tjh-2013-2

Review

DOI: 10.4274/Tjh.2013.0029

Physiopathology, Etiologic Factors, Diagnosis, and Course of Polycythemia Vera as Related to Therapy According to William Dameshek, 1940-1950 William Dameshek’e (1940-1950) Göre Tedavi Açısından Polistemia Vera’nın Fizyopatolojisi, Etiyolojik Faktörleri, Tanısı ve Seyri Jan Jacques Michiels, Goodheart Institute & Foundation, Freedom of Science and Education Thrombocythemia Vera Study Group, TVSG and European Working Groups on Myeloproliferative Neoplasms: EWG.MPN Erasmus University Medical Center, Rotterdam, the Netherlands

Abstract: According to Dameshek, true polycythemia (polycythemia vera: PV) is a chronic myeloproliferative disorder of the total bone marrow without any evidence of invasiveness, in which erythrocytosis, leukocytosis, and thrombocytosis are all simultaneously present. A possible hereditary or transmitted tendency may be present, but actual familial polycythemia is rare. As to the etiology, Dameshek proposed 2 highly speculative possibilities in 1950: the presence of excessive bone marrow stimulation by an unknown factor or factors, and a lack or a diminution in the normal inhibitory factor or factors. Dameshek’s hypothesis was confirmed in 2005 by Vainchenker in France by the discovery of the acquired JAK2V617F mutation as the cause of 3 phenotypes of classical myeloproliferative neoplasms: essential thrombocythemia, PV, and myelofibrosis. The JAK2V617F mutation induces a loss of inhibitory activity of the JH2 pseudokinase part on the JH1 kinase part of Janus kinase 2 (JAK2). This leads to enhanced activity of the normal JH1 kinase activity of JAK2, which makes the mutated hematopoietic stem cells hypersensitive to the hematopoietic growth factors thrombopoietin, erythropoietin, insulin-like growth factor-1, stem cell factor, and granulocyte colony-stimulating factor, resulting in trilinear myeloproliferation. In retrospect, the situation observed by Dameshek where all “stops” to blood production in the bone marrow are pulled in PV is caused by the JAK2V617F mutation.

Dameshek considered PV patients as fundamentally normal and therefore the treatment should be as physiologic as possible. For this reason, a systematic phlebotomy/iron deficiency method of treatment was recommended; the use of radioactive phosphorus is reserved for refractory cases and cases of major thrombosis. If the patient lives long enough and does not succumb to the effects of thrombosis or other complications, the marrow will gradually show signs of diminished activity. The blood smear shows nucleated red cells, increased polychromatophilia, and immature granulocytes of various types. With increasing reduction of erythropoietic tissue, myelofibrosis becomes more of an organized mass of fibrous tissue. There is prominent extramedullary hematopoiesis in the spleen, which becomes extraordinarily large and in some cases occupies almost the entire abdominal cavity. The enlarged spleen is made up largely of metaplastic marrow tissue in primary myeloid metaplasia of the spleen.

Key Words: Physiopathology, Etiologic Factors, Diagnosis, Polycythemia Vera

Address for Correspondence: Jan Jacques MICHIELS, M.D., Goodheart Insitute, Rotterdam - Blood Bloodcoagulation Erasmus Tower Veenmos 13 Rotterdam South Holland 3069 AT, Netherlands E-mail: goodheartcenter@upcmail.nl Received/Geliş tarihi : January 28, 2013 Accepted/Kabul tarihi : January 31, 2013

102

Turk J Hematol 2013;30:102-110

Michiels JJ: Dameshek Trilinear PV

Özet: Dameshek’e göre gerçek polistemi (polistemia vera: PV) eş zamanlı eritrositoz, lökositoz ve trombositozun olduğu, yayılma özelliği göstermeyen, tüm kemik iliğini ilgilendiren miyeloproliferatif bir hastalıktır. Olası kalıtsal veya iletilebilme eğilimi olabilir, ancak gerçek ailevi polistemi nadirdir. Etyolojiye yönelik olarak Dameshek 1950’de iki çok tartışmalı olasılık ileri sürmüştür: bilinmeyen faktör veya faktörlerce kemik iliğinin aşırı uyarılması ve normal baskılayıcı faktör veya faktörlerin eksikliği veya olmaması. Dameshek’in hipotezi 2005 yılında Fransa’da Vainchecker tarafından 3 klasik miyeloproliferatif neoplazinin fenotipinin nedeni olarak edinsel JAK2V617F mutasyonunun keşfi ile ispatlandı: esansiyel trombositemi, PV ve miyelofibroz. JAK2V617F mutasyonu Janus kinaz 2 (JAK2)’nin parçası JH1 kinaz üzerinde yer alan JH2 yalancı kinazın baskılayıcı aktivitesinin kaybına neden olmaktadır. Bu durum JAK2’nin normal JH1 kinaz aktivitesinin artışına neden olarak mutasyona uğramış hematopoetik kök hücrelerini trombopoetin, eritropoetin, insulin-benzeri büyüme faktörü-1, kök hücre faktörü ve granülosit koloni uyarıcı faktor gibi hematopoetik büyüme faktörlerine karşı ileri derecede hassaslaştırmak suretiyle her üç seride miyeloproliferasyona neden olmaktadır. Sonuç olarak, Dameshek tarafından gözlemlenen durum PV’da kemik iliğinde kan üretiminini sınırlayan tüm kontrol basamaklarının JAK2V617F mutasyonu ile ortadan kaldırıldığıdır.

Dameshek PV hastalarını özünde normal olarak değerlendirdiğinden tedavinin mümkün olduğunca fizyolojik olması gerekmekteydi. Bu nedenle, sistematik flebotomi/demir eksikliği tedavi metodu önerildi; radyoaktif fosfor kullanımı dirençli ve major trombozu olan hastalara saklandı. Hasta yeterince uzun yaşar ve tromboz etkisi ya da diğer komplikasyonlara bağlı kaybedilmezse, ilik giderek azalan aktivite belirtileri gösterecektir. Kan yaymasında çekirdekli eritrositler, artmış polikromatofili, değişik tiplerde olgunlaşmamış granülositler izlenir. Eritropoetik dokunun gittikçe azalmasıyla, miyelofibroz daha çok organize bir fibröz doku kitlesine dönüşür. Aşırı büyüyen ve bazı olgularda tüm karın boşluğunu dolduran dalakta belirgin ekstramedüller hematopoez vardır. Büyümüş dalak, büyük ölçüde dalağın primer miyeloid metaplazisi alanında yerleşen metastatik kemik iliğinden meydana gelir.

Anahtar Sözcükler: Fizyopatoloji, Etyolojik faktörler, Tanı, Polistemia Vera Introduction In 1940, Dameshek and Henstell [1] described 20 cases of polycythemia vera (PV) and recognized certain symptoms, signs, and laboratory tests that, when pieced together, spelled out the diagnosis of “primary” or “true” polycythemia. Dameshek (Figure 1) proposed the following groups of symptoms, signs, and laboratory features for the diagnosis of primary polycythemia or PV: Symptoms Headache, vertigo, visual disturbances, colored scotoma, acroparesthesias.

Symptoms referable to vascular disturbances of the extremities.

History of profuse hemorrhage after minor trauma.

History of venous and arterial thrombosis.

Signs Plethoric appearance of the face and conjunctivae, dilated retinal veins, splenomegaly, and hepatomegaly.

Red hands and feet and distended capillaries.

Laboratory Features: Blood and Bone Marrow Elevated erythrocyte counts (above 6x1012/L), hemoglobin percentage, leukocyte and platelet counts, and hematocrit and polymorphonuclear percentage, together with red cell hyperplasia and megakaryocytic hyperplasia in sternal bone marrow aspirate or biopsy. As in many other rather uncommon diseases, the diagnosis of PV may be overlooked

unless it is explicitly considered, and it is likely that many cases are never correctly diagnosed but rather masquerade under the diagnosis of various types of peripheral vascular disease including thromboangiitis obliterans (Burger’s disease), atypical erythromelalgia, or hypertension. Not every symptom, sign, or available bit of laboratory evidence is present in every case of the disease but Dameshek believed in 1940 that the following minimal data should be present before a definite diagnosis of PV can be made: plethoric appearance, splenomegaly, definitely elevated erythrocyte count (>6x 1012/L), elevated platelet count, and elevated hematocrit, together with red cell and megakaryocytic hyperplasia in bone marrow aspirate. In a doubtful case, the procedure of blood volume estimation may be helpful.

Possible Etiologic Factors of PV: Dameshek 1950 [2] In 1950, Dameshek wrote a seminal article on the possible etiologic factors, disease manifestations, and course of PV during long-term follow-up, along with his original experiences with treatment by venesection and his hesitations to use radioactive phosphorus (P32).

Dameshek considered PV as a disorder of the bone marrow characterized by an excessive production of blood cells by all the marrow elements, i.e. the nucleated red cells, the granulocytes, and the megakaryocytes. To use Greek terms, there is panmyelopathy, which in turn results in pancytosis.

The cause of the great and continuous blood production is obscure, but its results lead to many diverse manifestations that, as they are better understood, should lead to better control of the disease.

103

Turk J Hematol 2013;30:102-110

Little is known of the actual factors that stimulate cell growth. Loss of blood, either through hemorrhage or by excessive destruction (hemolysis), appears to be a powerful stimulatory factor to the bone marrow since the immediate reaction is an outpouring of early red cells (reticulocytes), granulocytes, and platelets. Another stimulatory factor, which, however, affects only the red cells, is that of anoxemia or arterial unsaturation. Whether due to high altitude or to certain types of pulmonary or cardiac disease, there is a resultant increase in erythropoietin. From the teleological standpoint, the increased erythropoietin that takes place with hemorrhage, hemolysis, or anoxemia is readily understood, although the exact mechanisms by which such stimulation takes place in unknown. If stimulatory factors are so little known, even less is known of possible inhibitory factors, although it seems likely that they too are present. Were it not for such “homeostatic” factors, bone marrow growth might conceivably develop out of proportion to the needs of the body. Certain indications are present implicating the spleen as a bone marrow “regulator” or inhibitor, but actual proof of such substances in splenic extracts is thus far lacking. Dameshek concluded in 1950 that although the bone marrow probably has normal stimulants and inhibitors that balance each other, thus resulting in extraordinarily stable blood counts, their nature is obscure.

In PV, all “stops” to blood production in the bone marrow seem to have been pulled out. The marrow is crowded with great numbers of nucleated red cells and granulocytes in all stages of maturation and with megakaryocytes actively producing platelets. Because of their large number and their size, the megakaryocytes often dominate the marrow picture (Figure 2). As compared to normal bone marrow (Figure 3), the bone marrow in PV is hypercellular with an increased number of large megakaryocytes (Figure 2).

Figure 1. Dameshek (photo courtesy of the American Society of Hematology).

104

Michiels JJ: Dameshek Trilinear PV

Figure 2. Marked megakaryocytic hyperplasia in the bone marrow of a patient with polycythemia vera. Puncture aspiration of the sternum: 250x. Source: Dameshek, JAMA, 1950 [2].

Figure 3. Normal bone marrow: 1) sternal bone marrow puncture smear (75x) showing numerous fat cells, islands of marrow cells, and 4 megakaryocytes (arrows); 2) mature megakaryocyte (750x) with course granularity of the cytoplasm, with defined platelet developments at the edges; 3) and 4) mature megakaryocytes (1000x); 5) polykaryocyte, a multinucleated giant cell, an occasional forerunner of the mature megakaryocyte; 6) polykaryocyte with course granularity and platelet production. Source: Dameshek and Miller, Blood, 1946 [3].

Turk J Hematol 2013;30:102-110

Michiels JJ: Dameshek Trilinear PV

What causes this enormous productivity of the marrow?

Hemorrhage and hemolysis are not present and in fact the hemolytic index in polycythemia may be reduced. There is no evidence of anoxemia; cyanosis is lacking, and the arterial saturation is normal. Some observers have claimed that a local anoxemia affecting only the marrow might be present and have pointed to arteriosclerotic lesions in the marrow as evidence of this. This may well be a mistaken cause-andeffect relationship, and the reverse might be even be true, i.e. the polycythemic state may lead to early arteriosclerosis.

Even more importantly, anoxemia leads only to an increase in red cells and not to leukocytosis or thrombocytosis.

Other observers have claimed that polycythemia can be linked to leukemia, i.e. that it is a generalized proliferative disorder involving the red cells. This can hardly be likely, for not only is PV a chronic disorder without any evidence of invasiveness, but it is a total marrow disorder in which erythrocytosis, leukocytosis, and thrombocytosis are all simultaneously present. Neoplastic growth is scarcely like this. Nevertheless, the possibility cannot be ruled out that PV may be a relatively benign, noninvasive, and generalized proliferative disorder of the entire marrow. A possible hereditary or transmitted tendency may be present, since the disorder occurs most commonly in Jews of Russian and Polish origin [4]. Actual familial polycythemia is rare, however. This leaves 2 highly speculative possibilities: the presence of excessive bone marrow stimulation by an unknown factor or factors, and a lack or a diminution in the normal inhibitory factor of factors. Complete ignorance must be admitted at this time of the cause of true polycythemia and of its exact nature. The 1950 hypothesis of Dameshek was confirmed by Vainchenker in France by the discovery in 2005 of the acquired JAK2V617F mutation as the cause of 3 phenotypes of classical myeloproliferative neoplasia: essential thrombocythemia, PV, and myelofibrosis [5,6,7,8,9]. The JAK2V617F mutation induces a loss of inhibitory activity of the JH2 pseudokinase part on the JH1 kinase part of Janus kinase 2 (JAK2). This leads to enhanced activity of the normal JH1 kinase activity of JAK2, which makes the mutated hematopoietic stem cells hypersensitive to the hematopoietic growth factors thrombopoietin, erythropoietin, insulin-like growth factor-1, stem cell

factor, and granulocyte colony-stimulating factor, resulting in trilinear hypermyeloproliferation. Indeed, all “stops” to blood production in the bone marrow have been pulled [4,5,6,7,8].

The Disease Polycythemia Vera: Dameshek 1950 [2] For whatever reason it is present, panmyelopathy results in an enormous increase in blood cells. All the elements are affected, with the result that the red blood cell count, the polymorphonuclear leukocytes, and the platelets are increased. Individual cases of polycythemia differ greatly, not only from the standpoint of how many blood cells are being produced but also in the relationship of the 3 different marrow elements to each other. For example, some cases show only a moderate elevation in erythrocytes, with, however an extreme degree of thrombocytosis, while in others the leukocytes count may be at or close to leukemic levels, with only slight increase in red blood cells and platelets. The blood counts in PV show the ranges given in Table 1.

It becomes necessary to define PV further. The normal red cell counts in persons at or near sea level may reach in males the figure of 6,000,000 per cubic millimeter (6x1012/L). Certain nervous, high-strung persons with cold acrocyanotic hands and feet or with peptic ulcer or hypertension may habitually show red blood cell values of 6,000,000 to 6,500,000 per cubic millimeter. Persons such as these do not show an associated leukocytosis or thrombocytosis, and the blood volume is uniformly normal; in fact, the plasma volume may even be low, indicating some possible degree of hemoconcentration.

A sharp distinction must furthermore be drawn between true polycythemia and anoxemic or secondary polycythemia.

Polycythemia is a panmyelopathy of unknown origin; anoxemic polycythemia is symptomatic of or secondary to various conditions, in which anoxemia is present. The differential clinical and laboratory features are presented in Table 2.

The most important end result of the extreme degree of panmyelopathy in PV is the development of an enormous mass of red blood cells in the circulation. The percentage volume of packed red blood cells (hematocrit) in relation to the total amount of blood becomes increased greatly, reaching levels of 60% to 70% or even 80%. However, this simple increase in

Table 1: Blood count range in polycythemia vera according to Dameshek, 1950 [2].

Hb:g/dL

15.6-25 g/dL (15.6 to 25.0 g)

Hematocrit

0.55-0.80 L/L

Red blood cells

6.5-12.5 x 1012/L

Mean cell volume

70-95fL (microcytic, normocytic)

White blood cells

8-50 (x109/L)

Polymorphonuclear cells

75% to 90%

Platelets

1000-6000 (x109/L) 105

Turk J Hematol 2013;30:102-110

Michiels JJ: Dameshek Trilinear PV

red cell concentration is in itself insufficient to cope with the continued great production of red blood cells (Figure 4). As a result, the total volume of blood is expanded to double or triple the normal values. In parallel with this increased volume, the hematocrit continues to rise such that the total red cell mass, which is normally about 45% of 5000 cc (2250 cc), may finally become increased in some cases to 75% of 15,000 cc (11,250 cc) or to an amount of 4 or 5 times the normal. The plasma volume in such circumstances may remain normal or become slightly increased. In the hypothetic examples given, the plasma volume becomes increased to 3750 cc even though the percentage of plasma is only 25% as compared to the normal percentage of 55%. The great increase in red cell mass leads to an abnormal type of physiologic state and thus to a host of clinical symptoms and signs.

Physiopathology and Symptoms of PV: Dameshek 1950 [2]

common, but coronary thrombosis, cerebral thrombosis, mesenteric thrombosis, hepatic vein thrombosis (Budd– Chiari syndrome), and even portal vein thrombosis may occur. Thrombotic disturbances of the stomach may be the cause for the rather common finding of gastric ulcer. This was present in about 1 of every 5 of the cases observed by my colleagues and me. The peripheral vascular lesions may simulate those of thromboangiitis obliterans, especially since both polycythemia and thromboangiitis appear most commonly in Russian and Polish Jews.

Course of PV during Long-Term Follow-Up Whatever the cause of the constant and excessive hematopoiesis is, it is likely that if the patient lives long enough and does not succumb to the effects of thrombosis or other complications, the marrow will gradually show

The presence of a great mass of blood in the circulation has at least 3 outstanding effects: 1) plethora, 2) decreased velocity of blood flow, and 3) increased viscosity of the blood.

The person with PV is actually “bursting with blood”. All the various organs become distended with a superabundance of blood, and as a result symptoms referable to all the organs of the body develop. This is particular true of the brain, which is enclosed in the “closed box” of the skull.

The greater the hematocrit level is, the slower the velocity of blood flow is. Slow blood flow and increased blood volume may mimic the symptoms of cardiac decompensation. Slow blood flow may also result in disturbances of the extremities, particularly of the feet.

The combined effects of sluggish blood flow, increased viscosity, and the very high platelet level are undoubtedly responsible for the thrombotic manifestations that occur so commonly in PV. Peripheral vascular lesions are most

Figure 4. Diagrammatic representation of percentage volume of packed red cells (hematocrit) and blood volume in polycythemia vera as compared to normal. Source: Dameshek, JAMA, 1950 [2].

Table 2: Differential clinical and laboratory features in polycythemia vera and secondary polycythemia according to Dameshek, 1950 [1].

Parameter

Polycythemia vera

Anoxemic or secondary polycythemia

Fundamental situation

Hyperplastic panmyelopathy

Anoxemia

Etiology

Unknown

Anoxemia (altitude, cardiac, pulmonary)

Bone marrow

Excessive erythroleuko-thrombocytopoiesis

Excessive erythropoiesis

Clinical

Plethoric appearance, splenomegaly

Cyanosis, chronic pulmonary disease, congenital cardiac disease

Blood

Pancytosis, erythrocytosis, leukocytosis, thrombocytosis

No pancytosis

Blood volume

High

High

Red cell volume

High

High

Plasma volume

Normal or increased

Low

Arterial oxygen saturation

Normal

Diminished

106

Turk J Hematol 2013;30:102-110

Michiels JJ: Dameshek Trilinear PV

Table 3: Collected results in the treatment of polycythemia vera with radiophosphorus [10].

Hematology clinic

Number (N) of cases

Satisfactory remissions

Unsatisfactory remissions

Deaths N / cause

Jefferson

22

17

3

1 / hemorrhage 1 / leukemia

Mayo Clinic

38

36

2

1 / leukemia

Univ. California

50

47

3

1 / leukemia

Univ. Penn.

8

7

1

Mt Sinai NY

14

12

2

New Eng Deaconess

3

2

1

Total

138

124

11

Figure 5. Diagrammatic representation of the course of polycythemia vera in some cases. The marrow becomes “burnt out” and anemia develops in about 2 of 10 cases.

Source: Dameshek, JAMA, 1950 [2]. signs of diminished activity. If this occurs, the red cell elements become reduced in number and a certain degree of fibrosis develops. With increasing reduction of erythropoietic tissue, myelofibrosis becomes more of an organized mass of fibrous tissue. Leukocyte production, at first unaffected, also becomes reduced, but megakaryocytes usually remain and the lack of other cell types is usually conspicuous. The blood smear shows nucleated red cells, increased polychromatophilia, and immature granulocytes of various types. The continued myelofibrosis either results in or is associated with (it is not clear which) extramedullary hematopoiesis in the spleen and, to a lesser extent, in other organs (Figure 5). The spleen becomes extraordinarily large and in some cases occupies almost the entire abdominal cavity. It is made up largely of metaplastic marrow tissue (myeloid metaplasia).

The course of the patient with PV (Figure 5) is usually a matter of many years, although it is difficult to state what the “normal” course of the disease would be without the various therapeutic methods that undoubtedly influence it.

3 / leukemia

The cause of the hemorrhagic diathesis of polycythemia is obscure. Bleeding does not ordinarily occur spontaneously, but rather only in response to trauma, as with a blow or following operative procedures. Extreme degrees of postoperative hematomas are common, and excessive bleeding occurs after dental extractions, tonsillectomy, polypectomy, and similar procedures. In view of the high platelet levels, the lack of any well-demonstrated abnormality of the coagulation factors in the blood, and the lack of any apparent abnormality of the capillaries, the cause of hemorrhagic tendency is obscure. In relapse, the bleeding might be explicable on the basis of “bursting with blood”, where an outlet often bleeds severely when the red cell mass has been greatly reduced.

Treatment of PV, 1940-1950 The treatment of polycythemia has passed through several successive stages. Phenylhydrazine, a hemolytic poison introduced by Morawitz, achieved wide popularity, but its unpredictable nature and the severe hemolytic crises that often ensued made its use relatively hazardous. All the elements, including iron for enhancing further red cell formation, were retained within the body. For these reasons, the systematic use of multiple venesections to reduce the red cell mass and the blood volume and to induce a state of iron deficiency seemed far more physiologic. According to Dameshek in 1946, the removal of 500 cc of blood twice weekly for 2 to 5 weeks, depending upon the initial hematocrit and hemoglobin levels, has proven to be a satisfactory method. To maintain the resulting state of iron deficiency somewhat longer, it has been our practice to keep the patient on a diet low in iron. Red cell formation under these circumstances is only partially reduced, but due to microcytosis of red cells, hemoglobin and hematocrit levels remain low for periods of 6 to 18 months, during which time the patient may be completely asymptomatic. Red cell levels during this induced remission of PV by phlebotomy alone gradually rise and remain at erythrocythemic levels above 107

Turk J Hematol 2013;30:102-110

6x1012/L, and so the red cell count as an index of therapy is of little value. The best index of therapy is the hematocrit value, although the hemoglobin concentration alone may be used since this correlates fairly closely with the hematocrit level. With this method of therapy, patients go along for many years with little more difficulty than do others in the older age group in which polycythemia occurs.

The treatment of PV is a long-term project and it is best to consider the polycythemia patients as fundamentally normal [2]. As such, they may have a long lifespan and every attempt should be made to keep the treatment as physiologic as possible. Since the fundamental difficulty in polycythemia is the extreme overproduction of blood by the cells of the bone marrow, which leads to an excessive mass of blood within the circulation, the treatment may be based either on a diminution of marrow production or on the removal of the excessive blood from the circulation.

The general mode of therapy in polycythemia involves the removal of excessive amounts of blood from the circulation by multiple venesections. The removal of the extra mass of blood by well-planned, multiple venesections is productive of 2 results: 1) the red cell mass, hemoglobin, and hematocrit are reduced to normal, whereas erythrocyte count remains increased above 6x1012L; 2) and the bone marrow develops a state of iron deficiency, with the result that erythrocytes produced are poorly hemoglobinized and microcytic. The mature red cells, although they may continue to increase in number, are small and hypochromic and thus greatly reduced in volume. The reduction of the red cell mass to normal levels is carried out by venesections of 500 cc, which are performed twice weekly. Although estimations of the blood volume are valuable, hematocrit determinations are ordinarily sufficient for clinical use (Figure 6). If these are difficult to obtain, hemoglobin estimations are of definite value, although they are by no means as helpful as hematocrit levels. Usually the hemoglobin concentrations parallel roughly the hematocrit readings. The reduction of

Figure 6. Diagrammatic representation of the plethoric blood volume in a case of polycythemia vera and its correction with systemic venesections performed twice weekly. Source: Dameshek, JAMA, 1950 [2].

108

Michiels JJ: Dameshek Trilinear PV

the hematocrit level to a normal value of about 45% may require from 2 to 4 weeks (i.e. 4 to 8 venesections). With a hematocrit level of approximately 70%, 8 venesections are ordinarily required. At the end of 2 to 4 weeks, longer in some cases, the patient is usually depleted of this extra blood. The considerable loss of blood results in the loss from the body of much of its readily available iron and thus a state of iron deficiency. In polycythemia, the reserve stores of iron are probably not too great because of the continued need for excessive quantities of iron for production of hemoglobin.

In any event, the development of a state of chronic iron deficiency is facilitated (Figure 7).

The reduction in iron reserve leads to an insufficient amount of iron for the synthesis of hemoglobin in the developing red cells, and as a result the mature red cells produced are smaller than normal and occupy less room in the circulation than do normal-sized red cells. Production of red cells probably continues in its ordinarily rapid fashion (persistence of increased erythrocyte counts above 6x1012/L) (Figure 7), but the insufficiency of iron for the developing red cells results in pronounced hypochromia and microcytosis.

During the state of chronic iron deficiency, the patient himself presents a normal appearance. On this program it is possible to control patients with polycythemia for a few to many years. Some of our patients have been under observation for periods of 10 to 15 years and are in as good of health now as comparable persons of the same age group. The course of arteriosclerotic and diabetic manifestations is not affected. We have seen no greater incidence of the myelofibrotic state than in patients with polycythemia treated by other measures.

Figure 7. Course in a case of polycythemia vera treated with multiple venesections and iron deficient diet. Note the development of marked microcytic hypochromia: discrepancy between increased red cell count (>6x1012/L), diagnostic for PV even in the iron-deficient state, and the relatively low values for hemoglobin and hematocrit.

Complete relief of hypervolemic symptoms occurred with this therapy. Source: Dameshek, JAMA, 1950 [2].

Turk J Hematol 2013;30:102-110

Michiels JJ: Dameshek Trilinear PV

The hemoglobin and hematocrit levels remain low for periods of 3 to 18 months or even longer; usually they parallel each other. The red blood cell count after transient correction to normal by venesection, on the other hand, rises gradually after 2 to 3 months and may reach levels of 6,000,000 to 8,000,000 within 6 months or longer (Figure 7).

The mean corpuscular volume of red cells becomes reduced to levels of 60 to 65 μm3. The discrepancy between the high red cell count, far above 6x1012/L, and low hemoglobin level becomes increasingly more striking. Within 3 to 8 months, or in some cases longer, the hematocrit reaches distinctly increased levels of above 50%, and at this time the patient usually complains of some symptoms previously present. At this point, 2 or 3 venesections may be required to induce further return of the hemoglobin and hematocrit levels to normal (Figure 7). The amount of blood requiring removal at this time is usually relatively small as compared with that removed during the initial relapse.

Dameshek hesitated to use a potentially dangerous radioactive material in an individual with a relatively long lifespan [2] and questioned whether the acute leukemic states that have occurred in some cases are due to the potentially leukemogenic drug P32 or are associated with the natural history of polycythemia. Whether or not the amounts of radioactivity as administered in the ordinary dose of P32 used in the treatment of PV are harmful or productive of leukemia is not known. In my own experience of about 50 reasonably well-followed cases of polycythemia, acute leukemia developed in only 1 (2%) instance without previous X-ray or radioactive phosphorus therapy. Time alone and the comparison of large numbers of well-documented cases in which patients were treated with or without radioactivity should determine whether or not the therapeutic method of Lawrence and Reinhard (personal communications) using radioactive phosphorus is leukemogenic. In my clinic I have restricted the intravenous use of radioactivity to those patients with PV having frequent thromboses in the presence of an extremely high platelet count or to patients with an unusual degree of refractoriness to therapy with venesections. The reduction that occurs in the blood platelets in patients with thrombosis is satisfactory and usually leads to a prolonged remission with amelioration in the thrombotic tendency.

The more recent introduction of radiophosphorus up to 1950 makes therapy a good deal easier and is ordinarily productive of an excellent remission [3]. Erf described in 1946 [10] 25 cases of primary polycythemia treated with P32. Seventeen showed satisfactory hematologic and clinical remissions, 3 showed unsatisfactory remissions, and in 3 the therapy was too recent to warrant the drawing of conclusions. The duration of the remissions was from 6 months to 3 years. One patient died after gastric hemorrhage, and another died after developing leukopenic myeloid

leukemia. In Table 1 are listed the collected results in the treatment of PV with radiophosphorus in 138 cases, with satisfactory results in 124 and unsatisfactory results in 5. Of the 5 deaths, 3 were due to leukopenic myeloid leukemia.

In 1946 Dameshek hesitated to use a potentially dangerous radioactive material in an individual with a relatively long lifespan. One naturally wonders whether the acute leukemic states that have occurred in some cases are due to the potentially leukemogenic drug or are associated with the polycythemia. The data at present up to 1950 are insufficient to permit statistical analysis at this point. The results of carefully prospective follow-up studies in cases treated with P32 will be awaited with interest.

As a conclusion, in 1950, Dameshek hypothesized that trilinear PV (erythrocythemia, thrombocythemia and granulocythemia) is caused by an unknown stimulatory and/or inhibitory factor of bone marrow hematopoietic progenitor cells. This hypothesis proved to be true by the discovery of the JAK2V617F mutation as the cause of the 3 main phenotypes of the MPNs essential thrombocythemia (ET), PV and myelofibrosis (MF).

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Dameshek W, Henstell HH. The diagnosis of polycythemia.

Ann Intern Med 1940:13:1360-1387.

2. Dameshek W. Physiopathology and course of polycythemia vera as related to therapy. JAMA 1950:142:790-796.

3. Dameshek W, Miller CE. The megakaryocytes in idiopathic thrombocytopenic purpura, a form of hypersplenism. Blood 1946;1:27-51.

4. Rezminoff P, Foot NC, Bethea JM. Etiologic and pathologic factors in polycythemia vera. Am J Med Sci 1935;189:753758.

5. Dameshek W. The treatment of polycythemia. Blood 1946;1:256.

6. James C, Ugo V, Le Couédic JP, Staerk J, Delhommeau F, Lacout C, Garçon L, Raslova H, Berger R, BennaceurGriscelli A, Villeval JL, Constantinescu SN, Casadevall N, Vainchenker W. A unique clonal JAK2 mutation leading to constitutive signalling causes polycythemia vera. Nature 2005;434:1144-1148.

7. Vainchenker W, Constantinescu SN. A unique activating mutation in JAK2 (V617F) is at the origin of polycythemia vera and allows a new classification of myeloproliferative diseases. Hematology Am Soc Hematol Educ Progr 2005:195-200.

109

Turk J Hematol 2013;30:102-110

8. Michiels JJ, De Raeve H, Berneman Z, Van Bockstaele D, Hebeda K, Lam K, Schroyens W. The 2001 World Health Organization (WHO) and the updated European Clinical and Pathological (ECP) criteria for the diagnosis, classiďŹ cation and staging of the Philadelphia chromosomenegative chronic myeloproliferative disorders. Sem Thromb Hemostas 2006;32:307-340.

110

Michiels JJ: Dameshek Trilinear PV

9. Michiels JJ, Berneman Z, Van Bockstaele D, Van Der Planken M, De Raeve H, Schroyens W. Clinical and laboratory features of platelet-mediated thrombosis and bleeding complications, and the molecular etiology of essential thrombocythemia and polycythemia vera: therapeutic implications. Sem Thromb Hemosts 2006;32:174-207.

10. Erf LA. Primary polycythemia: remissions induced by therapy with radiophosphorus. Blood 1946;1:202-208.

DOI: 10.4274/Tjh.2013.0045

Commentary

Clinical Trials in Turkey Türkiye’de Klinik Araştırmalar Hilal İlbars Turkish Medicines and Medical Devices Agency Director of Clinical Trials Unit, Ankara, Turkey

Turkey is an emerging economy in almost all sectors, and especially in pharmaceuticals. Turkey has had clinical trial legislation for a long time. There are also clinical trial regulations and guidelines. Turkey has taken major steps towards harmonizing its legislation with the European Union in the field of clinical research and currently Turkish regulations are totally in line with EC Directives (EC 2001/20 and EC 2005/28). The main objective of this article is to discuss the relevant parts of the minimum necessary information on current legislation related to clinical trials in Turkey, instead of detailing all current legislation related to the clinical trials in Turkey as of 2011. Details of legislation mentioned in the article can be found in the Official Gazette and on corporate websites. In order to protect the rights, well-being, and health of the subjects in accordance with internationally valid scientific and ethical standards, clinical trials must be performed within these legal regulation frameworks and attention should be paid to the presentation of quality and reliable data.

Turkey offers good opportunities with regard to the high number of enthusiastic physicians and, moreover, the higher availability of treatment-naive patients interested in participating in clinical trials.

Turkey is in the review phase to join the European Union and has undergone many important reforms involving patients rights, criminal law, specialized biotech drug dispensing acts, and so on. Along with policies and visions for scientific and technological development put forward by the EU in the mid-1990s, Turkey has taken major steps towards harmonizing with the EU in the field of clinical research and drug trials.

Turkey is known for its unique geographical location, straddling the continents of Europe and Asia with borders to 7 countries: Greece and Bulgaria to the northwest, Syria to the south, Iraq to the southeast, and Armenia, Georgia, and Iran to the east. It is a bridge to Europe from Asia and the Middle East.

Turkey is an emerging economy in almost all sectors, and especially in pharmaceuticals. Turkey has had clinical trial legislation for a long time. There are also clinical trial regulations and guidelines. Turkey has taken major steps towards harmonizing its legislation with the EU in the field of clinical research and, currently, Turkish regulations are totally in line with EC Directives (EC 2001/20 and EC 2005/28). Thus, there are ethics committees. According to the Turkish clinical trial legislation, after getting approval from an ethics committee, one needs to get permission for conducting clinical trials in Turkey from the Turkish Medicines and Medical Devices Agency (TMMDA). The TMMDA is working intensively to standardize ethics committee SOPs and applications.

Turkey has a population of 75 million people (median age: 30 years). Turkey also has well-reputed research sites with strong technical infrastructure capabilities at international standards.

The Clinical Trials Department of the TMMDA reviews clinical trials in Turkey. Under the Clinical Trials Department there are a phase evaluation unit, bioequivalence/ bioavailability evaluation unit, and a post-marketing surveillance evaluation unit.

The main objective of this article is to discuss the relevant parts of the minimum necessary information on current legislation related to clinical trials in Turkey, instead of

Address for Correspondence: Hilal İLBARS, M.D., Turkish Medicines and Medical Devices Agency Director of Clinical Trials Unit, Söğütözü Mah. 2176. Sok. No: 5 Ankara-TURKEY E-mail: hilalilbars@gmail.com Received/Geliş tarihi : February 09, 2013 Accepted/Kabul tarihi : March 05, 2013

111

Turk J Hematol 2013;30:111-114

İlbars H, et al: Clinical Trials In Turkey

“Personal Inviolability, Material and Spiritual Entity of the Individual”, clearly states that clinical trials cannot be conducted without consent of the subject.

detailing all current legislation related to the clinical trials in Turkey as of 2011. Details of legislation mentioned in the article can be found in the Official Gazette and on corporate websites.

In Act No. 1219 on Medicine and Practicing of the Medical Profession, article 70 states that clinical trials cannot be conducted without consent, and if clinical trials on children or persons with legal disability are planned, obtaining consent of the legal guardian is obligatory.

The distribution of clinical drug trials conducted in accordance with legal regulation in Turkey between 01.01.1997 and 31.12.2012 is shown in Table 1.

Table 1 shows that there is a decrease in the number of clinical trials in 2010 and 2011; this is because of some legal problems about regulation of clinical trials in Turkey.

Article 10 of Health Services Principal Act No. 3359 should also be known.

If we look the distribution of studies, the first 6 major areas are oncology, anesthesiology, the central nervous system, the cardiovascular system, endocrinology, and infectious diseases, followed by others.

As mentioned in the second paragraph of “Experiments on Humans”, the 90th article of Act No. 5237 of the Turkish Penal Code, in order to rule out penal responsibility of a consent-based scientific experiment on a human being, it should be known by the subject, as mentioned in the first paragraph, that a “person conducting a scientific experiment on human beings will be sentenced to imprisonment for a term of from one to three years”.

When we analyze the number of studies related to hematology that were conducted in 2012, there were 6 Phase II studies, 18 Phase III studies, 1 Phase IV study, and 1 PMS study. In oncology these numbers were 6 Phase II and 16 Phase III studies.

If trials on children are planned, the 31/3/2005 – 5328/7 amended article of the Turkish Penal Code should be known. Accordingly, in order to reach the desired objective, scientific data obtained as a result of the research should necessitate conduct of the research on children; along with the consent of any child who is able to declare consent, the

Before planning to conduct any clinical trial on human subjects in Turkey, being informed of the following main legal regulations will be helpful.

In the Turkish Constitution of 1982, in the second part on fundamental rights and duties, article 17 of chapter 1,

Table 1: The distribution of clinical drug trials conducted in accordance with legal regulation in Turkey between 01.01.1997 and 31.12.2012.

YEAR

PHASE I

PHASE II

PHASE III

PHASE IV

BA/BE*

PMS**

1997

0

2

66

48

2

0

1998

0

2

61

50

0

0

1999

0

5

59

59

0

0

2000

0

4

66

52

4

0

2001

0

5

61

92

16

0

2002

2

10

71

103

13

0

2003

0

10

81

89

33

0

2004

0

18

74

136

80

7

2005

0

10

66

135

143

21

2006

0

17

71

198

109

36

2007

0

16

105

214

92

45

2008

3

17

114

177

96

42

2009

5

28

113

147

81

78

2010

4

23

102

178

97

50

2011

4

18

71

51

109

31

2012

0

32

123

93

105

38

*BA/BE: Bioavailability/Bioequivalence. **PMS: Observational studies with drugs .

112

İlbars H, et al: Clinical Trials In Turkey

consent of parents or legal guardians must also be obtained; and authorized committees issuing approval for the research should involve pediatricians.

Especially if clinical trials involve special populations (such as disabled persons or children), the following articles of the Turkish Civil Code will be helpful to explain and obtain subjects’ informed consent: article 9-13 for legal capacity, article 14-16 for legal incapacity, article 23 for the protection of personality, article 404-410 for cases necessitating guardianship, article 411-412 for authority on guardianship procedures, article 413-416 for assignment of guardian, and article 417-418 for restraints of guardianship.

The 2008 revisions to the Declaration of Helsinki are essential.

Section V of the Act on Approval of Convention for the Protection of Human Rights and Dignity of the Human Being with regard to the Application of Biology and Medicine (“Oviedo Convention”): The Convention on Human Rights and Biomedicine is reserved specifically for scientific research and should be considered.

In assignments (especially for pharmacists), Act No. 657 on State Personnel and No. 6197 on Pharmacists and Pharmacies should be considered.

Articles 10 and 11 of the Medical Deontology Regulation highlight that it should be declared that the performed procedure is research and should be previously tested on experiment animals.

Regulations 1. Regulation on clinical trials issued on 13 April 2013 and numbered 28617 in the Official Gazette, should be known in all of its details.

2. In No. 28307 of the Official Gazette, dated 26 August 2011 and published on “Regulation on Promotion of Human Medicinal Products”, it is stated in section ğ of the 9th subparagraph of the 6th article that the license/ authorization holder will deliver human medicinal products, laboratory kits, and other such donations to be used in clinical trials directly to the responsible investigator.

The 4th subparagraph of the 7th article clearly states that domestic and foreign investigator meetings of national and international multicenter clinical trials sponsored by the license/authorization holder will not be considered as congress or symposium participation, the nature of the meeting should be clearly stated in the submitted application, and it should be noted that the meeting is organized for this reason. Section g of the 1st subparagraph of the 9th article states that promotional samples are not allowed to be used as investigational products in clinical trials.

3. No. 21942 of the Official Gazette, dated 27 May 1994 and published on “Regulation for Evaluation of Bioavailability and Bioequivalence (BA/BE) of Pharmaceutical Products”, is especially important for the assessment of BA/BE studies.

Turk J Hematol 2013;30:111-114

4. For research with medical devices, No. 27957 of the Official Gazette, dated 7 June 2011 and published on “Regulation for Medical Devices” and “Regulation for Implantable Active Medical Devices”; No. 26398 of the Official Gazette, dated in 9 January 2007 and published on “Regulation for In Vitro Medical Diagnostic Devices”; and related TSE standards should be known.

5. Review of the sections of No. 23420 of the Official Gazette related to clinical trials, published 1 August 1998 on “Regulation for Patient’s Rights”, will be helpful.

There are also several guidelines that detail the regulations mentioned above.

Guidelines for Operations: 1. Good Clinical Practices Guidelines 2. Sections of Good Manufacturing Practices Guidelines Related to Investigational Products 3. Guidelines for Ethical Approach to Clinical Research Conducted on Pediatric Populations 4. Guidelines for Insurance Compensation for Clinical Trials 5. Guidance on the Collection, Verification, and Presentation of Adverse Reaction Reports Occurring During Clinical Trials 6. Guidelines Regarding Independent Data Monitoring Committees 7. In assigning field staff, “Regulation for Site Organization Management Principles in Clinical Drug Studies” should be considered 8. Guidelines for Archiving in Clinical Trials 9. “Guidelines for Storage and Distribution of Investigational Products Used in Clinical Trials”, prepared for guidance on issues of appropriate storage and distribution of investigational products used for clinical trials 10. Guidelines for Human Medicinal Products with Fixed Combinations 11. Guidelines for Biosimilar Medicinal Products 12. Guidelines for Principles and Essentials of Good Clinical Practices of Advanced Treatment Medicinal Products 13. Guidelines for Preparation of Audit Reports for Good Clinical Practices 14. Guidelines for Auditing of Good Clinical Practices of Laboratories Participating in Clinical Drug Trials 15. Guidance for Conduction of Good Clinical Practice Inspections of Sponsor and Contract Research Organization 16. Guidance for the Conduct of Good Clinical Practice Inspections to Bioanalytical Part, Pharmacokinetic and Statistical Analyses of Bioequivalence Trials 17. Guidelines for the Conduct of Auditing of Good Clinical Practices of Phase I Units 113

Turk J Hematol 2013;30:111-114

18. Guidelines for Observational Studies with Drugs 19. Prohibitions section of Guidelines for Off Label Drug Use should be considered in publications 20. “The Guidelines for Compassionate Use Program”, aiming to provide patients who have a severe or emergent, life-threatening disease, whose treatment with approved and available medicinal products in Turkey failed and who are not able to participate in clinical trials conducted clinical trials, with free-of-charge treatment for humanitarian reasons by the developer/supplier of drugs that are not registered in Turkey and either are or are not registered abroad Guidelines for Submissions:

İlbars H, et al: Clinical Trials In Turkey

• Clinical trials conducted with cosmetic raw materials or products • Clinical trials conducted with all other materials and products that may be tested on humans • Bioavailability and bioequivalence studies • Comparableness studies for biosimilar products • Clinical trials with industrial advanced medicinal products • Clinical trials with nonindustrial advanced medicinal products • Stem-cell transplantation studies on human • Organ and tissue transplantation studies

1. Guidelines Regarding Application Format for Application to Ministry in Clinical Research

• New methods in surgical studies

2. Guidelines Regarding Application Format for Application to Ethics Committee in Clinical Trials

In order to protect the rights, well-being, and health of subjects in accordance with internationally valid scientific and ethical standards, clinical trials must be performed within this legal regulation framework and attention should be paid to presenting quality and reliable data.

SOP principles for ethics committees have also been published.

In accordance with the above-mentioned legal regulations, for certain studies approval of both an ethics committee and the Ministry of Health are required. These studies include: • Clinical drug trials with drugs and drug compositions conducted on humans even if they are registered or authorized • Clinical trials conducted with advanced treatment medicinal products

• Gene therapy studies

Turkey offers good opportunities with regard to the high number of enthusiastic physicians and, moreover, a higher availability of treatment-naive patients interested in participating in clinical trials.

Key words: Clinical trial, Turkey References

• Observational drug studies

1. Ministry of Health of Turkey General Directorate of Pharmaceuticals and Pharmacy. www.titck.gov.tr.

• Clinical trials conducted with traditional herbal medicinal products

2. Helsinki Declaration, Sixth Revision, Seoul, 2008.

• Observational medical device studies • Clinical trials conducted with medical devices

114

3. Convention for the Protection of Human Rights and Dignity of the Human Being with regard to the Application of Biology and Medicine, Oviedo, Spain, 1997.

Research Article

DOI: 10.4274/Tjh.2012.0161

Cardiogenic and Myogenic Gene Expression in Mesenchymal Stem Cells After 5-Azacytidine Treatment 5-Azasitidin Tedavisi Sonrasında Mezenkimal Kök Hücrelerinde Kardiyojenik ve Miyojenik Gen Sunumu Aungkura Supokawej1, Pakpoom Kheolamai2, Kuneerat Nartprayut1, Yaowalak U-pratya3, Sirikul Manochantr2, Methichit Chayosumrit4, Surapol Issaragrisil3,4 1Mahidol University, Faculty of Medical Technology, Department of Clinical Microscopy, Bangkok, Thailand 2Thammasat University, Faculty of Medicine, Division of Cell Biology, Department of Pre-clinical Science, Pathumthani, Thailand 3Mahidol University, Faculty of Medicine, Division of Hematology, Department of Medicine, Siriraj Hospital, Bangkok, Thailand 4 Mahidol University, Faculty of Medicine, Siriraj Hospital, Siriraj Center of Excellence for Stem Cell Research, Bangkok, Thailand

Abstract: Objective: 5-Azacytidine is a hypomethylating agent that is used for the treatment of myelodysplastic syndrome. This histone modifier is widely employed and plays a nonspecific role in influencing the differentiation capability of stem cells. The ability of bone marrow mesenchymal stem cells to differentiate into cardiomyocyte- and myocyte-like cells after exposure to 3 different doses of 5-azacytidine has been evaluated and compared. The aim of the study was to optimize the effective dose of 5-azacytidine for promoting the cardiomyocyte and myocyte differentiation capabilities of human mesenchymal stem cells (MSCs).

Materials and Methods: Human bone marrow aspirations were collected from healthy donors. MSCs were used for the study of mesodermal differentiation. MSCs were cultured to promote osteoblast differentiation and adipocyte differentiation. The evaluation of osteogenic or adipogenic properties was then performed through immunocytochemical staining. BMMSCs were trypsinized into single-cell suspensions and then prepared for flow cytometric analysis. The MSCs were treated with 5, 10, or 15 μM 5-azacytidine for 24 h and then cultured for 3 weeks. Total RNA was extracted from untreated and 5-azacytidine–treated cells. Troponin T and GATA4 antibodies were used as cardiogenic markers, whereas myogenin and MyoD antibodies were used as myocyte markers.

Results: The morphology and growth rate of MSCs that were treated with any of the 3 doses of 5-azacytidine were similar to the morphology and growth rate of control MSCs. An immunofluorescence analysis examining the expression of the cardiac-specific markers GATA4 and troponin T and the skeletal muscle-specific markers MyoD and myogenin revealed that cells treated with 15 μM 5-azacytidine were strongly positive for these markers. Real-time RT-PCR results were examined; these amplifications indicated that there were higher expression levels of cardiac- and skeletal muscle-specific mRNAs in MSCs treated with 15 μm 5-azacytidine than in MSCs that had either been treated with lower doses of 5-azacytidine or left untreated.

Address for Correspondence: Aungkura SUPOKAWEJ, PhD., Mahidol University, Faculty of Medical Technology, Department of Clinical Microscopy, Pran-nok, Bangkok-noi, Bangkok, Thailand Phone: +66-2-4197169 E-mail: mtajr@mahidol.ac.th Received/Geliş tarihi : October 27, 2012 Accepted/Kabul tarihi : February 11, 2013

115

Turk J Hematol 2013;30:115-121

Supokawej A, et al: Cardiomyogenic Expression in 5-aza–treated MSCs

Conclusion: MSCs treated with 5-azacytidine demonstrated the capacity to differentiate into both cardiomyocytes and skeletal myocytes, and 15 μM 5-azacytidine could be the optimal dose of this drug. Other promoting factors should be examined to investigate the possibility of promoting the differentiation of MSCs into specific cell types.

Key Words: Mesenchymal stem cells, Differentiation, Cardiomyocyte, Myocyte Özet: Amaç: 5-Azasitidin miyelodisplastik sendrom tedavisinde kullanılan hipometile edici bir ajandır. Bu histon değiştiricisi, kök hücrelerin diferansiyasyon yeteneği üzerinde yaygın olarak etkilidir ve bu konuda seçici olmayan bir rol oynamaktadır. Üç farklı dozda 5-azasitidine maruz kaldıktan sonra, kemik iliği mezenkimal kök hücrelerinin kardiyomiyosit ve miyosit benzeri hücrelere diferansiyasyon yeteneği irdelendi ve karşılaştırıldı. Bu çalışmanın amacı, 5-azasitidinin insan mezenkimal kök hücrelerinin (MKH) kardiyomiyosit ve miyosite diferansiyasyonunu sağlamak için gerekli olan etkin dozunun tespit edilmesidir.

Gereç ve Yöntemler: İnsan kemik iliği aspirasyonları sağlıklı donörlerden yapıldı. MSCler osteoblast ve adipozit farklılaşması için kültüre edildi. Osteojenik veya adipojenik özellikler immunositokimyasal boyama ile incelendi. BMMSCler tripsinize edilerek tek hücre süspansiyonu elde edildi ve akım sitometri için hazırlandı. MSClere 5, 10 veya 15 μM 5-azacytidine 24 saat uygulandı, daha sonra 3 hafta kültüre edildi. Total RNA 5-azacytidine uygulanan ve uygulanmayan hücrelerden elde edildi. Troponin T ve GATA4 antikorları kardiyojenik belirteçler, myojenin ve MyoD antikorları myosit belirteçleri olarak kullanıldı.

Bulgular: 5-Azasitidinin her 3 dozuna da maruz kalmış MKH’lerin morfoloji ve büyüme hızları, kontrol MKH’lerin morfoloji ve büyüme hızları ile benzerdi. İmmünfloresans yöntemi ile kalbe özgül belirteçler olan GATA4 ve troponin T ile çizgili kasa özgül belirteçler olan MyoD ve miyojenin sunumlarının incelenmesi sonucunda, 15 μM 5-azasitidine maruz kalan hücrelerde bu belirteçlerin kuvvetli pozitif olduğu görüldü. Gerçek zamanlı polimeraz zincir reaksiyonu sonuçları incelendi; 15 μM 5-azasitidine maruz kalan MKH’lerde, daha düşük doz 5-azasitidin alan veya 5-azasitidin uygulanmayan MKH’lere göre kalp ve çizgili kasa özgül mRNA’ların daha yüksek oranda sunum düzeyleri olduğu tespit edildi.

Sonuç: 5-Azasitidine maruz bırakılan MKH’lerin kardiyomiyosit ve miyositlere diferansiye olma yeteneği olduğu ve en uygun dozun 15 μM 5-azasitidin olabileceği gösterildi. MKH’lerin özgül hücre tiplerine diferansiyasyonunu incelemek için bunu etkileyebilecek diğer faktörlerin de irdelenmesi gerekmektedir.

Anahtar Sözcükler: Mezenkimal kök hücreler, Diferansiyasyon, Kardiyomiyosit, Miyosit Introduction Mesenchymal stem cells (MSCs) provide a promising approach for cellular therapy because of their self-renewing properties and multipotent differentiation capacity. MSCs were discovered by Friedenstein from bone marrow cultures and reported to be marrow stromal cells [1].

Since 1993, Pittenger and colleagues [2] have explored the characteristics and multipotent capabilities of these human bone marrow-derived cells. MSCs possess the following traits: plastic adherent properties; positivity for the cell surface markers CD105, CD90, and CD44; and an ability to differentiate into a mesodermal lineage (osteogenic, adipogenic, and chondrogenic cells) [3]. At present, MSCs from other sources have been found; these MSCs demonstrate efficiencies that are similar to the efficiencies of bone marrow-derived MSCs (BMMSCs) [4,5]. MSCs are very intriguing cells for therapeutic purposes because of both their capacity to differentiate into cells of a mesodermal lineage and their immunoregulatory roles [6,7].

The ability of MSCs to differentiate into specialized cells has been well studied; in particular, the differentiation of MSCs into cardiomyocytes and myocytes has been extensively 116

investigated [8] because stem cell-derived cardiomyocytes could prove extremely useful for addressing the myocardiogenic suffering of many patients [9]. Most of these in vitro studies have examined MSCs that have been treated with specific growth factors [10] and histone modifiers [11].

Through its function as a DNA methyltransferase inhibitor, 5-azacytidine can affect histone and DNA methylation and cause DNA hypomethylation. However, high doses of 5-azacytidine produce cytotoxic effects. Therefore, a low dose of 5-azacytidine was selected for use as a differentiation inducer in stem cells [12]. Given that DNA methylation can govern gene silencing activity [13], the hypomethylation activity of 5-azacytidine may play a nonspecific role in upregulating the differentiation-promoting factors of stem cells. However, skeletal and cardiac muscle differentiation from human stem cells through the use of 5-azacytidine remains controversial; moreover, 5-azacytidine has not yet been proven to produce completely differentiated cells. To investigate the effect of 5-azacytidine on the cardiomyogenic differentiation of BMMSCs, bone marrow mesenchymal stem cells were treated with low doses of 5, 10, or 15 μM 5-azacytidine, and the resulting expression levels of skeletaland cardiac-specific genes were examined.

Turk J Hematol 2013;30:115-121

Supokawej A, et al: Cardiomyogenic Expression in 5-aza–treated MSCs

Materials and Methods Sample Preparation Human bone marrow aspirations were collected from healthy donors who had completed written consent forms that were approved by the Siriraj Institution Review Board (SIRB) under permission No.si587/2008, which was approved on 30 October 2012 to be revised every 1 year. Each heparinized bone marrow aspiration sample was diluted with phosphate buffered saline (PBS) before being layered onto an equal volume of Ficoll-Hypaque density gradient. The sample was centrifuged at a speed of 2000 rpm for 30 min at room temperature. The interphase layer of mononuclear cells was transferred into new centrifugal tubes and then washed twice. The mononuclear cells were suspended in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 μg/mL streptomycin (complete medium), and the cells were seeded at 1x106 cells per T25 culture flask. The cells were cultivated in 5% CO2 at 37 °C for 5-7 days; the nonadherent cells were then removed, whereas the plastic-adherent cells (the MSCs) were maintained under the same culture conditions. The MSCs were maintained and were subcultured with 0.25% trypsin with EDTA; cells from passages 3-5 were employed for this study.

The Osteogenic and Adipogenic Differentiation of MSCs MSCs at passage numbers 3-5 were used for the study of mesodermal differentiation. Cells were cultured in 6-well plates at seeding densities of 1x104 cells/mL in lineagespecific differentiation media. MSCs were cultured in NH OsteoDiff medium (Miltenyi Biotec, Germany) to promote osteoblast differentiation and in NH AdipoDiff medium (Miltenyi Biotec) to promote adipocyte differentiation; in both cases, the medium was changed twice weekly. These culture conditions were maintained for 2-3 weeks, and the evaluation of osteogenic or adipogenic properties was then performed through immunocytochemical staining with alkaline phosphatase or Oil Red O (Sigma-Aldrich, USA), respectively, as well as through morphological observations.

Flow Cytometry BMMSCs from bone marrow at passages 3-5 were trypsinized with 0.5% trypsin-EDTA into single-cell suspensions and then washed twice with PBS. Cell suspensions containing 5x105 cells in a total volume of 50 μL were labeled with the following mouse antihuman antibodies, which were conjugated with either fluorescein isothiocyanate (FITC) or phycoerythrin (PE): CD34-PE (BD Pharmingen, USA), CD45-FITC (BD Pharmingen), CD73-PE (BD Pharmingen), CD90-FITC (AbD SeroTec, USA), and CD105-FITC (AbD SeroTec). The cells were incubated with the appropriate antibodies at 4 °C for 30 min in the dark. The labeled cells were washed twice with cold PBS and centrifuged at 2000 rpm for 5 minutes at 4 °C; the cells were then fixed with 1% paraformaldehyde. The samples were assessed with a flow cytometer (FACS CaliburTM, Becton Dickinson, USA), and the flow cytometry results were analyzed with the CellQuest

software package (Becton Dickinson).

MSCs and 5-Azacytidine Treatments MSCs of passages 3-5 were seeded at a density of 1x105 cells/ mL and cultured in a basal medium of DMEM supplemented with 10% FBS and penicillin-streptomycin. Three different doses of 5-azacytidine (Sigma-Aldrich), namely 5 μm, 10 μm, and 15 μm, were applied to MSC samples for 24 h before the culture medium was changed to the complete medium.

The culture conditions were maintained continuously for 2-3 weeks to observe the morphology, growth, and percent viability of the MSCs; MSCs from these cultures were then assessed through real-time RT-PCR and immunofluorescence studies for cardiomyocytes and myocytes.

Quantitative Real-Time PCR Total RNA was extracted from untreated and 5-azacytidine– treated cells after 1-3 weeks of culture using TRIzol® (Invitrogen, USA) in accordance with the manufacturer’s protocol. The RNA sample was diluted in DEPC water before it was quantified by spectrophotometry at 260 nm. The 2-μg RNA sample was reverse-transcribed into cDNA with Superscript III First-Strand Synthesis (Invitrogen) following the manufacturer’s instructions. Quantitative real-time PCR (qRT-PCR) analyses for cardiac- and myogenic-specific genes were performed with the following primers: α-cardiac actin (260 bp), sense 5’-TCTATGAGGGCTACGCTTTG-3’ and antisense 5’-GCCAATAGTGATGACTTGGC-3’; troponin T (225 bp), sense 5’-AGAGCGGAAAAGTGGGAAGA-3’ and antisense 5’-CTGGTTATCGTTGATCCTGT-3’; myogenin, sense 5’-GCCAGACTATCCCCTTCCTC-3’ and antisense 5’-GAGGCCGCGTTATGATAAAA-3’; Myf5 (167 bp), sense 5’-AATTTGGGGACGAGTTTGTG-3’ and antisense 5’-CATGGTGGTGGACTTCCTCT-3’; and GAPDH (139 bp), sense 5’-GTCAACGGATTTGGTCGTATTG-3’ and antisense 5’-CATGGGTGGAATCATATTGGAA-3’.

The PCR amplifications, which used SYBR® Green PCR (Applied Biosystems, USA), were run for 40 cycles, each of which involved the following steps: a denaturation step for 10 s at 95 °C, an annealing step for 10 s at 60 °C, and an extension step for 40 s at 72 °C. The expression levels of cardiogenic- and myogenic-specific markers from 5-azacytidine–treated cells and untreated cells were normalized with glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The gene expression levels of untreated cells and treated cells were then investigated with the comparative CT method. The observations were performed with an ABI 7500 Fast Real-Time PCR System (Applied Biosystems), and the resulting data were analyzed with the ABI 7500 software package, version 2.0.3 (Applied Biosystems).

Immunofluorescence Studies MSCs were cultured in 4-well chamber slides (Nunc, USA) in complete medium for 24 h under one of the following conditions: no 5-azacytidine, 5 μM 5-azacytidine, 10 μM 5-azacytidine, or 15 μM 5-azacytidine. After this period, the medium was changed to complete growth 117

Turk J Hematol 2013;30:115-121

Supokawej A, et al: Cardiomyogenic Expression in 5-aza–treated MSCs

medium and maintained for 7 days. Troponin T (Santa Cruz Biotechnology, Inc., USA) and GATA4 antibodies (Millipore, USA) were used as cardiogenic markers, whereas myogenin (Millipore) and MyoD antibodies (Millipore) were used as myocyte markers. The growth medium was completely removed before the cells were washed twice with PBS. The cells were then fixed in 4% paraformaldehyde in PBS for 30 min. Following this fixation, the fixative was removed and nonspecific binding blocking using 1% bovine serum albumin was performed. The appropriate primary antibody was added for 45 min at room temperature and washed twice with PBS. The FITC- or rhodamine-conjugated secondary antibody was added to cover the cell layer for 45 min in the dark. The cells were then washed twice with PBS solution and counterstained with DAPI before they were observed under a fluorescent microscope.

markers) but negative for CD34 and CD45 (hematopoietic markers) (Figure 1). The properties of MSCs that had differentiated into distinct lineages were evaluated for morphological changes and cytochemical staining. The morphological changes of MSCs that were cultured in osteogenic medium or adipogenic medium were observed (Figures 2A and 2C). The cytochemical staining was then performed and indicated that MSCs that were cultured in

Statistical Analysis The data analysis was performed with SPSS 11.0 (SPSS Inc., USA). The expressions of cardiogenic and myogenic genes in the MSCs that had been treated with 3 different doses of 5-azacytidine were compared with the expressions of those genes in untreated cells. The gene expressions are presented in terms of means ± standard errors, and the MannWhitney U test was used for significance assessments; in this study, P<0.05 was considered to be statistically significant.

Results The Cultures and Characterization of Human BMMSCs Bone marrow-derived MSCs were isolated from aspirated bone marrow based on their property of plastic adherence.

The MSCs were grown until they reached confluence; cells that had been passaged between 3 and 5 times were used for this study. The MSCs in culture demonstrated spindleshaped and fibroblast-like morphology (Figure 1). The MSCs were then characterized in terms of their cell surface markers and mesodermal differentiation capacity. The MSC surfaces were positive for CD73, CD90, and CD105 (MSC

Figure 1. In culture, MSCs presented a spindle-shaped and fibroblast-like morphology. Various cell surface markers were analyzed by flow cytometry; positive results were obtained for CD73, CD90, and CD105 (MSC markers), whereas negative results were obtained for CD34 and CD45 (hematopoietic markers).

118

Figure 2. The characterization of BMMSCs that have been induced to differentiate into osteoblast-like cells (A) or adipocyte-like cells (C). The cells were analyzed by cytochemical staining, and BMMSCs that were cultured in osteogenic conditions were positive for phosphatase (B), whereas BMMSCs that were cultured in adipogenic conditions were positive for Oil Red O (D).

Figure 3. BMMSC morphology was spindle-shaped in the growth medium for both untreated cells (A) and cells that had been treated with 5-azacytidine (B, C, D). The cells in the treated group were broader and displayed increased granular content around their nucleus (arrow) (B, C, D).

Turk J Hematol 2013;30:115-121

Supokawej A, et al: Cardiomyogenic Expression in 5-aza–treated MSCs

osteogenic medium were positive for alkaline phosphatase (Figure 2B) and that MSCs that were cultured in adipogenic medium were positive in Oil Red O stains (Figure 2D).

5-Azacytidine–treated BMMSCs MSCs were cultured in growth medium and treated with 1 of 3 different concentrations of 5-azacytidine (5, 10, or 15 μM) for 24 h. Subsequently, after 3 additional weeks of culture, the treated cells were compared with untreated

cells. The morphological changes over time were observed; these did not differ for various doses of the 5-azacytidine.

Both treated and untreated MSCs displayed spindle-shaped appearances. Compared with the untreated cells (Figure 3A), the treated cells were broader and possessed increased granular content around their nuclei (Figures 3B-3D). As shown in Figure 4, the growth of MSCs that were treated with any of the 3 different concentrations of 5-azacytidine for 24 h was similar to the growth of the control group.

Immunofluorescence

16 14 Cell Number (x104)

12 10 8

Control 5 μm 5-Azacytidine 10 μm 5-Azacytidine 15 μm 5-Azacytidine

6 4 2 0 0

1

2

3

4 Day

5

6

7

Figure 4. A comparison of the growth curves of untreated BMMSCs (control) and BMMSCs that had been treated with 1 of 3 different concentrations (5, 10, or 15 μM) of 5-azacytidine for 24 h. The results were similar in both the untreated (control) and treated groups.

Untreated BMMSCs and BMMSCs that had been treated for 24 h with 1 of 3 concentrations of 5-azacytidine (5, 10, or 15 μM) were maintained in complete media for 7 days.

Immunostaining was performed to study the expression of cardiac-specific proteins (GATA4 and troponin T) and skeletal-specific proteins (MyoD and myogenin). The expression of the examined cardiac- and skeletal-specific markers was observed in both treated and untreated BMMSCs. The highest signal intensity from these markers was displayed by the cells that had been treated with 15 μM 5-azacytidine (Figure 5).

Quantitative Real-time PCR To validate the observed upregulation of cardiac- and skeletal muscle-specific proteins, the levels of mRNAs that encode several cardiac- and skeletal muscle-specific genes were determined by qRT-PCR. The PCR results indicated that after 7 days, compared with untreated cells, 5-azacytidine– treated cells demonstrated increased expression levels of various cardiac- and skeletal muscle-specific genes, including α-cardiac actin, troponin T, Myf5, and myogenin.

5 4.5 4 3.5 3 5 μm 5-azacytidine

2.5

10 μm 5-azacytidine

2

15 μm 5-azacytidine

1.5 1

Figure 5. The immunofluorescence of BMMSCs that were either left untreated (control) or treated with 1 of 3 different concentrations of 5-azacytidine for 24 h: 0 (A-D), 5 (E-H), 10 (I-J), or 15 (M-P) μM. The BMMSCs were first immunostained with antibodies for cardiac-specific markers (green) GATA4 (A, E, I, M) and troponin T (B, F, J, N) and for skeletal-specific markers (green) MyoD (C, G, K, O) and myogenin (D, H, L, P), then incubated with an appropriate FITC- or rhodamine-conjugated secondary antibody for 45 min, counterstained with DAPI (blue), and finally visualized.

0.5 0 Actin

TNT

MYF

MYG

Figure 6. qRT-PCR demonstrated that compared with the expression levels of control cells, the expression level for myogenin was significantly higher in the cells that had been treated with 15 μM 5-azacytidine, and troponin T expression levels were significantly higher in the cells that had been treated with either 10 μM or 15 μM 5-azacytidine (p <0.05).

119

Turk J Hematol 2013;30:115-121

Supokawej A, et al: Cardiomyogenic Expression in 5-aza–treated MSCs

Four genes were expressed in both treated and untreated BMMSCs (data not shown). However, compared with the expression levels that were observed in untreated control cells, the myogenin expression level was significantly higher in the cells that had been treated with 15 μM 5-azacytidine, and the troponin T expression level was significantly higher in the cells that had been treated with either 10 or 15 μM 5-azacytidine (Figure 6; p <0.05). The expressions of both cardiac-specific genes (α-cardiac actin, troponin T) and skeletal muscle-specific marker genes (MyoD, myogenin) were increased only during the first week and subsequently decreased in the later weeks (data not shown).

Discussion Stem cells represent promising sources of future clinical applications. Because stem cells can not only self-renew but also differentiate into specialized cells, the potential of stem cells to support cell therapies has been widely studied, particularly with respect to the differentiation properties of these cells. The treatment of stem cells with the DNA methylating agent 5-azacytidine has been demonstrated to induce the differentiation of stem cells into multiple cellular phenotypes, including cardiomyocytes [14,15]; however, the mechanism underlying the effects of 5-azacytidine has not yet been elucidated. Konieczny and Emerson [16] suggested that 5–azacytidine can hypomethylate a myogenicdeterminant locus, resulting in the transcriptional activation of this locus and thereby allowing for the induction of myogenic differentiation. Because of its hypomethylation effects, 5-azacytidine has also been shown to induce nonspecific expression on a variety of genes [17].

Human BMMSCs are a type of multipotent stem cell that possess the potential to differentiate into many cell types that are derived from the mesoderm, such as osteoblasts [18], myocytes [19], and cardiomyocytes [20]. To investigate the effects of 5-azacytidine on the cardiogenic and myogenic differentiation of BMMSCs, bone marrow mesenchymal stem cells were treated with low doses of 5-azacytidine (5, 10, or 15 μM), and the expression of skeletal muscle- and cardiac-specific genes was compared. We cultured MSCs with the 5-azacytidine for 24 h before allowing the cells to grow in complete medium for 3 weeks. The expressions of both cardiac-specific genes (α-cardiac actin, troponin T) and skeletal muscle-specific marker gene (MyoD, myogenin) were increased in the examined cells, but only during the first week; these expression levels decreased in subsequent weeks. This result suggests that 5-azacytidine can enhance the expression of the examined genes for a short period of time [17]. Thus, to promote differentiation of MSCs into cardiomyocyte-like cells, the administration of additional exogenous growth factors or cytokines as co-inducers in combination with 5-azacytidine may be required [10]. A 120

few potential inducers that were previously investigated are IGF-1, oxytocin, bFGF, cardiotrophin, and TGF-β1 [21,22,23].

From our study, it appears that the treatment of MSCs with 5-azacytidine can promote the expression of both cardiac-specific genes (α-cardiac actin, troponin T) and skeletal muscle-specific marker genes (MyoD, myogenin).

We also studied the effect of 5-azacytidine on the percent viabilities of cells for 1 week, but no change in viability was observed for the 3 5-azacytidine concentrations that were tested. Moreover, the 15 μM 5-azacytidine–treated cells displayed higher myogenin expression than control cells. Troponin T also demonstrated its highest expression levels in cells that had been treated with 10 μM or 15 μM 5-azacytidine; these results are consistent with the findings of previously published studies on the differentiation of MSCs into cardiomyocyte-like cells [24,25].

In conclusion, our study demonstrated that 15 μM 5-azacytidine can promote the expression of cardiac- and skeletal muscle-specific genes in BMMSCs in culture. The in vitro treatment of BMMSCs with 5-azacytidine supports initial cardiomyogenic differentiation over a relatively short period of time (approximately 1 week). Thus, 5-azacytidine might be used as a pretreatment to induce BMMSCs towards complete cardiac differentiation. However, factors that promote specific cell types have not yet been elucidated, and this topic still merits further study.

