First, genetic aberration of a factor essential for immunoglobulin rearrangement may have occurred in lymphoid progenitor cells after combination chemotherapy. Second, rituximab combined chemotherapy may be associated with a risk of persistent differentiation arrest and apoptosis of B cell lineage in patients with a specific genetic background [21]. Since our patient was also treated with alpha-interferon and chemotherapy, those might have contributed to hypogammaglobulinemia. Because interferon is widely used for decreasing immunosuppression and improving immune function, it is also speculated that alphainterferon may have contributed to remission of leukemia in this case [23].

X-linked lymphoproliferative disease is a rare immunodeficiency disease that is characterized by a prediction for fatal or near-fatal EBVinduced infectious mononucleosis in childhood, subsequent hypogammaglobulinemia, and a markedly increased risk of lymphoma or other lymphoproliferative diseases [24]. A definitive diagnosis of X-linked lymphoproliferative disease is with mutation analysis for the SH2D1A and XIAP genes mutation. However we did not exclude the diagnosis of X-linked lymphoproliferative disease because the mutation analysis could not be performed in our case.

In conclusion, EBV-associated LPD in leukemia is a serious complication and extremely rare clinical entity. The present case was treated successfully with rituximab and alpha-interferon. Although rituximab therapy seems to be promising in these cases, persistent hypogammaglobulinemia may appear after treatment. Physicians treating this disease with rituximab should be aware of this rare potential complication. The chemotherapy and alpha-interferon treatment may contribute to hypogammaglobulinemia. In addition, further studies are needed to elucidate the pathogenesis of hypogammaglobulinemia after rituximab administration.

References 1. Hardy C, Feusner J, Harada S, Sanger W, Von Schmidt B, Yetz J, Saemundsen A, Lennette E, Linder J, Seeley JK, et al. Fatal Epstein-Barr virus-induced lymphoproliferation complicating acute lymphoblastic leukemia. J Pediatr 1984;105:64-67.

2. Taj MM, Hadzic N, Height SE, Wotherspoon A, Burke M, Hobson R, Viskaduraki M, Pinkerton CR. Long term outcome for immune suppression and immune related lymphoproliferative disorder: Prospective data from the UK CCLG Registry 1994-2004. Leuk Lymphoma 2012;53:842-848.

3. Yuksel-Soycan L, Aydogan G, Tanyeli A, Timur C, Erbay A, Oniz H, Patiroglu T, Yesilipek A, Soker M, Vural S, Pekun F, Bor O, Sarper N, Cetingul N, Guler E, Polat A, Biner B, Caglar K, Goksan B, Gedikoglu G. BFM-TR ALL 2000: First Turkish multicentric study in the treatment of pediatric acute lymphoblastic leukemia. Pediatr Blood Cancer 2006;47:426-427.

4. Rezk SA, Weiss LM. Epstein-Barr virus-associated lymphoproliferative disorders. Hum Pathol 2007;38:12931304.

5. Bernard F, Sarran N, Margueritte G, Barneon G, Astruc J. Successful treatment of an Epstein-Barr virus-associated B-cell lymphoproliferative disease in a child with acute lymphoblastic leukemia using an anti-CD20 monoclonal antibody. Med Pediatr Oncol 2001;36:329-331.

6. Look AT, Naegele RF, Callihan T, Herrod HG, Henle W. Fatal Epstein-Barr virus infection in a child with acute lymphoblastic leukemia in remission. Cancer Res 1981;41:4280-4283.

7. Joncas JH, Russo P, Brochu P, Simard P, Brisebois J, Dube J, Marton D, Leclerc JM, Hume H, Rivard GE. Epstein-Barr virus polymorphic B-cell lymphoma associated with leukemia and with congenital immunodeficiencies. J Clin Oncol 1990;8:378-384.

8. Rohrlich P, Lescoeur B, Rahimy C, Vilmer E, Brousse N, Foulon E. Epstein-Barr virus associated B-cell lymphoproliferation in an infant treated for acute lymphoblastic leukemia. Blood 1993;81:264.

9. Perkkiö M, Riikonen P, Seuri R, Vornanen M. Successful treatment of monoclonal, aggressive Epstein-Barr virusassociated B-cell lymphoproliferative disorder in a child with acute lymphoblastic leukemia. Med Pediatr Oncol 1999;32:447-449.

10. Mustafa MM, Winick NJ, Margraf LR. Epstein-Barr virus lymphoproliferative disorder in children with leukemia: case report and review of the literature. J Pediatr Hematol Oncol 1997;19:77-81.

11. Pondarre C, Kebaili K, Dijoud F, Basset T, Philippe N, Bertrand Y. Epstein-Barr virus-related lymphoproliferative disease complicating childhood acute lymphoblastic leukemia: no recurrence after unrelated donor bone marrow transplantation. Bone Marrow Transplant 2001;27:93-95.

12. Drury S, Sathiapalan R, Warrier RP. Central nervous system involvement of Epstein-Barr virus lymphoproliferative disease in a patient with acute lymphocytic leukemia. J Pediatr Hematol Oncol 2000;22:167-170.

13. Carbone A, Gloghini A, Dotti G. EBV-associated lymphoproliferative disorders: classification and treatment.

Oncologist 2008;13:577-585.

14. Rooney CM, Smith CA, Ng CY, Loftin SK, Sixbey JW, Gan Y, Srivastava DK, Bowman LC, Krance RA, Brenner MK, Heslop HE. Infusion of cytotoxic cells for the prevention and treatment of Epstein-Barr virus-induced lymphoma in allogeneic transplant recipients. Blood 1998;92:1549-1555.

15. Benkerrou M, Jais JP, Leblond V, Durandy A, Sutton L, Bordigoni P, Garnier JL, Le Bidois J, Le Deist F, Blanche S, Fischer A. Anti-B-cell monoclonal antibody treatment of severe posttransplant B-lymphoproliferative disorder: prognostic factors and long-term outcome. Blood 1998;92:3137-3147.

16. Quartier P, Brethon B, Philippet P, Landman-Parker J, Le Deist F, Fischer A. Treatment of childhood autoimmune haemolytic anemia with rituximab. Lancet 2001;358:1511-1513.

61

Özer E, et al: EBV-Associated Lymphoproliferative Disorder

17. Verschuuren EA, Stevens SJ, van Imhoff GW, Middeldorp JM, de Boer C, Koeter G, The TH, van Der Bij W. Treatment of posttransplant lymphoproliferative disease with rituximab: the remission, the relapse and the complication. Transplantation 2002;73:100-104.

18. Shimoni A, Hardan I, Avigdor A, Yeshurun M, Raanani P, BenBassat I, Nagler A. Rituximab reduces relapse risk after allogeneic and autologous stem cell transplantation in patients with high-risk aggressive non-Hodgkin’s lymphoma. Br J Haematol 2003;122:457-464.

19. Shortt J, Spencer A. Adjuvant rituximab causes prolonged hypogammaglobulinemia following autologous stem cell transplant for non-Hodgkin’s lymphoma. Bone Marrow Transplant 2006;38:433-436.

20. Imashuku S, Teramura T, Morimoto A, Naya M, Kuroda H. Prolonged hypogammaglobulinemia following rituximab treatment for post transplant Epstein-Barr virus-associated lymphoproliferative disease. Bone Marrow Transplant 2004;33:129-130.

62

Turk J Hematol 2013;30:58-62

21. Irie E, Shirota Y, Suzuki C, Tajima Y, Ishizawa K, Kameoka J, Harigae H, Ishii T. Severe hypogammaglobulinemia persisting for 6 years after treatment with rituximab combined chemotherapy due to arrest of B lymphocyte differentiation together with alteration of T lymphocyte homeostasis. Int J Hematol 2010:91:501-508.

22. Nishio M, Fujimoto K, Yamamoto S, Endo T, Sakai T, Obara M, Kumano K, Minauchi K, Yamaguchi K, Takeda Y, Sato N, Koizumi K, Mukai M, Koike T. Hypogammaglobulinemia with a selective delayed recovery in memory B cells and an impaired isotype expression after rituximab administration as an adjuvant to autologous stem cell transplantation for nonHodgkin lymphoma. Eur J Haematol 2006;77:226-232.

23. Anguille S, Lion E, Willemen Y, Van Tendeloo VF, Berneman ZN, Smits EL. Interferon-α in acute myeloid leukemia: an old drug revisited. Leukemia 2011;25:739-748.

24. Chaganti S, Ma CS, Bell AI, Croom-Carter D, Hislop AD, Tangye SG, Rickinson AB. Epstein-Barr virus persistence in the absence of conventional memory B cells: IgM + IgD +CD27 + B cells harbor the virus in X-linked lymphoproliferative disease patients. Blood 2008;112:672-678.

DOI: 10.4274/tjh.2012.0021

Case Report

A Case of Nonimmune Hydrops Fetalis Caused by Homozygous α-Thalassemia Homozigot α-Talasemiye Bağlı Gelişen Bir Nonimmün Hidrops Fetalis Olgusu Melek Akar1, Dilek Dilli1, Uğur Dilmen1,2 1Zekai

Tahir Burak Maternity Teaching Hospital, Department of Neonatology, Ankara, Turkey Beyazıt University Faculty of Medicine and Director General of Health Research, Ministry of Health, Department of Pediatrics and Neonatology, Ankara, Turkey 2Yıldırım

Abstract: Hydrops fetalis is a serious condition which indicates poor prognosis for the affected fetus. Although the incidence of isoimmune hydrops fetalis has decreased markedly, nonimmune hydrops fetalis cases have been more frequently reported.

Nonimmune-mediated hydrops can be caused by hemoglobinopathies. In this report we present a case of nonimmune hydrops fetalis caused by homozygous α-thalassemia. Because of the high incidence of the disease in our country, αthalassemia should be investigated in all cases with nonimmune hydrops fetalis.

Keywords: α-Thalassemia, Hydrops fetalis, Nonimmune

Özet: Hidrops fetalis, etkilenen fetüste kötü prognoza işaret eden ciddi bir durumdur. İzoimmün hidrops fetalis görülme sıklığı belirgin olarak azalmakla birlikte, giderek daha fazla sayıda nonimmün hidrops fetalis olgusu rapor edilmektedir.

Hemoglobinopatiler nonimmün aracılı hidropsa neden olabilir. Bu makalede, homozigot α-talasemiye bağlı gelişen bir nonimmün hidrops fetalis olgusu sunuldu. Ülkemizde insidansın yüksek olması nedeniyle nonimmünhidrops fetalisli tüm olgularda α-talasemi araştırılmalıdır.

Anahtar Sözcükler: α-talasemi, Hidrops fetalis, Nonimmün

Introduction Hydrops fetalis is a serious condition that indicates poor prognosis for the affected fetus [1]. Its etiologies include cardiovascular abnormalities, placental malformations/problems, hematologic problems, congenital infections, noncardiac congenital

anomalies, chromosomal aberrations, genetic syndromes, and miscellaneous causes. Isoimmune-or nonimmune-mediated mechanisms play a role in hematologic problems. Today, the incidence of isoimmune hydrops fetalis has decreased markedly.

However, nonimmune hydrops fetalis cases have been more frequently reported. Nonimmune-mediated hydrops can be

Address for Correspondence: Dilek DİLLİ, M.D., Zekai Tahir Burak Maternity Teaching Hospital, Department of Neonatology, Ankara, Turkey E-mail: dilekdilli2@yahoo.com Received/Geliş tarihi : March 22, 2012 Accepted/Kabul tarihi : May 28, 2012

63

Akar M, et al: α-Thalassemia and Nonimmune Hydrops Fetalis

caused by hemoglobinopathies [2]. In this report we present a case of nonimmune hydrops fetalis caused by homozygous α-thalassemia.

Case Report A 26-year-old gravida 3, para 1, abortus 2 woman was referred to the hospital at the 20th week of gestation because of hydrops fetalis.

The mother and the father were first cousins. Ultrasound scan confirmed the presence of fetal ascites, generalized skin edema, and thickened placenta. After that, both the mother and the father were suspected to be thalassemia carriers with hematological parameters.

The mother was noted to be anemic with a hemoglobin level of 105 g/L, hematocrit of 35.1%, and red blood cell indices including a mean corpuscular volume (MCV) of 73.2 fL, mean corpuscular hemoglobin (MCH) of 22.7 pg, mean corpuscular hemoglobin concentration (MCHC) of 311 g/L, and red cell distribution width (RDW) of 14.4%. The red blood cell morphology was notable for microcytic hypochromia. No further hematologic evaluation was performed on the parents at this time.

Although termination of pregnancy was offered, the couple decided to continue. During prenatal follow-up, no interventions, including fetal blood sampling or intrauterine transfusion, were performed. The woman went into preterm labor at 31 weeks of gestation. Emergency cesarean section was performed and a female baby weighing 1530 g was delivered.

The placenta was large and edematous. The baby required immediate intubation due to respiratory distress. On initial exam, the abdomen was markedly distended secondary to hepatosplenomegaly and ascites. There was generalized skin edema. Hypoplastic thorax and bilateral pes varus were noted.

Blood tests revealed a white blood count of 145 × 109/L, hemoglobin of 64 g/L, MCV of 97 fL, MCH of 25.5 pg, MCHC of 263 g/L, platelets of 276 × 109/L, reticulocyte count of 3%, total protein of 3.1 g/dL, and albumin of 1.6 g/dL (Table 1).

There was no blood incompatibility with a negative direct antiglobulin test (Coombs test). The peripheral blood smear was notable for marked microcytosis, hypochromia, polychromasia, poikilocytosis, and anisocytosis with numerous erythroblasts.

Hemoglobin electrophoresis revealed a high quantity of Hb Bart’s (95.2%) (Figure 1). Cytogenetic evaluation showed a normal karyotype of 46, XX. The patient died shortly after birth in spite of appropriate supportive treatment including oxygen, mechanical ventilation, fluid and electrolyte therapy, and blood transfusion.

After the patient’s death, the mother, the father, and a 9-year old sister had further evaluation for thalassemia. Hematological data of the patient and the family are shown in Table 1. The mother, the father, and the sister had low MCV and MCH, but high RBC and RDW. All had normal iron status. Mutation analysis using strip assay capable of detecting 22 mutations within the alpha genes showed that the father was heterozygous for a 20.5 kb double-gene deletion. No gene deletions were detected in the mother. It was recommended that the parents seek genetic counseling before becoming pregnant again.

64

Turk J Hematol 2013;30:63-66

Discussion Alpha-thalassemia is a widespread genetic disorder throughout the world caused primarily by reduced synthesis of the α-globin chains, and it has been found at a high incidence in Turkey [3,4]. In 2007, Çürük et al. [3] reported the frequency of α-thalassemia to be 3% for the Çukurova region in the south of Turkey. Recently, in a single-center study, Guvenc et al. [4] evaluated 3000 individuals comprising premarital couples or patients with anemia living in Adana, a city in the Çukurova region. The authors found that the prevalence of α-thalassemia was higher (7.5%) in that region.

The α-globin gene is located on chromosome 16p13.3 and mutations or deletions affecting either one or more α-globin genes cause α-thalassemia syndromes. The most frequent mutations of αglobin genes are single-gene deletions, and the deletion or inactivation of only one α-globin gene usually results in mild hematological findings. The α-thalassemia trait is caused by the deletion or inactivation of 2 α-thalassemia globin genes (--/αα or α/-α). This results in mild microcytic, hypochromic anemia with normal or altered Hb A2 levels. If 3 of 4 α-globin genes become inactive, the affected individual has only 1 functional α-globin gene presenting with Hb H disease, which is characterized by severe anemia. In the Mediterranean area, widespread mutations are the α (3.7) and –α (4.2) single α-globin gene deletions and the --MED and –α (20.5) double-gene deletions. In a study by Guvenc et al.

[4], the most commonly detected mutations were –α (3.7), -α (4.2), --MED , --20.5 , α (PA-2 α), ααα (anti-3.7), and α (PA-1α). Their results showed that the α-thalassemia mutations represented a great heterogeneity and that the α (3.7) deletion had the highest frequency in Adana. We could not perform genetic analysis on the patient.

However, the father was heterozygous for a 20.5 kb double-gene deletion. No gene deletions were detected in the mother, although her hematological parameters were consistent with thalassemia. We thought that the mother might have an undetected rare mutation.

The parents were advised to obtain genetic counseling before becoming pregnant again.

Hydrops fetalis resulting from Hb Bart’s disease and molecular characterization of Hb H disease in Turkey have been reported [5]; however, the prevalence and distribution of deletional alphathalassemia, which is responsible for Hb Bart’s disease, is not known.

In homozygous α-thalassemia, deletion of both copies of each of the 2 α-globin genes on chromosome 16 occurs, and thus no α-globin

Figure 1: Hemoglobin electrophoresis of the patient showing high Hb Bart’s.

Akar M, et al: α-Thalassemia and Nonimmune Hydrops Fetalis

Turk J Hematol 2013;30:63-66

Table 1: Hematological data of the patient, parents, and sister.

Patient

Mother

Father

Sister

White blood cell (x109/L)

145

6.32

7.46

7.81

Red blood cell (x1012/L)

1.96

5.79

7.32

5.94

Platelet (x109/L)

276

293

265

389

Hemoglobin (g/L)

64

122

154

116

Hematocrit (%)

17.9

37.7

45.2

35.4

Mean corpuscular volume (fL)

97

65.1

61.7

59.6

Mean corpuscular hemoglobin (pg)

25.5

21.1

21.0

19.5

Mean corpuscular hemoglobin concentration (g/L)

263

324

341

328

Red cell distribution width (%)

16.1

16.2

17.6

16.0

Iron (µg/dL)

NA

105

164

85

Iron binding capacity (µg/dL)

NA

321

337

346

Ferritin (ng/mL)

NA

19.3

78.9

34

Hemoglobin Bart, (%)

95.2

-

-

-

Hemoglobin F, (%)

4.8

0.98

1.18

0.93

Hemoglobin A, (%)

-

96.22

95.02

95.13

Hemoglobin A2, (%)

-

2.80

3.80

3.94

Whole Blood Count

Serum iron status

Hemoglobin electrophoresis

is produced. By 8 weeks of gestation, a switch to fetal hemoglobin production (hemoglobin F α2/γ2) occurs. Since α-globin chains are absent, hemoglobin F cannot be synthesized and hemoglobin Bart’s becomes the dominant hemoglobin. This results in a progressive severe anemia and tissue hypoxia. There is severe ineffective erythropoiesis with marked extramedullary hematopoiesis. All of these factors result in massive organomegaly, severe albuminemia, and heart failure leading to gross body edema, growth failure, and intrauterine demise [6,7]. Our patient presented with hydrops fetalis characterized by anemia, cardiac insufficiency, hepatosplenomegaly, and generalized edema. She was diagnosed with homozygous αthalassemia with a high Hb Bart’s level detected at birth.

