Turkish Journal of Hematology Volume: 31 - Issue: 3

Issue 3

September 2014

40 TL

ISSN 1300-7777

Volume 31

Review Article Atypical Hemolytic Uremic Syndrome: Differential Diagnosis from TTP/HUS and Management Mustafa N. Yenerel; İstanbul, Turkey

Research Articles Identification and Genetic Analysis of a Factor IX Gene Intron 3 Mutation in a Hemophilia B Pedigree in China Dong-Hua Cao, et al.; Shenyang, Zibo, China

Different Types of Cell Cycle- and Apoptosis-Related Gene Expressions Alter in Corticosteroid-, Vincristine-, and Melphalan-Resistant U-266 Multiple Myeloma Cell Lines Pelin Mutlu, et al.; Ankara, Turkey

The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the World Health Organization for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation Jan Jacques Michiels, et al.; Antwerp, Brussels, Belgium, Rotterdam, Netherlands

Tumor Necrosis Factor-Superfamily 15 Gene Expression in Patients with Sickle Cell Disease Ahmet Ata Özçimen, et al.; Mersin, Turkey

The Evaluation of Hydroxyethyl Starch (6% HES 130/0.4) Solution’s Potential Preventive Effects on Coagulation Status in Women with Gynecologic Malignancies Using Rotation Thromboelastography Meltem Olga Akay, et al.; Eskişehir, Turkey

Critical Role of Sensitized Serum in Rejection of Allogeneic Bone Marrow Cells Lu-Hong Xu, et al; Guangzhou, China

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study Selma Ünal, et al; Mersin, Ankara, Turkey

Factors Associated with Cytomegalovirus Reactivation Following Allogeneic Hematopoietic Stem Cell Transplantation: Human Leukocyte Antigens Might Be Among the Risk Factors Kadir Acar, et al; Ankara, Turkey

Cover Picture: A. Zahit Bolaman, Spring in Marmaris

3

Editor-in-Chief

International Review Board

Aytemiz Gürgey

Nejat Akar Görgün Akpek Serhan Alkan Çiğdem Altay Koen van Besien Ayhan Çavdar M.Sıraç Dilber Ahmet Doğan Peter Dreger Thierry Facon Jawed Fareed Gösta Gahrton Dieter Hoelzer Marilyn Manco-Johnson Andreas Josting Emin Kansu Winfried Kern Nigel Key Korgün Koral Abdullah Kutlar Luca Malcovati Robert Marcus Jean Pierre Marie Ghulam Mufti Gerassimos A. Pangalis Antonio Piga Ananda Prasad Jacob M. Rowe Jens-Ulrich Rüffer Norbert Schmitz Orhan Sezer Anna Sureda Ayalew Tefferi Nükhet Tüzüner Catherine Verfaillie Srdan Verstovsek Claudio Viscoli

TOBB Economy Technical University Hospital, Ankara, Turkey Maryland School of Medicine, Baltimore, USA Cedars-Sinai Medical Center, USA Ankara, Turkey Chicago Medical Center University, Chicago, USA Ankara, Turkey Karolinska University, Stockholm, Sweden Mayo Clinic Saint Marys Hospital, USA Heidelberg University, Heidelberg, Germany Lille University, Lille, France Loyola University, Maywood, USA Karolinska University Hospital, Stockholm, Sweden Frankfurt University, Frankfurt, Germany Colorado Health Sciences University, USA University Hospital Cologne, Cologne, Germany Hacettepe University, Ankara, Turkey Albert Ludwigs University, Germany University of North Carolina School of Medicine, NC, USA Southwestern Medical Center, Texas, USA Georgia Health Sciences University, Augusta, USA Pavia Medical School University, Pavia, Italy Kings College Hospital, London, UK Pierre et Marie Curie University, Paris, France King’s Hospital, London, UK Athens University, Athens, Greece Torino University, Torino, Italy Wayne State University School of Medicine, Detroit, USA Rambam Medical Center, Haifa, Israel University of Köln, Germany AK St Georg, Hamburg, Germany Memorial Şişli Hospital, İstanbul, Turkey Santa Creu i Sant Pau Hospital, Barcelona, Spain Mayo Clinic, Rochester, Minnesota, USA Istanbul Cerrahpaşa University, İstanbul, Turkey University of Minnesota, Minnesota, USA The University of Texas MD Anderson Cancer Center, Houston, USA San Martino University, Genoa, Italy

Past Editors Erich Frank Orhan Ulutin Hamdi Akan

Language Editor Leslie Demir

Ankara, Turkey

Associate Editors Ayşegül Ünüvar İstanbul University, İstanbul, Turkey

M. Cem Ar İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey

Cengiz Beyan Gulhane Military Medical Academy, Ankara, Turkey

Hale Ören Dokuz Eylül University, İzmir, Turkey

İbrahim C. Haznedaroğlu Hacettepe University, Ankara, Turkey

İlknur Kozanoğlu Başkent University, Adana, Turkey

Mehmet Ertem Ankara University, Ankara, Turkey

A. Muzaffer Demir Trakya University, Edirne, Turkey

Reyhan Diz Küçükkaya İstanbul Bilim University, İstanbul, Turkey

Assistant Editors A. Emre Eşkazan İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey

Ali İrfan Emre Tekgündüz Dr. A. Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey

İnci Alacacıoğlu Dokuz Eylul University, Ankara, Turkey

Nil Güler On Dokuz Mayıs University, Samsun, Turkey

Olga Meltem Akay Osmangazi University, Eskişehir, Turkey

Selami Koçak Toprak Ankara University, Ankara, Turkey

Şule Ünal Hacettepe University, Ankara, Turkey

Veysel Sabri Hançer İstanbul Bilim University, İstanbul, Turkey

Zühre Kaya

Statistic Editor Hülya Ellidokuz

Senior Advisory Board Yücel Tangün Osman İlhan Muhit Özcan

Gazi University, Ankara, Turkey

A-I

Publishing Services

Editorial Office İpek Durusu Bengü Timoçin

GALENOS PUBLISHER Molla Gürani Mah. Kaçamak Sk. No: 21, Fındıkzade, İstanbul, Turkey Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information Editorial Correspondence should be addressed to Dr. Aytemiz Gürgey Editor-in-Chief Address: 725. Sok. Görkem Sitesi Yıldızevler No: 39/2, 06550 Çankaya, Ankara / Turkey Phone : +90 312 438 14 60 E-mail : agurgey@hacettepe.edu.tr

All other inquiries should be adressed to TURKISH JOURNAL OF HEMATOLOGY Address: İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No:8 06550 Çankaya, Ankara / Turkey Phone : +90 312 490 98 97 Fax : +90 312 490 98 68 E-mail : info@tjh.com.tr ISSN: 1300-7777

Turkish Society of Hematology Teoman Soysal, President A. Muzaffer Demir, General Secretary Hale Ören, Vice President İbrahim C. Haznedaroğlu, Research Secretary Fahir Özkalemkaş, Treasurer A. Zahit Bolaman, Member Mehmet Sönmez, Member

Publishing Manager Sorumlu Yazı İşleri Müdürü A. Muzaffer Demir

Management Address Yayın İdare Adresi

Türk Hematoloji Derneği İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No:8 06550 Çankaya, Ankara / Turkey

Publishing House / Yayınevi

Online Manuscript Submission

Molla Gürani Mah. Kaçamak Sk. No: 21, 34093 Fındıkzade, İstanbul, Turkey Tel: +90 212 621 99 25 Faks: +90 212 621 99 27 E-posta: info@galenos.com.tr Baskı: Senk Ofset Matbaacılık Reklam Promosyon ve Tan. Hiz. San. Dış. Tic. Ltd. Şti. Tel.: +90 212 493 26 26 Topkapı Litros yolu, No: 24, Zeytinburnu, İstanbul, Turkey

http://mc.manuscriptcentral.com/tjh

Web page www.tjh.com.tr

Owner on behalf of the Turkish Society of Hematology Türk Hematoloji Derneği adına yayın sahibi Teoman Soysal

Printing Date / Basım Tarihi 15.07.2014

Cover Picture

A. Zahit Bolaman was born in 1959, Turkey.

He is currently working at Adnan Menderes University, Department of Hematology, Aydın. Üç ayda bir yayımlanan İngilizce süreli yayındır.

International scientific journal published quarterly.

Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish Journal of Hematology’nin Türk Hematoloji Derneği İktisadi İşletmesi tarafından yayınlanmasına karar vermiştir.

A-II

AIMS AND SCOPE The Turkish Journal of Hematology is published quarterly (March, June, September, and December) by the Turkish Society of Hematology. It is an independent, non-profit peer-reviewed international English-language periodical encompassing subjects relevant to hematology.

The Editorial Board of The Turkish Journal of Hematology adheres to the principles of the World Association of Medical Editors (WAME), International Council of Medical Journal Editors (ICMJE), Committee on Publication Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and Strengthening the Reporting of Observational Studies in Epidemiology (STROBE).

The aim of The Turkish Journal Hematology is to publish original hematological research of the highest scientific quality and clinical relevance. Additionally, educational material, reviews on basic developments, editorial short notes, case reports, images in hematology, and letters from hematology specialists and clinicians covering their experience and comments on hematology and related medical fields as well as social subjects are published.

General practitioners interested in hematology and internal medicine specialists are among our target audience, and The Turkish Journal of Hematology aims to publish according to their needs. The Turkish Journal of Hematology is indexed, as follows: - PUBMED Central - Science Citation Index Expanded - EMBASE - Scopus - CINAHL - Gale/Cengage Learning - EBSCO - DOAJ - ProQuest - Index Copernicus - Tübitak/Ulakbim Turkish Medical Database - Turk Medline

Impact Factor: 0.340 Subscription Information

The Turkish Journal of Hematology is sent free-of-charge to members of Turkish Society of Hematology and libraries in Turkey and abroad. Hematologists, other medical specialists that are interested in hematology, and academicians could subscribe for only 40 $ per printed issue. All published volumes are available in full text free-ofcharge online at www.tjh.com.tr.

Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97 Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh Web page: www.tjh.com.tr E-mail: info@tjh.com.tr

A-III

Permissions

Requests for permission to reproduce published material should be sent to the editorial office.

Editor: Professor Dr. Aytemiz Gürgey Adress: Ilkbahar Mah, Turan Günes Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97 Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh Web page: www.tjh.com.tr E-mail: info@tjh.com.tr Publisher Galenos Yayinevi Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul Telephone : 0212 621 99 25 Fax : 0212 621 99 27 info@galenos.com.tr

Instructions for Authors Instructions for authors are published in the journal and at www. tjh.com.tr

Material Disclaimer Authors are responsible for the manuscripts they publish in The Turkish Journal of Hematology. The editor, editorial board, and publisher do not accept any responsibility for published manuscripts.

The journal is printed on acid-free paper.

Editorial Policy Following receipt of each manuscript, a checklist is completed by the Editorial Assistant. The Editorial Assistant checks that each manuscript contains all required components and adheres to the author guidelines, after which time it will be forwarded to the Editor in Chief. Following the Editor in Chief’s evaluation, each manuscript is forwarded to the Associate Editor, who in turn assigns reviewers.

Generally, all manuscripts will be reviewed by at least three reviewers selected by the Associate Editor, based on their relevant expertise.

Associate editor could be assigned as a reviewer along with the reviewers. After the reviewing process, all manuscripts are evaluated in the Editorial Board Meeting.

Turkish Journal of Hematology’s editor and Editorial Board members are active researchers. It is possible that they would desire to submit their manuscript to the Turkish Journal of Hematology.

This may be creating a conflict of interest. These manuscripts will not be evaluated by the submitting editor(s). The review process will be managed and decisions made by editor-in-chief who will act independently. In some situation, this process will be overseen by an outside independent expert in reviewing submissions from editors.

TURKISH JOURNAL OF HEMATOLOGY INSTRUCTIONS TO AUTHORS The Turkish Journal of Hematology accepts invited review articles, research articles, brief reports, case reports, letters to the editor, and hematological images that are relevant to the scope of hematology, on the condition that they have not been previously published elsewhere. Basic science manuscripts, such as randomized, cohort, cross-sectional, and case control studies, are given preference. All manuscripts are subject to editorial revision to ensure they conform to the style adopted by the journal. There is a single blind kind of reviewing system.

Manuscripts should be prepared according to ICMJE guidelines (http://www.icmje.org/). Original manuscripts require a structured abstract. Label each section of the structured abstract with the appropriate subheading (Objective, Materials and Methods, Results, and Conclusion). Case reports require short unstructured abstracts.

Letters to the editor do not require an abstract. Research or project support should be acknowledged as a footnote on the title page.

Technical and other assistance should be provided on the title page.

Conflict-of-Interest Statement: To prevent potential conflicts of interest from being overlooked, this statement must be included in each manuscript. In case there are conflicts of interest, every author should complete the ICMJE general declaration form, which can be obtained at: http://www.icmje.org/coi_disclose.pdf.

Abstract and Keywords: The second page should include an abstract that does not exceed 300 words. For manuscripts sent by authors in Turkey, a title and abstract in Turkish are also required. As most readers read the abstract first, it is critically important. Moreover, as various electronic databases integrate only abstracts into their index, important findings should be presented in the abstract.

Objective: The abstract should state the objective (the purpose of the study and hypothesis) and summarize the rationale for the study.

Materials and Methods: Important methods should be written respectively.

Results: Important findings and results should be provided here.

Conclusion: The study’s new and important findings should be highlighted and interpreted.

Original Manuscripts Title Page Title: The title should provide important information regarding the manuscript’s content. The title must specify that the study is a cohort study, cross-sectional study, case control study, or randomized study (i.e. Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability of ferrous succinate tablet formulations without correction for baseline circadian changes in iron concentration in healthy Chinese male subjects: A single-dose, randomized, 2-period crossover study. Clin Ther. 2011; 33: 2054-2059).

The title page should include the authors’ names, degrees, and institutional/professional affiliations, a short title, abbreviations, keywords, financial disclosure statement, and conflict of interest statement. If a manuscript includes authors from more than one institution, each author’s name should be followed by a superscript number that corresponds to their institution, which is listed separately.

Please provide contact information for the corresponding author, including name, e-mail address, and telephone and fax numbers.

Running Head: The running head should not be more than 40 characters, including spaces, and should be located at the bottom of the title page.

Word Count: A word count for the manuscript, excluding abstract, acknowledgments, figure and table legends, and references, should be provided not exceed 2500 words. The word count for an abstract should be not exceed 300 words.

A-IV

Other types of manuscripts, such as case reports, reviews, perspectives, and editorials, will be published according to uniform requirements.

Provide 3-10 keywords below the abstract to assist indexers. Use terms from the Index Medicus Medical Subject Headings List (for randomized studies a CONSORT abstract should be provided (http://www.consort-statement.org).

Introduction: The introduction should include an overview of the relevant literature presented in summary form (one page), and what ever remains interesting, unique, problematic, relevant, or unknown about the topic must be specified. The introduction should conclude with the rationale for the study, its design, and its objective(s).

Materials and Methods: Clearly describe the selection of observational or experimental participants, such as patients, laboratory animals, and controls, including inclusion and exclusion criteria and a description of the source population. Identify the methods and procedures in sufficient detail to allow other researchers to reproduce your results.

Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for using them and an evaluation of their limitations.

Identify all drugs and chemicals used, including generic names, doses, and routes of administration. The section should include only information that was available at the time the plan or protocol for the study was devised (http://www.strobe-statement.org/fileadmin/ Strobe/uploads/checklists/STROBE_checklist_v4_combined.pdf).

Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported results. Statistically important data should be given in the text, tables and figures. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used.

Results: Present your results in logical sequence in the text, tables, and figures. Do not present all the data provided in the tables and/or figures in the text; emphasize and/or summarize only important findings, results, and observations in the text. For clinical studies provide the number of samples, cases, and controls included in the study. Discrepancies between the planned number and obtained number of participants should be explained. Comparisons, and statistically important values (i.e. P value and confidence interval) should be provided.

Discussion: This section should include a discussion of the data.

New and important findings/results, and the conclusions they lead to should be emphasized. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by the data. Do not repeat the findings/results in detail; important findings/results should be compared with those of similar studies in the literature, along with a summarization. In other words, similarities or differences in the obtained findings/results with those previously reported should be discussed. Limitations of the study should be detailed. In addition, an evaluation of the implications of the obtained findings/results for future research should be outlined.

4. Book Chapter Perutz MF. Molecular anatomy and physiology of hemoglobin. In: Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin: Genetics, Pathophysiology, Clinical Management. New York, Cambridge University Press, 2000.

5.Abstract Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin) stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).

6.Letter to the Editor Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further definition of 20q deletion in myeloid leukemia using fluorescence in situ hybridization. Blood 1994;84:2821-2823.

7. Supplement Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant. 2005;9(Suppl 7):81-86

Brief Reports

Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow transplantation from unrelated donors for patients with aplastic anemia after failure immunosuppressive therapy. Blood 2006;108:1485-1491.

Abstract length: Not to exceed 300 words.

Article length: Not to exceed 1200 words.

Introduction: State the purpose and summarize the rationale for the study.

Materials and Methods: Clearly describe the selection of the observational or experimental participants. Identify the methods and procedures in sufficient detail. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for their use and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration.

Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported findings/results. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used.

Results: Present the findings/results in a logical sequence in the text, tables, and figures. Do not repeat all the findings/results in the tables and figures in the text; emphasize and/or summarize only those that are most important.

Discussion: Highlight the new and important findings/results of the study and the conclusions they lead to. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by your data.

2.Organization as author

Case Reports

Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of syngeneic bone marrow graft without preconditioning in posthepatitis marrow aplasia. Lancet 1977;2:742-744.

Abstract length: Not to exceed 300 words.

Article length: Not to exceed 1200 words.

3.Book

Abstract

References Cite references in the text, tables, and figures with numbers in parentheses. Number references consecutively according to the order in which they first appear in the text. Journal titles should be abbreviated according to the style used in Index Medicus (consult List of Journals Indexed in Index Medicus). Include among the references any paper accepted, but not yet published, designating the journal and followed by, in press.

Examples of References: 1. List all authors.

Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961.

A-V

Case reports should be structured as follows: An unstructured abstract that summarizes the case.

Introduction: A brief introduction (recommended length: 1-2 paragraphs).

Case Presentation: This section describes the case in detail, including the initial diagnosis and outcome.

Discussion:This section should include a brief review of the relevant literature and how the presented case furthers our understanding to the disease process.

Invited Review Articles Abstract length: Not to exceed 300 words.

Article length: Not to exceed 4000 words.

Review articles should not include more than 100 references.

Reviews should include a conclusion, in which a new hypothesis or study about the subject may be posited. Do not publish methods for literature search or level of evidence. Authors who will prepare review articles should already have published research articles on therel evant subject. The study’s new and important findings should be highlighted and interpreted in the Conclusion section. There should be a maximum of two authors for review articles.

Images in Hematology Article length: Not exceed 200 words.

Authors can submit for consideration an illustration and photos that is interesting, instructive, and visually attractive, along with a few lines of explanatory text and references. Images in Hematology can include no more than 200 words of text, 5 references, and 3 figure or table. No abstract, discussion or conclusion are required but please include a brief title.

Authorship Each author should have participated sufficiently in the work to assume public responsibility for the content. Any portion of a manuscript that is critical to its main conclusions must be the responsibility of at least 1 author.

Contributor’s Statement All submissions should contain a contributor’s statement page. Each manuscript should contain substantial contributions to idea and design, acquisition of data, or analysis and interpretation of findings.

All persons designated as an author should qualify for authorship, and all those that qualify should be listed. Each author should have participated sufficiently in the work to take responsibility for appropriate portions of the text.

Acknowledgments Acknowledge support received from individuals, organizations, grants, corporations, and any other source. For work involving a biomedical product or potential product partially or wholly supported by corporate funding, a note stating, “This study was financially supported (in part) with funds provided by (company name) to (authors’ initials)”, must be included. Grant support, if received, needs to be stated and the specific granting institutions’ names and grant numbers provided when applicable.

Authors are expected to disclose on the title page any commercial or other associations that might pose a conflict of interest in connection with the submitted manuscript. All funding sources that supported the work and the institutional and/or corporate affiliations of the authors should be acknowledged on the title page.

Ethics

Letters to the Editor Article length: Not to exceed 500 words.

Letters can include no more than 500 words of text, 5-10 references, and 1 figure or table. No abstract is required, but please include a brief title.

Tables Supply each table on a separate file. Number tables according to the order in which they appear in the text, and supply a brief caption for each. Give each column a short or abbreviated heading. Write explanatory statistical measures of variation, such as standard deviation or standard error of mean. Be sure that each table is cited in the text.

Figures Figures should be professionally drawn and/or photographed.

Authors should number figures according to the order in which they appear in the text. Figures include graphs, charts, photographs, and illustrations. Each figure should be accompanied by a legend that does not exceed 50 words. Use abbreviations only if they have been introduced in the text. Authors are also required to provide the level of magnification for histological slides. Explain the internal scale and identify the staining method used. Figures should be submitted as separate files, not in the text file. High-resolution image files are not preferred for initial submission as the file sizes may be too large. The total file size of the PDF for peer review should not exceed 5 MB.

A-VI

When reporting experiments conducted with humans indicate that the procedures were in accordance with ethical standards set forth by the committee that oversees human experimentation. Approval of research protocols by the relevant ethics committee, in accordance with international agreements (Helsinki Declaration of 1975, revised 2002 available at http://www.wma.net/e/policy/b3.htm, “Guide for the Care and use of Laboratory Animals” www.nap.edu/catalog/5140. html/), is required for all experimental, clinical, and drug studies.

Patient names, initials, and hospital identification numbers should not be used. Manuscripts reporting the results of experimental investigations conducted with humans must state that the study protocol received institutional review board approval and that the participants provided informed consent.

Non-compliance with scientific accuracy is not in accord with scientific ethics. Plagiarism: To re-publish-whole or in part-the contents of another author’s publication as one’s own without providing a reference. Fabrication: To publish data and findings/results that do not exist. Duplication: Use of data from another publication, which includes re-publishing a manuscript in different languages.

Salamisation: To create more than one publication by dividing the results of a study preternaturally.

We disapprove of such unethical practices as plagiarism, fabrication, duplication, and salamisation, as well as efforts to influence the review process with such practices as gifting authorship, inappropriate acknowledgements, and references. Additionally, authors must respect participant right to privacy.

On the other hand, short abstracts published in congress books that do not exceed 400 words and present data of preliminary research, and those that are presented in an electronic environment are not accepted pre-published work. Authors in such situation must declare this status on the first page of the manuscript and in the cover letter.

(The COPE flowchart is available at: http://publicationethics.org) We use iThenticate to screen all submissions for plagiarism before publication.

Turkish Journal of Hematology uses plagiarism screening service to verify the originality of content submitted before publication.

Conditions of Publication All authors are required to affirm the following statements before their manuscript is considered: 1. The manuscript is being submitted only to The Turkish Journal of Hematology; 2. The manuscript will not be submitted elsewhere while under consideration by The Turkish Journal of Hematology; 3. The manuscript has not been published elsewhere, and should it be published in The Turkish Journal of Hematology it will not be published elsewhere without the permission of the editors (these restrictions do not apply to abstracts or to press reports for presentations at scientific meetings); 4. All authors are responsible for the manuscript’s content; 5. All authors participated in the study concept and design, analysis and interpretation of the data, drafting or revising of the manuscript, and have approved the manuscript as submitted. In addition, all authors are required to disclose any professional affiliation, financial agreement, or other involvement with any company whose product figures prominently in the submitted manuscript.

Authors of accepted manuscripts will receive electronic page proofs and are responsible for proofreading and checking the entire article within two days. Failure to return the proof in two days will delay publication.

If the authors cannot be reached by email or telephone within two weeks, the manuscript will be rejected and will not be published in the journal.

Copyright At the time of submission all authors will receive instructions for submitting an online copyright form. No manuscript will be considered for review until all authors have completed their copyright form. Please note, it is our practice not to accept copyright forms via fax, e-mail, or postal service unless there is a problem with the online author accounts that cannot be resolved. Every effort should be made to use the online copyright system. Corresponding authors can log in to the submission system at any time to check the status of any co-author’s copyright form. All accepted manuscripts become the permanent property of The Turkish Journal of Hematology and may not be published elsewhere-in whole or in part-without written permission.

Note: We cannot accept any copyright that has been altered, revised, amended, or otherwise changed. Our original copyright form must be used as is.

A-VII

Units of Measurement Measurements should be reported using the metric system, according to the International System of Units (SI). Consult the SI Unit Conversion Guide, New England Journal of Medicine Books, 1992.

An extensive list of conversion factors can be found at http://www. unc.edu/~rowlett/units/scales/clinical_data.html. For more details, see http://www.amamanualofstyle.com/oso/public/jama/si_conversion_ table.html . Example for CBC.

Hematology component

SI units

RBC

6.7-11 x 1012/L

WBC

5.5-19.5 x109/L

Hemoglobin

116-168 g/L

PCV

0.31-0.46 L/L

MCV

39-53 fL

MCHC

300-360 g/L

MCH

19.5-25 pg

Platelets

300-700 x 109/L

Source: http://www.vetstream.com/felis/Corporate/993fhtm/ha-mat.htm

Abbreviations and Symbols Use only standard abbreviations. Avoid abbreviations in the title and abstract. The full term for an abbreviation should precede its first use in the text, unless it is a standard abbreviation. All acronyms used in the text should be expanded at first mention, followed by the abbreviation in parentheses; thereafter the acronym only should appear in the text.

Acronyms may be used in the abstract if they occur 3 or more times therein, but must be reintroduced in the body of the text. Generally, abbreviations should be limited to those defined in the AMA Manual of Style, current edition. A list of each abbreviation (and the corresponding full term) used in the manuscript must be provided on the title page.

Online Manuscript Submission Process The Turkish Journal of Hematology uses submission software powered

by ScholarOne Manuscripts. The website for submissions to The Turkish Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This system is quick and convenient, both for authors and reviewers.

Setting up an account New users to the submission site will need to register and enter their account details before they can submit a manuscript. Log in, or click the “Create Account” button if you are a first-time user. To create a new account: After clicking the “Create Account” button, enter your name and e-mail address, and then click the “Next” button. Your

e-mail address is very important. Enter your institution and address information, as appropriate, and then click the “Next” Button. Enter a user ID and password of your choice, select your area of expertise, and then click the “Finish” button.

If you have an account, but have forgotten your log-in details, go to “Password Help” on the journal’s online submission system and enter your e-mail address. The system will send you an automatic user ID and a new temporary password.

Full instructions and support are available on the site, and a user ID and password can be obtained during your first visit. Full support for authors is provided. Each page has a “Get Help Now” icon that connects directly to the online support system. Contact the journal administrator with any questions about submitting your manuscript to the journal (info@tjh.com.tr). For ScholarOne Manuscripts customer support, click on the “Get Help Now” link on the top right hand corner of every page on the site.

The Electronic Submission Process Log in to your author center. Once you have logged in, click the “Submit a Manuscript” link in the menu bar. Enter the appropriate data and answer the questions. You may copy and paste directly from your manuscript. Click the “Next” button on each screen to save your work and advance to the next screen.

Upload Files Click on the “Browse” button and locate the file on your computer.

Select the appropriate designation for each file in the drop-down menu next to the “Browse” button. When you have selected all the files you want to upload, click the “Upload Files” button. Review your submission before sending to the journal. Click the “Submit” button when you are finished reviewing. You can use ScholarOne Manuscripts at any time to check the status of your submission. The journal’s editorial office will inform you by e-mail once a decision has been made. After your manuscript has been submitted, a checklist will then be completed by the Editorial Assistant. The Editorial Assistant will check that the manuscript contains all required components and adheres to the author guidelines. Once the Editorial Assistant is satisfied with the manuscript it will be forwarded to the Senior Editor, who will assign an editor and reviewers.

The Review Process Each manuscript submitted to The Turkish Journal of Hematology is subject to an initial review by the editorial office in order to determine if it is aligned with the journal’s aims and scope, and complies with essential requirements. Manuscripts sent for peer review will be assigned to one of the journal’s associate editors that has expertise relevant to the manuscript’s content. All manuscripts are single-blind peer reviewed. All accepted manuscripts are sent to a statistical and English language editor before publishing. Once papers have been reviewed, the reviewers’ comments are sent to the Editor, who will then make a preliminary decision on the paper. At this stage, based on the feedback from reviewers, manuscripts can be accepted, rejected, or revisions can be recommended. Following initial peer-review, articles

A-VIII

judged worthy of further consideration often require revision. Revised manuscripts generally must be received within 3 months of the date of the initial decision. Extensions must be requested from the Associate Editor at least 2 weeks before the 3-month revision deadline expires; The Turkish Journal of Hematology will reject manuscripts that are not received within the 3-month revision deadline. Manuscripts with extensive revision recommendations will be sent for further review (usually by the same reviewers) upon their re-submission. When a manuscript is finally accepted for publication, the Technical Editor undertakes a final edit and a marked-up copy will be e-mailed to the corresponding author for review and to make any final adjustments.

Submission of Revised Papers When revising a manuscript based on the reviewers’ and Editor’s feedback, please insert all changed text in red. Please do not use track changes, as this feature can make reading difficult. To submit revised manuscripts, please log into your author center at ScholarOne Manuscripts. Your manuscript will be stored under “Manuscripts with Decisions”. Please click on the “Create a Revision” link located to the right of the manuscript title. A revised manuscript number will be created for you; you will then need to click on the “Continue Submission” button. You will then be guided through a submission process very similar to that for new manuscripts. You will be able to amend any details you wish. At stage 6 (“File Upload”), please delete the file for your original manuscript and upload the revised version. Additionally, please upload an anonymous cover letter, preferably in table format, including a point-by-point response to the reviews’ revision recommendations. You will then need to review your paper as a PDF and click the “Submit” button. Your revised manuscript will have the same ID number as the original version, but with the addition of an R and a number at the end, for example, TJH-2011-0001 for an original and TJH-2011-0001.R1, indicating a first revision; subsequent revisions will end with R2, R3, and so on. Please do not submit a revised manuscript as a new paper, as revised manuscripts are processed differently. If you click on the “Create a Revision” button and receive a message stating that the revision option has expired, please contact the Editorial Assistant at info@tjh.com.tr to reactivate the option.

English Language Editing All manuscripts are professionally edited by an English language editor prior to publication.

Online Early The Turkish Journal of Hematology publishes abstracts of accepted manuscripts online in advance of their publication in print. Once an accepted manuscript has been edited, the authors have submitted any final corrections, and all changes have been incorporated, the manuscript will be published online. At that time the manuscript will receive a Digital Object Identifier (DOI) number. Both forms can be found at www.tjh.com.tr. Authors of accepted manuscripts will receive electronic page proofs directly from the printer, and are responsible for proofreading and checking the entire manuscript, including tables, figures, and references. Page proofs must be returned within 48 hours to avoid delays in publication.

CONTENTS

Memorial

A-XI

Prof. Dr. Burhan (Mehmet Burhanettin) SAY (1923-2014) Şinasi Özsoylu

216

Review Article

226

Research Articles

231

Different Types of Cell Cycle- and Apoptosis-Related Gene Expressions Alter in Corticosteroid-, Vincristine-, and Melphalan-Resistant U-266 Multiple Myeloma Cell Lines Pelin Mutlu, Ali Uğur Ural, Ufuk Gündüz

239

The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the World Health Organization for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation Jan Jacques Michiels, Fibo Ten Kate, King H. Lam, Wilfried Schroyens, Zwi Berneman, Hendrik De Raeve

255

Tumor Necrosis Factor-Superfamily 15 Gene Expression in Patients with Sickle Cell Disease Ahmet Ata Özçimen, Selma Ünal, Necmiye Canacankatan, Şerife Efsun Antmen

261

The Evaluation of Hydroxyethyl Starch (6% HES 130/0.4) Solution’s Potential Preventive Effects on Coagulation Status in Women with Gynecologic Malignancies Using Rotation Thromboelastograph Meltem Olga Akay, Ayten Bilir, Tufan Öge, Gökhan Kuş, Fezan Şahin Mutlu

266

Critical Role of Sensitized Serum in Rejection of Allogeneic Bone Marrow Cells Lu-Hong Xu, Jian-Pei Fang, Wen-Jun Weng, Hong-Gui Xu

272

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study Selma Ünal, Günay Balta, Fatma Gümrük

276

Factors Associated with Cytomegalovirus Reactivation Following Allogeneic Hematopoietic Stem Cell Transplantation: Human Leukocyte Antigens Might Be Among the Risk Factors Kadir Acar, Şahika Zeynep Akı, Zübeyde Nur Özkurt, Gülendam Bozdayı, Seyyal Rota, Gülsan Türköz Sucak

Case Reports

286

Solitary Bone Plasmacytoma Progressing into Retroperitoneal Plasma Cell Myeloma with No Related End Organ or Tissue Impairment: A Case Report and Review of the Literature Gargi Tikku, Jain, Monica, Mridha Asit, Grover Rajesh

290

Blastoid Variant Mantle Cell Lymphoma with Complex Karyotype Including 11q Duplication Özge Özer, Selami K. Toprak, Enver Öte, Zerrin Yılmaz, Feride İffet Şahin

295

Extramedullary Myeloid Tumor Involving the Pancreas: A Case Report and Review of the Literature Semra Paydaş, Hakan Özdoğu, Meral Günaldı, Veysel Haksöyler, Arbil Açıkalın, Melek Ergin

Atypical Hemolytic Uremic Syndrome: Differential Diagnosis from TTP/HUS and Management Mustafa N. Yenerel

Identification and Genetic Analysis of a Factor IX Gene Intron 3 Mutation in a Hemophilia B Pedigree in China Dong-Hua Cao, Xiao-Li Liu, Kai Mu, Xiang-Wei Ma, Jing-Li Sun, Xiao-Zhong Bai, Chang-Kun Lin, Chun-Lian Jin

A-IX

301

Extramedullary, Solitary Plasmacytoma of the Frontal Sinus. Case Report and Turkish Literature Review Ayşegül Verim, Shahrouz Sheidaii, Ömer Bilaç, Çiğdem Tepe Karaca, Barış Naiboğlu

307

Letters to the Editor

309

Toxoplasmosis-Associated Hemophagocytosis in a Preterm Newborn Sema Arayıcı, Fatma Nur Sarı, Neşe Yaralı, Mehmet Yekta Öncel, Gülsüm Kadıoğlu Şimşek, Nurdan Uras, Uğur Dilmen

311

Thalassemia Intermedia and Acute Lymphoblastic Leukemia: Is it a Coincidental Double Diagnosis?

Deniz Tuğcu, Zeynep Karakaş, Müge Gökçe, Leyla Ağaoğlu, Ayşegül Ünüvar, Ebru Sarıbeyoğlu, Arzu Akcay, Ömer Devecioğlu

313

A Rare Cause of Recurrent Oral Lesions: Chediak-Higashi Syndrome Müsemma Karabel, Selvi Kelekçi, Velat Şen, Duran Karabel, Çiğdem Aliosmanoğlu, Murat Söker

315

Renal Infiltration of Follicular Lymphoma Ivan Petković, Miljan Krstić, Ivica Pejcić, Svetislav Vrbić, Slavica Stojnev, Ana Cvetanović, Mirjana Balić, Mirjana Todorović

317

Hemoglobin Lansing (Alpha) [HBA2 CD87 (HIS>GLU) (C>A)] in a Turkish Individual Resulting from Another Nucleotide Substitution Nejat Akar, Didem Torun, Ayşenur Öztürk

319

First Observation of Hemoglobin Jabalpur [Beta 3 (NA3) Leu>Pro] in the Turkish Population Ayfer Çolak, Burak Toprak, Kanay Yararbaş, Fatma Akyol, Cengiz Ceylan

321

Multiple Liver and Muscle Abscesses and Sepsis with Bacillus pantothenticus in a Leukemia Patient Elif Gülsüm Ümit, Hasan Celalettin Ümit, Figen Kuloğlu, Ahmet Muzaffer Demir

323

A Systemic Lupus Erythematosus Patient with Isolated Neutropenia and Diminished Expression of CD55 and CD59 Similar to Paroxysmal Nocturnal Hemoglobinuria Abdülkerim Yıldız, Merih Kızıl Çakar, Elif Suyanı, Gülsan Türköz Sucak

325

Clofarabine Experience in Children with Multi-Relapsed Acute Leukemia Zeynep Karakaş, Begüm Şirin Koç, Serap Karaman, Sema Anak, Ayşegül Ünüvar, Ezgi Uysalol, Ömer Devecioğlu, Leyla Ağaoğlu, Gülyüz Öztürk

328

HBV and HCV Coinfection Associated with Warm-Type Autoimmune Hemolytic Anemia: A Case Report Quan-le Zhang, Li-juan Jia, Jin-biao Zhang, Wei-min Li, Yuan-kai Bo1, Jing-Li

332

Central Nervous System Involvement in Primary Adrenal Non-Hodgkin Lymphoma Padhi Somanath, Sahoo Jayaprakash

335

Images in Hematology

337

Unusual Manifestations of Vincristine Neuropathy: Report of Two Cases of Hodgkin Lymphoma Olga Meltem Akay, Eren Gündüz, Ercan Kaya, Mahmut Kebapcı, Zafer Gülbaş

339

Isolated Zinc Deficiency Causing Severe Microcytosis and Sideroblastic Anemia Gupta Shweta, Jain Prantesh, Sukhal Shashvat

Hemophagocytic Lymphohistiocytosis Syndrome Associated with Gaucher Disease Type 2 Bahoush Gholamreza, Miri-Aliabad Ghasem

Diagnosis: Infantile Malign Osteopetrosis Sevgin Taner, Ali Fettah, Neşe Yaralı, Sevde Seçer, Özge Ağlamış, Bahattin Tunç

A-X

Review Article

DOI: 10.4274/tjh.2013.0374

Atypical Hemolytic Uremic Syndrome: Differential Diagnosis from TTP/HUS and Management Atipik Hemolitik Üremik Sendrom: TTP/HÜS ile Ayırıcı Tanısı ve Tedavisi Mustafa N. Yenerel İstanbul University İstanbul Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey

Abstract: Atypical hemolytic uremic syndrome (aHUS) is a rare form of thrombotic microangiopathy (TMA). It has an unfavorable outcome with death rates as high as 25% during the acute phase and up to 50% of cases progressing to end-stage renal failure.

Uncontrolled complement activation through the alternative pathway is thought to be the main underlying pathopysiology of aHUS and corresponds to all the deleterious findings of the disease. Thrombotic thrombocytopenic purpura (TTP) and Shiga toxin-associated HUS are the 2 other important TMA diseases. Although differentiating HUS from TTP is relatively easy in children with a preceding diarrheal illness or invasive S. pneumoniae, differentiating aHUS from TTP or other microangiopathic disorders can present a major diagnostic challenge in adults. ADAMTS13 analysis is currently the most informative diagnostic test for differentiating TTP, congenital TTP, and aHUS. Today empiric plasma therapy still is recommended by expert opinion to be used as early as possible in any patient with symptoms of aHUS. The overall treatment goal remains restoration of a physiological balance between activation and control of the alternative complement pathway. So it is a reasonable approach to block the terminal complement complex with eculizumab in order to prevent further organ injury and increase the likelihood organ recovery. Persistence of hemolysis or lack of improvement of renal function after 3-5 daily plasmaphereses have to be regarded as the major criteria for uncontrolled TMA even if platelet count has normalized and as an indication to switch the treatment to eculizumab. Eculizumab has changed the future perspectives of patients with aHUS and both the FDA and the EMA have approved it as life-long treatment. However, there are still some unresolved issues about the follow-up such as the optimal duration of eculizumab treatment and whether it can be stopped or how to stop the therapy.

Key Words: Atypical hemolytic uremic syndrome (aHUS), Thrombotic thrombocytopenic purpura (TTP), Eculizumab, TTP/ HUS, Thrombotic microangiopathy (TMA), ADAMTS13

Özet: Atipik hemolitik üremik sendrom (aHÜS) trombotik mikroanjiopatilerin nadir görülen bir şeklidir. Kötü seyirli bir sendrom kabul edilen aHÜS olgularında özellikle akut dönemlerinde %25’e varan oranlarda ölüm riski mevcuttur ve yine olguların %50’ sinde son dönem böbrek yetersizliği ile sonuçlanır. Komplemanın alternatif yolağının kontrolsüz aktivasyonu sonucu oluştuğuna inanılan aHÜS olgularında tüm klinik bulgulardan da yine bu kontrolsüz kompleman aktivasyonu sorumlu tutulmaktadır. Trombotik trombositopenik purpura (TTP) ve Shiga toksinle ilişkili HÜS diğer iki önemli TMA nedenidir.

TTP ve HÜS ayırımı özellikle çocuklarda hastalığın hemen öncesinde saptanan diyare ya da invazif pnömoni varlığı sayesinde kolaylıkla yapılabilmektedir. Fakat erişkinde aHÜS olgularını TTP olgularından ya da diğer TMA nedenlerinden ayırmak zordur. ADAMTS13 analizi günümüzde TTP, konjenital TTP ve aHÜS olgularının ayırımında kullanılan en önemli inceleme Address for Correspondence: Mustafa N. YENEREL, M.D., İstanbul University İstanbul Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey Phone: +90 532 424 26 40 E-mail: mnyenerel@gmail.com Received/Geliş tarihi : November 6, 2013 Accepted/Kabul tarihi : June 9, 2014

216

Yenerel MN: Atypical Hemolytic Uremic Syndrome: Differential Diagnosis from TTP/HUS and Management

Turk J Hematol 2014;31:216-225

yöntemidir. Günümüzde aHÜS bulgularıyla başvuran hastalarda acil olarak plazma tedavisine başlanması hala uzman görüşü olarak tavsiye edilen bir tedavi seçeneğidir. Asıl tedavi beklentisi ise alternatif kompleman yolağının aktivasyonu ve kontrolü arasındaki fizyolojik dengenin sağlanmasıdır. Bu nedenle özellikle daha fazla organ hasarı gelişmesini önlemek ve oluşan hasarın düzeltilmesini sağlayabilmek için en makul tedavi seçeneği eculizumab ile terminal kompleman kompleksinin oluşmasının engellenmesidir. Kontrolsüz TMA olgularında özellikle üç ya da beş günlük plazmaferez tedavisiyle hemolizin kontrol altına alınamaması ve böbrek foksiyonlarında düzelme sağlanamaması trombositler düzelse bile eculizumab tedavisine geçilmesi için major kriter kabul edilmektedir. Eculizumab hem FDA hem de EMA tarafından aHÜS olgularının tedavisinde hayat boyu kullanımı için onaylanmış bir tedavidir ve günümüzde aHÜS olgularının seyrini değiştirmiştir. Fakat eculizumab tedavisinin aHÜS tedavisindeki optimum süresinin ne olduğu, takip sırasında ilacın kesilip kesilemeyeceği, ya da nasıl kesileceği gibi konular henüz açıklığa kavuşmamıştır.

Anahtar Sözcükler: Atipik hemolitik üremik sendrom (aHÜS), Trombotik trombositopenik purpura (TTP), Trombotik mikroanjiopati (TMA), TTP/HUS, Eculizumab, ADAMTS13 Introduction Hemolytic uremic syndrome (HUS) is a rare and severe thrombotic microangiopathy (TMA) characterized by the triad of microangiopathic hemolytic anemia, thrombocytopenia, and renal impairment. The disorder occurs most frequently in children under the age of 5 years, with an overall incidence of 1 to 2 cases per 100,000. The disease is generally caused by infectious agents and usually has a favorable outcome. Approximately half of the patients require dialysis during acute episodes, but renal function recovers in most of them [1,2]. A history of diarrhea is essential to define the diagnosis of postinfectious HUS and is generally seen 2 weeks before the episode [3]. The enterohemorrhagic Escherichia coli serotypes producing Shiga toxin are the most common infectious agents causing HUS. Shigella is the second important infectious agent that can cause HUS with the deleterious effects of Shiga toxins.

Streptococcus pneumoniae is another important infectious agent that can provoke more aggressive clinical forms [4,5,6,7]. Canadian pediatricians compared Streptococcus pneumoniae-related HUS cases with Shiga toxin-associated HUS and found that Streptococcus pneumoniae-related HUS patients were more likely to require dialysis and had a longer duration of hospitalization [8]. E. coli-associated HUS often occurs in clusters or outbreaks. In the absence of outbreaks, physicians are more likely to encounter atypical HUS (aHUS) than Shiga toxin-associated HUS. Approximately 5%-10% of HUS cases are classified as aHUS because they are not caused by Shiga toxinproducing bacteria or streptococci; these cases comprise a heterogeneous group of patients. The clinical outcome is unfavorable in this group, with death rates as high as 25% during the acute phase and up to 50% of cases progressing to end-stage renal failure (ESRF) [9,10]. This article reviews current concepts about the pathophysiology of aHUS and differential diagnosis from thrombotic thrombocytopenic purpura TTP/HUS and management.

Epidemiology aHUS is considered to be an extremely rare disease.

Although there are limited data available in the literature

about the incidence and prevalence of this entity, the estimated incidence rate was given as 1-2 cases per million annually in the United States [7]. In the European HUS registry, 167 patients were identified and the calculated prevalence of aHUS/recurrent HUS was reported as 3.3 per million-child population (<18 years) [11]. The age distribution is different and the prevalence in adults is expected to be lower, but clear data are not yet available. aHUS represents 5%-10% of HUS cases in children, but the majority of HUS is seen in adults.

The incidence of complement-aHUS is not known precisely.

However, more than 1000 aHUS patients investigated for complement abnormalities have been reported [12].

Pathophysiology of Thrombotic Microangiopathies TMA is a pathological process characterized by thickening of arterioles and capillaries, endothelial swelling and detachment, subendothelial accumulation of proteins and cell debris, and fibrin and platelet thrombi obstruction of vessel lumina [13]. TMA predominantly affects the renal microvasculature, although the brain, heart, lungs, and gastrointestinal tract may also be involved, ultimately leading to organ dysfunction [14,15,16,17,18]. TMA may result from 4 types of lesions: von Willebrand factor (VWF)platelet thrombi with no or minimal microangiopathy; fibrin-platelet thrombi, as exemplified by disseminated intravascular coagulopathy (DIC); inflammatory or proliferative microangiopathy accompanied with variable fibrin thrombi; or intravascular clusters of cancer cells [19].

TTP was originally defined pathologically as a systemic disease with widespread VWF-platelet thrombi in the arterioles and capillaries of multiple organs [20,21]. Advances in recent years have demonstrated that VWF-platelet thrombi result from a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 13 (ADAMTS13) deficiency. TTP is now defined as a thrombotic disorder resulting from severe ADAMTS13 deficiency. Autoimmune inhibitors against ADAMTS13 account for most of the cases, known as acquired TTP [22]. Genetic mutations are also found in a small number of patients with ADAMTS13 deficiency [19,23]. In Shiga-like toxin-producing E. coli HUS, the toxin triggers endothelial complement deposition through the upregulation of P-selectin and possibly interferes 217

Turk J Hematol 2014;31:216-225

Yenerel MN: Atypical Hemolytic Uremic Syndrome: Differential Diagnosis from TTP/HUS and Management

with the activity of complement regulatory molecules [24].

Evidence shows that Shiga toxins might directly contribute to complement activation as documented by C3 deposition on microvascular endothelial cell lines exposed to Shiga toxin and then perfused with human serum [25].

Complement activation products have been detected in the serum and plasma of HUS patients, and an in vitro study could show that Shiga toxin not only damages the kidneys directly but also indirectly via a complement, in 2 ways. First, it activates the complement, and second, it delays the functions of its control protein factor H on the cell surface, both known to damage the kidney [26,27].

Today, TMAs are classified into 4 groups. Group I includes TTP with severe ADAMTS13 deficiency due to autoimmune inhibitors or genetic mutations. Group II includes aHUS with defective complement regulation due to genetic mutations or autoantibodies of the activators or regulators of the complement pathway. Group III includes TMA via other mechanisms such as toxin-associated or drug-related HUS, and Group IV includes other types of pathology such as fibrin platelet thrombosis (e.g., DIC, HELLP syndrome, catastrophic antiphospholipid syndrome, heparininduced thrombocytopenia, or paroxysmal nocturnal hemoglobinuria) or malignancy- and vasculitis-associated thrombosis. Tsai reported that comorbid conditions such as infections, inflammation, surgery, trauma, pregnancy, intravenous contrast agents, and pancreatitis may trigger acute presentation in patients with preexisting TTP or aHUS, either by promoting the VWF-platelet interaction or by activating the complement system [28]. Tsai further subclassified groups I and II in terms of having one of these comorbidities or not. TTP, Shiga toxin-associated HUS, and aHUS are 3 main TMA diseases that have significant clinical overlap with patients presenting with similar signs and symptoms [13,29]. In aHUS, the predominant pathological abnormality is found in the renal arterioles and interlobular arteries. There is widespread endothelial swelling with retraction leading to exposure of the basement membrane.

The vessel lumens are occluded by red cells and platelet fibrin thrombi. This preglomerular picture differs from Shiga toxin-associated HUS, where the pathology predominantly affects the glomerular capillaries [30,31].

Differentiating TTP from aHUS can present a major diagnostic challenge. TTP is characteristically diagnosed when neurological features predominate, although HUS is suspected when renal failure predominates. Because of these overlapping and changing presentations, some investigators viewed TTP and HUS as one disease with a spectrum of organ involvement. Historically, the term TTP/HUS was widely used for situations in which the clinical symptoms did not fit clearly into either category, and it is difficult to make a differential diagnosis without ADAMTS13 assays.

ADAMTS13 assays are now available for most clinical practices, and they are crucial for the diagnosis of TTP and its differential diagnosis from aHUS. 218

During the last 2 decades, 4 regulatory proteins of the complement alternative pathway were shown to have a role in the pathogenesis of aHUS. Mutations in factor H and membrane cofactor protein (MCP) were the first mutations that helped to establish that aHUS is a disease of complement dysregulation. More than 50 different mutations in complement factor H (CFH), a plasma protein that inhibits the activation of the alternative pathway of the complement, have been described in aHUS cases.

