tjh-2013-4

Review

DOI: 10.4274/Tjh.2013.0054

Strategies in Haploidentical Stem Cell Transplantation in Adults Erişkinlerde Haploidentik Kök Hücre Naklinde Stratejiler Ulaş D. Bayraktar1,2, Stefan O. Ciurea1 1Department 2Mercy

of Stem Cell Transplantation and Cellular Therapy, The University of Texas MD Anderson Cancer Center, Houston, TX, USA Cancer Center, Medical Oncology, Hematology, Ardmore, OK, USA

Abstract: Haploidentical related donors are alternative stem cell sources for patients without human leukocyte antigen (HLA)-matched related or unrelated donors. Immediate access to the donor, availability for patients with rare haplotypes, ease of stem cell procurement, and lack of a requirement for a physical cord blood bank or an extensive HLA database render this type of hematopoietic stem cell transplantation particularly attractive despite the high histoincompatibility barrier between the recipient and the haploidentical graft. In this review, we answer the following questions: 1) What are the current transplant strategies used to overcome the histoincompatibility barrier in haploidentical stem cell transplantation and their clinical results?

2) How should we choose the donor when there is more than one available haploidentical donor? 3) How does transplantation from haploidentical donors compare to that from umbilical cord blood?

Key Words: Haploidentical stem cell transplantation, HLA, GVHD Özet: Tam “human leukocyte antigen” (HLA) uyumlu bağışçı bulunamayan hastalar için bir diğer seçenek yarı-eşlenik akraba bağışçılardan alınacak kök hücrelerdir. Bağışçı ve hasta arasında aşılması gereken yüksek HLA uyumsuzluğuna ragmen, yarıeşlenik akraba bağışçılarından kan kök hücre nakli (yarı-eşlenik kan kök hücre nakli [YKHN]); bağışçıya anında ulaşılabilirlik, ender gorülen haplotipler icin uygulanabilirlik, kök hücrelerin elde edilmesindeki kolaylık ve kord kanı bankası/doku bankasından bağımsızlığı dolayısıyla cazip bir yontemdir. Bu derlemede şu soruları cevaplandıracağız: 1) YKHN’de HLA uyumsuzluk bariyerini aşmak için kullanılan stratejiler ve sonuçları nelerdir? 2) Birden fazla yarı-eşlenik akraba bağışçısının olması durumunda bağışçı nasıl seçilmelidir? 3) YKHN’in korddan kök hücre nakline göre avantaj ve dezavantajları nelerdir?

Anahtar Sözcükler: Haploidentik kök hücre nakli, HLA, Graft Versus Host Hastalığı (GVHH) Address for Correspondence: Ulaş D. BAYRAKTAR, M.D., Department of Stem Cell Transplantation and Cellular Therapy, The University of Texas MD Anderson Cancer Center, Houston, TX, USA Phone: +1 (580) 223-7091 E-mail: darda.bayraktar@gmail.com Received/Geliş tarihi : February 13, 2013 Accepted/Kabul tarihi : July 25, 2013

342

Bayraktar DU, et al: Haploidentical Transplantation

Introduction Two-thirds of patients who require allogeneic hematopoietic stem cell transplantation (SCT) do not have a human leukocyte antigen (HLA)-matched related donor available [1]. A matched unrelated donor can be identified in only 50% to 60% of these cases. The chance of finding such a donor is particularly poor for patients whose ethnicity is under-represented in HLA databases. Haploidentical donors – parents, children, and half of siblings – are alternative stem cell sources for such patients without matched donors. The first successful SCT from a haploidentical donor (haploSCT) was reported in 1981 in a 10-month-old infant using an ex vivo T cell-depleted bone marrow graft from her father [2].

After 30 years of experience, transplanters are now better at overcoming the histoincompatibility barrier between the recipient and the haploidentical donor.

What are the current transplant strategies used to overcome the histoincompatibility barrier in haploSCT and their clinical results?

For successful haploSCT, both the patient’s and the graft’s immunity should be suppressed or modified to prevent graft failure and graft-versus-host disease (GVHD).

Various strategies have been devised to achieve the required suppression without substantially increasing treatmentrelated mortality (TRM) arising from immunosuppression.

These strategies may be studied in 2 groups: those utilizing ex vivo T cell-depleted grafts and those utilizing T cellreplete grafts.

With currently available magnetic selection methods, 3 to 5 logs of ex vivo T cell depletion (TCD) of the stem cell graft is possible [3], and this is the most effective method to prevent GVHD after SCT. Unfortunately, extensive TCD of the graft impairs engraftment and increases primary graft failure rates as more host immune cells survive post-SCT. In initial trials, T cell-depleted grafts from haploidentical donors were rejected in up to 50% of cases [4]. The risk of graft rejection may be reduced by intensification of the conditioning regimen [5,6], in vivo host TCD with antibodies [7], and increasing of the bone marrow (BM) inoculum (number of CD34+ cells infused) [8]. The most notable haploSCT protocol to date was devised at the University of Perugia in the 1990s, in which a “mega-dose” of CD34+ cells (while a threshold for the dose has not been defined, the reported minimum is 5.1x106 CD34+ cells/kg) derived from BM and peripheral blood after TCD was used with ablative conditioning and anti-thymocyte globulin [3,9].

While GVHD incidence was minimal and the graft rejection rate was acceptable, TRM due to infections remained an issue, which is the current focus of transplanters utilizing TCD grafts. Although ex vivo TCD in haploSCT is most commonly achieved by positive selection of CD34+ cells, negative selection of lymphocyte subsets through CD3/ CD19 or TCRαβ retains other donor immune cells, i.e.

Turk J Hematol 2013;30:342-350

natural killer (NK) cells, that may decrease the incidence of GVHD and exert a graft-versus-leukemia effect [10]. The strategies used in TCD haploSCT are summarized in Table 1 with their respective clinical results.

Without TCD of the graft, a higher-intensity GVHD prophylaxis regimen or selective inhibition of graft T cells becomes necessary to prevent GVHD after haploSCT. While Chinese researchers chose to intensify immunosuppression and prime the BM graft with granulocyte colony-stimulating factor (G-CSF) [11], researchers from Johns Hopkins led the way by selectively inhibiting graft immunity against donor cells using post-SCT cyclophosphamide [12,13]. One of the more established methods to be utilized in haploSCT, which was studied and reported in a recent Blood and Marrow Transplant Clinical Trials Network (BMT CTN) trial [14], post-SCT cyclophosphamide has little impact on stem cells and engraftment while primarily targeting donor lymphocytes activated by recipient antigens immediately after graft infusion. The rationale and clinical results of haploSCT strategies not utilizing TCD of the graft are summarized in Table 1.

Overall, while TCD results in lower GVHD incidence with acceptable engraftment rates when a “mega-dose” of CD34+ cells is used, a relatively high TRM rate primarily due to infections remains an issue. Furthermore, TCD requires an initial investment in facilities employing good manufacturing practice with cell selection instruments, i.e.

CliniMACS, and expertise to run such facilities. The initial investment cost may be difficult to attain in developing and under-developed countries where haploSCT would be particularly valuable since residents of such countries are generally under-represented in international HLA databases. While haploSCT with T cell-replete grafts may lead to higher GVHD incidence, it allows the intensity of conditioning regimens to be reduced through host immunity suppression utilizing engraftment. However, the reduced intensity conditioning regimen used in most studies of postSCT cyclophosphamide may lead to high relapse incidence in acute leukemic patients. At the MD Anderson Cancer Center, we compared the outcomes of haploSCT with TCD peripheral blood grafts to that with unmanipulated BM grafts after an identical ablative conditioning regimen (fludarabinemelphalan-thiotepa) [15]. Early results revealed significantly higher rates of overall and progression-free survival with unmanipulated BM grafts, primarily because of significantly lower TRM (16% vs. 42% at 1 year).

How should we choose the donor when there is more than one available haploidentical donor?

Most patients requiring SCT have more than one haploidentical donor. The presence of recipient antibodies against donor-specific HLA, killer immunoglobulin-like receptor (KIR) mismatch predicting NK cell alloreactivity, mismatch for non-inherited maternal vs. paternal alleles, degree of HLA mismatch between donor and recipient, 343

344

TBI 8 Gy day -8; Thio 5 mg/kg/day days -8, -7; rATG 5 mg/kg days -5 to -2 No post-SCT GVHD prophylaxis Graft: Mega-dose of CD34-selected PBSC

Ablative: Cy 90 mg/kg, araC 12 g/m2, TBI 1400 cGy, Almtz 12-40 mg RIC: TBI 450 cGy, Flu 120 mg/m2, Almtz 40 mg Graft: Mega-dose CD34-selected PBSC Allodepleted (through co-culture of donor T cells with recipient APCs followed by addition of immunotoxin against CD25 to eliminate activated T cells) infused on days 30, 60, 90

Flu 150 mg/m2; Thio 10 mg/m2; Mel 120 mg/m2 OKT-3 5 mg/day days -5 to 14 Post-SCT MMF only if graft included >5x104 CD3+ cells/kg Graft: CD3/CD19 depleted PBSC

TBI 8 Gy day -10; Thio 4 mg/kg days -10, -9; Flu 40 mg/m2/day days -10 to -6; Cy 35 mg/kg days -7, -6 Freshly isolated (by CD8 and CD19 depletion followed by CD25-selection) donor Tregs infused on day -4 Graft: Mega-dose of CD34-selected PBSC Varying doses of Tcons infused after graft infusion on day 0

TBI 1.5 Gy BID days -9 to -6 2x108 CD3+ cells/kg DLI day -6 Cy 60 mg/kg days -3 and -2 MMF and Tacrol after day -1 Graft: CD34-selected PB

Amrolia PJ, 2006 (39)

Federmann B, 2012 (26)

Di Ianni M, 2011 (40)

Grosso D, 2011(41)

Conditioning and GVHD prophylaxis

Aversa F, 2005 (3)

T cell-depleted grafts

Reference

2-step transplantation to optimize donor T cell dose by: a) Infusing a fixed dose of donor T cells (DLI) followed

by Cy to preferentially eliminate activated lymphocytes b) Infusing T cell-depleted PB graft after DLI to protect graft from Cy Ablative conditioning for better disease control and to prevent graft rejection

T cell depletion to prevent GVHD To hasten immune reconstitution post-SCT a fixed dose of Tcons infused with graft, which was preceded by Treg infusion to avoid GVHD Ablative conditioning to prevent graft rejection and for better disease control ATG was omitted to preserve infused Tregs and Tcons

RIC to decrease GVHD and TRM T cell depletion to prevent GVHD CD3/CD19 depletion used instead of CD34-selection to retain NK cells in graft OKT3 to prevent graft rejection – OKT3 preferred over ATG to spare NK cells

Rigorous T cell depletion to prevent GVHD Alemtuzumab to prevent graft rejection Post-SCT infusion of T cells to hasten immune reconstitution – allodepleted to prevent GVHD

Ablative conditioning for better disease control and to prevent graft rejection Rigorous T cell depletion to prevent GVHD ATG to prevent graft rejection and GVHD Mega-doses of progenitor cells to improve engraftment

Rationale

n=27 Median age: 52 (19-67) 17 AML (5 in CR1) 4 ALL 2 MDS 3 NHL (refractory) 1 AA

n=28 High-risk heme malignancies

n=61 38 AML 8 ALL 6 NHL 4 MM 3 CML 1 MDS 1 CLL

n=16 Median age: 9 (2-58) 7 AML (1 in CR1) 2 ALL 1 HL 1 CML 1 MDS 3 BMF

n=104 Median age: 33 (9-64) 67 AML (19 in CR1) 37 ALL (14 in CR1)

Patient characteristics

No primary graft failures Grade II-IV aGVHD in 16 pts (60%)

26 pts (93%) engrafted Grade II-IV aGVHD in 2 pts No cGVHD

3 primary graft failures Grade II-IV GVHD CI 46% cGVHD CI 18%

All engrafted Grade II-IV aGVHD in 2 pts (both after donor T cell infusion) cGVHD in 2 pts

94 pts (91%) engrafted Grade II-IV aGVHD in 8 pts (8%) cGVHD in 5 pts (7%)

Engraftment and GVHD

RI: 30% OS @ 3 yrs: 48%

TRM 13 pts (50%) 8 pts (31%) died of infection 1 pt relapsed OS @ 1 yr: 46%

NRM @ 2 yrs: 42% 18 pts (30%) died of infections RI @ 2 yrs: 31% EFS @ 2 yrs: 25% OS @ 2 yrs: 28%

5 pts alive @ median follow-up of 33 mos

TRM: 37% for pts in remission; 44% in pts with active disease 27 pts (26%) died of infections RI: 16% for pts in remission; 51% in pts with active disease EFS @ 3 yrs: 48% for pts in remission; 4% for pts with active disease

Survival

Table 1. Studies utilizing different strategies to overcome histoincompatibility barrier in hematopoietic stem cell transplantation from haploidentical donors.

Turk J Hematol 2013;30:342-350

Bayraktar DU, et al: Haploidentical Transplantation

Bu 3.2 mg/kg/day IV days -7, -6; Flu 30 mg/m2 days -7 to -2 rATG 3 mg/kg days -4 to -1; CsA 1.5 mg/kg from day -1; Mtx 15 mg/m2 on day 1 then 10 mg/m2 days 3, 6, 11 Graft: Unmanipulated PB

TBI 175 cGy BID days -6 to -3; Cy 1.8 g/m2 days -2, -1 Short-course Mtx, CsA Graft: ex vivo alloanergy induction with incubation of donor BM graft with recipient APCs and CTLA4-Ig

(A) Thio 5 mg/kg days -6 and -5; Flu 50 mg/m2 days -4 to -2; Bu 3.2 mg/kg IV daily days -4 to -2 (B) TBI 3.3 Gy days -8 to -6; Flu 30 mg/m2 days -5 to -2 Cy 50 mg/kg on days 3 and 5; CsA 1 mg/kg/day days 0 to 20; MMF 15 mg/kg q12h days 1 to 28 Graft: Unmanipulated BM

Flu 30 mg/m2 days -6 to -2; Cy 14.5 mg/kg days -6, -5; TBI 200 cGy day -1 Cy 50 mg/kg days 3, 4; Tacrol day 5 until 180; MMF day 5 until 35

araC 4 g/m2 days -10, -9; Bu 12 mg/kg PO q6h days -8 to -6; Cy 1.8 g/m2 days -5, -4; semustine 250 mg/ m2 day -3 rATG 2.5 mg/kg days -5 to -2; CsA day -9 onward; MMF 500 mg day -9 to 60; Mtx 15 mg/m2 on day 1 then 15 mg/m2 on days 3, 6, 11 Graft: G-CSF–primed unmanipulated BM and PB

Various TBI- or non-TBI–based regimens: 64 ablative, 16 RIC ATG 5 mg/kg days -4 to -1; CsA day -7 to day 180; Mtx 15 mg/m2 day 1 then 10 mg/m2 days 3, 6, 11; MMF day 7 to 100; basiliximab 10-20 mg days 0 and 4 Graft: G-CSF–primed unmanipulated BM

Lee KH, 2011 (42)

Davies JK, 2008 (43)

Raiola AM, 2013 (44)

Brunstein CG, 2011 (14) BMT CTN 0603

Huang XJ, 2009 (11)

Di Bartolomeo P, 2013 (45)

Intensive GVHD prophylaxis G-CSF–primed BM graft to hasten engraftment without increasing GVHD PBSC were omitted to decrease GVHD incidence

Combination of G-CSF–primed BM and PB grafts may lead to faster engraftment without increased GVHD ATG to prevent graft rejection and GVHD Intensive GVHD prophylaxis Ablative conditioning to prevent graft rejection and for better leukemia control

RIC to decrease GVHD incidence Post-SCT Cy to prevent GVHD by selectively eliminating donor alloreactive T cells that are acutely activated after graft infusion by host antigens

Post-SCT Cy to prevent GVHD by selectively eliminating donor alloreactive T cells that are acutely activated after graft infusion by host antigens Ablative conditioning to prevent graft rejection and for better disease control

Induction of allospecific anergy through blockage of CD80/86 on recipient APC. T cells require 2 signals for activation: MHC binding to TCR and co-stimulatory signal through CD28. Latter binds to CD80/86 on APCs

RIC to decrease GVHD incidence ATG to prevent graft rejection and GVHD

RIC to decrease GVHD incidence Post-SCT Cy to prevent GVHD by selectively eliminating donor alloreactive T cells that are acutely activated after graft infusion by host antigens

249 (99%) engrafted Grade II-IV aGVHD in 115 pts (46%) Limited cGVHD in 61 (28%), extensive cGVHD in 31 (14%) pts 1 pt had primary graft failure Grade II-IV aGVHD CI 24% cGVHD CI 17%

n=250 Median age: 25 (2-56) 108 AML (67 in CR1) 142 ALL (82 in CR1)

n=80 Median age: 37 (5-71) 45 AML (21 in CR1) 15 ALL (8 in CR1) 5 HL 5 CML 3 MDS 2 NHL 2 MF 3 MM

1 pt had primary graft failure Grade II-IV aGVHD CI 32% cGVHD CI 13%

2 (4%) graft failures Grade II-IV aGVHD in 6 pts (12%) cGVHD CI 26%

n=50 Median age: 42 (18-66) 25 AML (9 in CR1) 12 ALL (2 in CR1) 5 lymphoma (chemorefractory) 4 MF (leukemic transformation) 4 MPD (blast crisis) n=50 Median age: 48 (7-70) 22 AML 9 ALL 12 NHL 7 HL

2 (8%) graft failure Grade B-D aGVHD in 8 pts (38%) cGVHD CI 8%

No primary graft failures but early PD in 4 pts Grade II-IV aGVHD in 16 pts (20%) cGVHD CI 34%

n=83 Median age: 40 (16-70) 52 AML (12 in CR1) 16 ALL (3 in CR1) 15 MDS

n=24 Age range: 0.5-50 21 high-risk heme malignancy (none in CR1, 14 with PD) 3 with bone marrow failure

Graft rejection in 9 pts (13%) Grade II-IV aGVHD 34% cGVHD CI 5% (2 doses of post-SCT Cy) and 25% (1 dose of post-SCT Cy)

n=68 Median age: 46 (1-71) 27 AML (12 in CR1) 4 ALL (2 in CR1) 1 MDS 6 CML/CMML 3 CLL 13 HL (refractory) 10 NHL (refractory) 3 MM (refractory) 1 PNH

TRM CI @ 1 yr: 36% 11 pts (14%) died of infections RI @ 3 yrs: 26%-28% OS @ 3 yrs: 45% DFS @ 3 yrs: 38%

3-year TRM: 29% and 51% in high-risk AML and ALL 3-year RI: 20% and 49% in high-risk AML and ALL 3-year LFS: 55% and 25% in high-risk AML and ALL

NRM @ 1 yr: 7% RI @ 1 yr: 45% PFS @ 1 yr: 48% OS @ 1 yr: 62%

6-month TRM: 18% RI: 22% (33% in pts with active disease at SCT) 18-month DFS: 51% 18-month OS: 62%

TRM incidence 50% EFS and OS: 33% @ 10 yrs

TRM CI 18% RI: 27%-32% in pts with acute leukemia in CR; 79% in pts with refractory leukemia OS: 41%-60% in pts with leukemia in CR; 9% in pts with refractory leukemia

NRM @ 1 yr: 15% EFS @ 2 yrs: 26% OS @ 2 yrs 36% EFS longer in lymphoid vs. myeloid malignancies (p=0.02)

remission, CR1: first CR, aGVHD: acute GVHD, cGVHD: chronic GVHD, TRM: transplant-related mortality, RI: relapse incidence, EFS: event-free survival, Cy: cyclophosphamide, araC: cytarabine, Almtz: alemtuzumab, RIC: reduced-intensity conditioning, Flu: fludarabine, APC: antigen-presenting cell, HL: Hodgkin lymphoma, CML: chronic myeloid leukemia, MDS: myelodysplastic syndrome, BMF: bone marrow failure syndromes, yr: year, mo: month, pt: patient, MMF: mycophenolate mofetil, NK: natural killer, NHL: non-Hodgkin lymphoma, CLL: chronic lymphocytic leukemia, MM: multiple myeloma, CI: cumulative incidence, NRM: non-relapse mortality, OS: overall survival, Treg: regulatory T lymphocytes, Tcon: conventional T lymphocytes, DLI: donor lymphocyte infusion, Tacrol: tacrolimus, PB: peripheral blood, BM: bone marrow, AA: aplastic anemia, RBC: red blood cell, CMML: chronic myelomonocytic leukemia, PNH: paroxysmal nocturnal hemoglobinuria, PFS: progression-free survival, LFS: leukemia-free survival, Bu: busulfan, Mtx: methotrexate, CsA: cyclosporin A, PD: progressive disease, MHC: major histocompatibility complex, TCR: T cell receptor, MF: primary myelofibrosis, MPD: myeloproliferative disorder.

GVHD: Graft-versus-host disease, TBI: total body irradiation, Thio: thiotepa, rATG: rabbit anti-thymocyte globulin, SCT: hematopoietic stem cell transplantation, PBSC: peripheral blood stem cells, AML: acute myeloid leukemia, ALL: acute lymphoid leukemia, CR: complete

Cy 14.5 mg/kg/day IV days -6, -5; Flu 30 mg/m2 days -6 to -2; TBI 200 cGy day -1 Cy 50 mg/kg IV day 3 or days 3, 4; Tacrol from day 5 to 180; MMF day 5 to 35 Graft: RBC-depleted BM

Luznik L, 2008 (13)

T cell-replete grafts

Bayraktar DU, et al: Haploidentical Transplantation Turk J Hematol 2013;30:342-350

345

Turk J Hematol 2013;30:342-350

Bayraktar DU, et al: Haploidentical Transplantation

Table 2. Comparison of hematopoietic stem cell transplantation from umbilical cord and haploidentical donors.

Haploidentical donor

Umbilical cord

Advantages

- Short search and graft acquisition time - Availability for patients with rare haplotypes - Easy rescheduling of infusion - Does not require an umbilical cord bank or HLA database

- Short search and graft acquisition time - Availability for patients with rare haplotypes - Easy rescheduling of infusion - No potential for viral transmission

Issues

- Relatively high graft failure rates - Delayed immune reconstitution - Lack of T cell-mediated graft-versus-leukemia effect if ex vivo T cell-depleted grafts are used - Ease of post-transplant cell acquisition for therapy, i.e. donor NK cell or lymphocyte infusion

- Relatively high graft failure rates - Delayed immune reconstitution - Delayed engraftment - Potential for congenital disease transmission - Inability to use post-transplant cellular therapy, i.e. donor lymphocyte infusion

vdonor age, and ABO-match should be taken into account while deciding on the donor among available haploidentical candidates.

Transplant recipients may have developed anti-HLA antibodies against donor HLA antigens (donor-specific antibodies; DSAs) during pregnancy or after blood product transfusions. The presence of DSAs is associated with increased risk of primary graft failure after SCT [16,17,18,19]. Additionally, the level of DSAs in recipient serum is likely important. If a patient has DSAs against all haploidentical donors, selecting donors with the lowest antibody level may be appropriate. Treatment of recipients with plasma exchange or rituximab may also be reasonable and has been used in solid organ transplantations.

NK cells primarily attack hematopoietic cells, sparing solid organs [20]. In recipients lacking HLA class I alleles specific to the donor KIRs, donor NK cells may prevent GVHD and disease relapse by eliminating residual recipient antigenpresenting cells and leukemia cells [21,22]. Accordingly, KIR mismatch between recipient and donor has been associated with improved haploSCT outcomes [21,22,23]; however, this finding has been disputed by other researchers [24,25].

KIR mismatch may play a more pronounced role in SCT for myeloid malignancies [22,26]. Further studies are needed to verify the impact of NK alloreactivity and KIR mismatch on haploSCT outcomes.

Although a progressive increase in TRM with increasing genetic disparity has been historically reported, contemporary transplant strategies may negate this correlation by overcoming larger histoincompatibility barriers. In fact, Kasamon et al. reported no increased incidence of acute GVHD (aGVHD) and non-relapse mortality (NRM) after haploSCT from full-haplotype mismatched donors compared to those with better-matched donors [27].

Moreover, patients with more than 3 mismatches appeared to have better outcomes due to a lower relapse incidence.

346

Immunologic tolerance may develop between mother and fetus during pregnancy [28,29], leading to down-regulated immune responses if the mismatched haplotype between the recipient and the haploidentical donor is of maternal origin.

Accordingly, patients with maternal donors were found to survive longer than those with paternal donors [30], and TRM was reported to be lower in patients with recipients mismatched for non-inherited maternal HLA compared to those with recipients mismatched for paternal antigens [31].

The immune system is subject to senescence with advancing age. Although no data exist on an association between donor age and outcomes after haploSCT, the findings of higher GVHD incidence and shorter survival after unrelated donor transplants from older donors compared to younger donors would probably apply for haploSCT, as well.

Older multiparous women may be the least preferred donors for male recipients [32].

Studies have demonstrated that infusion of larger numbers of CD34+ cells improved outcomes after SCT [33,34,35].

Stem cell dose is also likely important in haploSCT, as can be inferred from the improved outcomes with megadoses of peripheral blood stem cells in TCD haploSCT [9].

Transplants involving a major ABO incompatibility require mononuclear cell separation to prevent a hemolytic reaction, which reduces the graft cell dose. If maximizing the infused stem cell dose is indeed important in haploSCT, then younger, larger donors without a major ABO incompatibility with the recipient should be preferred.

An in-depth review of donor selection in haploSCT is available from Ciurea and Champlin [32] and the proposed algorithm is shown in Figure 1.

How do transplants from haploidentical donors compare to those from umbilical cords?

For patients lacking an HLA-matched related or unrelated donor, umbilical cord blood (UCB) is another alternative stem cell source. UCB is more immune-plastic than

Bayraktar DU, et al: Haploidentical Transplantation

Turk J Hematol 2013;30:342-350

was similar in both arms at 46% and 48%. Similarly, a retrospective analysis of the European Group for Blood and Marrow Transplantation (EBMT) database demonstrated significantly lower acute GVHD rates after haploSCT compared to UCB SCT between 1998 and 2002 [38]. A randomized BMT CTN study is ongoing in the United States, comparing SCT from haploidentical donors and UCB in patients with hematological malignancies.

With our current knowledge, it is difficult to recommend one stem cell source over another for patients without matched donors. Until a large-scale randomized prospective study shows one’s superiority, transplant centers will and should choose an alternative stem cell source based on their own expertise. However, T cell-replete haploSCT is clearly advantageous for countries and centers without the financial backing to invest in and maintain an umbilical cord bank.

Despite these advantages and recent advances, haploSCT is a risky procedure with additional perils of late-onset chronic GVHD and infections due to the histoincompatibility barrier, late immune reconstitution, and intensified GVHD prophylaxis limiting its use to experienced centers.

Conflict of Interest Statement Figure 1. Proposed algorithm for donor selection in haploidentical stem cell transplantation. DSA indicates donor-specific anti-HLA antibodies; MFI: median fluorescence intensity, NIMA: non-inherited maternal antigens, NK: natural killer. Reproduced from Ciurea and Champlin with permission (32). peripheral blood and bone marrow grafts; therefore, 2 or 3 out of 6 HLA mismatches are allowed for UCB transplants.

However, use of UCB as a stem cell source has been limited until recently by the delayed engraftment and relatively high rate of primary graft failures due to the low volume and low CD34+ cell content. Use of double, instead of single, UCB has partially overcome these issues [36,37].

The advantages and disadvantages of haploSCT and UCB SCT are outlined in Table 2. Although they had not been systematically compared to each other, a recent parallel multi-center phase 2 trial by BMT CTN confirmed the utility of both double UCB and haploidentical donors as alternative stem cell sources [14]. Fifty patients in each arm, with advanced hematological malignancies, received either BM grafts from haploidentical donors or double UCB after similar conditioning regimens including fludarabine, cyclophosphamide, and low-dose total body irradiation (TBI). Grade II-IV acute GVHD and chronic GVHD incidences were numerically higher in the double UCB arm (40% vs. 32% and 25% vs. 13%), demonstrating efficacy of the post-SCT cyclophosphamide in the haploSCT arm. NRM at 1 year was 24% and 7% in the double UCB and haploSCT arms, while relapse incidence was 31% and 45%, respectively. One-year progression-free survival (PFS)

The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Sasazuki T, Juji T, Morishima Y, Kinukawa N, Kashiwabara H, Inoko H, Yoshida T, Kimura A, Akaza T, Kamikawaji N, Kodera Y, Takaku F. Effect of matching of class I HLA alleles on clinical outcome after transplantation of hematopoietic stem cells from an unrelated donor. Japan Marrow Donor Program. N Engl J Med 1998;339:1177-1185.

2. Reisner Y, Kapoor N, Kirkpatrick D, Pollack MS, Dupont B, Good RA, O’Reilly RJ. Transplantation for acute leukaemia with HLA-A and B nonidentical parental marrow cells fractionated with soybean agglutinin and sheep red blood cells. Lancet 1981;2:327-331.

3. Aversa F, Terenzi A, Tabilio A, Falzetti F, Carotti A, Ballanti S, Felicini R, Falcinelli F, Velardi A, Ruggeri L, Aloisi T, Saab JP, Santucci A, Perruccio K, Martelli MP, Mecucci C, Reisner Y, Martelli MF. Full haplotype-mismatched hematopoietic stem-cell transplantation: a phase II study in patients with acute leukemia at high risk of relapse. J Clin Oncol 2005;23:3447-3454.

4. O’Reilly RJ, Kernan NA, Cunningham I, et al. Allogeneic transplants depleted of T cells by soybean lectin agglutination and E rosette depletion. Bone Marrow Transplant 1988;3:3-6.

5. Schwartz E, Lapidot T, Gozes D, Singer TS, Reisner Y. Abrogation of bone marrow allograft resistance in mice by increased total body irradiation correlates with eradication of host clonable T cells and alloreactive cytotoxic precursors.

J Immunol 1987;138:460-465.

347

Turk J Hematol 2013;30:342-350

6. Terenzi A, Lubin I, Lapidot T, Salomon O, Faktorowich Y, Rabi I, Martelli MF, Reisner Y. Enhancement of T celldepleted bone marrow allografts in mice by thiotepa.

Transplantation 1990;50:717-720.

7. Cobbold SP, Martin G, Qin S, Waldmann H. Monoclonal antibodies to promote marrow engraftment and tissue graft tolerance. Nature 1986;323:164-166.

8. Reisner Y, Itzicovitch L, Meshorer A, Sharon N. Hemopoietic stem cell transplantation using mouse bone marrow and spleen cells fractionated by lectins. Proc Natl Acad Sci U S A 1978;75:2933-2936.

9. Aversa F, Tabilio A, Terenzi A, Velardi A, Falzetti F, Giannoni C, Iacucci R, Zei T, Martelli MP, Gambelunghe C, Rossetti M, Caputo P, Latini P, Aristei C, Raymondi C, Reisner Y, Martelli MF. Successful engraftment of T-cell-depleted haploidentical “three-loci” incompatible transplants in leukemia patients by addition of recombinant human granulocyte colonystimulating factor-mobilized peripheral blood progenitor cells to bone marrow inoculum. Blood 1994;84:3948-3955.

10. Bethge WA, Faul C, Bornhäuser M, Stuhler G, Beelen DW, Lang P, Stelljes M, Vogel W, Hägele M, Handgretinger R, Kanz L. Haploidentical allogeneic hematopoietic cell transplantation in adults using CD3/CD19 depletion and reduced intensity conditioning: an update. Blood Cells Mol Dis 2008;40:13-19.

11. Huang XJ, Liu DH, Liu KY, Xu LP, Chen H, Han W, Chen YH, Zhang XH, Lu DP. Treatment of acute leukemia with unmanipulated HLA-mismatched/haploidentical blood and bone marrow transplantation. Biol Blood Marrow Transplant 2009;15:257-265.

12. Luznik L, Jalla S, Engstrom LW, Iannone R, Fuchs EJ. Durable engraftment of major histocompatibility complexincompatible cells after nonmyeloablative conditioning with fludarabine, low-dose total body irradiation, and posttransplantation cyclophosphamide. Blood 2001;98:3456-3464.

13. Luznik L, O’Donnell PV, Symons HJ, Chen AR, Leffell MS, Zahurak M, Gooley TA, Piantadosi S, Kaup M, Ambinder RF, Huff CA, Matsui W, Bolaños-Meade J, Borrello I, Powell JD, Harrington E, Warnock S, Flowers M, Brodsky RA, Sandmaier BM, Storb RF, Jones RJ, Fuchs EJ. HLAhaploidentical bone marrow transplantation for hematologic malignancies using nonmyeloablative conditioning and high-dose, posttransplantation cyclophosphamide. Biol Blood Marrow Transplant 2008;14:641-650.

14. Brunstein CG, Fuchs EJ, Carter SL, Karanes C, Costa LJ, Wu J, Devine SM, Wingard JR, Aljitawi OS, Cutler CS, Jagasia MH, Ballen KK, Eapen M, O’Donnell PV; Blood and Marrow Transplant Clinical Trials Network. Alternative donor transplantation after reduced intensity conditioning: results of parallel phase 2 trials using partially HLA-mismatched related bone marrow or unrelated double umbilical cord blood grafts. Blood 2011;118:282-288.

348

Bayraktar DU, et al: Haploidentical Transplantation

15. Ciurea SO, Mulanovich V, Saliba RM, Bayraktar UD, Jiang Y, Bassett R, Wang SA, Konopleva M, Fernandez-Vina M, Montes N, Bosque D, Chen J, Rondon G, Alatrash G, Alousi A, Bashir Q, Korbling M, Qazilbash M, Parmar S, Shpall E, Nieto Y, Hosing C, Kebriaei P, Khouri I, Popat U, de Lima M, Champlin RE. Improved early outcomes using a T cell replete graft compared with T cell depleted haploidentical hematopoietic stem cell transplantation. Biol Blood Marrow Transplant 2012;18:1835-1844.

16. Ciurea SO, de Lima M, Cano P, Korbling M, Giralt S, Shpall EJ, Wang X, Thall PF, Champlin RE, Fernandez-Vina M. High risk of graft failure in patients with anti-HLA antibodies undergoing haploidentical stem-cell transplantation.

Transplantation 2009;88:1019-1024.

17. Ciurea SO, Thall PF, Wang X, Wang SA, Hu Y, Cano P, Aung F, Rondon G, Molldrem JJ, Korbling M, Shpall EJ, de Lima M, Champlin RE, Fernandez-Vina M. Donor-specific anti-HLA Abs and graft failure in matched unrelated donor hematopoietic stem cell transplantation. Blood 2011;118:5957-5964.

18. Takanashi M, Atsuta Y, Fujiwara K, Kodo H, Kai S, Sato H, Kohsaki M, Azuma H, Tanaka H, Ogawa A, Nakajima K, Kato S. The impact of anti-HLA antibodies on unrelated cord blood transplantations. Blood 2010;116:2839-2846.

19. Cutler C, Kim HT, Sun L, Sese D, Glotzbecker B, Armand P, Koreth J, Ho V, Alyea E, Ballen K, Ritz J, Soiffer RJ, Milford E, Antin JH. Donor-specific anti-HLA antibodies predict outcome in double umbilical cord blood transplantation.

Blood 2011;118:6691-6697.

20. Asai O, Longo DL, Tian ZG, Hornung RL, Taub DD, Ruscetti FW, Murphy WJ. Suppression of graft-versus-host disease and amplification of graft-versus-tumor effects by activated natural killer cells after allogeneic bone marrow transplantation. J Clin Invest 1998;101:1835-1842.

21. Ruggeri L, Capanni M, Casucci M, Volpi I, Tosti A, Perruccio K, Urbani E, Negrin RS, Martelli MF, Velardi A. Role of natural killer cell alloreactivity in HLA-mismatched hematopoietic stem cell transplantation. Blood 1999;94:333-339.

22. Ruggeri L, Capanni M, Urbani E, Perruccio K, Shlomchik WD, Tosti A, Posati S, Rogaia D, Frassoni F, Aversa F, Martelli MF, Velardi A. Effectiveness of donor natural killer cell alloreactivity in mismatched hematopoietic transplants.

Science 2002;295:2097-2100.

23. Symons HJ, Leffell MS, Rossiter ND, Zahurak M, Jones RJ, Fuchs EJ. Improved survival with inhibitory killer immunoglobulin receptor (KIR) gene mismatches and KIR haplotype B donors after nonmyeloablative, HLAhaploidentical bone marrow transplantation. Biol Blood Marrow Transplant 2010;16:533-542.

24. Huang XJ, Zhao XY, Liu DH, Liu KY, Xu LP. Deleterious effects of KIR ligand incompatibility on clinical outcomes in haploidentical hematopoietic stem cell transplantation without in vitro T-cell depletion. Leukemia 2007;21:848851.

Bayraktar DU, et al: Haploidentical Transplantation

25. Gagne K, Brizard G, Gueglio B, Milpied N, Herry P, Bonneville F, Chéneau ML, Schleinitz N, Cesbron A, Folléa G, Harrousseau JL, Bignon JD. Relevance of KIR gene polymorphisms in bone marrow transplantation outcome.

Hum Immunol 2002;63:271-280.

26. Federmann B, Bornhauser M, Meisner C, Kordelas L, Beelen DW, Stuhler G, Stelljes M, Schwerdtfeger R, Christopeit M, Behre G, Faul C, Vogel W, Schumm M, Handgretinger R, Kanz L, Bethge WA. Haploidentical allogeneic hematopoietic cell transplantation in adults using CD3/CD19 depletion and reduced intensity conditioning: a phase II study.

Haematologica 2012;97:1523-1531.

27. Kasamon YL, Luznik L, Leffell MS, Kowalski J, Tsai HL, Bolaños-Meade J, Morris LE, Crilley PA, O’Donnell PV, Rossiter N, Huff CA, Brodsky RA, Matsui WH, Swinnen LJ, Borrello I, Powell JD, Ambinder RF, Jones RJ, Fuchs EJ. Nonmyeloablative HLA-haploidentical bone marrow transplantation with high-dose posttransplantation cyclophosphamide: effect of HLA disparity on outcome.

Biol Blood Marrow Transplant 2010;16:482-489.

28. Harris DT, Schumacher MJ, LoCascio J, Booth A, Bard J, Boyse EA. Immunoreactivity of umbilical cord blood and post-partum maternal peripheral blood with regard to HLAhaploidentical transplantation. Bone Marrow Transplant 1994;14:63-68.

29. Claas FH, Gijbels Y, van der Velden-de Munck J, van Rood JJ. Induction of B cell unresponsiveness to noninherited maternal HLA antigens during fetal life. Science 1988;241:1815-1817.

30. Tamaki S, Ichinohe T, Matsuo K, Hamajima N, Hirabayashi N, Dohy H. Superior survival of blood and marrow stem cell recipients given maternal grafts over recipients given paternal grafts. Bone Marrow Transplant 2001;28:375-380.

31. van Rood JJ, Loberiza FR Jr, Zhang MJ, Oudshoorn M, Claas F, Cairo MS, Champlin RE, Gale RP, Ringdén O, Hows JM, Horowitz MH. Effect of tolerance to noninherited maternal antigens on the occurrence of graft-versus-host disease after bone marrow transplantation from a parent or an HLAhaploidentical sibling. Blood 2002;99:1572-1577.

32. Ciurea SO, Champlin RE. Donor selection in T cell-replete haploidentical hematopoietic stem cell transplantation: knowns, unknowns, and controversies. Biol Blood Marrow Transplant 2013;19:180-184.

33.

Díez-Campelo M, Pérez-Simón JA, Ocio EM, Castilla C, González-Porras JR, Sánchez-Guijo FM, Vázquez L, Caballero MD, Cañizo MC, San Miguel JF. CD34 + cell dose and outcome of patients undergoing reducedintensity-conditioning allogeneic peripheral blood stem cell transplantation. Leuk Lymphoma 2005;46:177-183.

34. Singhal S, Powles R, Treleaven J, Kulkarni S, Sirohi B, Horton C, Millar B, Shepherd V, Tait D, Saso R, Rowland A, Long S, Mehta J. A low CD34+ cell dose results in higher mortality and poorer survival after blood or marrow stem cell transplantation from HLA-identical siblings: should 2 x 106 CD34+ cells/kg be considered the minimum threshold?

Bone Marrow Transplant 2000;26:489-496.

Turk J Hematol 2013;30:342-350

35. Bittencourt H, Rocha V, Chevret S, Socié G, Espérou H, Devergie A, Dal Cortivo L, Marolleau JP, Garnier F, Ribaud P, Gluckman E. Association of CD34 cell dose with hematopoietic recovery, infections, and other outcomes after HLA-identical sibling bone marrow transplantation. Blood 2002;99:2726-2733.

36. Ballen KK, Spitzer TR, Yeap BY, McAfee S, Dey BR, Attar E, Haspel R, Kao G, Liney D, Alyea E, Lee S, Cutler C, Ho V, Soiffer R, Antin JH. Double unrelated reduced-intensity umbilical cord blood transplantation in adults. Biol Blood Marrow Transplant 2007;13:82-89.

37. Brunstein CG, Barker JN, Weisdorf DJ, DeFor TE, Miller JS, Blazar BR, McGlave PB, Wagner JE. Umbilical cord blood transplantation after nonmyeloablative conditioning: impact on transplantation outcomes in 110 adults with hematologic disease. Blood 2007;110:3064-3070.

38. Rocha V, Gluckman E. Clinical use of umbilical cord blood hematopoietic stem cells. Biol Blood Marrow Transplant 2006;12:34-41.

39. Amrolia PJ, Muccioli-Casadei G, Huls H, Adams S, Durett A, Gee A, Yvon E, Weiss H, Cobbold M, Gaspar HB, Rooney C, Kuehnle I, Ghetie V, Schindler J, Krance R, Heslop HE, Veys P, Vitetta E, Brenner MK. Adoptive immunotherapy with allodepleted donor T-cells improves immune reconstitution after haploidentical stem cell transplantation. Blood 2006;108:1797-1808.

40. Di Ianni M, Falzetti F, Carotti A, Terenzi A, Castellino F, Bonifacio E, Del Papa B, Zei T, Ostini RI, Cecchini D, Aloisi T, Perruccio K, Ruggeri L, Balucani C, Pierini A, Sportoletti P, Aristei C, Falini B, Reisner Y, Velardi A, Aversa F, Martelli MF. Tregs prevent GVHD and promote immune reconstitution in HLA-haploidentical transplantation. Blood 2011;117:3921-3928.

41. Grosso D, Carabasi M, Filicko-O’Hara J, Kasner M, Wagner JL, Colombe B, Cornett Farley P, O’Hara W, Flomenberg P, Werner-Wasik M, Brunner J, Mookerjee B, Hyslop T, Weiss M, Flomenberg N. A 2-step approach to myeloablative haploidentical stem cell transplantation: a phase 1/2 trial performed with optimized T-cell dosing. Blood 2011;118:4732-4739.

42. Lee KH, Lee JH, Lee JH, Kim DY, Seol M, Lee YS, Kang YA, Jeon M, Hwang HJ, Jung AR, Kim SH, Yun SC, Shin HJ. Reduced-intensity conditioning therapy with busulfan, fludarabine, and antithymocyte globulin for HLA-haploidentical hematopoietic cell transplantation in acute leukemia and myelodysplastic syndrome. Blood 2011;118:2609-2617.

43. Davies JK, Gribben JG, Brennan LL, Yuk D, Nadler LM, Guinan EC. Outcome of alloanergized haploidentical bone marrow transplantation after ex vivo costimulatory blockade: results of 2 phase 1 studies. Blood 2008;112:2232-2241.

349

Turk J Hematol 2013;30:342-350

44. Raiola AM, Dominietto A, Ghiso A, Di Grazia C, Lamparelli T, Gualandi F, Bregante S, Van Lint MT, Geroldi S, Luchetti S, Ballerini F, Miglino M, Varaldo R, Bacigalupo A. Unmanipulated haploidentical bone marrow transplantation and posttransplantation cyclophosphamide for hematologic malignancies after myeloablative conditioning. Biol Blood Marrow Transplant 2013;19:117-122.

350

Bayraktar DU, et al: Haploidentical Transplantation

45. Di Bartolomeo P, Santarone S, De Angelis G, Picardi A, Cudillo L, Cerretti R, Adorno G, Angelini S, Andreani M, De Felice L, Rapanotti MC, Sarmati L, Bavaro P, Papalinetti G, Di Nicola M, Papola F, Montanari M, Nagler A, Arcese W. Haploidentical, unmanipulated, G-CSF-primed bone marrow transplantation for patients with high-risk hematological malignancies. Blood 2013;121:849-857.

Research Article

DOI: 10.4274/tjh.2013.0151

Turkish Chronic Myeloid Leukemia Study: Retrospective Sectional Analysis of CML Patients Türk Kronik Myeloid Lösemi Çalışması: KML Hastalarının Geriye Dönük Kesitsel İncelenmesi Fahri Şahin1, Güray Saydam1, Melda Cömert1, Burak Uz2, Akif Selim Yavuz3, Esra Turan3, İpek Yönal3, Hilmi Atay4, Engin Keltikli4, Mehmet Turgut4, Mustafa Pehlivan5, Meltem Olga Akay6, Emel Gürkan7, Semra Paydaş7, Selda Kahraman8, Fatih Demirkan8, Onur Kırkızlar9, Seval Akpınar9, Gülsüm Emel Pamuk9, Muzaffer Demir9, Hasan Mücahit Özbaş10, Mehmet Sönmez10, Mine Gültürk11 Ayşe Salihoğlu11, Ahmet Emre Eşkazan11, Cem Ar11, Handan Haydaroğlu Şahin5, Şeniz Öngören11, Zafer Başlar11, Yıldız Aydın11, Mustafa Nuri Yenere13, Nükhet Tüzüner11, Burhan Ferhanoğlu11, İbrahim C. Haznedaroglu2, Osman İlhan12, Teoman Soysal11 1Ege

University Faculty of Medicine, Department of Hematology, İzmir, Turkey

2Hacettepe 3İstanbul

University Faculty of Medicine, Department of Hematology, Ankara, Turkey

University Faculty of Medicine, Department of Hematology, İstanbul, Turkey

4Ondokuz

Mayıs University Faculty of Medicine, Department of Hematology, Samsun, Turkey

5Gaziantep

University Faculty of Medicine, Department of Hematology, Gaziantep, Turkey

6Osmangazi 7Çukurova 8Dokuz

University Faculty of Medicine, Department of Hematology, Eskişehir, Turkey

University Faculty of Medicine Department of Hematology and Oncology, Adana, Turkey

Eylül University Faculty of Medicine, Department of Hematology, İzmir, Turkey

9Trakya

University Faculty of Medicine, Department of Hematology, Edirne, Turkey

10Karadeniz 11İstanbul 12Ankara

Technical University Faculty of Medicine, Department of Hematology, Trabzon, Turkey

University Cerrahpaşa Faculty of Medicine, Department of Hematology, İstanbul, Turkey University Faculty of Medicine, Department of Hematology, Ankara, Turkey

Abstract: Objective: here have been tremendous changes in treatment and follow-up of patients with chronic myeloid leukemia (CML) in the last decade. Especially, regular publication and updating of NCCN and ELN guidelines have provided enermous rationale and base for close monitorization of patients with CML. But, it is stil needed to have registry results retrospectively to evaluate daily CML practices.

Address for Correspondence: Güray SAYDAM, M.D., Ege University Faculty of Medicine, Department of Hematology, İzmir, Turkey E-mail: saydamguray@yahoo.com Received/Geliş tarihi : April 29, 2013 Accepted/Kabul tarihi : June 10, 2013

351

Şahin F, et al: CML in Turkey

Turk J Hematol 2013;30:351-358

Materials and Methods: In this article, we have evaluated 1133 patients’ results with CML in terms of demographical features, disease status, response, resistance and use of second-generation TKIs.

Results: The response rate has been found relatively high in comparison with previously published articles, and we detected that there was a lack of appropriate and adequate molecular response assessment.

Conclusion: We concluded that we need to improve registry systems and increase the availability of molecular response assessment to provide high-quality patient care.

Key Words: Chronic myeloid leukemia, Registry, Response Özet: Amaç: Kronik myeloid lösemi (KML) tanısı olan hastalarda tedavi ve takip kriterleri son 10 yılda çok ciddi değişimlere uğramıştır. Özellikle NCCN ve ELN kılavuzlarının yayınlanması ve düzenli olarak güncellenmesiyle hastaların daha yakın takibi mümkün olmuştur. Ancak güncel uygulamaları değerlendirebilmek için kayıt ve retrospektif analizlere ihtiyaç vardır.

Gereç ve Yöntemler: Bu çalışmada, ülkemizde 12 merkezin katılımıyla KML tanısıyla izlenen 1133 hastanın demografik özellikleri, hastalık durumları, yanıt, direnç ve ikinci kuşak tirozin kinaz inhibitör kullanımları analiz edilmiştir.

Bulgular: Hasta grubumuzda, yanıt oranlarının litaretüre göre daha yüksek olduğu, moleküler yanıt değerlendirmenin tüm merkezlerde mümkün olmadığı saptanmıştır.

Sonuç: KML hastalarının bakım kalitesinin arttırılması için moleküler teknik kullanımının arttırılması ve daha yaygın kayıt sistemine ihtiyaç vardır.

Anahtar Sözcükler: Kronik myeloid lösemi, Kayıt, Yanıt

Introduction Chronic myeloid leukemia (CML) is a clonal myeloproliferative disease characterized by t(9:22) translocation, which produces the BCR-ABL fusion gene [1].

It is very well documented that the expression of constitutively activated tyrosine kinase, which is a product of BCR-ABL, is the underlying reason for the CML phenotype [2,3]. The reciprocal translocation between chromosomes 9 and 22 produces the shortened 22q known as the Philadelphia chromosome (Ph), and the new fusion gene is called the BCR-ABL fusion gene [4]. The clinical presentation of CML in most cases is seen in 3 different clinical phases: the chronic phase, accelerated phase, and blastic phase [5]. If left untreated, newly diagnosed chronic-phase CML patients finally progress to the accelerated and blastic phases. The blastic phase is of mainly the myeloid phenotype in almost two-third of patients and of the lymphoid phenotype in most of the remaining patients [6]. The blastic phase of the disease in all forms has a poor prognosis, with overall survival of 3 to 6 months. Most of the patients have been diagnosed in chronic phase [7].

CML has been treated with hydroxyurea, interferon, chemotherapy, and, most effectively, allogeneic stem cell transplantation. After 2000, the treatment strategy and results were completely changed by the introduction of targeted treatment with tyrosine kinase inhibitor (TKI) imatinib. The tyrosine kinase activity of BCR-ABL is the main therapeutic target of imatinib, the first TKI to be used in the treatment of CML. A large phase III randomized 352

trial, known as IRIS, provided the clinical and scientific background for the use of imatinib in the treatment of Ph (+) leukemias [8]. At a median follow-up of 19 months, the rate of complete cytogenetic response (CCyR) in the imatinibtreated patients was 94%, compared with a CCyR of 8.5% achieved by patients in the IFN-alpha and cytarabine arm.

According to the 5-year results of the IRIS study, only 68% of the patients in CCyR still remained on imatinib therapy [9]. The previously reported prospective IRIS trial, which retrospectively compared patient groups treated with imatinib and interferon, and single-center studies and comparison of allogeneic stem cell transplantation with data reported from stem cell transplant registries have confirmed the superiority of imatinib treatment to previously used strategies [9,10,11].

However, there are only a few reports describing imatinib therapy in patients with CML treated outside prospective trials or even from CML patient registries [12,13].