Developmental abnormalities are commonly seen in hydrops fetalis. It is likely that fetal hypoxia disturbs organogenesis and fetal development. In one series, 17% of affected newborns were found to have congenital anomalies. They included hydrocephaly and microcephaly, as well as cardiopulmonary, skeletal, and genitourinary malformations.

Hypoplasia of lungs, thymus, adrenals, and kidneys has been observed [8]. Hypoplastic thorax and bilateral pes varus were observed in the reported patient.

There is an increased incidence of serious maternal morbidity in these pregnancies, such as preeclampsia, dystocia, postpartum hemorrhage due to large placenta, and the psychological burden of carrying a nonviable fetus to term. It was estimated that half of these women died from complications resulting from these pregnancies [9]. No complications associated with hydrops fetalis developed in the mother of our patient, except premature labor.

Fetuses with homozygous α-thalassemia usually die in utero.

Even if born alive, the prognosis is extremely poor, as almost all of them die within a few hours of birth. Therefore, any attempt at treatment should be started in utero [8]. The most ideal approach would be in utero stem cell transplantation before fetal immunological maturation [10]. However, this modality of treatment is still in the experimental stage. The alternative method is repeated in utero transfusion to prevent the complications of anemia, followed by postnatal transfusion while waiting for a suitable donor for bone marrow transplantation [11,12].

Unfortunately, no interventions could be performed in utero in the presented patient. She died shortly after birth despite supportive treatment.

65

Akar M, et al: α-Thalassemia and Nonimmune Hydrops Fetalis

Alpha-thalassemia is usually inherited in an autosomal recessive manner. The couples who have an offspring with Hb Bart’s disease represent the at-risk couples who are carriers of deletional alpha-thalassemia. Therefore, each child has a 25% chance of having Hb Bart’s disease. Prenatal testing may be carried out for couples who are at high risk of having a fetus with Hb Bart’s syndrome, or for a pregnancy in which one parent is a known α-thalassemia carrier and it is unknown whether the other parent has the mutation. In practice, any person found to have low erythrocyte MCV without iron deficiency should be considered a carrier of either α- or β-thalassemia mutation.

Hemoglobin electrophoresis and HbA2 levels are often used as part of the laboratory investigations to diagnose thalassemia carriers. If the HbA2 level is elevated, the individual is considered to be a carrier of β-thalassemia mutation. If the HbA2 level is normal or low, the person is considered to be a carrier of αthalassemia mutation. However, among people with microcytosis and high HbA2 levels, some are carriers of both α- and βthalassemia mutations. Red cell indices of both parents and the sister showed microcytosis and hypochromia despite the lack of iron deficiency. HbA2 levels were higher than 3.5 in the father and the sister. Therefore, we thought that they might be carriers of both α-thalassemia and β-thalassemia.

Recent studies have suggested that an immunocytological assay or a polymerase chain reaction-based DNA diagnostic technique can serve as alternative screening procedures. When parents have the αthalassemia trait, DNA analysis of the fetus is required. Fetal tissue obtained by chorionic villus sampling early in the first trimester is indicated. Prenatal diagnosis for hydrops fetalis can also be conducted using fetal blood obtained by cordocentesis or amniocentesis [13]. From Turkey, Gurgey et al. were the first to report α-thalassemia-related hydrops fetalis in a fetus [14].

In our case, the parents were unaware of their carrier status for thalassemia until hydrops fetalis was diagnosed at the 20th week of gestation. It was too difficult for the parents or the obstetrician to decide on termination of the pregnancy at that time. The mother’s hematological values were consistent with those of an α-thalassemia carrier. The patient’s hemoglobin electrophoresis revealed a high quantity of Hb Bart’s (95.2%). We want to emphasize that with carrier detection, timely genetic counseling, and the availability of prenatal diagnosis during early pregnancy, many couples at risk will be spared serious medical and psychological difficulties. We also indicate the importance of considering α-thalassemia in couples for whom red cell indices show microcytosis and hypochromia despite a lack of iron deficiency.

Because of the high incidence of the disease in our country [15,16], α-thalassemia should be investigated in all cases with nonimmune hydrops fetalis.

Written consent was received from the parents.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

66

Turk J Hematol 2013;30:63-66

References 1. Randenberg AL. Nonimmune hydrops fetalis part I: etiology and pathophysiology. Neonatal Netw 2010;29:281-295.

2. Joshi DD, Nickerson HJ, McManus MJ. Hydrops fetalis caused by homozygous alpha thalassemia and Rh antigen alloimmunization: report of a survivor and literature review.

Clin Med Res 2004;4:228-232.

3. Çürük MA, Genç A, Huseynova P, Zeren F, Aksoy A. Genotypes of alpha-thalassemia and HbH disease in Çukurova. Turkiye Klinikleri J Pediatr Sci 2007;3:17-23.

4. Guvenc B, Yildiz SM, Tekinturhan F, Dincer S, Akyuzluer I, Okten S, Erkman H. Molecular characterization of alphathalassemia in Adana, Turkey: a single center study. Acta Haematol 2010;123:197-200.

5. Oner C, Gürgey A, Oner R, Balkan H, Gümrük F, Baysal E, Altay C. The molecular basis of Hb H disease in Turkey.

Hemoglobin 1997;21:41-51.

6. Muncie HL Jr, Campbell J. Alpha and beta thalassemia. Am Fam Physician 2009;80:339-344.

7. Vishinsky EP. Alpha thalassemia major--new mutations, intrauterine management, and outcomes. Hematology Am Soc Hematol Educ Program 2009:35-41.

8. Chui DH, Waye JS. Hydrops fetalis caused by alphathalassemia: an emerging health care problem. Blood 1998;91:2213-2222.

9. Tongsong T, Wanapirak C, Sirivatanapa P, Sa-nguansermsri T, Sirichotiyakul S, Piyamongkol W, Chanprapaph P, Steger HF, Sekararithi R, Tuggapichitti A. Prenatal eradication of Hb Bart’s hydrops fetalis. J Reprod Med 2001;46:18-22.

10. Fung TY, Lau TK, Tam H, Li CK. In utero exchange transfusion in homozygous alpha-thalassaemia: a case report.

Prenat Diagn 1998;18:838-841.

11. Jones DR, Bui TH, Anderson EM, Ek S, Liu D, Ringdén O, Westgren M. In-utero haematopoietic stem cell transplantation: current perspectives and future potential.

Bone Marrow Transplant 1996;18:831-837.

12. Carr S, Rubin L, Dixon D, Star J, Dailey J. Intrauterine therapy for homozygous alpha-thalassemia. Obstet Gynecol 1995;85:876-879.

13. Rubin LP. Alpha-thalassemia major: antenatal diagnosis and management. Med Health R I 2001;84:152-155.

14. Gurgey A, Altay C, Beksaç MS, Bhattacharya R, Kutlar F, Huisman TH. Hydrops fetalis due to homozygosity for alphathalassemia-1, -(alpha)-20.5 kb: the first observation in a Turkish family. Acta Haematol 1989;81:169-171.

15. Fei YJ, Kutlar F, Harris HF 2nd, Wilson MM, Milana A, Sciacca P, Schiliro G, Masala B, Manca L, Altay C, Gurgey A, Pablos J Ma. de, Villegas A, Huisman THJ. A search for anomalies in the zeta, alpha, beta, and gamma globin gene arrangements in normal black, Italian, Turkish, and Spanish newborns.

Hemoglobin. 1989;13:45-65.

16. Ozsoylu S, Malik SA. Incidence of alpha-thalassemia in Turkey. Turk J Pediatr 1982;24:235-244.

Case Report

DOI: 10.4274/tjh.53215

Human Immunodeficiency Virus (HIV)-Negative and Human Herpes Virus-8 (HHV-8)-Positive Primary Effusion Lymphoma: A Case Report and Review of the Literature İnsan Bağışıklık Yetmezlik Virüsü (HIV) Negatif Human Herpes Virus-8 (HHV- 8) Pozitif Primer Efüzyon Lenfoma Olgusu ve Literatür Derlemesi Sonay Güven Karataş1, Reyhan Bayrak2, Özlem Şahin Balçık3, Kadir Serkan Yalçın1, Esra Atıcı1, Ümit Akyıldız1, Ali Koşar3 1Turgut

Özal University, School of Medicine, Department of Internal Medicine, Ankara, Turkey Özal University, School of Medicine, Department of Pathology, Ankara, Turkey 3Turgut Özal University, School of Medicine, Department of Hematology, Ankara, Turkey 2Turgut

Abstract: Primary effusion lymphoma (PEL) is a rare type of non-Hodgkin lymphoma that presents with serosal effusion in body cavities, without obvious tumor masses. Although PEL occurs in immunocompromised patients that are human immunodeficiency virus (HIV) positive, it also occurs in immunocompetent human herpes virus-8 (HHV-8)-positive patients. Herein we present an immunocompetent, HIV-negative, CD-20-negative, HHV-8-positive patient with pleural effusion that was diagnosed as PEL. The CHOP protocol and talc pleurodesis were administered. HHV-8 plays a causative role in PEL and is important for differentiating PEL from other types of lymphoma. As such, in addition to pleurodesis antiviral treatment should be considered for optimal treatment outcome.

Keywords: Differential diagnosis, Human herpes virus-8, Human immunodeficiency virus (HIV), Pleural effusion, Primary effusion lymphoma

Özet: Primer efüzyon lenfoması (PEL) vücut boşluklarındaki seröz zarlarda tümör kitlesi olmaksızın, sadece serozal effüzyonla karakterize, nadir görülen bir hodgkin dışı lenfomadır. PEL immünsupresif ve özellikle HIV pozitif olgularda görülmekle birlikte Human herpes virus-8 (HHV-8) pozitif immün sistemi sağlam olgularda da tespit edilmektedir. Bu olguda immünkompetan, HIV negatif, plevral effüzyonu olan HHV-8 pozitif, primer effüzyon lenfomalı erkek hasta sunulacaktır.

HHV-8 pozitif CD-20 negatif PEL olgumuzda tedavide CHOP protokolü ve talk plörodezis uygulandı. HHV-8 pozitifliği PEL tanı ve ayırıcı tanısında önemli role sahiptir. Bu yüzden, PEL tedavisinde plörodezise ek olarak antiviral tedavinin uygulanmasıyla başarılı sonuçlar elde edilebileceği düşünülmektedir.

Anahtar Sözcükler: Ayırıcı tanı, Human herpes virüs-8, Human immunodeficiency virus (HIV), Plevral efüzyon, Primer Efüzyon Lenfoması

Address for Correspondence: Sonay GÜVEN KARATAŞ, M.D., Turgut Özal University, School of Medicine, Department of Internal Medicine, Ankara, Turkey Phone: +90 312 287 41 64 E-mail: sonayguven@hotmail.com Received/Geliş tarihi : March 31, 2011 Accepted/Kabul tarihi : Feburary 21, 2012

67

Turk J Hematol 2013;30:67-71

Güven S, et al: HHV-8-Positive Primary Effusion Lymphoma

Introduction Primary effusion lymphoma (PEL) is a rare type of nonHodgkin lymphoma that presents with pleural, pericardial, or peritoneal serosal effusion in body cavities, without detectable tumor masses or lymphadenopathies. PEL usually occurs in 1 body cavity; however, some cases involving more than 1 cavity have been reported [1]. PEL primarily affects human immunodeficiency virus (HIV)-positive patients and immunocompromised patients with malignancy, cirrhosis, or solid organ transplantation; it rarely occurs in immunocompetent patients. Immunocompetent patients diagnosed as PEL are usually more than 60 years old, infected with human herpes virus-8 (HHV-8), and in some cases infected with Epstein Barr virus (EBV) [1,2,3,4,5,6]. PEL is considered a non-Hodgkin lymphoma (NHL) associated with HHV-8, HIV, and EBV [6]. Herein we present an HIV-negative, EBV-negative, HHV-8-positive immunocompetent male patient with PEL. Flow cytometry was not performed in our hospital because we do not have enough medical equipment for this technic.

Case Report Clinical Summary A 72-year-old male was admitted to hospital due to a 4-week history of anorexia, fatigue, shortness of breath, and nonproductive cough. He has had hyperlipidemia and type-2 diabetes mellitus for 20 years, and underwent coronary artery bypass grafting surgery in 1990. Breath sounds were absent on the left side. Laboratory findings are shown in the Table. Chest X-ray and chest computed tomography (CT) showed a massive, left-sided pleural effusion (Figure 1). Peripheral lymphadenopathy (LAP)

Figure 1: Chest X-ray and chest CT show a massive, left-sided pleural effusion.

68

and organomegaly were not observed. Bone marrow biopsy was not performed because the patient did not want the procedure.

Positron emission tomography-computed tomography (PET-CT) showed that there was no signicifiant findings. Echocardiography showed 40% ejection fractions, but no pericardial effusion. Due to the pleural effusion thoracentesis (continuous drainage of the left-sided pleural effusion) and talc pleurodesis were performed.

The pleural fluid was hemorrhagic and biochemical examination showed that it was exudate (lactate dehydrogenase [LDH]: 2386 U/L; albumin: 2.6 g/dL). Cytomorphological and immunocytochemical analysis of the pleural fluid showed high grade malignant lymphoma and the patient was diagnosed as HHV-8-positive PEL (Figure 2A-E).

The CHOP chemotherapy protocol (cyclophosphamide 750 mg/m2, adriamycin 50 mg/m2, and vincristine 1.4 mg/m2 on d 1, and prednisolone 100 mg on d 1-5; the cycle is repeated every 21 d) was initiated 1 month post diagnosis. After the first cycle cerebral vascular insufficiency was observed and therefore the protocol was discontinued. During follow-up the patient’s pleural effusion did not recur, but progressive abdominal swelling was observed 4 months post diagnosis. Abdominal ultrasonography showed significant ascites and chest X-ray showed the absence of pleural effusion. Paracentesis was performed because of the ascites. Cytomorphological and immunocytochemical analysis of the ascites showed similar findings as for the pleural fluid. HHV8-positive PEL was observed in ascites as well (Figure 2F). 2 months after paracentesis the patient returned to the hospital with recurrent ascites and paracentesis was performed again. Rightsided pleural effusion was observed 3 months after the last paracentesis. Thoracentesis and talc pleurodesis were performed

a

b

c

d

e

f

Figure 2A-F: Cytomorphology and immunophenotype of the PEL cells. Large, atypical lymphoid cells exhibit rounded nuclei, coarsely granular chromatin, and a moderate amount of cytoplasm.

Apoptotic bodies and necrotic debris are seen throughout the smears. Many of the smudged, small nuclei represent pyknosis (individual cell necrosis-not small lymphocytes (H&E, 1000×) (A-F a.

Mitotic figures were abundant (A). Expression of CD30 (B), CD138 (C), epithelial membrane antigen (EMA) (D), and HHV-8 (E) in tumor cells (immunoperoxidase, 1000×). Cytomorphology of the PEL cells in the smears of ascites specimen (F).

Turk J Hematol 2013;30:67-71

Güven S, et al: HHV-8-Positive Primary Effusion Lymphoma

Table 1: Laboratory findings.

Hematology

Blood Chemistry

Serology

RBC count: 4.51 × 1012/L

TP: 6.9 g/dL

Hbs Ag (–)

Hb: 12.5 g/dL

ALB: 3.1 g/dL

HCVAb (–)

WBC count: 7.2x109/L

T-bil: 0.5 mg/dL

HIV Ab (–)

Neutrophils: 70.4%

AST: 18 IU/L

Lymphocytes: 18.6%

ALP: 205 IU/L

Tumor Markers

Monocytes: 7.5%

γ-GGT: 308 IU/L

Ca-125: 64.5 U/m

Eosinophils: 0.9%

LDH: 120 IU/L

Basophils: 2.6%

BUN: 41 mg/dL

PLT count: 295 × 109/L

Cr: 1.0 mg/dL

Eritrocyte sedimentation rate (ESR) : 42 mm/h

due to pleural effusion. The right-sided pleural fluid showed similar findings as that for the left-sided pleural fluid examined earlier. The patient was still alive 29 months after diagnosis.

Cytomorphological and Immunocytochemical Analysis Figure 2A-F shows the cytomorphology and immunophenotype of the PEL cells. Smears or cytospins were prepared from the pleural fluid and ascites specimens, and were stained with hematoxylin and eosin (H&E), Giemsa, and Papanicolaou (Pap) methods. Cell blocks were fixed in 4% buffered formaldehyde and stained with H&E. Immunophenotypic profiles were determined according to standard immunoperoxidase methods, using paraffin sections from the cell block. The primary antibodies used for immunocytochemistry were as follows: CD2 (clone AB75, NeoMarkers); CD3 (clone SP7, NeoMarkers); CD4 (clone 4B12, DAKO); CD5 (clone CD5/54/F6, DAKO); CD7 (clone 272, NeoMarkers); CD8 (clone C8/144B, DAKO); CD19 (clone LE-CD19, DAKO); CD20 (clone L26, NeoMarkers); CD30 (clone Ber-H2, DAKO); CD43 (clone DF-T1, NeoMarkers); CD45 (Clone 2B11 + PD7/26, DAKO); CD138 (clone M115, DAKO); ALK-1 (clone ALK01, NeoMarkers); EMA (clone E29, DAKO); EBV/LMP (clone CS. 1-4, NeoMarkers); HHV-8/LANA (clone 13B10, Novacastra). Tumor cells did not express CD2, CD3, CD4, CD5, CD7, CD8, CD19, CD20, CD45, anaplastic lymphoma kinase (ALK), or EBV/LMP. Discussion PEL is characterized by proliferation of malignant lymphocytes in the major body cavities (without detectable solid masses), large-cell, immunoblastic, plasmablastic, or anaplastic cytomorphology, B-cell lymphoma that often has an indeterminate immunophenotype based on non-molecular methods, malignancy that usually develops in immunocompromised patients (especially those that are HIV-positive), and the universal presence of HHV-8 [7].