The majority of them are heterozygous and cause either single amino acid substitutions or premature translation interruption within the protein C-terminus, where binding sites for C3b/3d and heparin have been mapped [32]. If patients have defects in MCP or any other complement inhibitory proteins, even if heterozygous, they will probably be at increased risk for severe tissue damage because they cannot appropriately regulate C3 activation and amplification. The identification of factor H and MCP mutations has substantially enhanced the understanding of the molecular pathogenesis of atypical HUS [33]. During analysis of aHUS patients more mutations were found affecting other regulatory proteins, such as complement factor I (CFI) and thrombomodulin (THBD) and 2 proteins of the C3 convertase, C3 and factor B (CFB).

All these findings proved that uncontrolled complement activation through the alternative pathway is the main underlying pathophysiology of aHUS [34,35,36,37,38, 39,40,41,42,43,44,45,46]. Development of autoantibodies directed especially against CFH was identified as another form of aHUS in 2005 [46]. It has also been shown that presence of anti-CFH autoantibodies leads to an acquired and transient CFH deficiency [47,48].

A genetic mutation in complement regulatory proteins or by autoantibodies to CFH has been found as an explanation for constitutive complement activation in 50%-60% of cases of aHUS [31]. However, there are still 40%-50% of patients in whom a mutation cannot be demonstrated. Thus, the ultimate diagnosis of aHUS does not require a formal demonstration of its underlying genetic cause.

Clinical Findings of aHUS The onset of aHUS is generally sudden. Most patients have the complete triad of hemolytic uremic syndrome with anemia, thrombocytopenia, and renal failure, with or without anuria or reduced urine volume, and proteinuria if diuresis is maintained. Microangiopathic hemolysis is confirmed by the presence of schistocytes, low haptoglobin, and high lactate dehydrogenase levels. Patients usually complain of fatigue and general illness. Extrarenal manifestations are observed in 20% of patients and most of them (10%) are related to central nervous system involvement (CNS) [12]. CNS involvement is usually manifested by irritability, drowsiness, seizures, diplopia, cortical blindness, hemiparesis/hemiplegia, stupor, or coma [12].

Yenerel MN: Atypical Hemolytic Uremic Syndrome: Differential Diagnosis from TTP/HUS and Management

If diagnosis is delayed, life-threatening hyperkalemia, acidosis, and volume overload with arterial hypertension and hyponatremia may be observed. Arterial hypertension is frequent and often severe, due both to volume overload in the case of oliguria/anuria and to hyperreninemia secondary to renal TMA. Cardiac failure or neurological complications (seizures) due to hypertension are possible. Myocardial infarction due to cardiac microangiopathy has been reported in 3% of patients [16,49]. Distal ischemic gangrene can also occur [50]. Half of children and the majority of adults need dialysis at admission [12]. Multiorgan failure due to diffuse TMA is present in 5% of patients [17,49].

Differential Diagnosis If a patient comes to the clinic with microangiopathic hemolytic anemia, thrombocytopenia, and renal failure preceded by abdominal pain and diarrhea, the diagnosis has usually been Shiga toxin-associated HUS. This type of presentation accounts for 90% of HUS cases in children. Bloody diarrhea and abdominal pain are usually manifestations of hemorrhagic enterocolitis caused by Shiga toxin-producing bacteria, most commonly Escherichia coli O157:H7 [3]. Patients with Shiga toxin-associated HUS have been described that do not have obvious diarrhea prodromes.

On the other hand, patients with aHUS commonly present with abdominal pain and diarrhea, which may begin days to weeks before the patients seek medical care, thus giving rise to the impression of diarrhea-associated HUS. Diarrhea, with or without blood, is found in approximately 30% of patients with aHUS at the disease onset because of the gut involvement [17,51]. For this reason, categorization of HUS according to clinical presentation as diarrhea-positive or diarrhea-negative is inappropriate [52].

If a patient presents with a diarrheal prodrome, Shiga toxin-associated HUS can easily be differentiated with the presence of Shiga toxin in the stools (done by the Vero cell assay) and/or serum antibodies against Shiga toxin (by enzyme-linked immunosorbent assay) and/or antilipopolysaccharide antibodies against the most common serotypes in the country in question. Another infectious form of HUS occurs with T-antigen activation in association with pneumococcal sepsis and this can also easily be differentiated from aHUS. Although differentiating HUS from TTP is relatively easy in children with a preceding diarrheal illness or invasive S. pneumoniae, differentiating aHUS from TTP or other microangiopathic disorders can present a major diagnostic challenge in adults. Clinical presentation is also more confusing in adults and it is difficult to make a differential diagnosis without ADAMTS13 assays.

ADAMTS13 assays are now available for most clinical practices. In contrast, the mutation analysis tests for the diagnosis of aHUS are performed primarily in research laboratories. Furthermore, the molecular defects of aHUS

Turk J Hematol 2014;31:216-225

remain unknown in many cases. Therefore, for patients presenting with thrombocytopenia and microangiopathic hemolysis, ADAMTS13 analysis is currently the most informative diagnostic test for differentiating TTP, congenital TTP, and aHUS. Plasmapheresis should be started as soon as possible in any patient presenting with microangiopathic hemolytic anemia and thrombocytopenia without waiting for the results of other diagnostic investigations.

It also should not be forgotten to take plasma samples and store them at -20 °C for the analysis of ADAMTS13 activity and inhibitor levels before any plasma therapy.

It usually takes less than 1 week in Turkey to get the test results. During that time, further investigations should also be done to exclude other possible causes of TMA, such as Shiga toxin-associated HUS, systemic lupus erythematosus, antiphospholipid syndrome, infections, malignancies, endothelial-insulting drugs, and chemotherapies [53,54].

Acute TTP can easily be diagnosed if we find the plasma ADAMTS13 activity level to be less than 10% (or 5%, depending on the assays). The deficiency is caused by either inhibitors of ADAMTS13 or mutations of the ADAMTS13 gene. If there is a high inhibitor titer in a patient with a low ADAMTS13 level, then the diagnosis is acquired TTP. Inhibitors are detectable in 80%-90% of patients with acquired TTP using the conventional 1:1 mixing study performed in most clinical labs. Therefore, negative inhibitor results do not exclude the diagnosis of acquired TTP. Mutation analysis, family investigation, and/or serial ADAMTS13 assays are often needed to determine whether a patient has congenital or acquired TTP. Measurements of ADAMTS13 levels may also be quite informative even in the remission state of TTP, and an ADAMTS13 level below 5% (or 10%) is associated with high risk of relapse in the near future.

Plasma ADAMTS13 antigen, activity, and inhibitor levels are all normal or moderately decreased in aHUS patients. Even more than 10% ADAMTS13 activity in a patient suspected of TTP/HUS is important for the diagnosis of aHUS. However, there are different test designs developed for the analysis of ADAMTS13 activity and the assays are affected differently by a variety of conditions, such as plasma bilirubin, hemoglobin, or VWF levels. Interpretation of ADAMTS13 assay results requires correlation with the patientâ&#x20AC;&#x2122;s clinical status. Therefore, it is better to do these assays in reference laboratories [55]. Anti-CFH autoantibodies represent a significant etiology of aHUS, mainly in preadolescent children, but they may also be present in adults [46].

Therefore, screening of anti-CFH autoantibodies at the onset of the disease is also recommended, if possible.

Management of aHUS aHUS has an unfavorable outcome, with death rates as high as 25% during the acute phase and up to 50% of cases progressing to end-stage renal failure. It is confirmed that progress in intensive care and dialysis opportunity has 219

Turk J Hematol 2014;31:216-225

Yenerel MN: Atypical Hemolytic Uremic Syndrome: Differential Diagnosis from TTP/HUS and Management

contributed to the decrease of mortality. For this reason, all patients suspected of having aHUS should be transferred to a specialized center that has dialysis and plasmapheresis facilities.

Until recently, there have been no specific therapies for aHUS; plasma therapy remained the first-line treatment of aHUS in all guidelines published before 2010 based on expert opinions rather than clinical trials [56,57,58].

Plasmapheresis can replace deficient proteins and remove antibodies against complement regulatory proteins, such as anti-CFH antibodies. It would be especially sufficient in patients with defective complement regulatory proteins such as CFH. However, patient outcomes were still reported as poor with this syndrome if it was treated solely with plasma therapy [17,49,59].

According to the Italian registry, plasma therapy was found to be effective in 63% of patients, but only 5% had complete recovery and evolution to death or end-stage renal disease was reported as 37% with this approach [49].

There are also some observations from case studies, especially in children, that early intensive plasma therapy can reverse aHUS and that long-term plasma therapy can prevent relapses and evolution to ESRF in CFH-mutated patients [58,60]. Although most of them had relapses during infections and were treated by intensification of plasma therapy, most patients who received plasma therapy only during acute episodes died or were in ESRF within less than 1 year [58,60,61,62,63].

Case studies also showed that plasma therapy responses change with complement mutations. For example, it was reported that only 25% of patients with CFI mutation had a response and 75% progressed to death or ESRF in the Italian registry [49]. Again, all of the 5 CFI-mutated patients had complete or partial remission in the acute phase of the disease, but all had relapses and all except 1 developed ESRF within a few weeks or months [12,44,64].

MCP is a transmembrane protein. MCP mutations account for 15% of the aHUS cases; because it is a transmembrane protein, we do not expect any beneficial effects with plasmapheresis. At least 90% of patients undergo remission from acute episodes, whether or not they receive plasma therapy [17,40,49]. Long-term plasma therapy also does not seem to be effective in those patients [65]. Plasma therapies can also provide some degree of help in C3, CFB, or THBD mutations. It has been reported that 88% of THBD-mutated patients had a response with plasma therapy, but 43% of them progressed to death and 13% of them progressed to ESRF [49,65]. Remission has been achieved in 2 and 3 patients with C3 and CFB mutations, respectively [66,67,68].

Plasmapheresis and the removal of the antibodies is the first-line treatment in patients with anti-CFH antibodies.

Immunosuppressive treatment with steroids, intravenous 220

cyclophosphamide, mycophenolate mofetil, azathioprine, or anti-CD20 should also be used during the follow-up period.

However, there is still no standardized protocol for the duration or type of immunosuppressive therapy in patients with anti-CFH antibodies [12,18,69,70,71,72].

Transplantation Any aHUS patient who has ESRF is theoretically a candidate for renal transplantation. However, the clinical outcome of renal transplantation in patients with aHUS is discouraging. Patients with aHUS are more prone to develop acute rejections, which also affects graft survival.

Approximately half of the patient groups with aHUS will develop recurrent disease and graft loss [73].

The recurrence risk of aHUS after renal transplantation was found to be less than 1% in typical HUS patients.

However, the recurrence risk increases up to 60% in aHUS patients [74]. Eculizumab therapy is expected to shift the paradigm [28]. With eculizumab started preoperatively and continued postoperatively, preliminary experience suggests that excessive morbidity, mortality, and kidney graft failure may be prevented [75,76].

Although there are no clinical predictors of outcome, knowledge of the underlying genetic defect is helpful in predicting prognosis [77]. The recurrence risk in patients with a CFH mutation is 75%-90%; for patients with a CFI mutation, it is 45%-80%, and in the case of a C3 mutation, the risk of an aHUS recurrence is 40%-70% [77,78]. Recurrences have been seen in patients with CFB and thrombomodulin mutations, as well. On the other hand, patients with a mutation in the gene encoding the membrane-bound MCP have a low risk of developing a disease recurrence in the graft [13]. MCP is cell membrane-bound and highly expressed in the kidney; kidney transplants, then, would be expected to halt the disease process [4]. Combined liver-kidney transplantation has been attempted for patients with CFH and CFI mutations to address the abnormal protein synthesis in the liver and its downstream effect on the kidney. Simultaneous liver-kidney transplantation with prophylactic use of plasma therapy has been successful in patients with CFH mutations [60].

However, liver-kidney transplantation is associated with a higher mortality rate than kidney transplantation alone [79].

In the absence of a noted mutation comprising a sizable fraction of patients with aHUS, liver-kidney transplantation should be avoided [13,80].

Complement Inhibitor Therapy Eculizumab is a humanized monoclonal antibody that binds to complement C5 protein and prevents the formation of the terminal complement complex, also known as the membrane attack complex (MAC). This agent has been approved for paroxysmal nocturnal hemoglobinuria and was approved by the US Food and Drug Administration (FDA) for use in aHUS on 23 September 2011 [81]. In aHUS, uncontrolled activation of the alternative complement

Yenerel MN: Atypical Hemolytic Uremic Syndrome: Differential Diagnosis from TTP/HUS and Management

pathway corresponds to all the deleterious findings of the disease. The overall treatment goal remains restoration of a physiological balance between activation and control of the alternative complement pathway. Thus, it is a reasonable approach to block the terminal complement complex with eculizumab in order to prevent further organ injury and increase the likelihood of organ recovery.

The first case report using eculizumab as a therapeutic approach in aHUS was reported in 2009. Nurnberg et al. reported that an 18-month-old boy with a plasma-resistant congenital form of the disease achieved remission after the initiation of treatment with eculizumab [82]. The second important observation was the resolution of hemolysis and improvement of the transplant function after receiving eculizumab in a 30-year-old woman with a CFH mutation who had a recurrence of the hemolytic-uremic syndrome in a kidney graft [83].

Since these first reports, many case presentations have followed, demonstrating that good clinical responses have been observed when using eculizumab in patients with aHUS [75,76,78,79,82,83,84,85,86,87,88,89,90,91,92,93, 94,95,96,97].

The efficacy and safety of eculizumab was also evaluated recently in 2 phase II prospective, multicenter, controlled clinical studies carried out in patients â&#x2030;Ľ12 years of age [98].

There were 17 and 20 enrolled patients resistant to plasma therapy and ongoing chronic plasma treatment, respectively.

The authors reported that after 6 months of treatment with eculizumab, rates of hematological normalization (â&#x2030;Ľ2 consecutive normal measurements of platelets and lactate dehydrogenase) reached 76% in resistant cases and 90% in chronic cases. Furthermore, patients without demonstrated mutations/antibodies responded well [98].

The authors stated that the improvement in renal function was maintained in extended studies (mean follow-up period of 62-64 weeks) [98].

Patient outcomes were reported as being poor among those treated with plasma therapy [17,49]. Moreover, the switch from plasma therapy to eculizumab has been shown to improve renal function even in patients with long-lasting and stable chronic kidney disease [99].

Based on these results, the FDA and the European Medicines Agency (EMA) approved in the United States and Europe, respectively, the indication for eculizumab in the treatment of aHUS. After having eculizumab as an important treatment option in aHUS patients, several guidelines were also published about the diagnosis and management of aHUS patients. The latest guideline was published by the American Society of Nephrology and early treatment with eculizumab was recommended as the first choice in the suspicion of aHUS in a pediatric patient. It was also highly recommended to use early eculizumab in any adult patient with suspected aHUS. In the case of unavailability of eculizumab, early and intensive plasmapheresis should be administered until eculizumab is an available option [57].

Turk J Hematol 2014;31:216-225

Today, clinical experience has clearly demonstrated that eculizumab is superior to plasma exchange for aHUS. Therefore, eculizumab should be considered the first line of therapy for aHUS when the diagnosis is reasonably unequivocal (e.g., recurrent cases, familial cases, posttransplant recurrence, idiopathic cases with TTP excluded). However, it takes a few weeks to get eculizumab due to logistic issues in Turkey, and it is recommended that plasmapheresis should be initiated as early as possible in any patient with symptoms of aHUS. Plasma exchange therapy is also initiated when TTP cannot be excluded based on the clinical and laboratory information available. Persistence of hemolysis or lack of improvement of renal function after 3-5 daily plasmapheresis treatments have to be regarded as the major criteria for uncontrolled TMA even if the platelet count has normalized and as an indication to switch the treatment to eculizumab [11,12,73].

It should be noted that eculizumab increases the patientâ&#x20AC;&#x2122;s susceptibility to certain serious infections, particularly meningococcal infections. To reduce the risk of infection, all patients with aHUS must also be vaccinated at least 2 weeks prior to receiving Soliris [100]. In emergency situations, until vaccination provides immunization, prophylactic antimeningococcal antibiotics should also be given during the first 2 weeks of the eculizumab treatment.

Eculizumab has changed the future perspectives of patients with aHUS and both the FDA and the EMA have approved it as life-long treatment. However, there are still some unresolved issues about follow-up, such as the optimal duration of eculizumab treatment and whether it can be stopped or how to stop the therapy. All of these questions can be resolved with data from large international prospective cohort studies.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Ruggenenti P, Noris M, Remuzzi G. Thrombotic microangiopathy, hemolytic uremic syndrome, and thrombotic thrombocytopenic purpura. Kidney Int 2001;60:831-846.

2. Kaplan BS, Meyers KE, Schulman SL. The pathogenesis and treatment of hemolytic uremic syndrome. J Am Soc Nephrol 1998;9:1126-1133.

3. Tarr PI, Gordon CA, Chandler WL. Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet 2005;365:1073-1086.

4. Noris M, Remuzzi G. Hemolytic uremic syndrome. J Am Soc Nephrol 2005;16:1035-1050.

221

Turk J Hematol 2014;31:216-225

Yenerel MN: Atypical Hemolytic Uremic Syndrome: Differential Diagnosis from TTP/HUS and Management

5. Besbas N, Karpman D, Landau D, Loirat C, Proesmans W, Remuzzi G, Rizzoni G, Taylor CM, Van de Kar N, Zimmerhackl LB; European Paediatric Research Group for HUS. A classification of hemolytic uremic syndrome and thrombotic thrombocytopenic purpura and related disorders. Kidney Int 2006;70:423-431.

6. Scheiring J, Andreoli SP, Zimmerhackle LB. Treatment and outcome of Shiga-toxin-associated hemolytic uremic syndrome (HUS). Pediatr Nephrol 2008;23:1749-1760.

7. Constantinescu AR, Bitzan M, Weiss LS, Christen E, Kaplan BS, Cnaan A, Trachtman H. Non-enteropathic hemolytic uremic syndrome: causes and short-term course. Am J Kidney Dis 2004;43:976-982.

8. Brandt J, Wong C, Mihm S, Roberts J, Smith J, Brewer E, Thiagarajan R, Warady B. Invasive pneumococcal disease and hemolytic uremic syndrome. Pediatrics 2002;110:371-376.

9. Schieppati A, Ruggenenti P, Cornejo RP, Ferrario F, Gregorini G, Zucchelli P, Rossi E, Remuzzi G. Renal function at hospital admission as a prognostic factor in adult hemolytic uremic syndrome. The Italian Registry of Haemolytic Uremic Syndrome. J Am Soc Nephrol 1992;2:1640-1644.

10. Taylor CM, Chua C, Howie AJ, Risdon RA, British Association for Paediatric Nephrology. Clinico-pathological findings in diarrhoea-negative haemolytic uraemic syndrome. Pediatr Nephrol 2004;19:419-425.

11. Campistol JM, Arias M, Ariceta G, Blasco M, Espinosa M, Grinyó JM, Praga M, Torra R, Vilalta R, Rodríguez de Córdoba S. An update for atypical haemolytic uraemic syndrome: diagnosis and treatment. A consensus document.

Nefrologia 2013;33:27-45.

12. Loirat C, Frémeaux-Bacchi V. Atypical hemolytic uremic syndrome. Orphanet Journal of Rare Diseases 2011;6:60.

13. Hodgkins KS, Bobrowski AE, Lane JC, Langman CB. Clinical grand rounds: atypical hemolytic uremic syndrome. Am J Nephrol 2012;35:394-400.

14. Gulleroglu K, Fidan K, Hançer VS, Bayrakci U, Baskin E, Soylemezoglu O. Neurologic involvement in atypical hemolytic uremic syndrome and successful treatment with eculizumab. Pediatr Nephrol 2013;28:827-830.

15. Neuhaus TJ, Calonder S, Leumann EP. Heterogeneity of atypical haemolytic uraemic syndromes. Arch Dis Child 1997;76:518-521.

16. Sallée M, Daniel L, Piercecchi MD, Jaubert D, FremeauxBacchi V, Berland Y, Burtey S. Myocardial infarction is a complication of factor H-associated atypical HUS. Nephrol Dial Transplant 2010;25:2028-2032.

17. Sellier-Leclerc AL, Fremeaux-Bacchi V, Macher MA, Niaudet P, Guest G, Boudailliez B, Bouissou F, Deschenes G, Gie S, Tsimaratos M, Fishbach M, Morin D, Nivet H, Alberti C, Loirat C. Differential impact of complement mutations on clinical characteristics in atypical hemolytic uremic syndrome. J Am Soc Nephrol 2007;18:2392-2400.

222

18. Dragon-Durey MA, Sethi SK, Bagga A, Blanc C, Blouin J, Ranchin B, André JL, Takagi N, Cheong H, Hari P, Le Quintrec M, Niaudet P, Loirat C, Fridman WH, FrémeauxBacchi V. Clinical features of anti-factor H autoantibodyassociated hemolytic uremic syndrome. J Am Soc Nephrol 2010;21:2180-2187.

19.

Tsai HM. Autoimmune thrombotic microangiopathy: advances in pathogenesis, diagnosis, and management.

Semin Thromb Hemost 2012;38:469-482.

20. Moschcowitz E. An acute febrile pleiochromic anemia with hyaline thrombosis of the terminal arterioles and capillaries: an undescribed disease. Arch Intern Med 1925;36:89-93.

21. Asada Y, Sumiyoshi A, Hayashi T, Suzumiya J, Kaketani K. Immunohistochemistry of vascular lesion in thrombotic thrombocytopenic purpura, with special reference to factor VIII related antigen. Thromb Res 1985;38:469-479.

22. Tsai HM, Lian EC. Antibodies to von Willebrand factorcleaving protease in acute thrombotic thrombocytopenic purpura. N Engl J Med 1998;339:1585-1594.

23. Levy GG, Nichols WC, Lian EC, Foroud T, McClintick JN, McGee BM, Yang AY, Siemieniak DR, Stark KR, Gruppo R, Sarode R, Shurin SB, Chandrasekaran V, Stabler SP, Sabio H, Bouhassira EE, Upshaw JD Jr, Ginsburg D, Tsai HM. Mutations in a member of the ADAMTS gene family cause thrombotic thrombocytopenic purpura. Nature 2001;413:488-494.

24. Noris M, Mescia F, Remuzzi G. STEC-HUS, atypical HUS and TTP are all diseases of complement activation. Nat Rev Nephrol 2012;8:622-633.

25. Morigi M, Galbusera M, Gastoldi S, Locatelli M, Buelli S, Pezzotta A, Pagani C, Noris M, Gobbi M, Stravalaci M, Rottoli D, Tedesco F, Remuzzi G, Zoja C. Alternative pathway activation of complement by Shiga toxin promotes exuberant C3a formation that triggers microvascular thrombosis. J Immunol 2011;187:172-180.

26. Orth D, Wurzner R. Complement in typical hemolytic uremic syndrome. Semin Thromb Hemost 2010;36:620-624.

27. Lammle B, Kremer Hovinga JA, Alberio L. Thrombotic thrombocytopenic purpura. J Thromb Haemost 2005;3:1663-1675.

28. Tsai HM. Thrombotic thrombocytopenic purpura and the atypical hemolytic uremic syndrome: an update. Hematol Oncol Clin North Am 2013;27:565-584.

29. Barbour T, Johnson S, Cohney S, Hughes P. Thrombotic microangiopathy and associated renal disorders. Nephrol Dial Transplant 2012;27:2673-2685.

30. Noris M, Remuzzi G. Non-Shiga toxin-associated hemolytic uremic syndrome. In: Zipfel P (ed.). Complement and Kidney Disease. Basel, Birkhäuser, 2005.

31. Habib R. Pathology of the hemolytic uremic syndrome.

In: Kaplan BS, Trompeter RS, Moake JL (eds.). Hemolytic Uremic Syndrome and Thrombotic Thrombocytopenic Purpura. New York, Marcel Dekker, 1992.

Yenerel MN: Atypical Hemolytic Uremic Syndrome: Differential Diagnosis from TTP/HUS and Management

32. Hellwage J, Jokiranta TS, Friese MA, Wolk TU, Kampen E, Zipfel PF, Meri S. Complement C3b/C3d and cell surface polyanions are recognized by overlapping binding sites on the most carboxyl-terminal domain of complement factor H. J Immunol 2002;169:6935-6944.

33. Goodship TH, Liszewski MK, Kemp EJ, Richards A, Atkinson JP. Mutations in CD46, a complement regulatory protein, predispose to atypical HUS. Trends Mol Med 2004;10:226231.

34. Warwicker P, Goodship TH, Donne RL, Pirson Y, Nicholls A, Ward RM, Turnpenny P, Goodship JA. Genetic studies into inherited and sporadic hemolytic uremic syndrome.

Kidney Int 1998;53:836-844.

35. Richards A, Buddles MR, Donne RL, Kaplan BS, Kirk E, Venning MC, Tielemans CL, Goodship JA, Goodship TH. Factor H mutations in hemolytic uremic syndrome cluster in exons 18-20, a domain important for host cell recognition.

Am J Hum Genet 2001;68:485-490.

36. Caprioli J, Bettinaglio P, Zipfel P, Amadei B, Daina E, Gamba S, Skerka C, Marziliano N, Remuzzi G, Noris M; Italian Registry of Familial and Recurrent HUS/TTP. The molecular basis of familial hemolytic uremic syndrome: mutation analysis of factor H gene reveals a hot spot in short consensus repeat. J Am Soc Nephrol 2001;12:297307.

37. Neumann H, Salzmann H, Bohnert-Iwan B, Mannuelian T, Skerka C, Lenk D, Bender BU, Cybulla M, Riegler P, Konigsrainer A, Neyer U, Bock A, Widmer U, Male DA, Franke G, Zipfel PF. Haemolytic uraemic syndrome and mutations of the factor H gene: a registry based study of German speaking countries. J Med Genet 2003;40:676-681.

38. Perez-Caballero D, Gonzalez-Rubio C, Gallardo ME, Vera M, Lopez-Trascasa M, Rodriguez de Cordoba S, Sanchez-Corral P. Clustering of missense mutations in the C-terminal region of factor H in atypical hemolytic uremic syndrome. Am J Hum Genet 2001;68:478-484.

39. Dragon-Durey MA, Frémeaux-Bacchi V, Loirat C, Blouin J, Niaudet P, Deschenes G, Coppo P, Herman Fridman W, Weiss L. Heterozygous and homozygous factor H deficiencies associated with hemolytic uremic syndrome or membranoproliferative glomerulonephritis: report and genetic analysis of 16 cases. J Am Soc Nephrol 2004;15:787-795.

40. Caprioli J, Noris M, Brioschi S, Pianetti G, Castelleti F, Bettinaglio P, Mele C, Bresin E, Cassis L, Gamba S, Porrati F, Bucchioni S, Monteferrante G, Fang CJ, Liszewski MK, Kavanagh D, Atkinson JP, Remuzzi G. Genetics of HUS: the impact of MCP, CFH and IF mutations on clinical presentation, response to treatment, and outcome. Blood 2006;108:1267-1279.

41. Richards A, Kemp EJ, Liszewski MK, Goodship JA, Lampe AK, Decorte R, Müslümanoğlu MH, Kavukcu S, Filler G, Pirson Y, Wen LS, Atkinson JP, Goodship TH. Mutations in human complement regulator, membrane cofactor

Turk J Hematol 2014;31:216-225

protein (CD46), predispose to development of familial hemolytic uremic syndrome. Proc Natl Acad Sci U S A 2003;100:12966-12971.

42. Esparza-Gordillo J, Goicoechea de Jorge E, Buil A, Carreras Berges L, Lopez Trascasa M, Sanchez-Corral P, Rodriguez de Cordoba S. Predisposition to atypical hemolytic uremic syndrome involves the concurrence of different susceptibility alleles in the regulators of complement activation gene cluster in 1q32. Hum Mol Genet 2005;14:703-712.

43. Fremeaux-Bacchi V, Moulton EA, Kavanagh D, DragonDurey MA, Blouin J, Caudy A, Arzouk N, Cleper R, Francois M, Guest G, Pourrat J, Seligman R, Fridman WH, Loirat C, Atkinson JP. Genetic and functional analyses of membrane cofactor protein (CD46) mutations in atypical hemolytic uremic syndrome. J Am Soc Nephrol 2006;17:2017-2025.

44. Kavanagh D, Kemp EJ, Mayland E, Winney RJ, Duffield JS, Warwick G, Richards A, Ward R, Goodship JA, Goodship TH. Mutations in complement factor I predispose to development of atypical hemolytic uremic syndrome. J Am Soc Nephrol 2005;16:2150-2155.

45. Fremeaux-Bacchi V, Dragon-Durey MA, Blouin J, Vigneau C, Kuypers D, Boudailliez B, Loirat C, Rondeau E, Fridman WH. Complement factor I: a susceptibility gene for atypical haemolytic uraemic syndrome. J Medical Genet 2004;41:84.

46. Dragon-Durey MA, Loirat C, Cloarec S, Macher MA, Blouin J, Nivet H, Weiss L, Fridman WH, Fremeaux-Bacchi V. Antifactor H autoantibodies associated with atypical hemolytic uremic syndrome. J Am Soc Nephrol 2005;16:555-563.

47. Jozsi M, Strobel S, Dahse HM, Liu WS, Hoyer PF, Oppermann M, Skerka C, Zipfel PF. Anti-factor H autoantibodies block C-terminal recognition function of factor H in hemolytic uremic syndrome. Blood 2007;110:1516-1518.

48. Strobel S, Hoyer PF, Mache CJ, Sulyok E, Liu WS, Richter H, Oppermann M, Zipfel PF, Jozsi M. Functional analyses indicate a pathogenic role of factor H autoantibodies in atypical haemolytic uraemic syndrome. Nephrol Dial Transplant 2010;25:136-144.

49. Noris M, Caprioli J, Bresin E, Mossali C, Pianetti G, Gamba S, Daina E, Fenili C, Castelletti F, Sorosina A, Piras R, Donadelli R, Maranta R, van der Meer I, Conway EM, Zipfel PF, Goodship TH, Remuzzi G. Relative role of genetic complement abnormalities in sporadic and familial aHUS and their impact on clinical phenotype. Clin J Am Soc Nephrol 2010;5:1844-1859.

50. Kaplan BS, Garcia CD, Chesney RW, Segar WE, Giugno K, Chem R. Peripheral gangrene complicating idiopathic and recessive hemolytic uremic syndromes. Pediatr Nephrol 2000;14:985-989.

51. Geerdink LM, Westra D, van Wijk JA, Dorresteijn EM, Lilien MR, Davin JC, Kömhoff M, Van Hoeck K, van der Vlugt A, van den Heuvel LP, van de Kar NC. Atypical hemolytic uremic syndrome in children: complement mutations and clinical characteristics. Pediatr Nephrol 2012;27:1283-1291.

223

Turk J Hematol 2014;31:216-225

Yenerel MN: Atypical Hemolytic Uremic Syndrome: Differential Diagnosis from TTP/HUS and Management

52.

Gerber A, Karch H, Allerberger F, Verweyen HM, Zimmerhackl LB. Clinical course and the role of Shiga toxinproducing Escherichia coli infection in the hemolytic-uremic syndrome in pediatric patients, 1997-2000, in Germany and Austria: a prospective study. J Infect Dis 2002;186:493500.

66. Goicoechea de Jorge E, Harris CL, Esparza-Gordillo J, Carreras L, Arranz EA, Garrido CA, López-Trascasa M, Sánchez-Corral P, Morgan BP, Rodríguez de Córdoba S. Gain-of-function mutations in complement factor B are associated with atypical hemolytic uremic syndrome. Proc Natl Acad Sci U S A 2007;104:240-245.

53. Loirat C, Saland J, Bitzan M. Management of hemolytic uremic syndrome. Presse Med 2012;41:115-135.

67. Roumenina LT, Jablonski M, Hue C, Blouin J, Dimitrov JD, Dragon-Durey MA, Cayla M, Fridman WH, Macher MA, Ribes D, Moulonguet L, Rostaing L, Satchell SC, Mathieson PW, Sautes-Fridman C, Loirat C, Regnier CH, HalbwachsMecarelli L, Fremeaux-Bacchi V. Hyperfunctional C3 convertase leads to complement deposition on endothelial cells and contributes to atypical hemolytic uremic syndrome.

Blood 2009;114:2837-2845.

54. Zipfel PF, Heinen S, Skerka C. Thrombotic microangiopathies: new insights and new challenges. Curr Opin Nephrol Hypertens 2010;19:372-378.

55. Tsai HM. Pathophysiology of thrombotic thrombocytopenic purpura. Int J Hematol 2010;91:1-19.

56. Loirat C, Noris M, Fremeaux-Bacchi V. Complement and the atypical hemolytic uremic syndrome. Pediatr Nephrol 2008;23:1957-1972.

57. Taylor CM, Machin S, Wigmore SJ, Goodship TH. Clinical practice guidelines for the management of atypical haemolytic uraemic syndrome in the United Kingdom. Br J Haematol 2010;148:37-47.

58.

Loirat C, Garnier A, Sellier-Leclerc AL, Kwon T. Plasmatherapy in atypical hemolytic uremic syndrome.

Semin Thromb Hemost 2010;36:673-681.

59. Noris M, Remuzzi G. Atypical hemolytic-uremic syndrome.

N Engl J Med 2009;361:1676-687.

60. De S, Waters AM, Segal AO, Trautmann A, Harvey EA, Licht C. Severe atypical HUS caused by CFH S1191L-case presentation and review of treatment options. Pediatr Nephrol 2010;25:97-104.

61. Abarrategui-Garrido C, Melgosa M, Peña-Carrión A, de Jorge EG, de Córdoba SR, López-Trascasa M, SánchezCorral P. Mutations in proteins of the alternative pathway of complement and the pathogenesis of atypical hemolytic uremic syndrome. Am J Kidney Dis 2008;52:171-180.

62. Sethi SK, Dragon-Durey MA, Thaker N, Hari P, Bagga A. Hemolytic uremic syndrome due to homozygous factor H deficiency. Clin Exp Nephrol 2009;13:526-530.

63. Davin JC, Strain L, Goodship THJ. Plasma therapy in atypical haemolytic uremic syndrome: lessons from a family with a factor H mutation. Pediatr Nephrol 2008;23:1517-1521.

64. Nilsson SC, Karpman D, Vaziri-Sani F, Kristoffersson AC, Salomon R, Provot F, Fremeaux-Bacchi V, Trouw LA, Blom AM. A mutation in factor I that is associated with atypical hemolytic uremic syndrome does not affect the function of factor I in complement regulation. Mol Immunol 2007;44:1835-1844.

65. Davin JC, Buter N, Groothoff J, van Wijk J, Bouts A, Strain L, Goodship T. Prophylactic plasma exchange in CD46associated atypical haemolytic uremic syndrome. Pediatr Nephrol 2009;24:1757-1760.

224

68. Tawadrous H, Maga T, Sharma J, Kupferman J, Smith RJ, Schoeneman M. A novel mutation in the complement factor B gene (CFB) and atypical hemolytic uremic syndrome.

Pediatr Nephrol 2010;25:947-951.

69. Kwon T, Dragon-Durey MA, Macher MA, Baudouin V, Maisin A, Peuchmaur M, Fremeaux-Bacchi V, Loirat C. Successful pre-transplant management of a patient with anti-factor H autoantibodies-associated haemolytic uraemic syndrome.

Nephrol Dial Transplant 2008;23:2088-2090.

70. Lionet A, Provot F, Glowacki F, Fremeaux-Bacchi V, Hazzan M. A case of adult atypical haemolytic uraemic syndrome related to antifactor H autoantibodies successfully treated by plasma exchange, corticosteroids and rituximab. NDT Plus 2009;2:458-460.

71.

Boyer O, Balzamo E, Charbit M, Biebuyck-Gougé N, Salomon R, Dragon-Durey MA, Fremeaux-Bacchi V, Niaudet P. Pulse cyclophosphamide therapy and clinical remission in atypical hemolytic uremic syndrome with anti-complement factor H autoantibodies. Am J Kidney Dis 2010;55:923-927.

72. Lee BH, Kwak SH, Shin JI, Lee SH, Choi HJ, Kang HG, Ha IS, Lee JS, Dragon-Durey MA, Choi Y, Cheong HI. Atypical hemolytic uremic syndrome associated with complement factor H autoantibodies and CFHR1/CFHR3 deficiency.

Pediatr Res 2009;66:336-340.

73. Westra D, Wetzels JFM, Volokhina EB, van den Heuvel LP, van de Kar NCAJ. A new era in the diagnosis and treatment of atypical haemolytic uraemic syndrome. Neth J Med 2012;70:121-129.

74. Loirat C, Fremeaux-Bacchi V. Haemolytic uremic syndrome recurrence after renal transplantation. Pediatr Transplant 2008;12:619-629.

75. Weitz M, Amon O, Bassler D, Koenigsrainer A, Nadalin S. Prophylactic eculizumab prior to kidney transplantation for atypical hemolytic uremic syndrome. Pediatr Nephrol 2011;26:1325-1329.

76. Nester C, Stewart Z, Myers D, Jetton J, Nair R, Reed A, Thomas C, Smith R, Brophy P. Preemptive eculizumab and plasmapheresis for renal transplant in atypical hemolytic uremic syndrome. Clin J Am Soc Nephrol 2011;6:1488-1494.

Yenerel MN: Atypical Hemolytic Uremic Syndrome: Differential Diagnosis from TTP/HUS and Management

77. Artz MA, Steenbergen EJ, Hoitsma AJ, Monnens LAH, Wetzels JFM. Renal transplantation in patients with hemolytic uremic syndrome: high rate of recurrence increased incidence of acute rejections. Transplantation 2003;76:821-826.

78. Zuber J, Le Quintrec M, Sberro-Soussan R, Loirat C, Fremeaux-Bacchi V, Legendre C. New insights into postrenal transplant hemolytic uremic syndrome. Nat Rev Nephrol 2011;7:23-35.

79. Al-Akash SI, Almond PS, Savell VH Jr, Gharaybeh SI, Hogue C. Eculizumab induces long-term remission in recurrent posttransplant HUS associated with C3 gene mutation.

Pediatr Nephrol 2011;26:613-619.

80.

Saland JM, Ruggenenti P, Remuzzi G. Liver-kidney transplantation to cure atypical hemolytic uremic syndrome.

J Am Soc Nephrol 2009;20:940-949.

81. US Food and Drug Administration. FDA News Release.

23 September 2011. Available at http://www.fda. gov/NewsEvents/Newsroom/PressAnnouncements/ ucm272990.htm.

82. Gruppo RA, Rother RP. Eculizumab for congenital atypical hemolytic-uremic syndrome. N Engl J Med 2009;360:544-546.

83. Nurnberger J, Philipp T, Witzke O, Opazo Saez A, Vester U, Baba HA, Kribben A, Zimmerhackl LB, Janecke AR, Nagel M, Kirschfink M. Eculizumab for atypical hemolytic uremic syndrome. N Engl J Med 2009;360:542-544.

84. Ohanian M, Cable C, Halka K. Eculizumab safely reverses neurologic impairment and eliminates need for dialysis in severe atypical hemolytic uremic syndrome. Clin Pharmacol 2011;3:5-12.

85. Tschumi S, Gugger M, Bucher BS, Riedl M, Simonetti GD. Eculizumab in atypical hemolytic uremic syndrome: longterm clinical course and histological findings. Pediatr Nephrol 2011;26:2085-2088.

86. Chatelet V, Lobbedez T, Fremeaux-Bacchi V, Ficheux M, Ryckelynck JP, Hurault de Ligny B. Eculizumab: safety and efficacy after 17 months of treatment in a renal transplant patient with recurrent atypical hemolytic-uremic syndrome: case report. Transplant Proc 2010;42:4353-4355.

87. Legault DJ, Boelkins MR. Successful treatment of aHUS recurrence and arrest of plasma exchange resistant TMA post-renal transplantation with the terminal complement inhibitor eculizumab. Blood 2009;114:2421.

88. Davin JC, Gracchi V, Bouts A, Groothoff J, Strain L, Goodship T. Maintenance of kidney function following treatment with eculizumab and discontinuation of plasma exchange after a third kidney transplant for atypical hemolytic uremic syndrome associated with a CFH mutation. Am J Kidney Dis 2010;55:708-711.

89. Zimmerhackl LB, Hofer J, Cortina G, Mark W, Würzner R, Jungraithmayr TC, Khursigara G, Kliche KO, Radauer W. Prophylactic eculizumab after renal transplantation in atypical hemolytic-uremic syndrome. N Engl J Med 2010;362:1746-1748.

Turk J Hematol 2014;31:216-225

90. Durán CE, Blasco M, Maduell F, Campistol JM. Rescue therapy with eculizumab in a transplant recipient with atypical haemolytic uremic syndrome. Clin Kidney J 2012;5:28-30.

91. Mache CJ, Acham-Roschitz B, Fremeaux-Bacchi V, Kirschfink M, Zipfel PF, Roedl S, Vester U, Ring E. Complement inhibitor eculizumab in atypical hemolytic uremic syndrome. Clin J Am Soc Nephrol 2009;4:1312-1316.

92.

Kose O, Zimmerhackl LB, Jungraithmayr T, Mache C, Nurnberger J. New treatment options for atypical hemolytic uremic syndrome with the complement inhibitor eculizumab. Semin Thromb Hemost 2010;36:669-672.

93. Lapeyraque AL, Fremeaux-Bacchi V, Robitaille P. Efficacy of eculizumab in a patient with factor-H-associated atypical hemolytic uremic syndrome. Pediatr Nephrol 2011;26:621624.

94. Prescott HC, Wu HM, Cataland SR, Baiocchi RA. Eculizumab therapy in an adult with plasma exchange-refractory atypical hemolytic uremic syndrome. Am J Hematol 2010;85:976977.

95. Ohanian M, Cable C, Halka K. Reduced dose maintenance eculizumab in atypical hemolytic uremic syndrome (aHUS): an update on a previous case report. Clin Pharmacol 2011;3:45-50.

96.

Chatelet V, Fremeaux-Bacchi V, Lobbedez T, Ficheux M, Hurault de Ligny B. Safety and long-term efficacy of eculizumab in a renal transplant patient with recurrent atypical hemolytic-uremic syndrome. Am J Transplant 2009;9:2644-2645.

97. Vilalta R, Lara E, Madrid A, Chocron S, Muñoz M, Casquero A, Nieto J. Long-term eculizumab improves clinical outcomes in atypical hemolytic uremic syndrome. Pediatr Nephrol 2012;27:2323-2326.

98. Legendre CM, Licht C, Muus P, Greenbaum LA, Babu S, Bedrosian C, Bingham C, Cohen DJ, Delmas Y, Douglas K, Eitner F, Feldkamp T, Fouque D, Furman RR, Gaber O, Herthelius M, Hourmant M, Karpman D, Lebranchu Y, Mariat C, Menne J, Moulin B, Nurnberger J, Ogawa B, Remuzzi G, Richard T, Sberro-Soussan R, Severino B, Sheerin NS, Trivelli A, Zimmerhackl LB, Goodship T, Loirat C. Terminal complement inhibitor eculizumab in atypical hemolytic-uremic syndrome. N Engl J Med 2013;368:21692181.

99. Zuber J, Fakhouri F, Roumenina LT, Loirat C, FrémeauxBacchi V; French Study Group for aHUS/C3G. Use of eculizumab for atypical haemolytic uraemic syndrome and C3 glomerulopathies. Nat Rev Nephrol 2012;8:643-657.

100. US Food and Drug Administration. FDA News Release. 16 March 2007. Available at http://www.fda.gov/NewsEvents/ Newsroom/PressAnnouncements/2007/ucm108869.htm.

225

Research Article

DOI: 10.4274/tjh.2013.0275

Identification and Genetic Analysis of a Factor IX Gene Intron 3 Mutation in a Hemophilia B Pedigree in China Çin’de Bir Hemofili B Ailesinde Faktör IX İntron 3 Mutasyonunun Tanımlaması ve Genetik Analizi Dong-Hua Cao1, Xiao-Li Liu2, Kai Mu3, Xiang-Wei Ma1, Jing-Li Sun1, Xiao-Zhong Bai1, Chang-Kun Lin2, Chun-Lian Jin4 1Hospital

of PLA, Aristogenesis Center, Shenyang, China Women’s and Children’s Hospital, Assisted Reproductive Technology Laboratory, Shenyang, China 3Zibo Maternal and Child Health Hospital, Genetic Disease Laboratory, Zibo, China 4China Medical University, Department of Medical Genetics, Shenyang, China 2Shenyang

Abstract: Objective: Hemophilia B is caused by coagulation defects in the factor IX gene located in Xq27.1 on the X chromosome.

A wide range of mutations, showing extensive molecular heterogeneity, have been described in hemophilia B patients. Our study was aimed at genetic analysis and prenatal diagnosis of hemophilia B in order to further elucidate the pathogenesis of the hemophilia B pedigree in China.

Materials and Methods: Polymerase chain reaction amplification and direct sequencing of all the coding regions was conducted in hemophilia B patients and carriers. Prenatal diagnosis of the proband was conducted at 20 weeks.

Results: We identified the novel point mutation 10.389 A>G, located upstream of the intron 3 acceptor site in hemophilia B patients. The fetus of the proband’s cousin was identified as a carrier.

Conclusion: Our identification of a novel mutation in the F9 gene associated with hemophilia B provides novel insight into the pathogenesis of this genetically inherited disorder and also represents the basis of prenatal diagnosis.

Key Words: Hemophilia B, Factor IX, Mutation, Intron 3, mRNA splice site Özet: Amaç: Hemofili B, X kromozomu üzerinde Xq27,1’e lokalize faktör IX genindeki koagülasyon defektleri nedeniyle oluşur.

Hemofili B hastalarında yaygın moleküler heterojenite gösteren ve geniş bir dağılımı olan mutasyonlar tanımlanmıştır. Çalışmamız Çin’deki bir hemofili B ailesindeki patogenezi açığa kavuşturulmak için hemofili B’nin genetik analizi ve prenatal tanısını amaçlamıştır.

Address for Correspondence: Chun-Lian JİN, M.D., China Medical University, Department of Medical Genetics, Shenyang, China Phone: +86-024-23256666-532 E-mail: chunlianjin@126.com Received/Geliş tarihi : August 13, 2013 Accepted/Kabul tarihi : November 8, 2013

226

Turk J Hematol 2014;31:226-230

Cao DH, et al: F9 Intron 3 Mutations and Hemophilia B

Gereç ve Yöntemler: Hemofili B hastalarında ve taşıyıcılarda tüm kodlanan bölgelerin polimeraz zincir reaksiyonu ile amplifikasyonu ve direkt dizileme yapılmıştır. Probandın prenatal tanısı 20. haftada yapılmıştır.

Bulgular: Hemofili B hastalarında yeni bir nokta mutasyonu olan 10,389 A>G’nin intron 3’ün alıcı bölgesinin yukarı akımında bulunduğunu tanımladık. Probanın kuzeninin cenininin de taşıyıcı olduğu bulundu.

Sonuç: F9 geninde hemofili B ile ilişkili yeni bir mutasyonu tanımlamamız genetik olarak kalıtılan bu hastalığın patogenezine yeni bir açıklama getirmiştir ve prenatal tanının temelini temsil etmektedir.

Anahtar Sözcükler: Hemofili B, Faktör IX, Mutasyon, İntron 3, mRNA eklenme bölgesi

Introduction Hemophilia B (HB) is an X-linked inherited disorder resulting from deficiency in the blood coagulation factor IX (F9) caused by mutation of the factor IX gene (F9; GenBank accession number K02402.1). F9 is located at Xq27.1 and comprises 8 exons encoding 6 functional domains: prepropeptide, the Gla domain, epidermal growth factor (EGF)-1 and EGF-2 domains, the activation domain, and the catalytic domain [1]. The gene spans approximately 31 kb with an mRNA transcript of 2803 bases encoding a protein of 461 amino acid residues. The F9 gene and protein share considerable sequence homology and near identical structural organization with the coagulation vitamin K-dependent serine proteases factor VII, factor X, and protein C. However, a wide range of mutations, showing extensive molecular heterogeneity, have been described in patients affected by HB of varying severity [2].

In 2011, we ascertained a HB pedigree from Liaoning Province, China. In this study, we conducted genetic analysis and prenatal diagnosis of HB in order to further elucidate the pathogenesis of the HB pedigree and help a pregnant woman deliver a healthy baby.

Materials and Methods Proband At 6 months of age, the proband (male, born on 20 February 2008) presented with pelioma, cyanotic bumps, subcutaneous bleeding, and knee swelling following crawling movement. The child was diagnosed as factor IX-deficient (test results: F9 coagulum activity 1%) by the Department of Hematology of Beijing Union Hospital in May 2011. Currently the child exhibits swelling of both knee joints and limited mobility, and he has been treated with monthly doses of factor IX. Pedigree The identified HB pedigree comprises 4 patients (Figure 1,2). I 8, I 11, and II 6 exhibited similar symptoms as the proband. III 4 was pregnant (20 weeks).

DNA Isolation and DNA Analysis with PCR Genomic DNA samples of patients (I 8, I 11, IV 1), 4 obligate carriers (I 2, II 1, III 1, III 4), and 100 healthy

adults from our center were isolated from peripheral blood leukocytes using a DNA extraction kit (Tiangen, Beijing, China). The F9 exons were amplified in a total of 7 reactions using the primers and polymerase chain reaction (PCR) conditions shown in Table 1. Sequencing was performed using the BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) and analyzed with the ABI 3130 Genetic Analyzer. Exons 1 to 8 of the F9 gene were sequenced in all patients. The F9 sequence was used as a reference and mutations were numbered accordingly [3].

Amniotic Fluid Culture Conditions and Treatment A third-generation member of the pedigree (III 4), a 25-year-old female, was pregnant (20 weeks). She was identified as a carrier by sequencing analysis and the couple received genetic counseling at the Medical Center of the No. 202 Hospital of the People’s Liberation Army, China. The genetic development of HB and the probability of the presence of this gene in the fetus, as well as the consequences if the child was affected by the disorder or identified as a carrier, were explained in detail. Amniocentesis and amniotic fluid culture were then carried out at the parents’ request. DNA analysis was performed as described.

FIX mRNA Analysis The F9 gene is expressed as a 2.8-kb mRNA. Elucidation of mutations in the F9 gene is important in understanding how such mutations affect the function of the F9 protein.