Although there have been tremendous increases in knowledge regarding clinical and molecular features of CML, epidemiology and treatment of CML in daily practice have not been studied in detail [14]. Sources of epidemiological data are mainly mortality statistics, European cancer registries such as the Swedish Cancer Registry or the Saarland Registry in Germany, or the database of the Surveillance, Epidemiology, and End Results Program of the United States National Cancer Institute [15].

The European LeukemiaNet (ELN) has developed recommendations for the medical management of patients

Şahin F, et al: CML in Turkey

with CML in daily clinical practice [15]. A careful and close monitoring of treatment response and of prognostic factors is required first to identify development of first-line therapy (imatinib) resistance, intolerance, and noncompliance or progression to advanced-phase disease. Subsequently, the treatment benefits of second-line therapies have to be considered. For success of treatment strategies, all required data and monitoring schedules of patients should be recorded appropriately.

There have not been many studies of treatment, followup, and monitoring strategies of patients with CML treated with TKIs in Turkey. Recently, Saydam et al. published the results of patients with CML treated with dasatinib under a compassionate use program [7]. However, that article covered only a small segment of patients with CML, was not nationwide in scope, and did not focus on the general CML population.

The aim of this report was to determine the demographic features, disease characteristics, treatment and monitoring strategies, response status, and survival rates of patients with CML treated with TKIs in Turkey.

Materials and Methods Data Collection This study was designed as a retrospective sectional study. The primary objective of this study was to evaluate the patients with the diagnosis of CML in Turkey. To collect the essential and maximum available data on patients with CML, a steering committee was organized and met to define the required information and to create a standardized questionnaire. The questionnaire consisted of separate sections such as demographical data and patient characteristics, disease characteristics, therapy and side effects, and, finally, last status of the patients. Across all of Turkey, 11 centers were enrolled in the study and 2 physicians from each center were chosen to fill out the forms. Ethics committee approval was obtained from the Ege University Ethics Committee with the date of 22 November 2011 and number of B.30.2.EGE.0.20.05.00/BOY/1401/575. The first patient was recorded on 13 August 2012. The data collection process was finished by October 2012 and statistical analyses were completed by the end of January 2013.

Patients’ Inclusion Patients of ≥18 years old with the diagnosis of CML irrespective of the diagnosis date and treatment strategies were enrolled in the study if the required data could be provided by the primary physicians.

Patients’ Exclusion Patients were excluded if they did not have cytogenetically and/or molecularly confirmed diagnosis of CML at any time point in their follow-up. Patients who could not have regular follow-up or had interruption in their follow-up of longer

Turk J Hematol 2013;30:351-358

than 1 year, those who were referred for allogeneic stem cell transplantation, and those who stopped CML treatments were also excluded.

Treatment and Monitoring All patients with the diagnosis of CML were included irrespective of their current treatment, with the exception of allogeneic stem cell transplantation. The duration of the current treatment, dosage, dose and therapy changes, and side effects were recorded. If there was more than one treatment in the patient’s history, the same information regarding these other therapies was also obtained.

Information on monitoring was classified as the duration, time points, and results based on the ELN recommendations for hematological, cytogenetic, and molecular responses. The results for each time point were not evaluated independently and separately; instead, certain definitions such as complete hematological response (CHR), minor/minimal/partial/ major cytogenetic response (CyR), and major molecular response (MMR) or complete molecular response (CMR; undetectable BCR-ABL transcripts with currently available techniques) were used as recommended by and indicated in the National Comprehensive Cancer Network (NCCN) and ELN guidelines.

Endpoints The primary endpoint of this program was to provide information regarding clinical, demographic, laboratory, and treatment status of patients with the diagnosis of CML, and also to determine the response rates, number of treatmentrelated adverse events, and use of second-generation TKIs. Dose modifications, disease status under TKI treatment, and cytogenetic and molecular responses were also analyzed and evaluated according to the available patient data.

Statistical Analysis All the statistical analyses were performed by using the data obtained from the patients’ files as recorded by primary physicians. A special form was designed to summarize the required data; it was completed by primary physicians and analyzed by an independent contract research organization.

Any patient who received the diagnosis of CML at any time point was included in the evaluation. Demographics, disease status at baseline, time from diagnosis, duration of treatment, the reasons for switching therapy to dasatinib and/or nilotinib, and the median dose of imatinib were summarized for all patients. Additionally, the last disease status, mortality rates, discontinuation rates, use of second-generation TKIs, and reported adverse events and dose modifications were also presented.

Statistical analyses were performed by using SPSS 20 and Excel 2007. The variables were first assessed by Kolmogorov–Smirnov/Shapiro–Wilk testing in terms of normal distribution. The results were provided as mean±SD for normally distributed variables and as median (min-max) 353

Turk J Hematol 2013;30:351-358

Şahin F, et al: CML in Turkey

for abnormally distributed parameters. Time to progression (TTP) was defined as the time between starting the drug and either discontinuation/switching of the drug for any reason or death. Overall survival (OS) was defined as the time period between the time of diagnosis to death because of any reason as well as any death reported after the drug was stopped. TTP and OS evaluations were performed by using the Kaplan–Meier method.

Results The demographic features of patients at the time of diagnosis are illustrated in Table 1. Based on these data, median age was calculated as 46.1±14.8 years for all patients, and this was similar for both sexes in terms of time of diagnosis. There was no difference between the rates of male and female patients, as 50.7% of patients were female and 49.3% were male. It was noticed that all patients had splenomegaly within the range of a median of 5 cm up to 40 cm. Hepatomegaly was detected in 46.5% of patients.

Disease status of patients at the time of diagnosis is illustrated in Table 2. The median white blood cell (WBC) count was calculated as 101x103/mm3 (range: 29x102 to 14x106). The median eosinophil percentage was 2.5% (range: 0%-9%), while the basophil level was 3±5%. Median hemoglobin level at the time of diagnosis was 11.5 g/dL, while platelet count was 275.103/mm3 (range: 22.104 to 24.105/mm3). At the time of diagnosis, 77.5% of patients had bone marrow fibrosis of any degree, and 83.2% of patients had hypercellular bone marrow histology. During first evaluation of patients during diagnostic work-up, 94.9% of patients were in the chronic phase, 4.1% were in the accelerated phase, and 1.1% were in the blastic phase. Sokal risk scores at diagnosis were calculated as low in 575/831 (69.2%), intermediate in 201/ 831 (24.2%), and high in 55/831 (6.6%) among patients with available data. Most of the patients (76.4%) had been treated with hydroxyurea after diagnosis in terms of decreasing WBC count before starting imatinib. The median dose of imatinib was reported as 400 mg/day (range: 100-800 mg) and median duration of imatinib therapy was 35.6 (range: 0.7-275.5) months. Since this evaluation does not have limitations in terms of therapy and diagnosis duration and it includes all patients with the diagnosis of CML, treatment duration with imatinib has a large range at 0.7 months to 275.5 months.

All patients had imatinib as the first line of therapy regardless of the phase of the disease. The most prominent reported side effects of imatinib were as follows: cytopenias in more than one lineage (10.75%), edema (6.41%), thrombocytopenia (4.67%), nausea (3.91%), rashes in grades 1-2 (3.04%), musculoskeletal pain (2.61%), neutropenia (2.39%), leukopenia (1.85%), vomiting (1.52%), malaise (1.41%), and “others”, which covers mainly local edema, increase in biochemical parameters, and gastrointestinal disturbance (13.24%). Most of these side effects were managed successfully.

354

Response to treatment with imatinib was evaluated in terms of hematological, cytogenetic, and molecular response based on current and previously published NCCN and ELN guidelines. This evaluation was performed by patients’ primary physicians and the available data collected from screening forms were statistically analyzed. Based on this analysis, 95.7% of patients treated with imatinib had CHR and 63.8% of patients had CCyR at certain time points.

Molecular response evaluation could not be performed due to lack of available data in most of the patients. Response to imatinib therapy and results are provided in Table 4. When we checked the progression to accelerated and blastic phases under imatinib treatment, it was noted that 114 of 1133 patients (10.1%) had progressed. The rates of progression in all Sokal risk score groups were similar at 10.1% in all groups. Median time to progression was 58.5±30.1 months.

Table 5 summarizes the use of second-generation TKIs (dasatinib, nilotinib, or both) after imatinib failure or intolerance. Imatinib had to be replaced by dasatinib or nilotinib, or sequentially by both, in 332 patients (29.3% of total) and, of those, 307 (90.8%) had to have their imatinib therapy changed due to resistance/inadequate response and 25 (9.2%) had to have it changed because of dug intolerance.

The first choice for switching TKI therapy in 194 patients (58.8%) was dasatinib, in 138 patients (41.2%) it was nilotinib, and 114 patients had to use both drugs in the course of CML due to either failure or intolerance. When the response to second-generation TKIs was evaluated, CCyR was calculated as 31.3% in patients treated with nilotinib and/or dasatinib. Due to lack of available data, molecular response could not be assessed.

At the end of study and data collection period, 86 (7.6%) patients were deceased and 1047 (92.4%) patients were alive (Figure 1). The median survival time for all patients was 218 (0.7-245.6) months.

Table 1. Demographic characteristics.

Age (years; median ± SD)

46.1±14.8

Age, females (years; median ± SD)

45.9±14.6

Age, males (years; median ± SD)

46.4±15

Sex (n (%)) Female

575/1133 (50.7)

Male

558/1133 (49.3)

Spleen size at the time of diagnosis, median (cm; min-max)

5 (1-40)

Hepatomegaly at the time of diagnosis (n (%)) Yes

452/971 (46.5)

No

519/971 (53.5)

Turk J Hematol 2013;30:351-358

Şahin F, et al: CML in Turkey

Table 2. Laboratory characteristics and disease phases.

WBC count at the time of diagnosis (109/L; median (min-max))

101 (2.9-140)

Eosinophils at the time of diagnosis (median % (min-max))

2.5 (0-9)

Basophils at the time of diagnosis (median±SD, %)

3±5

Blasts at the time of diagnosis (median % (min-max))

1 (0-30)

Hb at the time of diagnosis (g/L; median (min-max))

115 (42-173)

Platelets at the time of diagnosis (109/L; median (min-max))

275 (22-2400)

Bone marrow fibrosis at the time of diagnosis (n (%)) Yes

711/917 (77.5)

No

206/917 (22.5)

Cellularity of bone marrow (n (%)) Hypercellular

721/867 (83.2)

Normocellular

141/867 (16.3)

Hypocellular

5/867 (0.6)

Disease phase at the time of diagnosis (n (%)) Chronic phase

885/933 (94.9)

Accelerated phase

38/933 (4.1)

Blastic phase

10/933 (1.1)

The use of hydroxyurea before TKI treatment (n (%)) Yes

820/1074 (76.4)

No

254/1074 (23.6)

Imatinib dose (mg/day; median (min-max))

400 (100-800)

Duration of imatinib treatment (months; median (min-max))

35.6 (0.7-275.5)

The OS time was recalculated after switching imatinib therapy to nilotinib or dasatinib and Kaplan–Meier survival estimation resulted in 189.7 (0-275.9) months of OS for those patients (Figure 2).

Discussion In this study, we have evaluated 1133 Turkish patients with the diagnosis of CML in terms of demographic characteristics and disease status, treatment strategies and switching rates, and side effects. We have found that, during the first evaluation of patients during diagnostic work-up, 94.9% of patients were in the chronic phase, 4.1% were in the accelerated phase, and 1.1% were in the blastic phase.

All patients had imatinib as a first-line therapy regardless of the phase of the disease. It was found that 95.7% of patients treated with imatinib had CHR and 63.8% of patients had CCyR at certain time points. Molecular response evaluation could not be performed due to lack of available data in

Figure 1: Overall survival analyses for all patients with the diagnosis of CML irrespective of treatment.

355

Turk J Hematol 2013;30:351-358

Ĺžahin F, et al: CML in Turkey

Table 3. The frequency of adverse events during imatinib treatment.

Table 4. Response evaluation in CML patients treated with imatinib.

Adverse events

Response

n

%

Multiple cytopenias Edema Thrombocytopenia Nausea Rash Musculoskeletal pain Neutropenia Leukopenia Vomit Malaise Arthralgia Itching Myalgia Others

99 59 43 36 28 24 22 17 14 13 8 5 4 122

10.75 6.41 4.67 3.91 3.04 2.61 2.39 1.85 1.52 1.41 0.87 0.54 0.43 13.24

Total

494

53.64

n (%)

Complete hematologic response Yes

1020/1066 (95.7)

No

46/1066 (4.3)

Complete cytogenetic response Yes

660/1033 (63.8)

No

373/1033 (36.2)

Table 5. The general characteristics of second-line treatment after imatinib failure/intolerance.

Parameters Number of patients

n (%) 332/1133 (29.3)

Reason for discontinuation of imatinib treatment Resistance

307/332 (90.8)

Intolerance

25/332 (9.2)

New TKI Dasatinib

194/332 (58.8)

Nilotinib

138/332 (41.2)

Dasatinib + nilotinib

114/332

Complete cytogenetic response

Figure 2: Overall survival plot after switching therapy to second-generation TKIs. most of the cases. When we checked the progression to accelerated and blastic phases under imatinib treatment, it was noted that 114 of 1133 patients (10.1%) had progressed.

Median time to progression was 58.5Âą30.1 months. Imatinib has to be replaced by dasatinib or nilotinib, or sequentially by both, in 332 patients (29.3% of total) and, of those, 307 (90.8%) had to change their imatinib therapy due to resistance/inadequate response and 25 (9.2%) had to change imatinib therapy because of drug intolerance. The first choice for switching TKI therapy in 194 patients (58.8%) was dasatinib, in 138 patients (41.2%) it was nilotinib, and 114 patients had to use both drugs in the course of CML due to either failure or intolerance.

356

Yes

102/332 (31.3)

No

230/332 (68.7)

Our study has been the first nationwide CML registration study with the largest enrolled patient population. Since it is not a prospective trial and does not have any time limitations, it may be accepted as a reflection of current CML practice in Turkey outside of clinical trials. Patients participating in clinical trials are usually selected according to strict eligibility criteria. However, in practical situations, the clinical features of patients are much more heterogeneous than those defined by the selection criteria in clinical trials.

Because of that, sometimes, the results of clinical trials might not be applicable to real medical practice. However, it is very obvious that the results of treatment with TKIs outside of clinical trials are mandatory in order to evaluate and prove the efficacy of TKIs and for confirmation of clinical trials.

The comparison of results obtained from clinical trials with results of patients in routine practice has always been controversial. To do this successfully, dedicated registry programs are required with well-defined parameters.

TARGET (Timely and Appropriate Registration System for GLIVEC Therapy) is a Japanese organization to improve

Turk J Hematol 2013;30:351-358

Ĺžahin F, et al: CML in Turkey

the quality of medical care for CML patients in Japan [16].

The TARGET system is an online database that can be easily accessed by physicians. Results of patients registered in the TARGET system from 2003 to 2010 were recently published [17]. In that study, Tauchi et al. evaluated 639 CML patients followed for 90 months and treated with imatinib as a firstline therapy. They reported high survival rates with eventfree survival (EFS), progression-free survival (PFS), and OS at 79.1%, 94.8%, and 95.1%, respectively. Of course, it is not possible to compare these results with ours, as their patient population was highly homogeneous and was followed more strictly compared to ours.

There are other registry studies reporting the results of CML patients in terms of changing trends and survival plots.

BjĂśrkholm et al. published the Swedish registry results of 3173 diagnosed patients who were followed for the last 36 years [18]. They reported that the survival rates of patients changed dramatically after introduction of imatinib into clinical practice and that the estimated survival of patients with CML could be prolonged by up to 79 years by appropriate use of imatinib. These data, however, were sorted from the Swedish Cancer Registry and are not specific for only CML; they also lack available data on PFS and EFS [18]. All the same, the study was very important because of its large number of patients and because it provided relative survival rates in terms of changing paradigms of CML treatments.

status of CML therapy and results currently available. We have the hematological and cytogenetic results of almost all patients, but unfortunately we do not have much information about molecular responses. Molecular response to TKI therapy in patients with CML could not be assessed in our retrospective study due to lack of available and standardized real-time RT-PCR results, the universally accepted technique for detection of BCR-ABL transcripts. Although a small part of the participating centers in this sectional study have been involved in ELN standardization projects, also known as the EUTOS Project, most of the centers do not have laboratory facilities for obtaining standardized PCR results [20]. Recently, major hematology clinics have started to use commercially available kits with international scale values.

Our study has clarified that appropriate and adequate recording systems and, furthermore, dedicated and specific, non-interventional, and prospective recording systems are mandatory for not only future projects and research but also for patient care and effective follow-up. Our study also confirmed that all Turkish CML patients have similar hematological and cytogenetic response results as those reported by clinical trials and national registry programs.

However, it is obvious that, for molecular evaluation, much more effort is required in terms of establishment of adequate PCR facilities, which should be standardized eventually.

Acknowledgments

CAMELIA is an international population-based, noninterventional, observational multicenter clinical registry system established by the Czech and Slovak Society of Hematology in 2004 [19]. Recently, they published 661 consecutive CML patients registered to this system in terms of the use of imatinib in first- or second-line treatment and the role of stem cell transplantation in this patient cohort.

However, these patients were entered into the system between the years of 2000 and 2008, and some of them could have begun imatinib therapy relatively late. They proposed that, for success of not only imatinib therapy but also of stem cell transplantation, timing and appropriate dosing have been important factors influencing the results. Some of our patients, as in the case of CAMELIA, were diagnosed before the introduction of imatinib, but they began being treated with imatinib immediately after its approval. We also did not aim to investigate the role of stem cell transplantation in our patient cohort.

We would like to thank all colleagues who provided the data of their patients for this analysis.

Our study, unfortunately, could not rely on any registry system, and the parameters for analyses were designed by other investigators before data were collected. Since this was not a prospective study, but rather was performed based on retrospective patients’ files, the lack of some data was seen due to inadequate records. However, one must not forget that this study includes the largest patient cohort ever assembled in Turkey to date, and it is a good reflection of the current

3. Lugo TG, Pendergast AM, Muller AJ, Witte ON. Tyrosine kinase activity and transformation potency of bcr-abl oncogene products. Science 1990;247:1079-1082.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Corm S, Roche L, Micol JB, Coiteux V, Bossard N, Nicolini FE, Iwaz J, Preudhomme C, Roche-Lestienne C, Facon T, Remontet L. Changes in the dynamic of the excess mortality rate in chronic phase-chronic myeloid leukemia over 19902007: a population study. Blood 2011;118:4331-4337.

2. Daley GQ, Van Etten RA, Baltimore D. Induction of chronic myelogenous leukemia in mice by the P210bcr/abl gene of the Philadelphia chromosome. Science 1990;247:824-830.

4. Rowley JD. Letter: A new consistent chromosomal abnormality in chronic myelogenous leukemia identified by quinacrine fluorescence and Giemsa staining. Nature 1973;243:290-293.

357

Turk J Hematol 2013;30:351-358

5. Sokal JE, Baccarani M, Russo D, Tura S. Staging and prognosis in chronic myelogenous leukemia. Semin Hematol 1988;25:49-61.

6. Kurzrock G, Gutterman J, Talpaz M. The molecular genetics of Philadelphia chromosome-positive leukemias. N Engl J Med 1988;319:990-998.

7. Saydam G, Haznedaroglu IC, Temiz Y, Soysal T, Sucak G, Tombuloglu M, Ozdogu H, Yavuz S, Altintas A, Ozet G, Gulbas Z, Ferhanoglu B, Ilhan O. Retrospective evaluation of patients treated with dasatinib for Philadelphia positive leukemias: Turkish experience of 16 months. UHOD 2009;19:195-204.

8. O’Brien SG, Guilhot F, Larson RA, Gathmann I, Baccarani M, Cervantes F, Cornelissen JJ, Fischer T, Hochhaus A, Hughes T, Lechner K, Nielsen JL, Rousselot P, Reiffers J, Saglio G, Shepherd J, Simonsson B, Gratwohl A, Goldman JM, Kantarjian H, Taylor K, Verhoef G, Bolton AE, Capdeville R, Druker BJ; IRIS Investigators. Imatinib compared with interferon and low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid leukemia. N Engl J Med 2003;348:994-1004.

9. Druker BJ, Guilhot F, O’Brien SG, Gathmann I, Kantarjian H, Gattermann N, Deininger MW, Silver RT, Goldman JM, Stone RM, Cervantes F, Hochhaus A, Powell BL, Gabrilove JL, Rousselot P, Reiffers J, Cornelissen JJ, Hughes T, Agis H, Fischer T, Verhoef G, Shepherd J, Saglio G, Gratwohl A, Nielsen JL, Radich JP, Simonsson B, Taylor K, Baccarani M, So C, Letvak L, Larson RA; IRIS Investigators. Five-year follow-up of patients receiving imatinib for chronic myeloid leukemia. N Engl J Med 2006;355:2408-2417.

10. Roy L, Guilhot J, Krahnke T, Guerci-Bresler A, Druker BJ, Larson RA, O’Brien S, So C, Massimini G, Guilhot F. Survival advantage from imatinib compared with combination interferon-alpha plus cytarabine in chronic-phase chronic myelogenous leukemia: historical comparison between two phase 3 trials. Blood 2006;108:1478-1484.

11. Bittencourt H, Funke V, Fogliatto L, Magalhães S, Setubal D, Paz A, Macedo AV, Ruiz J, Azambuja AP, Silla L, Clementino N, Pasquini R. Imatinib mesylate versus allogeneic BMT for patients with chronic myeloid leukemia in first chronic phase. Bone Marrow Transplant 2008;42:597-600.

12. de Lavallade H, Apperley JF, Khorashad JS, Milojkovic D, Reid AG, Bua M, Szydlo R, Olavarria E, Kaeda J, Goldman JM, Marin D. Imatinib for newly diagnosed patients with chronic myeloid leukemia: incidence of sustained responses in an intention-to-treat analysis. J Clin Oncol 2008;26:3358-3363.

358

Şahin F, et al: CML in Turkey

13. Lucas CM, Wang L, Austin GM, Knight K, Watmough SJ, Shwe KH, Dasgupta R, Butt NM, Galvani D, Hoyle CF, Seale JR, Clark RE. A population study of imatinib in chronic myeloid leukemia demonstrates lower efficacy than in clinical trials. Leukemia 2008;22:1963-1966.

14. Hehlmann R, Hocchaus A, Baccarani M. Chronic myeloid leukemia. Lancet 2007;370:342-350.

15. Rohrbacher M, Hasford J. Epidemiology of chronic myeloid leukemia. Best Pract Res Clin Haematol 2009;22:295-302.

16. Kizaki M, Okamoto S, Tauchi T, Tanaka H, Tanimoto M, Inokuchi K, Murayama T, Saburi Y, Hino M, Tsudo M, Shimomura T, Isobe Y; TARGET Investigators. Current and future perspectives on the TARGET system: the registration system for Glivec established by JSH. Int J Hematol 2008;88:409-417.

17. Tauchi T, Kizaki M, Okamoto S, Tanaka H, Tanimoto M, Inokuchi K, Murayama T, Saburi Y, Hino M, Tsudo M, Shimomura T, Isobe Y, Oshimi K, Dan K, Ohyashiki K, Ikeda Y; TARGET Investigators. Seven-year follow-up of patients receiving imatinib for the treatment of newly diagnosed chronic myelogenous leukemia by the TARGET system.

Leuk Res 2011;35:585-590.

18. Björkholm M, Ohm L, Eloranta S, Derolf A, Hultcrantz M, Sjöberg J, Andersson T, Höglund M, Richter J, Landgren O, Kristinsson SY, Dickman PW. Success story of targeted therapy in chronic myeloid leukemia: a population-based study of patients diagnosed in Sweden from 1973 to 2008.

J Clin Oncol 2011;29:2514-2520.

19. Faber E, Mužík J, Koza V, Demeková E, Voglová J, Demitrovi ová L, Chrudej J, Markuljak I, Cmunt E, Kozák T, Tóthová E, Jarošová M, Dušek L, Indrák K. Treatment of consecutive patients with chronic myeloid leukemia in the cooperating centres from the Czech Republic and the whole of Slovakia after 2000--a report from the population-based CAMELIA Registry. Eur J Haematol 2011;87:157-168.

20. Hasford J, Baccarani M, Hoffmann V, Guilhot J, Saussele S, Rosti G, Guilhot F, Porkka K, Ossenkoppele G, Lindoerfer D, Simonsson B, Pfirrmann M, Hehlmann R. Predicting complete cytogenetic response and subsequent progressionfree survival in 2060 patients with CML on imatinib treatment: the EUTOS score. Blood 2011;118:686-692.

Research Article

DOI: 10.4274/Tjh.2012.0083

Does HOXA9 Gene Expression in Egyptian Chronic Myelogenous Leukemia Patients Affect Disease Progression? A Retrospective Cohort Study Mısırlı Kronik Miyeloid Lösemi Hastalarında HOXA-9 Gen Sunumu Hastalık Progresyonu Üzerine Etkili midir?

Geriye Dönük Kohort Çalışması Manar Mohamd Mohamad Ismail1, Moneer M. Manar2 1Laboratory Medicine Department, Faculty of Applied Medical Science, Um Al Qura University, Saudi Arabia 2Epidemiology and Biostatistics Department, National Cancer Institute, Cairo University, Egypt

Abstract: Objective: Chronic myelogenous leukemia (CML) is a clonal stem cell disease and is consistently associated with the BCR-ABL

fusion gene. The chronic phase of the disease tends to pass into an accelerated phase and eventually leads to acute leukemia if left untreated. Oncoproteins necessary for leukemic transformation are both fundamentally and clinically relevant to identify as they might be new molecular targets for the development of specific anti-leukemic drugs. This study is an initial step to define the proportion of HOXA9 gene expression in some Egyptians with chronic-phase CML at diagnosis and to evaluate its relation with BCR-ABL expression and its clinical significance.

Materials and Methods: Sixty-two newly diagnosed CML patients (56 in chronic phase, 1 in accelerated phase, and 5 in blastic crises) were enrolled in the study. HOXA9 and BCR-ABL gene expressions were detected by one-step RT-PCR. ABL was chosen as a control gene to calculate HOXA9/ABL and BCR-ABL/ABL ratios from densitometric values of PCR product intensities.

Results: HOXA9 expression was encountered in 25/56 (44.6%) of newly diagnosed CML patients in the chronic phase. The median expression was 0.31 (range: 0.08-1.37) in relation to the ABL gene, with a higher frequency of expression in CML patients presenting with splenomegaly (p<0.001), high Sokal score (p<0.001), and BCR-ABL expression from the first round (p=0.004). No association could be detected with other clinical parameters, overall survival, or disease-free survival.

Conclusion: HOXA9 expression is closely related to poor prognostic factors, but we could not demonstrate its relationship to patient survival.

Key Words: Chronic myeloid leukemia, CML, Accelerated phase HOXA9 gene, BCR-ABL expression, BCR-ABL/ABL ratio

Address for Correspondence: Manar Mohamd Mohamad Ismail, M.D., 4 Fum Al-Khalig Square, National Cancer Institute, Egypt, Cairo Phone: 00966-505524982 E-mail: manarismail4@yahoo.com Received/Geliş tarihi : July 3, 2012 Accepted/Kabul tarihi : March 25, 2013

359

Ismail MMM, et al: HOXA9 Gene Expression in CML

Turk J Hematol 2013;30:359-365

Özet: Amaç: Kronik Miyeloid Lösemi (KML) klonal bir kök hücre hastalığıdır ve BCR-ABL füzyon geni ile ilişkilidir. Hastalık tedavi

edilmediği zaman, kronik evreden hızlanmış evreye ilerler ve sonunda akut lösemi ile sonuçlanır. Lösemik transformasyonda temel olarak gerekli olan ve klinik olarak ilişkili onkoproteinlerin belirlenmesi spesifik anti-lösemik ilaçlar için yeni moleküler hedef olabilecekleri için önemlidir. Bu çalışma bazı Mısırlı kronik evre KML hastalarında HOXA9 gen sunum oranını belirlemede ve bunun BCR-ABL sunumu ile ilişkisinin ve klinik öneminin değerlendirilmesinde başlangıç adımıdır.

Gereç ve Yöntemler: Çalışmaya altmış iki yeni tanı KML olgusu (56 kronik evre, 1 hızlanmış evre ve 5 blastik kriz) alındı.

HOXA9 ve BCR-ABL genlerinin sunumu tek basamaklı RT-PCR ile tespit edildi. HOXA9/ABL ve BCR-ABL/ABL oranlarının PCR ürün yoğunluklarının dansitometrik değerleri üzerinden hesaplanması için kontrol geni olarak ABL seçildi.

Bulgular: HOXA9 sunumu yeni tanı kronik evre KML olgularının %44.6’sında (25/56) tespit edildi. ABL geni ile ilişkili olarak ortanca sunum 0.32 idi (aralık: 0.08-1.37) ve splenomegali ile başvuran (p<0.001), yüksek Sokal skoru (p<0.001) ve birinci raundda BCR-ABL sunumu olan (p =0.004) KML olgularında daha yüksek sunum sıklığı vardı. Diğer klinik parametreler, genel sağkalım ve hastalıksız sağkalım ile ilişki tespit edilemedi.

Sonuç: HOXA9 sunumu kötü prognostik faktörler ile yakından ilişkilidir ancak çalışmamızda bunun hasta sağkalımı ile ilişkisini gösteremedik.

Anahtar Sözcükler: Kronik Miyeloid Lösemi, KML, akselere faz HOXA9 geni, BCR-ABL ekspresyonu, BCR-ABL/ABL oranı

Introduction Chronic myelogenous leukemia (CML) has a worldwide annual incidence of 1-2 cases per 100,000. It can occur at any age, but the median age at diagnosis is 40-59 years [1]. CML is a clonal stem cell disease and is consistently associated with the BCR-ABL fusion gene located on the Philadelphia chromosome [2]. The translocation fuses the BCR and ABL genes, which results in the production of oncoprotein with an aberrant tyrosine kinase, which confers proliferative and survival properties to hematopoietic cells [3].This kinase plays a critical role in the pathogenesis of CML by activating multiple signaling pathways such as Ras, PI3K, MAPK, JAK/STAT, and Myc [4]. In the early phases of the disease there is excessive accumulation of mature myeloid cells that pass into the accelerated phase and eventually develop to acute leukemia if left untreated [1]. Additional genetic changes may reflect genetic instability. Therefore, intrinsic aggressiveness of the disease has been reported to ensue at varying frequencies during disease progression to the accelerated and blast crisis phases [5,6].

The genetic events involved in CML’s transformation into the acute phase are poorly understood [7]. However, there is increasing evidence that abnormal HOXA protein expression is functionally significant in myeloid transformation [8]. The homeodomain protein of the HOX family plays an important role in regulating definitive hematopoiesis [9]. One of them, HOXA9, part of the A cluster on chromosome 7p15, is expressed under physiological conditions in primitive hematopoietic cells of human and murine origin. The expression pattern of the homeobox genes in hematopoietic cells is specific to both lineage and differentiation stage. This expression is down-regulated as blood cells differentiate, suggesting a function in early hematopoiesis [10].

360

A growing body of evidence supports the notion that misexpression of the HOXA9 homeobox gene is a common and critical event in human acute myelogenous leukemia (AML) and is critical to the induction and maintenance of the malignant phenotype [9,11]. It was also proven that enforced expression of HOXA9 in murine marrow cells can immortalize the cells in culture and thus contributes largely with other events in leukemogenesis [12].

The strong association between HOXA9 overexpression and development of AML has encouraged us to determine its expression in CML at diagnosis to determine its proportion among Egyptian patients and to evaluate its relation with BCR-ABL expression and the clinical significance of such expression in disease aggression and patient survival.

Materials and Methods Study Design Patients and Clinical Samples Peripheral EDTA blood samples (5 mL) were obtained from 62 new patients presenting to the outpatient clinic of the National Cancer Institute, Cairo University, during a 6-month period starting in March 2004 with suspected CML based on morphological examination of peripheral blood (PB) and bone marrow (BM) films and leukocyte alkaline phosphatase score. Diagnosis was confirmed by the presence of the BCR-ABL fusion gene either from the first round or by nested polymerase chain reaction (PCR).

Fifty-six patients were in the chronic phase, 1 was in the accelerated phase, and 5 had acute blastic crises (ABCs) on top of CML (2 with B-cell acute lymphocytic leukemia [B-ALL] and 3 with AML) according to World Health Organization classifications [13].

Ismail MMM, et al: HOXA9 Gene Expression in CML

The Sokal score, a prognostic score that depends on age, spleen size, PB blasts, and platelets [14], was calculated. Overall survival and disease-free survival (DFS) were calculated for all patients and in relation to the studied genes. The study was approved by the local ethics committee of the university. All patients presenting in the chronic phase were treated with hydroxyurea at 1 to 6 g/day orally, depending on the level of the white blood cell (WBC) count [15]. When the total leukocyte count (TLC) reached 20x109/L, the dosage was decreased to 1 to 2 g/day and given continuously with the goal of reaching normal WBC counts (5 to 15x109/L).The drug was temporarily discontinued if the WBC count dropped below 5x109/L [16].

RNA Purification Total RNA was extracted from 106 cells from PB EDTA samples using the QIAamp RNA Blood Mini Kit (QIAGEN, Cat. No. 52304) and stored at -80 °C. RT-PCR The OneStep RT-PCR kit (QIAGEN, Cat. No. 210212), which combines cDNA synthesis from RNA with PCR amplification to provide a rapid, sensitive method for analyzing gene expression, was used. The following primer sets were used: TGTGGTTCTCCTCCAGTTGATAGA/ TCGGTGAGGTTGAGCAGTCGAG, which amplifies a fragment of 267 bp for human HOXA9 [9]; T G T T G AC T G G C G T G AT G T AG T T G C T T G G / TCAGCGGCCAGTAGCATCTGACTT for ABL, which was used as an internal control; AC AG C AT T C C G C T G AC C AT C A ATA AG / TGTTGACTGGCGTGATGTAGTTGCTTGG (BCRABL, first round); and CTGACCATCAATAAGGAAG/ GACCCGGAGCTTTTCACCTTTAGTT (BCR-ABL; second round) [17].

The total reaction volume was 25 µL, containing 2.5 µL of RNA, 100 µM of each dNTP, 0.4 mM of each primer (forward and reverse primer for each gene), and the enzyme mix included in the kit (reverse transcriptase and hot-start Taq DNA polymerase) in a 1X RT reaction buffer. All RTPCR reactions included NTC control (reaction mix without RNA). The confirmation of BCR-ABL amplification was carried out by nested PCR if the sample did not reveal it from the first round.

Cycling Parameters The thermal cycle program included a step for reverse transcription (30 min, 50 °C); an initial PCR activation step (15 min, 95 °C); 30 cycles consisting of denaturation (1 min, 94 °C), annealing (1 min, 58 °C), and extension (1 min, 72 °C); and a final extension step (10 min, 72 °C).

Electrophoresis Ten microliters of the PCR products were subjected to electrophoresis on 2% agarose gel containing ethidium bromide. A molecular weight marker (100-1000 bp) was

Turk J Hematol 2013;30:359-365

used to assess the positions of the defined DNA band. The gels were visualized under UV light (Figure 1).The image obtained was analyzed using complete gel documentations and an analysis system (Biometra, Germany). In order to obtain a semi-quantitative value, the intensity of the gene of interest (HOXA9 or BCR-ABL) was compared to a control gene in the same sample [18]. ABL was chosen as a control gene [19]. The HOXA9/ABL and BCR-ABL/ABL ratios were calculated from densitometric values of PCR product intensities.

Statistical Methods Data were analyzed using SPSS 12. The chi-square test (Fisher’s exact test) was used to examine the relation between qualitative variables. Spearman’s rho method was used to test correlations between numerical variables. The Kaplan–Meier method was used for survival analysis with the log-rank test to compare survival curves. All tests were 2-tailed and p<0.05 was considered significant.

Results The clinical characteristics of chronic-phase CML patients are shown in Table 1. HOXA9 expression was encountered in 25/56 (44.6%) of newly diagnosed CML cases. The median expression was 0.31 (range: 0.08-1.37) in relation to the ABL gene in each sample. The expression of HOXA9/ABL ratio in the accelerated case was 0.31, and in the 3 myeloid blastic crisis cases it was 0.83, 0.59, and 0.51, while it was not expressed in cases of lymphoid crisis.

HOXA9 was not related to age, sex, percentage of blasts in PB or BM, hemoglobin levels, or platelet count (p>0.05).

HOXA9-positive CML was significantly associated with larger spleen size (15.9±2.5 cm vs. 5.4±3.2 cm, p<0.001), higher Sokal score (p<0.001), and BCR-ABL expression from the first round (p=0.004) (Table 2). The HOXA9/ABL ratio was positively correlated with the BCR/ABL ratio (r=0.538, p=0.008), but not correlated to Sokal score (r=0.001, p=0.995).

Survival Analysis The median follow-up for the chronic-phase CML patients was 3 years (range: 0.2-6.8). The cumulative overall survival was 77.5%. There was no significant relation between overall survival and expression of the HOXA9 gene (p=0.073) or BCR-ABL fusion gene expression whether from the first round or the second round (p=0.523). Within the HOXA9-positive cases, there was no significant relation between HOXA9/ABL ratio and overall survival (p=0.794).

Patients with a Sokal score of <0.8 had significantly higher overall survival (95%) compared to the other 2 groups with higher scores (p=0.017 and p=0.022) (Table 3; Figure 2).

Ten out of 56 patients progressed to either the accelerated phase or acute blastic crisis (5 progressed to acute leukemia and the other 5 to the accelerated phase), and 5 cases could not be followed. Regarding the patients that progressed to 361

Ismail MMM, et al: HOXA9 Gene Expression in CML

Turk J Hematol 2013;30:359-365

Table 1. Clinical characteristics of chronic-phase CML patients (n=56).

Characteristic Age (years) # Sex (male/female) Spleen size (cm) TLC (x109/L) # Hb (g/dL) # Platelets (x109/L) # Peripheral blood blasts # BM blasts # Sokal score ^ Low risk (<0.8) Intermediate risk (0.8-1.2) High risk (>1.2) BCR-ABL1 expression (first round) ^ Positive Negative = positive for BCR-ABL (second round) BCR/ABL ratio in first round positive cases # HOXA9 expression Positive ^ Negative ^ HOXA9/ABL ratio in HOXA9-positive cases# Disease progression * Chronic Accelerated Acute blastic crisis Survival status * Alive Dead

37 (18-71) 32/24 (1.3/1.0) 11 (2-19) 147.4 (10.7-566) 9.6 (5.7-13.9) 365.5 (59-1054) 1 (0-5) 2 (0-5) 24 (42.8%) 21 (37.5%) 11 (19.6%)

Figure 1. Agarose gel electrophoresis for PCR product. Case 1: A case of CML that failed to express the HOXA9 gene at 276 bp. Case 2: Another case of CML that did express the HOXA9 gene. Molecular size marker: 100-1000 bp. Band density is presented between brackets.

41 (73.2%) 15 (26.8%) 0.72 (0.13-2.35)

25 (44.6%) 31 (55.4%) 0.31 (0.08-1.37)

46 (82.2%) 5 (8.9%) 5 (8.9%) 44 (78.5%) 12 (21.4%)

: Data presented as median (range). ^: Data presented as frequency (%). *: Five cases could not be followed. #

acute leukemia, the 3 that developed AML had HOXA9/ABL ratios of 0.31, 0.47, and 1.37 at diagnosis, while the other 2 who developed ALL did not express HOXA9. Regarding the accelerated cases, only 1 patient had an HOXA9/ABL ratio of 0.25 at presentation. Considering Sokal scores, 3 patients passed to the accelerated phase and 1 developed ABC in the group with low scores (<0.8), 2 patients progressed to the accelerated phase and 3 developed ABC in the group with intermediate scores (0.8-1.2), and only 1 developed ABC in the high score group (>1.2).

362

Figure 2. Overall survival in 56 chronic-phase CML patients.

A) HOXA9/ABL ratio in relation to overall survival (OS). B) BCR/ABL ratio in relation to OS. C) Sokal score in relation to OS.

Ismail MMM, et al: HOXA9 Gene Expression in CML

Turk J Hematol 2013;30:359-365

The cumulative DFS for those who did not express HOXA9 was 71.7% versus 73.4% among HOXA9-positive cases (p=0.759). Within the HOXA9-positive cases, there was no significant relation between DFS and HOXA9/ABL ratio (p=0.337). DFS was 68.4% for cases in which BCR-ABL was expressed from the first round versus 85.7% for cases in which it was expressed from the second round (p=0.297). DFS was

75.2% in cases with a Sokal score of <0.8, 61.4% for score of 0.8-1.2, and 88.9% for score of >1.2, with no significant difference among the 3 levels (p>0.05) (Figure 3).

Discussion This study demonstrated an HOXA9 expression rate of 44.6% in patients with chronic-phase CML. A previous study found HOXA9 expressed at detectable levels in every sample [20]. Our results could be explained by the fact that the expression of HOXA9 is down-regulated during myeloid differentiation [21], and all of the cells in chronic-phase CML show myeloid differentiation.

In accordance with other studies, we found lower expression of the HOXA9/ABL ratio in the accelerated cases than in cases of myeloid blastic crisis [22,24], raising the possibility that HOXA9 may interact with BCR-ABL to transform BM cells.

In the current series, patients presenting with lymphoid crises failed to express HOXA9. This could be explained by the fact that over-expression of HOXA9 in more mature cells enhances granulopoiesis and partially blocks B lymphopoiesis [12]; thus, it would not be expressed in B-ALL. In addition, in a previous gene expression study of human leukemia, HOXA9 emerged as one of the top 20 genes that distinguished AML from ALL [25].

In the current study, patients with poor prognosis (i.e. intermediate or high Sokal score) demonstrated higher HOXA9 expression (p<0.001), which concurs with the results of previous studies [20,26]. Splenomegaly was associated with HOXA9 expression (p<0.001), which is one of the factors included in Sokal scores denoting poor prognosis. Splenomegaly was also a criterion found in an experimental animal study done by Mayotte et al., in which they induced leukemia by HOXA9 over-expression [24].

In this work, 92% of HOXA9-positive cases had BCRABL expressed from the first round (p=0.004), i.e. patients with more copies of the BCR-ABL fusion gene showed higher proportions of HOXA9 expression. A previous study reported that patients with poor prognosis had increased expression of BCR-ABL as well as the HOXA9 gene [20].

Figure 3. Disease-free survival (DFS) in 56 chronic-phase CML patients. A) HOXA9/ABL ratio in relation to DFS. B) BCR/ABL ratio in relation to DFS. C) Sokal score in relation to DFS.

Table 2. Relation between HOXA9 expression and both Sokal score and BCR-ABL expression in chronic-phase CML.

HOXA9 expression

Sokal score

Negative (n=31)

Positive (n=25)

Low risk (<0.8)

23 (74.2%)

1 (4%)

Intermediate risk (0.8-1.2)

8 (25.8%)

13 (52%)

High risk (>1.2)

0 (0%)

11 (44%)

18 (58.1%)

23 (92%)

13 (41.9%)

2 (8%)

BCR-ABL expression BCR-ABL (1st) positive BCR-ABL (1 ) negative = BCR-ABL (2 ) positive st

nd

p-value

<0.001

0.004

*Fisherâ&#x20AC;&#x2122;s exact test was used to examine the relation between qualitative variables

363

Ismail MMM, et al: HOXA9 Gene Expression in CML

Turk J Hematol 2013;30:359-365

Table 3. Impact of the studied factors on overall survival at 3 years among CML patients.

Chronic-phase CML Cumulative overall survival

p-value

HOXA9 expression Positive (n=23) Negative (n=28)

68.4 84.8

0.073

BCR-ABL expression First round (n=39) Second round (n=12)

76.0 82.5

0.523

Sokal score First group, <0.8 (n=20) Second group, 0.8-1.2 (n=20) Third group, >1.2 (n=11)

95.0 65.5 63.6

0.017 (between 1st & 2nd groups) 0.022 (between 1st & 3rd groups) 0.808 (between 2nd & 3rd groups)

In the current study, overall survival was 77.5% without significant relation to expression of the HOXA9 gene (p=0.073) or BCR-ABL (p=0.523). Overall survival was 95% for cases with a Sokal score of <0.8, which is significantly higher as compared to the other 2 groups (p=0.017 and p=0.022).

DFS was not significantly related to HOXA9 or BCR-ABL expression or to Sokal score (p>0.05). Contrary to these findings, a previous study reported a patient with poorer prognosis (high Sokal score) showing the highest HOXA9/ ABL ratio, who quickly entered blast crisis and died 5 months later [26].

In this cohort study, 5 patients progressed to acute leukemia; of those, 3/5 expressed HOXA9 at diagnosis and developed AML, while the other 2, who developed ALL, did not express HOXA9. These data support previously recorded results of an earlier experimental study in which all mice that received BM cells infected with BCR-ABL plus HOXA9 retroviruses died within 9 days of acute leukemia and, in all cases, the leukemia was myeloid [24]. The fact that the patients presenting with AML on top of CML in this study were expressing higher levels of HOXA9/ABL ratio may indicate that the combination of these oncogenes was sufficient for the full transformation into AML. Conclusion The rate of HOXA9 expression in the studied chronicphase CML cases was 44.6%. It was higher in cases of poor prognosis with high or intermediate Sokal scores and in patients that expressed the BCR-ABL fusion gene from the first round. We could not draw a firm conclusion about whether HOXA9 expression has a bad effect on overall or disease-free survival. However, for data regarding the proportion of HOXA9 expression in CML and its effect on blastic transformation, HOXA9 should be evaluated in a larger number of patients both at presentation and during blastic crisis, and it will be important to evaluate misexpression 364

of HOXA9 oncogenes when seeking genes involved in the progression of CML to acute myeloid leukemia.

Authorsâ&#x20AC;&#x2122; Contributions Manar Ismail was responsible for study design, all lab work, collection of clinical data, analysis and interpretation of findings, and writing of the paper.

Manar Moneer was responsible for statistical analysis, interpretation of the data, and revising of the paper.

Acknowledgments The authors acknowledge Dr. Heba Shaker for her scientific support, expert technical assistance, and permission to perform the practical work under her supervision in the BMT lab at the NCI, Cairo University.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Redaelli A, Bell C, Casagrande J, Stephens J, Botteman M, Laskin B, Pashos C. Clinical and epidemiological burden of chronic myeloid leukemia. Expert Rev Anticancer Ther 2004;4:85-96.

2. Melo JV, Barnes DJ. Chronic myeloid leukemia as model of disease evolution in human cancer. Nat Rev Cancer 2007;7:441-453.

3. Dash AB, Williams IR, Kutok JL, Kutok JL, Tomasson MH, Anastasiadou E, Lindahl K, Li S, Van Etten RA, Borrow J, Housman D, Druker B, Gilliland DG. A murine model of CML blast crisis induced by cooperation between BCR/ABL and NUP98/HOXA. Proc Nat Acad Sci USA 2002;99:7622-7627.

Ismail MMM, et al: HOXA9 Gene Expression in CML

4. Merkerova M, Bruchova H, Brdicka R. Expression analysis of PCNA gene in chronic myeloid leukemia- combined application of siRNA silencing and expression arrays. Leuk Res 2006;31:661-672.

5. Ahuja HG, Popplewell L, Tcheurekdjian L, Slovak ML. NUP98 gene rearrangements and the clonal evolution of chronic myelogenous leukemia. Genes Chromosomes Cancer 2001;30:410-415.

6. Kim TD, Türkmen S, Schwarz M, Koca G, Nogai H, Bommer C, Dörken B, Daniel P, Coutre P. Impact of additional chromosomal aberrations and BCR-ABL kinase domain mutations on the response to nilotinib in Philadelphia chromosome-positive chronic myeloid leukemia.

Haematologica 2010;95:582-588.

7. Calabretta B, Perrotti D. The biology of CML blastic crisis.

Blood 2004;103:4010-4020.

8. Eklund EA. The role of HOX gene in myeloid leukemogenesis.

Curr Opin Hematol 2006;13:67-73.

9. Eklund EA. The role of HOX gene in malignant myeloid diseases. Curr Opin Hematol 2007;14:85-89.

10. Lawrence HJ, Christensen J, Fong S, Hu YL, Weissman I, Sauvageau G, Humphries RK, Largman C. Loss of expression of the Hoxa-9 homeobox gene impairs the proliferation and repopulating ability of hematopoietic stem cells. Blood 2005;106:3988-3994.

11. Shah N, Sukumar S. The Hox genes and their roles in oncogenesis. Nat Rev Cancer 2010;10:361-371.

12. Thorsteinsdottir U, Mamo A, Kroon E, Jerome L, Bijl J, Lawrence HJ, Humphries K, Sauvageau G. Over expression of the myeloid leukemia associated HOXA9 gene in bone marrow cells induces stem cell expansion. Blood 2002;99:121-129.

13. Wadleigh M, Tefferi A. Classification and diagnosis of myeloproliferative neoplasms according to the 2008 World Health Organization criteria. Int J Hematol 2010;91:174179.

14. Sokal JE, Cox EB, Baccarani M, Tura S, Gomez GA, Robertson JE, Tso CY, Braun TJ, Clarkson BD, Cervantes F, Rozman C; Italian Cooperative CML Study Group. Prognostic discrimination in ‘good risk’ chronic granulocytic leukemia.

Blood 1984;63:789-799.

15.

Kennedy BJ. The evolution of hydroxyurea therapy in chronic myelogenous leukemia. Semin Oncol 1992;19:21-26.

Turk J Hematol 2013;30:359-365

16. Abhyankar D, Shende C, Saikia T, Advani SH. Hydroxyurea induced leg ulcers. J Assoc Physicians India 2000;48:926927.

17. Cross NCP, Melo JV, Feng L, Goldman JM. An optimized multiplex PCR for detection of BCR-ABL fusion mRNA in hematological disorders. Leukemia 1994;58:186-189.

18. Dorsam ST, Ferrell CM, Dorsam GP, Derynck MK, Vijapurkar U, Khodabakhsh D, Pau B, Bernstein H, Haqq CM, Largman C, Lawrence HJ. The transcriptome of the leukomogenic homeoprotein HOXA9 in human hematopoietic cells. Blood 2004;103:1676-1684.

19. Beillard E, Pallisgaard N, van der Velden VH, Bi W, Dee R, van der Schoot E, Delabesse E, Macintyre E, Gottardi E, Saglio G, Watzinger F, Lion T, van Dongen JJ, Hokland P, Gabert J. Evaluation of candidate control genes for diagnosis and residual disease detection in leukemic patients using ‘real-time’ quantitative reverse transcriptase polymerase chain reaction (RQ-PCR) Europe against cancer program.

Leukemia 2003;17:2474-2786.

20. Tedeschi FA, Cardozo MA, Valentini R, Zalazar FE. Coexpression of HoxA9 and bcr-abl genes in chronic myeloid leukemia. Leuk Lymphoma 2010;51:892-896.

21.

Fujino T, Yamazaki Y, Largaespada DA, Jenkins NA, Copeland NG, Hirokawa K, Nakamura T. Inhibition of myeloid differentiation by Hoxa9, Hoxb8, and Meis homeobox genes. Exp Hematol 2001;29:856-863.

22. Celetti A, Barba P, Cillo C, Rotoli B, Boncinelli E, Magli MC. Characteristic patterns of HOX gene expression in different types of human leukemia. Int J Cancer 1993;53:237-244.

23. Kroon E, Thorsteinsdottir U, Mayotte N, Nakamura T, Sauvageau G. NUP98-HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice. EMBO J 2001;20:350-361.