Acknowledgments: This study was supported by the Thailand Research Fund (Grant no. MRG5080187) and the Commission on Higher Education (Grant no. CHERESRG-49). S. Issaragrisil is a Senior Research Scholar of the Thailand Research Fund.

References 1. Friedenstein AJ, Chailakhyan RK, Latsinik NV, Panasyuk AF, Keiliss-Borok IV. Stromal cells responsible for transferring the microenvironment of the hemopoietic tissues. Cloning in vitro and retransplantation in vivo. Transplantation 1974;17:331-340.

2. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143-147.

3. Souza Neto JL, Araujo FI, Rego AC, Dominici VA, Azevedo IM, Egito ES, Brandao-Neto J, Medeiros AC. Effects of simvastatin in abdominal sepsis in rats. Acta Cir Bras 2006;21(Suppl 4):8-12.

4. Wu LF, Wang NN, Liu YS, Wei X. Differentiation of Wharton’s jelly primitive stromal cells into insulin-producing cells in comparison with bone marrow mesenchymal stem cells.

Tissue Eng Part A 2009;15:2865-2873.

Supokawej A, et al: Cardiomyogenic Expression in 5-aza–treated MSCs

5. Parolini O, Alviano F, Bagnara GP, Bilic G, Bühring HJ, Evangelista M, Hennerbichler S, Liu B, Magatti M, Mao N, Miki T, Marongiu F, Nakajima H, Nikaido T, Portmann-Lanz CB, Sankar V, Soncini M, Stadler G, Surbek D, Takahashi TA, Redl H, Sakuragawa N, Wolbank S, Zeisberger S, Zisch A, Strom SC. Concise review: isolation and characterization of cells from human term placenta: outcome of the first international Workshop on Placenta Derived Stem Cells.

Stem Cells 2008;26:300-311.

6. Ramasamy R, Tong CK, Seow HF, Vidyadaran S, Dazzi F. The immunosuppressive effects of human bone marrow-derived mesenchymal stem cells target T cell proliferation but not its effector function. Cell Immunol 2008;251:131-136.

7. Jung YJ, Ju SY, Yoo ES, Cho S, Cho KA, Woo SY, Seoh JY, Park JW, Han HS, Ryu KH. MSC-DC interactions: MSC inhibit maturation and migration of BM-derived DC. Cytotherapy 2007;9:451-458.

8. Li TS, Komota T, Ohshima M, Qin SL, Kubo M, Ueda K, Hamano K. TGF-beta induces the differentiation of bone marrow stem cells into immature cardiomyocytes. Biochem Biophys Res Commun 2008;366:1074-1080.

9. Segers VF, Lee RT. Stem-cell therapy for cardiac disease.

Nature 2008;451:937-942.

10. Bhang SH, Gwak SJ, Lee TJ, Kim SS, Park HH, Park MH, Lee DH, Lee SH, Kim BS. Cyclic mechanical strain promotes transforming-growth-factor-beta1-mediated cardiomyogenic marker expression in bone-marrowderived mesenchymal stem cells in vitro. Biotechnol Appl Biochem 2010;55:191-197.

11. Chang CP, Bruneau BG. Epigenetics and cardiovascular development. Annu Rev Physiol 2012;74:41-68.

12. Burlacu A, Rosca AM, Maniu H, Titorencu I, Dragan E, Jinga V, Simionescu M. Promoting effect of 5-azacytidine on the myogenic differentiation of bone marrow stromal cells. Eur J Cell Biol 2008;87:173-184.

Turk J Hematol 2013;30:115-121

16. Konieczny SF, Emerson CP. 5-Azacytidine induction of stable mesodermal stem cell lineages from 10T1/2 cells: evidence for regulatory genes controlling determination.

Cell 1984;38:791-800.

17. Bel A, Messas E, Agbulut O, Richard P, Samuel JL, Bruneval P, Hagège AA, Menasché P. Transplantation of autologous fresh bone marrow into infarcted myocardium: a word of caution. Circulation 2003;108 (Suppl 1):47-52.

18. Friedenstein AJ, Chailakhyan RK, Gerasimov UV. Bone marrow osteogenic stem cells: in vitro cultivation and transplantation in diffusion chambers. Cell Tissue Kinet 1987;20:263-272.

19. Ferrari G, Angelis CD, Coletta M, Paolucci E, Stornaiuolo A, Cossu G, Mavilio F. Muscle regeneration by bone marrowderived myogenic progenitors. Science 1998;279:15281530.

20. Beltrami AP, Barlucchi L, Torella D, Baker M, Limana F, Chimenti S, Kasahara H, Rota M, Musso E, Urbanek K, Leri A, Kajstura J, Nadal-Ginard B, Anversa P. Adult cardiac stem cells are multipotent and support myocardial regeneration.

Cell 2003;114:763-776.

21. Xinyun C, Zhi Z, Bin Z, Li R, Yucheng C, Yafei Y, Tingjie Z, Shengfu L. Effects of cardiotrophin-1 on differentiation and maturation of rat bone marrow mesenchymal stem cells induced with 5-azacytidine in vitro. Int J Cardiol 2010;143:171-177.

22. Heng BC, Haider HK, Sim EK, Cao T, Ng SC. Strategies for directing the differentiation of stem cells into the cardiomyogenic lineage in vitro. Cardiovasc Res 2004;62:34-42.

23. Paquin J, Danalache BA, Jankowski M, McCann SM, Gutkowska J. Oxytocin induces differentiation of P19 embryonic stem cells to cardiomyocytes. Proc Natl Acad Sci USA 2002;99:9550-9555.

13. Laurent L, Wong E, Li G, Huynh T, Tsirigos A, Ong CT Low HM, Sung KWK, Rigoutsos I, Loring J, Wei CL. Dynamic changes in the human methylome during differentiation.

Genome Res 2010;20:320-331.

24. Antonitsis P, Ioannidou-Papagiannaki E, Kaidoglou A, Papakonstantinou C. In vitro cardiomyogenic differentiation of adult human bone marrow mesenchymal stem cells.

The role of 5-azacytidine. Interact Cardiovasc Thorac Surg 2007;6:593-597.

14. Tomita S, Li RK, Weisel RD, Mickle DA, Kim EJ, Sakai T, Jia ZQ. Autologous transplantation of bone marrow cells improves damaged heart function. Circulation 1999;100(19 Suppl 19):247-256.

25. Zhang Y, Chu Y, Shen W, Dou Z. Effect of 5-azacytidine induction duration on differentiation of human first-trimester fetal mesenchymal stem cells towards cardiomyocyte-like cells. Interact Cardiovasc Thorac Surg 2009;9:943-946.

15. Taylor SM, Jones PA. Multiple new phenotypes induced in 10T1/2 and 3T3 cells treated with 5-azacytidine. Cell 1979;17:771-779.

121

Research Article

DOI: 10.4274/Tjh.2012.0033

High Throughput FISH Analysis: A New, Sensitive Option For Evaluation of Hematological Malignancies Yüksek Çıktılı FISH Analizi: Hematolojik Malignitelerin Değerlendirilmesinde Yeni ve Hassas Bir Seçenek Hakan Savlı1, Seda Eren1, Nilüfer Üzülmez1, Zeynep İlkay1, Duygu Yavuz1, Deniz Sünnetçi1, Abdullah Hacıhanifioğlu2, Naci Çine1 1Kocaeli University Faculty of Medicine, Department of Medical Genetics, Kocaeli, Turkey 2 Kocaeli University Faculty of Medicine, Department of Hematology, Kocaeli, Turkey

Abstract: Objective: The aim of this study was to determine the efficiency of the high throughput FISH analysis (HTFA) method for detecting genetic alterations in hematological malignancies, which is a new bacterial artificial chromosome array-based approach.

Materials and Methods: We performed a HTFA study of bone marrow aspiration and peripheral blood samples of 77 cases (n=19 myelodysplastic syndrome, n=17 acute lymphoblastic leukemia, n=9 chronic myeloid leukemia, n=32 acute myeloid leukemia) with hematological malignancies during the periods of initial diagnosis, treatment, and/or follow-up.

Results: Both numerical and structural abnormalities were detected by HTFA. We observed aberrations in 88% of our acute lymphoblastic leukemia patients, 25% of acute myeloid leukemia patients, and 31% of myelodysplastic syndrome patients.

In chronic myeloid leukemia cases, aberration was not detected by HTFA. Conclusion: Our results showed that HTFA, combined with other methods, will gradually take a place in the routine diagnosis of hematologic malignancies.

Key Words: Hematologic malignancies, Leukemia, Molecular genetics, Microarray

Özet: Amaç: Çalışmamızın amacı, hematolojik malignitelerde gözlenen genetik değişimlerin tespitinde, yeni bir BAC tabanlı array yaklaşımı olan HTFA metodunun etkinliğini gözlemlemektir.

Gereç ve Yöntemler: Tanı, tedavi ve /veya takip sürecinde olan toplam 77 (n=19 MDS, n=17 ALL, n=9 KML, n=32 AML) hematolojik maligniteli olgudan alınan kemik iliği aspirasyon ve periferik kan materyallerine HTFA metodu uygulandı.

Bulgular: Olgularımızda hem sayısal hem de yapısal kromozomal anomaliler tespit edildi. Anomali görülme oranı tanıya göre farklılık göstermektedir. ALL olgularının %88’inde, AML olgularının %25’inde ve MDS olgularının ise %31’inde aberasyon gözlenmiş olup, KML olgularında ise aberasyon saptanmamıştır.

Sonuç: HTFA yönteminin, diğer yöntemlerle birlikte kullanıldığında, hematolojik malignitelerin rutin tanı şemalarında yer alabileceğini göstermektedir.

Anahtar Sözcükler: Hematolojik maligniteler, Lösemi, Moleküler genetik, Mikroarray Address for Correspondence: Hakan SAVLI, M.D., Kocaeli University Faculty of Medicine, Department of Medical Genetics, Kocaeli, Turkey Phone: +90 262 303 88 40 E-mail: hakansavli@yahoo.com Received/Geliş tarihi : March 02, 2012 Accepted/Kabul tarihi : November 22, 2012

122

Savlı H, et al: High Throughput FISH Analysis

Turk J Hematol 2013;30:122-128

Introduction

to hematologic malignancies. HTFA might be thought of as a kind of array CGH technology, but it is not accepted as a traditional glass microarray platform due to the fact that multi-FISH probes are designed with BAC.

Hematologic malignancies are characterized by the clonal proliferation and accumulation of malignant immature or mature blood cells in the bone marrow and peripheral blood [1].

Acquired chromosomal abnormalities have been frequently reported in the blood cells of patients with hematological malignancies. Numerical and structural chromosomal abnormalities play an essential role in the pathogenesis of the disease. They also define patient subgroups and have important prognostic implications [2].

Translocations, deletions, inversions, and other rearrangements are structural chromosomal abnormalities that comprise genes with oncogenic potential, which activate specific differentiation or proliferation pathways and cause the progression of leukemogenesis [1].

Numerical chromosomal changes leading to clones with euploidy or aneuploidy are classified into groups according to chromosome number. Conventional cytogenetics has a very powerful ability to scan the genome for aberrations that involve both gains and losses of portions of the genome, as well as rearrangements within and among chromosomes.

Cytogenetic analysis plays an important role in the detection of chromosomal abnormalities in hematologic malignancies [3].

However, cytogenetic analysis has limitations such as low mitotic index, low chromosome band resolution, poor banding quality, and condensed or fuzzy appearance of the chromosomes. In order to overcome these limitations, molecular genetic methods such as fluorescence in situ hybridization (FISH), quantitative real-time polymerase chain reaction (Q-RT-PCR), and array comparative genomic hybridization (CGH) have emerged for diagnosis of hematologic malignancies [4,5].

CGH is a method for determining copy number gains and losses between 2 samples of DNA by competitively hybridizing differentially labeled DNA to metaphase chromosomes. This technology was first developed as a research tool for the investigation of genomic alterations in cancer [6,7]. DNA copy number alterations associated with chromosome abnormalities can be analyzed with high resolution by array CGH. Array CGH has been a valuable tool in the analysis of hematological malignancies that provides knowledge of the genomic alterations in this heterogeneous group of diseases [8,9,10].

A new technology called high throughput FISH analysis (HTFA) is different from conventional cytogenetics techniques and able to detect more than 1 deletionduplication region at the same time with high resolution at 300-500 kb. It is a bacterial artificial chromosome (BAC) array platform introduced for use in 2010. HTFA panels contain 31 regions on somatic chromosomes that are related

HTFA can even further magnify the precision of diagnosis and prognosis, as well as provide a single standardized platform [11]. Moreover, DNA copy number changes throughout the whole genome can be obtained from very small amounts of DNA. A major limitation of this array CGH-based technique is that balanced chromosomal rearrangements, such as reciprocal translocations or inversions, cannot be detected [12]. This requires additional cytogenetics and molecular cytogenetic approaches (e.g., FISH, karyotyping analysis, and Q-RT-PCR) to reveal cytogenetic changes. One other disadvantage of HTFA is that commercial platforms have still been insufficient for detecting mosaicism, while cut-off values differ among laboratories [9,12,13].

We applied HTFA analyses to 77 leukemia patients to determine unbalanced structural abnormalities and numerical abnormalities in 2010 and 2011 in the Medical Genetics Department of Kocaeli University. Our findings represent one of the first observations related to HTFA of hematological malignancies.

Materials and Methods We performed HTFA study on the bone marrow aspiration and peripheral blood samples of 77 patients (n=19 myelodysplastic syndrome [MDS], n=17 acute lymphoblastic leukemia [ALL], n=9 chronic myeloid leukemia [CML], n=32 acute myeloid leukemia [AML]) with hematological malignancies during the periods of initial diagnosis, treatment, and/or follow-up by the Hematology Department of Kocaeli University. Age, sex, white blood cell count, hemoglobin, diagnosis, and Q-RT-PCR findings of patients with abnormal HTFA results are listed in the Table 1.

Genomic DNA was obtained by using Magna Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics GmbH, Germany). The 260 and 280 nm wavelength absorbances were measured by spectrophotometer (ND1000, NanoDrop, USA). gDNAs with a A260/A280 ratio between 1.7 and 2.0 were used. Reference and samples were labeled with Cy5-dCTP and Cy3-dCTP using a fluorescent labeling system kit (dCTP/BAC, BlueGnome Ltd., UK). After incubation of 16 to 20 h at 37 °C, samples were purified with AutoSeq G50 columns (BlueGnome Ltd.). Human Cot-I DNA (BlueGnome Ltd.) was added to avoid consecutive matches from repetitive regions. A hybridization mixture was added and denaturated at 75 °C. Samples were loaded on HTFA platforms (BlueGnome Ltd.) and hybridized at 47 °C for 16-21 h. Finally, the HTFA platform was scanned (Agilent Microarray Scanner, Agilent Technologies, USA) and analyzed with BlueFuse Multi v2.1 software (BlueGnome Ltd.).

123

Turk J Hematol 2013;30:122-128

Savlı H, et al: High Throughput FISH Analysis

Table 1: Age, sex,WBC, diagnosis, Hgb, Q-RT-PCR and abnormal HTFA results of patients are listed. Abbreviations: NR, not requested by clinician.

Patient Age/ No Sex

WBC: Diagnosis x109/L

Hb g/dL

Q-RT-PCR Results HTFA Results

11H19

62/M

MDS

6.74

11.2

NR

del(20)(q11.21q13.33), trisomy21

10H78

5/F

ALL

3.76

6.91

t(9;22):(-) t(4;11):(-)

del(7p)

11H1

9/M

ALL

2.89

10.3

t(9;22):(-) t(4;11):(-)

dup(17)(q21.31q25.3), del(3)(p21.31p21.2), del(14)(q24.3), trisomy16, trisomy2

11H8

58/F

ALL

84.5

11.5

t(9;22):(-)

del(1)(p36.33p36.22), dup(1)(q24.1q44)

11H11

35/M

ALL

5.39

4.93

NR

del(Y)

10H27

80/F

MDS

1.33

12.1

t(15;17):(-)

del(3)(p26.3p14.2), del(5)(q13.2q35.3), del(12) (p13.33p11.22), monosomy 20

10H31

2/M

AML

3.22

13.3

NR

trisomy 21

10H6

34/E

ALL

2.13

12.2

NR

del(1)(p36.33)

10H9

43/M

AML

6.40

6.54

t(9;22):(+) t(15;17):(-)

del(Y), del(13)(q14.2q14.3)

10H73

67/F

ALL

0.74

8.06

NR

dup(2)(p25.3p11.2)

10H70

8/F

ALL

6.31

9.65

t(9;22):(-) t(4;11):(-)

trisomy 4, trisomy 6, trisomy10, trisomy 14, trisomy17, trisomy18, trisomy21, trisomyX

10H72

4/M

ALL

0.88

8.37

t(9;22):(-) t(4;11):(-)

trisomy 4, trisomy 6, trisomy8, trisomy10, trisomy 14, trisomy17, trisomy18, trisomy21, trisomyX, del(Y)

10H64

6/M

ALL

1.20

9.61

t(9;22):(-)

del(6)(q14.2q27), dup(8)(q23.3q24.3), trisomy21

10H46

37/F

AML

10.1

9.39

NR

dup(1)(q25.1q44), trisomy 6, trisomy 8

10H55

80/M

MDS

5.28

10.2

t(9;22):(-)

monosomy 13, monosomy 14, monosomy 22, del(16)(q11.2q24.3), dup(8)(q21.3q24.3)

10H14

42/M

AML

19.3

6.95

t(9;22):(-) t(4;11):(-)

trisomy 5, trisomy 8, trisomy 10, trisomy 21

10H21

21/F

ALL

58.4

5.84

t(9;22):(-) t(4;11):(-)

dup(1)(q23.3q44), del(9p), dup(9q), del(13) (q13.3q21.32)

10H22

15/M

ALL

2.95

8.83

t(9;22):(-) t(4;11):(-)

del(1)(q32.1q44), dup(11)(q13.4q25), trisomy 21

10H52

18/M

AML

3.24

9.27

NR

trisomy 8

10H66

27/F

AML

9.31

12.7

NR

dup(8)(q21.2q24.3)

10H67

5/M

ALL

0.59

10.1

NR

del(11)(q23.1q25), dup(X)(q21.31q28)

124

Turk J Hematol 2013;30:122-128

Savlı H, et al: High Throughput FISH Analysis

Table 1: (continued) 10H84

58/F

MDS

-

-

NR

dup(1q), dup(3q), monosomy 13, trisomy 21, del(X)

10H85

61/F

AML

1.74

10.7

NR

del(22)(q13.2q13.31), trisomy 8

11H4

6/M

ALL

5.43

10.1

t(9;22):(-) t(4;11):(-)

del(14)(q32.33)

11H5

5/M

ALL

25.4

1.75

t(9;22):(-) t(4;11):(-)

dup(1)(q23.3q44)

11H7

7/M

ALL

15.6

12.8

t(9;22):(-) t(4;11):(-)

trisomy X, trisomy 4

11H9

76/M

MDS

10.2

9.54

NR

del(9)(q12)

10H61

15/M

AML

-

-

NR

del(5)(q23.3q35.3), del(9)(p21.3p13.2), del(7) (q21.3q36.3)

10H74

44/F

MDS

4.81

4.91

NR

dup(1q), trisomy 7, trisomy 11, monosomy 13, dup(3)(q13.323q29), dup(5)(q31.1q35.3), dup(6)(p25.3q16.1), dup(9)(q21.11q34.13), del(12)(p13.33q13.13),trisomy 15, del(X)

Results Aberrations were detected in 29 of 77 patients. We identified numerical and structural abnormalities in 8 AML, 15 ALL, and 6 MDS patients. All numerical and structural aberrations detected by HTFA and Q-RT-PCR are listed in the Table.

In this study, we aimed to examine the HTFA method’s efficiency for detecting genetic aberrations, which are important for the diagnosis and prognosis of leukemia.

Discussion

Of our patient group, 62% had normal HTFA results and 38% had numerical and structural chromosomal abnormalities. The incidence of chromosomal abnormalities in hematologic malignancies changed according to the type of disease. We identified chromosomal abnormalities in 25% of AML and 31% of MDS cases. In ALL patients, the anomaly rate (88%) was higher than the anomaly rate (68%) detected by conventional cytogenetics in similar studies [14]. The major reason for differences between incidences is that HTFA enables the observation of submicroscopic changes that cannot be detected by conventional cytogenetics.

Additionally, this method does not require the obtaining of metaphases, and thus aberrations can be determined with all samples.

Detecting genetic aberrations in hematological malignancies provides essential information for diagnosis and prognosis to clinicians. At present, conventional cytogenetics methods such as G or R banding are the most widely used methods for identifying chromosome aberrations in cancer cells. These techniques have always been limited by the complexity and poor morphology of cancer chromosomes or the requirements of fresh material (dividing cells) to obtain metaphases. To overcome these problems, Q-RT-PCR, FISH, and high throughput (genomic) approaches such as array CGH are being used [6,9,13].

We observed both chromosome losses and gains as numerical chromosomal abnormalities related to leukemia.

Trisomy 8 is the most common single chromosomal abnormality in AML and MDS, representing approximately 6%-11% of these myeloid leukemias. It also has been reported in patients with lymphoid leukemias. We detected this anomaly in 4 of 37 (11%) AML and 1 of 17 (5%) ALL patients. However, although trisomy 8 is the most common numerical abnormality, the prognostic impact of the anomaly is not well known. As seen in recent studies, it does not confer a particularly favorable prognosis for AML [15,16].

CML patients (n=9) did not show any aberration with HTFA. More than 1 aberration existed in 21 of 29 cases.

Detected recurrent numerical aberrations were as follows: trisomy 8 in 1 ALL and 4 AML patients; trisomy 21 in 1 AML, 2 MDS, and 4 ALL patients; loss of chromosome Y in 1 AML and 2 ALL patients; loss of chromosome X in 2 MDS patients; gain of X in 3 ALL patients; and trisomy 10 in 2 ALL and 1 AML patients. Genome views of patients with normal karyotype and several abnormalities are shown in Figure 1.

125

Turk J Hematol 2013;30:122-128

SavlÄą H, et al: High Throughput FISH Analysis

30

A

Another numerical chromosomal abnormality of our study was trisomy 21. It was detected in 1 AML, 4 ALL, and 2 MDS cases. Acquired trisomy 21 is the second most common trisomy in MDS and AML after trisomy 8. Nevertheless, the clinical and prognostic impacts of this anomaly in myeloid leukemias remain incompletely characterized. One AML patient (Case 10H31) had constitutional trisomy 21. Clinical observations showed that there is a 10 to 20 times increased risk of leukemia in individuals with constitutional trisomy 21.

Trisomy may lead to leukemogenesis, whereby the presence of an increased copy number of certain genes gives a cell survival advantage and hence neoplastic potential. As an acquired anomaly, it is thought to lead to poor prognosis in MDS [17].

1.60

Log2 Ratio Ch1/Ch2

1.20 0.80 0.40 -0.00 -0.40 -0.80 -1.20 -1.60 1

2

3

4

5

6

7

8

9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y

Chromosomal Position

Figure 1. HTFA analysis results of several patients (A) patient with normal karyotype.

B

2.00 1.60 1.20

Log2 Ratio Ch1/Ch2

0.80 0.40 -0.00 -0.40 -0.80 -1.20 -1.60 1

2

3

4

5

6

7

8

9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y

Chromosomal Position

(B) Patient with trisomy 8.

C

Recurrent chromosomal deletions and duplications are observed in leukemia patients as unbalanced structural chromosomal abnormalities. Chromosomal deletions were found more frequently than duplications in our samples, consistent with the literature [13]. We detected 24 different microscopic (>5 Mb) and submicroscopic deletions (<5 Mb) in our study. Deletions in 4 patients (18%) were submicroscopic deletions, which cannot be visualized by conventional cytogenetics. One of the submicroscopic deletions that we observed was del(13)(q13.3q21.32).

Generally, the 13q anomaly was found at diagnosis, while, in rare cases, the anomaly appeared during the course of the disease. The deletion has been described as interstitial in most cases, with the following breakpoints: q13-q21 (most frequently), q13-q22, q14-q22, and q12-q21. Loss of material at band 13q14-21 is common to all cases. The data indicate the presence of 2 distinct breakpoint cluster regions: centromeric of RB1 in myeloid malignancies and distal to RB1 in some lymphoid B-cell and T-cell malignancies. Our deletion region covered the q14q21 critical region, which includes the RB1 gene. The RB1 gene is a tumor suppressor gene whose function is closely related to cell-cycle control.

The 13q14 deletions usually do not lead to inactivation of the RB1 gene, and del(13q) is associated with the presence

2.00 1.60

D

2.00 1.60

0.80

1.20

0.40

0.80 Log2 Ratio Ch1/Ch2

Log2 Ratio Ch1/Ch2

1.20

-0.00 -0.40 -0.80 -1.20

0.40 -0.00 -0.40 -0.80 -1.20

-1.60

-1.60 1

2

3

4

5

6

7

8

9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y

Chromosomal Position

(C) Patient with del(6)(q14.2q27), dup(8)(q23.3q24.3), trisomy 21.

126

1

2

3

4

5

6

7

8

9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y

Chromosomal Position

(D) Patient with trisomies of chromosomes 4, 6, 8, 10,14, 17, 18, 21, X and del(Y).

Savlı H, et al: High Throughput FISH Analysis

of one intact RB1 gene on the homologous chromosome, implying the role of an adjacent locus that may harbor important tumor suppressor gene(s) [18].

It is expected to detect aberrations affecting expression of immunoglobulin chain genes on 14q32 or T-cell antigen receptor genes on 7q34 in leukemia cases. We detected del(14)(q32.33) as a submicroscopic deletion in one AML patient. This region includes the D9 immunoglobulin heavy chain variable region. The T-cell antigen receptor B mRNA region is located on 7q34. del(7)(q21.3q36.3) was detected in one patient with AML and the aberration includes the 7q34 region, which is very variable [13]. del(5)(q23.3q35.3) and del(5)(q13.2q35.3) were seen in 1 AML and 1 MDS patient. Deletion of 5q can be observed in both de novo and therapy-related AML. It is also seen as monosomy 5. On the other hand, it is one of the most common structural rearrangements in MDS (10%), seen as an isolated abnormality or with additional karyotypic anomalies.

It is also observed in AML, with important prognostic significance. Prognosis of AML with 5q-/-5 is generally unfavorable, associated with rapid disease progression and poor outcome and survival, especially when it is seen as a part of complex karyotypes. The most commonly observed interstitial deletions are del(5)(q13q31), del(5)(q13q33), and del(5)(q22q33), forming a commonly deleted region at 5q31-q32 [19,20].

We detected 9p abnormalities in 2 patients with ALL and AML. In the ALL patient, del(9p) abnormality was seen, and del(9)(p21p13.2) was seen in a childhood AML patient. Deletions of the 9p21 chromosomal region are frequent in childhood ALL and encompass CDKN2A (MTS1), a gene encoding both p16INK4a and p14ARF. p16INK4a, an inhibitor of cyclin-dependent kinase, inhibits Rb phosphorylation, whereas p14ARF activates TP53 via interaction with the MDM2 protein 1. Hypermethylation of the promoter has been shown to be an alternate way of inactivation for these proteins in a variety of malignancies, including ALL [21].

All gains in the genome, such as duplications, triplications, or amplifications, were evaluated as duplications by HTFA. We detected duplicated chromosome regions in 12 patients and 4 of them had more than 1 duplication.

Marker chromosomes whose origin cannot be identified

by G banding are seen in hematological malignancies.

Marker chromosomes include duplicated regions of various chromosomes that cannot be identified by G banding.

Additional molecular methods are required to determine genes that are present in marker chromosomes [5]. A considerable advantage of HTFA is that this method is able to identify and determine all duplicated regions and genes that exist on marker chromosomes. The determining of duplicated genes provides valuable information for

Turk J Hematol 2013;30:122-128

prognosis and diagnosis. Four patients had more than 1 duplication. These patients may have extrachromosomal/ intrachromosomal duplications or amplifications that form marker chromosomes.

The c-myc gene is a proto-oncogene that is located on 8q24. Rearrangements and amplifications of myc are seen in leukemia. It plays a role in cellular processes such as cell cycle progression, apoptosis, metabolism, immortality, and adhesion [22]. Duplications including the 8q24 region were observed in 1 ALL, 1 AML, and 1 MDS patient.

Translocations having diagnostic and prognostic value for leukemia should be identified by appropriate methods. t(9;22) is the most common translocation in CML that can be detected by conventional cytogenetics, FISH, and Q-RTPCR methods. Additionally, it can be seen in ALL or AML as a poor diagnosis indicator [23]. We observed t(9;22) in 1 AML patient with Q-RT-PCR. In the HTFA results, there were no alterations in the breakpoints of chromosomes 9 and 22. This finding indicates that HTFA is not able to detect balanced chromosomal rearrangements such as translocations. The inability to detect balanced translocations is the main limitation of this method for leukemias.

Using conventional cytogenetic techniques, many karyotypic changes have been detected in metaphase preparations, which proved to be important diagnostic and prognostic markers for hematological malignancies.

Conventional cytogenetic methods have some limitations such as low mitotic index and poor morphology of cancer chromosomes [8]. No information about genetic alterations can be observed because of unsuccessful cell culturing. On the other hand, some submicroscopic alterations cannot be visualized because of poor chromosome morphology and lower resolution of G banding. These limitations lead to the assessment of genetically altered cells as normal cells. The FISH method was developed to overcome these difficulties with anomaly-specific probes. Based on karyotypic information, highly specific probes have been designed for karyotype analyses of interphase nuclei. It is very important to clarify that FISH is not a technique designed to look for new aberrations; it only detects alterations of the tested probe and the status of the rest of the genome remains hidden [3,9,12].

As a conclusion HTFA is a BAC-based multi-FISH analysis technique designed to overcome the limitations of FISH and conventional cytogenetics. High-resolution full-genome screening with HTFA will help to detect the candidate genes in leukemia and acquire more information about the mechanisms of leukemogenesis. To achieve further information about the effectiveness of HTFA, confirmative methods and studies with large numbers of patients are required. Although it has several limitations, we think that HTFA, combined with other methods, will gradually take its place in the routine diagnosis of hematologic malignancies.

127

Turk J Hematol 2013;30:122-128

Savlı H, et al: High Throughput FISH Analysis

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Harrison CJ. Acute lymphoblastic leukaemia. Best Pract Res Clin Haematol 2001;14:593-607.

2. Soszynska K, Mucha B, Debski R, Skonieczka K, Duszenko E, Koltan A, Wysocki M, Haus O. The application of conventional cytogenetics, FISH, and RT-PCR to detect genetic changes in 70 children with ALL. Ann Hematol 2008;87:991-1002.

3. Dave BJ, Sanger WG. Role of cytogenetics and molecular cytogenetics in the diagnosis of genetics imbalances. Semin Pediatr Neurol 2007;14:2-6.

4. Poddighe PJ, Moesker O, Smeets D, Awwad BH, Ramaekers FC, Hopman AH. Interphase cytogenetics of hematological cancer: comparison of classical karyotyping and in situ hybridization using a panel of eleven chromosome specific DNA probes. Cancer Res 1991;51:1959-1967.

5. McGrattan P, Campbell S, Cuthbert R, Jones FGC, McMullin MF, Humphreys M. Integration of conventional cytogenetics, comparative genomic hybridisation and interphase fluorescence in situ hybridisation for the detection of genomic rearrangements in acute leukaemia. J Clin Pathol 2008;61:903-908.

6. Kearney L, Horsley WS. Molecular cytogenetics in haematological malignancy: current technology and future prospects. Chromosoma 2005;114:286-294.

7. Usvasalo A, Elonen E, Saarinen-Pihkala UM, Räty R, HarilaSaari A, Koistinen P, Savolainen ER, Knuutila S, Hollmén J. Prognostic classification of patients with acute lymphoblastic leukemia by using gene copy number profiles identified from array-based comparative genomic hybridization data.

Leukemia Research 2010;34:1476-1482.

8. Calasanz MJ, Cigudosa JC. Molecular cytogenetics in translational oncology: when chromosomes meet genomics.

Clin Transl Oncol 2008;10:20-29.

9. Higgins RA, Gunn SR, Robetorye RS. Clinical application of array-based comparative genomic hybridization for the identification of prognostically important genetic alterations in chronic lymphocytic leukemia. Mol Diagn Ther 2008;12:271-280.

10. Bejjani BA, Shaffer LG. Application of array-based comparative genomic hybridization to clinical diagnostics.

J Mol Diagn 2006;8:528-533.

11. Margalit O, Somech R, Amariglio N, Rechavi G. Microarray-based gene expression profiling of hematologic malignancies: basic concepts and clinical applications.

Blood Rev 2005;19:223-234.

128

12. Zitzelsberger H, Lehmann L, Werner M, Bauchinger M. Comparative genomic hybridisation for the analysis of chromosomal imbalances in solid tumours and haematological malignancies. Histochem Cell Biol 1997;108:403-417.

13. Yasar D, Karadogan I, Alanoglu G, Akkaya B, Luleci G, Salim O, Timuragaoglu A, Toruner GA, Berker-Karauzum S. Array comparative genomic hybridization analysis of adult leukemia patients. Cancer Genet Cytogenet 2010;197:122-129.

14. Gmidène A, Sennana H, Elghezal H, Ziraoui S, Youssef YB, Elloumi M, Issaoui L, Harrabi I, Raynaud S, Saad A. Cytogenetics analysis of 298 newly diagnosed cases of acute lymphoblastic leukaemia in Tunisia. Hematol Oncol 2008;26:91-97.

15. Park TS, Lee ST, Song J, Lee KA, Kim J, Seok YM, Kim SJ, Lee JH, Choi JR. Trisomy 8 in an elderly patient with acute lymphoblastic leukemia as a sole abnormality. Cancer Genet Cytogenet 2008;187:57-58.

16. Paulsson K, Johansson B. Trisomy 8 as the sole chromosomal aberration in acute myeloid leukemia and myelodysplastic syndromes. Pathol Biol 2007;55:37-48.

17. Wan TSK, Au WY, Chan JCW, Chan LC, Ma SK. Trisomy 21 as the sole acquired karyotypic abnormality in acute myeloid leukemia and myelodysplastic syndrome. Leuk Res 1999;23:1079-1083.

18. Boyer J. del(13q) in myeloid malignancies. Atlas Genet Cytogenet Oncol Haematol September 2001. Available at http://AtlasGeneticsOncology.org/Anomalies/del13qID1096. html.

19. Charrin C. del(5q) in myeloid neoplasms. Atlas Genet Cytogenet Oncol Haematol March 1998. Available at http:// AtlasGeneticsOncology.org/Anomalies/del5qID1092.html.

20. Kanehira K, Ketterling RP, Van Dyke DL. del(5q) in myeloid neoplasms. Atlas Genet Cytogenet Oncol Haematol April 2009. Available at http://AtlasGeneticsOncology.org/ Anomalies/del5qID1092.html.

21. Mirebeau D, Acquaviva C, Suciu S, Bertin R, Dastugue N, Robert A, Boutard P, Méchinaud F, Plouvier E, Otten J, Vilmer E, Cavé H; EORTC-CLG. Prognostic significance of CDKN2A, CDKN2B and MTAP inactivation in B-lineage acute lymphoblastic leukemia of childhood. Results of the EORTC studies 58881 and 58951. Haematologica 2006;91:881-885.

22. Bilhou-Nabera C. t(8;14)(q24;q32); t(2;8)(p12;q24); t(8;22)(q24;q11). Atlas Genet Cytogenet Oncol Haematol February 1999. Available at http:// AtlasGeneticsOncology. org/Anomalies/t0814ID1050.html.

23. Huret JL. t(9;22)(q34;q11) in CML. Atlas Genet Cytogenet Oncol Haematol December 1997. Available at http:// AtlasGeneticsOncology.org/Anomalies/t0922CML.html.

Research Article

DOI: 10.4274/Tjh.2012.0048

Prognostic Impact of Nucleophosmin 1 (NPM1) Gene Mutations in Egyptian Acute Myeloid Leukemia Patients Nükleofosmin 1 (NPM1) Gen Mutasyonunun Mısırlı Akut Miyeloid Lösemi Hastalarındaki Prognostik Önemi Magda Zidan1, Howyda Shaaban1, Doaa El Ghannam2 1Banha University Faculty of Medicine, Department of Clinical Pathology, Benha, Egypt 2 Mansoura University Faculty of Medicine, Department of Clinical Pathology, Mansoura, Egypt

Abstract: Objective: Somatic mutations of the nucleophosmin gene (NPM1), which alter the subcellular localization of the product, are the most frequent mutations in patients with acute myeloid leukemia. The aim of the study was to assess the prevalence and prognostic impact of NPM1 gene mutations in adult AML patients.

Materials and Methods: Polymerase chain reaction and single-strand conformation polymorphism (PCR-SSCP) were used to screen 55 AML patients for mutations of NPM1 gene.

Results: NPM1 mutations were found in 12 (21.8%) of 55 patients, significantly associated with higher total leukocytie count, marrow blast percentage (p=0.03 and p=0.02, respectively), and M5 subtype (p<0.001). Patients with NPM1 mutations had significantly higher complete remission rates (p=0.003) and a trend to lower rates of mortality, relapse and refractory disease (p=0.28, p=0.45 and p=0.08, respectively). Survival analysis showed significantly longer disease-free survival (mean 18.635±1.229 versus 11.041±1.250 months, p=0.044) and overall survival (mean 19.810±1.624 versus 12.063±1.244 months, p=0.041) in patients with NPM1 mutations compared with those without. Multivariate analyses confirmed NPM1 mutation as a significant independent predictor for disease-free survival (HR=0.066, p=0.001) and overall survival (HR=0.125, p=0.002).

Conclusion: NPM1 mutation is a prognostic factor for a favorable outcome in Egyptian population. This finding is of major clinical importance since it strongly suggests that NPM1 mutations may allow one to divide the heterogeneous patient group of AML into prognostically different subgroups.

Key Words: Myeloid leukemia, NPM1 mutation Özet: Amaç: Nükleofosmin 1 (NPM1) genine ait olan ve ürünü hücrealtı düzeyde değiştiren somatik mutasyonlar, akut miyeloid lösemi (AML) hastalarında en sık tespit edilen mutasyonlardır. Bu çalışmada AML hastalarında NPM1 gen mutasyonlarının prevalansının ve prognostik öneminin değerlendirilmesi amaçlanmıştır.

Gereç ve Yöntemler: Elli beş AML hastasında NPM1 gen taraması için polimeraz zincir reaksiyonu ve tek-iplik konformasyon polimorfizmi kullanıldı.

Address for Correspondence: Magda ZIDAN, M.D., Banha University Faculty of Medicine, Department of Clinical Pathology, Benha, Egypt E-mail: doaamahmoud1970@yahoo.com Received/Geliş tarihi : April 12, 2012 Accepted/Kabul tarihi : October 02, 2012

129

Turk J Hematol 2013;30:129-136

Zidan M, et al: Prognostic Impact of Nucleophosmin 1 (NPM1) Gene Mutations in Egyptian Acute Myeloid Leukemia Patients

Bulgular: Elli beş hastanın 12’sinde (%21,8) NPM1 mutasyonları bulundu ve mutasyon varlığının yüksek lökosit sayısı, kemik iliği blast oranı (sırasıyla, p=0,03; p=0,02) ve M5 alt tipi (p<0,001) ile anlamlı ilişkisi olduğu tespit edildi. NPM1 mutasyonu olan hastalar, daha yüksek oranda tam remisyon (p=0,003), daha düşük mortalite eğilimi, nüks ve dirençli hastalık riski (sırasıyla, p=0,28, p=0,45, p=0,08) taşımaktaydı. Sağkalım analizinde, hastalıksız sağkalım (18,635±1,229 vs.

11,041±1,250 ay, p=0,044) ve genel sağkalım (ortalama 19,810±1,624 vs. 12,063±1,244 ay, p=0,041), NPM1 mutasyonu taşıyanlarda taşımayanlara göre anlamlı olarak daha uzun bulundu. Çok-değişkenli analizde, NPM1 mutasyonunun hastalıksız sağkalım (HR=0,066, p=0,001) ve genel sağkalım (HR=0,125, p=0,002) için anlamlı bağımsız öngörücü olduğu görüldü.

Sonuç: NPM1 mutasyonu, Mısırlı hastalarda iyi gidiş ile ilişkili olan bir prognostik faktördür. NPM1 mutasyonu kullanılarak heterojen bir hastalık olan AML’nin prognoz açısından farklı alt gruplara ayrılması mümkün olabileceğinden bu sonuç önemli bulunmuştur.

Anahtar Sözcükler: Miyeloid lösemi, NPM1 mutasyonu

Introduction Acute myeloid leukemia (AML) is a heterogeneous group of clonal hematopoietic stem cell disorders. The development of AML is associated with accumulation of acquired genetic alterations and epigenetic changes in hematopoietic progenitor cells that alter normal mechanisms of cell growth, proliferation, and differentiation [1]. Molecular analyses have yielded novel gene mutations that serve important markers for prognostic stratification of the heterogeneous AML group. The nucleophosmin 1 (NPM1) gene is mapped to chromosome 5q35 and encodes a protein of 294 amino acids. Nucleophosmin protein (NPM), also known as B23, numatrin, and NO38, is an abundant nucleolar phosphoprotein constantly shuttling between the nucleus/ nucleolus and cytoplasm [2]. NPM1 may assist in ribosomal protein assembly [3] and maintain genomic stability through its participation in DNA repair [4]. It also plays a crucial role in cell cycle regulation and apoptosis via its interactions with tumor suppressor p53 and alternate reading frame protein. The NPM1 gene frequently acts as a target of chromosomal translocations and causes the cytoplasmic dislocation of proteins in various types of leukemia and lymphoma, indicating its role in malignant transformation [5,6]. Discovery of heterozygous mutations of the NPM1 gene, involving the C-terminus at exon 12, is apparently specific for AML as these mutations have not been found in other hematolymphoid malignancies [7]. Within the group of patients with AML who have a normal karyotype, various studies have shown that patients with NPM1-mutated AML had a complete remission rate similar to [8] or significantly higher than [9,10] patients with wild-type NPM1 AML. Most studies have shown a statistical trend toward favorable outcome in event-free survival and overall survival [10-12].

Further analyses in the context of other molecular aberrations have shown that patients with NPM1-mutated AML who have a normal karyotype and lack FLT3-ITD (representing 130

about 30% of all AML cases) have a better prognosis. This also emphasizes the value of comprehensive molecular genetic screening, because screening may ultimately lead to improved risk stratification [13]. In the current study, we investigated a group of AML patients for NPM1 mutations to clarify the gene’s prognostic impact on disease outcome.

Materials and Methods Patients The present study included 55 newly diagnosed de novo adult AML patients representing various FrenchAmerican-British (FAB) subtypes. They were 25 males and 30 females with mean age of 45.65±16.28 years.

They were consecutive patients meeting selection criteria defined below. Written informed consent was obtained from the patients prior to their enrollment in this study.

Patients were diagnosed according to standard diagnostic methods including cytomorphological, cytochemical, immunophenotypic (positivity by flow cytometry was defined as an expression in at least 20% of cells in the gated population of interest, compared to internal negative control cells), and cytogenetic evaluation. In addition, 10 healthy subjects with matched age and sex were selected to act as a control group. Bone marrow (BM) samples from patients with AML were subjected to Ficoll-Hypaque (Pharmacia LKB, Uppsala, Sweden) density gradient centrifugation. All samples taken at diagnosis were confirmed to contain more than 90% leukemia cells after enrichment by centrifugation.

Inclusion criteria were status as a newly diagnosed AML patient and no history of previous treatment. Exclusion criteria were status as a secondary AML patient, markedly impaired hepatic or renal functions, concurrent severe and/ or uncontrolled medical conditions (e.g., uncontrolled diabetes, infection, or hypertension), family history of hematological malignancies, and positivity for FLT3/ITD gene mutations by polymerase chain reaction (PCR).

Zidan M, et al: Prognostic Impact of Nucleophosmin 1 (NPM1) Gene Mutations in Egyptian Acute Myeloid Leukemia Patients

Treatment Protocol Patients received the standard ‘3+7’ induction chemotherapy protocol: doxorubicin (30 mg/m2 per day) for 3 days and cytarabine (100 mg/m2 per day as a continuous 24-hour intravenous infusion) for 7 days [14]. Patients with acute promyelocytic leukemia (M3) received all-trans retinoic acid plus anthracycline [15]. BM aspiration was done between 21 and 28 days after initiation of chemotherapy. Consolidation comprised 3 to 4 courses of high-dose cytosine arabinoside (3 g/m2 every 12 hours on days 1, 3, and 5; in total, 18 g/m2). Following this, patients were followed up once every 3 months with clinical examination and complete blood counts. A BM aspiration was done if there was any suggestion of relapse on clinical examination or peripheral smear.

Screening of NPM1 Gene Mutation by PCR-SSCP Genomic DNA was extracted from BM samples with the AxyPrep Blood Genomic DNA Miniprep Kit (Axygen Bioscience, USA) according to the manufacturer’s protocol. For NPM1 mutation analysis, NPM1 exon 12 was amplified by genomic PCR using primers NPMex12F/ CTGATGTCTATGAAGTGTTGTGGTTCC (sense) and NPMex12R/CTCTGCATTATAAAAAGGACAGCCAG (antisense). The reaction mixture was made up in a total volume of 50 μL by the following constituents: 100 ng of genomic DNA, 0.5 U Taq DNA polymerase, 1X Taq polymerase buffer, 1.75 mM MgCl2, 0.4 μM NPM1 primers, and 0.4 mM dNTP. The samples were amplified by initial denaturation at 95 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 53 °C for 1 min, and 72 °C for 2 min, and final extension at 72 °C for 10 min. They were checked on 2% agarose gel electrophoresis using a DNA marker (Figure 1).

PCR products were mixed with 10 volumes of loading buffer and denatured at 96 °C for 5 min, quenched on ice immediately, and applied to 10% polyacrylamide gel electrophoresis. Normal NPM1 exhibits a specific conformational pattern. A mutant gene displays a pattern with different electrophoretic mobility (mobility shift) [16] (Figure 2).

Turk J Hematol 2013;30:129-136

Statistical Analysis Comparisons between data were performed with the Mann-Whitney test for continuous variables and the Fisher exact test for categorical variables. Survival curves for OS and DFS were calculated according to the Kaplan-Meier method and were compared using a 2-sided log rank test. Prediction of OS and DFS was done using multivariate analysis applying age, cytogenetics, FAB subtypes, total leukocyte count (TLC), and NPM1 mutation state as covariates. P<0.05 was considered statistically significant. SPSS 16.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analysis.

Results Frequency of NPM1 Mutations PCR products from 55 newly diagnosed AML patients were used to screen for the prevalence of NPM1 mutation in exon 12. The wild-type gene was 167 bp. NPM1 mutation showed a double band at positions of 167 and 171 bp (Figure 1) in 12 of 55 AML cases (21.8%). All healthy control subjects had the wild-type allele.

Figure 1. Agarose gel electrophoresis of NPM1 gene (exon 12): Lane 1 = Normal control sample. Lanes 2, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 15 represent wild-type NPM1 gene.

Lanes 3, 4, and 14 represent mutant NPM1 gene.

Criteria of Response and Survival Definitions Complete remission (CR) required bone marrow blasts of <5.0%, absence of blasts with Auer rods, absence of extramedullary disease, absolute neutrophil count of >1.0x 109/L, and platelet count of >100x109/L with independence from red cell transfusions. Relapse was defined by bone marrow blasts of ≥5.0%, reappearance of blasts in the blood, or development of extramedullary disease. Resistant disease was defined as more than 15.0% BM blasts after induction therapy. Overall survival (OS) was defined as the time from entry to death. For patients achieving first CR, disease-free survival (DFS) was defined as the time from first CR to an event (death in CR or relapse).

Figure 2. SSCP of NPM1 gene (exon 12): N = Normal control sample. Lanes 1, 4, 5, and 8 represent wild-type NPM1 gene.

Lanes 2, 3, 6, 7, and 9 represent mutant NPM1 gene.

131

Turk J Hematol 2013;30:129-136

Zidan M, et al: Prognostic Impact of Nucleophosmin 1 (NPM1) Gene Mutations in Egyptian Acute Myeloid Leukemia Patients

Gene Mutations and Clinical Characteristics All 55 patients were evaluated for clinical characteristics.

The presence of NPM1 mutations was not related to age, sex, or the occurrence of fever, pallor, bleeding tendency, splenomegaly, hepatomegaly, or lymphadenopathy (p=0.39,

0.76, 0.516, 0.605, 0.217, 0.190, 0.416, and 0.230, respectively) (Table 1). TLC and BM blast cells were significantly higher in the NPM1 mutation group than in the wild-type group (p= 0.03 and 0.02, respectively) (Table 2).

NPM1 mutations were significantly higher in FAB M5 (50%)

Table 1: Clinical data of NPM1 mutations versus wild type in AML patients.

Mutant NPM1 (n=12)

Wild type NPM1 (n=43)

p

Age

45.33±16.14

45.74±16.49

0.39

Sex Males Females

5.0 (41.7%) 7.0 (58.3%)

20.0 (46.5%) 23.0 (53.5%)

Fever

6.0 (50.0%)

26.0 (60.4%)

0.516

Pallor

11.0 (91.6%)

37.0 (86.0%)

0.605

Bleeding tendency

8.0 (66.6%)

20.0 (46.5%)

0.217

Splenomegaly

5.0 (41.6%)

27.0 (62.8%)

0.190

8.0 (66.6%)

23.0 (53.5%)

3.0 (25.0%)

19.0 (44.2%)

Hepatomegaly Lymphadenopathy

0.76

0.416 0.230

Mean ± standard deviation is indicated for age. Number and percentage of cases is shown for sex, fever, pallor, bleeding tendency, splenomegaly, hepatomegaly, and lymphadenopathy.

Table 2: Laboratory data of NPM1 mutations versus wild type in AML patients.

Mutant NPM1 (12 cases)

Wild NPM1 (43 cases)

p

TLC (x109/L)

29.7±112

11.8±88

0.03*

Marrow blasts (%)

75.50±13.82

62.3±24.56

0.02*

FAB classification M0 M1 M2 M3 M4 M5 M6

0 (0%) 0 (0%) 3 (25%) 1 (8.3%) 1 (8.3%) 6 (50%) 1 (8.3%)

2 (4.7%) 4 (9.3%) 7 (16.3%) 3 (7.0%) 11 (25.6%) 12 (27.9%) 3 (7%)

Cytogenetics AML-NK Abnormal cytogenetics

8 (66.7%) 4 (33.3%)

24 (55.8%) 19 (44.2%)

0.65

0.509

TLC: Total leukocyte count. Mean ± standard deviation is indicated for TLC and marrow blasts. Number and percentage of cases is shown for FAB and cytogenetics. *p<0.05 is considered significant.

132

Zidan M, et al: Prognostic Impact of Nucleophosmin 1 (NPM1) Gene Mutations in Egyptian Acute Myeloid Leukemia Patients

Turk J Hematol 2013;30:129-136

Table 3: Comparison between positive NPM1 and negative NPM1 cases as regards clinical outcome.

Mutant NPM1 (12)

Wild NPM1 (43)

P

Complete remission

9.0 (75%)

15.0 (34.9%)

0.003*

Total death

2.0 (16.7%)

14.0 (32.6%)

0.28

Refractory to treatment

0 (0%)

9.0 (25.6%)

0.083

Relapse

1 (8.3%)

3 (6.9%)

0.45

Number and percentage of cases is shown for complete remission, total death, refractoriness, and relapse. *p<0.05 is considered significant.

Table 4: Overall survival and disease-free survival as dependent parameters studied with other covariates (multivariate analysis).

Overall survival

Disease-free survival

P

Hazard ratio

95% CI P value Hazard for relative ratio risk

95% CI for relative risk

Age (≤50/>50 yr)

0.31

1.01

1.05-1.11

0.76

1.00

1.05-1.11

TLC (x109/L): More than 50x109/L versus less than 50x109/L

0.58

0.99

0.99-1.00

0.74

0.99

0.99-1.00

FAB subtypes

0.24

0.92

0.66-1.10

0.76

0.91

0.66-1.10

Cytogenetics

0.39

1.87

0.35-1.49

0.17

0.48

0.35-1.49

NPM1 mutation status

0.002*

0.125

0.024-0.321

0.001*

0.066

0.02-0.25

CI: confidence interval. *p<0.05 is considered significant.

than in other FAB subgroups (p<0.001) with a statistically insignificant difference between mutant and wild-type NPM1 regarding to FAB subtypes (p=0.65) (Table 2).

Cytogenetic data were available for all patients: 32 patients had normal karyotype while 7 had t(8;21)(q22;q22), 7 had inv16(p13.1q22), 4 had t(15;17)(q22;q12), and 5 had 11q23 abnormalities. According to the cytogenetics, NPM1 mutation was preferentially found in AML-NK patients (8 of 12; 66.7%). Among AML with abnormal cytogenetics, 2 cases with inv(16), 1 case with t(15;17), and 1 case with t(8;21) showed NPM1 mutations, with nonsignificant difference between mutant and wild-type NPM1 regarding to cytogenetics (p=0.509) (Table 1).

Prognostic Impact of NPM1 Twenty-four AML patients achieved CR after induction chemotherapy (43.6%). The CR rate was significantly higher in the patients with NPM1 mutations (9 of 12; 75%, p=0.003) than those without (15 of 43; 34.9%) (Table 3). Refractory disease, relapse, and mortality rate were nonsignificantly lower in cases of NPM1 mutation (p=0.08,

p=0.45, p=0.28) (Table 3). Patients with NPM1 mutations had a significantly longer DFS (mean 18.635±1.229 versus 11.041±1.250 months, p=0.044) and OS (19.810±1.624 versus 12.063±1.244 months, p=0.041) than those without (Figures 3 and 4). Multivariable analyses confirmed NPM1 mutation as a significant independent predictor for DFS and OS (hazard ratio=0.066, p=0.001; hazard ratio=0.125, p=0.002, respectively) (Table 4).

Discussion The prognostic effect of various chromosomal aberrations in AML is well established with implications for therapy. We evaluated the prevalence and prognostic impact of NPM1 mutations in adult AML patients. The incidence of NPM1 mutations was 21.8%, which was obviously lower than previously reported (35%, 45%, 64%) by some earlier studies [7,8,9] but approximately similar to that reported (25.8%, 28.2%) by others [10,17]. The lower detection rate may be due to a higher background of wild-type allele or lower percentage of NPM1 mutation-positive cells in some cases, in addition to variable numbers of cases, and some former 133

Turk J Hematol 2013;30:129-136

Zidan M, et al: Prognostic Impact of Nucleophosmin 1 (NPM1) Gene Mutations in Egyptian Acute Myeloid Leukemia Patients

studies also focused on NK-AML. Certain associations between gene mutations and clinical characteristics have been reported in the past years [18].

No significant differences were found between mutant NPM1 and wild-type patients regarding to age and sex. This is in accordance with the findings of other studies [10,19].

However, Suzuki et al. found that patients with NPM1 mutations were significantly older than those without mutations [10].

We also found a significantly increased TLC and blast cell percentage in patients with NPM1 mutations (p=0.03 and 0.02, respectively). This finding was consistent with some previous reports [10,13,20]. Boonthimat et al. reported that NPM1 mutations were particularly associated with higher platelet count [21], as was similarly observed by Thiede et al., who suggested that blasts with NPM1 mutation might retain a certain capacity for thrombocytic differentiation as demonstrated by in vitro experiments [22]. Regarding FAB classification, this study, in accordance with others, confirmed that NPM1 mutations occur most commonly in FAB class M5 (p=0.001) [7,13,20,23]. Association of NPM1 mutation with monocytic features of AML indicated 100 NPM1 mutations, n=12 Disease-free survival (%)

80 60 NPM1 wild type, n=43

40 20 0

0

5

10 15 Months from study entry

20

Figure 3. Kaplan-Meier curve for disease-free survival in wild and mutant NPM1 patients.

100

NPM1 mutation, n=12

80 Overall s urvival (%)

NPM1 wild type, n=43 60

40

20

0 0

5

10 15 Months from study entry

20

Figure 4. Kaplan-Meier curve for overall survival in wild and mutant NPM1 patients.

134

a participation of NPM1 mutation in inducing leukemic development towards monocytic features. Cytogenetic data were available for all patients. The NPM1 mutation was nonsignificantly higher in patients with a normal karyotype (66.7%). Other studies showed significantly higher NPM1 mutations in AML-NK [7,8,24].

We were interested in the impact of NPM1 mutations on the hematological response following induction therapy as well as on the survival of Egyptian AML patients.

For this reason, we considered the comprehensive data demonstrating that in AML patients an additional FLT3ITD mutation is associated with a worse outcome compared with the expression of a single NPM1 mutation that can improve the prognosis in these patients [9,22]. We therefore excluded those patients harboring FLT3-ITD mutation from this analysis. The clinical outcome of NPM1 mutations (NPM+/FLT3-ITD-) seems to be distinctly favorable. The frequency of CR was higher (p=0.003) and mortality rate, relapse, and refractory disease were nonsignificantly lower (p=0.28, p=0.45, p=0.08) in patients with NPM1 mutations than those without. Other studies reported higher rates of CR in mutant NPM1 patients, suggesting that these patients are more sensitive to chemotherapeutic agents [12,25]. These studies assumed that NPMc+ may interact with and sequester nuclear factor kappaB, contributing to the maintenance and survival of malignant clones and an impaired response to chemotherapy in the cytoplasm, thus leading to its inactivation and reduced DNA binding [12,25]. However, in other studies, patients younger than 60 years old and pediatric patients did not show a significantly different CR rate between mutant and wild NPM1 [26,27].

DFS and OS were significantly longer for patients with NPM1 mutations. Similar results were also obtained in other studies [9,12,13,21,23] that demonstrated a favorable impact of NPM1 mutations on outcome. On the other hand, Boonthimat et al. reported that they did not observe a major difference in the OS in Thai patients with and without NPM1 mutation [21]. This contradiction may be attributed to ethnic variations, different inclusion criteria, and different sample sizes. Multivariable analyses confirmed NPM1 mutation as a significant independent predictor for DFS (hazard ratio=0.066, p=0.001) and OS (hazard ratio=0.125, p=0.002). Similar results were obtained in other studies [9,10], where NPM1 mutations were a favorable prognostic factor for DFS and OS. Other genomic abnormalities may accompany NPM1 mutations and have a prognostic impact in the NPM1-mutated patients, e.g., AML-NK patients without FLT3-ITD mutations and with both mutant NPM1 and isocitrate dehydrogenase (IDH) represent a favorablerisk subset defined by a specific mutational genotype, whereas patients negative for FLT3-ITD mutations who had mutant NPM1 without concurrent IDH mutations had a much less favorable outcome, particularly if those patients had concurrent mutations associated with an unfavorablerisk profile [28]. Schneider et al. showed that the FLT3-ITD

Zidan M, et al: Prognostic Impact of Nucleophosmin 1 (NPM1) Gene Mutations in Egyptian Acute Myeloid Leukemia Patients

mRNA level has a high prognostic impact in NPM1-mutated AML-NK, and that it contributes to relapse risk stratification and might help to guide postremission therapy in NPM1mutated AML [29]. This is of major clinical importance, since it strongly suggests that NPM1 mutations may allow dissection of the heterogeneous group of AML into prognostically different subgroups. Since NPM1-mutated AML was listed as a provisional entity in the 2008 World Health Organization classification, routine screening of NPM1 gene mutations will eventually be needed to stratify patients with AML in the context of comprehensive genetic analysis. In conclusion, we propose that NPM1 mutations have prognostic significance in Egyptian AML patients; molecular assessment of NPM1 mutation at diagnosis offers valuable additional prognostic information and may thereby markedly affect therapeutic decisions.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Referencest 1. Slovak ML, Kopecky KJ, Cassileth PA, Harrington DH, Theil KS, Mohamed A, Paietta E, Willman CL, Head DR, Rowe JM, Forman SJ, Appelbaum FR. Karyotypic analysis predicts outcome of preremission and postremission therapy in adult acute myeloid leukemia: a Southwest Oncology Group/Eastern Cooperative Oncology Group Study. Blood 2000;96:4075-4083.

2. Borer RA, Lehner CF, Eppenberger HM, Nigg EA. Major nucleolar proteins shuttle between nucleus and cytoplasm.

Cell 1989;56:379-390.

3. Szebeni A, Olson MO. Nucleolar protein B23 has molecular chaperone activities. Protein Sci 1999;8:905-912.

4. Lee SY, Park JH, Kim S, Park EJ, Yun Y, Kwon J. A proteomics approach for the identification of nucleophosmin and heterogeneous nuclear ribonucleoprotein C1/C2 as chromatin-binding proteins in response to DNA doublestrand breaks. Biochem J 2005;388:7-15.

5. Colombo E, Marine JC, Danovi D, Falini B, Pelicci PG. Nucleophosmin regulates the stability and transcriptional activity of p53. Nat Cell Biol 2002;4:529-533.

6. Bertwistle D, Sugimoto M, Sherr CJ. Physical and functional interactions of the Arf tumor suppressor protein with nucleophosmin/B23. Mol Cell Biol 2004; 24: 985-996.

7. Falini B, Mecucci C, Tiacci E, Alcalay M, Rosati R, Pasqualucci L, La Starza R, Diverio D, Colombo E, Santucci A, Bigerna B, Pacini R, Pucciarini A, Liso A, Vignetti M, Fazi P, Meani N, Pettirossi V, Saglio G, Mandelli F, Lo-Coco F, Pelicci PG, Martelli MF. Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype. N Engl J Med 2005;352:254-266.

Turk J Hematol 2013;30:129-136

8. Boissel N, Renneville A, Biggio V, Philippe N, Thomas X, Cayuela JM, Terre C, Tigaud I, Castaigne S, Raffoux E, De Botton S, Fenaux P, Dombret H, Preudhomme C. Prevalence, clinical profile, and prognosis of NPM mutations in AML with normal karyotype. Blood 2005;106:3618-3620.

9. Schnittger S, Schoch C, Kern W, Mecucci C, Tschulik C, Martelli MF, Haferlach T, Hiddemann W, Falini B. Nucleophosmin gene mutations are predictors of favorable prognosis in acute myelogenous leukemia with a normal karyotype. Blood 2005; 106: 3733-3739.

10. Suzuki T, Kiyoi H, Ozeki K, Tomita A, Yamaji S, Suzuki R, Kodera Y, Miyawaki S, Asou N, Kuriyama K. Clinical characteristics and prognostic implications of NPM1 mutations in acute myeloid leukemia. Blood 2005;106:2854-2861.

11. Falini B, Martelli MP, Bolli N, Sportoletti P, Liso A, Tiacci E. Acute myeloid leukemia with mutated nucleophosmin (NPM1): is it an entity? Blood 2011;117:1109-1120.

12. Döhner K, Schlenk RF, Habdank M, Scholl C, Rücker FG, Corbacioglu A, Bullinger L, Fröhling S, Döhner H. Mutant nucleophosmin (NPM1) predicts favorable prognosis in younger adults with acute myeloid leukemia and normal cytogenetics: interaction with other gene mutations. Blood 2005;106:3740-3746.

13. Wang L, Xu WL, Meng HT, Qian WB, Mai WY, Tong HY, Mao LP, Tong Y, Qian JJ, Lou YJ, Chen ZM, Wang YG, Jin J. FLT3 and NPM1 mutations in Chinese patients with acute myeloid leukemia and normal cytogenetics. J Zhejiang Univ Sci B 2010;7:1581-1673.

14. Yates J, Glidewell O, Wiernik P, Cooper MR, Steinberg D, Dosik H, Levy R, Hoagland C, Henry P, Gottlieb A, Cornell C, Berenberg J, Hutchison JL, Raich P, Nissen N, Ellison RR, Frelick R, James GW, Falkson G, Silver RT, Haurani F, Green M, Henderson E, Leone L, Holland JF. Cytosine arabinoside with daunorubicin or adriamycin for therapy of acute myelocytic leukemia: a Cancer and Leukemia Group B study. Blood 1982;60:454-462.

15. Kanamaru A, Takemoto Y, Tanimoto M, Murakami H, Asou N, Kobayashi T, Kuriyama K, Ohmoto E, Sakamaki H, Tsubaki K. All-trans retinoic acid for the treatment of newly diagnosed acute promyelocytic leukemia. Japan Adult Leukemia Study Group. Blood 1995;85:1202-1206.

16. Hayashi K. PCR-SSCP: A simple and sensitive method for detection of mutations in the genomic DNA. Genome Res 1991;1:34-38.

17. Zhang Y, Zhang M, Yang L, Xiao Z. NPM1 mutations in myelodysplastic syndromes and acute myeloid leukemia with normal karyotype. Leuk Res 2007;31:109-111.

18. Falini B, Macijewski K, Weiss T, Bacher U, Schnittger S, Kern W. Multilineage dysplasia has no impact on biologic, clinicopathologic, and prognostic features of AML with mutated nucleophosmin (NPM1). Blood 2010;115:37763786.

135

Turk J Hematol 2013;30:129-136

Zidan M, et al: Prognostic Impact of Nucleophosmin 1 (NPM1) Gene Mutations in Egyptian Acute Myeloid Leukemia Patients

19. Haferlach C, Mecucci C, Schnittger S, Kohlmann A, Mancini M, Cuneo A, Testoni N, Rege-Cambrin G, Santucci A, Vignetti M, Fazi P, Martelli MP, Haferlach T, Falini B. AML with mutated NPM1 carrying a normal or aberrant karyotype show overlapping biologic, pathologic, immunophenotypic, and prognostic features. Blood 2009;114:3024-3032.

20. Kim Y, Kim H, Lee S, Ahn J, Yang D, Lee J, Lee I, Shin M, Kim H. Prognostic significance of nucleophosmin mutations and FLT3 internal tandem duplication in adult patients with cytogenetically normal acute myeloid leukemia. Korean J Hematol 2010;45:36-45.

21. Boonthimat C, Thongnoppakhun W, Auewarakul CU. Nucleophosmin mutation in Southeast Asian acute myeloid leukemia: eight novel variants, FLT3 coexistence and prognostic impact of NPM1/FLT3 mutations. Haematologica 2008;93:1565-1569.

22. Thiede C, Koch S, Creutzig E, Steudel C, Illmer T, Schaich M, Ehninger G. Prevalence and prognostic impact of NPM1 mutations in 1485 adult patients with acute myeloid leukemia (AML). Blood 2006;107:4011-4020.

23. Martelli MP, Pettirossi V, Thiede C, Cecchini D. CD34+ cells from AML with mutated NPM1 harbor cytoplasmic mutated nucleophosmin and generate leukemia in immunocompromised mice. Blood 2010;116:3907-3922.

24. Schnittger S, Schoch C, Dugas M, Kern W, Staib P, Wuchter C, Löffler H, Sauerland CM, Serve H, Büchner T. Analysis of FLT3 length mutations in 1003 patients with acute myeloid leukemia: correlation to cytogenetics, FAB subtype, and prognosis in the AMLCG study and usefulness as a marker for the detection of minimal residual disease. Blood 2002;100:59-66.

25. Gale RE, Green C, Allen C, Mead AJ, Burnett AK, Hills RK, Linch DC. The impact of FLT3 internal tandem duplication mutant level, number, size and interaction with NPM1 mutations in a large cohort of young adult patients with acute myeloid leukemia. Blood 2008;111:2776-2784.

136

26. Verhaak RG, Goudswaard CS, van Putten W, Bijl MA, Sanders MA, Hugens W, Uitterlinden AG, Erpelinck CA, Delwel R, Löwenberg B. Mutations in nucleophosmin (NPM1) in acute myeloid leukemia (AML): association with other gene abnormalities and previously established gene expression signatures and their favorable prognostic significance. Blood 2005;106:3747-3754.

27. Hollink IH, Zwaan CM, Zimmermann M, Arentsen-Peters TC, Pieters R, Cloos J, Kaspers GJ, de Graaf SS, Harbott J, Creutzig U, Reinhardt D, van den Heuvel-Eibrink MM, Thiede C. Favorable prognostic impact of NPM1 gene mutations in childhood acute myeloid leukemia, with emphasis on cytogenetically normal AML. Leukemia 2009;2:262-270.

28. Patel JP, Gönen M, Figueroa ME, Fernandez H, Sun Z, Racevskis J, Van Vlierberghe P, Dolgalev I, Thomas S, Aminova O, Huberman K, Cheng J, Viale A, Socci ND, Heguy A, Cherry A, Vance G, Higgins RR, Ketterling RP, Gallagher RE, Litzow M, van den Brink MR, Lazarus HM, Rowe JM, Luger S, Ferrando A, Paietta E, Tallman MS, Melnick A, Abdel-Wahab O, Levine RL. Prognostic relevance of integrated genetic profiling in acute myeloid leukemia. N Engl J Med 2012;366:1079-1089.

29. Schneider F, Hoster E, Unterhalt M, Schneider S, Dufour A, Benthaus T, Mellert G, Zellmeier E, Kakadia PM, Bohlander SK, Feuring-Buske M, Buske C, Braess J, Heinecke A, Sauerland MC, Berdel WE, Büchner T, Wörmann BJ, Hiddemann W, Spiekermann K. The FLT3ITD mRNA level has a high prognostic impact in NPM1 mutated, but not in NPM1 unmutated, AML with a normal karyotype. Blood 2012;119:4383-4386.

Research Article

DOI: 10.4274/Tjh.2011.0023

Gene Expression of VEGF-A and VEGF-C in Peripheral Blood Mononuclear Cells of Iranian Patients with Acute Myeloid Leukemia Akut Miyeloid Lösemili İranlı Hastaların Periferik Kan Mononükleer Hücrelerinde VEGF-A ve VEGF-C Gen Ekspresyonu Mohammad Reza Aliparasti1,2,3, Shohreh Almasi1,2,3, Zohreh Sanaat1, Aliakbar Movasaghpoor1, Reza Khalili-Dizaji1, Homaun Sadeghi-Bazargani4 1 Tabriz University of Medical Sciences, Department of Hematology and Oncology Research Center, Tabriz, Iran 2 Tabriz University of Medical Sciences, Department of Immunology Research Center, Tabriz, Iran 3 Tabriz University of Medical Sciences, Faculty of Medicine, Department of Immunology, Tabriz, Iran 4Neuroscience Research Center, Department of Statistics & Epidemiology, School of Health & Nutrition, Tabriz University of Medical Sciences, Tabriz, Iran

Abstract: Objective: The crucial role of angiogenesis in the pathophysiology of acute myeloid leukemia (AML) has been proposed.