CRP: 4.0 mg/dL

Although PEL is B-cell clonal in origin, it exhibits a non-B, non-T null phenotype. The neoplastic cells in PEL lack surface expression of B-cell markers, such as CD19, CD20, CD79a, and immunoglobulin, they express plasma cell-related markers, such as CD30, CD38, CD45, and CD138, but they also exhibit clonal rearrangement and somatic hypermutation of immunoglobulin genes, suggesting that they originate from post-germinal center B-cells [1,5,6,7]. Cytologically, PEL is a large cell lymphoma with both morphologic features of immunoblastic and anaplastic large cell lymphomas; therefore, cytomorphological differentiation of PEL from other lymphomas involving the body cavities may be difficult. The major differential diagnoses include anaplastic large cell lymphoma (ALCL), diffuse large B-cell lymphoma (DLBCL), Burkitt’s lymphoma, and pyothorax-associated lymphoma (PAL).

ALCL is a T-cell/null-cell lymphoma that typically involves lymph nodes or extra nodal sites, such as skin, soft tissue, and bone. ALCL presenting with pleural effusion has rarely been reported [8]. Also ALCL and PEL may overlap, both morphologically and immunophenotypically. The distinction between these 2 entities is important because ALCL has a much better prognosis. Morphologically, they are both high-grade lymphomas composed of large cells with pleomorphic nuclei and prominent, single-to-multiple nucleoli. Immunohistochemically, both entities usually stain positively for CD45, CD30, and EMA. Unlike PEL, ALCL usually expresses some T-cell markers and ALK-1; however, rare PEL cases express T-cell markers [9,10]. In addition, approximately 20%-40% of adult ALCL patients are negative for ALK-1 [11]; therefore, the importance of testing for the presence of HHV-8 in lymphoma cells cannot be overemphasized, because its detection is regarded as a sine qua non for the diagnosis of PEL, in contrast to ALCL. Burkitt’s lymphoma may present as a serous effusion, but is usually differentiated from PEL by its distinct morphologic features (i.e.

69

Turk J Hematol 2013;30:67-71

Güven S, et al: HHV-8-Positive Primary Effusion Lymphoma

medium-sized cells with round nuclei, prominent nucleoli, and basophilic vacuolated cytoplasm). Immunophenotyping usually shows a B-cell lineage in Burkitt’s lymphoma, as compared to the null-phenotype of PEL. Positive staining for CD10, Bcl-6, and cmy, and the absence of HHV-8 are also helpful findings in Burkitt’s lymphoma. DLBCL, including the immunoblastic variant, also overlaps with PEL. Although very rare cases of primary body cavity DLBCL have been reported [12], the majority of cases are associated with contiguous or disseminated disease at presentation. The immunophenotype and HHV-8 positivity are helpful in distinguishing these 2 entities, because DLBCL is HHV8-negative and expresses B-cell surface markers.

after pleurodesis should be considered for improving survival. In the present case talc pleurodesis for pleural effusion was also performed and after this treatment any pleural effusion was not repeated on the same side.

PAL is a pleural, EBV-associated NHL that develops following longstanding chronic pleural inflammation. It is not associated with systemic immunodeficiency, but is linked to local immunosuppression and chronic stimulation, inducing clonal proliferation of cells latently infected with EBV [13]. Unlike PEL, extensive local solid masses are also observed in PAL. Cytologically, PAL may be indistinguishable from PEL; as such, immunophenotyping and HHV-8 testing are essential for the differential diagnosis. PAL patients are HHV-8-negative and express B-cell markers. Furthermore, EBV detection, although important in the diagnosis of PAL also it could be seen in PEL, because of this reason the detection of EBV is not specific disorder for PAL [14].

1. Brimo F, Popradi G, Michel RP, Auger M. Primary Effusion Lymphoma involving Three Body Cavities. Cytojournal 2009;6:21.

PEL usually occurs in HIV-positive patients. HIV-negative PEL patients are in a immunodeficient state because of advanced age or some other conditions, including solid organ transplantation, cirrhosis, and malignancy [1,2,3,4,5,6,15]. The presented patient did not have any underlying immunodeficiency conditions, except for advanced age. A search for all series and case reports of HIV-negative and HHV-8-positive PEL cases published in the English-language literature as late as June 2011 was conducted.

A review of the literature by Yiakoumis et al. reported only 20 HIV-negative PEL cases, as well as 2 PEL cases that were HIVnegative and HHV-8-positive. %83,6 of the patients were male and the mean age of all patients was 62 years. Some of the patients had associated Kaposi sarcoma (KS) or multicentric Castleman’s disease (MCD) [15]. The CHOP and modified CHOP protocols were administered to 11of the patients; only 4 of these patients survived more than 1 year [16]. In addition to these cases, we found reports on another 6 HIV-negative PEL cases [1,15,17].

CHOP combination chemotherapy regimens are most commonly used as first-line therapy for PEL, which usually result in survival of only a few months-prognosis is very poor. In a retrospective study median survival was 6.2 months and the 1year overall survival rate was 39.3% [18]. HAART (highly-active antiretroviral therapy) is recommended in HIV-positive PEL patients and rituximab-CHOP chemotherapy is recommended for PEL patients that are HHV-8 negative and CD20 positive [6,18].

Tamara et al. reported good results with intracavitary cidofovir in HIV-negative, HHV-8-positive PEL patients [17]. Although PEL has a poor prognosis, use of CHOP chemotherapy, antiviral treatment after drainage of effusion, and intracavitary treatment 70

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References

2. Ascoli V, Scalzo CC, Danese C, Vacca K, Pistilli A, Lo Coco F. Human herpes virus-8 associated primary effusion lymphoma of the pleural cavity in HIV-negative elderly men. Eur Respir J 1999;14:1231-1234.

3. Ikebe T, Amemiya Y, Saburi M, Ando T, Kohno K, Ogata M, Hiramatsu K, Kadota J. Rare Primary effusion Lymphoma Associated with HHV-8 in Japan. Intern Med 2010;49:13031306.

4. Ceran F, Aydin Y, Ozçakar L, Han U, Yildiz M. Primary Effusion Lymphoma: An Untrivial Differential Diagnosis for Ascites. Yonsei Med J 2009;50:862-824.

5. Boulanger E, Hermine O, Fermand JP, Radford-Weiss I, Brousse N, Meignin V, Gessain A. Human Herpesvirus 8(HHV8) Associated Peritoneal Primary Effusion Lymphoma (PEL) in Two HIV-Negative Elderly Patients. Am J Hematol 2004;76:88-91.

6. Terasaki Y, Okumura H, Saito K, Sato Y, Yoshino T, Ichinohasama R, Ishida Y. HHV-8/KSHV-Negative and CD20 Positive Primary Effusion Lymphoma Successfully Treated by Pleural drainage Followed by Chemoteraphy Containing Rituximab. Intern Med 2008;47:2175-2178.

7. Wakely PE Jr, Menezes G, Nuovo GJ. Primary Effusion Lymphoma: Cytopathologic Diagnosis Using In Situ Molecular Genetic Analysis for Human Herpesvirus 8. Mod Pathol 2002;15:944-950.

8. Chan AC, Chan JK, Yan KW, Kwong YL. Anaplastic large cell lymphoma presenting as a pleural effusion and mimicking primary effusion lymphoma. A report of 2 cases. Acta Cytol 2003;47:809-816.

9. Lechapt-Zalcman E, Challine D, Delfau-Larue MH, Haioun C, Desvaux D, Gaulard P. Association of primary pleural effusion lymphoma of T-cell origin and human herpesvirus 8 in a human immunodeficiency virus-seronegative man. Arch Pathol Lab Med 2001;125:1246-1248.

10. Said JW, Shintaku IP, Asou H, deVos S, Baker J, Hanson G, Cesarman E, Nador R, Koeffler HP. Herpesvirus 8 inclusions in primary effusion lymphoma: report of a unique case with T-cell phenotype. Arch Pathol Lab Med 1999;123:257-260.

Turk J Hematol 2013;30:67-71

11. Gascoyne RD, Aoun P, Wu D, Chhanabhai M, Skinnider BF, Greiner TC, Morris SW, Connors JM, Vose JM, Viswanatha DS, Coldman A, Weisenburger DD. Prognostic significance of anaplastic lymphoma kinase (ALK) protein expression in adults with anaplastic large cell lymphoma. Blood 1999;93:3913-3921.

12. Fujisawa S, Tanioka F, Matsuoka T, Ozawa T. CD5+ diffuse large B-cell lymphoma with c-myc/IgH rearrangement presenting as primary effusion lymphoma. Int J Hematol 2005;81:315-318.

13. Aozasa K. Pyothorax-associated lymphoma. J Clin Exp Hematop 2006;46:5-10.

14. Hamoudi R, Diss TC, Oksenhendler E, Pan L, Carbone A, Ascoli V, Boshoff C, Isaacson P, Du MQ. Distinct cellular origins of primary effusion lymphoma with and without EBV infection. Leuk Res 2004;28:333-338.

Güven S, et al: HHV-8-Positive Primary Effusion Lymphoma

15. Brimo F, Michel RP, Khetani K, Auger M. Effusion Lymphoma.

A series of 4 cases and Review of the Literature With Emphasis on Cytomorphologic and Immunocytochemical Differential Diagnosis. Cancer 2007;111:224-233.

16. Yiakoumis X, Pangalis GA, Kyrtsonis MC, Vassilakopoulos TP, Kontopidou FN, Kalpadakis C, Korkolopoulou P, Levidou G, Androulaki A, Siakantaris MP, Sachanas S, Andreopoulos A. Primary Effusion lymphoma in Two HIV-Negative Patients Successfully Treated with Pleurodesis as First-line Theraphy.

Anticancer Res 2010;30:271-276.

17. Moyo TK, Richards KL, Damania B. Use of Cidofovir for the Treatment of HIV- negative Human Herpes Virus-8 Associated Primary Effusion Lymphoma. Clin Adv Hematol Oncol 2010;8:372-374.

18. Boulanger E, Gérard L, Gabarre J, Molina JM, Rapp C, Abino JF, Cadranel J, Chevret S, Oksenhendler E. Prognostic factors and outcome of human herpesvirus 8- associated primary effusion lymphoma in patients with AIDS. J Clin Oncol 2005;23:4372-4380.

71

Case Report

DOI: 10.4274/tjh.93798

Chanarin-Dorfman Syndrome with Multi-System Involvement in Two Siblings Çoklu Organ Tutulumu Olan Chanarin Dorfman Sendromlu İki Kardeş Seçil Arslansoyu Çamlar1, Pınar Gençpınar1, Balahan Makay1, Ayşe Yüzbaşıoğlu2, Nur Arslan1, Serap Emre Dökmeci2, Özden Anal1, Galip Köse1 1Dokuz

Eylul University School of Medicine, Department of Pediatrics, İzmir, Turkey

2Hacettepe

University School of Medicine, Department of Medical Biology, Ankara, Turkey

Abstract: Chanarin-Dorfman syndrome (CDS) is a very rare autosomal recessive inherited neutral lipid metabolism disorder associated with congenital ichthyosis and multi-system involvement. Observation of lipid vacuoles in neutrophils (Jordan’s anomaly) in peripheral blood smears in patients with ichthyosiform erythroderma is diagnostic. Herein we present 2 siblings with CDS that were referred to Dokuz Eylul University School of Medicine Department of Pediatrics due to ichthyosis. They had hepatomegaly, cataract, growth retardation, and sensorineural hearing loss. Some lipid vacuoles in neutrophils were noted in peripheral blood smear evaluation. Genetic analysis showed homozygous N209X mutation in both patients. They were put on a low-fat high-carbohydrate diet supplemented with medium-chain fatty acids. During 6 months of follow-up, no improvement was observed in both patients. In conclusion, although CDS is a rare lipid storage disease, it should always be a consideration in patients with congenital ichthyosis, especially those with extracutaneous symptoms or signs. The diagnosis of CDS is made based on a very simple test-peripheral blood smear.

Keywords: Ichthyosis, Child, Chanarin-Dorfman syndrome

Özet: Chanarin-Dorfman Sendromu (CDS) konjenital iktiyozis ve çoklu organ tutulumunu ile giden, otosomal resesif geçişli, nadir görülen bir nötral lipid metabolizması bozukluğudur. İktiyoziform döküntüleri olan hastalarda periferik kan yaymasında nötrofillerdeki lipid vakuollerinin (Jordan anomalisi) gösterilmesi ile tanı konur. Bu yazıda iktiyozis nedeniyle bölümümüze yönlendirilen ve hepatomegali, katarakt, büyüme geriliği, sensörinöral işitme kaybı eşlik eden, periferik kan yaymasında nötrofillerde lipid vakuolleri saptanarak CDS tanısı alan iki kardeş sunuldu. Yapılan genetik çalışmada her iki hastada da homozigot N209X mutasyonu saptandı. Hastalara tedavi amacıyla orta zincirli yağ asitleri ile zenginleştirilmiş ve yağ oranı düşük, karbohidrat içeriği yüksek olan bir diyet programı başlandı. Sonuç olarak, CDS oldukça nadir görülen bir lipid depo hastalığı olmasına rağmen, konjenital iktiyozlu özelikle de cilt dışı organlarda da tutulum bulguları olan her hastada akılda tutulmalıdır. Hastalığın tanısı periferik kan yayması gibi çok kolay bir testle konulabilir.

Anahtar Kelimeler: İktiyoz, Çocuk, Chanarin Dorfman Sendromu

Address for Correspondence: Nur ARSLAN , M.D., Dokuz Eylul University, School of Medicine, Department of Pediatrics, İzmir, Turkey Phone: +90 232 412 36 01 E-mail: nur.arslan@deu.edu.tr Received/Geliş tarihi : April 6, 2011 Accepted/Kabul tarihi : October 25, 2011

72

Turk J Hematol 2013;30:72-75

Arslan N, et al: Chanarin-Dorfman Syndrome in two Siblings

Introduction Chanarin-Dorfman syndrome (CDS, OMIM: 275630) is a rare autosomal recessive inherited neutral lipid metabolism disorder associated with ichthyosis and multi-system involvement [1,2]. It is characterized by congenital ichthyosiform erythroderma, vacuoles in leukocytes (Jordan’s anomaly), and variable involvement of the liver, muscles, and central nervous system [2].

Systemic involvement may manifest as hepatosplenomegaly, bilateral cataracts, growth retardation, myopathy, ataxia, bilateral sensorineural hearing loss, and horizontal nystagmus [2].

Observation of lipid vacuoles in neutrophils in peripheral blood smears in patients with ichthyosiform erythroderma is diagnostic [2,3]. Mutations of the ABHD5 gene have been identified as the cause of CDS. The human ABHD5 (CGI-58) gene, which is located on chromosome 3p21, encodes a protein of the esterase/lipase/thioesterase subfamily. This gene product coactivates adipose triglyceride lipase (ATGL), which controls hydrolyzation of triacylglycerol. Herein we present 2 siblings with generalized ichthyosiform erythroderma that were diagnosed as CDS based on observation of lipid vacuoles in neutrophils in peripheral blood smear evaluation. Additional mutation analysis confirmed the diagnosis.

infiltration in both patients. Stool pH was normal and stool fat excretion was negative in both patients. Electromyography and muscle biopsy was scheduled, but the parents did not consent to these evaluations. Both patients had mild mental retardation based on WISC-R test. The parents’ peripheral smears did not show vacuolization in eosinophils.

After obtaining informed consent from the parents, the patients’ DNA was isolated from peripheral leukocytes. Complete DNA sequencing of the 7 exons and the intron/exon boundaries of the ABHD5 gene (CGI-58 gene) was performed. PCR was performed as previously described [4]. Cycle sequencing was performed using an ABI PRISM Big Dye Terminator Cycle Sequencing Kit, according to the manufacturer’s instructions, and sequences were analyzed using an ABI PRISM 3130 DNA analyzer. Genetic analysis showed that both patients had homozygous N209X mutation.

The patients were put on a special diet and multivitamin program to treat their malnutrition and other symptoms. This diet

Case Report A 9-year-old girl and her 11-year-old brother were referred to our hospital for evaluation of ichthyosiform eruptions that have occurred since birth. They both suffered from non-bullous ichthyosiform lesions, with exacerbation in winter and after bathing. The patients were being treated with emollients, but skin scaling was persistant. The boy also had myopia and hearing loss, which began 1 year earlier. Both patients were born full-term via normal vaginal delivery to second-degree consanguineous parents.

No other family member had similar eruptions.

On physical examination both their weights and heights were below the 3rd percentile (Table). They had mild erythema and fine desquamation of the skin especially on extensor surfaces of the extremities (Figure 1). They had firm, non-tender hepatomegaly palpable 2 cm below the right costal margin. They did not have splenomegaly. No evidence of muscle weakness was noted and neurological examination findings were normal. Cardiovascular and respiratory system examinations were within normal limits. In both patients astigmatism and cataract, and bilateral moderate sensorineural hearing loss were noted on ophthalmological and otorhinolaryngological examination, respectively. The boy also had bilateral ectropion due to dry eye (Figure 2). Unfortunately, bone age of the patients was not estimated.

Complete blood count, urinalysis, serum electrolytes, protein, and albumin were within normal limits. Peripheral blood smear in both patients showed lipid vacuoles in granulocytes (Figure 3).