24. Mayotte N, Roy DC, Yao J, Kroon E, Sauvageau G. Oncogenic interaction between BCR-ABL and NUP98HOXA9 demonstrated by the use of an in vitro purging culture system. Blood 2002;100:4177-4184.

25. Golub TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek M, Mesirov JP, Coller H, Loh ML, Downing JR, Caligiuri MA, Bloomfield CD, Lander ES. Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science 1999;286:531-537.

26. Tedeschi FA, Zalazar FE. HOXA9 gene expression in the chronic myeloid leukemia progression. Leuk Res 2006;30:1453-1456.

365

Research Article

DOI: 10.4274/Tjh.2012.0199

Evaluation of Danazol, Cyclosporine, and Prednisolone as Single Agent or in Combination for Paroxysmal Nocturnal Hemoglobinuria Paroksismal Nokturnal Hemoglobinüri Tedavisinde Tek Başına veya Birlikte Kullanılan Danazol, Siklosporin ve Prednizolonun Değerlendirilmesi Kanjaksha Ghosh, Manisha Madkaikar, Maya Gupta, Farah Jijina National Institute of Immunohaematology, 13th Floor, NMS Building, KEM Hospital Campus, Parel, Mumbai, India and Department of Haematology, 10th Floor, NMS Building, KEM Hospital Campus, Parel, Mumbai, India

Abstract: Objective: The responses of 32 patients with paroxysmal nocturnal hemoglobinuria (PNH) were assessed after the patients were put on various combinations of danazol, prednisolone, and cyclosporine.

Materials and Methods: Nineteen males and 13 females aged between 14 and 60 years with confirmed diagnosis of PNH were treated with danazol (4), danazol + cyclosporine (7), cyclosporine (1), and prednisolone + danazol (20). Response to these interventions was assessed regularly. Danazol was added to cyclosporine in patients with aplastic bone marrow after 3 months of cyclocporine use only unless the former therapy was successful. Four patients with aplastic marrow received only danazol because they had renal insufficiency at presentation. Patients were evaluated with regular complete blood count and routine liver and renal function tests.

Results: One patient responded to cyclosporine only. Thirteen of 32 patients (40%) had complete response, 12/32 patients (37%) had partial response leading to freedom from red cell transfusion, and 2/32 (7%) had no response. Five patients (16%) died due to thrombosis or hemorrhage within 3 months of therapy before their response to therapy could be assessed. The median period of review of the cases was 4 years and 6 months.

Conclusion: Danazol is a useful addition to PNH therapy both in combination with cyclosporine for hypoplastic PNH and with prednisolone for other forms of PNH, and this therapy could be a good alternative where eculizumab and anti-lymphocyte globulin cannot be used for various reasons.

Key Words: Cyclosporine, Danazol, Hemoglobinuria, Paroxysmal, Immunosuppression, Prednisolone

Address for Correspondence: Kanjaksha GHOSH M.D., MRCPI, MRCP, FRCPath FACP, FRCP (Glasg) Director, National Institute of Immunohaematology E-mail: kanjakshaghosh@hotmail.com Received/Geliş tarihi Accepted/Kabul tarihi

366

: December 18, 2012 : June 10, 2013

Ghosh K, et al: Evaluation of Danazol, Cyclosporine, and Prednisolone as Single Agent or in Combination for Paroxysmal Nocturnal Hemoglobinuria

Turk J Hematol 2013;30:66-370

Özet: Amaç: Tek başına veya birlikte kullanılan danazol, siklosporin ve prednizolonun tedavideki yeri 32 paroksismal nokturnal

hemoglobinürili (PNH) hasta üzerinde değerlendirildi.

Gereç ve Yöntemler: Yaşları 14 ile 60 arasında değişen 19 erkek ve 13 kadın PNH tanılı hasta danazol (4), danazol + siklosporin (7), siklosporin (1), ve danazol + prednizolon (20) ile tedavi edildi. Aplastik kemik iliği olup en az 3 aylık siklosporin tedavisine yanıt alınamayan hastalarda tedaviye danazol eklendi. Aplastik kemik iliği olan 4 hastada tanı anında böbrek yetersizliği bulunması nedeniyle sadece danazol kullanıldı. Hastalar düzenli kan sayımı, karaciğer ve böbrek testleri ile değerlendirildi.

Bulgular: Bir hastada tek başına siklosporin kullanımına yanıt alındı. Otuz iki hastanın 13’ünde (%40) tam remisyon elde edildi. On iki hastada (%37) kısmi yanıt görüldü ve bu hastalarda eritrosit replasman gereksinimi ortadan kalktı. İki hastada ise (7) tedaviye yanıt alınamadı. Beş hasta (%16) tedavinin ilk 3 ayı içinde yanıt değerlendirmesi yapılamadan tromboz veya kanamadan kaybedildi. Ortanca takip süresi 4,5 yıldı.

Sonuç: Danazol hipoplastik PNH’da siklosporine, diğer PNH türlerinde ise prednizolonun yanına eklenebilecek yararlı bir tedavi tamamlayıcı ajan olarak görünmektedir. Özellikle eculizumab ve antilenfosit globulinlere erişimin kısıtlı olduğu yerlerde uygulanabilecek bir tedavi seçeneği oluşturmaktadır.

Anahtar Sözcükler: Siklosporin, Danazol, Hemoglobinüri, Paroksismal, İmmunosupresyon, Prednizolon Introduction Paroxysmal nocturnal hemoglobinuria (PNH) has been variously managed with immunosuppressive therapies such as corticosteroids and cyclosporine [1,2]. Unusual medicines like metronidazole [3] have also been used for this condition. Recently the humanized monoclonal antibody against the C5a component of the complement system (eculizumab) has been very successfully used to manage such cases [4], but such therapy has severe complications apart from the cost, which cannot be borne by average people in developing countries. Hence, there is a need for evaluating common medicines singly or in combination in PNH cases.

PNH is an uncommon disorder; hence, not many large series on treatment options for such patients are available.

Standard management like packed red cell transfusion, iron replacement where indicated, and relevant management for bleeding and thrombotic episodes is applicable to PNH patients along with specific therapy. In this study, 32 well-characterized PNH patients are described as to their outcomes with cyclosporine, steroids, and danazol therapy singly or in various combinations.

Materials and Methods Patients Thirty-two patients (19 males and 13 females) aged between 14 and 60 years (median age: 35 years) were recruited for the study over a 4-year period and were followed for at least 1.5 years from the time of diagnosis.

The diagnosis of PNH was made on the basis of paroxysmal nocturnal hemoglobinuria, pancytopenia, unusual thrombotic jaundice, anemia, and splenomegaly coupled with low leukocyte alkaline phosphatase score, and the diagnosis was confirmed with positive Ham’s test results and

the presence of more than 10% red cells and/or neutrophils from peripheral blood showing negative staining for both CD55 and CD59 monoclonal antibodies. The test was done on a Becton Dickinson FACSCalibur flow cytometer with antibodies supplied by the same company (Becton Dickinson, USA).

The study was sanctioned by the institutional ethics committee (IEC) of the hospital and informed consent from the patients was taken as is mandatory for sanctioning of studies by the IEC. Investigations The patients were tested for complete blood counts, reticulocyte count, bone marrow aspirate for morphology and iron stain, cytogenetic study, and routine biochemistry.

Urinary hemosiderin staining was done in addition to Ham’s test and flow cytometry tests to confirm the diagnosis. Other imaging studies were done as per requirements of individual cases.

Criteria of Response Complete response was defined as an increase in hemoglobin to >110 g/L without red cell support, absolute neutrophil count above 1.5x109/L, platelet count above 100x109/L, and no requirement for blood product support or any infection. Partial response was defined as freedom from red cell support but platelet and neutrophil counts that had not normalized.

Therapy Supportive management was given to patients in the form of packed red cell transfusion whenever hemoglobin fell below 70 g/L. Bleeding episodes were treated with random donor platelet infusions whenever required. Responses to therapy were assessed every 3 months and patients who did not respond at the end of 3 months were deemed as nonresponders to that therapy.

367

Ghosh K, et al: Evaluation of Danazol, Cyclosporine, and Prednisolone as Single Agent or in Combination for Paroxysmal Nocturnal Hemoglobinuria

If the patient had bone marrow aplasia as a part of PNH then the patient was started on cyclosporine at 6 mg/ kg daily per os (PO), and in the event of non-response or partial response at the end of 3 months, danazol at 100 mg twice daily PO was added. Oral danazol was titrated up to 400 mg/day if required. Four patients with aplastic marrow who presented with renal insufficiency (serum creatinine of >170 µmol/L) were treated only with danazol. PNH patients who did not have marrow hypoplasia were treated with oral prednisolone at 1 mg/kg PO along with danazol at 100 mg twice daily, which was slowly increased to 400 mg/day if there was no response. After response was achieved, oral corticosteroids were tapered to a level of 7.5-10 mg PO daily over a course of 6-8 weeks.

If the patient had a prior thrombotic episode and there was no response with either prednisolone and cyclosporine, the patient was warned about the risk of danazol in precipitating thrombosis. If the platelet count was greater than 50x109/L, the patient was started on thromboprophylaxis with lowdose warfarin to maintain an international normalized ratio (INR) of 1.5-2.0 along with danazol at the lowest possible dose.

The patients had imaging and other studies done as per the requirements of their individual cases. In addition, all

Turk J Hematol 2013;30:66-370

patients received a combination of oral iron and folic acid in addition to immunosuppressive and danazol therapy.

Results The clinical presentations of the 32 patients are given in Table 1. Twelve patients presented with marrow hypoplasia and they received either danazol or immunosuppressive therapy, or immunosuppressive therapy and danazol.

Twenty patients did not have any marrow hypoplasia and they were started with a combination of corticosteroids and danazol orally. The details of these patients are presented in Table 2.

During the course of follow-up, 5 patients died (16%).

One died due to massive gastrointestinal bleeding, 2 due to stroke, 1 due to cerebral venous thrombosis, and 1 due to intraventricular (cardiac) thrombosis. Out of 32 patients, 13 (40%) had complete response and 12 had (38%) partial response, while 2 patients, i.e. 1 receiving only danazol and 1 receiving danazol and prednisolone, did not respond. Hence, 25/32 (78%) patients with PNH had some response to therapy. There were 4/13 complete responses in hypoplastic PNH (33%) cases compared to 9/20 (45%) in PNH cases without marrow hypoplasia. This difference was statistically significant (chi-square test, p<0.01). Twelve

Table 1. Clinical feature at presentation of 32 PNH patients.

Parameter

Total

PNH with hypoplastic marrow

PNH with non-hypoplastic marrow

32

13

19

Age (years)

14-60

14-48

22-60

Male:female

5:3

2:1

3:1

Symptoms <1 year before diagnosis

22

9

13

Anemia (Hb<70 g/L)

32

13

19

Bleeding

14

10

4

Jaundice

18

4

14

Hemoglobinuria

18

5

13

Thrombosis

9

4

5

Pancytopenia

22

12

10

Median Hb (g/L)

–

5.1

6.1

–

1000

1400

Median platelet count (10 /L)

–

40.000

56.000

>2% reticulocyte count

22

7

15

Renal failure

4

4

Abnormal karyotype

0

0

0

Positive urine hemosiderinuria

28

8

20

Negative marrow iron

22

8

14

Number of patients

Median ANC (µL) 9

368

Ghosh K, et al: Evaluation of Danazol, Cyclosporine, and Prednisolone as Single Agent or in Combination for Paroxysmal Nocturnal Hemoglobinuria

Turk J Hematol 2013;30:66-370

Table 2. Response of PNH patients to different therapeutic modalities (N=32).

Treatment

Response

Partial response

No response

Death

Cyclosporine only (1)

1

0

0

0

Danazol only (4)

1

2

1

0

Cyclosporine + danazol (7)

2

4

0

1

Prednisolone + danazol (20)

9

6

1

4

Total (32)

13

12

2

5

out of 32 patients (38%) needed interruption of treatment because of danazol-induced derangement of liver function (10/24) or cyclosporine-induced renal dysfunction (2/8).

This interruption was temporary and did not prevent continuation of therapy. Nine patients had evidence of stroke at presentation.

Four patients with hypoplastic marrow had prior thrombosis, and all of them had low platelet counts and did not respond to cyclosporine therapy alone; hence, danazol was added to this groupâ&#x20AC;&#x2122;s treatment without anticoagulation and none of these patients had developed thrombosis upon follow-up. Five patients in the non-aplastic group had thrombosis at presentation and none of them developed any future thrombotic complications. These patients were on low-dose warfarin with a target INR of 1.5-2.0 as their platelet counts were above 30x109/L .

Discussion In the present study, 32 patients with confirmed PNH were treated with various combinations of prednisolone, danazol, and cyclosporine. Cyclosporine was used in those patients who had marrow hypoplasia with PNH. Danazol was added to cyclosporine after 3 months if the cyclosporine was ineffective. One out of 8 patients responded to cyclosporine only and 1/4 had complete response to danazol only, while in 2/7 a complete response was seen when danazol was added to cyclosporine. Hence, in hypoplastic PNH either cyclosporine or danazol alone is less effective (12% and 25% response, respectively) than the combination of cyclosporine and danazol (30% response). In other groups in which danazol and oral corticosteroids were used, there were better complete response rates (9/20, 45%; chi-square test, p<0.05), but death was significantly increased in this group: 4/20 (20%) as compared to 1/12 (8%). All of the deaths were due to thrombohemorrhagic complications.

There are no randomized trials demonstrating the efficacy of oral steroids in decreasing hemolysis in PNH, but they are still used in the treatment of acute episodes due to their immediate effects. However, continued use of high dosages of corticosteroids is associated with substantial side effects and hence the International PNH Interest Group recommends its use in pulse doses for controlling acute attacks of hemolysis

[5]. It appears that steroids inhibit the activation of complements by an alternate pathway to prevent hemolysis [6]. In a prior study, the effect of danazol for PNH efficacy was shown in 4/5 cases of classical PNH refractory to other conventional treatments [7]. This result is similar to our results in 4 patients for whom only danazol was used. How danazol works in PNH is not clearly known, but resistance to osmotic lysis is likely to be one of the mechanisms for its activity [7]. Cyclosporine has been used as a treatment modality for hypoplastic anemia in association with other immunosuppressive drugs like anti-thymocytic globulin [8].

Our rationale for giving cyclosporine to our PNH patients along with danazol seems to be fully justified based on the results showing complete or partial response in 7/7 (100%) patients receiving this combination. However, danazol was important in this group because cyclosporine alone, when used without danazol, was useful only in 1/8 patients. The present study shows that hypoplastic PNH is best treated by a combination of cyclosporine with danazol. We could not use anti-thymocytic globulin or anti-lymphocytic globulin for our patients with severely aplastic marrow because of financial constraints, and due to the same reason we could not use eculizumab, which is even more costly than antithymocytic globulin and anti-lymphocytic globulin.

As a majority of our patients received danazol and 4 of them died due to thrombotic complications while on danazol, it may well be argued whether danazol could have precipitated these thrombotic complications. PNH in its natural course generally has a high rate of venous thrombosis, reported to be as high as 39% [9]. Compared to that, our figure was modest: 4/32 died of thrombotic complication (12%) and 9/32 (28%) had thrombosis at presentation.

With such a high background rate of thrombosis, it does not appear that danazol increased the rate significantly.

Eculizumab is a useful medicine for PNH as it not only reduces hemolysis but also reduces the frequency of thrombosis, proving conclusively the role of activated complement components in the pathogenesis of thrombosis in this condition [4]. However, we were not able to use it because of its cost; this is also the case with recombinant erythropoietin, which has been used by some authors in combination with corticosteroids [6]. Eculizumab has its own serious side effects in the form of intense hemolysis 369

Ghosh K, et al: Evaluation of Danazol, Cyclosporine, and Prednisolone as Single Agent or in Combination for Paroxysmal Nocturnal Hemoglobinuria

Turk J Hematol 2013;30:66-370

if the medicine is stopped suddenly, or bacterial meningitis due to blockade of complement component C5a [4,5]. In the present study, danazol, which was used in 31/32 patients alone or in combination with cyclosporine or prednisolone, led to 13 complete remissions and 12 partial remissions (82% response) with freedom from red cell infusion. Hence, danazol appears to be a useful medicine for the treatment of PNH in developing countries where financial constraints preclude the use of eculizumab.

3. Saraya AK, Saxena R, Dhot PS, Rattan A. Metronidazole: a potential therapeutic agent in paroxysmal nocturnal hemoglobinuria. Am J Hematol 1994;47:150-151.

Conflict of Interest Statement

5. Hill A, Stephen J, Hillmen P. Recent developments in the understanding and management of paroxysmal nocturnal haemoglobinuria. Br J Haematol 2007;137:181-192.

The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Brodsky RA. Paroxysmal nocturnal hemoglobinuria. In: Hoffman R, Benz EJ, Shattil SJ, Furie B, Cohen HJ, Siberstein LE, McGlave P (eds). Hematology: Basic Principles and Practice, 4th ed. Philadelphia, Elsevier Churchill Livingstone, 2005.

2. Parker C, Omine M, Richards S, Nishimura J, Bessler M, Ware R, Hillmen P, Luzzatto L, Young N, Kinoshita T, Rosse W, Socié G; International PNH Interest Group. Diagnosis and management of paroxysmal nocturnal hemoglobinuria.

Blood 2005;106:3699-3709

370

4. Hillmen P, Young NS, Schubert J, Brodsky RA, Socié G, Muus P, Röth A, Szer J, Elebute MO, Nakamura R, Browne P, Risitano AM, Hill A, Schrezenmeier H, Fu CL, Maciejewski J, Rollins SA, Mojcik CF, Rother RP, Luzzatto L. The complement inhibitor eculizumab in paroxysmal nocturnal hemoglobinuria. N Engl J Med 2006; 355:1233-1243.

6. Bourantas K. High-dose recombinant human erythropoietin and low dose corticosteroids for treatment of anemia in paroxysmal nocturnal hemoglobinuria. Acta Haematol 1994;91:62-65.

7. Harrington WJ Sr, Kolodny L, Horstman LL, Jy W, Ahn YS. Danazol for paroxysmal nocturnal hemoglobinuria. Am J Hematol 1997;54:149-154.

8. Marsh JC, Ball SE, Darbyshire P, Gordon-Smith EC, Keidan AJ, Martin A, McCann SR, Mercieca J, Oscier D, Roques AW, Yin JA; British Committee for Standards in Haematology.

Guidelines for the diagnosis and management of acquired aplastic anaemia. Br J Haematol 2003;123:782-801.

9. Hillmen P, Lewis SM, Bessler M, Luzzato L, Dacie JV. Natural history of paroxysmal nocturnal haemoglobinuria. N Engl J Med 1995;333:1253-1258.

Research Article

DOI: 10.4274/Tjh.2012.0142

An Experimental Study of Radiation Effect on Normal Tissue: Analysis of HIF-1α, VEGF, eIF2, TIA-1, and TSP-1 Expression Radyasyonun Normal Doku Üzerine Etkisiyle Alakalı Deneysel Bir Çalışma: HIF-1 alfa, VEGF, eIF2, TIA-1 ve TSP-1 Ekspresyonlarının Analizi Caner Aktaş1, Cengiz Kurtman2, M. Kemal Özbilgin3, İbrahim Tek4, Selami Koçak Toprak5 1Bülent Ecevit University School of Medicine, Department of Radiation Oncology, Zonguldak, Turkey 2Ankara University School of Medicine, Department of Radiation Oncology, Ankara, Turkey 3Celal Bayar University School of Medicine, Department of Histology and Embryology, Manisa, Turkey 4Medicana International Hospital, Department of Medical Oncology, Ankara, Turkey 5Başkent University School of Medicine, Department of Hematology, Ankara, Turkey

Abstract: Objective: This study investigated whether or not the stress and hypoxia, which are the effects of radiation on normal

vascular endothelium, leading to the release of HIF-1α, VEGF, eIF2, TIA-1, and TSP-1 were related and the possibility of them stimulating angiogenesis.

Materials and Methods: Twenty-four male Swiss Albino mice were separated into 4 groups. The first group was the control group (Group 1), and the second, third, and fourth groups were euthanized after 24 h (Group 2), 48 h (Group 3), and 7 days (Group 4), respectively. A single-fractioned 10 Gy of ionizing radiation was applied to all mice’s pelvic zone with Co-60. Bladders were removed completely from the pelvic region. Immunohistochemistry and light microscopy were used to investigate whether there would be an increase or not in the angiogenesis pathway by using the HIF-1α, VEGF, eIF2, TIA-1, and TSP-1 antibodies.

Results: The HIF-1α antibody showed strong staining in Group 3, while the staining intensity was less in other groups. VEGF showed weak staining in Groups 1 and 4, while moderate staining in Group 2 and strong staining in Group 3 was observed. eIF2 showed strong staining in Groups 1 and 4. Groups 2 and 3 were stained weakly. In the present study, staining with TSP-1 was very strong in the samples belonging to Group 1, while other groups showed very weak staining.

Conclusion: When normal tissue was exposed to radiation, the positively effective factors (HIF-1, VEGF, eIF2, and TIA1) on the angiogenesis pathway were increased while the negative factor (TSP-1) was decreased. Radiation may initiate physiological angiogenesis in the normal tissue and accelerate healing in the damaged normal tissue.

Key Words: Angiogenesis, Radiation, Cancer and normal tissue, Vascular endothelium, HIF-1α, VEGF, eIF2, TIA-1, TSP-1

Address for Correspondence: Selami Koçak TOPRAK, M.D., Başkent University School of Medicine, Department of Hematology, Ankara, Turkey GSM: +90 532 656 02 06 E-mail: sktoprak@yahoo.com Received/Geliş tarihi : October 3, 2012 Accepted/Kabul tarihi : February18, 2013

371

Aktaş C, et al: Radiation Effect on Normal Tissue

Turk J Hematol 2013;30:371-378

Özet: Amaç: Çalışmada, radyasyonun normal vasküler endotelde oluşturduğu stres ve hipoksiye bağlı olarak HIF-1α, VEGF,

eIF2, TIA-1 ve TSP-1 ekspresyonu ile bunların aralarında ilişki olup olmadığı ve bu ekspresyonlar neticesinde anjiojenezin uyarılabileceği hipotezi araştırılmıştır.

Gereç ve Yöntemler: Bu amaç ile 24 adet erkek Swiss albino fare, kontrol grubu (1. Grup) ve sırasıyla 24 saat (2. Grup), 48 saat (3. Grup) ve 7. Günde (4. Grup) ötanazi uygulanmak üzere 4 gruba ayrıldı. Co-60 cihazı ile pelvis bölgesine tek fraksiyonda 10 Gy iyonize radyasyon uygulandı. İmmünhistokimyasal metod ve ışık mikroskobu yöntemi ile HIF-1α, VEGF, eIF2, TIA-1 ve TSP-1 antikorları kullanılarak mesane damar endotelinde anjiojenez yolunda yer alan faktörlerin ekspresyonları değerlendirildi.

Bulgular: Çalışmamızda iyonize radyasyon ile mesane damar endotelinde HIF-1α antikoru ile 3. grupta kuvvetli boyanma izlenirken diğer grupların boyanma şiddeti daha az idi. VEGF incelendiğinde, 1. ve 4. grupta zayıf boyanma izlenirken, 2. grupta orta derecede, 3.grupta ise kuvvetli boyanma izlendi. eIF2, 1. ve 4. grupta kuvvetli boyanma göstermiş, 2. ve 3. grupta ise zayıf boyanmıştı. TIA-1 ile yapılan değerlendirmede ise 1. grupta zayıf boyanma özellikleri gözlenirken, 2. ve 4. grup orta derecede, 3. grupta ise oldukça kuvvetli boyanma izlendi. Çalışmamızda TSP-1 ile boyanma 1. grup örneklerde oldukça kuvvetli gözlenirken, diğer gruplarda boyanma özellikleri oldukça zayıf izlendi.

Sonuç: Radyasyon uygulaması ile normal dokuda anjiojenez yolundaki pozitif etkili faktörlerin (HIF-1α, VEGF, eIF2, TIA1) arttığı görülürken, negatif etkili faktörün (TSP-1) düştüğü belirlendi. Bu sonuç ile radyasyona yanıt olarak normal dokuda fizyolojik anjiojenezin başlatılarak doku iyileşmesinin hızlandırılmaya çalışıldığı düşünülmüştür.

Anahtar Sözcükler: Anjiojenez, Radyasyon, Kanser ve normal doku, Vasküler Endotel, HIF-1α, VEGF, eIF2, TIA-1, TSP-1 Introduction

Treatments with radiotherapy targeting tumor cells and tissues can lead to potentially lethal and sublethal damage in vascular and perivascular structures, normal tissues, and cells. Tumor cells with good vasculature are more sensitive to radiation, while tumoral structures with poor oxygenation are more resistant to radiation [1]. The response of the normal vascular endothelium and tumor vasculature to radiation treatment is important.

Radiation treatment leads to direct cell death by developing fractures in the double-helical DNA structure, while the development of reactive oxygen species (ROS) is another reason for cell death [2]. ROS and the nuclear factor kappa B and interleukin-8, together with the factors that act on angiogenesis, can start the production of vascular endothelial growth factor (VEGF) in an independent pathway with the hypoxia-inducible factor (HIF) [3,4].

With the ionizing, oxidative, and reductive effects of radiation, factors like HIF, the endogenous mitogenic VEGF, the eukaryotic initiation factor 2 (eIF2) that determines the response of the cell towards stress, and T-cell intracytoplasmic antigen-1 (TIA-1) can be released [5]. Thrombospondin-1 (TSP-1) is the endogenous antiangiogenic factor, which can inhibit these factors that can be released as a response to stress [6]. It is known that factors other than TSP-1 are released during angiogenesis.

The aim of this study is immunohistochemical determination of VEGF, which can be released with the increase of HIF-1a, being the positive factor that can start physiological angiogenesis as a response to the stress that develops in normal vascular endothelium as a result of 372

radiation and hypoxic states; TIA-1, which determines apoptosis; levels of endogenously released TSP-1, which can inhibit angiogenesis; and eIF2, which is known to determine stress granules. Furthermore, by exposing normal vascular endothelium to ionizing radiation, the relation between negatively influencing TSP-1 and the positive factors HIF1, VEGF, eIF2, and TIA-1 of angiogenesis pathways is investigated. The present study tries to determine the varying conditions of HIF-1a, VEGF, eIF2, TIA-1, and TSP-1, all of which play a role on angiogenesis signaling pathways, and their interrelations by the immunohistochemical method at 24 h, 48 h, and 7 days.

Materials and Methods A total of 24 healthy, male, adult Swiss Albino mice, weighing 30-40 g, were obtained from the Gazi University Experimental Animal Laboratory and used as subjects. The subjects were isolated from stress and noise and fed with water and food ad libitum at 25 °C in a cycle of 12 h of dark and 12 h of light before being included in the study.

Care of the subjects was performed at the Gazi University Experimental Animal Laboratory throughout the study.

The subjects were divided into 4 groups, the first being the control group and each containing 6 mice. Except for the 6 subjects in the control group, mice were exposed to ionizing radiation at their pelvic region on the same day with the Co60, 780-C device present in the Department of Radiation Oncology of Gazi University School of Medicine, applied to a region with 5 a 23 cm dimensions with a source-to-surface distance of 80 cm for 10.7 min with a 1000 cGy dose for Dmax in a single fraction. For obtaining sedation before the procedure, intramuscular ketamine injection at a dose of 4550 mg/kg was performed. In the field, 5 mice were fixed at the prone position.

Aktaş C, et al: Radiation Effect on Normal Tissue

The 6 mice in Group 1 (control) were not exposed to any radiation. Euthanasia by the method of cardiac puncture blood collection on the first day was performed, following sedation with 45-50 mg/kg intramuscular ketamine injection. After euthanasia, the pelvic region was dissected and the bladder was completely removed.

The 6 mice in Groups 2, 3, and 4 were sedated with 4550 mg/kg intramuscular ketamine injection 24, 48, and 168 h after their pelvic region was exposed to a single fraction of 1000 cGy ionizing radiation, respectively, and euthanasia by cardiac puncture blood collection was performed. After euthanasia, the pelvic region was dissected and the bladder was completely removed.

All samples were first washed in a solution containing 10% formol and then placed in screw-cap sampling containers containing 10% formol, with separate boxes used for every animal.

The tissue samples taken after the procedure were embedded into paraffin following the routine light microscopy paraffin tissue method at the Department of Histology and Embryology of Celal Bayar University School of Medicine. Slides of 5 µm were evaluated with the indirect immunohistochemistry method by using HIF-1α (monoclonal antihuman/mouse HIF-1α antibody, cat. no. ab463; Abcam, Cambridge, MA, USA), VEGF (antimouse VEGF antibody; Santa Cruz Biotechnology, Santa Cruz, CA, USA ), TIA-1 (cat. no. ab40693; Abcam), eIF2 (anti-eIF2α antibody, sc-11386; Santa Cruz Biotechnology), and TSP-1 (anti-thrombospondin-1 antibody, cat. no. ab79450; Abcam) primary antibodies.

In the control and experimental groups, the vascular endothelial cells of the bladder tissue were compared with the immunohistochemical method. The effect of ionizing radiation at 24 h, 48 h, and 7 days on HIF-1α, VEGF, eIF2, TIA-1, and TSP-1 levels that play their role in angiogenesis signaling pathways was evaluated and scored under light microscope in accordance with groups for every parameter.

The intensity of staining was evaluated for every preparation as 1 (weak), 2 (medium), or 3 (strong). The number of stained cells in every field was determined as a percentage and, finally, the histochemical score (H score) of each subject was obtained.

The study protocol was approved by the local ethics committee for animal experimentation.

Statistical Analysis Analyses of data were performed with SPSS 15.0 for Windows. As the variables used in the study were in accordance with normal distribution, the Shapiro–Wilk test was used, and as the P-values in the test were significant at >0.05, it was concluded that the data were distributed normally.

During intergroup comparisons of variables, one-way analysis of variance (ANOVA) was used as the number of subgroups exceeded 2. The variance analysis test revealed

Turk J Hematol 2013;30:371-378

that the difference between groups was significant. Paired comparisons of groups that were found to be significant with the ANOVA test were performed and the paired comparison of groups with homogeneous variance (equal variance) was made with the Tukey test, while the Tamhane test was used for the comparison of nonhomogeneous groups. The confidence level was accepted as 95% in the performed statistical evaluations.

Results When the hematoxylin-eosin–stained preparations of bladder samples were investigated with the histochemical technique, the bladder lumen in Group 1 (control) was covered with folded and transitional epithelium and the epithelial thickness was in general 5 or 6 layers. The lamina propria under the epithelium consisted of collagen fibers.

These collagen fibers were distributed irregularly. Various blood vessels and additional fibroblasts, which are connective tissue cells, were observed within the lamina propria. Under the lamina propria, longitudinal muscle fibers were observed at the inner and outer layers, while circular fibers were seen in the middle. Bladder tissue samples of the experimental groups also revealed transitional epithelium coverage and underlining lamina propria. Slight edema was especially observed in Groups 2 and 3, different from Group 1 (Figure 1).

When the tissue samples were investigated with the histochemical technique, it was seen that Groups 4 and 1 were very weakly stained, while Group 2 showed medium immunoreactivity in preparations stained with the VEGF antibody. VEGF immunoreactivity was shown by a high level of staining in Group 3 (Figure 2).

Variance homogeneity test results for the VEGF variable showed that the intergroup variance was homogeneous (P=0.099; P>0.05) and the Tukey test was performed.

According to the VEGF Tukey honestly significant difference

Figure 1. Hematoxylin-eosin staining properties of the bladder in Group 1 (a), Group 2 (b), Group 3 (c), and Group 4 (d). Ep = epithelium, LP = lamina propria.

373

Turk J Hematol 2013;30:371-378

multiple comparison test, there was a statistically significant difference between the control group and Groups 2 and 3 (P = 0.009 and 0.000). However, there was no statistically significant difference between Group 4 and the control group (P = 0.386). Groups 2 and 3 were significantly different from the other groups (P = 0.009, 0.000, and 0.000). Although there was no statistically significant difference between Group 4 and the control group, Group 4 was significantly different from Groups 2 and 3 (P=0.386, 0.000, and 0.000).

The eIF2 antibody staining of Groups 1 and 4 revealed very strong staining at vessel walls. In Groups 2 and 3, however, the staining was medium and showed almost similar properties (Figure 3).

According to the eIF2 Tamhane multiple comparison test, the difference between Group 1 and Groups 2 and 3 was statistically significant (P = 0.000 and 0.001). There was no statistically significant difference between Group 4 and

AktaĹ&#x; C, et al: Radiation Effect on Normal Tissue

the control group (P = 0.989). Groups 2 and 3 significantly differed from the control group and Group 4 (P=0.002 and 0.001). When Group 4 was examined, the difference from Groups 2 and 3 was statistically significant (P=0.002 and 0.006).

Staining with the HIF-1Îą antibody was strong in Group 3, while the degree of staining in other groups was very little (Figure 4).

According to the HIF-1 Tukey honestly significant difference multiple comparison test, although the control group was statistically significantly different from Group 3 (P=0.000), no statistical difference could be revealed between the control group and Groups 2 and 4 (P=0.253 and 0.960). Group 2 was significantly different from Group 3 (P = 0.005), but no statistically significant difference could be determined for Groups 1 and 4 (P=0.253 and 0.1). Group 3 was statistically different from other groups (P=0.000, 0.005, and 0.000). Group 4 was significantly different from Group 3 (P=0.000). Group 4 was not significantly different from the control group and Group 2 (P=0.960 and 0.1).

When tissue samples stained with the TIA-1 antibody were examined, Group 3 showed strong staining while Groups 2 and 4 had medium staining. Samples of the control group were weakly stained (Figure 5).

Figure 2. Staining properties of the bladder with VEGF antibody in Group 1 (a), Group 2 (b), Group 3 (c), and Group 4 (d). Ep = epithelium, LP = lamina propria.

According to the TIA-1 Tamhane multiple comparison test, the control group was significantly different from Groups 2, 3, and 4 (P=0.000, 0.000, and 0.013). Group 2 was significantly different from Group 3 and the control group (P=0.003 and 0.014). There was no significant difference between Groups 2 and 4 (P=0.809). Group 3 was significantly different from the other groups (P=0.000, 0.014, and 0.000). Group 4 was statistically significantly different from Group 3 and the control group (P=0.013 and 0.000). However, the difference between Groups 4 and 2 did not reach statistical significance (P=0.809).

Figure 3. eIF2 staining properties of the bladder in Group 1 (a), Group 2 (b), Group 3 (c), and Group 4 (d). Ep = epithelium, LP = lamina propria.

Figure 4. HIF-1 staining properties of the bladder in Group 1 (a), Group 2 (b), Group 3 (c), and Group 4 (d). Ep = epithelium, LP = lamina propria.

374

Turk J Hematol 2013;30:371-378

Aktaş C, et al: Radiation Effect on Normal Tissue

Staining with TSP-1 was strong in the control group, while staining properties in other groups were seen at low levels (Figure 6).

According to the TSP-1 Tamhane multiple comparison test, the control group was statistically significantly different from the other groups (P=0.000, 0.000, and 0.000).

Although Group 2 was statistically significantly different from the control group (P=0.000), no significant difference could be revealed between Groups 3 and 4 (P=0.998 and 0.533). Group 3 was statistically significantly different from the control group (P=0.000). However, Group 3 was not statistically significantly different from Groups 2 and 4 (P=0.998 and 0.169). Although Group 4 was statistically significantly different from the control group (P=0.000), no significant difference could be revealed between Groups 2 and 3 (P=0.553 and 0.169).

The staining properties of all groups are given in Table 1.

Discussion

Figure 5. TIA-1 staining properties of the bladder in Group 1 (a), Group 2 (b), Group 3 (c), and Group 4 (d). Ep = epithelium, LP = lamina propria.

Figure 6. TSP-1 staining properties of the bladder in Group 1 (a), Group 2 (b), Group 3 (c), and Group 4 (d). Ep = epithelium, LP = lamina propria.

Table 1. Staining properties of all groups.

G1

G2

G3

G4

VEGF

+

++

++++

+

eIF2

++++

++

++

++++

HIF-1α

+

++

++++

+

TIA-1

+

++

++++

++

TSP-1

++++

+

+

+

G: Group. Weak (+), medium (++), and strong (++++) staining.

The sensitivity of tumor cells to radiation is important in treatment. However, the interest in the radiotherapeutic response for nontumor cell targets has been increasing.

Ischemic and hypoxic stress is the most important condition for pathological and physiological angiogenesis [7]. Vascular endothelial cells have been observed to be the critical determinant in both the normal and tumoral tissue. In primary targets, the degree of radiation damage in the endothelial cells can significantly affect the treatment response [8]. Depending on tumor vasculature, phenotype, and microenvironment, it is different for normal tissue vasculature. The most important molecular difference of tumoral endothelial cells is their close relation with tumorrelated cytokines [7,9,10]. VEGF and similar proteins released by the tumoral and normal tissues can send signals developing angiogenesis response by attaching to the tyrosine kinase receptor of the endothelial cell. Thus, the radiation resistance of tumoral endothelial cells can depend on tumor-related cytokines. Selective tumor vasculature targeting these cytokines can increase sensitivity to radiation [7,8,10].

It is suggested that the major determinant of radiotherapeutic response is tumor vasculature [11]. This relation shows that in addition to radiotherapy leading to direct cell death, the damage it causes to the vessels supplying the tumor leads to secondary cell death. As tumors need their vessels to survive, a small amount of damage in these vessels can lead to larger amounts of tumoral death.

It is reported that tumors sensitive to radiotherapy have good vasculature, while tumors with little vasculature are more resistant to radiation [11]. In a study reported by Gorski et al., the way in which tumor vasculature affects radiotherapeutic response was evaluated, and it was stressed that radiotherapy increased VEGF release while VEGF was responsible for the resistance of endothelial cells to radiation [12]. This study showed that the tumor actively protects its vasculature from radiation damage. In certain other studies, similar results were obtained on the role of the combination of antiangiogenic agents and radiotherapy in improving endothelial cell sensitivity to radiation [13,14,16].

It is known that HIF-1α is activated in the event of hypoxia in normal tissues and solid tumors. Many studies have shown that, during hypoxia, HIF-1α is the main regulator of physiologic and pathologic angiogenesis signaling pathways.

Normal tissue studies performed with radiation showed 375

Turk J Hematol 2013;30:371-378

that as a result of HIF-1 increase, levels of VEGF, which is a positive influencing factor of the angiogenesis pathway, are also increased [17]. When the organism is exposed to factors like stressing radiation, heat, hypoxia, ischemia, and infection, stress granules that contain approximately half mRNA are activated. These granules change cell metabolism in the recovery of stress-related damage. eIF2 and TIA-1 act in change and adaptation. While formation of granules decreases eIF2 levels by eIF2 phosphorylation, TIA-1 levels are increased under the influence of stressing factors. TSP1, which acts as an inhibitor endogenously on angiogenesis signaling pathways, is found at certain levels in normal tissue [18]. Higher levels of HIF-1 and VEGF, which increase with stressing factors in normal tissue studies, lead to TSP1 down-regulation, while decreased VEGF leads to TSP-1 up-regulation. This is explained by the VEGF-mediated negative feedback mechanism.

Following exposure to radiation, VEGF, which acts on the angiogenesis signaling pathways, was increased. In the present study, all immunohistochemical evaluations revealed that VEGF staining was weak in Groups 1 (control) and 4 (euthanasia on day 7), medium in Group 2 (euthanasia after 24 h), and strong in Group 3 (euthanasia after 48 h). These findings show that at the vessel endothelium of tissues exposed to radiation, VEGF levels are increased slightly in vascular endothelial cells exposed to stress 24 h after radiation and strongly at 48 h. This increase was thought to be related to the strong increase of HIF-1α at 48 h. In the study by Rabbani et al., VEGF levels increased with the increase in HIF-1α [17]. The release of VEGF is an important process in angiogenesis signaling pathways and ionizing radiation increases VEGF release by increasing HIF1α [12,17]. However, we determined that levels of HIF-1α and VEGF had regressed to control group levels at day 7. We administered a single fraction of 10 Gy of ionizing radiation.

This may be the reason for the regression observed in HIF1α and VEGF levels back to the control group levels at day 7. Imaizumi et al. in 2010 performed an animal study on normal tissues and revealed results similar to ours [19]. They exposed healthy mice to 1 fraction of 8 Gy, 15 Gy, and 20 Gy total body irradiation and observed that the VEGF levels of aortic endothelial cells decreased in comparison to the control group after 5 days. They concluded that high doses of ionizing radiation stopped endothelial cell proliferation, migration, and budding. It was indicated that in the tumoral environment, endothelial cells are not silent; they continue to multiply and are related to the microenvironment.

However, it was also stated that, with radiation exposure, de novo angiogenesis was blocked, but the recurrence in irradiated areas being more resistant than the recurrence in nonirradiated areas could be because of the radiationrelated inhibition of de novo angiogenesis. Our results are in accordance with this study. In our study, we observed that following radiation exposure, HIF-1α and VEGF, which are the positive influencing factors of the angiogenesis pathway, were increased immunohistochemically at 48 h and had regressed to the control group levels on day 7. In the study

by Imaizumi et al., HIF-1 levels influenced by the hypoxic stress that could depend on radiation were not measured.

376

Aktaş C, et al: Radiation Effect on Normal Tissue

In our study, after a single fraction of 10 Gy of radiation exposure, the increase in HIF-1α and VEGF at 48 h was determined immunohistochemically. Similarly, in the study

by Rabbani et al., VEGF levels increased following the increase in HIF-1 levels [17]. This shows that after normal tissue radiation exposure, the positive influencing factors (HIF-1, VEGF) of the angiogenesis pathway are increased.

VEGF increases the radiation resistance of the endothelial cells. Dicker et al. stated that the negative influence of this response can be eliminated with antiangiogenic medications and in their study performed on normal animals, along with radiation exposure, they used Cox-2 inhibitors that have a positive influence on the VEGF level of the angiogenesis pathway and succeeded in increasing apoptosis while inhibiting proliferation and migration [20].

It was reported that HIF-1 levels were regulated by the oxygen concentration, and following radiation treatment, tumor oxygenation changes with HIF-1 up-regulation [7,21]. Radiotherapy-induced HIF-1 activation is also related to reoxygenation [21]. In our study, among preparations stained with the HIF-1α antibody, Group 3 showed strong staining, while the degree of staining in other groups was significantly less. HIF-1α levels reaching their highest at 48 h showed that the hypoxic state, which depends on radiation, can be regulated with the increase in HIF-1α. Nevertheless, it is not correct to relate this condition to apoptosis. In tumoral tissues, the apoptosis in endothelial cells peaks at 4-8 h following radiation and the vascular damage typically starts after 48 h. However, the rate of endothelial cells entering apoptosis is between 0% and 8% following clinical doses of radiotherapy [13]. Li et al. performed a radiationrelated apoptosis study on the vascular endothelial cells of nontumoral tongue tissue in rats and observed that the rates of apoptosis on days 5, 8, 14, 21, and 28 were 78.3%, 89.3%, 83.5%, 69.3%, and 47.3%, respectively [22]. Their findings support the finding that apoptosis does not happen at the same time in tumoral and nontumoral environments.

Although apoptosis is stimulated by radiation in general, the main death mechanism may not be apoptosis in many cell types [23]. In our study, a single fraction of 10 Gy of radiation was given and the staining in HIF-1α was strong at 48 h; if fractioned radiation were used, different results could be obtained.

The RNA granules that emerge in mammalian cells exposed to heat, oxidation, radiation, and hypoxia are called stress granules. As a response to stress, the mammalian cell mRNA changes its cell metabolism for repairing stress-related damage. During this change and adaptation, RNA-binding TIA-1 also plays a role in the relation between eIF2 and stress granules [7,24,25,26]. When stress occurs once in the cell, the granules are depolarized. Kedersha and Anderson defined this in 2002 [26]. Stress granules can emerge in tissues exposed to stress a few hours before apoptosis. Stress granules can regulate protein translation in neurons during ischemia. Stress granules do not develop in environments in vitro because response to stress can only emerge in the microenvironment in vivo [7,26]. In our study, the eIF2 antibody showed strong immunohistochemical staining in the control group and

Turk J Hematol 2013;30:371-378

Aktaş C, et al: Radiation Effect on Normal Tissue

Group 4, while weak staining was observed in Groups 2 and 3. Following irradiation of bladder vessel endothelium, the eIF2 level was lower than that of the control group at 24 h, then showed the tendency to increase at 48 h and reached the level of the control group on day 7. Stress granules can emerge in 15-30 min after the organism is exposed to stress. The eIF2 level decreases following its phosphorylation. The decrease in eIF2 levels in Group 2 confirms this. In tissues exposed to stress, stress granules emerge a few hours before apoptosis.

During this change and adaptation, RNA-binding TIA-1 plays a role in the relation between eIF2 and stress granules [7].

The increasing tendency of eIF2 levels at 48 h and on day 7 can indicate the start of apoptosis and/or the cells’ recovery from stress [7,24,25,26]. This is supported in the study of Li et al. They determined apoptosis on day 5 [22]. eIF2 staining could have increased at 48 h and on day 7 because of apoptosis and/or the cells’ recovery from stress. However, in our study, apoptosis could not be determined; only the factors that increase and decrease before apoptosis were histochemically observed. Our method was not convenient for determining apoptosis.

In our study, the immunohistochemical evaluation performed with the TIA-1 antibody revealed that the control group was weakly stained, while Groups 2 and 4 showed medium staining and Group 3 was very strongly stained. This showed that no stressing factor existed in the control group, while in Groups 2 and 3, TIA-1 levels started to increase depending on stressing factors and reached a maximum in Group 3.

TSP-1 is our only variable with a negative influence on angiogenesis signaling pathways. Ischemic or hypoxic stress is the most important condition for pathological or physiological angiogenesis [8]. Although many factors positively control the pathological and physiological pathways of angiogenesis, the most important endogenous regulator in down-regulation is TSP-1. TSP-1 prevents formation of vessel lumen [18,27]. In our study, immunohistochemical staining with the TSP-1 antibody revealed that the control group was very strongly stained, while staining in the other groups was very weak. However, the mean TSP-1 level at day 7 showed the tendency to increase when compared to the mean levels at 24 and 48 h. This can be explained as follows: in our study, at the angiogenesis pathway that was the result of radiation-related hypoxia, the positive influencing factor HIF-1α, which is stressing, showed strong staining in Group 3 while staining weakly in Group 4. eIF2, which is the determinant of stress granules, showed weak staining in Groups 2 and 3, while getting close to control group levels in Group 4. Under the influence of the stressing factor, TIA-1 showed medium staining in Group 2 and strong staining in Group 3, while regressing to the control group levels in Group 4. VEGF showed strong staining in Group 3. Increased levels of positive influencing factors can explain TSP-1, which acts as an endogenous inhibitor at the angiogenesis pathway, being

weakly stained in Groups 2 and 3, while the slight increase in staining in Group 4 can be explained as the decrease in positively influencing factors of the angiogenesis pathway leading to the increased immunohistochemical staining of TSP-1. At the endothelial cells of the irradiated vessel, the hypoxic stress can lead to the release of HIF-1 or indirect HIF-1 increase by the increase in ROS, and VEGF release [7]. The positively influencing factors (HIF-1α, VEGF, eIF2, and TIA-1) of the angiogenesis pathway could be stimulated and this might have decreased TSP-1, which is acting as an endogenous angiogenesis inhibitor. Mean HIF-1α and VEGF levels increased at 24 and 48 h because of stressing factors and decreased after 7 days, and this can explain the TSP-1 levels reaching the control group levels after 7 days.

Suzuma et al. reported that increased VEGF leads to TSP1 down-regulation, while decreased VEGF leads to TSP-1 up-regulation. This can be explained by a VEGF-mediated negative feedback mechanism [28].

Conclusion Serum levels of angiogenic cytokines decrease after radiotherapy in patients with hematologic malignancy and become undetectable in patients with complete remission [29]. However, by exposing normal tissue to radiation, we determined that the positively influencing factors of the angiogenesis pathway increased, while the negatively influencing factor decreased. Radiation can start physiological angiogenesis in normal tissues and can accelerate the healing of damaged normal tissue. The normal and tumoral tissues respond to radiation differently. In the future, molecular studies designed with fractioned doses and diagnostic angiogenesis studies will lead to a better understanding of this subject.

Conflicts of Interest Statement None of the authors of this work have any conflicts of interest, including specific financial interests, relationships, and/or affiliations, relevant to the subject matter or materials included.

References 1. Vaupel P, Mayer A. Hypoxia in cancer: significance and impact on clinical outcome. Cancer Metastasis Rev 2007;26:225-239.

2. Bucci B, Misiti S, Cannizzaro A, Marchese R, Raza GH, Miceli R, Stigliano A, Amendola D, Monti O, Biancolella M, Amati F, Novelli G, Vecchione A, Brunetti E, De Paula U. Fractionated ionizing radiation exposure induces apoptosis through caspase-3 activation and reactive oxygen species generation. Anticancer Res 2006;26:4549-4557.

3. Végran F, Boidot R, Michiels C, Sonveaux P, Feron O. Lactate influx through the endothelial cell monocarboxylate transporter MCT1 supports an NF-κB/IL-8 pathway that drives tumor angiogenesis. Cancer Res 2011;71:2550-2560.

377

Turk J Hematol 2013;30:371-378

4. North S, Moenner M, Bikfalvi A. Recent developments in the regulation of the angiogenic switch by cellular stress factors in tumors. Cancer Lett 2005;218:1-14.

5. Anderson P, Kedersha N. Visibly stressed: the role of eIF2, TIA-1, and stress granules in protein translation. Cell Stress Chaperones 2002;7:213-221.

6. Taraboletti G, Rusnati M, Ragona L, Colombo G. Targeting tumor angiogenesis with TSP-1-based compounds: rational design of antiangiogenic mimetics of endogenous inhibitors.

Oncotarget 2010;1:662-673.

7. Moeller BJ, Cao Y, Li CY, Dewhirst MW. Radiation activates HIF-1 to regulate vascular radiosensitivity in tumors: role of reoxygenation, free radicals, and stress granules. Cancer Cell 2004;5:429-441.

8. Gondhowiardjo S. Apoptosis, angiogenesis and radiation treatment. Acta Med Indones 2004;36:100-108.

9. Dvorak HF. Rous-Whipple Award Lecture. How tumors make bad blood vessels and stroma. Am J Pathol 2003;162:17471757.

10. Moeller BJ, Dewhirst MW. Raising the bar: how HIF-1 helps determine tumor radiosensitivity. Cell Cycle 2004;3:11071110.

11. Garcia-Barros M, Paris F, Cordon-Cardo C, Lyden D, Rafii S, Haimovitz-Friedman A, Fuks Z, Kolesnick R. Tumor response to radiotherapy regulated by endothelial cell apoptosis. Science 2003;300:1155-1159.

12. Gorski DH, Beckett MA, Jaskowiak NT, Calvin DP, Mauceri HJ, Salloum RM, Seetharam S, Koons A, Hari DM, Kufe DW, Weichselbaum RR. Blockage of the vascular endothelial growth factor stress response increases the antitumor effects of ionizing radiation. Cancer Res 1999;59:3374-3378.

13. Geng L, Donnelly E, McMahon G, Lin PC, Sierra-Rivera E, Oshinka H, Hallahan DE. Inhibition of vascular endothelial growth factor receptor signaling leads to reversal of tumor resistance to radiotherapy. Cancer Res 2001;61:2413-2419.