One of the key regulators of angiogenesis is the vascular endothelial growth factor (VEGF). Among the VEGF family, it has been observed that VEGF-A and VEGF-C are expressed by AML cells and mediate leukemic cell proliferation, survival, and resistance to chemotherapy. Emerging evidence, however, suggests that elevated levels of VEGF or a proangiogenic phenotype may impede, rather than promote, early tumor development and progression. As the significance of VEGF-A and VEGF-C levels in the pathogenesis of AML has not been clarified well, the aim of this study is to evaluate gene expression of these angiogenesis promoters and its possible prognostic value in peripheral blood mononuclear cells of Iranian patients with AML. Materials and Methods: We investigated the mRNA expression of VEGF-A and VEGF-C in peripheral blood mononuclear cells of 27 patients with newly diagnosed AML and 28 healthy controls by quantitative real-time PCR. Results: Expression of VEGF-C mRNA was significantly lower in AML patients than in healthy controls (p<0.001). However, there was no significant decrement in expression of VEGF-A mRNA of AML patients compared to the control group (p=0.861).

VEGF-A and VEGF-C expression were not able to predict clinical outcome.

Conclusion: Our data showed that AML is associated with a decreased expression of VEGF-C mRNA. However, expression levels did not influence the clinical outcome in our study. It seems that angiogenesis is affected by different cytokines other than VEGF-C or VEGF-A, and VEGF is also affected by different cytokines. Taken together, these findings help to provide new insights into the investigation of other angiogenic factors and cytokines that may play roles in the pathogenesis of AML. Key Words: Acute myeloid leukemia, VEGF-A, VEGF-C, Gene expression, Angiogenesis Address for Correspondence: Shohreh ALMASI, M.D., Immunology Research Center, Tabriz University of Medical Sciences. /Address: Golgasht St. Daneshgah St, Tabriz-Iran, Postal Code: 5166614766 Po/Box: 51664 E-mail: almasysh@sums.ac.ir Received/Geliş tarihi : November 05, 2011 Accepted/Kabul tarihi : November 06, 2012

137

Aliparasti MR, et al: Gene expression of VEGF-A and VEGF-C in Peripheral Blood Mononuclear Cells of Iranian Patients with Acute Myeloid Leukemia

Turk J Hematol 2013;30:137-143

Özet: Amaç: Akut miyeloid lösemi (AML) patofizyolojisinde anjiyogenezinönemli rol oynadığı ileri sürülmektedir. Anjiyogenezdeki anahtar düzenleyicilerden biri damar endotel büyüme faktörü- vascular endothelial growth factor (VEGF)- dür. VEGF ailesi içinde, VEGF-A ve VEGF-C’nin AML hücreleri tarafından eksprese edildiği ve lösemik hücrenin proliferasyonu, yaşamı ve kemoterapiye direncine aracı olduğu gözlenmiştir. Buna rağmen mevcut bilgiler, artmış VEGF düzeylerinin veya proanjiyogenik bir fenotipin erken tümör gelişimi ve progresyonunu tetiklemekten ziyade engelleyebildiğini göstermiştir. VEGF-A ve VEGF-C düzeylerinin AML patogenezindeki yeri tam olarak açıklanamadığından, bu çalışmanın amacı İranlı AML hastalarının periferik kan mononükleer hücrelerinde sözügeçen anjiyogenez düzenleyicilerinin gen ekspresyonlarını ve prognostik değerini incelemektir.

Gereç ve Yöntemler: Yirmi yedi yeni tanı AML hastası ile 28 sağlıklı köntrolün periferik kan mononükleer hücrelerinde kantitatif real-time PCR ile VEGF-A ve VEGF-C’nin mRNA ekspresyonu araştırdık.

Bulgular: AML hastalarındaki VEGF-C mRNA ekspresyonu sağlıklı kontrollere göre belirgin olarak düşüktü (p<0.001).

Buna karşılık VEGF-A mRNA ekspresyonunda kontrol grubuna göre anlamlı bir azalma yoktu (p=0.861). VEGF-A ve VEGF-C ekspresyonunun klinik sonucu ön görme kapasitesi yoktur.

Sonuç: Bulgularımız AML’nin azalmış VEGF-C mRNA ekspresyonu ile ilişkili olduğunu gösterdi. Buna rağmen ekspresyon düzeyleri bizim çalışmamızda klinik sonucu etkilemedi. Hem VEGF başka sitokinlerden hem de anjiyogenez VEGF-C veya VEGF-A’dan başka sitokinlerden etkileniyor gibi görünmektedir. Sonuç olarak, bulgularımız AML patogenezinde rolü olabilecek diğer anjiyojenik faktör ve sitokinlerin araştırılmasına yeni bir bakış açısı sağlayarak yardımcı olacaktır.

Anahtar Sözcükler: Akut Miyeloid Lösemi, VEGF-A, VEGF-C, Gen ekspresyonu, Anjiyogenez

Introduction Acute myeloid leukemia (AML) is an aggressive hematologic malignancy characterized by accumulation of immature malignant myeloid cells in the bone marrow and blood due to their clonal proliferation without substantial maturation [1,2]. The pivotal role of angiogenesis has been suggested in the pathophysiology of AML. The crucial role of angiogenesis in the growth, persistence, and metastases of solid tumors has been indicated in many studies [3,4].

Moreover, the importance of angiogenesis in the pathogenesis of hematologic malignancies has been recognized recently.

Earliest studies have reported the increased microvessel density in the bone marrow of AML patients compared to normal groups [5,6,7,8]. Angiogenesis is controlled by a balance between proangiogenic and antiangiogenic growth factors and cytokines [9,10]. One of the most key regulators of angiogenesis is the vascular endothelial growth factor (VEGF), which increases permeability and promotes proliferation, migration, and differentiation of endothelial cells. The most responsible factor for angiogenesis is hypoxia, which induces expression of VEGF [10]. The VEGF family includes 5 glycoproteins: VEGF-A, VEGF-B, VEGF-C, VEGF-D, and PGF [11]. Among the VEGF family, it is known that VEGF-A and VEGF-C are expressed by AML cells [12,13].

There are 3 known VEGF receptor tyrosine kinases, VEGFRs 1, 2, and 3, that are exclusively expressed in endothelial cells, hematopoietic stem cells, and tumor cells [14,15]. It has been observed that leukemia cells commonly express one or both of VEGFR-1 and VEGFR-2, and they 138

can produce and secrete VEGF [16,17]. It has been shown that VEGF stimulates a mitogenic response in hematologic malignancies and promotes self-renewal of leukemia progenitors [17,18]. The role of VEGF-A as a proangiogenic factor in AML has been well documented [19]. Furthermore, recent studies have revealed the contribution of VEGF-C in hematological malignancies’ progression [20,21,22].

However, in spite of the evidence of the angiogenic role of VEGF in AML, there are investigations that reported lower VEGF-C [23,24] and VEGF-A [23] expression in the AML patient’s bone marrow than in healthy controls. Therefore, as the significance of VEGF-A and VEGF-C levels in the pathogenesis of AML has not been clarified well, the aim of this study was to evaluate gene expression of VEGF-A and VEGF-C and its possible prognostic value in peripheral blood mononuclear cells (PBMCs) of Iranian patients with AML. Materials and Methods Patients and Controls Twenty-seven (14 female and 13 male) patients with newly diagnosed AML who were referred to Shahid Ghazi Tabatabai Hospital in Tabriz from September 2009 to July 2010 were enrolled in this study. The initial diagnosis of AML and its subtypes were determined according to the French-American-British classification [25]. AML smears were routinely investigated at the same hospital, and subtyping was confirmed by flow cytometry. The clinical data of these patients are summarized in Table 1. The control group consisted of 28 healthy volunteers (14 females and 14 males) who were ethnically, age-, and sex-matched

Aliparasti MR, et al: Gene expression of VEGF-A and VEGF-C in Peripheral Blood Mononuclear Cells of Iranian Patients with Acute Myeloid Leukemia

to the patients and were recruited from the Tabriz Blood Transfusion Organization. Control subjects were screened by a physician using a questionnaire to ensure the absence of any hematological malignancies as well as a personal or family history of AML. This study was approved by the local ethics committees.

Blood Sampling and PBMC Isolation EDTA-added whole blood was collected from AML patients and controls. Mononuclear cells were isolated from peripheral blood by Ficoll-Hypaque density gradient centrifugation.

RNA Extraction and First-Strand cDNA Synthesis Total RNA was extracted from PBMCs and blasts using Trizol Reagent (Invitrogen, USA) according to the manufacturer’s description and treated with RNase-free DNase to remove any residual genomic DNA. Single-stranded cDNAs were synthesized by incubating total RNA (1 μg) with RevertAid H Minus M-MuL V reverse transcriptase (200 U), oligo-(dT)18 primer (5 μM), random hexamer primer (5 μM), dNTPs (1 mM), and RiboLockRNase-inhibitor (20 U) for 5 min at 37 °C, followed by 5 min at 25 °C followed by 60 min at 42 °C in a final volume of 20 μL. Reaction was terminated by heating at 70 °C for 5 min.

Table 1: Characteristics of AML patients.

Characteristics

Patients

No. of patients

27

Median age, years (range)

39.5 (20-60)

Sex (male/female)

13/14

WBC (x109/L)

34.4 (11-139)

Patients with WBC of >100x109/L

3

FAB classification no.

M1 M2 M3 M4 M5

5 8 4 5 4

FAB: French-American-British classification for AML

Turk J Hematol 2013;30:137-143

Real-Time Relative Quantitative RT-PCR Quantitative real-time PCR was done using the Corbett Life Science System (Rotor-Gene 6000) with 2 μL of 4-fold diluted cDNA in each PCR reaction in a final volume of 20 μL. Each PCR reaction contained 150 nM of primers and 1X FastStart SYBR Green Master (Roche). Sequences of primers are listed in Table 2. PCR amplifications were performed by the following 3-cycle program: 1) denaturation of cDNA (1 cycle: 95 °C for 10 min); 2) amplification (40 cycles: 95 °C for 15 s, 57 °C for 30 s, 60 °C for 34 s); 3) melting curve analysis (1 cycle: 60 to 95 °C with temperature transition rate of 1 °C/s). β-Actin (ACTB) mRNA expression levels were used to calculate relative expression levels. All data are presented as a ratio of the target gene/ACTB. The relative quantification was performed by 2(−∆Ct): expression of target genes / β-actin = (1+E)-Ct target gene / (1+E)-Ct β-actin.

The specificity of the PCR reactions was verified by generation of a melting curve analysis followed by gel electrophoresis, visualized by ethidium bromide staining.

Standard Curve Efficiency of RT-PCR reactions was determined by a standard curve, which was derived from the 10-fold serial dilution of a positive PCR product by a customary RT-PCR. Logarithms of concentrations were plotted against the target gene cycling threshold (Ct) of serial dilution. VEGF-A, VEGF-C, and ACTB efficiencies were 95%, 91%, and 96% respectively.

Statistical Analysis Expression of VEGF-A and VEGF-C was obtained with the Corbett Rotor-Gene 6000.

Normal distribution of data was evaluated using Stata software with qnorm program version 11. Data were analyzed with SPSS 16. Variables that had normal distribution were reported as means and standard deviations.

Medians were reported for the variables whose distribution deviated from the normal distribution. Differences between diagnostic groups were evaluated using the Kruskal–Wallis test and comparisons of gene expression levels between AML patients and the control group were performed with the Mann–Whitney test. Overall survival was measured from the date of first diagnosis to death from any cause.

Kaplan–Meier estimation was used to plot survival curves, and log-rank tests were used to test the difference between

Table 2: Sequences of primers.

Gene

Forward primer

Reverse primer

VEGF-A

GAGTGTGTGCCCACTGAGGAGTCCAAC

CTCCTGCCCGGCTCACCGCCTCGGCTT

VEGF-C

GATCTGGAGGAGCAGTTAGG

GAGTTGAGGTTGGCCTGTTC

β-actin

GCTGTGCTACGTCGCCCTG

GGAGGAGCTGGAAGCAGCC 139

Aliparasti MR, et al: Gene expression of VEGF-A and VEGF-C in Peripheral Blood Mononuclear Cells of Iranian Patients with Acute Myeloid Leukemia

Turk J Hematol 2013;30:137-143

groups. Univariate and multivariate Cox regression analyses were also used to estimate prognosis. Proportional hazard assumption was checked for the survival models. The correlation between continuous variables was studied using Spearman’s rank correlation (rs). All tests were 2-tailed and a 5% significance level was applied.

Results Patients and Controls We studied 27 patients with AML (14 females and 13 males) aged between 20 and 60 years (mean: 39.5 ±14.1 years) in this study; 52% of the subjects were female and 48% were male. All of the selected patients had white blood cell (WBC) counts of >10x109/L and blasts of >4% in the peripheral blood. AML subtypes, according to the FrenchAmerican-British classification, were 5 (19.2%) M1, 8 (30.8%) M2, 4 (15.4%) M3, 5 (19.2%) M4, and 4 (15.4%) M5. The blast counts in the specimens tested ranged from 5% to 71% with a mean value of 25% in peripheral blood.

All AML cases were negative for terminal deoxynucleotidyl transferase (TdT). Seventeen out of 27 AML patients (63%) were found to be CD34-positive (mean CD34 expression: 60.13%), whereas 10 patients (37%) were CD34-negative.

The control group ranged from 20 to 58 years of age (mean: 38 ± 10.6), of which 50% were male. All of the selected healthy controls had WBC counts of <10x109/L. Gene Expression Comparison of VEGF-A and VEGF-C Expression between AML Patients and Normal Controls In spite of the wide range of individual values of VEGF-A or VEGF-C, median expression of VEGF-C mRNA in PBMCs of the control group were increased by about 43-fold compared to AML patients (p<0.001) (Figure 1). However, there were no significant differences in VEGF-A mRNA expression between leukemia cells and normal control cells (p=0.861) (Figure 1). There were also no significant

Assessment of correlation between gene expression levels of VEGF-A or VEGF-C and French-American-British subtypes, peripheral WBC count, percentage of blasts, absolute blast count, hemoglobin value, platelet count, age, and sex revealed no significant correlations.

Association between VEGF-A or VEGF-C Expression in PBMCs and Immunophenotype of AML Cells We assayed the correlation between gene expression levels of VEGF-A or VEGF-C and expression of antigens CD2, CD3, CD4, CD7, CD10, CD11b, CD13, CD14, CD15, CD19, CD20, CD22, CD33, CD34, CD38, CD45, HLA-DR, TdT, and glycophorin A; no significant correlations were found.

Association between VEGF-A or VEGF-C Expression and Outcome Further investigation was performed by using the Kaplan–Meier survival curve and log-rank test to evaluate the suitability of these molecules as prognostic factors.

Patients were divided into a low group (expression of VEGF-A or VEGF-C below the median) and a high group (above the median). We rechecked the analysis based on the lower versus upper quartile (25%) of VEGF expression by developing a Cox model. All AML cases did not have bone marrow transplant. The median follow-up period of the 27 patients was 312 days (range: 1–990 days).

We performed a univariate Cox regression analysis of the impact of VEGF-A and VEGF-C gene expression on overall survival. This analysis showed that neither sex and age nor WBC count, absolute blast count, hemoglobin level, platelet count, prothrombin time, and partial thromboplastin

68

4.00E-3

2.00E-3

0.00E0 Normal

1.0

Low VEGF-A

73

B

0.8

1.0 0.8

0.08 0.06 0.04

0.6

p=0.793

0.4

Cum Survival

6.00E-3

A

0.10

Cum Survival

8.00E-3

Patient

p=0.548

0.6

Low VEGF-C

0.4 0.2 High VEGF-C

0.2 High VEGF-A

0.02

0.0

25

0.0 0

0.00

200 400 600 800 1000 Follow up (days)

Patient

0

200 400 600 800 1000 Follow up (days)

Normal

Figure 1. VEGF-A (A) and VEGF-C (B) mRNA expression in PBMCs of AML patients and normal controls (p=0.861 and p<0.001, respectively).

140

Association between VEGF-A or VEGF-C Expression in PBMCs of Leukemic Cells and Clinical Features

B Relative Expression of VEGF-C/β- actin

Relative Expression of VEGF-A/β- actin

A

correlations with PBMCs of VEGF-A and VEGF-C transcripts in patients and controls (rs=0.121, p=0.565 and rs=-0.170, p=0.438, respectively).

Figure 2. Kaplan–Meier survival curves for VEGF-A (A) and VEGF-C (B). Each angiogenesis factor was divided into high (solid line) and low (dotted line) concentration subgroups based on the distribution of mRNA levels.

Aliparasti MR, et al: Gene expression of VEGF-A and VEGF-C in Peripheral Blood Mononuclear Cells of Iranian Patients with Acute Myeloid Leukemia

time were significantly related to prognosis in the study population. The Kaplan–Meier curves for overall survival stratified according to VEGF-A and VEGF-C expression in the PBMCs of AML patients are shown in Figure 2.

Discussion The fact that angiogenesis may have an important role in AML and the key regulatory role of the VEGF/VEGFR complex in angiogenesis leads to the performing of studies regarding the role of VEGF in AML [26-28]. Fielder et al. reported that the leukemic cells of most patients with AML expressed VEGF-C [27]. Furthermore, Dias et al. demonstrated that VEGF-C, which was released from the endothelium, induced proliferation, promoted survival of AML cells, and protected VEGFR-3–expressing leukemic cells from chemotherapy-induced apoptosis [21].

In the present study, we observed a significant decrease of VEGF-C mRNA expression in leukemia cells compared to normal control cells (p<0.001). Although only 1 study has reported elevated expression of VEGF-C in the bone marrow of AML patients compared with the normal group [29], in 2 recent studies, in agreement with our results, decreased VEGF-C expression levels were reported in bone marrow mononuclear cells of AML patients compared to healthy controls. Lee et al. reported that the marrow level of VEGF-C was significantly lower (p<0.001) in AML patients compared to values in healthy controls [23]. Moreover, similar significant decrement of VEGF-C in the bone marrow of AML patients was observed by Hou et al. (p=0.0011) [24].

Loges et al. also reported that the expression of VEGF-C in AML patients was lower than in normal PBMCs; however, this difference was not significant [30].

In 2 previous studies, expressions of VEGF-C or VEGF-A were not an independent prognostic factor for relapse-free and overall survival [24,30], but it was shown that in the presence of higher levels of VEGF-C and VEGF-A, patients with high Ang-2 expression had a poor prognosis [24]. In this study, we found no relationship between VEGF-C expression levels and clinical outcome. It seems that angiogenesis is affected by different cytokines other than VEGF-C, as well as VEGF-C being affected by different cytokines It has been shown that VEGF-A induces proliferation, survival, and protection of AML cells against apoptosis by an autocrine loop via VEGFR signaling [31,32,33].

In the present study, we did not observe any significant differences in VEGF-A mRNA expression of AML patients compared to controls (p=0.861), and this observation is in concurrence with a previous study that reported lower levels of marrow VEGF-A in AML compared to normal controls (p=0.158) [23]. However, these results are controversial with regard to previous studies that indicated the significantly enhanced expression of VEGF-A in AML patients’ bone marrow compared to controls [24,34]. Additionally, we did

Turk J Hematol 2013;30:137-143

not observe any significant relationship between VEGF-A and clinical outcome.

Emerging evidence from genetically modified animal models, interestingly, proposes that elevated levels of VEGF-A may prevent, rather than promote, early tumor development and progression [35,36,37]. The study by Cervi et al. in a retrovirus-induced, spontaneous murine leukemia model reported a tumor inhibitory role for VEGF-A, and it was observed that a 2-fold overexpression of VEGF-A systemic levels leads to deceleration of tumorigenesis [37]. VEGF-A inhibits the growth and progression of various cancer types through recruitment of tumor inhibitory monocytic cells [38,39] and the negative regulation of tumor angiogenesis [35,36].

Stockmann et al. demonstrated that in the absence of myeloid cell-derived VEGF-A, an atypical high density vessel network is formed. They suggested that myeloid-derived VEGF-A plays a unique key role in facilitating changes in tumor vessel function and normalization [36]. Greenberg et al. observed that VEGF-A disrupts the function of vascular smooth muscle cells [35]. These studies have provided evidence to suggest that VEGF-A can act as a negative regulator of angiogenesis and tumor progression.

Overall, the studies described above suggest that VEGF-A plays a pivotal role in providing the mechanisms that regulate tumor growth and endow a survival advantage to the host.

In addition, these studies propose that VEGF-A acts as an inhibitor of tumor growth when its levels are modulated through genetic modification before cancer induction. The dichotomous (enhancer or inhibitor) roles of VEGF-A in tumor angiogenesis are dependent on its concentration in the host microenvironment.

These contradictory results may suggest that a complex regulation of the cytokine system exists during the angiogenesis process in AML, and more studies are necessary to clarify the role of VEGF and other proangiogenic cytokines in this disease.

In conclusion, in our study, we observed a significant decrement of VEGF-C levels in the PBMCs of AML patients compared to healthy controls. However, there was no significant decrement in expression of VEGF-A mRNA of AML patients compared to the control group. We were not able to assess any role of VEGF-C or VEGF-A in predicting prognosis in AML patients by evaluating the VEGF expression of PBMCs. It seems that angiogenesis affects different cytokines other than VEGF-C or VEGF-A, and VEGF is also affected by different cytokines. Taken together, these findings help to provide new insights into the investigation of other angiogenic factors and cytokines that may play roles in the pathogenesis of AML. To clarify the role of VEGF in AML pathogenesis, further comprehensive studies with larger sample sizes are recommended.

141

Aliparasti MR, et al: Gene expression of VEGF-A and VEGF-C in Peripheral Blood Mononuclear Cells of Iranian Patients with Acute Myeloid Leukemia

Turk J Hematol 2013;30:137-143

Acknowledgments We would like to acknowledge all AML patients and healthy individuals who vulnerably participated in this study.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Lowenberg B, Downing JR, Burnett A. Acute myeloid leukemia. N Engl J Med 1999;341:1051-1062.

2. Smith M, Barnett M, Bassan R, Gatta G, Tondini C, Kern W. Adult acute myeloid leukaemia. Crit Rev Oncol Hematol 2004;50:197-222.

3. Zetter BR. Angiogenesis and tumor metastasis. Annu Rev Med 1998;49:407-424.

4. Folkman J. Role of angiogenesis in tumor growth and metastasis. Semin Oncol 2002;29:15-18.

5. Hussong JW, Rodgers GM, Shami PJ. Evidence of increased angiogenesis in patients with acute myeloid leukemia. Blood 2000;95:309-313.

6. Padro T, Ruiz S, Bieker R, Burger H, Steins M, Kienast J, Buchner T, Berdel WE, Mesters RM. Increased angiogenesis in the bone marrow of patients with acute myeloid leukemia.

Blood 2000;95:2637-2644.

7. Negaard HF, Iversen N, Bowitz-Lothe IM, Sandset PM, Steinsvik B, Ostenstad B, Iversen PO. Increased bone marrow microvascular density in haematological malignancies is associated with differential regulation of angiogenic factors.

Leukemia 2009;23:162-169.

8. Carmeliet P. Angiogenesis in life, disease and medicine.

Nature 2005;438:932-936.

9. Ribatti D, Vacca A, Presta M. The discovery of angiogenic factors: a historical review. Gen Pharmacol 2000;35:227231.

10. Pugh CW, Ratcliffe PJ. Regulation of angiogenesis by hypoxia: role of the HIF system. Nat Med 2003;9:677-684.

11. Hicklin DJ, Ellis LM. Role of the vascular endothelial growth factor pathway in tumor growth and angiogenesis. J Clin Oncol 2005;23:1011-1027.

12. Bellamy WT, Richter L, Frutiger Y, Grogan TM. Expression of vascular endothelial growth factor and its receptors in hematopoietic malignancies. Cancer Res 1999;59:728-733.

13. Fielder W, Graeven U, Ergun S, Verago S, Kilic N, Stockschlader M, Hossfeld DK. Expression of FLT4 and its ligand VEGF-C in acute myeloid leukemia. Leukemia 1997;11:1234-1237.

14. Mustonen T, Alitalo K. Endothelial receptor tyrosine kinases involved in angiogenesis. J Cell Biol 1995;129:895-898.

142

15. Sato TN, Tozawa Y, Deutsch U, Wolburg-Buchholz K, Fujiwara Y, Gendron-Maguire M, Gridley T, Wolburg H, Risau W, Qin Y. Distinct roles of the receptor tyrosine kinases Tie-1 and Tie-2 in blood vessel formation. Nature 1995;376:70-74.

16. Korpelainen EI, Alitalo K. Signaling angiogenesis and lymphangiogenesis. Curr Opin Cell Biol 1998;10:159-164.

17. List AF, Glinsmann-Gibson B, Stadheim C, Meuillet EJ, Bellamy W, Powis G. Vascular endothelial growth factor receptor-1 and receptor-2 initiate a phosphatidylinositide 3-kinase-dependent clonogenic response in acute myeloid leukemia cells. Exp Hematol 2004;32:526-535.

18. Bellamy WT, Richter L, Sirjani D, Roxas C, Glinsmann-Gibson B, Frutiger Y, Grogan TM, List AF. Vascular endothelial cell growth factor is an autocrine promoter of abnormal localized immature myeloid precursors and leukemia progenitor formation in myelodysplastic syndromes. Blood 2001;97:1427-1434.

19. Dias S, Hattori K, Heissig B, Zhu Z, Wu Y, Witte L, Hicklin DJ, Tateno M, Bohlen P, Moore MA, Rafii S. Inhibition of both paracrine and autocrine VEGF/ VEGFR-2 signaling pathways is essential to induce long-term remission of xenotransplanted human leukemias. Proc Natl Acad Sci U S A 2001;98:10857-10862.

20. Chien MH, Ku CC, Johansson G, Chen MW, Hsiao M, Su JL, Inoue H, Hua KT, Wei LH, Kuo ML. Vascular endothelial growth factor-C (VEGF-C) promotes angiogenesis by induction of COX-2 in leukemic cells via the VEGF-R3/JNK/ AP-1 pathway. Carcinogenesis 2009;30:2005-2013.

21. Dias S, Choy M, Alitalo K, Rafii S. Vascular endothelial growth factor (VEGF)-C signaling through FLT-4 (VEGFR-3) mediates leukemic cell proliferation, survival, and resistance to chemotherapy. Blood 2002;99:2179-2184.

22. de Jonge HJ, Weidenaar AC, Ter Elst A, Boezen HM, Scherpen FJ, Bouma-Ter Steege JC, Kaspers GJ, Goemans BF, Creutzig U, Zimmermann M, Kamps WA, de Bont ES. Endogenous vascular endothelial growth factor-C expression is associated with decreased drug responsiveness in childhood acute myeloid leukemia. Clin Cancer Res 2008;14:924-930.

23. Lee CY, Tien HF, Hu CY, Chou WC, Lin LI. Marrow angiogenesis-associated factors as prognostic biomarkers in patients with acute myelogenous leukaemia. Br J Cancer 2007;97:877-882.

24. Hou HA, Chou WC, Lin LI, Tang JL, Tseng MH, Huang CF, Yao M, Chen CY, Tsay W, Tien HF. Expression of angiopoietins and vascular endothelial growth factors and their clinical significance in acute myeloid leukemia. Leuk Res 2008;32:904-912.

25. Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, Gralnick HR, Sultan C. Proposed revised criteria for the classification of acute myeloid leukemia. A report of the French-American-British Cooperative Group. Ann Intern Med 1985;103:620-625.

Aliparasti MR, et al: Gene expression of VEGF-A and VEGF-C in Peripheral Blood Mononuclear Cells of Iranian Patients with Acute Myeloid Leukemia

Turk J Hematol 2013;30:137-143

26. Aguayo A, Kantarjian H, Manshouri T, Gidel C, Estey E, Thomas D, Koller C, Estrov Z, Oâ&#x20AC;&#x2122;Brien S, Keating M, Freireich E, Albitar M. Angiogenesis in acute and chronic leukemias and myelodysplastic syndromes. Blood 2000;96:22402245.

33. Dias S, Hattori K, Zhu Z, Heissig B, Choy M, Lane W, Wu Y, Chadburn A, Hyjek E, Gill M, Hicklin DJ, Witte L, Moore MA, RaďŹ i S. Autocrine stimulation of VEGFR-2 activates human leukemic cell growth and migration. J Clin Invest 2000;106:511-521.

27. Fiedler W, Graeven U, Ergun S, Verago S, Kilic N, Stockschlader M, Hossfeld DK. Vascular endothelial growth factor, a possible paracrine growth factor in human acute myeloid leukemia. Blood 1997;89:1870-1875.

34. de Bont ES, Rosati S, Jacobs S, Kamps WA, Vellenga E. Increased bone marrow vascularization in patients with acute myeloid leukaemia: a possible role for vascular endothelial growth factor. Br J Haematol 2001;113:296304.

28. Dickson DJ, Shami PJ. Angiogenesis in acute and chronic leukemias. Leuk Lymphoma 2001;42:847-853.

29. Liersch R, Schliemann C, Bieker R, Hintelmann H, Buechner T, Berdel WE, Mesters RM. Expression of VEGF-C and its receptor VEGFR-3 in the bone marrow of patients with acute myeloid leukaemia. Leuk Res 2008;32:954-961.

30. Loges S, Heil G, Bruweleit M, Schoder V, Butzal M, Fischer U, Gehling UM, Schuch G, Hossfeld DK, Fiedler W. Analysis of concerted expression of angiogenic growth factors in acute myeloid leukemia: expression of angiopoietin-2 represents an independent prognostic factor for overall survival. J Clin Oncol 2005;23:1109-1117.

31. Gerber HP, Malik AK, Solar GP, Sherman D, Liang XH, Meng G, Hong K, Marsters JC, Ferrara N. VEGF regulates haematopoietic stem cell survival by an internal autocrine loop mechanism. Nature 2002;417:954-958.

32. Santos SC, Dias S. Internal and external autocrine VEGF/ KDR loops regulate survival of subsets of acute leukemia through distinct signaling pathways. Blood 2004;103:38833889.

35. Greenberg JI, Shields DJ, Barillas SG, Acevedo LM, Murphy E, Huang J, Scheppke L, Stockmann C, Johnson RS, Angle N, Cheresh DA. A role for VEGF as a negative regulator of pericyte function and vessel maturation. Nature 2008;456:809-813.

36. Stockmann C, Doedens A, Weidemann A, Zhang N, Takeda N, Greenberg JI, Cheresh DA, Johnson RS. Deletion of vascular endothelial growth factor in myeloid cells accelerates tumorigenesis. Nature 2008;456:814-818.

37. Cervi D, Shaked Y, Haeri M, Usenko T, Lee CR, Haigh JJ, Nagy A, Kerbel RS, Yefenof E, Ben-David Y. Enhanced natural-killer cell and erythropoietic activities in VEGF-A-overexpressing mice delay F-MuLV-induced erythroleukemia. Blood 2007;109:2139-2146.

38. Condeelis J, Pollard JW. Macrophages: obligate partners for tumor cell migration, invasion, and metastasis. Cell 2006;124:263-266.

39. Murdoch C, Lewis CE. Macrophage migration and gene expression in response to tumor hypoxia. Int J Cancer 2005;117:701-708.

143

Research Article

DOI: 10.4274/Tjh.2012.0043

Effects of Zinc Sulfate Supplementation in Treatment of Iron Deficiency Anemia Demir Eksikliği Anemisi Tedavisinde Çinko Sülfat Eklemenin Etkinliği Meltem Gülsan1, Barış Malbora2, Zekai Avcı3, Nilüfer Bayraktar4, İkbal Bozkaya5, Namik Özbek3 1Başkent University Faculty of Medicine, Department of Pediatrics, Ankara, Turkey 2Dr. Sami Ulus Maternity and Children’s Hospital, Department of Pediatric Hematology, Ankara, Turkey 3Başkent University Faculty of Medicine, Department of Pediatric Hematology, Ankara, Turkey 4Başkent University Faculty of Medicine, Department of Biochemistry, Ankara, Turkey 5Ankara Pediatric Hematology and Oncology Hospital, Department of Pediatric Hematology, Ankara, Turkey

Abstract: Objective: In this study, we aimed to compare the effect(s) of zinc sulphate on growth and serum iron variables when it is given with ferrous sulphate in iron deficiency anemia (IDA).

Materials and Methods: Patients (n=79) were randomly divided into two groups. In one group (n=40) 4 mg/kg/d ferrous sulfate was given orally. In the other group (n=39), in addition to ferrous sulfate, 5 mg/d oral zinc sulfate was given.

Results: Compared to the initial values statistically significant increase in mean height, weight, and head circumference has been observed in both groups after 3 months. However, there was no statistical difference between two groups concerning mean height, weight, and head circumference at the beginning (83.43±11.3 cm vs 84.62±12.77 cm; 12.36±3.08 kg vs 12.72±3.87 kg; 47.33±2.15 cm vs 47.26±2.73 cm, respectively), at the first month, (84.82±10.97 vs 85.97±12.28; 12.78±3.09 vs 13.09±3.87; 47.76±2.10 vs 47.61±2.67, respectively), and at the third month, (86.4±11.12 vs 87.69±12.13; 12.9±3.06 vs 13.35±3.81; 48.22±1.89 vs 48.07±2.45, respectively). There were no statistical differences between mean hematological parameters of the groups at the beginning, at the first month, and at the third month, either (mean hb of Group 1: 8.78±1.12 g/dL; 11.27±1.09 g/ dL; 12.05±1.00 g/dL respectively and of Group 2: 9.10±1.07 g/dL; 11.12±0.85 g/dL; 11.80±0.79 g/dL, respectively). Mean ferritin and zinc values of the groups were statistically insignificant at the beginning (Mean ferritin: 4.96±4.03 μg/dL vs 4.52±2.94 μg/dL, zinc: 88.64±15.35 ng/mL vs 86.84±17.34 ng/mL). Their increase was statistically significant at the third month (mean ferritin: 15.91±9.57 μg/dL vs 15.25±10.47 μg/dL; zinc: 88.02±15.10 ng/mL vs 95.25±16.55 ng/mL).

Conclusion: In our study neither positive nor negative effect of zinc administration on IDA treatment was demonstrated.

Therefore, in the treatment of IDA zinc together with iron should be used at different times if there is coexistent zinc deficiency.

Key Words: Iron deficiency anemia, Treatment, Ferrous sulfate, Zinc sulfate Özet: Amaç: Bu çalışmada, demir eksikliği anemisi tedavisinde ferröz sulfat verildiğinde çinko sülfatın büyüme ve serum demir değişkenleri üzerine etkinliğini karşılaştırmayı amaçladık.

Address for Correspondence: Barış MALBORA, M.D., Dr. Sami Ulus Maternity and Children’s Hospital, Department of Pediatric Hematology, Ankara, Turkey Gsm: +90 533 641 38 41 E-mail: barismalbora@gmail.com Received/Geliş tarihi : March 27, 2012 Accepted/Kabul tarihi : October 15, 2012

144

Turk J Hematol 2013;30:144-152

Gülsan, et al: Zinc Supplementation in Iron Deficiency Anemia

Gereç ve Yöntemler: Hastalar (n=79) rastgele iki gruba ayrıldı. Bir gruba (n=40) 4 mg/kg/gün’den oral yolla ferröz sülfat verildi. Diğer gruba ise (n=39) ferröz sülfata ek olarak 5 mg/gün’den çinko sülfat verildi.

Bulgular: Başlangıç değerleri ile karşılaştırıldığında tedavinin 3. ayında her iki grupta ortalama boy, vücut ağırlığı ve baş çevresi açısından istatistiksel olarak anlamlı bir artış tespit edildi. Ancak, iki grup arasında ortalama boy, vücut ağırlığı ve baş çevresinde tedavinin başlangıç (sırasıyla 83,43±11,3 cm ve 84,62±12,77 cm; 12,36±3,08 kg ve 12,72±3,87 kg; 47,33±2,15 cm ve 47,26±2,73 cm), 1. ay (sırasıyla 84.82±10,97 ve 85,97±12,28; 12,78±3,09 ve 13,09±3,87; 47,76±2,10 ve 47,61±2,67) ve 3. ayları (sırasıyla 86,4±11,12 ve 87,69±12,13; 12,9±3,06 ve 13,35±3,81; 48,22±1,89 ve 48,07±2,45) karşılaştırıldığında istatistiksel bir farklılık yoktu. Ortalama hematolojik parametrelerde de iki grup arasında başlangıç, 1. ay ve 3. ay değerleri karşılaştırıldığında istatistiksel fark görülmedi (sırasıyla grup 1 ortalama Hb: 8,78±1,12 g/dL; 11,27±1,09 g/dL; 12,05±1,0 g/dL, grup 2 ortalama Hb: 9,10±1,07 g/dL; 11,12±0,85 g/dL; 11,80±0,79 g/dL). Başlangıç ortalama ferritin ve çinko değerleri gruplar arasında istatistiksel olarak farklı değildi (ortalama ferritin: 4.96±4.03 μg/dL ve 4,52±2,94 μg/dL, ortalama çinko: 88,64±15,35 ng/mL ve 86,84±17,34 ng/mL). Ortalama ferritin ve çinko düzeyleri 3. ayda istatistiksel olarak anlamlı şekilde yükseldi (ortalama ferritin: 15,91±9,57 μg/dL ve 15,25±10,47 μg/dL; ortalama çinko: 88,02±15,10 ng/mL ve 95,25±16,55 ng/mL).

Sonuç: Çalışmamızda DEA tedavisinde çinko verilmesinin pozitif veya negatif bir etkisi gösterilemedi. Bu yüzden, DEA tedavisinde demire ek olarak çinko farklı zamanlarda, eşlik eden çinko eksikliği varsa verilmelidir.

Anahtar Sözcükler: Demir eksikliği anemisi, Tedavi, Ferröz sülfat, Çinko sülfat

Introduction Iron deficiency, the most common cause of anemia in the world and in Turkey, is estimated to affect 2 billion people, and more than half of them are anemic [1,2]. In Turkey, a prophylaxis program for iron deficiency was started in 2004 by the Ministry of Health. According to this program, all children should receive 1 mg/kg/d of ferrous sulfate (Fe-S) between 4 and 12 months of age. After this, the prevalence of iron deficiency anemia (IDA) was reported as 7.8% of children aged 12-23 months [3]. Zinc is the second most abundant trace element in the organism other than iron.

Nutritional zinc deficiency is also quite common in the world and in Turkey at rates as high as 15.7% [4,5,6].

Deficiencies of other trace elements, especially zinc, are frequently associated with IDA in developing countries and in Turkey [7,8,9]. Therefore, in the treatment of patients with IDA, zinc, in addition to iron, may be considered [10,11]. Because there are some concerns about their interactions in absorption from the intestines [12,13], in the present study, we aimed to compare the effect(s) of zinc sulfate (Zn-S) on growth and serum iron variables when it is given simultaneously with Fe-S. Materials and Methods Subjects A total of 103 children (aged from 6 months to 6 years) admitted to the hospital with IDA between November 2009 and March 2010 were included in the study. Inclusion criteria were hemoglobin (Hb) levels below 10 g/dL, serum ferritin levels below 10 ng/mL, and mean corpuscular volume (MCV) below the standard values determined by age and sex [14]. Patients whose serum zinc levels were <70 mg/ dL were diagnosed with zinc deficiency. Patients who had any chronic disease were excluded. Presenting symptoms;

dietary patterns including breast milk, cow’s milk, red meat, and complementary food consumption; socioeconomic conditions; presence of anemia in another sibling; presence of any infection at admission or within the last month; and any drug or prophylactic iron usage were recorded using a questionnaire. At each visit, height, body weight, and head circumference in children younger than 2 years old were measured and a physical examination was performed.

Patients were randomly divided into 2 groups. In the first group (Group 1), 4 mg/kg/d ferrous sulfate (Fe-S) (Ferro-sanol B® suspension by Adeka, Turkey) was given orally twice a day. In the other group (Group 2), in addition to Fe-S, 5 mg/d oral Zn-S (Zinco® suspension by Berko, Turkey) was given at least 4 hours apart. In order to prevent possible interaction during absorption, zinc and iron were given at different times. In addition, a list of iron- and zincrich diet and nutritional recommendations were given to all patients’ families. Vomiting, constipation, diarrhea, and extremely disturbing abdominal pain were used as drug incompatibility criteria and the compatibility of families and children to therapy was tracked by periodic phone calls and at each visit according to their laboratory levels.

Whenever the anemia improved (Hb ≥ 11 g/dL), treatment was maintained with a single dose of half of the total dosage of oral Fe-S for 1 additional month to replenish the iron stores. Zinc was given for 3 months without any change in dose in Group 2.

The study was approved by the Başkent University Research Board and Ethics Committee.

Written informed consent was obtained from the parents of the children.

Laboratory Methods Before treatment, complete blood count (CBC), serum ferritin, serum zinc, serum transferrin receptor (sTfR), 145

Turk J Hematol 2013;30:144-152

Gülsan, et al: Zinc Supplementation in Iron Deficiency Anemia

Results

and C-reactive protein (CRP) levels were measured. After randomization, only CBC was measured at the first month of treatment. If the anemia did not improve (Hb < 11 g/ dL), iron treatment was carried on without reduction. After this point, CBC measurements were performed at 10-day intervals until achieving a Hb level of ≥11 g/dL. At the third month, CBC, serum ferritin, serum Zn, and CRP levels were measured in all patients.

Demographic Data Of 103 patients, 24 were excluded from study. Reasons for exclusion were serious infection of 2 patients during the study period and incompatibility with the treatment of 2 patients. Twenty patients were not accessible for follow-up.

As a result, the final study population consisted of 79 patients (30 females and 49 males). Forty patients were in Group 1 and 39 patients were in Group 2. Mean ages in Group 1 and 2 were 23±16 months and 26.3±17.6 months, respectively.

Groups showed an equal distribution in terms of age and sex. There were no significant differences between their socioeconomic levels (Table 1). The 2 groups also did not differ statistically in terms of family income (Table 2) and parental education level and profession (Table 1) (p=0.48, p=0.22, and p=0.91, respectively) (Figure 1).

For CBC, an automated hemocytometer (Cell Dyn 3700, Abbott, USA) was used after routine calibration. Blood smears for the confirmation of IDA diagnosis were stained with Wright stain and examined under light microscopy.

Serum ferritin levels were measured by the immunoturbidimetric method (Roche/Hitachi Modular Analytics P, Japan). Serum zinc levels were measured by the atomic absorption spectrophotometric method (Atomic Absorption Spectrophotometer AA-6701F, Shimadzu, Japan). Serum transferrin receptor levels were measured by ELISA (BioVendor Human sTfR ELISA, Czech Republic).

No significant difference was found between the groups in terms of cow’s milk intake and its amount (p=0.24). In terms of duration of breastfeeding, the 2 groups did not differ significantly (p=0.6) (Table 3). Only 1 patient in Group 1 had never received breast milk, and another patient in Group 2 had been breastfed for more than 2 years. There was no difference between groups in terms of red meat consumption (p=0.65) (Table 4).

Statistical Methods SPSS 15.0 for Windows (SPSS Inc., USA) was used for the statistical evaluation of the data. The t-test for independent samples was used for normally distributed data and the Mann-Whitney U test was used for unevenly distributed data to compare variables between the Fe-S and Fe-S+Zn-S groups. To examine the time-dependent changes during treatment, the t-test for normally distributed data and the Wilcoxon test for unevenly distributed data were used. In addition, repeated measurement of 2-way ANOVA was used to examine whether the time-dependent changes showed differences between the groups.

The 2 groups did not differ significantly in terms of complementary food onset time (p=0.27) (Table 5).

Two patients were exclusively breastfed (a 1.5-year-old child in Group 1 and an 8-month-old baby in Group 2).

Four children had started to consume complementary foods after 1 year of age (3 children between 1 and 2 years of age, and 1 child after 2 years of age).

Statistical significance was accepted at p≤0.05.

Table 1: Education levels and professions of the mothers and fathers of the groups.

Parents

Mother

Father

Education* and profession#

Group 1 (n=40)

Group 2 (n=39)

Total (n=79)

Group 1 (n=40)

Group 2 (n=39)

Total (n=79)

Illiterate

2 (5%)

2 (5.1%)

4 (5.1%)

1 (2.5%)

0

1 (1.3%)

Primary school

14 (35%)

20 (51.3%)

34 (43%)

13 (32.5%)

17 (43.6%)

30 (38%)

Secondary school

15 (37.5%)

14 (35.9%)

29 (36.7%)

8 (20%)

12 (30.8%)

20 (25.3%)

High school

6 (15%)

3 (7.7%)

9 (11.4%)

13 (32.5%)

9 (23.1%)

22 (27.8%)

University

3 (7.5%)

0

3 (3.8%)

5 (12.5%)

1 (2.6%)

6 (7.6%)

Self-employed

0

0

0

16 (40%)

19 (48.7%)

35 (44.3%)

Civil servant

3 (5%)

1 (2.6%)

6 (5.1%)

24 (60% )

20 (51.3%)

44 (55.7%)

Housewife

37 (92.5%)

38 (97.4%)

75 (94.9%)

-

-

-

*p=0.27, #p=0.57 for mothers; *p=0.22, #p=0.91 for fathers.

146

Turk J Hematol 2013;30:144-152

Gülsan, et al: Zinc Supplementation in Iron Deficiency Anemia

Table 2: Distribution of the family income of the groups (Turkish lira, ). Subsistence wage was 521.89 and poverty line for a family of 4 people was 896 in Turkey at the study period according to the Turkish Statistical Institute (1 USD = 1.815).

Monthly family income*

Group 1 (n=40)

Group 2 (n=39)

Total (n=79)

Between

250 and 500

4 (10%)

6 (15.4%)

10 (12.7%)

Between

500 and 1000

23 (57.5%)

23 (59%)

46 (58.2%)

Between

1000 and 2000

11 (27.5%)

10 (25.6%)

21 (26.6%)

2 (5%)

0

2 (2.5%)

2000 and above *p=0.48.

Table 3: Distribution of cow’s milk intake amount and breastfeeding duration in the groups.

Daily cow’s milk intake*

Breastfeeding duration#

Amount

Group 1 (n=40)

Group 2 (n=39)

Total (n=79)

None

16 (40%)

10 (25.6%)

26 (32.9%)

250 mL

7 (17.5%)

8 (20.5%)

15 (19%)

500 mL

11 (27.5%)

7 (17.9%)

18 (22.8%)

1000 mL

5 (12.5%)

12 (30.8%)

17 (21.5%)

>1000 mL

1 (2.5%)

2 (5.1%)

3 (3.8%)

None

1 (2.5%)

0

1 (1.3%)

Less than 6 months

6 (15%)

8 (20.5%)

14 (17.7%)

6 months to 1 year

7 (17.5%)

5 (12.8%)

12 (15.2%)

More than 1 year

7 (17.5%)

12 (30.8%)

19 (24.1%)

Ongoing: <1 year of age Between 1 and 2 years of age

19 (47.5%) 14 (35%) 5 (12.5%)

14 (35.9%) 10 (25.6%) 4 (10.3%)

33 (41.8%) 24 (30.4%) 9 (11.4%)

*p=0.24, #p=0.6.

Table 4: Distribution of red meat consumption of the groups.

Red meat consumption*

Group 1 (n=40)

Group 2 (n=39)

Total (n=79)

None

13 (32.5%)

10 (25.6%)

23 (29.1%)

Occasionally

6 (15%)

9 (23.1%)

15 (19%)

Once a week

8 (20%)

10 (25.6%)

18 (22.8%)

2-3 times a week

12 (30%)

8 (20.5%)

20 (25.3%)

Every day

1 (2.5%)

2 (5.1%)

3 (3.8%)

*p=0.65.

147

Turk J Hematol 2013;30:144-152

Gülsan, et al: Zinc Supplementation in Iron Deficiency Anemia

In our study group, 47 of 79 patients (59.5%) had not received iron prophylaxis. Seven patients older than 1 year of age had received regular prophylaxis and 11 patients had received irregular prophylaxis up to age 1. Thirteen patients had received prophylaxis regularly for 1-2 months. Only a 10-month-old baby was still receiving iron prophylaxis at the time of diagnosis. There was no difference for receiving iron prophylaxis between the 2 groups (p=0.63).

Anthropometric Measurements Statistically significant increase in mean height, weight, and head circumference was observed in both groups after 3 months of treatment compared to the initial values (p<0.0001 for all 3 parameters) (Table 6). However, there were no differences between the groups concerning mean height, weight, and head circumference at the first month and at the third month of therapy (p>0.05 for all parameters). Seven patients who had zinc deficiency (4 from Group 1 and 3 from Group 2) showed comparable growth patterns with zinc-sufficient patients.

There were no children with malnutrition in the study.

Hematological Data The mean sTfR levels of patients at the time of diagnosis were 5.66±3.19 μg/mL in Group 1 and 4.598±2.64 μg/mL in Group 2. Serum transferrin receptor/log ferritin ratios of patients were 3.3 in Group 1 and 2.73 in Group 2 (p>0.05).

These parameters confirmed diagnosis of IDA in all patients.

When compared with initial values, mean Hb, hematocrit (Hct), MCV, mean corpuscular Hb (MCH), and mean corpuscular Hb concentration (MCHC) values showed statistically significant increases at the end of the first and third months. Mean red blood cell count (RBC) showed a significant increase at the end of 3 months compared to the pre-treatment levels; however, there was an insignificant decrease in this value between 1 and 3 months. Red blood cell distribution width (RDW) showed a statistically significant increase between 0 and 1 months and a significant decrease between 1 and 3 months. Platelet counts gradually decreased, and this reduction was statistically significant at the end of 3 months (Table 7).

Table 5: Distribution of complementary food onset time of the groups.

Complementary food onset time*

Group 1 (n=40)

Group 2 (n=39)

Total (n=79)

Not started

1 (2.5%)

1 (2.6%)

2 (2.5%)

Before 6 months of age

8 (20%)

13 (33.3%)

21 (26.6%)

After 6 months of age

29 (72.5%)

23 (59%)

52 (65.8%)

After 1 year of age

1 (2.5%)

2 (5.1%)

3 (3.8%)

After 2 years of age

1 (2.5%)

0

1 (1.3%)

*p=0.27.

Table 6: Comparison of the mean height, weight, and head circumference values of the groups at the beginning and at the first and third months.

Height (cm) (range)

Weight (kg) (range)

Groups

1

2

At the beginning

83.43±11.3 (68-115)

84.62±12.77 0.66 (66-114)

12.36±3.08 12.72±3.87 0.46 (6.9-20.1) (6.4-22.7)

47.33±2.15 47.26±2.73 0.91 (42.5-52) (42-53)

At the first month

84.82±10.97 85.97±12.28 0.66 (71-115) (68-114)

12.78±3.09 13.09±3.87 0.69 (7.6-20.4) (7.2-22)

47.76±2.10 47.61±2.67 0.81 (43-52) (42-53)

At the third month

86.4±11.12 (72-116)

12.9±3.06 (7.8-20)

48.22±1.89 48.07±2.45 0.78 (44-52) (43-53)

87.69±12.13 0.62 (69-115)

*34 patients in Group 1, 27 patients in Group 2.

148

p

1

2

Head circumference* (cm) (range) p

13.35±3.81 0.56 (8-22)

1

2

p

Turk J Hematol 2013;30:144-152

Gülsan, et al: Zinc Supplementation in Iron Deficiency Anemia

Serum ferritin and zinc levels of the groups did not differ statistically at the diagnosis (p=0.6 and p=0.62, respectively).

Initially 4 patients in Group 1 and 3 patients in Group 2 had zinc deficiency.

(27.5%) in Group 1 and 14 patients in Group 2 (35.9%)], and at 2 months in 6 patients (3 patients in each group).

At the end of 3 months of treatment, 4 (10%) patients in Group 1 and 6 (15%) patients in Group 2 achieved Hb levels of ≥11 g/dL; however, their ferritin levels were <10 ng/mL. These 10 patients continued two mg/kg/d Fe-S therapy after 3 months until ferritin levels reached 20 ng/mL. This period was not longer than 1 month in any patient. There were no significant differences between Groups 1 and 2 concerning time period to achieve Hb levels of ≥11 g/dL and ferritin levels of >10 ng/mL (p=0.71).

After 3 months of treatment, a mild zinc deficiency continued in only 1 patient from Group 1 (serum zinc level = 67 μg/dL). At the third month of treatment, the mean serum ferritin values increased to 15.91±9.57 ng/mL (range: 3.5-41.1 ng/mL) in Group 1 and to 15.25±10.47 ng/mL (range: 1.7-42.5 ng/mL) in Group 2. These increases were statistically significant (p<0.0001 for both).

Discussion

However, there was no significant difference between groups in terms of mean serum ferritin levels at the third month (p=0.77). At the end of the third month, the mean zinc level did not change in Group 1 compared to the values at diagnosis. However, there was a significant increase concerning mean serum zinc levels in Group 2 compared to the values at diagnosis (from 88.02 μg/dL at diagnosis to 95.25±16.55 at the third month, p=0.012). A significant difference concerning zinc levels was obtained between groups at the third month (p=0.046) (Figure 2).

Since iron and zinc deficiencies are frequent problems in the developing world, association of these 2 deficiencies is expected to be high [15,16,17,18]. For this reason, zinc status has been a subject of interest in children with IDA. Drugs that include zinc together with iron have been debated in terms of treatment efficacy. Therefore, there are several studies using zinc in addition to iron in prophylaxis or treatment of IDA. A recent study from Indonesia compared prophylactic treatment regimens of 10 mg/d of iron, 10 mg/d of zinc, or both in babies starting at 4 months of age and continuing for 6 months [19]. In that study, the percentage of babies who had anemia (Hb<11 g/dL) was higher in infants taking iron and zinc compared to babies taking only iron (46% vs. 28%; p<0.05). As a result, the authors suggested that

At the end of the first month, Hb levels of ≥11 g/dL were achieved and treatment was decreased to half of the therapeutic dose in 48 patients [26 patients (65%) in Group 1 and 22 (56.4%) patients in Group 2]. Target Hb levels were achieved at 1 month and 10 days in 25 patients [11 patients

Table 7: Comparison of the hematological data of the groups at the beginning and at the first and third months.

Beginning

First month

Third month

Group 1

Group 2

p

Group 1

Group 2

p

Group 1

Group 2

p

Hb (g/L)

87.8±11.2

91.0±10.7

0.20

112.7±10.9

111.2± 8.5

0.49

120.5±10.0

118.0±7.9

0.23

RBC (x1012/L)

4.7±0.5

4.7±0.48

0.96

5.13±0.43

5.04±0.47

0.37

5.03±0.385

4.95±0.398

0.37

WBC (x109/L)

8.8±2.9

9.8±2.9

0.13

9.3±2.6

10±3.2

0.27

9.8± 2.8

10.1±3.81

0.66

Hct (%)

27.5±3.6

28.4±3.14

0.25

34.18±3.2

33.73±2.54

0.48

35.99±3.05

35.12±2.27

0.15

58.77±6.01

60.5±6.28

0.20

66.38±4.12

66.62±5.36

0.81

71.95±5.03

71.27±4.58

0.53

318.9±18

321.5±15.7

0.49

329.3±13.9

330.2±11.7

0.76

335.1±10.5

335.4±11.6

0.90

MCH (pg)

18.94±2.55 19.61±2.76

0.26

21.96±1.96

22.14±1.93

0.67

24.12±1.907

23.90±1.869

0.61

RDW (%)

19.78±3.56 18.71±2.78

0.14

27.63±5.79

26.44±7.19

0.42

19.95±4.22

19.82±3.60

0.88

0.31

351±110

346±83

0.82

329±79

337±69

0.63

MCV (fL) MCHC (g/L)

PLT (x109/L)

390± 124

419± 132

Hct, hematocrit; Hb, hemoglobin; MCH, mean cell hemoglobin; MCHC, mean cell hemoglobin concentration; MCV, mean cell volume; RBC, red blood cell count; RDW, red blood cell distribution width; WBC, white blood cell count.

149

Turk J Hematol 2013;30:144-152

Gülsan, et al: Zinc Supplementation in Iron Deficiency Anemia

103 patients were enrolled 24 patients were excluded

39 patients Group 2 (Fe+Zn)

40 patients Group 1 (Fe-S)

14 patients Hb<11 g/dL Treatment continued

26 patients Hb>11 g/dL Treatment was decreased ½

22 patients Hb>11 g/dL Treatment was decreased ½

17 patients Hb<11 g/dL Treatment continued First month

First month 1 month and 10 days 1 patient Hb >11 g/dL ferritin< 15 ng/mL

Third month

11 patients Hb> 11 g/dL Treatment was decreased ½

3 patients Hb<11 g/dL same dose continued

2 patients Hb >11 g/dL ferritin< 15 ng/mL Half dose continued

9 patients Hb >11 g/dL ferritin> 15 ng/mL Treatment stopped

2 patients Hb >11 g/dL ferritin< 15 ng/mL Treatment was decreased ½

40 days

1 patient Hb >11 g/dL ferritin< 15 ng/mL Half dose continued

3 patients Hb >11 g/dL ferritin< 15 ng/mL Half dose continued

11 patients Hb >11 g/dL ferritin> 15 ng/mL Treatment stopped

1 patients Hb >11 g/dL ferritin< 15 ng/mL Half dose continued

3 patients Hb<11 g/dL same dose continued

14 patients Hb> 11 g/dL Treatment was decreased ½

Follow up

Follow up

Figure 1. Study diagram.

zinc (μg/dL)

18 16 14 12 10 8 6 4 2 0

group 1

group 2

96 group 2

94 92 μg/dl

ng/ml

Ferritin (ng/mL)

group 1 group 2

90

group 1

group 1 group 2

88 86 84

0

3 months

82 3

0 months

Figure 2. Distribution of the serum ferritin and zinc levels of the groups by months (initial and final levels).

150

Gülsan, et al: Zinc Supplementation in Iron Deficiency Anemia

supplementation of zinc together with iron reduced its bioavailability. Another study found that only supplemental zinc during 12 weeks in adolescent athletes reduced plasma iron levels [20]. In addition, experimental studies showed that high amounts of zinc reduced iron absorption [12,13].

However, if the Fe:Zn ratio was 2:1, there was no change in the level of iron in another study [21]. In order to reduce the possible interaction of iron and zinc based on these findings, we gave iron and zinc at different times in the present study.

Because there were no differences between the hematological data of our 2 groups during and after treatment, it is seen that the iron and zinc absorptions were not affected by each other if iron and zinc were given at different times.

Comparison of iron and zinc supplementation alone or together, in terms of treatment efficacy and post-treatment zinc levels, came into question with the results of some studies. Zinc deficiency was found to be very high (82.8%) in children aged 1-12 years with the diagnosis of IDA in a study from Turkey [8]. However, another Turkish study disclosed that figure to be 28.2% [9]. In our small sample, we found 7 (8.86%) patients who had zinc deficiency together with IDA. Serum zinc levels of 3 patients who had zinc deficiency in Group 1 reached normal levels and 1 patient showed a subnormal result (67 mg/dL) at the end of 3 months of Fe-S supplementation alone. Similarly, a recent study from Turkey disclosed that zinc levels of children treated for IDA increased at the third month in patients treated with Fe-S, whereas this increase was achieved at the sixth month in a group of patients treated with ferric iron [22]. This study, together with ours, supports the idea that zinc deficiency in patients with IDA could be managed by giving only ferrous sulfate. Because the iron deficiency disturbs the mucosal structure and villi, it may cause zinc deficiency due to malabsorption [23]. After mucosal regeneration, zinc absorption also improves. This could be also due to the common dietary sources of zinc and iron or the role of zinc in erythropoiesis [18]. In addition, increased appetite of children and attention of the families to these children’s diet may contribute to increased levels of zinc during the treatment of IDA. Schultink et al. [24] compared iron sulfate and a drug containing a combination of iron sulfate and zinc in anemic (Hb<11 g/dL) children for 8 weeks. They found no statistically significant reduction in the levels of serum zinc levels after the treatment in patients who were given only iron. Interaction effects between iron and serum zinc in clinical supplementation trials were recently reviewed [25], and in 9 of 10 reviewed trials of iron-only supplementation in young children, there was no effect of iron supplementation on serum zinc. In 4 reviewed trials, the addition of iron to zinc supplements had no adverse effect on serum zinc. In our study, zinc and iron given at different times might not have influenced each other and the increases in the serum ferritin and zinc levels at the end of treatment were satisfactory.

In the present study, mean values of height, weight, and head circumference of both groups showed a statistically

Turk J Hematol 2013;30:144-152

significant increase after treatment, but there was no significant difference between the groups. This indicates that administration of zinc together with iron does not have an additional effect on the growth of children. Lind et al. [26] found that prophylactic doses of zinc given alone increased weight for age Z-score and knee-heel length while the iron given alone increased only knee-heel distance.

They observed that the effect of combined iron and zinc on growth and development was not different from the effect when given individually. In another study from Mexico, prophylactic iron, zinc, or iron plus zinc was given to children between 18 and 36 months of age for 12 months.

It was seen that the growth of all 3 groups was not different from that of the children receiving a placebo [27]. In a study

by Alarcon et al. [28], no difference was found between groups in terms of growth after treatment, either. The results of our study are similar to the results of these studies.

Because iron and zinc were given prophylactically in most of these studies and these children did not have iron or zinc deficiency, the treatments may not have affected the growth.

Our study was made up of a group with iron deficiency, but we still could not reveal any difference between the groups in terms of growth.

In Turkey, blood counts of approximately one-fourth of children admitted to a study had been measured before the beginning of the iron prophylaxis program by the Ministry of Health and two-thirds of these were anemic [3]; the program was thus started in 2004 and IDA incidence was reduced, but in our study, adherence to prophylaxis was still not good.

Most of the patients had not received any prophylaxis and only a small percentage had received it regularly. Increasing the applicability and educating parents concerning the importance of iron prophylaxis would reduce the incidence of anemia in this age group.

In conclusion, the use of iron or of iron together with zinc in the treatment of IDA showed similar effects. Because these cations were given at different times in the present study, the probable interaction at the level of absorption was prohibited. Due to the high probability of multiple mineral deficiencies in developing countries, including Turkey, additional zinc supplementation to patients with IDA may be considered useful. However, in our study neither a positive nor a negative effect of zinc administration on IDA treatment was demonstrated. Therefore, in the treatment of IDA, zinc together with iron should be used at different times if there is a coexistent zinc deficiency.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Funding Source: This study was supported by the Başkent University Research Fund (Project Number KA09/181).

151

Turk J Hematol 2013;30:144-152

Gülsan, et al: Zinc Supplementation in Iron Deficiency Anemia

References 1. Wilson DB. Disorders of Iron Metabolism and Sideroblastic Anemia. In: Nathan DG, Orkin SH, Gingsburg D, Look TA, (eds). Nathan and Oski’s Hematology of Infancy and Childhood. 6th ed. Philadelphia, WB Saunders Company, 2009,522-542.

2. Freire WB. Strategies of the Pan American Health Organization/World Health Organization for the Control of Iron Deficiency in Latin America. Nutr Reviews 1997;55:183-188.

3. Turkish Ministry of Health. Research report of iron use in children aged 12-24 months. Ankara, Ministry of Health, 2008.

4. Black MM. Zinc deficiency and child development. Am J Clin Nutr 1998;68 (Suppl):464-469.

5. Çakmak D, Kalaycı M, Ekiz H, Braun HJ, Kılınç Y, Yılmaz A. Zinc deficiency as a practical problem in plant and human nutrition in Turkey: A NATO Science for Stability project.

Field Crops Research 1999;60:175-188.

6. Wetherilt H, Ackurt F, Brubacher G, Okan B, Aktas S, Turdu S. Blood vitamin and mineral levels in 7-17 years old Turkish children. Int J Vitam Nutr Res 1992;62:21-29.

7. David BM. Trace elements. In: Carl AB, Edward RA, (eds).

Tietz Textbook of Clinical Chemistry. Philadelphia, WB Saunders Company, 1999,1029-1055.

8. Erdoğan S, Akyol B, Önal H, Önal Z, Keles ES. Demir eksikliği anemisinde serum çinko düzeylerinin değerlendirilmesi. Çocuk Dergisi 2003;3:49-55.

9. Ece A, Uyanik BS, Iscan A, Ertan P, Yiğitoğlu MR. Increased serum copper and decreased serum zinc levels in children with iron deficiency anemia. Biol Trace Element Res 1997;59:31-39.

10. Chang S, El Arifeen S, Bari S, Wahed MA, Rahman KM, Rahman MT, Mahmud AB, Begum N, Zaman K, Baqui AH, Black RE. Supplementing iron and zinc: double blind, randomized evaluation of separate or combined delivery.

Eur J Clin Nutr 2010;64:153-160.

11. Kırmızıtas A. Demir eksikliği anemisi olan çocuklarda çözünebilir transferrin reseptörü, eritrosit ve serum çinko düzeylerinin tedavideki yeri. Adana, Pediatri Uzmanlık Tezi, 2005.

12. Solomons NW, Jacob RA. Studies on the bioavailability of zinc in humans: effects of heme and nonheme iron on the absorption of zinc. Am J Clin Nutr 1981;34:475-482.

13. Sandström B, Davidsson L, Cederblad A, Lönnerdal B. Oral iron, dietary ligands and zinc absorption. J Nutr 1985;115:411-414.

14. Lanzkowsky P. Iron-deficiency anemia. In: Lanzkowsky P, (ed). Manual of Pediatric Hematology and Oncology. 5th ed.

New York, Churchill Livingstone, 2011,38-57.

15. International Zinc Nutrition Consultative Group (IZiNCG).

Assessment of the risk of zinc deficiency in populations and options for its control. Food and Nutrition Bulletin 2004;25:91-204.

152

16. Brown KH, Peerson JM, Rivera J, Allen LH. Effect of supplemental zinc on the growth and serum zinc concentrations of prepubertal children: a meta-analysis of randomized controlled trials. Am J Clin Nutr 2002;75:10621071.

17. De la Cruz-Góngora V, Gaona B, Villalpando S, ShamahLevy T, Robledo R. Anemia and iron, zinc, copper and magnesium deficiency in Mexican adolescents: National Health and Nutrition Survey 2006. Salud Publica Mex 2012;54:135-145.

18. Cole CR, Grant FK, Swaby-Ellis ED, Smith JL, Jacques A, Northrop-Clewes CA, Caldwell KL, Pfeiffer CM, Ziegler TR. Zinc and iron deficiency and their interrelations in lowincome African American and Hispanic children in Atlanta.

Am J Clin Nutr 2010;91:1027-1034.

19. Dijkhuizen MA, Wieringa FT, West CE, Martuti S, Muhilal S. Effects of iron and zinc supplementation in Indonesian infants on micronutrient status and growth. J Nutr 2001;131:2860-2865.

20. De Oliveira K de J, Donangelo CM, De Oliveira AV Jr, Da Silveira CL, Koury JC. Effect of zinc supplementation on the antioxidant, copper, and iron status of physically active adolescents. Cell Biochem Funct 2009;27:162-166.

21. Solomons NW. Competitive interaction of iron and zinc in the diet: consequences for human nutrition. J Nutr 1986;116:927-935.

22. Sözmen EY, Kavakli K, Cetinkaya B, Akçay YD, Yilmaz D, Aydinok Y. Effects of iron(II) salts and iron(III) complexes on trace element status in children with iron-deficiency anemia. Biol Trace Element Res 2003;94:79-86.

23. Ghosh S, Daga S, Kasthuri D, Musra RC, Chuttanu HK. Gastrointestinal function in iron deficient states in children.

Am J Dis Child 1972;123:14-17.

24. Schultink W, Merzenich M, Gross R, Shrimpton R, Dillon D. Effects of iron-zinc supplementation on the iron, zinc, and vitamin A status of anaemic pre-school children. Food Nutr Bull 1997;18:311-316.

25. Fischer Walker C, Kordas K, Stoltzfus RJ, Black RE. Interactive effects of iron and zinc on biochemical and functional outcomes in supplementation trials. Am J Clin Nutr 2005;82:5-12.

26. Lind T, Lonnerdal B, Stenlund H, Gamayanti IL, Ismail D, Seswandhana R, Persson LA. A community-based randomized controlled trial of iron and zinc supplementation in Indonesian infants: effects on growth and development.

Am J Clin Nutr 2004;80:729-736.

27. Rosado JL, Lopez P, Munoz E, Martinez H, Allen LH. Zinc supplementation reduced morbidity, but neither zinc nor iron supplementation affected growth or body composition of Mexican preschoolers. Am J Clin Nutr 1997;65:13-19.

28. Alarcon K, Kolsteren PW, Prada A, Chian MA, Velarde RE. Effects of separate delivery of zinc or zinc and vitamin A on hemoglobin response, growth, and diarrhea in young Peruvian children receiving iron therapy for anemia. Am J Clin Nutr 2004;80:1276-1282.

Research Article

DOI: 10.4274/Tjh.2012.0107

Clinical Significance of Reticulocyte Hemoglobin Content in the Diagnosis of Iron Deficiency Anemia Demir Eksikliği Anemisi Tanısında Retikülosit Hemoglobin İçeriğinin Klinik Önemi Mustafa Karagülle1, Eren Gündüz1, Fezan Şahin Mutlu2, Meltem Olga Akay1 1Eskişehir Osmangazi University Medical School, Department of Hematology, Eskişehir, Turkey 2Eskişehir Osmangazi University Medical School, Department of Biostatistics, Eskişehir, Turkey

Abstract: Objective: The aim of this study was to evaluate the clinical significance of reticulocyte hemoglobin content (CHr) in the diagnosis of iron deficiency anemia (IDA) and to compare it with other conventional iron parameters.

Materials and Methods: A total of 32 female patients with IDA (serum hemoglobin <120 g/L and serum ferritin <20 ng/ mL) and 18 female patients with iron deficiency (serum hemoglobin > 120 g/L and serum ferritin <20 ng/mL) were enrolled.