Serum alanine aminotransferase and creatine phosphokinase in both patients were elevated. Serum lipid profiles were within normal limits and serum biotinidase activity was normal. The patients’ laboratory results are summarized in the Table.

Abdominal ultrasonography showed an enlarged liver with fatty

Figure 1: Mild erythema and fine desquamation of the skin especially on the extensor surfaces of the extremities.

Figure 2: Bilateral ectropion due to dry eye obtained additionaly in the male patient.

73

Turk J Hematol 2013;30:72-75

Arslan N, et al: Chanarin-Dorfman Syndrome in two Siblings

included 15% protein, 65%-70% carbohydrates, and 20% fat (18% middle chain triglycerides and 2% long chain triglycerides).

Ursodeoxycholic acid and vitamin E were administered for their hepatic cytoprotective and antioxidant effects, respectively. Local application of emollients containing urea was continued for the treatment of ichthyosis. In six months follow-up, they had no clinical improvement.

Discussion Two siblings were diagnosed as CDS based on physical examination, peripheral blood smear findings, and mutation analysis. CDS is a rare autosomal recessive inherited lipid storage disease associated with congenital ichthyotic erythroderma, and is characterized by neutral lipid accumulation in different organs, such as skin, muscle, the liver, central nervous system, and granulocytes [2,3,5]. To the best of our knowledge nearly 40 patients with this rare disorder have been described to date.

Accumulation of lipid droplets in various tissues is related to abnormal catabolism of triacylglycerols. Neutral lipid, in the form of triacylglycerol, accumulates in leukocytes, fibroblasts, the liver, muscle cells, and intestinal mucosa as non-membrane-enclosed cytoplasmic droplets [6]. These droplets can be observed in peripheral smears as vacuoles in granulocytes and monocytes, which is known as Jordan’s anomaly [6,7]. CGI-58 protein is located on the surface of cytoplasmic lipid droplets. It improves the catabolism of stored fat in adipose tissues by working in conjunction with perilipin and adipose triglyceride lipase (ATGL) [1,8,9,10]. When perilipin is activated by CGI-58, hormonesensitive lipase activity is stimulated, leading to lipolysis [9]. Thus, mutation in the CGI-58 gene (ABHD5 gene) interferes with lipolysis and leads to accumulation of lipid droplets and, consequently, CDS. Different degrees of liver involvement in CDS have been reported. The liver is clinically affected in 64% of CDS cases; however, steatohepatitis in liver biopsy specimens and elevated liver enzymes are reported all of the (100%) CDS patients with or without hepatomegaly [6,11]. Liver biopsy could not be

performed in the presented patients, but transaminase levels were high, and hepatomegaly and hepatosteatosis were observed on physical examination and ultrasonographically, respectively.

Homozygous N209X mutation was noted in both patients.

Emre et al. [12] reported that N209X mutation was the most common mutation (58.3%) in Turkish CDS patients. To date, 4 Turkish patients with homozygous N209X mutation and 1 with heterozygous N209X mutation have been reported [4,12]. This mutation is predicted to have a negative effect on both CGI-58 structure and function. The N209X nonsense mutation causes premature termination of translation, and results in a truncated 140-amino acid peptide instead of the normal protein. This mutation further illustrates the functional importance of CGI-58 in lipid metabolism and epidermal differentiation. Determination of the correlation between the phenotypic and genotypic characteristics remains difficult, as most ABHD5 mutations are novel and unique.

Management of patients with CDS is difficult. Emollients are useful for local treatment [13]. Kakourou et al. [14] prescribed a low-fat diet to their CDS patient and observed improvement in skin and liver manifestations during 1 year of the therapy. The presented patients were prescribed a diet of 15% protein, 65%70% carbohydrates, and 20% fat (18% middle chain triglycerides and 2% long chain triglycerides). During 6 months of follow-up no improvements were observed in either patient. In conclusion, although CDS is a rare lipid storage disease, it should be a consideration in every patient with congenital ichthyosis, especially those with extracutaneous signs, as a simple peripheral smear can establish the diagnosis.

Table 1: Patient clinical and laboratory data.

Patient 1 (girl) Patient 2 (boy) Age (years)

9

12

Weight

23 kg (<3rd percentile)

24.6 kg (<3rd percentile)

Height

118 cm (<3rd percentile)

127 cm (<3rd percentile)

Weight for height (%)

107

97

Peripheral blood smear

Neutrophil vacuolization

Neutrophil vacuolization

AST (U /L) (normal: 5-34)

43

113

ALT (U /L) (normal: 0-55)

63

192

CK (U /L) (normal: 30-200)

633

492

Grade 2 hepatosteatosis

Hepatosplenomegaly and grade 2 hepatosteatosis

Abdominal ultrasound Figure 3: The peripheral blood smear revealed lipid vacuoles in granulocytes.

74

AST: Aspartate aminotransferase; ALT: alanine aminotransferase; CK: creatine kinase.

Turk J Hematol 2013;30:72-75

Arslan N, et al: Chanarin-Dorfman Syndrome in two Siblings

Conflict of Interest Statement The authors have no conflicts of interest relevant to the materials presented in this manuscript.

References

7. Dursun A, Kubar A, Gokoz A, Duru F, Gürgey A. Neutral lipid storage disease co-existing with ichthyosiform dermatosis. Eur J Pediatr 1994;153:210-211.

8. Yamaguchi T, Osumi T. Chanarin-Dorfman syndrome: deficiency in CGI-58, a lipid droplet-bound coactivator of lipase. Biochim Biophys Acta 2009;1791:519-523.

1. Selimoglu MA, Esrefoglu M, Gul M, Gungor S, Yildirim C, Seyhan M. Chanarin-Dorfman syndrome: clinical features of a rare lipid metabolism disorder. Pediatr Dermatol 2009;26:40-43.

9. Sztalryd C, Xu G, Dorward H, Tansey JT, Contreras JA, Kimmel AR, Londos C. Perilipin A is essential for the translocation of hormone-sensitive lipase during lipolytic activation. J Cell Biol 2003;161:1093-1103.

2. Pujol RM, Gilaberte M, Toll A, Florensa L, Lloreta J, GonzálezEnseñat MA, Fischer J, Azon A. Erythrokeratoderma variabilislike ichthyosis in Chanarin-Dorfman syndrome. Br J Dermatol 2005;153:838-841.

10. Lass A, Zimmermann R, Haemmerle G, Riederer M, Schoiswohl G, Schweiger M, Kienesberger P, Strauss JG, Gorkiewicz G, Zechner R. Adipose triglyceride lipasemediated lipolysis of cellular fat stores is activated by CGI-58 and defective in Chanarin-Dorfman Syndrome. Cell Metab 2006;3:309-319.

3. Mela D, Artom A, Goretti R, Varagona G, Riolfo M, Ardoino S, Sanguineti G, Vitali A, Ricciardi S. Dorfman-Chanarin syndrome: a case with prevalent hepatic involvement. J Hepatol 1996;25:769-771.

4. Lefèvre C, Jobard F, Caux F, Bouadjar B, Karaduman A, Heilig R, Lakhdar H, Wollenberg A, Verret JL, Weissenbach J, Ozgüc M, Lathrop M, Prud'homme JF, Fischer J. Mutations in CGI58, the gene encoding a new protein of the esterase/lipase/ thioesterase subfamily in Chanarin Dorfman syndrome. Am J Hum Genet 2001;69:1002-1012.

5. Wollenberg A, Geiger E, Schaller M, Wolff H. DorfmanChanarin syndrome in a Turkish kindred: conductor diagnosis requires analysis of multiple eosinophils. Acta Derm Venereo 2000;80:39-43.

6. Gurakan F, Kaymaz G, Kocak N, Ors U, Yüce A, Atakan N. A cause of fatty liver: neutral lipid storage disease with ıchthyosis: electron microscopic findings. Dig Dis Sci 1999;44:2214-2217.

11. Pena-Penabad C, Almagro M, Martinez W, García-Silva J, Del Pozo J, Yebra MT, Sánchez-Manzano C, Fonseca E. DorfmanChanarin syndrome (neutral lipid storage disease): new clinical features. Br J Dermatol 2001;144:430–432.

12. Emre S, Unver N, Evans SE, Yüzbaşioğlu A, Gürakan F, Gümrük F, Karaduman A. Molecular analysis of ChanarinDorfman syndrome (CDS) patients: Identification of novel mutations in the ABHD5 gene. Eur J Med Genet 2010;53:141144.

13. Pahwa M, Kar R, Singh A, Goel A, Ramesh V, Jain R. Chanarin–Dorfman syndrome with eccrine gland vacuolation: a case report. Int J Dermatol 2008;47:1257–1259.

14. Kakourou T, Drogari E, Christomanou H, Giannoulia A, Dacou-Voutetakis C. Neutral lipid storage disease – response to dietary intervention. Arch Dis Child 1997;77:184.

75

Case Report

DOI: 10.4274/tjh.2012.0009

Acquired Factor VIII Inhibitors: Three Cases Edinsel Faktör VIII İhibitörleri: Üç Olgu Tay Za Kyaw1, S. Jayaranee1, Ping Chong Bee2, Edmund Fui Min Chin2 1Malaya

University Faculty of Medicine, Department of Pathology, Kuala Lumpur, Malaysia

2Malaya

University Faculty of Medicine, Department of Medicine, Kuala Lumpur, Malaysia

Abstract: Acquired hemophilia A is a rare, but devastating bleeding disorder caused by spontaneous development of autoantibodies directed against coagulation factor VIII. In 40%-50% of patients it is associated with such conditions as the postpartum period, malignancy, use of medications, and autoimmune diseases; however, its cause is unknown in most cases.

Acquired hemophilia A should be suspected in patients that present with a coagulation abnormality, and a negative personal and family history of bleeding. Herein we report 3 patients with acquired hemophilia A that had different underlying pathologies, clinical presentations, and therapeutic responses. Factor VIII inhibitor formation in case 1 occurred 6 months after giving birth; underlying disorders were not identified in cases 2 or 3. The bleeding phenotype in these patients’ ranged from no bleeding tendency with isolated prolongation of APTT (activated partial thromboplastin time) to severe intramuscular hematoma and hemarthrosis necessitating recombinant activated factor VII infusion and blood components transfusion. Variable responses to immunosuppressive treatment were also observed.

Keywords: Acquired hemophilia, FVIII inhibitors, Hemarthrosis, Postpartum inhibitors

Özet: Edinsel hemofili A, faktör VIII’e karşı kendiliğinden gelişen otoantikorlar nedeniyle oluşan nadir ancak yıkıcı bir kanama hastalığıdır. Olguların %40-50’de doğum sonrası dönem, malignansi, ilaç kullanımı ve otoimmun hastalıklar bu duruma neden olurken, diğer olgularda neden çoğu zaman bulunamaz. Kanamaya yönelik kişisel ve ailesel öyküsü bulunmayan ve koagulasyon bozukluğu olan olgularda edinsel hemofili A dan mutlaka şüphelenmeliyiz. Bu yazıda altta yatan farklı patolojileri, klinik başvuruları ve tedavi cevapları olan 3 edinsel hemofili A olgularını sunduk. İlk olguda faktör VIII inhibitör oluşumu doğumdan 6 ay sonra gelişirken ikinci ve üçüncü olguda altta yatan neden bulunamamıştır. Bu olguların kanama fenotipi hiçbir kanama eğilimi olmadan izole aPTT (aktive parsiyel tromboplastin zamanı) uzaması ya da kan ürünü transfüzyonu ve rekombinant aktive faktör VII infüzyonu gerektiren hemartroz ve ciddi kas içi kanaması şeklinde değişmekteydi.Immunsupresif tedaviye değişken yanıtları da gözlenmiştir.

Anahtar Kelimeler: Edinsel hemofili, Faktör VIII inhibitörleri, Hemartroz, Doğum sonrası inhibitörler

Address for Correspondence: Kyaw TAY ZA, M.D., Malaya University Faculty of Medicine, Department of Medicine, Kuala Lumpur, Malaysia Phone: +60-3-79492375 E-mail: kyawtayza79@gmail.com Received/Geliş tarihi : January 12, 2012 Accepted/Kabul tarihi : May 10, 2012

76

Turk J Hematol 2013;30:76-80

Kyaw ZT, et al: Three Acquired Hemophilia A Cases

Introduction Acquired hemophilia A (AHA) is a rare bleeding disorder caused by spontaneous development of autoantibodies directed against coagulation factor VIII (FVIII). It has an incidence of approximately 1.5 cases/million/year [1]. The etiology of AHA is obscure in the majority of cases. In about 40%-50% of patients AHA is associated with such underlying conditions as the postpartum period, malignancy, use of medications, and autoimmune diseases, including rheumatoid arthritis and systemic lupus erythematosus (SLE) [2]. AHA is more common in adults and is equally distributed between the sexes [3].

The diagnosis of AHA is often difficult because of the lack of personal or family history of bleeding [4]. The bleeding pattern in AHA differs from that observed in congenital hemophilia.

Hemarthrosis, a typical bleeding manifestation of congenital FVIII deficiency, is uncommon in AHA. The majority of patients with AHA present with bleeding into the skin, muscles, soft tissues, and mucous membranes (e.g. epistaxis, gastrointestinal and urological bleeding, and retroperitoneal hematomas) [4]. Severe or life-threatening bleeding occurs in >80% of patients and typically occurs early in the course of the disease [1,5]. Mortality due to AHA is reported to be 9%-22% [1,5]. Herein we report 3 patients with AHA that had different underlying pathologies, clinical presentations, and therapeutic responses.

Case Report Case 1 Written informed consent was obtained from the patients.

In September 1998 a 28-year-old Chinese female was referred to our center for further investigation of incidentally observed prolonged APTT (activated partial thromboplastin time) 6 months post delivery of her first child. Family and personal history of bleeding diathesis were negative. Laboratory investigation showed an APTT of 69.6 s (reference range: 28.5-38 s), which was not corrected via mixing with an equal volume of normal plasma. Her FVIII activity was 2% (reference range: 50%-150%) and her FVIII inhibitor level was 512 Bethesda units (BU). Prothrombin time, thrombin time, and full blood count (FBC) were normal. Lupus anticoagulant (LA), anti-cardiolipin antibody (ACA), and hepatitis screening results were negative. Connective tissue disease (CTD) screening showed a normal level of anti-DNA antibody and a significantly elevated anti-nuclear factor (ANF) titer (1:1280); however, the patient’s clinical features did not indicate CTD. Based on the high-titer FVIII inhibitors, prednisolone and azathioprine were initiated. Prednisolone was gradually tapered off and stopped after about 1 year, at which time the FVIII inhibitor level was 115 BU. Azathioprine was discontinued in September 2001 following observation of a marked reduction in FVIII inhibitor (2 BU) and improved FVIII activity (23%). Two years later FVIII inhibitors disappeared spontaneously and FVIII activity increased to 47%. When the patient returned to our hospital in 2007 for the antenatal care during her second pregnancy, her routine coagulation screening was normal and her

FVIII level was 120%. CTD screening was not repeated due to the absence of clinical signs and symptoms of CTD. Case 2 A 23-year-old single Chinese female presented to our center in late February 2009 with complaints of easy bruising and bilateral leg swelling. History and physical examination were normal. Doppler ultrasound of her lower legs showed no evidence of thrombosis. Coagulation profile showed isolated prolongation of APTT (66.5 s), which was not corrected via mixing with normal plasma.

FVIII activity was markedly reduced (2.8%), with a high FVIII inhibitor titer (61 BU). FIX, FXI, and FXII activity were low; however, a repeat of FIX, FXI, and FXII assays after serial dilution of the patient’s plasma showed activity of 94%, 67%, and 50%, respectively. LA was negative. Other coagulation test results were normal. FBC, thyroid function test, and CTD screening, which included C3, C4, ANF, ACA, and rheumatoid factor, findings were normal. HBsAg and anti-Hepatitis C virus antibodies were negative. Thoracic and abdominal computerized tomography (CT) findings were normal.

The patient was started on prednisolone 60 mg/d in March 2009 and 1 month later azathioprine 50 mg/d was added. After a few weeks of treatment the swelling in both legs completely resolved. In October 2009 prednisolone was discontinued, and the FVIII inhibitor level was undetectable and FVIII activity was 24.6%. Then, 6 months later the patient’s FVIII activity was normal (52.4%). Azathioprine was stopped in March 2011 and at the time this manuscript was prepared the patient was doing well. Her APTT at the last follow-up was normal.

FVIII activity and FVIII inhibitor levels in cases 1 and 2-during and after treatment with immunosuppressive agents-are shown in Figures 1 and 2, respectively.

Case 3 A 71-year-old female presented to our hospital in December 2010 with acute onset of right knee pain and swelling associated with easy bruising. She had been taking amlodipine and

Figure 1: Factor VIII activity and FVIII inhibitor levels during and after the immunosuppressive therapy in the first patient 77

Turk J Hematol 2013;30:76-80

Kyaw ZT, et al: Three Acquired Hemophilia A Cases

Cyclophosphamide 100 mg/d i.v. was added for 3 d and was later switched to oral cyclophosphamide 50 mg/d during hospitalization. Although there was significant clinical improvement, FVIII activity before discharge was only 3.9% and the FVIII inhibitor concentration was 54.4 BU. She was discharged in January 2011 and prescribed prednisolone 40 mg/d. Her APTT test results have been normal since April 2011. Her FVIII activity in June 2011 was 58%, with undetectable FVIII inhibitors. She is currently taking prednisolone 5 mg/d and is asymptomatic.

Discussion

Figure 2: Factor VIII activity and FVIII inhibitor levels during and after the immunosuppressive therapy in the second patient

Figure 3: (A) CT scan image demonstrating a subcutaneous haematoma in the right axilla region impinging on the surrouding vessels (black arrows). (B) CT scan image demostrating an intramuscular haematoma in the left lattissimus dorsi muscle (white arrows) simvastatin for hypertension and hypercholesterolemia, respectively. Ten years earlier she was diagnosed with cervical carcinoma and underwent hysterectomy followed by chemotherapy.