To investigate this issue, RNA was extracted from the peripheral blood of patients and normal controls using the Blood RNA Kit (Tiangen) according to the manufacturer’s protocol. Using the Reverse Transcription Kit (Promega, Madison, WI, USA), cDNA was generated according to the manufacturer’s instructions. Intron 3 was amplified with 2 pairs of primers containing the 5’-end GT donor splice site and the 3’-end AG acceptor splice site, which were designed using Primer5 software. The products were 438 bp and 213 bp in length, respectively. Amplification of the β-actin gene (the β-actin is specific to the cDNA) was included as a reference (626 bp). Details of the primers and PCR conditions are shown in Table 2. The PCR products were ligated into the TA cloning vector for sequencing as described.

227

Turk J Hematol 2014;31:226-230

Cao DH, et al: F9 Intron 3 Mutations and Hemophilia B

Sequencing of Intron 3 A pair of primers for amplification were designed using Primer5 software to amplify intron 3. The upstream primer (5’-TTGAAGAAGCACGAGAA-3’) is located in exon 2 while the downstream primer (5’-AACAACCCGAGTGAAGT-3’) is located in exon 6. The target fragment size in normal human cDNA is 473 bp. PCR amplification was performed using patient and control cDNA as templates and sequencing was conducted as described.

correct sequences of PCR products confirmed the presence of a residual part of intron 3 in the cDNA of the HB patient.

The target fragment (438 bp) containing the 5’-end GT donor splice site of intron 3 at the intron 3/exon 3 intersection of the F9 gene was not amplified from the patient (Lane 5 of Figure 3) or control (Lane 4 of Figure 3) cDNA templates.

However, the target fragment was successfully amplified from normal human DNA (Lane 6 of Figure 3) and the correct sequences were confirmed. This demonstrated the

Results Genetic Analysis Screening for molecular differences in the F9 gene was conducted by sequencing of genomic DNA in 3 patients, 4 carriers, and 100 healthy adults. We identified a novel point mutation at position 10,389 (A>G), located upstream of the AG splice site between intron 3 and exon 4. All carriers were identified as heterozygotes and the mutation was not detected in the 100 healthy adults.

Prenatal Diagnosis The fetal DNA was screened for prenatal diagnosis at the request of the mother (carrier) using the same method.

The results identified the fetus (IV 2) as a heterozygote for this mutation, thus confirming the child to be a carrier for HB. The prenatal protocol included 2 counseling sessions, psychosocial evaluation of the couple, and an obstetric assessment.

Study of HB Pathogenesis The target fragment (213 bp) containing the 3’-end AG acceptor splice site at the intersection of intron 3 and exon 4 was successfully amplified from normal human DNA (Lane 3 of Figure 3) and patient cDNA templates (Lane 2 of Figure 3). However, the target fragment was not amplified from the control cDNA template (Lane 1 of Figure 3), suggesting that intron 3 and exon 4 were correctly spliced and there was no residue of intron 3 in the cDNA of the control cDNA. The

Figure 1. Family pedigree. Solid symbols indicate affected individuals; circles represent females and squares represent males; open symbols indicate healthy individuals; circles with black dots indicate carriers. The proband is labeled with an arrow.

228

Figure 2. Sequencing maps of the F9 gene in patients and carriers. A, the proband; B, the proband’s mother (carrier); C, a normal control. Arrows indicate mutation loci.

Figure 3. PCR amplification of the 3’-end and 5’-end of factor F9 intron 3. Lanes 1, 2, and 3 represent the 3’-end of intron 3 amplified from normal human cDNA, patient cDNA, and normal human DNA as templates; Lanes 4, 5, and 6 represent the 5’-end of intron 3 amplified with normal human cDNA, patient cDNA, and normal human DNA as templates. The β-actin fragment was not amplified in Lanes 3 and 6 because β-actin cannot be amplified from DNA as it is specific to the cDNA. Lane M is a size marker.

Cao DH, et al: F9 Intron 3 Mutations and Hemophilia B

Turk J Hematol 2014;31:226-230

Table 1. Primers for mutation analysis of factor IX gene.

Exon

Primer sequence

Annealing temperature (°C)

Product size (bp)

Exon 1

5’-ACCACTTTCACAATCTGCTA-’3 5’-AAAGGCAAGCATACTCAAT- ‘3

55

159

Exons 2-3

5’-GAACATCACAGATTTTGGCTCC-’3 5’-ATGGGTTAGAGGGTTGGACTG-’3

60

661

Exon 4

5’- GGCTTCCAGGTCAGTAGTTTTGC-’3 5’-TTTTCCAGTTTCAACTTGTTTCAGAGG-’3

60

308

Exon 5

5’-AAATGATGCTGTTACTGTCT-’3 5’-GTTTGTTAAAATGCTGAAGT-’3

55

229

Exon 6

5’-AAATAACGCAATCAACC-’3 5’-ATCCCAATAGGTCTGTCTA-’3

55

479

Exon 7

5’-CAAATGTATTATGCAGTAAGAG-’3 5’-TGTACCAATCATATTAAAGAGC-’3

55

218

Exon 8

5’-ATTAGGTCAGTGGTCCCAAGTAGTC-’3 5’-CATTTTCTAATCAATTTGCTCAGGTA-’3

60

811

Table 2. RT-PCR primer details.

Annealing Product temperature (°C) size (bp)

Primer sequence F9-Intron 3 donor site

F: 5’-TTGGAAGCAGTATGTTGG-3’ R: 5’-AAGAAGGGTAATGGGGAG-3’

55

438

F9-Intron 3 acceptor site

F: 5’-TGGCTTCCAGGTCAGTAG-3’ R: 5’-AAGGGACACCAACATTCA-3’

60

213

Beta-actin

F: 5’-CCTCGCCTTTGCCGATCC-3’ R: 5’-GGATCTTCATGAGGTAGTCAGTC-3’

60

626

functional splicing activity of the 5’-end GT donor splice site of intron 3.

Sequencing of Intron 3 The target fragment was successfully amplified from normal human cDNA templates and the correct PCR products were confirmed by sequencing. The target fragment was not amplified from HB patient cDNA templates.

Discussion HB occurs in approximately 1 in 30,000 male live births [4] and this rate is not significantly affected by the ethnicity of the population. In all cases, HB is caused by mutation of the F9 gene, although mutation analyses of different cohorts have demonstrated extensive heterogeneity [5,6,7].

Mutations of this type are generally thought to include point mutations, missense mutations, nonsense mutations,

mRNA splice site mutations, deletions, and rearrangements/ inversions [1]. However, this study of a HB pedigree in China identified a novel mutation (10,389 A>G) in intron 3 of the F9 gene, located upstream of the AG splice site between intron 3 and exon 4.

The third base of the upstream 3’ acceptor splice site of the F9 gene intron 3 (-3 A>G) was identified as a heterozygous mutation locus in the proband’s mother (III 1) as well as the maternal grandmother (II 1), great-grandmother (I 2), and maternal first cousin (III 4), all of whom were carriers. The fetus (IV 2) of III 4 was identified as a carrier by prenatal diagnosis. The baby girl was delivered normally and normal F9 activity was confirmed.

Intronic splice sites are critical for maturation of premRNA. Therefore, we investigated the presence of splice site mutations in the F9 gene at the mRNA level by RT229

Turk J Hematol 2014;31:226-230

PCR analysis. It can be speculated that the (-3 A>G) mutation may lead to failure of normal intron 3 splicing.

We propose that the mutated splicing site leads to abnormal transcription of DNA to mRNA. Consequently, the abnormal mRNA results in the synthesis of abnormal F9 protein, thus causing patient morbidity. It is also possible that abnormally spliced mRNA cannot enter the cytoplasm, resulting in the absence of the translated protein. Thus, we hypothesize that the (-3 A>G) mutation at the base upstream of the intron 3/ exon 4 AG splice site in the patient in the pedigree results in aberrant splicing of the F9 mRNA. This accounts for the presence of partial residual sequences of intron 3 in patient cDNA, although it is unclear how long these sequences are maintained in patient cDNA. Amplification of this region was not achieved from patient cDNA even with the use of multiple primer pairs. Several factors may account for this: 1) no target fragment was amplified by PCR in the presence of excessive residual intron 3; 2) amplification is hindered owing to a high GC content and repetitive sequences in the introns; 3) the F9 gene in the patient cDNA is cleaved into 2 fragments such that exon 3 is separated from the residual portion of intron 3.

Point mutations (single-nucleotide substitutions) were the most common gene defects. Few mutations occur in the introns of the F9 gene, while most insertions and deletions in the exons cause frame shifts, leading to severe HB in almost all patients [8]. The findings of the present study further clarify the pathogenesis of HB, although the mechanism by which mutations in the F9 gene lead to dyspoiesis remains to be elucidated. Although further studies in this pedigree are required, this study provides the basis of a method for prenatal diagnosis of HB. Acknowledgments We thank all the patients and their families who participated in this study. This study was supported by the National Foundation of China (No. 30973140), the Doctor Starting Funding of Liaoning (No. 20111123), and the Natural Science Foundation of Liaoning (No. 201202230).

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

230

Cao DH, et al: F9 Intron 3 Mutations and Hemophilia B

References 1. Bowen DJ. Haemophilia A and haemophilia B: molecular insights. Mol Pathol 2002;55:127-144.

2. Green P. Haemophilia B Mutation Database, Version 12.

London, UK, Kings College of London, 2003. Available at http://www.kcl.ac.uk/ip/petergreen/haemBdatabase.html.

3. Yoshitake S, Schach BG, Foster DC, Davie EW, Kurachi K. Nucleotide sequence of the gene for human factor IX (antihemophilic factor B). Biochemistry 1985;24:37363750.

4. Belvini D, Salviato R, Radossi P, Pierobon F, Mori P, Castaldo G, Tagariello G; AICE HB Study Group. Molecular genotyping of the Italian cohort of patients with hemophilia B. Haematologica 2005;90:635-642.

5. Mukherjee S, Mukhopadhyay A, Banerjee D, Chandak GR, Ray K. Molecular pathology of haemophilia B: identification of five novel mutations including a LINE 1 insertion in Indian patients. Haemophilia 2004;10:259-263.

6. Espinos C, Casana P, Haya S, Cid AR, Aznar JA. Molecular analyses in hemophilia B families: identification of six new mutations in the factor IX gene. Haematologica 2003;88:235-236.

7. Onay UV, Kavakli K, Kilinç Y, Gürgey A, Aktuğlu G, Kemahli S, Özbek U, Çağlayan SH. Molecular pathology of haemophilia B in Turkish patients: identification of a large deletion and 33 independent point mutations. Br J Haematol 2003;120:656-659.

8. Rallapalli PM, Kemball-Cook G, Tuddenham EG, Gomez K, Perkins SJ. An interactive mutation database for human coagulation factor IX provides novel insights into the phenotypes and genetics of hemophilia B. J Thromb Haemost 2013;11:1329-1340.

Research Article

DOI: 10.4274/tjh.2013.0231

Different Types of Cell Cycle- and ApoptosisRelated Gene Expressions Alter in Corticosteroid-, Vincristine-, and Melphalan-Resistant U-266 Multiple Myeloma Cell Lines Hücre Döngüsü ve Apoptoz ile İlgili Gen İfadelerinin Kortikosteroid, Vinkristin ve Melfalan Dirençli U-266 Multipl Myelom Hücre Hatlarında Analizi Pelin Mutlu1, Ali Uğur Ural2, Ufuk Gündüz3 1Middle

East Technical University, Central Laboratory, Molecular Biology and Biotechnology R&D Center, Ankara, Turkey Hospital, Clinic of Hematology, Ankara, Turkey 3Middle East Technical University, Department of Biological Sciences, Ankara, Turkey 2Bayındır

Abstract: Objective: Deregulation of the cell cycle and apoptosis mechanisms in normal cells causes many problems, including cancer.

In this study, a genome-wide expression analysis of cell cycle- and apoptosis-related genes in corticosteroid-, vincristine-, and melphalan-resistant U-266 multiple myeloma cell lines was conducted.

Materials and Methods: Resistant U-266 sublines were induced by application of each drug by stepwise dose increments.

Resistance gained by the cells was confirmed with XTT cytotoxicity assay and microarray analyses were carried out. Among the cell cycle- and apoptosis-related gene expressions, alterations of more than 2-fold were considered significant.

Results: Cyclin E2 was drastically overexpressed in the vincristine-resistant subline and a general upregulation was observed for various cyclin-dependent kinases. Some of the cyclin-dependent kinase inhibitor encoding genes were downregulated in resistant sublines in general. Tumor necrosis factor receptor genes were generally downregulated in corticosteroid- and melphalan-resistant U-266 sublines. Different types of effector caspases were downregulated in all resistant sublines. Ceramide metabolism genes seemed to be changed in favor of survival, especially in the melphalan-resistant subline.

Conclusion: This report shows that different types of chemotherapeutic drugs alter different apoptotic and cell cycle-related gene expressions and, as a result, may cause drug-resistant phenotypes in U-266 multiple myeloma cell lines. Among those gene expressions, the most drastic increase in cyclin E2 could be important for the survival of vincristine-resistant U-266 cell lines, whereas alteration of ceramide metabolism genes could be important in melphalan resistance.

Key Words: Drug resistance, Multiple myeloma, Cell cycle, Apoptosis

Address for Correspondence: Ufuk GÜNDÜZ, M.D., Middle East Technical University, Department of Biological Sciences, Ankara, Turkey Phone: +90 312 210 51 83 E-mail: ufukg@metu.edu.tr Received/Geliş tarihi : July 4, 2013 Accepted/Kabul tarihi : September 16, 2013

231

Turk J Hematol 2014;31:231-238

Mutlu P, et al: Gene Expressions in Resistant U266 Cells

Özet: Amaç: Normal hücrelerde hücre döngüsü ve apoptoz mekanizmalarının düzensiz çalışması kanser de dahil olmak üzere pek

çok soruna neden olmaktadır. Bu çalışmada; kortikosteroid, vinkristin ve melfalan’a dirençli U-266 multipl miyelom hücre hatlarında hücre döngüsü ve apoptoz ile ilgili genlerin ifade düzeylerindeki farklılıklar incelenmiştir.

Gereç ve Yöntemler: İlaç dirençli U-266 hücre hatları her bir ilacın artan dozlarda U-266 hücrelerine uygulanması ile geliştirilmiştir. Dirençlilik gelişimi XTT sitotoksisite testleri ile gösterilmiş ve mikroarray analizi gerçekleştirilmiştir. Hücre döngüsü ve apoptoz ile ilgili olan gen ifadelerinden iki katın üzerinde olan değişiklikler anlamlı olarak kabul edilmiştir.

Bulgular: Vinkristin dirençli U-266 hücre hattında siklin E2 gen ifadesinin büyük ölçüde arttığı ve çeşitli siklin bağımlı kinaz genlerinin ifadelerinde genel olarak artış olduğu gözlenmiştir. Dirençli hatlarda, bazı siklin bağımlı kinaz inhibitörü kodlayan gen ifadelerinde azalma saptanmıştır. Tümör nekroz faktörü reseptör genlerinin ifadeleri kortikosteroid ve melfalan dirençli U-266 hücre hatlarında genellikle azalmıştır. Tüm dirençli hücrelerde farklı tiplerdeki efektör kaspaz gen ifadelerinde azalma gözlenmiştir. Seramid metabolizması gen ifadelerinde ise melfalan dirençli U-266 hücrelerinin hayatta kalmalarını sağlayacak şekilde değişimler saptanmıştır.

Sonuç: Bu sonuçlar, farklı kemoterapötik ilaçların farklı apoptoz ve hücre döngüsü ile ilgili gen ifadelerini değiştirerek U-266 multipl myeloma hücre hatlarında dirençliliğe neden olabileceğini göstermektedir. Bu gen ifadeleri arasında, siklin E2’deki yüksek artış vinkristine dirençli U-266 hücrelerinin hayatta kalımı için önemli olabilecekken, seramid metabolizması ile ilgili gen ifade değişiklikleri melfalan direnci açısından önemli olabileceği düşünülmektedir.

Anahtar Sözcükler: İlaç direnci, Multipl myelom, Hücre döngüsü, Apoptoz Introduction The emergence of drug resistance in tumor cells is a major complication for successful anticancer chemotherapy [1]. The balance between cell proliferation and apoptosis is a critical phenomenon for both development and normal tissue homeostasis. Deregulation of these processes in a normal cell results in many diseases, including cancer. Identification of genes that control cell death and apoptosis shows a linkage between apoptosis and cell cycle control mechanisms [2].

In one study it was shown that doxorubicin-resistant lung carcinoma cells exhibit altered cell cycle responses [3].

The cell cycle governs the fate of the cell [4]. Progression is controlled by external and internal signals. Cell cycle checkpoints control events throughout the cell cycle by the help of cyclins and cyclin-dependent kinases (CDKs) [4,5].

Cyclins are a family of proteins that control the progression of cells through the cell cycle by activating CDK enzymes [6,7]. At least 9 structurally related CDKs (CDK1-CDK9) have been identified. A considerable number of cyclins have also been identified to date (cyclin A-cyclin T) [4].

Cell cycle-mediated drug resistance is an important problem that must be overcome in cancer chemotherapy. It is best described as a relative insensitivity to a chemotherapeutic agent because of the position of the cells in the cell cycle. It was demonstrated when flavopiridol exposure was followed by paclitaxel in human gastric and breast cancer cells. The multiple cell cycle effects of flavopiridol, including the inhibition of different CDK activities at the G1 and G2 phases, create cell cycle arrest, which prevents cells from entering the M phase [8,9].

The process of apoptosis is controlled by a diverse range of cell signals, either extracellularly (toxins, hormones, growth 232

factors) or intracellularly (glucocorticoids, heat, radiation, viral infection, nutrient deprivation) [10,11]. There are 2 main methods of regulation for apoptosis, either targeting mitochondria functionality or directly transducing the signal via adaptor proteins to the apoptotic mechanisms. In the mitotic process, mitochondrial proteins known as small mitochondria-derived activators of caspases are released into the cytosol following an increase in permeability and then bind to inhibitor of apoptosis proteins (IAPs), preventing the IAPs from arresting the apoptosis [12]. For the direct transduction process, 2 theories have been suggested: the tumor necrosis factor-induced (TNF) model and the Fas-Fas ligand-mediated model, both involving receptors (TNFRs) coupled to extrinsic signals [13]. There is a balance between proapoptotic (bax, bid, bak, bad) and antiapoptotic (bcl-xl, bcl-2) proteins following TNF-R1 and Fas activation [14].

Caspases, which play a central role in apoptosis, are highly conserved proteases that degrade a host of intracellular proteins to carry out the cell death program.

In addition to changes in the expression levels of particular proteins that are related to cell cycle and apoptosis, multidrug-resistant (MDR) cells exhibit major alterations in their sphingolipid composition. Sphingolipids, which include ceramides and sphingosine, are essential structural components of cell membranes that also have messenger functions that regulate the proliferation, survival, and death of cells [15,16]. Ceramide accumulation inside the cell triggers apoptosis.

A 2- to 3-fold overexpression of glucosylceramide appears to be a rather general aspect of P-glycoproteinexpressing MDR cells. An increased turnover of ceramide to glucosylceramide may allow MDR cells to escape apoptosis,

Turk J Hematol 2014;31:231-238

Mutlu P, et al: Gene Expressions in Resistant U266 Cells

since ceramide plays a major role in the regulation of apoptosis [1]. Glucosylceramide synthase overexpression has been shown to enhance resistance to doxorubicin, suggesting that inhibition of ceramide metabolism or catabolism might enhance cancer chemotherapy [15].

This study demonstrates a genome-wide expression analysis of cell cycle, apoptosis, and ceramide metabolism genes in corticosteroid (U-266/Pred)-, vincristine (U-266/ Vinc)-, and melphalan (U-266/Melp)-resistant multiple myeloma cells.

Materials and Methods Cell Lines The human U-266 multiple myeloma cell line was obtained from Gülhane Military Medical School, Ankara, Turkey. The cells were grown in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum, 1% L-glutamine, and 1% gentamicin (Biological Industries, Beit-Haemek, Israel) and were maintained at 37 °C in a humidified air atmosphere with 5% CO2. Corticosteroid (methyl prednisolone) (U-266/Pred)-, vincristine (U-266/ Vinc)-, and melphalan (U-266/Melp)-resistant sublines were developed from the original U-266 cells by applying each drug separately in dose increments. The XTT cell viability assay was performed for original and drug-resistant sublines with the Cell Proliferation Assay Kit (Biological Industries).

The fold of resistance values of the sublines were previously reported [17].

RNA Isolation, cDNA Synthesis, and Target Preparation RNA isolation from all cells was performed using TRI reagent (Sigma, St. Louis, MO, USA) according to the manufacturer’s instructions. All RNA samples were prepared as duplicates for statistical analysis. RNA concentrations were adjusted to at least 2.5 µg/µL. cRNA synthesis, target hybridization, and scanning were performed at the Ankara University Biotechnology Institute (Ankara, Turkey). cDNAs were synthesized from total RNA by One-Cycle Target Labeling Assay (Affymetrix, Santa Clara, CA, USA) according to the manufacturer’s instructions. Secondstrand cDNA synthesis, biotin-labeled cRNA synthesis, and cRNA fragmentation were performed using the Affymetrix GeneChip Kit. Hybridization was conducted at 45 °C and 60 rpm for 16 h in an Affymetrix Gene Chip Hybridization Oven 640 and the arrays were stained using a hybridization stain kit according to the instructions in the technical manual.

Washing and staining were performed in an Affymetrix GeneChip Fluidics Station 450 with EukGE-WS2v5 fluidics script. The arrays were scanned in an Affymetrix GeneChip Scanner 3000.

Data Analysis Affymetrix GeneChip Operating Software and GeneSpring GX 7.3.1 Software (Agilent Technologies, Inc., Santa Clara, CA, USA) were used for expression data

analysis. The data were normalized by robust multichip analysis method. The gene expression levels were calculated at the level of oligonucleotide sets by using the median polish method [18] and log 2 equivalents were calculated.

Statistically significant data were selected by independent sample t-test (p<0.05) between duplicate data for resistant and original cells. The genes upregulated and downregulated more than 2-fold were considered and, by using the Kyoto Encyclopedia of Genes and Genomes pathway, grouping of data that could contribute to drug resistance was performed.

Finally, the genes that encode proteins related to cell cycle and apoptosis were selected and evaluated for possible relations to drug resistance phenotype. The microarray data of this study were confirmed with the RT-PCR results of the representative genes (MDR1, MRP1, Bcl-2, LRP, and BCRP) of the MDR phenotype (unpublished data).

Results Alterations in cell cycle- and apoptosis-related genes in drug-resistant U-266 multiple myeloma sublines are shown in Table 1. Different types of cell cycle-encoding genes and CDKs, especially CDK6 (-119-fold) and cyclin D3 (-104fold), were downregulated, whereas CDK inhibitor encoding genes (CDKN2B and CDKN2A) were upregulated in the corticosteroid-resistant U-266 cell line. However, cyclin E2 and the 2 recently identified subunits of E2F, E2F7 and E2F8, were drastically overexpressed in vincristine resistance. In melphalan resistance, some of the CDK inhibitor encoding genes (CDKN1A and CDKN1C) were downregulated.

TNF alpha-induced protein 3 (TNFAIP3) and TNF receptor superfamily member 10d (TNFRSF10) were downregulated in the U-266/Pred subline. However, TNFinducible gene 6 protein (TNFAIP6) and TNF alpha-induced protein 8 (TNFAIP8) were upregulated in vincristine resistance.

Caspase-3, -6, and -7 are called effector caspases, which are downstream caspases that in turn cleave other protein substrates within the cell to trigger the apoptotic processes.

A general downregulation of different types of caspases was observed in drug-resistant sublines (Table 1).

The baculoviral IAP repeat-containing (BIRC) group of genes, which belongs to a family that inhibits apoptosis, was overexpressed in corticosteroid and vincristine resistance but not in the melphalan-resistant subline. The Bcl-related genes (BNIP1 and BNIP3) were upregulated in the U-266/ Vinc subline whereas they were downregulated in U-266/ Pred. The most common Bcl-2 and Bcl-XL genes of this family were not significantly altered in these sublines, as confirmed

by RT-PCR and western blot analysis (data not shown).

The programmed cell death-related genes (PDCD11 and PDCD4) were also upregulated in the vincristine-resistant subline and downregulated in the corticosteroid-resistant one, which is parallel to Bcl-related gene expressions.

233

Turk J Hematol 2014;31:231-238

Mutlu P, et al: Gene Expressions in Resistant U266 Cells

Table 1 also shows the altered gene expressions in ceramide metabolism. The LAG1 homolog ceramide synthase 6 (LASS 6), sphingomyelin phosphodiesterase (SMPD3), and degenerative spermatocyte homolog 1 lipid desaturase (DEGS1) genes were upregulated while UDP-glucose ceramide glycosyltransferase (UGCG) and N-acylsphingosine amidohydrolase (ASAH1) genes were downregulated in the corticosteroid-resistant subline; all of these regulations cause accumulation of ceramide inside the cells. However, the LASS 6 and SMPD1 genes were downregulated in melphalan resistance, leading to degradation to ceramide inside the cells.

Discussion The cyclin E2 gene was 487-fold overexpressed in the U-266/Vinc subline. Cyclin E is a member of the cyclin family, which is required for the transition from the G1 to the S phase [19]. On the other hand, 2 of the transcription factor E2F subunits, E2F7 and E2F8, were highly overexpressed in the vincristine-resistant U-266 subline. E2F7 and E2F8 have an important role in DNA damage response. They repress E2F site-dependent transcription in a pRb-independent manner and delay cell cycle progression. High levels of E2F7 and E2F8 expression were shown as intrinsically lower sensitivity to E2F1-dependent apoptosis [20]. In order to overcome the mitotic inhibition of vincristine, the cells seem to upregulate the expression of their cell cycle-related genes. The breast cancer type 2 susceptibility (BRCA2) and CDKN1A interacting protein is also known as BCCIP. This gene product was isolated on the basis of its interaction with BRCA2 and p21 proteins. Functional studies indicate that this protein may be an important cofactor for BRCA2 in tumor suppression and a modulator of CDK2 kinase activity via p21 [21]. p21 is an important tumor suppressor protein that is regulated by p53. BCCIP gene expression was downregulated in both the corticosteroid- and vincristineresistant U-266 sublines. Therefore, this downregulation may have a significant effect on cell cycle stimulation.

In melphalan resistance, CDK inhibitor encoding genes (CDKN1A and CDKN1C) were downregulated, which may again be correlated with cell proliferation.

TNF acts via the TNF receptor (TNF-R) and is part of the extrinsic pathway for triggering apoptosis [13].

TNFRSF10, which is a proapoptotic gene, was shown to be upregulated in melanoma cells destined to undergo apoptosis [22]. In this study, this gene was downregulated in the corticosteroid-resistant U-266 subline, indicating a change towards cell survival. TNFAIP8 and TNFAIP6 (TSG6) genes were both upregulated in vincristine resistance.

TNFAIP8 is known as an antiapoptotic protein, and TSG6 is involved in the context of inflammation and is often associated with extracellular matrix remodeling [23]. TSG-6 is a secretory protein that has been identified as a member of the hyaluronate binding protein family [24]. It binds 234

extracellular matrix glycosaminoglycan hyaluronan [25].

It was also reported that TSG-6 modulates the interaction of hyaluronan with CD44 marker and thus can interfere with CD44-mediated interactions of lymphoid cells with hyaluronan in postcapillary venules [26]. CD44 is involved in various cell adhesion events, including lymphocyte migration, hematopoiesis, and tumor metastasis [27].

TNFRSF19, which activates the JNK signaling pathway and is capable of inducing apoptosis by a caspase-independent mechanism [28], was downregulated in the U-266/Melp subline. From these results, it can be seen that resistant sublines tend to escape apoptosis by regulating different types of TNF-related genes. Although different drugs trigger different regulatory pathways, they all tend to maintain the survival of the cell.

Different types of the effector caspases that trigger the apoptotic processes were downregulated in all resistant U-266 sublines. BIRC-related genes were overexpressed in corticosteroid- and vincristine-resistant sublines. The BIRC group of genes inhibits apoptosis by binding to TNF receptorassociated factors TRAF-1 and TRAF-2 [29]. BAG and BNIP are Bcl-related genes. These genes were upregulated in the vincristine-resistant U-266 subline and downregulated in the corticosteroid-resistant one. BAG is a Bcl-2-associated multifunctional prosurvival molecule that binds to Hsp70/ Hsc70 proteins. BNIP proteins, on the other hand, have roles in apoptosis in regulating the expression of genes associated with cell apoptosis, growth inhibition, and cell proliferation [30]. Programmed cell death is death of a cell mediated by an intracellular program. The PDCD11, PDCD4, and PDCD2 genes were overexpressed in the U-266/Vinc subline but downregulated in corticosteroid resistance, as in the case of Bcl-related genes. PDCD11 is an NFÎşB binding protein that colocalizes in the nucleus [31]. The PDCD4 gene encodes a protein localized to the nucleus in proliferating cells. It has recently been demonstrated to be a new tumor suppressor gene involved in colon carcinogenesis [32]. Its role in resistance of multiple myeloma cells is not clear.

The PDCD2 gene encodes a nuclear protein expressed in a variety of tissues. Expression of this gene has been shown to be repressed by Bcl-6, suggesting that Bcl-6 regulates apoptosis by its effects on PDCD2 [33].

Ceramides are a family of lipid molecules. The most wellknown functions of ceramides as cellular signals include regulating the differentiation, proliferation, programmed cell death, and apoptosis of cells [34]. Increased intercellular ceramide levels are associated with apoptosis and so downregulation of genes that are responsible for ceramide synthesis or upregulation of genes that have roles in ceramide clearance is effective in cell proliferation. Constitutive degradation of sphingolipids and glycosphingolipids takes place in the acidic subcellular compartments, the late endosomes and the lysosomes. Ceramide can be further hydrolyzed by acid ceramidase to form sphingosine and a

Turk J Hematol 2014;31:231-238

Mutlu P, et al: Gene Expressions in Resistant U266 Cells

Table 1. Expression levels of cell cycle- and apoptosis-related genes in corticosteroid-, vincristine-, and melphalan-resistant U-266 cell lines.

Gene name

Gene symbol

Description

U-266/Pred fold change

U-266/Vinc U-266/Melp fold change fold change

236313_at

CDKN2B

Cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)

+5.31

-6.40

NS

2188264_at

BCCIP

BRCA2 and CDKN1A interacting protein

-2.86

-3.16

NS

224847_at

CDK6

Cyclin-dependent kinase 6

-119.5

NS

NS

209644_x_at

CDKN2A

Cyclin-dependent kinase inhibitor 2A

+2.56

NS

NS

203469_s_at

CDK10

Cyclin-dependent kinase 10

-2.60

+2.36

NS

212897_at

CDC2L6

Cell division cycle 2-like 6

+2.53

-2.12

NS

226396_at

CDK3

Cyclin-dependent kinase 3

-3.13

+3.86

NS

201700_at

CCND3

Cyclin D3

-104

NS

NS

211792_s_at

CDKN2C

Cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4

NS

+3.81

NS

203252_at

CDK2AP2

CDK2-associated protein 2

NS

-5.16

NS

202284_s_at

CDKN1A

Cyclin-dependent kinase inhibitor 1A (p21, Cip1)

NS

-158.6

-12.04

202246_s_at

CDK4

Cyclin-dependent kinase 4

NS

+2.84

NS

203418_at

CCNA2

Cyclin A2

NS

+4.25

NS

205034_at

CCNE2

Cyclin E2

NS

+488

NS

228033_at

E2F7

E2F transcription factor 7

NS

+177

NS

219990_at

E2F8

E2F transcription factor 8

NS

+49

NS

216894_x_at

CDKN1C

Cyclin-dependent kinase inhibitor 1C (p57, Kip2)

NS

NS

-2.88

202643_s_at

TNFAIP3

Tumor necrosis factor, alphainduced protein 3

-4.50

NS

NS

227345_at

TNFRSF10

Tumor necrosis factor receptor superfamily member 10d

-2.02

NS

+2.04

224090_s_at

TNFRSF19

Tumor necrosis factor receptor superfamily member 19

NS

NS

-2.12

206026_s_at

TNFAIP6

Tumor necrosis factor, alphainduced protein 6

NS

+5.31

NS

208296_x_at

TNFAIP8

Tumor necrosis factor, alphainduced protein 8

NS

+2.62

NS

202763_at

CASP3

Caspase 3, apoptosis-related cysteine peptidase

-3.38

NS

-2.86

209790_s_at

CASP6

Caspase 6, apoptosis-related cysteine peptidase

-8.33

NS

NS

235

Turk J Hematol 2014;31:231-238

Mutlu P, et al: Gene Expressions in Resistant U266 Cells

207181_s_at

CASP7

Caspase 7, apoptosis-related cysteine peptidase

NS

-3.27

NS

210538_s_at

BIRC3

Baculoviral IAP repeat-containing 3

+404

NS

NS

202076_at

BIRC2

Baculoviral IAP repeat-containing 2

+548

NS

NS

225858_s_at

BIRC4

Baculoviral IAP repeat-containing 4

NS

+6.54

NS

217911_s_at

BAG3

BCL2-associated athanogene 3

-9.31

NS

NS

37226_at

BNIP1

BCL2/adenovirus E1B 19 kDa interacting protein 1

-2.98

+2.60

NS

201849_at

BNIP3

BCL2/adenovirus E1B 19 kDa interacting protein 3

-2.69

+3.05

NS

212422_at

PDCD11

Programmed cell death 11

-3.48

+2.31

NS

212593_s_at

PDCD4

Programmed cell death 4

-3.50

+6.02

NS

228420_at

PDCD2

Programmed cell death 2

NS

+2.51

NS

212442_s_at

LASS6

LAG1 homolog, ceramide synthase 6

+2.08

+2.12

-2.18

209857_s_at

SPHK2

Sphingosine kinase 2

+2.88

+3.86

NS

221765_at

UGCG

UDP-glucose ceramide glycosyltransferase

-18.63

NS

NS

209420_s_at

SMPD1

Sphingomyelin phosphodiesterase 1

NS

NS

-3.45

219695_at

SMPD3

Sphingomyelin phosphodiesterase 3

+5.65

NS

NS

207431_s_at

DEGS1

Degenerative spermatocyte homolog 1, lipid desaturase

+2.88

-6.14

NS

213702_x_at

ASAH1

N-acylsphingosine amidohydrolase (acid ceramidase)

-2.39

-2.39

NS

NS: nonsignificant.

free fatty acid, both of which are able to leave the lysosome, in contrast to ceramide. In this study, LASS 6 and SMPD1 genes were downregulated in melphalan resistance, leading to degradation to ceramide inside the cells. On the other hand, the LASS 6, SMPD3, and DEGS1 genes were upregulated while UGCG and ASAH1 were downregulated in the corticosteroid-resistant subline. These regulations cause accumulation of ceramide inside corticosteroid-resistant cells. The upregulation of ceramidase, sphingosine kinase, and glucosylceramide synthase and the downregulation of ceramide synthase genes can be important for drug resistance phenotypes since they lower the ceramide levels within the cell. In the literature, there are some studies that support this hypothesis [15]. Glucosylceramide synthase overexpression has been shown to enhance resistance to doxorubicin and alterations of ceramide/sphingosine 1-phosphate were shown to be involved in the regulation of resistance to imatinib in the K562 chronic myeloid leukemia cell line [35]. Several anticancer agents, including the cytotoxic retinoid fenretinide (4-HPR), have been shown to act by increasing tumor cell ceramide via de novo synthesis [15]. Expression of glucosylceramide synthase mRNA in 236

the vincristine-resistant KBV200 cell line was shown in association with multidrug resistance [36].

In conclusion, in the vincristine-resistant U-266 multiple myeloma cell line, cyclin E2 gene expression was drastically increased, whereas ceramide metabolism genes were altered only in melphalan resistance in favor of survival in the U-266 cell line. However, TNF receptor genes were generally downregulated in corticosteroidand melphalan-resistant U-266 sublines. This shows that different types of chemotherapeutic drugs alter different apoptotic and cell cycle-related gene expressions. On the other hand, all of the anticancer agents studied here are currently used in the clinical treatment of multiple myeloma. In vitro, different drug-resistant U-266 multiple myeloma cell lines show altered patterns of gene expressions related to apoptosis and the cell cycle. From a clinical perspective, this in vitro study may be a guide to clinicians for the development of new treatment strategies in drug-resistant cases. In the clinical setting, patients give different responses to the same antimyeloma regimens. By figuring out the patient profile, like in the case of our in vitro study, different types of drug combinations can be

Mutlu P, et al: Gene Expressions in Resistant U266 Cells

used in order to overcome the drug resistance phenotype.

However, the results of this study only provide preliminary insight into this phenomenon.

Acknowledgments We gratefully acknowledge the Ankara University Biotechnology Research Center for technical assistance. This study was supported by TÜBİTAK (SBAG 3297), Turkey.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Klappe K, Hinrichs JW, Kroesen BJ, Sietsma H, Kok JW. MRP1 and glucosylceramide are coordinately overexpressed and enriched in rafts during multidrug resistance acquisition in colon cancer cells. Int J Cancer 2004;110:511-522.

2. Fotedar R, Diederich L, Fotedar A. Apoptosis and the cell cycle. Prog Cell Cycle Res 1996;2:147-163.

3. O’Loughlin C, Heenan M, Coyle R, Clynes M. Altered cell cycle response of drug-resistant lung carcinoma cells to doxorubicin. Eur J Cancer 2000; 36:1149-1160.

4. Kaldis P, Russo AA, Chou HS, Pavletich NP, Solomon MJ. Human and yeast cdk-activating kinases (CAKs) display distinct substrate specificities. Mol Biol Cell 1998;9:25452560.

5. Liebermann DA, Hoffman B, Steinman RA. Molecular controls of growth arrest and apoptosis: p53-dependent and independent pathways. Oncogene 1995;11:199-210.

6. Galderisi U, Jori FP, Giordano A. Cell cycle regulation and neural differentiation. Oncogene 2003;22:5208-5219.

7. Clute P, Pines J. Temporal and spatial control of cyclin B1 destruction in metaphase. Nat Cell Biol 1999;1:82-87.

8. Motwani M, Delohery TM, Schwartz GK. Sequential dependent enhancement of caspase activation and apoptosis by flavopiridol on paclitaxel-treated human gastric and breast cancer cells. Clin Cancer Res 1999;5:1876-1883.

9. Chan TA, Hwang PM, Hermeking J, Kinzler KW, Vogelstein B. Cooperative effects of genes controlling the G2/M checkpoint. Genes Dev 2000;14:1584-1588.

10. Popov SG, Villasmil R, Bernardi J. Lethal toxin of Bacillus anthracis causes apoptosis of macrophages. Biochem Biophys Res Commun 2002;293:349-355.

11. Mattson MP, Chan SL. Calcium orchestrates apoptosis. Nat Cell Biol 2003;5:1041-1043.

12.

Fesik SW, Shi Y. Controlling the caspases. Science 2001;294:1477-1478.

13. Wajant H. The Fas signaling pathway: more than a paradigm.

Science 2002;296:1635-1636.

Turk J Hematol 2014;31:231-238

14. Murphy KM, Ranganathan V, Farnsworth ML, Kavallaris M, Lock RB. Bcl-2 inhibits Bax translocation from cytosol to mitochondria during drug-induced apoptosis of human tumor cells. Cell Death Differ 2000;7:102-111.

15. Reynolds CP, Maurer BJ, Kolesnick RN. Ceramide synthesis and metabolism as a target for cancer therapy. Cancer Lett 2004;206:169-180.

16. Bartke N, Hannun YA. Bioactive sphingolipids: metabolism and function. J Lipid Res 2009;50:S91-S96.

17. Mutlu P, Baran Y, Ural AU, Avcu F, Dirican B, Beyzadeoglu M, Gunduz U. Effect of cobalt-60 (γ radiation) on multidrugresistant multiple myeloma cell lines. Cell Biol Int 2011;35:721-725.

18.

Humphries MJ. Integrin structure. Biochem Soc T 2000;28:311-339.

19. Lindahl T, Landberg G, Ahlgren J, Nordgren H, Norberg T, Klaar S, Holmberg L, Berg J. Overexpression of cyclin E protein is associated with specific mutation types in p53 gene and poor survival in human breast cancer. Carcinogesis 2004;25:375-380.

20. Zalmas LP, Zhao X, Graham AL, Fisher R, Reilly C, Coutts AS, La Thangue NB. DNA-damage response control of E2F7 and E2F8. EMBO Rep 2008;9:252-259.

21.

Coleman RA, Rao P, Fogelsong RJ, Bardes ES. 2-Bromopalmitoyl-CoA and 2-bromopalmitate: promiscuous inhibitors of membrane-bound enzymes.

Biochim Biophys Acta 1992;1125:203-209.

22.

Kokkinakis DM, Brickner AG, Kirkwood JM, Liu X, Goldwasser JE, Kastrama A, Sander C, Bocangel D, Chada S. Mitotic arrest, apoptosis and sensitization to chemotherapy of melanomas by methionine deprivation stress. Mol Cancer Res 2006;4:575-589.

23. Ewing RW, Chu P, Elisma F, Li H, Taylor P, Climie S, McBroom-Cerajewski L, Robinson MD, O’Connor L, Li M, Taylor R, Dharsee M, Ho Y, Heilbut A, Moore L, Zhang S, Ornatsky O, Bukhman YV, Ethier M, Sheng Y, Vasilescu J, Abu-Farha M, Lambert JP, Duewel HS, Stewart II, Kuehl B, Hogue K, Colwill K, Gladwish K, Muskat B, Kinach R, Adams SL, Moran MF, Morin GB, Topaloglou T, Figeys D. Large-scale mapping of human protein-protein interactions by mass-spectrometry. Mol Syst Biol 2007;3:89.

24. Lee TH, Wisniewski HG, Vilcek J. A novel secretory tumor necrosis factor-inducible protein (TSG-6) is a member of the family of hyaluronate binding proteins, closely related to the adhesion receptor CD44. J Cell Biol 1992;116:545557.

25. Parkar AA, Day AJ. Overlapping sites on the Link module of human TSG-6 mediate binding to hyaluronan and chondroitin-4-sulphate. FEBS Letters 1997;410:413-417.

26. Lesley J, Gal I, Mahoney DJ, Cordell MR, Rugg MS, Hyman R, Day AJ, Mikecz K. TSG-6 modulates the interaction between hyaluronan and cell surface CD44. J Biol Chem 2004;279:25745-25754.

237

Turk J Hematol 2014;31:231-238

27. Lesley J, Hyman R, Kincade PW. CD44 and its interaction with extracellular matrix. Adv Immunol 1993;54:271-335.

28. Chaudhary D, Long AJ, Bourque K, Adams D, Hubscher S, Towler P, Potts D, Wood CR. TRADE, a novel TNF receptor superfamily member, induces apoptosis and activates NFÎşB and Jnk. Scand J Immunol 2000;51(Suppl 1):33.

29. Rothe M, Pan MG, Henzel WJ, Ayres TM, Goeddel DV. The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins. Cell 1996;83:1243-1252.

Mutlu P, et al: Gene Expressions in Resistant U266 Cells

33. Baron BW, Hyjek E, Gladstone B, Thirman MJ, Baron JM. PDCD2, a protein whose expression is repressed by BCL6, induces apoptosis in human cells by activation of the caspase cascade. Blood Cells Mol Dis 2010;45:169-175.

34. Haimovitz-Friedman A, Kan CC, Ehleiter D, Persaud RS, McLoughlin M, Fuks Z, Kolesnick RN. Ionizing radiation acts on cellular membranes to generate ceramide and initiate apoptosis. J Exp Med 1994;180:525-535.

30. Xie L, Qin WX, He XH, Shu HQ, Yao GF, Wan DF, Gu JR. Differential gene expression in human hepatocellular carcinoma Hep3B cells induced by apoptosis-related gene BNIP-2. World J Gastroenterol 2004;10:1286-1291.

35. Baran Y, Salas A, Senkal CE, Gunduz U, Bielawski J, Obeid LM, Ogretmen B. Alterations of ceramide/sphingosine 1-phosphate rheostat involved in the regulation of resistance to imatinib-induced apoptosis in K562 human chronic myeloid leukemia cells. J Biol Chem 2007;282:1092210934.

31. Turner AJ, Knox AA, Prieto JL, McStay B, Watkins NJ. A novel small-subunit processome assembly intermediate that contains the U3 snoRNP, nucleolin, RRP5 and DBP4. Mol Cell Biol 2009;29:3007-3017.

36. Yang Q, Zhang J, Wang SM, Zhang JR. Expression of glucosylceramide synthase mRNA in vincristine-resistant KBV200 cell line in association with multidrug resistance.

Di Yi Jun Yi Da Xue Xue Bao 2004;24:779-781.

32. Fassan M, Pizzi M, Giacomelli L, Mescoli C, Ludwig K, Pucciarelli S, Rugge M. PDCD4 nuclear loss inversely correlates with miR-21 levels in colon carcinogenesis.

Virchows Arch 2011;458:413-419.

238

Research Article

DOI: 10.4274/tjh.2013.0131

The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the World Health Organization for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation JAK2V617F Mutasyonu Bulunan Prefibrotik Myeloproliferatif Neoplazmların Tanı, Sınıflandırma ve Evrelendirmesinde Dünya Sağlık Örgütü Kriterlerinin 2007/2008 Gözden Geçirilmesi ve Avrupa Klinik, Moleküler ve Patolojik (ECMP) Kriterleri Jan Jacques Michiels1,2, Fibo Ten Kate3, King H. Lam3, Wilfried Schroyens1, Zwi Berneman1, Hendrik De Raeve4 1Antwerp University Hospital, Department of Hematology, Antwerp, Belgium 2Goodheart Institute, European Working Group on Myeloproliferative Neoplasms (EWG-MPN), Rotterdam, Netherlands 3Erasmus University Medical Center, Department of Pathology, Rotterdam, Netherlands 4OLV Hospital Aalst and University Hospital, Departments of Pathology, Brussels, Belgium

Abstract: Objective: The prefibrotic stages of JAK2V617F essential thrombocythemia (ET) and JAK2V617F polycythemia vera (PV) can

easily be diagnosed clinically without use of bone marrow biopsy histology. We assessed the 2008 WHO and European Clinical, Molecular, and Pathological (ECMP) criteria for the diagnosis of myeloproliferative neoplasms (MPNs).

Materials and Methods: Studied patients included 6 JAK2V617F-mutated ET and 4 PV patients during long-term follow-up in view of critical analysis of the literature. The bone marrow biopsy histology diagnosis without use of clinical data was PV in 7 (of which 3 were cases of ET with features of early prodromal PV) and classical PV in 4.

Results: The ECMP criteria distinguish 3 sequential phenotypes (1, 2, or 3) of JAK2V617F-mutated ET: normocellular ET-1; ET-2, with clinical and bone marrow features of PV (prodromal PV), and ET-3, with hypercellular dysmorphic megakaryocytic and granulocytic myeloproliferation (ET.MGM). The 3 patients with ET-2 or prodromal PV developed slow-onset PV after Address for Correspondence: Jan Jacques MICHIELS, M.D., Antwerp University Hospital, Department of Hematology, Antwerp, Belgium E-mail: goodheartcenter@upcmail.nl Received/Geliş tarihi : April 12, 2013 Accepted/Kabul tarihi : May 27, 2013

239

Turk J Hematol 2014;31:239-254

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

a follow-up of about 10 years. Bone marrow biopsy histology differentiates MPNs of various molecular etiologies from all variants of primary or secondary erythrocytoses and thrombocytoses with sensitivity and specificity of near 100%.

Conclusion: Normocellular ET (WHO-ET), prodromal PV, and classical PV show overlapping bone marrow biopsy histology features with similar pleomorphic clustered megakaryocytes in the prefibrotic stages of JAK2V617F mutated MPN. Erythrocytes are below 6x1012/L in normocellular ET and prodromal PV, and are consistently above 6x1012/L in classical PV and at the time of transition from prodromal PV into classical PV. Red cell count at a cut-off level of 6x1012/L separates ET from PV and obviates the need for red cell mass measurement when bone marrow histology and JAK2V617F mutation screening are included in the diagnostic work-up of MPNs. Key Words: Myeloproliferative disorders, Myeloproliferative neoplasm, Essential thrombocythemia, Polycythemia vera, Primary myelofibrosis, JAK2V617F mutation, Bone marrow histopathology, Red cell mass, Erythrocyte count

Özet: Amaç: JAK2V617F esansiyel trombositemi (ET) ve JAK2V617F polisitemia veranın (PV) prefibrotik evrelerinin tanısı, kemik iliği biyopsi histolojisine gerek kalmadan kolaylıkla klinik olarak konulabilir. Biz, myeloproliferatif neoplazmlarının (MPNs) tanısı için 2008 Dünya Sağlık Örgütü (DSÖ) ve Avrupa Klinik, Moleküler ve Patolojik (ECMP) kriterlerini değerlendirdik.

Gereç ve Yöntemler: Çalışmaya, literatür değerlendirmesi gözönünde bulundurularak uzun sureli gözlemde tutulan 6

JAK2V617F mutasyon pozitif ET ve 4 PV hastası dahil edildi. Dört klasik PV ve 7 PV olgusuna klinik veriler kullanılmadan, kemik iliği biyopsi histolojisine dayanarak tanı konuldu (bunların 3’ü erken prodromal PV özellikleri taşıyan ET idi).

Bulgular: ECMP kriterleri JAK2V617F mutasyonu olan ET’yi 3 ardışık fenotipe ayırmaktadır. Normosellüler ET-1; PV’nin klinik ve kemik iliği özelliklerini taşıyan ET-2 (prodromal PV) ve hipersellüler dismorfik megakaryositik ve granülositik myeloproliferasyon ile birlikte olan, ET-3 (ET.MGM). ET-2 ya da prodromal PV’li 3 hasta, yaklaşık 10 yıllık bir izlemin ardından yavaş başlangıçlı PV’ye dönüşmüşlerdir. Kemik iliği biyopsi histolojisi, çok çeşitli moleküler etiyolojik etkenlere sahip olan myeloproliferatif neoplazmları neredeyse %100’e varan bir duyarlık ve özgüllükle, birincil ve ikincil trombositoz ve eritrositozun hemen her tipinden ayırt etmektedir.