14. Hess C, Vuong V, Hegyi I, Riesterer O, Wood J, Fabbro D, Glanzmann C, Bodis S, Pruschy M. Effect of VEGF receptor inhibitor PTK787/ZK222584 [correction of ZK222548] combined with ionizing radiation on endothelial cells and tumour growth. Br J Cancer 2001;85:2010-2016.

15. Kozin SV, Boucher Y, Hicklin DJ, Bohlen P, Jain RK, Suit HD. Vascular endothelial growth factor receptor-2-blocking antibody potentiates radiation-induced long-term control of human tumor xenografts. Cancer Res 2001;61:39-44.

16. Lund EL, Bastholm L, Kristjansen PE. Therapeutic synergy of TNP-470 and ionizing radiation: effects on tumor growth, vessel morphology, and angiogenesis in human glioblastoma multiforme xenografts. Clin Cancer Res 2000;6:971-978.

17.

Rabbani ZN, Mi J, Zhang Y, Delong M, Jackson IL, Fleckenstein K, Salahuddin FK, Zhang X, Clary B, Anscher MS, Vujaskovic Z. Hypoxia inducible factor 1α signaling in fractionated radiation-induced lung injury: role of oxidative stress and tissue hypoxia. Radiat Res 2010;173:165-174.

378

Aktaş C, et al: Radiation Effect on Normal Tissue

18. Mizukami Y, Kohgo Y, Chung DC. Hypoxia inducible factor-1 independent pathways in tumor angiogenesis. Clin Cancer Res 2007;13:5670-5674.

19. Imaizumi N, Monnier Y, Hegi M, Mirimanoff RO, Rüegg C. Radiotherapy suppresses angiogenesis in mice through TGF-βRI/ALK5-dependent inhibition of endothelial cell sprouting. PLoS One 2010;5:11084.

20. Dicker AP, Williams TL, Grant DS. Targeting angiogenic processes by combination rofecoxib and ionizing radiation.

Am J Clin Oncol 2001;24:438-442.

21. Bussink J, Kaanders JH, Rijken PF, Raleigh JA, Van der Kogel AJ. Changes in blood perfusion and hypoxia after irradiation of a human squamous cell carcinoma xenograft tumor line.

Radiat Res 2000;153:398-404.

22. Li CY, Hong Y, Tao XA, Xia J, Cheng B. The correlation between the severity of radiotherapy-induced glossitis and endothelial cell injury in local tissues in a rat model. Med Oral Patol Oral Cir Bucal 2011;16:711-715.

23. Abend M. Reasons to reconsider the significance of apoptosis for cancer therapy. Int J Radiat Biol 2003;79:927-941.

24.

Sparmann A, Bar-Sagi D. Ras-induced interleukin-8 expression plays a critical role in tumor growth and angiogenesis. Cancer Cell 2004;6:447-458.

25.

Xu L, Pathak PS, Fukumura D. Hypoxia-induced activation of p38 mitogen-activated protein kinase and phosphatidylinositol 3’-kinase signaling pathways contributes to expression of interleukin 8 in human ovarian carcinoma cells. Clin Cancer Res 2004;10:701-707.

26. Kedersha N, Anderson P. Stress granules: sites of mRNA triage that regulate mRNA stability and translatability.

Biochem Soc Trans 2002;30:963-969.

27. Suri C, McClain J, Thurston G, McDonald DM, Zhou H, Oldmixon EH, Sato TN, Yancopoulos GD. Increased vascularization in mice overexpressing angiopoietin-1.

Science 1998;282:468-471.

28. Suzuma K, Takagi H, Otani A, Oh H, Honda Y. Expression of thrombospondin-1 in ischemia-induced retinal neovascularization. Am J Pathol 1999;154:343-354.

29. Ria R, Cirulli T, Giannini T, Bambace S, Serio G, Portaluri M, Ribatti D, Vacca A, Dammacco F. Serum levels of angiogenic cytokines decrease after radiotherapy in non-Hodgkin lymphomas. Clin Exp Med 2008;8:141-145.

Research Article

DOI: 10.4274/Tjh.2012.0205

Arterial Stiffness and Pulse Wave Reflection in Young Adult Heterozygous Sickle Cell Carriers Genç Erişkin Heterozigot Orak Hücre Taşıyıcılarında Arteryel Sertlik ve Nabız Dalga Yansıması Tünzale Bayramoğlu1, Oğuz Akkuş1, Kamil Nas2, Miklós Illyes3, Ferenc Molnar4, Emel Gürkan5, M. Bayram Bashırov6, Şerafettin Demir7, Gamze Akkuş5, Esmeray Acartürk1 1Çukurova University, Faculty of Medicine, Department of Cardiology, Adana, Turkey 2Szent János Hospital Department of Radiology, Budapest, Hungary 3Heart Institute Faculty of Medicine, University of Pécs, Pécs, Hungary 4Department of Hydrodynamic Systems, Budapest University of Technology and Economics, Budapest, Hungary 5Çukurova University, Faculty of Medicine, Department of Internal Medicine, Hematology, Adana, Turkey 6Çukurova University, Faculty of Medicine, Adana, Turkey 7Adana State Hospital, Department of Cardiology, Adana, Turkey

Abstract: Objective: Pulse wave velocity (PWV) and aortic augmentation index (AI) are indicators of arterial stiffness. Pulse wave

reflection and arterial stiffness are related to cardiovascular events and sickle cell disease. However, the effect of these parameters on the heterozygous sickle cell trait (HbAS) is unknown. The aim of this study is to evaluate the arterial stiffness and wave reflection in young adult heterozygous sickle cell carriers.

Materials and Methods: We enrolled 40 volunteers (20 HbAS cases, 20 hemoglobin AA [HbAA] cases) aged between 18 and 40 years. AI and PWV values were measured by arteriography.

Results: Aortic blood pressure, aortic AI, and brachial AI values were significantly higher in HbAS cases compared to the control group (HbAA) (p=0.033, 0.011, and 0.011, respectively). A statistically significant positive correlation was found between aortic pulse wave velocity and mean arterial pressure, age, aortic AI, brachial AI, weight, and low-density lipoprotein levels (p=0.000, 0.017, 0.000, 0.000, 0.034, and 0.05, respectively) in the whole study population. Aortic AI and age were also significantly correlated (p=0.026). In addition, a positive correlation between aortic PWV and systolic blood pressure and a positive correlation between aortic AI and mean arterial pressure (p=0.027 and 0.009, respectively) were found in HbAS individuals. Our study reveals that mean arterial pressure and heart rate are independent determinants for the aortic AI. Mean arterial pressure and age are independent determinants for aortic PWV. Conclusion: Arterial stiffness measurement is an easy, cheap, and reliable method in the early diagnosis of cardiovascular disease in heterozygous sickle cell carriers. These results may depend on the amount of hemoglobin S in red blood cells.

Further studies are required to investigate the blood pressure changes and its effects on arterial stiffness in order to explain the vascular aging mechanism in the HbAS trait population.

Key Words: Sickle cell, Arterial stiffness, Pulse wave velocity, Quality of life Address for Correspondence: Oğuz AKKUŞ, MD, Çukurova University Faculty of Medicine, Department of Cardiology Yüreğir Street, Adana, Turkey GSM: +90 532 668 58 70 E-mail: oakkusfb@gmail.com Received/Geliş tarihi : December 23, 2012 Accepted/Kabul tarihi : June 26, 2013

379

Turk J Hematol 2013;30:379-386

Bayramoğlu T, et al: Arterial Stiffness and Pulse Wave Reflection in Young Adult Heterozygote Sickle Cell Carriers

Özet: Amaç: Nabız dalga hızı ve aort artırma indeksi arteryel sertliğin belirleyicileridir. Nabız dalga yansıması ve arteryel sertlik

kardiyovasküler olaylar ve orak hücre hastalığı ile ilişkilidir. Ancak bu belirteçlerin heterozigot orak hücre taşıyıcılarına (HbAS) olan etkisi bilinmemektedir. Çalışmanın amacı genç erişkin heterozigot orak hücre taşıyıcılarında arteryel sertlik ve dalga yansımasını değerlendirmektir.

Gereç ve Yöntemler: Çalışmaya 18-40 yaşlar arası 40 gönüllü (20 Hemoglobin AS, 20 Hemoglobin AA) dahil edildi.

Arttırma indeksi ve nabız dalga hızı arteriyografi ile ölçüldü.

Bulgular: Orak hücre taşıyıcılarında aort kan basıncı, aort artırma indeksi, brakiyal artırma indeksi değerleri kontrol grubuna

(HbAA) göre anlamlı yüksek saptandı (p=0,033, 0.011, 0,011). Tüm çalışma popülasyonunda aort nabız dalga hızı, ortalama arter basıncı, yaş, aort artırma indeksi, brakiyal arttırma indeksi, kilo ve düşük yoğunluklu lipoprotein arasında istatistiksel pozitif anlamlı korelasyon saptandı (p=0,000, 0,017, 0,000, 0,000, 0,034, 0,05). Aort artırma indeksi ve yaş arasında anlamlı korelasyon bulundu (p=0,026). Orak hücre taşıyıcılarında aort nabız dalga hızı ve sistolik kan basıncı ile aort arttırma indeksi ve ortalama arter basıncı arasında anlamlı pozitif korelasyonlar saptandı (p=0,027, 0,009). Çalışmamızda ortalama arter basıncı ve kalp hızının aort artırma indeksi için, ortalama arter basıncı ve yaşın ise aort nabız dalga hızı için en önemli bağımsız belirleyiciler olduğu görüldü.

Sonuç: Arteryel sertlik ölçümü HbAS taşıyıcılarında erken kardiyovasküler hastalık tanısı için kolay, ucuz ve uygun bir yöntemdir. Bu sonuçlar kırmızı kan hücrelerindeki hemoglobin S miktarına bağlı olabilir. Heterozigot orak hücre taşıyıcılarında, vasküler yaşlanma mekanizmasını açıklayabilmek için kan basıncı değişimlerinin arter sertliği üzerine olan etkilerini inceleyen daha çok çalışmaya ihtiyaç vardır.

Anahtar Sözcükler: Orak hücre, Arteriyel sertlik, Nabız dalga hızı, Yaşam kalitesi

Introduction

Materials and Methods

Sickle cell disease (SCD) affects many systems as it is a chronic and hemolytic autosomal recessive disease.

Atherosclerosis is a common finding in patients with sickle cell anemia [1]. Moreover, the most common cause of morbidity and mortality in these patients are ischemic complications [2]. As a consequence of atherosclerosis, arterial stiffness increases. Arterial stiffness causes a faster reflection of the forward pulse wave from bifurcation points in peripheral vessels. As a result of the new waveform, systolic blood pressure (SBP) increases, diastolic blood pressure (DBP) decreases, cardiac workload increases, and coronary perfusion falls. The role of arterial stiffness and wave reflection has been established in many studies [3,4]. In addition, the relationship between SCD and pulse wave reflection causing stroke has been demonstrated [5]. These vascular complications develop as a result of microvascular occlusion by dense and rigid sickle cells [6].

Inversely, due to lower blood pressure in the homozygous sickle cell form (HbSS), aortic pulse wave velocity (PWV) was found to be lower than in the healthy hemoglobin AA genotype (HbAA) group [7]. Pulse wave velocity (PWV) is a susceptible diagnostic element, and it is also involved in risk stratification for subclinical organ damage [8]. Based on previous studies, if the change of wave reflection and arterial stiffness are related to cardiovascular events, there is a need for more investigations within sickle cell populations. In this study we investigated the relationship between carriers of heterozygous sickle cell (HbAS) and arterial stiffness parameters.

Twenty individuals with HbAS (16 women and 4 men, mean age of 28.65±6.50 years) and 20 healthy participants with HbAA as a control group (16 women and 4 men, mean age of 31.10±5.86 years) were included in the study.

Diagnosis was made by hemoglobin electrophoresis and family screening in both groups. Atrial fibrillation and/or flutter, chronic renal failure, mild or severe valvular heart disease, and other chronic diseases were the exclusion criteria. Our local ethics committee approved the study and written informed consent was obtained from all participants.

Physical Examination Blood pressures were measured with the aid of a mercury sphygmomanometer after subjects rested for at least 15 min and had not consumed caffeinated beverages or tobacco in the last 12 h. We recorded heart rate by counting the number of heart beats in 1 min. Circulatory and cardiac examinations were performed. Skin pallor, cold extremities, peripheral cyanosis, cardiac cachexia, cardiac murmurs, increased apex beat, and third and fourth heart sounds were noted as pathological findings on physical examination.

Laboratory Examination A 12-lead electrocardiogram was recorded on admission.

Fasting venous blood samples were taken after 12 h of fasting.

Complete blood count, thyroid function tests, fasting blood glucose, blood urea, creatinine, sodium, potassium, total cholesterol, low-density lipoprotein cholesterol (LDL-C), and hemoglobin electrophoresis were checked for all participants.

380

Patients

Turk J Hematol 2013;30:379-386

Bayramoğlu T, et al: Arterial Stiffness and Pulse Wave Reflection in Young Adult Heterozygote Sickle Cell Carriers

Echocardiographic Examination All echocardiographic measurements were obtained from the patients at rest. Standard echocardiographic examination and pulsed-wave Doppler and tissue Doppler imaging were performed on an ACUSON SequoiaTM ultrasound machine (Siemens Medical Solutions, USA) with a 2.5- or 3.5-MHz phased-array transducer. The mean of all recordings from 3 consecutive cycles was used for measurements. M-mode measurements of left ventricular end-diastolic and end-systolic dimensions and volumes, ventricular septal and posterior wall thicknesses, and left atrial end diastolic dimensions were calculated in accordance with the recommendations of the American Society of Echocardiography [9]. Left ventricular mass was calculated by use of the Penn formula (1.04 × [(SVd + IVSd + ADd)³ – (SVd)³] – 13.6). Left ventricular ejection fraction was calculated by use of the modified Simpson technique. Left ventricular diastolic function was evaluated in the apical 4-chamber view by means of pulsed-wave and tissue Doppler imaging. The pulsed-wave Doppler imaging was performed in order to measure transmitral flow values, including the peak early diastolic filling velocity (E), the peak late diastolic filling velocity (A), the early diastolic/late diastolic filling velocity (E/A) ratio, the E-wave deceleration time, and the isovolumic relaxation time. The tissue Doppler imaging was performed in order to measure systolic myocardial velocity (Sm), peak early diastolic myocardial velocity (Em), and peak late diastolic myocardial velocity (Am). The Em/Am ratio was calculated at the end of expiration.

Pulse Waveform Analysis Assessment of arterial stiffness was performed noninvasively with the commercially available Arteriograph (TensioMed, Budapest, Hungary) [10]. We measured the participants’ oscillometric pulse waves and the distance between the jugulum and symphysis (which is the same as by the invasive method for the distance between the aortic root and the aortic bifurcation), and the PWV was calculated.

Pulse waves were recorded at suprasystolic pressure. The oscillation signs were identified from a cuff inflated to at least >35 mmHg above the systolic blood pressure. In this state there is complete brachial artery occlusion and it functions as a membrane before the cuff. Pulse waves hit the membrane and oscillometric waves were measured by the device, and we could see the waveforms on the monitor.

The augmentation index (AI) was defined as the ratio of the difference between the second (P2, appearing because of the reflection of the first pulse wave) and first systolic peaks (P1, induced by the heart systole) to pulse pressure (PP), and it was expressed as a percentage of the ratio (AI = [P2 – P1] / PP × 100). SBP, DBP, PP, central aortic pressure (AP), heart rate, and other hemodynamic parameters were expressed as return time (RT, measured in seconds), and diastolic reflection area (DRA), systolic area index (SAI %), and diastolic area index (DAI %) were measured noninvasively

with the TensioMed Arteriograph. DRA reflects the quality of the coronary arterial diastolic filling, while SAI and DAI are the areas of the systolic and diastolic portions under the pulse wave curve of a complete cardiac cycle, respectively.

Hence, coronary perfusion is better when DAI and DRA values are higher. Furthermore, RT is the PWV time from the aortic root until the bifurcation and return, and so this value gets smaller as the aortic wall gets stiffer.

Statistical Analysis Statistical analysis was performed using SPSS 13.0.

Categorical measures were summarized as number and percentage; numerical measures were summarized as mean and standard deviation (or, wherever necessary, median and minimum-maximum). The chi-square test was used to compare categorical measurements between the groups.

The quantitative measurements of independent groups were compared by either t-test or Mann–Whitney U test for parametric and non-parametric data, respectively. Univariate analysis was used to determine the correlations between PWV and AI, SBP, heart rate, weight, height, fasting plasma glucose, serum urea, creatinine, LDL-C, total cholesterol, and Hb. Stepwise multiple regression analysis was used to determine whether HbAS, age, weight, mean arterial pressure (MAP), heart rate, Hb, and the value of total cholesterol were independent predictors of PWV and AI. The mutual relationship of PWV and AI with blood pressure and heart rate was determined by covariance analysis. In correlation analysis, p≤0.01 was considered significant. In other analyses, we treated p≤0.05 as significant.

Results Table 1 shows the clinical, laboratory, and hemodynamic characteristics of the study population. Age, weight, and height were similar between groups. Aortic pressure, sodium, potassium, LDL-C, total cholesterol, mean corpuscular volume, mean corpuscular hemoglobin, and red cell distribution width were significantly different between groups. In terms of arterial stiffness parameters, only aortic AI and brachial AI were significantly higher in HbAS individuals (p=0.011). Considering the whole study population, positive correlations were found between PWV and mean arterial pressure, age, weight, aortic AI, brachial AI, and LDL-C (Figure 1). Table 2 shows the relationship between statistically significant variables in the whole study population. Furthermore, aortic AI increased with age and decreased with higher heart rate (p≤0.05).

Positive correlations were found between PWV and AI and SBP, MAP, age, and weight in HbAS individuals (Figure 2). PWV increased with higher values of SBP, MAP, age, and weight (p=0.000, p=0.002, p=0.016, and p=0.027, respectively). Aortic AI and MAP were also found to have a positive correlation (p=0.009). A negative correlation was found between aortic AI and serum potassium levels 381

Turk J Hematol 2013;30:379-386

Bayramoğlu T, et al: Arterial Stiffness and Pulse Wave Reflection in Young Adult Heterozygote Sickle Cell Carriers

Table 1. Clinical, laboratory and hemodynamic characteristics of HbAS and HbAA participants.

Variable

HbAS (N=20), mean±SD (min/max)

HbAA (N=20), mean±SD (min/max)

p

31.10±5.86 (19/38)

28.65±6.50 (19/38)

NS

Weight (kg)

67.1±12 (49/98)

65.15±10.5 (45/82)

NS

Height (cm)

164.8±6.8 (155/177)

167.75±7.79 (155/179)

NS

SBP (mmHg)

123.8±14.5 (108/160)

117.9±10.3 (80/160)

NS

DBP (mmHg)

72.25±9.63 (56/95)

70.05±6.26 (60/80)

NS

Heart rate (beats/min)

75.50±9.30 (56/95)

74.9±15.6 (55/114)

NS

MAP (mmHg)

89.35±9.86 (76/114)

85.95±6.88 (76/98)

NS

PP (mmHg)

51.60±12.8 (37/88)

47.9±8.40 (33/64)

NS

AP (mmHg)

95.64±23.2 (62/151)

80.15±7.31 (69/95)

0.033

PWV (m/s)

7.80±1.49 (5.8/10.6)

7.15±0.7 (5.9/8.1)

NS

Aortic AI (%)

22.62±15.05 (-3.2/51.8)

10.67±8.4 (-0.2/28.3)

0.011

Brachial AI (%)

-29.66±29.73 (-80.6/28)

-53.27±16.65 (-74.4/-18.5)

0.011

RT (ms)

143.1±25.9 (99/180)

152.0±16.5 (124/187)

NS

SAI (%)

47.64±9.19 (37/74.4)

46.40±5.74 (36.6/57.3)

NS

DAI (%)

52.29±9.13 (25.5/62.9)

53.6±5.74 (42.6/63.3)

NS

DRA

57.85±16.7 (35.6/89.4)

63.48±16.84 (35.2/115.1)

NS

Fasting blood glucose (g/dL)

84.65±13.44 (61/114)

85.7±12.9 (58/100)

NS

Blood urea (mg/dL)

12.3±2.99 (8/16.4)

12.05±2.36 (9/17.6)

NS

Creatinine (mg/dL)

0.71±0.12 (0.46/0.88)

0.76±0.22 (0.08/1.09)

NS

Sodium (mmol/L)

141.15±2.48 (136/148)

142.6±1.19 (141/144)

0.009

5.06±0.8 (4/6.7)

4.52±0.31 (4/5.3)

0.038

98.0±24.2 (40/130)

80.90±27.45 (45/132)

0.033

167.1±27.99 (88/200)

146.0±32.9 (104/209)

0.035

13.15±1.187 (11.6/15.9)

13.8±1.49 (11.7/16.5)

NS

Hct (%)

37.9±2.95 (34.7/45.7)

39.5±4.27 (33.4/46.4)

NS

MCV (fL)

79.0±4.29 (72.2/86.3)

86.06±3.52 (81/92.8)

<0.001

MCH (pg)

27.7±1.73 (25/30.7)

30.05±1.43 (27.6/33)

<0.001

34.75±0.66 (33.7/36)

34.92±0.94 (33.5/36.4)

NS

247.0±49.9 (150/336)

224.4±45.98 (145/316)

NS

RDW (%)

14.43±1.66 (12.7/18.8)

13.7±1.66 (12.3/18.4)

0.035

LVMI (g/m2)

100.78±19.8 (64/137)

91.21±22.09 (63/136)

NS

PABs (mmHg)

24.50±2.76 (20/30)

24.0±2.05 (20/25)

NS

EF (%)

65.35±3.89 (59/72)

66.95±4.47 (60/74)

NS

Age

Potassium (mmol/L) LDL-C (mg/dL) Total cholesterol (mg/dL) Hb (g/dL)

MCHC (%) Platelet count

(x109/L)

SBP = systolic blood pressure; DBP = diastolic blood pressure; MAP = mean arterial pressure; PP = pulse pressure; AP = central aortic pressure; PWV = aortic pulse wave velocity; AI = augmentation index; RT = return time; SAI = systolic area index; DAI = diastolic area index; DRA = diastolic reflection area; LDL-C = low-density lipoprotein cholesterol; Hb = hemoglobin; Hct =hematocrit; MCV = mean corpuscular volume; MCH = mean corpuscular hemoglobin; MCHC = mean corpuscular hemoglobin concentration; RDW = red cell distribution width; LVMI = left ventricular mass index; PABs = systolic pulmonary artery pressure; EF = ejection fraction; NS = not significant.

382

Turk J Hematol 2013;30:379-386

BayramoÄ&#x;lu T, et al: Arterial Stiffness and Pulse Wave Reflection in Young Adult Heterozygote Sickle Cell Carriers

(p=0.007). In contrast to aortic AI, considering all groups there was no correlation between PWV and heart rate. Serum potassium level was higher in HbAS carriers. This may have been due to more hemolysis while the blood samples of

carriers were being held in the in vitro hypoxic environment.

There was no statistically significant association between PWV and serum potassium concentration in sickle cell carriers. However, in the group of HbAA participants with

Figure 1. Correlations between pulse wave velocity (PWV) and mean arterial pressure (MAP), age, weight, aortic augmentation index (AI-aortic), brachial augmentation index (AI-brachial), and low-density lipoprotein cholesterol (LDL-C) in the whole study population.

Figure 2. Correlations between pulse wave velocity (PWV) and aortic augmentation index (AI-aortic) and brachial augmentation index (AI-brachial), systolic blood pressure (SBP), mean arterial pressure (MAP), age, weight, and potassium in HbAS individuals.

Table 2. The relationships among statistically significant variables in the whole study population.

Groups

HbAS and HbAA (n=40)

Variables

Correlation value

p

Significance level

PWV-MAP PWV-Age PWV-Weight PWV-Aortic AI PWV-Brachial AI PWV-LDL-C Aortic AI-Age

r2=0.436 r2=0.16 r2=0.129 r2=0.459 r2=0.462 r2=0.112 r2=0.146

0.000 0.017 0.034 0.000 0.000 0.05 0.026

p<0.01 p<0.05 p<0.05 p<0.01 p<0.01 p<0.05 p<0.05

Hb = hemoglobin; PWV = aortic pulse wave velocity; MAP = mean arterial pressure; AI = augmentation index; LDL-C = low-density lipoprotein cholesterol.

Table 3. The relationships among statistically significant variables in HbAS and HbAA participants.

Groups

HbAS (n=20)

HbAA (n=20)

Variables PWV-Aortic AI PWV-Brachial AI PWV-SBP PWV-Weight PWV-Age PWV-MAP Aortic AI-MAP Aortic AI-potassium PWV-potassium

Correlation value

p

Significance level

r2=0.603 r2=0.601 r2=0.286 r2=0.285 r2=0.332 r2=0.496 r2=0.397 r2=(-0.392)

0.000 0.000 0.027 0.027 0.016 0.002 0.009 0.007

p<0.01 p<0.01 p<0.05 p<0.05 p<0.05 p<0.01 p<0.01 p<0.05

r2=0.267

0.028

p<0.05

Hb = hemoglobin; PWV = aortic pulse wave velocity; AI = augmentation index; SBP = systolic blood pressure; MAP = mean arterial pressure; LDL-C=low-density lipoprotein cholesterol.

383

Turk J Hematol 2013;30:379-386

Bayramoğlu T, et al: Arterial Stiffness and Pulse Wave Reflection in Young Adult Heterozygote Sickle Cell Carriers

these studies were associated with arterial stiffness and wave reflection [5,7,18].

Table 4. Predictors of aortic pulse wave velocity.

Variable

β

SE

t

p

MAP (mmHg)

0.586

0.023

3.517

0.003

Age

0.404

0.040

2.429

0.029

Stepwise multiple regression analysis; n=40.

Model r2=0.496; F=14.739.

Model p<0.005. β: regression coefficient.

Table 5. Predictors of aortic augmentation index.

Variable

β

SE

t

p

MAP (mmHg)

0.716

0.272

3.847

0.002

Heart rate (beats/min)

-0.423

0.309

- 2.272

0.041

Stepwise multiple regression analysis; n=40.

Model r2=0.397; F=9.203.

Model p<0.005. β: regression coefficient.

high potassium levels, PWV was found to be increased (p=0.028). Table 3 shows the separate relationships between statistically significant variables and HbAS and HbAA by multivariate analysis.

After performing multiple stepwise regression analysis, we established that PWV and aortic AI were both independently positively associated with MAP (p=0.003 and 0.002, respectively). At the same time, PWV was also positively associated with age (p=0.029). The aortic AI was independently negatively associated with heart rate (p=0.041). Multiple stepwise regression analysis results are shown in Tables 4 and 5.

Discussion Cardiovascular effects of pulse reflection and arterial stiffness have been demonstrated. The effect of vascular aging on prognosis has been proven in publications about many diseases. Major determinants of these detrimental results were pulse pressure [11], AI [12], and PWV [13].

PWV is an indicator of subclinical organ damage at values higher than 12 m/s [8]. Sickle cell anemia is a hereditary disorder causing abnormal hemoglobin synthesis. Sickle cell patients (HbSS) are often admitted to the hospital because of the painful symptoms, and this process is associated with shortened life expectancy [2]. However, HbAS is a benign disorder with a standard life-span outside of cases of vigorous exercise or in military pilots [14,15]. There are many comprehensive studies related to the hemodynamic changes as a complication of the disease [16,17]. Some of 384

Rees et al. [19] measured blood concentrations of nitric oxide in patients with SCD. Nitric oxide causes hypotension due to vasodilatation. Concentrations were higher than in the healthy control group. They also identified similar values during painful-crisis and steady-state SCD, but higher values than in hemoglobin E/beta-thalassemic form. HbSS patients experienced painful/hemolytic crises more often than heterozygous patients (HbAS). Lemogoum et al. [7] examined HbSS patients to investigate the connection between lower blood pressure and arterial stiffness. They excluded patients who experienced painful/hemolytic crises. SBP, DBP, and MAP were significantly lower in HbSS patients. Pulse pressure is found to be increasing as arterial stiffness worsens. Benetos et al. [11] determined the value of pulse pressure to predict cardiovascular outcomes. In our study, central aortic pressure was higher in the HbAS group (p=0.033). SBP, DBP, MAP, and pulse pressures were also higher in the HbAS group, but these results were not statistically significant. Aortic PWV was similar between HbAA and HbAS participants. Aortic and brachial AI values were significantly higher in the HbAS group (p=0.011). In the current study, blood pressure values were similar between groups, except for central aortic pressure. AI values were found to be higher in HbAS carriers. PWV was not significantly different between groups in our study, in contrast to patients with HbSS according to the findings of Lemogoum et al. [7]. In light of these results, the lower blood pressure can explain the reduced PWV in homozygous (HbSS) patients and the positive association between arterial stiffness and blood pressure. However, blood pressure and wave reflection changes may be affected by factors other than nitric oxide in homozygous and heterozygous forms of disease.

The influence of age-dependent vascular damage and the effect of arterial stiffness are well established [20]. There was no significant difference between groups in terms of mean age in this study. There was a positive association between PWV with age in the entire study population and among HbAS carriers (p=0.017 and 0.016, respectively).

Demirci et al. [21] suggested that worsening arterial stiffness was the most related variable to higher MAP values. In stepwise multiple regression analysis we obtained a positive correlation between PWV and MAP (p=0.003). PWV was increased by higher MAP. Cypien et al. [22] examined MAP and arterial stiffness in women and, after multiple regression analysis, MAP was found to be associated with AI (p<0.001).

For each 10% increase in AI, the risk of mortality related to coronary events was increased by 28% [23]. In our study, the most determinative predictors of arterial stiffness were aortic AI and brachial AI according to univariate analysis.

These values were higher in HbAS patients. According to stepwise multiple regression analysis, there was a positive correlation between aortic AI and MAP (p=0.002). Bahl et al. [24] identified higher heart rates in patients with

Turk J Hematol 2013;30:379-386

Bayramoğlu T, et al: Arterial Stiffness and Pulse Wave Reflection in Young Adult Heterozygote Sickle Cell Carriers

low hemoglobin levels (below 7 mg/dL). Nevertheless, there was no significant heart rate change in patients with HbSS, except for extreme cases (painful/hemolytic crisis) [25]. Our heterozygous patients had similar hemoglobin and hematocrit levels as those in the HbAA group. Mean corpuscular volume and mean corpuscular hemoglobin were lower in patients with HbAS (p<0.001). As a result, heart rate (beats/min) values were not distinct between groups. Wilkinson et al. [26] assessed the effects of changes in heart rate on wave reflection and arterial stiffness. AI was significantly decreased with higher heart rate and was much more sensitive to the effect of heart rate in their study. Our results were compatible with their findings, as the aortic AI was inversely related to heart rate (p=0.041).

Pannier et al. [27] examined the simultaneous PWV measurements of the aorta, brachial, and femoral arteries in 305 patients and unequivocally proved that only the PWV measurements of the aorta had a predictive value. We measured PWV only from the aorta.

Noninvasive measurement of arterial stiffness is a valuable method. Arteriography results have a considerably tight relationship with cardiac catheterization measurements [10]. Nevertheless, a study comparing other devices that can measure PWV showed that similar PWV values were obtained using the SphygmoCor (8.1±1.1 m/s) or the Arteriograph (8.6±1.3 m/s). However, for the Complior method, values were significantly different (10.1±1.7 m/s) because the recorded travel distance for PWV was higher than the others [28].

Our study revealed that MAP and heart rate were independent determinants for the aortic AI. MAP and age were also independent determinants for aortic pulse wave velocity. The most important independent predictors of arterial stiffness were MAP and age.

Conclusion Sickle cell disease (HbSS) is associated with shortened life expectancy, although the sickle cell trait (HbAS) is a benign carrier condition and is not associated with shortened life expectancy in ordinary people. HbAS patients have a better life quality with fewer complaints than HbSS patients, but still at levels lower than among the normal healthy population.

Unpredictable cardiovascular collapse and death may occur in the HbAS population during or after vigorous exercise.

Therefore, measurement of arterial stiffness might help achieve a better understanding of complications associated with sickle cell carriers. Arterial stiffness measurement is an easy, cheap, and reliable method in the early diagnosis of cardiovascular disease in heterozygous sickle cell carriers.

These results may depend on the amount of S hemoglobin in red blood cells. Further studies are required to investigate blood pressure changes and their effects on arterial stiffness in order to explain the vascular aging mechanism in patients with sickle cell disorder.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Elsharawy MA, Moghazy KM, Shawarby MA. Atherosclerosis in sickle cell disease - a review. Int J Angiol 2009;18:62-66.

2. Platt OS, Brambilla DJ, Rosse WF, Milner PF, Castro O, Steinberg MH, Klug PP. Mortality in sickle cell disease. Life expectancy and risk factors for early death. N Engl J Med 1994;330:1639-1644.

3. Laurent S, Boutouyrie P, Asmar R, Gautier I, Laloux B, Guize L, Ducimetiere P, Benetos A. Aortic stiffness is an independent predictor of all-cause and cardiovascular mortality in hypertensive patients. Hypertension 2001;37:1236-1241.

4. Cruickshank K, Riste L, Anderson SG, Wright JS, Dunn G, Gosling RG. Aortic pulse wave velocity and its relationship to mortality in diabetes and glucose intolerance: an integrated index of vascular function? Circulation 2002;106:20852090.

5. Belizna C, Loufrani L, Ghali A, Lahary A, Primard E, Louvel JP, Henrion D, Lévesque H, Ifrah N. Arterial stiffness and stroke in sickle cell disease. Stroke 2012;43:1129-1130.

6. Francis RB Jr, Johnson CS. Vascular occlusion in sickle cell disease: current concepts and unanswered questions. Blood 1991;77:1405-1414.

7. Lemogoum D, Van Bortel L, Najem B, Dzudie A, Teutcha C, Madu E, Leeman M, Degaute JP, van de Borne P. Arterial stiffness and wave reflections in patients with sickle cell disease. Hypertension 2004;44:924-929.

8. Mancia G, De Backer G, Dominiczak A, Cifkova R, Fagard R, Germano G, Grassi G, Heagerty AM, Kjeldsen SE, Laurent S, Narkiewicz K, Ruilope L, Rynkiewicz A, Schmieder RE, Boudier HA, Zanchetti A, Vahanian A, Camm J, De Caterina R, Dean V, Dickstein K, Filippatos G, Funck-Brentano C, Hellemans I, Kristensen SD, McGregor K, Sechtem U, Silber S, Tendera M, Widimsky P, Zamorano JL, Erdine S, Kiowski W, Agabiti-Rosei E, Ambrosioni E, Lindholm LH, Viigimaa M, Adamopoulos S, Agabiti-Rosei E, Ambrosioni E, Bertomeu V, Clement D, Erdine S, Farsang C, Gaita D, Lip G, Mallion JM, Manolis AJ, Nilsson PM, O’Brien E, Ponikowski P, Redon J, Ruschitzka F, Tamargo J, van Zwieten P, Waeber B, Williams B; Management of Arterial Hypertension of the European Society of Hypertension; European Society of Cardiology. 2007 Guidelines for the Management of Arterial Hypertension: The Task Force for the Management of Arterial Hypertension of the European Society of Hypertension (ESH) and of the European Society of Cardiology (ESC). Eur Heart J 2007;25:1105-1187.

385

Turk J Hematol 2013;30:379-386

Bayramoğlu T, et al: Arterial Stiffness and Pulse Wave Reflection in Young Adult Heterozygote Sickle Cell Carriers

9. Schiller NB, Shah PM, Crawford M, DeMaria A, Devereux R, Feigenbaum H, Gutgesell H, Reichek N, Sahn D, Schnittger I et al. Recommendations for quantitation of the left ventricle by two-dimensional echocardiography. American Society of Echocardiography Committee on Standards, Subcommittee on Quantitation of Two-Dimensional Echocardiograms. J Am Soc Echocardiogr 1989;2:358-367.

10. Horváth IG, Németh A, Lenkey Z, Alessandri N, Tufano F, Kis P, Gaszner B, Cziráki A. Invasive validation of a new oscillometric device (Arteriograph) for measuring augmentation index, central blood pressure and aortic pulse wave velocity. J Hypertens 2010;28:2068-2075.

11. Benetos A, Safar M, Rudnichi A, Smulyan H, Richard JL, Ducimetieère P, Guize L. Pulse pressure: a predictor of longterm cardiovascular mortality in a French male population.

Hypertension 1997;30:1410-1415.

12. Weber T, Auer J, O’Rourke MF. Arterial stiffness, wave reflections, and the risk of coronary artery disease.

Circulation 2004;109:184-189.

13. Choi CU, Park EB, Suh SY, Kim JW, Kim EJ, Rha SW, Seo HS, Oh DJ, Park CG. Impact of aortic stiffness on cardiovascular disease in patients with chest pain. Assessment with direct intra-arterial measurement. Am J Hypertens 2007;20:11631169.

14. Harris KM, Haas TS, Eichner ER, Maron BJ. Sickle cell trait associated with sudden death in competitive athletes. Am J Cardiol 2012;110:1185-1188.

15. Mitchell BL. Sickle cell trait and sudden death--bringing it home. J Natl Med Assoc 2007;99:300-305.

16. Zorca S, Freeman L, Hildesheim M, Allen D, Remaley AT, Taylor JG, Kato GJ. Lipid levels in sickle-cell disease associated with haemolytic severity, vascular dysfunction and pulmonary hypertension. Br J Haematol 2010;149:436445.

17. Pegelow CH, Colangelo L, Steinberg M, Wright EC, Smith J, Phillips G, Vichinsky E. Natural history of blood pressure in sickle cell disease: risks for stroke and death associated with relative hypertension in sickle cell anemia. Am J Med 1997;102:171-177.

18. Aessopos A, Farmakis D, Tsironi M, Diamanti-Kandarakis E, Matzourani M, Fragodimiri C, Hatziliami A, Karagiorga M. Endothelial function and arterial stiffness in sicklethalassemia patients. Atherosclerosis 2007;191:427-432.

19. Rees DC, Cervi P, Grimwade D, O’Driscoll A, Hamilton M, Parker NE, Porter JB. The metabolites of nitric oxide in sickle-cell disease. Br J Haematol 1995;91:834-837.

386

20. Laurent S, Cockcroft J, Van Bortel L, Boutouyrie P, Giannattasio C, Hayoz D, Pannier B, Vlachopoulos C, Wilkinson I, StruijkerBoudier H; European Network for Non-invasive Investigation of Large Arteries. Expert consensus document on arterial stiffness: methodological issues and clinical applications. Eur Heart J 2006;27:2588-2605.

21. Demirci MS, Gungor O, Kircelli F, Carrero JJ, Tatar E, Demirci C, Kayikcioglu M, Asci G, Toz H, Ozkahya M, Ok E. Impact of mean arterial pressure on progression of arterial stiffness in peritoneal dialysis patients under strict volume control strategy. Clin Nephrol 2012;77:105-113.

22. Cypiene A, Dadoniene J, Rugiene R, Ryliškyte L, Kovaite M, Petrulioniene Z, Venalis A, Laucevieius A. The influence of mean blood pressure on arterial stiffening and endothelial dysfunction in women with rheumatoid arthritis and systemic lupus erythematosus. Medicina (Kaunas) 2010;46:522-530.

23. Chirinos JA, Zambrano JP, Chakko S, Veerani A, Schob A, Willens HJ, Perez G, Mendez AJ. Aortic pressure augmentation predicts adverse cardiovascular events in patients with established coronary artery disease.

Hypertension 2005;45:980-985.

24. Bahl VK, Malhotra OP, Kumar D. Non-invasive assessment of systolic and diastolic left ventricular function in patients with chronic severe anemia: a combined M-mode, twodimensional and Doppler echocardiographic study. Am Heart J 1992;124:1516-1523.

25. Covitz W, Espeland M, Gallagher D, Hellenbrand W, Leff S, Talner N. The heart in sickle cell anemia. The Cooperative Study of Sickle Cell Disease (CSSCD). Chest 1995;108;12141219.

26. Wilkinson IB, Mohammad NH, Tyrrell S, Hall IR, Webb DJ, Paul VE, Levy T, Cockcroft JR. Heart rate dependency of pulse pressure amplification and arterial stiffness. Am J Hypertens 2002;15:24-30.

27. Pannier B, Guérin AP, Marchais SJ, Safar ME, London GM. Stiffness of capacitive and conduit arteries: prognostic significance for end-stage renal disease patients.

Hypertension 2005;45:592-596.

28.

Rajzer MW, Wojciechowska W, Klocek M, Palka I, Brzozowska-Kiszka M, Kawecka-Jaszcz K. Comparison of aortic pulse wave velocity measured by three techniques: Complior, SphygmoCor and Arteriograph. J Hypertens 2008;26:2001-2007.

Research Article

DOI: 10.4274/Tjh.2012.0135

Evaluation of the Safety of Imatinib Mesylate in 200 Iraqi Patients with Chronic Myeloid Leukemia in the Chronic Phase: Single-Center Study İmatinib Mesilatın Kronik Faz Kronik Myeloid Lösemi Tanılı 200 Iraklı Hastada Güvenirliğinin Değerlendirilmesi: Tek Merkezli Çalışma Bassam Francis Matti1, Alaadin Sahham Naji1, Alaa Fadhil Alwan2 1Baghdad

Teaching Hospital, Clinical Hematology Department, Baghdad, Iraq

2National

Center of Hematology, Clinical Hematology Department, Baghdad, Iraq

Abstract: Objective: Imatinib mesylate, a tyrosine kinase inhibitor, is presently the drug of choice for chronic myeloid leukemia (CML). During therapy, a few patients may develop hematological and non-hematological adverse effects.

Materials and Methods: The aim of this study was to evaluate the safety of imatinib therapy in patients with CML. Between December 2007 and October 2009 two hundred patients with CML in chronic phase were included in the study. Written informed consent was obtained from all patients prior to the start of the study. Imatinib was started at 400 mg orally daily. Patients were monitored carefully for any adverse effects. Complete blood count, liver, and renal function tests were done once in 2 weeks during the first month and on a monthly basis during follow-up. Toxicities that encountered were graded as per the National Cancer Institute common toxicity criteria version 2. Both hematologic and non-hematologic toxicities were managed with short interruptions of treatment and supportive measures, but the daily dose of imatinib was not reduced below 300 mg/day.

Results: Two hundred CML patients in chronic phase were included in this study; the male:female ratio was 0.7:1 with mean age 39.06±13.21 years (ranged from 15-81 years). The study showed that the commonest hematological side effects were grade 2 anemia (12.5%) followed by leukopenia (8%) and thrombocytopenia (4%), while the most common non-hematological adverse effects were superficial edema and weight gain (51.5%), followed by musculoskeletal pain (35.5%), then gastro-intestinal symptoms (vomiting, diarrhea) (19%). Fluid retention was the commonest side effect, which responded to low-dose diuretics.

The drug was safe and well tolerated. There were no deaths due to toxicity.

Conclusion: Imatinib mesylate a well-tolerated drug, and all undesirable effects could be ameliorated easily. The most common hematological and non-hematological side effects were anemia and fluid retention, respectively.

Key Words: Safety, Imatinib, Chronic myeloid leukemia

Address for Correspondence: Alaa Fadhil ALWAN , M.D., National Center of Hematology, Clinical Hematology Department, Baghdad, Iraq Phone: +9647702743114 E-mail: ala_sh73@yahoo.com Received/Geliş tarihi : September 18, 2012 Accepted/Kabul tarihi : January 16, 2013

387

Matti1 BF, et al: Evaluation of the Safety of Imatinib Mesylate in 200 Iraqi Patients with Chronic Myeloid Leukemia in the Chronic Phase: Single-Center Study

Turk J Hematol 2013;30:387-393

Özet: Amaç: Bir tirozin kinaz inhibitörü olan imatinib mesilat, günümüz kronik miyeloid lösemi (KML) itedavisinde ilk seçenek ilaçtır. Tedavi sırasında az sayıda hastada hematolojik ve non-hematolojik yan etkiler gelişebilir.

Gereç ve Yöntemler: Bu çalışmanın amacı KML hastalarında imatinib tedavisinin güvenirliğini değerlendirmektir. Aralık 2007-Ekim 2009 arasında kronik faz KML tanılı 200 hasta çalışmaya alındı. Çalışmanın başlamasından önce tüm hastalardan yazılı onam alındı. İmatinib oral yoldan günde 400 mg başlandı. Hastalar yan etkiler yönünden dikkatle izlendi. Tam kan sayımı, karaciğer ve böbrek fonksiyon testleri ilk ay içinde iki haftada bir, sonrasındaki takipte ise ayda bir yapıldı. İzlenen toksisiteler ulusal kanser enstitüsü toksisite kriterleri 2. versiyona göre derecelendirdi. Hematolojik ve non-hematolojik toksisiteler tedavinin kısa süre kesilmesi ve destek önlemleri ile yönetildi, ancak imatinibin günlük dozu 300 mg’ın altına inilmedi.

Bulgular: Çalışmaya 200 hasta dahil edildi. Erkek/kadın oranı 0,7:1, ortanca yaş 39,06 (15-81) idi. Çalışmada en sık rastlanan hematolojik yan etkiler grade 2 anemi (%12,5), lökopeni (%8) ve trombositopeni (%4) iken, en sık görülen non-hematolojik toksisiteleri yüzeyel ödem ve kilo alma (%51,5) takiben kas-iskelet ağrısı (%35,5) ve sonrasında gastrointestinal semptomlar (kusma, ishal-%19) olarak bulundu. En sık görülen yan etki düşük doz diüretiklere yanıt veren sıvı retansiyonuydu. İlaç güvenilir bulundu ve iyi tolere edildi. Toksisiteye bağlı ölüm izlenmedi.

Sonuç: İmatinib mesilat iyi tolere edilen bir ilaçtır ve tüm yan etkiler kolay yönetilebilir. En sık gözlenen hematolojik yan etki anemi, non-hematolojik yan etki ise sıvı retansiyonuydur.

Anahtar Sözcükler: Güvenilirlik, İmatinib, Kronik miyeloid lösemi

Introduction Chronic myeloid leukemia (CML) arises as the result of a mutation in a pluripotent stem cell and is characterized by progressive granulocytosis, marrow hypercellularity, and splenomegaly [1,2,3]. CML accounts for about 20% of newly diagnosed cases of leukemia in adults [2,4]. The diagnostic hallmark is the Philadelphia chromosome [5], which is present in all dividing cells of hematopoietic lineage, as well as in B and T cells in some patients, but is absent in all other cells. The essential role of BCR-ABL tyrosine kinase activity for cellular transformation provides the rationale for targeting this function therapeutically [6].

Imatinib selectively inhibits the proliferation and induces apoptosis in BCR-ABL–positive cell lines as well as fresh leukemic cells from patients with Philadelphia chromosomepositive CML and Philadelphia chromosome-positive acute lymphoblastic leukemia [7,8]. Growth inhibition of the CML cell line K562 occurred at micromolar concentrations and was associated with inhibition of BCR-ABL tyrosine kinase activity [9]. In addition to that, imatinib inhibits the receptor tyrosine kinases for platelet-derived growth factors (PDGFs), stem cell factor (SCF), and c-kit and inhibit PDGF receptor and SCF-mediated cellular events [10].

The prospective International Randomized Imatinib Study (IRIS) showed clear superiority for imatinib when compared to interferon and low-dose cytarabine as standard therapy for CML. After a median follow-up of 19 months, the estimated rate of major cytogenetic response was 87.1% 388

in the imatinib group and 34.7% in the interferon group.

In regard to the molecular responses to imatinib mesylate, among 1106 patients from the IRIS study, 370 patients in complete cytogenetic response (CCR) were monitored by real-time quantitative polymerase chain reaction. Those who achieved a 3-log reduction from the initial BCR-ABL/ BCR ratio after 12 months of therapy had a progression-free survival of 100% in 14 months, compared to 95% for those who had not achieved a 3-log reduction but were in CCR and 85% for those who had not achieved CCR at 12 months (p<0.001) [11].

Imatinib mesylate is a well-tolerated agent. In phase II trials with this drug, grade 3 to 4 hematologic toxicity was seen in 34% of chronic phase, 58% of accelerated phase, and 63% of blastic phase patients. Non-hematologic toxicity most commonly included nausea (58%-71%), fluid retention (56%-71%), muscle cramps (37%-50%), diarrhea (37%-53%), and skin rash (39%-43%) [12]. However, these adverse events were mostly mild and only rarely resulted in permanent discontinuation of therapy [13-15].

The updated 5-year IRIS study results showed that the rate of toxicity with first-line imatinib declined with time with; most of them being of grade 1 (mild) or 2 (moderate) in severity, generally able to be managed and tending to be most frequent in the first year of treatment. Imatinib discontinuation due to drug-related adverse effects was less than 4%. Grade 3 or 4 non-hematologic toxicities include fatigue, depression, myalgia, arthralgia, and nausea.

Hematologic grade 3-4 toxicities within the first 2 years were

Matti1 BF, et al: Evaluation of the Safety of Imatinib Mesylate in 200 Iraqi Patients with Chronic Myeloid Leukemia in the Chronic Phase: Single-Center Study

Turk J Hematol 2013;30:387-393

reported to be neutropenia, thrombocytopenia, anemia, and elevated liver enzymes at 3.7%, 1.5%, 1.8%, and 0.4%, respectively [16]. The aim of the present study was to evaluate the safety of imatinib mesylate in CML patients.

were evaluated by using Student’s t-test this statement should be omitted. P<0.05 was regarded as significant.

Materials and Methods

In this study, 200 patients with CML in the chronic phase were included; 112 patients were female while 88 patients were male with a male-to-female ratio of 0.7:1. Age ranged from 15 to 81 years with a mean age of 39.06 ± 13.21 years; other pretreatment characteristics are shown in Table 1.

Table 2 shows the hematologic and non-hematologic side effects, while Table 3 shows the distribution of side effects according to sex.

The study was conducted from December 2007 through October 2009; during this period, 200 patients with CML in the chronic phase treated with imatinib mesylate were evaluated at the National Center of Hematology by history, clinical examination, and laboratory tests.

Eligibility criteria included age of 15 years and older, Eastern Cooperative Oncology Group (ECOG) performance status of 0 to 2, adequate hepatic and renal functions, no prior imatinib therapy, and absence of pregnancy. Chronic myeloid leukemia in the chronic phase was defined as less than 10% blasts and less than 20% basophils in the peripheral blood and bone marrow, and a platelet count of more than 100 x 109/L but less than 1000 x 109/L. The study was approved by the institutional ethics committee. Written informed consent was obtained from all patients prior to the start of the study. Therapy was initiated with imatinib at 400 mg orally daily and patients were monitored carefully for any adverse effects. Complete blood count and blood film, liver function tests, renal function tests, and coagulation parameters were recorded once in 2 weeks during the first month and monthly thereafter. Toxicities encountered were graded as per the National Cancer Institute’s common toxicity criteria, version 2. Both hematologic and non-hematologic toxicities were managed with short interruptions of treatment and supportive measures, but the daily dose of imatinib was not reduced below 300 mg/day.

Regarding assessment of imatinib toxicity on the gastrointestinal tract, we assessed whether there was any nausea, vomiting, stomatitis, or diarrhea in patients who received imatinib.

Any fever with or without infection in CML patients was evaluated by identifying any elevation in temperature at the time of registration and recording any history of fever, whether it was related to any infection or not.

Dermatological abnormalities during the period of imatinib intake including any skin rash or itching, along with hair loss and color changes, were evaluated by direct examination.

Neurological evaluation was done only by clinical neurological assessment with notification of any dysesthesia or paresthesia.