Results: CHr was 24.95±3.92 pg in female patients with IDA and 29.93±2.96 pg in female patients with iron deficiency.

CHr showed a significant positive correlation with hemoglobin, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, serum iron, and transferrin saturation and a significant negative correlation with transferrin and total iron-binding capacity. The cut-off value of CHr for detecting IDA was 29 pg.

Conclusion: Our data demonstrate that CHr is a useful parameter that can be confidently used in the diagnosis of IDA, and a CHr cut-off value of 29 pg predicts IDA. Key Words: Iron deficiency anemia, Reticulocyte hemoglobin content, Diagnosis Özet: Amaç: Bu çalışmanın amacı, DEA tanısında retikülosit hemoglobin içeriğinin (CHr) klinik önemini belirlemek ve diğer konvansiyonel demir parametreleri ile karşılaştırmaktır.

Gereç ve Yöntemler: Çalışmaya demir eksikliği (serum hemoglobin >120 g/L ve serum ferritin <20 ng/mL) olan 18 kadın hasta ve demir eksikliği anemisi (serum hemoglobin <120 g/L ve serum ferritin <20 ng/mL) olan 32 kadın hasta dahil edildi.

Bulgular: Demir eksikliği anemisi olan hastalarda retikülosit hemoglobin içeriği 24,95±3,92 pg, demir eksikliği olan hastalarda ise 29,93±2,96 pg idi. CHr; hemoglobin, MCV, MCH, MCHC, serum demiri ve transferrin saturasyonu ile anlamlı pozitif korelasyon; transferrin ve total demir bağlama kapasitesi ile anlamlı negatif korelasyon gösterdi. DEA tanısı için CHr cut-off değeri 29 pg olarak saptandı.

Sonuç: Bizim verilerimiz, CHr’nin DEA tanısında güvenle kullanılabilecek faydalı bir parametre olduğunu ve 29 pg olan CHr cut-off değerinin demir eksikliği anemisini öngördüğünü göstermektedir.

Anahtar Sözcükler: Demir eksikliği anemisi, Retikülosit hemoglobin içeriği, Tanı

Address for Correspondence: Meltem Olga AKAY, M.D., Eskişehir Osmangazi University Medical School, Department of Hematology, Eskişehir, Turkey Phone: +90 222 239 84 66 E-mail: olga.akay@hotmail.com Received/Geliş tarihi : August 10, 2012 Accepted/Kabul tarihi : January 12, 2013

153

Turk J Hematol 2013;30:153-156

Karagülle M, et al: Reticulocyte Hemoglobin Content and Anemia

Introduction Iron deficiency anemia (IDA) is the most common form of nutritional anemia worldwide [1]. Various biochemical parameters are used to diagnose IDA, including ferritin, transferrin saturation (TS), serum iron, and mean corpuscular volume (MCV). Despite the availability of these parameters, their validity for the diagnosis of IDA is still debatable. Serum ferritin, the most specific indicator of iron deficiency, is an acute phase reactant and its level is affected by inflammation. TS fluctuates due to the diurnal variation of serum iron, and serum iron levels decrease with infection, inflammation, and malignancy and increase with liver disease [2].

Reticulocytes are the youngest erythrocytes released from the bone marrow into the blood and they circulate for 1-2 days before becoming mature erythrocytes. The reticulocytes’ hemoglobin content reflects the amount of iron available for hemoglobin production in the bone marrow. Therefore, reticulocyte hemoglobin content (CHr) has been proposed as an iron status marker [3]. Several studies have indicated that CHr measurement in peripheral blood samples is useful for diagnosis of iron deficiency [4,5,6,7,8]. It has been shown to be an accurate measure of iron status and a reliable iron marker for monitoring iron therapy’s effectiveness [3,9].

In this study, we aimed to evaluate the significance of CHr in the diagnosis of IDA and compare it with other conventional iron parameters.

Materials and Methods Patients The study was conducted at Eskişehir Osmangazi University, Faculty of Medicine, Department of Hematology.

After obtaining the approval of the ethics committee and informed consent, 32 female patients with IDA (serum hemoglobin <120 g/L and serum ferritin <20 ng/mL) and 18 female patients with iron deficiency (serum hemoglobin >120 g/L and serum ferritin <20 ng/mL) were enrolled.

Sample Collection and Laboratory Methods Samples for complete blood count and CHr were collected in K3EDTA tubes and analyzed with an automated hematology analyzer, ADVIA 2120i (Siemens, New York, USA). Serum iron and total iron-binding capacity (TIBC) were measured with a LISA 500 Plus automated chemical analyzer (Hycell Diagnostics, Paris, France). Serum ferritin was measured with a Hitachi E170 automated analyzer (Hitachi, Tokyo, Japan). TS was calculated by dividing serum iron by TIBCx100. Transferrin was measured with a BN II automated chemical analyzer (Siemens, Marburg, Germany).

Statistical Analysis Data were analyzed using IBM SPSS 20. The independent samples t-test was applied for normally distributed variables 154

and results were given as mean ± standard deviation. The Mann-Whitney U test was applied for abnormally distributed variables and results were given as median (quartiles) values.

Receiver operating characteristic (ROC) curve analysis was performed to identify the optimal CHr cut-off value for predicting IDA. P<0.05 was accepted as significant.

Results There was no statistically significant difference between the 2 groups in terms of age and red blood cell (RBC) count. Hemoglobin, MCV, mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), serum iron, and TS were significantly lower in female patients with IDA in respect to iron-deficient female patients. Transferrin and TIBC were significantly higher in female patients with IDA compared to female patients with iron deficiency. CHr was 24.95±3.92 pg in the IDA group and 29.93±2.96 pg in the iron deficiency group, and a statistically significant difference was observed between the 2 groups in respect to CHr (Table 1).

CHr showed a significant positive correlation with hemoglobin (r=0.775), MCV (r=0.868), MCH (r=0.883), MCHC (r=0.685), serum iron (r=0.648), and TS (r=0.764) and a significant negative correlation with transferrin (r=-0.599) and TIBC (r=-0.613).

A cut-off value of CHr was determined as 29.3 pg (90.6% sensitivity, 66.7% specificity) by ROC analysis in female patients with IDA anemia (Figure 1). Power analysis of CHr was calculated as 1, which was perfect (NCCS 2007, PASS 2005, and GESS 2006).

Discussion Various biochemical parameters are being used for the diagnosis of IDA. However, there might be some difficulties in the assessment of these conventional parameters. For example, ferritin behaves as an acute phase reactant, which limits its diagnostic accuracy greatly. The serum ferritin level is frequently increased independently of iron status by factors such as acute/chronic inflammation, infection, malignancy, liver disease, and alcohol use. Serum iron levels also decrease with infection, inflammation, and malignancy and increase with liver disease. TS is a calculated parameter, and therefore it reflects confounding effects on individual components [2].

Measurement of CHr provides an indirect measure of the functional iron available for new RBC production. In a study performed by Mast et al., it was reported that CHr of <28 pg had an optimal sensitivity (74%) and specificity (73%) for diagnosis of iron deficiency, using Prussian blue staining of the bone marrow aspirate to define iron deficiency. In this study, the area under the curve of CHr exceeded that of ferritin, TS, and MCV, showing that CHr is a useful marker for diagnosis of iron deficiency in adults [4].

Turk J Hematol 2013;30:153-156

Karagülle M, et al: Reticulocyte Hemoglobin Content and Anemia

Table 1: Hematologic and iron parameters in iron deficiency anemia group and iron deficiency group.

Iron Deficiency Group (n=18)

Iron Deficiency Anemia Group (n=32)

p-value

Mean±SD

Mean±SD

Hemoglobin (g/L)

120.63±0.49

9.86±1.40

<0.001

Age (years)

32.65±13.58

35.88±10.22

>0.05

MCV (fL)

80.85±6.04

71.51±8.60

<0.001

MCHC (g/L)

334.4±9.4

313.6±19.3

<0.001

CHr (pg)

29.93±2.96

24.95±3.92

<0.001

Median (25%-75%)

Median (25%-75%)

Hematocrit (%)

38.00 (37.07-38.40)

32.55 (27.45-34.60)

<0.001

RBC (1012/L)

4.51 (4.12-5.19)

4.46 (3.71-5.09)

>0.05

MCH (pg)

27.90 (25.62-28.52)

22.65 (19.57-25.57)

<0.001

Iron (μmol/L)

2515.79 (2096.49-3754.62)

2134.61 (1296-2592)

<0.05

TS (%)

11.55 (7.89-17.14)

7.99 (4.87-9.75)

<0.01

Transferrin (mg/dL)

244.50 (222.50-286.00)

288.50 (264.25-309.00)

<0.01

Iron-binding capacity

305.00 (277.58-357.51)

361.26 (343.65-405.59)

<0.01

Ferritin (ng/mL)

7.55 (5.82-12.23)

4.56 (2.67-7.41)

<0.001

Data are given as mean±standard deviation or median values (25th/75th percentiles), p<0.05.

for iron deficiency with 100% high sensitivity was 32 pg [11]. In another study, a CHr cut-off value of 32 pg was found to be appropriate for the assessment of iron deficiency in hemodialysis patients, in which an ethnic effect on CHr levels was considered to explain the higher cut-off [3]. In our study, a CHr cut-off value of 29 pg with 90.6% sensitivity and 66.7% specificity was determined to predict IDA.

CHR 100 Sensitivity: 90.6 Specificity: 66.7 Criterion: <=29.3

Sensitivity

80 60 40 20 0 0

20

40

60

80

100

100-Specificity

Figure 1: The ROC curve analysis for CHr.

Several studies have assessed the value of CHr as an indicator of iron deficiency in dialysis patients. In a recent study by Thomas et al., functional iron deficiency was defined as CHr < 28 pg [10]. Fishbane et al. also reported that CHr of <28 pg predicted iron deficiency more accurately than did serum ferritin and TS in dialysis patients receiving erythropoietin [2]. Mitsuiki et al. reported that a CHr index

With the present investigation, we have identified the value of CHr in the diagnosis of IDA. CHr showed the strongest correlation with hemoglobin, MCV, MCH, and TS with r>0.7, which was considered meaningful. Therefore, CHr in conjunction with these conventional parameters appears to be useful and reliable in identifying IDA. In conclusion, besides the current conventional parameters that we use in routine practice to diagnose IDA, there is still a need for more sensitive and powerful parameters. CHr is a useful parameter that can be confidently used in the diagnosis of IDA, and a CHr cut-off value of 29 pg predicts IDA. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

155

Turk J Hematol 2013;30:153-156

Karagülle M, et al: Reticulocyte Hemoglobin Content and Anemia

References 1. Goddard AF, McIntyre AS, Scott BB. Guidelines for the management of iron deficiency anaemia. Gut 2000;46(Suppl 3-4):IV1-IV5.

2. Fishbane S, Galgano C, Langley RC Jr, Canfield W, Maesaka JK. Reticulocyte hemoglobin content in the evaluation of iron status of haemodialysis patients. Kidney Int 1997;52:217222.

3. Kim JM, Ihm CH, Kim HJ. Evaluation of reticulocyte haemoglobin content as marker of iron deficiency and predictor of response to intravenous iron in haemodialysis patients. Int J Lab Hematol 2008;30:46-52.

4. Mast AE, Blinder MA, Lu Q, Flax S, Dietzen DJ. Clinical utility of the reticulocyte hemoglobin content in the diagnosis of iron deficiency. Blood 2002;99:1489-1491.

5. Brugnara C, Zurakowski D, DiCanzio J, Boyd D, Platt Q. Reticulocyte hemoglobin content to diagnose iron deficiency in children. JAMA 1999;281:2225-2230.

156

6. Ullrich C, Wu A, Armsy C, Rieber S, Wingerter S, Brugnara C, Shapiro D, Bernstein H. Screening healthy infants for iron deficiency using reticulocyte hemoglobin content. JAMA 2005;294:924-930.

7. Bakr AF, Sarette G. Measurement of reticulocyte hemoglobin content to diagnose iron deficiency in Saudi children. Eur J Pediatr 2006;165:442-445.

8. Brugnara C. Iron deficiency and erythropoiesis: new diagnostic approaches. Clin Chem 2003;49:1573-1578.

9. Chuang CL, Liu RS, Wei YH, Huang TP, Tarng DC. Early prediction of response to intravenous iron supplementation by reticulocyte hemoglobin content and high-fluorescence reticulocyte count in haemodialysis patients. Nephrol Dial Transplant 2003;18:370-377.

10. Thomas C, Thomas L. Biochemical markers and hematologic indices in the diagnosis of functional iron deficiency. Clin Chem 2002;48:1066-1076.

11. Mitsuiki K, Harada A, Miyata Y. Reticulocyte hemoglobin content in haemodialysis patients with acute infection. Clin Exp Nephrol 2004;8:257-262.

Research Article

DOI: 10.4274/Tjh.2012.0171

Inhibition of MicroRNA miR-92a Inhibits Cell Proliferation in Human Acute Promyelocytic Leukemia MikroRNA miR-92a Inhibisyonu İnsan Akut Promyelositik Lösemide Hücre Proliferasyonunu İnhibe Eder Mohammadreza Sharifi, Rasoul Salehi, Yousof Gheisari, Mohammad Kazemi Mohammadreza Sharifi, Rasoul Salehi, Yousof Gheisari, Mohammad Kazemi Pediatrics Inherited Diseases Research Center & Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfhan, Iran

Abstract: Objective: MicroRNAs (miRNAs) are endogenous non-coding RNAs, 19-25 nucleotides in length involved in posttranscriptional regulation of gene expression in a considerable majority of mRNAs. In many tumors, up- or down-regulation of different miRNAs has been reported. In acute myeloid leukemia up-regulation of miR-92a has been reported in humans in vitro studies. In this study it is mainly aimed to assess the effect of inhibition of miR-92a in viability of acute promyelocytic leukemia (APL).

Materials and Methods: We performed inhibition of miR-92a in an acute promyelocytic leukemia (APL) cell line (HL-60) using locked nucleic acid (LNA) antagomir. At different time points after LNA-anti-miR92a transfection, miR-92a quantitation and cell viability were assessed by qRT-real-time-polymerase chain reaction (PCR) and MTT assays. The data was processed using the ANOVA test.

Results: Down-regulation of miR-92a in APL cell line (HL-60) by LNA antagomir extensively decreased cell viability in APL. Cell viability gradually decreased over time as the viability of LNA-anti-miR transfected cells was less than 50% of untreated cells at 72 h post-transfection. The difference of cell viability between LNA-anti-miR and control groups was statistically significant (p<0.024).

Conclusion: Based on our findings, it is concluded that inhibition of miR-92a may represent a potential novel therapeutic approach for treatment of APL. Key Words: microRNA, miR-92a, Acute Promyelocytic Leukemia, Locked Nucleic Acid Özet: Amaç: MikroRNA (miRNA) lar endojen protein kodlamayan RNA’lar, 19-25 nükleotit uzunlukta olup mRNA’ların önemli bir çoğunluğunda post-transkripsiyonel gen ekspresyon regülasyonunda yer almaktadırlar. Çoğu tümörde, farklı miRNA’ların up- veya down-regülasyonu rapor edilmiştir. Akut myeloid lösemide miR-92a’nın up-regülasyonu insan in vitro çalışmalarında bildirilmiştir. Bu çalışmada esas olarak, akut promyelositik lösemi (APL) de miR-92a inhibisyonunun etkisinin değerlendirilmesi amaçlanmıştır.

Address for Correspondence: Rasoul SALEHI, PhD, Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, 81744-176, Iran Phone: +98 311 792 24 87 E-mail: r_salehi@med.mui.ac.ir Received/Geliş tarihi : November 10, 2012 Accepted/Kabul tarihi : December 31, 2012

157

Turk J Hematol 2013;30:157-162

Sharifi M, et al: miR-92a and Acute Promyelocytic Leukemia

Gereç ve Yöntemler: Akut Promyelositik Lösemi (APL) hücre dizisinde (HL-60) locked nükleik asit (LNA) antagomir kullanarak miR-92a’nın inhibisyonunu gerçekleştirdik. LNA-anti-miR92a transfeksiyonu sonrası farklı zamanlarda, miR-92a kantitasyonu ve hücre viabilitesi qRT-Real-Time-polimeraz zincir reaksiyonu (PCR) ve MTT testleri ile değerlendirildi.

ANOVA testi kullanılarak veriler işlendi.

Bulgular: APL hücre dizisinde (HL-60) LNA antagomir ile miR-92a down regülasyonu APL’de hücre viabilitesini belirgin ölçüde azalttı. Post-transfeksiyon sonrası 72. saatte, LNA-anti-miR transfekte hücreler muamele edilmemiş hücrelerin %50 sinden azı olduğunda, hücre viabilitesi kademeli olarak zaman içinde azaldı. LNA-anti-miR ve kontrol grupları arasında hücre canlılığı açısından farklılık istatistiksel olarak anlamlıydı (p<0.024).

Sonuç: Bulgularımıza göre, miR-92a inhibisyonunun APL tedavisi için yeni bir potansiyel terapötik yaklaşım olabileceği sonucuna varılmıştır.

Anahtar Sözcükler: mikroRNA, miR-92a, Akut promyelositik lösemi, Locked nükleik asit

Introduction MicroRNAs (miRNAs) are post-transcription regulators of gene expression involved in many cellular biological and pathological activities [1]. Initially discovered in 1993 in Caenorhabditis elegans should be italicized, miRNAs were next revealed in many other organisms, including human beings, and proved to play crucial roles in regulation of gene expression. They are composed of the short ribonucleic acid (RNA) chain of 19-25 nucleotides [2]. MiRNAs are involved in various biological processes, including the cell cycle, differentiation, growth and development, metabolism, aging and apoptosis [3,4,5,6,7]. Deregulation of miRNAs expression, including both down- and up-regulation of their biogenesis, mimics the phenomenon attributed to the oncogenes and tumor suppressor genes, depending on the target mRNA regulated by particular species of miRNAs [8,9,10,2,11,12].

In addition, many reports favoring their essential function In addition, many reports favor their essential function in a wide range of diseases, including heart and cardiovascular diseases; rheumatological, infectious, inflammatory, autoimmune, metabolic disorders and cancers [8,13,14].

Acute myeloid leukemia (AML) is a disorder of hematopoietic stem cells, accompanied with obstruction in hematopoietic cell differentiation and increased clonal neoplastic proliferation. If remained untreated, this malignancy leads to death within a few weeks to several months [15]. Despite extensive studies, the biological and pathophysiological of AML are not yet clearly known [16]. MiRNAs as influential players in cell function can potentially shed light on the pathogenesis of this disorder and could be considered as a potential novel therapeutic option, especially in cases where conventional therapies are less beneficial [17,18,19].

Recent studies on miRNAs in relation to AML revealed many up- and down-regulation events, some correlated with particular cytogenetic aberrations. It has been shown that there is an increased expression of miR-92a in AML[20, 21]. In addition, this miRNA has been shown to negatively regulate p63 in CD32 cells (a murine myeloid cell line) leading to increased proliferation of these cells [22]. MiR158

92a is a member of the miR-17-92 cluster located on chromosome 13q31.3. It has been suggested that this cluster may function as the oncogene in some other malignancies, including chronic myelocytic leukemia [23].

Based on this evidence, we have proposed to examine the effects of miR-92a inhibition on HL-60 cell line proliferation and viability as a basic preliminary step in developing a novel therapeutic strategy for AML. According to the AmericanFrench-British (FAB) classification, AML is divided into eight subtypes, M0-M7 [15]. HL-60 cells are suitable in vitro model of AML-M3, also known as acute promyelocytic leukemia (APL).

Materials and Methods Cell Culture The HL-60 cell line (Human Promyelocytic Leukemia: APL) was purchased from the National Cell Bank of Iran (NCBI; Pasteur Institute, Iran) with Cytogenetic: 44,X,-X,-5,dic(5;17) (q11;p11)del(7)(p?),der(7)t(5;7)(q11;q?31)t(5;16) (q11;?),add(8)(?),der(9)del(9)(p2?)t(9;14)(q2?;q2?),del(10) (p?),ins(11;8)(q13?;?),der(14)t(14;15)(q1?;q?),15,der(16) (5;16)(q?;q?22~24),der(16)t(7;16)(?;q?22~24),+18. The cell culture was maintained in Roswell Park Memorial Institute (RPMI) 1640 (Gibco, Paisley, UK) supplemented with fetal calf serum (FCS; Gibco, Paisley, UK) 15% v/v, 100 U/mL of penicillin and 100 μg/mL of streptomycin (Gibco, Paisley, UK) in an air-saturated and humid atmosphere consisting of 5% CO2 in 25-cm2 culture flasks (Nunc, Roskilde, Denmark) at 37°C. The cells were passaged twice weekly to maintain an exponential growth phase.

Cell Transfection The nucleotide sequences of miR-92a were obtained from www.mirbase.org as UAUUGCACUUGUCCCGGCCUGU (accession number MIMAT0000092). The miRCURY LNA microRNA Inhibitor™ for hsa-miR-92a and microRNA inhibitor negative control (scrambled) oligonucleotides were purchased from Exiqon, Denmark. Both oligonucleotides were labeled at the 5´ end with fluorescent dyes, 6-FAM, for subsequent detection of transfected cells.

Turk J Hematol 2013;30:157-162

Sharifi M, et al: miR-92a and Acute Promyelocytic Leukemia

Reverse Transcriptase microRNA Real Time Polymerase Chain Reaction Reverse transcriptase (RT) microRNA real time polymerase chain reaction (PCR) was performed to determine the efficiency of miR-92a inhibition by LNAanti-miR. Briefly, the total cellular RNA was extracted 24, 48, and 72 h post transfection with the miRCURY RNA Isolation Kit™ (Exiqon, Copenhagen, Denmark) and cDNA was synthesized with the Universal cDNA Synthesis Kit™ (Exiqon, Copenhagen, Denmark). Real time PCR was performed by using SYBR® Green Master Mix Kit™ (Exiqon, Copenhagen, Denmark) and specific miR-92a primers (all consumables in this section were from Exiqon, Copenhagen, Denmark). Synthetic RNA spike-in templates and their primers (Exiqon, Denmark) were used for RTPCR internal control. The ABI Step One Plus (ABI, USA) instrument was used for real time PCR experiments and the ∆∆Ct method for data calculation.

Cells Viability Assay The viability of cells were assessed by the MTT (3[4, 5 dimethylthiazol-2-yl]-2, 5-diphenyl tetrazolium bromide) assay, which is based on reduction of MTT by the mitochondrial dehydrogenase of intact cells to purple formazan products. The conversion is directly related to the number of living cells. The MTT assay was performed at the time intervals of 48, and 72 h post transfection. Two hundred microliters of MTT (Sigma-Aldrich, USA) at the concentration of 50 mg/mL was added to 5x105 HL-60 cells suspended in 2 mL of RPMI 1640 medium and incubated for 4 h at 37 °C in the dark. Two hundred microliters of dimethyl sulfoxide (DMSO; Sigma-Aldrich, USA) was added to each

well and was shaken until dissolution of crystals. Blank samples were prepared using exactly the same procedure with an exception of cell incorporation. Absorbance was measured by using a spectrophotometer (PG Instrument T80, England) at 570 nm. Reading was converted to the percentage of the controls.

Statistical Analysis All the experiments were carried out in triplicate. The results were calculated by using the SPSS (version 16) software. The ANOVA test was used to assess differences the between the groups. Data were presented as mean±SD. Statistical significance was defined as p<0.05.

Results miRCURY LNA microRNA Inhibitor™ Strongly Inhibits miR-92a For inhibition of miR-92a, the miRCURY LNA microRNA Inhibitor™ was transfected to HL-60 cells with the X-tremeGENE siRNA Transfection Reagent. On the basis of the initial optimization experiments, transfection was performed with 50 pM of LNA-anti-miR and 5 μL of the transfection reagent. As the transfected oligonucleotides were fluorochrome-conjugated, transfection efficiencies were assessed by fluorescence microscopy and flow cytometry.

Carefully optimized protocol produced transfection efficiency of 90% [Figure 1].

120 100

100

98.5

100

Viability % (MTT-Test)

HL-60 cell transfection was performed by using the X-treme GENE siRNA Transfection Reagent™ (Roche, Mannheim, Germany) according to the manufacturer instructions. Briefly, 5x105 cells in the exponential growth phase were cultured in six-well culture plates (Nunc, Roskilde, Denmark) containing 1.8 mL RPMI 1640 per well without antibiotics and FCS. The 50 pmol miRCURY LNA microRNA inhibitor™ was mixed with 5 μL X-treme GENE siRNA Transfection Reagent™ in 200 μl Opti-MEM I Medium™ (Gibco, Paisley, UK) and incubated for 15 min at room temperature. The complex was then added to the cells and swirled cautiously to ensure even distribution over the entire plate surface. After 8 h of incubation, the FCS and antibiotics were added, and the cells were incubated for the 24, 48, and 72 h. Untreated cells and cells transfected with scrambled-LNA were cultured parallel to the LNAanti-miR transfected cells. Efficiency of the transfection was examined by flow cytometry and fluorescent microscopy. LNA was conjugated with 6-FAM™ Fluorescein (6-carboxyfluorescein) in order to detect and quantify LNA transfected cells by fluorescent microscopy and FACSCalibur flow cytometer (BD, USA).

94

100 95.4

92.6

80 61.3

60 Untreated 44.9

Scrambled LNA LNA-ant-miR-92a

40

20

0 24 h

48 h Time

72 h

Figure 1: HL-60 cells have been transfected with 6-FAM™ fluorescein-conjugated LNA oligonucleotides and then to assess transfection efficiency, they have been observed by a fluorescent microscope and analyzed by flow cytometry.

Phase contrast (a) and fluorescent (b) images of the same field of HL-60 cells show that a majority of the cells were transfected. Representative FSC-SCS and FL1-Count flow cytometry graphs are shown in (c). Scale bars: 50 μm.

159

Turk J Hematol 2013;30:157-162

Sharifi M, et al: miR-92a and Acute Promyelocytic Leukemia

Expression of miR-92a was evaluated by reverse transcriptase microRNA real time PCR in HL-60 cells transfected with the miRCURY LNA microRNA Inhibitor™ (LNA-anti-miR group), the microRNA inhibitor scrambled oligonucleotides (scrambled LNA group), and untreated HL-60 cells (untreated groups), at 24, 48, and 72 h posttransfection. Although, miR-92a expression was a little lower in the scrambled LNA-transfected cells compared to the untreated cells, the differences were not statistically significant. However, in all three time points, the expression of miR-92a was considerably lower in the LNA-anti-miR group compared to the control groups (p<0.025). The expression of miR-92a was at the lowest level 24 h after transfection and gradually increased in the next two time points [Figure 2].

and several other cancers [26]. It is suggested that miR92a target’s estrogen receptor (ERβ1) mRNA hence down regulating its expression in breast cancer [27]. In AML, miR-92a overexpression was observed, as well as its inverse relationship with p63 protein expression in murine CD32myeloid cells [22, 21].

There are a number of studies on oncomiRs as an approach to cancer treatment by employing an appropriate inhibitory molecule to down-regulate specific cellular miRNAs [28,29,30]. These studies are rapidly expanding into advanced phases expecting to generate a new path

Inhibition of miR-92a Decreased Viable HL-60 Cells

Discussion AML, a prevalent malignancy of myeloid cells, is associated with a high rate of morbidity and mortality [16, 15]. In spite of recent progresses, the therapeutic options for this disorder are still suboptimal and, therefore, novel therapeutic options are urgently needed [16,24,15]. MiRNAs are known to function as either oncogenes (oncomiRs) or tumor suppressors [25].

Reversal of the deregulated miRNAs normalized their cellular levels and hence provides blockage of the pathological pathways resulted from miRNAs ill expression, which is an alternative novel therapeutic option [21].

In this study, we have used LNA-anti-miR to the inhibition of miR-92a in APL (AML-M3) cell line. Real time PCR data confirmed that this miRNA was almost entirely down-regulated after LNA-anti-miR transfection.

As well, the MTT assay showed that inhibition of miR92a is associated with decreased cell viability after 24, 48, and 72 h.

Although, probably due to the transfection reagent toxicity, cell viability was minimally decreased in the scrambled LNA transfected cells compared to the normal controls (untreated cells) but this difference was not statistically significant.

MiR-92a is traced to be involved in various leukemia, including AML and ALL, hepatocellular carcinoma (HCC), 160

Transfection

Transfection

Figure 2: Assessment of the miR-92a level by real time PCR 24, 48, and 72 h after transfection. The ∆∆Ct method was used for data analysis, and the untreated group was considered as a reference for each time point. Data were mean±SD of three independent experiments.

1.2 1

1

1

1 0.8

0.77 0.6603

Mean miR-92a

To assess the effect of miR-92a inhibition on cell viability, the MTT assay was performed 24, 48, and 72 h after transfection. Cell viability was lower in the scrambledLNA group compared to the untreated cells at 48 and 72 h after transfection (p<0.05). Cell viability of HL-60 cells was considerably decreased LNA-anti-miR post-transfection.

The effect of LNA-anti-miR transfection on the cell viability gradually increased over time as the viability of the LNA-antimiR transfected cell was less than 50% of the untreated cells at 72 h post-transfection [Figure 3]. The difference of the cell viability between the LNA-anti-miR and both control groups (untreated and scrambled treated) was statistically significant (p<0.024) at all three time points [Figure 3].

0.593

0.6

Untreated Scrambled LNA

0.4

LNA-ant-miR-92a

0.2

24h

0.04

0.019

0.0007

0

48h Time

72h

Figure 3: Assessment of cell viability by the MTT assay performed 24, 48, and 72 h after transfection. The viability of the untreated cells in each time point was considered as 100% and the viability of other groups is presented as the percentage of the untreated cells in the same time point. Data were mean±SD of three independent experiments.

Sharifi M, et al: miR-92a and Acute Promyelocytic Leukemia

in challenges like chemo resistant cases or circumstances needing augmentation of weak response to therapies [25].

One of the technologies employed in oncomiRs inhibition is the LNA technology [31]. In this study, we used the same technology to suppress already up-regulated miR-92a in an APL cell line. Prevention of cellular proliferation subsequent to the LNA transfection is indicative of successful inhibition of miR92a in the cell line under study. Based on the fact that cytogenetic abnormality of APL is really complex and needs careful karyotype examination for patient’s stratification and design of the therapeutic plan, blockage of APL proliferation by inhibition of just one miRNA is a big achievement. Manni et al. reported in a mouse acute myeloid leukemia cell line that miR-92 inhibits p63 expression and that this protein has an important role in cell proliferation [22]. Perhaps in human APL, p63 expression is inhibited by miR-92a and induces the cell proliferation.

Chemotherapy is a routine approach for AML treatment [15, 16], However, in many cases, chemo resistance does not allow effective treatment and cell proliferation would not relief, as it is frequently exemplified by resistance to alltrans retinoic acid (ATRA) [24]. On the other hand, there are some instances that oncomiR inhibition acts to sensitize the cells to chemotherapy agents, making this combination therapy more effective than any one of the strategies used alone [32,33].

Turk J Hematol 2013;30:157-162

4. Alvarez-Garcia I, Miska EA. MicroRNA functions in animal development and human disease. Development 2005;132:4653-4662.

5. Griffiths-Jones SM. The microRNA sequence database.

Methods Mol Biol 2006;342:129-138.

6. Baltimore DB. MicroRNAs in Inflammation and their disregulation in cancer and autoimmune disease. Annual Review of Immunology. 2012;30.

7. Rottiers V, Näär AM. MicroRNAs in metabolism and metabolic disorders. Nat Rev Mol Cell Biol 2012;13:239250.

8. Barh D, Malhotra R, Ravi B, Sindhurani P. MicroRNA let7: an emerging next-generation cancer therapeutic. Curr Oncol 2010;17:70-80.

9. Drakaki A, Iliopoulos D. MicroRNA gene networks in oncogenesis. Curr Genomics 2009;10:35-41.

10. George G, Mittal RD. MicroRNAs: Potential biomarkers in cancer. Indian J Clin Biochem 2010;25:4-14.

11. Seto AG. The road toward microRNA therapeutics. Int J Biochem Cell Biol 2010;42:1298-1305.

12. Gu J, Zhu X, Li Y, Dong D, Yao J, Lin C, Huang K, Hu H, Fei J. miRNA-21 regulates arsenic-induced anti-leukemia activity in myelogenous cell lines. Med Oncol 2011;28:211218.

As a conclusion, taken together, our data suggest that inhibition of miR-92a with LNA-anti-miR may provide an alternative approach for the treatment of APL. It can be used alone or in combination with current therapies to reduce the existing limitations in the treatment of this malignancy.

We realize that further in vivo studies are definitely required to assess the feasibility of this strategy. However, efficient in vivo delivery of anti-miR oligonucleotides remains an obstacle to be tackled before we can move to clinical trials.

13. Spizzo R, Rushworth D, Guerrero M, Calin GA. RNA inhibition, microRNAs, and new therapeutic agents for cancer treatment. Clin Lymphoma Myeloma 2009;9 Suppl 3:S313-318.

Conflict of Interest Statement

16. Shipley JL, Butera JN. Acute myelogenous leukemia. Exp Hematol 2009;37:649-658.

The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Ruan K, Fang X, Ouyang G. MicroRNAs: novel regulators in the hallmarks of human cancer. Cancer Lett 2009;285:116126.

2. Reddy SD, Gajula RP, Pakala SB, Kumar R. MicroRNAs and cancer therapy: the next wave or here to stay? Cancer Biol Ther 2010;9:479-482.

3. Fabbri M, Garzon R, Andreeff M, Kantarjian H, GarciaManero G, Calin G. MicroRNAs and noncoding RNAs in hematological malignancies: molecular, clinical and therapeutic implications. Leukemia 2008;22:1095-1105.

14. Trang P, Weidhaas J, Slack F. MicroRNAs as potential cancer therapeutics. Oncogene 2008;27:S52-57.

15. Richard A. McPherson RA, Pincus MR. Henry’s. Clinical Diagnosis and Management by Laboratory Methods. 21st ed. Philadelphia: Saunders; 2007.

17. Umezu T, Ohyashiki K, Kuroda M, Ohyashiki JH. Leukemia cell to endothelial cell communication via exosomal miRNAs. Oncogene 2012.

18. Wieser R, Scheideler M, Hackl H, Engelmann M, Schneckenleithner C, Hiden K, Papak C, Trajanoski Z, Sill H, Fonatsch C. microRNAs in acute myeloid leukemia: Expression patterns, correlations with genetic and clinical parameters, and prognostic significance. Genes Chromosomes Cancer 2010;49:193-203.

19. Zhang H, Chen YQ. New insight into the role of miRNAs in leukemia. Sci China C Life Sci 2009;52:224-231.

20. Tanaka M, Oikawa K, Takanashi M, Kudo M, Ohyashiki J, Ohyashiki K, Kuroda M. Down-regulation of miR-92 in human plasma is a novel marker for acute leukemia patients.

PLoS One 2009;4:e5532.

161

Turk J Hematol 2013;30:157-162

21. Ohyashiki JH, Umezu T, Kobayashi C, Hamamura RS, Tanaka M, Kuroda M, Ohyashiki K. Impact on cell to plasma ratio of miR-92a in patients with acute leukemia: in vivo assessment of cell to plasma ratio of miR-92a. BMC Res Notes 2010;3:347.

22. Manni I, Artuso S, Careccia S, Rizzo MG, Baserga R, Piaggio G, Sacchi A. The microRNA miR-92 increases proliferation of myeloid cells and by targeting p63 modulates the abundance of its isoforms. The FASEB J 2009;23:39573966.

23. Uziel T, Karginov FV, Xie S, Parker JS, Wang YD, Gajjar A, He L, Ellison D, Gilbertson RJ, Hannon G, Roussel MF. The miR-17~92 cluster collaborates with the Sonic Hedgehog pathway in medulloblastoma. Proc Natl Acad Sci U S A 2009;106:2812-2817.

Sharifi M, et al: miR-92a and Acute Promyelocytic Leukemia

27. Al-Nakhle H, Burns PA, Cummings M, Hanby AM, Hughes TA, Satheesha S, Shaaban AM, Smith L, Speirs V. Estrogen receptor β1 expression is regulated by miR-92 in breast cancer. Cancer Res 2010;70:4778-4784.

28. Zhou T, Zhang G, Liu Z, Xia S, Tian H. Overexpression of miR-92a correlates with tumor metastasis and poor prognosis in patients with colorectal cancer. Int J Colorectal Dis 2013;28:19-24.

29. Zhao X, Yang L, Hu J, Ruan J. miR-138 might reverse multidrug resistance of leukemia cells. Leuk Res 2010;34:1078-1082.

30. Saito Y, Friedman JM, Chihara Y, Egger G, Chuang JC, Liang G. Epigenetic therapy upregulates the tumor suppressor microRNA-126 and its host gene EGFL7 in human cancer cells. Biochem Biophys Res Commun 2009;379:726-731.

24. Estey EH. Acute myeloid leukemia: 2012 update on diagnosis, risk stratification, and management. Am J Hematol 2012;87:89-99.

31. Ørom UA, Kauppinen S, Lund AH. LNA-modified oligonucleotides mediate specific inhibition of microRNA function. Gene 2006;372:137-141.

25. Iorio MV, Croce CM. MicroRNA dysregulation in cancer: diagnostics, monitoring and therapeutics. A comprehensive review. EMBO Mol Med 2012;4:143-159.

32. Yuan Y, Zeng ZY, Liu XH, Gong DJ, Tao J, Cheng HZ, Huang SD. MicroRNA-203 inhibits cell proliferation by repressing ∆Np63 expression in human esophageal squamous cell carcinoma. BMC Cancer 2011;11:57.

26. Hu G, Drescher KM, Chen XM. Exosomal miRNAs: biological properties and therapeutic potential. Front Genet 2012;3:56.

162

33. Li X, Liu J, Zhou R, Huang S, Huang S, Chen XM. Gene silencing of MIR22 in acute lymphoblastic leukaemia involves histone modifications independent of promoter DNA methylation. Br J Haematol 2010;148:69-79.

Research Article

DOI: 10.4274/Tjh.2012.0132

Trends in Transfusion Transmitted Infections Among Replacement Blood Donors in Karachi, Pakistan Karaçi, Pakistan’daki Kan Bağışçılarında Transfüzyonla Bulaşan Enfeksiyonların Yaygınlığı Syed Mohammad Irfan1, Jamal Uddin1, Hasan Abbas Zaheer2, Sadia Sultan1, Amjad Baig1 1Liaquat

National Hospital, Department of Haematology, Karachi, Pakistan

2Pakistan

Institute of Medical Sciences, Pakistan

Abstract: Objective: To determine the prevalence of Hepatitis-B, Hepatitis-C and Human Immunodeficiency infections in replacement blood donors.

Materials and Methods: From January 2004 to December 2011, 108,598 apparently healthy donors donated blood at our Blood Bank. Screening was done by Microparticle Enzyme Immuno Assay (MEIA) method on Axsym System (Abbott Diagnostic, USA) and in year 2011 by Chemiluminescent Immunoassay (CIA) method on Architect i2000 (Abbott Diagnostic, USA). From 2010 onward, HIV reactive donors were advised for confirmatory tests and reported back with the results.

Results: Of the 108,598 total donors, 108,393 (99.8%) were replacement donors with a mean age of 28.92 (17-55) years. Of this, only 164 (0.15%) were females. Among the replacement donors, 4,906 (4.5%) were found to be reactive for Hepatitis-B, C and Human Immunodeficiency Virus. All the reactive patients, except one, were males. HbsAg was positive in 2,068 (1.90%) and anti-HCV in 2832 (2.61%) donors, while 111 (0.10%) were positive for Human Immunodeficiency Virus. Co-infectivity was observed in 103 (0.09%) cases. The prevalence appeared to be higher in younger age group (17-30 yrs). Only 16.6% cases should be patients returned with results of the confirmatory tests for HIV and were found positive.

Conclusion: Hepatitis-B and C sero-prevalence in our series of replacement donors appears high compared to most studies from neighboring countries and relatively low in comparison to earlier studies from Pakistan. Prevalence of HIV, however, appears low and turn out of HIV positive cases for confirmatory tests is low.

Key Words: Replacement Blood Donors, Hepatitis-B, Hepatitis-C, HIV Özet: Amaç: Kan bağışçılarında, Hepatit-B, Hepatit-C ve Human Immunodeficiency enfeksiyonlarının prevelansını belirlemek.

Gereç ve Yöntemler: Ocak 2004’den aralık 2011’e kadar, 108598 sağlıklı verici, kan bankamıza bağışta bulunmuştur.

Taramalar, Axsym System (Abbott Diagnostic, USA) için Microparticle Enzyme Immuno Assay (MEIA) methodu ve 2011 yılında da Architect i2000 (Abbott Diagnostic, USA) için Chemiluminescent Immunoassay (CIA) yöntemi ile yapılmıştır. 2010 yılından itibaren, HIV reaktif vericilerin sonuçlarına doğrulama testleri uygulanmış ve kişilere geri bildirimde bulunulmuştur.

Address for Correspondence: Syed Mohammad IRFAN, M.D., Liaquat National Hospital, Department of Haematology, Stadium road Karachi, Karachi, Sindh 74800, Pakistan Phone: +92-2134412581 E-mail: irfan6697@yahoo.com Received/Geliş tarihi : September 15, 2012 Accepted/Kabul tarihi : December 31, 2012

163

Turk J Hematol 2013;30:163-167

Irfan SM, et al: Trends in Transfusion Transmitted Infections Among Replacement Blood Donors in Karachi, Pakistan

Bulgular: Toplam 108598 bağışçının 108393’ü (%99,8) replasman bağışçısı olup, yaş ortalaması 28,92 (17-55) idi. Bunların sadece 164’ü (%0,15) kadındı. Kan bağışçıları arasında 4906 (%4,5) olgu Hepatit-B, C ve Human Immunodeficiency Virus yönünden pozitif bulundu. Bunların biri hariç hepsi erkekti. Bağışçıların 2068’inde (%1,90) Hbs Ag ve 2832’sinde (%2,61) ise anti-HCV pozitif bulundu. 111 (%0,10) kişi Human Immunodeficiency Virus yönünden pozitifdi. Birden fazla enfeksiyon varlığı 103 (%0,09) olguda saptandı. Prevelans, görece genç yaştakilerde (17-30 yaş) daha yüksek bulundu. Sadece %16,6 olgu HIV doğrulama testi ile pozitif saptanarak reddedildi.

Sonuç: Çalışmamızda kan bağışçılarındaki Hepatit-B ve C seroprevelansı, komşu ülkelerin çalışmalarıyla kıyaslandığında yüksek bulunmakla birlikte, Pakistan’dan daha evvel yapılan çalışmalardaki sonuçlarla karşılaştırıldığında ise görece düşük saptanmıştır. Buna karşın, HIV prevelansı ve doğrulama testine tabi tutulan HIV pozitif olgu sayısı ise düşük görünmektedir.

Anahtar Sözcükler: Replasman kan bağışçısı, Hepatit-B, Hepatit-C ve HIV

Introduction

Materials and Methods:

Blood transfusion carries the risk of acquiring Transfusion Transmitted Infections (TTIs), including HIV, Hepatitis, Malaria, and infrequently Toxoplasmosis, Brucellosis and some other viral infections like CMV, EBV and Herpes. Among all infections, HIV and hepatitis are the most commonly screened viruses in a transfusion service [1].

This cross sectional study was conducted in the blood bank of Liaquat National Hospital from January 2004 to December 2011. Institutional clearance was obtained from the ethical committee of the Hospital.

Transfusion services in Pakistan are fragmented and there is great variation in the standard of services provided by the different blood banks in the country. There are some isolated centers which follow internationally recommended practices but on the whole there is a lot of room for improvement in the quality of work performed in the vast majority of the blood banks. Also we do not have a system to inform the health authorities about TTIs except for HIV positive cases, which are referred to provincial HIV / AIDS control program for confirmation and subsequent treatment if required. In the recent past, however, the level of awareness and sensitization about blood safety and particularly the significance of voluntary donations and screening of donated blood has improved considerably. Paid donations are becoming uncommon and the predominant reliance is on the replacement donors [2]. The prevalences of Hepatitis B, C and HIV show wide variation in the general public and blood donors [3,4,5].

In several studies conducted in Pakistan and in other countries of the world, prevalence of TTIs appears high among replacement blood donors compared to voluntary donors [6,7]. Prevalence of TTIs is highly uncommon in the developed countries due to a well-developed healthcare and blood transfusion system which follows stringent donor selection criteria, deferral on the basis of high risk behavior and sensitive screening tests [8].

We undertook a review of sero-prevalence of blood donors in our hospital. Being the largest study on replacement blood donors from Pakistan, it is likely to reflect trends in TTIs in major cities of the country.

164

Donors were interviewed and an informed consent was sought from all of them. The findings were recorded with a on a specially designed questionnaire which was further improved from 2010 onwards. Donor’s name, age, sex, national identity card number, phone number and type of donor (replacement or voluntary) were recorded. Only healthy blood donors, having no history of jaundice, intravenous drug abuse, non-marital sexual contacts, tattooing, blood transfusion and fulfilling the physical fitness criteria for age, weight, or blood pressure and haemoglobin levels were bled for donation. Screening methods included Microparticle Enzyme Immunoassay on Axsym system (Abbott diagnostic, USA) and in year 2011

by Chemiluminescent Immunoassay (CIA) method on Architect i2000 (Abbott Diagnostic, USA). Reactive results were repeated on the same sample with the same method.

From 2010 onward, data were collected prospectively and HIV positive patients were contacted on cell phone, counseled and referred to provincial HIV/AIDS control centers for confirmation and subsequent therapy if required.

Donors were advised to come back to us with results of confirmatory tests. Donors were contacted multiple times if they did not respond initially.

Data were entered and analyzed using SPSS version 13 statistical package. Mean ± SD was calculated for the quantitative variable, i.e. age. Frequency and percentages were calculated for qualitative variables, i.e. sex, type of donor and positivity rate.

Results A total of 108,598 blood donations were collected during the study period. Blood donation rate remained similar over years with an increasing trend from 2010 onward. Of the

Irfan SM, et al: Trends in Transfusion Transmitted Infections Among Replacement Blood Donors in Karachi, Pakistan

total donors, 108,393 (98.8 %) were replacement donors and only 205 (1.2%) were voluntary donors (Figure 1). Mean age of replacement donors was 28.92 years and all except 164 (0.15%) were males.

The positivity rates among replacement and voluntary donors were 4.51% and 0.48%, respectively. Among the replacement donors sero-prevalence of Hepatitis B, C and HIV was 2068 (1.90%), 2832 (2.61%) and 111 (0.10%) cases, respectively. Positivity rate for viral markers remained the same over study years except for HIV which showed a small dip in the year 2008 (Figure 2). Little difference was seen in the mean age of Hepatitis B (28.5 years), Hepatitis C (29.4 years) and HIV positive cases (30.0 years). Hepatitis B, Hepatitis C and HIV reactivity rates were found high among the younger age group (Figure 3). Co-infectivity was seen in 103 donors (0.09%). Co-infectivity for Hepatitis B and Hepatitis C was highest: 0.084%. HIV seropositivity along with hepatitis B and C was present in 0.004% and 0.001%, respectively, and reactivity for all three viral markers was seen in 0.001% donors (Table 1).

Of the 30 HIV reactive patients from 2010 onward, 28 could be contacted on cell phone for counseling and confirmatory tests while 10/30 donors (33%) did not respond to calls at all.

Only 60% received the calls, however, and only 12/30 (40%)

18000

16,276 14,768

16000 13,759 14000

13,392

13,037

12,698

12,251

12,211

12000 10000 8000 6000 4000 2000 0 2004

2005

2006

2007

2008

2009

2010

2011

Turk J Hematol 2013;30:163-167

reported to blood bank for detailed history and were referred to designated centers for confirmatory tests. They were also advised to report back to us with the results of confirmatory tests to keep our record updated. However, only 5/30 (16.6%) returned back and all were positive for the confirmatory tests for HIV. Discussion Liaquat National Hospital is a 700 bed tertiary care hospital, located in the heart of cosmopolitan city of Karachi (population 18 million). The hospital caters to a population of about 4 million people. Majority of the patients (and donors) attending the hospital come from lower middle class compared to public care hospitals, which caters to patients from a low socioeconomic group.

Blood donation in Pakistan, like most of the developing world, is predominantly reliant on family / replacement donations. This category is known to have higher prevalence of TTIs compared to regular voluntary donors [6,7]. However, for cultural, economic and social reasons replacement donors cannot and should not be discouraged or eliminated from the blood donor pool especially in countries like Pakistan which has a strong tradition of family bonds. The replacement donors in such societies should be motivated and recruited to become regular voluntary donors to ameliorate the chronic shortage of voluntary blood donors. Thus, in such an environment the strategy for mobilization, recruitment and retention of voluntary non-remunerated blood donors should focus on the captive audience, i.e. the replacement blood donors [9]. This approach is likely to be more beneficial as well as more costeffective than a generalized media campaign for the general public, adopted conventionally in the developed countries which do not have a large pool of replacement donors available.

Hepatitis B and C remain major public health concern in Pakistan. In our study prevalence of Hepatitis B and Hepatitis C was relatively on the lower side compared to many studies from Pakistan [3,4,6,7]. Mujeeb and Mehmood reported high positivity rate of hepatitis B (4.9%) and comparable rate for hepatitis C (2.4%) from Karachi in family / replacement donor [6]. Our results for hepatitis B and C are also low

Figure 1: Replacement donors over years.

2000 1800 1600 REACTIVE HbsAg:2068(1.90%)

REACTIVE ANTI HCV: 2832(2.61%)

REACTIVE HIV:111(0.10%)

1400

427

1200

396

1000 364

351

337

321

300

600

304

400

278

267

250

800

336

253

247

245

224

200 0

2004

22

15

9 2005

2006

19 2007

6 2008

2009

14

16

10 2010

2011

Figure 2: Distribution of reactive donors per year.

17-30

31-40

41-55

HBV Positive

1378

554

136

HCV Positive

1759

851

222

HIV Positive

65

39

7

Figure 3: Age groups and seroprevalence of Hepatitis-B, C and HIV. 165

Turk J Hematol 2013;30:163-167

Irfan SM, et al: Trends in Transfusion Transmitted Infections Among Replacement Blood Donors in Karachi, Pakistan

when compared to another study in replacement donors by Sultan et al. from Lahore, the 2nd largest city of Pakistan [7].

Mujeeb et al [10] has reported higher prevalence of hepatitis B (4.7%) and C (3.6 %) in first time replacement donors from the same city. Low prevalence in our series of donors is likely because of stringent behavioral screening practices which we have been trying in last few years. We specifically paid more attention to improved donor selection criteria, education and salary package of donor attendants and supervision of the donor area by trained resident doctors. Comparative data in replacement donors from neighboring countries are shown in Table 2 which exhibits higher prevalence of hepatitis B and C in our series of donors [11,12,13,14,15]. Likely reasons are deepened poverty, statutory ambiguity in certain laws, unsafe health practices of public & professionals and lack of universal access to health care. Also our prevalence for hepatitis B and C appear high in comparison to studies on voluntary donors from the neighboring countries which is self explanatory [12, 13,16] (Table 3). Wide variations are seen in positivity rate for TTIs from other developing countries of the world for which varied and multiple reasons exist. Our positivity rates

are much higher when compared to developed nations where greater awareness, high living standards and use of nucleic acid amplification testing (NAT) have led to very low risk of acquiring TTIs [17,18,19,20].

HIV positivity rate in our study, however, appear significantly low when compared to studies from neighboring countries in replacement donors except for a study by Ahmed et al., which reported a low HIV positivity rate of 0.008% [11,13,14,15]. Also the trends appear static over years (except for a dip in 2008). Another striking feature in our study is the high prevalence of TTIs in youngest age group (Figure 3).

Sultan et al., which reported a significantly lower prevalence of HIV in replacement donors younger than 35 years (0.03%) versus 35–55 years (0.3%) [7] . The same study has reported lower prevalence of hepatitis B and hepatitis C in age group younger than 35 years (1.4% and 3.3%) compared to donors with 35-55 years of age (2.6% and 6.3%). The higher prevalence of TTIs in younger donors as seen in our study can emerge as an immense public health problem as well as it may lead to higher donor deferral rates and so shortage of

Table 1: Co-infectivity of the TTIs.

Total Infected

Hepatitis B & C Hepatitis B & HIV Positive Positive

Hepatitis C & HIV Positive

Hepatitis B, C & HIV Positive

4906 (4.51%)

94 (0.084%)

2 (0.001%)

2 (0.001%)

5 (0.004%)

Table 2: Comparison with regional studies on replacement donors.

Country

Prevalence HBV%

HCV%

HIV%

Number of donors

India (Delhi)

2.23

0.66

0.56

28,956*

Arora et al. [12]

India (Southern Haryana)

2.0

1.2

0.44

4010

3

Kaur et al. [13]

India (Chandigarh)

1.07

0.5

0.44

23321

4

Ahmed et al. [11]

Bangladesh

1.39

0.024

0.008

12131Ω

5

Shrershta et al. [15]

Nepal

0.47

0.64

0.12

21716

6

Our study

Pakistan, Karachi

1.90

2.61

0.10

108393

S/N

References

1

Pahuja et al. [14]

2

*:99.47% were replacement blood donors out of total. Ω: two reactive cases for Hepatitis-B out of 139 voluntary donors were excluded.

Table 3: Comparison with regional studies in voluntary donors.

Prevalence HBV%

HCV%

HIV%

Number of donors

India (Southern Haryana)

0.27

0.15

0.0

1.839

Kaur et al [13]

India (Chandigarh)

0.65

0.3

0.15

19.118

3

Khedmat et al [16]

Iran (Tehran)

0.9

2.1

0.2

1.004.889

4

Our study

Pakistan, Karachi

1.90

2.61

0.10

108.393

S/N

References

Country

1

Arora et al [12]

2

166

Irfan SM, et al: Trends in Transfusion Transmitted Infections Among Replacement Blood Donors in Karachi, Pakistan

blood in future. However the issue has been actively taken up by provincial government and a “hepatitis prevention and control program” has been launched aggressively in last 2-3 years. Public awareness is being raised and poor people are being provided Hepatitis vaccine free of cost. As a result of extensive campaigns, people are getting vaccinated privately for their health and safety. However the trend needs to be investigated by public health experts as there may be a need to invest in promotion of healthy life style.

Multiple infections pose a small but enhanced risk to the recipient’s life. Co-infectivity rates in blood donors have not been reported from Pakistan and limited data are available from the neighboring countries. In our series of donors, coinfectivity was detected in 103 (0.09%) donors. Hepatitis B & C co-infection was seen in 94 (92.2%) compared to HIV and Hepatitis co-infection which was seen in 8 (7.8%) donors only (Table 1). Kaur et al. from India also show low rates for coinfection in HIV seropositive donors compared to those who were seronegative for HIV [13]. Studies from Sub-Saharan Africa also show high positivity rate of HIV co-infections in countries which are likely to have a Generalized HIV Epidemic [9]. A trend towards higher co-infectivity also prevails in replacement donors compared to voluntary donors [13].

As a conclusion it appears that Hepatitis B and C reactivity rates in our series of donors appear high compared to most reported studies in replacement donors from neighboring countries, however, HIV appears low. Higher prevalence in younger donors is alarming and is likely to adversely affect the current static trends in medium and long term. This situation calls for concerted efforts to overcome it as it implies that we are likely to face more shortage of healthy donors in future.

Acknowledgements The authors sincerely thank blood donors for giving correct information. We are also thankful to Mr. Mustansar for data analysis and Mr. Asif for Manuscript typing.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Transfusion Transmitted Diseases. In Brecher ME (ed).

Technical manual. 15th edition. Bethesda, American Association of Blood Banks, 2005: 667-712.

2. Kassi M, Afghan AK, Khanani MR, Khan IA, Ali SH. Safe blood transfusion practices in Blood banks of Karachi.

Transfus Med 2011;21:57-62.

3. Attaullah S, Khan S, Khan J. Trend of transfusion transmitted infections frequency in blood donors: a road map for its prevention and control. J Transl Med 2012;10:20-25.

4. Nazar H, Nadia N, Shazia N, Zulfiqar A, Farhat A. Prevalence of hepatitis B and C in blood donors of Karachi. Biomedica 2008;24:116-117.

Turk J Hematol 2013;30:163-167

5. National survey on Prevalence of Hepatitis B & C in general population of Pakistan. Pakistan Medical Research Council (PMRC) 2010. http://www.pmrc.gov.pk.

6. Mujeeb SA, Mahmood T. Prevalence of HBV, HCV and HIV infections among family blood donors. Ann Saudi Med 1996;16:702-703.

7. Sultan F, Mehmood T, Mahmood MT. Infectious Pathogens in volunteer and replacement blood donors in Pakistan: a ten year experience. Intern J Infect Dis 2007;11:407-412.

8. Soldan K, Davison K, Dow B. Estimates of the frequency of HBV, HCV and HIV infectious donations entering the blood supply in the United Kingdom, 1996 to 2003. Euro Surveil 2005;10:17-19.

9. Allain JP. Moving on from voluntary non-remunerated donors: Who is the best blood donor ? Br J Haematol 2012;154:763-769.

10. Mujeeb SA, Nanan D, Sabir S, Altaf A, Kadir M. Hepatitis B and C infections in first time blood donors in Karachi-a possible subgroup for sentinel surveillance. Eastern Medit health J 2006;12:735-741.

11. Ahmed MU, Begum HA, Hossain T, Chakraborty P. Incidence of common transfusion transmitted disease among blood donors. J Arm Forc Med Col Bangl 2009;5:4-6.

12. Arora D, Arora B, Khetarpal A. Seroprevalence of HIV, HBV, HCV and Syphilis in blood donors in Southern Haryana.

Ind J Pathol Microbiol 2010;53:308-309.

13. Kaur G, Basu S, Kaur R, Kaur P, Garg S. Patterns of infections among blood donors in a tertiary care centre: a retrospective study. Nat Med J Ind 2010;23:147-149.

14. Pahuja S, Sharma M, Baitha B, Jain M. Prevalance and trends of markers of Hepatitis C, B and HIV in Delhi Blood donors: A Hospital based study. Jpn J Infect Dis 2007;60:389-391.

15. Shrestha AC, Ghimre P, Tiwari BR, Rajkarnikar M. Transfusion transmissible infections among blood donors in Kathmandu. Nepal. J Infect Dev Ctries 2009;10:794-797.

16. Khedmat F, Alavian SM, Miri SM, Amini M, Abolghasemi H, Hajibeigi B, Alaeddini F, Fallahian F. Trends in seroprevalence of Hepatitis B, Hepatitis C, HIV and Syphilis Infections in Iranian Blood Donors from 2003 to 2005. Hepatitis Monthly 2009;9:24-28.

17. Coste J, Reesink HW, Engelfriet CP, Laperche S. Implementation of donor screening for infectious agents transmitted by blood by nucleic acid technology. Vox Sang 2005;88:289-303.

18. Alvarez M, Oyonarte S, Rodriguez PM, Hernandez JM. Estimated risk of transfusion-transmitted viral infection in Spain. Transfusion 2002;42:994-998.

19. Gonzalez M, Regine V, Vulcano F, Giampaolo A, Hassan Hj. Residual risk of transfusion transmitted HIV, HCV and HBV infection in Italy. Transfusion 2005;45:1670-1675.

20. Offergeld R, Faensen D, Ritter S, Hamouda O. Human immunodeficiency virus, hepatitis C and hepatitis B infection among blood donors in Germany 2000-2002: risk of virus transmission and the impact of nucleic acid amplification testing. Euro Surveillance 2005;10:8-11.

167

Research Article

DOI: 10.4274/Tjh.2011.0048

Screening Bleeding Disorders in Adolescents and Young Women with Menorrhagia Menorajisi Olan Adolesan ve Genç Kadınlarda Pıhtılaşma Bozukluklarının Araştırılması Suar Çakı Kılıç, Nazan Sarper, Emine Zengin, Sema Aylan Gelen Kocaeli University Medical Faculty, Department of Pediatric Hematology, Kocaeli, Turkey

Abstract: Objective: Chronic menorrhagia causes anemia and impairment of life quality. In this study the aim was the screening of bleeding disorders in adolescents and young women with menorrhagia.

Materials and Methods: The study was performed prospectively by pediatric hematologists. A form including demographic characteristics of the patients, bleedings other than menorrhagia, familial bleeding history, characteristics of the menorrhagia, and impairment of life quality due to menorrhagia was filled out by the researcher during a face-to-face interview with the patient. A pictorial blood assessment chart was also used for evaluation of blood loss. All patients underwent pelvic ultrasound sonography testing and women also received pelvic examination by gynecologists. Whole blood count, peripheral blood smear, blood group, serum transaminases, urea, creatinine, ferritin, PFA-100, PT, aPTT, INR, TT, fibrinogen, VWF:Ag, VWF:RCo, FVIII, and platelet aggregation assays were performed. Platelet aggregations were studied by lumiaggregometer.

Results: Out of 75 patients enrolled, 60 patients completed the study. The mean age was 20.68±10.34 (range: 10-48) years and 65% (n=39) of the patients were younger than 18 years. In 18 (46%) of the adolescents, menorrhagia subsided spontaneously.

In 20% (n=12) of the patients, a bleeding disorder was detected (1 case of type 3 von Willebrand disease, 2 patients with low VWF:Ag, 1 case of probable von Willebrand disease, 3 cases of Bernard-Soulier syndrome, 2 cases of Glanzmann thrombasthenia, 2 cases of immune thrombocytopenic purpura, 1 case of congenital factor VII deficiency).

Conclusion: In patients with menorrhagia, at least complete blood count, peripheral smear, aPTT, PT, VWF:Ag, VWF:RCo, FVIII, and fibrinogen assays must be performed. When there is history of nose and gum bleeding, platelet function assay by lumiaggregometer must also be performed. In nearly 50% of adolescents, menorrhagia is dysfunctional and transient. Detailed coagulation assays can be postponed in adolescents if bleeding history other than menorrhagia and/or family history of bleeding and/or parental consanguinity is absent. All subjects with menorrhagia must consult with gynecologists and hematologists.

Key Words: Menorrhagia, Bleeding disorder, von Willebrand disease, Platelet aggregation defects Özet: Amaç: Kronik menoraji anemiye ve yaşam kalitesinde bozulmaya neden olur. Bu çalışmanın amacı adolesan ve genç kadınlarda pıhtılaşma bozukluklarının taranmasıdır.

Address for Correspondence: Suar Çakı KILIÇ, M.D, Kocaeli University Medical Faculty, Department of Pediatric Hematology, Kocaeli, Turkey GSM: +90 262 303 72 15 E-mail: suarcaki@superonline.com Received/Geliş tarihi : May 29, 2012 Accepted/Kabul tarihi : Jun 11, 2012

168

Kılıç ÇS, et al: Screening Bleeding Disorders in Adolescents and Young Women with Menorrhagia

Turk J Hematol 2013;30:168-176

Gereç ve Yöntemler: Bu çalışma çocuk hematoloji hekimleri tarafından prospektif olarak yapıldı. Araştıcı tarafından hastayla karşılıklı yapılan görüşmede hastaların demografik özelliklerini, menoraji dışındaki diğer kanama öyküsünü, aile öyküsünü, yoğun menstruasyon kanamasının özelliklerini ve bu durumun yaşam kalitesini etkileme derecesini içeren bir form dolduruldu. Menstruasyondaki kan kaybının yoğunluğunu değerlendirmek için resimli kanama değerlendirme çizelgesi kullanıldı. Tüm hastalara jinekologlar tarafından pelvik muayene ve ultrasonografi yapıldı. Tam kan sayımı, periferik yayma, kan grubu, serum transaminazları, üre, kreatinin, ferritin, PFA-100, PZ, aPTZ, INR, TT, fibrinojen, VWF: Ag, VWF: RCo, FVIII, trombosit agregasyon testleri yapıldı. Trombosit agregasyon testleri lumiagregometri yöntemiyle çalışıldı.

Bulgular: Çalışmaya 75 hasta ile başlandı 60 hasta çalışmayı tamamladı. Ortalama yaş 20,68±10,34 (10-48) olan hastaların %65’i (n=39) 18 yaşın altındaydı. Adolesanların %46’sında (n=18) menoraji kendiliğinden düzeldi. Hastaların %20’sinde (n=12) pıhtılaşma bozukluğu saptandı. (1 hasta Tip III Von Willebrand hastalığı, 2 hasta düşük VWF: Ag, 1 hasta olası Von Willebrand hastalığı, 3 hasta Bernard-Soulier sendromu, 2 hasta Glanzmann trombastenisi, 2 hasta immun trombositopenik purpura, 1 hasta doğumsal FVII eksikliği).

Sonuç: Menorajili hastalarda başlangıçta tam kan sayımı, periferik yayma, aPTZ, PZ, VWF:Ag, VWF:RCo, FVIII ve fibrinojen düzeyleri bakılmalıdır. Burun ve dişeti kanaması hikayesi varlığında, trombosit fonksiyonları lumiagregometrik yöntemle değerlendirilmelidir. Adolesanların yaklaşık %50’sinde menoraji hormonal fonksiyon bozukluğuna bağlı ve geçicidir. Detaylı pıhtılaşma testlerinin yapılması menoraji dışında kanama hikayesi olanlar ve/veya ailevi kanama hikayesi olanlar ve/veya akraba evliliği olan hastalar dışında ertelenmelidir. Tüm menorajili hastalar jinekoloji ve hematoloji hekimleri tarafından değerlendirilmelidir.

Anahtar Kelimeler: Menoraji, Pıhtılaşma bozukluğu, Von Willebrand hastalığı, trombosit agregasyon bozuklukları Introduction Menorrhagia is defined as a menstrual blood loss of more than 80 mL per menstrual cycle. Its estimated prevalence in healthy women is 9%-14% [1]. A variety of organic, endocrine, gynecologic, or other systemic causes may be responsible for menorrhagia [2]. Menstrual problems are likely to be worse in women with bleeding disorders, as they are more likely to have heavy and painful menstrual periods and ovulation bleeding and pain [3,4]. The excessive blood loss can cause anemia and tiredness. In various published series, 32%-100% of women with von Willebrand disease (VWD), the most common inherited bleeding disorder, were reported to have heavy menstrual bleeding. Heavy menstrual bleedings were reported among 10%-70% of women with other bleeding disorders [5]. Underlying bleeding disorders were generally missed due to unavailability of detailed coagulation assays in routine laboratory procedures and lack of hematology consultation. The aim of this study was the screening of bleeding disorders in adolescents and young women presenting with menorrhagia.

Materials and Methods The ethics committee of Kocaeli University approved the study. The patients’, and for patients younger than 18 years also their legal guardians’, written informed consent was obtained. The study was performed prospectively by pediatric hematologists between June 2009 and December 2010 in adolescents and women of reproductive age during their admission to the gynecology and adult and pediatric hematology outpatient and emergency care units of

Kocaeli University Hospital. Physicians of the Gynecology Department were informed about the study and referrals of patients presenting with menorrhagia were requested.

The adult hematology unit was also informed about the study and referral of patients presenting with menorrhagia was requested. Patients presenting with menorrhagia were referred to hematology clinics by second level referral centers due to suspected bleeding disorders. The researcher filled out a form including demographic characteristics of the patients, bleedings other than menorrhagia, familial bleeding history, and characteristics of the menorrhagia during a face-to-face interview with the patient. Pictorial blood assessment charts (PBAC) were also distributed for evaluation of blood loss during menstruation. Patients compared the degree of saturation of their sanitary pads and tampons with those depicted on the chart. Patients ticked the pictures throughout menstruation and wrote the number of the tampons and/or pads used every day. Lightly stained pads or tampons obtained a score of 1, moderately stained pads or tampons a score of 5, and soaked pads or tampons a score of 20. The total points were calculated by the researcher. A PBAC total score of greater than 100 was considered a blood loss of more than 80 mL [6].

To evaluate the quality of life during menstrual periods, patients were asked to rate 7 parameters of daily living on a scale of 0-10, with 0 meaning that menses “does not interfere” with that parameter and 10 meaning that menses “completely interferes”. The parameters were patients’ general activity, ability to work and attend school, family activities, and ability to enjoy life, sleep, mood, and overall quality of life. Total points were 0-35 for the mildly affected 169

Turk J Hematol 2013;30:168-176

Kılıç ÇS, et al: Screening Bleeding Disorders in Adolescents and Young Women with Menorrhagia

and 36-70 for the severely affected [3]. All the patients had pelvic ultrasonography in the gynecology outpatient clinic and women also had pelvic examinations to exclude gynecological pathologies. Patients with gynecological pathologies such as myoma uteri or a history of systemic disease such as diabetes mellitus and hypothyroidism were excluded from the study.

Blood samples were obtained in the first 5 days of the menstrual cycle and oral contraceptives (OCs) and nonsteroidal anti-inflammatory drugs were withdrawn at least 10 days before. Vacutainer tubes with citrate were used and samples reached the local laboratory within 15 min.

Aggregation assays were performed within 3 h. Whole blood count, peripheral blood smear, blood group, ferritin, platelet function analyzer 100 (PFA-100), prothrombin time (PT), activated partial thromboplastin time (aPTT), thrombin time (TT), fibrinogen, von Willebrand factor antigen (VWF:Ag), VWF ristocetin cofactor (VWF:RCo), factor VIII (FVIII), and platelet aggregation assays were performed.

Serum transaminases, urea, and creatinine assays were also performed, because uremia impairs platelet functions and liver disease impairs synthesis of the coagulation factors.

Other rare coagulation factor assays were performed when PT and/or aPTT were prolonged. Whole blood count was studied with the Celldyn-3700© (Abbot); biochemistry testing with the Aeroset 70© (Abbot); serum ferritin level with the Modular E-170© (Roche); PFA-100 testing with equipment by Dade-Behring©; PT, aPTT, fibrinogen, thrombin time, and VWF:Ag with Star© (Diagnostica Stago); and platelet aggregation testing and VWF:RCo with ChronoLog Lumiaggregometry. Collagen, ristocetin, adenosine diphosphate (ADP), and epinephrine were used as agonists.

The concentrations of agonists were: collagen, 0.5 mg/mL; ristocetin, 1.5 mg/mL; ADP, 1.0 μM/L; and epinephrine, 1.0 μM/L. Collagen and ADP cartridges were used for PFA-100.