Sonuç: Normosellüer ET (DSÖ-ET), prodromal PV ve klasik PV’nin üçü de prefibrotik evrede benzer pleomorfik megakaryosit kümeleşmesi özelliği barındıran birbirleriyle örtüşen kemik iliği biyopsi histolojisine sahiptirler. Eritrosit sayısı, normosellüler ET ve prodromal PV’de 6x1012/L’nin altındayken, klasik PV’de ve prodromal PV’den klasik PV’ye dönüşümde ise kalıcı olarak 6x1012/L’nin üstünde seyretmektedir. 6x1012/L düzeyindeki kırmızı hücre cut-off değeri ET’yi PV’den ayırmakta ve ek olarak kemik iliği histolojisi ve JAK2V617F mutasyon taramasının uygulanan prosedürler içinde olmasıyla myeloproliferatif neoplazmların tanısında kırmızı hücre kitle tayini ihtiyacını da ortadan kaldırmaktadır.

Anahtar Sözcükler: Myeloproliferatif hastalıklar, Myeloproliferatif neoplasm, Esansiyel trombositemi, Polisitemia vera, Primer myelofibrozis, JAK2V617F mutasyonu, Kemik iliği histolojisi, Kırmızı kan hücresi kitlesi, Kırmızı kan hücresi sayısı

Introduction Focusing on the elucidation of platelet-mediated erythromelalgia in essential thrombocythemia (ET) and polycythemia vera (PV) [1,2,3] and on the association of migraine-like microvascular cerebral transient ischemic attacks (MIAs) as specific presenting symptoms of thrombocythemia in ET [4], we were able to document the prefibrotic stages of ET and PV by the combined use of clinical, laboratory, and bone marrow histopathology features for each of the primary myeloproliferative neoplasms (MPNs). Since 1975 we have diagnosed and classified ET and PV patients according to the Rotterdam Clinical and Pathological (RCP [5,6]), European Clinical and Pathological (ECP; http:// www.mpn-stichting.nl/doctors_brochure_2004.pdf [7,8,9]), and European Clinical, Molecular, and Pathological (ECMP [10,11]) criteria for prefibrotic ET and PV and primary 240

chronic megakaryocytic granulocytic myeloproliferation (CMGM). The ECMP criteria for ET, PV, and CMGM or chronic idiopathic myelofibrosis were published in June 2007 [9,10,11] and preceded the World Health Organization (WHO) revised diagnostic criteria for PV, ET, and primary fibrosis (PMF) in August 2007 [12]. The RCP, ECP, and ECMP criteria included a minimum platelet count of 350 to 400x109/L for the diagnosis of ET and the presence of enlarged megakaryocytes in bone marrow biopsy as the pathognomonic clue to prefibrotic ET and PV. According to the ECP and ECMP criteria, the criteria for ET defined by the Polycythemia Vera Study Group (PVSG) overlooked about 30% of masked ET with thrombocythemia at platelet counts below 600x109/L [13] until the official introduction of the 2008 WHO classification of MPN using a minimum count of 450x109/L for the diagnosis of ET [14,15]. In this report, we present 10 cases of MPNs with the JAK2V617F mutation

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

diagnosed without the use of bone marrow histopathology in 6 ET and 4 PV patients. Based on bone marrow biopsy histology alone by 3 expert pathologists, 3 ET patients showed a normocellular ET bone marrow picture and 3 ET and 4 PV patients showed a hypercellular PV picture. In the present study we applied the ECP and ECMP [9] criteria for diagnosis, classification, and staging of JAK2V617Fmutated MPN (Tables 1, 2, and 3). This study reveals the existence of 3 sequential phenotypes of JAK2V617F-mutated ET patients clearly in between normocellular ET (WHO-ET) and post-ET myelofibrosis. As compared to the 2008 WHO classification, the 2008 ECMP classification encompasses a wider scale of specific clinical, laboratory, and bone marrow biopsy histology features of JAK2V617F-positive ET and PV, thereby making possible a proper diagnosis, staging, and timely initiation of appropriate first-, second-, or third-line treatment options.

Materials and Methods Ten patients who presented with aspirin-responsive migraine-like transient ischemic attack as the clue to prefibrotic stage ET or PV according to WHO, ECP, and ECMP criteria were selected (Tables 1 and 2) from 22 MPN patients with various fibrotic degrees of MPN that were referred from European countries to JJM at the Antwerp University Hospital between January 2001 and August 2007 for expert evaluation and treatment recommendation. The ET and PV patients were subsequently followed up by their local hematologists until 2013.

Diagnostic evaluation included a complete clinical history, physical examination, retrospective clinical and laboratory data collection from hospital records, actual blood cell counts, white blood differential count, leukocyte alkaline phosphatase (LAP: normal value <100) score, peripheral blood morphology for the presence of large platelets, tear drop red cells, erythroblasts, screening for the JAK2V617F mutation in peripheral blood using polymerase chain reaction testing according to Baxter et al. [16], bone marrow aspirate for morphology, serum erythropoietin (EPO) levels, spontaneous endogenous erythroid colony (EEC+) formation, red cell mass (RCM) measurement, and spleen size on echogram [6,7,8,9]. The presence of a Philadelphia chromosome or BCR-ABL fusion protein was excluded in all patients.

Bone marrow biopsies from the iliac crest were stained with hematoxylin and eosin (H&E) for histopathology evaluation. All bone marrow biopsies were evaluated for morphology, grading of cellularity, and scoring of reticulin fibers according to PVSG recommendations according to Ellis et al. [17] (Table 3). In addition to silver impregnation for the detection of reticulin fibers, the collagen staining of Mason was used for objective detection of collagenization of reticulin fibers and grading of myelofibrosis according to Thiele et al. [18] to clearly distinguish among prefibrotic, early fibrotic, and advanced fibrotic stages of ET and PV

Turk J Hematol 2014;31:239-254

[17,18] (Table 3). Peripheral blood and bone marrow biopsy histology data were evaluated according to the 2008 WHO classification and the ECMP criteria for ET and PV (Tables 1 and 2).

Results Thrombocythemia-Specific Symptoms in JAK2V617FPositive ET and PV The age of patients at the time of the first MPN-specific symptoms and increased platelet count ranged from 23 to 56 years for patients with clinical presentation of ET (n=6) and from 37 to 49 years for PV (n=4). The MIAs in 6 ET patients ranged from attacks of transient blindness, diplopia, scotomas, and migraine-like attacks followed by throbbing headaches, nausea, vomiting, or even seizures. The time lapse between the first symptoms of MIAs and the delay in the diagnosis of ET in 5 patients ranged from 4 to 12 years (Table 4). Six ET patients had normal erythrocyte counts below 6x1012/L and normal values for red cell mass (Table 4). Four PV patients with MIAs (Table 4, cases 7, 8, 9, and 10) had a documented short history of MIAs of about 1 year and presented with increased red cell mass and increased values for red blood cell counts in excess of 6x1012/L, consistent with acute-onset PV. Diagnosis of JAK2V617F-Positive ET and PV without Bone Marrow Histology At the time of presentation, 1 PV (case 7) and all ET patients revealed a heterozygous JAK2V617F mutation of less than 40%, but the percentage of mutated alleles increased from 25% to 65% after 5 years in PV case 8 and from 38% to 71% in PV case 9. PV case 10 presented with 75% JAK2V617F allele mutation burden. The diagnoses based on the clinical, laboratory, and molecular criteria without the use of bone marrow histology were ET in 6 and PV in 4 patients (Table 4A). All patients except 1 (PV case 8, platelets 397x109/L) presented with elevated platelet counts at the time of initial MIAs ranging from 405 to 924x109/L. The erythrocyte counts at time of diagnosis were below 6.0x1012/L in 6 ET and above 6.0x1012/L in 4 PV patients. The erythrocyte counts rose from below to above 6x109/L in 3 ET patients at the time of evolution into classical PV (Table 4A, Figure 1). The hemoglobin and hematocrit levels remain low in PV in remission by phlebotomy alone for periods of months and years and parallel each other (Figure 1). The red blood cell counts remained above 6.0 to 7.5x1012/L in treated PV patients by phlebotomy alone (Table 4A, Figure 1), indicating that correction of hemoglobin and hematocrit is related to reduction of mean corpuscular volume to less than 70 to 65 Âľm3 due to iron deficiency.

Diagnosis of ET and PV by Bone Marrow Histology Alone The bone marrow histology findings are summarized in Table 4B. All MPN patients carrying the JAK2V617F mutation showed an increase of pleomorphic enlarged 241

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

Turk J Hematol 2014;31:239-254

Table 1. Diagnosis and classification of prefibrotic JAK2V617F-positive ET and prodromal PV according to the European Clinical, Molecular, and Pathological (ECMP) criteria to distinguish 3 phenotypes of ET and subsequent early prefibrotic and fibrotic stages between ET and post-ET myelofibrosis.

Clinical and molecular criteria

Pathological criteria

Platelet count of ≥350x10 /L Normal hematocrit (males <0.51, females <0.48) and normal erythrocytes (<6x1012/L) are mandatory Presence of JAK2V617F mutation Increased LAP score Low serum EPO level Spontaneous EEC No or minor splenomegaly on echogram No preceding or allied CML, PV, RARS-T, or MDS

Normocellular ET (WHO-ET) Predominant proliferation of enlarged mature megakaryocytes with hyperlobulated nuclei and mature cytoplasm, lacking conspicuous morphological abnormalities. No increase of cellularity or immaturity of erythropoiesis.

ET with features of PV: Prodromal PV Increased cellularity (60%-80%) with increased erythropoiesis or trilineage myeloproliferation (75%-100%). Proliferation and clustering of small to giant (pleomorphic) megakaryocytes with hyperlobulated nuclei.

ET: presence of JAK2V617F mutation and one or more of the above

ET.MGM Increased cellularity due to chronic megakaryocytic and granulocytic myeloproliferation (MGM) and normal or reduced erythroid precursors.

Loose to dense clustering of more pleomorphic megakaryocytes with hyperploid or clumpy nuclei (not or some cloud-like).

Grading of reticulin fibrosis (RF), reticulin collagen fibrosis (RCF, PVSG [17]), and myelofibrosis (MF, Thiele et al. [18]): Prefibrotic: RF-0/1 = MF-0 Early fibrotic: RF-2 = MF-1 Fibrotic: RCF-3 = MF-2 Sclerotic: RF-4 = MF-3

9

Clinical ET stage: Borderline or mild anemia Borderline or increased LDH Slight to moderate splenomegaly Hetero-/homozygous JAK2V617F mutation Post-ET myelofibrosis Splenomegaly Anemia, increased CD34+ cells

Masked ET or PV: In the setting of splanchnic vein thrombosis (SVT, Budd-Chiari syndrome or portal vein thrombosis) in 241 patients, platelet counts were between 238 and 456x109/L (mean: 333) in 74 patients carrying the JAK2V617F mutation and between 104 and 258x109/L (mean: 159) in 147 JAK2 wild-type SVT patients [42].

Applying WHO bone marrow features in 539 PVSG-defined ET patients, the relative frequency of ET stage 1 versus ET stages 3, 4, and 5 was 1.1:1.5:2.2:0.7 [33].

megakaryocytes. Bone marrow cellularity ranged from 60% to 90% with increased erythropoiesis in 9 patients and increased myelopoiesis in 1 ET and 3 PV patients.

Two patients fulfilled the histological WHO bone marrow features for ET (cases 1 and 2, Table 4, Figure 2). Seven patients (3 ET and 4 PV, Table 4B) fulfilled the histological WHO bone marrow features for PV (Figures 3, 4, 6, 7, and 8). There was no (MF-0, n=5) or slight (MF-1, n=2) increase of reticulin fibers (Table 4B).

Based solely on the bone marrow histology as judged by 3 expert hematopathologists, diagnosis was consistent with ET in 2 cases, PV in 7/10 cases, and ET with hypercellular dysmorphic megakaryocytic and granulocytic myeloproliferation (ET.MGM [5]) or prefibrotic PMF-0 [7,8] in 1 case (Table 4B). The morphology of clustered large pleomorphic megakaryocytes was diagnostic for ET and PV in all 10 MPN patients as 242

compared to controls, reactive thrombocytosis, or reactive or congenital erythrocytosis (Figure 7C). The bone marrow was normocellular or slightly hypercellular (≤65%) in 2 ET cases, hypercellular (≥75%) due to increased erythropoiesis in 2 ET cases (Figure 3), hypercellular due to increased erythropoiesis and granulopoiesis (trilinear) in 1 ET and 2 PV cases (Figure 4), and with increased granulopoiesis with relatively reduced erythropoiesis in 1 ET case (Figure 5). The bone marrow was hypercellular (≥75%) in 4 PV patients due to increased erythropoiesis in 2 (Figures 6 and 7) and increased erythropoiesis and granulopoiesis (trilinear PV) in 2 (Figure 8).

2008 WHO and ECMP Diagnoses of JAK2V617FMutated MPN The initial diagnoses were ET in 5, MPN unclassifiable in 1, and PV in 4 patients according to 2008 WHO criteria [14,15] (Table 4B). Diagnoses in the 6 JAK2V617F-mutated

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

Turk J Hematol 2014;31:239-254

Table 2. European Clinical, Molecular, and Pathological (ECMP) criteria for the diagnosis of PV and diagnostic differentiation between PV and congenital or acquired erythrocytosis.

Clinical and molecular criteria

Pathological criteria (WHO)

Major A0. Prodromal PV: Hematocrit upper limit normal, 0.45 to 0.51 in males and 0.43 to 0.48 in females; erythrocytes <6x1012/L. A1. Classical PV: Hematocrit >0.51/>0.48 in male/ females, erythrocytes >6x1012/L. A2. Presence of JAK2V617F or JAK2 exon 12 mutation, mandatory.

A3. Low serum EPO level.

Minor B1. Persistent increase of platelet count: grade I, 400-1500; grade II, >1500.

B2. Granulocytes >10 x109/L or leukocytes >12 x109/L and/or raised LAP score in the absence of fever or infection.

B3. Splenomegaly on palpation or on ultrasound echogram (>12 cm length in diameter).

B4. Spontaneous EEC formation (optional).

P1. Bone marrow pathology: increased cellularity (60%-100%) due to trilinear increase of erythropoiesis, megakaryopoiesis and granulopoiesis, and clustering of small to giant (pleomorphic) megakaryocytes with hyperlobulated nuclei.

Absence of stainable iron. No pronounced inflammatory reaction (plasmacytosis, cellular debris).

P2. Selective increase of normoblastic erythropoiesis, normal granulopoiesis and megakaryocytes of normal size and morphology, and no clustering in primary/secondary erythrocytosis.

P3. Grading of reticulin fibrosis (RF), reticulin collagen fibrosis (RCF [17]) and myelofibrosis (MF [18]): Prefibrotic: RF-0/1 = MF-0 Early fibrotic: RF-2 = MF-1 Fibrotic: RCF-3 = MF-2 Post-PV MF: RF-4 = MF-3

2008 WHO bone marrow and ECMP criteria for early and overt PV: A0, A2, B1, and P1 establish early PV (mimicking ET), PV ECP stage 0, or masked PV. A1, A2, P1, and none of B establish polycythemic PV ECP stage 1.

A1, A2, P1, and one or more of B establish classic and advanced PV ECP stages 2 and 3.

A1 and P2 with normal or increased values of serum EPO is consistent with erythrocytosis.

B3 and P1 is consistent with latent (masked) primary myeloproliferative disease (PMD).

A3 confirms PV. B4 is an important research option.

Table 3. Grading of bone marrow cellularity according to Ellis et al., PVSG, 1975 [17].

Grading reticulin fibrosis (RF=+) [17]

Grading myelofibrosis (MF), Thiele et al. [18]

Description of reticulin fibers (RFs) [17] and reticulin/collagen fibers (RCFs) [7] in MF [18] as a secondary event in myeloproliferative neoplasms (MPNs)

Normal RF-0

N MF-0

No RFs, occasional individual fibers or focal areas with tiny amount of reticulin fiber network

Slight increase RF-1

+ MF-0

Fine RF network throughout much of the section and no course RFs

Moderate increase RF-2

++

Diffuse fine reticulin network with focal collections of thick coarse RFs and no collagenization

MF-1 Marked increase, BM dry tap RF-3 = RCF

+++ MF-2

Diffuse and dense increase in reticulin with extensive intersections and presence of collagen fibers and no or minor osteosclerosis

OS dry tap RF-4 = RCF&O

Sclerotic MF-3

Diffuse and dense reticulin with coarse bundles of collagen associated with significant osteosclerosis (O)

N: normal cellularity (<50%-60%). +: increased cellularity as judged by decease in fat cells (cellularity: 60%-80%). ++: hypercellular with absence of fat cells (80%-100%).

Grading of reticulin and collagen fibrosis by Ellis et al. (PVSG, 1975) [17] and Thiele et al., 2005 [18].

243

Turk J Hematol 2014;31:239-254

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

Table 4A. Clinical and laboratory data, bone pathohistology, and diagnosis of ET or PV.

4A: Case

1

2

3

4

5

6

7

8

9

10

56/M

60/M

66/F

37/F

31/F

40/F

43/F

50/M

47/F

38/M

A. Clinical data Age (years), F/M Platelets, x10 /L

575

814

544

553

576

425

405

397

924

384

Duration of MIAs

2 years

11 years

8 years

<1 year

8 years

14 years

<1 year

1 year

<1 year

1 year

JAK2V617F *

+/-

+/-

+/-

+/-

+/-

+/-

+/-

+/+

+/+

+/+

Normal

Zero

Decreased

Decreased Decreased

nt.

Decreased

Zero

Zero

Zero

Leukocytes, x10 /L

6.7

5.3

12.9

8.2

6.2

6.1

14.3

7.3

13.1

8.0

LAP score

-

160

197

N

186

N

263

163

232

284

9

Serum EPO 9

Hemoglobin, g/dL

13.6

15.5

14.2

14.4

140

13.4

18.31

18.6

16.3

12.8

Hematocrit

0.40

0.45

0.44

0.44

0.41

0.40

0.52

0.63

0.53

0.60

Erythrocytes, x1012/L

4.5

5.3

4.7

4.8

4.9

4.6

6.1.

6.3

7.4

6.7

EEC

+

+

+

+

+

nt.

+

+

+

+

↑

↑

↑

Red cell mass

N

N

N

N

nt.

N

↑

Spleen, cm

-

13

16

13

11.8

16.5

13

13.7

14.3

16

Clinical Diagnosis

ET

ET

ET

ET

ET

ET

PV

PV

PV

PV

JAK2V617F * : +/- is heterozygous, +/+ is homozygous.

PV patients with documented increased RCM had erythrocytes above 6.0x1012/L at diagnosis and at time of transition of prodromal PV into classic PV.

Table 4B. Bone marrow (BM) histology features and diagnosis according to 2008 WHO and ECMP criteria in 10 patients with JAK2V617F-positive MPN at diagnosis and during long-term follow-up.

4B: Case

1

2

3

4

5

6

7

8

9

10

B. BM Histology

-

Figure 2

Figure 4

-

Figure 3

Figure 5

Figure 6

Figure 7

Figure 8

-

Cellularity

65%

60%

90%

75%

75%

80%

75%

80%

80%

80%

M:E ratio

1

1

1

0.5

0.7

4

1

0.7

1.5

-

Megakaryocytes

MPN

MPN

MPN

MPN

MPN

MPN

MPN

MPN

MPN

MPN

Myeloid lineage

N

N

Increased

N

N

Increased

N

N

Increased

Increased

Erythroid lineage

Increased

Increased

Increased

Increased

Increased

N

Increased

Increased

Increased

Increased

Iron

Stainable

Stainable

-

US

US

US

US

US

US

US

Fibrosis

MF-0

MF-1

MF-0

MF-0

MF-0

MF-0

MF-0

MF-0

MF-1

MF-0

ET

ET

ET

ET

ET

MPNuc

PV

PV

PV

PV

Pro-PVà

PV

PV

PV

PV

-

-

-

-

C. MPN Diagnosis WHO 2008 ECMP 2008

ET

ET

Pro-PVà

Pro-PVà

ET.MGM

Follow-up years

-

-

10 years

7 years

11 years

pPMF

PV

PV

PV

àPV

M:E = myeloid erythroid ratio, US = unstainable, uc = unclassifiable.

ET cases according to ECMP [10,11] criteria (Tables 1 and 2) included normocellular ET (WHO-ET) in 2 (Figure 2) and prodromal PV (Figure 3) in 3. Prodromal PV is characterized by PV bone marrow picture, low serum EPO, presence of EEC, normal values for hemoglobin and hematocrit, erythrocyte count of <6.0x1012/L, and normal RCM (Table 4A). The diagnosis in 1 ET patient was prefibrotic ET (case 6) with hypercellular megakaryocytic244

granulocytic (MGM [5]) bone marrow with normal (relatively reduced) erythropoiesis, no reticulin (Figure 5), and moderate splenomegaly (spleen size on echogram of 16 cm). ET.MGM [5] is consistent with prefibrotic primary myelofibrosis pPMF-0 according to the 2004 ECP criteria (http://www.mpn-stichting.nl/doctors_brochure_2004.pdf) [7,8,9].

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

Figure 1. Upper left: ET case 2 (Table 4) with a typical ET bone marrow picture (Figure 2); the patient remained asymptomatic for a documented period of 8 years at increased platelet counts (730 to 915x109/L) while treated with low-dose aspirin (80 mg).

Turk J Hematol 2014;31:239-254

Figure 3. ET stage 2, case 4 (Table 4), with prodromal PV with increased cellularity of the bone marrow due to increased erythropoiesis (A and B: H&E stain; C: Lederle stain for granulopoiesis; D: silver stain for reticulin).

Lower left: ET case 3 (Table 4); the patient had increased platelet counts between 500 and 600x109/L and atypical migraine-like cerebral ischemic manifestations that were overlooked until 2005. In 2005, ET with a 5-year history of fatigue and aquagenic pruritus was diagnosed and PV with erythrocyte count above 6x1012/L developed in 2006. Low-dose PEGASYS (45 µg/week for 6 months followed by 30 µg/ week) induced a maintained complete hematologic remission of the PV with relief of pruritus, obviating the need for aspirin and phlebotomy during 6 years of follow-up (2006-2012).

Upper right: ET case 3 was diagnosed in 1997, but bone marrow biopsy was hypercellular, consistent with PV (Figure 4). In 2004, PV with erythrocyte counts above 6x1012/L developed. Low-dose PEGASYS (45 µg/week for 6 months followed by 45 µg once per 3 to 4 weeks) induced a maintained complete hematologic remission, obviating the need for phlebotomy (2006-2013).

Lower right: Case 8 (Table 4); the patient presented with rapid-onset JAK2V617Fpositive erythrocythemic PV with a typical ET/PV bone marrow picture (Figure 7) in 2005 carrying the homozygous JAK2V617F mutation on repeated testing. The erythrocyte counts were far above 6x1012/L and remained above 6x1012/L at the time of hematological remission of PV by phlebotomy alone on top of low-dose aspirin.

Figure 4. ET, case 3 (Table 4), showing a typical PV bone marrow picture at time of diagnosis of ET according to ECP criteria not meeting the PVSG criteria (Table 2); after 7 years of follow-up, the ET evolved into PV featuring increased red cell counts above 6x1012/L at the time of PV diagnosis in 2004 and a complete hematological response to low interferon alpha-2a in 2005 (Figure 1) for 8 years up to 2013.

Bone Marrow Biopsy Histology Features in PVSGDefined PV and ET Figure 2. ET of stage 1 showing a typical ET bone marrow picture with increased cellularity (60%) due to slight increase of erythropoiesis in case 2 with a 10- to 15-year history of stable ET disease up to 2013 (case 2, Table 4, Figure 1) (A, B, and C: H&E stain; D: silver stain for reticulin).

Characteristic histology findings in bone marrow biopsies of 155 evaluable PV patients with documented increased RCM in the PVSG 01 study revealed a broad spectrum of no, slight, and moderate to marked (>80%) increase of bone marrow cellularity from 50% to 60% in 10 cases, from 60% to 80% in 45 cases, and from 80% to 100% in 100 cases (compare Figure 245

Turk J Hematol 2014;31:239-254

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

Figure 5. ET stage 3, case 6 (Table 4), showing an ET.MGM or â&#x20AC;&#x153;pPMFâ&#x20AC;? bone marrow picture with increased granulopoiesis and pleomorphic megakaryopoiesis with dysmorphic nuclei (not cloud-like) but no increase of reticulin fibrosis (RF-0/1), with a long history of MPD disease, normal LAP score, and moderate splenomegaly at time of bone marrow diagnosis (A, B, and C: PAS stain; D: silver stain for reticulin).

Figure 7. Upper A and B: Bone marrow smears of case 8 (Table 4) with rapid-onset erythrocythemic PV show large megakaryocytes and hypercellularity (B) as compared to normal-sized megakaryocytes and normal cellularity in a control bone marrow smear (A).

Middle panels, B: Typical ET/PV picture in bone marrow biopsy specimen of case 8 with rapid-onset erythrocythemic PV and increased RCM, homozygous for the JAK2V617F mutation in 2005 (Table 4). Please note that loosely clustered pleomorphic enlarged megakaryocytes in this PV case are somewhat less enlarged and have hyperlobulated nuclei (B, right) as compared to larger megakaryocytes in classical PV with a hypercellular trilinear bone marrow proliferation (C, left bottom).

Figure 6. Bone marrow picture with loose clusters of pleomorphic megakaryocytes and slight increase of cellularity (ET/PV bone marrow picture) due to increased erythropoiesis in a case of rapid-onset PV (case 7, Table 4).

9 and Table 5) [17]. Reticulin fiber (RF) content was normal (RF-0 and -1: prefibrotic) in 94 cases, slightly increased (RF2: early fibrotic) in 40 cases, and moderately to markedly increased (RF-3 and -4) in 21 cases (Table 3). Reticulin fibrosis was absent (RF-0 and -1) in 9 of 10 PV patients with a normocellular ET bone marrow picture, in 45 PV patients with a mixed ET/PV bone marrow picture, and in 40 of 90 PV patients with a hypercellular PV bone marrow picture.

Out of 155 evaluable PV patients with increased RCM in the PVSG 01 study, 94 PV cases (61%) had no increase of reticulin 246

Bottom panels, C: Direct comparison in case 10 with trilinear PV showing pleomorphic large megakaryocytes (C, left) as compared to small and isolated normal-sized megakaryocytes in the bone marrow biopsy of a patient with idiopathic erythrocytosis (C, right). fibrosis (very early stage PV upfront treated with leukemogenic agents), 40 PV cases (26%) had increased RF of grade 2 (= early MF 1 with no collagenization), and 21 PV patients (13.5%) had advanced reticulin/collagen fibrosis (RF/RCF) (grade 3 and 4 fibrosis in the bone marrow = overt MF grade 2 and 3 with collagenization) (Table 3) [7,17,18]. We conclude from the PVSG 01 and the present study that bone marrow histology alone cannot clearly distinguish among WHOand ECMP-defined ET, prodromal PV, and PV (prefibrotic and fibrotic stages) in JAK2V617F-positive groups of MPN

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

Figure 8. Rapid onset trilinear PV, case 9 (Table 4), with a typical trilinear PV bone marrow picture complicated by bleeding and poor response to pegylated interferon, indicating the need to treat with hydroxyurea on top of lowdose aspirin, which resulted in eliminating the thrombohemorrhagic diathesis and significant improvement of quality of life during long-term follow-up (2006-2013).

Turk J Hematol 2014;31:239-254

Figure 10. An elevated venous hemoglobin concentration could not be used as a surrogate marker for absolute erythrocytosis in a series of 77 consecutive Swedish PV patients (31 males and 46 females) with increased RCM (black dots): only 35% of male and 63% of female PV patients had hemoglobin values above the 2008 WHO defined criterion of 18.5 and 16.5 g/dL, respectively [30]. megakaryocytes with slight to moderate increase of trilinear hematopoietic cellularity (60%-80%) [27]. The laboratory data of these 23 cases diagnosed as initial (latent) PV did not meet the PVSG- and WHO-defined levels of hemoglobin and hematocrit required for diagnosis of PV [27], but did meet the criterion of increased erythrocyte counts above 6x1012/L in men and above 5.5x1012/L in women (Table 6) when the ECMP criteria for PV in Table 2 are applied.

Figure 9. The spectrum of ET bone marrow picture (left panels, A and B) and PV bone marrow picture (right panel, A) in PVSG-defined PV in 155 bone marrow biopsies of the PVSG 01 study [17]. Please note the presence of clustered pleomorphic enlarged megakaryocytes in the ET and PV bone marrow pictures of 155 PVSG-defined PV cases with documented increased RCM. ET/PV bone marrow pictures (black and white) have increased cellularity (range: 60%-80%) with loose clusters of pleomorphic enlarged megakaryocytes according to Ellis et al. in the PVSG 01 study of 1975 [17]. patients. A typical ET/PV bone marrow picture is frequently seen in ET and PV in the PVSG 01 study (Figure 9) and in the present study (Table 4, Figures 2,3,4,5,6,7,8). The finding of a mixed ET/PV bone marrow histopathology picture in PV was previously observed by Thiele et al. in cases of so-called initial (latent) PV with thrombocythemia at platelet counts between 600 and 1260x109/L, mimicking ET (Table 6) [27]. The mixed ET/PV bone marrow histopathology picture in the latter study showed a clustered distribution of pleomorphic large

In 37 evaluable 1975 PVSG-defined ET patients with platelet counts above 1000x109/L, only 11% had normocellular bone marrow consistent with ET while about 80% had pretreatment ET/PV or PV bone marrow with increased cellularity between 50% and 90%, but only 11% had typical PV hypercellular bone marrow greater than 90% (Table 5) [28,29]. The majority of bone marrow biopsies showed marked megakaryocyte hyperplasia with atypical large megakaryocytes. Bone marrow reticulin content was essentially normal in 90% of 1975 PVSGdefined ET patients (prefibrotic MPN) (Table 5). The PVSG concluded that megakaryocyte morphology in PV and ET in the PVSG 01 and ET studies were identical in appearance, and ET and PV cannot be distinguished from one another based on bone marrow histology alone. Leukocytosis is common in the 1975 PVSG-defined ET and PV cases. LAP scores of over 100 were seen in 42% of ET cases, whereas 70% of PV cases had values over 100. Pruritus was observed in 14% of ET cases, which is clearly less than the 43% incidence in PV patients.

The spleen was palpable in 38% of ET and 70% of PV patients, and when enlarged in ET cases the spleen was only 2 to 4 cm below the costal margin.

Discussion Dameshek believed in 1940 that the minimal criteria for a definite diagnosis of PV were definitively elevated erythrocyte count (>6x1012/L), and elevated hematocrit 247

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

Turk J Hematol 2014;31:239-254

Table 5. Bone marrow biopsy data of 155 cases in 1975 PVSG-defined PV patients [17].

PVSG 01 Study

Increase of silver stained reticulin in bone marrow biopsy:

Grading: RF-0/1 RF-2

RF-3 RF-4

Bone marrow (BM) picture, Figure 9

Cellularity

-----

Number

Normal, <50%

-----

-----

5 1 - = 6 ET BM

Slight increase 50%-60%

4

-

-

4 ET BM

Moderate increase 60%-80%

45

-

-

45 ET/PV BM

80%-90%

25

25

5

55 PV BM

90%-100%

15

14

8

45 PV BM

Total RF

RF0/1 RF-2 RF-3 RF-4

Marked increase 8

94 40 13 8

155 13+8 PV-RF-3/4

Conclusion: The spectrum of bone marrow pictures of 155 bone marrow biopsies in 1975 PVSG-defined PV patients of the PVSG-01 study showed an ET picture in 10, an ET/PV picture in 45, and a typical PV picture in 90 PVSG-defined PV cases of the PVSG 01 study [17].

Bone marrow biopsy data in 37 PVSG-defined ET patients with platelet counts of >1000x10/9/L [28,29].

Cellularity Normal Slightly Moderately Markedly

increased increased increased increased Overall cellularity

11%

19%

60%

10%

Megakaryocyte number

0%

8%

27%

65%

Erythroid elements

16%

32%

41%

11%

Myeloid elements 19% 30% 46% 5% Reticulin fibers

RF-0/1: 78%

RF-2: 19%

RF-3: 3%

RF-4: 0%

Conclusion: The 1975 PVSG-defined ET patients have platelet counts in excess of 1000x10 /L and normocellular bone marrow in 11% consistent with ET, slightly increased cellularity in 19% consistent with ET, and moderate or marked increased cellularity due to increased erythropoiesis (PV-like) or granulopoiesis in 70% consistent with prefibrotic or early fibrotic hypercellular ET with a PV or ET.MGM (pPMF) bone marrow picture.

9

and platelet count together with erythrocytic and megakaryocytic hyperplasia in bone marrow aspirate [19]. In a doubtful case, blood volume estimation may be helpful. According to Dameshek in 1950, PV is a trilinear chronic myeloproliferative disorder (MPD) characterized by excessive production of nucleated red cells, granulocytes and megakaryocytes, peripheral blood erythrocytosis, leukocytosis, and thrombocytosis [20]. Some PV cases show only a moderate elevation of erythrocytes clearly above 6x1012/L with an extreme degree of thrombocytosis, while other PV patients present with increased leukocyte counts close to leukemic levels, with only a slight increase in platelets [19]. As to the etiology of hypercellular trilinear hematopoiesis in PV, Dameshek proposed 2 highly speculative possibilities in 1950 [20]: first, the presence of excessive bone marrow stimulation by an unknown factor or factors, and, second, a lack of or a diminution in the normal inhibitory factor or factors. Dameshekâ&#x20AC;&#x2122;s hypothesis of PV as a trilinear MPD in 1950 could be confirmed 248

by Vainchenkerâ&#x20AC;&#x2122;s discovery in 2005 of the JAK2V617F mutation as the cause of 3 phenotypes of MPDs: ET, PV, and secondary myelofibrosis [21,22]. The JAK2V617F mutation became a pathognomonic clue to MPN because it makes the mutated hematopoietic stem and progenitor cells hypersensitive to TPO, EPO, and G-SCF, thereby leading to a growth advantage of the mutated cells in comparison to the normal trilinear hematopoietic progenitor cells in the bone marrow with the consequence of increased peripheral blood platelet, leukocyte (granulocyte), and/or erythrocyte counts. About half of the PVSG-defined ET patients carry the JAK2V617F mutation, have low serum EPO levels, and show spontaneous erythroid colony formation (EEC+) [9,10,15]. PVSG-defined PV patients carry the JAK2V617F mutation in 95% of cases and are characterized by high LAP scores, are EEC+, and have decreased serum EPO levels; the few JAK2V617F-negative PV patients (5%) carry the exon 12 mutation in about 3% of cases [9,10,11,15].

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

Turk J Hematol 2014;31:239-254

Table 6. Laboratory features of initial (latent) PV with clustered distribution of pleomorphic enlarged megakaryocytes in bone marrow with increased cellularity (60%-70%) diagnosed by Thiele et al. [27] as ET mimicking PV in 23 patients that did have erythrocytes above 6x1012/L in males and above 5.5 in the majority of females, consistent with the diagnosis of PV (Table 2).

Normal values Erythrocytes, x1012/L

Males

7.2 (6.1-8.6)

4.5-5.9

Females

6.5 (5.2-7.6)

4.0-5.5

Hemoglobin, g/dL

Males

17.8 (17.0-18.3)

13.2-16.4

Females

15.6 (15.0-16.4)

11.6-15.0

Hematocrit, %

Males

53.4 (50.3-60.4)

0.40-0.50

Females

50.0 (43.0-58.0)

0.35-0.45

Leukocytes, x10 /L

14.2 (6.0-17.3)

4.0-10.0

Thrombocytes, x109/L

780 (608-1260)

140-360

LAP

193 (85-391)

10-80

9

LDH, U/L

268 (183-536)

Spleen size: on echogram/scan Not tested <12 cm on palpation, cm below costal margin 2.0 (0-3.9) Not palpable

Bone marrow histopathology may significantly contribute to diagnostic differentiation and staging of the primary JAK2V617F-mutated MPNs of ET and PV, with the MPL515-positive ET and JAK2-MPL wild-type ET as the presenting feature of primary dysmegakaryocytic myeloproliferation (PMGM) [23,24]. The natural history of each MPN of various molecular etiology may pass through early, overt, and advanced stages of MPN by grading cellularity and bone marrow reticulin (MF-0/1) or reticulincollagen fibrosis (MF-2/3) [23,24]. Megakaryocytes are pronouncedly pleomorphic and dysmorphic in the prefibrotic and fibrotic hypercellular (80%-100%) bone marrow stages in JAK2V617F-positive PV and ET.MGM, and are very likely different from PMGM in prefibrotic and JAK2 wild-type PMF patients [7,8,9,10,23,24]. Bone marrow histopathology has the power to distinguish PV (either JAK2V617F- or exon 12-mutated) from congenital and secondary erythrocytosis and to distinguish ET of various underlying molecular etiologies from reactive thrombocytosis with a sensitivity and specificity of very near 100% [7,8,9,10,25,26,27]. The present study shows that histology of pleomorphic megakaryocytes and bone marrow cellularity was not different in JAK2V617F-positive normocellular ET, prodromal PV, and classical PV patients.

The prefibrotic stage of prodromal PV may precede PV for about 10 years. This type of slow-onset PV (ET type 2, Table 4B) differs from acute-onset JAK2V617F homozygous PV with a short previous MPN history (Figure 1, case 8; Figures 7 and 8; Table 4, cases 8 and 9). Three of the 4 patients with

acute onset PV shown in (Table 4) were homozygous for JAK2V617F. Whether or not these 2 types of slow-onset PV versus rapid-onset PV differ at the biological level for the JAK2V617F mutation load, MPN disease burden, and natural history with regard to progression to post-PV myelofibrosis remains to be evaluated in long-term prospective clinical and basic research studies of newly diagnosed MPN patients.

The JAK2V617F mutation is causative for a broad spectrum of trilinear MPNs; its presence rules in prefibrotic and fibrotic stages of ET and PV and excludes erythrocytoses, thrombocytoses, and thrombocythemia and myelofibrosis of other clonal origins. With the advent of JAK2V617F mutation and bone marrow histopathology as a pathognomonic clue to MPN, RCM measurement no longer has additional diagnostic value. It is erythrocytosis that distinguishes PV from all other variants of MPNs, but PV is usually hetero-/homozygous for the JAK2V617F mutation and associated with thrombocythemia, granulocythemia, and splenic hematopoietic neoplasia (SHN). For the diagnosis of PV, the minimal criteria of elevated erythrocyte count (>6x1012/L) and elevated hematocrit must be present, but bone marrow aspirate is diagnostic, showing a panmyelosis (increased trilinear hematopoiesis) and pleomorphic large megakaryocytes in diagnostic bone marrow biopsies. Both hemoglobin and hematocrit levels are clearly dependent on the iron status, related to low or decreased ferritin levels, and on increased spleen size in untreated PV patients who in fact do have or have had 249

250 Low risk since 2000 [43] Phlebotomy Aspirin Low-dose IFN → Response = MPN disease reduction [45]

Low risk since 1985 [3] Aspirin Phlebotomy Low-dose IFN for Intermediate Stage PV [23,45]

N: <12

N: <400

>16 (10)

>0.51

>6

Early PV

50-80 RF-0/1

No

N: <12

+

+

+ +(++)

Low risk since 1985 [3]

Aspirin since 1985 [3,4] Phlebotomy since 1950, Dameshek [20]

Leukocytes, x109/L

Platelets, x109/L

Hemoglobin, g/dL (mmol/L)

Hematocrit

Erythrocytes, x1012/L

WHO bone marrow

Bone marrow cellularity (%) Grading myelofibrosis [17]

Splenomegaly on palpation

Spleen size, echogram cm

EEC+

Low serum EPO

JAK2V617F in granulocytes and BFU-e

Therapeutic implications, Barbui et al. [48]

First-line treatment option, Klidjian et al. [49] Second-line IFN Third-line HU/JAK2 Inhibitors [50,51,52]

+ +(++)

+

+

<12-15

No/+

50-80 RF-0/1

Prodromal PV

<6

<0.51

<16 (10)

>400

<12

N/↓

N/↓

Serum EPO

+ +(++)

+

+

12-15

No/+

60-100 RF-0/1

Early PV

>6

>0.51

>16 (10)

N or >400

<12

Phlebotomy Aspirin IFN → if resistant → HU PVSG 2000 [23,44,45]

Intermediate since 2000 [43,49]

+/++ ++

+

+

12-18

+

80-100 RF-0/1-2

Trilinear PV

>6

>0.51

>16 (10)

>400

N->12

↓

↓

N

RCM

↑

↑

↑

Classic PV prefibrotic

2

↑

↑

↑

N/↑

LAP score

1 Polycythemic PV prefibrotic

Erythrocythemic PV

Michiels 2008-2013 clinical diagnosis

0 Prodromal PV

0

PV, ECMP stage

Table 7. ECMP staging of PV patients related to currently available therapeutic options anno 2014.

Up front JAK2 inhibitor Supportive BMT to be defined

High risk, 2013

+/++ ++

+

+

18->20

++/+++

80-100 RCF-1/2

Trilinear PV

Normal

>0.51

>16 (10)

< or >1000

>15

↓

↑

↑/↑↑

Masked or Inapparent PV (IPV) MF stage

3

JAK2 inhibitor supportive palliative BMT

Post-PV MF, 2013

++ ++

+

+

>20

Large

Decreased RCF-2/3

PV/MF

Normal, low/↓

Variable

N / >12

Variable

>20

Variable

Variable

Variable

Post-PV myelofibrosis, neoplastic features

4

Supportive

Since 1950

++ ++

?

+

>20

Large

Decreased RCF-3

PV/MF

N/↓

N↓

<12

Variable

>20

N/↓

N/↓

Variable

Spent-phase ‘anemic’ PV MDS AL

5

Turk J Hematol 2014;31:239-254

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

increased RCM, thereby allowing the overlooking of initial or latent-stage PV. The authors of the 2008 WHO criteria for PV stated that the measured RCM could be preplaced by a surrogate marker of a hemoglobin value of above 18.5 g/dL in men and above 16.5 g/dL in women [14,15]. Johansson et al. showed that WHO-defined elevated hemoglobin concentration cannot be used as a surrogate marker for absolute erythrocytosis in PV patients (Figure 10) [30].

In a series of 77 consecutive patients (31 males and 46 females) with PV in the study of Johansson et al., only 35% of male and 63% of female PV patients had hemoglobin values above 18.5 and 16.5 g/dL, respectively (Figure 10).

In our experience, treatment of PV by phlebotomy alone corrects the hemoglobin and hematocrit values but, due to microcytic erythrocytes caused by iron deficiency, the number of erythrocytes remains above 6.0x1012/L in PV and below 6.0x1012/L in JAK2V617F-mutated ET patients (Figure 1, case 8). The erythrocyte count at a cut-off of 6.0x1012/L according to ECMP criteria (Tables 1 and 2) within JAK2V617F-positive MPN entities appears to be a sensitive and specific criterion to distinguish ET and prodromal PV from overt PV. In a recent study of 26 PV patients with increased RCM, erythrocytes counts were above 6.5x1012/L in 100%, hemoglobin was above 18 g/ dL in 50%, hematocrit above 0.55 in 46%, and decreased serum EPO was <3.3 Âľg/mL in 94% [31].

The 2008 WHO laboratory, molecular, and pathological criteria for the diagnosis of Philadelphia-chromosome (Ph1-) MPNs [14,15] failed to stage each of the MPNs, ET, PV, and ET.MGM, and failed to define transitional stages between ET and PV and between ET and post-ET myelofibrosis [32,33,34].

The 2008 WHO criteria for PMF only detect the advanced spent-phase state of fibrotic MPN complicated by pronounced myeloid metaplasia of the spleen. A clear-cut diagnosis of either JAK2V617F-positive ET.MGM or JAK2 wild-type pPMF and prefibrotic, early fibrotic, or fibrotic ET/PMF cannot be made by the 2008 WHO classification [14,15]. Consequently, the various fibrotic stages of ET in various MPDs/MPNs with hypercellular megakaryo-granylocytic myeloproliferation (ET.MGM or prefibrotic PMF) in the bone marrow are to be diagnosed by expert hematopathologists as MPN unclassifiable (MPNuc) [34]. In future prospective studies, the first step in classification of MPNs should be the molecular classification of MPNs as JAK2V617F-mutated, MPL515-mutated, and JAK2MPL wild-type [23,24]. A set of relevant WHO bone marrow criteria combined with MPN-specific clinical and laboratory features including EEC, EPO levels, JAK2 mutation for ET, prodromal PV and PV, and ET.MGM according to ECMP has the potential to define main phenotypes or stages of JAK2V617Fpositive MPN. JAK2 wild-type ET carrying the MPL515 mutation has no clinical, laboratory, or bone marrow features of prodromal PV or PV at diagnosis and during follow-up [35,36,37,38]. JAK2 wild-type but MPL515-mutated ET cases have normal serum EPO and ferritin levels and no spontaneous EECs [23,24].

Turk J Hematol 2014;31:239-254

Proper WHO diagnosis of MPNs is difficult in patients with splanchnic vein thrombosis (SVT) as the Buddâ&#x20AC;&#x201C;Chiari syndrome (BCS) and/or portal vein thrombosis (PVT), since the typical peripheral blood changes are usually less pronounced [39,40,41,42,43]. In 241 SVT patients (104 with BCS, 137 with PVT; Kiladjian et al. [42]), JAK2V617F was found in 94 (38%) and MPL515 mutations were not detected. The platelet counts were between 238 and 456x109/L (median: 333) in 74 patients carrying the JAK2V617F mutation and between 104 and 258x109/L (median: 159) in 147 JAK2 wild-type SVT patients [42]. In this cohort of 241 SVT patients, the values for hemoglobin were 13.0 (range: 11.1-14.4) and 13.4 (range: 12.3-15.4) in the JAK2 wild-type and JAK2V617F-mutated cases, respectively. In 62 evaluable JAK2V617F-positive cases of SVT, RCM was increased (>125%) in 38 cases despite normal values for hemoglobin, consistent with PV complicated by splenomegaly and hypersplenism (inapparent PV or masked PV, Table 7), and RCM was normal in 24 cases, consistent with prodromal PV, ET, or ET.MGM. In 147 JAK2 wild-type SVT patients, 144 bone marrow biopsies were evaluable and 10 were positive for the diagnosis ET or MF [42]. In a recent metaanalysis of 1062 BCS and 855 PVT patients, mean prevalence of MPN and JAK2V617F was 41% and 41%, respectively, and JAK2V617F screening in SVT patients without typical hematologic features indentified MPN in 17% and 15% of BCS and PVT patients [43]. We conclude that the JAK2V617F mutation and extensive thrombophilia screening and bone marrow biopsy should be included in the diagnostic work-up of SVT patients [40,41,42,43].

In view of new molecular biological insights and current novel treatment options, proper staging of ET, ET.MGM, prodromal PV, and overt and advanced PV patients according to ECMP criteria has a significant and determinative impact on first-, second-, and third-line treatment options in MPN patients carrying the JAK2V617F mutation (Table 7) [44,45]. The broad spectrum of JAK2V617F mutation load, heterozygous in ET, hetero-/ homozygous in PV, and homozygous in advanced PV and post-MPN myelofibrosis [46,47] and its related pathobiological evolution into symptomatic and advanced stages including thrombohemorrhagic manifestations, the degree of splenomegaly and hypersplenism, the degree of bone marrow cellularity, and fibrosis [7,9,15,18,32,33] (Table 7) indeed characterize and classify the JAK2V617Fmutated trilinear MPNs. The JAK2V617F mutated trilinear MPN is a distinct clonal MPN with a very broad spectrum of clinical manifestations of ET and PV, and various stages in between prefibrotic ET and PV versus post-ET and postPV myelofibrosis in terms of JAK2 mutation load, MPN disease burden, and sequential prefibrotic, early fibrotic, and fibrotic stages at the bone marrow level paralleling the degree of extramedullary hematopoietic neoplasm in the spleen, which can objectively be measured by the 251

Turk J Hematol 2014;31:239-254

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

degree of splenomegaly on echogram (Table 7). The ECMP criteria for the classification of JAK2V617F-positive ET, prodromal PV, ET.MGM, and classic PV in terms of JAK2V617F mutation load and MPN disease burden (Table 7) will allow much better staging of PV patients related to targeted treatment recommendations according to current guidelines for low-risk PV (aspirin-phlebotomy), for intermediate-risk PV (pegylated interferon), for high-risk PV (hydroxyurea versus JAK2 inhibitors), and for postPV myelofibrosis (JAK2 inhibitors; Table 7) [23,24,45].

A similar risk stratification has been reached for primary advanced myelofibrosis, post-ET myelofibrosis, and postPV myelofibrosis to clarify the targeted indication of JAK2 inhibitors [50,51,52]. In very early stage PV with absence of constitutional symptoms and itching, phlebotomy on top of low-dose aspirin is enough without the need of myeloreductive treatment with pegylated interferon (IFN).

Evidence is accumulating that pegylated IFN is the firstline treatment option in symptomatic intermediate stage PV to postpone the use of hydroxyurea as long as possible or even life-long [23,44,45,49]. Patients with advanced PV, masked PV, or inapparent PV who have large spleens (Table 7) usually complicated by pronounced constitutional symptoms during their course of PV disease are candidates for targeted JAK2 inhibitor treatment since hydroxyurea is predicted to induce anemia and acceleration of myelofibrosis [23,24,44,45]. The JAK2 inhibitors exert a salutary effect on constitutional symptoms and splenomegaly, do not induce histologic or cytogenetic remission, and are predicted to improve the quality of life significantly and do improve survival [50,51,52; personal communications with Srdan Verstovsek, 2014].

Authors’ Contributions JJM and FTK designed the study. HDR coordinated the bone marrow pathology data. JJM, ZB, and WS collected and JJM analyzed the clinical, molecular, and pathological data. JJM, FTK, KL, and HDR interpreted the clinical and bone marrow pathology studies. JJM and HDR wrote the manuscript.