For all patients, baseline weight was recorded and then weight measurements were done monthly after imatinib therapy began to determine any weight change.

The statistical analysis was performed using SPSS 17.0 (SPSS Inc., Chicago, IL, USA). Differences between groups

Results

Discussion Imatinib has been generally well tolerated, with grade 3 or 4 toxicities being uncommon. The most common side effects of imatinib were usually of grade 1 or 2.

The most common side effects encountered in this study were non-hematologic, with all grades of superficial edema (51.5%), followed by bone pain (35.5%) and then nausea (32.5%).

Imatinib has the potential to induce severe and prolonged myelosuppression, particularly in patients with minimal residual normal hematopoiesis. However, over time, some patients can achieve recovery of normal hematopoiesis and Table 1. Pretreatment characteristics of 200 patients with CML.

Variables

Results

Sex, no. (%) Male Female Mean age, years min-max (years)

88 (44) 112 (56) 39.06 ± 13.21 15-81

ECOG at diagnosis, no. (%) 0-1 1-2

134 (67) 66 (33)

Splenomegaly, no. (%) 0-4 cm 1-9 cm ≥10 cm Hepatomegaly, no. (%)

12 (6) 114 (57) 74 (37) 42 (21)

Peripheral blood median, (min-max) Hemoglobin level, g/L Leukocyte count, 109/L Platelet count, 109/L Basophils, % Blasts in peripheral blood, % Blasts in bone marrow, %

104 (58-127) 191 (43-814) 331.5 (132-992) 4 (3-13) 5 (1-9) 3 (2-7)

389

Matti1 BF, et al: Evaluation of the Safety of Imatinib Mesylate in 200 Iraqi Patients with Chronic Myeloid Leukemia in the Chronic Phase: Single-Center Study

Turk J Hematol 2013;30:387-393

a major cytogenetic response despite having experienced recurrent grade 3 neutropenia and thrombocytopenia and frequent dose interruptions [17,18].

hemorrhagic manifestations, all within the first few weeks of initiation of treatment. This may be due to concomitant platelet dysfunction, which is in agreement with the study

by Druker et al., in which hemorrhage was experienced in 18.9% of patients. However, this study did not find that use of NSAIDs or other concomitant treatment significantly increased the risk of bleeding in CML patients [19].

Hematologic adverse effects included anemia, which was documented in 14% of CML cases, most of them of grade 1 or 2. It was found more frequently in females than in males (P = 0.0001); this may be due to the fact that the basal hemoglobin level is lower in females or that they are more sensitive to the myelosuppressive effect of imatinib than males. Grade 3-4 hematologic toxicity was registered only in 4.5%. Regarding the percentage of all grades, leukopenia and thrombocytopenia in this study were found at 10% and 4%, respectively, while grade 3-4 neutropenia was documented in 1%. Of all CML patients studied, 13.5% complained of

Breccia et al. found that grade 3-4 hematologic toxicities were experienced in 24% of chronic phase CML patients; of these, 7% experienced toxicity of grades 3-4 in early chronic phase patients, with a negative influence on cytogenetic response [17].

Edema and fluid retention occurred in 51.5% of cases, manifested clinically by periorbital edema, leg edema, and

Table 2. Distribution of the common toxicity effects according to grade. Significant results are given in bold.

Type of toxicity

Grade 0

Grades 1 and 2

Grades 3 and 4

All grades

No.

%

No.

%

No.

%

%

Anemia

172

86

25

12.5

3

1.5

14%

Leukopenia

180

90

16

8

4

2

10%

Neutropenia

188

89

10

5

2

1

6%

Thrombocytopenia

192

96

8

4

0

0

4%

Hemorrhage

173

86.5

21

10.5

6

3

13.5%

Infection

163

81.5

34

17

3

1.5

18.5%

Fever

153

76.5

47

23.5

0

0

23.5%

Nausea

135

67.5

65

32.5

0

0

32.5%

Vomiting

173

86.5

27

13.5

0

0

13.5%

Stomatitis

162

81

35

17.5

3

1.5

19%

Diarrhea

157

78.5

43

21.5

0

0

21.5%

Skin rash

150

75

50

25

0

0

25%

Creatinine

195

97.5

5

2.5

0

0

2.5%

Proteinuria

178

89

22

11

0

0

11%

Hematuria

189

94.5

11

5.5

0

0

5.5%

Bilirubin

195

97.5

5

2.5

0

0

2.5%

AST/ALT

198

99

2

1

0

0

1%

Paresthesia

170

85

30

15

0

0

15%

Edema

97

48.5

52

26

51

25.5

51.5%

Bone pain

129

64.5

71

35.5

0

0

35.5%

Weight gain

145

72.5

55

27.5

0

0

27.5%

Hair loss

186

93%

14

7

0

0

7%

Hair discoloration

181

90.5%

19

9.5

0

0

9.5%

390

Matti1 BF, et al: Evaluation of the Safety of Imatinib Mesylate in 200 Iraqi Patients with Chronic Myeloid Leukemia in the Chronic Phase: Single-Center Study

Turk J Hematol 2013;30:387-393

Table 3. Difference in adverse effects between males and females on imatinib therapy. Significant results are given in bold.

Type of toxicity

Males (88)

Females (112)

P-value

All grades

No.

%

No.

%

Anemia

8

9.09

20

17.85

0.001

Leukopenia

9

10.22

11

9.82

0.154

Neutropenia

9

10.22

13

11.6

0.618

Thrombocytopenia

2

2.2

2

1.7

0.110

Hemorrhage

8

9.09

19

17

0.460

Infection

9

10.22

28

25

0.038

Fever

15

17.04

32

28.57

0.155

Nausea

25

28.4

40

35.7

0.126

Vomiting

11

12.5

16

14.28

0.858

Stomatitis

12

13.6

26

23.21

0.212

Diarrhea

17

26

23.21

0.495

Skin rash

16

18.18

34

30.35

0.138

Creatinine

3

3.4

2

1.78

0.465

Proteinuria

11

12.5

11

9.82

0.686

Hematuria

4

4.54

7

6.25

0.600

Bilirubin

1

1.13

4

3.57

0.496

AST/ALT

0

0

2

1.78

0.452

Paresthesia

8

9.09

22

19.6

0.001

Edema

35

39.7

68

60.7

0.011

Bone pain

26

29.5

45

40.1

0.001

Hair loss

3

3.4

11

9.82

0.005

Color changes

3

3.4

16

14.28

0.12

Weight gain

30

34

25

22.3

0.42

19.31

P value from T test

generalized edema, which was significantly more common in female patients than in males (P<0.011). No ascites or anasarca cases were documented in this study; in addition, neither pleural nor pericardial effusions were registered in this study, similar to the findings of Breccia et al. [17].

Hensley et al. reported that the non-hematologic main adverse effects with imatinib included fatigue, edema, nausea, diarrhea, muscle cramps, and rash [18]; Druker et al. found similar results regarding fluid retention and edema at 53.2% [19], but severe periorbital edema was occasionally observed and was postulated to be an effect of plateletderived growth factor receptor and KIT expressed by dermal dendrocytes [19,20].

Regarding bone pain, this study found that it was experienced by 35.5% of patients, which is similar to the rates reported by other studies [19,21].

Paresthesia was found in 15%, which was not proven by electromyography or nerve conduction study; this was highly significant in females (P<0.001), which may be due to hypophosphatemia, hypocalcemia, and hypomagnesemia caused either by the imatinib or NSAIDs. Low incidence of severe infections (grades 3 and 4) was noticed in 1.5% of patients with chronic phase CML, more significantly so in females. Typically patients with chronic phase CML do not suffer from an increase in bacterial or fungal infections until the advanced state of blastic crisis [21].

Regarding all gastrointestinal side effects (nausea, vomiting, stomatitis, and diarrhea), they were seen in 86% of patients, but they were more likely to be of grade 1 or 2 and did not force the patients to stop using the drug, except for stomatitis of grades 3 and 4, which occurred just in 1.5% of cases. Nausea due to direct irritant effect of the drug on the 391

Turk J Hematol 2013;30:387-393

Matti1 BF, et al: Evaluation of the Safety of Imatinib Mesylate in 200 Iraqi Patients with Chronic Myeloid Leukemia in the Chronic Phase: Single-Center Study

gastric mucosa was experienced by 32.5% of patients, which was not significantly different between males and females.

Less frequently, vomiting was encountered in 13.5%, while stomatitis was of grades 1 and 2 in most occasions, associated with neutropenia, and was registered in 17.5% of patients, mainly in females.

Druker et al. stated that nausea and vomiting was experienced by 42.5% and 14.7%, respectively [19]; however, these side effects could be reduced by taking imatinib with food, dividing the dose, or using antiemetic medications [21].

Elevation of the total serum bilirubin and other liver enzymes (ALT and AST) occurred in 2.5% and 1% of cases, respectively. This elevation occurred mostly in those patients with long durations of imatinib therapy rather than those with less than 1 year of treatment. The cause of this increase in bilirubin may the drug interaction that metabolized in the liver due to drugs like acetaminophen, or, in one patient, antituberculosis medication [22].

Hepatotoxicity is uncommon, occurring in approximately 3% of patients, usually within 6 months of the onset of imatinib use. Acute liver failure has been described [22]. Other causes of liver dysfunction should be excluded, including viral studies and examination of serum ferritin level, Îą1-anti-trypsin level, and concurrent use of hepatotoxic drugs such as acetaminophen. Imatinib is metabolized by the CYP3A4/5 P-450 enzyme system.

Thus, caution needs to be taken when using drugs that are metabolized by the liver [22].

Grade 1 and 2 elevations of creatinine were noticed in 2.5% of cases, while proteinuria and hematuria were seen in 11% and 5.5% of cases, respectively. This may be related to the direct effect of the drug on the kidneys, or to underlying kidney diseases caused by diabetes or chronic uncontrolled hypertension. It was not significantly related to the use of other medications.

During this study, discoloration of patientsâ&#x20AC;&#x2122; hair occurred in 9.5% of cases, in which the hair color changed from white to a dark color, while hair loss occurred in only 7% of CML patients. Hair depigmentation and hypopigmentation of the skin, probably related to the inhibition of the KIT receptor tyrosine kinase by imatinib, were reported in a French study, in which 133 patients with CML were treated with imatinib mesylate. Among these 133 patients, 5 men and 4 women (median age, 63.4 years; range, 53 to 75) with gray hair before treatment had progressive repigmentation of the hair (on the head in 8 patients and on the body and head in 1) during treatment. The median time between the end of interferon-alpha therapy and the start of treatment with imatinib mesylate was 5.7 months (range, 0.5 to 42). Hair repigmentation occurred after a median of 5 months (range, 2 to 14) of treatment with imatinib mesylate. How imatinib mesylate might induce hair repigmentation is a mystery 392

[23]. Functional assays show inhibition of the DDR1 gene by imatinib mesylate, a potent inhibitor of BCR-ABL tyrosine kinase and c-kit tyrosine kinase. Interestingly, the use of imatinib can lead to vitiligo-like lesions, possibly due to inhibition of tyrosinase activity through the c-kit pathway blockade. The DDR1 gene is located between the HLA-E and HLA-C genes at chromosomal region 6p21, previously linked to vitiligo susceptibility in a Chinese population. In another study, imatinib has been proposed as a therapy for vitiligo because of its effects on the DDR1 gene [24,25].

Out of 200 patients in this study, weight gain was more significantly common among males than females (34% versus 22%); this was mostly because of fluid retention, which was statistically not significant. However, it is clear that fluid retention alone cannot account for the progressive increases in weight seen in some patients, as increased appetite has been reported by some patients while taking imatinib, which abates with discontinuation of treatment for any reason. Another aspect of weight gain has been observed with return of a normal appetite following the discontinuation of interferon-alpha treatment. Patients prone to weight problems need to be cautioned about the association of imatinib with weight gain [26].

In conclusion, imatinib mesylate is a well-tolerated drug, in our study and all undesirable effects were easy to manage.

The most common hematologic side effect was anemia.

Regarding the non-hematologic side effects, edema, bone pain, and nausea were the most commonly encountered conditions.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Faderl S, Talpaz M, Estrov Z, Oâ&#x20AC;&#x2122;Brien S, Kurzrock R, Kantarjian HM. The biology of chronic myeloid leukemia.

N Engl J Med 1999;341:164-172.

2. Sawyers CL. Chronic myeloid leukemia. N Engl J Med 1999;340:1330-1340.

3. Sawyers CL, Druker B. Tyrosine kinase inhibitors in chronic myeloid leukemia. Cancer J Sci Am 1999;5:63-69.

4. Faderl S, Talpaz M, Estrov Z, Kantarjian HM. Chronic myelogenous leukemia: biology and therapy. Ann Intern Med 1999;131:207-219.

5. Nowell PC, Hungerford DA. A minute chromosome in human chronic granulocytic leukemia. Science 1960;132:1497-1500.

6. Lugo TG, Pendergast AM, Muller AJ, Witte ON. Tyrosine kinase activity and transformation potency of bcr-abl oncogene products. Science 1990;247:1079-1082.

Matti1 BF, et al: Evaluation of the Safety of Imatinib Mesylate in 200 Iraqi Patients with Chronic Myeloid Leukemia in the Chronic Phase: Single-Center Study

7. Anafi M, Gazit A, Gilon C, Ben Neriah Y, Levitzki A. Selective interactions of transforming and normal abl proteins with ATP, tyrosine-copolymer substrates, and tyrphostins. J Biol Chem 1992;267:4518-4523.

8. Anafi M, Gazit A, Zehavi A, Ben Neriah Y, Levitzki A. Tyrphostin-induced inhibition of p210bcr-abl tyrosine kinase activity induces K562 to differentiate. Blood 1993;82:3524-3529.

9. Kaur G, Gazit A, Levitzki A, Stowe E, Cooney DA, Sausville EA. Tyrphostin induced growth inhibition: correlation with effect on p210 bcr-abl autokinase activity in K562 chronic myelogenous leukemia. Anticancer Drugs 1994;5:213-222.

10. Brunstein CG, McGlave PB. The biology and treatment of chronic myelogenous leukemia. Oncology 2001;15:23-31.

11. Hughes TP, Kaeda J, Branford S. Frequency of major molecular responses to imatinib or alpha-interferon plus cytarabine in newly diagnosed chronic myeloid leukemia.

N Engl J Med 2004;349:1423-1432.

12.

Deininger MWN, O’Brien SG, Ford JM. Practical management of patients with chronic myeloid leukemia receiving imatinib. J Clin Oncol 2003;21:1-11.

13. Kantarjian H, Sawyers C, Hochhaus A, Guilhot F, Schiffer G, Gambacorti-Passerini C, Niederwieser D. Hematologic and cytogenetic responses to imatinib mesylate in chronic myelogenous leukemia. N Engl J Med 2002;346:645-652.

14. Talpaz M, Silver RT, Druker BJ. Imatinib induces durable hematologic and cytogenetic responses in patients with accelerated phase chronic myeloid leukemia: results of a phase 2 study. Blood 2002;99:1928-1937.

15. Druker BJ, Sawyers CL, Kantarjian H. Activity of a specific inhibitor of the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the Philadelphia chromosome. N Engl J Med 2001;344:1038-1042.

16. Druker BJ, Guilhot F, O’Brien S, Larson RA, on behalf of the IRIS. Long-term benefits of imatinib (IM) for patients newly diagnosed with chronic myelogenous leukemia in chronic phase (CML-CP): the 5-year update from the IRIS study. J Clin Oncol 2006;24:338.

Turk J Hematol 2013;30:387-393

17. Breccia M, Stefanizzi C, Cannella L, Latagliata R, Frustaci AM, Carmosino I, Santopietro M, Alimena G. Differences in hematological and non-hematological toxicity during treatment with imatinib in patients with early and late chronic phase chronic myeloid leukemia. Leuk Lymphoma 2008;49:2328-2832.

18. Hensley ML, Ford JM. Imatinib treatment: specific issues related to safety, fertility, and pregnancy. Semin Hematol 2003;40:21-25.

19. Druker BJ, Talpaz M, Resta DJ, Peng B, Buchdunger E, Ford JM, Lydon NB, Kantarjian H, Capdeville R, Ohno-Jones S, Sawyers CL. Efficacy and safety of a specific inhibitor of the bcr-abl tyrosine kinase in chronic myeloid leukemia. N Engl J Med 2001;344:1031-1037.

20. Esmaeli B, Prieto VG, Butler CE, Kim SK, Ahmadi MA, Kantarjian HM, Talpaz M. Severe periorbital edema secondary to STI571 (Gleevec). Cancer 2002;95:881-887.

21. Reichard KK, Larson RS, Rabinowitz I. Chronic myeloid leukemia. In: Green JP, Foerster J, Rodgers GM, Paraskevas F, Glader B, Arber DA, Means RT Jr, editors. Wintrobe’s Clinical Hematology. 12th ed. Philadelphia: Lippincott Williams and Wilkins; 2009. pp. 2006-2030.

22. Cross TJ, Bagot C, Portmann B, Wendon J, Gillett D. Imatinib mesylate as a cause of acute liver failure. Am J Hematol 2006;83:189-192.

23. Etienne G, Cony-Makhoul P, Mahon FX. Imatinib mesylate and gray hair. N Engl J Med 2002;347:446.

24. Legros L, Cassuto JP, Ortonne JP. Imatinib mesilate (Glivec): a systemic depigmenting agent for extensive vitiligo? Br J Dermatol 2005;153:691-692.

25. Silva de Castro C, Machado do Nascimento L, Walker G, Werneck RI, Nogoceke E, Mira M. Genetic variants of the DDR1 gene are associated with vitiligo in two independent Brazilian population samples. J Invest Dermatol 2010;130:1813-1818.

26. Atallah E, Durand JB, Kantarjian H, Cortes J. Congestive heart failure is a rare event in patients receiving imatinib therapy. Blood 2007;110:1233-1237.

393

Research Article

DOI: 10.4274/Tjh.2012.0086

Hematological Parameters in Severe Complicated Plasmodium falciparum Malaria among Adults in Aden Ciddi Komplike Falciparum Sıtmalı Aden Yetişkinlerinde Hematolojik Parametreler Sawsan Bakhubaira Aden University, Faculty of Medicine and Health Sciences, Department of Hematology Oncology, Aden, Yemen

Abstract: Objective: To study some hematological parameters in adult patients with complicated severe malaria and their relations to clinical outcome.

Materials and Methods: This was a prospective study, including 77 patients from Aden Governorate with complicated

severe malaria over the course of 2 years (2010-2011).

Results: The common form of severe malaria in Aden was cerebral malaria (25.9%), followed by renal failure (18.2%), severe anemia (16.9%), and hepatitis (14.3%), with a case fatality rate of 7.8%. Hemoglobin concentration was significantly different among the various complications of severe malaria, while platelet and white blood cell counts did not show such differences.

The mean age was older among patients that died. Hematological parameters did not significantly differ among dead or surviving patients. Thrombocytopenia was seen in 42.9% of patients and 18.2% of these had platelet counts of <50.0x109/L. However, none of them developed bleeding.

Conclusion: This study concluded that hematological changes are common complications encountered in severe malaria, but they are not related to the clinical outcome.

Key Words: Complicated, Severe, Malaria, Thrombocytopenia

Özet: Amaç: Komplike ağır sıtmalı hastalarda bazı hematolojik parametrelerin klinik sonuç ile ilişkisinin incelenmesi.

Gereç ve Yöntemler: Aden vilayetinde iki yıllık sürede (2010-2012) tanı alan 77 komplike ağır sıtma hastasını içine alan prospektif bir çalışma yapıldı.

Bulgular: Ağır sıtmanın çeşitli komplikasyonlarında hemoglobin konsantrasyonları önemli ölçüde farklı idi, bununla birlikte trombosit ve lökosit sayıları bu farklılığı göstermedi. Yaş ortalaması ölen hastalar arasında büyüktü.

Hematolojik parametreler, ölen ya da hayatta kalan hastalar arasında önemli derecede farklı değildi. Trombositopeni oranı %42,9 idi ve bunların %18,2’sinde sayı 50,0 x109/L’den küçüktü. Ancak hiçbirinde kanama gelişmedi.

Sonuç: Bu çalışma ile, hematolojik değişikliklerin ağır sıtmada sık karşılaşılan komplikasyonlar olduğu fakat klinik sonuç ile ilişkili olmadığı sonucuna varılmıştır.

Anahtar Kelimeler: Komplike, Ciddi, Sıtma, Trombositopeni

Address for Correspondence: Sawsan BAKHUBAİRA, M.D, Aden University, Faculty of Medicine and Health Sciences, Department of Hematology Oncology, Aden, Yemen Phone: 00967777929010 E-mail: bakhubaira@gmail.com Received/Geliş tarihi : October 16, 2011 Accepted/Kabul tarihi : May 16, 2013

394

Sawsan Bakhubaira: Hematological Parameters in Severe Malaria in Aden

Introduction Malaria is an important cause of death and illness, especially in tropical countries [1]. The most severe forms of and deaths from malaria are caused by Plasmodium falciparum, with other species rarely producing serious complications, debilitating relapses, and even death [2].

Major complications of severe malaria can develop rapidly and progress to death within hours or days [3]. These include cerebral malaria, pulmonary edema, acute renal failure, severe anemia, and/or bleeding. Acidosis and hypoglycemia are the most common metabolic complications [1,2,3,4].

The World Health Organization (WHO) established criteria for severe malaria that assisted clinical and epidemiological studies. This project was begun in 1990 [4] and was then revised in 2000 to include other clinical manifestations and laboratory values that portend a poor prognosis based on clinical experience in semi-immune patients [3].

In Yemen, malaria remains a significant health problem, with Plasmodium falciparum as the predominant species that is responsible for 90% of malaria cases [5]. Different studies were conducted on severe malaria, such as that of Al-Taiar et al. [6] on pediatric patients, which showed severe malaria constituting 17% of pediatric hospital admissions.

In the same study, the main presentation of severe malaria was respiratory distress (40%), followed by severe anemia (37%) and cerebral malaria (8%). Another study conducted

by Al-Mekhlafi et al. [7] reported that severe malaria puts a high burden on health services in Yemen, and they found a high prevalence of severe malaria among children younger than 5 years old.

The previous studies on severe malaria in Yemen did not focus on the hematological parameters of complicated severe malaria in adults; therefore, this study was conducted to evaluate the main hematological parameters in adult patients with complicated severe malaria in Aden, where a large central referral hospital and a branch of the National Center of Public Health Laboratories (NCPHL) are present.

Materials and Methods This was a prospective study that included 77 patients from Aden Governorate with complicated severe malaria admitted to Al-Gamhouria Modern General Hospital (Aden, Yemen) and treated at the NCPHL in Aden during 2 years (2010-2011). Patients were selected according to the following criteria: adult Yemeni patients with severe malaria (aged 18 years or more), confirmed to have Plasmodium falciparum malaria parasites in the peripheral blood or bone marrow, and presenting with severe malaria as according to the WHO definition [3]. Severe malaria patients were followed within the hospital until death or discharge (not including discharge against medical advice).

Turk J Hematol 2013;30:394-399

Exclusion criteria included severe malaria patients of <18 years of age, severe malaria patients who were not residents of Aden (because they usually refuse to stay in the hospital after initial improvement), and severe malaria patients who absconded or were discharged against medical advice.

The hematological data were collected from the NCPHL in Aden. The clinical data were obtained directly from patients or relatives as well as from physicians in the intensive care unit of the internal medical department of the hospital, where complicated severe malaria patients are admitted.

In the NCPHL, malaria is diagnosed by thick and thin blood films. These films were stained with Giemsa for the detection and characterization of Plasmodium falciparum malaria and the parasite load was determined for each film.

Diagnosis of severe malaria was established according to the WHO criteria published in 2000 [3]: - Severe anemia was defined as normocytic normochromic anemia with hematocrit of <15% or hemoglobin of <5 g/ dL in the presence of parasitemia at >1000/µL. In the case of microcytic/hypochromic anemia, iron deficiency, thalassemia, and hemoglobinopathy were ruled out.

- Cerebral malaria was defined as unrousable coma not attributable to any other cause, with a Glasgow Coma Scale score of ≤9, or coma that persisted for at least 30 minutes after a generalized convulsion.

- Renal failure was defined as urine output of <400 mL/24 h and serum creatinine of >3.0 mg/dL despite adequate volume repletion.

- Circulatory collapse (algid malaria) was defined as systolic blood pressure of <70 mmHg with cold, clammy skin or a core-skin temperature difference of >10 °C. - Black-water fever was defined as the passage of dark red, brown, or black urine secondary to massive intravascular hemolysis and resulting hemoglobinuria.

- Hepatitis was defined as the presence of clinically detected jaundice with serum bilirubin concentration of >3 mg/dL and ultrasonographic evidence of enlarged, inflamed liver with elevated liver enzymes.

- Hypoglycemia was defined as plasma glucose level of <40 mg/dL. - Prostration and weakness was defined as a patient who could not sit or walk with no obvious neurological explanations.

Statistical Analysis The collected data were analyzed with SPSS 18.

Quantitative variables were presented as mean values, standard deviations, and ranges. Results were tested by the Mann–Whitney or Student t-test with a 95% level of significance and p≤0.05 was considered statistically significant.

395

Turk J Hematol 2013;30:394-399

Sawsan Bakhubaira: Hematological Parameters in Severe Malaria in Aden

Ethical Considerations This study was approved by the ethics committee of the hospital as well as by the ethics committee of the NCPHL in Aden. During data collection from patients or relatives, verbal consent was obtained, and names and personal data were completely secured and transferred to codes to keep patients’ identities private.

Results A total of 88 patients were diagnosed with complicated severe malaria, and 11 of these were excluded due to leaving the hospital early against medical advice. The remaining 77 patients were followed until discharge with medical advice or death.

The most common form of complicated severe malaria among the studied 77 patients in Aden was cerebral malaria (25.9%), followed by renal failure, severe anemia, and hepatitis at 18.2%, 16.9%, and 14.3%, respectively (Table 1).

The mean hemoglobin concentration showed a highly significant statistical difference in relation to the type of complications in severe malaria (p=0.00001); it was lowest in those with severe anemia (3.5 g/dL), increasing to 8.2 g/ dL in cases of renal failure, to 9 and 9.1 g/dL respectively in hepatitis cases and in prostrated patients, and up to 11.4

and 11.6 g/dL in cerebral malaria and algid malaria patients, respectively (Table 1).

Platelet and white blood cell (WBC) counts did not show significant statistical differences in relation to the type of complications in severe malaria (p=0.052 and p=0.095, respectively) (Table 1).

The studied patients were followed until complete improvement and discharge, while 6 of them died, representing a case fatality rate of 7.8% (Figure 1). The mean age of deceased patients with severe malaria was statistically significantly older than the mean age of those who survived after severe malaria: 45.2 years versus 29.3 years, respectively (p=0.015). However, the mean values of the studied hematological parameters (hemoglobin, platelet, and WBC counts) were not significantly different among those who died or survived after severe complicated malaria (Table 2).

Thirty-three patients from the studied 77 with severe complicated malaria had thrombocytopenia (platelet count of <150x109/L) at variable degrees; this rate represents 42.9% of all severe complicated malaria cases in this study. However, none of them developed bleeding. In these patients, the

Table 1. Studied hematological parameters by type of complications in severe malaria.

(n=77)

Hemoglobin concentration (g/dL)

n

%

Mean±SD

Range

Mean±SD

Range

Mean±SD

Range

Cerebral malaria

20

25.9

11.4±1.7

9.2-13.8

143.5±52.8

40-373

5.8±4.6

1.0-19.0

Renal failure

14

18.2

8.2±2.6

5.7-11.4

152.4±80.6

20-350

4.3±2.1

1.3-9.0

Severe anemia

13

16.9

3.5±1.2

2.0-4.8

197.4±63.9

90-296

2.8±0.2

1.0-5.5

Hepatitis

11

14.3

9.0±3.3

5.8-13.8

200.7±135.4

20-482

5.6±2.5

2.0-9.9

Algid malaria

8

10.4

11.6±2.6

7.2-13.9

232.0±108.5

60-396

3.5±0.8

1.0-6.2

Hypoglycemia

5

6.5

10.4±1.1

9.0-12.0

120.7±85.4

76-291

5.5±2.8

2.6-8.8

Prostration and weakness

3

3.9

9.1±1.7

7.8-11.3

89.4±35.2

60-130

6.2±1.4

1.5-9.8

Black-water fever

3

3.9

10.8±2.4

8.1-13.2

133.0±13.2

122-147

4.0±1.4

2.3-8.1

Complications

Mann–Whitney test (p-value)

0.00001

p≤0.05 is statistically significant. SD: standard deviation; WBC: white blood cell.

396

Platelet count (x109/L)

0.052

WBC count (x109/L)

0.095

Turk J Hematol 2013;30:394-399

Sawsan Bakhubaira: Hematological Parameters in Severe Malaria in Aden

count was repeated by manual method. They were classified into 3 grades: grade 1 thrombocytopenia with counts of <150 to 75x109/L, grade 2 thrombocytopenia with counts of <75 to 50x109/L, and grade 3 thrombocytopenia with counts of <50x109/L. The studied cases of thrombocytopenia were classified as 57.6% in grade 1, 24.2% in grade 2, and 18.2% in grade 3 (Table 3).

Discussion This study demonstrated some hematological parameters in complicated severe malaria due to Plasmodium falciparum, which is the most common type of malaria infection in Yemen, accounting for 90% of malaria cases [5].

Cerebral malaria was the most common complication in severe malaria in adults, representing a quarter of the studied cases (25.9%). Several hypotheses have been proposed to explain the pathophysiology of cerebral malaria, but none have been completely satisfactory. Moreover, there is no association of cerebral malaria with altered hematological parameters [1]. This is similar to the findings of this study

Three of the 6 deceased patients had grade 1 thrombocytopenia, 2 had grade 2, and 1 had grade 3 (Table 3). Five out of the 6 deceased patients in this study (83.3%) had cerebral malaria, while the sixth patient (16.7%) had renal failure (Table 4).

Table 2. Age and studied hematological parameters of deceased versus surviving patients with complicated severe malaria.

Alive (n=71)

Hematological parameters

Died (n=6)

p*

Mean±SD

Range

Mean±SD

Range

Age (years)

29.3±14.5

18-70

45.2±21.1

19-80

0.015

Hemoglobin concentration (g/dL)

10.1±2.8

3.2-13.9

9.3±2.4

2.0-12.2

0.312

131.9±85.8

40-373

140.5±67.1

48-335

0.812

4.2±2.7

1.0-19.0

3.4±1.4

1.0-9.9

0.477

Platelet count (x109/L) WBC count (x109/L)

*: p-values were calculated by t-test. SD: standard deviation; WBC: white blood cell.

Table 3. Grades of thrombocytopenia associated with complicated severe malaria in adult patients in Aden.

Thrombocytopenia Grade

n

%

Minimum

Maximum

Number of deceased patients

(x109/L)

Grade 1

<150.0-75.0

19

57.6

75.0

149.3

3

Grade 2

<75.0-50.0

8

24.2

50.0

74.6

2

Grade 3

<50.0

6

18.2

24.3

49.2

1

33

100.0

24.3

149.3

6

Total

397

Turk J Hematol 2013;30:394-399

Sawsan Bakhubaira: Hematological Parameters in Severe Malaria in Aden

(Table 1), whereby mean hemoglobin, WBC, and platelet counts were not affected in cerebral malaria patients.

Hemoglobin concentration showed lowest mean values reaching 3.5 g/dL in the studied patients with severe anemia. Plasmodium falciparum malaria is one of the most common causes of anemia. The other Plasmodium species rarely cause anemia because only select red cell populations (reticulocytes in the case of P. vivax and P. ovale and older cells in P. malariae) are invaded. Multiple mechanisms cause anemia in severe malaria, the most important being hemolysis of infected and uninfected red blood cells (RBCs), splenic sequestration of RBCs, dyserythropoiesis, and bone marrow suppression; such factors can culminate in the chronically low hemoglobin values observed in patients residing in holoendemic regions [8,9].

Studies found that anemia is also correlated with the severity of malaria infection [10]. In this study, the mean WBC count did not show a deviation from the normal reference range in all types of complicated severe malaria.

This is similar to the results reported by Bashawri et al. [11] Table 4. Causes of mortality in 6 adult patients with complicated severe malaria in Aden.

Cause of death

n

%

Cardiopulmonary arrest with cerebral malaria

5

83.3

Cardiopulmonary arrest with renal failure

1

16.7

Total

6

100.0

in Saudi Arabia. However, other studies showed that during severe P. falciparum infection there are changes in leukocyte proliferation and function.

Thrombocytopenia was detected in 42.9% of the studied patients with complicated severe malaria. This is a common hematological alteration in malaria, which may be a result of peripheral platelet destruction and consumption. Studies showed that immune complexes generated by malarial antigens lead to sequestration of the injured platelets by macrophages in the spleen [12]. The present finding of thrombocytopenia is similar to that that reported by Banzal et al. [13] in Saudi Arabia (50.4%).

In this study, thrombocytopenia was graded to look for the percentage of lower platelet counts; 18.2% of the studied patients showed a count of <50.0x109/L. In a study by Khan et al. [14], a quarter (26.8%) of the cases of P. falciparum malaria showed grade 3 thrombocytopenia with a count of <50.0x109/L. However, none of our patients bled, and all of them recovered from thrombocytopenia quickly during treatment.

In regard to mortality associated with complicated severe malaria, neurological manifestations were the major determinant of morbidity and mortality in severe malaria cases in adults. All 6 of the deceased patients in this study suffered cardiopulmonary arrest and died. Postmortem autopsy is not a routine in Yemen; it is only done in legal cases. Five out of the 6 deceased patients in this study (83.3%) had cerebral malaria and the sixth (16.7%) had renal failure. However, hematological findings were not seriously deteriorated in the studied patients with cerebral malaria. This finding is similar to that reported by Mengistu and Diro in Ethiopia [15], as well as to the findings of Giha

Table 5. Sex, age, and studied hematological parameters in patients with cerebral malaria.

Patients with cerebral malaria (n=20) Hematological parameters Mean±SD Sex of patient:

Male

Range 18 (90.0%)

Female

2 (10.0%)

Age (years)

31.6±17.0

18-80

Hemoglobin concentration (g/dL)

11.4±1.7

9.2-13.8

143.5±52.8

40-373

5.8±4.6

1.0-19.0

Platelet count (x109/L) WBC count (x109/L) Sex of patients expressed as number and percentage. SD: standard deviation; WBC: white blood cell.

398

Sawsan Bakhubaira: Hematological Parameters in Severe Malaria in Aden

et al. [16] in Sudan, who reported mean hemoglobin levels to be higher in patients who died of severe malaria than in the survivors.

Conclusion This study concluded that hematological changes are common complications encountered in any patient with severe malaria. Hemoglobin concentration is associated with significant changes in relation to the type of complications of severe malaria; however, it is not associated with the clinical outcome after severe malaria. The total WBC count cannot be used as a predictor for severity. Thrombocytopenia can implicate complications, but it is usually asymptomatic and platelet transfusions are generally not required because patients recover quickly. It is recommended that physicians should rely on the clinical presentation and complaints of patients with severe malaria and not hurry to conduct transfusion of blood or blood components based on the findings of hematological parameters alone (Table 5).

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Trampuz A, Jereb M, Muzlovic I, Prabhu RM. Clinical review: severe malaria. Crit Care 2003;7:315-323.

2. Svenson JE, MacLean JD, Gyorkos TW, Keystone J. Imported malaria. Clinical presentation and examination of symptomatic travelers. Arch Intern Med 1995;155:861868.

3. [No authors listed.] Severe falciparum malaria. World Health Organization, Communicable Diseases Cluster. Trans R Soc Trop Med Hyg 2000;94(Suppl. 1):1-90.

4. [No authors listed.] Severe and complicated malaria. World Health Organization, Division of Control of Tropical Diseases.

Trans R Soc Trop Med Hyg 1990;84(Suppl. 2):1-65.

5. Al-Mekhlafi AM, Mahdy MA, Azazy AA, Fong MY. Molecular epidemiology of Plasmodium species prevalent in Yemen based on 18 s rRNA. Parasit Vectors 2010;3:110.

Turk J Hematol 2013;30:394-399

6. Al-Taiar A, Jaffar S, Assabri A, Al-Habori M, Azazy A, AlMahdi N, Ameen K, Greenwood BM, Whitty CJ. Severe malaria in children in Yemen: two site observational study.

BMJ 2006;333:827-832.

7. Al-Mekhlafi AM, Mahdy MA, Azazy AA, Fong MY. Clinical situation of endemic malaria in Yemen. Trop Biomed 2010;27:551-558.

8. Buffet PA, Safeukui I, Milon G, Mercereau-Puijalon O, David PH. Retention of erythrocytes in the spleen: a doubleedged process in human malaria. Curr Opin Hematol 2009;16:157-164.

9. Perkins DJ, Were T, Davenport GC, Kempaiah P, Hittner JB, Ongâ&#x20AC;&#x2122;echa JM. Severe malarial anemia: innate immunity and pathogenesis. Int J Biol Sci 2011;7:1427-1442.

10. Das BS, Nanda NK, Rath PK, Satapathy RN, Das DB. Anemia in acute Plasmodium falciparum malaria in children from Orissa State, India. Ann Trop Med Parasitol 1999;93:109-118.

11.

Bashawri LAM, Mandil AA, Bahnassy AA, Ahmed MA. Malaria: hematological aspects. Ann Saudi Med 2002;22:372-377.

12. Looareesuwan S, Davis JG, Allen DL, Lee SH, Bunnag D, White NJ. Thrombocytopenia in malaria. Southeast Asian J Trop Med Public Health 1992;23:44-50.

13. Banzal S, Ayoola EA, El-Sammani EE. The clinical pattern and complications of severe malaria in the Gizan Region of Saudi Arabia. Ann Saudi Med 1999;19:378-380.

14. Khan SJ, Abbass Y, Marwat MA. Thrombocytopenia as an indicator of malaria in adult population. Malaria Res Treat 2012;2012:405981. doi: 10.1155/2012/405981. Epub 2012 Jul 2.

15. Mengistu G, Diro E. Treatment outcome of severe malaria in adults with emphasis on neurological manifestations at Gondar University Hospital, north west Ethiopia. Ethiop J Health Dev 2006;20:106-111.

16. Giha HA, Elghazali G, A-Elgadir TM, A-Elbasit IE, Eltahir EM, Baraka OZ, Khier MM, Adam I, Troye-Blomberg M, Theander TG, Elbashir MI. Clinical pattern of severe Plasmodium falciparum malaria in Sudan in an area characterized by seasonal and unstable malaria transmission.

Transact Royal Soc Trop Med Hyg 2005;99:243-251.

399

Case Report

DOI: 10.4274/Tjh.2012.0180

Co-expression of t(15;17) and t(8;21) in a Case of Acute Promyelocytic Leukemia: Review of the Literature Akut Promiyelositik Lösemili Bir Hastada t(15;17) ve t(8;21) Birlikteliği: Literatürün Gözden Geçirilmesi Burak Uz, Eylem Eliaçık, Ayse Işık, Salih Aksu, Yahya Büyükaşık, İbrahim C. Haznedaroğlu, Hakan Göker, Nilgün Sayınalp, Osman İ. Özcebe Hacettepe University Medical School, Department of Internal Medicine, Division of Hematology, Ankara, Turkey

Abstract: Additional chromosomal abnormalities in acute myelogenous leukemia have been identified as one of the most important prognostic factors. Favorable chromosomal changes such as t(8;21), inv(16), and t(15;17) are associated with higher rates of complete remission and event-free survival. Translocation (15;17) characterizes acute promyelocytic leukemia (APL) (FrenchAmerican-British class M3) in almost all patients. Secondary chromosomal abnormalities are also present in approximately 23%-29% of patients with newly diagnosed APL. The prognostic implications of t(8;21) and other secondary cytogenetic aberrations in APL are reviewed here. We present a 47-year-old woman diagnosed with APL whose initial cytogenetic analysis included both t(8;21) and t(15;17). The initial induction chemotherapy included 3 days of idarubicin (12 mg/m2/day) and daily all-trans retinoic acid (ATRA; 45 mg/m2/day). At the sixth week of treatment, a control bone marrow biopsy was found to be normocellular, t(15;17) bcr3 and t(8;21) were negative, and t(15;17) bcr1 fusion transcripts were reduced from 5007 (1.78525699%) copies per 1 µg RNA to 40 (0.00062020%) with real-time quantitative polymerase chain reaction. Consolidation with 4 days of idarubicin (5 mg/m2/day), ATRA (45 mg/m2/day for 15 days), and cytarabine (1 g/m2/day for 4 days) was then started. However, the patient became pancytopenic and had neutropenic fever after consolidation treatment. Unfortunately, she died 3 months after the time of APL diagnosis, due to acute respiratory distress syndrome-like respiratory problems and multiorgan dysfunction requiring respiratory support and hemodialysis.

Key Words: Additional chromosomal abnormalities, Acute promyelocytic leukemia Özet: Akut miyeloid lösemide ek kromozomal anomaliler en önemli prognostik faktörlerden biri olarak belirlenmiştir. Translokasyon t(8;21), inv(16), ve t(15;17) gibi olumlu kromozomal değişiklikler daha yüksek tam remisyon ve olaysız sağkalım ile ilişkilidir.

Translokasyon (15;17) neredeyse tüm hastalarda akut promiyelositik lösemiyi (APL) tanımlamaktadır (Fransız-Amerikanİngiliz [FAB] sınıf M3). Yeni tanı alan APL hastalarının yaklaşık %23-29’unda ikincil kromozomal anomaliler de bulunmaktadır.

Bu olgu vesilesiyle APL’de t(8;21) ve diğer ikincil sitogenetik aberasyonların prognostik etkileri gözden geçirilmiştir. APL tanısı konan 47 yaşındaki kadın hastanın tanı anındaki sitogenetik analizinde t(8;21) ve t(15;17) birlikteliği saptandı.

Başlangıç indüksiyon kemoterapisi 3 gün idarubisin (12 mg/m2/gün), ve günlük all-trans retinoik asit (ATRA) (45 mg/m2/gün) içermekteydi. Tedavinin 6. haftasında yapılan kontrol kemik iliği biyopsisi normoselülerdi. t(15;17) bcr3 ve t(8;21) negatifti, ve gerçek zamanlı kantitatif polimeraz zincir reaksiyonu (RQ-PCR) ile tespit edilen t(15;17) bcr1 füzyon transkriptleri 5007 (1,78525699 %) kopya/1 µg RNA’dan 40 (0,00062020 %)’a düşmüştü. Bunun üzerine 4 gün idarubisin (5 mg/m2/gün), 15 gün ATRA (45 mg/m2/gün), ve 4 gün sitarabin (1 g/m2/gün) içeren konsolidasyon tedavisi başlandı. Konsolidasyon tedavisi sonrasında hastada pansitopeni ve nötropenik ateş tablosu gelişti. APL tanısından 3 ay sonra, solunum desteği ve hemodiyaliz gerektiren çoklu organ fonksiyon bozukluğu ve ARDS-benzeri solunum problemleri nedeniyle hasta kaybedildi.

Anahtar Kelimeler: Ek kromozomal anomaliler, Akut promiyelositik lösemi Address for Correspondence: Burak UZ, M.D., Hacettepe University Medical School, Department of Internal Medicine, Division of Hematology, Ankara, Turkey Phone: +90 312 305 15 43 E-mail: burakuz78@gmail.com Received/Geliş tarihi : November 22, 2012 Accepted/Kabul tarihi : January 10, 2013

400

Uz B, et al: Co-expression of t(15;17) and (8;21) in APL

Introduction Acute promyelocytic leukemia (APL) accounts for approximately 10%-15% of acute myelogenous leukemia (AML) cases and is a very specific subtype with regard to morphologic, clinical, and prognostic features [1]. Although APL has the highest frequency of hemorrhagic morbidity and mortality among all subtypes of AML, most patients with t(15;17) will respond to a combination treatment with all trans-retinoic acid (ATRA), cytarabine (Ara-C), and anthracycline-based chemotherapy [1,2].

Balanced chromosome rearrangements are detected in approximately 25%-30% of adults with de novo AML [35] and have attracted a great deal of attention because of specific translocations and inversions associated with the prognosis of the patients harboring them. t(15;17) is known to be found in almost all APL patients [1]. Chromosomal abnormalities accompanying t(15;17) are reported in 23%39% of APL cases [2,6,7,8,9,10]. Additional chromosome rearrangements including t(8;21) and t(15;17) are rarely seen in APL patients [11,12]. However, the clinical impact of these secondary anomalies has not been clearly elucidated yet.

Herein, we present an APL patient who had both t(15;17) and t(8;21) at the time of diagnosis. Diagnosis of APL in this patient was based on karyotyping, immunophenotyping, and molecular studies of bone marrow cells. The treatment and clinical course of the patient is summarized. Informed consent was obtained.

Case Report In February 2012, a 47-year-old woman was admitted to the General Surgery Department of our institution with a 3-week history of fever, anal pain, and rectal discharge.

Her initial blood count showed pancytopenia as follows: Hb, 55 g/L (normal range: 117-155), WBC: 1.6 x 109/L (normal range: 4.1-11.2) with 0.2 x 109/L absolute count (10.4%) of neutrophils, and platelets, 56 x 109/L (normal range: 159388). Peripheral blood smear revealed 1% neutrophils, 11% lymphocytes, 88% lymphomononuclear cells, poikilocytosis, anisocytosis, and schistocytes. Besides a mild increase in fasting blood glucose (6.56 mmol/L; normal range: 3.96.1), all biochemical parameters were within normal limits.

Abdominal magnetic resonance imaging (MRI) revealed a lesion consistent with abscess formation (1.8 x 1.3 cm) adjacent to the right of the anal canal, which was hyperintense in T2A-weighted images and demonstrated peripheral involvement after the administration of intravenous contrast medium. A lateral internal sphincterotomy was performed in March 2012. After the operation she had continuous fever and leukocytosis (21.8 x 109/L) with 19.6 x 109/L absolute count (89.9%) of neutrophils. Her platelet count decreased to 11 x 109/L. Despite replacement with platelet suspensions, she had retinal bleeding. Coagulation parameters revealed a

Turk J Hematol 2013;30:400-404

increased prothrombin time (2.22 international normalized ratio; normal range: 0.86-1.20), D-dimer level (>20 mg/ mL; normal range: 0-0.48), and thrombin time (27.2 s; normal range: 16.6-22.5). Fibrinogen level was found to be low (1.4 µmol/L; normal range: 6.4-11.9). Activated partial thromboplastin time was normal. The patient was referred to the hematology division. Her physical examination revealed fever (38.3 °C), generalized petechiae, and bilateral complete loss of pupillary light reflex. She did not have a chronic disease or history of drug usage. She had been pancytopenic since December 2011, and a bone marrow biopsy performed at another center was found to be normocellular (50%), with no finding of dysplasia. The bone marrow biopsy was repeated to reveal a marked increase in cellularity, with a grade I-II/III increase in reticulin network.

Intermediate- to large-sized immature cells with large cytoplasm and irregularly shaped nuclei including light chromatin and 2-3 little nucleoli were seen. The immature cells were CD34-negative. Immature cells were accepted as Faggot cells including Auer rods with May-Grünwald Giemsa staining. Bone marrow aspiration revealed 20% blasts and 20% promyelocytes. Thus, the patient’s diagnosis was APL. Spinal lumbosacral MRI showed diffuse bone marrow signal alterations and contrast medium involvement of all vertebrae and iliac bones. A suspicious compression at the L5 level was also reported, but the patient did not have any neurologic deficits.

Flow cytometric analysis of bone marrow samples identified the presence of an abnormal population of CD13(+)/CD33(+)/CD45(+)/MPO(+)/DR(-)/Tdt(-) cells.

Analysis of 25 metaphases showed clonal abnormalities.

The karyotype was interpreted as 46,XX,t(8;21)(q22;q22) [1]/46,XX,t(15;17)(q22;q21)[5]/46,XX[24].

Additional fluorescence in situ hybridization (FISH) studies for the PML locus at 15q22 and RARα locus at 17q21 were carried out.

Analysis of 100 interphase nuclei showed a hybridization pattern consistent with PML/RARα fusion in 36 (36%) nuclei (nuc ish(PMLx3)(RARAlfax3)(PML conRARAlfax1) [36/100]). In addition, real-time quantitative (RQ) polymerase chain reaction (PCR) analysis with t(15;17) bcr1 transcript revealed 5007 copies (1.78525699%) of fusion transcripts per 1 µg RNA and 305 copies (0.1082556554%) of fusion transcripts per 1 µg RNA with t(15;17) bcr3 transcript. FLT3 ITD and D835 mutations were studied from peripheral blood with the PCR and restriction fragment length polymorphism (PCR-RFLP) method, and both were negative.

Induction chemotherapy consisting of 3 days of idarubicin (12 mg/m2/day) and daily ATRA (45 mg/m2/day) was initiated. After the induction therapy, the pancytopenic state improved (Hb: 109 g/L, WBC: 3.6 x 109/L with 2.1 x 109/L absolute count (59.0%) of neutrophils, platelets: 239 x 109/L), and the hemostasis tests returned to normal limits except a mild increase in D-dimer (2.02 mg/mL) 401

Turk J Hematol 2013;30:400-404

Uz B, et al: Co-expression of t(15;17) and (8;21) in APL

and fibrinogen levels (15.6 µmol/L). At the sixth week of treatment, a control bone marrow biopsy was found to be normocellular. In addition, t(15;17) bcr3 and t(8;21) were negative, and t(15;17) bcr1 fusion transcripts were reduced from 5007 (1.78525699%) copies per 1 µg RNA to 40 (0.00062020%). Consolidation treatment including 4 days of idarubicin (5 mg/m2/day), ATRA (45 mg/m2/day for 15 days), and cytarabine (1 g/m2/day for 4 days) was then started. After consolidation therapy, the patient became pancytopenic and had neutropenic fever. She was transferred to the intensive care unit because of acute respiratory distress syndrome-like respiratory problems and multiorgan dysfunction requiring hemodialysis and respiratory support.

Despite appropriate antibiotic treatment, multiple red blood cell and platelet transfusions, and inotropic agents, the patient expired 3 monts after the time of APL diagnosis.

Discussion In the APL-93 trial, the incidence of chromosomal abnormalities in addition to t(15;17) was 26%, and trisomy 8 was the most frequent secondary change (46% of the cases with secondary changes) [2]. Additional chromosome rearrangements including t(8;21) and t(15;17) are rarely seen in APL patients treated initially with ATRA plus chemotherapy [11,13,14,15]. Two case studies reported a coexistence of t(8;21) and t(15;17) chromosomal anomalies in their patients at the time of diagnosis, and they concluded that t(8;21) may have been the first event to originate from an early leukemic clone, while t(15;17) was acquired later in the course of the disease [11,13]. Charrin et al. detected 2 clones at the initial phase of an AML including 46,XX,t(15;17) and 46,XX,t(8;21),t(15;17). Relapse occurred after 12 months of complete remission with typical APL syndrome when t(15;17) alone was the most predominant [11]. Movafagh et al. [16] reported a female patient in whom 2 French-American-British (FAB)-specific chromosome aberrations evolved from a single leukemic clone and co-expressed t(15;17) and t(8;21). Recently, in a case of APL-M3v in which complete remission was achieved soon after a course of ATRA plus chemotherapy, a novel t(8;21) chromosomal aberration was detected from 3 to 18 months after initial treatment. Intermittent detection of t(8;21) during periods without ATRA therapy may reflect the antitumor effect of ATRA on M2 leukemic cells and 2 independently growing aberrant stem cell clones in this patient. The authors also suggested that the proportion of M2 leukemic cells at the time of diagnosis should be below the sensitivity level of the nested PCR detection limit, and, after chemotherapy, alteration of bone marrow cell kinetics should trigger t(8;21) via complex mechanisms [12].