Physical examination showed right knee swelling and tenderness associated with limited movement due to the underlying hemarthrosis. Bruising was present on the patient’s forearms. Whole-body CT showed a soft tissue hematoma in the right axilla that extended to the right shoulder girdle and medial aspect of the right upper arm, and an intramuscular hematoma in the left latissimus dorsi that extended to the lumbar region. No other abnormality was detected (Figure 3). Coagulation profile showed isolated prolongation of APTT (106.3 s), which was not corrected via mixing with normal plasma. The FVIII level was markedly reduced (0.9%), with an FVIII inhibitor level of 35 BU. FBC at admission was as follows: hemoglobin: 9.9 g/dL, white cell count: 9.4 × 109/L; platelet count: 359 × 109/L. CTD screening results were normal. LA was negative. Tumor markers (CEA, CA125, and CA19-9) were within the normal range.

During this admission she developed new intramuscular hematomas and hemarthrosis, hemoglobin dropped to 5.6 g/dL, and she was given recombinant activated factor VII (rFVIIa) 0.9 μg/kg as a single dose together with blood components; i.v. methylprednisolone 500 mg/d was started simultaneously and was changed to oral prednisolone 40 mg/d after 3 d.

78

Herein we described 3 AHA cases with different clinical presentations, underlying pathologies, and therapeutic responses.

The bleeding phenotype in these patients ranged from no bleeding tendency with isolated prolongation of APTT, to severe intramuscular hematoma and hemarthrosis necessitating rVIIa infusion and blood components transfusion. The occurrence of hemarthrosis in case 3 is unusual, but there are other reports of a similar presentation [6].

In case 1 FVIII inhibitor formation was probably a result of the postpartum state. Postpartum FVIII inhibitors usually develop 1-4 months post delivery, but may occur as late as 1 year [7]. FVIII inhibitor formation can occur following any pregnancy, but is observed more often after the first birth, as in case 1 [7]. The majority of patients with postpartum AHA have low-titer FVIII inhibitors, which tends to disappear spontaneously after a median period of 30 months [4,8]; however, high-titer postpartum FVIII inhibitors may persist for years despite immunosuppressive therapy and may precede the development of an overt autoimmune disease [4]. Case 1 presented with high-titer FVIII inhibitors that was resistant to immunosuppressants. Her CTD screening at presentation showed a high ANF titer. The possibility of AHA as a preceding event of CTD cannot be completely excluded in this patient. Although no feature of CTD was observed during the 5-year follow-up of AHA or during the follow-up of her second pregnancy, it is important that we continue to monitor for features of CTD in case 1.

Underlying disorders such as CTD, malignancy, hepatitis, and dermatological and respiratory diseases were not detected in cases 2 and 3. Although case 3 has been taking anti-hypertensive and anti-lipemic medications, none have been reported to cause AHA. Additionally, there was no evidence of malignancy in case 3.

Idiopathic AHA often occurs in elderly individuals and usually presents with life-threatening bleeding, as in case 3 [4]. All possible underlying causes must be carefully investigated and excluded before making a diagnosis of idiopathic AHA. Patients with idiopathic AHA should also undergo long-term follow-up, which is particularly true for those aged less than 40 years in whom the occurrence of idiopathic AHA is uncommon [1]. The importance of long-term follow-up is highlighted in a report by Hsieh et al. [9] of a 38-year-old female that initially presented with AHA, and then developed SLE 7 years later.

The management of AHA is two fold: (1) to control bleeding and (2) to eradicate FVIII inhibitors. Hemostatic control is necessary in patients with active severe bleeding, irrespective of

Turk J Hematol 2013;30:76-80

inhibitor titer [10]. Several therapeutic approaches have been utilized for the control of bleeding, including bypassing agents, such as rVIIa and activated prothrombin complex concentrate (aPCC), porcine FVIII, human or recombinant FVIII, and desmopressin (DDAVP) [4]. Plasma-derived porcine FVIII concentrate was successfully used in the past to manage AHA, in particular because FVIII autoantibodies often have low crossreactivity with porcine FVIII; however, it is no longer commercially available, but a recombinant porcine B-domaindepleted FVIII molecule is under development [10]. The choice of treatment agent depends on the severity of bleeding and the FVIII inhibitor titer [2]. Thus, while clinically mild cases of AHA with low-titer inhibitors can be managed successfully using DDAVP or FVIII concentrates, patients with high-titer FVIII inhibitors and severe bleeding benefit from bypassing agents [8].

Currently, bypassing agents rVIIa and aPCC are the most frequently used first-line treatments; both of these bypassing agents have been proven effective in the treatment of AHA [11].

A large retrospective study by Goudemand and the French FEIBA Study Group reported that aPCC had good hemostatic efficacy in 89% of bleeding episodes [12]. The first large-scale study on the use of rVIIa in patients with AHA was a retrospective analysis of 38 patients by Hay et al. [13]. The 38 patients were treated for 78 bleeding episodes using rVIIa, and 100% of patients had a good response when rVIIa was used as the first-line treatment and in 75% of patients when it was used as salvage therapy. Case 3 in the present study had severe bleeding episodes with significantly reduced hemoglobin that required use of rVIIa and blood components, and marked clinical improvement was observed following rVIIa infusion. In case 2 although swelling in the legs was probably caused by intramuscular hemorrhaging, the patient was clinically stable with a normal hemoglobin level; thus, hemostatic control was not required.

The second aim of AHA management is eradication of FVIII autoantibodies. Although spontaneous resolution of FVIII inhibitors may occur in up to 30% of patients [14], the occurrence is unpredictable and patients remain at risk of severe bleeding if the inhibitors persist [15]; therefore, immunosuppressive therapy for eradication of inhibitors is recommended in all AHA patients [10]. In contrast to AHA, immunosuppressive therapy has had limited success in eradicating FVIII alloantibodies in congenital hemophilia patients [16]. In severe congenital hemophilia A patients with FVIII inhibitors, immune tolerance induction (ITI) therapy using regular applications of FVIII for a certain period is the only proven strategy for eradication of FVIII inhibitors and induction of FVIII-specific immune tolerance [17]. The most widely used ITI strategies [Bonn protocol and van Creveld protocol] require regular infusion of FVIII products without using immunosuppressive agents [17]. Patients with AHA FVIII autoantibodies exhibit rapid and non-linear inactivation of FVIII antigens (type 2 kinetics) [3]; therefore, it is difficult to saturate these autoantibodies by adding FVIII antigens. High-dose FVIII infusion therapy used to eradicate inhibitors in congenital hemophilia was unsuccessful in AHA, particularly in high-titer patients [18].

Kyaw ZT, et al: Three Acquired Hemophilia A Cases

The most successful immunosuppressive regimens for the management of AHA are corticosteroids alone or in combination with cyclophosphamide [2]. A non-randomized study by the United Kingdom Hemophilia Center Doctors’ Organization [1] reported that there wasn’t a significant difference between groups treated with steroids alone or in combination with cytotoxic agents. Nonetheless, a randomized prospective trial that included 31 AHA patients [15] reported that 50% of steroid-resistant patients responded to a cyclophosphamidecontaining regimen. Combination therapies, such as steroids with azathioprine or with other cytotoxic agents, have also been shown to be effective [10]. In non-responders, alternative approaches have been proposed in particular, rituximab.

Rituximab is a monoclonal antibody (against the pan B-cell antigen CD20) that induces rapid in vivo depletion of normal B-lymphocytes [19]. Although earlier reports of this agent’s effectiveness were based primarily on lymphomas and other autoimmune diseases, recent studies have reported promising results in terms of eradicating FVIII inhibitors at a common dose of 375 mg/m2/week for up to 4 weeks [10]. Rituximab may also be useful as a first-line therapy when chemotherapeutic agents are contraindicated [10].

Case 1 in the present study was given immunosuppressants immediately because of high-titer FVIII inhibitors, even though she was asymptomatic. Her FVIII inhibitors persisted despite receiving immunosuppressive treatment for 3 years. The inhibitors disappeared spontaneously 2 years later. The effect of immunosuppressive therapy on the natural history of FVIII inhibitors in postpartum women is unclear. A retrospective analysis of 51 postpartum FVIII inhibitor patients reported that steroid treatment was no better than no treatment.

Immunosuppression did not induce complete remission, but may have slightly reduced the time to complete remission [20]. In contrast to case 1, cases 2 and 3 had good responses to immunosuppressants, and cases 1 and 2 received similar treatment. FVIII inhibitors in case 2 disappeared 6 months after the start of treatment. In case 3 cyclophosphamide was given during hospitalization; however, she was discharged on prednisolone only. Her FVIII level was normal and FVIII inhibitors were undetectable 5 months after initiating prednisolone treatment. Case 3 appeared to have achieved remission with prednisolone alone; however, cyclophosphamide probably contributed to shortening the time to remission.

In conclusion, AHA is a heterogeneous condition in terms of clinical characteristics, pathogenicity, and therapeutic response, as in the presented cases. Although it is generally recommended that all AHA patients receive immunosuppressants to eradicate FVIII inhibitors immediately following diagnosis, so as to avoid the risk of fatal hemorrhage, the optimal therapeutic strategy has not yet been defined [10]. Large, multinational collaborative randomized controlled trials are required for better assessment of treatment regimes in these patients with a rare, but devastating disorder.

79

Kyaw ZT, et al: Three Acquired Hemophilia A Cases

Conflict of Interest Statement The authors have no conflicts of interest relevant to the materials presented in this manuscript.

References 1. Collins PW, Hirsch S, Baglin TP, Dolan G, Hanley J, Makris M, Keeling DM, Liesner R, Brown SA, Hay CR; UK Haemophilia Centre Doctors' Organisation. Acquired haemophilia A in the United Kingdom: a 2-year national surveillance study by the United Kingdom Haemophilia Centre Doctors’ Organisation.

Blood 2007;109:1870-1877.

2. Delgado J, Jimenez-Yuste V, Hernandez-Navarro F, Villar A. Acquired Haemophilia: review and meta-analysis focused on therapy and prognostic factors. Br J Haematol 2003;121:21-35.

3. Ma AD and Carrizosa D. Acquired factor VIII inhibitors: pathophysiology and treatment. Hematology Am Soc Hematol Educ Program 2006:432-437.

4. Franchini M, Gandini G, Paolantonio TD, Mariani G. Acquired Haemophilia A: A concise review. Am J Hematol 2005;80:55-63.

5. Green D, Lechner K. A survey of 215 nonhaemophilic patients with inhibitors to factor VIII. Thromb Haemost 1981;45:200-203.

6. Wendling D, Bertrand MA. Haemarthrosis in acquired haemophilia. Two case reports. Joint Bone Spine 2003;70:532534.

7. Michiels JJ. Acquired haemophilia in women postpartum: clinical manifestations, diagnosis and treatment. Clin Appl Thromb Hemost 2000;6:82-86.

8. Franchini M. Postpartum Acquired Factor VIII Inhibitors. Am J Hematol 2006;81:768-773.

9. Hsieh C-C, Chen H-H, Chen D-Y, Lan J-L. Systemic lupus erythematosus develop seven years after acquisition of acquired haemophilia A in a patient with palindromic rheumatism: a case report. Formosan Journal of Rheumatology 2009;23:47-51.

80

Turk J Hematol 2013;30:76-80

10. Huth-Kuhne A, Baudo F, Collins P, Ingerslev J, Kessler CM, Levesque H, Castellano MEM, Shima M, St-Louis J. International recommendations on the diagnosis and treatment of patients with acquired haemophilia A. Haematologica 2009;94:566-573.

11. Franchini M, Lippi G. Acquired factor VIII inhibitors. Blood 2008;112:250-255.

12. Goudemand J. Treatment of bleeding episodes occurring in patients with acquired haemophilia with FEIBA: the French experience. Haemophilia 2004;10:14.

13. Hay CRM, Negrier C, Ludlam CA. The treatment of bleeding in acquired hemophilia with recombinant factor VIIa: a multicenter study. Thromb Haemost 1997;78:1463-7.

14. Lottenberg R, Kentro TB, Kitchens CS. Acquired haemophilia A. A natural history study of 16 patients with factor VIII inhibitors receiving little or no therapy. Arch Intern Med 1987;147:1077-1081.

15. Green D, Rademaker AW, Briët E. A prospective, randomized trial of prednisone and cyclophosphamide in the treatment of patients with factor VIII autoantibodies. Thromb Haemost 1993;70:753-757.

16. Green D. Factor VIII antibodies. Immunosuppressive therapy.

Ann NY Acad Sci 1975;240:389-399.

17. Reipert BM, van Helden PM, Schwarz HP, Hausl C. Mechanisms of action of immune tolerance induction against factor VIII in patients with congenital haemophilia A and factor VIII inhibitors. Br J Haematol 2007;136:12-25.

18. Zeitler H, Ulrich-Merzenich G, Hess L, Konsek E, Unkrig C, Walger P, Vetter H, and Brackmann HH. Treatment of acquired hemophilia by the Bonn-Malmö Protocol: documentation of an in vivo immunomodulating concept.

Blood 2005;105:2287-2293.

19. Boye J, Elter T, Engert A. An overview of the current clinical use of the anti-CD20 monoclonal antibody rituximab. Ann Oncol 2003;14:520-525.

20. Hauser I, Schneider B, Lechner K. Postpartum factor VIII inhibitors. A review of the literature with special reference to the value of steroid and immunosuppressive treatment.

Thromb Haemost 1995;73:1-5.

DOI: 10.4274/tjh.2011.0035

Letter to the Editor

Non-Leukemic Granulocytic Sarcoma Presenting with Multiple Skin Nodules and a Retroperitoneal Mass Cilt Nodülleri ve Karın İçi Kitle ile Başvuran Lösemik Olmayan Granülositik Sarkomlu Olgu Merve Pamukcuoğlu1, Kadir Acar1, Nalan Akyürek2, Gülsan Türköz Sucak1 1Gazi University University, School of Medicine, Department of Hematology, Ankara, Turkey 2Gazi University University, School of Medicine, Department of Pathology, Ankara, Turkey

To the Editor, Here we present a case of multiple granulocytic sarcomas with monocytic differentiation involving the skin and retroperitoneal area.

A 19-year-old man presented with the complaints of generalized arthralgia and fixed non-tender nodular lesions (Figure 1). Physical examination revealed generalized immobile, painless violaceous erythematous nodules on his back, bilateral arms and legs, and joints. The largest nodule was 3×2 cm, located on his right posterolateral upper leg. Abnormal laboratory values included hemoglobin of 84 g/L, hematocrit of 27.2%, erythroid sedimentation rate of 58 mm/h, and lactate dehydrogenase of 613 IU/L. Blood smear revealed hypochromia and microcytosis, and bone marrow was normocellular without blasts. However, monocyte and macrophage marker CD163 was positive in 10%15% of the bone marrow cells. The pathological examination of the nodular lesions revealed medium-sized, irregular-shaped blastic cells with frequent mitotic activity, which infiltrated the dermis. The tumor tissue contained tingible body macrophages with nuclear debris. In immunohistochemical study, these cells were positive for CD163, lysozyme, CD4, and CD43, while CD117, MPO, CD68, langerin, CD1a, S–100, CD35, CD21, clusterin, fascin, factor 13a, CD123, TCL–1, TdT, CD3, CD20, and CD30 were all negative. The Ki–67 proliferation index of the neoplastic cells was 80%. In situ hybridization study with the EBER probe for Epstein-Barr virus was negative.

Abdominal and thorax computerized tomography (CT) was performed, which revealed a right retroperitoneal mass with blurred margins. A CT-guided biopsy was performed. The biopsy showed pleomorphic cell infiltration with large mononuclear and binuclear cells with clear nucleoli, which were CD163-positive, CD117-negative, and focal MPO-positive. These atypical pleomorphic, monocytic-histiocytic cells did not have blastic morphology. A high dose of cytosine-arabinoside and idarubicin was started. The nodular lesions disappeared 20 days after starting chemotherapy. Arthralgia, dyspnea, and respiratory distress developed consequently. Right pleural effusion was demonstrated in the chest X-ray. The cytological examination of the pleural fluid revealed blastic infiltration. Since the retroperitoneal mass persisted in follow-up abdominal CT, a new chemotherapy regimen containing fludarabine, cytosine arabinoside, and idarubicin was started. However, pleural effusion persisted and required Pleurocan evacuation. Methotrexate (Mtx) was given intrapleurally accompanied with systemic high-dose Mtx. Tumor lysis syndrome developed 28 days after this regimen and required intubation; the patient died due to cardiac arrest 3 days later.

Granulocytic sarcoma (GS) is the tumoral infiltration of extramedullary sites with immature myeloid precursor cells; it is associated with 3%-8% of acute myeloid leukemia (AML) cases and rarely with chronic myeloproliferative disorders [1].

Monocytic differentiation of GS is seen mostly in AML M4 and M5 subtypes according to the French-American-British (FAB)

Address for Correspondence: Merve Pamukcuoğlu, M.D. Gazi University University, School of Medicine, Department of Hematology, Ankara, Turkey Phone: +90 312 212 68 40 E-mail: drmpamuk@yahoo.com Received/Geliş tarihi : December 04, 2012 Accepted/Kabul tarihi : October 03, 2012

81

Turk J Hematol 2013;30:81-82

Pamukcuoğlu M, et al: Non-Leukemic Granulocytic Sarcoma Presenting with Multiple Skin Nodules and a Retroperitoneal Mass

approximately one-quarter of patients with GS having skin involvement [4]. The presented patient had arthralgia and multiple granulocytic nodules on various parts of the body and joints without bone morrow involvement. The morphologic appearance of the skin lesions was typical for leukemia cutis in its color and nodular form, as is immunohistochemistry with monocytic differentiation. Nevertheless, most of the aleukemic GS of skin is known to be associated with infiltration with cells of monocytic differentiation [5].

In conclusion, myeloid leukemias might present with granulocytic sarcomas, particularly in skin without bone marrow involvement. Multiple skin lesions of nodular pattern with violaceous color might suggest an underlying myeloid neoplasm.