Acknowledgment We gratefully thank Dr. Jürgen Thiele, who was a most respected active member of the EWG.MPD (1998-2005) and significantly contributed to the formulation of the ECP, WHO, and ECMP criteria for the diagnosis of the MPNs ET, PV, and MF and the various clinicopathological fibrotic stages of all variants of clonal MPNs. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Michiels JJ. Erythromelalgia and thrombocythemia. PhD, Erasmus University, Rotterdam, 1981.

252

2. Michiels JJ, Ten Kate FWJ, Vuzevski VD, Abels J. Histopathology of erythromelalgia in thrombocythemia.

Histopathology 1984;8:669-678.

3. Michiels JJ, Abels J, Steketee J, van Vliet HHDM, Vuzevski VD. Erythromelalgia caused by platelet-mediated arteriolar inflammation and thrombosis in thrombocythemia. Ann Intern Med 1985;102:466-471.

4. Michiels JJ, Koudstaal PJJ, Mulder AH, Van Vliet HHDM. Transient neurologic and ocular manifestations in primary thrombocythemia. Neurology 1993;43:1107-1110.

5. Michiels JJ, Kutti J, Stark P, Bazzan M, Gugliotta L, Marchioli R, Griesshammer M, van Genderen PJJ, Brière J, Kiladjian JJ, Barbui T, Finazzi G, Berlin NI, Pearson TC, Green AC, Fruchtmann SM, Silver RT, Hansmann E, Wehmeier A, Lengfelder E, Landolfi R, Kvasnicka HM, Hasselbalch H, Cervantes F, Reilly JT, Demory JL, Gisslinger H, Guardiola P, Martyre MC, Le Bousse-Kerdilès MC, Thiele J. Diagnosis, pathogenesis and treatment of the myeloproliferative disorders essential thrombocythemia, polycythemia vera, and essential megakaryocytic granulocytic metaplasia and myelofibrosis. Neth J Med 1999;54:46-62.

6. Michiels JJ, Juvonen E. Proposal for revised diagnostic criteria of essential thrombocythemia and polycythemia vera by the Thrombocythemia Vera Study Group. Semin Thromb Hemost 1997;23:339-347.

7. Michiels JJ, Thiele J. Clinical and pathological criteria for the diagnosis of essential thrombocythemia, polycythemia vera and idiopathic myelofibrosis (agnogenic myeloid metaplasia). Int J Hematol 2002;76:133-145.

8. Michiels JJ. Bone marrow histopathology and biological markers as specific clues to the differential diagnosis of essential thrombocythemia, polycythemia vera and prefibrotic and fibrotic agnogenic myeloid metaplasia.

Hematol J 2004;5:93-102.

9. Michiels JJ, De Raeve H, Berneman Z, Van Bockstaele D, Hebeda K, Lam K, Schroyens W. The 2001 World Health Organization (WHO) and updated (2006) European Clinical and Pathological (ECP) criteria for the diagnosis, classification and staging of the Philadelphia chromosomenegative chronic myeloproliferative disorders. Semin Thromb Hemost 2006;32:307-340.

10. Michiels JJ, De Raeve H, Hebeda K, Lam KH, Berneman Z, Schroyen W, Schwarz J. WHO bone marrow features and the 2007 European clinical molecular and pathological criteria (ECMP) for the diagnosis and classification of myeloproliferative disorders. Leuk Res 2007;31:10311038.

11. Michiels JJ, De Raeve H, Hebeda K, Lam KH, Bot F, Berneman Z, Schroyens W. Biology diagnosis and classification of MPD. Lecture, 1st International Lymphoma-Leukemia-Myeloma (LLM) Congress, May 2007, Turkey. Turk J Hematol 2007;24:37-54.

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

12. Tefferi A, Thiele J, Orazi A, Kvasnicka HM, Barbui T, Hanson CA, Barosi G, Verstovsek S, Birgegard G, Mesa R, Reilly JT, Gisslinger H, Vannucchi AM, Cervantes F, Finazzi G, Hoffman R, Gilliland DG, Bloomfield CD, Vardiman JW. Proposal and rationale for revision of the World Health Organization diagnostic criteria for polycythemia vera, essential thrombocythemia, and primary myelofibrosis: recommendations from an ad hoc international expert panel. Blood 2007;110:1092-1097.

13.

Lengfelder E, Hochhaus A, Kronawitter U, Hoch D, Queisser W, Jahn-Eder M, Kurkhardt R, Reiter A, Ansari H, Hehelmann R. Should a platelet count of 600x109/L be used as a diagnostic criterion in essential thrombocythemia? An analysis of the natural course including early stages. Br J Haematol 1998;100:15-23.

14. Tefferi A, Vardiman JW. Classification and diagnosis of myeloproliferative neoplasms: the 2008 World Health Organization criteria and point of care diagnostic algorithms.

Leukemia 2008;22:14-22.

15. Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J, Vardiman JW. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. 4th ed. Lyon, France, IARC Press, 2008.

16. Baxter EJ, Scott LM, Campbell PJ, East C, Fourouclas N, Swanton S, Vassiliou GS, Bench AJ, Boyd EM, Curtin N, Scott MA, Erber WN, Green AR; Cancer Genome Project.

Acquired mutation of the tyrosine kinase JAK2 in human myeloproliferative disorders. Lancet 2005;365:1054-1061.

17. Ellis JT, Silver RT, Coleman M, Geller SA. The bone marrow in polycythemia vera. Semin Hematol 1975;12:433-444.

18. Thiele J, Kvasnicka HM, Facchetti F, Franco V, Van Der Walt J, Orazi A. European consensus for grading bone marrow fibrosis and assessment of cellularity in myeloproliferative disorders. Haematologica 2005;90:1128-1132.

19. Dameshek W, Henstell HH. The diagnosis of polycythemia.

Ann Intern Med 1940:13:1360-1387.

20. Dameshek W. Physiopathology and course of polycythemia vera as related to therapy. JAMA 1950;142:790-797.

21. James C, Ugo V, Le Couedic JP, Staerk J, Delhommeau F, Lacout C, Garรงon L, Raslova H, Berger R, BennaceurGriscelli A, Villeval JL, Constantinescu SN, Casadevall N, Vainchenker W. A unique clonal JAK2 mutation leading to constitutive signalling causes polycythemia vera. Nature 2005;434:1144-1148.

22. Vainchenker W, Delhommeau F, Constantinescu SN, Bernard OA. New mutations and pathogenesis of myeloproliferative neoplasms. Blood 2011;118:1723-1735.

23. Michiels JJ, Ten Kate FWJ, De Raeve H, Gadisseur A. Classification of BCR/ABL-positive essential thrombocythemia and chronic myeloid leukemia as compared to BCR/ ABL-negative myeloproliferative disorders essential thrombocythemia, polycythemia vera and primary (dys) megakaryocytic granulocytic myeloproliferation (ET, PV and PMGM). World J Hematol 2014 (in press).

Turk J Hematol 2014;31:239-254

24. Michiels JJ, Berneman Z, Schroyens W, Hebeda K, Bot F, Lam KH, De Raeve H. 1975 PVSG, 2008 World Health Organization (WHO) and the 2008 European Clinical, Molecular and Pathological (ECMP) criteria for the diagnosis of myeloproliferative neoplasms. World J Hematol 2013;2:71-88.

25. Thiele J, Kvasnicka HM, Zankovich R, Diehl V. The value of bone marrow histopathology for the differentiation between early stage polycythemia vera and secondary (reactive) polycythemias. Haematologica 2001;86:368-374.

26. Thiele J, Kvasnicka HM, Muehlhausen K, Walter S, Zankovich R, Diehl V. Polycythemia rubra vera versus secondary polycythemias. A clinicopathological evaluation of distinctive features in 199 patients. Pathol Res Pract 2001;197:77-84.

27. Thiele J, Kvasnicka HM, Deihl V. Initial (latent) polycythemia vera with thrombocytosis mimicking essential thrombocythemia. Acta Haematol 2005;113:213-219.

28. Iland H, Laszlo J, Peterson P, Murphy S, Briere J, Weinfeld A, Rosenthal DS, Landaw SA, Ellis J, Silverstein MH, Wasserman LR. Essential thrombocythemia: clinical and laboratory characteristics at presentation. Trans Assoc Am Phys 1983;96:165-174.

29. Murphy S, Iland H, Rosenthal D, Laszlo J. Essential thrombocythemia: an interim report from the Polycythemia Vera Study Group. Semin Hematol 1986;23:117-182.

30. Johansson PL, Safai-Kutti S, Kutti J. An elevated venous haemoglobin concentration cannot be used as a surrogate marker for absolute erythrocytosis: a study of patients with polycythememia vera and apparent polycythemia. Br J Haematol 2005;129:701-705.

31. Usman M, Bilwani F, Kakepoto GN, Sajid AR, Khursshid M. Polycythemia vera and idiopathic erythrocytosis: comparison of clinical and laboratory parameters. J Pak Med Assoc 2004;54:249-251.

32.

Thiele, Kvasnicka HM. Chronic myeloproliferative disorders with thrombocythemia: a comparative study of two classification systems (PVSG, WHO) on 839 patients.

Ann Hematol 2003;82:148-152.

33. Thiele J, Kvasnicka HM. A critical reappraisal of the WHO classification of the chronic myeloproliferative disorders.

Leuk Lymphoma 2006;47:381-396.

34. Buhr T, Hebeda K, Kaloutsi V, Porwit A, Van der Walt J, Kreipe H. European Bone Marrow Working Group trial to discriminate essential thrombocythemia from prefibrotic primary myelofibrosis. Haematologica 2012;97:360-365.

35. Antonioli E, Guglielmelli P, Poli G, Bogani C, Pancrazzi A, Longo G, Ponziani V, Tozzi L, Pieri L, Santini V, Bosi A, Vannucchi AM; Myeloproliferative Disorders Research Consortium (MPD-RC). Influence of JAK2V617F allele burden on phenotype in essential thrombocythemia.

Haematologica 2008;93:41-48.

253

Turk J Hematol 2014;31:239-254

Michiels JJ, et al: The European Clinical, Molecular, and Pathological (ECMP) Criteria and the 2007/2008 Revisions of the WHO for the Diagnosis, Classification, and Staging of Prefibrotic Myeloproliferative Neoplasms Carrying the JAK2V617F Mutation

36. Vannucchi AM, Antonioli E, Guglielmelli P, Longo G, Pancrazzi A, Ponziani V, Bogani C, Ferrini PR, Rambaldi A, Guerini V, Bosi A, Barbui T; MPD Research Consortium.

Prospective identification of high risk polycythemia vera patients based on JAK2(V617F) allele burden. Leukemia 2007;21:1952-1959.

45. Michiels JJ, Ten Kate FWJ, Koudstaal PJ, Gadisseur A. Pathophysiology of platelet-mediated microvascular disturbances and major thrombosis in essential thrombocythemia and polycythemia vera: reversal by aspirin and platelet reduction but not by anticoagulation.

World J Hematol 2013:2:20-41.

37. Beer PA, Campbell PJ, Scott LM, Bench AJ, Erber WN, Bareford D, Wilkins BS, Reilly JT, Hasselbalch HC, Bowman R, Wheatley K, Buck G, Harrison CN, Green AR. MPL mutations in myeloproliferative disorders: analysis of the PT-1 cohort. Blood 2008;112:141-149.

46. Scott LM, Scott MA, Campbell PJ, Green AR. Progenitors homozygous for the V617F mutation occur in most patients with polycythemia vera, but not essential thrombocythemia.

Blood 2006;108:2435-2437.

38. Jones AV, Campbell PJ, Beer PA, Schnittger S, Vannucchi AM, Zoi K, Percy MJ, McMullin MF, Scott LM, Tapper W, Silver RT, Oscier D, Harrison CN, Grallert H, Kisialiou A, Strike P, Chase AJ, Green AR, Cross NC. The JAK2 46/1 haplotype predisposes to MPL-mutated myeloproliferative neoplasms.

Blood 2010;115:4517-4523.

47. Moliterno AR, Williams DM, Isaacs MA, Spivak JL. Phenotypic variability within the JAK2V617F-positive MPD: roles of progenitor cell and neutrophil allele burden. Exp Hematol 2008;36:1480-1486.

39. De Stefano V, Teofili L, Leone G, Michiels JJ. Spontaneous erythroid colony formation as the clue to an underlying myeloproliferative disorder in patients with Budd-Chiari syndrome or portal vein thrombosis. Semin Thromb Hemost 1997;23:411-418.

48. Barbui T, Barosi G, Birgegard G, Cervantes F, Finazzi G, Griesshammer M, Harrison C, Hasselbalch HC, Hehlmann R, Hoffman R, Kiladjian JJ, Krรถger N, Mesa R, McMullin MF, Pardanani A, Passamonti F, Vannucchi AM, Reiter A, Silver RT, Verstovsek S, Tefferi A; European LeukemiaNet. Philadelphia-negative classical myeloproliferative neoplasms: critical concepts and management recommendations from European LeukemiaNet. J Clin Oncol 2011;29:761-770.

40. Valla DC. The diagnosis and management of the BuddChiari syndrome: consensus and controversies. Hepatology 2003:38:793-803.

49. Kiladjian JJ, Mesa R, Hoffmann R. The renaissance of interferon therapy for the treatment of myeloid malignancies.

Blood 2011;117:4706-4716.

41. Michiels JJ, Commandeur S, Hoogenboom GJ, Wegman JJ, Scholten L, van Rijssel RH, De Raeve H. JAK2V617F positive early stage myeloproliferative disease (essential thrombocythemia) as the cause of portal vein thrombosis in two middle-aged women: therapeutic implications in view of the literature. Ann Hematol 2007;31:1031-1038.

50. Verstovsek S, Mesa RA, Gotlib J, Levy RS, Gupta V, DiPersio JF, Catalano JV, Deininger M, Miller C, Silver RT, Talpaz M, Winton EF, Harvey JH Jr, Arcasoy MO, Hexner E, Lyons RM, Paquette R, Raza A, Vaddi K, Erickson-Viitanen S, Koumenis IL, Sun W, Sandor V, Kantarjian HM. A double-blind, placebo controlled trial of ruxolitinib for myelofibrosis. N Engl J Med 2012;366:799-807.

42. Kiladjian JJ, Cervantes F, Leebeek FW, Marzac C, Cassinat B, Chevret S, Cazals-Hatem D, Plessier A, Garcia-Pagan JC, Darwish Murad S, Raffa S, Janssen HL, Gardin C, Cereja S, Tonetti C, Giraudier S, Condat B, Casadevall N, Fenaux P, Valla DC. The impact of JAK2 and MPL mutations on diagnosis and prognosis of splanchnic vein thrombosis: a report on 241 cases. Blood 2008;111:4922-4929.

43. Smalberg H, Arends L, Valla DC, Kiladjian JJ, Janssen HLA, Leebeek FWG. Myeloproliferative neoplasms in BuddChiari syndrome and portal vein thrombosis: a metaanalysis. Blood 2012;120:4921-4928.

44. Michiels JJ, Barbui T, Fruchtman SM, Kutti J, Rain JD, Silver RT, Tefferi A, Thiele J. Diagnosis and treatment of polycythemia vera and possible future study designs of the PVSG. Leuk Lymphoma 2000;36:239-253.

254

51. Harrison C, Kiladjian JJ, Al-Ali HK, Gisslinger H, Waltzman R, Stalbovskaya V, McQuitty M, Hunter DS, Levy R, Knoops L, Cervantes F, Vannucchi AM, Barbui T, Barosi G. JAK inhibition with ruxolitinib versus best available therapy for myelofibrosis. N Engl J Med 2012;366:787-798.

52. Tefferi A. JAK inhibitors for myeloproliferative neoplasms: clarifying facts from myths. Blood 2012;119:2721-2730.

Research Article

DOI: 10.4274/tjh.2012.0130

Tumor Necrosis Factor-Superfamily 15 Gene Expression in Patients with Sickle Cell Disease Orak Hücre Hastalığı Olan Hastalarda Tümör Nekroz Faktör Süperailesi-15 Gen Ekspresyonu Ahmet Ata Özçimen1, Selma Ünal2, Necmiye Canacankatan3, Şerife Efsun Antmen4 1Mersin University Faculty of Science and Art, Department of Biology, Mersin, Turkey 2Mersin University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Mersin, Turkey 3Mersin University Faculty of Pharmacy, Department of Biochemistry, Mersin, Turkey 4Mersin University Medical Services Vocational School, Mersin, Turkey

Abstract: Objective: The aim of this study was to investigate the relation between tumor necrosis factor-superfamily 15 (TNFSF15) gene expression and clinical findings in children with sickle cell disease (SCD).

Materials and Methods: Forty-nine patients with SCD and 38 healthy controls were included in this study. TNFSF15 gene expression and plasma levels were analyzed. TNFSF15 gene expression was compared in subgroups considering the frequency of painful crises and acute chest syndrome (ACS).

Results: It was found that TNFSF15 gene expression was significantly higher in patients with SCD than the controls (p=0.001), whereas there was no significant difference between the patients with SCD and the control groups considering plasma levels of TNFSF15. TNFSF15 gene expression was also significantly higher in SCD patients with ACS (p=0.008).

Conclusion: These findings suggest that TNFSF15 may have a role in the pathogenesis of SCD presenting with ACS. Further studies on larger groups are needed to determine the function of TNFSF15 in SCD patients with ACS and pulmonary hypertension. Analysis of TNFSF15 expression may also serve as a promising approach in ACS therapy.

Key Words: Sickle cell disease, Inflammation, Cytokine, TNFSF15 gene Özet: Amaç: Bu çalışmanın amacı, orak hücre hastalığı (OHH) olan çocukların klinik bulgularıyla birlikte tümör nekroz faktör süperailesi-15 (TNFSF15) gen ifadesi arasındaki ilişkinin araştırılmasıdır.

Gereç ve Yöntemler: Bu amaç için, OHH’li 49 hasta ve 38 sağlıklı kontrol bu çalışmaya dahil edilmiştir. TNFSF15 gen ifadesi ve plazma düzeyleri analiz edilmiştir. Aynı zamanda, TNFSF15 gen ifadesi akut göğüs ağrısı ve ağrılı kriz sıklığına göre de alt-gruplar karşılaştırılmıştır.

Bulgular: STNFSF15 plazma düzeyleri ile ilişkili olarak kontrol ve OHH’li hastalar arasında anlamalı bir fark bulunmazken, TNFSF15 gen ifadesi düzeyleri OHH hastalarında kontrol grubuna göre anlamlı bir şekilde artmış olarak bulunmuştur Address for Correspondence: Selma ÜNAL, M.D., Mersin University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Mersin, Turkey Phone: +90 324 337 43 00 E-mail: unalselma@hotmail.com Received/Geliş tarihi : September 13, 2012 Accepted/Kabul tarihi : March 29, 2013

255

Turk J Hematol 2014;31:255-260

Özçimen AA, et al: TNFSF15 Expression in SCD Patients

(p=0,001). TNFSF15 gen ifadesi aynı zamanda akut göğüs ağrısı olan OHH’li hastalarda anlamlı olarak artmış bulunmuştur (p=0,008).

Sonuç: Bu bulgular, TNFSF15 gen ifadesinin özellikle akut göğüs ağrılı OHH patogenezinde bir rolü olacağını düşündürmektedir. Pulmoner hipertansiyonlu ve akut göğüs ağrılı OHH hastalarında TNFSF15 işlevinin belirlenmesi için ileri geniş grup çalışmalarına ihtiyaç duyulmaktadır. TNFSF15 gen ifadesi aynı zamanda, OHH tedavisinde yeni bir yaklaşıma da katkı sağlayacaktır.

Anahtar Sözcükler: Orak hücre hastalığı, Enflamasyon, Sitokin, TNFSF15 geni

Introduction Sickle cell disease (SCD) is characterized by periodic vaso-occlusive crises, chronic hemolysis, and frequent infections that are accompanied by pain and organ damage [1,2]. Vaso-occlusive crises have been generally attributed to the abnormal shape and poor deformability of sickle erythrocytes [3]. Recent studies have pointed out that sickle red blood cells (SS RBCs) have the ability to bind vascular endothelial cells [4,5] and ultimately cause hypoxia and infarction. This increased adherence is directly related to the vaso-occlusive crises [6]. Vascular cell adhesion molecule-1 (VCAM-1) and intercellular adhesion molecule-1 (ICAM-1) are members of the immunoglobin superfamily. It was demonstrated that the expression of VCAM-1, ICAM-1, and E selectin were increased after incubation of SS RBCs with endothelial cells in vitro [4,7].

The interactions between these molecules are mediated by the activated endothelial cells and by inflammatory cytokines such as tumor necrosis factor-α (TNF-α) [8].

It was found that the adherence of SS RBCs is easier to TNF-α activated endothelial cell monolayers than to the resting endothelial cells [5,9].

The TNF and TNF receptor superfamilies (TNFRs) of proteins take part in the regulation of many important biological processes such as development, organogenesis, apoptosis, inflammation, and innate and adaptive immunity [10,11,12]. In humans, a total of 29 TNFRs and at least 18 specified members of the TNF superfamily with 15%-25% amino acid sequence homology have been identified [11,13]. TNF and IL-1α induce expression of an endothelial cell-derived TNF-like factor, tumor necrosis factor superfamily member 15 (TNFSF15), which has been recently discovered, and they also induce a ligand for deathdomain receptor 3 (DR3) and decoy receptor 3 (DcR3) [14].

DR3 shows the highest homology to TNFR1. Interestingly, TNFR1 is ubiquitously expressed but DR3 is preferentially expressed by lymphocytes, which are efficiently induced after T cell activation [15]. There are several variants of TNFSF15. These have been discovered as the products of different transcripts generated with the use of cryptic splice sites and alternate exons. TNF superfamily ligand A (TL1A) is the longest and most abundant form of TNFSF15 [16].

256

In previous studies, it was reported that TNFSF15 took part in the development of diverse T cell-mediated autoimmune diseases, such as inflammatory bowel disease (IBD), and in experimental models such as chronic murine ileitis and autoimmune encephalomyelitis [17,18,19,20,21,22,23,24,25].

Although signal mediators in SCD were studied at the cellular and gene expression levels in many experimental studies, the effects of inflammatory cytokines in the pathogenesis of SCD remain to be studied [26].

The aim of our study is to determine the gene expression and the serum levels of TNFSF15 and investigate the relation between TNFSF15 gene expression and clinical findings in children with SCD. Materials and Methods Study Population We investigated TNFSF15 gene expression and serum levels in children with SCD. The diagnosis of SCD was confirmed according to hematological and clinical data.

Forty-nine children (34 males and 15 females; mean age: 9.24±3.66 years, range: 3-17 years) with SCD (38 SS, 11 Sβ), who were followed in the Pediatric Hematology Unit of Mersin University, Mersin, Turkey, were included in the study (Group 1: patients with SCD). Thirty-eight children (19 males and 19 females; mean age: 7.84±3.53 years, range: 2-16 years) were consecutively selected from healthy unrelated subjects from the same geographic area of Turkey (Group 2; controls).

The information about painful crisis, acute chest syndrome (ACS), and stroke was taken from hospital medical records.

Patients who had histories of vaso-occlusive crises and erythrocyte transfusion in the last 1 month were excluded.

The patients were classified according to history of painful crises in the last 1 year. Group 1a included patients who had no painful crises, Group 1b included patients who had 1-4 painful crises, Group 1c included patients who had 5-10 painful crises, and Group 1d included patients who had more than 10 painful crises in the last 1 year. The patients were also classified according to ACS data.

Turk J Hematol 2014;31:255-260

Özçimen AA, et al: TNFSF15 Expression in SCD Patients

The protocol of this study was approved by the Ethics Committee of the School of Medicine of Mersin University.

The investigation conforms to the principles outlined in the Declaration of Helsinki.

RNA Isolation and Quantitative Real-Time PCR Blood samples were collected from patients with SCD who had been treated at Mersin University Research Hospital and from healthy subjects as controls. The blood mononuclear cells were separated by Red Blood Cell Lysis Buffer (Roche, Mannheim, Germany). Total RNA was extracted from peripheral blood mononuclear cells using the High Pure RNA Isolation Kit (Roche) following the manufacturer’s protocol including an additional genomic DNA digestion step with DNase I. Five micrograms of total RNA was used to synthesize cDNA. First-strand cDNA synthesis was conducted using the Transcriptor First Strand cDNA Synthesis Kit (Roche) according to the manufacturer’s recommendations. Realtime monitoring of PCR reactions was performed with the LightCycler®2.0 Real-Time PCR Detection System (Roche).

Each reaction was conducted with TNFSF15-specific primers.

The specific PCR assay was designed with the web-based Probe Finder software, using primers and probes from the Universal Probe Library (www.roche-applied-science.com/ sis/rtpcr/upl/index.jsp, UPL, Roche). We selected a UPL assay for the TNFSF15 real-time PCR with the following primerprobe combination: forward primer 5′- caagggcacacctgacagt -3′ and reverse primer 5′- cctagttcatgttcccagtgc- 3′, with UPL probe #33 (Cat. No. 04687663001, Roche). β-Actin (ACTB) was used as an internal control (Cat. No. 0504616500, UPL Human ACTB Gene Assay, Roche).

Determination of Serum TNFSF15 Serum TNFSF15 levels were determined by ELISA assay by pairing a monoclonal antibody with biotinylated antiTNFSF15. A monoclonal antibody specific for hTL1A was coated onto the wells of the microtiter plate. hTL1A was recognized by the addition of a biotinylated monoclonal antibody specific for hTL1A. After removal of excess biotinylated antibody, streptavidin-peroxidase was added.

Peroxidase activity was quantified using the substrate 3,3’,5,5’-tetramethylbenzidine. Plates were read in an ELISA plate reader at 450 nm after acidification. The intensity of the color reaction is directly proportional to the concentration of hTL1A in the samples [Manual TL1A, Soluble (Human) Detection Set for ELISA Application, Apotech, Epalinges, Switzerland].

considered to represent a statistically significant result.

Results Forty-nine patients with SCD and 38 healthy controls were included in this study. The mean TNFSF15 gene expressions were 0.24±0.35 and 0.048±0.07 in the patients with SCD and the controls, respectively. As shown in Figure 1, TNFSF15 gene expression was significantly higher in patients with SCD than the controls (p=0.001).

On the other hand, there was no difference between the patients with SCD and the controls in terms of plasma levels of TNFSF15 (Table 1). As we correlated TNFSF15 gene expression and plasma level, a negative nonlinear relation (r=-0.037, p=0.797) in patients and a positive nonlinear relation (r=0.312, p=0.05) in the control group were found. We also compared TNFSF15 gene expression in subgroups according to frequency of painful crises, history of ACS, and stroke. According to history of painful crises in the last 1 year, 11 patients in Group 1a, 21 patients in Group 1b, 7 patients in Group 1c, and 10 patients in Group 1d were included. Sixteen patients (33%) had ACS and 4 (8%) patients had stroke. There were no differences between the groups according to frequency of painful crises in terms of TNFSF15 gene expression and plasma levels (p>0.05) (Table 2). Interestingly, SCD patients with ACS showed much higher TNFSF15 levels (p=0.008).

TNFSF15 gene expression was also significantly higher in SCD patients with ACS (p=0.008) (Figure 2). Mean TNFSF15 gene expressions were 0.46±0.50 and 0.14±0.18 in SCD patients with and without ACS, respectively (Table 2). We also examined the TNFSF15 gene expression and serum levels in the SCD patients with and without stroke and did not find a significant difference (p>0.05).

Discussion

Statistical Analysis Statistical analyses were carried out using SPSS 11.5 and STATISTICA 6.0. Since the data were distributed nonnormally, the Kruskal–Wallis test, the Mann–Whitney U test, and Spearman’s correlation analysis were used in comparisons between groups. A value of p<0.05 was

Figure 1. The relative expression of TNFSF15 gene in patients with SCD (n=49) and the control group (n=38) (p=0.001).

257

Turk J Hematol 2014;31:255-260

Özçimen AA, et al: TNFSF15 Expression in SCD Patients

In this study, we aimed to investigate the relation between the gene expression and serum levels of TNFSF15 and clinical findings in children with SCD. TNFSF15 is the gene encoding antiangiogenic protein expressed abundantly on endothelial cells, but not on B or T cells. Additionally, the expression of this protein is inducible

by TNF and IL-1α. This cytokine inhibits endothelial cell proliferation and thus may function as an angiogenesis inhibitor [13].

TNFSF15 gene expression levels were investigated in various inflammatory diseases [17,18,19,20,21,22,23,24,25].

The studies that investigated TNFSF15 were experimental and the first clinical study with TNFSF15 was carried out in patients with IBD. It was reported that TNFSF15 polymorphisms are associated with susceptibility to IBD in a European cohort [18]. Additionally, TNFSF15 single nucleotide polymorphisms and haplotypes were found to be strongly correlated to Crohn’s disease in Japanese patients [17,19]. The association was confirmed by studies involving 2 European IBD cohorts [18,20,21].

Thus, we assumed that TNFSF15 gene expression and serum levels would be highest in Group 1d, in which the frequency of painful crises was high, but there were no differences between groups. It is supposed that TNFSF15 gene expression may have not a role by itself in the pathogenesis of painful crises.

Additionally, contrary to expectations, we could not find any difference related to serum levels of TNFSF15 between the patients with SCD and the control group. As we correlated the groups separately, we found a negative nonlinear relation (r=0.037, p=0.797) in patients and a positive nonlinear relation (r=0.312, p=0.05) in the control group between TNFSF15 gene expression and plasma level. The low abundance of TNFSF15 protein in SCD patients might therefore be involved in the posttranslational unknown modifications of late conversion of TNFSF15 protein.

Furthermore, Al-Lamki et al. suggested that TNFSF15 might contribute to renal inflammation and injury through DR3-mediated activation of NF-κB and caspase-3 [22]. In recent studies it was demonstrated that, due to inflammation, TNFSF15 gene expression levels could be varied. Additionally, alterations in TNFSF15 levels from T-cell lymphocytes were reported [22,23,24,25].

In this study, we evaluated both the gene expression and the serum levels of TNFSF15 in children with SCD and we found that TNFSF15 gene expression was significantly higher in patients with SCD than the controls (p=0.001). Acute pain crises in SCD are usually accompanied with infection and/or inflammation, with IL 1-β and TNF-α released [27,28,29].

Figure 2. The relative expression of TNFSF15 gene in SCD patients with ACS (n=16) and in SCD patients without ACS (n=33) (p=0.008).

Table 1. TNFSF15 gene expression and plasma levels of SCD patients and controls.

Groups

Patients with SCD (n=49)

Control (n=38)

p-value

TNFSF15 gene expression

0.24±0.35

0.048±0.07

*p=0.001

Plasma levels of TNFSF15 (ng/mL)

224.84±254.75

277.45±424.12

p>0.05

Descriptive values are expressed as mean ± SD. *p<0.05: statistically significant.

Table 2. TNFSF15 gene expression and plasma levels of SCD patients with ACS and without ACS.

Groups

SCD patients with ACS (n=16)

SCD patients without ACS (n=33)

p-value

TNFSF15 gene expression

0.46±0.50

0.14±0.18

p=0.008

Plasma levels of TNFSF15 (ng/mL)

231.56±76.83

221.59±75.11

p>0.05

Descriptive values are expressed as mean ± SD.

258

Özçimen AA, et al: TNFSF15 Expression in SCD Patients

Interestingly, TNFSF15 gene expression and serum level were dramatically higher in SCD patients with ACS than in the other patients (p=0.008). It may be suggested that TNFSF15 may have a role in the pathogenesis of ACS. Similar to our results, Safaya et al. also found marked expression of TNFSF15 and DR3 in human pulmonary arterial and lung microvascular endothelial cells by induction of butyrate and reported that TNFSF15 might modulate inflammation and sickle cell vasculopathy [30].

According to our results, we suggest that TNFSF15 gene expression might be altered in pulmonary endothelial cells in patients with ACS, and this may lead to the activation of other proinflammatory cytokines, which causes clinical symptoms of SCD. Pulmonary hypertension is one of the most important complications in patients with SCD in older age. Endothelial cell damage and inflammation have a prominent role in the pathogenesis of these complications, as in ACS. Thus, it might be expected that TNFSF15 gene expression has increased in patients with pulmonary hypertension. Since there was no patient with SCD and pulmonary hypertension in our study population, we could not research the relation between the TNFSF15 gene and pulmonary hypertension.

In summary, it might be suggested that increased TNFSF15 gene expression may have a role in the pathogenesis of the chronic inflammatory status of SCD patients. The higher antiangiogenic TNFSF15 gene expression levels may contribute to chronic hypoxia status, development of organ damage, and ACS in these patients.

The present study is limited by its number of patients. The mechanisms should be further tested by in vivo models.

Further studies on larger groups are needed in order to appreciate the function of TNFSF15 in SCD patients with ACS and pulmonary hypertension. TNFSF15 expression may also serve as a promising approach in ACS therapy.

Acknowledgments This study was supported by the Scientific and Technological Research Council of Turkey [TÜBİTAK, SBAGHD-255 (107S308)]. The authors express their appreciation to Prof. Dr. Yasemin Kaçar for her valuable contributions in editing the manuscript and to Assoc. Prof. Bahar Taşdelen for her valuable assistance in statistical evaluation.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Hebbel RP, Osarogiagton R, Kaul D. The endothelial biology of sickle cell disease: inflammation and a chronic vasculopathy. Microcirculation 2004;11:129-151.

Turk J Hematol 2014;31:255-260

2. Cheung ATW, Chen PCY, Larkin EC, Duong PL, Ramanuiam S, Tablin F, Wun T. Microvascular abnormalities in sickle cell disease: a computer-assisted intravital microscopy study. Blood 2002;99:3999-4005.

3. Malowany JI, Butany J. Pathology of sickle cell disease. Sem Diagn Path 2012;29:49-55.

4. Kutlar A, Ataga KI, McMahon L, Howard J, Galacteros F, Hagar W, Vichinsky E, Cheung ATW, Matsui N, Embury SH. A potent oral P-selectin blocking agent improves microcirculatory blood flow and a marker of endothelial cell injury in patients with sickle cell disease. Am J Hematol 2012;87:536-539.

5. Gladwin MT, Sachdev V. Cardiovascular abnormalities in sickle cell disease. J Am Coll Cardiol 2012;59:1123-1133.

6. Hebbel RP, Boogaerts MA, Eaton JW, Steinberg MH. Erythrocyte adherence to endothelium in sickle cell anemia: a possible determinant of disease severity. N Engl J Med 1980;302:992-995.

7. Shiu YT, Udden MM, McIntire LV. Perfusion with sickle erythrocytes up-regulates ICAM-1 and VCAM-1 gene expression in cultured human endothelial cells. Blood 2000;95:3232-3241.

8. Tissot Van Patot MC, MacKenzie S, Tucker A, Voelkel NF. Endotoxin-induced adhesion of red blood cells to pulmonary artery endothelial cells. Am J Physiol Lung Cell Mol Physiol 1996;270:28-36.

9. Vordermeier S, Singh S, Biggerstaff J, Harrison P, Grech H, Pearson TC, Dumonde DC, Brown KA. Red blood cells from patients with sickle cell disease exhibit an increased adherence to cultured endothelium pretreated with tumor necrosis factor (TNF). Br J Haematol 1992;81:591-597.

10. Aggarwal BB. Signalling pathways of the TNF superfamily: a double-edged sword. Nat Rev Immunol 2003;3:745-756.

11.

Bodmer JL, Schneider P, Tschopp J. The molecular architecture of the TNF superfamily. Trends Biochem Sci 2002;27:19-26.

12. Locksley RM, Killeen N, Lenardo MJ. The TNF and TNF receptor superfamilies: integrating mammalian biology.

Cell 2001;104:487-501.

13. Gaur U, Aggarwal BB. Regulation of proliferation, survival and apoptosis by members of the TNF superfamily.

Biochem Pharmacol 2003;66:1403-1408.

14. Migone TS, Zhang J, Luo X, Zhuang L, Chen C, Hu B, Hong JS, Perry JW, Chen SF, Zhou JX, Cho YH, Ullrich S, Kanakaraj P, Carrell J, Boyd E, Olsen HS, Hu G, Pukac L, Liu D, Ni J, Kim S, Gentz R, Feng P, Moore PA, Ruben SM, Wei P. TL1A is a TNF-like ligand for DR3 and TR6/DcR3 and functions as a T cell costimulator. Immunity 2002;16:479-492.

15. Chinnaiyan AM, O’Rourke K, Yu GL, Lyons RH, Garg M, Duan DR, Xing L, Gentz R, Ni J, Dixit VM. Signal transduction by DR3, a death domain-containing receptor related to TNFR-1 and CD95. Science 1996;274:990-992.

259

Turk J Hematol 2014;31:255-260

16. Jin T, Kim S, Guo F, Howard A, Zhang YZ. Purification and crystallization of recombinant human TNF-like ligand TL1A. Cytokine 2007;40:115-122.

17. Yamazaki K, McGovern D, Ragoussis J, Paolucci M, Butler H, Jewell D, Cardon L, Takazoe M, Tanaka T, Ichimori T, Saito S, Sekine A, Iida A, Takahashi A, Tsunoda T, Lathrop M, Nakamura Y. Single nucleotide polymorphisms in TNFSF15 confer susceptibility to Crohn’s disease. Hum Mol Genet 2005;14:3499-3506.

18. Thiebaut R, Kotti S, Jung C, Merlin F, Colombel JF, Lemann M, Almer S, Tysk C, O’Morain M, Gassull M, Binder V, Finkel Y, Pascoe L, Hugot JP. TNFSF15 polymorphisms are associated with susceptibility to inflammatory bowel disease in a new European cohort. Am J Gastroenterol 2009;104:384-391.

19. Nakagome S, Takeyama Y, Mano S, Sakisaka S, Matsui T, Kawamura S, Oota H. Population-specific susceptibility to Crohn’s disease and ulcerative colitis; dominant and recessive relative risks in the Japanese population. Ann Hum Genet 2010;74:126-136.

20. Tremelling M, Berzuini C, Massey D, Bredin F, Price C, Dawson C, Bingham SA, Parkes M. Contribution of TNFSF15 gene variants to Crohn’s disease susceptibility confirmed in UK population. Inflamm Bowel Dis 2008;14:733-737.

21. Picornell Y, Mei L, Taylor K, Yang H, Targan SR, Rotter JI. TNFSF15 is an ethnic-specific IBD gene. Inflamm Bowel Dis 2007;13:1333-1338.

22. Al-Lamki RS, Wang J, Tolkovsky AM, Bradley JA, Griffin JL, Thiru S, Wang EC, Bolton E, Min W, Moore P, Pober JS, Bradley JR. TL1A both promotes and protects from renal inflammation and injury. J Am Soc Nephrol 2008;19:953960.

260

Özçimen AA, et al: TNFSF15 Expression in SCD Patients

23. Prehn JL, Mehdizadeh S, Landers CJ, Luo X, Cha SC, Wei P, Targan SR. Potential role for TL1A, the new TNF-family member and potent costimulator of IFN-γ, in mucosal inflammation. Clin Immunol 2004;112:66-77.

24.

Young HA, Towey MG. TL1A: A mediator of gut inflammation. Proc Natl Acad Sci USA 2006;103:83038304.

25. Bamias G, Mishina M, Nyce M, Ross WG, Kollias G, RiveraNieves J, Pizzarro TT, Comminelli F. Role of TL1A and its receptor DR3 in two models of chronic murine ileitis. Proc Natl Acad Sci USA 2006;103:8441-8446.

26.

Lanaro C, Franco-Penteado F, Albuqueque DM, Saad STO, Conran N, Costa FF. Altered levels of cytokines and inflammatory mediators in plasma and leukocytes of sickle cell anemia patients and effects of hydroxyurea therapy. J Leukoc Biol 2009;85:235-242.

27. Vichinsky EP, Styles LA, Colangelo LH, Wright EC, Castro O, Nickerson B. Acute chest syndrome in sickle cell disease: clinical presentation and course. Cooperative Study of Sickle Cell Disease. Blood 1997;89:1787-1792.

28. Makis AC, Hatzimichael EC, Bourantas KL. The role of cytokines in sickle cell disease. Ann Hematol 2000;79:407413.

29. Pathare A, Kindi SA, Daar S, Dennison D. Cytokines in sickle cell disease. Hematology 2003;8:329-337.

30. Safaya S, Klings E, Odhiambo A, Li G, Farber F, Steinberg M. Effect of sodium butyrate on lung vascular TNFSF15 (TL1A) expression: differential expression patterns in pulmonary artery and microvascular endothelial cells.

Cytokine 2009;46:72-78.

Research Article

DOI: 10.4274/tjh.2013.0003

The Evaluation of Hydroxyethyl Starch (6% HES 130/0.4) Solution’s Potential Preventive Effects on Coagulation Status in Women with Gynecologic Malignancies Using Rotation Thromboelastography Jinekolojik Maligniteli Kadınlarda Hidroksietil Nişasta (%6 HES 130/0.4) Solüsyonunun Potansiyel Koruyucu Etkilerinin Rotasyonel Trombelastografi Kullanılarak Değerlendirilmesi Meltem Olga Akay1, Ayten Bilir2, Tufan Öge3, Gökhan Kuş1, Fezan Şahin Mutlu4 1Eskişehir Osmangazi University Faculty of Medicine, Department of Hematology, Eskişehir, Turkey 2Eskişehir Osmangazi University Faculty of Medicine, Department of Anesthesiology and Reanimation, Eskişehir, Turkey 3Eskişehir Osmangazi University Faculty of Medicine, Department of Obstetrics and Gynecology, Eskişehir, Turkey 4Eskişehir Osmangazi University Faculty of Medicine, Department of Biostatistics, Eskişehir, Turkey

Abstract: Objective: The aim of this study was to determine the effects of in vitro hemodilution with 6% hydroxyethyl starch (HES) 130/0.4 solution on the coagulation status of women with gynecologic malignancies by using rotation thromboelastogram (ROTEM®).

Materials and Methods: Twenty-two patients with gynecological tumors scheduled for anesthesia were enrolled. Blood samples were diluted by 20% with 6% HES (130/0.4) solution.

Results: In the INTEM assay, clotting time (CT) (p<0.01) and clot formation time (CFT) (p<0.001) were significantly increased and maximum maximum clot formation (MCF) (p< 0.001) was significantly decreased in HES hemodilution compared with the undiluted control samples. In the EXTEM assay, there was a similar significant increase in increase in CFT (p<0.01) and a decrease in maximum a decrease in MCF (p<0.01) in HES hemodilution when compared with control samples.

Conclusion: HES 130/0.4 solution causes significant hypocoagulable changes in the thromboelastographic profile of gynecologic cancer patients in vitro.

Key Words: Blood coagulation, Colloids, Genital neoplasms, Thromboelastography

Address for Correspondence: Meltem Olga AKAY, M.D., Eskişehir Osmangazi University Faculty of Medicine, Department of Hematology, Eskişehir, Turkey E-mail: olga.akay@hotmail.com Received/Geliş tarihi : January 1, 2013 Accepted/Kabul tarihi : April 17, 2013

261

Turk J Hematol 2014;31:261-265

Akay OM, et al: HES in Women with Gynecologic Malignancies

Özet: Amaç: Bu çalışmanın amacı, jinekolojik maligniteli kadınlarda %6 hidroksietil nişasta (HES) 130/0,4 solüsyonu ile hemodilüsyonun koagülasyon durumu üzerine in vitro etkilerinin rotasyonel trombelastogram (ROTEM®) kullanarak belirlenmesidir.

Gereç ve Yöntemler: Anestezi programına alınan jinekolojik tümörlü 22 hasta dahil edildi. Kan örnekleri %6 HES (130/0,4) solüsyonu ile %20 dilue edildi.

Bulgular: INTEM analizinde, HES hemodilüsyonunda, dilüsyon yapılmayan kontrol örneklerine göre pıhtılaşma zamanı (CT) (p<0.01) ve pıhtı oluşma zamanı (CFT) (p<0,001) anlamlı uzamış ve maksimum pıhtı sertliği (MCF) (p<0,001) anlamlı kısalmış idi. EXTEM analizinde, HES hemodilüsyonunda, dilüsyon yapılmayan kontrol örneklerine göre benzer olarak CFT değerinde anlamlı uzama (p<0,01) ve MCF değerinde anlamlı kısalma (p<0,01) mevcut idi.

Sonuç: HES 130/0,4 solüsyonu jinelolojik kanserli hastaların trombelastografik profilinde in vitro önemli hipokoagulabl değişikliklere yol açmaktadır.

Anahtar Sözcükler: Kan koagülasyonu, Kolloidler, Genital neoplaziler, Trombelastografi Introduction Venous thromboembolism (VTE) is a serious and frequent problem in gynecologic cancer patients. Malignancy is associated with a baseline hypercoagulable state due to many factors including release of inflammatory cytokines, activation of the clotting system, expression of hemostatic proteins on tumor cells, inhibition of natural anticoagulants, and impaired fibrinolysis [1]. On the other hand, several risk factors related to the patient, cancer type, and therapeutic interventions such as central venous catheters, perioperative transfusion, systemic treatments including chemotherapy and hormone therapy, and surgery are associated with an increased risk of VTE in cancer patients [2]. Surgery in gynecologic cancer, as an important contributing factor to hypercoagulable states, shows several differences from general surgery. Patients often require intrapelvic procedures, such as lymph node dissection and excision of peritoneal metastases, which significantly increase the incidence of VTE in gynecologic cancer patients [3]. The incidence of asymptomatic deep VTE based on objective diagnostic screening is given as 15%-40% among patients undergoing major gynecologic surgery without preventive measures by the American College of Chest Physicians’ guidelines [4].

Intravascular volume deficits often occur during major abdominal surgery and adequate restoration of intravascular volume is an important therapeutic maneuver in managing the surgical patient care. Synthetic colloid solutions like gelatins and hydroxyethyl starch (HES) preparations are frequently used as an alternative for blood loss replacement to restore intravascular volume and avoid the risk associated with transfusion of allogenic blood products [5,6]. Gelatins have little negative influence on the coagulation process, whereas HES, especially if administered in large volumes, can impair coagulopathy because of reduced release of factor VIII/von Willebrand Factor, impaired platelet function, and hemodilution. Their compromising effects on blood coagulation are mainly dependent on their molecular 262

weight (MW) and degree of substitution (DS). Recently developed 6% HES 130/0.4 solutions impair coagulation to a lesser degree, because of lower mean MW and lower DS [7]. From a theoretical point of view, HES-related coagulopathy can attenuate the hypercoagulable states. In this context, we hypothesized that besides the advantage of avoiding transfusion-associated risks, HES may have potential beneficial effects on the hypercoagulable state of gynecologic cancer surgery when used for the restoration of intravascular volume deficits.

This study was designed to assess the influence of 6% HES 130/0.4 preparation on hemostasis by using modified rotation thromboelastogram in women with gynecologic malignancies in vitro.

Materials and Methods After obtaining approval from our institute’s ethics committee on 18 May 2012 and patients’ informed consent, 22 patients with gynecological cancer (13 endometrial and 9 ovarian) scheduled for anesthesia were enrolled in this study between 18 May and 30 June 2012. Patients with a history of hematological or coagulation disorders, those taking anticoagulant therapy, and those with renal or liver dysfunction were excluded.

Blood was withdrawn from each volunteer using a 19-gauge needle under minimum stasis. All blood samples were collected using a 2-syringe technique. After discarding the initial 2 mL of blood to prevent tissue thromboplastin contamination, samples for thromboelastography (TEG) analysis were drawn into 4.5-mL vacutainers (Becton Dickinson) containing 3.2% trisodium citrate with a citrate/ blood ratio of 1:9. After harvesting the sample, the blood was diluted by 20% using 6% HES 130/0.4 (Voluven®, Fresenius Kabi, Bad Hamburg, Germany); 20% hemodilution corresponds to a volume of HES infusion that simulates the recommended blood replacement volume used clinically in the perioperative period. Undiluted whole blood acted as a

Turk J Hematol 2014;31:261-265

Akay OM, et al: HES in Women with Gynecologic Malignancies

control. Blood coagulation of HES dilution and the undiluted control was assessed using TEG. Thromboelastography TEG analysis was performed with the ROTEM® Coagulation Analyzer (Pentapharm, Munich, Germany).

After incubating the test solution at 37 °C for 2 min, 300 µL of citrated blood was recalcified with 20 µL of 0.2 mol/L CaCl2 (star-TEM®, Pentapharm) and activation of coagulation was performed with different agents. In INTEM, coagulation is activated with 20 µL of contact activator (partial thromboplastin-phospholipid from rabbit brain extract and ellagic acid, in-TEM®, Pentapharm). In EXTEM, coagulation is activated by 20 µL of tissue factor (tissue thromboplastin from rabbit brain extract, ex-TEM®, Pentapharm).

The method and the parameters of ROTEM® have been described in detail previously [8]. All TEG samples were analyzed within 30-90 min of blood collection by the same investigator. The integrated computer of the device calculated the following standard variables: clotting time (CT), clot formation time (CFT), and maximum clot formation (MCF). The CT is the time from start of the measurement until initiation of clotting. CT is influenced by activities of coagulation factors. CFT is the time from initiation of clotting until a clot firmness of 20 mm is detected. CFT is influenced by activities of coagulation factors, platelet count/function, thrombin formation, fibrin precipitation, fibrinogen, and hematocrit. MCF represents the firmness of the clot. It is affected by fibrin and fibrinogen concentration, platelet count/function, thrombin concentration, factor XIII, and hematocrit.

Statistics Statistical analysis was carried out using IBM SPSS Statistics 20. Normally distributed continuous dependent variables were analyzed using the paired t-test and are presented as mean and standard deviation. Nonnormally distributed variables were compared with the Wilcoxon test for 2 dependent groups and are presented as median (25th to 75th percentile). A p-value of less than 0.05 (p<0.05) was accepted as significant.

Results Results of ROTEM® parameters are presented in Table 1.

In the INTEM assay, CT (p<0.01) and CFT (p<0.001) were significantly increased and MCF (p<0.001) was significantly decreased in HES hemodilution compared with undiluted control samples. In the EXTEM assay, there was a similar significant increase in CFT (p<0.01) and a decrease in MCF (p<0.01) in HES hemodilution when compared with control samples. As anticipated, the ROTEM® parameters of 20% HES-diluted whole-blood samples of patients with gynecological tumors suggested a hypocoagulable state when compared with the baseline parameters. This

hypocoagulability was diagnosed readily by the presence of decelerated clot formation, as evidenced by increasing of CT and CFT, and a decrease of the clot strength, as evidenced by shortening of MCF. Discussion The results of the present study confirm that 6% HES 130/0.4 does influence the coagulation process in vitro. ROTEM® parameters of HES-diluted whole-blood samples of patients with gynecological tumors suggested a hypocoagulable state when compared with the control parameters.