The prognostic impacts of additional cytogenetic abnormalities in APL patients have been analyzed in a number of studies, and conflicting results were obtained [2,6,7,8,9,10]. Grimwade et al. evaluated 1612 AML 402

patients and found that these cytogenetic changes did not alter the prognosis of patients with favorable karyotypic anomalies such as t(15;17). Trisomy 21 was categorized in the intermediate risk group, while monosomies 5 and 7 had no effects on response rates and overall survival [10]. In the largest study by de Botton et al. [2], patients with only t(15;17) and patients with t(15;17) plus other chromosomal abnormalities were compared. In accordance with the findings of Grimwade et al. [10], additional cytogenetic changes in patients with t(15;17) had no impact on complete remission rate, event-free survival, relapse and overall survival at 2 years. Calabrese et al. suggested that complex chromosome translocations were secondary changes that occurred after standard t(8;21) and t(15;17), thus clarifying the hierarchy of the cytogenetic events [17].

Today, ATRA in combination with conventional chemotherapy increases the efficacy of ATRA dramatically and improves the long-term survival of APL patients to 75% [18]. In non-APL AML, the effects of ATRA are less clear.

However, there has been a long-standing interest in the clinical use of ATRA for the treatment of AML subtypes other than APL. ATRA has growth inhibitory effects in non-M3 leukemic cells through cytotoxicity and apoptosis [19].

ATRA’s inhibitory roles in non-APL leukemic cells including the HL-60 cell line [20], ovarian carcinoma, neuroblastoma, and germ cell tumors [21] were also reported. Based on these promising scientific data, Schlenk et al. evaluated ATRA in combination with intensive chemotherapy in nonAPL elderly AML patients. They suggested that patients with the genotype mutant NPM1 without FLT3 ITD who had been randomized to the ATRA arm had a significantly better relapse-free and overall survival compared to patients with the same genotype who had not been randomized to the ATRA arm. They considered that ATRA may exert its effect by down-regulation or by posttranslational modification of the antiapoptotic protein bcl-2 [22]. Four cases of AML that were initially misdiagnosed as APL based on FAB classification were successfully treated with ATRA alone.

Three of these patients achieved complete response (CR), but all of them relapsed early. Their diagnoses were changed to t(8;21) AML based on karyotype analysis. One of the 3 patients who achieved CR had a decrement of the AML1ETO fusion gene from 92% to 0% after 10 days of ATRA treatment. However, prior use of arsenic trioxide in the same patient did not alter the AML1-ETO fusion gene in the bone marrow cells according to FISH analysis. Interestingly, one patient who had a temporary response (without CR) with ATRA achieved CR after a combined treatment including daunorubicin and cytarabine. The presence of both AML1ETO and PML-RARα fusion genes were detected by RT-PCR in this patient [23]. The authors suggested that AML1ETO and PML-RARα recruit a multiprotein complex containing histone deacetylases (HDACs) on crucial myeloid differentiation via several co-repressors, which leads to a cell differentiation block [24]. In addition, oligomerization and

Uz B, et al: Co-expression of t(15;17) and (8;21) in APL

formation of high-molecular-weight complexes by AML1ETO and PML-RARα play a critical role in the aberrant recruitment of HDAC activity [25].

Our case showed the typical APL morphology and coexpression of t(8;21) and t(15;17), which was detected by conventional cytogenetic analysis. RQ-PCR technology has recently reached a level of sensitivity, accuracy, and practical ease that supports its use as a routine bioinstrumentation for gene level measurement [26]. However, in our patient, t(8;21) was determined by cytogenetic analysis, but not

by RQ-PCR. FLT3 ITD and D835 mutations were both negative. Classic AIDA induction chemotherapy [27,28] was administered to the patient. She went into remission after induction chemotherapy. t(15;17) bcr3 and t(8;21) became negative, and t(15;17) bcr1 fusion transcripts were reduced from 5007 (1.78525699%) copies per 1 µg RNA to 40 (0.00062020%) according to RQ-PCR. Consolidation treatment including 4 days of idarubicin (5 mg/m2/day), ATRA (45 mg/m2/day for 15 days), and cytarabine (1 g/m2/ day for 4 days) was then started.

Co-expression of t(8;21) and t(15;17) is rarely seen in APL patients. The role of chromosome translocations other than t(15;17) in APL is still unclear. The current literature data support the concept that patients harboring t(15;17) with any other additional chromosomal abnormality a similarly favorable prognosis as patients with t(15;17) alone. Combined use of conventional cytogenetics, FISH [29], and PCR should increase the detection of additional chromosomal abnormalities either in diagnosis or in the treatment period of APL. Combination therapy with ATRA, Ara-C, and anthracycline should be an appropriate choice to improve the prognosis in these patients. Further studies are required to clarify the clinical features and prognosis with complex translocations.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Saydam G. [Acute promyelocytic leukemia]. Turkiye Klinikleri J Med Sci 2007;3:42-49.

2. de Botton S, Chevret S, Sanz M, Dombret H, Thomas X, Guerci A, Fey M, Rayon C, Huguet F, Sotto JJ, Gardin C, Cony Makhoul P, Travade P, Solary E, Fegueux N, Bordessoule D, San Miguel J, Link H, Desablens B, Stamatoullas A, Deconinck E, Geiser K, Hess U, Maloisel F, Castaigne S, Preudhomme C, Chomienne C, Degos L, Fenaux P; European APL Group. Additional chromosomal abnormalities in patients with acute promyelocytic leukaemia (APL) do not confer poor prognosis: results of APL 93 trial. Br J Haematol 2000;111:801-806.

Turk J Hematol 2013;30:400-404

3. Byrd JC, Mrózek K, Dodge RK, Carroll AJ, Edwards CG, Arthur DC, Pettenati MJ, Patil SR, Rao KW, Watson MS, Koduru PR, Moore JO, Stone RM, Mayer RJ, Feldman EJ, Davey FR, Schiffer CA, Larson RA, Bloomfield CD; Cancer and Leukemia Group B (CALGB 8461). Pretreatment cytogenetic abnormalities are predictive of induction success, cumulative incidence of relapse, and overall survival in adult patients with de novo acute myeloid leukemia: results from Cancer and Leukemia Group B (CALGB 8461).

Blood 2002;15;100:4325-4336.

4. Slovak ML, Kopecky KJ, Cassileth PA, Harrington DH, Theil KS, Mohamed A, Paietta E, Willman CL, Head DR, Rowe JM, Forman SJ, Appelbaum FR. Karyotypic analysis predicts outcome of preremission and postremission therapy in adult acute myeloid leukemia: a Southwest Oncology Group/Eastern Cooperative Oncology Group study. Blood 2000;96:4075-4083.

5. Grimwade D, Walker H, Harrison G, Oliver F, Chatters S, Harrison CJ, Wheatley K, Burnett AK, Goldstone AH; Medical Research Council Adult Leukemia Working Party.

The predictive value of hierarchical cytogenetic classification in older adults with acute myeloid leukemia (AML): analysis of 1065 patients entered into the United Kingdom Medical Research Council AML11 trial. Blood 2001;98:1312-1320.

6. Schoch C, Haase D, Haferlach T, Freund M, Link H, Lengfelder E, Löffler H, Büchner T, Fonatsch C. Incidence and implication of additional chromosome aberrations in acute promyelocytic leukaemia with translocation t(15;17)(q22;q21): a report on 50 patients. Br J Haematol 1996;94:493-500.

7. Slack JL, Arthur DC, Lawrence D, Mrózek K, Mayer RJ, Davey FR, Tantravahi R, Pettenati MJ, Bigner S, Carroll AJ, Rao KW, Schiffer CA, Bloomfield CD. Secondary cytogenetic changes in acute promyelocytic leukemia—Prognostic importance in patients treated with chemotherapy alone and association with the intron 3 breakpoint of the PML gene: a Cancer and Leukemia Group B study. J Clin Oncol 1997;15:1786-1795.

8. Hiorns LR, Swansbury GJ, Mehta J, Min T, Dainton MG, Treleaven J, Powles RL, Catovsky D. Additional chromosome abnormalities confer worse prognosis in acute promyelocytic leukaemia. Br J Haematol 1997;96:314-321.

9. Pantic M, Novak A, Marisavljevic D, Djordjevic V, Elezovic I, Vidovic A, Colovic M. Additional chromosome aberrations in acute promyelocytic leukemia: characteristics and prognostic influence. Med Oncol 2000;17:307-313.

10. Grimwade D, Walker H, Oliver F, Wheatley K, Harrison C, Harrison G, Rees J, Hann I, Stevens R, Burnett A, Goldstone A. The importance of diagnostic cytogenetics on outcome in AML: analysis of 1,612 patients entered into the MRC AML 10 trial. Blood 1998;92:2322-2333.

11. Charrin C, Ritouet D, Campos L, Devaux Y, Archimbaud E, Fraisse J, Fiere D, Germain D. Association of t(15;17) and t(8;21) in the initial phase of an acute promyelocytic leukemia. Cancer Genet Cytogenet 1992;58:177-180.

403

Turk J Hematol 2013;30:400-404

12. Neto WK, Serpa M, Sanabani SS, Bueno PT, Velloso ED, Dorlhiac-Llacer PE, Bendit I. Early detection of t(8;21) chromosomal translocations during treatment of PMLRARA positive acute promyelocytic leukemia: a case study.

Clin Med Insights Oncol 2010;4:163-170.

13. Bonomi R, Giordano H, del Pilar Moreno M, Bodega E, Landoni AI, Gallagher R, del Rosario Uriarte M. Simultaneous PML/RARα and AML1/ETO expression with t(15;17) at onset and relapse with only t(8;21) in an acute promyelocytic leukemia patient. Cancer Genet Cytogenet 2000;123:41-43.

14. Varella-Garcia M, Brizard F, Roche J, Flandrin G, Drabkin H, Brizard A. AMl1/ETO and PMl/RARA rearrangements in a case of AML-M2 acute myeloblastic leukemia with t(15;17).

Leuk Lymphoma 1999;33:403-406.

15. Xu L, Zhao WL, Xiong SM, Su XY, Zhao M, Wang C, Gao YR, Niu C, Cao Q, Gu BW, Zhu YM, Gu J, Hu J, Yan H, Shen ZX, Chen Z, Chen SJ. Molecular cytogenetic characterization and clinical relevance of additional, complex and/or variant chromosome abnormalities in acute promyelocytic leukemia. Leukemia 2001;15:1359-1368.

16. Movafagh A, Varma N, Varma S. Co-expression of two FAB-specific chromosome changes, t(15;17) and t(8;21), in a case of acute promyelocytic leukemia. Ann Hematol 1996;72:375-377.

17. Calabrese G, Min T, Stuppia L, Powles R, Swansbury JG, Morizio E, Peila R, Donti E, Fioritoni G, Palka G. Complex chromosome translocations of standard t(8;21) and t(15;17) arise from a two-step mechanism as evidenced by fluorescence in situ hybridization analysis. Cancer Genet Cytogenet 1996;91:40-45.

18.

Degos L, Wang ZY. All trans-retinoic acid in acute promyelocytic leukemia. Oncogene 2001;20:7140-7145.

19. Lehmann S, Bengtzen S, Broberg U, Paul C. Effects of retinoids on cell toxicity and apoptosis in leukemic blast cells from patients with non-M3 AML. Leuk Res 2000;24:19-25.

20. Petrie K, Zelent A, Waxman S. Differentiation therapy of acute myeloid leukemia: past, present and future. Curr Opin Hematol 2009;16:84-91.

21. Miller WH Jr. The emerging role of retinoids and retinoic acid metabolism blocking agents in the treatment of cancer.

Cancer 1998;83:1471-1482.

22. Schlenk RF, Döhner K, Kneba M, Götze K, Hartmann F, Del Valle F, Kirchen H, Koller E, Fischer JT, Bullinger L, Habdank M, Späth D, Groner S, Krebs B, Kayser S, Corbacioglu A, Anhalt A, Benner A, Fröhling S, Döhner H; German-Austrian AML Study Group (AMLSG). Gene mutations and response to treatment with all-trans retinoic acid in elderly patients with acute myeloid leukemia. Results from the AMLSG Trial AML HD98B. Haematologica 2009;94:54-60.

404

Uz B, et al: Co-expression of t(15;17) and (8;21) in APL

23. Qian SX, Li JY, Hong M, Qiu HR, Fan L, Xu W. Acute myeloid leukemia in four patients with t(8;21) treated with all-trans retinoic acid as a single agent. Leuk Lymphoma 2008;49:998-1001.

24. Lutterbach B, Westendorf JJ, Linggi B, Patten A, Moniwa M, Davie JR, Huynh KD, Bardwell VJ, Lavinsky RM, Rosenfeld MG, Glass C, Seto E, Hiebert SW. ETO, a target of t(8;21) in acute leukemia, interacts with the N-CoR and mSin3 corepressors. Mol Cell Biol 1998;18:7176-7184.

25. Lin RJ, Evans RM. Acquisition of oncogenic potential by RAR chimeras in acute promyelocytic leukemia through formation of homodimers. Mol Cell 2000;5:821-830.

26. Savlı H, Hatırnaz Ö. [Quantitative real time-polymerase chain reaction and gene expression analysis in haematology: a review]. Turkiye Klinikleri J Med Sci 2004;24:653-660.

27. Sanz MA, Martín G, Rayón C, Esteve J, González M, DíazMediavilla J, Bolufer P, Barragán E, Terol MJ, González JD, Colomer D, Chillón C, Rivas C, Gómez T, Ribera JM, Bornstein R, Román J, Calasanz MJ, Arias J, Alvarez C, Ramos F, Debén G. A modified AIDA protocol with anthracyclinebased consolidation results in high antileukemic efficacy and reduced toxicity in newly diagnosed PML/RARαpositive acute promyelocytic leukemia. PETHEMA Group.

Blood 1999;94:3015-3021.

28. Sanz MA, Montesinos P, Rayón C, Holowiecka A, de la Serna J, Milone G, de Lisa E, Brunet S, Rubio V, Ribera JM, Rivas C, Krsnik I, Bergua J, González J, Díaz-Mediavilla J, Rojas R, Manso F, Ossenkoppele G, González JD, Lowenberg B; PETHEMA and HOVON Groups. Risk-adapted treatment of acute promyelocytic leukemia based on all-trans retinoic acid and anthracycline with addition of cytarabine in consolidation therapy for high-risk patients: further improvements in treatment outcome. Blood 2010;115:51375146.

29. Ogur G, Fen T, Sucak G, Heimann P, Cankuş G, Haznedar R. Impact of fluorescence in situ hybridization in the detection of cryptic fusion transcript PML/RARA and a complex t(5;15;17) in a case of acute promyelocytic leukemia. Turk J Haematol 2000;17:207-212.

DOI: 10.4274/Tjh.2012.0172

Case Report

Primary Adrenal Lymphoma with Secondary Central Nervous System Involvement: A Case Report and Review of the Literature İkincil Merkezi Sinir Sistemi Tutulumu Olan Primer Adrenal Lenfoma: Olgu Sunumu ve Derleme Kübra Aydın¹, Kerem Okutur¹, Mustafa Bozkurt¹, Özlem Aydın3, Esat Namal¹, Akın Öztürk¹, Kezban Nur Pilancı¹, Reyhan Diz Küçükkaya², Osman Gökhan Demir¹ 1İstanbul

Bilim University Division of Medical Oncology, Department of Internal Medicine, İstanbul, Turkey

2İstanbul

Bilim University Division of Hematology, Department of Internal Medicine, İstanbul, Turkey

3Acıbadem

University School of Medicine, Department of Pathology, İstanbul, Turkey

Abstract: Approximately 10%-20% of all systemic lymphomas have central nervous system (CNS) involvement, which has been correlated to a worsened prognosis. It is well known that secondary involvement of the adrenal glands may occur in up to 25% of patients during the course of diffuse lymphoma. Primary adrenal lymphoma (PAL), however, is a different entity, and it is defined as the presence of adrenal lymphoma without evidence of either nodal involvement or leukemia. It has been shown that this occurrence is rarely accompanied by extranodal involvement, such as in the CNS. PAL exhibits a tendency for CNS relapse and this possibility should be examined even before symptoms are present. Herein we present a patient with PAL and secondary CNS involvement.

Key Words: Primary adrenal lymphoma, Central nervous system involvement

Özet:

Tüm sistemik lenfomaların yaklaşık %10-20’sinde merkezi sinir sistemi (MSS) tutulumu mevcuttur ve bunun kötü prognozla ilişkili olduğu görülmüştür. Yaygın lenfoma hastalık seyrinde hastaların %25’inde ikincil adrenal bez tutulumu olduğu iyi bilinmektedir. Fakat primer adrenal lenfoma (PAL) farklı bir kavramdır ve ne lösemi ne de lenf bezi tutulumu olmadan adrenal lenfoma görülmesi olarak tanımlanmıştır. Bu duruma nadiren MSS gibi lenf bezi dışı tutulumların eşlik ettiği görülmüştür.

Sonuç olarak PAL MSS’de nüks etme eğilimi göstermektedir ve bu belirti vermeden önce araştılmalıdır. Burada ikincil MSS tutulumu olan bir PAL olgusu sunmaktayız.

Anahtar Sözcükler: Primer adrenal lenfoma, Merkezi sinir sistemi tutulumu

Introduction Central nervous system (CNS) involvement is found in about 10%-20% of all systemic lymphomas, and it is generally correlated with a worsened prognosis [1]. Secondary involvement of the CNS in non-Hodgkin lymphoma may be

shown in several different ways, and rapid control of CNS involvement in this scenario is deemed to be necessary to prevent neurologic morbidity and to preserve/enhance the quality of life. Lymphoma cells seem to enter the CNS via hematogenous spread or direct extension from adjacent bone metastases, or through centripetal growth along neurovascular

Address for Correspondence: Kübra AYDIN, M.D., Department of Internal Medicine, Division of Medical Oncology, İstanbul Bilim University, Istanbul, Turkey GSM: +90 505 527 11 78 E-mail: drkubra@yahoo.com Received/Geliş tarihi : November 11, 2012 Accepted/Kabul tarihi : May 8, 2013

405

Aydın K, et al: PAL with CNS Involvement

Turk J Hematol 2013;30:405-408

bundles. It has also been hypothesized that known lymphoma cells have a potential to spread from retroperitoneal lymph nodes or patient’s bone marrow to the leptomeninges via the intervertebral venous plexus [2].

Several series of autopsies have shown that up to 25% of patients with non-Hodgkin lymphoma have adrenal gland involvement, and this is usually associated with advanced disease [3]. However, in contrast, primary adrenal lymphoma (PAL) is a different entity, defined as the presence of adrenal lymphoma without evidence of nodal involvement or leukemia.

In addition, this has been found to be rarely accompanied by extranodal involvement. This is considered to be an enigma, however, because a normal adrenal gland in humans has been shown to be devoid of any lymphoid or hematopoietic tissue.

Possible explanations for the occurrence of PAL include either preexisting autoimmune adrenalitis with lymphocyte infiltration or hematopoietic rest tissue in the adrenals, although this is not conclusively proven to exist due to the rarity of the disease [4].

In this article we report a rare case of PAL with secondary CNS involvement and review the literature.

Case Report A 75-year-old male was admitted to our neurology clinic with a chief complaint of dullness for a duration of 2 months.

The patient had a history of diabetes mellitus and Parkinson’s disease. A brain MRI was obtained and revealed a paramedian subcortical mass measuring 30 mm x 25 mm x 25 mm, located on the superior and middle frontal gyrus of the left brain hemisphere. Moreover, this lesion was accompanied by diffuse perilesional vasogenic edema. Due to the mass and edema effects, there was compression noted on the anterior horn of the left lateral ventricle. Additionally, a similar mass was detected measuring 2.5 cm in diameter located at the right frontal periventricular. After diagnosis, the patient underwent surgical intervention and an excisional biopsy was performed. The histopathological examination of the specimen revealed a CD20+ large B cell lymphoma (Figures 1A and 1B).

Subsequently, the patient was referred to our medical oncology outpatient clinic. Physical examination at the outpatient admission showed no pathological findings correlated to vital signs and systems. The patient’s blood pressure was 120/70 mmHg, while the respiratory rate was 18/min, pulse rate was 67/min, and body temperature was 37.0 °C. There was no lymphadenopathy or organomegaly noted. Laboratory tests revealed a normal complete blood count; however, the erythrocyte sedimentation rate was found to be 45 mm/h.

Additionally, β2-microglobulin and other laboratory values were found to be within normal limits. The patient’s baseline lactate dehydrogenase (LDH) level was within the normal levels. HIV test results were negative, while the International Prognostic Index score was calculated to be 4 (high risk). Chest computed tomography (CT) imaging was reviewed and determined to be normal, without any evidence of hilar lymphadenopathy or pulmonary lesions. An abdominal CT scan revealed bilateral adrenal mass. The left adrenal mass was measured as 30 mm x 33 mm, whereas the right adrenal mass was 32 mm x 53 mm in diameter. PET/CT scanning revealed a fluorodeoxyglucose 406

(FDG) uptake focus only in the adrenal glands, and the brain was without pathologic glycolytic activity, as were all other regions of the body (Figures 2A and 2B). A CT-guided fine needle aspiration biopsy was obtained from both adrenal masses, and this scan revealed a CD20+ large B cell lymphoma similar in presentation to the patient’s brain pathology (Figure 1C). Bone marrow biopsy was normal, having no lymphoma infiltration. Thus, the diagnosis for this patient was reported to be stage IV diffuse large B cell PAL with secondary CNS involvement. Unfortunately, because of generalized seizures and status epilepticus, the patient was transferred to the intensive care unit (ICU). Antiepileptic and antiedema drugs were administered. Along the course, gram-negative septicemia occurred, and suitable antibiotics for coverage were included in the patient’s treatment. A new cranial CT was performed and suggested a rapid, progressive cranial mass (Figure 2C).

Whole-brain radiotherapy was then initiated. Several days after initiation of radiotherapy, the patient improved, and he was subsequently transferred to a regular nursing floor. Wholebrain radiotherapy was completed, and then the patient was discharged from the hospital. Six weeks later, a repeat cranial MRI showed tumor regression. Afterwards, the patient was started on chemotherapy utilizing R-COP (rituximab 375 mg/ m2, cyclophosphamide 750 mg/m2, vincristine 1.4 mg/m2, prednisone 100 mg/m2). We did not administer adriamycin due to the patient’s age, his general health status, his history of sepsis, and an increased risk of further infection. Unfortunately, 2-3 days after the completion of the third cycle of chemotherapy, the patient had a focal epileptic seizure. Repeat cranial MRI revealed a progressive left cranial mass, which at this time crossed the corpus callosum and was in the left side of the brain hemisphere. The patient was then readmitted to the ICU. Because of his age and history of whole-brain radiotherapy, a high dose of methotrexate could not be given. The patient died at the end of a 6 months of follow-up period due to disease progression. Informed consent was obtained.

1A

1B

1C

Figure 1: The histopathological examination of the specimen showed a.

CD20(+) large B cell lymphoma 2A

2B

2C

Figure 2: The images of PET-CT and Cranial MR.

Turk J Hematol 2013;30:405-408

Aydın K, et al: PAL with CNS Involvement

Discussion Primary CNS lymphomas (PCNSLs) make up approximately 1% of intracranial neoplasms and only about 1% of extranodal non-Hodgkin lymphomas. These lymphomas are mostly present in individuals over 60 years of age, and this seems to be related to a reduction of immunologic vigilance, particularly T lymphocytes. PCNSL has a tendency to remain within the CNS and there is low incidence of systemic spread from these neoplasms [5]. In the case presented, we initially expected the outcome to be PCNSL; however, FDG uptake was detected in the bilateral adrenal glands in PET/CT, and the subsequent biopsy revealed a different diagnosis.

Bilateral adrenal masses are found to exist in about 10%15% of the adrenal “incidentaloma” cases, likely to be diagnosed as metastatic disease (mostly from lung or breast), congenital adrenal hyperplasia, lymphoma, infection, hemorrhage, adrenocorticotropic hormone-dependent Cushing’s syndrome, and lastly, pheochromocytoma [6]. There are 2 types of adrenal involvement in lymphoma: PAL, which is defined as a disease originating from and confined to the adrenal glands solely, and non-Hodgkin lymphoma with adrenal involvement [7]. PAL is extremely rare; only about 100 cases have been previously reported in the literature [8]. PAL usually does not have disease found elsewhere, but if it is present, it is more likely extranodal

in nature. Sites for extranodal involvement for PAL are the CNS and the gastrointestinal tract, as well as other endocrine organs [9]. In our case, CNS involvement was present. Mantzios et al. reviewed a total of 100 cases that had been previously reported in the literature over the past 4 decades [8]. According to their findings, PAL shows a predilection for older males with a maleto-female ratio of 2:1. The mean age at presentation with PAL was 65 years of age. These findings were similar in our case. As in our case, more than two-thirds of patients had a significant bilateral enlargement of the adrenal glands. The prognosis of PAL is poor. More than 90% of patients died within 1 year of diagnosis. Overall survival time in our case from time of diagnosis was roughly 6 months. Recently, Kim et al. published a study investigating prognostic factors in primary diffuse large B cell lymphoma (DLBCL) of the adrenal gland. Contrary to prior reports, their data suggested that outcomes of PAL are encouraging when a regimen of R-CHOP is utilized and that achieving complete response after R-CHOP therapy is predictive of survival [10].

Similarly, 5 cases of PAL with CNS involvement have been reported in the literature [10,11,12,13,14]. Table 1 summarizes the features of these reported cases. All of the patients reported were males older than the age of 50 (median age: 65), and bilateral involvement was noted in all. In one case, a high-

Table 1. Cases of primary adrenal lymphoma with central nervous system involvement.

Case no.

1

Reference year/

2008/China

country Age/sex

74/M

2

3

4

5

6 (present case)

2005/France

2002/Korea

2001/Israel

2004/Greece

2013/Turkey

51/M

61/M

60/M

80/M

75/M

Presenting

Anorexia, nausea,

Generalized

Abdominal pain

Weight loss,

Fever, fatigue,

Dullness,

symptoms

vomiting, weight

seizure

weakness, abdominal pain

nausea, emesis, and

generalized

constipation

seizure

loss, fatigue, pigmentation

Site

Bilateral

Bilateral

Bilateral

Bilateral

Bilateral

Bilateral

Size

R5.9 L7.7

R5 L4

R5.8 L5.8

R6 L4

R9 L10

R3.3 L5.3

(max. cm) Diagnosis

US, CT, PET,

CT, biopsy

CT, MRI, PET,

CT, Ga67 scan,

CT, biopsy

CT, PET, biopsy

Pathology

biopsy DLBCL

DLBCL

biopsy DLBCL

biopsy DLBCL

Burkitt/

DLBCL

Burkitt-like Treatment

CHOP

MVBP, MTX(it)

CEOP, WBRT

ACVBP Site of CNS

Prognosis

Not defined

6 months

CHOP, WBRT, high-dose

lymphoma CNOP+R

MTX

Cerebral,

Frontal lobe,

epidural

basal ganglia,

16 months

cerebellum 6 months

WBRT, R-COP

Parietal lobe

Leptomeninges

Frontal lobe

14 months

2 months

6 months

Abbreviations: WBRT, Whole brain radiotherapy; DLBCL, Diffuse large B cell lymphoma;R, Right adrenal gland; L, Left adrenal gland; CHOP, Cyclophosphamide, doxorubicin, oncovin, prednisone; MVBP, Methotrexate, etoposide, BCNU, prednisone; ACVBP, Adriamycin, cyclophosphamide, vindesine, bleomycin, prednisone; CEOP, Cytoxan, epirubicin, vincristine, prednisolone; CNOP+R, Cyclophosphamide, mitoxantrone, vincristine, prednisolone + rituximab.

407

Aydın K, et al: PAL with CNS Involvement

Turk J Hematol 2013;30:405-408

grade atypical Burkitt/Burkitt-like lymphoma histology was found, while all others were cases of DLBCL. Only one patient presented initially with brain symptoms comparable to those of our case. Patients in the study had recurrence in the brain after systemic chemotherapy regimen. Survival was noted to be a median time of 6 months from initial diagnosis.

Some patients are at an increased risk for developing CNS relapse, especially if involvement of specific extranodal sites (bone marrow, epidural, testes, paranasal sinuses, kidneys, adrenal glands, liver, and breast) is noted, or if there are 2 or more extranodal sites with elevated LDH. Lumbar puncture should be performed for initial evaluation in all suspected patients. Although optimal management of these patients is still under investigation, intrathecal methotrexate (MTX) has historically been the most common used regimen. It has been suggested that systemic intravenous MTX at a dose of 3500 mg/ m2 followed by leucovorin rescue should be adopted for CNS prophylaxis in high-risk patients and that intrathecal therapy be considered only for those patients who are not able to tolerate systemic therapy [15,16].

For patients with presentation of parenchymal CNS involvement, systemic methotrexate (3-3, 5 g/m2) should be incorporated into the treatment regimen. Systemic MTX with leucovorin rescue has been safely incorporated into R-CHOP-21, with MTX administrated on day 15 of the 21day cycle. Systemic MTX is the optimal treatment for isolated CNS relapse that involves the brain parenchyma, and longterm survival is possible in some patients. These patients do not appear to benefit from intrathecal treatment, and only symptomatic benefit is noted from radiation treatment [17].

More case studies and data on the treatments performed are necessary to develop a better picture of diagnostic procedures and treatment regimens that have maximum efficacy.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Hollender A, Kvaloy S, Lote K, Nome O, Holte H. Prognostic factors in 140 adult patients with non-Hodgkin’s lymphoma with systemic central nervous system (CNS) involvement. A single centre analysis. Eur J Cancer 2000;36:1762-1768.

2. Levitt LJ, Dawson DM, Rosenthal DS, Moloney WC. CNS involvement in the non-Hodgkin’s lymphomas. Cancer 1980;45:545-552.

3. Kita M, Mandala E, Saratzis A, Ventzi L, Venizelos I, Keryttopoulos P, Efstathiadou Z, Garyfallos A, Avrimides A. Primary adrenal lymphoma presenting as Addison’s disease.

Case report and review of the literature. Exp Clin Endocrinol Diabetes 2008;116:363-365.

4. Reddy SV, Prabhudesai S, Gnanasekaran B. Origin of primary adrenal lymphoma and predisposing factors for primary adrenal insufficiency in primary adrenal lymphoma. Indian J Endocrinol Metab 2011;15:350-351.

408

5. Ferreri AJ, Reni M. Primary central nervous system lymphoma.

Crit Rev Oncol Hematol 2007;63:257-268.

6. Wang J, Sun NC, Renslo R, Chuang CC, Tabbarah HJ, Barajas L, French SW. Clinically silent primary adrenal lymphoma: a case report and review of the literature. Am J Hematol 1998;58:130-136.

7. Kunavisarut T, Nitiyanant W, Muangsomboon S, Tongdee T, Siritanratkul N. Non-Hodgkin lymphoma with adrenal insufficiency: a case report and literature review. J Med Assoc Thai 2009;92:687-690.

8. Mantzios G, Tsirigotis P, Veliou F, Boutsikakis I, Petraki L, Kolovos J, Papageorgiou S, Robos Y. Primary adrenal lymphoma presenting as Addison’s disease: case report and review of literature. Ann Hematol 2004;83:460-463.

9. Salvatore JR, Ross RS. Primary bilateral adrenal lymphoma.

Leuk Lymphoma 1999;34:111-117.

10. Kim YR, Kim JS, Min YH, Hyunyoon D, Shin HJ, Mun YC, Park Y, Do YR, Jeong SH, Park JS, Oh SY, Lee S, Park EK, Jang JS, Lee WS, Lee HW, Eom H, Ahn JS, Jeong JH, Baek SK, Kim SJ, Kim WS, Suh C. Prognostic factors in primary diffuse large B-cell lymphoma of adrenal gland treated with rituximab-CHOP chemotherapy from the Consortium for Improving Survival of Lymphoma (CISL). J Hematol Oncol 2012;5:49-57.

11. Wang J, Sun H, Bai R, Gao S, Li Y. F-FDG PET/CT images in primary adrenal lymphoma. Eur J Radiol Extra 2008;68:8387.

12. Mermershtain W, Liel Y, Zirkin HJ, Lupu L, Lantsberg S, Cohen Y. Primary bilateral adrenal lymphoma relapsing as a solid cerebral mass after complete clinical remission. Am J Clin Oncol 2001;24:583-585.

13. Vélayoudom FL, Cardot-Bauters C, Decouvelaere AV, Vlaeminck V, Bauters F, Wémeau JL. Non-Hodgkin’s lymphoma involving the adrenal glands and the central nervous system (CNS): a particular evolution after chemotherapy. Ann Endocrinol (Paris) 2005;66:527-531.

14. Hahn JS, Choi HS, Suh C, Lee WJ. A case of primary bilateral adrenal lymphoma (PAL) with central nervous system (CNS) involvement. Yonsei Med J 2002;43:385-390.

15. Armitage JO. How I treat patients with diffuse large B-cell lymphoma. Blood 2007;1:29-36.

16. Abramson JS, Hellmann M, Barnes JA, Hammerman P, Toomey C, Takvorian T, Muzikansky A, Hochberg EP. Intravenous methotrexate as central nervous system (CNS) prophylaxis is associated with a low risk of CNS recurrence in high-risk patients with diffuse large B-cell lymphoma. Cancer 2010;116:4283-4290.

17. van Besien K, Ha CS, Murphy S, McLaughlin P, Rodriguez A, Amin K, Forman A, Romaguera J, Hagemeister F, Younes A, Bachier C, Sarris A, Sobocinski KS, Cox JD, Cabanillas F. Risk factors, treatment, and outcome central nervous system recurrence in adults with intermediate-grade and immunoblastic lymphoma. Blood 1998;91:1178-1184.

DOI: 10.4274/Tjh.2012.0072

Case Report

Primary Bone Lymphoplasmacytic Lymphoma Presenting with Spinal Cord Compression: A Case Report Spinal Kord Basısı ile Ortaya Çıkan Lenfoplazmasitik Primer Kemik Lenfoması: Olgu Sunumu Yang Lei, Liu Zi, Su Long, Li Pei, Li Wei

Jilin University, Department of Hematology and Oncology, Changchun, China

Abstract: Primary bone lymphoma is a rare disease, and the main pathological type is diffuse large B-cell lymphoma. The occurrence of follicular, marginal zone and lymphoplasmacytic lymphomas is rare. Vertebras are also sites that can be affected, and spinal cord compression is reported in 14% of patients with vertebral involvement. However, there is no report on primary vertebral lymphoplasmacytic lymphoma with spinal cord compression. The present report presents one case of primary vertebral lymphoplasmacytic lymphoma with spinal cord compression and increased serum and urine λ light chain, without an elevated heavy chain of immunoglobulin.

Key Words: Primary bone lymphoma, Lymphoplasmacytic lymphoma, Spinal cord compression

Özet:

Primer kemik lenfoması nadir bir hastalık olup, en sık patolojik tipi difüz büyük B hücreli lenfomadır. Folliküler, marjinal lenfoma ya da lenfoplazmasitik lenfoma alt tipleri nadirdir. Vertebra tutulan bölgelerden biridir ve spinal kord basısı vertebral tutulumu olan hastaların %14’ünde bildirilmiştir. Bununla birlikte, spinal kord basısı ile başvuran bir primer vertebra lenfoplazmasitik lenfoma daha önce rapor edilmemiştir. Bu yazıda spinal kord kompresyonuna neden olmuş primer vertebra lenfoplazmasitik lenfoması olan ve serum, idrar λ hafif zincir miktarı artmış ancak immünglobulin ağır zinciri normal bulunan bir olgu sunulmuştur.

Anahtar Sözcükler: Primer kemik lenfoması, Lenfoplazmasitik lenfoma, Spinal kord basısı

Introduction Primary bone lymphoma (PBL) is defined as lymphoma localized to the bone without evidence of involvement of lymph nodes or other tissues at presentation. It one of the rarest primary bone malignancies, accounting for less than 5% of all primary bone tumors [1]. PBL constitutes less than 1-2% of all malignant lymphomas in adults [2]. Most PBLs are primary bone diffuse large B-cell type lymphomas

with a rare occurrence of follicular, marginal zone and lymphoplasmacytic types [3]. The long bones are primarily affected and the femur is the most commonly involved location as a single site [2,4]. The common signs and symptoms are local bone pain with or without soft tissue swelling and pathological fracture. Spinal cord compression is reported in 14% of patients with vertebral involvement but the presence of B symptoms is relatively uncommon

Address for Correspondence: Yang LEİ, M.D., Jilin University, Department of Hematology and Oncology, Changchun, China Phone: 86-0431-88782051 E-mail: allan54@126.com Received/Geliş tarihi : June 7, 2012 Accepted/Kabul tarihi : September 27, 2012

409

Turk J Hematol 2013;30:409-412

Lei Y, et al: Primary Bone Lymphoplasmacytic Lymphoma Presenting with Spinal Cord Compression: A Case Report

[2,5]. PBL has a better prognosis following radiotherapy and chemotherapy than many other malignant tumors, and therefore early identification allows for appropriate treatments [2,6]. In this report, the authors present a 61-yearold patient with a primary vertebra lymphoplasmacytic lymphoma presenting with spinal cord compression.

Case Report A 61-year-old woman presented to the emergency department with a 3-month history of progressive chest and back pain, 1-month history of numbness and weakness of the lower extremities, and paraplegia for 1 day. Initially, the patient had a paroxysmal pain of the chest and lower back, which spread progressively to the bilateral scapula, oxter, and praecordia. Two months later, she felt numbness in her left lower extremity. After 1 week, she felt weakness in the lower extremities and had difficulty in walking. In three months, the symptoms worsened and hypoesthesia appeared. She became paraplegic the day before admission to hospital. The history revealed no cardiac, bowel, or bladder problems and her pain was not associated with motor or sensory neurological deficits at presentation. On physical examination she had no superficial lymphadenopathy or hepatosplenomegaly. The superficial hypoesthesia was located below the bilateral papilla plane. Tenderness and pain in percussion were positive at the level of vertebra T1-T3, in addition to a mild pain at the level of vertebra L4. Muscular force was normal for upper limbs, and the forces of hip, knee, and ankle joints were Grade III for both extending and flexing. Patellar reflex was strengthened and Achilles tendon reflex was normal. Computerized tomography (CT) scan showed a space-occupying lesion located in and outside the left canalis spinalis and foramen intervertebral levels T1-T3, accompanied with the destruction of the second vertebra.

Serum calcium, albumin, and lactate dehydrogenase were within normal range. β2-microglobulin was slightly increased (2.57 mg/L; normal range is 0.7-1.8 mg/L). Blood and urine immunofixation were positive for λ chain. Serumfree lambda light chain was 175.3 mg/L (normal range is 6.72-22.81 mg/L), and κ chain was 10.6 mg/L (normal range is 5.81-21.04 mg/L). The 24-h urine λ chain was 949.2 mg (normal range is <7.8 mg). Serum IgG was normal, but a slight decrease was seen for IgA and IgM, at 0.616 g/L (normal range is 0.7-4.0 g/L) and 0.192 g/L (normal range is 0.4-2.3 g/L), respectively. The erythrocyte sedimentation rate was 21 mm/h (normal range is 0-20 mm/L for females), and the International Prognostic Index score was 4. Bone marrow examinations with both smear and biopsy were normal. Informed consent was obtained from the patient.

On 30 September 2010, the patient received decompressive laminectomy, and the excision material was evaluated by hematoxylin-eosin (H&E) staining and immunohistochemistry. The results revealed diffuse tumor cell proliferation, which infiltrated and damaged the adjacent bone and soft tissues. The middle-sized tumor cells showed 410

plasma cell features that were characterized by abundant cytoplasm and asymmetrical nuclei. The chromatin was granulated and Russell bodies could be observed. No plasmablasts could be found. The morphology suggested a proliferative disease of plasma cells (Figures 1A-1D). The immunohistochemical staining result was CD20 (+) (Figure 2A), CD138 (±) (Figure 2B), CD56 (+) (Figure 2C), CD79a (+) (Figure 2D), CD38 (+), Lambda (+), NUM-1 (+), Ki-67 (some +), PAX5 (weakly positive), Bcl-2 (+/-), CyclinD1 (-), CD21 (-), CD5 (-), CD3 (-), CK-P (-), CD43 (-), CD23 (-), CD10 (-), Bcl-6 (-), MPO (-), Kappa (-), EMA (-), and EBER (-). The pathological diagnosis was lymphoplasmacytic lymphoma.

Positron emission tomography (PET)-CT was utilized to stage and determine the disease focus. The results revealed that the second vertebra had hypermetabolism accompanied

Figure 1: The hematoxylin-eosin (H&E) stained laminectomy material revealed middle-sized tumor cells with plasma cell features that were characterized by abundant cytoplasm and asymmetrical nuclei. The morphology suggested a proliferative disease of plasma cells.

Figure 2: The immunohistochemical staining resulted in CD20 (+) (Figure 2A), CD138 (±) (Figure 2B), CD56 (+) (Figure 2C), CD79a (+) (Figure 2D) cells. The pathological diagnosis was lymphoplasmacytic lymphoma.

Lei Y, et al: Primary Bone Lymphoplasmacytic Lymphoma Presenting with Spinal Cord Compression: A Case Report

Turk J Hematol 2013;30:409-412

classified in 4 groups: group 1, lymphoma in a single bone site with or without regional lymph node involvement; group 2, lymphoma in multiple bones, but no visceral or lymph node involvement; group 3, bone tumor with involvement of other visceral sites or lymph nodes at multiple sites; and group 4, lymphoma involving any other site and found by bone biopsy that was done to rule out possible involvement [2]. In this case, the patient was considered as having PBL involving 2 separate sites of the bone based on the result of accessory examination.

Figure 3: PET-CT of the patient revealed FDG uptake at second thoracic (Figure 3A, C) and fourth lumbar vertabrae (Figure 3B, D). with bone destruction, and the standardized uptake value (SUV) was 3.2 (average: 2.1) (Figure 3A). The fourth lumbar vertebra was also hypermetabolic accompanied with bone destruction, and the SUV was 3.0 (Figure 3B), which suggested infiltration of lymphoma and compression fracture of the lumbar vertebra. There was no significant hypermetabolic focus in other sites.

Local radiation therapy was given to the second thoracic and fourth lumbar vertebras (total: 44 Gy/22 f). The back pain gradually disappeared and muscle strength and feeling gradually recovered during the treatment. The patient then performed functional training for 1 month. Muscular tension and strength recovered to normal and she could move freely.

Reexamination of the serum and urine immunofixation showed positivity of the λ chain. The λ chain was 413.1 mg (decrease of >50%) for 24 h. PET-CT showed significantly decreased focus in the second thoracic and fourth lumbar vertebras (Figures 3C and 3D). After that, the patient received R-CHOP chemotherapy (R: rituximab, 600 mg; C: cyclophosphamide, 1125 mg; H: epirubicin, 112.5 mg; O: vindesine, 4 mg; P: prednisone, 100 mg).

Discussion PBL is a rare presentation of non-Hodgkin’s lymphoma.

It was first described as a distinct clinicopathological entity in 1939 by Parker and Jackson [7]. The real prevalence of PBL is unclear because of the considerable difficulty in distinguishing primary from secondary bone lymphoma [2].

According to Coley’s criteria [8], primary bone lymphoma should have: 1) a primary focus in a single bone; 2) positive histological diagnosis; and 3) no evidence of distant soft tissue or distant lymph node involvement. Regional lymph node involvement at diagnosis is not considered as an exclusion criterion [9,10]. Recently, multiple bone involvement was also recognized as primary bone lymphoma, as long as the other 2 criteria are met [9]. According to the WHO classification, lymphoma involving the bone can be

The stage of PBL was established with the Ann Arbor staging system. Single localized bone lesions were classified as Stage IE, and in the case of lymph node involvement on the same side of the diaphragm, patients were considered to have Stage IIE. If lymph nodes in both sides of the diaphragm were involved, the case was considered as Stage IIIE. Stage IVE disease was defined as cases of multiple sites of bone involvement. Hence, the present patient was evaluated as a Stage IVE case.

Lymphoplasmacytic lymphoma (LPL) is one of the rare subtypes accounting for only 1% to 2% of all non-Hodgkin’s lymphomas. This lymphoma arises from plasma cells, which are mature B-lymphocytes [11]. It is most often associated with increased IgM protein produced by the lymphoma cells and is commonly referred to as Waldenström’s macroglobulinemia (WM), which is considered an indolent lymphoma; the disease progresses very slowly and patients usually live many years after diagnosis. Recently, there was also a case report of non-secretory immunoglobulin of LPL [12]. Instead of the signs and symptoms caused by infiltration and the circulating IgM of WM, such as lymphadenopathy, hepatosplenomegaly or hyperviscosity, our patient only presented with increased λ chain and spinal cord compression. The immunohistochemistry revealed positive staining for CD20, CD79a, and Lambda of B cell markers and negative for CD38 and CD138 of plasma cells, and so this patient was diagnosed with lymphoplasmacytic lymphoma. It is difficult to rule out plasmacytoma when the bone is involved, but B cell antigen is negative in these patients.

Several studies have suggested that combined modality (chemotherapy and radiotherapy) was the best treatment for patients with PBL [2,13]. Beal et al. concluded that PBL patients treated with combination chemotherapy and irradiation had significantly better survival than patients treated with a single modality (chemotherapy or radiotherapy alone), but the 5-year overall survival rate between the 2 groups was not significantly different [2,14].

Ramadan et al. reported patients with advanced-stage disease who received chemotherapy plus irradiation with a poor outcome when compared with those who received chemotherapy alone (10-year overall survival rates were 25% and 56%, respectively) [4]. However, this difference must 411

Turk J Hematol 2013;30:409-412

Lei Y, et al: Primary Bone Lymphoplasmacytic Lymphoma Presenting with Spinal Cord Compression: A Case Report

be very cautiously interpreted because the decision to use radiotherapy was individualized. It is possible that patients with more biologically aggressive disease were more likely to receive irradiation, obscuring its impact [3]. Moreover, this result was derived from PBL of diffuse large-cell lymphoma [3]. However, there was no available information in this report about lymphoplasmacytic lymphoma.

After therapeutic and diagnostic surgery, the patient received radiation therapy for local lesions of the vertebras.

As she was in an advanced stage (Stage IVE), the R-CHOP regimen was given for the subsequent treatment. She is currently alive after the treatment and was periodically reexamined for almost 1 year; there was no sign of disease progression or relapse.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Mulligan ME, McRae GA, Murphey MD. Imaging features of primary lymphoma of bone. AJR Am J Roentgenol 1999;173:1691-1697.

2. Nasiri MR, Varshoee F, Mohtashami S, Raziee HR, Aledavood A, Ghafarzadeh K, Memar B, Vojdani S, Sarvizadeh M. Primary bone lymphoma: a clinicopathological retrospective study of 28 patients in a single institution. J Res Med Sci 2011;16:814-820.

3. Bhagavathi S, Fu K. Primary bone lymphoma. Arch Pathol Lab Med 2009;133:1868-1871.

4. Ramadan KM, Shenkier T, Sehn LH, Gascoyne RD, Connors JM. A clinicopathological retrospective study of 131 patients with primary bone lymphoma: a population-based study of successively treated cohorts from the British Columbia Cancer Agency. Ann Oncol 2007;18:129-135.

5. Zinzani PL, Carrillo G, Ascani S, Barbieri E, Tani M, Paulli M, Stefoni V, Sabattini E, Alinari L, Binazzi R, Tura S, Baccarani M, Pileri SA. Primary bone lymphoma: experience with 52 patients. Haematologica 2003;88:280-285.

412

6. Rahmat K, Wastie M, Abdullah B. Primary bone lymphoma: report of a case with multifocal skeletal involvement.

Biomed Imaging Interv J 2007;3:52.

7. Parker F, Jackson H. Primary reticulum cell sarcoma of bone.

Surg Gynecol Obstet 1939;45-53.

8. Coley BL, Higginbotham NL, Groesbeck HP. Primary reticulum cell sarcoma of bone; summary of 37 cases.

Radiology 1950;55:641-658.

9. Singh T, Satheesh CT, Lakshmaiah KC, Suresh TM, Babu GK, Lokanatha D, Jacob LA, Halkud R. Primary bone lymphoma: a report of two cases and review of the literature. J Cancer Res Ther 2010;6:296-298.

10. Baiocchi OC, Colleoni GW, Rodrigues CA, Barton D, Kerbauy FR, Garcia RJ, Segreto RA, Alves AC, Bordin JO. Importance of combined-modality therapy for primary bone lymphoma. Leuk Lymphoma 2003;44:1837-1839.

11. Kristinsson SY, Björkholm M, Goldin LR, McMaster ML, Turesson I, Landgren O. Risk of lymphoproliferative disorders among first-degree relatives of lymphoplasmacytic lymphoma/Waldenström macroglobulinemia patients: a population-based study in Sweden. Blood 2008;112:30523056.

12. Kobayashi K, Yokote T, Hirata Y, Nakayama S, Hiraoka N, Takayama A, Iwaki K, Akioka T, Takubo T, Tsuji M, Hanafusa T. Two case reports of non-secretory [correction of non-secretary]-Ig types of lymphoplasmacytic lymphoma (LPL). Ann Hematol 2010; 89: 945-947.

13. Qureshi A, Ali A, Riaz N, Pervez S. Primary non-Hodgkin’s lymphoma of bone: experience of a decade. Indian J Pathol Microbiol 2010;53:267-270.

14. Beal K, Allen L, Yahalom J. Primary bone lymphoma: treatment results and prognostic factors with long-term follow-up of 82 patients. Cancer 2006;106:2652-2656.

DOI: 10.4274/Tjh.2012.0055

Case Report

Sweet Syndrome in a Patient with Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma: Curious Lymphocyte/Neutrophil Fluctuations KLL’li bir hastada Sweet Sendromu: İlginç Lenfosit/Nötrofil Dalgalanmaları Çiğdem Usul Afşar1, Semra Paydaş1, Meral Günaldı1, Berna Bozkurt Duman1, Vehbi Erçolak1, Suzan Zorludemir2, Arbil Açıkalın2 1Çukurova University Medical Faculty, Department of Medical Oncology, Adana, Turkey 2Çukurova University Medical Faculty, Department of Pathology, Adana, Turkey

Abstract: Sweet syndrome, also referred to as acute febrile neutrophilic dermatosis, is characterized by tender, red inflammatory nodules or papules that occur in association with infection, malignancy, connective tissue disease, or following exposure to certain drugs. Here, we present Sweet syndrome in a case with small lymphocytic lymphoma/chronic lymphocytic leukemia (SLL/CLL) which is a relatively rare co-occurrence.

Key Words: Chronic lymphocytic leukemia, Fever, Malignancy, Neutrophilic leucocytosis, Steroid, Sweet syndrome

Özet:

Akut febril nötrofilik dermatoz da denilen Sweet sendromu; enfeksiyon, malignite, konnektif doku hastalıkları veya bazı ilaçlara maruz kalma sonucu ortaya çıkan; kırmızı, hassas inflamatuvar nodüller veya papüllerle karakterizedir. Burada oldukça nadir bir birliktelik olan küçük lenfositik lenfoma/kronik lenfositik lösemili (SLL/CLL) bir vakada gelişen Sweet sendromunu sunduk.