The positivity of monocytic markers such as CD68 and CD163 is typical for leukemia with a predilection to the skin. Patients with aleukemic granulocytic sarcoma might have a very aggressive course, with evolution to tumor lysis syndrome.

Key Words: Granulocytic sarcoma, Skin, Monocytic differentiation Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References Figure 1: Multiple violaceous skin nodules. classification [2]. Any extramedullary anatomic site may be involved with GS and it might rarely precede but usually occurs simultaneously with acute leukemia. CD163 positivity is controversial in GS. While Lau et al. claimed that CD163 is a highly specific marker for cells of monocyte/macrophage lineage, they did not demonstrate CD163 positivity in GS in their series [2]. Backe et al., however, demonstrated CD163 positivity in myeloid leukemias with monocytic differentiation [3], while Benet et al. demonstrated CD163 positivity in 52% of their cases of leukemia cutis [4].

The prevalence of skin involvement in myeloid malignancies is approximately 3%, and it is usually associated with cases with monocytic differentiation. It is difficult to identify the origin of the tumor when it is not associated with bone marrow infiltration, namely “aleukemic leukemia cutis” [4]. In a series of 173 patients with leukemia cutis, 7.5% of the patients with leukemic skin infiltration had no underlying myeloid neoplasm (4). Skin is one of the most common sites of involvement in GS, with

82

1. Srinivasan B, Ethunandan M, Anand R, Hussein K, Ilankovan V. Granulocytic sarcoma of the lips: report of an unusual case.

Oral Surg Oral Med Oral Radiol Endod 2008;105:34–36.

2. Lau SK, Chu PG, Weiss LM. CD163: A specific marker of macrophages in paraffin- embedded tissue samples. Am J Clin Pathol 2004;122:794–801.

3. Backé E, Schwarting R, Gerdes J, Ernst M, Stein H. Ber-MAC3: New monoclonal antibody that defines human monocyte/macrophage differentiation antigen. J Clin Pathol 1991;44:936–945.

4. Bénet C, Gomez A, Aguilar C, Delattre C, Vergier B, BeylotBarry M, Fraitag S, Carlotti A, Dechelotte P, Hospital V, d’Incan M, Costes V, Dereure O, Ortonne N, Bagot M, Laroche L, Blom A, Dalac S, Petrella T. Histologic and immunohistologic characterization of skin localization of myeloid disorders: a study of 173 cases. Am J Clin Pathol 2011;135:278–290.

5. Ohno S, Yokoo T, Ohta M, Yamamoto M, Danno K, Hamato N, Tomii K, Ohno Y, Kobashi Y. Aleukemic leukemia cutis. J Am Acad Dermatol 1990;22:374–377.

DOI: 10.4274/tjh.2012.0153

Letter to the Editor

Carbamazepine and Multiple Myeloma: Possible Interaction Karbamazepin ve Multipl Miyelom: Olası İlişki Meral Günaldı1, Semra Paydaş1, Çiğdem Usul Afşar1, Berna Bozkurt Duman1, Vehbi Erçolak1, Veysel Haksöyler2 1Çukurova University Faculty of Medicine, Department of Medical Oncology, Adana, Turkey 2Çukurova University Faculty of Medicine, Department of Internal Medicine, Adana, Turkey

To the Editor, Epilepsy is the most common chronic neurological disease and patients are treated by various classes of antiepileptic drugs [1]. In addition to their acute side effects, there are long-term adverse effects of antiepileptic drugs [2]. Hemopoietic neoplasias such as lymphoma, multiple myeloma, and some solid cancers including lung, liver, pancreas, and gastrointestinal cancers are the malignant disorders most frequently discussed in relation to use of antiepileptic drugs [3,4]. The carcinogenic effect of carbamazepine is very limited. However, there are some case reports and series containing a limited number of cases of hypogammaglobulinemia, monoclonal gammopathy of undetermined significance (MGUS), and multiple myeloma [3,4,5,6,7,8,9,10,11]. We present here a 54year-old woman with multiple myeloma with long exposure to carbamazepine. Vertebral fracture was detected and vertebroplasty was done urgently. There was no evidence of neurologic deficit. She had a history of 400 mg carbamazepine usage for more than 20 years due to idiopathic epilepsy. Laboratory examination showed total protein/albumin of 8.85/3.41 g/dL and calcium of 10.77 mg/dL (8.4-9.2); she had macrocytic anemia. Bence-Jones protein in the urine was not demonstrated. Protein electrophoresis showed an M-peak (Figure 1) with an elevated serum level of immunoglobulin G (IgG) of 2740 mg/dL. Immunoelectrophoresis revealed M-protein composed with a kappa chain. Bone marrow aspiration and biopsy showed 90% plasma cell infiltration and CD38 and kappa were positive. Cytogenetic analysis of bone marrow showed 17 p deletion (+), 13 q deletion (+), t (11;14), t (4;14). Histopathological examination of a vertebroplasty specimen

revealed plasma infiltration. Carbamazepine usage was stopped and treatment was continued with valproic acid. A regimen containing bortezomib (1.3 g/m2), dexamethasone (40 mg), and zoledronic acid was prescribed. After 4 courses of chemotherapy, blood and bone marrow exams were normal. Stem cell transplantation was planned for consolidation. Carbamazepine-related multiple myeloma has been reported in a few case reports. It has been suggested that carbamazepine may cause the IgG type of M-protein multiple myeloma, MGUS, and hypogammaglobulinemia

Figure 1: Abnormal serum protein electrophoresis pattern in a patient with multiple myeloma. Note the large spike in the early gamma region.

Address for Correspondence: Çiğdem Usul AFŞAR, M.D. Çukurova University Faculty of Medicine, Department of Medical Oncology, Adana, Turkey Gsm: +90 505 830 38 97 E-mail: cigdemusul@yahoo.com Received/Geliş tarihi : October 14, 2012 Accepted/Kabul tarihi : November 16, 2012

83

Günaldı M, et al: Carbamazepine And Multiple Myeloma: Possible Interaction

[5,6,9,11,12]. Our patient was younger than is usual for multiple myeloma. We can speculate that the exposure to an extrinsic factor may be associated with younger age in this case. The relationships among the duration of use of antiepileptic drugs, cumulative dose of antiepileptic drugs, and development of multiple myeloma are not known completely. In our case, multiple myeloma developed after 20 years of carbamazepine use. In conclusion, carbamazepine may be a potential drug in the development of multiple myeloma.

For this reason, periodical evaluation of serum levels of immunoglobulin is necessary in patients receiving carbamazepine.

Key Words: Multiple myeloma, Carbamazepine, Epilepsy.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Bell GS, Sander JW. The epidemiology of epilepsy: the size of the problem. Seizure 2001;10:306-314.

2. White SJ, McLean AEM, Howland C. Anticonvulsant drugs and cancer: a cohort study in patients with severe epilepsy.

Lancet 1979;2:458-461.

3. Sander JW. The epidemiology of epilepsy revised. Curr Opin Neurol 2003;16:165-170.

4. Olsen JH, Schulgen G, Boice JD Jr, Whysner J, Travis LB, Williams GM, Johnson FB, McGee JO. Antiepileptic treatment and risk for hepatobiliary cancer and malignant lymphoma.

Cancer Res 1995;55:294-297.

84

Turk J Hematol 2013;30:83-84

5. Tohen M, Castillo J, Baldessarini RJ, Zarate C Jr, Kando JC. Blood dyscrasias with carbamazepine and valproate: a pharmacoepidemiological study of 2,228 patients at risk. Am J Psychiatry 1995;152:413-418.

6. Kyle RA, Rajkumar SV. Monoclonal gammopathies of undetermined significance. Hematol Oncol Clin North Am 1999;13:1181-1202.

7. Matzner Y, Polliack A. Monoclonal gammopathy and subsequent multiple myeloma in a patient on chronic diphenylhydantoin therapy. Isr J Med Sci 1978;14:1265-1267.

8. Voutsinas D, Foudoulaki L, Sofroniadou K, Galanakis N. Visceral leishmaniasis in a patient with acquired hypogammaglobulinemia. Eur J Intern Med 2001;12:127-129.

9. Selby JV, Friedman GD, Fireman BH. Screening prescription drugs for possible carcinogenicity: eleven to fifteen years of follow up. Cancer Res 1989;49:5736-5747.

10. Kanoh T, Dobashi H, Inada T. Multiple myeloma associated with phenytoin (diphenylhydantoin) therapy. Rinsho Ketsueki 1996;37:239-243.

11. Moreno-Ancillo A, Cosmes Martín PM, Domínguez-Noche C, Martín-Núñez G, Fernández-Galán MA, López-López R, González-Hurtado JA, Gil-Adrados AC. Carbamazepine induced transient monoclonal gammopathy and immunodeficiency.

Allergol Immunopathol (Madr) 2004;32:86-88.

12. Adelöw C, Ahlbom A, Feychting M, Johnsson F, Schwartzbaum J, Tomson T. Epilepsy as a risk factor for cancer. J Neurol Neurosurg Psychiatry 2006;77:784-786.

DOI: 10.4274/tjh.2012.0027

Letter to the Editor

The Accelerated Phase of Chediak-Higashi Syndrome: The Importance of Hematological Evaluation Chediak-Higashi Sendromunun Hızlanmış Fazı: Hematolojik Değerlendirmenin Önemi Shreekant Bharti1, Prateek Bhatia2, Deepak Bansal2, Neelam Varma1 1Post Graduate Institute of Medical Education and Research, Department of Hematology, Chandigarh, India 2 Post Graduate Institute of Medical Education and Research, Department of Pediatric (Hematology), Chandigarh, India

To the Editor, Chediak-Higashi syndrome is a rare autosomal recessive disease that was first described in 1943 by Bequez-Cesar in 3 siblings that bore the primary clinical features. In 1952 Chediak (a Cuban hematologist) and in 1954 Higashi (a Japanese pediatrician) described a series of cases characterized by misdistribution of myeloperoxidase in the patients’ neutrophilic granules [1,2].

Mean age of onset is 5.85 years; however, most patients die before age 10 years. In patients that do survive beyond childhood the neurologic problems persist and/or increase in magnitude [3].

Most cases are diagnosed clinically based on partial albinism and recurrent pyogenic infections. Both of our patients had hypopigmentation of the skin with patchy grey hairs, mild coagulation defects identified via the presence of petechial rashes on the skin, and a history of recurrent infections since birth.

The characteristic hematological finding is massive lysosomal inclusions in all white cells, formed via a combined process of fusion, cytoplasmic injury, and phagocytosis due to a microtubular defect [3]. These granules exhibit both azurophilic and specific granular markers (Figure 1), and are strongly myeloperoxidase positive. Approximately 85% of cases develop a fatal accelerated phase characterized by pancytopenia, hemophagocytosis, and

marked infiltration of organs by lymphocytes, leading to multiorgan dysfunction [4]. Herein we present 2 cases in the accelerated phase of Chediak-Higashi syndrome. Both were born to apparently healthy non-consanguineous parents.

Case 1 was a 2.5-year-old female that presented with a 6month history of abdominal distension and moderate pallor, and a 5-d history of cough. General physical examination showed that she was thin built, and had normal facies with patchy grey hair and hypopigmentation of the skin. Systemic examination showed hepatosplenomegaly; the liver was 6 cm below the right costal margin and the spleen was 13 cm below the left costal margin. The cardiovascular and respiratory systems were normal. She also had bilateral cervical lymphadenopathy. Case 2 was a 3-year-old female that presented with a 3-month history of fever, and a 1-month history of abdominal distension, itching over the body, and moderate pallor. Physical examination showed patchy gray hair and generalized albinism with petechial spots on the thighs and abdomen. The patient weighed 7.6 kg, was of average build with normal facies and significant hepatosplenomegaly; the liver was 4 cm below the right costal margin and the spleen was 7 cm below the left costal margin.

Both patients underwent bone marrow aspiration due to peripheral blood pancytopenia and organomegaly. Hemogram findings in cases 1 and 2 were, respectively, as follows: Hb: 4.2

Address for Correspondence: Prateek BHATIA, M.D. Post Graduate Institute of Medical Education and Research, Department of Pediatric (Hematology), Chandigarh, India Phone: +91-9914208329/+91-9417186867/+91-0172-2755329 E-mail: prateekbhatia@rediffmail.com Received/Geliş tarihi : February 15, 2012 Accepted/Kabul tarihi : July 09, 2012

85

Turk J Hematol 2013;30:85-87

Bharti S, et al: Accelerated Phase of Chediak-Higashi

Table: Bone marrow aspirate findings in cases 1 and 2.

Parameters

Case 1

Case 2

Cellularity

Hypercellular for age

Tiny particles; normocellular

M:E ratio

1:1.8, mild megaloblastosis

15:1

Decreased

Not observed

Predominant lymphocytosis (55%)

Lymphocytosis (60%)

Moderate to severe hemophagocytosis (3+); (>5 histiocytes with hemophagocytosis/10 Hpf).

Large intracytoplasmic MPO-positive granules within the granulocytes and monocytes

Moderate hemophagocytosis (2+); (2-5 histiocytes with hemophagocytosis/10 Hpf).

Many large coarse MPO-positive intracytoplasmic granules in the granulocytes, lymphocytes, and monocytes.

Megakaryocytes Diff. Counts Other comments

Chediak-Higashi syndrome-peripheral blood pancytopenia and marked hemophagocytosis (Figure 2) on bone marrow aspirate, along with lymphocyte infiltration on trephine biopsy section. Both cases were negative for HIV, CMV, and EBV serology.

Figure 1: Large intracytoplasmic granules in a granulocytic cell (Giemsa stained bone marrow aspirate film; 1000×).

Figure 2: Hemophagocytosis in bone marrow smear (Giemsa stain; 1000×). g/dL and 3.9 g/dL; WBC: 4 × 109/L and 3 × 109/L; platelet count: 8 × 109/L and 6 × 109/L. Bone marrow aspiration findings in both cases are shown in the Table 1. Both patients had hematological findings characteristic of the accelerated phase of 86

The genetic hallmark of Chediak-Higashi syndrome is mutations in the CHS1/LYST gene. The gene product is known to regulate lysosomal organelle function and size. The mutations could not be characterized in the presented cases because the DNA material for analysis was insufficient in one case and the other died due to the fulminant accelerated phase before hematological diagnosis was established. It is well known that Chediak-Higashi syndrome patients with deletions in the LYST gene usually present with a fulminant accelerated phase early in life, whereas those with missense mutations have a relatively better prognosis characterized by the absence of an accelerated phase and no neurological involvement [5].

The hematological findings of pancytopenia and hemophagocytosis suggest a possible deletion in the LYST gene in both of the presented cases, but ethnicity data and complete DNA analysis are needed to further substantiate the findings; nonetheless, both cases presented with the characteristic clinical and hematological profiles diagnostic of Chediak-Higashi syndrome.

Careful examination of peripheral blood film in suspected cases can facilitate early diagnosis and further evaluation. In addition, recognition of early cytopenias should alert clinicians and hematologists of an impending accelerated phase. Furthermore, bone marrow aspiration is a useful diagnostic procedure for identifying tissue hemophagocytosis in such patients.

Key Words: Accelerated phase, Chediak Higashi, Hematology Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2013;30:85-87

Bharti S, et al: Accelerated Phase of Chediak-Higashi

References 1. Kaplan J, De Domenico I, Ward DM. Chediak-Higashi syndrome. Curr Opin Hematol 2008;15:22-29.

2. Barak Y, Nir E. Chediak-Higashi syndrome. Am J Pediatr Hematol Oncol 1987;9:42-55.

3. Usha HN, Preetha D Prabhu, Sridevi M, Baindur K, Balakrishnan CM. Chediak-Higashi Syndrome. Indian Pediatrics 1994;34:1115-1119.

4. Blume RS, Wolff SM. The Chediak-Higashi syndrome: studies in four patients and a review of the literature. Medicine (Baltimore) 1972;51:247-280.

5. Scherber E, Beutel K, Ganschow R, Schulz A, Janka G, Stadt Uz. Molecular analysis and clinical aspects of four patients with Chediak-Higashi syndrome (CHS). Clin Genet 2009;76:409-412.

87

DOI: 10.4274/tjh.2012.0016

Letter to the Editor

Fasciola Hepatica Infection as a Cause of Severe Hypereosinophilia Şiddetli Hipereozinofilinin Nedeni Olarak Fasciola Hepatika Enfeksiyonu Meriç Kaymak Cihan2, Cahit Babür2, Lale Olcay1 1Dr.

Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital Department of Pediatric Hematology, Ankara, Turkey

2Ankara

Refik Saydam Hygiene Institute, Directorate of Epidemics Research Parasitological Laboratory, Ankara, Turkey

To the Editor, Eosinophilia is considered as severe at levels of >5 × 109/L [1]. In childhood, the causes of severe eosinophilia are parasitic infections (visceral larva migrans, trichinosis, hookworm diseases, ascariasis, strongyloidiasis, fascioliasis), allergic disorders, malignant diseases (eosinophilic leukemia, Hodgkin disease, hypereosinophilic syndromes), and some collagen tissue diseases [2].

A boy from a rural area of Turkey, aged 6 years and 10 months, was admitted to our clinic with abdominal pain and severe hypereosinophilia. He had lately developed abdominal pain at the umbilical area, waxing and waning in character. His physical examination was unremarkable.

His laboratory tests are presented in Table 1.

Since no blast was found in the peripheral blood smear of the patient, secondary causes of hypereosinophilia were investigated.

Multiple tests for parasitic infections and collagen tissue disorders were performed (Table 1). Tests for Echinococcus granulosus indirect hemagglutination (IHA) (1/320; normal: <1/160) and Fasciola hepatica IHA (1/5120; normal: <1/160) were positive. A hypodense lesion of 6 × 4 cm was found in the left lobe of the liver upon computed tomography and ultrasonography. Until the Echinococcus granulosus-specific IgE test was revealed to be negative, the patient was given 2 doses of albendazole at 15 mg/kg/day. After 2 weeks, IHA tests for Fasciola hepatica and

Echinococcus granulosus were repeated, which were again positive at 1/5120 (normal: <1/160) and 1/320 (normal: 1/160), respectively.