Cancer patients, and especially those undergoing surgery for cancer, are at extremely high risk for VTE, even with appropriate thromboprophylaxis [2]. The risk of VTE in cancer patients undergoing surgery is 3 to 5 times greater than that in surgical patients without cancer and this status is directly related with postoperative morbidity, mortality, and higher health care costs [9,10]. Gynecologic cancer surgery shows several differences from general surgery.

Patients often require intrapelvic procedures, such as lymph node dissection and excision of peritoneal metastases, and it is likely that VTE will occur at a high incidence in these patients [3].

Cancer patients may be exposed to many different agents that can affect platelet function and coagulation during their medical or surgical treatment. In surgical patients, synthetic colloids are widely used as plasma substitutes because of their ability to increase and maintain circulating blood volume [6]. The effect of colloids on hemostasis may potentially be caused by the dilution effect and accompanying changes in blood viscosity and platelet count, an effect on the activity of blood coagulation factors and fibrinolysis, or an influence on platelet function [4]. Hartog et al. reported that the extent of coagulopathy depends on the pharmacokinetic properties of the HES molecules, such as MW or the DS of carbon atoms with hydroxyl moieties. HES 130/0.4 has a lower MW (130 kDa) and DS (0.4) and is suggested to affect coagulation to a lesser degree than HES 470/0.7 or HES 200/0.5. In their systemic review, 24 studies that assessed hemostasis

by TEG were included and 19 of these studies confirmed that HES 130/0.4 leads to hypocoagulation. It was also mentioned that the effects on hemostasis may be clinically relevant, particularly at higher doses [11]. In a study by Ansari et al., parallel hypocoagulable results were reported with TEG in pregnant patients by using a mixture of lactate Ringer’s solution and HES (130/0.4) [12]. In another study including pregnant women at term, Turker et al. concluded that both HES and gelatin produce mild hypocoagulable changes, but thromboelastographic parameters remain within or just below the normal reference [13]. As with malignancy, pregnancy can cause hypercoagulability, and venous thromboembolism is also a leading cause of maternal mortality and morbidity.

263

Turk J Hematol 2014;31:261-265

Akay OM, et al: HES in Women with Gynecologic Malignancies

Table 1. Values of ROTEM® parameters in the undiluted control and 10% HES diluted samples.

INTEM EXTEM

Parameter

Control

HES

p-values

CT (s)

173.5 (155.3-193.0)

184 (169.8-204.5)

<0.01

CFT (s)

65.5 (52.3-77.8)

86 (71.0-100.0)

<0.001

MCF (mm)

65.7±5.3

60.0±5.8

<0.001

CT (s)

71.5±15.1

65.8±12.4

>0.05

CFT (s)

84.5 (58.8-92.8)

96 (67.8-108.3)

<0.01

MCF (mm)

66.5±5.5

63.7±5.4

<0.01

INTEM: contact activated TEG, EXTEM: tissue factor activated TEG. CT: clotting time, CFT: clot formation time, MCF: maximum clot firmness.

Data are given as mean±SD or median (25%-75%).

The major result of the present study was that 6% HES 130/0.4 preparation caused significant hypocoagulable changes on the thromboelastographic profile of gynecologic cancer patients in vitro. HES negatively affected the speed of clot formation as evidenced by increasing of CFT and impaired clot strength as evidenced by shortening of MCF values in both INTEM and EXTEM assays. In other studies, different concentrations of HES 130/0.4 were included from 10% up to 40%. It was recommended that the maximum dose of HES 130/0.4 not exceed 15-20 mL/kg [14]. The volume of HES 130/0.4 (6%) used in our study was chosen to simulate the recommended blood replacement volume used clinically in perioperative settings. We used a modified rotation thromboelastogram (ROTEM®, Pentapharm) instead of conventional TEG because different aspects of the coagulation process can be detected earlier and better

by ROTEM®. The most important benefits of ROTEM® technology include rapid availability of test results; less susceptibility to mechanical stress, movement, and vibration; and enhanced reproducibility [15]. The data are also continuous, digital, and retrievable for further calculations [16]. Our study identified the value of using thromboelastographic techniques in monitoring the effects of HES on the coagulation status of gynecologic cancer patients.

Our results suggest that HES could be a suitable synthetic colloid for plasma volume substitution during acute normovolemic hemodilution in the context of major abdominal surgery for gynecologic malignancy. As Hartog et al. discussed in their report, a hypocoagulatory effect as defined by a reduction in final clot strength may not be necessarily a bad thing in perioperative and postoperative periods, which are associated with hypercoagulable states [11]. However, it should not be forgotten that the interference of colloids with the system must be in an accurate balance since it may increase bleeding risk in much higher doses. If used correctly for the appropriate patient population intraoperatively, besides the advantage of decreasing exposure to allogenic blood transfusion, HES 264

may avoid the risk of surgery-related thrombosis in patients with gynecologic malignancies.

However, the clinical relevance of this in vitro study has some limitations. Factors such as the physiological recruitment of platelets and coagulation factors in response to hemodilution or the effects of hypothermia and pharmacokinetics of HES are hard to study in vitro [12].

In vivo hemostasis studies are necessary for the assessment of hypercoagulability associated with intraoperative colloid regimen in cancer patients undergoing surgery.

In conclusion, 6% HES 130/0.4 solution caused significant hypocoagulable changes in the thromboelastographic profiles of gynecologic cancer patients in vitro. Thus, further investigations that correlate this hypocoagulability with the clinical picture are needed to determine if HES could be a more suitable synthetic colloid for plasma volume substitution during major abdominal surgery of gynecologic malignancies.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Rodrigues CA, Ferrarotto R, Kalil Filho R, Novis YA, Holf PM. Venous thromboembolism and cancer: a systematic review. J Thromb Thrombolysis 2010;30:67-78.

2. Spyropoulos AC, Brotman DJ, Amin AN, Deitelzweig SB, Jaffer AK, McKean SC. Prevention of venous thromboembolism in the cancer surgery patient. Cleve Clin J Med 2008;75:S1726.

3. Suzuki N, Yoshioka N, Ohara T, Yokomichi N, Nako T, Yahagi N, Igarashi S, Kobayashi Y, Yoshimatsu M, Takizawa K, Nakajima Y, Kiguchi K, Ishizuka B. Risk factors for perioperative venous thromboembolism: a retrospective study in Japanese women with gynecologic diseases.

Thromb J 2010;8:17.

Akay OM, et al: HES in Women with Gynecologic Malignancies

4. Geerts WG, Berggvist D, Pineo GF, Heit JA, Samama CM, Lassen MR, Colwell CW; American College of Chest Physicians. Prevention of venous thromboembolism.

American College of Chest Physicians Evidence-Based Clinical Practice Guidelines. Chest 2008;133(6 Suppl):381S453S. 5. Jin SL, Yu BW. Effects of acute hypervolemic fluid infusion of hydroxyethyl starch and gelatin on hemostasis and possible mechanisms. Clin Appl Thromb Hemost 2010;16:91-98.

6. Ickx BE, Bepperling F, Melot C, Schulman C, Van der Linden PJ. Plasma substitution effects of a new hydroxyethyl starch HES 130/0.4 compared with HES 200/0.5 during and after extended acute normovolaemic haemodilution. Br J Anaesth 2003;91:196-202.

7. Kang JG, Ahn HJ, Kim GS, Hahm TS, Lee JJ, Gwak MS, Choi SJ. The hemostatic profiles of patients with type O and non-O blood after acute normovolemic hemodilution with 6% hydroxyethyl starch (130/0.4). Anesth Analg 2006;103:1543-1548.

8. Akay OM, Ustuner Z, Canturk Z, Mutlu FS, Gulbas Z. Laboratory investigation of hypercoagulability in cancer patients using rotation thrombelastography. Med Oncol 2008;26:358-364.

9. Donati MB. Cancer 1994;24:128-131.

and

thrombosis.

Haemostasis

Turk J Hematol 2014;31:261-265

11. Hartog CS, Reuter D, Loesche W. Influence of hydroxyethyl starch (HES) 130/0.4 on hemostasis as measured by viscoelastic device analysis: a systematic review. Intensive Care Med 2011;37:1725-1737.

12. Ansari T, Riad W. The effect of haemodilution with 6% hydroxyethyl starch (130/0.4) on haemostasis in pregnancy: an in-vitro assessment using thromboelastometry. Eur J Anaesthesiol 2010;27:304-305.

13. Turker G, Yilmazlar T, Mogol EB, Gurbet A, Dizman S, Gunay H. The effects of colloid pre-loading on thromboelastography prior to caesarean delivery: hydroxyethyl starch 130/0.4 versus succinylated gelatine. J Int Med Res 2011;39:143149.

14. Oh CS, Sung TY, Kim SH, Kim DH, Lim JA, Woo NS. Assessment of coagulation with 6% hydroxyethyl starch 130/0.4 in cesarean section. Korean J Anesthesiol 2012;62:337-342.

15. Schobersberger W, Mittermayr M, Fries D, Innerhofer P, Klingler A. Changes in blood coagulation of arm and leg veins during a simulated long-haul flight. Thromb Res 2007;119:293-300.

16. Sorenson B, Johansen P, Christiansen K, Woelke M, Ingerslev J. Whole blood coagulation thromboelastographic profiles employing minimal tissue factor activation. J Thromb Haemost 2002;1:551-558.

10. Moraca RJ, Sheldon DG, Thirlby RC. The role of epidural anesthesia and analgesia in surgical practice. Ann Surg 2003;238:663-673.

265

Research Article

DOI: 10.4274/tjh.2012.0213

Critical Role of Sensitized Serum in Rejection of Allogeneic Bone Marrow Cells Sensitize Serumun Allojeneik Kök Hücrelerin Rejeksiyonunda Kritik Rolü Lu-Hong Xu1,2, Jian-Pei Fang1,2, Wen-Jun Weng1,2, Hong-Gui Xu1,2 1Sun 2Key

Yat-sen University, Sun Yat-sen Memorial Hospital, Department of Pediatrics, Guangzhou, China Laboratory of Malignant Tumor Gene Regulation and Target, Guangzhou, China

Abstract: Objective: Humoral immunity has been clearly implicated in solid organ transplantation, but little is known about the relationship between humoral immunity and hematopoietic stem cell transplantation. This study was designed to investigate that relationship.

Materials and Methods: Sensitized serum was obtained from a sensitized murine model established by allogeneic splenocyte transfusion. Sensitized serum was incubated with allogeneic bone marrow cells (BMCs) in vitro and the cytotoxicity was evaluated by the complement-dependent cytotoxicity method. Mice were transplanted with allogeneic BMCs incubated with sensitized serum after lethal irradiation. The engraftment was assayed by hematopoietic recovery and chimera analysis.

Moreover, mice received passive transfer of sensitized serum 1 day prior to transplantation. Mortality was scored daily after bone marrow transplantation.

Results: The in vitro experiments showed that sensitized serum was capable of impairing allogeneic BMCs through the complement-dependent cytotoxicity pathway. The animal studies showed that BMCs incubated with sensitized serum failed to rescue mice from lethal irradiation. The engraftment assay showed that the allogeneic BMCs incubated with sensitized serum were rejected with time in the recipients. Furthermore, the mice died of marrow graft rejection by transfer of sensitized serum prior to transplantation.

Conclusion: Taken together, our results indicated that sensitized serum played a critical role in graft rejection during hematopoietic stem cell transplantation.

Key Words: Sensitized serum, Bone marrow cells, Rejection, Transplantation Özet: Amaç: Solid organ transplantasyonlarında humoral immunitenin önemi ile ilgili bilgilerimiz daha açık olmakla birlikte, humoral immunite ve hematopoetik kök hücre nakli arasındaki ilişki konusunda bilgilerimiz sınırlıdır. Bu çalışmada bu ilişkinin araştırılması hedeflenmiştir.

Address for Correspondence: Lu-Hong XU and Jian-Pei FANG, M.D., Sun Yat-sen University, Sun Yat-sen Memorial Hospital, Department of Pediatrics, Guangzhou, China E-mail: xulvhong@126.com Received/Geliş tarihi : December 29, 2012 Accepted/Kabul tarihi : May 6, 2013

266

Xu HL, et al: Critical Role of Sensitized Serum in Rejection of Allogeneic Bone Marrow Cells

Turk J Hematol 2014;31:266-271

Gereç ve Yöntemler: Sensitize bir fare modelinden allojeneik splenosit transfüzyonu elde edildi. Sensitize serum, allojeneik kemik iliği hücreleri ile in vitro olarak inkübe edildi ve sitotoksisite komplemana bağımlı sitotoksisite metodu ile değerlendirildi. İrradiasyon sonrası farelere sensitize serumda inkübe edilmiş allojeneik kemik iliği hücreleri transplante edildi. Engraftman, hematopoetik düzelme ve kimerizm analizleri ile değerlendirildi. Ayrıca, farelere transplanttan 1 gün önce sensitize serum pasif olarak uygulandı. Kemik iliği transplantasyonu sonrası mortalite günlük olarak skorlandı.

Bulgular: İn vitro çalışmalar göstermiştir ki, sensitize serum komplemana bağımlı sitotoksisite üzerinden allojeneik kemik iliği hücrelerini etkilemektedir. Sensitize serum ile inkübe edilmiş kemik iliği hücreleri fareleri letal dozda irradiasyondan korumakta başarısız olmuştur. Sensitize serum ile inkübe edilen kemik iliği hücreleri alıcılarda zaman içinde rejeke edilmişlerdir. Ayrıca, transplantasyondan önce sensitize serum verilen fareler graft rejeksiyonu nedeniyle ölmüşlerdir.

Sonuç: Bu bilgiler ışığında, sensitize serumun hematopoetik kök hücre transplantasyonunda oluşabilecek graft rejeksiyonunda kritik bir role sahip olduğu söylenebilir.

Anahtar Sözcükler: Sensitize serum, Kemik iliği hücreleri, Rejeksiyon, Transplantasyon

Introduction Humoral immunity has been identified to play an important role in solid organ transplantation, especially for sensitized recipients. Allograft rejection is correlated with high levels of donor-reactive antibodies in sensitized serum [1,2,3]. However, little is known about the relationship between humoral immunity and hematopoietic stem cell transplantation. Many hematological diseases, such as thalassemia major, sickle cell disease, and aplastic anemia, require long-term transfusion support. Given that these patients receive repeated transfusions from human leukocyte antigen-mismatched donors, they would be sensitized easily and produce high levels of donor-reactive antibodies [4,5,6].

Currently, allogeneic hematopoietic stem cell transplantation is the only available curative treatment for these diseases.

Notably, clinical findings showed that these sensitized patients are at high risk of allogeneic donor graft rejection [7,8]. We assume that allogeneic donor cells present in the blood have direct contact with recipient immune cells in the circulation and may activate donor-reactive antibody production. Thus, humoral immunity may play a critical role in marrow graft rejection.

The level of sensitization associated with transfusions is due to white blood cells present in allogeneic blood products [9,10]. Here, a murine model of sensitization was established by repeated transfusions of allogeneic spleen cells. The serum obtained from such a sensitized model contains high levels of donor-reactive antibodies [11]. In the present study, we tried to explore the effect of sensitized serum on engraftment of allogeneic bone marrow cells (BMCs) in vivo. Moreover, the role of sensitized serum in marrow graft rejection was evaluated by passive transfer prior to transplantation. Informed consent was obtained.

Materials and Methods Animals Male C57BL/6 and BALB/c mice, aged 6 to 8 weeks and weighing 18 to 20 g, were purchased from the Experimental

Animal Center of Sun Yat-sen University (Guangzhou, China). All animals were handled and housed in accordance with the guidelines of the Sun Yat-sen University Animal Care and Use Committee.

Sensitized Serum and Allogeneic BMCs Sensitized serum was collected from sensitized mice.

Briefly, BALB/c mice were sensitized by repeated transfusions of allogeneic spleen cells from C57BL/6 mice [11,12]. A total of 1x106 nucleated splenocytes (0.1 mL) were transfused to BALB/c mice via their tail vein weekly for 2 weeks (on day -14 and day -7, respectively). The serum was obtained from the sensitized mice on day 0. Non-sensitized serum was obtained from naive BALB/c mice. All sera were heated at 56 °C for 30 min and were frozen at -20 °C for future use.

Meanwhile, allogeneic BMCs were collected from femurs and tibias of C57BL/6 mice. The BMCs were cultured in RPMI-1640 medium.

Complement-Dependent Cytotoxicity Experiment The presence of appropriate alloreactive antibodies in sensitized serum was tested by the complement-dependent cytotoxicity (CDC) method. Ten microliters of serum and 10 µL of allogeneic BMCs were added in 96-well culture plates. Wells were washed once after incubation at 37 °C for 30 min. Ten microliters of rabbit complement (One Lambda Company Limited, Canoga Park, CA, USA) was added and incubated for another 30 min. Fluorescent dye ethidium bromide/acridine orange (One Lambda Company Limited) was added and the percent of non-viable cells was determined by manual counting using a fluorescence microscope [13,14].

Transplantation of BMCs Incubated with Serum Allogeneic BMCs were incubated with a 1:10 dilution of sensitized serum or non-sensitized serum for 1 h on ice.

The cells were washed and were then labeled with FITCconjugated goat anti-mouse antibody (BD PharMingen, San Diego, CA, USA). The percentage of binding rate was detected by a flow cytometer (Becton Dickinson, San Jose, CA, USA).

267

Turk J Hematol 2014;31:266-271

Xu HL, et al: Critical Role of Sensitized Serum in Rejection of Allogeneic Bone Marrow Cells

Naive BALB/c mice underwent total body irradiation with 800 cGy using cobalt-60 gamma rays before transplantation.

After incubation, allogeneic BMCs were washed 3 times prior to infusion of 1x107 BMCs into irradiated BALB/c mice. Naive BALB/c mice only receiving irradiation alone were used as controls. The recipients were maintained on acidified water with added antibiotics (cidomycin, 32x104 U/L and erythromycin, 250 mg/L).

Engraftment Assay Mortality was scored daily. The survival rate was determined 28 days after transplantation. Twenty microliters of peripheral blood collected in 1-mL tubes with buffer was obtained from the tails of recipients every week after transplantation. Cell numbers were measured by a System KX-21 hematology series cell counter (Sysmex Company, Kobe, Japan). BMCs obtained from femurs of the recipients were counted every week after transplantation. For chimera analysis, BMCs were suspended in RPMI 1640 medium and FITC-labeled H-2Db (BD PharMingen) was added to the cells. The cells were set aside for flow cytometric analysis [15].

Passive Transfer of Serum Prior to Transplantation One day before bone marrow transplantation, 100 µL of sensitized serum or non-sensitized serum was injected intravenously into naive BALB/c mice. The mice underwent total body irradiation with 800 cGy using cobalt-60 gamma rays. A total of 1x107 allogeneic BMCs were transfused intravenously into the irradiated mice. Mortality was scored daily after bone marrow transplantation.

Statistical Analysis Results are expressed as mean ± standard error of the mean, and the data were analyzed with SPSS 16.0. Comparisons between experimental results were made using one-way ANOVA test analysis. Values of log-rank p were determined using the Kaplan-Meier method comparing survival curves and p<0.05 was considered statistically significant.

BMCs Incubated with Sensitized Serum Failed to Engraft in Recipients BMCs were incubated with a 1:10 dilution of sensitized serum or non-sensitized serum in vitro. The cells were washed and were then labeled with FITC-conjugated goat anti-mouse antibody. By flow cytometric analysis, the percentage of binding rate in the sensitized serum group and non-sensitized serum group was 95.12±2.32% and 4.15±2.17%, respectively, and the differences were statistically significant (p<0.001).

The results of animal survival duration are shown in Figure 1. Each group contained 10 mice. Without transplantation, the mice died at 10 to 16 days after irradiation, with a median of 14 days. The irradiated mice that received allogeneic BMCs incubated with non-sensitized serum remained alive at 28 days. However, 70% (7/10) of the mice receiving allogeneic BMCs incubated with sensitized serum died at 9 to 13 days after irradiation, with a median of 10 days. By log-rank analysis, there was a significant difference between the non-sensitized serum group and the sensitized serum group (p<0.0001), while there was no significant difference between the irradiated control group and the sensitized serum group (p>0.05).

Engraftment of allogeneic BMCs in recipients was assayed at days 7 and 14 after transplantation. The results of hematopoietic recovery and chimera analysis are shown in Tables 2 and 3. The white blood cells, hemoglobin, and platelets in peripheral blood increased over time in mice that received BMCs incubated with non-sensitized serum. In contrast, hematopoietic recovery was noted to be decreased with time in those that received BMCs incubated with sensitized serum. Correlating to peripheral hematopoietic recovery, the number of BMCs per femur and the percentage of H-2Db+ cells in bone marrow increased with time in the non-sensitized serum group but decreased with time in the sensitized serum group.

Results Sensitized Serum was Capable of Impairing Allogeneic BMCs The effect of sensitized serum on allogeneic BMCs was evaluated by the CDC method, which represents the intensity of the complement killing reaction. As shown in Table 1, following 30 min of incubation with rabbit complement, sensitized serum in Group D had significantly increased in the intensity of reaction (% dead cells >40%). In contrast, the reaction remained negative for non-sensitized serum in Group C and samples containing no serum in Group B (% dead cells <10%). As expected, without addition of rabbit complement, there was no increased intensity of reaction in non-sensitized serum (Group E) or in sensitized serum (Group A).

268

Figure 1. Survival analysis of recipients after irradiation. The irradiation control group was treated with lethal irradiation of 800 cGy, but without bone marrow transplantation. The other irradiated mice received allogeneic bone marrow cells incubated with sensitized or non-sensitized serum, respectively. Each group contained 10 mice. The survival events were monitored daily.

Turk J Hematol 2014;31:266-271

Xu HL, et al: Critical Role of Sensitized Serum in Rejection of Allogeneic Bone Marrow Cells

CDC experiment in Group D was significantly higher than that in Group C (p<0.0001), indicating that sensitized serum was capable of impairing allogeneic BMCs through the CDC pathway. Moreover, the cytotoxic index in Group E and

Transfer of Sensitized Serum Induced Transplantation Failure The irradiated mice were transferred with sensitized serum or non-sensitized serum prior to transplantation. The survival data are recorded in Figure 2. Each group contained 10 mice. All the mice that received non-sensitized serum remained alive at day 28 after bone marrow transplantation.

However, 80% (8/10) of the mice that received sensitized serum died at 9 to 15 days after bone marrow transplantation, with a median of 13 days. By log-rank analysis, there was a significant difference between the recipients transferred with non-sensitized serum and those transferred with sensitized serum (p<0.0001). Moreover, the white blood cells, hemoglobin, and platelets in the peripheral blood of dying mice were (0.28±0.08)x109/L, 80.4±8.02 g/L, and (38.8±7.25)x109/L, respectively. These values indicated that the mice died from marrow graft rejection.

Figure 2. Survival analysis of recipients after bone marrow transplantation. The naive BALB/c mice were transferred with 100 µL of sensitized or non-sensitized serum 1 day before transplantation. All the mice received allogeneic bone marrow cells after lethal irradiation. Each group contained 10 recipients. The survival events were monitored daily.

Discussion CDC is a reaction in which an antibody bound to its antigen activates a reaction cascade of the complement system. Our results showed that the cytotoxic index of the

Table 1. Intensity of reaction in complement-dependent cytotoxicity experiment (n=5).

% Dead cells Group

Compositions

30 min

A

Bone marrow cells (BMCs)

0.48±0.12

B

BMCs + complement

7.05±1.56*

C

BMCs + non-sensitized serum + complement

6.80±1.73*

D

BMCs + sensitized serum + complement

40.75±3.12**

E

BMCs + sensitized serum

0.51±0.11

*: p<0.05 compared with group A, **: p< 0.001 compared with group C.

Table 2. Hematopoietic recovery of recipients post transplantation (n=5).

Group

White blood cells (x109/L)

Hemoglobin (g/L)

Platelets (x109/L)

Day +7

Day +14

Day +7

Day +14

Day +7

Day +14

Sensitized serum

0.65±0.07*

0.32±0.15**

143.60±5.73*

87.00±9.97**

71.60±8.38*

40.80±6.05**

Non-sensitized serum

0.94±0.09

3.24±0.30

147.00±7.97

172.40±7.09

90.80±9.36

848.40±19.55

: p<0.05, **: p<0.001 compared with the non-sensitized serum group at the same time point.

*

269

Turk J Hematol 2014;31:266-271

Xu HL, et al: Critical Role of Sensitized Serum in Rejection of Allogeneic Bone Marrow Cells

Table 3. Bone marrow cells recovery and chimeras analysis in recipients post transplantation (n=5).

Group

BMCs (x106 per femur)

% H-2Db+ cells

Day +7

Day +14

Day +7

Day +14

Sensitized serum

0.63±0.08*

0.26±0.02*

10.71±3.18*

4.32±1.27*

Non-sensitized serum

3.96±0.27

5.96±0.32

50.07±4.70

86.82±7.09

: p<0.001 compared with non-sensitized serum group at the same time point.

*

Group A was negative, indicating that the reaction depended on complement. In the binding experiment, our results suggested that the donor-reactive antibodies in sensitized serum were binding 95% of BMCs with 1:10 dilution. BMCs incubated with sensitized serum could not rescue mice from lethal irradiation. The engraftment assay demonstrated that allogeneic BMCs incubated with sensitized serum were rejected along with time in recipients. Furthermore, 80% (8/10) of the mice died of marrow graft rejection by transfer of sensitized serum prior to transplantation, indicating that sensitization could be transferred by donorreactive antibodies in serum. All of the results indicated that sensitized serum played a critical role in graft rejection during hematopoietic stem cell transplantation.

The mechanism of donor graft rejection by sensitized serum remains unclear. It has been suggested that donorreactive antibodies in sensitized serum may induce primary endothelium injury through complement-dependent pathway and complement-independent pathway antibodydependent cell cytotoxicity in solid organ transplantation.

Endothelium injury results in progressive tissue injury and final graft function loss [16,17,18]. Otherwise, the hematopoietic stem cells present in circulation are prone to being impaired by donor-reactive antibodies. Several studies have found that humoral immunity plays a critical role in the rejection of allogeneic marrow in sensitized recipients.

Preformed antibody is the initial and major barrier to bone marrow engraftment in allosensitized recipients. The rejection might be dependent upon host FcR+ cells [19,20].

Moreover, alloreactive memory T cells are also considered to contribute to rejection of donor BMCs in sensitized recipients [21]. Recently, donor-reactive antibodies in sensitized serum were found to be associated with graft failure in patients with hematopoietic stem cell transplantation [22]. Our previous data showed that high levels of donor-reactive antibodies were found in serum of patients with beta-thalassemia major.

In addition, the sensitized serum had an inhibitory effect on proliferation and differentiation of hematopoietic stem cells in vitro [23].

It is urged to develop new strategies to prevent and reduce the risk of graft rejection mediated by humoral immunity. The managements include inhibition and depletion of antibody-producing cells, removal or blockage of preexisting or newly developed antibodies, and 270

impediment or postponement of antibody-mediated primary and secondary tissue injury [16,24,25]. We suggest that leukocyte-depleted blood components be used for patients requiring long-term blood transfusions. Donor-reactive antibodies should be routinely monitored for sensitized patients in allogeneic transplantation. Intervention therapies such as removal or blockade of serum antibodies may be considered before transplantation [26]. In clinical settings, 4 sensitized patients were reported to be treated with a combination of rituximab and plasma exchange. This intervention decreased the antibody levels substantially in 2 patients, who both achieved marrow engraftment [27].

Further investigations are required to develop new strategies for sensitized transplantation.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Acknowledgments: This work was supported by the National Natural Science Foundation of China (81100370).

References 1. Cai J, Terasaki PI. Induction immunosuppression improves long-term graft and patient outcome in organ transplantation: an analysis of United Network for Organ Sharing registry data. Transplantation 2010;90:1511-1515.

2. O’Leary JG, Kaneku H, Susskind BM, Jennings LW, Neri MA, Davis GL, Klintmalm GB, Terasaki PI. High mean fluorescence intensity donor-specific anti-HLA antibodies associated with chronic rejection postliver transplant. Am J Transplant 2011;11:1868-1876.

3. Naemi FM, Ali S, Kirby JA. Antibody-mediated allograft rejection: the emerging role of endothelial cell signalling and transcription factors. Transpl Immunol 2011;25:96103.

4. Lo SC, Chang JS, Lin SW, Lin DT. Platelet alloimmunization after long-term red cell transfusion in transfusion-dependent thalassemia patients. Transfusion 2005;45:761-765.

5. Friedman DF, Lukas MB, Jawad A, Larson PJ, OheneFrempong K, Manno CS. Alloimmunization to platelets in heavily transfused patients with sickle cell disease. Blood 1996;88:3216-3222.

Xu HL, et al: Critical Role of Sensitized Serum in Rejection of Allogeneic Bone Marrow Cells

Turk J Hematol 2014;31:266-271

6. Laundy GJ, Bradley BA, Rees BM, Younie M, Hows JM. Incidence and specificity of HLA antibodies in multitransfused patients with acquired aplastic anemia.

Transfusion 2004;44:814-825.

17. Gebel HM, Moussa O, Eckels DD, Bray RA. Donor-reactive HLA antibodies in renal allograft recipients: considerations, complications, and conundrums. Hum Immunol 2009;70:610-617.

7. Lucarelli G, Gaziev J. Advances in the allogeneic transplantation for thalassemia. Blood Rev 2008;22:53-63.

18. Jackson AM, Connolly JE, Matsumoto S, Noguchi H, Onaca N, Levy MF, Naziruddin B. Evidence for induced expression of HLA class II on human islets: possible mechanism for HLA sensitization in transplant recipients. Transplantation 2009;87:500-506.

8. Fang J, Huang S, Chen C, Zhou D, Li CK, Li Y, Huang K. Umbilical cord blood transplantation in Chinese children with beta-thalassemia. J Pediatr Hematol Oncol 2004;26:185-189.

9. Petranyi GG, Reti M, Harsรกnyi V, Szabo J. Immunologic consequences of blood transfusion and their clinical manifestations. Int Arch Allergy Immunol 1997;114:303315.

10. Eikmans M, Waanders MM, Roelen DL, van Miert PP, Anholts JD, de Fijter HW, Brand A, Claas FH. Differential effect of pretransplant blood transfusions on immune effector and regulatory compartments in HLA-sensitized and nonsensitized recipients. Transplantation 2010;90:11921199.

11. Semple JW, Speck ER, Milev YP, Blanchette V, Freedman J. Indirect allorecognition of platelets by T helper cells during platelet transfusions correlates with anti-major histocompatibility complex antibody and cytotoxic T lymphocyte formation. Blood 1995;86:805-812.

12. Xu LH, Fang JP, Xu HG, Weng WJ. Homing and engraftment of bone marrow cells derived from different donors in a murine model of sensitization. Hematology 2012;17:215219.

13. Bernard O, Scheid MP, Ripoche MA, Bennett D. Immunological studies of mouse decidual cells. I. Membrane markers of decidual cells in the days after implantation. J Exp Med 1978;148:580-591.

14. Ribble D, Goldstein NB, Norris DA, Shellman YG. A simple technique for quantifying apoptosis in 96-well plates. BMC Biotechnol 2005;5:12.

15. Kushida T, Inaba M, Hisha H, Ichioka N, Esumi T, Ogawa R, Iida H, Ikehara S. Intra-bone marrow injection of allogeneic bone marrow cells: a powerful new strategy for treatment of intractable autoimmune diseases in MRL/lpr mice. Blood 2001;97:3292-3299.

16. Cai J, Terasaki PI. Humoral theory of transplantation: mechanism, prevention, and treatment. Hum Immunol 2005;66:334-342.

19. Xu H, Chilton PM, Tanner MK, Huang Y, Schanie CL, Dy-Liacco M, Yan J, Ildstad ST. Humoral immunity is the dominant barrier for allogeneic bone marrow engraftment in sensitized recipients. Blood 2006;108:3611-3619.

20.

Taylor PA, Ehrhardt MJ, Roforth MM, Swedin JM, Panoskaltsis-Mortari A, Serody JS, Blazar BR. Preformed antibody, not primed T cells, is the initial and major barrier to bone marrow engraftment in allosensitized recipients.

Blood 2007;109:1307-1315.

21. Nagata S, Okano S, Yonemitsu Y, Nakagawa K, Tomita Y, Yoshikai Y, Shimada M, Maehara Y, Sueishi K. Critical roles of memory T cells and antidonor immunoglobulin in rejection of allogeneic bone marrow cells in sensitized recipient mice. Transplantation 2006;82:689-698.

22. Spellman S, Bray R, Rosen-Bronson S, Haagenson M, Klein J, Flesch S, Vierra-Green C, Anasetti C. The detection of donor-directed, HLA-specific alloantibodies in recipients of unrelated hematopoietic cell transplantation is predictive of graft failure. Blood 2010;115:2704-2708.

23. Fang JP, Xu LH, Yang XG, Wu YF, Weng WJ, Xu HG. Panel reactive antibody in thalassemic serum inhibits proliferation and differentiation of cord blood CD34+ cells in vitro.

Pediatr Hematol Oncol 2009;26:338-344.

24. Amante AJ, Ejercito R. Management of highly sensitized patients: capitol medical center experience. Transplant Proc 2008;40:2274-2280.

25. Marfo K, Lu A, Ling M, Akalin E. Desensitization protocols and their outcome. Clin J Am Soc Nephrol 2011;6:922-936.

26. Fang JP, Xu LH. Hematopoietic stem cell transplantation for children with thalassemia major in China. Pediatr Blood Cancer 2010;55:1062-1065.

27. Ciurea SO, de Lima M, Cano P, Korbling M, Giralt S, Shpall EJ, Wang X, Thall PF, Champlin RE, Fernandez-Vina M. High risk of graft failure in patients with anti-HLA antibodies undergoing haploidentical stem-cell transplantation.

Transplantation 2009;88:1019-1024.

271

Research Article

DOI: 10.4274/tjh.2012.0081

Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population: A Preliminary Study Beta Talasemili Hasta ve Sağlam Türk Çocuklarında C282Y HFE Gen Mutasyonunun Araştırılması: Ön Çalışma Selma Ünal1, Günay Balta2, Fatma Gümrük2 1Mersin

University Faculty of Medicine, Department of Pediatric Hematology, Mersin, Turkey University Faculty of Medicine, Department of Pediatric Hematology, Ankara, Turkey

2Hacettepe

Abstract: Objective: This study was planned in order to determine the effect of C282Y mutation in development of secondary hemochromatosis in beta-thalassemia patients and to determine the prevalence and allele frequency of this mutation in a healthy control group.

Materials and Methods: Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years) with beta-thalassemia major (BTM) and 13 beta-thalassemia intermedia (BTI) patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13-26 years) were included in the study. The control group comprised 100 healthy blood donors.

Results: Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM or BTI, or in control group.

Conclusion: The C282Y mutation, which is supposed to be responsible for the majority of hereditary hemochromatosis, was not found to have a role in the development of hemochromatosis in beta-thalassemia patients and was not detected in a healthy Turkish population. However, research on larger cohorts of individuals is required in order to determine the exact prevalence of the HFE gene mutation in Turkish populations from diverse ethnic origins and whether it would have an impact on iron loading in thalassemic populations.

Key Words: Beta-thalassemia, C282Y mutation, Hemochromatosis Özet: Amaç: Herediter hemokromatozisin büyük bir kısmından sorumlu tutulan C282Y mutasyonunun beta talasemili hastalarda

gelişen sekonder hemokromatozisdeki arttırıcı rolünü belirlemek ve bu mutasyonun, sağlıklı kontrol grubunda prevalansını ve allel sıklığını göstermek.

Address for Correspondence: Selma ÜNAL, M.D., Mersin University Faculty of Medicine, Department of Pediatric Hematology, Mersin, Turkey Phone: +90 324 337 43 00 E-mail: unalselma@hotmail.com Received/Geliş tarihi : July 2, 2012 Accepted/Kabul tarihi : September 17, 2012

272

Turk J Hematol 2014;31:272-275

Ünal S, et al: Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population

Gereç ve Yöntemler: Kırk biri kız, 46’si erkek (ortanca yaş: 15,6±6,1, yaş aralığı: 3-30 yaş) toplam 87 Beta talasemi major

ve 13 Beta talasemi intermedialı hasta (6 erkek, 7 kız, ortanca yaş: 19,6±3,5, yaş aralığı: 13-26) çalışmanın hasta grubunu oluşturdu. Kontrol grubu olarak 100 sağlıklı birey çalışmaya dahil edildi.

Bulgular: Ne Beta talasemili hasta ne de sağlıklı bireyde homozigot yada heterezigot C282Y mutasyonu tespit edilemedi.

Sonuç: Herediter hemokromatozis gelişiminde önemli bir faktör olarak düşünülen C282Y mutasyonu, sağlıklı Türk

popülasyonu ve Beta talasemili hastalarda hemokromatozis gelişimi için arttırıcı bir faktör olarak bulunamamıştır. Bu konuda daha geniş katılımlı çalışmaların yapılmasına gerek olup, demir metabolizmasından sorumlu olan diğer düzenleyici protein gen mutasyonlarının da sekonder hemokromatozisi olan beta talasemili hastalarda araştırılması gerektiği düşünülmektedir.

Anahtar Sözcükler: Beta-talasemi, C282Y mutasyonu, Hemokromatozis Introduction Hereditary hemochromatosis (HH) is a disease of iron regulation that results in excessive iron absorption and ultimately in iron overload and multiple organ failure, such as cirrhosis of the liver, diabetes mellitus, arthropathy, and cardiomyopathy [1,2]. In northern Europe, HH affects approximately 1 in 200-300 persons [3]. This autosomal recessive condition stems from at least 2 genetic mutations in the HFE gene (also known as the HLA-H gene), a candidate gene localized to chromosome 6p22.1. A G-to-A transition at nucleotide 845 (845 A-G) results in a Cys-toTyr substitution at codon 282 (C282Y), whereas a C-to-G change at position 187 causes a His-to-Asp mutation at codon 63 (H63D) [4,5]. There is a clear association between C282Y and HH. Over 90% of HH patients from the UK are homozygous for this mutation [6]. However, in Italy and France, 70% of HH cases are homozygous for C282Y [7,8].

Beta-thalassemia is a serious genetic disorder that increases iron absorption, and regular blood transfusion causes iron accumulation and secondary hemochromatosis. Excess iron is extremely toxic to all cells of the body and can cause serious and irreversible organic damage, such as cirrhosis, diabetes, heart disease, and hypogonadism [9]. While the causes of iron accumulation in beta-thalassemia patients are clear, the fact that this accumulation occurs in higher amounts in some patients suggests a possible association between HH and beta-thalassemia. This study was planned in order to determine the effect of the C282Y mutation, which is supposed to be responsible for the majority of HH, in the development of secondary hemochromatosis in betathalassemia patients, and to determine the prevalence and allele frequency of this mutation in a healthy control group.

Materials and Methods Eighty-seven children and young adults (46 males and 41 females; mean age: 15.6±6.1 years, range: 3-30 years) with beta-thalassemia major (BTM) and 13 beta-thalassemia intermedia (BTI) patients (6 males and 7 females; mean age: 19.6±3.5 years, range: 13–26 years) who were followed in the Pediatric Hematology Unit of Hacettepe University, Ankara, Turkey, were included in the study. One hundred healthy blood donors who were consecutively selected from

the same geographic area of Turkey without personal or family history of hemochromatosis constituted the control group. This study was approved by the Hacettepe University Ethics Board and informed consent was obtained from all subjects included in the study.

A full physical examination was performed and a detailed medical history was taken for every patient. The diagnosis of thalassemia was made based on the clinical presentation, hematological indices including hemoglobin electrophoresis, and mutation analysis. Hemochromatosis was evaluated based on serum ferritin, alanine aminotransferase (ALT), and aspartate aminotransferase (AST) levels in all the betathalassemia patients by standard methods.

Analysis of HFE Gene C282Y Mutation Genomic DNA was isolated from 10 mL of peripheral blood by the standard manual methods of phenolchloroform extraction. PCR amplification of the DNA region encompassing the C282Y mutation site was performed by using the primer pair reported before (F5’CAAGTGCCTCCTTTGGTGAAGGTGACACAT3’; R5’CTCAGGCACTCCTCTCAACC3’) at the stepwise annealing temperatures of 60 °C (5 cycles) and 64 °C (30 cycles) [3]. Rsa I digestion of 343-bp PCR products was expected to yield 203- and 140-bp DNA fragments for normal alleles and 203-, 111-, and 29-bp DNA fragments for mutant alleles.

Results The mean ALT, AST, and ferritin levels were 46.3 IU (range: 9-150), 43 IU (range: 17-154), and 3166 µg/L (range: 890-16,000) in the patients with BTM and 38 IU (range: 1185), 41 IU (range: 14-87), and 718 µg/L (range: 163-1689) in the patients with BTI, respectively. According to the betaglobin gene mutation analysis, IVS-I-110/IVS-I-110 was the most common mutation in BTM patients (27%). Neither heterozygous nor homozygous HFE gene C282Y mutation was detected in patients with BTM and BTI or in the control group.

Discussion In Mediterranean countries, the most common cause of iron overload is BTM. Iron accumulation in 273

Turk J Hematol 2014;31:272-275

Ünal S, et al: Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population

thalassemic patients depends both on increased intestinal iron absorption, which is proportional to the degree of erythroid hyperplasia, and on blood transfusions. Progress in iron-chelating therapy over the last 20 years has dramatically changed the prognosis of these patients, as iron overload may be maintained at low levels in regularly transfused thalassemic subjects by applying lifelong regular chelation [10,11]. While the causes of iron accumulation in beta-thalassemia patients are obvious, the fact that this accumulation occurs in higher amounts in some patients suggests a possible relation between the gene mutations that cause beta-thalassemia and HH. HH is an autosomal recessive disease characterized by abnormal accumulation of iron in parenchymal organs and organ failures [1]. It has been shown that 2 mutations, which were identified after isolation of the HFE gene, are responsible for the majority of the cases. Among these mutations, the homozygous C282Y mutation is present in the etiology of a major proportion of HH patients [4]. The effect of the HFE gene C282Y mutation of hemochromatosis in the occurrence of non-transfusional iron overload in patients with beta-thalassemia has been controversial.

In previous reports from different countries, the association between beta-thalassemia and the HFE gene mutation has been investigated. In India, thalassemia is the most common cause of iron overload while HH is very rare.

Severe iron overload was reported in a 61-year-old Indian patient with BTI, heterozygous for C282Y [12]. This finding allowed speculation that defective HFE might behave as a modifying gene involved in the severity of iron loading in beta-thalassemia. Piperno et al. suggested that the betathalassemia trait aggravates the clinical picture of C282Y homozygotes, favoring higher rates of iron accumulation and the development of severe iron-related complications [13].

In a study by Jazayeri et al., heterozygote C282Y mutation was found in 3.2% of patients with the beta-thalassemia trait. However, the mean ferritin level in patients with HFE mutations showed no significant difference from that of patients without mutations [14].

Longo et al. detected that the allele frequency of C282Y mutation was 1.4% in Italian thalassemics and they suggested that the presence of a single mutation in the HFE gene did not influence the severity of iron loading in thalassemia patients [15].

We did not detect the C282Y mutation in the Turkish beta-thalassemia patients or the controls. Similarly, the C282Y mutation was not detected in healthy blood donors in 2 previous studies from Turkey [16,17]. In contrast, a homozygous C282Y mutation was detected by Yönal et al. in a Turkish family [18].

In conclusion, this study did not support the role of C282Y mutation in the development of secondary hemochromatosis in a group of beta-thalassemia patients.

274

However, further research on larger cohorts of individuals is required in order to determine the exact prevalence of HFE gene mutation in Turkish populations from diverse ethnic origins and whether or not this would have an impact on iron loading in thalassemic populations.

The role of genetic factors other than the C282Y mutation contributing to hemochromatosis should also be studied in the thalassemic population with severe iron overload despite good compliance to chelating regimens in Turkey.

Acknowledgment The authors would like to thank Prof. Dr. Aytemiz Gürgey for her invaluable comments and advice.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Ajioka RS, Kushner JP. Hereditary haemochromatosis. Semin Hematol 2002;39:235-241.

2. Camaschella C, De Gobbi M, Roetto A. Hereditary hemochromatosis progress and perspectives. Rev Clin Exp Hematol 2000;44:302-320.

3. Merryweather-Clarke AT, Pointon JJ, Shearman JD, Robson KJ. Global prevalence of putative haemochromatosis mutations. J Med Genet 1997;34:275-278.

4. Bomford A. Genetics of haemochromatosis. Lancet 2002;360:1673-1681.

5. Ruiz-Argüelles GJ, Garcés-Eisele J, Gelbart T, MonroyBarreto M, Reyes-Núñez V, Juárez-Morales JL, de Lourdes González-Garrido M, Ramírez-Cisneros FJ, GallegosAntúnez D. Analysis of HFE-codon 63 /282 (H63D/C282Y) gene variants in Mexican mestizos: blood donors and patients with hereditary hemochromatosis. Arch Med Res 2000;30:422-424.

6. Worwood M, Sherman JD, Wallace DF. A simple genetic test identifies 90% of UK patients with hereditary haemochromatosis.

The UK Haemochromatosis Consortium. Gut 1997;41:841-844.

7. Carella M, D’Ambrosio L, Totaro A, Gifa A. Mutation analysis of the HLA-H gene in Italian hemochromatosis patients. Am J Hum Genet 1997;60:828-832.

8. Martıinez PA, Guillard A, Blanc F et al. Diagnosis of hemochromatosis gene mutations. Blood 1997;90:7.

9. Olivieri NF. The beta-thalassemias. N Engl J Med 1999;341:99-109.

10. Oliveri NF, Brittenham GM. Iron chelating therapy and the treatment of thalassemia. Blood 1997;89:739-761.

11. Porter JB. Practical management of iron overload. Br J Haematol 2001;115:239-252.

Ünal S, et al: Survey of HFE Gene C282Y Mutation in Turkish Beta-Thalassemia Patients and Healthy Population

12. Agarwal S, Tewari D, Arya V, Moorchung N, Tripathi R, Chaudhuri G, Pradhan M. Status of HFE mutation in thalassemia syndromes in north India. Ann Hematol 2007;86:483-485.

13. Piperno A, Mariani R, Arosio C, Vergani A, Bosio S, Fargion S, Sampietro M, Girelli D, Fraquelli M, Conte D, Fiorelli G, Camaschella C. Haemochromatosis in patients with β-thalassaemia trait. Br J Haematol 2000;111:908-914.

14. Jazayeri M, Bakayev V, Adibi P, Haghighi Rad F, Zakeri H, Kalantar E, Zali MR. Frequency of HFE gene mutations in Iranian beta-thalassaemia minor patients. Eur J Haematol 2003;71:408-411.

15. Longo F, Zecchina G, Sbaiz L, Fischer R, Piga A, Camaschella C. The influence of hemochromatosis mutations on iron overload of thalassemia major. Haematologica 1999;84:799803.

Turk J Hematol 2014;31:272-275

16. Barut G, Balci H, Bozdayi M, Hatemi I, Ozcelik D, Senturk H. Screening for iron overload in the Turkish population.

Dig Dis 2003;21:279-285.

17. Simsek H, Sumer H, Yilmaz E, Balaban YH, Ozcebe O, Hascelik G, Buyukask Y, Tatar G. Frequency of HFE mutations among Turkish blood donors according to transferrin saturation: genotype screening for hereditary hemochromatosis among voluntary blood donors in Turkey.

J Clin Gastroenterol 2004;38:671-675.

18. Yönal O, Hatirnaz O, Akyüz F, Köroğlu G, Ozbek U, Cefle K, Mungan Z. Definition of C282Y mutation in a hereditary hemochromatosis family from Turkey. Turk J Gastroenterol 2007;18:53-57.

275

Research Article

DOI: 10.4274/Tjh.2013.0244

Factors Associated with Cytomegalovirus Reactivation Following Allogeneic Hematopoietic Stem Cell Transplantation: Human Leukocyte Antigens Might Be Among the Risk Factors Allojeneik Kök Hücre Nakli Sonrası Sitomegalovirus Reaktivasyonu ile İlişkili Faktörler: İnsan Lökosit Antijenleri Risk Faktörleri Arasında Olabilir Kadir Acar1, Şahika Zeynep Akı1, Zübeyde Nur Özkurt1, Gülendam Bozdayı2, Seyyal Rota2, Gülsan Türköz Sucak1 1Gazi 2Gazi

University Faculty of Medicine, Department of Hematology, Ankara, Turkey University Faculty of Medicine, Department of Microbiology, Ankara, Turkey

Abstract: Objective: Cytomegalovirus (CMV) is a significant cause of morbidity and mortality in allogeneic hematopoietic stem cell

transplantation (AHSCT) recipients. Current practice includes prophylactic and preemptive treatment modalities, which have risks, side effects, and costs of their own. There is no established risk scoring system that applies to all patients. We aimed to investigate the risk factors for CMV reactivation in AHSCT recipients.

Materials and Methods: We retrospectively analyzed the risk factors for CMV reactivation in 185 consequent AHSCT recipients transplanted between September 2003 and December 2009 at the Stem Cell Transplantation Unit of Gazi University.

Besides the standard transplant-related parameters, HLA antigens were also included among the variables analyzed.

Results: Despite the very high rate of donor (94.6%) and recipient (100%) seropositivity, which are the so-called major risk factors in previous reports, our reactivation rate was much lower, with a frequency of 24.9%. The underlying disease, sex, conditioning regimen, and presence of antithymocyte globulin or fludarabine in the conditioning regimen had no impact on reactivation rate. CMV reactivation was significantly more frequent in recipients with graft-versus-host disease (GVHD) compared to those without GVHD (p<0.0001). CMV reactivation was significantly more frequent (p<0.05) in patients with HLA-B14, HLADRB1*01, and HLA-DRB1*13 antigens and less frequent in recipients with HLA-A11 and HLA-DRB1*04 antigens (p<0.05).