Anahtar Sözcükler: Kronik lenfositik lösemi, Ateş, Malignite, Nötrofilik lökositoz, Steroid, Sweet sendromu

Introduction In 1964 Robert D. Sweet described a new entity called “acute febrile neutrophilic dermatosis” and he characterized the features of the disease. Also known as Sweet syndrome (SS), it is characterized by a sudden onset of symptoms including fever, neutrophilia, and characteristic skin lesions [1]. However, this disease is not limited to the skin; other

organs may be involved. There are various types, including idiopathic, para-inflammatory, drug-induced, pregnancyrelated, and paraneoplastic disease [2,3,4,5]. Paraneoplastic disease may be associated with hematological disorders, mainly myeloproliferative diseases [6]. About 85% of the cases have hematopoietic neoplasias, and 15% have solid tumors [3]. Small lymphocytic lymphoma/chronic

Address for Correspondence: Çiğdem Usul AFŞAR, M.D., Çukurova University Medical Faculty, Department of Medical Oncology, Adana, Turkey Phone: +90 322 338 60 60 E-mail: cigdemusul@yahoo.com Received/Geliş tarihi : April 27, 2012 Accepted/Kabul tarihi : Sep 03, 2012

413

Turk J Hematol 2013;30:413-415

Afşar, et al: CLL and Sweet Syndrome

lymphocytic leukemia (SLL/CLL) is a relatively rare entity accompanying SS and a few cases have been reported so far [7,8].

Case Report A 58-year-old woman was admitted to our hospital with fever, nausea, abdominal pain, and oral ulcer. She had a 10-year history of SLL/CLL. Initially, she had been treated with cyclophosphamide, vincristine, and prednisolone (CVP). Relapse developed 5 years later and she was then treated with a regimen of rituximab, fludarabine, and cyclophosphamide (R-FC). In 2006, when she was in remission for CLL/SLL, a lung mass was detected and a hemangioma was diagnosed on biopsy. At that time there was no evidence of SS and she had no symptoms due to disease until she presented with fever, large aphthous lesions on the tongue, and hepatosplenomegaly. Informed consent was obtained. The patient was not using any drugs or herbal products. Mouth and skin lesions, fever, and neutrophilic fluctuations in the patient clinically suggested SS (Figure 1, Table 1), and a biopsy was taken. Initial complete blood cell as follows were: white blood cells, 13.9 × 109/L; neutrophils, 7.46 × 109/L, hemoglobin, 9.6 g/dL, and platelets, 16.9 × 109/L. Bone marrow aspiration showed lymphocytosis. One week later, neutrophilic leukocytosis occurred, which was confirmed by peripheral smear, and at that time, the skin lesions worsened. The pathological examination revealed inflammatory infiltrate (neutrophils) located in the dermis, epidermis, and adipose tissue. Microscopically, there was dense perivascular infiltration of the dermis composed

Figure 1: Mouth, skin lesions and neutrophilic fluctuations in the patient.

largely by neutrophils (Figure 2), vasodilatation, endothelial swelling, and erythrocyte extravasation (Figure 3), with prominent edema of the upper dermis. Prednisolone was initiated; the fever disappeared within 12 hours and the mucosal lesions improved dramatically. However, during follow-up, purpuric, hemorrhagic, and necrotic painful skin lesions had developed, and fever had recurred at the end of the fourth week. Clinically, these lesions also suggested SS, and a biopsy was obtained. Pulse steroid (1 g daily) was given, but the response was not as good as it was earlier; skin lesions showed progression, and clinical symptoms suggested myositis. Computed tomography (CT) revealed consolidations in the lungs. Due to the difficulty in excluding an opportunistic infection and underlying CLL/SLL, piperacillin/tazobactam (4 × 4.5 g), acyclovir Introduction Discussion Sweet syndrome is an interesting entity and most commonly accompanies myeloid neoplasias. Sweet syndrome accompanying CLL/SLL is rare, and so far, few cases have been reported. The pathogenesis of this entity is not clear yet, but hematopoietic growth factors seem to play important role in the mechanism of disease; thus increased use of these cytokines may potentially increase the incidence of this entity. Among these growth factors, granulocyte colony-stimulating factor (G-CSF), both endogenous and exogenous, is the most important factor in the development of the signs and symptoms of the disease [9]. The clinical

Figure 2: Dense perivascular infiltration of the dermis composed largely by neutrophils.

Table 1. Neutrophil and leucocyte counts week by week.

Week 1

Week 2

Week 3

Week 4

Week 5

Neutrophil count

13x109/L

30x109/L

10x109/L

41x109/L

36x109/L

Leucocyte count

30x109/L

38x109/L

14x109/L

46x109/L

42x109/L

414

Turk J Hematol 2013;30:413-415

Afşar, et al: CLL and Sweet Syndrome

Systemic corticosteroids are the therapeutic gold standard for SS. After initiation of treatment with systemic corticosteroids, there is a prompt response consisting of dramatic improvement of both the dermatosis-related symptoms and the skin lesions. There was a good response at first in our patient, but she relapsed quickly after discontinuation of the steroids.

In conclusion, SS is rare in patients with SLL/CLL. It should be kept in mind that this syndrome can accompany malignancies and cannot be managed easily as an idiopathic form. This report emphasizes the association of SS with SLL/ CLL, and very high neutrophil levels in spite of lymphocyte infiltration in bone marrow is the other interesting and important point.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Sweet RD. An acute febrile neutrophilic dermatosis. Br J Dermatol 1964;76:349-356.

Figure 3: Neutrophilic infiltration, vasodilatation, endothelial swelling and erythrocyte extravasation.

2. Prevost-Blank PL, Shwayder TA. Sweet’s syndrome secondary to granulocyte colony-stimulating factor. J Am Acad Dermatol 1996;35: 995-997.

importance of SS with respect to hematologic malignancies is that it can be the very early sign of an indolent or recurrent malignancy.

3. Von den Driesch P. Sweet’s syndrome (acute febrile neutrophilic dermatosis). J Am Acad Dermatol 1994;31:535556.

Mucosal involvement of the mouth, appearing as oral or vaginal ulcers, is uncommon in patients with classical SS. Mucosal SS suggests an underlying malignancy, an important point in daily practice. In our patient, oral lesion was the first sign of SS, and skin lesions developed later. At the beginning, dramatic response to steroids was observed, with fever and oral lesion disappearing within 12 hours. Another very interesting point was that there was neutrophilia in the peripheral blood while there was lymphocyte infiltration in the bone marrow.

After a short remission with steroids, skin lesions developed.

Concomitant muscle pains suggesting myositis and CT changes in the lungs were detected, along with more severe neutrophilia, as high as 50 × 109/L. There was no evidence of an autoimmune process. At that time, a high dose of corticosteroid was given; a minimal response was observed but skin and muscle problems increased. Fever recurred despite the use of broad-spectrum antibiotics in addition to the pulse steroid, and her condition deteriorated. At the end, a complicated clinical picture suggesting thrombotic thrombocytopenic purpura developed and she died.

4. Cohen PR. Sweet’s syndrome – a comprehensive review of an acute febrile neutrophilic dermatosis. Orphanet J Rare Dis 2007;2:34.

5. Cohen PR, Kuzrock R. Sweet syndrome and cancer. Clin Dermatol 1993;11:149-157.

6. Ventura F, Rocha J, Pereira T, Marques H, Pardal F, Brito C. Sweet syndrome as the presenting symptom of hairy cell leukemia. Dermatol Online J 2009;15:12.

7. Cholongitas E, Pipili C, Dasenaki M, Kaklamanis L. Piperacillin/tazobactam-induced Sweet syndrome in a patient with chronic lymphocytic leukemia and autoimmune cholangitis. Am J Dermatopathol 2008;30:203-204.

8. Thompson MA, Dyson SW, Faderl S. Sweet’s syndrome in chronic lymphocytic leukemia associated with neutropenic fever and granulocyte colony stimulation factor. Am J Hematol 2006;81:703-705.

9. Paydas S, Sahin B, Zorludemir S. Sweet’s syndrome accompanying leukaemia: seven cases and review of the literature. Leuk Res 2000;24:83-86.

415

DOI: 10.4274/Tjh-2013.0156

Letter to the Editor

Lymphoma Associated with Sjögren’s Syndrome Sjögren Sendromu ile İlişkili Lenfoma Tuğba Aktan Köşker1, Şükran Erten2, Esra Erden3 1Atatürk

Education and Research Hospital, Internal Medicine, Ankara, Turkey

2Atatürk

Education and Research Hospital, Department of Rheumatology, Ankara, Turkey

3Ankara

University Medical Faculty, Department of Pathology, Ankara, Turkey

To the Editor, A 50-year-old woman visited the outpatient rheumatology department presenting with heel spurs and radiating pain in the legs and the right hip. She had sicca symptoms and morning stiffness lasting for 15 min.

Her physical examination was normal other than positive FABERE test of the right hip. Routine biochemical tests and complete blood count were normal. Serological tests were positive for anti-nuclear antibodies (+2) with a speckled pattern, and positive for both anti-SS-A/Ro and anti-SS-B/ La antibodies. The erythrocyte sedimentation rate and C-reactive protein level were normal. The rheumatoid factor was 17.4 IU/mL (reference range: 0-14 IU/mL).

of atypical round cells with pleomorphic vesicular nuclei undergoing frequent mitosis and eosinophilic cytoplasm (Figure 1). Immunohistochemically, neoplastic cells were positive for CD20, and the Ki-67 proliferation index was around 70%.

She received 3 cycles of rituximab plus cyclophosphamide, epirubicin, vincristine, and prednisolone. Because of cardiotoxicity, she received 5 cycles of rituximab, cyclophosphamide, and Oncovin.

After 2 months, her symptoms were resolved and her CT scan revealed a remarkable decrease in the generalized swelling of the lymph nodes. Five months later, a PET scan showed no findings consistent with recurrence or

The sacroiliac magnetic resonance findings were compatible with trochanteric bursitis. The results of Schirmer’s test were <5 mm for both eyes and a minor salivary gland biopsy showed focal periductal lymphoid aggregate. With these findings, the present case apparently met the criteria for the diagnosis of Sjögren’s Syndrome (SS) [1]. The patient was treated with hydroxychloroquine and artificial tear drops.

Eighteen months later, the patient was admitted with painless swelling of the parotid glands. There was generalized peripheral lymphadenopathy in the neck, axillary, and inguinal regions.

Excisional biopsies were obtained from the right inguinal lymph node, which revealed a high-grade, B-cell nonHodgkin lymphoma (NHL). The tumor tissue was composed

Address for Correspondence: Tuğba AKTAN KÖŞKER, M.D., Atatürk Education and Research Hospital, Internal Medicine, Ankara, Turkey GSM: +90 541 385 40 74 E-mail: tubaaktan@hotmail.com Received/Geliş tarihi : May 2, 2013 Accepted/Kabul tarihi : June 20, 2013

416

Figure 1: a) Tumor tissue deforming the structure, of lymph nodes and infiltrating extranodal structures b) Tumor cells with large pleomorphic nucleus, apparent nucleolus, and frequent mitosis.

Köşker AT, et al: Lymphoma Associated with Sjögren’s Syndrome

involvement of the primary malignancy, and these findings were consistent with remission.

SS is a common autoimmune disorder characterized by the degeneration of exocrine glands, clinically presenting as eye and mouth dryness [2]. Patients with SS have high levels of immunoglobulin, anti-Ro/SSA, and anti-La/SSB. SS is seen in all age groups, but it is more common in the fourth and fifth decades of life [3]. We report a case of NHL associated with SS presenting with enlargement of the parotid gland and generalized peripheral lymphadenopathy.

The incidence of NHL in patients with SS has been reported as 5%. The risk of NHL development in patients with SS is approximately 40-44 times greater than that in the general population [2]. Lymphomas that appear during the course of SS are usually localized extranodal low-grade B-cell NHL and the major histopathological type is mucosaassociated lymphoid tissue lymphoma [4].

The clinical and laboratory signs of lymphoma are based on etiology. The reported extranodal sites are mostly the salivary glands, followed by the stomach, nasopharynx, skin, lung, lachrymal gland, liver, and bones. In this disease, although rare, central nervous system involvement can also be seen [5].

In conclusion, we encountered a rare case of SS complicated with NHL. We recommend that patients with SS be carefully evaluated for occult malignancy and in particular for NHL. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2013;30:416-417

Key Words: Sjögren’s syndrome, non-Hodgkin lymphoma, malignancy References 1. Vitali C, Bombardieri S, Jonsson R, Moutsopoulos HM, Alexander EL, Carsons SE, Daniels TE, Fox PC, Fox RI, Kassan SS, Pillemer SR, Talal N, Weisman MH; European Study Group on Classification Criteria for Sjögren’s Syndrome. Classification criteria for Sjögren’s syndrome: a revised version of the European criteria proposed by the American-European Consensus Group. Ann Rheum Dis 2002;61:554-558.

2. Watanabe Y, Koyama S, Miwa C, Okuda S, Kanai Y, Tetsuka K, Nokubi M, Dobashi Y, Kawabata Y, Kanda Y, Endo S. Pulmonary mucosa-associated lymphoid tissue lymphoma in Sjögren’s syndrome showing only the LIP pattern radiologically. Intern Med 2012;51:491-495.

3. Soldevilla HF, Molina RM, Navarra SV. Breast lymphoma in Sjögren’s syndrome complicated by acute monocular blindness. Int J Rheum Dis 2010;13:164-170.

4. Anaya JM, McGuff HS, Banks PM, Talal N. Clinicopathological factors relating malignant lymphoma with Sjögren’s syndrome. Semin Arthritis Rheum 1996;25:337-346.

5. Kinikli G, Erten S, Tanju S, Savas A, Kaygusuz G. Central nervous system lymphoma in a patient with Sjogren’s syndrome and autoimmune thyroiditis (Hashimoto’s thyroiditis). Clin Rheumatol 2007;26:1377-1379.

417

DOI: 10.4274/Tjh-2013.0226

Letter to the Editor

Hepatitis B Vaccine-Associated Atypical Hemolytic Uremic Syndrome Hepatit B Aşısı ile İlişkili Atipik Hemolitik Üremik Sendrom Zekai Avcı1, Cengiz Bayram2, Barış Malbora3 1Ankara 2

Children’s Hematology and Oncology Research Hospital, Department of Hematology, Ankara, Turkey

Ankara Pediatric and Pediatric Hematology Oncology Training and Research Hospital, Department of Pediatric Hematology, Ankara, Turkey

3Dr.

Sami Ulus Research and Training Hospital of Women’s and Children’s Health and Diseases, Ankara, Turkey

To the Editor, Hemolytic uremic syndrome (HUS) is one of the common causes of acute renal failure in children and is characterized by microangiopathic hemolytic anemia and thrombocytopenia.

About 5% to 10% of all HUS cases in children are nondiarrheal HUS (atypical HUS) [1,2]. Many triggering causes of atypical HUS, such as non-enteric infections, viruses, drugs, systemic diseases, glomerulopathies, malignancies, transplantations, and pregnancy, have been identified [1,2,3,4]. Here we report a patient who developed atypical HUS after a hepatitis B vaccination.

A 55-day-old female infant was admitted to our hospital with sudden onset of jaundice and pallor 1 day after the second dose of recombinant hepatitis B vaccine injection (containing 10 µg HBsAg/0.5 mL and 0.475 mg aluminum hydroxide/0.5 mL). There was no history of fever, diarrhea, or cough. The first dose of hepatitis B vaccine was administered at birth. She had no health problems in the neonatal period and was solely breastfed. The family history was non-contributory.

On physical examination, the patient was in poor general condition and hypoactive with pale and icteric skin. Body temperature was 37 °C, pulse rate was 140/min, respiratory rate was 48/min, and blood pressure was 70/40 mmHg. There was no hepatosplenomegaly. Laboratory examination revealed a hemoglobin level of 51 g/L, leukocyte count of

10x109/L, platelet count of 28x109/L, and reticulocyte level of 3.9%. Anisocytosis, poikilocytosis, polychromasia, helmet cells, marked schistocytes, and rare platelets were observed in the peripheral blood smear, compatible with microangiopathic hemolytic anemia and thrombocytopenia.

Direct and indirect Coombs test results were negative.

Biochemical analyses were as follows: urea 88 mg/dL (normal range: 5-18), creatinine 1.1 mg/dL (normal: 0.20.4), total bilirubin 13.7 mg/dL (normal: <1.2), direct bilirubin 2.6 mg/dL (normal: <0.2), uric acid 8.1 mg/ dL (normal: 2.4-6.4), aspartate aminotransferase 96 U/L (normal: 15-55), lactic dehydrogenase 4641 U/mL (normal: 170-580), and the other serum biochemical tests within normal limits. Urine microscopy showed numerous red blood cells. Microscopic examination of stool was normal and occult blood test results were negative. Her stool culture and urine culture were also negative. Serum complement component 3 (C3) and C4 levels were 76.5 mg/dL (normal: 79-752) and 5.89 mg/dL (normal: 16-38), respectively.

Prothrombin time, activated partial thromboplastin time, and fibrinogen level were within the normal ranges. Renal ultrasound showed increased echogenicity in both kidneys.

As the patient had acute renal failure, thrombocytopenia, and microangiopathic hemolytic anemia, she was diagnosed with HUS. After transfusion of red blood cells, intravenous fluid therapy was initiated and intravenous furosemide was administered. Fresh frozen plasma infusion was also started.

Address for Correspondence: Barış MALBORA, M.D., Dr. Sami Ulus Research and Training Hospital of Women’s and Children’s Health and Diseases, Ankara, Turkey Phone: +90 312 305 60 00 E-mail: barismalbora@gmail.com Received/Geliş tarihi : July 2, 2013 Accepted/Kabul tarihi : July 19, 2013

418

Avcı Z: Hepatitis B Vaccine-Associated Atypical Hemolytic Uremic Syndrome

Turk J Hematol 2013;30:418-419

On the third day of hospitalization, she had a seizure that was ended with a single dose of midazolam and did not recur again. Hemolysis and thrombocytopenia continued until day 8 of hospitalization and the patient required red blood cell transfusions 5 times during this period. Urea and creatinine levels progressively rose to 119 mg/dL and 2.2 mg/dL, respectively. She had no oliguria. Hypertension was treated with nifedipine and enalapril. On day 9 of hospitalization, renal function, thrombocytopenia, and hemolysis began to improve, and plasma therapy was discontinued within the following 2 days. She no longer needed dialysis. The patient was discharged in good general condition on day 16 of hospitalization with improved complete blood count, biochemical tests, and complement levels. Factor H and factor I levels were normal when measured 3 months after hospital discharge. At 6 months of age, the patient’s hepatitis B antibody titer was at the protective level, and thus the third dose of hepatitis B vaccine was not administered. The patient completed the immunization schedule except for the third dose of hepatitis B without further problems. She is currently 38 months old and has no problems.

the second case of atypical HUS associated with hepatitis B vaccination. In contrast to the first reported case, we did not observe a relapse with other vaccinations.

Differentiation of HUS into typical HUS and atypical HUS may become confusing according to prodromal symptoms.

Because infants below 6 months of age are generally breastfed (pre-weaning period), exposure to Escherichia coli O157:H7 is less likely in this age group and, therefore, other causes of HUS should be considered in patients under 6 months of age [4]. Our patient was a 55-day-old infant with no history of bloody diarrhea or other infection. Her stool and urine cultures were negative for Escherichia coli and Shigella. Her clinical presentation was consistent with the diagnosis of atypical HUS.

1. Amirlak I, Amirlak B. Haemolytic uraemic syndrome: an overview. Nephrology (Carlton) 2006;11:213-218.

Our patient had clinical and laboratory findings of atypical HUS approximately 1 day after hepatitis B vaccine injection, and thus we suggest that the hepatitis B vaccine may play a triggering role for the onset of atypical HUS. Geerdink et al. [5] first reported a patient who developed atypical HUS a few days after a hepatitis B vaccination in their cohort study and they observed a relapse shortly after combined anti-diphtheria–pertussis–tetanus–polio vaccination in the same patient. To our knowledge, ours is

The triggering role of vaccination in the onset or relapse of atypical HUS has not been defined yet. We suggest that, compatible with the other adverse effects of vaccination, the immune-mediated activation of the complementary system triggers atypical HUS development. Therefore, recent history of vaccination should be examined, especially in patients without any other triggering conditions. Further reports are needed to confirm this hypothesis.

Key Words: Hemolytic uremic syndrome, Hepatitis B vaccine, Children Authors’ Contributions All authors planned and performed the experiments and wrote the manuscript.

Conflict of Interest Disclosure There is no potential conflict of interest to disclose.

References

2. Scheiring J, Rosales A, Zimmerhackl LB. Clinical practice.

Today’s understanding of the haemolytic uraemic syndrome.

Eur J Pediatr 2010;169:7-13 3. Westra D, Wetzels JF, Volokhina EB, van den Heuvel LP, van de Kar NC. A new era in the diagnosis and treatment of atypical haemolytic uraemic syndrome. Neth J Med 2012;70:121-129.

4. Ariceta G, Besbas N, Johnson S, Karpman D, Landau D, Licht C, Loirat C, Pecoraro C, Taylor CM, Van de Kar N, Vandewalle J, Zimmerhackl LB; European Paediatric Study Group for HUS. Guideline for the investigation and initial therapy of diarrhea-negative hemolytic uremic syndrome.

Pediatr Nephrol 2009;24:687-696.

5. Geerdink LM, Westra D, van Wijk JA, Dorresteijn EM, Lilien MR, Davin JC, Kömhoff M, Van Hoeck K, van der Vlugt A, van den Heuvel LP, van de Kar NC. Atypical hemolytic uremic syndrome in children: complement mutations and clinical characteristics. 2012;27:1283-1291.

419

DOI: 10.4274/Tjh.2012.0163

Letter to Editor

Peripheral Neuropathy in Sézary Syndrome: Coincidence or a Part of the Syndrome?

Sézary Sendromunda Periferal Nöropati: Tesadüf mü Yoksa Sendromun Bir Parçası mı?

Yeşim S. Karadağ1, Aydın Gülünay1, Neşe Öztekin1, Fikri Ak1, Saadettin Kılıçkap2 1Ankara

Numune Research and Training Hospital, Department of Neurology, Ankara, Turkey

2Hacettepe

Cancer Institute, Department of Preventive Oncology, Ankara, Turkey

To the Editor, A 48-year-old male patient was admitted with the complaints of diffuse skin dryness, fatigue, and numbness of the hands. He reported cramps and fasciculation occurring at nights and weakness of the arms. His physical examination (AG) revealed a diffuse dryness with widespread squames on the scalp, trunk, arms, and thighs (Figure 1). Neurological examination revealed hypoactive deep tendon reflexes in both lower extremities and hypoesthesia of gloves-socks type. His white blood cell count was 43,600/mm3, 50%-55% of which comprised eosinophils. Flow cytometry revealed a Sézary cell count of 3200/µL, a CD4/CD8 ratio greater than 22.5, and less than 7% T-cells that expressed CD7.

The same clonal amplification was demonstrated by T-cell receptor gene analysis of skin, blood, and lymph nodes.

Computerized tomography showed axillary and inguinal lymphadenopathies. The patient was at stage IIA. Biopsies from skin lesions and lymph nodes were performed. Immunohistochemical examination was consistent with SS, showing diffuse CD4 staining. Diagnosis of motor axonal neuropathy was based on the decrease of compound muscle action potential amplitudes of right median, peroneal, and bilateral posterior tibial nerves in a nerve conduction study. Other etiologies for motor axonal neuropathy such as diabetes mellitus were excluded. PUVA therapy was used for his skin lesions. Photopheresis was performed once a month.

After the therapy, his neuropathy improved.

Address for Correspondence: Saadettin KILIÇKAP M.D., Hacettepe Cancer Institute, Department of Preventive Oncology, Ankara, Turkey Phone: +90 312 306 26 62 E-mail: skilickap@yahoo.com Received/Geliş tarihi Accepted/Kabul tarihi

420

: May 8, 2013 : June 10, 2013

Discussion Polyneuropathy in patients with cancer may be related to chemotherapy and is rarely due to direct invasion of the nerve [6,7]. Neuronal antigens expressed by the tumor stimulate an immune response characterized by T cells, antibodies, or both, which attack not only the tumor but also the neural tissue [8]. Although these scenarios could be expected in lymphomas, nervous system involvement is not commonly reported in reviews of SS [1,2].

The co-occurrence of SS and peripheral neuropathy was first reported in 1978 by Bargman and Coupe [5].

Another case of SS with neurolymphomatosis was reported

by Bezier et al. [3]. In that case, muscle and nerve biopsy specimens showed neurogenic muscle atrophy and an axonal neuropathy secondary to an epineurial and endoneurial infiltration by Sézary cells [3]. Although extracutaneous spread is not uncommon in advanced stages of SS, neurological complications are rare and result from leptomeningeal or central nervous system involvement.

Our patient had axonal peripheral neuropathy without central nervous system involvement. Neuropathic symptoms started prior to his medications, which reassured us that the responsible etiology may have been his primary disease. The neuropathic symptoms of the patient appeared at the time of diagnosis and improved after treatment. These findings support the idea that the neuropathy associates with SS and may be a consequence of paraneoplastic syndrome.

Karadağ YS, et al: Peripheral Neuropathy in Sézary Syndrome

Turk J Hematol 2013;30:420-421

References 1. Hwang ST, Janik JE, Jaffe ES, Wilson WH. Mycosis fungoides and Sézary syndrome. Lancet 2008;371:945-957.

2. Kubica AW, Davis MD, Weaver AL, Killian JM, Pittelkow MR. Sézary syndrome: a study of 176 patients at Mayo Clinic. J Am Acad Dermatol 2012;67:1189-1199.

3. Bezier M, Reguiaï Z, Delaby P, Laroche L, Saïd G, Bernard P, Grange F. Neurolymphomatosis associated with Sézary syndrome. Arch Dermatol 2009;145:294-296.

Figure 1: Widespread squames on the scalp and trunk (A and B), and a diffuse dryness with widespread squames on the arms and thighs (C and D).

This case emphasizes the importance of keeping polyneuropathy in mind while dealing with patients with SS, although it is difficult to treat, and suggests the possible role of neurotropism of malignant cells.

Key Words: Sézary syndrome, Mycosis fungoides, Axonal neuropathy Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

4. Atiq OT, DeAngelis LM, Rosenblum M, Portlock CS. Cutaneous T-cell lymphoma presenting with diffuse lymphomatous infiltration of the peripheral nerves: response to combination chemotherapy. Am J Clin Oncol 1992;15:212-215.

5. Bargman H, Coupe RL. Sézary’s syndrome: report of a case showing peripheral neuropathy and bone marrow fibrosis.

Arch Dermatol 1978;114:1360-1362.

6. England JD, Asbury AK. Peripheral neuropathy. Lancet 2004;363:2151-2161.

7. Viala K, Béhin A, Maisonobe T, Léger JM, Stojkovic T, Davi F, Leblond V, Bouche P. Neuropathy in lymphoma: a relationship between the pattern of neuropathy, type of lymphoma and prognosis? J Neurol Neurosurg Psychiatry 2008;79:778-782.

8. Rudnicki, SA, Dalmau J. Paraneoplastic syndromes of the peripheral nerves. Curr Opin Neurol 2005;18:598-603.

421

DOI: 10.4274/TJH.2013.0030

Letter to the Editor

Rituximab and Fludarabine or Cyclophosphamide Combination Treatment for Older Waldenström Macroglobulinemia Patients İleri Yaştaki Waldenström Makroglobulinemi Hastalarında Rituksimab’ın Fludarabin veya Siklofosfamid ile Kombinasyon Tedavisi XiaoWei Xu, Chun Wang, YaMin Wang, LiLi Zhou, HaiTao Bai Department of Hematology, Shanghai First People’s Hospital, Shanghai, Jiao Tong University, Shanghai, China

Waldenström macroglobulinemia (WM) is a rare and incurable B cell malignancy. Most WM cells express CD20, which enables the use of anti-CD20 monoclonal antibody rituximab-based strategies. Rituximab has been evaluated in WM for about 10 years as a single agent with major response rates of 30% to 40%, whereas the combination of rituximab with chemotherapy has resulted in response rates of 70% to 90% [1,2,3].

However, the extent to which achievement of complete response (CR) confers clinical benefit is still debatable.

As such, we administered rituximab (375 mg/m2, day 0) combined with fludarabine (40 mg, days 1-3) or cyclophosphamide (200 mg, days 1-2) in WM patients naive to rituximab and report herein the toxicities and effects of these combinations. A total of 4 elderly patients (ages older than 80) were identified with WM diagnoses from 2007 to 2012 in our department.

According to recommendations for assessing response from the Third International Workshop on WM, 2 of 4 (50%) patients achieved complete response, 2 (50%) had major or minor response, and the overall response rate was 100% at the end of the treatment [4].

The individual changes in serum IgM, IgM paraprotein, and hemoglobin levels for all patients are shown in Figure 1.

Hematologic toxicity was one of the major side effects of this regimen. Neutropenia and thrombocytopenia were found in 2 patients at the end of the treatment. Pulmonary infection was observed in one patient.

With a median follow-up of 27 months, all 4 patients died. Two patients with sustainable CR died of pulmonary infection or heart failure, respectively, after follow-up for 11 and 36 months. One patient who achieved a major response duration of 34 months died of duodenal squamous adenocarcinoma. The last patient with minor response had progression of disease in 2 months and died of WM after 10 months of follow-up.

Gruson et al. assigned a rituximab and fludarabine combination in a treatment cycle that was repeated every month for 6 months. Five patients aged 52-85 years with

Figure 1: Individual changes in A) IgM, B) IgM paraprotein, and C) HB serum levels.

Address for Correspondence: Chun WANG, M.D., Department of Hematology, Shanghai First People’s Hospital, Shanghai, Jiao Tong University, Shanghai, China Phdne : +00-86-21-63240090-3101 E-mail: xuxiaowei1616@126.com Received/Geliş tarihi : March 1, 2013 Accepted/Kabul tarihi : January 28, 2013

422

Xu WX, et al: Rituximab and Fludarabine or Cyclophosphamide Combination Treatment for Older Waldenström Macroglobulinemia Patients

IgM achieved overall and complete response at 80% and 40%, respectively [5]. Several analyses have identified age as a major adverse factor [6]. Our results showed that 2 patients with sustainable CR were older than 80 years old and had high-risk International Prognostic Scoring System for WM scores. Therefore, with this combination regimen, age is no longer a major risk factor.

In a study by Dimopoulos et al., which combined rituximab and fludarabine or cyclophosphamide in 11 patients with WM, combination treatment was used monthly for 4 cycles. The partial response rate was only 55% and no patients achieved complete response [7]. The 4-cycle combination therapy was thus not enough for WM patients and 5-6 cycles were necessary.

In conclusion, rituximab in association with fludarabine or cyclophosphamide is well tolerated and effective for elderly WM patients.

Key Words: Monoclonal IgM protein, rituximab, Waldenström macroglobulinaemia Conflict of Interest Statement The authors have declared no conflicts of interest.

References 1. Dimopoulos MA, Panayiotidis P, Moulopoulos LA, Sfikakis P, Dalakas M. Waldenström’s macroglobulinemia: clinical features, complications, and management. J Clin Oncol 2000;18:214-216.

2. Treon SP, Gertz MA, Dimopoulos M, Anagnostopoulos A, Blade J, Branagan AR, Garcia-Sanz R, Johnson S, Kimby E, Leblond V, Fermand JP, Maloney DG, Merlini G, Morel P, Morra E, Nichols G, Ocio EM, Owen R, Stone MJ. Update on treatment recommendations from the Third International Workshop on Waldenström’s macroglobulinemia. Blood 2006;107:3442-3446.

Turk J Hematol 2013;30:422-423

3. Dimopoulos MA, Zervas C, Zomas A, Kiamouris C, Viniou NA, Grigoraki V, Karkantaris C, Mitsouli C, Gika D, Christakis J, Anagnostopoulos N. Treatment of Waldenström’s macroglobulinemia with rituximab. J Clin Oncol 2002;20:2327-2333.

4. Kimby E, Treon SP, Anagnostopoulos A, Dimopoulos M, Garcia-Sanz R, Gertz MA, Johnson S, LeBlond V, Fermand JP, Maloney DG, Merlini G, Morel P, Morra E, Nichols G, Ocio EM, Owen R, Stone M, Bladé J. Update on recommendations for assessing response from the Third International Workshop on Waldenström’s macroglobulinemia. Clin Lymphoma Myeloma 2006;6:380-383.

5. Morel P, Duhamel A, Gobbi P, Dimopoulos MA, Dhodapkar MV, McCoy J, Crowley J, Ocio EM, Garcia-Sanz R, Treon SP, Leblond V, Kyle RA, Barlogie B, Merlini G. International prognostic scoring system for Waldenstrom macroglobulinemia. Blood. 2009,113:4163-4170.

6. Gruson B, Ghomari K, Beaumont M, Garidi R, Just A, Merle P, Merlusca L, Marolleau JP, Royer B. Long-term response to rituximab and fludarabine combination in IgM anti-myelinassociated glycoprotein neuropathy. J Peripher Nerv Syst 2011;16:180-185.

7. Dimopoulos MA, Hamilos G, Efstathiou E, Siapkaras I, Matsouka C, Gika D, Grigoraki V, Papadimitriou C, Mitsibounas D, Anagnostopoulos N. Treatment of Waldenström’s macroglobulinemia with the combination of fludarabine and cyclophosphamide. Leuk Lymphoma 2003;44:993-996.

423

DOI: 10.4274/Tjh.2013.0154

Letter to the Editor

Carbamazepine and Hematological Malignancies Karbamazepin ve Hematolojik Maligniteler İrfan Yavaşoğlu1, Gökhan Sargın2, Aslı Demirbulat2 1Adnan 2Adnan

Menderes University Medical Faculty, Division of Hematology, Aydın, Turkey Menderes University Medical Faculty, Department of Internal Medicine, Aydın, Turkey

To the Editor, The letter entitled “Carbamazepine and Multiple Myeloma: Possible Interaction”, written by Günaldı et al. [1] and published in one of the recent issues of your journal, was quite interesting. We would like to emphasize some points about that letter.

In the reported case, the patient’s serum globulin level was 5.44 g/dL, and serum protein electrophoresis (Figure 1 of the cited letter) showed that the M-peak was closest to the beta-fraction. Thus, it becomes important to know the level of light chains and IgA as heavy chains. The serum protein electrophoresis should also be evaluated for biclonal gammopathy due to its pattern shown in Figure 1.

Interleukin-6 (IL-6) is the main growth factor for multiple myeloma (MM) and studies of epileptic patients showed elevated levels of IL-6 after carbamazepine therapy [2].

We have no information about the level of IL-6 in the case reported by Günaldı et al.

The specific abnormalities such as t(4;14), t(14;16), and deletion (del) 17p detected by fluorescence in situ hybridization (FISH) analysis were reported as high-risk MM [3]. Tricot et al. [4] reported that partial or complete deletions of chromosome 13 were associated with poor prognosis in MM. Chromosome 13 deletions detected only

by FISH independently in the absence of other abnormalities do not carry significantly higher risk, whereas t(11;14) does not predict superior outcome [5]. It is interesting to see cytogenetic abnormalities del17p-t(4;14)-del13 and t(11;14) in same patient. However, the consensus is that the data are not yet adequate to suggest routine use of these FISH markers to predict prognosis [5].

Address for Correspondence: Gökhan SARGIN, M.D., Adnan Menderes University Medical Faculty, Department of Internal Medicine, Aydın, Turke GSM: +90 553 424 10 97 E-mail: gokhan_sargin@hotmail.com Received/Geliş tarihi : May 1, 2013 Accepted/Kabul tarihi : June 10, 2013

424

The number of people who had suffered from side effects due to carbamazepine was reported as 14,705. Ten of them (0.07%) had MM [6]. Drug-related (although rarely from carbamazepine) hypogammaglobulinemia is a well-known condition. 9-Acridine carboxaldehyde is one of the carbamazepine metabolites generating activated neutrophils, and presumably monocytes. This metabolite increases lymphocyte proliferations at lower concentrations and decreases them at higher concentrations. The relationship between hypogammaglobulinemia and carbamazepine is thus clearer [7]. There have also been reports of agranulocytosis, leucopenia, pure erythrocyte aplasia, and thrombocytopenia after carbamazepine [8]. Additionally, phenytoin is considered a possible carcinogenic for humans and was reported as a carcinogenic drug in animals [9].

A diagnosis of epilepsy in the same year as a cancer diagnosis carried an increased risk for leukemia, pancreatic cancer, non-Hodgkin’s lymphoma, acute myeloid leukemia, and Hodgkin’s disease, but not for chronic lymphatic leukemia or MM. The issue of cancer incidence in people with epilepsy remains an open question [9,10]. In conclusion, the answer is still unknown as to whether the drugs for epilepsy or epilepsy itself causes MM. Key Words: Carbamazepine, Hematological malignancies, Multiple myeloma References 1. Günaldı M, Paydaş S, Afşar ÇU, Duman BB, Erçolak V, Haksöyler V. Carbamazepine and multiple myeloma: possible interaction. Turk J Hematol 2013;30:83-84.

Yavaşoğlu İ; Carbamazepine and Hematological Malignancies

2. Verrotti A, Basciani F, Trotta D, Greco R, Morgese G, Chiarelli F. Effect of anticonvulsant drugs on interleukins-1, -2 and -6 and monocyte chemoattractant protein-1. Clin Exp Med 2001;1:133-136.

3. Avet-Loiseau H. Role of genetics in prognostication in myeloma. Best Pract Res Clin Haematol 2007;20:625-635.

4. Tricot G, Barlogie B, Jagannath S, Bracy D, Mattox S, Vesole DH, Naucke S, Sawyer JR. Poor prognosis in multiple myeloma is associated only with partial or complete deletions of chromosome 13 or abnormalities involving 11q and not with other karyotype abnormalities. Blood 1995;86:4250-4256.

5. Munshi NC, Anderson KC, Bergsagel PL, Shaughnessy J, Palumbo A, Durie B, Fonseca R, Stewart AK, Harousseau JL, Dimopoulos M, Jagannath S, Hajek R, Sezer O, Kyle R, Sonneveld P, Cavo M, Rajkumar SV, San Miguel J, Crowley J, Avet-Loiseau H; International Myeloma Workshop Consensus Panel 2. Consensus recommendations for risk stratification in multiple myeloma: report of the International Myeloma Workshop Consensus Panel 2.

Blood 2011;117:4696-4700.

Turk J Hematol 2013;30:4324-425

6. eHealthMe.com. From FDA Reports: Carbamazepine and Myeloma – Multiple. © 2013. Available at http://www. ehealthme.com/ds/carbamazepine/myeloma+-+multiple.

7. Furst SM, Uetrecht JP. The effect of carbamazepine and its reactive metabolite, 9-acridine carboxaldehyde, on immune cell function in vitro. Int J Immunopharmacol 1995;17:445452.

8. Flanagan RJ, Dunk L. Haematological toxicity of drugs used in psychiatry. Hum Psychopharmacol 2008;23:27-41.

9. Singh G, Driever PH, Sander JW. Cancer risk in people with epilepsy: the role of antiepileptic drugs. Brain 2005;128:717.

10.

Adelow C, Ahlbom A, Feychting M, Johnsson F, Schwartzbaum J, Tomson T. Epilepsy as a risk factor for cancer. J Neurol Neurosurg Psychiatry 2006;77:784-786.

425

DOI: 10.4274/Tjh.2013.0022

Letter to the Editor

H1N1 Infection-Related Hemophagocytic Lymphohistiocytosis in a Child H1N1 Enfeksiyonu ile İlişkili Hemofagositik Lenfohistiositoz Saptanan Bir Çocuk Hasta Fatih Demircioğlu1, Elif Kazancı2, Dildar Bahar Genç2, Hakan Erdoğan2, Sevil Bilir Göksügür1, Mervan Bekdaş1 1Medical

Faculty, Abant İzzet Baysal University, Department of Pediatrics, Bolu, Turkey Children’s Hospital, Department of Pediatrics, Bursa, Turkey

2Dörtçelik

To the editor, Hemophagocytic lymphohistiocytosis (HLH) is a clinical condition characterized by macrophage and activated histiocyte proliferation, leading to uncontrolled phagocytosis of hematopoietic precursor cells. The clinical presentation is characterized by fever, pancytopenia, hepatosplenomegaly, and hemophagocytosis in the reticuloendothelial system. In addition to the primary form of the disorder, secondary HLH has been associated with a variety of infections, malignancy, and autoimmune disease [1]. Virus-associated HLH is a well-recognized clinical condition. Most cases are related to Epstein-Barr virus (EBV), cytomegalovirus (CMV), human herpes virus 6, and human herpes virus 8 infections [2].

H1N1 influenza-associated HLH has been reported in children extremely rarely [3,4]. We present here a successfully treated case of severe H1N1 influenza-related HLH. A 4-year-old boy was admitted to our hospital with a 5-day history of fever, malaise, myalgia, cough, respiratory distress, oliguria, and diffuse petechial eruption. On physical examination he was found febrile, pale, and dehydrated. His vital signs included a temperature of 38.7 °C, heart rate of 154 beats per minute, respiratory rate of 42 breaths per minute, blood pressure of 79/56 mmHg, and capillary refill time of >2 s. He had 6-cm hepatomegaly and 9-cm splenomegaly below the costal margin. The rest of the physical examination was normal.

Address for Correspondence: Fatih DEMİRCİOĞLU, M.D., Medical Faculty, Abant İzzet Baysal University, Department of Pediatrics, Bolu, Turkey E-mail: fatih_demircioglu@yahoo.com Received/Geliş tarihi : January 23, 2013 Accepted/Kabul tarihi : February 4, 2013

426

Laboratory examination demonstrated hemoglobin of 9.2 g/dL, white blood cell count of 3000/mm3 (24% neutrophils, 62% lymphocytes, and 14% monocytes), and platelet count of 56,000/mm3. In the peripheral smear investigation, toxic granulation was observed. Biochemical evaluation revealed that blood urea nitrogen was 118 mg/dL, creatinine 1.6 mg/ dL, sodium 124 mmol/L, potassium 2.92 mmol/L, C-reactive protein 18.5 mg/dL (N: 0.0-1.0 mg/dL), fibrinogen 120 mg/dL, and ferritin 875 ng/mL. Serum triglycerides were increased to 268 mg/dL but cholesterol levels were in the normal range. The serum aspartate aminotransferase, alanine aminotransferase, and lactate dehydrogenase levels were elevated at 208, 72, and 893 U/L, respectively. Serologic markers for EBV; CMV; parvovirus B19; toxoplasmosis; hepatitis A, B, and C viruses; human immunodeficiency virus, salmonella; and Brucella agglutinins were all negative.

Results of the urine analysis were in the normal range. Chest radiograph demonstrated infiltrates in both lung fields and bilateral pleural effusions.

Intravenous fluid replacement and meropenem and dopamine infusion were started. On the second day of hospital admission, H1N1 influenza was identified from nasopharyngeal swabs by specific PCR, and then oseltamivir (6 mg/kg in 2 daily doses, per os) was added to the treatment. HLH was suspected because of the patient’s persistent fever, severe pancytopenia, hyperferritinemia, hypertriglyceridemia, hepatosplenomegaly, and

Turk J Hematol 2013;30:426-428

DemircioÄ&#x;lu F, et al: H1N1 Infection-Related Hemophagocytic Lymphohistiocytosis in a Child

Figure 1: Bone marrow smear shows histiocytes with hemophagocytosis (A and B). hypofibrinogenemia. A bone marrow aspiration was performed and the results revealed typical hemophagocytosis (Figure 1). Therefore, intravenous immunoglobulin (IVIG) was added to the treatment due to the diagnosis of H1N1associated HLH. Renal functions returned to normal on the second day of treatment. The patientâ&#x20AC;&#x2122;s respiratory function gradually recovered on day 4. On the third day of oseltamivir and meropenem therapy, the patient became afebrile, and oseltamivir and meropenem therapies were stopped after 5 days and 10 days of treatment, respectively.

On the 10th day of admission, physical examination and laboratory evaluation were found normal. He was discharged on day 14. In the first year of follow-up, hematologic and biochemical values were normal, except for moderate splenomegaly and hyperferritinemia (ferritin level was 725 ng/mL). Immunodeficiency, infection, malignancy, and other splenomegaly-related conditions were excluded. Informed consent was obtained.

Discussion The H1N1 virus was first observed in March 2009 in Mexico and then spread rapidly throughout the world. Cases of H1N1 have generally been mild, with patients recovering fully within 1 week [5]. Hematological manifestation of H1N1 has commonly been observed with leucopenia, neutropenia, and idiopathic thrombocytopenic purpura.

Rarely, HLH has been observed [6].

HLH represents a severe hyperinflammatory condition with the major symptoms of prolonged fever, peripheral cytopenia affecting at least 2 lineages, hepatosplenomegaly, hypertriglyceridemia and/or hypofibrinogenemia, hyperferritinemia, decreased or absent natural killer cell activity, and high soluble interleukin 2 receptor serum levels and hemophagocytosis by activated macrophages.

Five of these 8 criteria should be fulfilled to confirm diagnosis [1,2]. Our patient had prolonged fever, pancytopenia, hepatosplenomegaly, hyperferritinemia, hypofibrinogenemia, and hemophagocytosis at bone marrow aspiration and was diagnosed with HLH according to the criteria of HLH 2004 [1,2].

Our patient had prolonged fever, fatigue, myalgia, pneumonia, and prerenal insufficiency and diagnosed H1N1 influenza. The first reported case of H1N1 influenza virus-related HLH was in a 17-year-old female patient who completely recovered with steroid and oseltamivir treatment [3]. Following this case report, 23 more patients were reported of various ages between 2 months and 61 years old. In most of the cases, pancytopenia, hepatosplenomegaly, hyperferritinemia, hypofibrinogenemia, and hemophagocytosis at bone marrow aspiration were detected [3,4,7,8,9,10,11,12]. Oseltamivir and systemic steroid was the most commonly preferred treatment option. We diagnosed our patient with H1N1 virus-associated HLH. Besides oseltamivir, we also add IVIG to the treatment.

On the third day of oseltamivir and second day of IVIG therapy, the patient became afebrile; oseltamivir therapy was stopped after 5 days of treatment.

HLH has high mortality rates if early diagnosis and treatment are delayed. In previously reported cases, only 5 out of 23 patients survived. In our case, treatment was started at the second day of hospitalization and a good response was achieved. In the first year of follow-up, hematologic and biochemical values remained normal, except for moderate splenomegaly and hyperferritinemia. To et al. reported prolonged viral load clearance and cytokine activation in H1N1 swine influenza virus infection [13]. We did not detect any obvious cause of splenomegaly in our patient.

The splenomegaly and hyperferritinemia in our case may therefore be associated with prolonged inflammatory process and decreased viral load clearance. We report a very rare case of H1N1-related HLH in childhood, which was diagnosed early and successfully treated. If it is diagnosed late, H1N1associated HLH has very high mortality rates, but early diagnosis and treatment have favorable outcomes. It may also cause prolonged viral load clearance and cytokine response.

Key Words: Children, Hemophagocytic lymphohistiocytosis, Swine-origin influenza Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Janka GE. Familial and acquired hemophagocytic lymphohistiocytosis. Annu Rev Med 2012;63:233-246.

2. Rouphael NG, Talati NJ, Vaughan C, Cunningham K, Moreira R, Gould C. Infections associated with haemophagocytic syndrome. Lancet Infect Dis 2007;7:814-822.

3. Zheng Y, Yang Y, Zhao W, Wang H. Novel swine-origin influenza A (H1N1) virus-associated hemophagocytic syndrome--a first case report. Am J Trop Med Hyg 2010;82:743-745.

427

Turk J Hematol 2013;30:426-428

Demircioğlu F, et al: H1N1 Infection-Related Hemophagocytic Lymphohistiocytosis in a Child

4. Ozdemir H, Çiftçi E, Ince EU, Ertem M, Ince E, Doğru U. Hemophagocytic lymphohistiocytosis associated with 2009 pandemic influenza A (H1N1) virus infection. J Pediatr Hematol Oncol 2011;33:135-137.

10. Ur Rehman J, Wali G, Sayes NM, Maulawi A, Aslam M, Khalid I. Novel influenza A (H1N1) virus-induced hemophagocytosis: first case reported in Saudi Arabia. Ann Saudi Med 2012;32:86-89.

5. Novel Swine-Origin Influenza A (H1N1) Virus Investigation Team, Dawood FS, Jain S, Finelli L, Shaw MW, Lindstrom S, Garten RJ, Gubareva LV, Xu X, Bridges CB, Uyeki TM. Emergence of a novel swine-origin influenza A (H1N1) virus in humans. N Engl J Med 2009;360:2605-2615.

11. Beutel G, Wiesner O, Eder M, Hafer C, Schneider AS, Kielstein JT, Kühn C, Heim A, Ganzenmüller T, Kreipe HH, Haverich A, Tecklenburg A, Ganser A, Welte T, Hoeper MM. Virus-associated hemophagocytic syndrome as a major contributor to death in patients with 2009 influenza A (H1N1) infection. Crit Care 2011;15:80.

6. Unal S, Gökçe M, Aytaç-Elmas S, Karabulut E, Altan I, Ozkaya-Parlakay A, Kara A, Ceyhan M, Cengiz AB, Tuncer M, Cetin M, Gümrük F. Hematological consequences of pandemic influenza H1N1 infection: a single center experience. Turk J Pediatr 2010;52:570-575.

7. Willekens C, Cornelius A, Guerry MJ, Wacrenier A, Fourrier F. Fulminant hemophagocytic lymphohistiocytosis induced by pandemic A (H1N1) influenza: a case report. J Med Case Rep 2011;5:280.

8. Katsumi A, Nishida T, Murata M, Terakura S, Shimada K, Saito S, Kobayashi M, Kodaira A, Shibata S, Oda I, Yagi T, Kiyoi H, Matsushita T, Kojima T, Naoe T. Virus-associated hemophagocytic syndrome caused by pandemic swine-origin influenza A (H1N1) in a patient after unrelated bone marrow transplantation. J Clin Exp Hematop 2011;51:63-65.

9. Asai N, Ohkuni Y, Matsunuma R, Iwama K, Otsuka Y, Kawamura Y, Motojima S, Kaneko N. A case of novel swine influenza A (H1N1) pneumonia complicated with virusassociated hemophagocytic syndrome. J Infect Chemother 2012;18:771-774.

428

12. Harms PW, Schmidt LA, Smith LB, Newton DW, Pletneva MA, Walters LL, Tomlins SA, Fisher-Hubbard A, Napolitano LM, Park PK, Blaivas M, Fantone J, Myers JL, Jentzen JM. Autopsy findings in eight patients with fatal H1N1 influenza.

Am J Clin Pathol 2010;134:27-35.

13. To KK, Hung IF, Li IW, Lee KL, Koo CK, Yan WW, Liu R, Ho KY, Chu KH, Watt CL, Luk WK, Lai KY, Chow FL, Mok T, Buckley T, Chan JF, Wong SS, Zheng B, Chen H, Lau CC, Tse H, Cheng VC, Chan KH, Yuen KY. Delayed clearance of viral load and marked cytokine activation in severe cases of pandemic H1N1 2009 influenza virus infection. Clin Infect Dis 2010;50:850-859.

DOI: 10.4274/Tjh.2013.0127

Letter to the Editor

Antiphospholipid Antibodies and Systemic Scleroderma Antifosfolipid Antikorları ve Sistemik Skleroderma Muhammed Mubarak1, Hamid Nasri2 1Sindh

Institute of Urology and Transplantation (SIUT), Karachi, Pakistan University of Medical Sciences, Department of Nephrology, Division of Nephropathology, Isfahan, Iran

2Isfahan

Dear Editor: We read with great interest the article by Touré and colleagues published in a recent issue of your journal, entitled “Antiphospholipid Antibodies and Systemic Scleroderma”.