High PBAC score and/or duration of menses greater than or equal to 7 days with a sensation of flooding or bleeding through a tampon or pad in ≤2 h, history of treatment of anemia, clots greater than 2.5 cm in diameter, family history of diagnosed bleeding disorder, history of excessive bleeding with tooth extraction, delivery or miscarriage or surgery, history of spontaneous nosebleed that persisted for 10 min or needed medical attention, spontaneous gum bleeds, prolonged bleeding from minor wounds, easy bruising with minimal trauma, or similar bleeding symptoms in the family were regarded as clinical factors supporting existence of a bleeding disorder. The following criteria were used for diagnosis of bleeding disorders. Criteria for diagnosis of Glanzmann’s thrombasthenia (GT) were normal PT, aPTT, platelet count, and morphology; no curve with ADP, epinephrine, or collagen; and normal curve with ristocetin in platelet aggregation by lumiaggregometry. Criteria for 170

diagnosis of Bernard-Soulier syndrome (BSS) were low platelet count, large platelets and normal aggregation with physiologic agonists, and no curve with ristocetin. For laboratory diagnosis of VWD, VWF:Ag, VWF:Rco, and FVIII coagulant assays were used. The normal value for these parameters was 50-200 IU/dL. VWF:Ag levels of 30 IU/dL or lower are required for the definite diagnosis of inherited VWD (especially type 1). VWF:Ag is less than 50 IU/dL in most patients with type 2A, 2B, or 2M VWD. VWF:Rco is less than 30 IU/dL in types 1 and 2. Levels of 30 to 50 IU/dL are classified as low VWD. In patients with blood group O, VWF:Ag is 25% lower. In type 1, both VWF:Ag and VWF:Rco are low and VWF:Rco/VWF:Ag is >0.5-0.7. In types 2A, 2B, and 2M, the VWF:Rco level is decreased more than VWF:Ag (VWF:Rco/VWF:Ag is <0.5-0.7). In types 1 and 2, the FVIII level may be low or normal. In type 2N, VWF:Ag and VWF:Rco may be normal or decreased. In type 3, VWF:Ag and VWF:Rco are absent (<3). In type 2N and type 3, FVIII is <30 IU/dL and <10 IU/dL, respectively [7]. Diagnostic criteria for immune thrombocytopenic purpura (ITP) was platelet count of <150,000/mm3 and normal or increased number of megakaryocytes and/or megakaryoblasts on marrow smear.

After blood samples were obtained, iron salts, hormones (estrogen, progesterone, OCs), tranexamic acid, platelet concentrates, steroids, or fresh frozen plasma were administered regarding the underlying bleeding disorder.

Hormonal therapies were prescribed by the consulting gynecologists of the outpatient clinic.

Statistical analysis was performed using SPSS 16.

Descriptive statistics, chi-square test, and Fisher’s exact test were used. P<0.05 was considered statistically significant.

Results During the study, 75 patients presented with menorrhagia, but 60 of them completed the study. Fifteen of the patients refused to come for platelet aggregation assays. The mean age of the patients was 20.68±10.34 (range: 10-48) years, and 65% (n=39) were younger than 18 years. Clinical and laboratory characteristics of the 75 enrolled patients are summarized in Table 1. In 20% (n=12) of the patients that completed the study, a bleeding disorder was detected (1 case of type 3 VWD, 2 cases of low VWF:Ag, 1 case of probable VWD, 3 of BSS, 2 of GT, 2 of ITP, and 1 of congenital factor VII deficiency). History and laboratory characteristics of the patients with congenital bleeding disorders are shown in Table 2.

In patients with bleeding disorders, a history of mucosal bleeding, hypoferritinemia, and prolonged closure time were significantly more frequent (p<0.05). High PBAC score (>100), presence of anemia or severe anemia, mean hemoglobin, ovulation pain, menorrhagia beginning at

Turk J Hematol 2013;30:168-176

Kılıç ÇS, et al: Screening Bleeding Disorders in Adolescents and Young Women with Menorrhagia

menarche, and quality of life were not different between patients with and without bleeding disorders (Table 3).

There was no difference between patients with and without congenital bleeding disorders in familial bleeding history, parental consanguinity, and high PBAC score. There was a positive correlation between PBAC score and anemia.

In the medical history of the patients, the administered drugs due to menorrhagia were iron salts, tranexamic acid, combined OCs, and progesterone. Red blood cell transfusion was performed in 16 (26.6%) of the patients during followup. Oral iron salts, OCs, high-dose estrogen, tranexamic acid, apheresis platelets, packed red cells, and fresh frozen plasma were administered to the patients. Patients with ITP had pulse steroids for 3 days. The only surgical procedure was splenectomy in a patient with chronic ITP. There was partial response to the splenectomy (platelet count: 50,00080,000/mm3), but this decreased menstrual blood loss.

Patients were followed for 1 year with visits or phone calls.

At the end of the first year of menarche in 18 (46%) of the adolescents, menorrhagia subsided spontaneously and was diagnosed as dysfunctional bleeding. All patients benefited from medical treatment.

Discussion At least 5%-10% of women of reproductive age will seek medical attention for menorrhagia [8]; however, an underlying etiology is identified in only 50% of cases [2]. The most common endocrinological cause of heavy menstrual bleeding in adolescent girls is anovulatory dysfunctional uterine bleeding owing to the immaturity of the hypothalamic–pituitary–ovarian axis [9]. In the present study, in nearly half of the adolescents, menorrhagia subsided spontaneously, probably with maturation of this axis, and no bleeding disorder could be detected.

It is clear that menorrhagia impairs quality of life in women. In the present study, 73.84% of women reported poor quality of life. In a study by Kouides et al., 46% of the patients with type 1 VWD reported losing time from work or school in the past 12 months because of menorrhagia. The median time lost was 4 (range: 1-24) days [3].

In a recent study from Sweden enrolling 152 women with idiopathic menorrhagia and 56 healthy, regularly menstruating women, a strong association was found between idiopathic menorrhagia and family history of heavy

Table 1: Clinical and laboratory characteristics of the patients with menorrhagia (n=75).

Characteristiscs

Numbers or values

Mean age, years (min-max)

20.07±10.13 (10-48)

# adolescents/# adult patients (ratio)

50/25 (2:1)

# patients with mucosal bleeding other than menorrhagia (%)

16 (21.91)

# patients with menorrhagia since menarche (%)

46 (63.88)

# patients having history of treatment for menorrhagia (%)

50 (66.66)

# patients with PBAC score of >100 (%)

66 (88)

# patients with severely affected quality of life score (%)

48 (73.84)

Mean hemoglobin (g/L)

103.3±26.4

(RV*=120-140)

Mean platelet count (x109/L)

282.892±108.519

(RV=150-400x109/L)

Mean prothrombin time (s)

13.71±1.26

(RV=11.5-15.5)

Mean activated partial thromboplastin time (s)

29.98±4.81

(RV=26.5-40)

Mean thrombin time (s)

16.07±1.26

(RV=14-21)

Mean fibrinogen (g/dL)

3.47±1.02

(RV= 2-4)

Mean PFA-100 collagen epinephrine (s)

132±44.86

(RV=85-157)

Mean PFA-100 collagen ADP (s)

98.28±33.80

(RV=65-125)

Mean VWF:Ag (IU/dL)

104.34±46.31

(RV>30)

Mean VWF:RCo (IU/dL)

88.88±33.98

(RV>30)

Mean FVIII (%)

125.16±40.32

(RV=50-150)

Mean serum ferritin (ng/mL)

14.89±27.89

(RV≥12)

*RV: Reference value

171

172

15

14

25

34

22

12

5

6

7

8

9

10

yes

no

yes

yes

yes

yes

yes

no

yes

yes

yes

yes

yes

yes

no

no

no

yes

no

yes

yes

no

no/no

no/no

no/no

yes

traction/

tooth ex-

no/no

no/no

yes

traction/

tooth ex-

yes

traction/

tooth ex-

no/no

no/no

no/no

no/no

no/no

no/no

no/no

no/no

no/no

52

145

13

82

14

76

7

92

79

242

255

159

392

260

50

18.6

70.3

208

ND

ND

3.6

1.79

5.97

8.3

4.15

11

21.7/27.2

14/36.2

13/31.1

15/55.6

12.2/29.6

12.7/20

13.4/22

12.6/25.4

13.5/23

ND

3.15

2.84

ND

3.06

ND

2.92

4.4

3.1

ND

ND

123/ 180

ND

ND

177/>300

ND

129/ 126

300/>300

ND

257/>275

PFA100 Fibr., ADP/ g/L epin. S

ND

38/33-40

61/55

2/2

29/ 35

126/ND

137 / 261

58/ 240

ND/96

ND

VWF:R-co/ VWF:Ag,IU/ dL

ND

46

85

1

95

ND

300

300

ND

ND

ND

normal curves

ristocetin

no curve wit

ristocetin

no curve with

normal curves

ristocetin

no curve with

ristocetin

no curve with

ristocetin

no curve with

epinephrine

ADP, collagen,

no curve with

epinephrine

ADP, collagen,

no curve with

Pathology FVIII, in IU/dL aggregation tests

Dx: Diagnosis, Fibr: Fibrinogen, FVII def.: FVII defciency, *FVII level was 20%, ND: Not done, VWD: Von Willebrand disease, VWF: Von Willebrand factor, BSS: Bernard-Soulier syndrome, GT: Glanzmann thrombasthenia.

def.

*FVII

VWF

Low

VWD?

type 3

VWD

VWF

Low

BSS

BSS

yes

no/no

1.91

15

yes

yes

15.2/20.9

4

BSS

yes

78.1

15

no

279

3

GT

no/no

15

no/no

2

yes

17

1

yes

rare

Case Age Dx

GT

PTs/ Easy Bleeding Surgery/ Delivery/ Hb, Ferritin, Epistaxis PLT,109/L aPTT bruising gums bleeding bleeding g/L ng/mL s

Table 2: Bleeding history and laboratory characteristics of the patients with congenital clotting defects.

Turk J Hematol 2013;30:168-176

Kılıç ÇS, et al: Screening Bleeding Disorders in Adolescents and Young Women with Menorrhagia

Kılıç ÇS, et al: Screening Bleeding Disorders in Adolescents and Young Women with Menorrhagia

menstrual bleeding (r=0.68). The authors suggested that familial menorrhagia must be due to a hereditary trait [10].

In the present study, 39.58% of the patients without bleeding disorder had a family history of menorrhagia.

In this single center study, a bleeding disorder (VWD, other platelet function defects, or ITP) was identified in 20% of the patients, similar to the findings of James’ study [11]. A review of 11 studies conducted internationally found 13% (range: 11%-15.6%; 131 of 988 patients) of women with menorrhagia to have VWD [12]. In these studies, testing for other bleeding disorders of this population was not extensive, and only one study involved tests of platelet function beyond performance of a bleeding time test [13]. In a study performed in 6 centers in the United States, among 232 women with PBAC scores of >100, a laboratory abnormality was found in 73.3%, including both white (68.1%) and black (91.9%) subjects; 6.0% had VWD, 56.0% had abnormal platelet aggregation tests, 4.7% had a non-VWD coagulation defect, and 6.5% had an abnormal PFA only. Platelet aggregation was reduced in 58.9% of the subjects, with multiple agonists in 28.6%, a single agonist in

Turk J Hematol 2013;30:168-176

6.1%, and ristocetin alone in 4.2%. Laboratory abnormalities of hemostasis, especially platelet function defects, were common, but the clinical significance of these abnormalities was uncertain. This study also screened rare coagulation defects and compared factor levels of the patients with those of the control subjects. Twenty-three subjects had non-VWD coagulation defects (deficiencies of factors II, V, VII, XI, and XIII and fibrinogen, plasminogen activator inhibitor-1, and alpha-2-antiplasmin). Levels of these factors were above 50 IU/dL but slightly below the reference range, which may have limited the clinical significance [14]. Levels of factors V, VII, and X above 15%-20% and factor II above 20%30% are generally considered adequate for hemostasis and thought not to be associated with significant bleeding. We did not study rare factor deficiencies routinely but measured the FVII level as 20 IU/dL in a patient with prolonged PT. According to some guidelines, in daily practice, initial tests for bleeding disorders should rule out more common causes of bleeding. These tests include whole blood counts, aPTT, PT, and possibly fibrinogen level or thrombin time. Patients with isolated prolonged PTT or with normal PTT, PT, platelet

Table 3: Comparison of the patients with and without bleeding disorders (n = 60).

Patients with Patients bleeding without disorders bleeding disorders

p

Nose bleeding: ratio (%)

9/12 (75)

6/48 (12.5)

0.00

Easy bruising: ratio (%)

10/12 (83.3)

9/48 (18.7)

0.00

Gingival bleeding: ratio (%)

5/12 (41.6)

5/48 (10.4)

0.02

Postoperative bleeding*: ratio (%)

3/3 (100)

7/18 (38.8)

0.09

Postpartum bleeding*: ratio (%)

1/1 (100)

1/13 (23)

0.36

High PBAC score: ratio (%)

12/12 (100)

44/48 (91)

0.57

Anemia: ratio (%)

9/12 (75)

23/48 (72.9)

0.09

Severe anemia (Hb < 7 g/dL): ratio (%)

3/12 (25)

6/48 (12.5)

0.06

Mean Hb (g/dL)

9.11±3.35

10.69±2.44

0.33

Low ferritin**: ratio (%)

6/6 (100)

21/38 (55.26)

0.03

Ovulation pain: ratio (%)

4/11 (36.36)

15/47 (31.9)

1.00

Menorrhagia at menarche: ratio (%)

10/12 (83.33)

32/48 (66.66)

0.3

Poor quality of life (points > 35): ratio (%)

8/12 (66.6)

33/48 (68.75)

1.0

Prolonged closure time (PFA-100 collagen epinephrine)**: ratio (%)

4/5 (80)

10/45 (22.22)

0.01

Prolonged closure time (PFA-100 collagen-ADP)**: ratio (%)

2/4 (50)

1/45 (2.2)

0.01

Parental consanguinity: ratio (%)

5/10 (50)

7/48 (14.58)

0.18

Familial bleeding history: ratio (%)

6/10 (60)

19/48 (39.58)

0.4

*Some of the patients had surgery or pregnancy. **Some laboratory assays could not be performed in all patients.

173

Turk J Hematol 2013;30:168-176

Kılıç ÇS, et al: Screening Bleeding Disorders in Adolescents and Young Women with Menorrhagia

count, and fibrinogen level in the presence of bleeding signs or symptoms should receive VWF:Ag, VWF:RCo, and factor VIII assays to test for VWD [7].

The diagnosis of VWD is complex and the diagnosis of mild forms can be difficult. Persons with levels of 30 to 50 IU/dL may need agents to increase VWF levels during invasive procedures or childbirth. Therefore, it is important to correlate severity and cause of bleeding with results of laboratory tests [7]. The levels of VWF and clotting factor VIII may vary depending on multiple factors, including age, race, genetic factors, blood type, stress, inflammation, hormones, and sample processing. When test results are low-normal or minimally decreased, the tests should be repeated if bleeding symptoms and family history suggest VWD [12]. In our series, patient 7 had prolonged aPTT and very low VWF antigen, VWF:RCo, and FVIII levels. Patient 8 had normal VWF:Ag and VWF:RCo levels (55 and 61 IU/ dL), but she had familial history of menorrhagia, epistaxis, and a pathological curve with ristocetin in the platelet aggregation study. Diagnosis of VWD was not confirmed but the patient’s compliance was poor for repeating laboratory assays. Patients 6 and 9 had low VWF levels that were between 30 and 50 U/dL. Menorrhagia has been reported to be present in 51% of women with BSS and 13%-98% of women with GT [15,16,17].

In patients with GT and BSS, severe nose and gum bleeds in childhood were very striking, but the symptoms were not recognized by physicians and the patients were not referred to hematologists. These features were as important in the history of these patients as consanguineous marriage of the parents and bleeding history of the siblings. These defects show autosomal recessive inheritance. Only one patient with GT reported that her brothers had the same disease. Even in the United States, it was reported that there was a median of 16 years (0-39 years) between the first bleeding symptom and recognition of VWD in women. The average age at onset of bleeding symptoms was 6 years and at diagnosis of VWD was 23 years [18]. History of bleeding in surgery is important in bleeding disorders but this may be especially unhelpful in adolescents, because they might not yet have been exposed to such hemostatic challenges.

The PFA-100 is easy to perform and a quick test, but is not the gold standard compared to lumiaggregometry. In our study, the number of the patients with bleeding disorders was too low to make a conclusion about the sensitivity and specificity of screening with PFA-100, although closure times seemed longer in patients with bleeding disorders. Eighty-one women with a physicians’ diagnosis of menorrhagia underwent PFA-100 and bleeding time tests to evaluate their effectiveness as screening tools for VWD and platelet dysfunction. Data showed that PFA-100 had a sensitivity of 80%, specificity of 89%, positive predictive value (PPV) of 33%, negative predictive value (NPV) of 174

98%, and efficiency 88% for VWD. For platelet aggregation defects, the PFA-100 closure time had a sensitivity of 23%, specificity 92%, PPV of 75%, NPV of 52%, and efficiency of 55%. Neither the PFA-100 nor the bleeding time tests are effective for purposes of classifying women for standard platelet aggregometry testing in women presenting with menorrhagia [13].

In a study by Kadir et al., menorrhagia since menarche was noted in 11 (8.9%) of 123 women without a bleeding disorder compared with 13 (65%) of 20 women with VWD (p=0.001) and 4 (66.7%) of 6 women with FXI deficiency (p<0.001) [19]. Although in our study, in patients with a bleeding disorder, menorrhagia since menarche was more frequent compared to the other patients (83.3% versus 66.7%), this difference was not significant (p=0.31). However, there were adolescents in our group and adolescents with dysfunctional menorrhagia had menorrhagia since menarche.

It is clear that in the absence of iron-deficiency anemia, heavy menstrual bleeding is a subjective complaint and up to 50% of women describing menorrhagia will have a measured monthly blood loss within normal limits [20]. The PBAC score is useful in showing the severity of menorrhagia. Our study also confirmed that PBAC scores of >100 showed good correlation with anemia (p=0.05).

Medical treatments including hormones, antifibrinolytics, and iron salts are useful in the management of patients without gynecological pathology regardless of the etiology.

The concentrated spray form of desmopressin is not available in Turkey and the parenteral form can be used only in inpatient settings. Consequently, we did not try desmopressin (DDAVP) in patients with VWD. We used oral tranexamic acid in all patients and it reduced menstrual blood loss. Oral tranexamic acid (20-25 mg/kg every 8 h; generally a 1000-mg dose) for 5-7 days of the menstrual cycle was our practice. In some studies, a reduction in menstrual blood loss by 50% was shown [21]. It can be used in combination with OCs. In a recent study, tranexamic acid (1.3 g per os 3 times daily) showed a favorable safety profile, supporting its use as a therapy for cyclic heavy menstrual bleeding [22]. When OCs were compared with DDAVP nasal spray in managing menorrhagia in adolescents with type 1 VWD, they showed equivalent effectiveness. In DDAVP treatment, there were severe headaches and flushing [23]. Replacement with iron salts is also essential in the management of these women. It was reported that in some women with menorrhagia, iron deficiency impairs platelet aggregation, and this is reversed by iron replacement [24].

Adolescents were sexually inactive and unwilling to use OCs, and they generally used them for only 3 months.

Unexplained hemorrhage often triggers surgical interventions such as endometrial ablation and/or hysterectomy.

In our study, only one surgical intervention, splenectomy for chronic ITP, was performed. In adolescents and women of child-bearing age, preservation of fertility is essential.

Kılıç ÇS, et al: Screening Bleeding Disorders in Adolescents and Young Women with Menorrhagia

The limitations of this study were the low number of patients and the lack of routine screening of rare coagulation defects (II, V, VII, X, XI, XII, XIII) when PT, PTT, and TT were normal. FIX carriage was also not screened when there was no history of hemophilia B in the family. Multimer analysis of VWF was also not available. In addition, some assays were missing in some patients due to subjects’ incompliance to the study. We tried to compare some characteristics of the patients with and without underlying bleeding disorders to find predictive factors for underlying bleeding disorders.

However, the statistical power was low due to patient numbers in the groups.

In conclusion, screening of subjects with menorrhagia for underlying bleeding disorders is laborious and not all coagulation assays are available in many routine laboratories.

In patients with menorrhagia, at least complete blood count, peripheral smear, aPTT, PT, VWF:Ag, VWF:RCo, and fibrinogen assays must be performed. When there is a history of nose and gum bleeding, platelet function assay by lumiaggregometer must also be performed. In patients with a history of surgical bleeding, screening of rare coagulation deficiencies is also required. In nearly 50% of adolescents, menorrhagia subsides with the maturation of the hypothalamic–pituitary–ovarian axis. Detailed coagulation assays can be postponed in adolescents if bleeding history other than menorrhagia and/or family history of bleeding and/or parental consanguinity is absent. All subjects with menorrhagia must consult with gynecologists and hematologists. In subjects with bleeding disorders, future follow-up for management of pregnancy and delivery is essential for the safety of the mother and offspring.

Acknowledgment Thanks to laboratory technician İlknur Çağlar for her meticulous work in all of the coagulation assays. Thanks also to the physicians that referred patients to us and performed gynecological evaluations. The Kocaeli University Research Foundation sponsored the study. There was no conflict of interest in this study.

References

Turk J Hematol 2013;30:168-176

4. Kadir RA, Economides DL, Sabin CA, Pollard D, Lee CA. Assessment of menstrual blood loss and gynaecological problems in patients with inherited bleeding disorders.

Haemophilia 1999;5:40-48.

5. James AH. More than menorrhagia: a review of the obstetric and gynaecological manifestations of von Willebrand disease. Thromb Res 2007;120:17-20.

6. Higham JM, O’Brien PM, Shaw RW. Assessment of menstrual blood loss using a pictorial chart. Br J Obstet Gynaecol 1990;97:734-739.

7. Yawn B, Nichols WL, Rick ME. Diagnosis and management of von Willebrand disease: guidelines for primary care. Am Fam Physician 2009;80:1261-1268.

8. Kouides PA. Bleeding symptom assessment and hemostasis evaluation of menorrhagia. Curr Opin Hematol 2008;15:465-472.

9. Peyvandi F, Garagiola I, Menegatti M. Gynecological and obstetrical manifestations of inherited bleeding disorders in women. J Thromb Haemost 2011;9 (Suppl 1):236-245.

10. Kuzmina N, Palmblad J, Mints M. Predictive factors for the occurrence of idiopathic menorrhagia. Evidence for a hereditary trait. Mol Med Report 2011;4(5):935-939.

11. James AH. Women and bleeding disorders. Haemophilia 2010;16 (Suppl. 5):160-167.

12. Shankar M, Lee CA, Sabin CA, Economides DL, Kadir RA. Von Willebrand disease in women with menorrhagia: a systematic review. BJOG 2004;111:734-740.

13. Philipp CS, Dilley A, Miller CH, Evatt B, Baranwal A, Schwartz R, Bachmann G, Saidi P. Platelet function defects in women with unexplained menorrhagia. J Thromb Haemost 2003;1:477-484.

14. Miller CH, Philipp CS, Stein SF, Kouides PA, Lukes AS, Heit JA, Byams VR, Dowling NF, Kulkarni R. The spectrum of haemostatic characteristics of women with unexplained menorrhagia. Haemophilia 2011;17:e223-229.

15. Lopez JA, Andrews RK, Afshar-Kharghan V, Berndt MC. Bernard-Soulier syndrome. Blood 1998;91:4397-4189.

16. George JN, Caen JP, Nurden AT. Glanzmann thrombasthenia: the spectrum of clinical disease. Blood 1990;75:1383-1395.

1. Van Eijkeren MA, Christiaens GC, Sixma JJ, Haspels A. Menorrhagia: a review. Obstet Gynecol Surv 1989;44:421429.

17. Toogeh G, Sharifian R, Lak M, Safaee R, Artoni A, Peyvandi F. Presentation and pattern of symptoms in 382 patients with Glanzmann thrombasthenia in Iran. Am J Hematol 2004;77:198-199.

2. Warner P, Critchley HO, Lumsden MA, Campbell-Brown M, Douglas A, Murray G. Referral for menstrual problems: cross sectional survey of symptoms, reasons for referral, and management. Br Med J 2001;323:24-28.

18. Kirtava A, Crudder S, Dilley A, Lally C, Evatt B. Trends in clinical management of women with von Willebrand disease: a survey of 75 women enrolled in haemophilia treatment centres in the United States. Haemophilia 2004;10:158-161.

3. Kouides PA, Phatak PD, Burkart P, Braggins C, Cox C, Bernstein Z, Belling L, Holmberg P, MacLaughlin W, Howard F. Gynecological and obstetrical morbidity in women with type I von Willebrand disease: results of a patient survey.

Haemophilia 2000;6:643-648.

19. Kadir RA, Economides DL, Sabin CA, Owens D, Lee CA. Frequency of inherited bleeding disorders in women with menorrhagia. Lancet 1998;351:485-489.

20. Cameron IT. Dysfunctional uterine bleeding. Review.

Baillieres Clin Obstet Gynaecol 1989;3:315 -327.

175

Turk J Hematol 2013;30:168-176

Kılıç ÇS, et al: Screening Bleeding Disorders in Adolescents and Young Women with Menorrhagia

21. Lethaby A, Farquhar C, Cooke I. Antifibrinolytics for heavy menstrual bleeding. Cochrane Database Syst Rev 2000;4:CD000249.

22. Lukes AS, Freeman EW, Van Drie D, Baker J, Adomako TL. Safety of tranexamic acid in women with heavy menstrual bleeding: an open-label extension study. Womens Health (Lond Engl) 2011;7:591-598.

176

23. Amesse LS, Pfaff-Amesse T, Leonardi R, Uddin DJA 2nd.

Oral contraceptives and DDAVP nasal spray: patterns of use in managing vWD-associated menorrhagia: a singleinstitution study. J Pediatr Hematol Oncol 2005;27:357363.

24. Akay OM, Şahin F, Gülbaş Z. Evaluation of inherited and acquired platelet function disorders in iron deficient women with menorrhagia by whole blood lumi-aggregometer. Turk J Haematol 2005;22:71-78.

Research Article

DOI: 10.4274/Tjh.2012.0092

Experimental Investigation of the Effects of a Blood Stopper Agent (Ankaferd Blood Stopper) on Bone Surfaces Kanama Durdurucu Ajanın (Ankaferd Blood Stopper) Kemik Yüzeylerine Etkisinin Deneysel Olarak İncelenmesi Hasan Onur Şimşek1, Mustafa Şenol Tüzüm1, Timuçin Baykul1, İnanç Elif Gürer2, Cumhur İbrahim Başsorgun2 1Süleyman Demirel University Faculty of Dentistry, Department of Oral and Maxillofacial Surgery, Isparta, Turkey 2Akdeniz University Faculty of Medicine, Department of Medical Pathology, Antalya, Turkey

Abstract: Objective: This study aims to experimentally investigate the efficiency of Ankaferd Blood Stopper (ABS) on early and longterm bone healing and its effects on bone surfaces.

Materials and Methods: Thirty adult male Wistar albino rats were used in the study. These rats were randomly divided into three groups, and bilaterally bone defects were created in the femur of each rat. A 3.0-mm-deep monocortical circular defect was created with a 3.0 mm diameter trephine drill on the proximal part of the femur, and 0.05 mL ABS was applied to the experimental group while the control group was left untreated. Group 1, group 2, and group 3 rats were sacrificed on days 7, 28, and 42, respectively. Trabecular bone area (Tb.Ar), medullary bone diameter (Me.Dm), osteoblast area (Ob.Ar), osteoid area (O.Ar) and mineralized bone area (Md.Ar) were examined in the histomorphometric analysis. Also new bone formation was scored according to the histologic evaluation

Results: The results showed that while new the to day 7 experimental group showed much more bone formation than the to day 7 control group, there was no significant difference between the to day 28 and day 42 experimental groups and to day 28 and day 42 control groups. Accordingly, ABS applied in bone cavities only had a larger accelerator effect on bone healing for the seventh-day to day 7 experimental group. In clinical observations, no allergic or inflammatory reactions were observed on the skin and other preoperative and postoperative periods. Moreover in, the histomorphometric study, necrotic areas and infection areas were not observed.

Conclusion: ABS has an acceleratory effect on the short-term bone healing process and is a reliable agent for routine use.

However, its effects on the long-term bone healing process are insignificant. We think that a wide series of research projects are required to confirm the effects of ABS speeding up the healing process in addition to its characteristic as a blood stopping agent.

Key Words: Hemostasis, Ankaferd Blood Stopper, Bone healing, Bone histomorphometry

Address for Correspondence: Hasan Onur ŞİMŞEK, M.D., Süleyman Demirel University Faculty of Dentistry, Department of Oral and Maxillofacial Surgery, Isparta, Turkey Phone: +90 246 211 88 45 E-mail: onursimsek@sdu.edu.tr Received/Geliş tarihi : July 22, 2012 Accepted/Kabul tarihi : November 14, 2012

177

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

Turk J Hematol 2013;30:177-183

Özet: Amaç: Çalışmamızda deneysel olarak Ankaferd Blood Stopper (ABS)’ın erken ve geç dönem kemik iyileşmesi ve kemik yüzeylere etkisinin incelenmesi amaçlanmıştır.

Gereç ve Yöntemler: Çalışmaya 30 yetişkin erkek Wistar albino rat dahil edilmiştir. Denekler rastgele üç grubu ayrılmış ve kemik defektleri her bir femura uygulanmıştır. Kemik defektleri femurun proksimal kısmında 3,0 mm çapında trefin frez yardımıyla 3,0 mm derinliğinde, monokortikal ve dairesel olarak hazırlanmıştır. Deney grubuna 0,5 mL ABS uygulanırken kontrol grubuna herhangi bir madde uygulanmamıştır. Denekler 3 gruba ayrılarak sırasıyla yedinci, yirmi sekizinci ve kırk ikinci günlerde sakrifiye edilmiştir. Örneklerin histomorfometrik analizlerinde trabeküler kemik yüzey alanı, medullar kemik çapı, osteoblast yüzey alanı, osteoid kemik yüzey alanı ve mineralize kemik yüzey alanları incelenmiştir. Yeni kemik oluşumunun histolojik değerlendirmesi yapılarak, yeni kemik oluşum skorlaması yapılmıştır.

Bulgular: Çalışmamız sonucunda ABS kemik kavitelerinde uygulanmasının 7. gün deney grubunda kemik iyileşmesini hızlandırıcı etkileri üzerine daha net bulgulara ulaşılmış ve 7. gün sonuçlarına göre yeni kemik yapımını deney grubunda fazla olarak bulunmuştur. Ankaferd Blood Stopper kemik kavitelerinde uygulanmasının 28. ve 42. gün deney ve kontrol gruplarında benzer sonuçlara ulaşılmıştır. Klinik gözlemlerde intraoperatif ve postoperatif dönemde cilt ve diğer dokularda alerjik ve iltihabi reaksiyonlar gözlenmemiştir. Ayrıca histomorfometrik çalışmalarda nekrotik alanlara ve enfeksiyoz reaksiyonlara rastlanmamıştır.

Sonuç: Sonuç olarak, ABS kısa dönem kemik iyileşmesinde olumlu etkileri olabileceği gösterilirken, uzun dönem de kemik yapımını artırıcı etkileri olduğu gösterilmemiştir. Bununla birlikte ameliyat öncesi ve sonrasında herhangi bir yabancı cisim reaksiyonu veya nekrotik alanlara rastlanılmaması ve komplikasyon oluşturmaması pozitif etkileri olarak değerlendirilebilir.

Ankaferd Blood Stopper’in kanama durdurucu ajan olmasının yanında kemik iyileşmesini hızlandırıcı etkileri, geniş serili araştırmalarla desteklenmesi gerektiğini düşünmekteyiz.

Anahtar Sözcükler: Hemostaz, Ankaferd Blood Stopper, Kemik iyileşmesi, Kemik histomorfometri Introduction All surgical procedures in oral and maxillofacial surgery within the area of operation lead to varying degrees of bleeding.

Providing an effective hemostasis agent during an operation is one of the most basic surgical principles. Bleeding control is vital for pathological hemostasis patient groups. Excessive bleeding in these patients is not only distressing for the patient, but also prevents the completion of procedures. Bleeding in patients can cause excessive blood loss, poor wound healing, or infection [1,2]. In addition to routine hemostatic methods, various local hemostatic agents are widely used for bleeding management [3,4,5,6]. Ankaferd Blood Stopper (ABS), which is manufactured for use in dentistry, is an effective

hemostatic agent. ABS consists of 5 different plant extracts: Urtica dioica, Vitis vinifera, Glycyrrhiza glabra, Alpinia officinarum, and Thymus vulgaris (Table 1). Goker et al. suggested that ABS stimulated the formation of an encapsulated protein network that provides focal points for erythrocyte aggregation [7]. In addition, the combination of these plants in ABS appears to provide a unique composition for tissue oxygenation and the physiological hemostatic process without disturbing the levels of any individual clotting factor [7]. Various experimental and clinical studies have demonstrated the effect of ABS on bleeding control [8,9,10,11,12,13,14].

Many dentistry studies have reported the reliability and availability of ABS [15,16,17]. Besides its bleeding control

Table 1: Ingredients in the ampoule, spray, and pad forms of ABS. Quantity of ingredient

Urtica dioica1 2

Ampoule 2 mL

Pad 2.5×7 cm (3 mL)

Spray (mg/mL)

0.12

0.18

0.06

0.16

0.24

0.08

2

Glycyrrhiza glabra

0.18

0.27

0.09

Alpinia officinarum2

0.14

0.21

0.14

Thymus vulgaris3

0.10

0.15

0.10

Vitis vinifera

1Dried root extract, 2dried leaf extract, 3dried grass extract.

178

Turk J Hematol 2013;30:177-183

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

Table 2: Classification of groups.

Group 1

Group 2

Group 3

a

Day 7 experimental group (n=10)

Day 28 experimental group (n=10)

Day 42 experimental group (n=9)

b

Day 7 control group (n=10)

Day 28 control group (n=10)

Day 42 control group

(n=9)

Table 3: Histological scoring of the specimens.

Figure 1. Preparation of bone defect. feature, ABS reportedly accelerates early bone healing and formation [18]. The aim of our study was to investigate the efficiency of the early and long-term bone healing benefits of ABS and its clinical usage on bone surfaces.

Materials and Methods Animal Care and Experimental Procedure The study was accepted by Süleyman Demirel University’s Scientific Research Projects Unit. Süleyman Demirel University’s Animal Tests Local Ethics Council approved the treatment of animals in the study. Surgical procedures were performed at Süleyman Demirel University’s Experimental Animal Production and Experimental Research Laboratory.

A total of 30 adult male Wistar albino rats with an average weight of 340 g were used in the study. The animals were housed in groups of 5 per cage and fed standard pellets and water in a temperature-regulated room (22 °C, 55% humidity, and a 12-h light/dark cycle) without any limitation of mobilization. These rats were randomly divided into 3 groups [group 1 (n=10), group 2 (n=10), group 3 (n=10)] and bilateral bone defects were created in the femur of each rat.

Right femoral defects served as the experimental group, while left femoral defects served as the control group (subgroup a, experimental group; subgroup b, control group) (Table 2).

Surgical Procedure The preoperative weights of all rats were measured, and general anesthesia was achieved by intramuscularly applying 15 mg/kg ketamine HCl (10% Alfamine®) and 60 mg/kg xylazine HCl (Alfazyne®, 2%) to each rat. After achieving an adequate depth of anesthesia, the femoral regions were scrubbed with 10% povidone-iodine solution (İsosol®, Central Lab., İstanbul). An approximately 2-cm longitudinal

1 point

Hematoma

2 points

Hematoma and fibrous tissue

3 points

Hematoma and light woven bone

4 points

Hematoma and dense woven bone

5 points

Woven bone

skin incision was made in the operation area. A full-thickness flap was prepared and the bone surface of the femur was exposed. Under saline solution irrigation, a monocortical circular defect 3.0 mm deep was created with a 3.0-mmdiameter trephine drill on the proximal part of the femur (Figure 1). The experimental group was treated with 0.5 mL of ABS while the control group was left untreated. Muscle and subcutaneous tissues were sutured with a 4/0 absorbable suture (Buril 4/0, AlfaTıp, Bursa), and the skin was sutured with a 3/0 silk suture (Bursilk® USP 3/0, Göksel Med., Bursa).

After surgery, intramuscular amikacin sulfate antibiotics (Amikozit, Eczacıbaşı-Zenitiva®) were administered twice a day for 3 days postoperatively. Group 1, group 2, and group 3 rats were sacrificed on days 7, 28, and 42, respectively.

During the operations, one of the rats (group 3) died due to a complication with the general anesthesia.

Histomorphometric Procedures Histomorphometric examinations were performed at Akdeniz University’s Department of Medical Pathology.

Fifty-eight specimens were evaluated and fixed in a 10% neutral buffered formalin solution for at least 72 h. The specimens were placed into 10% silver nitrate for 24 h. A TBD-2 solution was used for the decalcification process. The specimens were cut transversally into semi-serial sections of 3-4 μm and stained with hematoxylin–eosin (HE) and Van Gieson solution.

The specimens were analyzed using the AxioVision Release 4.7.1 software program. Histomorphometric parameters of medullary bone diameter, trabecular bone area, osteoid area, mineralized bone area, and osteoblast area were measured.

New bone formation was scored according to histologic evaluation (Table 3). Parameters for histomorphometry were derived from the work of Parfitt et al. [19]. Medullary bone diameter and trabecular bone area at 40x (4/0.10 lens, 10/23 ocular) and osteoid area, mineralized bone area, and 179

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

Turk J Hematol 2013;30:177-183

osteoblast area at 400x (40/0.65 lens, 10/23 ocular) were measured (Figures 2 and 3).

Groups 2a and 2b were compared according to medullary bone diameter (p=0.333), trabecular bone area (p=0.333), osteoid area (p=0.575), mineralized bone area (p=0.386), and osteoblast area (p=0.445) (Table 5). Although statistically significant differences (Wilcoxon test) were not obtained, medullar bone diameter, trabecular bone area, and osteoblast area mean values of the experimental group were higher than those of the control group. Osteoid area and mineralized bone area mean values were higher in the control group.

In terms of histological scoring of the new bone tissue in defect areas, values were higher in the control group than in the experimental group and the chi-square test was not statistically significant (p=0.572).

Results Statistical Analysis Statistical analysis was carried out using SPSS 10.0 (SPSS Inc., Chicago, IL, USA). The results are expressed as mean ± standard deviation. The Wilcoxon and chi-square tests were used to compare data between the control and experimental samples. Differences at p≤0.05 were considered significant.

Groups 1 a and 1 b were compared according to medullary bone diameter (p=0.575), trabecular bone area (p=0.646), osteoid area (p=0.508), mineralized bone area (p=0.799), and osteoblast area (p=0.022) (Table 4). Although statistically significant differences (Wilcoxon test) were not obtained (excluded osteoblast area), mean values for the experimental group were higher than those for the control group. In terms of histological scoring of new bone tissue in the defect area, values were higher in the experimental group than in the control group and the chi-square test was statistically significant (p=0.013).

Groups 3a and 3b were compared according to medullary bone diameter (p=0.214), trabecular bone area (p=0.441), osteoid area (p=0.314), mineralized bone area (p=0.314), and osteoblast area (p=0.374) (Table 6). Although statistically significant differences (Wilcoxon test) were not obtained, the medullary were not obtained, the medullar bone diameter and trabecular bone area of the experimental group were higher in mean

Figure 2. Histomorphometric section of group 3b (HE, 100x).

O: osteoid, Ob: osteoblast, Tb: trabecular bone, Me: medullary bone, Md: mineralized bone.

Figure 3. Histomorphometric section of group 3b (HE, 200x).

O: Osteoid, Ob: osteoblast, Tb: trabecular bone, Me: medullary bone, Md: mineralized bone.

Table 4: Statistical analysis of groups 1a and 1b.

Variable

n

Z

p

Tb.Ar

2

μm

10

-.459

.646

Me.Dm

μm

10

-.561

.575

O.Ar

2

μm

10

-.663

.508

Mineralized area

Md.Ar

μm2

10

-.255

.799

Osteoblast area

Ob.Ar

μm2

10

-2.293

.022

Trabecular bone area Medullary bone diameter Osteoid area

P values were calculated by Wilcoxon tests. n=number of specimens.

180

Turk J Hematol 2013;30:177-183

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

Table 5: Statistical analysis of groups 2a and 2b.

Variable Trabecular bone area Medullary bone diameter Osteoid area

n

Z

p

Tb.Ar

μm2

10

-.968

.333

Me.Dm

μm

10

-.968

.333

O.Ar

μm2

10

-.561

.575

2

Mineralized area

Md.Ar

μm

10

-.866

.386

Osteoblast area

Ob.Ar

μm2

10

-.764

.445

P values were calculated by Wilcoxon tests. n=number of specimens.

Table 6: Statistical analysis of groups 3a and 3b.

Variable Trabecular bone area Medullary bone diameter Osteoid area Mineralized area

n

Z

p

Tb.Ar

2

μm

9

-.770

.441

Me.Dm

μm

9

-1.244

.214

O.Ar

μm2

9

-1.007

.314

2

9

-1.007

.314

2

9

-.889

.374

Md.Ar

Osteoblast area

Ob.Ar

μm μm

P values were calculated by Wilcoxon tests. n=number of specimens.

value than in the control group. Osteoblast area, osteoid area, and mineralized bone area mean values were also higher than in the control group. In terms of histological scoring of new bone tissue in defect areas, values were higher in the experimental group than in the control group and the chi-square test was not statistically significant (p=0.368).

Discussion ABS is a plant-based hemostatic agent composed of a standardized mixture of Urtica dioica, Vitis vinifera, Glycyrrhiza glabra, Alpinia officinarum, and Thymus vulgaris. All of these plants are individually effective on the endothelium, blood cells, angiogenesis, cellular proliferation, vascular dynamics, and mediators [7]. The basic mechanism of ABS ensures formation of focal points for erythrocyte aggregation through the formation of an encapsulated protein network. Reportedly, following ABS use, a decrease in plasma fibrinogen activity and a drop in fibrinogen antigen levels were observed and, accordingly, thrombin time was prolonged.

Moreover, the total protein, albumin, and globulin levels in plasma were significantly reduced. Therefore, ABS affects fibrinogen-erythrocyte agglutination, leading to a protein network stimulating erythrocyte aggregation [7].

During study carried out in order to clarify ABS’s mechanism of action on coagulation by functional proteomics analysis, many plant and human proteins have been identified in ABS’s content. Demiralp et al. evaluated the study as enlightening in terms of the investigation of hemostatic, wound healing, and anti-inflammatory effects of ABS [20].

The hemostatic properties of ABS have been demonstrated by studies carried out in dentistry and other fields [8,9,10,11,12,13,14,15,16,17]. Baykul et al. reported at the end of a study performed on 4 patients with von Willebrand disease, chronic liver disease, and mitral valve replacement that ABS was an effective agent in stopping localized bleeding during tooth extraction with diathesis patients [15]. Ercetin et al.’s study on the reliability and qualification of ABS in dental surgery and bleeding showed that ABS can be beneficial for local hemostasis, wound healing, and infection control during periodontal surgery and tooth extraction [16]. Sonmez et al. reported that ABS use gave effective results in the early stage in a patient with type II Glanzmann thrombocytopenia [17].

In addition to its hemostatic agent properties, ABS has been demonstrated to cause rapid healing in bone tissue.

In a study performed with Ankaferd Blood Stopper on 16 Wistar albino male rats, Işler et al. found that at the end of day 7, the presence of new bone formation in the ABS group was significantly higher than that in the control group, and they reported that ABS application had a positive impact on early-stage bone tissue healing [18]. The objective of our study was to experimentally study the early and late-stage effects of ABS on bone surfaces and its reliability for clinical applications. During our investigation, medullar bone diameter and trabecular surface area of the defect region, osteoblast surface area in the defect region, and mineralized bone surface area were histomorphometrically measured.

Moreover, new bone formation and necrosis areas were examined. Foreign body reactions and infection findings were clinically investigated.

181

Turk J Hematol 2013;30:177-183

The absence of any statistically significant difference between medullar bone area measurements in all 3 groups in our study’s findings suggests that section areas measured had similar values, and the study shows the reliability of the agent.

Trabecular bone, which was another parameter of our study, is considered the fundamental structural component of cancellous bone [19]. The amount of trabecular bone provides histological information about new bone formation [21,22,23,24]. A study

by Chiba et al. reported that hematoma started to change to fibrous tissue during a 7-day period and to conjunctive bone on day 10 [23]. Pereira et al. examined the osteoblasts in newly forming trabecular areas observed on the defect site and reported that the osteoblasts had a cubic structure at the end of day 7 and that immature bones formed on day 7 of the study [25]. For the assessment of new bone formation, osteoblast area, osteoid area, and the amount of mineralized bone are taken into consideration as other important parameters. An immature structure was observed in newly forming trabecular bone in the early bone healing stage in our study. High values of osteoblast, osteoid, and mineralized areas in the test group suggest a higher amount of new bone formation. These findings were supported by a high amount of conjunctive bones in the test group on day 7 and the statistically significant nature of these values. These results suggest that ABS may have positive effects on early-stage bone healing.

ABS is thought to create new stimulation in the area to which it is applied. In a previous study, potential transcription factor changes caused by ABS on human umbilical vein endothelial cells were investigated in order to study the effect of ABS on the endothelium. It was confirmed that ABS is extremely effective in stopping bleeding by its accelerated speed of complex formation between the cells, and it was concluded that the bond formed inside the complex is extremely strong. It was stated that at low doses, it is effective both outside and inside the cells, and it can affect many mechanisms inside the cell [26].

In late-stage findings of our study, the control group histomorphometrically showed superiority in osteoblast and osteoid surface areas and accordingly in mineralized surface areas; however, superiority of new bone formation sites could not be shown. Failure of either the study or control group to show superiority can be ascribed to the ongoing normal ossification process. Moreover, the regular increase shown in trabecular bone and mineralized bone surface areas between the groups according to study days 7, 28, and 42 may suggest that ABS has no negative or delaying effects on physiological bone healing. Although ABS has boosting effects on bone healing during the early period, it is possible that these effects are eliminated with time during the normal physiological bone healing process.

Reactions in tissues caused by the substances used to stop bleeding are important for the reliability of the materials used. Absence of any necrosis areas and foreign body reactions in tissues at the end of the administration 182

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

indicates the reliability of the substance. Hemostatic agents administered on ranges of tension come in contact with bone surfaces. In a study by Bilgili et al., high-dosage systemic administration of ABS in an in vivo animal model was shown to not cause mucosal toxicity, hematotoxicity, hepatotoxicity, nephrotoxicity, or biochemical toxicity [27].

In another study in which the in vitro antimicrobial activity of ABS was investigated, clinical isolate obtained by the agar well diffusion technique from 102 patients was examined.

Fifteen different microorganisms were assessed during the study. It was found that all gram-negative and gram-positive microorganisms had zones against ABS with a diameter of 15 mm on average and in the range 10-18 mm, and ABS was reported to be antimicrobially active [28]. Hence, reactions caused by ABS in tissue were also investigated in our study. The findings showed that ABS use did not cause any foreign body reaction, and no necrotic areas were formed.

No swelling, inflammatory reaction, or allergic reactions were observed clinically in the surgery sites. The absence of any foreign body reaction and only one necrotic area are supported by the findings of Işler et al. [18]. No necrotic tissue was observed in bone tissue and defect areas during the histomorphometric examination in our study. These findings support each other.

As a conclusion of this study, ABS applied in bone cavities was found to have an accelerator effect on short-term bone healing, but no effect on long-term bone healing. Even though its superiority in terms of physiological healing during the long-term bone healing process could not be shown, we think that the speeding up of short-term healing is significant in the recovery of function, phonetics, and aesthetics of patients.

In addition, ABS showed positive features in that it did not cause any foreign body reaction or necrotic areas, and no complications during clinical observations before and after surgery were observed. We think that a wide series of research projects are required to confirm the effects of ABS in speeding up the healing process in addition to its characteristics as a blood-stopping agent.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Refrences 1. Israels S, Schwetz N, Boyar R, McNicol A. Bleeding disorders: characterization, dental considerations and management. J Can Dent Assoc 2006;72:827.

2. Peterson LJ, Ellis E, Hupp JR, Tucker MR. Contemporary Oral and Maxillofacial Surgery. 3rd ed. St. Louis: Mosby, 1998.

3. Oz MC, Rondinone JF, Shargill NS. Floseal matrix: new generation topical hemostatic sealant. J Card Surg 2003;18:486-493.

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

4. Sabel M, Stummer W. The use of local agents: Surgicel and surgifoam. Eur Spine J 2004;13:97-101.

5. Seyednejad H, Imami M, Jameieson T, Seifalian AM. Topical haemostatic agents. Brit J Surg 2008;95:11971225.

6. Schonauer C, Tessitore E, Barbagallo G, Albanese V, Moraci A. The use of local agents: bone wax, collagen, oxidized cellulose. Eur Spine J 2004;13:89-96.

7. Goker H, Haznedaroglu IC, Ercetin S, Kirazli S, Akman U, Ozturk Y, Firat HC. Haemostatic actions of the folkloric medicinal plant extract Ankaferd Blood Stopper. J Int Med Res 2008;36:163-170.

8. Haznedaroglu BZ, Beyazit Y, Walker SL, Haznedaroglu IC. Pleiotropic cellular, hemostatic, and biological actions of Ankaferd hemostat. Crit Rev Oncol Hematol 2012;83:21-34.

9. Huri E, Akgül T, Yücel MÖ, Astarçı HM, Üstün H, Germiyanoğlu RC. The second step in vitro trial of Ankaferd Bloodstopper: comparison with the other hemostatic agents. Turk J Med Sci 2011;41:7-15.

10. Kurt M, Akdoğan M, Onal IK, Kekilli M, Arhan M, Shorbagi A, Aksu S, Kurt OK, Haznedaroglu IC. Endoscopic topical application of Ankaferd Blood Stopper for neoplastic gastrointestinal bleeding: a retrospective analysis. Dig Liver Dis 2010;42:196-199.

11. Ulus TA, Turan NN, Ozyalcin S, Aydog G, Ulus F, Göker H, Haznedaroğlu IC. Surgical and histopathological effects of topical Ankaferd hemostat on major arterial vessel injury in relation to the enhanced intra-arterial blood pressure. Turk J Hematol 2011;28:206-212.

12. Teker AM, Korkut AY, Gedikli O, Kahya V. Prospective, randomized, controlled clinical trial of Ankaferd Blood Stopper in patients with acute anterior epistaxis. Eur Arch Otorhinolaryngol 2010;267:1377-1381.

13. Karakaya K, Ucan HB, Tascılar O, Emre AU, Cakmak GK, Irkorucu O, Ankarali H, Comert M. Evaluation of a new hemostatic agent Ankaferd Blood Stopper in experimental liver laceration. J Invest Surg 2009;22:201-206.

14. Koşar A, Cipil HS, Kaya A, Uz B, Haznedaroğlu IC, Goker H, Ozdemir O, Erçetin S, Kirazli S, Firat HC. The efficacy of Ankaferd Blood Stopper in antithrombotic drug-induced primary and secondary hemostatic abnormalities of a rat-bleeding model. Blood Coagul Fibrinolysis 2009;20:185-190.

15. Baykul T, Alanoglu GE, Kocer G. Use of Ankaferd Blood Stopper as a hemostatic agent: a clinical experience. J Contemp Dent Pract 2010;11:1-7.

Turk J Hematol 2013;30:177-183

16. Ercetin S, Haznedaroglu IC, Kurt M, Onal IK, Aktas A, Kurt KO, Goker H, Ozdemir O, Kirazli S, Firat HC. Safety and efficacy of Ankaferd Blood Stopper in dental surgery.

Int J Hematol Oncol 2010;20:1-5.

17. Sonmez M, Baltacioğlu E, Sarac O, Erkut N. The use of Ankaferd Blood Stopper in a patient with Glanzmann’s thrombasthenia with gingival bleeding. Blood Coagul Fibrinolysis 2010;21:382-383.

18. Işler SC, Demircan S, Cakarer S, Cebi Z, Keskin C, Soluk M, Yüzbaşioğlu E. Effects of folk medicinal plant extract Ankaferd Blood Stopper on early bone healing. J Appl Oral Sci 2010;18:409-414.

19. Parfitt AM, Drezner MK, Glorieux FH, Kanis JA, Malluche H, Meunier PJ, Ott SM, Recker RR. Bone histomorphometry: standardization of nomenclature, symbols, and units. J Bone Miner Res 1987;2:595-610.

20. Demiralp DO, Haznedaroglu IC, Akar N. Functional proteomic analysis of Ankaferd Blood Stopper. Turk J Hematol 2010;27:70-77.

21. Uusitalo H, Rantakokka J, Ahonen M, Jamsa T, Tuukkanen J, Kahari VM, Vuorio E, Aro HT. A metaphyseal defect model of the femur for studies of murine bone healing.

Bone 2001;28:423-429.

22. Duarte PM, Marques MR, Bezerra JP, Bastos MF. The effects of caffeine administration on the early healing and bone density. A histometric study in rats. Arch Oral Biol 2009;54:717-722.

23. Chiba S, Okada K, Lee K, Serge GV, Neer RM. Molecular analysis of defect healing in rat diaphyseal bone. J Vet Med Sci 2001;63:603-608.

24. Shearer JR, Roach HI, Parsons SW. Histology of a lengthened human tibia. J Bone Joint Surg 1992;74:39-44.

25. Pereira AC, Fernandes RG, Carvalho YR, Balducci I, Leite HF. Bone healing in drill hole defects in spontaneously hypertensive male and female rats’ femurs. A histological and histometric study. Arq Bras Cardiol 2007;88:93-97.

26. Yılmaz E, Gulec S, Torun D, Haznedaroglu IC, Akar N. The effects of Ankaferd Blood Stopper on transcription factors in HUVEC and the erythrocyte protein profile.

Turk J Hematol 2011;28:276-285.

27. Bilgili H, Captug O, Kosar A, Kurt M, Kekilli M, Shorgabi A, Kar Kurt O, Ozdemir O, Goker H, Haznedaroglu IC. Oral systemic administration of Ankaferd Blood Stopper has no short-term toxicity in an in vivo rabbit experimental model. Clin Appl Thromb Hemost 2010;16:533-536.

28. Fisgin NT, Caycı YT, Coban AY, Ozatli D, Tanyel E, Durupinar B, Tulek N. Antimicrobial activity of plant extract Ankaferd Blood Stopper. Fitoterapia 2009;80:48-50.

183

Research Article

DOI: 10.4274/Tjh.2012.0092

Experimental Investigation of the Effects of a Blood Stopper Agent (Ankaferd Blood Stopper) on Bone Surfaces Kanama Durdurucu Ajanın (Ankaferd Blood Stopper) Kemik Yüzeylerine Etkisinin Deneysel Olarak İncelenmesi Hasan Onur Şimşek1, Mustafa Şenol Tüzüm1, Timuçin Baykul1, İnanç Elif Gürer2, Cumhur İbrahim Başsorgun2 1Süleyman Demirel University Faculty of Dentistry, Department of Oral and Maxillofacial Surgery, Isparta, Turkey 2Akdeniz University Faculty of Medicine, Department of Medical Pathology, Antalya, Turkey

Abstract: Objective: This study aims to experimentally investigate the efficiency of Ankaferd Blood Stopper (ABS) on early and longterm bone healing and its effects on bone surfaces.

Materials and Methods: Thirty adult male Wistar albino rats were used in the study. These rats were randomly divided into three groups, and bilaterally bone defects were created in the femur of each rat. A 3.0-mm-deep monocortical circular defect was created with a 3.0 mm diameter trephine drill on the proximal part of the femur, and 0.05 mL ABS was applied to the experimental group while the control group was left untreated. Group 1, group 2, and group 3 rats were sacrificed on days 7, 28, and 42, respectively. Trabecular bone area (Tb.Ar), medullary bone diameter (Me.Dm), osteoblast area (Ob.Ar), osteoid area (O.Ar) and mineralized bone area (Md.Ar) were examined in the histomorphometric analysis. Also new bone formation was scored according to the histologic evaluation

Results: The results showed that while new the to day 7 experimental group showed much more bone formation than the to day 7 control group, there was no significant difference between the to day 28 and day 42 experimental groups and to day 28 and day 42 control groups. Accordingly, ABS applied in bone cavities only had a larger accelerator effect on bone healing for the seventh-day to day 7 experimental group. In clinical observations, no allergic or inflammatory reactions were observed on the skin and other preoperative and postoperative periods. Moreover in, the histomorphometric study, necrotic areas and infection areas were not observed.

Conclusion: ABS has an acceleratory effect on the short-term bone healing process and is a reliable agent for routine use.

However, its effects on the long-term bone healing process are insignificant. We think that a wide series of research projects are required to confirm the effects of ABS speeding up the healing process in addition to its characteristic as a blood stopping agent.

Key Words: Hemostasis, Ankaferd Blood Stopper, Bone healing, Bone histomorphometry

Address for Correspondence: Hasan Onur ŞİMŞEK, M.D., Süleyman Demirel University Faculty of Dentistry, Department of Oral and Maxillofacial Surgery, Isparta, Turkey Phone: +90 246 211 88 45 E-mail: onursimsek@sdu.edu.tr Received/Geliş tarihi : July 22, 2012 Accepted/Kabul tarihi : November 14, 2012

177

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

Turk J Hematol 2013;30:177-183

Özet: Amaç: Çalışmamızda deneysel olarak Ankaferd Blood Stopper (ABS)’ın erken ve geç dönem kemik iyileşmesi ve kemik yüzeylere etkisinin incelenmesi amaçlanmıştır.

Gereç ve Yöntemler: Çalışmaya 30 yetişkin erkek Wistar albino rat dahil edilmiştir. Denekler rastgele üç grubu ayrılmış ve kemik defektleri her bir femura uygulanmıştır. Kemik defektleri femurun proksimal kısmında 3,0 mm çapında trefin frez yardımıyla 3,0 mm derinliğinde, monokortikal ve dairesel olarak hazırlanmıştır. Deney grubuna 0,5 mL ABS uygulanırken kontrol grubuna herhangi bir madde uygulanmamıştır. Denekler 3 gruba ayrılarak sırasıyla yedinci, yirmi sekizinci ve kırk ikinci günlerde sakrifiye edilmiştir. Örneklerin histomorfometrik analizlerinde trabeküler kemik yüzey alanı, medullar kemik çapı, osteoblast yüzey alanı, osteoid kemik yüzey alanı ve mineralize kemik yüzey alanları incelenmiştir. Yeni kemik oluşumunun histolojik değerlendirmesi yapılarak, yeni kemik oluşum skorlaması yapılmıştır.

Bulgular: Çalışmamız sonucunda ABS kemik kavitelerinde uygulanmasının 7. gün deney grubunda kemik iyileşmesini hızlandırıcı etkileri üzerine daha net bulgulara ulaşılmış ve 7. gün sonuçlarına göre yeni kemik yapımını deney grubunda fazla olarak bulunmuştur. Ankaferd Blood Stopper kemik kavitelerinde uygulanmasının 28. ve 42. gün deney ve kontrol gruplarında benzer sonuçlara ulaşılmıştır. Klinik gözlemlerde intraoperatif ve postoperatif dönemde cilt ve diğer dokularda alerjik ve iltihabi reaksiyonlar gözlenmemiştir. Ayrıca histomorfometrik çalışmalarda nekrotik alanlara ve enfeksiyoz reaksiyonlara rastlanmamıştır.

Sonuç: Sonuç olarak, ABS kısa dönem kemik iyileşmesinde olumlu etkileri olabileceği gösterilirken, uzun dönem de kemik yapımını artırıcı etkileri olduğu gösterilmemiştir. Bununla birlikte ameliyat öncesi ve sonrasında herhangi bir yabancı cisim reaksiyonu veya nekrotik alanlara rastlanılmaması ve komplikasyon oluşturmaması pozitif etkileri olarak değerlendirilebilir.

Ankaferd Blood Stopper’in kanama durdurucu ajan olmasının yanında kemik iyileşmesini hızlandırıcı etkileri, geniş serili araştırmalarla desteklenmesi gerektiğini düşünmekteyiz.

Anahtar Sözcükler: Hemostaz, Ankaferd Blood Stopper, Kemik iyileşmesi, Kemik histomorfometri Introduction All surgical procedures in oral and maxillofacial surgery within the area of operation lead to varying degrees of bleeding.

Providing an effective hemostasis agent during an operation is one of the most basic surgical principles. Bleeding control is vital for pathological hemostasis patient groups. Excessive bleeding in these patients is not only distressing for the patient, but also prevents the completion of procedures. Bleeding in patients can cause excessive blood loss, poor wound healing, or infection [1,2]. In addition to routine hemostatic methods, various local hemostatic agents are widely used for bleeding management [3,4,5,6]. Ankaferd Blood Stopper (ABS), which is manufactured for use in dentistry, is an effective

hemostatic agent. ABS consists of 5 different plant extracts: Urtica dioica, Vitis vinifera, Glycyrrhiza glabra, Alpinia officinarum, and Thymus vulgaris (Table 1). Goker et al. suggested that ABS stimulated the formation of an encapsulated protein network that provides focal points for erythrocyte aggregation [7]. In addition, the combination of these plants in ABS appears to provide a unique composition for tissue oxygenation and the physiological hemostatic process without disturbing the levels of any individual clotting factor [7]. Various experimental and clinical studies have demonstrated the effect of ABS on bleeding control [8,9,10,11,12,13,14].

Many dentistry studies have reported the reliability and availability of ABS [15,16,17]. Besides its bleeding control

Table 1: Ingredients in the ampoule, spray, and pad forms of ABS. Quantity of ingredient

Urtica dioica1 2

Ampoule 2 mL

Pad 2.5×7 cm (3 mL)

Spray (mg/mL)

0.12

0.18

0.06

0.16

0.24

0.08

2

Glycyrrhiza glabra

0.18

0.27

0.09

Alpinia officinarum2

0.14

0.21

0.14

Thymus vulgaris3

0.10

0.15

0.10

Vitis vinifera

1Dried root extract, 2dried leaf extract, 3dried grass extract.

178

Turk J Hematol 2013;30:177-183

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

Table 2: Classification of groups.

Group 1

Group 2

Group 3

a

Day 7 experimental group (n=10)

Day 28 experimental group (n=10)

Day 42 experimental group (n=9)

b

Day 7 control group (n=10)

Day 28 control group (n=10)

Day 42 control group

(n=9)

Table 3: Histological scoring of the specimens.

Figure 1. Preparation of bone defect. feature, ABS reportedly accelerates early bone healing and formation [18]. The aim of our study was to investigate the efficiency of the early and long-term bone healing benefits of ABS and its clinical usage on bone surfaces.

Materials and Methods Animal Care and Experimental Procedure The study was accepted by Süleyman Demirel University’s Scientific Research Projects Unit. Süleyman Demirel University’s Animal Tests Local Ethics Council approved the treatment of animals in the study. Surgical procedures were performed at Süleyman Demirel University’s Experimental Animal Production and Experimental Research Laboratory.

A total of 30 adult male Wistar albino rats with an average weight of 340 g were used in the study. The animals were housed in groups of 5 per cage and fed standard pellets and water in a temperature-regulated room (22 °C, 55% humidity, and a 12-h light/dark cycle) without any limitation of mobilization. These rats were randomly divided into 3 groups [group 1 (n=10), group 2 (n=10), group 3 (n=10)] and bilateral bone defects were created in the femur of each rat.

Right femoral defects served as the experimental group, while left femoral defects served as the control group (subgroup a, experimental group; subgroup b, control group) (Table 2).

Surgical Procedure The preoperative weights of all rats were measured, and general anesthesia was achieved by intramuscularly applying 15 mg/kg ketamine HCl (10% Alfamine®) and 60 mg/kg xylazine HCl (Alfazyne®, 2%) to each rat. After achieving an adequate depth of anesthesia, the femoral regions were scrubbed with 10% povidone-iodine solution (İsosol®, Central Lab., İstanbul). An approximately 2-cm longitudinal

1 point

Hematoma

2 points

Hematoma and fibrous tissue

3 points

Hematoma and light woven bone

4 points

Hematoma and dense woven bone

5 points

Woven bone

skin incision was made in the operation area. A full-thickness flap was prepared and the bone surface of the femur was exposed. Under saline solution irrigation, a monocortical circular defect 3.0 mm deep was created with a 3.0-mmdiameter trephine drill on the proximal part of the femur (Figure 1). The experimental group was treated with 0.5 mL of ABS while the control group was left untreated. Muscle and subcutaneous tissues were sutured with a 4/0 absorbable suture (Buril 4/0, AlfaTıp, Bursa), and the skin was sutured with a 3/0 silk suture (Bursilk® USP 3/0, Göksel Med., Bursa).

After surgery, intramuscular amikacin sulfate antibiotics (Amikozit, Eczacıbaşı-Zenitiva®) were administered twice a day for 3 days postoperatively. Group 1, group 2, and group 3 rats were sacrificed on days 7, 28, and 42, respectively.

During the operations, one of the rats (group 3) died due to a complication with the general anesthesia.

Histomorphometric Procedures Histomorphometric examinations were performed at Akdeniz University’s Department of Medical Pathology.

Fifty-eight specimens were evaluated and fixed in a 10% neutral buffered formalin solution for at least 72 h. The specimens were placed into 10% silver nitrate for 24 h. A TBD-2 solution was used for the decalcification process. The specimens were cut transversally into semi-serial sections of 3-4 μm and stained with hematoxylin–eosin (HE) and Van Gieson solution.

The specimens were analyzed using the AxioVision Release 4.7.1 software program. Histomorphometric parameters of medullary bone diameter, trabecular bone area, osteoid area, mineralized bone area, and osteoblast area were measured.

New bone formation was scored according to histologic evaluation (Table 3). Parameters for histomorphometry were derived from the work of Parfitt et al. [19]. Medullary bone diameter and trabecular bone area at 40x (4/0.10 lens, 10/23 ocular) and osteoid area, mineralized bone area, and 179

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

Turk J Hematol 2013;30:177-183

osteoblast area at 400x (40/0.65 lens, 10/23 ocular) were measured (Figures 2 and 3).

Groups 2a and 2b were compared according to medullary bone diameter (p=0.333), trabecular bone area (p=0.333), osteoid area (p=0.575), mineralized bone area (p=0.386), and osteoblast area (p=0.445) (Table 5). Although statistically significant differences (Wilcoxon test) were not obtained, medullar bone diameter, trabecular bone area, and osteoblast area mean values of the experimental group were higher than those of the control group. Osteoid area and mineralized bone area mean values were higher in the control group.

In terms of histological scoring of the new bone tissue in defect areas, values were higher in the control group than in the experimental group and the chi-square test was not statistically significant (p=0.572).

Results Statistical Analysis Statistical analysis was carried out using SPSS 10.0 (SPSS Inc., Chicago, IL, USA). The results are expressed as mean ± standard deviation. The Wilcoxon and chi-square tests were used to compare data between the control and experimental samples. Differences at p≤0.05 were considered significant.

Groups 1 a and 1 b were compared according to medullary bone diameter (p=0.575), trabecular bone area (p=0.646), osteoid area (p=0.508), mineralized bone area (p=0.799), and osteoblast area (p=0.022) (Table 4). Although statistically significant differences (Wilcoxon test) were not obtained (excluded osteoblast area), mean values for the experimental group were higher than those for the control group. In terms of histological scoring of new bone tissue in the defect area, values were higher in the experimental group than in the control group and the chi-square test was statistically significant (p=0.013).

Groups 3a and 3b were compared according to medullary bone diameter (p=0.214), trabecular bone area (p=0.441), osteoid area (p=0.314), mineralized bone area (p=0.314), and osteoblast area (p=0.374) (Table 6). Although statistically significant differences (Wilcoxon test) were not obtained, the medullary were not obtained, the medullar bone diameter and trabecular bone area of the experimental group were higher in mean

Figure 2. Histomorphometric section of group 3b (HE, 100x).

O: osteoid, Ob: osteoblast, Tb: trabecular bone, Me: medullary bone, Md: mineralized bone.

Figure 3. Histomorphometric section of group 3b (HE, 200x).

O: Osteoid, Ob: osteoblast, Tb: trabecular bone, Me: medullary bone, Md: mineralized bone.

Table 4: Statistical analysis of groups 1a and 1b.

Variable

n

Z

p

Tb.Ar

2

μm

10

-.459

.646

Me.Dm

μm

10

-.561

.575

O.Ar

2

μm

10

-.663

.508

Mineralized area

Md.Ar

μm2

10

-.255

.799

Osteoblast area

Ob.Ar

μm2

10

-2.293

.022

Trabecular bone area Medullary bone diameter Osteoid area

P values were calculated by Wilcoxon tests. n=number of specimens.

180

Turk J Hematol 2013;30:177-183

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

Table 5: Statistical analysis of groups 2a and 2b.

Variable Trabecular bone area Medullary bone diameter Osteoid area

n

Z

p

Tb.Ar

μm2

10

-.968

.333

Me.Dm

μm

10

-.968

.333

O.Ar

μm2

10

-.561

.575

2

Mineralized area

Md.Ar

μm

10

-.866

.386

Osteoblast area

Ob.Ar

μm2

10

-.764

.445

P values were calculated by Wilcoxon tests. n=number of specimens.

Table 6: Statistical analysis of groups 3a and 3b.

Variable Trabecular bone area Medullary bone diameter Osteoid area Mineralized area

n

Z

p

Tb.Ar

2

μm

9

-.770

.441

Me.Dm

μm

9

-1.244

.214

O.Ar

μm2

9

-1.007

.314

2

9

-1.007

.314

2

9

-.889

.374

Md.Ar

Osteoblast area

Ob.Ar

μm μm

P values were calculated by Wilcoxon tests. n=number of specimens.

value than in the control group. Osteoblast area, osteoid area, and mineralized bone area mean values were also higher than in the control group. In terms of histological scoring of new bone tissue in defect areas, values were higher in the experimental group than in the control group and the chi-square test was not statistically significant (p=0.368).