The mildly high Echinococcus granulosus IHA was considered to be a cross-reaction with Fasciola hepatica. The parents reported that they had been consuming spring water. For treatment of Fasciola hepatica infection, the patient was given 2 doses of triclabendazole at 10 mg/kg/dose, 1 week apart. The eosinophil counts 1 and 4 months following the second dose declined to 0.64 × 109/L (7.8%) and 0.468 × 109/L (4%), respectively, with no symptoms.

Fasciola hepatica, a liver fluke, is observed in areas of sheep farming and is common in developing countries [3]. More than 180 million people are at risk of Fasciola hepatica infection and 2.4 million people are already infected with this parasite [4].

Eosinophilia is encountered in 14%-82% of patients and may wax and wane during the chronic stage [5,6].

In fascioliasis, liver lesions may be present and bile ducts may be observed as thickened and dilated in tomography [7,8].

Fasciola hepatica eggs in stool are generally observed in the acute phase but not in the chronic phase [6]. Serological tests including enzyme-linked immunosorbent assay (ELISA), IHA, complement-fixation, immunofluorescence, counter electrophoresis, and double diffusion are in use. However, all of these sensitive methods may still yield cross-reaction in parasitic infections like Echinococcus [7].

Address for Correspondence: Meriç Kaymak Cihan, M.D. Dr. Abdurrahman Yurtaslan Ankara Oncology Training and Research Hospital Department of Pediatric Hematology, ankara, Turkey Gsm: +90 312 336 09 09/7448 E-mail: cigdemusul@yahoo.com Received/Geliş tarihi : February 5, 2012 Accepted/Kabul tarihi : November 14, 2012

88

Turk J Hematol 2013;30:88-90

Cihan KM, et al: Fasciola Hepatica Infection as a Cause of Severe Hypereosinophilia

Table 1: Laboratory test results of the patient.

Tests

Results

Complete Blood Count

White blood cells: 36,920 × 109/L; hemoglobin: 143 g/L; platelet count: 397 × 109/L

Peripheral Blood Smear

11% polymorphonuclear leucocytes, 66% eosinophils, 5% eosinophilic bands, 17% lymphocytes, and 1% neutrophilic bands; eosinophil count yielding 23,840 × 109/L

IgA / IgM / IgG

81.4 mg/dL (normal: 70-303) / 223 mg/dL (normal: 69-387) / 1650 mg/dL (normal: 764-2134)

IgE

4328 kU/L (normal: 0-100 kU/L)

Toxocara IgG

Negative

Toxoplasma IgM / IgG

Negative / Negative

Sabin–Feldman Dye Test

Negative

Leishmania IgM / IgG

Negative / Negative

Echinococcus granulosus indirect hemagglutination (IHA)

1/320 ( normal: <1/160)

Fasciola hepatica IHA

1/5120 (normal: <1/160)

Echinococcus granulosus-specific IgE

Negative

Direct Coombs Test / Indirect Coombs Test

Negative / Positive

Collagen Tissue Disease Markers

Negative

Abdominal Ultrasonography

Hepatomegaly and a hypoechoic area of 46 × 33 mm in size without regular contours observed in left lobe of liver

Abdominal Computed Tomography

Hypodense lesion of 6 × 4 cm observed in left lobe of liver along with dilatation of in trahepatic bile ducts at lateral segment of left lobe of liver

Stool Examination, 5 Times

Negative

Anal Band Test

Negative

For treatment of Fasciola, 2 doses of triclabendazole, at 10 mg/kg/dose 1 week apart, are recommended [6].

Fascioliasis develops by the taking in of metacercarial cysts through consumption of aquatic plants (watercress in particular), or of contaminated water like in our case [6]. Fascioliasis can be prevented by taking hygienic precautions. Prognosis is excellent with appropriate treatment.

Long-duration and repetitive antigen exposure to T lymphocytes by parasites gives rise to excess production of interleukin (IL)-5, IL-4, and IL-13 by the T cells, which stimulates proliferation and survival of eosinophils [9].

Our case highlights that in severe eosinophilia, fascioliasis must also be considered, particularly when patients are from rural sheepbreeding areas and drink spring water.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Roufosse F, Weller PF. Practical approach to the patient with hypereosinophilia. J Allergy Clin Immunol 2010;1:39-44.

89

Cihan KM, et al: Fasciola Hepatica Infection as a Cause of Severe Hypereosinophilia

2. Wagelie-Steffen A, Aceves SS. Eosinophilic disorders in children. Curr Allergy Asthma Rep 2006;6:475-482.

3. Adel AFM. Trematodes and Other Flukes. In: Mandell GL, Bennet JE, Dolin R (eds). Principles and Practice of Infectious Diseases, 5th ed. Philadelphia, Churchill Livingstone, 2000; 2954-2956.

4. World Health Organization. Risk Control of Foodborne Trematode Infection. WHO Technical Series No. 849. Geneva, WHO, 1995: 157.

5. el-Shabrawi M, el-Karaksy H, Okasha S, el-Hennawy A. Human fascioliasis: clinical features and diagnostic difďŹ culties in Egyptian children. J Trop Pediatr 1997;43:162-166.

90

Turk J Hematol 2013;30:88-90

6. Fried B, Abruzzi A. Food-borne trematode infections of humans in the United States of America. Parasitol Res 2010;106:1263-1280.

7. Noyer CM, Coyle CM, Werner C, Dupouy-Camet J, Tanowitz HB, Wiitner M. Hypereosinophilia and liver mass in an immigrant. Am J Trop Med Hyg 2002;66:774-776.

8. Demirci M, Korkmaz M, Kaya S, Kuman A. Fascioliasis in eosinophilic patients in the Isparta region of Turkey. Infection 2003;31:15-18.

9. Lampinen M, Carlson M, Hakansson LD, Venge P. Cytokineregulated accumulation of eosinophils in inďŹ&#x201A;ammatory disease. Allergy 2004;59:793-805..

DOI: 10.4274/tjh.2012.0121

Letter to the Editor

National Thalassemia Prevention Campaign: The Talotır Project Ulusal Talasemi Önleme Kampanyası: Talotır Projesi Duran Canatan1, Yeşim Aydınok2, Yurdanur Kılınç3, Zeynep Karakaş4, İlgen Şaşmaz3, Hilmi Apak5, Nazan Sarper6 1Mediterranean Blood Diseases Foundation, Hemoglobinopathy Diagnosis Center, Antalya, Turkey 2Ege University, Department of Pediatric Hematology, İzmir, Turkey 3Çukurova University, Department of Pediatric Hematology, Adana, Turkey 4İstanbul University, Çapa Medical Faculty, Department of Pediatric Hematology, İstanbul, Turkey 5İstanbul University, Cerrahpaşa Medical Faculty, Department of Pediatric Hematology, İstanbul, Turkey 6Kocaeli University, Department of Pediatric Hematology, Kocaeli, Turkey

To the Editor, Thalassemia and abnormal hemoglobins are a serious health problem throughout the world. The first preventive and educational studies were begun in Italy in the 1970s by the World Health Organization [1]. In Turkey, very important steps for treating thalassemia have been taken since 2000. The Turkish National Hemoglobinopathy Council (TNHC) was created to combine all relevant centers, foundations, and associations into one organization together with the Ministry of Health (MOH) in 2000. New regulations were issued by the MOH and TNHC in 2002. Data on patients with thalassemia and hemoglobinopathies were collected from all 81 provinces in Turkey and revealed a map of hemoglobinopathy in Turkey in 2002. A hemoglobinopathy control program (HCP) was begun in 33 provinces in 2003 [2].

The Thalassemia Federation was established as a civil society organization in 2005. The National Thalassemia Prevention Campaign (NTPC) was organized for public education and support of the HCP by the Thalassemia Federation. The aim of this campaign was to educate different parts of the population and raise awareness about thalassemia and hemoglobinopathies in Turkey.

The Thalassemia Federation arranged an assembly to plan and design this project with representatives from the MOH, Ministry of the Interior, Ministry of Education, and Ministry of Religious

Affairs before the NTPC. Master slides including both public and health workers’ education programs were prepared by a scientific committee. A long-term project called Talotır was specially designed for education and training.

A total of 23 provinces in Thrace and the western and southern Anatolia regions, including a population of about 50 million with high incidences of thalassemia, were chosen for Talotır. The target population for education primarily comprised doctors, other healthcare staff, teachers, students, officials, religious leaders, and patients and their families, in addition to the public.

The Talotır educational tour was launched at Taksim Square in İstanbul on 8 May 2007, World Thalassemia Day, and concluded in Antalya on 23 December of that year.

As a result, a total of 62,682 people were educated in those 8 months in 23 provinces. This represents 0.12% of the total population living in those 23 provinces being educated about thalassemia, with raised awareness in the broader population by the press and media in Turkey.

According to reports by the MOH, while premarital screening tests were done in 30% of all marriages in 2003, this rate reached 81% in 2008. As the result of these screenings, the number of infants born with thalassemia was decreased by 87% in 2008.

Address for Correspondence: Duran CANATAN, M.D., Mediterranean Blood Diseases Foundation, Hemoglobinopathy Diagnosis Center, Antalya, Turkey Tel.: +90 242 243 20 20 E-mail: durancanatan@gmail.com Received/Geliş tarihi : September 01, 2012 Accepted/Kabul tarihi : November 14, 2012

91

Turk J Hematol 2013;30:91-92

Canatan D, et al: Thalassemia Prevention

The objectives of the HCP were to control and ultimately to eradicate thalassemia and hemoglobinopathies in Turkey. The success of preventive programs depends on educational programs and campaigns [3]. This campaign provided very important support to the HCP in Turkey, because a total of 62,682 people (0.12% of the total population), including healthcare workers, students, teachers, officials, religious leaders, and others, were educated about thalassemia and hemoglobinopathies.

In conclusion, educational programs are very important for prevention thalassemia and hemoglobinopathy. Campaigns and educational programs will continue for a Turkey without thalassemia in next years.

Acknowledgments: We would like to thank all trainers of the educational program, the representatives of the Ministry for planning, and Novartis Oncology for financial support.

Key Words: Thalassemia, Prevention, Campaign

92

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interest, relationship, and/or affiliations relevant to the subject matter or materials included.

References 1. Modell B, Darlison M. Global epidemiology of hemoglobin disorders and derived service indicators. Bull World Health Organ 2008;86:480-487.

2. Canatan D, Kose MR, Ustundağ M, Haznedaroglu D, Ozbaş S. Hemoglobinopathy control program in Turkey. Community Genet 2006;9:124-126.

3. Ministry of Health Mother and Child Heath General Directorate. Hemoglobinopathy control program. Turkiye Klinikleri J Hem Onc - Special Topics 2010;3:5-8.

DOI: 10.4274/tjh.37891

Letter to the Editor

Low HbA2 Level in β-Thalassemia Trait β-Talasemi Taşıyıcıda HbA2 Düzeyi Düşüklüğü Şinasi Özsoylu Retired Professor of Pediatrics, Hematology, and Hepatology Honorary Fellow of American Academy of Pediatrics Honorary Member of American Pediatric Society Fellow of Islamic World Academy of Sciences

Reply

To the Editor, Dr. Köseler and her colleagues reported the presence of δthalassemia in 3 out of 12 patients carrying the β-thalassemia trait with low HbA2 in the recent issue of this journal without giving any explanations for the remaining 9 cases (2012; 29: 289-290) [1].

I wish that they would also look for the presence of αthalassemia, at least in those 9 cases, because this seems to be the more prevalent type of thalassemia in our country, as first shown by us [2,3] and as further supported by Canatan et al. in this journal [4].

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References

We are thankful for the valuable comments of Prof. Dr. Şinasi Özsoylu in regard to our letter entitled “HbA2-Yokoshima (delta 25(B7)Gly-Asp) and HbA2-Yialousa (delta 27(B9)Ala-Ser) in Turkey”, published in the Turkish Journal of Hematology (2012; 29: 289-290).

We reported in our letter the presence of the abnormal hemoglobin variants known as HbA2-Yokoshima and HbA2Yialousa in Denizli Province in Turkey. Our letter was not concerned with delta-thalassemia. Since these delta variants could affect the value of HbA2 in beta-thalassemia carriers in laboratory diagnosis, we emphasized the importance of that effect.

Unfortunately, we have neither the data nor the observation and concern for the possible effect of alpha-thalassemia on the laboratory value of HbA2 in our letter.

Aylin Köseler, Ayfer Atalay, Erol Ömer Atalay

1. Köseler A, Atalay A, Atalay ÖE. HbA2-Yokoshima (delta 25(B7)Gly >Asp) and Hb A2-Yialousa (delta 27(B9)Ala>Ser) in Turkey. Turk J Hematol 2012;29:289-290.

2. Özsoylu Ş, Malik SA. Incidence of alpha-thalassemia in Turkey. Turk J Pediatr 1982;24:235-244.

3. Özsoylu Ş. The incidence of alpha-thalassemia in Antalya, Turkey. Turk J Hematol 2003;20:113.

4. Canatan D, Özdemir Z, et al. The studies of thalassemia. Turk J Hematol 2002; 19(3): 433-434.

Address for Correspondence: Şinasi ÖZSOYLU, M.D. Beysukent Altınşehir Sitesi No: 30 Ankara, Turkey Phone: +90 312 235 41 88 E-mail: sinasiozsoylu@hotmail.com Received/Geliş tarihi : November 14, 2012 Accepted/Kabul tarihi : November 14, 2012

1

93

DOI: 10.4274/tjh.02703

Letter to the Editor

About the Treatment of Kasabach-Merritt Syndrome Kasabach-Merritt Sendromu Tedavisi Hakkında Şinasi Özsoylu Retired Professor of Pediatrics, Hematology, and Hepatology Honorary Fellow of American Academy of Pediatrics Honorary Member of American Pediatric Society Fellow of Islamic World Academy of Sciences

To the Editor, Dr. Emre and colleagues briefly reported on a 24-year-old female with Kasabach-Merritt syndrome in the most recent issue of this journal [1].

Three units of fresh frozen plasma were administrated within 3 days to the patient for the correction of severe hypofibrinogenemia despite a very high D-dimer level (5000 ng/mL), both of which reflected consumption coagulopathy, as stated by the authors.

Although post-transfusion laboratory findings were not reported and consumption coagulopathy did not seem to be aggravated in the authors’ patient, I would like to draw attention to the complication of substrate supplementation in consumption coagulopathy cases without the taking of necessary precautions.

On such an occasion, I urge our approach of mega-dose methylprednisolone treatment (MDMP; daily, 30 mg/kg for 3 days, then 20 mg/kg for 4 days, and subsequently 10, 5, 2, and 1 mg/kg with each dose administered for 1 week, around 6 AM as a single dose). This was originally given intravenously, but the oral route is now recommended. Although both routes seem to be equally effective, oral administration is more practical, is cheaper, and does not require patient admission [2,3,4,5].

References 1. Emre U, Gökmen A, Özen B, Demiryürek E, Gül Ş, Gökçe D. Spontaneous subdural hematoma associated with KasabachMerritt syndrome: A case report. Turk J Hematol 2012;29:291-292.

Address for Correspondence: Şinasi ÖZSOYLU, M.D. Beysukent Altınşehir Sitesi No: 30 Ankara, Turkey Phone: +90 312 235 41 88 E-mail: sinasiozsoylu@hotmail.com Received/Geliş tarihi : November 14, 2012 Accepted/Kabul tarihi : November 14, 2012

94

2. Özsoylu Ş, İrken G, Gürgey A. High dose intravenous methylprednisolone for Kasabach-Merritt syndrome. Eur J Pediatr 1989;143:403-405.

3. Özsoylu Ş. High dose intravenous methylprednisolone (HIVMP) in hematologic disorders. Hematol Rev 1990;4:197-207.

4. Özsoylu Ş, Ertürk G. Oral megadose methylprednisolone for childhood acute idiopathic thrombocylopenic purpura. Blood 1991;77:1856-1857.

5. Özsoylu Ş. How should glucocorticoids be used? Turk J Med Sci 2007;37:123-124.

Reply Dear Editor, We have appreciated the valuable contributions of Prof.Dr. Şinasi ÖZSOYLU. Fresh frozen plasma (FFP) is among the options for treatment in KMS as well as steroid therapy. As intracranial haemorrhage was present in our case, FFP was preferred initially for the treatment of hypofibrinogenemia. As there was not any systemic complication during the clinical course; steroid treatment was not commenced during the follow-up. During the follow up, there has not been observed clinical complication associated with FFP treatment. We have not observed any complications during the FFP treatment during the follow-up. Certainly, it is imperative to pay utmost care in terms of KMS treatment algorithms and therapeutic complications because of the continuous presence of coagulopathic condition in these patients.

With regards Ufuk Emre

DOI: 10.4274/tjh.03779

Letter to the Editor

Megadose Methylprednisolone (MDMP) For Granulocytic Sarcoma (GS) Granülositik Sarkom (GS) Tedavisinde Megadoz Metilprednizolon (MDMP) Şinasi Özsoylu Retired Professor of Pediatrics, Hematology, and Hepatology Honorary Fellow of American Academy of Pediatrics Honorary Member of American Pediatric Society Fellow of Islamic World Academy of Sciences

To the Editor, Baytan et al.’s case report entitled, Cerebellar granulocytic sarcoma: A case report (2012; 19: 177-180), [1] provides an opportunity for me to remind physicians that short-course megadose methylprednisolone (MDMP: 30 mg/kg for 3 d, then 20 mg/kg for 4 d each dose administered over the course of 10-15 min intravenously or orally; calculated dose of powder put into a spoon and then covered with honey and administered before 0600), has been effectively used for the treatment of granulocytic sarcoma (GS) [2,3,4,5]. With this treatment extramedullary relapse rarely occurs, even in patients that develop bone marrow relapse [2].