In this study, they investigated 40 patients with systemic scleroderma (SSc) for the presence of antiphospholipid antibodies (aPLs). Overall, they found aPLs in 23 (57.5%) patients. The most frequently encountered antibody was IgG anti-β2 glycoprotein I (GP I) (37.5% of the patients), followed by anticardiolipins (17.5%) and lupus anticoagulants (5%).

No statistically significant association of positive aPL tests to any of the scleroderma complications was observed. They suggested that patients affected by SSc be followed in order to monitor vascular complications following the confirmation of the presence of antiphospholipid syndrome (APS) [1].

We would like to remind readers of a few points about APS nephropathy (APSN) and rheumatologic disease. Although high proportions of patients showing association of SSc and aPLs were described by Touré et al., more attention and support is needed to find the co-existence of APSN with systemic lupus erythematosus and SSc in routine evaluation of these patients [2,3,4]. Thus, the main question to bear in mind is: what do nephrologists or rheumatologists need to know about APS and APSN? APS is being increasingly recognized as an important cause of renal damage due to thrombosis at any location within the renal vasculature [5]. The term “APSN” refers to the various renal pathologies caused by vascular lesions in the glomeruli, arterioles, and/or interlobular arteries

in patients with aPLs [5,6,7]. From the nephrology point of view, this small-vessel, vaso-occlusive nephropathy may present with hypertension, acute and/or chronic renal failure, and often a low-grade proteinuria clinically [8,9,10]. It is also necessary to increase the awareness of the morphologic features of this disease among pathologists and nephrologists from developing countries for its early and accurate diagnosis and appropriate management. It is clear that the diagnosis of APSN can only be made based on renal biopsy. None of the patients in the study under discussion showed renal manifestations or complications, and neither did they undergo renal biopsy [11,12].

There were additionally some errors in the study. The authors did not classify the disease. The timing of antibody testing was also not provided. It is not clear how many of the patients were diagnosed with APS. Laboratory criteria alone are not enough to definitively diagnose this condition.

The titer of antibodies was not given. This may be one of the factors underlying the lack of association of the aPLs with complications of SSc. There was also no information about SSc serologies such as anti-Sc70. An age of 41 years is given as both the median and mean value in different places.

The frequency of anti-β2 GP I is given as 50% in the results section, but it is 37.5% as given in Table 2. Hypochromic skin macula is described as present in 100% of cases in the results section, while in Table 1, it is 94.7%. The percentage value of pulmonary hypertension in Table 1 is also wrong; it should be 12.5%. The values for complications/manifestations in Tables 1 and 3 do not match. In the discussion section, the study period is given as 8 months rather than 18 months.

Address for Correspondence: Hamid NASRI, M.D., Isfahan University of Medical Sciences, Department of Nephrology, Division of Nephropathology, Isfahan, Iran E-mail: hamidnasri@med.mui.ac.ir Received/Geliş tarihi : April 11, 2013 Accepted/Kabul tarihi : April 30, 2013

429

Turk J Hematol 2013;30:429-430

Mubarak M, et al: RE: Antiphospholipid Antibodies and Systemic Scleroderma

Declaration of Conflicting Interests The authors declare no conflicts of interest with respect to the authorship and/or publication of this article.

References 1. Touré AO, Ly F, Sall A, Diatta A, Gadji M, Seck M, Faye B, Dieye T, Diop S. Antiphospholipid antibodies and systemic scleroderma. Turk J Hematol 2013;30:32-36.

2. Nasri H. Hypertension and renal failure with right arm pulse weakness in a 65 years old man. J Nephropathol 2012;1:130-133.

3. Mubarak M. Catastrophic antiphospholipid syndrome presenting with sudden renal failure: the lesson lies in vascular lesions. J Nephropathol 2013;2:135-138.

4. Mardani S, Nasri H. Catastrophic antiphospholipid syndrome presenting with sudden renal failure and past history of long-lasting psychosis and hypertension in a woman. J Nephropathol 2013;2:110-113.

5. Kronbichler A, Mayer G. Renal involvement in autoimmune connective tissue diseases. BMC Med 2013;11:95.

6. Serrano F. Antiphospholipid syndrome: a complex disease. J Nephropathol 2013;2:73-74.

7. Sinico RA, Cavazzana I, Nuzzo M, Vianelli M, Napodano P, Scaini P, Tincani A. Renal involvement in primary antiphospholipid syndrome: retrospective analysis of 160 patients. Clin J Am Soc Nephrol 2010;5:1211-1217.

8. Ardalan MR, Vahedi A. Antiphospholipid syndrome: a disease of protean face. J Nephropathol 2013;2:81-84.

9. Nishimura M, Nii T, Trimova G, Miura S, Umezawa K, Ushiyama A, Kubota T. The NF-κB specific inhibitor DHMEQ prevents thrombus formation in a mouse model of antiphospholipid syndrome. J Nephropathol 2013;2:114121.

10. Biggioggero M, Meroni PL. The geoepidemiology of the antiphospholipid antibody syndrome. Autoimmun Rev 2010;9:299-304. doi: 10.1016/j.autrev.2009.11.013. Epub 2009 Nov 25.

11.

Nasri H. Antiphospholipid syndrome-associated nephropathy: Current concepts . J Ren Inj Prev 2013; 2: 1-2. doi:10.12861/jrip.2013.01 12.

Baradaran A. Antiphospholipid syndrome-associated nephropathy; a nephropathy needs classification. J Nephropharmacol. 2012;1:7-9.

Reply, * For table 3 : the good version is this one * I don’t know what you mean about the timing of the study. We led our study during 18 months.

Raynaud’s phenomenon APL + (26) and APL - (13)

* For anti-beta2 GPI, we tested for IG M and IG G and we found these following results: 50% of patients had either G or M, 37,5% had IGM and the same proportion Ig G. Of course some patients had both.

Acrosclerosis APL + (22) and APL - (6)

* For table 1, I made a mistake with hypochromic maculae, wich was the main reason of counsulting: all patients (100%) have had this abnormalities. The rate of pulmonary hypertension is also 12.5%.

430

Pulmonary hypertension APL + (4) and APL - (1) I am really sorry for all these disturbances and thank you again.

Best regards Dr Awa O Touré

DOI: 10.4274/TJH-2013.0150

Letter to the Editor

The Relationship between Survival and Multidrug Resistance Protein 1 Multi Drug Rezistans Protein 1 ile Survi Arasındaki İlişki Kadir Öztürk, Yusuf Emrah Eyi, Yakup Aksoy Hakkari Military Hospital, Department of İnternal Medicine, Hakkari, Turkey Hakkari Military Hospital, Department of Emergency Medicine, Hakkari, Turkey Hakkari Military Hospital, Department of Ophthalmology, Hakkari, Turkey

To the Editor, We read with great enthusiasm the recently published article entitled “The Frequency and Clinical Relevance of Multidrug Resistance Protein Expression in Patients with Lymphoma” by Gündüz and colleagues [1]. In that very welldesigned study, they tried to evaluate the relationships between levels of multidrug resistance protein 1 (MDR1), multidrug resistance-associated protein (MRP), and lung resistancerelated protein (LRP) and median survival in patients with non-Hodgkin lymphoma (NHL), Hodgkin lymphoma (HL), and reactive lymphadenopathy (LAP). They concluded that MDR1, MRP, and LRP expression did not influence overall survival in NHL and HL patients.

The authors reported that the age difference between patient groups was not significant; the mean age was 53.2±17.5 years in the NHL patients (group 1) and 37.6±13.7 years in the HL patients (group 3), and p<0.05 was accepted as statistically significant. Although there were both statistically and clinically significant differences between the groups in age, the authors reported that there was no significant difference in age between the groups. In previous studies, it was reported that MDR1, MRP, and LRP expression levels were correlated with age [2]. In addition, in the study under present discussion, it was declared that the average survival time of patients with HL (49.50±4.69 months) was longer than that of patients with reactive LAP (42.46±5.85 months).

Although the authors reported that survival of patients with HL was longer than that of the patients with reactive LAP, HL has higher mortality than in a healthy population despite all advances in treatment [3].

In the study, it was indicated that there was not a relationship between MDR1, MRP, and LRP expression and lactate dehydrogenase, albumin, beta-2 microglobulin, C-reactive protein, or erythrocyte sedimentation rate.

However, the authors did not mention any numerical or statistical values in regard to these results.

We thank the authors for their contribution.

References 1. Gündüz E, Dinçer M, Yıldız G, Bal C, Gülbaş Z. The frequency and clinical relevance of multidrug resistance protein expression in patients with lymphoma. Turk J Hematol 2012;29:120-125.

2. Schaich M, Soucek S, Thiede C, Ehninger G, Illmer T; SHG AML96 Study Group. MDR1 and MRP1 gene expression are independent predictors for treatment outcome in adult acute myeloid leukaemia. Br J Haematol 2005;128:324332.

3. National Cancer Institute. Hodgkin Lymphoma-SEER Stat Fact Sheets. Bethesda, NCI, n.d. Available at http://seer. cancer.gov/statfacts/html/hodg.html; accessed 26 August 2012.

Address for Correspondence: Yusuf EYİ, M.D., Hakkari Military Hospital, Department of Emergency Medicine, Hakkari, Turkey GSM: +90 532 582 28 02 E-mail: dremraheyi@hotmail.com Received/Geliş tarihi : April 29, 2013 Accepted/Kabul tarihi : May 6, 2013

431

Turk J Hematol 2013;30:431-432

Öztürk K, et al: The Relationship between Survival and Multidrug Resistance Protein 1

Reply, The mean ages for patient groups were 53.2 +/- 17.5 in non Hodgkin lymphoma (NHL) patients (group 1), 41.7 +/- 15.1 in non malignant patients and 37.6 +/13.7 in Hodgkin lymphoma (HL) patients (group 3).

The difference was statistically significant between NHL and HL groups but there was no statistically significant difference between lymphoma patients and non malignant group. Unfortunately it was written as only “NHL patients were older than HL patients (p<0.05), the difference was not significant” with missing words.

The difference was not significant sentence should be written as “the difference was not significant between lymphoma patients and non malignant group”.

Although Schaich et al reported a correlation between age and MDR1, MRP and LRP expressions in acute myeloid leukemia patients we didn’t investigate such a relation ship. It can be analyzed in further studies.

Survival of our patients with HL was 49.5+/-4.69 months. This was 42.46+/-5.85 months for NHL group.

Survival was shorter than HL group for NHL patients but was not different between lymphoma groups and non malignant group. The survival is for not only reactive lymphadenopathy (LAP) but all malignant group although we mentioned as reactive LAP in our article. Non malignant group consisted of reactive LAP, granulomatous inflammation, dermatopathic LAP, benign mixed tumour and Kikuchi’s disease. These subgroups and the small number of patients in HL group might have effected our results.

In the study MDR1, MRP and LRP expressions were not related with lactate dehydrogenase, albümin, beta 2 microglobulin, C reactive protein or erythrocyte sedimentation rate. The numerical and statistical values are not given because we didn’t want to confuse with many numbers and can be shared if requested.

Zafer Gülbaş

432

Images in Hematology

Primary Mesenteric Follicular Lymphoma Associated with Mesenteric Migration of Intrauterine Device Intrauterin Aracın Mezenterik Migrasyonu ile Birlikte Primer Mezenterik Foliküler Lenfoma

DOI: 10.4274/Tjh.2012.0207

A 39-year-old woman received an intrauterine device (IUD) placement 6 years ago, and lower abdominal pain occurred intermittently 1 year after the placement. Every attack lasted for a few days and was relieved spontaneously.

Pain occurred again 2 days before admission, with nausea, vomiting, and constipation. Physical examination revealed a mass in the left lower abdomen with localized tenderness.

Abdominal computed tomography showed that a mass, 5.9 × 4.0 cm in size, was adjacent to the aorta abdominalis and below the umbilicus. A 2-cm circinate foreign body was observed close to the mass (Figure 1). Exploratory laparotomy showed that a metallic IUD was on the mesenterium, while the uterine was intact, and the mesenterium, 130 cm distal to the Treitz ligament until 40 cm proximal to the ileocecum, was occupied by purple nodules, which coalesced into a large mass (Figure 2). Diseased mesenterium and relevant intact small bowel were resected successfully. Postoperative pathologic study showed abnormal crowding of follicles and many large centroblasts with nucleoli adjacent to the nuclear membrane with admixed cleaved cells, in accordance with Grade III follicular lymphoma (Figure 3). Immunohistochemistry results were positive for CD20, CD21, mum-1, Bcl-2, and Bcl-6 and weakly positive for CD10, with a Ki-67 index of 60%. Further bone marrow smear and biopsy had negative results. She was treated with 6 cycles of combined chemotherapy after surgery, and no relapse was observed at the 1-year follow-up. Informed consent was obtained.

Figure 1: Abdominal CT reveals a mass of 5.9 x 4.0 cm in size adjacent to the aorta abdominalis under the umbilicus, to the right of which a dissociative circinate foreign body of 2 cm in diameter is observed (arrow).

Xue-Feng Sun1, Jun Feng2, Wei Liu3 1Peking

Union Medical College Hospital, Department of Respiratory Medicine, Beijing, China 2Peking Union Medical College Hospital, Department of Hematology, Beijing, China 3Peking Union Medical College Hospital, Department of General Surgery, Beijing, China Address for Correspondence: Wei LIU, M.D., Peking Union Medical College Hospital, Department of General Surgery, Beijing, China E-mail: liu_wei_95@sina.com Received/Geliş tarihi : December 25, 2012 Accepted/Kabul tarihi : March 15, 2013

Figure 2: During laparotomy, a metallic IUD was noticed on the mesenterium. The mesenterium to the left of the IUD is occupied by purple nodules coalescing into a large mass.

Some nodules were ruptured, and brown mucus was seen flowing out.

433

Turk J Hematol 2013;30:433-434

Sun FX, et al: Follicular Lymphoma with Migrated IUD

lymphoma followed IUD placement and migration, and they were adjacent in space, which brought about the postulation that there was some unusual association between the formation of follicular lymphoma and the migrated IUD. This might be explained by the fact that the pathogenesis of lymphoma is associated with inflammation [3].

Key Words: Mesenteric follicular lymphoma,

Intrauterine device

Conflict of Interest Statement The authors declare that they have no conflicts of interest that could be perceived as having influenced the impartiality of the materials presented.

Funding Figure 3: Ostoperative pathologic study showed abnormal crowding of follicles and many large centroblasts with nucleoli adjacent to the nuclear membrane with admixed cleaved cells, in accordance with Grade III follicular lymphoma (hematoxylin and eosin, 100x).

IUDs become embedded in the uterine wall or even perforated into the peritoneal cavity only in very rare cases.

It has been reported that perforation of the uterus occurs in 0.87 of 1000 insertions [1]. Follicular lymphoma is an indolent lymphoma and accounts for about 10% of nonHodgkin lymphomas in China. Although the presence of primary follicular lymphoma of the gastrointestinal tract is relatively commonly seen, primary mesenteric follicular lymphoma is extremely rare.

It is usually considered that IUDs are unrelated to malignancy, and might even act as a protective cofactor in cervical carcinogenesis [2], but there are no studies about the safety of migrated IUDs. In this case, mesenteric follicular

434

The present study received no grant from a funding agency in the public, commercial, or for-profit sectors.

References 1. Markovitch O, Klein Z, Gidoni Y, Holzinger M, Beyth Y. Extrauterine mislocated IUD: is surgical removal mandatory?

Contraception 2002;66:105-108.

2. Castellsagué X, Díaz M, Vaccarella S, de Sanjosé S, Muñoz N, Herrero R, Franceschi S, Meijer CJ, Bosch FX. Intrauterine device use, cervical infection with human papillomavirus, and risk of cervical cancer: a pooled analysis of 26 epidemiological studies. Lancet Oncol 2011;12:1023-1031.

3. Rosenquist R. Introduction: The role of inflammation, autoimmune disease and infectious agents in development of leukaemia and lymphoma. J Intern Med 2008;264:512513.

Images in Hematology

Interstitial Pneumonitis in a Patient with Chronic Myeloid Leukemia Kronik Miyeloid Lösemi Hastasında Gelişen İnterstisyel Pnömoni

Figure 1: Chest X-ray showed bilateral interstitial infiltrates (A). Thoracic CT revealed patchy parenchymal consolidations in both apical lungs, bilateral superior segments of the lower lobes, and the posterior regions of both lungs (B).

Ahmet Emre Eşkazan1, Ayşe Salihoğlu2, Serdar Erturan3, Teoman Soysal2 1İstanbul

University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey 2İstanbul University Cerrahpaşa Faculty of Medicine, Department of Chest Disease, İstanbul, Turkey

Address for Correspondence: Teoman SOYSAL, M.D., İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey Phone: +90 212 589 79 34 E-mail: soysal12@istanbul.edu.tr Received/Geliş tarihi : August 24, 2012 Accepted/Kabul tarihi : December 14, 2012

DOI: 10.4274/Tjh.2012.0115

A 43-year-old otherwise healthy male patient was admitted to our hematology clinic with leukocytosis in April 2008. Philadelphia-positive chronic phase chronic myeloid leukemia (CML) was the diagnosis. Imatinib mesylate (IM) at 400 mg/day was initiated in May 2008. He tolerated the therapy quite well; only a mild skin rash developed, which was easily controlled with antihistamines. He was admitted with dry cough and shortness of breath, unresponsive to moxifloxacin therapy, in February 2010, after 20 months of IM treatment. He had a 15-pack-year history of smoking, which he had quit 2 years ago. He was afebrile and there were crackles on auscultation in both lungs. His chest X-ray showed bilateral interstitial infiltrates (Image 1A), and thoracic computed tomography (CT) revealed patchy parenchymal consolidations in both apical lungs, bilateral superior segments of the lower lobes, and the posterior regions of both lungs (Image 1B). Pulmonary function tests showed a restrictive ventilatory defect. No elevations of the acute phase reactants were detected, and the IgE blood level was within the normal limits. Fiberoptic bronchoscopy revealed normal airways, and bronchoalveolar lavage showed no abnormalities with the transbronchial fine needle biopsy showing nonspecific interstitial inflammation. The diagnosis was nonspecific interstitial pneumonitis and the possible cause was thought to be IM. Imatinib was discontinued and methylprednisolone (80 mg/day) was initiated. Under the corticosteroid therapy, his symptoms and radiological findings were resolved.

Imatinib is indicated in the first-line treatment of CML. It is generally well tolerated, but mild adverse events including edema, nausea, diarrhea, abdominal pain, muscle cramps, and skin rash can be seen. Pulmonary complications such as dyspnea and cough are usually due to the pulmonary edema and pleural effusion that are seen in approximately 7%-14% of the patients receiving IM [1,2]. Interstitial pneumonitis during imatinib therapy is a rare entity [3]. While receiving IM and between days 10 and 337 of treatment, interstitial pneumonitis cases are documented [1]. The pathogenesis of the interstitial pulmonary disease during IM includes the direct toxic effects of the inflammatory and immune system cells resulting in parenchymal lung injury and fibrosis [4]. Our patient had tolerated IM well until month 20 of treatment, when a serious pulmonary complication occurred.

Interstitial pneumonitis can be reversible when diagnosed early and treated quickly; thus, pulmonary symptoms in patients receiving IM should be closely monitored and possible pulmonary toxicity should always be kept in mind.

Informed consent was obtained.

435

Turk J Hematol 2013;30:435-436

EĹ&#x;kazan EA, et al: Interstitial Pneumonitis in a CML Patient

Key words: CML, imatinib, interstitial pneumonitis Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Yokoyama T, Miyazawa K, Kurakawa E, Nagate A, Shimamoto T, Iwaya K, Akata S, Aoshima M, Serizawa H, Ohyashiki K. Interstitial pneumonia induced by imatinib mesylate: pathologic study demonstrates alveolar destruction and fibrosis with eosinophilic infiltration.

Leukemia 2004;18:645-646.

436

2. Rajda J, Phatak PD. Reversible drug-induced interstitial pneumonitis following imatinib mesylate therapy. Am J Hematol 2005;79:80-81.

3. Isshiki I, Yamaguchi K, Okamoto S. Interstitial pneumonitis during imatinib therapy. Br J Haematol 2004;125:420.

4. Robibaro B, Kropfmueller A, Prokop M, Haber P, Gisslinger H. Imatinib, cytokines and interstitial lung disease in a patient with primary myelofibrosis. Ann Hematol 2010;89:829-831.

30th Volume Index / 30. Cilt Dizini SUBJECT INDEX - KONU DİZİNİ March 2013 - December 2013 Mart 2013 - Aralık 2013

Acute Leukemia Children / Çocuk, 58 Epstein-Barr virus / Epstein-Barr virus, 58 Leukemia / Lösemi, 58 Lymphoproliferative disorder / Lenfoproliferatif hastalık, 58 Rituximab / Rituximab, 58 Myeloid leukemia / Miyeloid lösemi, 129 NPM1 mutation / NPM1 mutasyonu, 129 Acute myeloid leukemia / Akut miyeloid yösemi, 137 Angiogenesis / Anjiyogenez, 137 Gene expression / Gen ekspresyonu, 137 VEGF-A, VEGF-C / VEGF-A, VEGF-C, 137 Acute promyelocytic leukemia / Akut promyelositik lösemi, 157 Locked nucleic acid / Locked nükleik asit, 157 microRNA / mikroRNA, 157 miR-92a / miR-92a, 157 Acute leukemia / Akut lösemi, 263 Chemotherapeutics / Kemoterapötikler, 263 TRAIL / TRAIL, 263 Cardiotoxicity / Kardiyotoksisite, 290 Chemotherapy / Kemoterapi, 290 Childhood / Çocukluk çağı, 290 Endocrinology / Endokrinoloji, 290 Late effects / Geç etki, 290 Leukemia / Lösemi, 290 Acute myeloid leukemia / Akut miyeloid lösemi, 300 Neuropilin-1 / Neuropilin-1, 300 Acute promyelocytic leukemia / Akut promiyelositik lösemi, 400 Additional chromosomal abnormalities / Ek kromozomal anomaliler, 400 Anemia Iron deficiency anemia / Demir eksikliği anemisi, 145 Treatment / Tedavi, 145 Ferrous sulfate / Ferröz sülfat, 145 Zinc sulfate / Çinko sülfat, 145 Reticulocyte hemoglobin content / Retikülosit hemoglobin içeriği, 153 Diagnosis / Tanı, 153 Iron deficiency anemia / Demir eksikliği anemisi, 153

Autoimmun hemolytic anemia / Otoimmün hemolitik anemi, 194 Megadose methylprednisolone / Megadoz metilprednizolon, 194 Obesity / Obezite, 293 Bleeding Disorders Oral surgery / Ağız cerrahisi, 19 Hemophilia / Hemogli, 19 Hemostasis / Hemostaz, 19 Ankaferd blood stopper / Ankaferd blood stopper, 19 Platelet aggregation defects / Trombosit agregasyon bozuklukları, 168 Von Willebrand disease / Von Willebrand hastalığı, 168 Menorrhagia / Menoraji, 168 Bleeding disorder / Pıhtılaşma bozukluğu, 168 Bone Marrow Lymphocyte / Lenfosit, 1 Stem cell physiology / Kök hücre fizyolojisi, 1 Immunity / Bağışıklık, 1 Hematopoetic stem cells / Hematopoetik kök hücreler, 1 Blood cells / Kan hücreleri, 1 Monocyte / Monosit, 256 Mesenchymal stromal cell / Mezenkimal stromal hücre, 256 Bone marrow transplantation / Kemik iliği nakli, 256 İmmunsupresion / İmmünspresyon, 256 Blood Smear May-Grünwald-Giemsa stain / May-Grunwald-Giemsa boyaması, 53 Blood smear / Çevre kan yayması, 53 Polymorphonuclear neutrophils / Parçalı nötrogl , 53 Gender / Cinsiyet, 53 Nuclear appendages / Çekirdek ilave uzantısı, 53 Chanarin-Dorfman syndrome Chanarin-Dorfman syndrome / Chanarin Dorfman Sendromu, 72 Ichthyosis / İktiyoz, 72 Child / Çocuk, 72 Acute myeloblastic leukemia / Akut miyeloblastik lösemi, 230 Pseudo Chediak-Higashi anomaly / Yalancı Chediak Higashi

Subject Index - Konu Dizini

Anomalisi, 230 Child / Çocuk, 230

Hemophilia / Hemofili, 19 Hemostasis / Hemostaz, 19

Chronic Leukemia Imatinib / Imatinib, 247 Chronic myeloid leukemia / Kronik myeloid lösemi, 247,352,359,387 Tyrosine kinase inhibitor / Tirozin kinaz inhibitörü, 247 Dasatinib / Dasatinib, 247 Nilotinib / Nilotinib, 247 Bosutinib / Bosutinib, 247 Ponatinib / Ponatinib, 247 Obesity / Obezite, 300 Insulin resistance / İnsülin direnci, 300 Anemia / Anemi, 300 Inflammation / İnflamasyon, 300 CML / KML, 359 Accelerated phase HOXA9 gene / Akselere faz HOXA9 geni, 359 BCR-ABL expression / BCR-ABL ekspresyonu, 359 Safety / Güvenilirlik, 387 Imatinib / İmatinib, 387 BCR-ABL / ABL ratio / BCR-ABL / ABL oranı, 359

Hydrops α-Thalassemia / α-talasemi, 63 Hydrops fetalis / Hidrops fetalis, 63 Nonimmune / Nonimmün, 63

Endothelial Protein C Receptor sEPCR / sEPCR, 37 EPCR / EPCR, 37 A3 / A3, 37 Pediatric stroke / Pediatrik inme, 37 Essential Thrombocythemia Leg ulcers / Bacak ülserleri, 184 Hydroxyurea / Hidroksiüre, 184 Essential thrombocythemia / Esansiyel trombositemia, 184 Interferon / İnterferon, 184 Factor VIII Inhibitors Hemarthrosis / Hemartroz, 76 Acquired hemophilia / Edinsel hemogli, 76 FVIII inhibitors / Faktör VIII inhibitörleri, 76 Postpartum inhibitors / Doğum sonrası inhibitörler, 76 Granulocytic Sarcoma Monocytic differentiation / Monositik Farklılaşma, 82 Granulocytic sarcoma / Granülositik sarkom, 82 Skin / Deri, 82 Hematological Malignancies Molecular genetics / Moleküler genetik, 122 Hematologic malignancies / Hematolojik maligniteler, 122 Leukemia / Lösemi, 122 Microarray / Mikroarray , 122 Hemophilia Ankaferd blood stopper / Ankaferd blood stopper, 19 Oral surgery / Ağız cerrahisi, 19

Iron Iron deficiency anemia / Demir eksikliği anemisi, 145 Treatment / Tedavi, 145 Ferrous sulfate / Ferröz sülfat, 145 Zinc sulfate / Çinko sülfat, 145 Iron deficiency anemia / Demir eksikliği anemisi, 153 Reticulocyte hemoglobin content / Retikülosit hemoglobin içeriği, 153 Diagnosis / Tanı, 153 Iron / Demir, 307 Omeprazole / Omeprazol, 307 PPI / PPI, 307 Proton pump inhibitors / Proton pompa inhibitörleri, 307 Anemia / Anemi, 307 Obesity / Obezite, 293 Insulin resistance / İnsülin direnci, 293 Anemia / Anemi, 293 Inflammation / İnflamasyon, 293 Langerhans Cell Sarcoma Langerhans / Langerhans, 198 Sarcoma / Sarkom, 198 Axillary / Aksiller, 198 Lymph node / Lenf nodu, 198 Differential diagnosis / Ayırıcı tanı, 198 Lymphoma Differential diagnosis / Ayırıcı tanı, 67 Human herpes virus-8 / Human herpes virüs-8, 67 Human immunodegciency virus (HIV) / Human immunodeficiency virus (HIV), 67 Pleural effusion / Plevral efüzyon, 67 Primary effusion lymphoma / Primer efüzyon lenfoması, 67 Renal lymphoma / Renal lenfoma, 191 Central nervous system involvement / Santral sinir sistemi tutulumu, 191 Children / Çocuklar, 191 Diffuse large B-cell lymphoma / Diffüz büyük B hücreli lenfoma, 275 p53 / p53, 275 Bcl-2 / Bcl-2, 275 Ki67 / Ki67, 275 Prognosis / Prognoz, 275 Primary adrenal lymphoma / Primer adrenal lenfoma, 405 Central nervous system involvement / Merkezi sinir sistemi tutulumu, 405

Subject Index - Konu Dizini

Primary bone lymphoma / Primer kemik lenfoması, 409 Lymphoplasmacytic lymphoma / Lenfoplazmasitik lenfoma, 409 Spinal cord compression / Spinal kord basısı, 409 Sjögren’s syndrome / Sjogren sendromu, 416 Non-Hodgkin lymphoma / Hodgkin dışı lenfoma, 416 Malignancy / Habis, 416 Mesenchymal Stem Cells Mesenchymal stem cells / Mezenkimal kök hücreler, 116 Differentiation / Diferansiyasyon, 116 Cardiomyocyte / Kardiyomiyosit, 116 Myocyte / Miyosit, 116 Mezenchimal stromal cell / Mezenkimal stromal hücre, 256 Bone marrow transplantation / Kemik iliği nakli, 256 İmmunsupresion / İmmünspresyon, 256 Multiple Myeloma Multiple myeloma / Multipl miyelom, 84 Carbamazepine / Karbamazepin, 84 Epilepsy / Epilepsi, 84 Multiple myeloma / Multipl miyelom, 234 Quality of life / Yaşam kalitesi, 234 Supportive care / Destekleyici tedavi, 234 Myeloproliferative Disorders MPL W515L / K mutations / MPL W515L / K mutasyonları, 8 JAK-2 V617F mutation / JAK-2 V617F mutasyonu, 8 Myeloproliferative neoplasms / Miyeloproliferatif neoplazmlar, 8 Essential thrombocythemia / Esansiyel trombositemi, 8 Primary myelofibrosis / Primer miyelofibroz, 8 Myeloproliferative neoplasm / Miyeloproliferatif neoplazi, 13 SOCS1 / SOCS1, 13 SOCS3 / SOCS3, 13 Secondary erythrocytosis/thrombocythemia / Sekonder eritrositoz/trombositemi, 13 Renal transplantation / Böbrek nakli, 315 Lymphoproliferative disorder / Lenfoproliferatif hastalık, 315 Burkitt lymphoma / Burkitt lenfoma, 315 Mutation MPL W515L/K mutations / MPL W515L/K mutasyonları, 8 JAK-2 V617F mutation / JAK-2 V617F mutasyonu, 8 Myeloproliferative neoplasms / Miyeloproliferatif neoplazmlar, 8 Essential thrombocythemia / Esansiyel trombositemi, 8 Primary myelofibrosis / Primer miyelofibroz, 8 Methylation Myeloproliferative neoplasm / Miyeloproliferatif neoplazi, 13 SOCS1 / SOCS1, 13 SOCS3 / SOCS3, 13 Secondary erythrocytosis-thrombocythemia / Sekonder eritrositoz-trombositemi, 13 Myeloperoxidase Deficiency Leucocyte function disorders / Lökosit fonksiyon bozuklukları, 232

Myeloperoxidase / Miyeloperoksidaz, 232 Neutrophil / Nötrofil, 232 Polycythemia Vera Physiopathology / Fizyopatoloji, 102 Etiologic factors / Etyolojik faktörler, 102 Diagnosis / Tanı, 102 Polycythemia vera / Polistemia vera, 102 Stem Cell Transplantation DVT / DVT, 188 Non-myeloablative allogeneic stem cell transplantation / Miyeloablatif olmayan allojeneik kök hücre nakli, 188 Incidence / İnsidans, 188 Allogeneic hematopoietic stem cell transplantation (allo HSCT) / Allojenik hematopoietik kök hücre nakli, 204 Hepatotoxicity / Hepatotoksisite, 204 Encephalitozoon intestinalis / Encephalitozoon intestinalis, 204 Albendazole / Albendazol, 204 Haploidentical stem cell transplantation / Haploidentik kök hücre nakli, 342 HLA / HLA, 342 GVHD / Gratf versus host hastalığı (GVHH), 342 Sickle Cell Sickle cell disease / Orak hücreli anemi, 25 Nutritional status / Beslenme durumu, 25 Endocrine system diseases / Endokrin sistem hastalıkları, 25 Children / Çocuklar, 25 Sickle cell / Orak hücre, 379 Arterial stiffness / Arteriyel sertlik, 379 Pulse wave velocity / Nabız dalga hızı, 379 Quality of life / Yaşam kalitesi, 379 Treatment Ankaferd blood stopper / Ankaferd blood stopper, 19 Oral surgery / Ağız cerrahisi, 19 Hemophilia / Hemofili, 19 Hemostasis / Hemostaz, 19 Hemostasis / Hemostaz, 177 Ankaferd blood stopper / Ankaferd blood stopper, 177 Bone healing / Kemik iyileşmesi, 177 Bone histomorphometry / Kemik histomorfometri, 177 Chronic myeloid leukemia / Kronik myeloid lösemi, 247 Tyrosine kinase inhibitor / Tirozin kinaz inhibitörü, 247 Imatinib / Imatinib, 247 Nilotinib / Nilotinib, 247 Dasatinib / Dasatinib, 247 Bosutinib / Bosutinib, 247 Ponatinib / Ponatinib, 247 Thrombosis / Tromboz, 325 Neonate / Yenidoğan, 325 Tissue plasminogen activator / Doku plazminojen aktivatörü, 325 Preterm / Prematüre, 325 Cyclosporine / Siklosporin, 366

Subject Index - Konu Dizini

Danazol / Danazol, 366 Hemoglobinuria / Hemoglobinüri, 366 Paroxysmal / Paroksismal, 366 Immunosuppression / İmmunosupresyon, 366 Prednisolone / Prednizolon, 366 Safety / Güvenilirlik, 387 Imatinib / İmatinib, 387 Chronic myeloid leukemia / Kronik miyeloid lösemi, 387 Thalassemia α-Thalassemia / α-talasemi, 63 Hydrops fetalis / Hidrops fetalis, 63 Nonimmune / Nonimmün, 63 Thalassemia / Talasemi, 91 Prevention / Önlem, 91 Campaign / Kampanya, 91 Childhood / Çocukluk çağı, 283 Regional left ventricular cardiac function / Bölgesel sol ventriküler kardiyak fonksiyonlar, 283 Strain / Strain, 283 Strain rate imaging / Strain hız görüntüleme, 283 Thalassemia / Talasemi, 283 Transfusion Replacement blood donors / Replasman kan bağışçısı, 163 Hepatitis-B / Hepatit-B, 163 Hepatitis-C / Hepatit-C, 163 HIV / HIV, 163 Thrombosis DVT / DVT, 188 Non-myeloablative allogeneic stem cell transplantation / Miyeloablatif olmayan allojeneik kök hücre nakli, 188 Incidence / İnsidans, 188 Eosinophilia / Eozinofili, 311 Hypereosinophilic syndrome / Hipereozinofilik sendrom, 311 Thrombosis / Tromboz, 311 Intestinal obstruction / Intestinal tıkanıklık, 311 Venous thrombosis / Venöz tromboz, 48 Blood platelet disorders / Kan trombosit bozuklukları, 48 Platelet aggregation / Trombosit agregasyonu, 48 Platelet function tests / Trombosit fonksiyon testleri, 48 Thrombosis / Tromboz, 325 Neonate / Yenidoğan, 325 Tissue plasminogen activator / Doku plazminojen aktivatörü, 325 Preterm / Prematüre, 325 Viral Infection Differential diagnosis / Ayırıcı tanı, 67 Human herpes virus-8 / Human herpes virüs-8, 67

Human immunodeficiency virus (HIV) / Human immunodeficiency virus (HIV), 67 Pleural effusion / Plevral efüzyon, 67 Primary effusion lymphoma / Primer efüzyon lenfoması, 67 von Willebrand Disease von Willebrand disease / von Willebrand hastalığı, 40 Prevalence / Prevalans, 40 PFA-100 / PFA-100, 40 Sensitivity / Sensitivite, 40 Specificity / Spesifite, 40 DDAVP / TR, 214 Preeclampsia / Preeklampsi, 214 Pregnancy / Hamilelik, 214 Deficiency / Eksiklik, 214 Platelet / Platelet, 214 Other Hematologists / Hematologlar, 269 Fertility preservation / Fertilite prezervasyonu, 269 Attitude / Tutum, 269 Complicated / Komplike, 287 Severe / Ciddi, 287 Malaria / Sıtma, 287 Thrombocytopenia / Trombositopeni, 287 Angiogenesis / Njiojenez, 371 Radiation / Radyasyon, 371 Cancer and normal tissue / Kanser ve normal doku, 371 Vascular endothelium / Vasküler endotel, 371 HIF-1a / HIF-1a, 371 VEGF / VEGF, 371 eIF2 / eIF2, 371 TIA-1 / TIA-1, 371 TSP-1 / TSP-1, 371 Chronic lymphocytic leukemia / Kronik lenfositik lösemi, 413 Sweet syndrome / Sweet sendromu, 413 Malignancy / Malignite, 413 Neutrophilic leucocytosis / Nötrofilik lökositoz, 413 Steroid / Steroid, 413 Fever / Ateş, 413 Hemolytic uremic syndrome / Hemolitik üremik sendrom, 418 Hepatitis B vaccine / Hepatit B aşısı, 418 Children / Çocuk, 426, 439 Sézary syndrome / Sézary sendromu, 420 Mycosis fungoides / Mukozis fungoides, 420 Axonal neuropathy / Aksonal nöropati, 420 Hemophagocytic lymphohistiocytosis / Hemofagositik, 426 Swine-origin influenza / Domuz gribi, 426

30th Volume Idex / 30. Cilt Dizini AUTHOR INDEX - YAZAR DİZİNİ March 2013 - December 2013 Mart 2013 - Aralık 2013

A. Uğur Ural, 256

Arbil Açıkalın, 315, 413

Caner Aktaş, 371

Abdullah Hacıhanifioğlu, 122

Aslı Demirbulat, 424

Catherine Messina, 307

Abdülsamet Erden, 100

Asmae Quessar, 340

Cem Ar, 351

Abibatou Sall, 32

Aungkura Supokawej, 115

Cengiz Bayram, 418

Adem Güler, 325

Awa Oumar Touré, 32

Cengiz Beyan, 13

Affaf Adda, 53

Ayça Dilruba Aslanger, 223

Cengiz Kurtman, 371

Afife Karabıyık, 37

Aydın Gülünay, 420

Ceyhun Dizdarer, 40

Ahmet Baran, 191

Aylin Orgen Çallı, 198,275

Christoph Klein, 232

Ahmet Durmuş, 209

Aynur Akbulut, 223

Chun Wang, 422

Ahmet Emin Kürekçi, 325

Aysel Pekel, 256

Ciğdem Usul Afşar, 83,413

Ahmet Emre Eşkazan, 98,211,351,435

Ayşe Işık, 328, 400

Cumhur İbrahim Başsorgun, 177

Ahmet Gözen, 336

Ayşe Salihoğlu, 351,435

Deepak Bansal, 85

Ahmet İrdem, 283

Ayşe Yüzbaşıoğlu, 72

Deniz Sünnetçi, 122

Ajda Ersoy Güneş, 234

Bahar Dirican, 256

Deniz Torun, 13

Akın Öztürk, 405

Bahar Taşdelen, 25

Derya Güleç, 331

Akif Selim Yavuz, 351

Bahriye Payzin, 198,275

Dildar Bahar Genç, 426

Alaa Fadhil Alwan, 387

Balahan Makay, 72

Dilek Dilli, 63

Alaadin Sahham Naji, 387

Barış Malbora, 144,230,418

Dingming Wan, 263

Alassane Diatta, 32

Bassam Francis Matti, 387

Doaa El Ghannam, 129

Alev Akyol Erikçi, 48

Baysal Karaca, 331

Dökmeci Özden, 72

Ali Bay, 283

Berna Atabay, 58

Duran Canatan, 91

Ali Koşar, 67

Berna Bozkurt Duman, 83,221,413

Duygu Yavuz, 122

Ali Seçkin Yalçın, 283

Betül Bolat Küçükzeybek, 275

Ebru Kızılkılıç, 216

Ali Sengül, 256

Betül Tavil, 336

Ece Böber, 290

Ali T. Taher, 184

Bilgül Mete, 321

Edmund Fui Min Chin, 76

Ali Ünal, 204,341

Blaise Faye, 32

Ekrem Ünal, 232

Ali Zahit Bolaman, 269

Burak Uz, 351,400

Elif Kazancı, 426

Aliakbar Movasaghpoor, 137

Burhan Ferhanoğlu, 351

Elmas Uzer, 341

Alireza Hamidian Jahromi, 214

Bülent Eser, 204

Elvin Akdağ, 256

Amjad Baig, 163

Bülent Zülfikar, 25

Emel Gürkan, 315,351,379

Anal Galip Köse, 72

Cahit Babür, 88

Emin Kansu, 188

Anupama Chawla, 307

Can Öztürk, 58

Emine Zengin, 168

Author Index - Yazar Dizini

Emre Tekgündüz, 48

Hakan Akgün, 333

Kadir Acar, 81

Engin Keltikli, 351

Hakan Erdoğan, 426

Kadir Öztürk, 333,431

Engin Özçivici, 1

Hakan Göker, 328,400

Kadir Öztürk, 431

Erdem Akbal, 209

Hakan Savlı, 122

Kadir Serkan Yalçın, 67

Eren Gündüz, 157

Hakkı Oğuz Kazancıoğlu, 25

Kamil Nas, 379

Erman Öztürk, 48

Haldun Öniz, 58

Kanay Yararbaş, 223

Erol Ayyıldız, 219

Hale Ören, 290

Kanjaksha Ghosh, 336

Esat Namal, 405

Hanan M. Mahmoud, 300

Kemal Erdinç, 325

Esmeray Acartürk, 379

Handan Haydaroğlu Şahin, 351

Kerem Okutur, 405

Esra Arun Özer, 58

Hasan Abbas Zaheer, 163

Kezban Nur Pilancı, 405

Esra Atıcı, 67

Hasan Mücahit Özbaş, 351

Kiraz Mızrak, 219

Esra Erden, 416

Hasan Onur Şimşek, 177

Kübra Aydın, 405

Evren Özdemir, 188

Hassiba Lazreg, 53

Kuneerat Nartprayut, 115

Eylem Eliaçık, 328,400

Hatice Eke Güngör, 232

Lale Olcay, 88,336

Fahri Güneş, 209

Hava üsküdar Teke, 100

Leylagül Kaynar, 204

Fahri Şahin, 234,351

Henriette Wa Berenschot, 194

Li Geng, 311

Farah Jijina, 366

Hilal İlbars, 111

Li Pei, 409

Faruk Özkul, 209

Hilmi Apak, 91

Li Wei, 409

Fatih Demircioğlu, 426

Hilmi Atay, 351

LiLi Zhou, 422

Fatih Kurnaz, 204

Homaun Sadeghi Bazargani, 137

Ling Sun, 263

Fatih Şap, 40

Howyda Shaaban, 129

Liu Zi, 409

Fatimata Ly, 32

Hui Sun, 263

M. Bayram Bashırov, 379

Ferenc Molnar, 379

Hülya Şıvgın, 204

M. Kemal Özbilgin, 371

Ferhat Özden, 98

Hüseyin Toman, 209

M. Yavuz Köker, 341

Ferit Avcu, 256

İbrahim C. Haznedaroğlu,

Macoura Gadji, 32

Fezan Şahin Mutlu, 157

247,328,351,400

Magda Zidan, 129

Figen Atalay, 216

İbrahim Tek, 371

Mahmut Yaşar Çeliker, 307

Fikri Ak, 420

İkbal Bozkaya, 144

Fikri Başlamışlı, 315

İlgen Şaşmaz, 91

Fuat Emre Canpolat, 325

İlker İnanç Balkan, 321

Manisha Madkaikar, 371

Gamze Akkuş, 379

İlknur Sivrikoz Ak,

Maya Gupta, 366

Giray Bozkaya, 331

İnan Anaforoğlu, 209

Mehmet Aşık, 209

Gökhan Sargın, 424

İnanç Elif Gürer, 177

Mehmet Sönmez, 351

Göksel Leblebisatan, 283

İnci Alacacıoğlu, 198

Mehmet Turgut, 351

Gül Tokgöz, 223

İpek Yönal, 351

Mehran Karimi, 214

Gülersu İrken, 290

İrfan Yavaşoğlu, 269,424

Mehtap Evran, 221

Gülhis Deda, 37

Jamal Uddin, 163

Melda Cömert, 234,351

Gülsan Türköz Sucak, 81

Jan Jacques Michiels, 102

Melek Akar, 63

Gülsüm Ak, 25

Jie Ma, 263

Melek Ergin, 315

Gülsüm Emel Pamuk, 351

Jihane Abou Rahal, 184

Meliha Nalçacı, 8

Güray Saydam, 234,351

Joseph E. Maakaron, 184

Meltem Bay, 219

Gürhan Kadıköylü, 269

Julie Sawalle Belohradsky, 232

Meltem Gülşan, 144

Hadjer Beliali, 53

Jun Feng, 433

Meltem Olga Akay, 157,351

HaiTao Bai, 422

Kaan Kavaklı, 40

Meral Günaldı, 83,413

Manal A.shams Eldin El Telbany, 300

Author Index - Yazar Dizini

Meral Türker, 58

Nilüfer Bayraktar, 144

Samer Ghosn, 184

Meriç Kaymak Cihan, 88

Nilüfer Üzülmez, 122

Samim Özen, 25

Mert Küçük, 269

Nur Arslan, 72

Sawsan Bakhubaira, 394

Mervan Bekdaş, 426

Nur Soyer, 331

Seçil Arslansoyu Çamlar, 72

Merve Pamukcuoğlu, 81

Nuriye Uzuncan, 331

Seda Eren, 122

Meryem Qachouh, 340

Nükhet Tüzüner, 98,351

Selami Koçak Toprak, 219,338,371

Mesut Akyol, 13

Oğuz Akkuş, 379

Selami Koçak Toprak, 219

Methichit Chayosumrit, 115

Onur Çakır, 25

Selda Kahraman, 351

Miklós Illyes, 379

Onur Kırkızlar, 48,351

Selin Berk, 98

Mila Tempel, 307

Oral Nevruz, 13,256

Selma Ünal, 25

Mine Gültürk, 351

Orçun Dabak, 325

Sema Aylan Gelen, 168

Mohamed Amine Bekadja, 53

Orhan Gürsel, 325

Semra Paydaş, 83,221,315,351,413

Mohamed Brahimi, 53

Osman Başpınar, 283

Serap Emre, 72

Mohammad Kazemi, 157

Osman Gökhan Demir, 405

Serdar Erturan, 435

Mohammad Reza Aliparasti, 137

Osman İ. Özcebe, 400

Serdar Şıvgın, 204

Mohammadreza Sharifi, 157

Osman İlhan, 219,351

Serdar Ümit Sarıcı, 325

Moneer M. Manar, 359

Osman Özcebe, 328

Serhan Küpeli, 191

Mouna Lamchahab, 340

Ömer Doğru, 191

Seval Akpınar, 48,351

Moussa Seck, 32

Özlem Şahin Balçık, 67

Seven Uludokumacı, 321

Muhterem Bahçe, 13

Özlem Tüfekçi, 290

Sevgi Gözdaşoğlu, 96

Murat Beyzadeoğlu, 256

Pakize Karakaya, 290

Sevil Bilir Göksügür, 426

Murat Törüner, 219

Pakpoom Kheolamai, 115

Shengmei Chen, 263

Mustafa Balal, 315

Pınar Gençpınar, 72

Shohreh Almasi, 137

Mustafa Bozkurt, 405

Ping Chong Bee, 76

Shreekant Bharti, 85

Mustafa Çakar, 333

Prateek Bhatia, 85

Sibel Bilgili, 331

Mustafa Çetin, 204

Qing Li, 311

Sibel Erdamar, 98

Mustafa Karagülle, 157

Qiutang Zhang, 263

Sibel Kınık, 336

Mustafa Kır, 290

R. Simin Ada, 216

Sirikul Manochantr, 115

Mustafa Nuri Yenere, 351

Rasoul Salehi, 157

Sonay Güven Karataş, 67

Mustafa Pehlivan, 351

Reşat Özaras, 321

Soufi Osmani, 53

Mustafa Şenol Tüzüm, 177

Reyhan Bayrak, 67

Soumaya Anoun, 340

Mutea A. Iskander, 300

Reyhan Diz- Küçükkaya, 8,405

Stefan O. Ciurea, 342

Muzaffer Demir, 48,351

Reza Khalili Dizaji, 137

Su Long, 409

Mükerrem Safalı, 256

Rim S. Ishak, 184

Suar Çakı Kılıç, 168

Naci Çine, 122

S. Jayaranee, 76

Suat Ali Doğan, 341

Nalan Akyürek, 81

Saadettin Kılıçkap, 420

Surapol Issaragrisil, 115

Namik Özbek, 144,230

Sadi Bener, 198,275

Suzan Zorludemir, 413

Nazan Sarper, 91,168

Sadia Sultan, 163

Süleyman Yazar, 204

Neelam Varma, 85

Said Benchekroun, 340

Sümer Sütçüoğlu, 58

Nejat Akar, 37,233

Saime Paydaş, 315

Syed Mohammad Irfan, 163

Neslihan Erçetin, 25

Sakine Türkmen, 223

Şebnem Yılmaz, 290

Neşe Öztekin, 420

Salih Aksu, 328,400

Şefik Güran, 13

Neşe Saltoğlu, 321

Salih Kozan, 13

Şeniz Öngören, 351

Nilgün Sayınalp, 328,400

Saliou Diop, 32

Şerafettin Demir, 379

Author Index - Yazar Dizini

Şinasi Özsoylu, 93,94,95,194,225,226,227,228

Xinnv Xu, 311 Xue-Feng Sun, 433

Şükran Erten, 416

Yahya Büyükaşık, 328,400

Tandakha Dieye, 32

Yakup Aksoy, 333,431

Tao Li, 263

YaMin Wang, 422

Tao Sui, 311

Yanfang Liu, 263

Tarif H. Sallam, 300

Yang Lei, 409

Tay Za Kyaw, 76

Yaowalak U-pratya, 115

Tayfun İde, 256

Yasin Yıldırım, 219

Teoman Soysal, 98,211,321,435

Yelda Morgül, 198

Timuçin Baykul, 177

Yeşim Aydınok, 91

Timur Selçuk Akpınar, 8

Yeşim S. Karadağ, 420

Tuğba Aktan Köşker, 416

Yıldız Aydın, 420

Tuğba Doğruluk Paksoy, 275

Yousof Gheisari, 157

Tülay Kavaklı, 40

Yuming Li, 311

Tünzale Bayramoğlu, 379

Yurdanur Kılınç, 91

Türkan Patıroğlu, 232

Yusuf Emrah Eyi, 333,431

Uğur Dilmen, 63

Zafer Başlar, 351

Ulaş D. Bayraktar, 342

Zaher K. Otrock, 184

Ümit Akyıldız, 67

Zekai Avcı, 144,230,418

Vehbi Erçolak, 83,413

Zeynep İlkay, 122

Veysel Haksöyler, 83

Zeynep Karakaş, 91

Veysel Sabri Hançer, 8

Zhongxing Jiang, 263

Wei Liu, 433

Zohreh Sanaat, 137

XiaoWei Xu, 422