Discussion ABS is a plant-based hemostatic agent composed of a standardized mixture of Urtica dioica, Vitis vinifera, Glycyrrhiza glabra, Alpinia officinarum, and Thymus vulgaris. All of these plants are individually effective on the endothelium, blood cells, angiogenesis, cellular proliferation, vascular dynamics, and mediators [7]. The basic mechanism of ABS ensures formation of focal points for erythrocyte aggregation through the formation of an encapsulated protein network. Reportedly, following ABS use, a decrease in plasma fibrinogen activity and a drop in fibrinogen antigen levels were observed and, accordingly, thrombin time was prolonged.

Moreover, the total protein, albumin, and globulin levels in plasma were significantly reduced. Therefore, ABS affects fibrinogen-erythrocyte agglutination, leading to a protein network stimulating erythrocyte aggregation [7].

During study carried out in order to clarify ABS’s mechanism of action on coagulation by functional proteomics analysis, many plant and human proteins have been identified in ABS’s content. Demiralp et al. evaluated the study as enlightening in terms of the investigation of hemostatic, wound healing, and anti-inflammatory effects of ABS [20].

The hemostatic properties of ABS have been demonstrated by studies carried out in dentistry and other fields [8,9,10,11,12,13,14,15,16,17]. Baykul et al. reported at the end of a study performed on 4 patients with von Willebrand disease, chronic liver disease, and mitral valve replacement that ABS was an effective agent in stopping localized bleeding during tooth extraction with diathesis patients [15]. Ercetin et al.’s study on the reliability and qualification of ABS in dental surgery and bleeding showed that ABS can be beneficial for local hemostasis, wound healing, and infection control during periodontal surgery and tooth extraction [16]. Sonmez et al. reported that ABS use gave effective results in the early stage in a patient with type II Glanzmann thrombocytopenia [17].

In addition to its hemostatic agent properties, ABS has been demonstrated to cause rapid healing in bone tissue.

In a study performed with Ankaferd Blood Stopper on 16 Wistar albino male rats, Işler et al. found that at the end of day 7, the presence of new bone formation in the ABS group was significantly higher than that in the control group, and they reported that ABS application had a positive impact on early-stage bone tissue healing [18]. The objective of our study was to experimentally study the early and late-stage effects of ABS on bone surfaces and its reliability for clinical applications. During our investigation, medullar bone diameter and trabecular surface area of the defect region, osteoblast surface area in the defect region, and mineralized bone surface area were histomorphometrically measured.

Moreover, new bone formation and necrosis areas were examined. Foreign body reactions and infection findings were clinically investigated.

181

Turk J Hematol 2013;30:177-183

The absence of any statistically significant difference between medullar bone area measurements in all 3 groups in our study’s findings suggests that section areas measured had similar values, and the study shows the reliability of the agent.

Trabecular bone, which was another parameter of our study, is considered the fundamental structural component of cancellous bone [19]. The amount of trabecular bone provides histological information about new bone formation [21,22,23,24]. A study

by Chiba et al. reported that hematoma started to change to fibrous tissue during a 7-day period and to conjunctive bone on day 10 [23]. Pereira et al. examined the osteoblasts in newly forming trabecular areas observed on the defect site and reported that the osteoblasts had a cubic structure at the end of day 7 and that immature bones formed on day 7 of the study [25]. For the assessment of new bone formation, osteoblast area, osteoid area, and the amount of mineralized bone are taken into consideration as other important parameters. An immature structure was observed in newly forming trabecular bone in the early bone healing stage in our study. High values of osteoblast, osteoid, and mineralized areas in the test group suggest a higher amount of new bone formation. These findings were supported by a high amount of conjunctive bones in the test group on day 7 and the statistically significant nature of these values. These results suggest that ABS may have positive effects on early-stage bone healing.

ABS is thought to create new stimulation in the area to which it is applied. In a previous study, potential transcription factor changes caused by ABS on human umbilical vein endothelial cells were investigated in order to study the effect of ABS on the endothelium. It was confirmed that ABS is extremely effective in stopping bleeding by its accelerated speed of complex formation between the cells, and it was concluded that the bond formed inside the complex is extremely strong. It was stated that at low doses, it is effective both outside and inside the cells, and it can affect many mechanisms inside the cell [26].

In late-stage findings of our study, the control group histomorphometrically showed superiority in osteoblast and osteoid surface areas and accordingly in mineralized surface areas; however, superiority of new bone formation sites could not be shown. Failure of either the study or control group to show superiority can be ascribed to the ongoing normal ossification process. Moreover, the regular increase shown in trabecular bone and mineralized bone surface areas between the groups according to study days 7, 28, and 42 may suggest that ABS has no negative or delaying effects on physiological bone healing. Although ABS has boosting effects on bone healing during the early period, it is possible that these effects are eliminated with time during the normal physiological bone healing process.

Reactions in tissues caused by the substances used to stop bleeding are important for the reliability of the materials used. Absence of any necrosis areas and foreign body reactions in tissues at the end of the administration 182

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

indicates the reliability of the substance. Hemostatic agents administered on ranges of tension come in contact with bone surfaces. In a study by Bilgili et al., high-dosage systemic administration of ABS in an in vivo animal model was shown to not cause mucosal toxicity, hematotoxicity, hepatotoxicity, nephrotoxicity, or biochemical toxicity [27].

In another study in which the in vitro antimicrobial activity of ABS was investigated, clinical isolate obtained by the agar well diffusion technique from 102 patients was examined.

Fifteen different microorganisms were assessed during the study. It was found that all gram-negative and gram-positive microorganisms had zones against ABS with a diameter of 15 mm on average and in the range 10-18 mm, and ABS was reported to be antimicrobially active [28]. Hence, reactions caused by ABS in tissue were also investigated in our study. The findings showed that ABS use did not cause any foreign body reaction, and no necrotic areas were formed.

No swelling, inflammatory reaction, or allergic reactions were observed clinically in the surgery sites. The absence of any foreign body reaction and only one necrotic area are supported by the findings of Işler et al. [18]. No necrotic tissue was observed in bone tissue and defect areas during the histomorphometric examination in our study. These findings support each other.

As a conclusion of this study, ABS applied in bone cavities was found to have an accelerator effect on short-term bone healing, but no effect on long-term bone healing. Even though its superiority in terms of physiological healing during the long-term bone healing process could not be shown, we think that the speeding up of short-term healing is significant in the recovery of function, phonetics, and aesthetics of patients.

In addition, ABS showed positive features in that it did not cause any foreign body reaction or necrotic areas, and no complications during clinical observations before and after surgery were observed. We think that a wide series of research projects are required to confirm the effects of ABS in speeding up the healing process in addition to its characteristics as a blood-stopping agent.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Refrences 1. Israels S, Schwetz N, Boyar R, McNicol A. Bleeding disorders: characterization, dental considerations and management. J Can Dent Assoc 2006;72:827.

2. Peterson LJ, Ellis E, Hupp JR, Tucker MR. Contemporary Oral and Maxillofacial Surgery. 3rd ed. St. Louis: Mosby, 1998.

3. Oz MC, Rondinone JF, Shargill NS. Floseal matrix: new generation topical hemostatic sealant. J Card Surg 2003;18:486-493.

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

4. Sabel M, Stummer W. The use of local agents: Surgicel and surgifoam. Eur Spine J 2004;13:97-101.

5. Seyednejad H, Imami M, Jameieson T, Seifalian AM. Topical haemostatic agents. Brit J Surg 2008;95:11971225.

6. Schonauer C, Tessitore E, Barbagallo G, Albanese V, Moraci A. The use of local agents: bone wax, collagen, oxidized cellulose. Eur Spine J 2004;13:89-96.

7. Goker H, Haznedaroglu IC, Ercetin S, Kirazli S, Akman U, Ozturk Y, Firat HC. Haemostatic actions of the folkloric medicinal plant extract Ankaferd Blood Stopper. J Int Med Res 2008;36:163-170.

8. Haznedaroglu BZ, Beyazit Y, Walker SL, Haznedaroglu IC. Pleiotropic cellular, hemostatic, and biological actions of Ankaferd hemostat. Crit Rev Oncol Hematol 2012;83:21-34.

9. Huri E, Akgül T, Yücel MÖ, Astarçı HM, Üstün H, Germiyanoğlu RC. The second step in vitro trial of Ankaferd Bloodstopper: comparison with the other hemostatic agents. Turk J Med Sci 2011;41:7-15.

10. Kurt M, Akdoğan M, Onal IK, Kekilli M, Arhan M, Shorbagi A, Aksu S, Kurt OK, Haznedaroglu IC. Endoscopic topical application of Ankaferd Blood Stopper for neoplastic gastrointestinal bleeding: a retrospective analysis. Dig Liver Dis 2010;42:196-199.

11. Ulus TA, Turan NN, Ozyalcin S, Aydog G, Ulus F, Göker H, Haznedaroğlu IC. Surgical and histopathological effects of topical Ankaferd hemostat on major arterial vessel injury in relation to the enhanced intra-arterial blood pressure. Turk J Hematol 2011;28:206-212.

12. Teker AM, Korkut AY, Gedikli O, Kahya V. Prospective, randomized, controlled clinical trial of Ankaferd Blood Stopper in patients with acute anterior epistaxis. Eur Arch Otorhinolaryngol 2010;267:1377-1381.

13. Karakaya K, Ucan HB, Tascılar O, Emre AU, Cakmak GK, Irkorucu O, Ankarali H, Comert M. Evaluation of a new hemostatic agent Ankaferd Blood Stopper in experimental liver laceration. J Invest Surg 2009;22:201-206.

14. Koşar A, Cipil HS, Kaya A, Uz B, Haznedaroğlu IC, Goker H, Ozdemir O, Erçetin S, Kirazli S, Firat HC. The efficacy of Ankaferd Blood Stopper in antithrombotic drug-induced primary and secondary hemostatic abnormalities of a rat-bleeding model. Blood Coagul Fibrinolysis 2009;20:185-190.

15. Baykul T, Alanoglu GE, Kocer G. Use of Ankaferd Blood Stopper as a hemostatic agent: a clinical experience. J Contemp Dent Pract 2010;11:1-7.

Turk J Hematol 2013;30:177-183

16. Ercetin S, Haznedaroglu IC, Kurt M, Onal IK, Aktas A, Kurt KO, Goker H, Ozdemir O, Kirazli S, Firat HC. Safety and efficacy of Ankaferd Blood Stopper in dental surgery.

Int J Hematol Oncol 2010;20:1-5.

17. Sonmez M, Baltacioğlu E, Sarac O, Erkut N. The use of Ankaferd Blood Stopper in a patient with Glanzmann’s thrombasthenia with gingival bleeding. Blood Coagul Fibrinolysis 2010;21:382-383.

18. Işler SC, Demircan S, Cakarer S, Cebi Z, Keskin C, Soluk M, Yüzbaşioğlu E. Effects of folk medicinal plant extract Ankaferd Blood Stopper on early bone healing. J Appl Oral Sci 2010;18:409-414.

19. Parfitt AM, Drezner MK, Glorieux FH, Kanis JA, Malluche H, Meunier PJ, Ott SM, Recker RR. Bone histomorphometry: standardization of nomenclature, symbols, and units. J Bone Miner Res 1987;2:595-610.

20. Demiralp DO, Haznedaroglu IC, Akar N. Functional proteomic analysis of Ankaferd Blood Stopper. Turk J Hematol 2010;27:70-77.

21. Uusitalo H, Rantakokka J, Ahonen M, Jamsa T, Tuukkanen J, Kahari VM, Vuorio E, Aro HT. A metaphyseal defect model of the femur for studies of murine bone healing.

Bone 2001;28:423-429.

22. Duarte PM, Marques MR, Bezerra JP, Bastos MF. The effects of caffeine administration on the early healing and bone density. A histometric study in rats. Arch Oral Biol 2009;54:717-722.

23. Chiba S, Okada K, Lee K, Serge GV, Neer RM. Molecular analysis of defect healing in rat diaphyseal bone. J Vet Med Sci 2001;63:603-608.

24. Shearer JR, Roach HI, Parsons SW. Histology of a lengthened human tibia. J Bone Joint Surg 1992;74:39-44.

25. Pereira AC, Fernandes RG, Carvalho YR, Balducci I, Leite HF. Bone healing in drill hole defects in spontaneously hypertensive male and female rats’ femurs. A histological and histometric study. Arq Bras Cardiol 2007;88:93-97.

26. Yılmaz E, Gulec S, Torun D, Haznedaroglu IC, Akar N. The effects of Ankaferd Blood Stopper on transcription factors in HUVEC and the erythrocyte protein profile.

Turk J Hematol 2011;28:276-285.

27. Bilgili H, Captug O, Kosar A, Kurt M, Kekilli M, Shorgabi A, Kar Kurt O, Ozdemir O, Goker H, Haznedaroglu IC. Oral systemic administration of Ankaferd Blood Stopper has no short-term toxicity in an in vivo rabbit experimental model. Clin Appl Thromb Hemost 2010;16:533-536.

28. Fisgin NT, Caycı YT, Coban AY, Ozatli D, Tanyel E, Durupinar B, Tulek N. Antimicrobial activity of plant extract Ankaferd Blood Stopper. Fitoterapia 2009;80:48-50.

183

Research Article

DOI: 10.4274/Tjh.2012.0092

Experimental Investigation of the Effects of a Blood Stopper Agent (Ankaferd Blood Stopper) on Bone Surfaces Kanama Durdurucu Ajanın (Ankaferd Blood Stopper) Kemik Yüzeylerine Etkisinin Deneysel Olarak İncelenmesi Hasan Onur Şimşek1, Mustafa Şenol Tüzüm1, Timuçin Baykul1, İnanç Elif Gürer2, Cumhur İbrahim Başsorgun2 1Süleyman Demirel University Faculty of Dentistry, Department of Oral and Maxillofacial Surgery, Isparta, Turkey 2Akdeniz University Faculty of Medicine, Department of Medical Pathology, Antalya, Turkey

Abstract: Objective: This study aims to experimentally investigate the efficiency of Ankaferd Blood Stopper (ABS) on early and longterm bone healing and its effects on bone surfaces.

Materials and Methods: Thirty adult male Wistar albino rats were used in the study. These rats were randomly divided into three groups, and bilaterally bone defects were created in the femur of each rat. A 3.0-mm-deep monocortical circular defect was created with a 3.0 mm diameter trephine drill on the proximal part of the femur, and 0.05 mL ABS was applied to the experimental group while the control group was left untreated. Group 1, group 2, and group 3 rats were sacrificed on days 7, 28, and 42, respectively. Trabecular bone area (Tb.Ar), medullary bone diameter (Me.Dm), osteoblast area (Ob.Ar), osteoid area (O.Ar) and mineralized bone area (Md.Ar) were examined in the histomorphometric analysis. Also new bone formation was scored according to the histologic evaluation

Results: The results showed that while new the to day 7 experimental group showed much more bone formation than the to day 7 control group, there was no significant difference between the to day 28 and day 42 experimental groups and to day 28 and day 42 control groups. Accordingly, ABS applied in bone cavities only had a larger accelerator effect on bone healing for the seventh-day to day 7 experimental group. In clinical observations, no allergic or inflammatory reactions were observed on the skin and other preoperative and postoperative periods. Moreover in, the histomorphometric study, necrotic areas and infection areas were not observed.

Conclusion: ABS has an acceleratory effect on the short-term bone healing process and is a reliable agent for routine use.

However, its effects on the long-term bone healing process are insignificant. We think that a wide series of research projects are required to confirm the effects of ABS speeding up the healing process in addition to its characteristic as a blood stopping agent.

Key Words: Hemostasis, Ankaferd Blood Stopper, Bone healing, Bone histomorphometry

Address for Correspondence: Hasan Onur ŞİMŞEK, M.D., Süleyman Demirel University Faculty of Dentistry, Department of Oral and Maxillofacial Surgery, Isparta, Turkey Phone: +90 246 211 88 45 E-mail: onursimsek@sdu.edu.tr Received/Geliş tarihi : July 22, 2012 Accepted/Kabul tarihi : November 14, 2012

177

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

Turk J Hematol 2013;30:177-183

Özet: Amaç: Çalışmamızda deneysel olarak Ankaferd Blood Stopper (ABS)’ın erken ve geç dönem kemik iyileşmesi ve kemik yüzeylere etkisinin incelenmesi amaçlanmıştır.

Gereç ve Yöntemler: Çalışmaya 30 yetişkin erkek Wistar albino rat dahil edilmiştir. Denekler rastgele üç grubu ayrılmış ve kemik defektleri her bir femura uygulanmıştır. Kemik defektleri femurun proksimal kısmında 3,0 mm çapında trefin frez yardımıyla 3,0 mm derinliğinde, monokortikal ve dairesel olarak hazırlanmıştır. Deney grubuna 0,5 mL ABS uygulanırken kontrol grubuna herhangi bir madde uygulanmamıştır. Denekler 3 gruba ayrılarak sırasıyla yedinci, yirmi sekizinci ve kırk ikinci günlerde sakrifiye edilmiştir. Örneklerin histomorfometrik analizlerinde trabeküler kemik yüzey alanı, medullar kemik çapı, osteoblast yüzey alanı, osteoid kemik yüzey alanı ve mineralize kemik yüzey alanları incelenmiştir. Yeni kemik oluşumunun histolojik değerlendirmesi yapılarak, yeni kemik oluşum skorlaması yapılmıştır.

Bulgular: Çalışmamız sonucunda ABS kemik kavitelerinde uygulanmasının 7. gün deney grubunda kemik iyileşmesini hızlandırıcı etkileri üzerine daha net bulgulara ulaşılmış ve 7. gün sonuçlarına göre yeni kemik yapımını deney grubunda fazla olarak bulunmuştur. Ankaferd Blood Stopper kemik kavitelerinde uygulanmasının 28. ve 42. gün deney ve kontrol gruplarında benzer sonuçlara ulaşılmıştır. Klinik gözlemlerde intraoperatif ve postoperatif dönemde cilt ve diğer dokularda alerjik ve iltihabi reaksiyonlar gözlenmemiştir. Ayrıca histomorfometrik çalışmalarda nekrotik alanlara ve enfeksiyoz reaksiyonlara rastlanmamıştır.

Sonuç: Sonuç olarak, ABS kısa dönem kemik iyileşmesinde olumlu etkileri olabileceği gösterilirken, uzun dönem de kemik yapımını artırıcı etkileri olduğu gösterilmemiştir. Bununla birlikte ameliyat öncesi ve sonrasında herhangi bir yabancı cisim reaksiyonu veya nekrotik alanlara rastlanılmaması ve komplikasyon oluşturmaması pozitif etkileri olarak değerlendirilebilir.

Ankaferd Blood Stopper’in kanama durdurucu ajan olmasının yanında kemik iyileşmesini hızlandırıcı etkileri, geniş serili araştırmalarla desteklenmesi gerektiğini düşünmekteyiz.

Anahtar Sözcükler: Hemostaz, Ankaferd Blood Stopper, Kemik iyileşmesi, Kemik histomorfometri Introduction All surgical procedures in oral and maxillofacial surgery within the area of operation lead to varying degrees of bleeding.

Providing an effective hemostasis agent during an operation is one of the most basic surgical principles. Bleeding control is vital for pathological hemostasis patient groups. Excessive bleeding in these patients is not only distressing for the patient, but also prevents the completion of procedures. Bleeding in patients can cause excessive blood loss, poor wound healing, or infection [1,2]. In addition to routine hemostatic methods, various local hemostatic agents are widely used for bleeding management [3,4,5,6]. Ankaferd Blood Stopper (ABS), which is manufactured for use in dentistry, is an effective

hemostatic agent. ABS consists of 5 different plant extracts: Urtica dioica, Vitis vinifera, Glycyrrhiza glabra, Alpinia officinarum, and Thymus vulgaris (Table 1). Goker et al. suggested that ABS stimulated the formation of an encapsulated protein network that provides focal points for erythrocyte aggregation [7]. In addition, the combination of these plants in ABS appears to provide a unique composition for tissue oxygenation and the physiological hemostatic process without disturbing the levels of any individual clotting factor [7]. Various experimental and clinical studies have demonstrated the effect of ABS on bleeding control [8,9,10,11,12,13,14].

Many dentistry studies have reported the reliability and availability of ABS [15,16,17]. Besides its bleeding control

Table 1: Ingredients in the ampoule, spray, and pad forms of ABS. Quantity of ingredient

Urtica dioica1 2

Ampoule 2 mL

Pad 2.5×7 cm (3 mL)

Spray (mg/mL)

0.12

0.18

0.06

0.16

0.24

0.08

2

Glycyrrhiza glabra

0.18

0.27

0.09

Alpinia officinarum2

0.14

0.21

0.14

Thymus vulgaris3

0.10

0.15

0.10

Vitis vinifera

1Dried root extract, 2dried leaf extract, 3dried grass extract.

178

Turk J Hematol 2013;30:177-183

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

Table 2: Classification of groups.

Group 1

Group 2

Group 3

a

Day 7 experimental group (n=10)

Day 28 experimental group (n=10)

Day 42 experimental group (n=9)

b

Day 7 control group (n=10)

Day 28 control group (n=10)

Day 42 control group

(n=9)

Table 3: Histological scoring of the specimens.

Figure 1. Preparation of bone defect. feature, ABS reportedly accelerates early bone healing and formation [18]. The aim of our study was to investigate the efficiency of the early and long-term bone healing benefits of ABS and its clinical usage on bone surfaces.

Materials and Methods Animal Care and Experimental Procedure The study was accepted by Süleyman Demirel University’s Scientific Research Projects Unit. Süleyman Demirel University’s Animal Tests Local Ethics Council approved the treatment of animals in the study. Surgical procedures were performed at Süleyman Demirel University’s Experimental Animal Production and Experimental Research Laboratory.

A total of 30 adult male Wistar albino rats with an average weight of 340 g were used in the study. The animals were housed in groups of 5 per cage and fed standard pellets and water in a temperature-regulated room (22 °C, 55% humidity, and a 12-h light/dark cycle) without any limitation of mobilization. These rats were randomly divided into 3 groups [group 1 (n=10), group 2 (n=10), group 3 (n=10)] and bilateral bone defects were created in the femur of each rat.

Right femoral defects served as the experimental group, while left femoral defects served as the control group (subgroup a, experimental group; subgroup b, control group) (Table 2).

Surgical Procedure The preoperative weights of all rats were measured, and general anesthesia was achieved by intramuscularly applying 15 mg/kg ketamine HCl (10% Alfamine®) and 60 mg/kg xylazine HCl (Alfazyne®, 2%) to each rat. After achieving an adequate depth of anesthesia, the femoral regions were scrubbed with 10% povidone-iodine solution (İsosol®, Central Lab., İstanbul). An approximately 2-cm longitudinal

1 point

Hematoma

2 points

Hematoma and fibrous tissue

3 points

Hematoma and light woven bone

4 points

Hematoma and dense woven bone

5 points

Woven bone

skin incision was made in the operation area. A full-thickness flap was prepared and the bone surface of the femur was exposed. Under saline solution irrigation, a monocortical circular defect 3.0 mm deep was created with a 3.0-mmdiameter trephine drill on the proximal part of the femur (Figure 1). The experimental group was treated with 0.5 mL of ABS while the control group was left untreated. Muscle and subcutaneous tissues were sutured with a 4/0 absorbable suture (Buril 4/0, AlfaTıp, Bursa), and the skin was sutured with a 3/0 silk suture (Bursilk® USP 3/0, Göksel Med., Bursa).

After surgery, intramuscular amikacin sulfate antibiotics (Amikozit, Eczacıbaşı-Zenitiva®) were administered twice a day for 3 days postoperatively. Group 1, group 2, and group 3 rats were sacrificed on days 7, 28, and 42, respectively.

During the operations, one of the rats (group 3) died due to a complication with the general anesthesia.

Histomorphometric Procedures Histomorphometric examinations were performed at Akdeniz University’s Department of Medical Pathology.

Fifty-eight specimens were evaluated and fixed in a 10% neutral buffered formalin solution for at least 72 h. The specimens were placed into 10% silver nitrate for 24 h. A TBD-2 solution was used for the decalcification process. The specimens were cut transversally into semi-serial sections of 3-4 μm and stained with hematoxylin–eosin (HE) and Van Gieson solution.

The specimens were analyzed using the AxioVision Release 4.7.1 software program. Histomorphometric parameters of medullary bone diameter, trabecular bone area, osteoid area, mineralized bone area, and osteoblast area were measured.

New bone formation was scored according to histologic evaluation (Table 3). Parameters for histomorphometry were derived from the work of Parfitt et al. [19]. Medullary bone diameter and trabecular bone area at 40x (4/0.10 lens, 10/23 ocular) and osteoid area, mineralized bone area, and 179

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

Turk J Hematol 2013;30:177-183

osteoblast area at 400x (40/0.65 lens, 10/23 ocular) were measured (Figures 2 and 3).

Groups 2a and 2b were compared according to medullary bone diameter (p=0.333), trabecular bone area (p=0.333), osteoid area (p=0.575), mineralized bone area (p=0.386), and osteoblast area (p=0.445) (Table 5). Although statistically significant differences (Wilcoxon test) were not obtained, medullar bone diameter, trabecular bone area, and osteoblast area mean values of the experimental group were higher than those of the control group. Osteoid area and mineralized bone area mean values were higher in the control group.

In terms of histological scoring of the new bone tissue in defect areas, values were higher in the control group than in the experimental group and the chi-square test was not statistically significant (p=0.572).

Results Statistical Analysis Statistical analysis was carried out using SPSS 10.0 (SPSS Inc., Chicago, IL, USA). The results are expressed as mean ± standard deviation. The Wilcoxon and chi-square tests were used to compare data between the control and experimental samples. Differences at p≤0.05 were considered significant.

Groups 1 a and 1 b were compared according to medullary bone diameter (p=0.575), trabecular bone area (p=0.646), osteoid area (p=0.508), mineralized bone area (p=0.799), and osteoblast area (p=0.022) (Table 4). Although statistically significant differences (Wilcoxon test) were not obtained (excluded osteoblast area), mean values for the experimental group were higher than those for the control group. In terms of histological scoring of new bone tissue in the defect area, values were higher in the experimental group than in the control group and the chi-square test was statistically significant (p=0.013).

Groups 3a and 3b were compared according to medullary bone diameter (p=0.214), trabecular bone area (p=0.441), osteoid area (p=0.314), mineralized bone area (p=0.314), and osteoblast area (p=0.374) (Table 6). Although statistically significant differences (Wilcoxon test) were not obtained, the medullary were not obtained, the medullar bone diameter and trabecular bone area of the experimental group were higher in mean

Figure 2. Histomorphometric section of group 3b (HE, 100x).

O: osteoid, Ob: osteoblast, Tb: trabecular bone, Me: medullary bone, Md: mineralized bone.

Figure 3. Histomorphometric section of group 3b (HE, 200x).

O: Osteoid, Ob: osteoblast, Tb: trabecular bone, Me: medullary bone, Md: mineralized bone.

Table 4: Statistical analysis of groups 1a and 1b.

Variable

n

Z

p

Tb.Ar

2

μm

10

-.459

.646

Me.Dm

μm

10

-.561

.575

O.Ar

2

μm

10

-.663

.508

Mineralized area

Md.Ar

μm2

10

-.255

.799

Osteoblast area

Ob.Ar

μm2

10

-2.293

.022

Trabecular bone area Medullary bone diameter Osteoid area

P values were calculated by Wilcoxon tests. n=number of specimens.

180

Turk J Hematol 2013;30:177-183

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

Table 5: Statistical analysis of groups 2a and 2b.

Variable Trabecular bone area Medullary bone diameter Osteoid area

n

Z

p

Tb.Ar

μm2

10

-.968

.333

Me.Dm

μm

10

-.968

.333

O.Ar

μm2

10

-.561

.575

2

Mineralized area

Md.Ar

μm

10

-.866

.386

Osteoblast area

Ob.Ar

μm2

10

-.764

.445

P values were calculated by Wilcoxon tests. n=number of specimens.

Table 6: Statistical analysis of groups 3a and 3b.

Variable Trabecular bone area Medullary bone diameter Osteoid area Mineralized area

n

Z

p

Tb.Ar

2

μm

9

-.770

.441

Me.Dm

μm

9

-1.244

.214

O.Ar

μm2

9

-1.007

.314

2

9

-1.007

.314

2

9

-.889

.374

Md.Ar

Osteoblast area

Ob.Ar

μm μm

P values were calculated by Wilcoxon tests. n=number of specimens.

value than in the control group. Osteoblast area, osteoid area, and mineralized bone area mean values were also higher than in the control group. In terms of histological scoring of new bone tissue in defect areas, values were higher in the experimental group than in the control group and the chi-square test was not statistically significant (p=0.368).

Discussion ABS is a plant-based hemostatic agent composed of a standardized mixture of Urtica dioica, Vitis vinifera, Glycyrrhiza glabra, Alpinia officinarum, and Thymus vulgaris. All of these plants are individually effective on the endothelium, blood cells, angiogenesis, cellular proliferation, vascular dynamics, and mediators [7]. The basic mechanism of ABS ensures formation of focal points for erythrocyte aggregation through the formation of an encapsulated protein network. Reportedly, following ABS use, a decrease in plasma fibrinogen activity and a drop in fibrinogen antigen levels were observed and, accordingly, thrombin time was prolonged.

Moreover, the total protein, albumin, and globulin levels in plasma were significantly reduced. Therefore, ABS affects fibrinogen-erythrocyte agglutination, leading to a protein network stimulating erythrocyte aggregation [7].

During study carried out in order to clarify ABS’s mechanism of action on coagulation by functional proteomics analysis, many plant and human proteins have been identified in ABS’s content. Demiralp et al. evaluated the study as enlightening in terms of the investigation of hemostatic, wound healing, and anti-inflammatory effects of ABS [20].

The hemostatic properties of ABS have been demonstrated by studies carried out in dentistry and other fields [8,9,10,11,12,13,14,15,16,17]. Baykul et al. reported at the end of a study performed on 4 patients with von Willebrand disease, chronic liver disease, and mitral valve replacement that ABS was an effective agent in stopping localized bleeding during tooth extraction with diathesis patients [15]. Ercetin et al.’s study on the reliability and qualification of ABS in dental surgery and bleeding showed that ABS can be beneficial for local hemostasis, wound healing, and infection control during periodontal surgery and tooth extraction [16]. Sonmez et al. reported that ABS use gave effective results in the early stage in a patient with type II Glanzmann thrombocytopenia [17].

In addition to its hemostatic agent properties, ABS has been demonstrated to cause rapid healing in bone tissue.

In a study performed with Ankaferd Blood Stopper on 16 Wistar albino male rats, Işler et al. found that at the end of day 7, the presence of new bone formation in the ABS group was significantly higher than that in the control group, and they reported that ABS application had a positive impact on early-stage bone tissue healing [18]. The objective of our study was to experimentally study the early and late-stage effects of ABS on bone surfaces and its reliability for clinical applications. During our investigation, medullar bone diameter and trabecular surface area of the defect region, osteoblast surface area in the defect region, and mineralized bone surface area were histomorphometrically measured.

Moreover, new bone formation and necrosis areas were examined. Foreign body reactions and infection findings were clinically investigated.

181

Turk J Hematol 2013;30:177-183

The absence of any statistically significant difference between medullar bone area measurements in all 3 groups in our study’s findings suggests that section areas measured had similar values, and the study shows the reliability of the agent.

Trabecular bone, which was another parameter of our study, is considered the fundamental structural component of cancellous bone [19]. The amount of trabecular bone provides histological information about new bone formation [21,22,23,24]. A study

by Chiba et al. reported that hematoma started to change to fibrous tissue during a 7-day period and to conjunctive bone on day 10 [23]. Pereira et al. examined the osteoblasts in newly forming trabecular areas observed on the defect site and reported that the osteoblasts had a cubic structure at the end of day 7 and that immature bones formed on day 7 of the study [25]. For the assessment of new bone formation, osteoblast area, osteoid area, and the amount of mineralized bone are taken into consideration as other important parameters. An immature structure was observed in newly forming trabecular bone in the early bone healing stage in our study. High values of osteoblast, osteoid, and mineralized areas in the test group suggest a higher amount of new bone formation. These findings were supported by a high amount of conjunctive bones in the test group on day 7 and the statistically significant nature of these values. These results suggest that ABS may have positive effects on early-stage bone healing.

ABS is thought to create new stimulation in the area to which it is applied. In a previous study, potential transcription factor changes caused by ABS on human umbilical vein endothelial cells were investigated in order to study the effect of ABS on the endothelium. It was confirmed that ABS is extremely effective in stopping bleeding by its accelerated speed of complex formation between the cells, and it was concluded that the bond formed inside the complex is extremely strong. It was stated that at low doses, it is effective both outside and inside the cells, and it can affect many mechanisms inside the cell [26].

In late-stage findings of our study, the control group histomorphometrically showed superiority in osteoblast and osteoid surface areas and accordingly in mineralized surface areas; however, superiority of new bone formation sites could not be shown. Failure of either the study or control group to show superiority can be ascribed to the ongoing normal ossification process. Moreover, the regular increase shown in trabecular bone and mineralized bone surface areas between the groups according to study days 7, 28, and 42 may suggest that ABS has no negative or delaying effects on physiological bone healing. Although ABS has boosting effects on bone healing during the early period, it is possible that these effects are eliminated with time during the normal physiological bone healing process.

Reactions in tissues caused by the substances used to stop bleeding are important for the reliability of the materials used. Absence of any necrosis areas and foreign body reactions in tissues at the end of the administration 182

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

indicates the reliability of the substance. Hemostatic agents administered on ranges of tension come in contact with bone surfaces. In a study by Bilgili et al., high-dosage systemic administration of ABS in an in vivo animal model was shown to not cause mucosal toxicity, hematotoxicity, hepatotoxicity, nephrotoxicity, or biochemical toxicity [27].

In another study in which the in vitro antimicrobial activity of ABS was investigated, clinical isolate obtained by the agar well diffusion technique from 102 patients was examined.

Fifteen different microorganisms were assessed during the study. It was found that all gram-negative and gram-positive microorganisms had zones against ABS with a diameter of 15 mm on average and in the range 10-18 mm, and ABS was reported to be antimicrobially active [28]. Hence, reactions caused by ABS in tissue were also investigated in our study. The findings showed that ABS use did not cause any foreign body reaction, and no necrotic areas were formed.

No swelling, inflammatory reaction, or allergic reactions were observed clinically in the surgery sites. The absence of any foreign body reaction and only one necrotic area are supported by the findings of Işler et al. [18]. No necrotic tissue was observed in bone tissue and defect areas during the histomorphometric examination in our study. These findings support each other.

As a conclusion of this study, ABS applied in bone cavities was found to have an accelerator effect on short-term bone healing, but no effect on long-term bone healing. Even though its superiority in terms of physiological healing during the long-term bone healing process could not be shown, we think that the speeding up of short-term healing is significant in the recovery of function, phonetics, and aesthetics of patients.

In addition, ABS showed positive features in that it did not cause any foreign body reaction or necrotic areas, and no complications during clinical observations before and after surgery were observed. We think that a wide series of research projects are required to confirm the effects of ABS in speeding up the healing process in addition to its characteristics as a blood-stopping agent.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Refrences 1. Israels S, Schwetz N, Boyar R, McNicol A. Bleeding disorders: characterization, dental considerations and management. J Can Dent Assoc 2006;72:827.

2. Peterson LJ, Ellis E, Hupp JR, Tucker MR. Contemporary Oral and Maxillofacial Surgery. 3rd ed. St. Louis: Mosby, 1998.

3. Oz MC, Rondinone JF, Shargill NS. Floseal matrix: new generation topical hemostatic sealant. J Card Surg 2003;18:486-493.

Şimşek HO, et al: Effects of Ankaferd Blood Stopper on Bone Surfaces

4. Sabel M, Stummer W. The use of local agents: Surgicel and surgifoam. Eur Spine J 2004;13:97-101.

5. Seyednejad H, Imami M, Jameieson T, Seifalian AM. Topical haemostatic agents. Brit J Surg 2008;95:11971225.

6. Schonauer C, Tessitore E, Barbagallo G, Albanese V, Moraci A. The use of local agents: bone wax, collagen, oxidized cellulose. Eur Spine J 2004;13:89-96.

7. Goker H, Haznedaroglu IC, Ercetin S, Kirazli S, Akman U, Ozturk Y, Firat HC. Haemostatic actions of the folkloric medicinal plant extract Ankaferd Blood Stopper. J Int Med Res 2008;36:163-170.

8. Haznedaroglu BZ, Beyazit Y, Walker SL, Haznedaroglu IC. Pleiotropic cellular, hemostatic, and biological actions of Ankaferd hemostat. Crit Rev Oncol Hematol 2012;83:21-34.

9. Huri E, Akgül T, Yücel MÖ, Astarçı HM, Üstün H, Germiyanoğlu RC. The second step in vitro trial of Ankaferd Bloodstopper: comparison with the other hemostatic agents. Turk J Med Sci 2011;41:7-15.

10. Kurt M, Akdoğan M, Onal IK, Kekilli M, Arhan M, Shorbagi A, Aksu S, Kurt OK, Haznedaroglu IC. Endoscopic topical application of Ankaferd Blood Stopper for neoplastic gastrointestinal bleeding: a retrospective analysis. Dig Liver Dis 2010;42:196-199.

11. Ulus TA, Turan NN, Ozyalcin S, Aydog G, Ulus F, Göker H, Haznedaroğlu IC. Surgical and histopathological effects of topical Ankaferd hemostat on major arterial vessel injury in relation to the enhanced intra-arterial blood pressure. Turk J Hematol 2011;28:206-212.

12. Teker AM, Korkut AY, Gedikli O, Kahya V. Prospective, randomized, controlled clinical trial of Ankaferd Blood Stopper in patients with acute anterior epistaxis. Eur Arch Otorhinolaryngol 2010;267:1377-1381.

13. Karakaya K, Ucan HB, Tascılar O, Emre AU, Cakmak GK, Irkorucu O, Ankarali H, Comert M. Evaluation of a new hemostatic agent Ankaferd Blood Stopper in experimental liver laceration. J Invest Surg 2009;22:201-206.

14. Koşar A, Cipil HS, Kaya A, Uz B, Haznedaroğlu IC, Goker H, Ozdemir O, Erçetin S, Kirazli S, Firat HC. The efficacy of Ankaferd Blood Stopper in antithrombotic drug-induced primary and secondary hemostatic abnormalities of a rat-bleeding model. Blood Coagul Fibrinolysis 2009;20:185-190.

15. Baykul T, Alanoglu GE, Kocer G. Use of Ankaferd Blood Stopper as a hemostatic agent: a clinical experience. J Contemp Dent Pract 2010;11:1-7.

Turk J Hematol 2013;30:177-183

16. Ercetin S, Haznedaroglu IC, Kurt M, Onal IK, Aktas A, Kurt KO, Goker H, Ozdemir O, Kirazli S, Firat HC. Safety and efficacy of Ankaferd Blood Stopper in dental surgery.

Int J Hematol Oncol 2010;20:1-5.

17. Sonmez M, Baltacioğlu E, Sarac O, Erkut N. The use of Ankaferd Blood Stopper in a patient with Glanzmann’s thrombasthenia with gingival bleeding. Blood Coagul Fibrinolysis 2010;21:382-383.

18. Işler SC, Demircan S, Cakarer S, Cebi Z, Keskin C, Soluk M, Yüzbaşioğlu E. Effects of folk medicinal plant extract Ankaferd Blood Stopper on early bone healing. J Appl Oral Sci 2010;18:409-414.

19. Parfitt AM, Drezner MK, Glorieux FH, Kanis JA, Malluche H, Meunier PJ, Ott SM, Recker RR. Bone histomorphometry: standardization of nomenclature, symbols, and units. J Bone Miner Res 1987;2:595-610.

20. Demiralp DO, Haznedaroglu IC, Akar N. Functional proteomic analysis of Ankaferd Blood Stopper. Turk J Hematol 2010;27:70-77.

21. Uusitalo H, Rantakokka J, Ahonen M, Jamsa T, Tuukkanen J, Kahari VM, Vuorio E, Aro HT. A metaphyseal defect model of the femur for studies of murine bone healing.

Bone 2001;28:423-429.

22. Duarte PM, Marques MR, Bezerra JP, Bastos MF. The effects of caffeine administration on the early healing and bone density. A histometric study in rats. Arch Oral Biol 2009;54:717-722.

23. Chiba S, Okada K, Lee K, Serge GV, Neer RM. Molecular analysis of defect healing in rat diaphyseal bone. J Vet Med Sci 2001;63:603-608.

24. Shearer JR, Roach HI, Parsons SW. Histology of a lengthened human tibia. J Bone Joint Surg 1992;74:39-44.

25. Pereira AC, Fernandes RG, Carvalho YR, Balducci I, Leite HF. Bone healing in drill hole defects in spontaneously hypertensive male and female rats’ femurs. A histological and histometric study. Arq Bras Cardiol 2007;88:93-97.

26. Yılmaz E, Gulec S, Torun D, Haznedaroglu IC, Akar N. The effects of Ankaferd Blood Stopper on transcription factors in HUVEC and the erythrocyte protein profile.

Turk J Hematol 2011;28:276-285.

27. Bilgili H, Captug O, Kosar A, Kurt M, Kekilli M, Shorgabi A, Kar Kurt O, Ozdemir O, Goker H, Haznedaroglu IC. Oral systemic administration of Ankaferd Blood Stopper has no short-term toxicity in an in vivo rabbit experimental model. Clin Appl Thromb Hemost 2010;16:533-536.

28. Fisgin NT, Caycı YT, Coban AY, Ozatli D, Tanyel E, Durupinar B, Tulek N. Antimicrobial activity of plant extract Ankaferd Blood Stopper. Fitoterapia 2009;80:48-50.

183

DOI: 10.4274/Tjh.2012.0134

Case Report

Successful Management of Hydroxyurea-induced Leg Ulcers in Essential Thrombocythemia: Report of 3 Cases Hidroksiüre’nin Anlatılmamış Hikayesi: Bacak Ülserli 3 Olgunun Tedavisi Jihane Abou Rahal1,2, Rim S. Ishak2, Zaher K. Otrock 2, Joseph E. Maakaron1, Samer Ghosn2, Ali T. Taher1 1American

University of Beirut Medical Center, Department of Internal Medicine, Beirut, Lebanon

2 American

University of Beirut Medical Center, Department of Dermatology, Beirut, Lebanon

Abstract: Essential thrombocythemia is one of the myeloproliferative neoplasms with a plethora of thrombohemorrhagic complications.

Hydroxyurea has been proven to be an effective treatment for this condition. However, it is not without side effects. We herein report 3 patients with essential thrombocythemia treated with hydroxyurea who developed refractory leg ulcers, and we outline their successful management. We also review the literature to shed light on the mechanism of this toxicity. Awareness of this important treatment complication is important to avoid the pitfall of futile invasive interventions.

Key Words: Hydroxyurea, Essential thrombocythemia, Leg ulcers, Interferon Özet: Esansiyel trombositoz, trombohemorajik komplikasyonların sık görüldüğü miyeloproliferatif hastalıklardan biridir.

Hidroksiürenin bu durum için etkili bir tedavi olduğu kanıtlanmıştır. Bununla birlikte, yan etkisiz değildir. Bu makalede refrakter bacak ülserleri gelişen 3 esansiyel trombositoz hastasında hidroksiüre ile başarılı şekilde gerçekleştirilen tedavi sürecini bildiriyoruz. Aynı zamanda, bu toksisitenin mekanizmasına ışık tutacak literatür gözden geçirilmiştir. Bu önemli komplikasyonun farkında olmak, gereksiz invaziv girişimlerden kaçınmak için önemlidir.

Anahtar Kelimeler: Hidroksiüre, Esansiyel trombositemia, Bacak ülserleri, İnterferon

Introduction Essential thrombocythemia (ET) is a BCR-ABL1negative myeloproliferative disorder characterized by stem cell-derived clonal myeloproliferation leading to thrombocytosis. To establish a diagnosis of ET, reactive causes of thrombocytosis should be absent and other chronic myeloproliferative disorders should be ruled out [1].

An effective treatment for ET is hydroxyurea (HU), yet it is well known to cause several side effects, among them being HU-induced multiple and painful treatment-resistant leg ulcers [2]. We herein report 3 cases of HU-induced ulcers that were treated by discontinuation of HU and introduction of interferon, with marked improvement of the ulcers and good control of the ET.

Address for Correspondence: Ali T. TAHER, M.D., Hematology-Oncology Division, Department of Internal Medicine, American University of Beirut Medical Center, P.O. Box: 11-0236, Riad El-Solh, 1107 2020 Beirut, Lebanon Phone: 00961 1350000 E-mail: ataher@aub.edu.lb Received/Geliş tarihi : September 12, 2012 Accepted/Kabul tarihi : October 16, 2012

184

Turk J Hematol 2013;30:184-187

Rahal JA, et al: Hydroxyurea-induced Leg Ulcers

Case 1 An 88-year-old Caucasian woman with a history of transient ischemic attack 17 years prior to presentation was referred to our clinic for anemia (hemoglobin= 11.0 g/dL; hematocrit= 32%), thrombocytosis (1100x109/L), and splenomegaly. Her family history was positive for polycythemia vera and her bone marrow aspirate showed huge clumped platelets. A diagnosis of ET was made and she was started on HU and aspirin. She later tested positive for the JAK2 V617F mutation once the test became commercially available. She was started on HU (500 mg daily) and aspirin (100 mg daily) and responded well to treatment, with platelet count dropping to around (600x109/L), correction of the anemia, and development of macrocytosis. She was also taking calcium, 5 mg of folic acid, and multivitamins.

In 2004, platelet count started rising again and hemoglobin dropped. The HU dose was increased to 1000 mg twice a week and 500 mg for 5 days/week. She presented in 2011 with extensive cutaneous ulcerations of 2 months in duration over her right lateral malleolus. Upon diagnosis of HU-induced ulcer, the causative drug was discontinued and she was started on 90 μg of pegylated interferon alpha 2a (Pegasys®) to control her platelet count. Two weeks after discontinuing HU, the ulcerations drastically improved.

Platelet count kept dropping and she is now maintained on 90 μg of Pegasys every 2–3 weeks.

Case 2 A 59-year-old Caucasian woman presented to our clinic after sustaining a myocardial infarction. Work-up revealed thrombocytosis (900x109/L) . She also had splenomegaly on exam. A bone marrow aspirate showed hypercellular bone marrow with increased megakaryocytes, and mutational analysis showed the patient to be homozygous for the JAK2 V617F mutation. The diagnosis of ET was made and she was started on aspirin and HU; the dose was titrated to 1500 mg daily with an adequate erythroid and platelet response (~400x109/L). In the fifth year of HU treatment, she developed skin ulceration over the plantar aspect of the soles bilaterally. At that time, she was taking low-dose aspirin and 1500 mg of HU 500. HU was then stopped and the patient was switched to anagrelide. However, she was not able to tolerate it due to dizziness and gastrointestinal distress. The patient was then shifted to 135 μg per week of Pegasys® with subsequent improvement in her platelet counts and healing of her ulcers. Platelet count is now adequately controlled and she only requires 90 μg of Pegasys every 2–3 weeks.

Case 3 A 76-year-old Caucasian woman presented in 2002 with a platelet count of (10x109/L). Her spleen size was also on the upper limit of normal with a span of 13.1 cm. Mutational analysis for JAK2 V617F was negative. A bone marrow aspirate

revealed significant clumping of platelets. She was started on HU and titrated to a dose of 1000 mg twice per week and 500 mg for the rest of the days. In 2009, she developed a gradual drop in hemoglobin and hematocrit (10 g/dL, 30%). Work-up revealed stage I adenocarcinoma of the colon, which was successfully resected. In 2010, she developed a left lower extremity ulcer measuring approximately 2x2 cm in size. She also developed dermatomyositis. At first, the ulcers were treated with surgical debridement and antibiotic administration. However, they did not heal despite the lack of bony involvement. The patient was diagnosed with HU-induced ulcers. Upon discontinuation of the drug, the ulcers started healing spontaneously and showed marked improvement within 3 months. Meanwhile, the platelet counts were rising. The patient was started on pegylated interferon alpha 2a (90-μg injections once weekly).

The ulcers healed completely 6 months after HU was ceased, and the patient was continued on interferon with clinical and hematological remission up to 1 year after initiation of therapy. She is now adequately controlled with a Pegasys 90μg injection once every 3 weeks.

Discussion This report highlights an important and often undiagnosed toxicity associated with hydroxyurea and its successful management in ET patients. The benefit of HU treatment in ET is not a survival benefit since the patients already have a near normal survival rate, with 80% alive at 15 years [1]. Instead, the aim of treatment in ET is preventing thrombohemorrhagic complications, as well as dealing with the associated vasomotor disturbances (headache, lightheadedness, acral paresthesia, etc). Indeed, the risk of developing thrombosis reaches 20% in this population [1]. Paradoxically, in the case of platelet counts higher than 1000x109/L, some patients may develop acquired von Willebrand syndrome [1]. Accordingly, ET patients are divided into either low risk or high risk for thrombosis.

Table 1 shows the different risk strata for patients with ET along with their recommended treatment. Our patients were placed on HU since they had all suffered thrombotic events. For over 50 years, HU has been used in the treatment of chronic myeloproliferative disorders, such as chronic myeloid leukemia, polycythemia vera, and ET [3]. It is the hydroxylated derivative of urea, which works by blocking the ribonucleotide-diphosphate reductase, thus inhibiting the synthesis of DNA and ultimately leading to cell death in the S phase of the cell cycle. Its cytotoxic effects are most prominent in the bone marrow and in epithelial cells. HU is usually well tolerated with few side effects [4]. Among its adverse effects are bone marrow depression, megaloblastosis, fatigue, headache, fever, and gastrointestinal symptoms [4]. The drug has also been reported to cause an array of dermatological reactions that include alopecia, skin or fungal hyperpigmentation, poikiloderma, erythematous scaling eruptions, atrophy of the skin and subcutaneous tissues, 185

Turk J Hematol 2013;30:184-187

Rahal JA, et al: Hydroxyurea-induced Leg Ulcers

Table 1: Classification of ET along with recommended treatment [1].

Risk Stratification

Description

Recommended treatment

Low risk

Age of <60 years, and no previous thrombotic episodes

Low-dose aspirin

Low risk with extreme thrombocytosis (>1000x109/L)

Might have acquired von Willebrand syndrome

Low-dose aspirin if no evidence of acquired von Willebrand syndrome

High risk

Age of ≥60, or previous thrombotic event

Low-dose aspirin with hydroxyurea

erythema and scaling of acral sites simulating chronic dermatomyositis, lichen planus-like lesions, and skin tumors on UV-exposed areas [4,5,6,7,8,9]. In addition, leg and oral ulcers have been documented in patients taking HU [9].

The leg ulcers caused by HU typically occur on the lateral malleolar area and have been reported in approximately 9% of patients taking hhigher doses of HU for a period exceeding 1 year [3,10]. These extremely painful ulcers, although small and superficial, rarely heal if the medication is not withdrawn [3]. Although the exact mechanism by which HU causes these ulcers is unclear, 3 possible mechanisms explain how HU causes cutaneous ulcerations in a patient with ET (Figure 1). First, the thrombocytosis that is associated with ET, coupled to a poorly understood effect of HU on vessel endothelium and platelets, is likely to result in platelet thrombus with subsequent transient occlusion of microvessels [3]. Megaloblastosis (a known side effect of HU) has been postulated to play a role, too, as the enlarged red blood cells circulate less easily in small blood vessels [3,10]. Because it promotes cell death, HU can decrease keratinocyte viability, which in turn will hinder any re-epithelialization after the injury done by the above mechanisms. The effect is typically most visible on surfaces prone to mechanical trauma, such as the malleolar areas [3,10].

The cornerstone of treatment of HU-associated ulcers is discontinuation of HU. Indeed, the ulcerations rarely respond to conventional optimal therapy [2,3,5,8,10,11]. They appear to be even refractory to surgical treatment if HU is not discontinued, as evidenced by a failed flap in the case reported

by Tsuchiya et al. [3] in 2010 as well as in our own experience with the third case. Being a rarely encountered side effect of HU, HU-induced ulcers are frequently underdiagnosed, thus delaying their appropriate management. Even when appropriately diagnosed, the physician is often faced with the inability to discontinue HU in order to keep the original disease under control [11]. This leads to a delay and/or inability in healing the ulcers, putting the patient at risk of functional and psychological discomfort as well as potential superimposed infections. In addition, the patients are typically resumed on HU after healing of the wounds, despite a high risk for the ulcerations to recur upon reintroducing 186

Figure 1: Possible mechanisms leading to hydroxyureainduced ulcers. the HU [11]. Our 3 patients with HU-induced ulcers healed completely after discontinuation of HU. When they were shifted to interferon therapy (Pegasys®), it maintained good control over their primary disease, comparable to that of HU. This degree of disease control with interferon is in accordance with findings of previous studies, which established that interferon-alpha 2a adequately controls thrombocytosis and vasomotor symptoms in ET [12].

As a conclusion this report demonstrates the complication of hydroxyurea-induced leg ulcerations and outlines successful management options. Our experience shows complete regression of the ulcers and adequate control over the primary disease after discontinuation of HU and replacement with an effective agent. Alternative treatment with interferon seems to be a viable option, especially given the risk of recurrence of ulcers when HU is resumed. It also offers a treatment substitute in cases where discontinuation of HU without replacement is not possible due to the need of tight control over ET. Conflict of Interest ATT serves on the Novartis Speakers Bureau. He also receives research funding from Novartis. The other authors declare that they have no conflict of interest. This study did not receive any external funding.

Rahal JA, et al: Hydroxyurea-induced Leg Ulcers

Refenences 1. Tefferi A. Polycythemia vera and essential thrombocythemia: 2012 update on diagnosis, risk stratification, and management. Am J Hematol 2012;87:285–293.

2. Demircay Z, Comert A, Adiguzel C. Leg ulcers and hydroxyurea: report of three cases with essential thrombocythemia. Int J Dermatol 2002;41:872–874.

3. Tsuchiya S, Ichioka S, Sekiya N. Hydroxyurea-induced foot ulcer in a case of essential thrombocythaemia. J Wound Care 2010;19:361–364.

4. Kikuchi K, Arita K, Tateishi Y, Onozawa M, Akiyama M, Shimizu H. Recurrence of hydroxyurea-induced leg ulcer after discontinuation of treatment. Acta Derm Venereol 2011;91:373–374.

5. Radaelli F, Calori R, Faccini P, Maiolo AT. Early cutaneous lesions secondary to hydroxyurea therapy. Am J Hematol 1998;58:82–83.

6. Richard M, Truchetet F, Friedel J, Leclech C, Heid E. Skin lesions simulating chronic dermatomyositis during long-term hydroxyurea therapy. J Am Acad Dermatol 1989;21:797–799.

Turk J Hematol 2013;30:184-187

7. Renfro L, Kamino H, Raphael B, Moy J, Sanchez M. Ulcerative lichen planus-like dermatitis associated with hydroxyurea. J Am Acad Dermatol 1991;24:143–145.

8. Papi M, Didona B, DePità O, Abruzzese E, Stasi R, Papa G, Cavalieri R. Multiple skin tumors on light-exposed areas during long-term treatment with hydroxyurea. J Am Acad Dermatol 1993;28:485–486.

9. Najean Y, Rain JD. Treatment of polycythemia vera: the use of hydroxyurea and pipobroman in 292 patients under the age of 65 years. Blood 1997;90:3370–3377.

10. Martorell-Calatayud A, Requena C, Nagore-Enguídanos E, Guillén-Barona C. [Multiple, painful, treatment-resistant leg ulcers associated with dermatomyositis-like lesions over the interphalangeal joints induced by hydroxyurea]. Actas Dermosifiliogr 2009;100:804–807.

11. Ruzzon E, Randi ML, Tezza F, Luzzatto G, Scandellari R, Fabris F. Leg ulcers in elderly on hydroxyurea: a single center experience in Ph- myeloproliferative disorders and review of literature. Aging Clin Exp Res 2006;18:187–190.

12. Middelhoff G, Boll I. A long-term clinical trial of interferon alpha-therapy in essential thrombocythemia. Ann Hematol 1992;64:207–209.

187

DOI: 10.4274/Tjh.92499

Case Report

Deep Vein Thrombosis Following Non-myeloablative Allogeneic Stem Cell Transplantation: Presentation of Three Cases and Literature Review Miyeloablatif Olmayan Allojeneik Kök Hücre Nakli Sonrası Derin Ven Trombozu: Üç Vaka Sunumu ve Literatürün Gözden Geçirilmesi Evren Özdemir, Emin Kansu Hacettepe University, Institute of Oncology, Stem Cell Transplantation Unit, Ankara, Turkey

Abstract: The incidence of deep vein thrombosis (DVT) after non-myeloablative (NMA) allogeneic stem cell transplantation (allo-SCT) is unknown. In addition, very few studies on the predisposing factors for DVT post SCT have been published. The incidence of DVT among patients that underwent NMA allo-SCT at our hospital was 4.1% (3 of 73) over the course of last 8 years, and to the best of our knowledge this is the first study to report the incidence of DVT following NMA allo-SCT. The present findings show that NMA allo-SCT patients may have multiple risk factors for DVT. Herein we present 3 cases of DVT following NMA allo-SCT and a literature review.

Key Words: DVT, Non-myeloablative allogeneic stem cell transplantation, Incidence

Özet: Miyeloablatif olmayan allojeneik kök hücre nakli (NST) sonrası derin ven trombozu (DVT) sıklığı bilinmemektedir. Ek olarak, allojeneik nakil sonrası DVT gelişiminin nedenleri ile ilgili çok az sayıda çalışma mevcut olup, bu çalışmalarda izole bazı etiyolojik faktörler tanımlanmıştır. Merkezimizde NST protokolleri ile tedavi edilen hastalarda DVT gelişme sıklığı son sekiz yıl içinde %4,1 (73 hastada 3 vaka) olarak bulunmuş olup, bu hasta grubunda bildirilen ilk rapordur. NST sonrası DVT gelişimi ile ilgili gözlemimiz, bu hastalarda birden çok risk faktörünün bir arada bulunduğudur. Burada, bu hasta grubunda DVT gelişen üç vaka sunulmuş ve ilgili literatür gözden geçirilmiştir.

Anahtar Kelimeler: DVT, Miyeloablatif olmayan allojeneik kök hücre nakli, İnsidans

Introduction Deep vein thrombosis (DVT) increases the incidence of morbidity and mortality following myeloablative stem cell transplantation (SCT) [1,2,3,4,5,6,7]. The incidence of thromboembolic events following conventional Address for Correspondence: Evren ÖZDEMİR , M.D., Hacettepe University, Institute of Oncology, Stem Cell Transplantation Unit, Ankara, Turkey Phone: +90 312 305 28 65 E-mail: dreozdemir@yahoo.com Received/Geliş tarihi : April 19, 2011 Accepted/Kabul tarihi : February 22, 2012

188

myeloablative autologous and allogeneic (allo) SCT are approximately 5% and 15%, rrespectively [1]; however, the incidence of DVT following non-myeloablative (NMA) allo-SCT is unknown. In addition, very few studies on the predisposing factors for DVT post- SCT have been published.

To the best of our knowledge the present study is the first

Turk J Hematol 2013;30:188-190

Özdemir E, et al: DVT After Non-myeloablative Allo-SCT

to report the incidence of DVT following NMA allo-SCT. Herein we present 3 cases of DVT following NMA allo-SCT and a review of the literature. Written informed consents to publish their data were obtained from all 3 patients.

Case Reports Case 1 A 47-year-old male underwent NMA allo-SCT (using fludarabine and total body irradiation (TBI) [200 cGy]) from an HLA-identical sibling due to high-risk acute myeloblastic leukemia (AML). His post-transplant course was complicated by chronic graft-versus host-disease (GVHD) of the skin (sclerodermatous type) and oral mucosa, which responded well to mycophenolate mofetil, systemic steroids, and photopheresis. The patient developed DVT of the left femoral vein and subsequent pulmonary emboli 5 months post transplantation while receiving the above-mentioned immunosuppressive treatments. The patient did not have a history of DVT; however, his family history included close relatives that died at early ages due to myocardial infarction and cerebrovascular events. As such, thrombophilia screening was performed, which showed factor (F) V Leiden homozygous mutation; this finding was confirmed by testing DNA obtained via oral mucosal swabbing. The patient was started on anticoagulation treatment with low molecular weight heparin (LMWH) with subsequent resolution of the DVT. The patient had long-term chronic GVHD necessitating low-dose steroid treatment. Life-long anticoagulation treatment with warfarin was planned.

Case 2 A 37-year-old male underwent NMA allo-SCT (using fludarabine and TBI [200 cGy]) from an HLA-identical sibling due to high risk AML. His post-transplant course was complicated by grade II acute GVHD of the gastrointestinal tract, followed by chronic GVHD of the oral mucosa. The patient responded well to treatment with mycophenolate mofetil and systemic steroids. He developed DVT of the left femoral vein 7 months post transplantation while the steroid treatment was being tapered. The patient had no history of DVT; however, as he was only 37 years old thrombophilia screening was performed, which showed a slightly low free protein S antigen level (45%) (normal range: 60%-130%).

This finding was confirmed via subsequent confirmatory testing and family studies. The patient was given anticoagulation treatment with LMWH with subsequent resolution of the DVT. The patient’s chronic GVHD was successfully treated and steroids were completely tapered off. Nonetheless, the patient’s low free protein S antigen level persisted, suggesting hereditary deficiency; therefore, lifelong anticoagulation treatment with warfarin was planned.

Case 3 A 40-year-old female underwent NMA allo-SCT (using fludarabine and TBI [200 cGy]) from an HLA-identical sibling

due to secondary AML. One week post transplantation her left jugular catheter site was extremely painful and swollen. The catheter was withdrawn and doppler ultrasound confirmed a left jugular vein thrombus. She had no history of DVT, but because she was only 40 years old thrombophilia screening was performed, which showed low-level protein C activity (55%) (range: 70%-130%) and an elevated fibrinogen level (658 mg/dL). The DVT was treated with low molecular weight heparin. Protein C activity and the fibrinogen level returned to normal 30 d post transplantation. The patient was given anticoagulation treatment for 3 months only.

Discussion SCT recipients have a high incidence of DVT. DVT has been reported to occur following conventional myeloablative autologous SCT and allo-SCT; however, little is known about the incidence of and risk factors for DVT following NMA allo-SCT. Patients undergoing SCT have known risk factors for the development of DVT, which include underlying malignancy, conditioning regimen, immobility during hospitalization, and the universal use of central venous catheters. In addition, there are several reports detailing the risk factors for the development of DVT post SCT. Decreases in circulating natural anticoagulants, protein C [2,3,4,5,6], protein S [3], ve AT-III [5] and an increase in fibrinogen [5] have been shown to occur following SCT, which cause a hypercoagulable state, a risk factor associated with thromboembolic events post transplantation.

A large-scale study evaluated hemostatic complications in autologous SCT and allo-SCT patients, and reported that thromboembolic events were more common in alloSCT recipients (15%) [1]. Chronic GVHD and treatment with steroids were the major factors associated with the occurrence of DVT [1]. Antiphospholipid syndrome with elevated anticardiolipin antibody titers, commonly in association with GVHD, has been reported to cause catastrophic thromboembolism following allo-SCT [6].

Another large-scale study reported that the incidence of DVT among allo-SCT recipients was about 5%; however, most of the patients received peri-transplant low molecular weight heparin prophylaxis. Additionally, the most frequent factor associated with DVT was catheter use, followed by GVHD [7]. FV Leiden is associated with a 3-8-fold increase in the risk of venous thrombosis in heterozygous patients, versus an 80-fold increase in homozygous patients [8]. Patients with FV Leiden mutation have a significantly higher risk for the development of DVT associated with other predisposing factors, especially with catheter insertion [8,9,10].

Previously reported risk factors for the development of DVT post SCT are summarized in Table 1.

Most of our NMA allo-SCT patients had a diagnosis of lymphoid malignancy (n=28), followed by myeloid malignancy (n=22), multiple myeloma (n=14), and solid 189

Turk J Hematol 2013;30:188-190

Özdemir E, et al: DVT After Non-myeloablative Allo-SCT

Table 1: Reported risk factors for the development of DVT post-SCT. Decreased natural anticoagulants (protein S, protein C, and AT-III)2-6 Increased fibrinogen5 Chronic GVHD1 Steroid use1 Antiphospholipid antibodies6 FV Leiden mutation8-10 Catheter use9-10 tumors (n=6). The NMA regimens used at our hospital were as follows: fludarabine+TBI (n=32, 46%); fludarabine+MEL (n=20, 28.5%); fludarabine+CTX (n=6, 8.5%); FLAG (n=6, 8.5%); fludarabine+BU (n=6, 8.5%).

The incidence of DVT in the patients that underwent NMA allo-SCT at our hospital was 4.1% (3 of 73 cases).

To the best of our knowledge the present study is the first to report the incidence of DVT following NMA allo-SCT. Although the number of patients was small, the incidence rate is lower than previously reported for conventional alloSCT. None of the presented patients received peri-transplant DVT prophylaxis. Interestingly, all 3 patients with DVT were diagnosed as AML and received the fludarabine+TBI NMA regimen. It remains unclear if the diagnosis of AML and/or the conditioning regimen had any effect on the occurrence of DVT; however, this warrants further prospective studies.

We observed that the 3 patients that developed DVT following NMA allo-SCT may have had multiple predisposing factors. Our patients had combinations of previously reported risk factors, further increasing the likelihood of DVT, as follows: Case 1: FV Leiden homozygous mutation, chronic GVHD, and steroid use; Case 2: Protein S deficiency, chronic GVHD, and steroid use; Case 3: low protein C activity, elevated fibrinogen, and catheter use. Case 1 had a strong family history, cases 2 and 3 belonged to a younger age group to justify thrombophilia screening. In cases 1 and 2 hereditary risk factors were noted as underlying the development of DVT; however, other acquired risk factors also likely added to the existing risk. Case 3 had no known hereditary risk factor; however, the acquired temporary risks were sufficient to cause DVT. In conclusion, DVT following NMA allo-SCT may be associated with multiple predisposing factors with additive risks. Additional large-scale prospective studies are necessary to determine the precise incidence, at-risk populations, and the potential risks and benefits of thromboprophylaxis in this patient population.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

190

References 1. Pihusch R, Salat C, Schmidt E, Göhring P, Pihusch M, Hiller E, Holler E, Kolb HJ. Hemostatic complications in bone marrow transplantation: a retrospective analysis of 447 patients. Transplantation 2002;74:1303-1309.

2. Gordon BG, Saving KL, McCallister JA, Warkentin PI, McConnell JR, Roberts WM, Coccia PF, Haire WD. Cerebral infarction associated with protein C deficiency following allogeneic bone marrow transplantation. Bone Marrow Transplant 1991;8:323-325.

3. Grigg A, Gibson R, Bardy P, Szer J. Acute portal vein thrombosis after autologous stem cell transplantation. Bone Marrow Transplant 1996;18:949-953.

4. Gordon BG, Haire WD, Patton DF, Manno PJ, Reed EC. Thrombotic complications of BMT: association with protein C deficiency. Bone Marrow Transplant 1993;11:61-65.

5. Gordon B, Haire W, Kessinger A, Duggan M, Armitage J. High frequency of antithrombin 3 and protein C deficiency following autologous bone marrow transplantation for lymphoma. Bone Marrow Transplant 1991;8:497-502.

6. Kasamon KM, Drachenberg CI, Rapoport AP, Badros A. Catastrophic antiphospholipid syndrome: atypical presentation in the setting of chronic graft versus host disease: case report and review of the literature. Haematologica 2005;90:17.

7. Gonsalves A, Carrier M, Wells PS, McDiarmid SA, Huebsch LB, Allan DS. Incidence of symptomatic venous thromboembolism following hematopoietic stem cell transplantation. J Thromb Haemost 2008;6:1468-73.

8. Rosendaal FR, Koster T, Vandenbroucke JP, Reitsma PH. High risk of thrombosis in patients homozygous for factor V Leiden (activated protein C resistance). Blood 1995;85:1504-1507.

9. Fijnheer R, Paijmans B, Verdonck LF, Nieuwenhuis HK, Roest M, Dekker AW. Factor V Leiden in central venous catheterassociated thrombosis. Br J Haematol 2002;118:267-270.

10. Jansen FH, van der Straaten HM, Roest M, Haas F, de Groot PG, Fijnheer R. Elevated levels of D-dimer and fragment 1+2 upon central venous catheter insertion and factor V Leiden predict subclavian vein thrombosis. Haematologica 2005;90:499-504.

DOI: 10.4274/Tjh.03164

Case Report

A Pediatric Renal Lymphoma Case Presenting with Central Nervous System Findings Santral Sinir Sistemi Bulguları ile Prezente Olan Pediatrik Renal Lenfoma Ahmet Baran1, Serhan Küpeli2, Ömer Doğru3 1Diyarbakır

Children’s Diseases Hospital, Department of Radiology, Diyarbakır, Turkey

2Diyarbakır

Children’s Diseases Hospital, Department of Pediatric Oncology, Diyarbakır, Turkey

3Diyarbakır

Children’s Diseases Hospital, Department of Pediatric Hematology, Diyarbakır, Turkey

Abstract: In pediatric patients renal lymphoma frequently presents in the form of multiple, bilateral mass lesions, infrequently as a single or retroperitoneal mass, and rarely as diffuse infiltrative lesions. In patients with apparent central nervous system involvement close attention to other physical and laboratory findings are essential for preventing a delay in the final diagnosis.

Herein we present a pediatric patient with renal lymphoma that presented with central nervous system findings that caused a delay in diagnosis.

Key Words: Renal lymphoma, Central nervous system involvement, Children

Özet: Çocukluk çağında böbrek kökenli lenfoma sıklıkla bilateral kitle lezyonları, daha az sıklıkla da tek veya retroperitoneal bir kitle olarak veya difüz infiltratif lezyonlar şeklinde dikkate gelebilir. Tanının gecikmemesi adına, santral sinir sistemi tutulumu bulguları olan hastalarda, diğer fizik ve laboratuar bulgularına da yeterince dikkat edilmesi zorunludur. Bu yazıda, renal lenfoması olan ancak santral sinir sistemi bulguları ile prezente olduğundan tanı konulmasında gecikilen bir çocuk hasta sunulmuştur.