Administration of MP early in the morning usually prevents the occurrence of steroidal side effects, most likely due to preservation of ACTH steroid homeostasis. This treatment should be considered for the treatment of GS, as it is less expensive, more convenient, and easy to administer orally at home. I would like to emphasize that to the best of my knowledge neutrophilic sepsis has not been reported in association with this treatment [2,5].

References 1. Baytan B, Evim MS, Güneş MA, Kocaeli H, Balaban Ş, Korfalı E. Cerebellar granulocytic sarcoma: A case report. Turk J Hematol 2012;29:177-180 2. Hiçsönmez G, Özsoylu S, Tuncer M, Erer B. High dose intravenous methylprednisolone in the treatment of acute non-lymphoblastic leukemia with ocular involvement. Turk J Pediatr 1988;30:181-183.

3. Hiçsönmez G, Ozbek N, Kale G, Erdem G, Bilgiç S, Hazar V. Dramatic effects of high dose methylprednisolone on orbital granulocytic sarcoma. Pediatr Hematol Oncol 1996;13187190.

4. Özsoylu Ş. Megadose methylprednisolone for granulocytic sarcoma. Acta Haematol 2001;105:118.

5. Özsoylu Ş. Megadose methylprednisolone for granulocytic sarcome. Turk J Hematol 2009;26:213.

Address for Correspondence: Şinasi ÖZSOYLU, M.D. Beysukent Altınşehir Sitesi No: 30 Ankara, Turkey Phone: +90 312 235 41 88 E-mail: sinasiozsoylu@hotmail.com Received/Geliş tarihi : November 14, 2012 Accepted/Kabul tarihi : November 14, 2012

95

DOI: 10.4274/tjh.48265

Letter to the Editor

Autoerythrocyte Sensitization Syndrome Treated with Kallikrein Inhibitor Kallikrein İnhibitörü ile Tedavi Edilen Otoeritrosit Sensitizasyon Sendromu Sevgi Gözdaşoğlu Retired Professor of Pediatrics, Hematology

To the Editor, I read the letter related to autoerythrocyte sensitization syndrome in a 7-year-old boy published in the Turkish Journal of Hematology [1]. I would like to remark on a few points that were not mentioned in that study. Autoerythrocyte sensitization syndrome was first described in 1972 by Karaca et al. from Turkey.

They reported in detail on all characteristics in 2 patients, 19- and 23-year-old women [2,3], and a girl having severe emotional problems along with Gardner-Diamond syndrome was reported as the first childhood case in 1974 in our department [4].

The noteworthy characteristic of these ecchymoses is that they begin with local itching, burning, or pain before the lesions appear.

Skin lesions are found to be correlated with periods of increased psychic stress and these patients are prone to hysteria, masochism, depression, and anxiety. The relationship between the syndrome and an underlying psychiatric disorder has been clearly emphasized. Although the etiological component of emotional stress in the formation of the lesions is not clear, the neuroimmune system is postulated as a mediator in the appearance of lesions.

Gastrointestinal bleeding, epistaxis, hematuria, abdominal pain, diarrhea, nausea and vomiting, syncopal attacks, chest pain, headache, and menometrorrhagia are other findings or complaints in these patients [5,6].

The pathogenesis of autoerythrocyte sensitization syndrome remains unclear.

Address for Correspondence: Sevgi GÖZDAŞOĞLU, M.D. Kemer sok. 21/78, Büyükesat, Ankara, Turkey Gsm: +90 312 447 80 46 E-mail: sgozdasoglu@hotmail.com.

Received/Geliş tarihi : December 17, 2012 Accepted/Kabul tarihi : December 17, 2012

96

Agle and Ratnoff identified polypeptides similar to bradykinin occurring in subcutaneous tissues in these patients [7,8]. Leiba et al. reported the possible role of bradykinin in the pathogenesis of the syndrome (DNA sensitization) [9].The kinin-kallikrein system is complex, with several bioactive peptides that are formed in many different compartments. This system plays a role in inflammation, coagulation, sodium homeostasis, sensations of pain, cardioprotective effects of proconditioning, and control of blood pressure [10]. Regulation in venous capillary tonus by fluctuations in the kinin-kallikrein system is suggested [6].

All of these studies suggest to us the treatment of the syndrome with bradykinin inhibitor. In our case, a 20-year-old married woman suffering from nausea, vomiting, abdominal pain, fatigue, and ecchymoses around the lower part of her extremities was admitted to the Department of Gastroenterology of the Ankara University School of Medicine. Characteristic skin lesions were present on the ventral surfaces of her legs. These lesions were painful, edematous, and of 2 to 6 cm in diameter. Physical examination was otherwise within normal limits. Routine laboratory tests and coagulation studies were normal. The skin lesions started spontaneously or following minimal trauma. They were characterized by itching and pain, followed by edematous ecchymoses. Intradermal injection of 0.1 mL of 60% suspension of washed red blood cells from the patient reproduced these characteristic skin lesions while the serum and plasma of the patient and saline were ineffective. The tests were repeated several times and found to be positive. She was diagnosed with

Turk J Hematol 2013;30:96-97

Gözdaşoğlu S,: Autoerythrocyte Sensitization Syndrome Treated with Kallikrein Inhibitor

autoerythrocyte sensitization syndrome and treated with kallikrein inhibitor aprotinin at 2000 IU/kg IV in 8 h [11]. After the treatment, all skin lesions disappeared and the patient received psychological support. The beneficial results obtained with kallikrein inhibitor in this case is suggestive of an important role of the kinin–kallikrein system on the pathogenesis of autoerythrocyte sensitization syndrome.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Okur M, Turan H, Özkan A, Güneş C, Kocabay K. An extremely rare cause of bruising in children: autoerythrocyte sensitization syndrome. Turk J Hematol 2012;29:201-203.

2. Karaca M, Akoğuz Ö, Bölükoğlu B. Otoeritrosit hassasiyeti sendromu. Türk Hematoloji Cemiyeti VII Kongresi. 13-15 April 1972, Ankara. Hematoloji III, s. 111.

3. Karaca M, Akoğuz Ö, Bölükoğlu B. Autoerythrocyte sensitization syndrome. New Istanbul Contrib Clin Sci 1973;10:222-229.

4. Çavdar AO, Gözdaşoğlu S. Gardner-Diamond sendromu. A Ü Tıp Fac Mec 1974;2:344-351.

5. Gottlieb AJ. Autoerythrocyte and DNA sensitivity. In: William JW, Beutler E, Erslev AJ, Lichtman MA, editors. Hematology.

4th ed. McGraw-Hill, New York, 1991, 1441-1444.

6. Miranda JV. Gardner-Diamond’s syndrome: literature review.

Int J Collab Res Int Med Pub Health, at www.readperiodicals .com/2674727381, 2012.

7. Agle DP, Ratnoff OD. Purpura as a psychosomatic entity. Arch Int Med 1962;109:685-694.

8. Groch GS, Finch SC, Rogoway W, Fischer DS. Studies in the pathogenesis of autoerythrocyte sensitization syndrome. Blood 1966;28:19-33.

9. Leiba H, Almog C, Kaufman S, Edery H. Possible role of bradykinin in a patient with recurrent ecchymoses (DNA sensitization). Isr J Med Sci 1972;8:67-74.

10. Campbell DJ. The kallikrein-kinin system in humans. Clin Exp Pharmacol Physiol 2001;28:1060-1065.

11. Gözdaşoğlu S, Türker K, Kandilci U, Kervancıoğlu C, Uzunalimoğlu Ö. Oto eritrositduyarlık sendromu ve kallikrein-inhibitörü (Trasylol R) ile tedavi. A Ü Tıp Fac Mec 1980;43:427-230.

Reply Dear Editor, I thank the author for her polite contribution. Notwithstanding, in the first paragraph, according to her declaration sentence of “Autoerythrocyte sensitization syndrome was first described in 1972 by Karaca et al. from Turkey”, it is understood as is the syndrome had been first defined in Turkey. However, it was first defined in 1955 by Gardner and Diamond, not in Turkey. Thus, the sentence seems to require correction in order not to be misinterpreted, say “Autoerythrocyte sensitization was first defined in 1955 by Gardner and Diamond, and the first case from Turkey was defined in 1972 by Karaca et al. from Turkey”.

I also thank you for your polite message and admirable concern.

Best wishes Mesut Okur, MD

97

Images in Hematology

Simultaneous Detection of B-Cell Chronic Lymphocytic Leukemia and Colon Adenocarcinoma in the Same Mesenteric Lymph Node Aynı Mezenterik Lenf Bezinde B-Hücreli Kronik Lenfositik Lösemi ve Kolon Adenokanserinin Eş Zamanlı Saptanması

A

50-year-old male patient presented with microcytic anemia (hemoglobin: 10.2 g/dL, hematocrit: 33.8%, mean corpuscular volume: 64 fL), leukocytosis of 19.7 x 109/L (lymphocytes of 51.2%, 10x109/L), and normal platelet count.

During the etiological work-up of his anemia an abdominal computed tomography (CT) scan was done, which showed a mass of 6.5x5.5 cm located in the ascending colon and hepatic flexura causing a wall thickening of 20 mm. The thoracic CT was normal. A complete colonoscopy showed an ulcerovegetative lesion in the transverse colon narrowing the lumen and multiple biopsies were performed, which revealed a well-differentiated colon adenocarcinoma. During the surgical removal of the tumor, 4 peripancreatic and 48

A

Keywords: Chronic lymphocytic leukemia, CLL, Colon adenocarcinoma

Ahmet Emre Eşkazan1, Selin Berk2, Ferhat Özden3, Sibel Erdamar3, Nükhet Tüzüner3, Teoman Soysal4

DOI: 10.4274/tjh.2012.0169

B

Figure 1: Adenocarcinoma metastasis and diffuse infiltration of small lymphocytes in the same mesenteric lymph node (A: hematoxylin and eosin, 40×; B: hematoxylin and eosin, 400×).

1Diyarbakır

Training and Research Hospital, Department of Hematology, Diyarbakır, Turkey

2İstanbul

University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, İstanbul, Turkey

3İstanbul

University Cerrahpaşa Faculty of Medicine, Department of Pathology, İstanbul, Turkey

4İstanbul

University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey

Address for Correspondence: Ahmet Emre EŞKAZAN, M.D., Diyarbakır Training and Research Hospital, Department of Hematology, Diyarbakır, Turkey Phone: +90 533 722 73 76 E-mail: emreeskazan@hotmail.com Received/Geliş tarihi : November 06, 2012 Accepted/Kabul tarihi : November 07, 2012

98

Figure 2: CD20 is positive in diffuse lymphoid infiltration, whereas it is negative in metastatic glands (40×).

Turk J Hematol 2013;30:98-99

mesenteric lymph nodes and the perilymphatic fat tissue were resected, which all had diffuse infiltration of atypical lymphocytes.

In one mesenteric lymph node, both invasion of the colon adenocarcinoma and atypical lymphocytes were demonstrated (Figures 1A and 1B). The atypical lymphocytes were immunohistochemically positive for CD20 (Figure 2), Bcl-2, CD23, and CD5 consistent with B-cell chronic lymphocytic leukemia/small lymphocytic lymphoma (B-CLL/SLL). After the patient was referred to the hematology department, flow cytometry was performed from the peripheral blood, which was also consistent with B-CLL/SLL. He had early-stage CLL and so we decided to monitor the disease; the patient was referred to the medical oncology department for the treatment of colon adenocarcinoma.

Patients with CLL have more than twice the risk of developing a second cancer, and this increased incidence is attributed to disease- or therapy-related immunosuppression [1]. The most common types of cancers developing in CLL patients are skin cancers, soft-tissue sarcoma, colorectal and lung carcinoma [2].

The incidental detection of CLL/SLL based on the histological evaluation of the lymph nodes resected for rectal adenocarcinoma is a rare entity [3,4].

The synchronous diagnosis of B-CLL/SLL and colon adenocarcinoma in our case is most probably coincidental.

However in the synchronous presentation of these two malignancies, an epidemiological association has been noted [5], and this synchronous relationship can also be explained in terms of the immunosuppression over a prolonged period of time.

Eşkazan AE, et al: CLL and Colon Adenocarcinoma in the Same Lymph Node

Conflict of Interest Statement All authors have no conflict of interest to declare.

References 1. Tsimberidou AM, Wen S, McLaughlin P, O'Brien S, Wierda WG, Lerner S, Strom S, Freireich EJ, Medeiros LJ, Kantarjian HM, Keating MJ. Other malignancies in chronic lymphocytic leukemia/small lymphocytic lymphoma. J Clin Oncol 2009;27:904-910.

2. Hisada M, Biggar RJ, Greene MH, Fraumeni JF Jr, Travis LB. Solid tumors after chronic lymphocytic leukemia. Blood 2001;98:1979-1981.

3. Dennis RJ, Alberts JC. The implications of an incidental chronic lymphocytic leukaemia in a resection specimen for colorectal adenocarcinoma. World J Surg Oncol. 2007;5:126.

4. Silvestris N, Zito FA, Fiore MG, Simone G, Tommasi S, Izzi G, Guarini A, Colucci G. Synchronous presentation of B-cell chronic lymphocytic leukemia/small-cell lymphoma and colon adenocarcinoma within the mesenteric lymph nodes and a single liver metastasis. J Clin Oncol 2011;29:e11-13.

5. Kyasa MJ, Hazlett L, Parrish RS, Schichman SA, Zent CS. Veterans with chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL) have a markedly increased rate of second malignancy, which is the most common cause of death. Leuk Lymphoma 2004;45:507-513.

99

Images in Hematology

Blue Lunula Related with Hydroxyurea Hidroksiüre İlişkili Mavi Lunula

Figure 1: Blue pigment changes in the lunula regions of hand nails

Keywords: Neoplasia, Hematopoiesis Hava Üsküdar Teke1, Abdülsamet Erden2 1Eskişehir Osmangazi University, Faculty of Medicine, Department of

Hematology, Eskişehir, Turkey 2Kayseri Education and Research Hospital, Internal Medicine, Kayseri, Turkey

Address for Correspondence: Hava ÜSKÜDAR TEKE, M.D., Eskişehir Osmangazi University, Faculty of Medicine, Department of Hematology, Eskişehir, Turkey Phone: +90 222 239 29 79 E-mail: havaus@yahoo.com Received/Geliş tarihi : October 30, 2011 Accepted/Kabul tarihi : May 10, 2012

100

H

DOI: 10.4274/tjh.2011.0016

ydroxyurea, which is an inhibitor of ribonucleoside reductase and is used as a systemic antitumor agent, is frequently used for the treatment of myeloproliferative and hematologic diseases. While the most common side effect is myelosuppression, gastrointestinal symptoms such as nausea, vomiting, stomatitis, and anorexia and rash, skin ulcers, hyperpigmentation in nails, and dermatologic toxicities like facial erythema may also be observed. At higher dosages, neurologic symptoms may be rarely seen (1,2).

A 76-year-old female patient applied to the hematology polyclinic in August 2010 complaining about weakness. She had no other diseases except for hypertension. She had used acetylsalicylic acid (ASA) and an angiotensin receptor antagonist. In her examinations it was found that her white blood cell count was 13.7 × 103/μL, hemoglobin level was 14.8 g/dL, mean corpuscular volume was 60 fL, and platelet level was 1161 × 103/μL. Among biochemical parameters, her potassium level was 5.9 meq/L, lactate dehydrogenase was 319 IU/L, sedimentation was 12 mm/h, ferritin was 22.9 μg/L and fibrinogen was normal, and C-reactive protein was normal. In her physical examination, it was seen that her liver was 1-2 cm palpable under the costa, Traube’s space was closed, and the spleen was 1-2 cm palpable under the costa. The thrombocytes were increased in the peripheral blood smear and defective thrombocytes were present. Her history revealed that her thrombocyte level was 787 × 103/μL in 2008 and 1097 × 103/μL in 2009. Bone marrow aspiration and biopsy were carried out considering essential thrombocythemia. The JAK-2 V617F gene mutation was determined to be positive and Ph chromosome was determined to be negative. Her bone marrow biopsy was observed as hypercellular and megakaryocytes were observed, including multilobular nucleotides, which increased in number and were generated as clusters. After the essential thrombocythemia diagnosis, the patient was treated with hydroxyurea (1000 mg/day). It was also recommended that she continue using ASA. The patient came for follow-up after 3 weeks. In her physical examination, it was seen that blue pigment changes were present in the lunula regions of the nails of both hands and feet (see Figure 1). It was determined that the PT-PTTINR-fibrinogen level was normal, hemoglobin level was 13.6 g/dL, platelet count was 583 × 103/μL, and white blood cell count was 8.1 × 103/μL. It was found that the pigment changes in the nails of the patient were caused by hydroxyurea; use of hydroxyurea was stopped and replaced by use of anagrelide. When the patient came for examination after 2 further weeks, her nail lesions were decreased, and after the fourth week, these lesions had completely disappeared.

It is known that hydroxyurea, which is a ribonucleoside reductase inhibitor and is used as a systemic antitumor agent

Turk J Hematol 2013;30:100-101

in hematologic diseases, causes brown pigmentation in nails.

However, blue lunula related with hydroxyurea is rarely observed (2,3). In our study the blue color change (lunular pigmentation) occurred in both hand and foot lunula regions 3 weeks after the start of the treatment, and 4 weeks after the cessation of hydroxyurea, the color returned to normal.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Teke HÜ: Blue lunula Related with Hydroxyurea

References 1. Hoffman R, Furie B, McGlave P, Silberstein LE, Shattil SJ, Benz EJ, Heslop H (eds). Hematology: Basic Principles and Practice, fifth edition. Philadelphia, Churchill Livingstone, pp. 882-883.

2. Kumar B, Saraswat A, Kaur I. Mucocutaneous adverse effects of hydroxyurea: a prospective study of 30 psoriasis patients.

Clin Exp Dermatol 2002;27:8-13.

3. Jeevankumar B, Thappa DM. Blue lunula due to hydroxyurea.

J Dermatol 2003;30:628-630.

101