Conclusion: Universal risk factors/scores that apply to all transplant recipients are required for tailored prophylaxis and/ or treatment strategies for CMV reactivation. Uncovering the role of genetic factors, including HLA antigens, as possible risk factors might lead the way to risk-adaptive strategies for adoptive cellular therapy and/or vaccination.

Key Words: Cytomegalovirus reactivation, Human leukocyte antigens, Allogeneic stem cell transplantation, Graft-versus-host disease, Prognosis, CMV scoring index Address for Correspondence: Gülsan TÜRKÖZ SUCAK, M.D., Gazi University Faculty of Medicine, Department of Hematology, Ankara, Turkey E-mail: aysucak@gazi.edu.tr Phone: +90 312 202 6317 Received/Geliş tarihi : July 12, 2013 Accepted/Kabul tarihi : February 18, 2014

276

Turk J Hematol 2014;31:276-285

Acar K, et al: Is It Time for Tailored Approaches to CMV Reactivation?

Özet: Amaç: Allojeneik kök hücre nakli (AKHN) alıcılarında sitomegalovirus (CMV) önemli mortalite ve morbidite nedenidir.

Mevcut uygulama profilaksi ve önleyici tedavi yöntemleridir ki, bunun da riskleri, yan etkileri ve maliyeti vardır. Öte yandan tüm hastalar için geçerli bir yerleşik risk puanlama sistemi yoktur. Bu çalışmada, AKHN yapılan hastalarda CMV reaktivasyonu için risk faktörlerini araştırmayı amaçladık.

Gereç ve Yöntemler: Gazi Üniversitesi Kök Hücre Nakil Ünitesi’nde Eylül 2003 ve Aralık 2009 tarihleri ararsında AKHN yapılan 185 hastanın CMV reaktivasyonu sonuçları geriye dönük olarak incelendi. Nakille ilişkili standart parametrelerin yanı sıra HLA antijenleri arasındaki değişkenler de incelendi.

Bulgular: Major risk faktörü olarak adlandırılan alıcı (%100) ve vericilerdeki (%94,6) yüksek seropozitiflik oranlarına karsın bizim çalışmamızda reaktivasyon oranı %24,9 idi. Altta yatan hastalık, yaş, cinsiyet, hazırlama rejimi, hazırlama rejiminde anti timosit globulin (ATG) veya fludarabin kullanılmasının CMV reaktivasyonu üzerine etkisinin olmadığı görülmüştür.

CMV reaktivasyonu graft versus host hastalığı (GVHH) olmayanlarla kıyaslandığında GVHH olan alıcılarda daha sık olarak bulunmuştur (p<0,0001). HLA-B14, HLA-DRB1*01, ve HLADRB1* 13 antijenleri olanlarda CMV reaktivasyonu daha sık (p<0,05) iken, HLA-A11, HLADRB1* 04 antijenleri olanlarda daha düşük bulunmuştur (p<0,05).

Sonuç: Tüm kök hücre alıcılarına uygulanabilecek CMV profilaksisi ve/veya tedavisi için oluşturulmuş evrensel bir risk skorlaması gerekmektedir. HLA antijenleri de dahil olmak üzere genetik risk faktörlerinin rolünün ortaya çıkarılması hücresel tedavi ve/veya aşılama yöntemleri gibi stratejilerin belirlenmesine olanak sağlayacaktır.

Anahtar Sözcükler: Sitomegalovirüs reaktivasyonu, İnsan lökosit antijeni, Allojeneik kök hücre nakli, Graft versus host hastalığı, Prognoz, CMV skorlama indeksi

Introduction Despite the major advances in transplant techniques, reactivation of cytomegalovirus (CMV) remains a major cause of morbidity and mortality, particularly in allogeneic hematopoietic stem cell transplantation (AHSCT) recipients [1]. Defining the risk factors for reactivation will guide risk-adapted treatment strategies and avoid unconditional prophylactic pharmacologic agents that have risks and costs of their own. On the other hand, promising results with adoptive cellular therapy with CD8+ and CD4+ virusspecific T cells suggest that high-risk patients might benefit from such novel treatments [2,3,4]. Seropositivity of the recipient, reduced intensity conditioning, graft-versushost disease (GVHD) above grade 2, and treatment with corticosteroids are among the factors previously reported to be associated with increased risk of CMV reactivation [5,6].

The prognostic factors and risk scoring systems defined so far do not apply to all AHSCT recipients. CMV reactivation occurs in up to 70% of seropositive recipients after AHSCT in the absence of antiviral prophylaxis [5,7,8,9]. Seropositivity for anti-CMV IgG antibody is very high in Turkey, varying between 96.4% and 97.8% [10,11]. Despite the very high rate of CMV seropositivity, the reactivation rate in AHSCT recipients is surprisingly much lower in Turkey compared to other countries around the world [7,9,12,13]. Genetic factors, whether human leukocyte antigen (HLA) or nonHLA factors, might be responsible for the discrepancies in reactivation rates in different parts of the world. However, the genetic determinants in the host and donor that might have a potential impact on reactivation remain obscure.

Nevertheless, some HLA types have been previously

reported to be associated with higher CMV reactivation rates in stem cell and solid organ transplantation recipients [12,14,15,16]. Single nucleotide polymorphisms of the genes of the immune system have also been previously shown to influence the incidence of GVHD and some infectious complications [17,18].

We investigated the role of various prognostic variables, including the HLA antigens of the donors and recipients, in posttransplantation CMV reactivation.

Materials and Methods Patients We evaluated the CMV infection status of 185 consecutive patients who received AHSCT for various hematological malignancies and severe aplastic anemia at the Stem Cell Transplantation Unit of Gazi University Hospital between September 2003 and December 2009.

Patient characteristics are given in Table 1. HLA typing was performed or repeated for all the recipients and donors in the same laboratory. Serologic or molecular methods were used for assessment of HLA-A and HLA-B alleles, and molecular methods were used for HLA-DR alleles. Peripheral blood was the stem cell source in all transplants. Details of the conditioning regimens are shown in Table 1. Acute GVHD (aGVHD) was graded according to European Blood and Marrow Transplantation criteria [18]. Prophylaxis for GVHD consisted of cyclosporine and methotrexate in the myeloablative and cyclosporine and mycophenolate mofetil in the nonmyeloablative transplants. This study was approved by the local ethics committee of the Gazi University Medical Faculty.

277

Turk J Hematol 2014;31:276-285

Acar K, et al: Is It Time for Tailored Approaches to CMV Reactivation?

Table 1. Patient characteristics.

n Mean age Sex Male Female Diagnosis Acute myeloid leukemia Acute lymphoblastic leukemia Myelodysplastic syndrome Chronic myeloid leukemia, chronic phase Granulocytic sarcoma Chronic lymphocytic leukemia Hodgkin’s disease Non-Hodgkin’s lymphoma Multiple myeloma Severe aplastic anemia Myelofibrosis Large granular lymphocytic leukemia Thalassemia major Donor type Matched related (fully matched) Mismatched related (1 Ag mismatch) Mismatched related (2 Ag mismatch) MUD (fully matched) MUD (1 Ag mismatch) MUD (2 Ag mismatch) Preparative regimen Myeloablative Nonmyeloablative Conditioning regimens Cyclophosphamide - busulfan Fludarabine - melphalan TBI - cyclophosphamide TBI - fludarabine TBI - melphalan Cyclophosphamide - busulfan - fludarabine TBI- cyclophosphamide - thiotepa Etoposide - melphalan ATG - cyclophosphamide ATG - cyclophosphamide - fludarabine Cyclophosphamide Fludarabine Rituximab - Zevalin - fludarabine -melphalan MUD: mismatched unrelated donor, TBI: total body irradiation, ATG: antithymocyte globulin.

278

n

%

185 100 32.28 years (range: 16-64)

119 64.3 66 35.7

66 35.7 40 21.6 7 3.8 9 4.9 3 1.6 2 1.1 14 7.6 9 4.9 11 5.9 21 11.4 1 0.5 1 0.5 1 0.5

159 85.9 8 4.3 6 3.2 6 3.2 5 2.7 1 0.5 120 65

84 24 27 6 1 12 4 2 8 11 2 3 1

64.9 35.1

45.4 13.0 14.6 3.2 0.5 6.5 2.2 1.1 4.3 5.9 1.1 1.6 0.5

Acar K, et al: Is It Time for Tailored Approaches to CMV Reactivation?

Turk J Hematol 2014;31:276-285

Table 2. CMV reactivation in various risk groups.

Donor/recipient CMV status

n

%

Positive/positive

175

94.6

Negative/positive

10

5.4

46

24.9

Early reactivation

29

15.7

Late reactivation

17

9.2

29/46

63

48 (16-84)

Late CMV reactivation

17/46

37

Median time to first late CMV reactivation (days)

287 (124-1038)

CMV reactivation (number of episodes)

61

Number of recurrent CMV reactivation patients

11

23.9

CMV disease

5

10.9

IP

3

HC

1

IP+HC

1

CMV reactivation by diagnosis

Acute myeloid leukemia

20

43.5

Acute lymphoblastic leukemia

9

19.6

Severe aplastic anemia

3

6.5

Chronic myeloid leukemia, chronic phase

2

4.3

Chronic myeloid leukemia, blastic phase

1

2.2

Multiple myeloma

3

6.5

Hodgkin’s disease

3

6.5

Non-Hodgkin’s lymphoma

1/9

2.2

Myelodysplastic syndrome

2/7

4.3

Granulocytic sarcoma

0/3

0

Chronic lymphocytic leukemia

1/2

2.2

Thalassemia

0/1

0

Large granular lymphocytic leukemia

1/1

2.2

Myelofibrosis

0/1

0

91

49.1

Grade II-IV aGVHD

34

37.3

Extensive cGVHD

7

7.6

Concurrent grade II-IV aGVHD

32

35.1

Concurrent extensive cGVHD

6

6.5

Concurrent steroid therapy

38

92.6

Mortality

2

1.1

CMV reactivation (number of patients)

Early CMV reactivation Median time to first early CMV reactivation (days)

GVHD

CMV: cytomegalovirus, aGVHD: acute graft-versus-host disease, cGVHD: chronic graft-versus-disease, HC: hemorrhagic cystitis, IP: interstitial pneumonia.

279

Turk J Hematol 2014;31:276-285

Acar K, et al: Is It Time for Tailored Approaches to CMV Reactivation?

Table 3. CMV reactivation and HLA-A status of patients and donors.

The HLA antigens with less frequent CMV reactivation

HLA-A11

Absent 110 Present 28

43 3

0.02

HLA-DRB1*04

Absent 100 Present 38

40 6

0.05

HLA-B14

Absent 136 Present 2

42 4

0.04

HLA-DRB1*01

Absent 129 Present 9

38 8

0.03

HLA-DRB1*13

Absent 120 Present 18

34 12

0.05

The HLA antigens with more frequent CMV reactivation

CMV reactivation

HLA

Absent

Present p-value

whether this scoring system could be validated in our cohort [1]. According to this scoring system, the recipient’s CMV seropositivity conveyed a risk score of 4 points while donor CMV seropositivity was 1 point, presence of aGVHD was 2 points, and use of T cell-depleting agents was 1 point for antithymocyte globulin (ATG) and 2 points for alemtuzumab.

The patients were stratified into 3 risk groups: low risk (02), intermediate risk (3-5), and high risk (6-7).

Standards of Care for CMV Prophylaxis and Treatment All patients received leukocyte-filtered blood products irradiated by 3000 cGy of radiation. CMV reactivation was treated preemptively with ganciclovir, 5 mg/kg intravenously twice daily for 2 weeks, and then daily for 2 weeks until 2 consecutive negative PCR results were achieved.

Statistics and Data Analysis

Figure 1. Overall survival in patients with and without cytomegalovirus reactivation.

Definitions of CMV Reactivation and Disease CMV infection was defined as replication of CMV demonstrated in the body fluids or any tissue in the absence of clinical findings or organ involvement. CMV disease was defined as infection accompanied by clinical findings and/or the presence of organ involvement.

CMV DNA was routinely monitored once a week by quantitative PCR method (QIAGEN GmbH, Hilden, Germany). CMV reactivation was defined as 2 consecutive titers of CMV DNA above 500 copies/mL. CMV reactivations occurring in the first 100 days after AHSCT were designated as “early”, while “late” reactivations were reactivations that occurred after day +100.

As a risk scoring system, the CMV scoring index (CSI), defined recently, was also applied retrospectively to check 280

Statistical analyses were performed using SPSS 15 for Windows. Patient characteristics, disease characteristics, and the association between the HLA type and CMV reactivation were compared using chi-square and Fisher’s exact tests for categorical variables. Other categorical risk factors were analyzed by chi-square and Fisher’s exact tests.

Continuous and nonparametric variables were compared with the Mann–Whitney U test. Overall survival (OS) and progression-free survival (PFS) were estimated using the Kaplan–Maier method, with differences between patients groups with and without CMV reactivation compared by log-rank test. Logistic regression analysis was used to analyze the relevance of CMV reactivation and HLA type, steroid treatment, and aGVHD. Statistical significance was defined at p<0.05.

Results Patient Characteristics We studied 185 consecutive patients (119 males, 66 females) who received AHSCT for a variety of hematological

Acar K, et al: Is It Time for Tailored Approaches to CMV Reactivation?

malignancies and severe aplastic anemia. We retrospectively reviewed the medical records to assess the incidence of postAHSCT CMV antigenemia and disease. Other variables that might influence the frequency of posttransplantation CMV reactivation, such as HLA antigens, conditioning regimens, presence of acute and chronic GVHD, presence of steroid treatment, or engraftment time, were also retrieved from the patientsâ&#x20AC;&#x2122; charts. Patients were followed for a median of 385 days after AHSCT. The characteristics of the patients included in the study are given in Table 1.

One hundred and seventy-three patients received AHSCT from HLA-identical sibling donors and 12 patients received matched unrelated donor (MUD) stem cells. The CMV statuses of the patients and donors are shown in Table 2. All the recipients and 175 (94.6%) of the donors were CMV-seropositive. While all the Turkish sibling donors were seropositive, only 2 of the 12 MUD donors from overseas (Germany, USA) were CMV-seropositive.

Our data were reanalyzed according to a recently published risk scoring system to investigate whether this scoring system applies to our patient cohort as well [1]. One hundred and eight patients had intermediate risk (score of 3-5; 90.8%) while 17 patients had high risk (score of 6-7; 9.2%). There were no patients with a low risk score (score of 0-2). The incidence of CMV reactivation was as follows: 43 of 168 patients (25.6%) in the intermediate risk group and 3 of the 17 patients (17.6%) in the high risk group had at least 1 episode of reactivation (p>0.05).

Incidence of CMV Reactivation and Disease A total of 46 subjects (24.9%) experienced CMV reactivation at a median of 56 days (range: 16-1038 days) after AHSCT. Twenty-nine of the 185 patients (15.7%) had early CMV reactivation while 17 patients (9.2%) had late CMV reactivation. Median time to early CMV reactivation was 48 days (range: 16-84 days). Median time to late CMV reactivation was 287 days (range: 124-1038 days). Eleven of the 46 patients (24.9%) developed recurrent reactivation episodes, with a total of 61 reactivation episodes.

CMV disease developed in 5 patients with reactivation (10.9% of the reactivated cases and 2.7% of the cohort), and 2 of these recipients succumbed to CMV disease (4.3% of the reactivated cases and 1.1% of the entire cohort). The data of 46 cases with CMV reactivation are given in Table 2.

Engraftment and CMV Reactivation The engraftment days for neutrophils and platelets were similar in patients with or without CMV reactivation and recurrent CMV reactivation (p>0.05).

GVHD and Steroid Therapy Ninety-one (49.2%) of 185 patients had GVHD after transplantation. Fifty-nine (31.9%) patients had acute while 32 (17.3%) had chronic GVHD. Thirty-two of the recipients with grade II-IV aGVHD and 6 with extensive chronic

Turk J Hematol 2014;31:276-285

GVHD had active GVHD during CMV reactivation. Thirtyeight of the recipients, namely those suffering from active GVHD, were on concurrent steroid therapy. GVHD occurred at a median of 25 (range: 5-48) days after transplantation in cases with early reactivation and a median of 75 (range: 8-721) days after transplantation in cases with late CMV reactivation.

The groups with and without CMV reactivation were similar with respect to sex, diagnosis, underlying disease and its subtype and status, intensity and type of conditioning regimen, and the presence of T cell-depleting agents fludarabine and ATG in the conditioning regimen. CMV reactivation was similar in patients who were HLA-matched or mismatched by 1 or 2 antigens.

CMV reactivation rate was significantly higher in cases with GVHD compared to those without GVHD (p<0.0001).

CMV reactivation was significantly more frequent in patients with aGVHD compared to patients with chronic GVHD (p<0.04). The frequency of CMV reactivation increased with ascending intensity of GVHD. CMV reactivation was significantly more frequent (p<0.0001) in cases with grade 3 aGVHD and diffuse chronic GVHD. The timing of CMV reactivation was a median of 27 (range: 5-48) days after GVHD in cases with early CMV reactivation. CMV reactivation was found to be significantly higher (p<0.0001) in patients with steroid-requiring GVHD. In a subanalysis of patients with recurrent CMV episodes, 8 of the 41 patients (19.5%) with grade II-IV aGVHD or chronic extensive GVHD experienced repeating CMV episodes. The recurrent reactivation rate was 3 in 144 (2.0%) in patients without GVHD or with grade I aGVHD or chronic limited GVHD (p<0.001).

Influence of Donor and Recipient HLA Type on CMV Reactivation The frequency of HLA antigens of the patients and donors was analyzed with respect to CMV reactivation. The frequency of each HLA antigen was analyzed and compared in patients with and without CMV reactivation (Table 3).

CMV reactivation was significantly more frequent (p<0.05) in patients with HLA-B14, HLA-DRB1*01, and HLADRB1*13 antigens. On the other hand, CMV reactivation was significantly less frequent (p<0.05) in HSCT recipients with HLA-A11 and HLA-DRB1*04 antigens.

Interestingly, survival was significantly longer in patients with CMV reactivation. The OS of the patients with CMV reactivation with a median follow-up of 516 days was 40.7% (median: 953 days), whereas the OS was 29.5% (median: 385 days) in patients without CMV reactivation with a median follow-up of 319 days (p<0.05; Figure 1). However, a subanalysis performed by excluding the very early deaths (20 patients who died within 30 days after transplantation) demonstrated similar survival in patients with and without CMV reactivation. The OS was 40.7% in patients with CMV 281

Turk J Hematol 2014;31:276-285

Acar K, et al: Is It Time for Tailored Approaches to CMV Reactivation?

reactivation with a median follow-up of 953 days, whereas OS was 34.5% in patients without CMV reactivation with a median follow-up of 546 days (p>0.05).

The PFS of patients with CMV reactivation was 52.9% (did not reach the median value), whereas the PFS was 46.2% (median: 529 days) in patients without reactivation (p>0.05).

in different countries using the same prognostic criteria need to be examined. Non-HLA genetic factors including single nucleotide polymorphisms, microsatellites of cytokines, and innate immunity have gained popularity over the last 15 years as factors that either contribute to or mitigate AHSCT complications [27]. We think that HLA or non-HLA genetic factors might be responsible for the discrepancies.

Various risk factors, including seropositivity of the donor and the recipient, type of conditioning, T cell depletion, donor source, and GVHD, have been claimed to be associated with CMV reactivation [19,20,21]. GVHD and the seropositivity of the donor and/or recipient are the common risk factors defined in most of these studies.

Thirty-three patients in our series received fludarabine in the conditioning regimen and this agent was not found to be a risk factor for reactivation, in contrast to some previous reports [1,28]. Ganciclovir causes delayed immune reconstitution in addition to its myelotoxicity, which suggests that it might have contributed to recurrent reactivation episodes in the 25% of our reactivated patients who received these agents in their initial reactivation episodes. However, the immunosuppressive effects of ganciclovir cannot solely explain the repeating episodes as some patients do not have repeating reactivations despite receiving the same treatment.

We performed a subanalysis of patients with recurrent CMV reactivation. While 8 of the 41 patients (19.5%) with grade II-IV aGVHD experienced repeating CMV episodes, the recurrent reactivation rate was 3 in 144 (2%) in patients without aGVHD or with grade I aGVHD (p<0.01). Thus, GVHD seems to be the main predisposing risk factor for recurrent reactivation episodes.

All of the recipients and sibling donors were CMVseropositive in our series, while 17% of the unrelated donors were seropositive. The country of origin of the unrelated donors was the United States or Germany. Although CMV is endemic all over the world, its prevalence varies widely between 40% and 92.1% with respect to geographic and socioeconomic status of the pertinent country. The prevalence might vary even in different geographic parts of the same country [22,23,24,25,26]. The very high prevalence of seropositivity for CMV in donors and recipients in the present study is quite similar to previous reports on AHSCT recipients (97.2%) and the normal population (97.8%) in Turkey [12]. However, there is a major contradiction in our results with respect to previously established risk factors for CMV reactivation. Relatively low early and late reactivation rates were demonstrated in our patients despite the very high rate of seropositivity in the recipients/donors, which is also in accordance with the previous reports from Turkish transplant centers [13].

GVHD was present in 49.2% of the patients presented in this study, approximately two-thirds of them having aGVHD. Eighty-three percent of the CMV reactivations were seen in patients with GVHD, while reactivation was more common in aGVHD compared to chronic GVHD. Steroidrequiring grade II-IV GVHD was found to be a significant factor contributing to CMV reactivation as 38 of the 41 patients with grade II-IV aGVHD had CMV reactivation at some point in the follow-up period of the study. Moreover, CMV reactivation was also correlated with the severity of GVHD. Almost all the relevant literature is in consensus with respect to the role of GVHD in CMV reactivation. There is also consensus on the cause of this association, namely the cellular and humoral immunodeficiencies related to GVHD itself and the drugs, particularly steroids, used in its treatment [29,30]. The role of antiviral CMV pharmacologic prophylaxis in patients with steroid-requiring GVHD could be the subject of prospective randomized trials. However, we should mention that the majority of the reactivations were successfully managed in our patient population.

In multivariate analysis including HLA-B14, HLADRB1*01, HLA-DRB1*13, aGVHD, and steroid treatment as variables, steroids were demonstrated to have an independent impact on CMV reactivation.

Discussion CMV reactivation remains a cause of significant morbidity and mortality in AHSCT recipients. Risk factors should be identified to tailor the treatment. However, no scoring system that applies to all transplant recipients has been validated so far.

A risk scoring system, the CSI, was defined for CMV reactivation in AHSCT recipients in a recent multicenter report from Australia [1]. Their reactivation rates were 5.8%, 44.8%, and 67.7% in low, intermediate, and high risk groups, respectively. However, our data are far from verifying their results as the reactivation rate in our series was much lower. More than 90% of our patients had an intermediate CSI risk score with a 25.6% reactivation rate.

More importantly, the reactivation rate was 17.6% in our patients with high CSI risk scores. Diverse reactivation rates 282

Age, sex, conditioning regimen, and the degree of HLA matching did not have a significant impact on CMV reactivation. However, the relatively low number of HLAmismatched transplants in the present cohort should be kept in mind. Neither fludarabine nor ATG in the conditioning regimen caused an increase in the reactivation rate, contrary to some previous reports [1,28]. We think that the decreased GVHD rate and immunosuppression leading to infectious complications caused by these agents might have balanced each other.

Turk J Hematol 2014;31:276-285

Acar K, et al: Is It Time for Tailored Approaches to CMV Reactivation?

The mortality was 40% in patients with CMV disease in the presented series, which is unacceptably high, albeit much lower than in previously reported series [31]. Adoptive transfer of CMV-specific T cells for treatment, or donor and recipient vaccination strategies as a prophylactic modality in high-risk patients, might obviate the development of the disease and/or the mortality attributed to it [32,33]. This will only be possible by identifying patients at risk.

CMV reactivation was significantly more common in patients with the HLA antigens HLA-B14, HLA-DRB1*01, and HLA-DRB1*13, while it was significantly less common in patients with HLA-A11 and HLA-DRB1*04. The clinical relevance of these results is not clear. Some earlier reports have claimed that some HLA alleles, and HLA-DR15 in particular, might be associated with deficient immunity against CMV, although this was not verified later [16,34]. On the other hand, a higher incidence of HLA-DR15, HLA-A30, and HLA-B40 was found in a subgroup of AHSCT recipients with CMV reactivation in the absence of aGVHD [12].

Similar to our results, HLA-A11 was found to be associated with decreased frequency of CMV reactivation in liver transplant recipients [35]. The HLA-A11 antigen was also previously demonstrated to be associated with a robust cytotoxic T cell response against the Epsteinâ&#x20AC;&#x201C;Barr virus, another latent viral infection [36,37,38].

Another intriguing result of the present study is that the OS of the patients with CMV reactivation was longer than that of those without reactivation. Findings of a survival advantage for patients with CMV reactivation have been published before [39,40]. The antigenic stimulus of CMV during viremia might have caused the clonal expansion of CMV-specific NK and T cells, which in turn might have led to a graft-versus-tumor (GvT) effect [41]. Indeed, the PFS of the patients with reactivation was longer at 52.9% (median not reached) than the PFS of the patients without reactivation of 46.2% (median: 529 days), although without statistical significance. Levels of CMV-specific CD8+ T cells have been demonstrated to be significantly higher in patients with reactivation. However, these cells were demonstrated to be less functional, with reduced cytokine production [42]. It should also be noted that the GvT effect is an integral part of GVHD, a transplant complication where CMV is significantly more frequent. However, subanalysis with the exclusion of the very early deaths in our cohorts demonstrated similar OS in the patients with and without CMV reactivation, suggesting that the patients who died very early did not live long enough to experience a CMV reactivation.

In conclusion, Turkish allogeneic transplant recipients in our study cohort had a relatively low rate of CMV reactivation despite the very high rate of CMV seropositivity in the donors and recipients. Our results failed to validate a previously defined scoring system, which suggests that ethnic, geographic, or genetic factors might contribute to CMV reactivation rate. CMV reactivation was significantly more common in patients with acute and chronic GVHD

and the HLA antigens HLA-B14, HLA-DRB1*01, and HLADRB1*13, while it was significantly less common in patients with HLA-A11 and HLA-DRB1*04. The 40% mortality rate in the patients who developed CMV disease indicates the importance of risk-adapted prophylactic strategies. The role of genetic factors including HLA as possible risk factors warrants verification in large databases.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. George B, Kerridge IH, Gilroy N, Huang G, Hertzberg MS, Bradstock KF, Gottlieb DJ. A risk score for early cytomegalovirus reactivation after allogeneic stem cell transplantation identifies low-, intermediate-, and high-risk groups: reactivation risk is increased by graft-versus-host disease only in the intermediate-risk group. Transpl Infect Dis 2012;14:141-148.

2. Bao L, Cowan MJ, Dunham K, Horn B, McGuirk J, Gilman A, Lucas KG. Adoptive immunotherapy with CMV-specific cytotoxic T lymphocytes for stem cell transplant patients with refractory CMV infections. J Immunother 2012;35:293298.

3. Aspord C, Laurin D, Richard MJ, Vie H, Chaperot L, Plumas J. Induction of antiviral cytotoxic T cells by plasmacytoid dendritic cells for adoptive immunotherapy of posttransplant diseases. Am J Transplant 2011;11:2613-2626.

4. Mackinnon S, Thomson K, Verfuerth S, Peggs K, Lowdell M. Adoptive cellular therapy for cytomegalovirus infection following allogeneic stem cell transplantation using virusspecific T cells. Blood Cells Mol Dis 2008;40:63-67.

5. Cook M, Briggs D, Craddock C, Mahendra P, Milligan D, Fegan C, Darbyshire P, Lawson S, Boxall E, Moss P. Donor KIR genotype has a major influence on the rate of cytomegalovirus reactivation following T-cell replete stem cell transplantation. Blood 2006;107:1230-1232.

6. Ng AP, Worth L, Chen L, Seymour JF, Prince HM, Slavin M, Thursky K. Cytomegalovirus DNAemia and disease: incidence, natural history and management in settings other than allogeneic stem cell transplantation. Haematologica 2005;90:1672-1679.

7. Mickletwaite K, Hansen A, Foster A, Snape E, Antonenas V, Sartor M, Shaw P, Bradstock K, Gottlieb D. Ex vivo expansion and prophylactic infusion of CMV-pp65 peptidespecific cytotoxic T-lymphocytes following allogeneic hematopoietic stem cell transplantation. Biol Blood Marrow Transplant 2007;13:707-714.

8. Almyroudis NG, Jakubowski A, Jaffe D, Sepkowitz K, Pamer E, Oâ&#x20AC;&#x2122;Reilly RJ, Papanicolaou GA. Predictors for persistent cytomegalovirus reactivation after T-cell-depleted allogeneic hematopoietic stem cell transplantation. Transpl Infect Dis 2007;9:286-294.

283

Turk J Hematol 2014;31:276-285

9. Yanada M, Yamamoto K, Emi N, Naoe T, Suzuki R, Taji H, Iida H, Shimokawa T, Kohno A, Mizuta S, Maruyama F, Wakita A, Kitaori K, Yano K, Hamaguchi M, Hamajima N, Morishima Y, Kodera Y, Sao H, Morishita Y. Cytomegalovirus antigenemia and outcome of patients treated with pre-emptive ganciclovir: retrospective analysis of 241 consecutive patients undergoing allogeneic hematopoietic stem cell transplantation. Bone Marrow Transplant 2003;32:801-807.

10.

Tamer GS, Dündar D, Çalışkan E. Seroprevalence of Toxoplasma gondii, rubella and cytomegalovirus among pregnant women in western region of Turkey. Clin Invest Med 2009;32:E43-E47.

11. Ataman Ş, Çolak D, Günseren F, Çolak T, Şenol Y, Aktekin MR, Gültekin M. Investigation of cytomegalovirus seroepidemiology in Antalya with a population-based cross-sectional study and review of related data in Turkey.

Microbiyol Bul 2007;41:545-555.

12. Kekik C, Beşışık SK, Seyhun Y, Oguz FS, Sargın D, Çarin MN. Relationship between HLA tissue type, CMV infection, and acute graft-vs-host disease after allogeneic hematopoietic stem cell transplantation: single-center experience.

Transplant Proc 2009;41:3859-3862.

13. Hazar V, Uğur A, Colak D, Saba R, Tezcan G, Kupesiz A, Karadogan I, Gultekin M, Yesilipek A, Undar L. Cytomegalovirus antigenemia and outcomes of patients undergoing allogeneic peripheral blood stem cell transplantation: effects of long-term high-dose acyclovir prophylaxis and preemptive ganciclovir treatment. Jpn J Infect Dis 2006;59:216-221.

14. Wu X, He J, Wu D, Bao X, Qiu Q, Yuan X, Han Y, Sun A, Chen G, Xu Y. KIR and HLA-Cw genotypes of donorrecipient pairs influence the rate of CMV reactivation following non-T-cell deleted unrelated donor hematopoietic cell transplantation. Am J Hematol 2009;84:776-777.

15. Varga M, Rajczy K, Telkes G, Hídvegi M, Peter A, Remport A, Korbonits M, Fazakas J, Toronyi E, Sarvary E, Kobori L, Jaray J. HLA-DQ3 is a probable risk factor for CMV infection in high-risk kidney transplant patients. Nephrol Dial Transplant 2008;23:2673-2678.

16. Wada K, Mizuno S, Ohta H, Nishiyama Y. Immune response to neutralizing epitope on human cytomegalovirus glycoprotein B in Japanese: correlation of serologic response with HLA-type. Microbiol Immunol 1997;41:841-845.

17. Peggs KS, Mackinnon S. Augmentation of virus-specific immunity after hematopoietic stem cell transplantation by adoptive T-cell therapy. Hum Immunol 2004;65:550-557.

18. Przepiorka D, Weisdorf D, Martin P, Klingemann HG, Beatty P, Hows J, Thomas ED. Consensus conference on acute GVHD grading. Bone Marrow Transplant 1995;15:825828.

19. Boeckh M, Nichols WG. The impact of cytomegalovirus serostatus of donor and recipient before hematopoietic stem cell transplantation in the era of antiviral prophylaxis and preemptive therapy. Blood 2004;103:2003-2008.

284

Acar K, et al: Is It Time for Tailored Approaches to CMV Reactivation?

20. Marty FM, Bryar J, Browne SK, Schwarzberg T, Ho VT, Bassett IV, Koreth J, Alyea EP, Soiffer RJ, Cutler CS, Antin JH, Baden LR. Sirolimus-based graft-versus-host disease prophylaxis protects against cytomegalovirus reactivation after allogeneic hematopoietic stem cell transplantation: a cohort analysis. Blood 2007;110:490-500.

21. Takami A, Mochizuki K, Asakura H, Yamazaki H, Okumura H, Nakao S. High incidence of cytomegalovirus reactivation in adult recipients of an unrelated cord blood transplant.

Haematologica 2005;90:1290-1292.

22. Alanen A, Kahala K, Vahlberg T, Koskela P, Vainionpaa R. Seroprevalence, incidence of prenatal infections and reliability of maternal history of varicella zoster virus, cytomegalovirus, herpes simplex virus and parvovirus B19 infection in South-Western Finland. BJOG 2005;112:50-56.

23. Odland JO, Sergejeva IV, Ivaneev MD, Jensen IP, StrayPedersen B. Seropositivity of cytomegalovirus, parvovirus and rubella in pregnant women and recurrent aborters in Leningrad County, Russia. Acta Obstet Gynecol Scand 2001;80:1025-1029.

24. Wong A, Tan KH, Tee GS, Yeo GS. Seroprevalence of cytomegalovirus, toxoplasma and parvovirus in pregnancy.

Singapore Med J 2000;41:151-155.

25. Ghazi HO, Telmesani AM, Mahomed MF. TORCH agents in pregnant Saudi women. Med Princ Pract 2002;11:180-182.

26. Gratacap-Cavallier B, Morand P, Dutertre N, Bosson JL, Baccard-Longère M, Jouk PS, Cans C, Jean D, Cart-Lamy P, Vandekerckhove C, Benbassa A, Micoud M, Seigneurin JM. Cytomegalovirus infection in pregnant women.

Seroepidemiological prospective study in 1,018 women in Isere. J Gynecol Obstet Biol Reprod (Paris) 1998;27:161-166.

27. Dickinson AM. Non-HLA genetics and predicting outcome in HSCT. Int J Immunogenet 2008;35:375-380.

28. Hamadani M, Blum W, Phillips G, Elder P, Andritsos L, Hofmeister C, O’Donnell L, Klisovic R, Penza S, Garzon R, Krugh D, Lin T, Bechtel T, Benson DM, Byrd JC, Marcucci G, Devine SM. Improved nonrelapse mortality and infection rate with lower dose of antithymocyte globulin in patients undergoing reduced-intensity conditioning allogeneic transplantation for hematologic malignancies. Biol Blood Marrow Transplant 2009;15:1422-1430.

29. Cope AV, Sabin C, Burroughs A, Rolles K, Griffiths PD, Emery VC. Interrelationships among quantity of human cytomegalovirus (HCMV) DNA in blood, donor-recipient serostatus, and administration of methylprednisolone as risk factors for HCMV disease following liver transplantation. J Infect Dis 1997;176:1484-1490.

30. George B, Kerridge I, Gilroy N, Huang G, Hertzberg M, Gottlieb D, Bradstock K. Fludarabine-based reduced intensity conditioning transplants have a higher incidence of cytomegalovirus reactivation compared with myeloablative transplants. Bone Marrow Transplant 2010;45:849-855.

31. Emanuel D. Treatment of cytomegalovirus disease. Semin Hematol 1990; 27(2 Suppl 1):22-27; discussion 28-29.

Acar K, et al: Is It Time for Tailored Approaches to CMV Reactivation?

32. Sellar RS, Peggs KS. The role of virus-specific adoptive T-cell therapy in hematopoietic transplantation. Cytotherapy 2012;14:391-400.

33.

Fuji S, Kapp M, Grigoleit GU, Einsele H. Adoptive immunotherapy with virus-specific T cells. Best Pract Res Clin Haematol 2011;24:413-419.

34. Chen Y, Rocha V, Bittencourt H, Scieux C, Loiseau P, Espérou H, Devergie A, Guardiola P, Socié G, Chevret S, Charron D, Gluckman E, Ribaud P. Relationship between HLA alleles and cytomegalovirus infection after allogeneic stem cell transplant. Blood 2001:98;500-501.

35. Fan J, Meng XQ, Yang MF, Zhou L, Chen XM, Hu MJ, Fan WW, Ma WH, Li LJ. Association of cytomegalovirus infection with human leukocyte antigen genotypes in recipients after allogeneic liver transplantation. Hepatobiliary Pancreat Dis Int 2006;5:34-38.

36. Gavioli R, Kurilla MG, de Campos-Lima PO, Wallace LE, Dolcetti R, Murray RJ, Rickinson AB, Masucci MG. Multiple HLA A11-restricted cytotoxic T-lymphocyte epitopes of different immunogenicities in the Epstein-Barr virusencoded nuclear antigen 4. J Virol 1993;67:1572-1578.

37. Rickinson AB, Moss DJ. Human cytotoxic T lymphocyte responses to Epstein-Barr virus infection. Annu Rev Immunol 2007;15:405-431.

Turk J Hematol 2014;31:276-285

38. Guma M, Angulo A, Lopez-Botet M. NK cell receptors involved in the response to human cytomegalovirus infection. Curr Top Microbiol Immunol 2006;298:207-223.

39. Kim DH, Won DI, Lee NY, Sohn SK, Baek JH, Kim JG, Suh JS, Lee KB. Survival benefit of asymptomatic cytomegalovirus reactivation after HLA identical allogeneic peripheral blood stem cell transplantation. Transplantation 2006;81:101108.

40. Nann-Rütti S, Tzankov A, Cantoni N, Halter J, Heim D, Tsakiris D, Arber C, Buser A, Gratwohl A, Tichelli A, Rovo A. Large granular lymphocyte expansion after allogeneic hematopoietic stem cell transplant is associated with a cytomegalovirus reactivation and shows an indolent outcome. Biol Blood Marrow Transplant 2012;18:17651770.

41. Behrendt CE, Rosenthal J, Bolotin E, Nakamura R, Zaia J, Forman SJ. Donor and recipient CMV serostatus and outcome of pediatric allogeneic HSCT for acute leukemia in the era of CMV-preemptive therapy. Biol Blood Marrow Transplant 2009;15:54-60.

42. Özdemir E, St John LS, Gillespie G, Rowland-Jones S, Champlin RE, Molldrem JJ, Komanduri KV. Cytomegalovirus reactivation following allogeneic stem cell transplantation is associated with the presence of dysfunctional antigenspecific CD8+ T cells. Blood 2002;100:3690-3697.

285

Case Report

DOI: 10.4274/Tjh.2012.0167

Solitary Bone Plasmacytoma Progressing into Retroperitoneal Plasma Cell Myeloma with No Related End Organ or Tissue Impairment: A Case Report and Review of the Literature Hedef Organ ya da Doku Disfonksiyonuna Yol Açmadan Retroperitoneal Plazma Hücreli Miyeloma Progrese Olan Soliter Kemik Plazmasitomu: Bir Olgu Sunumu ve Literatür Derlemesi Gargi Tikku1, Monica Jain1, Asit Mridha1, Rajesh Grover2 1Delhi 2Delhi

State Cancer Institute, Department of Oncopathology, Delhi, India State Cancer Institute, Department of Radiotherapy, Delhi, India

Abstract: Solitary bone plasmacytomas and plasma cell myeloma are clonal proliferations of plasma cells. Many patients with solitary bone plasmacytomas develop plasma cell myeloma on follow-up. We present a case of a 70-year-old man who presented with fracture and a lytic lesion in the subtrochanteric region of the left femur and was assigned a diagnosis of solitary bone plasmacytoma. He received local curative radiotherapy. However, 4 months later his serum M protein and β2-microglobulin levels increased to 2.31 g/dL and 5.965 mg/L, respectively. He complained of abdominal fullness and constipation. Ultrasound and non-contrast CT imaging revealed multiple retroperitoneal masses. Colonoscopic examination was normal. Biopsy of the a retroperitoneal mass confirmed it to be a plasmacytoma. Repeat hemogram, blood urea, serum creatinine, skeletal survey, and bone marrow examination revealed no abnormalities. This is an unusual presentation of plasma cell myeloma, which manifested as multiple huge extramedullary retroperitoneal masses and arose from a solitary bone plasmacytoma, without related end organ or tissue impairment and bone marrow plasmacytosis. The patient succumbed to his disease 8 months after the appearance of the retroperitoneal masses.

This case highlights the importance of close monitoring of patients diagnosed with solitary bone plasmacytoma with increased serum M protein and serum β2-microglobulin levels, so that early therapy can be instituted to prevent conversion to plasma cell myeloma.

Key Words: Solitary bone plasmacytoma, Retroperitoneal plasma cell myeloma, Related end organ or tissue impairment, Bone marrow plasmacytosis

Özet: Soliter kemik plazmasitomları (SKP) ve plazma hücreli miyelom (PHM) plazma hücrelerinin klonal proliferatif hastalıklarıdır. SKP’si olan hastaların çoğu izlemde PHM geliştirir. Burada sol femurda subtrokanterik bölgede kırık ve litik lezyonla başvuran ve SKP tanısı alan 70 yaşındaki erkek hasta sunulmuştur. Hastaya lokal küratif radyoterapi

Address for Correspondence: Gargi TIKKU, M.D., Delhi State Cancer Institute, Department of Oncopathology, Delhi, India Phone: 9899101454 E-mail: gargi.tikku@gmail.com Received/Geliş tarihi : November 5, 2012 Accepted/Kabul tarihi : April 8, 2013

286

Tikku G, et al: SBP Progressing into Retroperitoneal PCM

Turk J Hematol 2014;31:286-289

uygulanmıştır. Ancak 4 ay sonrasında hastanın serum M proteini ve β2-mikroglobulin düzeyleri sırasıyla 2,31 g/dL ve 5,965 mg/L düzeylerine çıkmıştır. Hastanın eşlik eden karında şişkinlik ve kabızlık yakınmaları bulunmaktadır.

Kolonoskopik incelemesi normal olan hastanın retroperitoneal kitlesinden alınan biyopsi sonucunda plazmasitoma tanısı doğrulanmıştır. Tekrarlanan tam kan sayımı, kan üre, serum kreatinin, kemik taraması ve kemik iliği incelemelerinde anormallik bulunmamıştır. Çok sayıda ekstramedüller retroperitoneal kitlelerle bulgu vermesi, SKP gelişmesi, organ ya da doku hasarlanmasına neden olmaması ve kemik iliği tutulumunun bulunmaması gibi nedenlerle özellikli bir PHM olgusu sunulmuştur. Hasta retroperitoneal kitleler belirdikten 8 ay sonra kaybedilmiştir. Olgumuz, SKP tanısı alan ve yüksek serum M proteini ve β2-mikroglobulin düzeylerine sahip hastaların yakın izlenmesi gerektiğine ve PHM dönüşümü önlemek amacıyla erken tedavi başlanmasının uygun olabileceğine işaret etmektedir.

Anahtar Sözcükler: Soliter kemik plazzmasitoması, Retroperitoneal plazma hücreli myeloma, İlişkili organ ya da doku disfonksiyonu, Kemik iliği plazmasitozu

Introduction Solitary bone plasmacytomas (SBPs) and plasma cell myeloma (PCM) are clonal proliferations of plasma cells.

The majority of patients with apparent SBP go on to develop PCM and approximately 5% of all patients with PCM have an initial diagnosis of solitary plasmacytoma [1]. Here we present a case of SBP progressing to PCM with unusual features.

Case Presentation A 70-year-old male came to the hospital with fracture of the left femur. X-ray of the left femur showed a lytic lesion in the subtrochanteric region. Laboratory investigations revealed hemoglobin level of 10.2 g/dL, white blood cell count of 8200/µL, blood urea of 21 mg/dL, creatinine of 1.1 mg/dL, serum Ca2+ of 9.1 mg/dL, total protein of 7.8 g/dL, and albumin of 3.01 g/dL (A:G=0.63). Open reduction and internal fixation were done using a dynamic hip fixator, but there was no healing of the fracture even after 5 months.

A biopsy from the fracture site showed sheets of CD138positive plasma cells with kappa light chain restriction. Bone marrow was normocellular with normal hemopoietic cells and plasma cells constituted 2% of the nucleated differential count. Serum β2-microglobulin was 6.3 ng/L and M spike was 0.74 g/dL. Immunofixation electrophoresis revealed the M spike in the β-globulin region to be of IgA kappa. Bence Jones proteins were absent in the urine. No other lytic or soft tissue lesions were detected in a whole-body MRI scan.

Hence, a diagnosis of SBP was made. The patient received radiotherapy (26 cycles) to the left femur over a period of 1 month with a total dose of 5000 cGy. Four months after completion of radiotherapy, a repeat serum protein electrophoresis showed an M spike measuring 2.31 g/dL in the β-globulin region, β2-microglobulin of 5.965 mg/L, total protein of 8.6 g/dL, albumin of 3.2 g/dL, and an A:G ratio of 0.59. The patient complained of diffuse abdominal pain, swelling, and constipation. Abdominal ultrasound revealed a heterogeneous, hypervascular mass of 9.4x6.2 cm in the left suprarenal area, displacing the pancreas anteriorly, and large peripancreatic lymph nodes. Non-contrast CT imaging showed a mass (6.6x4.5 cm) near the pylorus with multiple peripancreatic lymph nodes and a left suprarenal retroperitoneal mass. Colonoscopic examination was normal.

Tru-Cut biopsy from the retroperitoneal mass revealed extramedullary plasmacytoma (Figure 1). Blood analysis showed a hemoglobin level of 10.8 g/dL, serum calcium of 8.1 mg/dL, and creatinine of 1.09 mg/dL. Urine analysis did not reveal any Bence Jones proteins. Bone marrow aspirate showed 2% plasma cells. Bone marrow biopsy showed no increase or clusters of plasma cells. A whole-body PET-CT scan showed multiple metabolically active mass lesions in the retroperitoneum and peripancreatic lymph nodes. The uptake in the lungs, liver, spleen, remainder of the lymph node group regions, and skeletal system was within normal limits. A diagnosis of PCM was made. The patient was treated with chemotherapy with subcutaneous injection of bortezomib and dexamethasone. There was a decrease in the size of the mass after chemotherapy, but the patient’s condition deteriorated and he died 2 months after initiation of chemotherapy.

Discussion and Review of the Literature Solitary plasmacytoma, a localized collection of monoclonal plasma cells without evidence of a systemic plasma cell proliferative disorder (e.g., PCM), constitutes less than 3%-5% of all plasma cell neoplasms. There are 2 types of plasmacytomas: 1) solitary plasmacytoma of the bone and 2) extraosseous (extramedullary) plasmacytoma [2,3]. SBP is more common in men (65%), the median age at diagnosis being 55 years. The most commonly affected bones in order of frequency are the vertebrae, ribs, skull, pelvis, femur, clavicle, and scapula [4]. The thoracic vertebrae are commonly involved and long bone involvement below the elbow or knee is rare [3,5].

Recommended diagnostic criteria for SBP [4] include: 1) a single area of bone destruction due to clonal plasma cells; 2) normal marrow without clonal disease; 3) normal results upon skeletal survey and MRI imaging of the spine, pelvis, proximal femora, and humeri; 4) no anemia, hypercalcemia, or renal impairment attributable to myeloma; and 5) absent or low serum or urinary level of monoclonal protein and preserved levels of uninvolved immunoglobulins.

Our case fulfilled all of the recommended diagnostic criteria for SBP. Biopsy from the left femur lesion demonstrated monoclonal CD138-positive plasma cells with kappa light chain restriction without related end organ or 287

Turk J Hematol 2014;31:286-289

Figure 1. H&E section showing retroperitoneal plasmacytoma (40x). tissue impairment (RETI) or bone marrow plasmacytosis.

Serum protein electrophoresis showed an M spike of 0.74 g/dL in the β2 region and serum immunofixation electrophoresis confirmed the M spike to be of IgA kappa. M protein in the serum or urine has been noted in 24%-72% of SBP patients in various series [4,6,7] with normal uninvolved immunoglobulin levels. In our case, initial plasma proteins were normal and Bence Jones protein was absent.

The preferred treatment for SBP is curative radiotherapy (>4000 cGy), which can give long-term disease-free survival in approximately 30% of cases [8]. Our patient also received radiotherapy to the left femur with curative intent, but failed to respond. Repeat serum protein evaluation revealed a rising M spike in the β2 region (2.31 g/dL), which indicated disease progression. The patient had abdominal fullness, constipation, and multiple retroperitoneal masses. There was reversal of the A:G ratio with increasing globulin levels. Urinary Bence Jones protein remained absent.

Histopathological examination of the retroperitoneal masses confirmed extramedullary plasmacytoma. The serum β2microglobulin level also increased from 6.3 ng/L to 5.965 mg/L, denoting Stage III PCM according to the current International Staging System [9].

SBPs are known to progress to PCM in a majority of patients [4,8,10]. Bataille et al. [11], in their study of 114 cases of solitary myeloma, revealed that 85% of the patients experienced disease progression after 10 years of diagnosis.

Among the remaining 15% of patients without progression at 10 years, the monoclonal protein always disappeared following treatment with surgery and/or radiation therapy. Additionally, Wilder et al. [12] found that patients with complete disappearance of paraprotein by 1 year were relatively stable as compared to patients with persistence of paraprotein after 1 year, indicating the absence of occult disease outside the radiotherapy port. It has been observed that increasing levels of M protein or failure to completely remove the M protein 288

Tikku G, et al: SBP Progressing into Retroperitoneal PCM

from the serum and/or urine after effective local radiotherapy in SBP is associated with progression to multiple myeloma, as was seen in our case. Thus, serial quantification of M protein allows easy assessment of the course of disease and efficacy of treatment [13].