Anahtar Kelimeler: Renal lenfoma, Santral sinir sistemi tutulumu, Çocuklar

Introduction Rapid and accurate diagnosis of non-Hodgkin lowercase L (NHL) the second most common malignant tumor of childhood in developing countries- is important for reducing morbidity and mortality. Radiologically, primary renal lymphoma has a similar appearance in pediatric and adult cases [1,2,3]. Herein we present a pediatric patient

with renal lymphoma that presented with central nervous system (CNS) findings, as well as a discussion concerning the delay in diagnosis due to this atypical presentation.

Case According to the discharge report of a 4-year-old female patient, she presented to a university hospital with a 1-month

Address for Correspondence: Serhan KÜPELİ, M.D., Diyarbakır Children’s Diseases Hospital, Department of Pediatric Oncology, Diyarbakır, Turkey GSM: +90 535 763 45 49 E-mail: serkupeli@yahoo.com Received/Geliş tarihi : September 30, 2011 Accepted/Kabul tarihi : February 13, 2012

191

Turk J Hematol 2013;30:191-193

Baran A, et al: Pediatric Renal Lymphoma

history of abdominal distention, and a 5-7-d history of headache and inability to move her right eye. Right-eye proptosis and abdominal distention were observed on physical examination. Laboratory findings were as follows: WBC count: 11,400 mm–3 (normal range: 4,000-11,000 mm–3); urea: 65 mg dL–1 (normal range: 10-48 mg dL–1); uric acid: 9.4 mg dL–1 (normal range: 2.2-5.7 mg dL–1); LDH: 1107 U L–1 (normal range: 120-300 U L–1); creatinine: 1.92 mg dL–1 (normal range: 0.6-1.3 mg dL–1). Additionally, cranial CT performed due to ptosis and inability to move the right eye showed a 35x25x15-mm lesion in the sellar region that exhibited homogeneous contrast enhancement with intravenous contrast material (IVCM) (Figure 1). Contrastenhanced CT angiographic examination showed a hyperdense 37x12x22-mm mass that extended from the sellar region to the parasellar region, surrounding both cavernous sinuses in their entirety, and normal arterial structures in the brain. CT angiography did not show any evidence of thrombus and the patient was referred to our pediatric oncology department with the diagnosis of an intracranial mass.

At the time of admission physical examination of the patient showed pale skin, right-eye proptosis, ptosis, right central facial paralysis, external ophthalmoplegia, abdominal distention, enlarged superficial veins of the abdomen, and an abdominal mass with ill-defined borders. The patient’s uric acid level was 18.9 mg dL-1 and suggestive of tumor lysis syndrome; as such, 1 session of hemodialysis was administered. Thereafter, alkaline fluid, allopurinol treatment, and close electrolyte monitoring were performed, and tumor lysis syndrome prophylactic treatment was given.

Abdominal USG examination showed renal enlargement, significant corticomedullary separation, and elevated intraabdominal fluid. Abdominal CT showed bilateral kidney enlargement and free fluid (Figure 2). Peripheral blood smear and bone marrow examination were normal, and Burkitt’s lymphoma was diagnosed following cytological examination of intraabdominal fluid obtained via paracentesis.

NHL-BFM 95 chemotherapy protocol was administered to the patient, but following the first course the patient experienced a severe neutropenic sepsis. Meropenem and vancomycin were initially given due to severe febrile neutropenia, and severe oral and anal mucositis. Amphotericin-B and amikacin were added to the therapy on d 3 because of persistent fever, neutropenia, and hypotension, but unfortunately she died on treatment d 5. Pseudomonas aeruginosa was cultured in blood and urine samples obtained during the febrile neutropenic episode. Written informed consent was obtained from the patient’s parents to publish the findings.

Discussion Renal lymphoma rarely presents as a single mass lesion in 1 or both kidneys, and may present in the form of a retroperitoneal mass and diffuse renal enlargement [1,2,3]. Following a delay in admission to our pediatric oncology department, the presented patient was observed to have an abdominal mass, which was confirmed radiologically. Radiologically, primary renal lymphoma has a similar appearance in pediatric and adult cases [1,2,3]. Unlike in adults, the pathological diagnosis of renal lymphoma in pediatric cases is commonly Burkitt’s lymphoma. In 6%-70% of pediatric patients it presents in the form of numerous bilateral renal masses, versus a single unilateral lesion or bilateral mass lesions in 10%-20%, and a retroperitoneal mass with diffuse renal enlargement in 5%-10% [2,3,4]. Diagnosis of Burkitt’s lymphoma in this presented case was based on cytological examination of intraabdominal fluid obtained via paracentesis. Renal biopsy for diagnostic purposes was not performed due to the poor clinical condition of the patient and samples were obtained from intraabdominal and cerebrospinal fluids.

CT findings of renal lymphoma are generally nonspecific [1,2,3]. The presented patient’s axial CT scan

Lumbar puncture showed L3-type blasts in cerebrospinal fluid, which was consistent with Burkitt’s lymphoma. The

A

B

Figure 1: Contrast-enhanced and non-contrast-enhanced axial cranial CT scans. A. Mild hyperdense lesion in the sellar region with well-defined borders. B. Homogeneous significant contrast enhancement and extension of the lesion to the cavernous sinus is seen following intravenous injection of contrast material.

192

Figure 2: Non-contrast-enhanced axial abdominal CT scan.

Significant bilateral kidney enlargement and intraabdominal free fluid are seen.

Turk J Hematol 2013;30:191-193

Baran A, et al: Pediatric Renal Lymphoma

made without contrast material due to renal insufficiency showed only significant bilateral kidney enlargement and intraabdominal free fluid. Multiple bilateral mass lesions are also observed in leukemia (particularly AML), multiple angiomyolipoma, fungal infections, cystic renal diseases, and metastatic diseases [3]. Benign lesions can be differentiated from malignant renal disease by their particular imaging characteristics: for instance, attenuation in cystic renal disease, presence of fat content in angiomyolipoma, and reduced kidney size in fungal infections. Whereas Wilms’ tumor is observed in young children (0-5 years) with a single renal mass, renal cell carcinoma, metanephric adenoma, solitary angiomyolipoma, and focal infections are observed in older children (after 5 years). Differential diagnosis of a retroperitoneal mass includes retroperitoneal tumors such as neuroblastoma. Diffuse kidney enlargement has numerous causes and its differential diagnosis is difficult.

Diffuse renal enlargement can be observed in response to chemotherapeutical agents in patients with tumor lysis syndrome secondary to infections or tumor involvement [5].

Palpation of the abdominal mass and an elevated uric acid level were noteworthy in the presented patient, and diagnosis was based paracentesis, despite the absence of enlarged retroperitoneal lymph nodes. Renal insufficiency associated with tumor lysis syndrome is a frequent complication that clinicians must be aware of [6,7,8]. Bilateral primary renal NHL is an extremely rare condition in the pediatric age group and only a few cases have been reported in the Englishlanguage medical literature [9,10,11,12]. Primary renal NHL generally presents with an abdominal mass, as in the presented case, but renal failure, hematuria, and anemia have also been described [13,14]. Interestingly, Jindal et al. [12] recently reported a 3-year-old male with bilateral primary renal B-cell lymphoma that presented with orbital metastases, and was characterized by difficulty in diagnosis and management similar to that in the presented patient. The overall prognosis in patients with bilateral primary renal NHL is poor, especially in those that present with renal failure.

In pediatric lymphoma cases the presence of renal disease at the time of diagnosis does not indicate a poor prognosis, but recurrence is associated with a 5-year survival rate of only 30% [15]. Primary renal lymphoma−especially in association with central nervous system involvement−is a rare condition. In the presented case the focus of attention on the central nervous system delayed the diagnosis. In particular, in cases with concomitant elevated uric acid and nephromegaly the diagnosis of renal lymphoma should always be a consideration.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Chepuri NB, Strouse PJ, Yanik GA. CT of renal lymphoma in children. AJR Am J Roentgenol 2003;180:429-431.

2. Horii SC, Bosniak MA, Megibow AJ, Raghavendra BN, Subramanyam BR, Rothberg M. Correlation of CT and ultrasound in the evaluation of renal lymphoma. Urol Radiol 1983;5:69-76.

3. Cohan RH, Dunnick NR, Leder RA, Baker ME. Computed tomography of renal lymphoma. J Comput Assist Tomogr 1990;14:933-938.

4. Heiken JP, Gold RP, Schnur MJ, King DL, Bashist B, Glazer HS. Computed tomography of renal lymphoma with ultrasound correlation. J Comput Assist Tomogr 1983;7:245-250.

5. Jones DP, Mahmoud H, Chesney RW. Tumor lysis syndrome: pathogenesis and management. Pediatr Nephrol 1995;2:206-212.

6. Coggins CH. Renal failure in lymphoma. Kidney Int 1980;17:847-855.

7. Truong LD, Soroka S, Sheth AV, Kessler M, Mattioli C, Suki W. Primary renal lymphoma presenting as acute renal failure. Am J Kidney Dis 1987;9:502-506.

8. Malbrain ML, Lambrecht GL, Daelemans R, Lins RL, Hermans P, Zachée P. Acute renal failure due to bilateral lymphomatous infiltrates. Primary extranodal nonHodgkin’s lymphoma (p-EN-NHL) of the kidneys: does it really exist? Clin Nephrol 1994;42:163-169.

9. Ageitos AR, Bruno JF, Vázquez AM, López IC, Freire AP. Bilateral primary renal Burkitt lymphoma presenting with acute renal failure. An Pediatr (Barc) 2010;73:199-201.

10. Dash SC, Purohit K, Mohanty SK, Dinda AK. An unusual case of bilateral renal enlargement due to primary renal lymphoma. Indian J Nephrol 2011;21:56-58.

11. Arranz Arija JA, Carrion JR, Garcia FR, Tejedor A, PérezManga G, Tardio J, Menarguez FJ. Primary renal lymphoma: report of 3 cases and review of the literature. Am J Nephrol 1994;14:148-153.

12. Jindal B, Agarwala S, Bakhshi S, Jain V, Gupta AK, Kumar R, Bal CS, Iyer VK, Gupta SD. Bilateral primary renal lymphoma with orbital metastasis in a child. Pediatr Blood Cancer 2009;52:539-541.

13. Buyukpamukçu M, Varan A, Aydin B, Kale G, Akata D, Yalçin B, Akyuz C, Kutluk T. Renal involvement of non-Hodgkin’s lymphoma and its prognostic effect in childhood. Nephron Clin Pract 2005;100:86-91.

14. Lowe LH, Isuani BH, Heller RM, Stein SM, Johnson JE, Navarro OM, Hernanz-Schulman M. Pediatric renal masses: Wilms tumor and beyond. Radiographics 2000;20:15851603.

15. Kobrinsky NL, Sposto R, Shah NR, Anderson JR, DeLaat C, Morse M, Warkentin P, Gilchrist GS, Cohen MD, Shina D, Meadows AT. Outcomes of treatment of children and adolescents with recurrent non-Hodgkin’s lymphoma and Hodgkin’s disease with dexamethasone, etoposide, cisplatin, cytarabine, and l-asparaginase, maintenance chemotherapy, and transplantation: Children’s Cancer Group Study CCG5912. J Clin Oncol 2001;19:2390-2396.

193

DOI: 10.4274/Tjh.2012.0070

Case Report

Megadose Methylprednisolone (MDMP) Treatment in a Patient with Autoimmune Hemolytic Anemia (AIHA) Resistant to Conventional Corticosteroid Administration: A Case Report Konvansiyonel Kortikosteroid Uygulamasına Resiztan Otoimmün Hemolitik Anemili Bir Hastanın Megadoz Metilprednizolonla Tedavisi Şinasi Özsoylu1,2, Henriette WA Berenschot2 1Fatih

University, School of Medicine, Department of Hematology, Ankara, Turkey

2Albert

Schweitzer Hospital, Division of Hematology, Dordrecht, Netherlands

Abstract: A female in the Netherlands with severe autoimmune hemolytic anemia (AIHA) was treated with conventional corticosteroid (2 mg/kg/d in divided doses) and blood transfusions for 18 months without improvement. The presented patient responded to megadose methylprednisolone (MDMP) 30 mg/kg/d for 3 d, followed by 20 mg/kg for 4 d, and subsequently 10, 5, 2, and 1 mg/kg/d each for 1 week.

Key Words: Autoimmun hemolytic anemia, Megadose methylprednisolone

Özet: Ağır otoimmün hemolitik anemili bir kadın hasta 18 ay konvansiyonel kortizon (2 mg/kg/gün bölünmüş dozlarda) uygulamasına cevap vermeyince splenektomi planlandığı için bize başvurdu. Oral megadoz metilprednizolon (MDMP; 30 mg/kg/gün 3 gün, 20 mg/kg/gün 4 gün verildikten sonra haftada 10, 5, 2 ve 1 mg/kg/gün dozlarda) sabah 6’da verilmesi ile kısa sürede Coombs pozitifliği devam etmesine rağmen hemoliz durdu ve hematolojik bulgular düzeldi. Son 18 aydan beri tedavi almayan hastada Coombs pozitifliği devam etmekte ise de hemoliz olmaksızın şikâyetsiz olarak yılda bir kere kontrole gelmek üzere takip edilmektedir.

Anahtar Kelimeler: Otoimmün hemolitik anemi, Megadoz metilprednizolon

Introduction A 36-year-old female suddenly developed pallor, tachycardia, fatigue, jaundice, and dark urine. She was diagnosed with as autoimmune hemolytic anemia (AIHA) Address for Correspondence: Şinasi ÖZSOYLU, M.D., Fatih University, School of Medicine, Department of Hematology, Ankara, Turkey E-mail: sinasiozsoylu@hotmail.com Received/Geliş tarihi : June 04, 2012 Accepted/Kabul tarihi : September 19, 2012

194

based on a high reticulocyte count, positive direct Coombs test, hemoglobinuria, and low haptoglobin level, and received the conventional treatment of prednisone (2 mg/ kg in divided doses) and blood transfusions. Tests for paroxysmal nocturnal hemoglobinuria were negative, and

Özsoylu Ş, et al: Megadose Methylprednisolone (MDMP) Treatment in a Patient with Autoimmune Hemolytic Anemia (AIHA) Resistant to Conventional Corticosteroid Administration: A Case Report

acquired thrombotic thrombocytopenic purpura and Evans syndrome were excluded. As her low hemoglobin level could not be corrected with prednisone treatment, the symptoms and signs persisted, and transfusion requirement did not decrease during 18 months, the possibility of splenectomy was discussed with her. She was then referred to us for meagdose methylprednisolone (MDMP) treatment before splenectomy [1,2,3,4,5].

The patient presented to us for the first time on 18 March 2006 in Ankara after having received transfusion.

She appeared pale, depressed, cushingoid, and jaundiced, which was more severe in the sclerae. Her blood pressure was 106/65 mm/Hg, pulse rate was 112/min, and temperature was 36.5 °C. Her spleen and liver were 2 cm and 1 cm below the respected costal margins. Her Hb level was 8.2 g/dL, Hct was 26%, and reticulocyte count was >20%. Peripheral blood smear showed several spherocytes and macrocytes, and polychromasia and anisocytosis were noted. Hemoglobinuria (not hematuria), unconjugated bilirubinemia (3.35 mg%), elevated LDH (491 U/L), normal vitamin B12 (439 pg/mL), and normal folic acid (13.24

Turk J Hematol 2013;30:194-197

ng/mL) were noted; therefore, her macrocystosis (MCV: 106.7 fL) was considered to be associated with her marked reticulocytosis.

She was started on our MDMP treatment regimen, as follows: 30 mg/kg/d for 3 d, followed by 20 mg/kg/d for 4 d, and then 10, 5, 2, and 1 mg/kg/d each for 1 week [1].

Each dose was given orally at about 0600 by placing the methylprednisolone (MP) powder in a tablespoon and covering it with honey, as the taste of MP is extremely bitter. Dark urine due to hemoglobinuria disappeared on d 3 of treatment and scleral jaundice cleared markedly after 1 week, along with a decrease in bilirubinemia (1.86 mg/ dL). Her hemoglobin started to increase (Hb: 9.2 g/dL; Hct: 28.4%) during the first week of MDMP treatment as her reticulocyte count decreased (8.19%). Her early morning blood sugar was high (152 mg/dL), most likely due to ingestion of honey. She was administered saline nose drops to prevent of upper respiratory tract infection [7,8] and she was directed to walk rapidly as much as possible to prevent muscle atrophy, in addition to performing bicycling-like leg exercises when lying down.

Table 1: Laboratory findings during the first month of MDMP treatment (doses are also indicated).

15.03.2006 18.03.2006

24.03.2006

1.04.2006

6.04.2006

Hemoglobin (g/dL)

8.2

8.2

9.5

11.8

13.1

Hematocrit (%)

26

26

28.4

34.1

39

2.23

2.22

2.61

3.27

3.65

MCV (fL)

114

106.7

108 .7

104.5

107

Reticulocyte (%)

17.5

20.6

8.19

2.7

Haptoglobin

<0.03

<7

-

1.4

WBC (x109/L)

8.1

7.9

-

11.3

83

95.3

Erythrocyte

(1012/L)

Granulocytes (%) Plt (x109/L)

384

470

453

410

Direct Coombs

4+

4+

-

4+

Indirect Coombs Lactic dehydrogenase

negative 859

neg

491

Anti ds-DNA

negative

ANA

negative

394

Glucose (mg/dL)

152

HbAıc

5.8

ALT

N

N

-

AST

N

N

-

Bilirubin (mg/dL)

236

jaundice cleared

Indirect Prednol-L mg/kg/d (total, mg)

202

30 (2000)

3.99

1.86

20 (1500)

10 mg (750)

5mg (350) 195

Özsoylu Ş, et al: Megadose Methylprednisolone (MDMP) Treatment in a Patient with Autoimmune Hemolytic Anemia (AIHA) Resistant to Conventional Corticosteroid Administration: A Case Report

Turk J Hematol 2013;30:194-197

Her Hb (12.8 g/dL) and Hct (39%) returned to normal during the second week of the treatment, along with normalization of the haptoglobin level (1.4 g/L) and a decrease in the reticulocyte count (2.7%). Her spleen was non-palpable and urine glucose was positive (4+) without ketonuria; however, blood electrolytes, lipids, and pH levels were within normal limits; therefore, they were related to honey ingestion during the very early MDMP administration.

The patient began insulin (20 IU) and oral antidiabetic (glutazione t.i.d.) treatment when she was in the Netherlands prior to presentation. As her fasting blood glucose was 125 mg/dL before honey ingestion with MP, and her blood electrolytes, lipids, and pH were normal, insulin was discontinued the 8th week of the treatment. She started to complain about proctatatis, and a perianal abscess was diagnosed and drained the 10th week of the treatment, during which time she was taking MP 64 mg/d in the early morning. In addition, her oral antidiabetic treatment was discontinued at the same time, as she had only minor symptoms of hypoglycemia. She again appeared mildly cushingoid the 11th week of treatment, at which time her Hb (13.3g dL), Hct (39%), and MCV (92.1 fL) were normal, and her reticulocyte count (3.12%) was slightly elevated, and she was taking only MP 48 mg/d; her early blood sugar was 141 mg, but HbA1c was normal (3.97%) at that time.

Her peripheral blood smear was negative for spherocytes and polychromasia, despite Coombs positivity.

On the 6th month of treatment despite normal Hb (14.6 g/dL), Hct (42.1%), MCV (90.1), and reticulocyte count (1.34%) steroid-induced glaucoma was suspected. The MP dose was decreased (16 to 32 mg every other d) and eye drops (Betoptic) were prescribed. The MP dose was tapered to 16 mg/d on the 8th month of the treatment. During the 14th month of MDMP treatment she was taking MP 16 mg every 5 d, despite questionable direct Coombs positivity.

She has been engaged in normal daily activity without dietary restriction, and her blood pressure was 98/62 mm/ Hg. She does not have eye complaints and her eye tension has been almost normal during the last 4 months. At the time this report was prepared the patient was still using serum physiologic nose drops t.i.d. Her MP treatment was discontinued after 61 months of treatment despite Coombs positivity; however, her Hb level remained normal without any sign of hemolysis during the last 27-month period and she has had normal blood glucose for more than 5.5 years.

Discussion The presented patient is a good example that illustrates the necessity of giving corticosteroids once a day in the early morning, so as not to disturb ACTH corticosteroid homeostasis and prevent their side effects. With the exception of adrenal insufficiency divided corticosteroid doses should not be given. It is also important to note that MDMP treatment differs from pulse MP treatment (in which 196

MP 1000 mg is given intravenously at any time of the day within 4 h) and conventional corticosteroid treatment, both of which can suppress ACTH secretion, the main cause of steroidal side effects [6].

Steroid-induced glaucoma was suspected in the presented patient in about the 7th month of MDMP treatment, but her eye pressure was not evaluated prior to MDMP treatment though she had some vision complaints at presentation. As such, we repeatedly monitored for cataract, but the complaints were related to hypotension. Most importantly, her steroid induced diabetes was cured with MDMP, making her the second patient in which corticosteroid induced diabetes was cured during MDMP treatment [9]. Neither electrolytes nor lipid fraction disturbances were observed in the presented patient during hyperglycemic period, which was controlled without dietary or salt restriction as the MDMP dose decreased, as in our previous patient. Additionally, her chronic AIHA came under control after 1 week of MDMP treatment, hemoglobinuria resolved and the bilirubin level decreased after 3 d of MDMP; the only side effect was a mild cushingoid appearance that regressed after 2 months of the treatment, despite continuation of a relatively low dose of MP (48 mg/d).

MDMP treatment has been used to successfully treat more than 700 patients with different hematological and non-hematological disorders in whom corticosteroid administration was advised, and we have shown that MDMP treatment does not impair the growth of patients, even with long-term administarion [2,10]. Others [11] also supported our observations that corticosteroid side effects practically are not seen with our way of MDMP administration, such as hypertension, obesity and suppression of growth in children. MDMP has been used to treat AIHA patients [3,5].

Coombs test results were reported to have become negative in more than 4 cases with improvement of anemia in all patients [3,12] with prolonged administration of MDMP treatment, as in the presented patient. Also of importance is patient activity during MDMP treatment for the prevention of muscle atrophy and the use of saline nose drops for the prevention of upper respiratory system infections. We think that in addition to a decrease in antibody formation, an increase in the erythropoietin level with MDMP should be considered in the improvement of anemia.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Ozsoylu S, Coşkun T, Minassazi S. High dose intravenous glucocorticoid in the treatment of childhood acquired aplastic anaemia. Scand J Hematol 1984;33:309-316.

Özsoylu Ş, et al: Megadose Methylprednisolone (MDMP) Treatment in a Patient with Autoimmune Hemolytic Anemia (AIHA) Resistant to Conventional Corticosteroid Administration: A Case Report

2. Ozsoylu S. High-dose intravenous corticosteroid treatment for patients with Diamond-Blackfan syndrome resistant or refractory to conventional treatment. Am J Pediat Hematol Oncol 1988;10:217-223.

3. Ozsoylu S. High dose intravenous methylprednisolone (HIVMP) in hematologic disorders. Hematology Reviews 1990;4:197-207.

4. Ozsoylu S, Irken G, Karabent A. High-dose intravenous methylprednisolone for acute childhood idiopathic thrombocytopenic purpura. Eur J Hematol 1989;42:431435.

5. Yetgin S, Ozsoylu S. Comparison of megadose methylprednisolone versus conventional dose prednisolone in hematologic disorders. J Pediatr Hematol Oncol 2007;29:253-259.

6. Ozsoylu S. Megadose methylprednisolone for childhood Idiopathic thrombocytopenic purpura (ITP). Turk J Med Sci 2005;35:347-356.

Turk J Hematol 2013;30:194-197

8. Engin E, Kılınç Ö, Özsoylu Ş. Sağlık personelinin serum fizyolojik ile üst solunum yolları enfeksiyonlarından korunması. Yeni Tıp Dergisi 1997;14:211-212.

9. Ozturk G, Ozsoylu S. Megadose methylprednisolone for a corticosteroid induced diabetic patient with aplastic anemia.

Turk J Med Sci 1994;21:74.

10. Özsoylu Ş, İrken G, Gürgey A. High dose intravenous methylprednisolone for Kasabach-Merrit syndrome. Eur J Pediatr 1989;143:403-405.

11. Bernini JC, Carrillo JM, Buchanan GR. High-dose intravenous methylprednisolone therapy for patients with Diamond-Blackfan anemia refractory to conventional doses of prednisone. J Pediat 1995;127:654-659.

12. Gürgey A, Yenicesu I, Kanra T, Ozsoylu S, Altay C, Hiçsönmez G, Yetgin S, Tuncer M, Gümrük F, Cetin M. Autoimmune hemolytic anemia with warm antibodies in children: retrospective analysis of 51 cases. Turk J Ped 1999;41:467-471.

7. Ozsoylu S. Nose drops and commun cold. Eur J Pediatr 1985;144:294.

197

DOI: 10.5152/tjh.2011.98

Case Report

Langerhans Cell Sarcoma of the Axillary Lymph Node: A Case Report and Review of the Literature Aksiller Lenf Nodunun Langerhans Hücreli Sarkomu: Olgu Sunumu ve Literatürün Gözden Geçirilmesi Aylin Orgen Çallı1, Yelda Morgül1, İnci Alacacıoğlu2, Sadi Bener1, Bahriye Payzin2 1İzmir

Atatürk Training and Research Hospital, Department of Pathology, İzmir, Turkey

2İzmir

Training and Research Hospital, Department of Hematology, İzmir, Turkey

Abstract: Langerhans cell sarcoma is a rare, high-grade neoplasm with overtly malignant cytological features and the Langerhans phenotype. Herein, we present a rare case of Langerhans cell sarcoma in a 65-year-old female that presented with a painless enlarging mass in her right axillary region, along with the histopathological features and diagnostic characteristics in the light of literature on Langerhans cell sarcoma.

Key Words: Langerhans, Sarcoma, Axillary, Lymph node, Differential diagnosis

Özet: Langerhans hücreli sarkom malign sitolojik görünümlü ve Langerhans fenotipine sahip nadir görülen yüksek dereceli neoplazmdır. Biz, sağ aksiller bölgede büyümüş ağrısız kitlesi olan 65 yaşında Langerhans hücreli sarkom olgusunu sunduk ve Langerhans hücreli sarkomun tanısal ve histopatolojik özelliklerini literatür eşliğinde gözden geçirdik.

Anahtar Kelimeler: Langerhans, Sarkom, Aksiller, Lenf nodu, Ayırıcı tanı

Introduction Langerhans cell sarcoma (LCS), also known as malignant histiocytosis X, is a rare entity defined as a tumor characterized by its LC immunophenotype and appearance.

It has a high mitotic rate and anaplastic cytological features, and is usually observed in lymph nodes and skin, but may also affect the liver, spleen, and lungs [1,2,3,4,5]. The immunoprofile is (CD1a+, S100+), and some cells should have the characteristic LC features of grooved nuclei and/or Birbeck granules. LCS tends to affect the elderly and has an aggressive clinical course associated with a high mortality rate despite aggressive treatment [4].

Address for Correspondence: Aylin Orgen ÇALLI, M.D., İzmir Atatürk Training and Research Hospital, Department of Pathology, İzmir, Turkey Phone: +90 232 244 44 44/2586 E-mail: calliaylin@gmail.com Received/Geliş tarihi : April 18, 2011 Accepted/Kabul tarihi : October 25, 2011

198

Herein we report a new and unusual case of LCS in a 65-year-old female that presented with a mass in her axillary lymph node. The aim of this report was to emphasize that LCS, although rare, should be considered in the differential diagnosis because of its ability to mimic metastatic lesions in lymph nodes.

Case Presentation A 66-year-old female presented with a mass in the axilla that had been present for 4-5 months. Neither systemic symptoms nor a positive family history was observed.

Çallı AO, et al: Langerhans Cell Sarcoma of the Axillary Lymph Node: A Case Report and Review o the Literature

The patient had a history of type-2 diabetes mellitus and hypertension, and was using oral antidiabetics and amlodipine. All laboratory tests (complete blood count, serology, and microbiology), ultrasonographic examination, and computed tomography of the head and neck region, lungs, and lower abdomen were normal. At another clinic the mass was excised and diagnosed as breast carcinoma.

The patient was referred to our hospital for further investigation and treatment. Paraffin blocks were sent to our department for further pathological examination.

Microscopic observation showed that the lymph node architecture was partially preserved, with retention of normal or hypoplastic germinal centers (Figure 1). The infiltrate was seen primarily in the parafollicular and subcapsular regions (Figure 2). The patient’s sinuses were distended by large and pleomorphic tumor cells that contained abundant

Turk J Hematol 2013;30:198-203

pale eosinophilic cytoplasm and bizarre, grooved nuclei (Figure 3). Many of the cells exhibited multinucleation, nuclear lobulation, and high mitotic activity (Figure 4).

The neoplastic cells had the LC immunophenotype, and strongly expressed CD1a and S-100 (Figure 5, 6). The cells were also positive for fascin and weakly positive for CD45. The tumor cells were negative for CD30, ALK-1, CD-2, CD-3, CD-4, CD-8, CD-7, CD-11c, CD-20, CD-21, CD-45 RO, CD-68, granzyme B, Bcl-2 protein, HMB-45, Melan A, EMA, pan cytokeratin, and follicular dendritic cell marker (CD21). The biopsy specimen was diagnosed as LCS. The patient underwent total surgical resection. No chemotherapy or radiotherapy was planned. At the 1-year follow-up the patient was doing well.

Figure 3: Hematoxylin and eosin staining showing lymph node involvement of langerhans cell carcinoma. Sinusoidal infiltration by lymphoma cells is evident (HEx200).

Figure 1: Low power view of LCS (HEx100).

Figure 2: The follicle surrounded large, pleomorphic cells (HEx100).

Figure 4: Histopathologic slides shows large atypical cells with malignant features including hyperchromatic nuclei with prominent nucleoli, and high mitotic rate (HEx400).

199

Turk J Hematol 2013;30:198-203

Çallı AO, et al: Langerhans Cell Sarcoma of the Axillary Lymph Node: A Case Report and Review o the Literature

Fascin

(+)

Clusterin CD68

(–) (–) (+)

(–)

(–)

(–)

(–)

(–)

(+/–)

Table 1: Immunohistochemical profile of dendritic, histiocyte, and stromal cell types.

Immunohistochemical Marker

Langerin

(–)

(+)

CD123 CD163 CD4

CD1a

LCH only +

(–)

S100

CD45 CD21 CD23

(+)

(–)

(+)

CD35

Cell Type

(+)

(+/–)

(–)

(+)

(–)

(–/+)

(–)

(–)

(+)

(+)

(+)

(–)

LC

(–)

(+)

(–)

(–)

(–)

(–)

(+)

(–)

(+)

(+)

(–)

(+)

(–)

(+/–)

(–)

IDC

(+/–)

(–)

(–)

(–)

(–)

(–)

(+)

(–)

(–)

(+)

(–)

(+/–)

(+)

(–)

(+)

(–)

Macrophage or histiocyte

(–)

(–)

(–)

(+)

(–)

(+)

(–)

(–)

(–)

(+)

v

(–)

(+)

(–)

(+)

(–/+)

I/DDC

(–)

(–)

(–)

(–)

(–)

(–)

(–)

(–)

(–)

(+)

(+/–)

(–)

pDC

(+)

(–)

(–/+)

(+)

(–)

(+)

(+)

(–)

(+)

(–)

(–)

(–)

FDC

(–)

(+)

(–) (–)

(–) (–)

(–)

FXIIIa TCL1 Lysozyme

200

(–)

Figure 6: Tumor cells positive for immunostain for LCA (x400) (A), Tumor cells positive for immunostain for S-100 (x200) (B), Tumor cells positive for immunostain for EMA x400) (C), Tumor cells showed high Ki-67 proliferation index (x1000) (D).

(–)

Figure 5: Tumor cells diffuse positive for immunostain for CD1a (x200).

(+)

The diagnosis of LCS is based on the following: malignant cytological features, such as atypia, hyperchromatic

FRC

Mature/fully-differentiated histiocytic/dendritic cell neoplasms rarely affect hematopoietic or lymphoid tissues.

They have been categorized into subtypes based on their location, enzyme histochemistry, ultrastructure, and immunohistochemical features, and are further classified into 5 groups designated by the WHO, as follows: LC histiocytosis (LCH); LCS; interdigitating dendritic cell sarcoma/tumor (IDCS/T); follicular dendritic cell sarcoma/ tumor (FDCS/T); dendritic cell sarcoma, not otherwise specified [6].

Abbreviations LC: Langerhans cells; IDC: interdigitating dendritic cells; I/DDC: interstitial/dermal dendritic cells; pDC: plasmacytoid dendritic cell; FDC: follicular dendritic cell; FRC: fibroblastic reticular cell.

Immunostaining grades: +: strongly positive; +/−: subset positive; −/+: focally positive; −: negative; v: variable staining

Discussion

Turk J Hematol 2013;30:198-203

Çallı AO, et al: Langerhans Cell Sarcoma of the Axillary Lymph Node: A Case Report and Review o the Literature

Table 2: LCS cases reported since 1992.

Case Reference No.

Sex

Age

Site

Therapy Outcome

1

Tani et al. [1]

F

49

skin

CT

death

2

Lauritzen et al. [10]

M

38

skin

CT

partial remission after 12 months

3

Itoh et al. [2]

F

74

skin

SE+CT+RT death

4

Pileri et al. [6]

F

17

cervical

CT+RT

ACR

5

Pileri et al. [6]

M

46

cervical

CT

AWD

6

Pileri et al. [6]

M

28

mediastinal

None

death

7

Pileri et al. [6]

F

50

skin

NA

NA

8

Pileri et al. [6]

F

10

skin

SE+RT

ACR

9

Pileri et al. [6]

F

23

skin

CT

death

10

Pileri et al. [6]

M

65

lung, liver, generalized LAP

CT

death

11

Pileri et al. [6]

M

72

axillary mediastinal LAP, CNS lesions

CT

death

12

Pileri et al. [6]

F

50

bone

SE

ACR

13

Misery et al. [13]

F

38

skin

SE

ACR

14

Kawase et al. [14]

M

59

lymph node, bone marrow, spleen, skin

SE

death

15

Kawase et al. [14]

M

35

lung, liver, bone, lymph nodes

SE

death

16

Kawase et al. [14]

F

61

liver, spleen, lymph nodes

SE

death

17

Kawase et al. [14]

M

60

bone

RT

alive

18

Lee et al. [11]

M

34

lung

SE

ACR

19

Ferringer et al. [3]

M

33

posterior thigh skin

SE

ACR

20

Ju¨lg et al. [9]

M

81

lung, mediastinal,

SE

death

21

Lian et al. [12]

F

57

ankle bone

SE+CT+RT death

22

Bohn et al. [4]

M

47

lymph nodes, skin

SE+RT

AWD

23

Sumida et al. [15]

M

57

supraclavicular lymph node

CT

death

24

Zhao et al. [5]

F

74

gallbladder

SE

ACR

25

Nakayama et al. [16]

M

62

cervical lymph node

RT

ACR

26

Present case

F

65

axillary lymph node

SE

ACR

Abbreviations ACR: Alive in complete remission; AWD: alive with disease; NA: not available; CNS: central nervous system; SE: surgical excision; RT: radiation therapy: CT: chemotherapy.

nuclei, prominent nucleoli, and frequent mitotic figures; the appearance of typical Birbeck granules; a typical immunophenotype with consistent expression of CD1a and S-100 protein, and langerin. The most helpful clues in the diagnosis of LCS are the expression of several histiocytic markers, such as CD68, and the weak expression of lysozyme.

As LCH is also a proliferating disorder of Langerhans cells, LCH stains positive for CD1a and S-100 protein, and at times exhibits Birbeck granules, as does LCS. Polylobated and multinucleated Langerhans cells are, however, observed in LCS, and their nuclei are cytologically benign. With

approximately 10-20 mitoses 10 HPFs–1, mitotic activity is generally low. In contrast, LCS is often characterized by a preponderance of large cells with complex nuclear outlines and a substantial quantity of cytoplasm. The nuclei of tumor cells exhibit malignant cytological features, such as prominent nucleoli with occasional grooves and high mitotic activity [3,4,5,6].

LCS must be differentiated from histiocytic sarcoma and other dendritic cell tumors. Immunohistochemical studies are essential for the differential diagnosis, and neoplastic cells 201

Turk J Hematol 2013;30:198-203

Çallı AO, et al: Langerhans Cell Sarcoma of the Axillary Lymph Node: A Case Report and Review o the Literature

in LCS should stain with CD1a. CD1a is a highly sensitive and specific marker of LCS, as compared to other dendritic cells and dendritic cell neoplasms [7] (Table 1). LCS is an extremely rare aggressive neoplasm that occurs in lymph nodes and extranodal sites, such as the skin, gall bladder, and bone [1,2,3,4,5]. To the best of our knowledge the Englishlanguage literature includes only 25 previously reported cases of LCS (Table 2) [1,2,3,4,5,6,8,9,10,11,12,13,14,15].

LCS is usually associated with multiple organ involvement, including the skin, lymph nodes, lungs, bone, spleen, and liver. Patients range in age between 10 and 81 years, with a male-female ratio of approximately 1:1. At present, there are no reports on the organized series of treatment for LCS. The majority of reported cases had a short survival time and a poor prognosis, as shown in Table 1; 50% (12 patients) of 24 patients died of the disease within 2 years. Successful treatment of advanced multiple organ diseases is achievable with such systemic combination chemotherapy as the CHOP regimen (cyclophosphamidedoxorubicin hydrochloride-vincristine-prednisolone), which was used in 15 of the published cases [16]. When considering the findings associated with localized LCS, radiotherapy might be the best treatment; however, many more LCS case findings are necessary to more clearly identify an optimal treatment strategy. The presented case was treated with total excision of the mass only, and did not receive adjuvant chemotherapy or radiation. The patient was doing well at the 1-year follow-up.

In conclusion, LCS of the axillary lymph node is a rare lesion that mimics metastasis of breast cancer, both clinically and radiologically. Correct diagnosis can only be made based on histopathological examination. Due to the vastly different treatment options, pathologists should be aware of this unusual neoplasm in order to facilitate correct diagnosis.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Tani M, Ishii N, Kumagai M, Ban M, Sasase A, Mishima Y. Malignant Langerhans cell tumor. Br J Dermatol 1992;126:398-403.

2. Itoh H, Miyaguni H, Kataoka H, Akiyama Y, Tateyama S, Marutsuka K, Asada Y, Ogata K, Koono M. Primary cutaneous Langerhans cell histiocytosis showing malignant phenotype in an elderly woman: report of a fatal case. J Cutan Pathol 2001;28:371-378.

202

3. Ferringer T, Banks PM, Metcalf JS. Langerhans cell sarcoma.

Am J Dermatopathol 2006;28:36-39.

4. Bohn OL, Ruiz-Argüelles G, Navarro L, Saldivar J, SanchezSosa S. Cutaneous Langerhans cell sarcoma: a case report and review of the literature. Int J Hematol 2007;85:116120.

5. Zhao G, Meng L, Wu ZY, et al. Clinical and pathological features of Langerhans cell sarcoma: a case report of Langerhans cell sarcoma involving gallbladder and perineal lymph nodes. Int J Surg Pathol 2008;19:1.

6. Pileri SA, Grogan TM, Harris NL, Banks P, Campo E, Chan JK, Favera RD, Delsol G, De Wolf-Peeters C, Falini B, Gascoyne RD, Gaulard P, Gatter KC, Isaacson PG, Jaffe ES, Kluin P, Knowles DM, Mason DY, Mori S, Müller-Hermelink HK, Piris MA, Ralfkiaer E, Stein H, Su IJ, Warnke RA, Weiss LM. Tumours of histiocytes and accessory dendritic cells: an immunohistochemical approach to classification from the International Lymphoma Study Group based on 61 cases. Histopathology 2002;41:1-29.

7. Inamdar KV, Jones D. Histiocytic and Dendritic Cell Neoplasms.In: Jones D, ed. Neoplastic hematopathology: experimental and clinical approaches. Humana, Totowa;2010:459-477.

8. Jülg BD, Weidner S, Mayr D. Pulmonary manifestation of a Langerhans cell sarcoma: case report and review of the literature. Virchows Arch 2006;448:369-374.

9. Lauritzen AF, Delsol G, Hansen NE, Horn T, Ersbøll J, HouJensen K, Ralfkiaer E. Histiocytic sarcomas and monoblastic leukemias. A clinical, histologic, and immunophenotypical study. Am J Clin Pathol 1994;102:45-54.

10. Lee JS, Ko GH, Kim HC, Jang IS, Jeon KN, Lee JH. Langerhans cell sarcoma arising from Langerhans cell histiocytosis: a case report. J Korean Med Sci 2006;21:577-580.

11. Lian YL, He HY, Liao SL, Yin LJ, Han ZH, Zheng J. Langerhans cell sarcoma of talus: report of a case. Zhonghua Bing Li Xue Za Zhi 2006;35:697-698.

12. Misery L, Godard W, Hamzeh H, Lévigne V, Vincent C, Perrot JL, Gentil-Perret A, Schmitt D, Cambazard F. Malignant Langerhans cell tumor: a case with a favorable outcome associated with the absence of blood dendritic cell proliferation. J Am Acad Dermatol 2003;49:527-529.

13. Kawase T, Hamazaki M, Ogura M, Kawase Y, Murayama T, Mori Y, Nagai H, Tateno M, Oyama T, Kamiya Y, Taji H, Kagami Y, Naoe T, Takahashi T, Morishima Y, Nakamura S. CD56/ NCAM-positive Langerhans cell sarcoma: a clinicopathologic study of 4 cases. Int J Hematol 2005;81:323-329.

14. Sumida K, Yoshidomi Y, Koga H, Kuwahara N, Matsuishi E, Karube K, Oshima K, Gondo H. Leukemic transformation of Langerhans cell sarcoma. Int J Hematol 2008; 87:527-531.

Ă&#x2021;allÄą AO, et al: Langerhans Cell Sarcoma of the Axillary Lymph Node: A Case Report and Review o the Literature

15. Nakayama M, Takahashi K, Hori M, Okumura T, Saito M, Yamakawa M, Tabuchi K, Hara A. Langerhans cell sarcoma of the cervical lymph node: a case report and literature review. Auris Nasus Larynx 2010;37:750-753.

Turk J Hematol 2013;30:198-203

16. Yoshimi A, Kumano K, Motokura T, Takazawa Y, Oota S, Chiba S, Takahashi T, Fukayama M, Kurokawa M. ESHAP therapy effective in a patient with Langerhans cell sarcoma.

Int J Hematol 2008;87:532-537.

203

Case Report

DOI: 10.4274/Tjh.90692

Encephalitozoon intestinalis: A Rare Cause of Diarrhea in an Allogeneic Hematopoietic Stem Cell Transplantation (HSCT) Recipient Complicated by Albendazole-Related Hepatotoxicity Allojenik Hematopoietik Kök Hücre Nakli Alıcısında Albendazol Tedavisi Sırasında Gelişen Hepatotoksisite ile Komplike Olmuş Nadir Bir Diare Etkeni: Encephalitozoon Intestinalis Serdar Şıvgın1, Bülent Eser1, Leylagül Kaynar1, Fatih Kurnaz1, Hülya Şıvgın2, Süleyman Yazar3, Mustafa Çetin1, Ali Ünal1 1Erciyes

University, School of Medicine, Department of Hematology, Dedeman Stem Cell Transplantation Hospital, Kayseri, Turkey University, School of Medicine, Department of Medical Genetics, Kayseri, Turkey 3Erciyes University, School of Medicine, Department of Parasitology, Kayseri, Turkey 2Erciyes

Abstract: A 50-year-old male patient previously diagnosed with acute myelomonocytic (M4) leukemia in July 2009 underwent allogeneic hematopoietic stem cell transplantation (allo-HSCT). During the pre-transplant period complete blood count (CBC), liver and renal function tests, coagulation tests, and other parameters were normal. On the first day of transplantation teicoplanin (400 mg d–1 for the first 3 d, and then 400 mg d-1) and caspofungin (first dose was 1×70 mg d–1, followed by 1×50 mg d–1) were started intravenously due to white plaques and oropharyngeal candidiasis in the patient’s mouth and perianal erythema. On the 14th d of transplantation watery diarrhea occurred, along with abdominal discomfort, nausea, and fatigue.

Stool examination was negative for findings of bleeding. Investigation of Microsporidia confirmed a rare pathogen Encephalitozoon intestinalis in the patient’s stool sample via species-specific immunofluorescence antibody (IFA) assay and albendazole treatment was started at a dose of 2×400 mg d–1. On the 5th d of albendazole treatment (d 18 of treatment) liver function test (LFT) results began to deteriorate. As LFT results continued to deteriorate, albendazole was withdrawn on the 7th d of treatment. Biopsy was performed on the 22nd d of transplantation and histopathological analysis confirmed the diagnosis of toxic hepatitis. LFT results began to decrease after withdrawal of albendazole treatment. On the 13th d of albendazole treatment all LFT values returned to normal. The presented allo-HSCT case had a rare pathogenic agent (E. intestinalis) that caused diarrhea, as well as hepatotoxicity due to albendazole treatment. This is the first reported case of E. intestinalis diagnosed via IFA in Turkey.

Key Words: Allogeneic hematopoietic stem cell transplantation (allo-HSCT), Hepatotoxicity, Encephalitozoon intestinalis, Albendazole Address for Correspondence: Serdar ŞIVGIN, M.D., Erciyes University, School of Medicine, Department of Hematology, Dedeman Stem Cell Transplantation Hospital, Kayseri, Turkey Phone: +90 352 437 49 37 E-mail: drssivgin@gmail.com Received/Geliş tarihi : August 19, 2010 Accepted/Kabul tarihi : January 02, 2012

204

Şıvgın S, et al: Encephalitozoon intestinalis in HSCT Recipient

Turk J Hematol 2013;30:204-208

Özet: Önceden akut myelomonositik lösemi(M4) tanısı almış 50 yaşındaki erkek hastaya, Temmuz 2009’da allojenik hematopoietik kök hücre nakli yapıldı (AHKHN). Nakil öncesi dönemde, tam kan sayımı, karaciğer ve böbrek fonksiyon testleri, koagulasyon parametreleri ve diğer ölçümler normal bulundu. Naklin birinci gününde,orofaringeal candidiasisle birlikte ağız içindeki beyaz plaklar ve ayrıca perianal eritem nedeniyle hastaya intravenöz teikoplanin (ilk 3 gün 400mg/ gün ve sonrasında günde 400mg) ve kaspofungin (ilk doz 1x70 mg/gün ve sonrasında 1x50 mg/gün) başlandı. Naklin 14.gününde,karında huzursuzluk, bulantı ve yorgunluk gibi şikayetlerle birlikte sulu diare ortaya çıktı. gaita incelemesinde kanama bulgusu yoktu. Tür-özgün IFA metodu ile nadir bir patojen olan Encephalitozoon intestinalis tesbiti doğrulandı ve 2x400 mg/gün albendazol tedavisi hemen başlandı. Albendazol tedavisinin 5. gününde (naklin 18. günü), hastanın karaciğer fonksiyon testleri (KCFT) bozulmaya başladı. KCFT’nin bozulması devam ettiğinden, tedavinin 7. gününde albendazol kesildi. Naklin 22. gününde Kc biopsisi yapılarak, tanı patologlar tarafından ‘toxik hepatit’ olarak doğrulandı.

KCFT albendazol tedavisinin kesilmesinden sonra hızla düzelmeye başladı. albendazol tedavi sürecinin 13.gününde tüm KCFT değerleri normale döndü. Bu vaka; AHKHN yapılmış bir hastada nadir diare etkeni - Encephalitozoon intestinalis- ile albendazol tedavisi sırasında gelişen hepatotoksisiteyi göstermektedir. Ayrıca, IFA metodu ile Türkiye’den bildirilen ilk E. intestinalis vakasıdır.

Anahtar Kelimeler: Allojenik hematopoietik kök hücre nakli, Hepatotoksisite, Encephalitozoon intestinalis, Albendazol

Introduction Diarrhea is a major cause of morbidity and discomfort in patients undergoing high-dose chemotherapy and allogeneic hematopoietic stem cell transplantation (allo-HSCT) [1].

Infectious events, such as bacterial and viral gastro-enteritis, may be a more frequent cause of diarrhea than previously thought [2]. Inflammation of the intestinal mucosa due to chemotherapy, use of multiple medications such as prophylactic antimicrobials, and infection are common causes of diarrhea in allo-HSCT patients [3]. The incidence of infectious gastro-enteritis associated with allo-HSCT and autologous HSCT varies from 13% to 40% [4].

Microsporidia are obligate intracellular parasites that are recognized as important opportunistic pathogens in immunocompromised and transplanted patients [4,5].

Enterocytozoon bieneusi and, less frequently, Encephalitozoon intestinalis are the most prevalent Microsporidia species in humans; both of these are associated with enteric infections.

In clinical practice, albendazole is widely used for treatment of these pathogens. Herein we present a case previously diagnosed as myelomonocytic leukemia that underwent allo-HSCT and was complicated by hepatotoxicity due to antimicrobial treatment for a rare pathogenic microorganism E. intestinalis.

Case A 50-year-old male patient previously diagnosed with acute myelomonocytic (M4) leukemia in July 2009 was given 2 courses of doxorubicin and cytarabine as induction chemotherapy. After complete remission was achieved, high-dose cytarabine was given as a consolidation regimen.

The patient had 1 mismatched donor and underwent allo-HSCT. The conditioning regimen was busulfan +

cyclophosphamide. The laboratory findings were as follows: HBsAg: (–); anti-HDV: (–); anti-HCV: (–); anti-HEV: (–); anti-HBs: 96 mIU mL–1; anti-HBe: (–); ant-HBc Ig M: (–); anti-CMV Ig M: (–); anti-EBV Ig M: (–); anti-ParvoV IgM: (–); anti-HIV: (–). Clostridium difficile toxin A was negative and genetic analysis for inv (16) was negative. Complete blood count analysis was as follows: Hb: 14.6 dL–1 (13-17 g dL–1); WBC: 8790 μL–1 (4-10×103 μL–1); platelet count: 271,000 μL–1 (150-400×103 μL–1). Biochemical findings were as follows: glucose: 69 mg dL–1 (74-106 mg dL–1); BUN: 20 mg dL–1 (7.9-21 mg dL–1); creatinine: 0.87 mg L–1 (0.66-1.09 mg L–1); Ca: 10.3 mg dL–1 (8.8-10.6 mg dL–1); ALT: 20 u L–1 (0-35 u L–1); AST: 30 u L–1 (0-31 u L–1); ALP: 83 u L–1 (30-120 u L–1); GGT: 25 (0-38); albumin: 4.9 d L–1 (3.5-5.2 g dL–1); direct/indirect bilirubin: 1.01/0.19 mg dL–1 (0.3-1.2/0-0.2 mg dL: –1); LDH: 230 u L–1 (100-245 u L–1).

Prothrombin and activated partial thromboplastin time was 12 and 40.8 s–1 (12-18 and 26-44 s–1), respectively.

During the pre-transplant period the patient’s complete blood count (CBC), liver and renal function tests, coagulation tests, and other parameters were normal. No genetic aberrations or mutations were observed. Following administration of the conditioning regimen (busulphan + cyclophosphamide), the patient underwent allo-HSCT in January 2010. On the first d of transplantation teicoplanin (400 mg d–1 for the first 3 d, and then 400 mg d–1) and caspofungin (first dose 1×70 mg d–1, followed by 1×50 mg d–1) were given intravenously due to white plaques and oropharyngeal candidiasis in the patient’s mouth, and perianal erythema. On the second d of transplantation, imipenem (4×500 mg d–1) was added to the treatment due to neutropenic fever.

On the 14th d of the transplantation watery diarrhea occurred, along with abdominal discomfort, nausea, and fatigue. Stool examination showed no findings of 205

Turk J Hematol 2013;30:204-208

Şıvgın S, et al: Encephalitozoon intestinalis in HSCT Recipient

bleeding, but a rare pathogen E. intestinalis was detected via immunofluorescence antibody (IFA) assay (Figure 1), which was performed according to the manufacturer’s instructions, as follows: stool sample was diluted with PBS and filtrated through a 50-μm filter; 2 μL of the fecal sample suspension was placed on 18-well slides and dried for 1 h; the slides were fixed with methanol dipped subsequently in acetone for 10 min at –20 °C; 20 μL of the monoclonal antibodies was added to the slides and incubated for 30 min at room temperature in a humid atmosphere; the slides were washed in PBS 3 times; 20 μL of conjugate was added to the slides and incubated for 30 min at room temperature in the dark; cover slips were mounted on glass slides with 3 drops of anti-fading fluorescence mounting medium and viewed with a fluorescence microscope equipped with the 450-nm fluorescein filter.

Immediately after the diagnosis was confirmed, albendazole treatment was started at a dose of 2×400 mg

d–1. On the fifth d of albendazole treatment (18th day of treatment) LFT results began to deteriorate. First, teicoplanin was discontinued on the 18th day of transplantation, and imipenem together with caspofungin was initiated on the 19th d. As the LFT results continued to deteriorate, albendazole was discontinued on the seventh d of albendazole treatment (Table 1). The patient was thought to have toxic hepatitis and percutaneous liver biopsy was performed for differential diagnosis. During the pre-transplant period the patient did not have liver function abnormality and abdominal ultrasonography showed no pathological findings, such as hepatosteatosis or cholestatic disorder.

After the biopsy was performed on the 22nd day of transplantation, histopathological analysis of the specimen confirmed the diagnosis of toxic hepatitis. Stool examination was repeated 8 d after the diagnosis and was negative. As the patient’s diarrhea resolved, the medications used to treat diarrhea were withdrawn. LFT results began to decrease immediately after the discontinuation of albendazole treatment. On the 13th d of albendazole treatment, all LFT values returned to normal (Figure 2). The patient was discharged on d 34 of treatment.

Discussion Patients that undergo allo-HSCT are at risk of severe infectious complications during the post-transplant period.

Early infections are primarily attributed to neutropenia and to microbial invasion due to the breakdown of mucosal barriers. Microsporidia can cause disease in human immunodeficiency virus-infected patients and other immunocompromised individuals [6]. E. bieneusi and E. intestinalis are the 2 species that most often cause intestinal infection in humans, manifesting with malabsorption, watery diarrhea, abdominal pain, weight loss, and nausea.

Serological studies have suggested that several species of

Figure 1. E. intestinalis spores with IFA method.

Table 1: *LFT after albendazole treatment.

Days

1

2

3

4

5

6

7** 8

9

10

11

12

13

22

16

21

31

44

106

195

393

519

374

387

210

129

94

32

AST (u L )

26

36

45

70

181

327

623

704

366

287

120

66

50

45

GGT (u L–1)

99

96

73

74

92

112

194

321

276

214

270

210

184

122

ALP (u L–1)

92

95

66

74

98

108

169

158

255

194

219

168

154

147

Total BIL (mg dL–1)

0.08 0.09

0.07

0.09

0.12

0.13

0.20

0.85

0.30

0.41

0.65

0.60

0.61 0.51

Direct BIL (mg dL–1)

0.08 0.09

0.07

0.09

0.12

0.13

0.20

0.85

0.30

0.41

0.65

0.60

0.61 0.51

ALT (u L–1) –1

*Liver Function Tests (LFT). **Cessation of albendazole treatment.

ALT: Alanine transaminase; AST: aspartate transaminase; ALP: alkaline phosphatase; BIL: bilirubin; GGT: gamma glutamyl transpeptidase.

206

Turk J Hematol 2013;30:204-208

Şıvgın S, et al: Encephalitozoon intestinalis in HSCT Recipient

800 700 600 LFT

alt ast ggt alp

500 400 300 200 100 0

1

2

3

4

5

6

7

8

9 10 11 12 13 14 15 16 17 days

Figure 2: LFT after albendazole treatment.

Microsporidia may commonly infect immunocompetent adults; such infection is usually treated with albendazole and fumagillin.

The diagnosis of microsporidiosis is difficult. Although a variety of methods are used to detect Microsporidia in clinical laboratories, special stains and light microscopy are routinely used for detection [7,8]. Traditional PCR enhances the detection of Microsporidia and has been used in some clinical laboratories; however, many of the assays were developed for research purposes and do not lend themselves to routine use in clinical laboratories because of their cumbersome specimen processing and DNA extraction methods, as well as false-positive results [9], which may be due to cross contamination, and false-negative results that occur because of inadequate specimen storage, low target concentration, or the presence of fecal inhibitors; these include complex acidic polysaccharides protein, DNases, heme compounds, fat, and proteinases [10].

Liver dysfunction [11] is a common problem in HSCT recipients and it is important to determine its etiology in order to administer appropriate therapy. Liver dysfunction following HSCT may be due to a variety of causes, including graft-versus-host disease (GVHD), infections, hepatic veno-occlusive disease (VOD) drugs, transfusion-related hemochromatosis, viral hepatitis, and infiltration with leukemic cells [11,12]. In the presented patient there were no post-allo-HSCT complications due to the pre-transplant medication regimen. Anti-microbial prophylaxis consisted of oral fluconazole, moxifloxacin, acyclovir, and metronidazole, which were administered from the beginning of conditioning treatment until engraftment day (d 12). When the patient’s LFT results began to rise, we first considered that the other antiviral and antibiotic agents were the major cause of deterioration because there were no data available regarding the hepatotoxic effect of albendazole in allo-HSCT patients; however, albendazole treatment should be considered carefully in cases of hepatic dysfunction or chronic liver disease [13].

In the presented patient pre-transplant administration of metronidazole was not sufficient to avoid diarrhea due to

E. intestinalis. This species is primarily diagnosed in patients that have undergone solid organ transplantation, but is very rare in allo-HSCT patients, and data must thus be carefully monitored for future advances. Current reports of the efficacy of albendazole in the treatment of AIDS patients with E. intestinalis infection are inconsistent. The clinical manifestations of E. intestinalis infection in immunocompetent patients range from asymptomatic infections to self-limited diarrhea. The infectious form is a spore (1.8-5.0 μm) that is very resistant to environmental conditions [14]. The detection of spores in human feces or other human bodily fluids is very cumbersome and difficult. Treatment of E. intestinalis infection should continue for 14 d.

Differences in drug susceptibility between the various Microsporidia species that infect patients with AIDS have been documented in both prospective studies involving small numbers of patients and anecdotal case reports [15,16,17].

The most common clinical symptom of E. intestinalis infection is watery diarrhea [18], but symptoms indicative of dissemination to the urinary, hepatobiliary, and respiratory tracts are not unusual [19]. Preliminary data suggest that albendazole has potent antiparasitic efficacy in AIDS patients infected with E. intestinalis; however, experience with this drug is limited, as there have been fewer than 40 reported cases of human infection due to E. intestinalis [20].

To the best of our knowledge hepatotoxicity is not a rare complication of albendazole treatment, but the presented case is the first allo-HSCT patient to be diagnosed with E. intestinalis. The most common side effects of albendazole treatment are abdominal pain, nausea, vomiting, serum transaminase elevation, and rarely, leucopenia.

Prognosis after allo-HSCT is largely dependent on whether or not complications involving the liver, lung, and intestine can be avoided. This may be very important, as the diagnosis can be accomplished by interpretation of the clinical setting in which liver dysfunction occurs. As a conclusion, >1 possible cause of liver dysfunction may be identifiable in these critical patients, which can delay accurate diagnosis of any complication in the post-transplant period. In conclusion, pre-transplant prophylactic regimens may be insufficient to avoid all complications during the post-transplant period, and a wide variety of possibilities should be taken into account while evaluating clinical and laboratory abnormalities. The presented case is the first to have E. intestinalis infection diagnosed via IFA in Turkey.

This case presentation is the first to describe an allo-HSCT patient with a rare pathogenic agent E. intestinalis that caused diarrhea, as was well as hepatotoxicity due to albendazole treatment.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

207

Turk J Hematol 2013;30:204-208

Şıvgın S, et al: Encephalitozoon intestinalis in HSCT Recipient

References 1. van Kraaij MG, Dekker AW, Verdonck LF, van Loon AM, Vinjé J, Koopmans MP, Rozenberg-Arska M. Infectious gastro-enteritis: an uncommon cause of diarrhoea in adult allogeneic and autologous stem cell transplant recipients.

Bone Marrow Transplant 2000;26:299-303.

2. Yolken RH, Bishop CA, Townsend TR, Bolyard EA, Bartlett J, Santos GW, Saral R. Infectious gastroenteritis in bone-marrow-transplant recipients. New Engl J Med 1982;306:1010-1012.

3. Bilgrami S, Feingold JM, Dorsky D, Edwards RL, Bona RD, Khan AM, Rodriguez-Pinero F, Clive J, Tutschka PJ. Incidence and outcome of Clostridium difficile infection following autologous peripheral blood stem cell transplantation.

Bone Marrow Transplant 1999;23:1039-1042.

4. Lanternier F, Boutboul D, Menotti J, Chandesris MO, Sarfati C, Mamzer Bruneel MF, Calmus Y, Mechaï F, Viard JP, Lecuit M, Bougnoux ME, Lortholary O. Microsporidiosis in solid organ transplant recipients: two Enterocytozoon bieneusi cases and review. Transpl Infect Dis 2009;11:83-88.

5. Barbosa J, Rodrigues AG, Pina-Vaz C. Cytometric approach for detection of Encephalitozoon intestinalis, an emergent agent. Clin Vaccine Immunol 2009;16):1021-1024.

6. Wolk DM, Schneider SK, Wengenack NL, Sloan LM, Rosenblatt JE. Real-time PCR method for detection of Encephalitozoon intestinalis from stool specimens. J Clin Microbiol 2002;40:3922-3928.

7. Guerard A, Rabodonirina M, Cotte L, Liguory O, Piens MA, Daoud S, Picot S, Touraine JL. Intestinal microsporidiosis occurring in two renal transplant recipients treated with mycophenolate mofetil. Transplantation 1999;68:699-707.

8. Thellier M, Breton J. Enterocytozoon bieneusi in human and animals, focus on laboratory identification and molecular epidemiology. Parasite 2008;15:349-358.

9. Alfa Cisse O, Ouattara A, Thellier M, Accoceberry I, Biligui S, Minta D, Doumbo O, Desportes-Livage I, Thera MA, Danis M, Datry A. Evaluation of an Immunofluorescent-Antibody Test Using Monoclonal Antibodies Directed against Enterocytozoon bieneusi and Encephalitozoon intestinalis for Diagnosis of Intestinal Microsporidiosis in Bamako (Mali). J Clin Microbiol 2002;40:1715-1718.

10. Kim BK, Chung KW, Sun HS, Suh JG, Min WS, Kang CS, Sim SI, Shin WS, Kim CC. Liver disease during the first posttransplant year in bone marrow transplantation recipients: retrospective study. Bone Marrow Transplantation 2000;26;193-197.

208

11. El-Sayed MH, El-Haddad A, Fahmy OA, Salama II, Mahmoud HK. Liver disease is a major cause of mortality following allogeneic bone-marrow transplantation. Eur J Gastroenterol Hepatol 2004;16:1347-1354.

12. Aksoy DY, Tanriover MD, Uzun O, Zarakolu P, Ercis S, Ergüven S, Oto A, Kerimoglu U, Hayran M, Abbasoglu O. Diarrhea in neutropenic patients: a prospective cohort study with emphasis on neutropenic enterocolitis. Ann Oncol 2007;18:183-189.

13. Wichro E, Hoelzl D, Krause R, Bertha G, Reinthaler F, Wenisch C. Microsporidiosis in travel-associated chronic diarrhea in immune-competent patients. Am J Trop Med Hyg 2005;73:285-287.

14. Stine SW, Vladich FD, Pepper IL, Gerba CP. Development of a method for the concentration and recovery of microsporidia from tap water. J Environ Sci Health A Tox Hazard Subst Environ Eng 2005;40:913-925.

15. Cali A, Kotler DP, Orenstein JM. Septata intestinalis N. G., N. Sp., an intestinal microsporidian associated with chronic diarrhea and dissemination in AIDS patients. Microbiol 1993;40:101-112.

16. Weber R, Bryan RT, Schwartz DA, Owen RL. Human microsporidial infections. Clin Microbiol Rev 1994;7:426461.

17. Orenstein JM, Tenner M, Cali A, Kotler DP. A microsporidian previously undescribed in humans, infecting enterocytes and macrophages, and associated with diarrhea in an acquired immunodeficiency syndrome patient. Hum Pathol 1992;23:722-728.

18. Molina JM, Oksenhendler E, Beauvais B, Sarfati C, Jaccard A, Derouin F, Modaï J. Disseminated microsporidiosis due to Septata intestinalis in patients with AIDS: clinical features and response to albendazole therapy. J Infect Dis 1995;171:245-249.

19. Orenstein JM, Dieterich DT, Lew EA, Kotler DP. Albendazole as a treatment for intestinal and disseminated microsporidiosis due to Septata intestinalis in AIDS patients: a report of four patients. AIDS 7 1993;(Suppl 3):40-42.

20. Weber R, Sauer B, Spycher MA, Deplazes P, Keller R, Ammann R, Briner J, Lüthy R. Detection of Septata intestinalis in stool specimens and coprodiagnostic monitoring of successful treatment with albendazole. Clin Infect Dis 1994;19:342-345.

DOI: 10.4274/Tjh.2012.0173

Letter to the Editor

Co-occurrence of Papillary and Follicular Thyroid Carcinoma in a Patient with Hodgkin’s Disease Papiller ve Folliküler Tiroit Kanserlerinin Hodgkin’s Lenfomalı Bir Hastada Eş Zamanlı Olarak Saptanması Mehmet Aşık1, Faruk Özkul2, Hüseyin Toman3, Ahmet Durmuş4, İnan Anaforoğlu5, Fahri Güneş6, Erdem Akbal7 1Çanakkale

Onsekiz Mart University, Faculty of Medicine, Department of Endocrinology and Metabolism, Çanakkale, Turkey Education and Research Hospital, Department of General Surgery, Trabzon, Turkey 3Çanakkale Onsekiz Mart University, Faculty of Medicine, Department of Anesthesia and Reanimation, Çanakkale, Turkey 4Numune Education and Research Hospital, Department of Hematology, Trabzon, Turkey 5Numune Education and Research Hospital, Department of Endocrinology and Metabolism, Trabzon, Turkey 6Çanakkale Onsekiz Mart University, Faculty of Medicine, Department of General Medicine, Çanakkale, Turkey 7Çanakkale Onsekiz Mart University, Faculty of Medicine, Department of Gastroenterology, Çanakkale, Turkey 2Numune

To the Editor, Hodgkin’s disease (HD) is a lymphoproliferative neoplasm primarily of B cell origin. The annual incidence of HD is estimated to be 1-3 cases per 100,000 people in the world [1]. Developments in multi-agent chemotherapy regimens in HD have increased the survival rates significantly.

However, these patients have begun to encounter late therapy toxicities, such as secondary solid and hematologic tumors, infertility, and pulmonary and cardiac events, which lead to delayed mortality. Second solid tumors may develop long after the first HD diagnosis. However, synchronous tumors in HD occur rarely. In addition, synchronous thyroid malignancies in HD are extremely rare. To our knowledge, up to the present only a few cases of synchronous HD and thyroid malignancies have been reported. We present a HD patient who demonstrated 2 different kinds of thyroid cancer in the early period.

A 42-year-old man was admitted to the hematology department complaining of a lump in the neck, weight loss, and night sweats. Physical examination was unremarkable other

than left cervical lymphadenopathy and thyroid nodules.

Laboratory tests showed normal hemogram, biochemistry, and thyroid function results. Cervical ultrasound revealed large (up to 6×4.5 cm) bilateral, multiple conglomerated lymphadenopathies in the submandibular, cervical, and supraclavicular districts. In addition, it showed 3-cm (the largest size) multiple nodules bilaterally in the thyroid lobes. An excisional biopsy of the cervical lymphadenopathy demonstrated a mixed cellularity type of HD. However, fine needle aspiration biopsy of the thyroid nodules had not been performed. With systemic work-up, the staging procedures and bone marrow aspiration biopsy were consistent with stage IIB: unfavorable. An ABVD chemotherapy protocol (adriamycin, bleomycin, vinblastine, and dacarbazine, once every 2 weeks) was begun with the patient. When response to treatment was evaluated after 3 courses of chemotherapy, the lymphadenopathies had disappeared on computerized tomography. The treatment was continued and completed with 6 cycles. When PET/CT was performed to evaluate the patient’s response to treatment, a focal uptake in the neck was seen, confined to the thyroid lobes (SUVmax: the upper

Address for Correspondence: Mehmet AŞIK, M.D., Çanakkale 18 Mart University, Faculty of Medicine, Department of Endocrinology and Metabolism, Çanakkale, Turkey.

GSM: +90 505 265 30 177 E-mail: mehmetzu@yahoo.com Received/Geliş tarihi : November 11, 2012 Accepted/Kabul tarihi : January 28, 2013

209

Turk J Hematol 2013;30:209-210

Aşık M, et al: Co-occurrence of Papillary and Follicular Thyroid Carcinoma in a Patient with Hodgkin’s Disease

part of the right lobe and left lobe of the thyroid, 10.80 and 14.35, respectively). Lymphadenopathy was not seen.

The patient was given a total thyroidectomy. Pathologic examination demonstrated a mass of about 2.5 cm in size, a follicular thyroid carcinoma in the right thyroid lobe, and a micropapillary thyroid carcinoma of approximately 0.6 cm in size in the left thyroid lobe. The patient was given 100 mCi radioactive iodine therapy in the post-operative period.

In post-ablation scanning there was no uptake, except in the thyroid bed. The patient continues to be followed in remission for the 3 diseases for 3 years.

For the first time in our present case, we have detected both HD and 2 different pathologies of thyroid cancer.

Previously, only one case was reported in which HD and thyroid papillary cancer were seen simultaneously [2]. Our present case showed follicular thyroid carcinoma in the right thyroid lobe and micropapillary thyroid carcinoma in the left thyroid lobe. We think the reason for this is coincidence.

Choice of treatment in HD is based on the extent or stage of the disease. Stage of the disease is determined according to the Cotswolds modified Ann Arbor staging system. It is evaluated by clinical staging techniques that include physical, laboratory, and imaging tools. Combined chemotherapy is used for early-stage unfavorable HD. At present, 4-6 cycles of ABVD chemotherapy protocol are usually used for stage I-II A/B unfavorable disease, because it highly effective and has a favorable toxicity profile.

inadequate to distinguish between benign and malignant nodules. Thyroid fine needle aspiration for cytology is the initial procedure of choice [6]. If our present patient had been evaluated by fine needle aspiration biopsy at first admission, his thyroid cancers would have been diagnosed earlier. When HD was diagnosed, we focused on the primary disease and its staging because HD rarely occurs together with a second primary thyroid malignancy. In conclusion, every patient with HD with thyroid nodules should be evaluated with a thyroid biopsy.

Conflict of Interest None of authors of this paper has any conflicts of interest, including specific financial interests, relationships, and/or affiliations, relevant to the subject matter or materials included in this manuscript.

Key words: Hodgkin’s disease, Thyroid carcinoma, Fine needle aspiration biopsy References 1. Parkin DM, Whelan SL, Ferlay J, Teppo L, Thomas DB. Cancer incidence in five continents. Volume VIII. IARC Sci Publ 2002;155:1-781.

2. Dudeque Pianovski MA, de Lacerda Filho L. A teenager with simultaneous Hodgkin disease and thyroid carcinoma.

Med Pediatr Oncol 2003;41:91-92.

The second malignancy emerging after therapy of HD has been mainly solid tumors. With prolonged follow-up after HD treatment, an annual incidence of second solid tumors of approximately 29 per 10,000 patients is seen [2].

The most common secondary cancers have been observed for the breast, lung, stomach, and bladder [3]. Risk factors for second cancers occurring after treatment of HD include exposure to radiotherapy and younger age. Increased risk of solid cancers is not expected for patients treated solely with chemotherapy [4]. The development of a second thyroid cancer in HD has been associated especially with radiotherapy treatment in the neck region [5]. Recently, one study revealed that radiotherapy treatment leads to an 18-fold increased risk of a second thyroid cancer compared to the general population [4]. The latent period after radiotherapy treatment is an important factor for developing a second thyroid cancer, with a mean latent period of 10-12 years [4,5].

3. Ng AK, Bernardo MP, Weller E, Backstrand KH, Silver B, Marcus KC, Tarbell NJ, Friedberg J, Canellos GP, Mauch PM. Long-term survival and competing causes of death in patients with early-stage Hodgkin’s disease treated at age 50 or younger. J Clin Oncol 2002;15:2101-2108.

Nodules of the thyroid are commonly encountered in clinical practice. Routine laboratory tests are usually

6. Mazzaferri El. Management of a solitary thyroid nodule. N Engl J Med 1993;328:553-559.

210

4. Sklar C, Whitton J, Mertens A, Stovall M, Green D, Marina N, Greffe B, Wolden S, Robison L. Abnormalities of the thyroid in survivors of Hodgkin’s disease: data from the Childhood Cancer Survivor Study. J Clin Endocrinol Metab 2000;85:3227-3232.

5. Dores GM, Metayer C, Curtis RE, Lynch CF, Clarke EA, Glimelius B, Storm H, Pukkala E, van Leeuwen FE, Holowaty EJ, Andersson M, Wiklund T, Joensuu T, van’t Veer MB, Stovall M, Gospodarowicz M, Travis LB. Second malignant neoplasms among long-term survivors of Hodgkin’s disease: a population-based evaluation over 25 years. J Clin Oncol 2002;15:3484-3494.

DOI: 10.4274/Tjh.2012.0013

Letter to the Editor

Dasatinib May Override F317L BCR-ABL Kinase Domain Mutation in Patients with Chronic Myeloid Leukemia Dasatinib F317L BCR-ABL Mutasyonu Olan Kronik Miyeloid Lösemi Hastalarında Etkili Olabilir Ahmet Emre Eşkazan1, Teoman Soysal2 1Diyarbakır 1İstanbul

Training and Research Hospital, Department of Hematology, Diyarbakır, Turkey

University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey

To the Editor, The most common mechanisms for resistance in patients with chronic myeloid leukemia (CML) receiving imatinib mesylate are BCR-ABL kinase domain (KD) mutations. The mutations are stratified according to in vitro 50% inhibitory concentration (IC50) values. The F317L KD mutation has been shown to induce a 9- to 13.5-fold increase of dasatinib IC50 with respect to wild-type BCR-ABL in cellular assays [1].

The pharmacokinetic data showed that F317L is predicted to be moderately sensitive to dasatinib [2]. Jabbour et al. [3] published data on a cohort of 20 CML patients with F317L mutation and evaluated the characteristics and outcomes of these patients with tyrosine-kinase inhibitor (TKI) therapy.

Among these 20 patients, F317L was detected in 12 after imatinib failure and in 8 after dasatinib failure. In the postimatinib failure group, 3 patients received dasatinib. The best achieved response was partial hematologic response in 1 and complete hematologic response (CHR) in 2. Müller et al. [4] also reported the results of analysis of original dasatinib phase 2/3 trial data according to pre-existing mutations. Of the 402 patients with baseline KD mutations, 14 had F317L mutations; 13 (93%), 2 (14%), and 1 (7%) achieved CHR, major cytogenetic response (MCyR), and complete cytogenetic response (CCyR), respectively. None of the patients achieved major molecular response (MMR).

Among our CML cohort, we identified KD mutations by the denaturing high performance liquid chromatography sequencing method as described before [5]. In the literature, it has been recently demonstrated by our group as well as by some others that there are CML patients with F317L mutation who achieved and maintained both CCyR and MMR with dasatinib after imatinib failure (Table 1) [6,7,8,9].

Dasatinib is known to have significant therapeutic activity against the Src kinases, and this is responsible for several of its “off-target effects”. Pulmonary toxicity [i.e. pleural effusion (PE)] following dasatinib use can be observed in CML patients [10]. Lymphocytosis in CML patients receiving dasatinib might have contributed to therapeutic efficacy, and Mustjoki et al. [11] showed a strong association between clonal T/NK cell expansion and lymphocytic PE under dasatinib therapy and prolonged stable responses in patients with advanced Ph-positive leukemias. Among the 4 CML cases described in the literature with F317L in which MMR was achieved with dasatinib, 3 had episodes of reversible dasatinib-induced PEs and modest lymphocytosis was seen in 1 (Table 1). These clinical and laboratory findings may be attributed to the good response in these patients.

In conclusion, evidence indicating the resistance of the F317L mutation to TKIs mainly comes from in vitro

Address for Correspondence: Teoman SOYSAL, M.D., İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey Gsm: +90 532 465 82 44 E-mail: soysal12@istanbul.edu.tr Received/Geliş tarihi : January 14, 2013 Accepted/Kabul tarihi : February 01, 2013

211

212

Oyekunle et al., 2011 [7]

Eskazan et al., 2011 [8]

Intermesoli 40/M et al., 2011 [9]

2

3

4

L-CP

E-CP

L-CP

L-CP

CML stage at the start of imatinib

CCyR

CCyR and MMR

CHR and mCyR

CCyR

Best response to imatinib

36

38

25

27

Response duration to imatinib, months

54

38

31

42

Duration of imatinib treatment, months

CML stage at imatinib failure

E255K

none

H396R

CP

CP

CP

E279K and CP H396R

KD mutations other than F317L

140

100

140

140

Dasatinib dose, mg/ day

34

38

54

20

Duration of dasatinib treatment, months

CCyR and CMR

CCyR and CMR

CCyR and MMR

CCyR and MMR

Best response to dasatinib

none

PE

PE

PE and lymphocytosis

Off-target effects of dasatinib

66

38

60

35

Followup after imatinib failure, months

M= male, F= female, L-CP= late chronic phase, E-CP = early chronic phase, CP= chronic phase, CCyR= complete cytogenetic response, MMR= major molecular response, CMR= complete molecular response, mCyR= minor cytogenetic response, DAS= dasatinib, PE= pleural effusion.

45/F

59/F

Faber et al., 52/M 2010 [6]

Age in years/ sex

1

Author, year

Table 1: Characteristics of CML patients with F317L mutation with MMR under dasatinib published in the literature.

Turk J Hematol 2013;30:211-213

EĹ&#x;kazan AE, et al: Dasatinib in CML patients with F317L

Eşkazan AE, et al: Dasatinib in CML patients with F317L

studies. Since mutations are classified on the basis of their in vitro sensitivity to TKIs, the in vivo outcomes may not be in accordance with in vitro studies in every case. The presence of the F317L KD mutation may not uniformly predict poor outcomes in CML patients mainly on dasatinib.

Outcomes may be related to a complex interplay of several factors possibly including the off-target effects of the TKI. It is important to carefully investigate and monitor individual patients, and although a switch to a TKI with better in vitro potency against a mutation may improve outcome, this strategy might not always be necessary, especially if the patient is in durable cytogenetic or molecular response.

Conflict of Interest None of authors of this paper has any conflicts of interest, including specific financial interests, relationships, and/or affiliations, relevant to the subject matter or materials included in this manuscript.

References 1. O’Hare T, Walters DK, Stoffregen EP, Jia T, Manley PW, Mestan J, Cowan-Jacob SW, Lee FY, Heinrich MC, Deininger MW, Druker BJ. In vitro activity of Bcr-Abl inhibitors AMN107 and BMS-354825 against clinically relevant imatinib-resistant Abl kinase domain mutants. Cancer Res 2005;65:4500-4505.

2. Laneuville P, Dilea C, Yin OQ, Woodman RC, Mestan J, Manley PW. Comparative In vitro cellular data alone are insufficient to predict clinical responses and guide the choice of BCR-ABL inhibitor for treating imatinib-resistant chronic myeloid leukemia. J Clin Oncol 2010;28:169-171.

3. Jabbour E, Kantarjian HM, Jones D, Reddy N, O’Brien S, Garcia-Manero G, Burger J, Cortes J. Characteristics and outcome of chronic myeloid leukemia patients with F317L BCR-ABL kinase domain mutation after therapy with tyrosine kinase inhibitors. Blood 2008;112:4839-4842.

Turk J Hematol 2013;30:211-213

5. Erbilgin Y, Çatal S, Eşkazan AE, Hatırnaz Ö, Sosyal T, Özbek U. ABL gene kinase domain mutation scanning by denaturing high performance liquid chromatography sequencing method. Turk J Hematol 2011;28:97-102.

6. Faber E, Mojzikova R, Plachy R, Rozmanova S, Stastny M, Divoka M, Jarosova M, Indrak K, Divoky V. Major molecular response achieved with dasatinib in a CML patient with F317L BCR-ABL kinase domain mutation. Leuk Res 2010;34:91-93.

7. Oyekunle AA, Castagnetti F, Gugliotta G, Soverini S, Baccarani M, Rosti G. F317L BCR-ABL1 kinase domain mutation associated with a sustained major molecular response in a CML patient on dasatinib. Leuk Res 2011;35:118-120.

8. Eskazan AE, Soysal T, Erbilgin Y, Ozbek U, Ferhanoglu B. Chronic myeloid leukemia patients with F317L BCR-ABL kinase domain mutation are resistant to dasatinib: is that true for all the patients? Leuk Res 2011;35:145-146.

9. Intermesoli T, Castagnetti F, Soverini S, Bussini A, Spinelli O, Gnani A, Bassan R, Rosti G. Durable molecular response despite F317L and E255K mutations: Successful treatment of chronic myeloid leukemia with sequential imatinib, nilotinib and dasatinib. Leuk Res 2012;36:10-11.

10. Eskazan AE, Soysal T, Ongoren S, Gulturk E, Ferhanoglu B, Aydin Y. Pleural and pericardial effusions in chronic myeloid leukemia patients receiving low-dose dasatinib therapy. Haematologica 2011;96:15.

11. Mustjoki S, Ekblom M, Arstila TP, Dybedal I, Epling-Burnette PK, Guilhot F, Hjorth-Hansen H, Höglund M, Kovanen P, Laurinolli T, Liesveld J, Paquette R, Pinilla-Ibarz J, Rauhala A, Shah N, Simonsson B, Sinisalo M, Steegmann JL, Stenke L, Porkka K. Clonal expansion of T/NK-cells during tyrosine kinase inhibitor dasatinib therapy. Leukemia 2009;23:1398-1405.

4. Müller MC, Cortes JE, Kim DW, Druker BJ, Erben P, Pasquini R, Branford S, Hughes TP, Radich JP, Ploughman L, Mukhopadhyay J, Hochhaus A. Dasatinib treatment of chronic-phase chronic myeloid leukemia: analysis of responses according to preexisting BCR-ABL mutations.

Blood 2009;114:4944-4953.

213

DOI: 10.4274/Tjh.2012.0044

Letter to the Editor

DDAVP Might Reduce the Risk of Preeclampsia in Pregnant Women with VWF Deficiency DDAVP VWF Eksikliği olan Gebelerde Preeklampsi Riskini Azaltabilir Alireza Hamidian Jahromi1,2, Mehran Karimi2 1Louisiana

State University Health Sciences Center, Department of Surgery, Shreveport, LA, United States

2Hematology

Research Center, Shiraz University of Medical Sciences, Shiraz, Iran

To the Editor, Preeclampsia is the most common medical disorder of pregnancy [1]. Preeclampsia can present very early in pregnancy with hypertension and proteinuria. Preeclampsia includes a spectrum of clinical symptoms varying from subtle weight gain and swelling of the face and extremities to severe headache, abdominal pain, nausea, vomiting, and visual impairment. Endothelial cell changes along with widespread fibrin deposition in the microvasculature are parts of the proposed pathophysiological changes in this medical condition [1]. Presence of an impaired fibrinolysis pathway along with the overactive coagulation cascade present in the patients with severe preeclampsia can lead to multiple organ dysfunctions [1].

Women with early-onset preeclampsia, i.e. presentation earlier than 34 weeks gestational age, constitute a subgroup of patients with more severe and more common hematologic abnormalities [1]. The Paris Collaborative Group [2] performed a metaanalysis of 31 randomized trials of preeclampsia primary prevention, which included more than 32,000 pregnant women, and proposed that administration of antiplatelet agents during pregnancy was associated with “moderate but consistent reductions in the relative risk of preeclampsia” [2]. All of the above evidence Address for Correspondence: Mehran KARIMI, M.D., Hematology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran Phone: 0098-7116473239 E-mail: karimim@sums.ac.ir Received/Geliş tarihi : February 09, 2013 Accepted/Kabul tarihi : March 14, 2013

214

supports the theory that platelet–endothelial interaction can have a central role in the pathogenesis of preeclampsia.

Von Willebrand Factor (VWF) is a polymeric plasma glycoprotein comprising multiple 250-kDa subunits that facilitates platelet adhesion to the vessel wall by linking platelet membrane receptors to the subendothelium and is the cornerstone of platelet–endothelial interaction. It also serves as the plasma carrier for Factor VIII and actually stabilizes the molecule.

VWF is synthesized and released from the endothelial cells and megakaryocytes into the circulation [3].

Desmopressin (DDAVP) induces release of stored factor VIII and VWF into the circulation. Due to this effect, DDAVP is a known treatment for mild VWF and factor VIII deficiency.

It has been suggested that DDAVP use during pregnancy is safe for both mother and child [4]. In a review of the literature on the safety of DDAVP during pregnancy, Ray found no evidence to support the idea that this medication might interact with oxytocin, cause early delivery, or have neonatal adverse effects [4]. DDAVP (0.3 μg/kg) was used in a preeclamptic patient with prolonged bleeding time in an attempt to correct her bleeding tendency and prepare her for epidural anesthesia [5]. It might be the case that DDAVP usage in pregnancy has a protective effect against the development of preeclampsia in women with VWF

Turk J Hematol 2013;30:214-215

Jahromi AH, et al: DDAVP Reduces Risk of Preeclampsia in Pregnancy

deficiency, as well. According to this hypothesis, DDAVP can be used in a single IV dose of 0.33 μg/kg between 28 and 34 weeks of gestational age, when risk of preeclampsia is high, with blood pressure being monitored while the DDAVP is used. It is safe during pregnancy and a randomized clinical trial is proposed to confirm this hypothesis.

On the other hand, VWF deficiency could be a risk factor for preeclampsia. Given this fact, it might be possible that women with VWF deficiency will have increased risk of developing preeclampsia. Thus, in the case of preeclampsia associated with bleeding symptoms, VWF deficiency should be taken into account. DDAVP can be considered in such cases as an alternative treatment.

Key Words: DDAVP, Preeclampsia, Pregnancy, Deficiency, Platelet

References 1. Heilmann L, Rath W, Pollow K. Hemostatic abnormalities in patients with severe preeclampsia. Clin Appl Thromb Hemost 2007;13:285-291.

2. Askie LM, Duley L, Henderson-Smart DJ, Stewart LA; PARIS Collaborative Group. Antiplatelet agents for prevention of pre-eclampsia: a meta-analysis of individual patient data.

Lancet 2007;369:1791-1798.

3. Cohan N, Karimi M. Diagnosis and management of von Willebrand disease in Iran. Semin Thromb Hemost 2011;37:602-606.

4. Ray JG. DDAVP use during pregnancy: an analysis of its safety for mother and child. Obstet Gynecol Surv 1998;53:450-455.

5. Fragneto RY, Datta S. Epidural analgesia in a preeclamptic parturient after normalization of a prolonged bleeding time with DDAVP. Reg Anesth 1995;20:448-451.

215

DOI: 10.4274/Tjh.2012.0147

Letter to the Editor

Imatinib-Induced Psoriasis İmatinibe Bağlı Psoriasis Olgusu Figen Atalay1, Ebru Kızılkılıç2, R. Simin Ada3 1Başkent

University School of Medicine, Department of Hematology, İstanbul, Turkey University, School of Medicine, Department of Hematology, Istanbul, Turkey 3Başkent University School of Medicine, Department of Dermatology, İstanbul, Turkey 2Maltepe

To the Editor, Imatinib is a signal transduction regulator that selectively inhibits the tyrosine kinase family, including bcr-abl and c-kit, and the platelet-derived growth factor (PDGF) receptor. It is currently the first-line therapy for newly diagnosed chronic myeloid leukemia (CML) patients [1].

We report the case of a patient who had no previous history of psoriasis but developed psoriasis after starting imatinib.

A 21-year-old woman was diagnosed with CML in the chronic phase. Imatinib mesylate was started at a daily dose of 400 mg. The patient achieved a complete hematological response within 3 months. Five months after her CML diagnosis and imatinib usage, she developed an erythematous scaly eruption with plaques of various sizes on her trunk and extremities (Figures 1, 2, and 3). She had no previous history of psoriasis and had not taken any drugs except for imatinib, nor did she have any relatives with a history of psoriasis. The patient underwent a skin biopsy, which revealed a neutrophilic scale crust and loss of the granular cell layer, which are most consistent with psoriasis (Figure 4). The discontinuation of imatinib treatment and subsequent introduction of narrowband ultraviolet B therapy improved the skin condition, and her psoriatic skin lesions had almost disappeared within 3 weeks. Since that time, nilotinib has been started. So far, the patient has not complained of any cutaneous side effects, and she achieved a complete cytogenetic response at 6 months and remains clinically well, currently receiving nilotinib at a dose of 200 mg twice daily.

Address for Correspondence: Figen ATALAY, M.D., Başkent University, School of Medicine, Department of Hematology, İstanbul, Turkey Phone: +90 216 554 15 00 E-mail: f_noyan@yahoo.com Received/Geliş tarihi : October 09, 2013 Accepted/Kabul tarihi : January 14, 2013

216

Cutaneous reactions to imatinib are common and may occur in 7% to 88.9% of patients in different series.

Maculopapular eruptions, erythematous eruptions, edema, and periorbital edema are the most common adverse events seen [2]. In 2002, Miyagawa et al. reported a patient who had intractable psoriasis but experienced significant improvement while being treated with imatinib for

Figure 1: Scaly erythematous papules and plaques on the right arm.

Atalay F, et al: Imatinib-Induced Psoriasis

Turk J Hematol 2013;30:216-218

Figure 4: Parakeratosis, leukocyte abscesses in the keratin layer (big arrow), psoriasiform hyperplasia of the epithelium, loss of the granular layer areas of parakeratosis, leukocyte abscesses in the surface epithelium, superficial perivascular lymphocytes (small arrows), extravasated erythrocytes.

Figure 2: Erythematous papulosquamous lesions on the lower extremities.

Figure 3: Scaly erythematous papules and plaques on the neck, upper extremities, and and trunk.

concomitant metastatic gastrointestinal stromal tumors [3].

Valeyrie et al. also reported psoriatic dermatological changes in 4 out of 54 patients who were using imatinib. Two of these 4 patients had no history of psoriasis [2,4]. Psoriasis has long been identified as an immune disorder in which T lymphocytes play a primary role in the pathogenesis. Imatinib affects cytokine production and the proliferation of T cells and inhibits the secretion of interferon-c by T effector cells.

These effects, together with imatinib’s suppression of c-kit and PDGF receptors, may help to explain the exacerbation of psoriasis in some patients [5,6,7,8,9]. The cause of imatinibrelated nonpsoriatic forms of skin lesions is not clear. The most probable cause is the fact that imatinib affects mast cells. Because mast cells express a functional c-kit, which is susceptible to imatinib, this drug causes mast cells to proliferate. Another mechanism involves chemoattractant substances, such as cytokines and growth factors, which can lead to an accumulation of dermal mast cells. Imatinibrelated skin toxicities are usually dose-dependent, and skin biopsies have shown a mixed cellular infiltrate [10]. In our case, we replaced imatinib with nilotinib therapy, and the psoriasis has not recurred over the course of about 1 year. The patient still maintains a complete molecular and hematological response. Imatinib-induced skin reactions can be self-limiting, but occasionally drug withdrawal is required. This case demonstrates that imatinib can cause psoriasis to occur or can exacerbate the condition. In cases where patients using imatinib develop psoriasis, nilotinib can be a safe alternative.

Key words: Chronic Myelogenous Leukemia, Imatinib, Psoriasis 217

Turk J Hematol 2013;30:216-218

Atalay F, et al: Imatinib-Induced Psoriasis

References 1. Scheinfeld N. Imatinib mesylate and dermatology part 2: a review of the cutaneous side effects of imatinib mesylate. J Drugs Dermatol 2006;5:228-231.

2. Heidary N, Naik H, Burgin S. Chemotherapeutic agents and the skin: an update. J Am Acad Dermatol 2008;58:545-570.

3. Miyagawa S, Fujimoto H, Ko S, Hirota S, Kitamura Y. Improvement of psoriasis during imatinib therapy in a patient with a metastatic gastrointestinal stromal tumour. Br J Dermatol 2002;147:406-407.

4. Valeyrie L, Bastuji-Garin S, Revuz J, Bachot N, Wechsler J, Berthaud P, Tulliez M, Giraudier S. Adverse cutaneous reactions to imatinib (STI-571) in Philadelphia chromosomepositive leukemias: a prospective study of 54 patients. J Am Acad Dermatol 2003:48:201-206.

5. Amitay-Laish I, Stemmer SM, Lacouture ME. Adverse cutaneous reactions secondary to tyrosine kinase inhibitors including imatinib mesylate, nilotinib, and dasatinib.

Dermatol Ther 2011;24:386-395.

218

6. Dickens E, Lewis F, Bienz N. Imatinib: a designer drug, another cutaneous complication. Clin Exp Dermatol 2009;34:603-604.

7. Krane JF, Murphy DP, Gottlieb AB, Carter DM, Hart CE, Krueger JG. Increased dermal expression of platelet-derived growth factor receptors in growth-activated skin wounds and psoriasis. J Invest Dermatol 1991;96:983-986.

8. Yamamoto T, Katayama I, Nishioka K. Possible contribution of stem cell factor in psoriasis vulgaris. J Dermatol Sci 2000;24:171-176.

9. Leder C, Ortler S, Seggewiss R, Einsele H, Wiendl H. Modulation of T-effector function by imatinib at the level of cytokine secretion. Exp Hematol 2007;35:1266-1271.

10. Thachil J. T-regulatory cell response in psoriasis and changes with imatinib therapy. Clin Exp Dermatol 2009;34:e1022.

DOI: 10.4274/Tjh.2012.0186

Letter to the Editor

Adsorptive Leukocytapheresis in Inflammatory Bowel Diseases: Our Preliminary Results are Encouraging İnflamatuvar Barsak Hastalıklarında Adzorptif Lökositaferez Uygulaması: İlk Sonuçlarımız Oldukça Cesaret Verici Murat Törüner1, Selami Koçak Toprak2, Kiraz Mızrak3, Yasin Yıldırım3, Meltem Bay3, Erol Ayyıldız3, Osman İlhan3 1Ankara

University, School of Medicine, Department of Gastroenterology, Ankara, Turkey

2Başkent

University, School of Medicine, Department of Hematology, Ankara, Turkey

3Ankara

University, School of Medicine, Department of Hematology, Therapeutic Apheresis Unit, Ankara, Turkey

To the Editor, Inflammatory bowel disease (IBD), consisting of ulcerative colitis (UC) and Crohn’s disease (CD), is a chronic recurrent disorder with unclear etiology. A close relation to autoimmune status featured by antibodies against colonic epithelial cells was suggested in light of recent studies [1]. Although 5-aminosalicylates and corticosteroids are frequently used in treatment, the management of both conditions is far from being fully satisfactory [2]. Thus, many biological treatment methods, like targeting cytokines involved in intestinal inflammation, have been developed in the last decade with various results in terms of efficacy and safety. One of them is cytapheresis, which aims to suppress and reduce impaired immune responses in the diseased intestine by removing circulating activated leukocytes, especially granulocytes, which have been shown to cause intestinal crypt abscess.

Two patients (Table 1) who were refractory to their present treatments were administered adsorptive cytapheresis (leukocytapheresis - Cellsorba®) at our unit in 80-min sessions once a week for a total of 5 weeks following required legal permissions. No complications related to the

method were observed and in the CD case, the discharge from the fistula stopped, while in the UC case, bloody defecation and the need for erythrocyte suspensions disappeared. In both patients, the quality of life increased along with weight gain and the complaints were almost completely removed.

Leukocytapheresis is an extracorporeal removal of activated granulocytes and monocytes, representing the major source of pro-inflammatory cytokines in the intestinal mucosa, from the blood using special filters or columns.

Table 1: Features of patients and the procedure.

Crohn’s disease

Ulcerative colitis

Age (years)

20

41

Sex

Female

Male

Weight (kg)

40

58

Processed volume (median, mL) Procedure time (median, min)

3500 (3000-4000) 87 (78-89)

Address for Correspondence: Selami Koçak TOPRAK, M.D., Başkent University, School of Medicine, Department of Hematology, Ankara, Turkey GSM: +90 532 656 02 06 E-mail: sktoprak@yahoo.com Received/Geliş tarihi : November 29, 2012 Accepted/Kabul tarihi : January 22, 2013

219

Turk J Hematol 2013;30:219-220

Törüner M, et al: Adsorptive Leukocytapheresis in Inflammatory Bowel Diseases

Table 2: Pre- and post-procedure laboratory tests results.

Parameter

Crohn’s disease

Ulcerative colitis

Pre-procedure

Post-procedure

Pre-procedure

Post-procedure

WBC (×109/L)

7.3

6.5

7.35

7

Hb (g/dL)

9.4

9.6

9.2

10.7

292

290

341

220

ESR (mm/h)

77

45

88

49

CRP (mg/L)

111

21

42.5

2.3

PLT

(×109/L)

WBC: White blood cells, Hb: hemoglobin, PLT: thrombocytes, ESR: erythrocyte sedimentation rate; CRP: C-reactive protein.

Cellsorba® (Asahi Medical, Tokyo, Japan), an adsorptive column, is made of non-woven polyester fiber filter and is able to remove about 90%–100% of granulocytes and monocytes, 30%–60% of lymphocytes, and 30% of platelets from the peripheral blood [2]. Pro-inflammatory cytokines like TNF-α, IL-2, IL-8, and IFN-γ, which are especially high in patients with IBD, and acute phase reactants like C reactive protein and erythrocyte sedimentation rate are close to the normal limits following leukocytapheresis. Additionally, CD14(dull)CD16+ monocytes, which are specifically known as the source of TNF-α and IL-12, are selectively removed from peripheral blood and, thus, Cellsorba may be presented as an extracorporeal anti-TNF-α therapy [3]. In a pilot study including 20 UC cases refractory to conventional treatments, the procedure was performed once a week for 5 consecutive weeks and a clinical response was observed in 14 patients, while an endoscopic response was observed in 6 patients.

In the responding group, the significance of the response in patients receiving monthly maintenance apheresis therapy continued when compared to the observation arm [4]. In another study containing 18 active CD cases, the procedure was performed once a week for 5 consecutive weeks, followed by monthly maintenance apheresis therapy, and it was reported that clinical remission was achieved at a rate of 50% [5]. In our 2 cases, although pro-inflammatory cytokines were not evaluated, the decrease in levels of acute phase reactants and the marked clinical-endoscopic response were both deemed significant (Table 2). However, for leukocytapheresis to show its efficiency and take its

220

place among the first line of treatment choices in IBD and especially CD, further randomized and controlled studies performed on large patient series and including long-term follow-up results are required.

References 1. Matsumoto T, Fukunaga K, Kamikozuru K, Tozawa K, Yokoyama Y, Kusaka T, Onishi K, Miwa H, Nakamura S. Cytapheresis as a non-pharmacological therapy for inflammatory bowel disease. Transfus Med Hemother 2008;35:18-23.

2. Danese S, Angelucci E, Stefanelli T, Omodei P, Luigiano C, Finazzi S, Pagano N, Repici A, Vecchi M, Malesci A. Cytapheresis in inflammatory bowel diseases: current evidence and perspectives. Digestion 2008;77:96-107.

3. Kanai T, Makita S, Kawamura T, Nemoto Y, Kubota D, Nagayama K, Totsuka T, Watanabe M. Extracorporeal elimination of TNF-alpha-producing CD14(dull)CD16(+) monocytes in leukocytapheresis therapy for ulcerative colitis. Inflamm Bowel Dis 2007;13:284-290.

4. Emmrich J, Petermann S, Nowak D, Beutner I, Brock P, Klingel R, Mausfeld-Lafdhiya P, Liebe S, Ramlow W. Leukocytapheresis (LCAP) in the management of chronic active ulcerative colitis--results of a randomized pilot trial.

Dig Dis Sci 2007;52:2044-2053.

5. Kosaka T, Sawada K, Ohnishi K, Egashira A, Yamamura M, Tanida N, Satomi M, Shimoyama T. Effect of leukocytapheresis therapy using a leukocyte removal filter in Crohn’s disease. Intern Med 1999;38:102-111.

DOI: 10.4274/Tjh.2012.0177

Letter to the Editor

A Case with Hypothyrodism Following Autologous Stem Cell Transplantation Otolog Kök Hücre Naklini Takiben Gelişen Hipotiroidi Vakası Berna Bozkurt Duman1, Semra Paydaş1, Mehtap Evran2 1Çukurova

University Medical Faculty, Department of Oncology, Adana, Turkey

2Çukurova

University Medical Faculty, Department of Endocrinology, Adana, Turkey

To the Editor, Hypothyroidism is the leading cause of thyroid dysfunction and can be seen in up to 40% of these patients and appropriate treatment is critical importance [1,2].

Hypothyroidism is seen most frequently in patients receiving total body irradition (TBI) containing conditioning regimens.

Hypothyroidism may be seen in cases receiving chemotherapyonly conditioning regimens but less frequently [3,4,5]. Here we report a case of hypoythyroidism detected 6 months after autologous hematopoietic stem cell transplantation (HSCT) for multiple myeloma (MM).

Case Report A 56-year-old woman was diagnosed with DurieSalmon stage IIIA and International Staging System stage II MM. Four cycles of VAD (Vincristine 0.4 mg for 4 days, doxorubicine 9mg/m2 for 4 days, dexamethasone 40mg for 12 days) and zoledronic acid were given. Bone marrow aspiration and biopsy was normal. Esbach was 12 g/day at the beginning and it was negative after therapy. Induction with high dose melphalan (200 mg/m2) and mobilization was performed with cyclophosphamide (4 g/m2) plus G-CSF (5-10 μg/kg/d) and HSCT was performed. Hypothyroidism was detected 6 months after transplantation. Free T3 was 0.462 pg/mL (N:T3: 2.3-4.2 pg/mL), free T4 was 0.179 ng/mL (N: 0.61-1.12 ng/mL), and TSH was 771.6 mIU/L

(N: 0.34-5.6 mIU/L). She had no known prior history of thyroid dysfunction. Antimicrosomal antibody was found to be high 600.1 U/mL (normal range: less than 50) and antityroglobuline was within normal limits (2.21 mg/dL).

At the beginning hypothyroidism could not be controlled and dose was increased up to 200 mcg (Table 1). TSH alpha subunit and hypophysis MR were performed. Pathologic finding was not found. She has been free of disease in followup for 3 years and with normal thyroid function.

Discussion The prevalence of posttransplant hypothyroidism is highly variable and is seen in up to 58% of the cases [1,2,3,4,5,6,7,8].

Niedzielska et al. reported on 16 patients after auto-HSCT and 30 patients after allo-HSCT; hypothyroidism was found in 5 of these patients (3 after allo-HSCT, 2 after auto-HSCT) in their series [9]. Post-transplant hypothyroidism is seen generally after a median of 1.5 to 2 years [3,4,9]. Earlier thyroid dysfunction as short as 6 months after HSCT was reported [7]. The current concept of pathogenesis immune thyroiditis after allogeneic transplantation is the transfer of a clone of donor lymphocytes with antithyroidal activity. T cells play an important role in thyroid damage and also complementmediated injury [10]. Significant hypothyroidism can be seen after autologous transplantation receiving chemotherapyonly condiotioning regimen. High levels of autoimmune markers may suggest the immune etiology.

Address for Correspondence: Berna Bozkurt DUMAN, M.D., Cukurova University Medical Faculty, Department of Oncology, Adana, Turkey Phone: +90 322 355 01, E-mail: berboz@hotmail.com Received/Geliş tarihi : November 20, 2012 Accepted/Kabul tarihi : January 02, 2013

221

Turk J Hematol 2013;30:221-222

Duman BB, et al: Posttransplantation Hypothyroidism

Table 1: Thyroid function tests at follow up.

Thyroid Before 07.08.2008 03.03.2009 Function Tx Tests mg/dL

06.05.2009

23.06.2009

23.07.2009 23.10.2009 22.12.2009 28.01.2010

Free T3

2.4

0.462

0.5

1.25

1.02

1.5

0.815

4.66

Free T4

1.1

0.065

0.179

0.538

0.516

0.446

0.206

2.78

TSH

3.3

681.1

771

315.4

324.6

326.4

452.5

0.378

TX*

Tx:transplantation *: The date of transplantation Normal levels for thyroid functions (free T3: 2.3-4.2 pg/mL. Free T4: 0.61-1.12 ng/mL. TSH: 0.34-5.6 mIU/L).

Refenences 1. Borgström B, Bolme P. Thyroid function in children after allogeneic bone marrow transplantation. Bone Marrow Transplant 1994;13:59-64.

6. Thomas BC, Stanhope R. Long-term treatment with growth hormone in Noonan’s syndrome. Acta Paediatr 1993;82:853-855.

2. Sklar CA, Kim TH, Ramsay NK. Thyroid dysfunction among long-term survivors of bone marrow transplantation. Am J Med 1982;73:688-694.

7. Kami M, Tanaka Y, Chiba S, Matsumura T, Machida U, Kanda Y, Nakagawa K, Mitsuhashi T, Tanaka Y, Hirai H. Thyroid function after bone marrow transplantation: possible association between immune-mediated thyrotoxicosis and hypothyroidism. Transplantation 2001;71:406-411.

3. Toubert ME, Socié G, Gluckman E, Aractingi S, Espérou H, Devergie A, Ribaud P, Parquet N, Schlageter MH, Beressi JP, Rain JD, Vexiau P. Short- and long-term follow-up of thyroid dysfunction after allogeneic bone marrow transplantation without the use of preparative total body irradiation. Br J Haematol 1997;98:453-457.

8. Abou-Mourad YR, Lau BC, Barnett MJ, Forrest DL, Hogge DE, Nantel SH, Nevill TJ, Shepherd JD, Smith CA, Song KW, Sutherland HJ, Toze CL, Lavoie JC. Long-term outcome after allo-SCT: close follow-up on a large cohort treated with myeloablative regimens. Bone Marrow Transplant 2010;45:295-302.

4. Michel G, Socié G, Gebhard F, Bernaudin F, Thuret I, Vannier JP, Demeocq F, Leverger G, Pico JL, Rubie H, Mechinaud F, Reiffers J, Gratecos N, Troussard X, Jouet JP, Simonin G, Gluckman E, Maraninchi D. Late effects of allogeneic bone marrow transplantation for children with acute myeloblastic leukemia in first complete remission: the impact of conditioning regimen without total-body irradiation--a report from the Société Française de Greffe de Moelle. J Clin Oncol 1997;15:2238-2246.

9. Somali M, Mpatakoias V, Avramides A, Sakellari I, Smias Ch, Anagnostopoulos A, Papachristou A, Antoniadou A. Thyroid dysfunction in adult long-term survivors after hemapoeitic stem-cell transplantation (HSCT). Horm Metab Res 2005;37:494-499.

5. Sanders JE. Late effects in children receiving total body irradiation for bone marrow transplantation. Radiother Oncol 1990;18 (Suppl 1):82-87.

222

10. Karthaus M, Gabrysiak T, Brabant G, Prahst A, Link H, Soudah B, Geissler RG, Diedrich H, Ganser A, Hertenstein B. Immune thyroiditis after transplantation of allogeneic CD34+ selected peripheral blood cells. Bone Marrow Transplant 1997;20:697-699.

DOI: 10.4274/Tjh.2013.0014

Letter to the Editor

First Observation of Hb South Florida [beta 1(NA1) Val>Met] in Turkey Türkiye’de Gözlenen ilk Hb South Florida [beta 1(NA1) Val>Met] Olgusu Ayça Dilruba Aslanger1, Aynur Akbulut2, Gül Tokgöz3, Sakine Türkmen4, Kanay Yararbaş5 1 Kocaeli

Derince Training and Research Hospital, Medical Genetics Department, Kocaeli, Turkey Kocaeli Derince Training and Research Hospital, Department of Pediatrics, Kocaeli, Turkey 3 Kocaeli Derince Training and Research Hospital, Department of Hematology, Kocaeli, Turkey 4 Hemoglobinopathy Screening Center, Child, and Family Planning, Department of Health of Mother, Kocaeli, Turkey 5Düzen Laboratory Group, İstanbul, Turkey 2

To the Editor, Hemoglobin (Hb) South Florida [beta1(NA1) Val>Met] is a rare beta hemoglobin variant that was first reported in 1985 from South Florida [1,2]. We report here, for the first time in Turkey, a 17-year-old female originally from Kars with Hb South Florida. She was referred to the Hemoglobinopathy Screening Center because of the history of thalassemia in some of her distant relatives. The variant was detected by high-performance liquid chromatography (HPLC) and confirmed with DNA sequencing. HPLC was performed with a Primus Ultra2 Hb variant analyzer (Trinity Biotech Dublin, Ireland) with the following results: Hb rate for HbA0 44%, HbA2 3.2%, spurious HbA1c peak (Acetyl Hb South Florida) 16%, Hb X1 (Hb South Florida 1) 26.3%, Hb X2 (Hb South Florida 2) 4.2%, and HbA1 (the sum of all HbA1 forms including those with several minor peaks [range: 0.1%3.4%]) 6.3% (Figure 1). Red blood cell parameters were all in normal ranges, as follows: Hb 13.2 g/dL, Hct 38.5%, RBC 4.8×1012/L, MCV 81 fL, MCH 27.7 pg, and MCHC 34.2 g/ dL. HbA1c was shown to be 3.0% with the Glycohemoglobin Analyzer’s standard analysis mode (Tosoh Bioscience, Tokyo, Japan). DNA sequencing (ABI 3130 Genetic Analyzer, Applied Biosystems, Foster City, CA, USA) confirmed this Hb variant

with a heterozygous mutation at the β-globin gene exon 1 codon 2 (c.4G>A, p.Val2Met, rs33395835, NG_000007.3).

This mutation, next to the initiation codon, was named as codon 1 by the Huisman Database [beta1(NA1) Val>Met] [3].

Hb South Florida was first reported in a Caucasian boy who had markedly elevated HbA1c (14.8%) [1,2]. The detecting methods for HbA1c have the potential of detecting coexisting Hb variants or hemoglobinopathies. However, the HPLC techniques for HbA1c testing used in many hospitals are not designed for diagnosing Hb variants [4]. Thus, our case had a spuriously high HbA1c result of 16% in HPLC for variant hemoglobinopathy analysis mode, which measures acetyl Hb, and HbA1c of 3% in HPLC for standard analysis mode. Therefore, it is hard to identify this variant with a routine HbA1c measurement.

This hemoglobin variant in the heterozygous state does not produce any clinical symptoms. Only one other patient from Malaysia has been reported since the original report with a compound heterozygote mutation of c.4G>A (GTG>ATG) and IVS1-1 (G→A) [5,6]. Although the combination of Hb South Florida with β-thalassemia was found in the Malay with no associated clinical symptoms except hematological results consistent with the beta thalassemia trait, we knew that the

Address for Correspondence: Ayça Dilruba ASLANGER, M.D., Kocaeli Derince Training and Research Hospital, Medical Genetics Department, Kocaeli, Turkey Phone: +90 262 317 80 00 E-mail: aaslanger@yahoo.com Received/Geliş tarihi : January 14, 2013 Accepted/Kabul tarihi : March 01, 2013

223

Turk J Hematol 2013;30:223-224

Aslanger AD, et al: First Observation of Hb South Florida [beta 1(NA1) Val>Met] in Turkey

variant with retention of initiator methionine and N-alphaacetylation. Proc Natl Acad Sci USA 1985;82:8448-8452.

Hb A0 44%

2. Shah SC, Malone JI, Boissel JP, Kasper TJ. Hemoglobin South Florida. New variant with normal electrophoretic pattern mistaken for glycosylated hemoglobin. Diabetes 1986;35:1073-1076.

Hb X1 (Hb South Florida 1) 26.3%

Hb X2 (Hb South Florida 2) 4.2%

Acetyl Hb South Florida (Spurious HbA1c peak) 16%

Hb A2 3.2%

1

2

3 Time (min)

4

5

6

Figure 1: HPLC result of heterozygous Hb South Florida case. interactions between 2 different Hb variants could result in more severe disease. This is especially important for countries like Turkey where the prevalence of the β-thalassemia carrier state and abnormal Hb is very high [7].

Key words: Abnormal hemoglobin, Hemoglobinopathy, HbA1c, Hb South Florida References 1. Boissel JP, Kasper TJ, Shah SC, Malone JI, Bunn HF. Aminoterminal processing of protein: hemoglobin South Florida, a

224

3. Huisman THJ, Carver MFH, Efremov GD. Hb South Florida. In: A Syllabus of Human Hemoglobin Variants (1996). Huisman Syllabus [database on the Internet]. The Sickle Cell Anemia Foundation, Augusta, GA, USA. Last accessed January 2013; available at http://globin.bx.psu. edu/cgi-bin/hbvar/query_vars3?mode=output&display_ format=page&i=713.

4. Thomas LB, Agosti SJ, Man MA, Mastroides SM. Screening for hemoglobinopathies during routine hemoglobin A1c testing using the Tosoh G7 Glycohemoglobin Analyzer. Ann Clin Lab Sci 2007;37:251-255.

5. Tan JA, Chin PS, Wong YC, Tan KL, Chan LL, George E. Characterization and confirmation of rare beta-thalassaemias mutations in the Malay, Chinese and Indian ethnic groups in Malaysia. Pathology 2006;38:437-441.

6. Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E. Interaction of Hb South Florida (codon 1; GTG→ATG) and HbE, with beta-thalassemia (IVS1-1; G→A): expression of different clinical phenotypes. Eur J Pediatr 2009;168:10491054.

7. Acemoglu H, Beyhun NE, Vancelik S, Polat H, Guraksın A. Thalassemia screening in a non-prevalent region of a prevalent country (Turkey): is it necessary? Public Health 2008;122:620-624.

DOI: 10.4274/Tjh.2013.0059

Letter to the Editor

Congenital Diaphragmatic Hernia and Iron Deficiency Anemia Konjenital Diafragmatik Herni ve Demir Noksanlığı Anemisi Şinasi Özsoylu Fatih University School of Medicine, Department of Hematology, Ankara, Turkey

To the Editor,

Reply,

The case described by Dr. Sarper and her colleagues in their letter to the editor, entitled “Severe iron deficiency anemia due to late presentation of congenital diaphragmatic hernia in a toddler”, was not a late but rather a delayed diagnosis case since iron deficiency anemia was diagnosed in this patient at least a year earlier with intermittent vomiting [1]. The diagnosis of a diaphragmatic hernia might be delayed up to at least 5 years of age as reported by us. This entity should not be extremely rare, since at least 9 patients in an 8-year period were seen by us [2]. We suggest that it should be looked for especially in very severe cases of iron deficiency anemia with frequent vomiting. Although restricted transfusion (<7 g/dL) was recommended in adult patients with upper gastrointestinal bleeding [3], as in the authors’ patients very severe anemia (<4 g/dL) was detected in 7 of our 9 patients.

References 1. Sarper N, Zengin E, Kılıç SÇ, Tugay M, Aydoğan A, Kayabey Ö. Severe Iron Deficiency Anemia due to late Presentation of Congenital Diaphragmatic Hernia in a Toddler. Turk J Hematol 2012; 29:430-431 2. Yetgin S, Hiçsönmez G, Altay Ç, Ozsoylu Ş. Diafragma hernisine bağlı demir eksikliği anemisi. Çocuk Sag ve Hast Dergisi 1973;16:209-213.

3. Villanueva C, Colomo A, Bosch A, et al. Transfusion strategies for acute upper gastroindestinal bleeding. New Eng J Med 2013;368:11-21.

In this case report [1], the title was “Late presentation of congenital diaphragmatic hernia….’’ because it is known that over 90% of the patients will be diagnosed either antenatally or will present with respiratory distress in the few hours of life [2]. The patient’s admission to our Center was at the age of 3 and she had a one-year history of intermittent vomitting and iron deficiency anemia. Özsoylu suggests that iron deficiency anemia due to diaphragmatic hernia is not very rare. Congenital diaphragmatic hernia occurs in about 1 in 3000 births [2]. It is not clear how many of these cases present with iron deficiency anemia. Similar to our message in the last paragraph, Özsoylu also emphasizes that in patients with very severe iron deficiency anemia and frequent vomiting diaphragma hernia must be considered in the differential diagnosis. We did not have the chance to reach Yetgin et al.’s paper as it is not present online [3].

References 1. Sarper N, Zengin E, Kılıç SÇ, Tugay M, Aydoğan A, Kayabey Ö. Severe Iron Deficiency Anemia due to late Presentation of Congenital Diaphragmatic Hernia in a Toddler. Turk J Hematol 2012; 29:430-431.

2. Davenport M , Holmes K. Current management of congenital diaphragmatic hernia. Br J Hosp Med 1995;53:95-101.

3. Yetgin S, Hiçsönmez G, Altay Ç, Özsoylu Ş. Diafragma hernisine bağlı demir eksikliği anemisi. Çocuk Sağ ve Hast Dergisi 1973;16:209-213.

Address for Correspondence: Şinasi ÖZSOYLU, M.D., Fatih University, School of Medicine, Department of Hematology, Ankara, Turkey Phone: +90 312 235 41 88 E-mail: sinasiozsoylu@hotmail.com Received/Geliş tarihi : February 17, 2013 Accepted/Kabul tarihi : February 18, 2013

225

DOI: 10.4274/Tjh.2013.0053

Letter to the Editor

Huge Dose Vitamin B12 (Vit B12) Treatment for Pernicious Anemia Pernisiöz Anemide Çok Yüksek Doz Vitamin B12 Tedavisi Şinasi Özsoylu Fatih University School of Medicine, Department of Hematology, Ankara, Turkey

To the Editor, The recent letter by Aytaç and colleagues, entitled “Poland syndrome associated with pernicious anemia and gastric dysplasia”, gives me an opportunity to question the vitamin B12 dose administered for the treatment of pernicious anemia [1].

Vitamin B12 was initiated by the authors (1000 μg daily for 5 days, 1000 μg weekly for 4 weeks, and then 1000 μg monthly for life) without taking into account that its daily requirement is 2 μg and its half-life is more than 350 days [2,3,4,5].

Although to my knowledge, vitamin B12 toxicity has not been reported, its extra benefit related to huge doses is also not known.

On this occasion, I would like to bring to attention that the Poland syndrome’s association with leukemia was previously reported by us [6].

References 1. Aytaç E, Durgun AV, Büyüktaş D, Erdamar S, Ongören S. Poland Syndrome Associated with Pernicious Anemia and Gastric Dysplasia Turk J Hematol 2012;29:441-444 2. Irken G, Özsoylu S, Yetgin S, Gurgey A et al. Çocukluk çağında vit B12 eksikliğine bağlı megalo blastik anemi. Çocuk Sag ve Hast. Dergisi 1989;32:29-37.

3. Özsoylu Ş. Gastrointestinal bulgularla giden bir konjenital Vitamin B12 eksikliği vakası. Çocuk Sağ ve Hast Der 2008;51:74-9.

4. Ozsoylu S. Vitamin B12 (vit B12) deficiency treatment in infants and its prevention. Turk J Pediatric 2011;53:718.

Address for Correspondence: Şinasi ÖZSOYLU, M.D., Fatih University, School of Medicine, Department of Hematology, Ankara, Turkey Phone: +90 312 235 41 88 E-mail: sinasiozsoylu@hotmail.com Received/Geliş tarihi : February 17, 2013 Accepted/Kabul tarihi : February 18, 2013

226

5. Özsoylu Ş. Vit B12 treatment. Eur J Pediatr 2012;171:737.

6. Hiçsönmez G, Özsoylu Ş. Poland syndrome and leukemia.

Am J Dis Children 1982;136:1098-9.

Authors’ reply: B-12 Regimen for Treatment of Pernicious Anemia It has been a great honor for us to have a chance to criticize the debatable topic with Professor Özsoylu, we appreciate his kind interest to our case presentation and also giving us the opportunity to comment on this issue.

The management strategy of the adult patient in our report was planned by considering existing B-12 deficiency and the operation performed subsequently, a total gastrectomy.

Although daily requirement and in-vivo metabolism of B-12 is known, some of the expert hematologists treat pernicious anemia with high dose B-12 in current clinical practice [1,2]. They also claim that beginning with high dose B-12 replacement helps delay relapse especially in patients who may discontinue treatment [1]. While there are various recommended schedules for vitamin B12 injections, there is no consensus on an exact B-12 regimen for pernicious anemia [2]. As Professor Özsoylu stated, new studies questioning B-12 regimen for pernicious anemia are needed.

Erman Aytac, Deram Buyuktas References 1. Carmel R. How I treat cobalamin (vitamin B12) deficiency.

Blood 2008;112:2214-2221.

2. Stabler SP. Clinical practice. Vitamin B12 deficiency. N Engl J Med 2013;368:149-160.

DOI: 10.4274/Tjh.2013.0050

Letter to the Editor

About Pyrimidine 5’-Nucleotidase Deficiency Pirimidin 5’nükleotidaz noksanlığı hakkında Şinasi Özsoylu Fatih University, School of Medicine, Department of Hematology, Ankara, Turkey

To the Editor,

Reply,

Agapidou et al.’s case of pyrimidine 5’-nucleotidase deficiency and heterozygous α-thalassemia was an interesting co-existence [1]. Did the authors have the chance to study the offspring for these hereditary conditions from birth?

We also reported a family with severe hereditary pyrimidine 5’-nucleotidase deficiency; in addition, 3 other families were also mentioned [2]. Since then 5 other patients also received this diagnosis. Therefore, I believe that this deficiency is not very rare in this area.

References 1. Agapidou A, Theodoridou S, Tegos K, Mandala E, Leukou E, Karakasidou O, Aletra B, Sevastidou A, Alemayehou M, Voskaridou E. Co-Existence of Hereditary Pyrimidine 5’-Nucleotidase Deficiency and Heterozygous α-Thalassemia: A Case Presentation. Turk J Hematol 2012;29:433-435.

2. Özsoylu Ş, Gürgey A. A case of hemolytic anemia due to erythrocyte pyrimidine 5’-nucleotidase deficiency. Acta Hematologica 1981;66:56-58.

Dear Mr Şinasi ÖZSOYLU I would like to thank you for your interest in our work. Concerning our manuscript entitled ‘”Co-Existence of Hereditary Pyrimidine 5-Nucleotidase Deficiency and Heterozygous α-Thalassemia” published in TJH, the specific patient was diagnosed during her early childhood in NIMITS hospital, Athens by Prof Tegos. She came to our center, in General Hospital Hippokratio Thessaloniki, Prevention Unit for her prenatal control and at that time we discovered that she was also heterozygous in α-thalassemia. We consider it an interesting case report because even though pyrmidine 5’-nucleotidase deficiency is not very rare in the area, it is quite difficult to diagnose it due to lack of specific centers dealing with such enzymic deficiencies and furthermore we describe a co-existence of pyrimidine 5’-nucleotidase deficiency and heterozygous α-thalasemia which is rare according to international literature. We are looking forward to further reviews.

Alexandra Agapidou

Address for Correspondence: Şinasi ÖZSOYLU, M.D., Fatih University, School of Medicine, Department of Hematology, Ankara, Turkey Phone: +90 312 235 41 88 E-mail: sinasiozsoylu@hotmail.com Received/Geliş tarihi : February 12, 2013 Accepted/Kabul tarihi : February 13, 2013

227

DOI: 10.4274/Tjh.2013.0052

Letter to the Editor

Megadose Methyl-Prednisolone (MDMP) for Autoimmune Hemolytic Anemia Otoimmün Hemolitik Anemi Tedavisinde Megadoz Metilprednizolon (MDMP) Şinasi Özsoylu Fatih University, School of Medicine, Department of Hematology, Ankara, Turkey

To the Editor,

References

Üsküdar Teke and colleagues originally used 1 mg kg–1 day–1 methylprednisolone (MDMP) for their patient with autoimmune hemolytic anemia without improvement, and after 3 weeks of steroid treatment splenic infarct developed.

The patient was splenectomized but the hemolytic anemia again did not improve. Therefore, azathioprine was prescribed [1].

1 Teke HU, Karahan S, Gumus U. Splenic infarct in a patient with autoimmune hemolytic anemia. Turk J Hematol.

2012;29:432-433

A 36-year-old woman with severe autoimmune hemolytic anemia was sent to me from the Netherlands, who was treated for more than 1.5 years with corticosteroid. Her anemia and hemolysis responded promptly to MDMP administration without disappearance of Coombs positivity [2].

3. Özsoylu Ş. Is a high homosystein level related to thrombosis?

TJH 2012;29:438.

The authors searched for causes of thrombophilia in their patient because of splenic infarct, without evaluation of the fibrinolytic system.

Since the coagulation depends on the dynamic balance between procoagulant and fibrinolytic activities, the later system should also be evaluated in the case of splenic infarct, I believe.

On this occasion, I would like to bring to attention that high homocysteine levels’ relation to thrombosis is doubtful, as was previously studied [3].

Address for Correspondence: Şinasi ÖZSOYLU, M.D., Fatih University, School of Medicine, Department of Hematology, Ankara, Turkey Phone: +90 312 235 41 88 E-mail: sinasiozsoylu@hotmail.com Received/Geliş tarihi : February 12, 2013 Accepted/Kabul tarihi : February 13, 2013

228

2. Özsoylu Ş, Berencshot H. Megadose prednisolone (MDMP) for a patient with autoimmune hemolytic anemia (AIHA) resistant to conventional corticostoroid administration.

(Accepted for publication by TJH)

Reply We want to thank for the comments of Şinasi ÖZSOYLU, MD. The new diagnosis in primary (idiopathic) autoimmune hemolytic anemia patients is suggested as glucocorticoids (steroids), prednison 1 mg/kg/day or metilprednisolon intravenously. With this dosage it is recommended to continue the treatment until the target hemoglobin value >10 g/dl and hematocrit value >30% are reached and if the target values are not reached within 3 weeks, second step of treatment should be applied [1]. In our case after 3 weeks steroid treatment, both symptomatic splenic infarct development and due to no result of 3 weeks steroid treatment splenectomy is applied simultaneously as a second step treatment. In our case due to splenic infarct development in accordance with etiology trombophilia investigation are

Turk J Hematol 2013;30:228-229

Özsoylu Ş, et al: Megadose Methyl-Prednisolone (MDMP) for Autoimmune Hemolytic Anemia

observed [2]. As Dr. Özsoylu has already specified, due to the coagulation being dependant on the dynamic balance between procoagulant and fibrinolytic activity, fibrinolytic system could have been evaluated as well. However, because of the insufficient laboratory conditions, investigation about the fibrinolytic system couldn’t have been done.

Hava Üsküdar Teke1, Samet Karahan2

References 1. Lechner K, Jager U. How I treat autoimmune hemolytic anemias in adults. Blood 2010;116:1831-1838.

2. Teke HÜ, Karahan S, Gümüş Ü. Splenic infarct in a patient with autoimmune hemolytic anemia. Turk J Hematol 2012;29:432-433.

1Eskişehir Osmangazi University, Faculty of Medicine, Department of Hematology, Eskişehir, Turkey 2Kayseri Education and Research Hospital, Depertmant of Internal Medicine, Kayseri, Turkey

229

Images in Hematology

Pseudo Chediak-Higashi Anomaly Psödo-Chediak-Higashi Anomalisi

Figure 1: Wright staining of a bone marrow smear shows large eosinophilic granules (PCH granules) within the blast and myeloid cells.

Zekai Avcı1, Barış Malbora2, Namık Özbek3 1Başkent University Faculty of Medicine, Department of Pediatric,

Hematology, Ankara, Turkey 2Dr. Sami Ulus Maternity and Children’s Hospital, Department of

Pediatric Hematology, Ankara, Turkey 3Başkent University Faculty of Medicine, Department of Pediatric

Hematology and Oncology, Ankara, Turkey

Address for Correspondence: Barış MALBORA, M.D., Dr. Sami Ulus Maternity and Children’s Hospital, Department of Pediatric Hematology, Ankara, Turkey Gsm: +90 533 641 38 41 E-mail: barismalbora@gmail.com Received/Geliş tarihi : October 24, 2011 Accepted/Kabul tarihi : February 21, 2012

230

DOI: 10.4274/Tjh.2011.0010

A 9-year-old girl was admitted to hospital with a 1-month history of fever, weight loss, epistaxis, and abdominal pain.

The girl’s parents were non-consanguineous. Her medical history was unremarkable. Upon admission she weighed 27 kg (25th-50th percentile), was 131 cm tall (50th percentile), and was pale. Physical examination showed multiple cervical and inguinal microlymphadenopathies, without hepatosplenomegaly. Complete blood count findings were as follows: hemoglobin 7.9 g/dL; white blood cell count: 12.3x109/L; platelet count: 9.2×109/L. Her peripheral blood smear showed 43% blast cells, 42% lymphocytes, 8% monocytes, 6% neutrophils, and 1% eosinophils. Bone marrow aspiration showed hypercellularity, with 45% myeloblasts, 15% promyelocytes, 7% myelocytes, 4% metamyelocytes, 1% eosinophils, 2% neutrophils, 15% lymphocytes, and 11% normoblasts. Wright staining of a bone marrow smear showed large (2-4 μm) round-to-oval, hyaline-structured eosinophilic granules (pseudo Chediak-Higashi [PCH] granules) within 15% of the blast cells, promyelocytes, and myelocytes (Figure). Some of the granules appeared to be in vacuoles, giving them a haloed appearance. The blasts were myeloperoxidase (MPO)-positive, and periodic acidSchiff (PAS)-negative. Immunophenotypic analysis of the leukemic cells showed proliferation of CD13 (75%), CD33 (59%), CD34 (95%), CD117 (68%), and HLA DR (44%).

The patient was diagnosed with as type M2 acute myeloid leukemia (AML). Cytogenetic analysis of a bone marrow sample showed 45,XX,t(8;21)(q22;q22). Cerebrospinal fluid biochemistry was normal, without detectable cells, based on cytocentrifuge analysis. The patient was treated according to the Berlin-Frankfurt-Munster (BFM) 2004 treatment protocol for AML. She is being followed without chemotherapy for two years and she does not have any problems.

PCH anomaly was first described in 1964 by Didisheim et al. [1]. Later, VanSlyck and Rebuck [2] reported similar granules in the leukemic cells of 2 patients with AML-M4, and used the term, pseudo Chediak-Higashi anomaly of acute leukemia, because of the resemblance of the granules to those seen in patients with inherited Chediak-Higashi syndrome. PCH anomaly is characterized by the presence of large cytoplasmic eosinophilic granules in leukemic blast cells, promyelocytes, and myelocytes. It is most often observed in patients with AML subtypes M2, M3, M4, and M5, but it is also associated with chronic myeloid leukemia, myelodysplastic syndrome, and mixed-lineage leukemias [1,2,3,4,5,6,7]. Most reported cases of PCH anomaly in

Malbora B, et al: Pseudo Chediak-Higashi Anomaly

leukemia patients are in adults; there are only a few reported childhood cases.

Ultrastructural studies of PCH anomaly have shown that the granules are strongly MPO positive, with variable positivity for PAS, Sudan black, and high-iron diamine, and without an obviously crystalline structure [5,8]. Electron microscopic studies suggest that these granules are formed by the fusion of azurophilic granules [9]. Some studies propose that these granules should be considered a morphological variant of Auer bodies [10]; however, the pathophysiology of PCH anomaly remains unknown. The clinical significance of this abnormality has yet to be been determined, because PCH anomaly is not always associated with disseminated intravascular coagulation or any other characteristic clinical picture. Additional research is required to establish the therapeutic and prognostic relevance of PCH anomaly.

Key words: Pseudo Chediak-Higashi anomaly, Acute myeloblastic leukemia, Child Conflict of Interest

Turk J Hematol 2013;30:230-231

3. Powari M, Varma N, Varma S, Komal HS. Pseudo-Chediak Higashi anomaly in an Indian patient with acute myeloid leukemia (AML-M2). Am J Hematol 2000;65:324-325.

4. Symes PH, Williams ME, Flessa HC, Srivastava AK, Swerdlow SH. Acute promyelocytic leukemia with the pseudoChediak-Higashi anomaly and molecular documentation of t(15;17) chromosomal translocation. Am J Clin Pathol 1993;99:622-627.

5. Rao S, Kar R, Saxena R. Pseudo Chediak-Higashi anomaly in acute myelomonocytic leukemia. Indian J Pathol Microbiol 2009;52:255-256.

6. Tsai IM, Tsai CC, Ladd DJ. Pseudo-Chediak-higashi anomaly in chronic myelogenous leukemia with myelofibrosis. Am J Clin Pathol 1977;67:608-609.

7. Gallardo R, Kranwinkel RN. Pseudo-Chédiak-Higashi anomaly. Am J Clin Pathol 1985;83:127-129.

8. Ahluwalia J, Kumar V, Trehan A, Marwaha RK, Garewal G. The psuedo-Chediak-Higashi anomaly: an unusual staining pattern in an Indian child with acute myeloid leukemia.

Pediatr Hematol Oncol 2004;21:199-202.

None of authors of this paper has any conflicts of interest, including specific financial interests, relationships, and/or affiliations, relevant to the subject matter or materials included in this manuscript.

9. Tulliez M, Vernant JP, Breton-Gorius J, Imbert M, Sultan C. Pseudo-Chediak-Higashi anomaly in a case of acute myeloid leukemia: electron microscopic studies. Blood 1979;54:863-871.

References

10. Payne CM, Harrow EJ. A cytochemical and ultrastructural study of acute myelomonocytic leukemia exhibiting the pseudo-Chediak-Higashi anomaly of leukemia and “splinter-type” Auer rods. Am J Clin Pathol 1983;80:216223.

1. Didisheim P, Trombold JS, Vandervoort LE, Mibashan RS. Acute promyelocytic leukemia with fibrinogen and factor V deficiencies. Blood 1964;23:717-728.

2. Van Slyck EJ, Rebuck JW. Pseudo-Chediak-Higashi anomaly in acute leukemia. A significant morphologic corollary. Am J Clin Pathol 1974;62:673-678.

231

Images in Hematology

Myeloperoxidase Deficiency: The Secret Under the Flag of Unstained Cell Myeloperoksidaz Eksikliği, Boyanmamış Hücre Bayrağı Altındaki Gizem

Türkan Patıroğlu1, Hatice Eke Güngör2, Julie Sawalle Belohradsky3, Ekrem Ünal1, Christoph Klein4 1Erciyes University, School of Medicine, Department of Pediatrics,

Division of Pediatric Hematology and Oncology, Kayseri, Turkey 2Erciyes University, School of Medicine, Department of Pediatrics,

Division of Pediatric Allergy and Immunology, Kayseri, Turkey 3University Children’s Hospital, Molecular Genetic Diagnostics,

Infektionsimmunologisches Labor, Munich, Germany 4University Children’s Hospital, Department of Pediatrics,

Division of Pediatric Hematology and Oncology, Munich, Germany

Address for Correspondence: Hatice EKE GÜNGÖR, M.D., Erciyes University, School of Medicine, Department of Pediatrics, Division of Pediatric Allergy and Immunology, Kayseri, Turkey Phone: +90 352 437 49 01 E-mail: haticeekegungor@hotmail.com Received/Geliş tarihi : January 22, 2012 Accepted/Kabul tarihi : March 29, 2012

232

DOI: 10.4274/Tjh.2012.0012

Myeloperoxidase (MPO) deficiency is one of the most common inherited phagocyte defects, but it is rarely associated with clinical symptoms [1]. MPO, which is abundant in azurophilic granules of neutrophils and in the lysosomes of monocytes, plays a key role in amplifying the toxicity of hydrogen peroxide generated by the respiratory burst [1,2]. The diagnosis of MPO deficiency was rare before 1979; currently, the diagnosis is easily made due to the widespread use of automated flow cytochemical analysis in clinical hematology laboratories for enumerating peripheral blood neutrophils with peroxidase activity [2].

The MPO gene is encoded on chromosome 17q23 [3].

Primary deficiency of MPO is inherited as an autosomal recessive disorder. A secondary form of MPO deficiency has been described in various disorders, including lead poisoning, severe infections, neuronal lipofuscinosis, obstructive jaundice, diabetes mellitus, and such disseminated cancers as acute and chronic myeloid leukemia, myelodysplastic syndrome, and Hodgkin’s lymphoma [1,2,4]. MPOdeficient neutrophils are markedly less efficient at killing Candida albicans and Aspergillus hyphae [1]. Although MPO is involved in killing certain microorganisms, to date, no particular susceptibility to persistent or severe infections has been noted in the vast majority of MPO-deficient patients [1,2]. Recurrent Candida infection has been observed predominantly in MPO-deficient patients that also have diabetes mellitus. In addition to infectious manifestations, the relationship between congenital MPO deficiency and the occurrence of malignancy remains controversial [1,2].

There is no specific treatment for MPO deficiency; however, in symptomatic patients antifungal treatment is crucial.

Herein we present a 17-year-old male that presented to our hematology department with neutropenia. Anamnesis showed that the patient did not have any recurrent or severe infection, but had been receiving benzathine penicillin prophylaxis due to acute rheumatic fever for years. Physical examination showed the following: weight: 58 kg (3-10p); height: 169 cm (10-25p); 1-2-degree/6 systolic murmur in the mesocardial region; the remainder of the examination was unremarkable.

Complete blood count results were as follows: hemoglobin: 13.1 g/dL; leucocyte count: 6140/mm3; platelet count: 503,000/mm3. The formulation of the leucocytes was interesting, with an absolute neutrophil count of 20/ mm3 and a high absolute unstained cell count of 3020/mm3 (nearly 50%). Although the absolute neutrophil count was

Turk J Hematol 2013;30:232-233

Patıroğlu T, et al: Myeloperoxidase Deficiency: The secret under the flag of unstained cell

neutrophil count and the peripheral blood smear suggested the possibility of MPO deficiency, and we therefore performed cytochemical staining of peroxidase and flow cytometry analysis. Cytochemical staining of peroxidase was negative, as compared to the control (Figure 1a, 1b), and flow cytometry analysis showed a dramatic decrease in MPO(+) neutrophils (Figure 2). In addition, we identified a compound heterozygous MPO gene mutation [c.1705C> T];[c.2031-2A>C]. The patient was followed-up for 12 months after his initial examination, during which time he was asymptomatic and healthy. In conclusion, we think that MPO deficiency must be considered in patients with incompatibility of neutropenia between smear and counter, especially when the flag of unstained cell is remarked.

Key words: Leucocyte function disorders, Myeloperoxidase, Neutrophil Conflict of interest statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations, relevant to the subject matter or materials included.

References

Figure 1: The cytochemical staining of the neutrophil from patient (a) shows negativity when compared to the control (b).

1. Dinauer MC, Newburger PE. The phagocyte system and disorders of granulopoiesis and granulocyte function. In: Orkin SH, Nathan DG, Ginsburg D, Look AT, Fisher DE, Lux SE, eds. Nathan and Oski’s Hematology of Infancy and Childhood. 7th ed. Philadelphia: Saunders-Elsevier, 2009:1109-1221.

20/mm3, peripheral blood smear showed normal formulation

2. Lanza F. Clinical manifestation of myeloperoxidase deficiency. J Mol Med 1998;76:676-681.

of leucocytes (49% neutrophils, 47% lymphocytes, and 4% monocytes). The inconsistency between the absolute

3. Marchetti C, Patriarca P, Solero GP, Baralle FE, Romano M. Genetic characterization of myeloperoxidase deficiency in Italy. Hum Mutat 2004;23:496-505.

4. Arumugan G, Rajagopal R. Evaluation of neutrophil functions in obstructive jaundice patients. Turk J Hematol 2004;21:189-196.

Figure 2: The flow cytometry analysis showed reduced positivity of myeloperoxidase at the gate of neutrophils.

233