The serum β2-microglobulin level was significant; however, no renal impairment was present in this patient throughout the course of the disease. These markedly increased levels of β2-microglobulin reflected the appearance of huge retroperitoneal masses with increasing tumor burden and conversion to PCM. Normal renal function may be related to the absence of secretion of Bence Jones proteins in the urine, which are known to cause renal tubular damage. Another cause for renal damage is hypercalcemia, which by inducing vasoconstriction followed by a decrease in glomerular filtration rate may also lead to renal damage; however, there was no hypercalcemia in our case as there were no multiple lytic bony lesions.

PCM is a bone marrow-based, multifocal plasma cell neoplasm associated with M protein in the serum and/ or urine. In most cases there is generalized bone marrow involvement. The most common sites are in the bone marrow areas of the most active hematopoiesis. Extramedullary involvement is generally a manifestation of advanced disease [2]. In our case, there was no bone marrow plasmacytosis even when the patient developed Stage III PCM. The unusual feature of disease progression in our case manifested as multiple huge extramedullary retroperitoneal masses, which have not been reported before in the literature.

Only a few cases of retroperitoneal plasmacytomas have been reported to date [14,15,16,17,18,19,20,21]. All of these were primary retroperitoneal tumors (extramedullary plasmacytomas) with no bony lesions on skeletal survey. In all of these cases, bone marrow aspiration and biopsy were normal.

About 8% of patients with PCM are initially asymptomatic [22]. The majority have between 10% and 20% bone marrow plasma cells and the median level of serum M protein is nearly 30 g/L. Normal polyclonal immunoglobulins are reduced in >90% of patients and approximately 70% have monoclonal light chains in the urine [23]. The unique features in our case were the low serum M protein (i.e. below 30 g/L), the critical value of PCM, and the absence of RETI. With conversion to PCM, the patient received chemotherapy with bortezomib and dexamethasone, which led to a decrease in the size of the mass. However, the patient succumbed to his disease 2 months after initiation of chemotherapy and 11 months after the diagnosis of SBP. Conclusions 1. Rising M protein in serum after local curative radiotherapy doses calls for a more radical treatment approach in the form of chemotherapy, even if the disease is localized to bone with no evidence of RETI.

Tikku G, et al: SBP Progressing into Retroperitoneal PCM

2. Rising β2-microglobulin levels indicate disease progression even when there is no evidence of RETI. 3. Bone marrow plasmacytosis is not necessary for the diagnosis of PCM. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1.

Bolek TW, Marcus RB, Mendenhall NP. Solitary plasmacytoma of bone and soft tissue. Int J Radiat Oncol Biol Phys 1996;36:329-333.

2. McKenna R, Kyle R, Kuehl W, Grogan T, Harris N, Coupland R. Plasma cell neoplasms. In: Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J, Vardiman JW (eds). WHO Classification of Tumors of Haematopoeitic and Lymphoid Tissues. Lyon, France, IARC, 2008.

3. International Myeloma Working Group. Criteria for the classification of monoclonal gammopathies, multiple myeloma and related disorders: a report of the International Myeloma Working Group. Br J Haematol 2003;121:749757.

4. Dimopoulos MA, Moulopoulos LA, Maniatis A, Alexanian R. Solitary plasmacytoma of bone and asymptomatic multiple myeloma. Blood 2000;96:2037-2044.

5. Delauche-Cavallier MC, Laredo JD, Wybier M, Bard M, Mazabraud A, Bail Darne JL, Kuntz D, Ryckewaert A. Solitary plasmacytoma of spine. Long-term clinical course.

Cancer 1988;61:1707-1714.

6. Dimopoulos MA, Hamilos G. Solitary bone plasmacytoma and extramedullary plasmacytoma. Curr Treat Options Oncol 2002;3:255-259.

7. Soutar R, Lucraft H, Jackson G, Reece A, Bird J, Low E, Samson D; Guidelines Working Group of the UK Myeloma Forum; British Committee for Standards in Haematology; British Society for Haematology. Guidelines on the diagnosis and management of solitary plasmacytoma of bone and solitary extramedullary plasmacytoma. Br J Haematol 2004;124:717-726.

8. Weber DM. Solitary bone and extramedullary plasmacytoma.

Hematology Am Soc Hematol Educ Program 2005:373376.

9. Greipp PR, San Miguel J, Durie BG, Crowley JJ, Barlogie B, Bladé J, Boccadoro M, Child JA, Avet-Loiseau H, Kyle RA, Lahuerta JJ, Ludwig H, Morgan G, Powles R, Shimizu K, Shustik C, Sonneveld P, Tosi P, Turesson I, Westin J. International staging system for multiple myeloma. J Clin Oncol 2005;23:3412-3420.

10. Knobel D, Zouhair A, Tsang RW, Poortmans P, Belkacémi Y, Bolla M, Oner FD, Landmann C, Castelain B, Ozsahin M; Rare Cancer Network. Prognostic factors in solitary plasmacytoma of the bone: a multicenter rare cancer network study. BMC Cancer 2006;6:118.

Turk J Hematol 2014;31:286-289

11. Bataille R, Sany J. Solitary myeloma: clinical and prognostic features of a review of 114 cases. Cancer 1981;48:845-851.

12. Wilder RB, Ha CS, Cox JD, Weber D, Delasalle K, Alexanian R. Persistence of myeloma protein for more than one year after radiotherapy is an adverse prognostic factor in solitary plasmacytoma of bone. Cancer 2001;94:1532-1537.

13. Durie BG, Harousseau JL, Miguel JS, Bladé J, Barlogie B, Anderson K, Gertz M, Dimopoulos M, Westin J, Sonneveld P, Ludwig H, Gahrton G, Beksac M, Crowley J, Belch A, Boccadaro M, Cavo M, Turesson I, Joshua D, Vesole D, Kyle R, Alexanian R, Tricot G, Attal M, Merlini G, Powles R, Richardson P, Shimizu K, Tosi P, Morgan G, Rajkumar SV; International Myeloma Working Group. International uniform response criteria for multiple myeloma. Leukemia 2006;20:1467-1473.

14.

Kobayashi H, Itoh T, Murata R, Tanabe M. Primary retroperitoneal plasmacytoma with tumor thrombus within the renal vein. J Urol 1992;147:452-454.

15. Tanaka Y, Samma S, Hayashi Y, Fujimoto K, Nagayoshi J, Yoneda T, Okajima E, Uemura H, Hirao Y, Okajima E. A case of retroperitoneal extramedullary plasmacytoma. Hinyokika Kiyo 1993;39:639-643.

16. Marks ES, Lee KM. Acute renal failure secondary to vascular occlusion by a retroperitoneal plasmacytoma. Cancer 1984;53:1228-1229.

17. Chen TC, Wu JH, Ng KF, Lien JM, Hung CF. Solitary extramedullary plasmacytoma in the retroperitoneum. Am J Hematol 1998;58:235-238.

18. Sharma LM, Biswas G, Rai SS, Nair R, Parikh PM. Retroperitoneal plasmacytoma: a case report and review of literature. Indian J Cancer 2004;41:133-134.

19. Hong W, Yu XM, Jiang MQ, Chen B, Wang XB, Yang LT, Zhang YP. Solitary extramedullary plasmacytoma in retroperitoneum: a case report and review of the literature.

World J Gastroenterol 2009;15:2425-2427.

20. Saito M, Tsuchiya N, Iinuma M, Mitsumori K, Matsuura S, Shimoda N, Ohyama CS, Sato K. A case of retroperitoneal extramedullary plasmacytoma.

Hinyokika Kiyo 2003;49:735-739.

21. Tsai YS, Cheng HL, Lin JS, Tong YC, Chang KC. Retroperitoneal plasmacytoma associated with hyperamylasemia. J Urol 1999;162:1681-1682.

22. Kyle RA, Remstein ED, Therneau TM, Dispenzieri A, Kurtin PJ, Hodnefield JM, Larson DR, Plevak MF, Jelinek DF, Fonseca R, Melton LJ 3rd, Rajkumar SV. Clinical course and prognosis of smoldering (asymptomatic) multiple myeloma.

N Engl J Med 2007;356:2582-2590.

23.

Kyle RA, Gertz MA, Witzig TE, Lust JA, Lacy MQ, Dispenzieri A, Fonseca R, Rajkumar SV, Offord JR, Larson DR, Plevak ME, Therneau TM, Greipp PR. Review of 1027 patients with newly diagnosed multiple myeloma. Mayo Clin Proc 2003;78:21-33.

289

Case Report

DOI: 10.4274/tjh.2012.0195

Blastoid Variant Mantle Cell Lymphoma with Complex Karyotype Including 11q Duplication 11q Duplikasyonu İçeren Kompleks Karyotipe Sahip Bir Blastoid Varyant Mantle Hücreli Lenfoma Özge Özer1, Selami K. Toprak2, Enver Öte1, Zerrin Yılmaz1, Feride İffet Şahin1 1Başkent University Faculty of Medicine, Department of Medical Genetics, Ankara, Turkey 2Başkent University Faculty of Medicine, Department of Hematology, Ankara, Turkey

Abstract: We describe a case of blastoid mantle cell lymphoma with a complex karyotype. The blastoid variant is a rare type of non-Hodgkin lymphoma exhibiting an aggressive clinical course. Mantle cell lymphoma is a distinct entity of mature B-cell neoplasms genetically characterized by the presence of t(11;14). In the present case, conventional analysis revealed structural abnormalities of chromosomes 2, 4, 6, 10, 13, and 19, along with 3 additional marker chromosomes.

The derivative 1 chromosome determined in the case was a result of t(1p;11q). Our interesting finding was the presence of a different translocation between 11q and chromosome 1 in addition to t(11;14). Thus, the resulting 11q duplication was believed to additionally increase the enhanced expression of cyclin D1 gene, which is responsible in the pathogenesis of the disease. Fluorescence in situ hybridization method by the t(11;14) probe revealed clonal numerical abnormalities of chromosomes 11 and 14 in some cells. The detection of multiple abnormalities explains the bad prognosis in the present case. On the basis of our findings, we can easily conclude that results of cytogenetic analyses of similar mantle cell lymphoma patients would provide clues about new responsible gene regions and disease prognosis. In conclusion, it has been suggested that the presence of multiple chromosomal aberrations in addition to the specific t(11;14) may have a negative impact on clinical course and survival rate.

Key Words: Cytogenetics, Non-Hodgkin’s lymphoma, Other lymphoproliferative diseases, Other leukemias

Özet: Kompleks karyotipe sahip bir blastoid mantle hücreli lenfoma olgusunu sunuyoruz. Blastoid alt tip, saldırgan bir klinik seyre sahip olup, ender görülen bir Hodgkin dışı lenfoma alt tipidir. Mantle hücreli lenfoma ise, özellikle t(11;14) varlığı ile diğer B hücreli neoplazmlardan ayırt edilmektedir. Sunulan olguda geleneksel kromozom analizi sonrası 1, 2, 4, 6, 10, 13 ve 19. kromozomların yapısal anormalliklerine ek olarak 3 adet marker kromozom saptanmıştır.

Hastamızda ayrıca, t(1p;11q) sonucunda oluşmuş türev 1. kromozom gözlenmiştir. Buradan hareketle, 11q bölgesinin, ilginç olarak t(11;14) haricinde 1. kromozom ile farklı bir translokasyona da katıldığını söyleyebiliriz. Bu nedenle ortaya çıkan 11q duplikasyonunun hastalığın oluşma sürecinden sorumlu tutulan siklin D1 geninin ifadelenmesini arttırdığı düşünülmektedir. Çalışma sırasında, floresan in situ melezleme yöntemi ile t(11;14) probu kullanılarak bazı hücrelerde klonal sayısal 11. ve 14. kromozom anormallikleri görüntülenmiştir. Çok sayıda kromozom bozukluğunun Address for Correspondence: Selami K. TOPRAK, M.D., Başkent University Faculty of Medicine, Department of Hematology, Ankara, Turkey E-mail: sktoprak@yahoo.com Received/Geliş tarihi : December 14, 2012 Accepted/Kabul tarihi : February 18, 2013

290

Özer Ö, et al: Blastoid Variant Mantle Cell Lymphoma with Complex Karyotype Including 11q Duplication

Turk J Hematol 2014;31:290-294

saptanmış olması olgumuzun kötü klinik gidişini açıklamaktadır. Hastamıza ilişkin bulgularımız ışığında, aynı tanıya sahip hasta grubunda yapılacak sitogenetik inceleme sonuçlarının yeni sorumlu gen bölgeleri hakkında ipuçları vereceği rahatlıkla söylenebilir. Sonuç olarak, hastamızda t(11;14) varlığına ek olarak çoklu kromozom bozukluklarının bulunmasının, klinik gidiş ve tedavi yanıtı üzerine olumsuz bir etki gösterdiği açıktır.

Anahtar Sözcükler: Sitogenetik, Hodgkin Dışı Lenfoma, Diğer lenfoproliferatif hastalıklar, Diğer lösemiler

Introduction Mantle cell lymphoma (MCL) is a mature B-cell neoplasm defined as a distinct entity in 1992 constituting 4%-6% of all non-Hodgkin lymphomas [1]. The clinical course of MCL ranges from an indolent disease to a rapidly progressive malignancy, with poor prognosis and a median overall survival of about 3-5 years as reported in earlier studies [2,3]. The disease is typically advanced at diagnosis, with a leukemic component in 20%-30% of patients [1]. MCL is responsive to a great variety of initial therapies, but relatively short-term remissions are achieved with conventional strategies or with intensive treatment approaches [4]. The genetic hallmark of disease is the translocation t(11;14) (q13;q32) leading to aberrant expression of cyclin D1, which is not typically expressed in normal lymphocytes [1]. Many cases have additional cytogenetic abnormalities and often have a complex karyotype. Leukemic presentation of MCL can cause diagnostic confusion with other CD5+ B-cell leukemias and the use of cytogenetic techniques, together with morphology and immunophenotype, is required to establish the correct diagnosis [5]. Here, we report the clinical correlation and prognostic impact of a panel of cytogenetic abnormalities detected in a case of a blastoid variant of MCL with a rare association of a complex translocation by fluorescence in situ hybridization (FISH) and conventional cytogenetic analysis.

Case Presentation Clinical Progression A 74-year-old female consulted with the Outpatient Clinic of the Gynecology and Obstetrics Department because of fatigue, abdominal pain, and B symptoms.

Abdominal and thoracic computerized tomography revealed hepatosplenomegaly; paraaortic, mesenteric, and parailiac multiple enlarged lymph nodes; a mass lesion on the midline in accordance with conglomerate lymphoid tissue at the periumblical localization; and mediastinal, hilar, and bilateral axillary and supraclavicular widespread lymphadenopathies.

Total excision biopsy was performed on the left supraclavicular lymph nodes and this biopsy material revealed diffuse infiltrations and patched nodular configurations, along with atypical irregularly shaped lymphoid cells that showed diffuse and strong immunohistochemical staining with cyclin D1 and CD20. The patient entered our close follow-up program with

the diagnosis of MCL. Bone marrow biopsy material showed infiltration by flow cytometry and pathologic examination.

The patient’s Mantle Cell Lymphoma International Prognostic Index score was 11 (high risk). During the course of diagnosis, the patient had febrile neutropenia and diffuse pleural effusion accompanying pneumonia. The patient was followed in the intensive care unit, with multiple antibiotic treatments againts pseudomonal, gram (+), fungal, and atypical agents in accordance with the febrile neutropenia protocol. At this time, an R-Hyper CVAD A-arm regimen containing cyclophosphamide, vincristine, doxorubicin, and dexamethasone alternating with a high-dose methotrexate and cytarabine + rituximab combination was started with modified doses. Active hematochezia started on the third day of chemotherapy, and in the following days, sepsis, disseminated intravascular coagulation, and multiple organ failure developed. On the sixth day of treatment, the patient died with the above-mentioned clinical picture despite all interventions.

Genetic Analyses Conventional cytogenetic analysis was performed on induced cultures set up from bone marrow aspiration samples. Chromosomes were harvested after 72 and 120 h of incubation following colcemid addition. Giemsatrypsin (GTG) banded chromosomes were analyzed and the composite karyotype was reported according to the 2009 International System for Human Cytogenetic Nomenclature as 44x47, XX, der(1) t(1p;11q), der(2) t(2q;?) der(4) t(4q;11q), del(6q), der(10) t(10q;?), t(11;14) (q13;q32), der(13) t(13q;?), der(19) t(19p;?), +3mar[cp8]/46, XX[2] [6] (Figures 1 and 2).

For FISH, metaphase spreads were hybridized with the LSI IGH/CCND1-XT DF probe (Vysis, Abbott Park, IL, USA) in order to investigate MCL-specific t(11;14) translocation.

Additionally, numerical abnormalities of chromosomes 11 and 14 were also observed.

Hybridization with the whole chromosome 11 probe (WCP 11, ID Labs, London, ON, Canada) supported our finding in the conventional karyotype, as we observed the chromosome 11 signal on chromosome 1, indicating a translocation between chromosomes 1 and 11 (Figure 3).

Discussion and Review of the Literature Although MCL accounts for only 5% to 10% of all lymphoma diagnoses, it contributes disproportionately 291

Turk J Hematol 2014;31:290-294

Özer Ö, et al: Blastoid Variant Mantle Cell Lymphoma with Complex Karyotype Including 11q Duplication

to lymphoma deaths because of its often aggressive clinical course and lack of definitive curative therapy.

MCL is a malignancy with distinct molecular genetics and pathological features. Peripheral blood involvement has been reported with variable frequency, but information on the natural history of patients presenting with leukemia is lacking [7]. For the present case, diagnosis was based on morphology, immunophenotype, presence of t(11;14), histology, and cyclin D1 expression. MCL usually consists of small to medium-sized lymphoid cells with irregular nuclear contours, somewhat dispersed chromatin, inconspicuous nucleoli, and scant cytoplasm [8]. According to the World Health Organization lymphoma classification, 4 cytologic variants of MCL can be defined, including the small cell variant, the marginal zone-like variant, the blastoid variant, and the pleomorphic variant [9]. The blastoid (approximately 20% of all MCLs) and pleomorphic variants are considered to be associated with a poorer prognosis.

Figure 1. Karyotype of the patient showing t(11;14) and other chromosomal abnormalities 300x200 mm (96x96 DPI).

Figure 2. Karyotype including t(11;14) and other chromosomal abnormalities observed in the patient 374x275 mm (96x96 DPI).

292

The patient presented with splenomegaly, abdominal and mediastinal lymphadenopathy, pleural effusion, and peripheral blood lymphoma cells. A bone marrow (BM) smear showed an increase in large, abnormal lymphoid cells with oval or round nuclei, distinct nucleoli, and basophilic cytoplasm with vacuolization. Flow cytometry analysis from peripheral blood and BM showed these cells to be positive for CD5, CD19, IgM/D, and CD20 and negative for CD10 and CD23. Additionally, an immunohistochemical pattern positive for CD5, CD19, bcl-2, CD20, CD79a, and cyclin D1 and negative for CD23 and CD30 was found in both lymph node and BM specimens. A blastoid variant of MCL was diagnosed from these results. According to the Ann Arbor staging system, the patient was accepted as stage IV and the performance status was grade 3-4 according to the Eastern Cooperative Oncology Group scale.

The CCND1/IGH gene rearrangement is the most important factor in the diagnosis of MCL. The t(11;14) determines the ectopic and deregulated expression of cyclin D1, which is not typically expressed in normal lymphoid cells. A disease’s aggressive clinical behavior is related to its genetic and molecular pathogenesis, which integrates alterations in cell cycle regulation, DNA damage response mechanisms, and activation of cell survival pathways [10].

The patient died during first-line therapy with a rapid and bad course, in accordance with the aggressive properties of primary disease with a complex karyotype, along with the contribution of her advanced age and chemotherapeutic side effects. The presence of multiple chromosome abnormalities in addition to t(11;14) is well known to be associated with blastoid variants and poor prognoses in MCL [11].

The additional chromosomal abnormality determined in the present case as a result of conventional cytogenetic analysis was reported in previous studies in different cases

Figure 3. FISH result of the patient after hybridization with WCP 11 probe. Signals were observed on der(1) t(1p;11q), der(11) t(11;14), (der)14 t(11;14) and on normal chromosome 11 on a previously GTG banded metaphase 364x270 mm (96x96 DPI).

Özer Ö, et al: Blastoid Variant Mantle Cell Lymphoma with Complex Karyotype Including 11q Duplication

[12,13]. Espinet et al., in their study including 145 MCL cases, reported a total of 550 chromosomal changes (14 numerical and 403 structural). Among these, the most common secondary abnormalities were loss of 1p, 13q, and 17p; changes in 10p; and gains in 3q [13]. Numerical abnormalities include trisomy 3, trisomy 12, monosomy 8, monosomy 9, and loss of sex chromosomes (X Y). The most common secondary abnormality was 13q deletion in the classic variant of MCL. In the present case, conventional analysis revealed structural abnormalities of chromosomes 2, 4, 6, 10, 13, and 19, along with additional 3 marker chromosomes. The derivative 1 chromosome determined in the case was as a result of t(1p;11q). Our interesting finding was the presence of a different translocation between 11q and chromosome 1 in addition to t(11;14). Thus, the resulting 11q duplication was believed to additionally increase the enhanced expression of the cyclin D1 (CCND1) gene, which is responsible in the pathogenesis of the disease.

We think that this finding increases the importance of the current case. Moreover, the interest of this case lies in the presence of these aberrant clones that are not very widely known or studied although their presence was pointed out many years ago. Tetraploid chromosome clones in blastoid MCL variants with chromosome 1 involvement were first reported by Ott et al., while recurrent losses at 1p (55%), 8p (29%), 9q (29%), 11q (55%), 13q (42%), and 17p (32%) and gains at 3q (39%), 8q (26%), 15q (23%), and 18q (23%) were recently reported in aggressive MCL presenting genomic complexity and high proliferation index [14,15].

Previous studies have reported that, in similar situations, additional findings can be determined by the FISH method in addition to conventional cytogenetics and that t(11;14) alone is not sufficient for development of a malignant phenotype [12]. Thus, the use of the FISH method in addition to conventional cytogenetic analysis for diagnosis would be beneficial for the patient in terms of clinical followup and treatment. In the present case, the FISH method by the t(11;14) probe revealed clonal numerical abnormalities of chromosomes 11 and 14 in some cells. Although the FISH method does not require metaphase spreads, determining signals on the same metaphases, especially following GTG banding, would contribute to the clarification of the disease pathogenesis. However, the success of hybridization in the FISH method performed following GTG banding is low. In the present case, we were not able to evaluate t(4q;11q) due to hybridization failure after GTG banding.

In cases with more than 2 structural abnormalities, the clinical prognosis has been reported to be unfavorable. In the present case, multiple structural abnormalities were detected concurrently. Following the analysis of the 10 metaphases examined, a complex karyotype showing clonal abnormalities was reported. The detection of multiple abnormalities explains the bad prognosis in the present case. Although the enhanced expression of the CCND1 gene alone is held responsible for the development of lymphoma, the additional influence of tumor suppressors like TP53 and

Turk J Hematol 2014;31:290-294

RB1 and oncogenes like BCL2, CD4, and MYC play a role in the development of MCL [12]. On the basis of our findings in the current case, we can easily conclude that results of cytogenetic analyses of similar MCL patients would provide clues about new responsible gene regions and disease prognosis.

We did not have the opportunity to investigate the present case at the molecular level. However, we think that in cases representing a complex karyotype, imaging with contemporary molecular methods that enable detailed investigation of all chromosomes and related gene areas with a single hybridization of patient DNA, such as array CGH, would be advantageous in clarifying the mechanisms underlying disease pathogenesis.

In conclusion, it has been suggested that the presence of multiple chromosomal aberrations in addition to the specific t(11;14) may have a negative impact on clinical course and survival rate. Written informed consent was obtained from the patient’s family.

Conflict of interest statement None of the authors of this paper has a conflict of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Perez-Galán P, Dreyling M, Wiestner A. Mantle cell lymphoma: biology, pathogenesis, and the molecular basis of treatment in the genomic era. Blood 2011;117:26-38.

2. Fisher RI, Dahlberg S, Nathwani BN, Banks PM, Miller TP, Grogan TM. A clinical analysis of two indolent lymphoma entities: mantle cell lymphoma and marginal zone lymphoma (including the mucosa-associated lymphoid tissue and monocytoid B-cell subcategories): a Southwest Oncology Group study. Blood 1995;85:1075-1082.

3. Yatabe Y, Suzuki R, Tobinai K, Matsuno Y, Ichinohasama R, Okamoto M, Yamaguchi M, Tamaru J, Uike N, Hashimoto Y, Morishima Y, Suchi T, Seto M, Nakamura S. Significance of cyclin D1 overexpression for the diagnosis of mantle cell lymphoma: a clinicopathologic comparison of cyclin D1-positive MCL and cyclin D1-negative MCL-like B-cell lymphoma. Blood 2000;95:2253-2261.

4. Ogura M. Current treatment strategy and new agents in mantle cell lymphoma. Int J Hematol 2010;92:25-32.

5. Parry-Jones N, Matutes E, Morilla R, Brito-Babapulle V, Wotherspoon A, Swansbury GJ, Catovsky D. Cytogenetic abnormalities additional to t(11;14) correlate with clinical features in leukaemic presentation of mantle cell lymphoma, and may influence prognosis: a study of 60 cases by FISH. Br J Haematol 2007;137:117-124.

6. Shaffer LG, Slovak ML, Campbell LJ. ISCN (2009): An International System for Human Cytogenetic Nomenclature.

Basel: S. Karger AG; 2009.

293

Turk J Hematol 2014;31:290-294

Özer Ö, et al: Blastoid Variant Mantle Cell Lymphoma with Complex Karyotype Including 11q Duplication

7. Matutes E, Parry-Jones N, Brito-Babapulle V, Wotherspoon A, Morilla R, Atkinson S, Elnenaei MO, Jain P, Giustolisi GM, A’Hern RP, Catovsky D. The leukemic presentation of mantle-cell lymphoma: disease features and prognostic factors in 58 patients. Leuk Lymphoma 2004;45:20072015.

8. Pileri SA, Falini B. Mantle cell lymphoma. Haematologica 2009;94:1488-1492.

9. Ghielmini M, Zucca E. How I treat mantle cell lymphoma.

Blood 2009;114:1469-1476.

10. Royo C, Salaverria I, Hartmann EM, Rosenwald A, Campo E, Bea S. The complex landscape of genetic alterations in mantle cell lymphoma. Semin Cancer Biol 2011;21:322334.

11. Seok Y, Kim J, Choi JR, Kim YR, Park SJ, Kim SJ, Song J, Lee KA. CD5-negative blastoid variant mantle cell lymphoma with complex CCND1/IGH and MYC aberrations. Ann Lab Med 2012;32:95-98.

12. Katzenberger T, Kienle D, Stilgenbauer S, Höller S, Schilling C, Mäder U, Puppe B, Petzoldt C, Sander S, Bullinger L, Stöcklein H, Kalla J, Hartmann E, Adam P, Ott MM, MüllerHermelink HK, Rosenwald A, Ott G. Delineation of distinct tumour profiles in mantle cell lymphoma by detailed cytogenetic, interphase genetic and morphological analysis.

Br J Haematol 2008;142:538-550.

294

13. Espinet B, Salaverria I, Bea S, Ruiz-Xiville N, Balagué O, Salido M, Costa D, Carreras J, Rodriguez-Vicente AE, Luís Garcia J, Hernandez-Rivas JM, Calasanz MJ, Siebert R, Ferrer A, Salar A, Carrio A, Polo N, Garcia-Marco JA, Domingo A, Gonzalez-Barca E, Romagosa V, Marugán I, Lopez-Guillermo A, Milla F, Luis Mate J, Luno E, Sanzo C, Collado R, Oliver I, Monzo S, Palacin A, Gonzalez T, Sant F, Salinas R, Ardanaz MT, Font L, Escoda L, Florensa L, Serrano S, Campo E, Sole F. Incidence and prognostic impact of secondary cytogenetic aberrations in a series of 145 patients with mantle cell lymphoma. Genes Chromosomes Cancer 2010;49:439-451.

14. Ott G, Kalla J, Ott MM, Schryen B, Katzenberger T, Müller JG, Müller-Hermelink HK. Blastoid variants of mantle cell lymphoma: frequent bcl-1 rearrangements at the major translocation cluster region and tetraploid chromosome clones. Blood 1997;89:1421-1429.

15. Halldorsdottir AM, Sander B, Göransson H, Isaksson A, Kimby E, Mansouri M, Rosenquist R, Ehrencrona H. Highresolution genomic screening in mantle cell lymphomaspecific changes correlate with genomic complexity, the proliferation signature and survival. Genes Chromosomes Cancer 2011;50:113-121.

DOI: 10.4274/tjh.2012.0166

Case Report

Extramedullary Myeloid Tumor Involving the Pancreas: A Case Report and Review of the Literature Pankreasın Ekstra-Medüller Miyeloid Tümörü: Olgu Sunumu ve Literatürün Gözden Geçirilmesi Semra Paydaş1, Hakan Özdoğu2, Meral Günaldı1, Veysel Haksöyler3, Arbil Açıkalın4, Melek Ergin4 1Çukurova University Faculty of Medicine, Department of Medical Oncology, Adana, Turkey 2Çukurova University Faculty of Medicine, Department of Medical Hematology, Adana, Turkey 3Çukurova University Faculty of Medicine, Department of Internal Medicine, Adana, Turkey 4Çukurova University Faculty of Medicine, Department of Medical Pathology, Adana, Turkey

Abstract: Extramedullary myeloid tumors (EMMTs) are the tumors of myeloid cells. These tumors may occur in all of the organs of the body, but some localizations are rare. Pancreatic involvement of EMMTs is a rare entity. Here we report a case of EMMT of the pancreas 4 years after allogeneic stem cell transplantation and we review the existing data about EMMTs involving the pancreas.

Key Words: Extramedullary myeloid tumor, Pancreas, Allogeneic stem cell transplantation Özet: Extramedüller miyeloid tümörler (EMMT) miyeloid hücrelerin neoplazileridir. Bu tümörler bütün organlarda oluşabilir fakat bazı lokalizasyonlarda EMMT saptanması nadirdir ve pankreasın EMMT ile tutulumu da nadirdir. Burada allogeneik kök hücre naklinden 4 yıl sonra gelişen pankreas EMMT’ü sunulmuş ve mevcut bilgi gözden geçirilmiştir.

Anahtar Sözcükler: Extramedüller miyeloid tümör, Pankreas, Allogeneik kök hücre nakli

Introduction Granulocytic sarcoma is the tumor of immature myeloid cells. It was first defined by Burns about 100 years ago [1].

There are many synonyms for this entity but the most recent is “extramedullary myeloid tumor” (EMMT) [2]. It may be isolated or may accompany myeloid neoplasias, including acute myeloblastic leukemia (AML), chronic myeloid

leukemia (CML), and myeloproliferative/myelodysplastic neoplasias [3]. An important and interesting point for EMMT has been its development after allogeneic stem cell transplantation [4]. The incidence of EMMT in such cases is highly variable, but an unchanged reality is the poor prognosis of malignancies accompanying EMMTs. The management is systemic chemotherapy according to the underlying malignancy in addition to local treatments

Address for Correspondence: Semra PAYDAŞ, M.D., Çukurova University Faculty of Medicine, Department of Medical Oncology, Adana, Turkey E-mail: sepay@cu.edu.tr Received/Geliş tarihi : November 04, 2012 Accepted/Kabul tarihi : March 13, 2013

295

Turk J Hematol 2014;31:295-300

Paydaş S, et al: Extramedullary Myeloid Tumor Involving the Pancreas: A Case Report and Review of the Literature

including surgery and/or radiation therapy. Nearly all tissues and organs may be involved in an EMMT. The most commonly involved organs are the skin, lymph nodes, soft tissues, bone, and periosteum; less frequently, other tissues or organs have also been reported to be involved in EMMT. However, some organ involvements are rare. Pancreatic EMMT is rare; so far, 11 cases, 2 after allogeneic stem cell transplantation, have been reported. Here we report a case of EMMT of the pancreas presenting as jaundice and mimicking pancreatic cancer, and the literature is reviewed.

Case Presentation A 37-year-old man was admitted to the hospital at December 2010 with fatigue, abdominal pain, and a 10-kg weight loss over 6 months. The pain was localized to the epigastrium and increased following food intake. Upper endoscopic examination 4 months prior to admission showed no abnormality. One month later he noted dark urine and jaundice. Abdominal ultrasonography showed a hilar mass of the pancreas. Additionally, there was intra/ extrahepatic bile duct dilatation, hydropic gallbladder, and splenomegaly. Upper abdominal MRI and MR angiography showed a mass lesion localized at the head of pancreas, invading the superior mesenteric vein and bilateral renal veins with intra/extrahepatic bile duct dilatation. In October, a cholecystectomy was performed. Frozen section biopsy taken from the pancreas revealed chronic pancreatitis.

After surgery, he was referred to our department and was hospitalized.

He had a past medical history of intermediate-risk AML 5 years prior to admission. He had received 1 course of induction treatment (cytosine arabinoside, 7 days, plus idarubicin, 3 days) and 3 courses of postinduction treatment (high-dose cytosine arabinoside), and then an allogeneic stem cell transplant from his sister 4 years prior to admission. The conditioning regimen was Bu 6.4/Flu 120/ ATG 20. Cyclosporine had been given for 11 months after transplantation with no subsequent immunosuppressive treatment. His family and social histories were unremarkable.

Informed consent was obtained.

be negative. Ascites cytology was negative for tumor cells.

Other tumor markers were CEA, 1.1; CA19-9, 9.26; AFP, 10; and CA-125, 352 IU. PET/CT showed a huge mass involving the pancreas and invading surrounding structures (Figure 1).

Upon follow-up, the most important problem of the patient was dyspeptic complaints. Upper gastrointestinal endoscopic examination was repeated and enterogastric reflux, F1 varices, portal hypertensive gastropathy, and a duodenal mass obstructing the lumen and diverticula were detected. Histopathological exam of the biopsy taken from the duodenal mass revealed myeloid sarcoma (Figure 2) with strongly positive myeloperoxidase (Figure 3). Molecular study of the origin of this tumor showed that 98% was patient-origin and 2% was donor-origin.

There was no evidence of leukemic infiltration in the bone marrow and biopsy was normocellular. Pancreatic resection and radiation therapy were deemed impossible due to the very large tumor invading vital structures. Salvage FLAGIDA (fludarabine–cytosine arabinoside–idarubicin–G-CSF) chemotherapy was given, but the patient died of neutropenic sepsis 8 months after his first gastrointestinal symptoms.

Clinical presentations, bone marrow status at the beginning, treatment approaches and responses, and the last status are presented in Table 1.

Discussion and Review of the Literature Nearly all of the organs have been reported to be involved with EMMTs. The most commonly involved organs are the skin, lymph nodes, soft tissues, bone, and periosteum. The testes, kidneys, orbit, ovaries, uterus, bladder, gingiva, and stomach are the other sites involved in EMMTs [3]. Pancreatic involvement has been reported, but it is a relatively uncommon localization for EMMTs. Eleven cases (2 after transplant) of pancreatic EMMT were

Vital signs were within normal limits upon physical examination. There was jaundice, ascites, and abdominal scars associated with surgery. The liver and spleen were palpable 2 and 3 cm below the right and left costal margins, respectively, and there was (+++) pretibial edema.

Laboratory findings were Hb of 11.1 g/dL, WBC 4x109/L, platelet count 194x109/L, blood urea nitrogen/creatinine 3.9/0.4 mg/dL, total/direct bilirubin 6.4/1.9 mg/dL, lactate dehydrogenase 546 IU, aspartate aminotransferase/alanine aminotransferase 48/87 IU, alkaline phosphatase 2348 IU, total protein/albumin 5.4/1.9 mg/dL, ferritin 1397 ng/ mL, PT-INR 1.3, and thyroid function tests within normal limits. Hepatitis antibodies for HBV and HCV were found to 296

Figure 1. PET/CT showing pancreas and surrounding tissue invasion by extramedullary myeloid tumor.

Publication year

1987

1996

1997

1999

1999

2003

2003

Authors

King et al. [5]

Moreau et al.

[6]

Marcos et al.

[7]

RavandiKashani et al.

[8]

RavandiKashani et al.

[8]

Servin-Abad et al. [9]

Breccia et al.

[10]

F

M

F

M

F

F

F

42

64

61

31

37

37

36

Abdominal pain, fatigue

Abdominal pain, jaundice, AML history (8 months ago)

Epigastric pain

Epigastric pain, jaundice

Abdominal pain, jaundice, respiratory infection, history of AML

Epigastric pain, jaundice, respiratory infection

Epigastric pain, jaundice

15% blast infiltration, AML-M2

No evidence of BM infiltration

78% blast infiltration

BM: 6% blasts

Relapsed AML, 60% blastic cells

No evidence of BM infiltration

No evidence of BM infiltration

Sex Age Clinical Bone presentation marrow (BM) status

Mass in the head and tail of pancreas enlarging toward stomach, thrombosis of splenic vein

Mass in the head of pancreas, 4x4 cm; retrocrural lymph nodes, seminal vesicles

Mass in the head of pancreas, 4x5 cm; peripancreatic nodes

Mass in the head of pancreas, 7x7 cm

Hepatosplenomegaly, mass in the head of pancreas, 4X4X2 cm

Mass in the head of pancreas, 4X4 cm

Mass in the head of pancreas and retroperitoneal lymph nodes

Pancreatic mass localization

Ara-C, idarubicin

Daunorubicin, mylotarg, Ara-C

Ara-C, idarubicin

Ara-C, idarubicin, ATRA, G-CSF

No treatment

AML-type treatment

Ara-C, daunorubicin, thioguanine

Treatment

CR

CR

CR

CR

NA

CR

CR

Allograft from compatible donor, CR 49 months later

Died after 4 months due to stroke while in remission

Relapse, died 10 months later

Well in maintenance treatment

Died 45 days later; EMMT was confirmed by autopsy

No AML at 2-year follow-up

Alive at 2 years

Response Last status

Table 1. Clinical presentation, treatment approaches, and outcome in cases of pancreatic EMMT (CR: complete response, NA: not assessed).

PaydaĹ&#x; S, et al: Extramedullary Myeloid Tumor Involving the Pancreas: A Case Report and Review of the Literature Turk J Hematol 2014;31:295-300

297

298

2003

2012

2012

Rossetti et al.

[14]

Messeger

2013

F

2000

Chong et al.

[4]

Paydaş et al. [present case]

F

2011

Li et al. [13]

M

NA

NA

F

M

2010

Rong et al.

[12]

F

2008

Schafer et al.

[11]

37

19

45

NA

NA

48

40

75

Epigastric and abdominal pain, weight loss, AML history 5 years ago, allotransplantation

Epigastric pain, hyperamylasemia

Epigastric pain, jaundice

CML – EMMT 15 months after allotransplantation

AML M4Eo transplantation, pancreatic involvement followed by BM relapse

Persistent epigastric pain, acute abdomen signs, high fever

Abdominal pain, jaundice, weight loss, pancreatic mass suggesting pancreas cancer

Abdominal pain, epistaxis, weight loss, jaundice

No evidence of BM infiltration

NA

NA

No evidence of BM involvement

Time to relapse: 24 months

No evidence of BM infiltration

No evidence of BM infiltration

AML M4Eo

Mass in the head of pancreas invading superior mesenteric vein

Wirsung duct dilatation, pancreatic mass, peritoneal infiltration

Distension of common bile duct and Wirsung duct, pancreatic mass

Lymphoid tissue involvement of pancreas

NA

Mass in the tail of pancreas, 4X4.5 cm; splenomegaly-splenic infarction

Mass in the head of pancreas

Mass in the head of pancreas

Cholecystectomy, frozen from pancreatic mass: chronic inflammation

Acute pancreatitis treatment

Curative Whipple procedure

Pancreatic resection

Chemotherapy

Distal pancreatectomy, splenectomy

Whipple surgery, Ara-C

Ara-C, mitoxantrone, etoposide

Ara-C, idarubicin

Ara-C based treatment, second-line amsacrine, third-line clofarabine

Cisplatin, Ara-C, dexamethasone

NA

CR

Recommendation of AML treatment, but she refused it

CR

CR

Died within 2 months

12 months

Died within 1 month

Systemic relapse after 4 months

Postrelapse survival of 84+ months

Recurrence after 2 months and she died

Died 3 months later

Relapse, died 7 months later

Turk J Hematol 2014;31:295-300

Paydaş S, et al: Extramedullary Myeloid Tumor Involving the Pancreas: A Case Report and Review of the Literature

PaydaĹ&#x; S, et al: Extramedullary Myeloid Tumor Involving the Pancreas: A Case Report and Review of the Literature

Turk J Hematol 2014;31:295-300

Ara-C), while 2 did not receive chemotherapy in spite of recommendations. Eight of these 9 patients achieved complete response after chemotherapy and/or surgical approach. Survival times were variable; 1 patient died 45 days after diagnosis, while 1 was living 49 months after allotransplantation.

Figure 2. Biopsy taken from duodenal mass showing extramedullary myeloid tumor.

Figure 3. Strong myeloperoxidase staining in tumor. reported between 1987 and 2011 [5,6,7,8,9,10,11,12,13]. In nontransplant patients, the age was between 31 and 75 years, and 7 of them were female. The most common presenting symptoms of these patients were abdominal/epigastric pain and jaundice. Weight loss, fever, and acute abdomen are less likely reported symptoms. Four of these 9 cases had no known history of AML or other myeloid malignant disorder and these cases were clinically mimicking pancreatic cancer.

At the beginning, fine needle aspiration or open biopsies reported chronic inflammation or high-grade lymphoma.

Myeloid origins of these tumors were detected after systemic evaluation or careful histopathological examination by myeloperoxidase and chloroacetate esterase. Four patients had newly diagnosed AML or bone marrow biopsy was done due to peripheral cytopenias, and blastic infiltration was detected at rates between 6% and 78%. In 1 case, there was AML history 8 months prior, but there was no evidence of bone marrow infiltration when the patient presented with jaundice. Among these 9 cases, 7 were treated by AMLtype chemotherapy (regimens involving anthracycline plus

EMMTs are not rare after allogeneic transplantation and their most common localizations are the breast, gastrointestinal tract, skin, spine, central nervous system, and testes [4]. Looking at the literature, pancreatic involvement after transplantation is very rare. We found only 2 cases of EMMT with pancreatic involvement after allogeneic transplantation. One of these 2 patients had AML, and relapse in the pancreas developed 2 years after allogeneic transplantation. Only chemotherapy was given and the patient was reported to be in remission 89 months after EMMT development [4]. The second case involved CML and a pancreatic mass developed 15 months after transplantation while the bone marrow was in remission.

Pancreatic resection was done and immunosuppressive drugs were stopped, but bone marrow relapse developed and the patient died 4 months later [14]. In general, the biology of pancreatic EMMT is not different from other sites of EMMTs, but delayed diagnosis may be the cause of the bad outcome of this entity. In principle, treatment includes local treatment as well as systemic antineoplastic AML-type treatment.

Pancreatic involvement of EMMT developed in our case after allogeneic transplantation. At the beginning, pancreatic cancer had been suspected in the department of surgery.

However, the history of AML and allotransplantation suggested EMMT. Histologic confirmation of this entity was made by duodenoscopic mass biopsy. Although the first endoscopic exam was negative when the patient was admitted for pancreatic mass, the endoscopic exam was repeated and biopsy of the then-detected mass showed myeloid sarcoma; this was confirmed by myeloperoxidase stain. There was no evidence of bone marrow relapse in our case.

In conclusion, although rare, EMMT may be seen in the pancreas and may mimic pancreatic cancer. Pancreatic EMMT may be seen either in isolation or accompanying myeloid malignancies, and also following allogeneic stem cell transplantation.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Burns A. Observations on the Surgical Anatomy of the Head and Neck. Edinburgh, Thomas Royce and Co., 1811.

299

Turk J Hematol 2014;31:295-300

Paydaş S, et al: Extramedullary Myeloid Tumor Involving the Pancreas: A Case Report and Review of the Literature

2. Vardiman JW, Thiele J, Arber DA, Brunning RD, Borowitz MJ, Porwit A, Harris NL, Beau MML, Hellstrom-Lindberg E, Tefferi A, Bloomfield CD. The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes. Blood 2009;114:937-951.

3. Paydas S, Zorludemir S, Ergin M. Granulocytic sarcoma: 32 cases and review of the literature. Leuk Lymphoma 2006;47:2527-2541.

4. Chong G, Byrnes G, Szer J, Grigg A. Extramedullary relapse after allogeneic bone marrow transplantation for haematological malignancy. Bone Marrow Transplant 2000;26:1011-1015.

5. King DJ, Ewen SW, Sewell HF, Dawson AA. Obstructive jaundice: an unusual presentation of granulocytic sarcoma.

Cancer 1987:60:114-117 6. Moreau P, Milpied N, Thomas O, Fiche M, Parys V, Paineau J, Dutin JP, Harousseau JL. Primary granulocytic sarcoma of the pancreas: efficacy of early treatment with intensive chemotherapy. Rev Med Intern 1996;17:677-679.

7. Marcos HB, Semelka RC, Woosley JT. Abdominal granulocytic sarcomas: demonstration by MRI. Magn Reson Imaging 1997;15:873-876.

8. Ravandi-Kashani F, Estey E, Cortes J, Medeiros LJ, Giles FJ. Granulocytic sarcoma of the pancreas: a report of two cases and literature review. Clin Lab Haem 1999;21:219-224.

300

9. Servin-Abad L, Caldera H, Cardenas R, Casillas J. Granulocytic sarcoma of the pancreas. Acta Haematol 2003;110:188-192.

10. Breccia M, D’Andrea M, Mangarelli A, Morano AG, D’Elia GM, Alimena G. Granulocytic sarcoma of the pancreas successfully treated with intensive chemotherapy and stem cell transplantation. Eur J Haematol 2003;70:190-192.

11.

Schafer HS, Becker H, Schmitt-Graff A, Lübbert M. Granulocytic sarcoma of core-binding factor (CBF) acute myeloid leukemia mimicking pancreatic cancer. Leuk Res 2008;32:1472-1475.

12. Rong Y, Wang D, Lou W, Kuang T, Jin D. Granulocytic sarcoma of the pancreas: a case report and review of the literatures. BMC Gastroenterol 2010;10:80.

13. Li XP, Liu WF, Ji SR, Wu SH, Sun JJ, Fan YZ. Isolated pancreatic granulocytic sarcoma: a case report and review of the literature. W J Gastroenterol 2011;17:540-542.

14. Rossetti JM, Lister J, Shadduck RK, Bloom E, Geyer SJ, Caushaj PF, Homann J, Papasavas P, Cedar M. Localized lymphoid relapse in the pancreas following allogeneic hematopoietic stem cell transplant for chronic myelogenous leukemia. Leuk Lymphoma 2003;44:1071-1074.

Case Report

DOI: 10.4274/tjh.2012.0175

Extramedullary Plasmacytoma of the Frontal Sinus: Case Report and Turkish Literature Review Frontal Sinüs Yerleşimli Soliter Extrameduller Plazmasitoma: Olgu Sunumu ve Türk Literatür Derlemesi Ayşegül Verim, Shahrouz Sheidaii, Ömer Bilaç, Çiğdem Tepe Karaca, Barış Naiboğlu Haydarpaşa Numune Training and Research Hospital, Clinic of Otorhinolaryngology, İstanbul, Turkey

Abstract: Solitary extramedullary plasmacytomas (EMPs) are nonepithelial neoplasms of plasma cell origin categorized among nonHodgkin lymphomas, without the bone marrow involvement and systemic spread seen in multiple myeloma. They are uncommon tumors comprising 3% of all plasma cell neoplasias. Although they usually occur in the upper respiratory tract, only 1 case of EMP localized to the frontal sinus has been reported in the English literature. We present in this report a rare case of EMP originated from the left frontal sinus leading to left eyeball proptosis and movement restriction. A survey of sinonasal EMPs in the Turkish literature is reported, as well. Paranasal computerized tomography and magnetic resonance imaging of a 69-year-old female who presented with left eyeball proptosis and left-sided headache revealed a solid mass in the left frontal sinus. Histopathological analysis of the completely excised mass supported the diagnosis of plasmacytoma.

The definitive diagnosis of solitary EMP was confirmed with further investigations at hematology and oncology clinics. The patient was treated with surgery followed by local radiotherapy to the head and neck region, and she was disease-free at her 1-year follow-up. Treatment of sinonasal EMP is surgery alone or surgery combined with radiotherapy. Long-term follow-up is a requisite for systemic control because of the disease’s high potential to transform into multiple myeloma.

Key Words: Extramedullary plasmacytoma, Frontal sinus, Mucocel, Sinonasal neoplasm Özet: Ekstrameduller soliter plazmasitomlar plazma hücrelerinden kaynaklanan, non Hodgkin lemfomalar arasında sınıflandırılmış, kemik iliğini tutmayan ve multipl miyelom gibi jeneralize olmamış formda non epitelyal tümörlerdir. Nadir görülen tümörler olup plasma hücreli neoplazilerin %3’ünü oluştururlar. Çoğunlukla üst solunum yolunda sinonazal yerleşimli olmasına rağmen frontal sinüs yerleşimli olanına literatürde 1 olguda rastlanılmıştır. Bu yazıda sol frontal sinüs yerleşimli sol gözde proptoz ve hareket kısıtlılığına sebep olan nadir bir extrameduller soliter plazmasitom olgusu sunulmakta ve Türk literatüründeki sinonazal yerleşimli EMP’ler gözden geçirilmektedir. Altmış dokuz yaşında baş ağrısı ve sol gözde dışa itilme yakınması ile gelen bayan hastada çekilen paranazal BT ve MR sol frontal sinüs kitlesini ortaya koymuştur. Açık cerrahi ile tamamı çıkarılan kitlenin histopatolojik analizi plazmasitom tanısını koydurmuştur. Soliter EMP tanısı hematoloji ve onkoloji klinikleri tarafından yapılan tetkiklerle kesinleşmiştir. Hastaya postoperatif radyoterapi uygulanarak olumlu yanıt elde edilmiştir. Hasta halen sağlıklı olup 18. ay kontrolunda nüks izlenmemiştir. Sinonazal yerleşimli ekstramedüller plazmasitomların tedavileri cerrahi, cerrahi ve/veya radyoterapidir. Uzun dönemde hastalığın multipl miyeloma dönüşme gibi bir potansiyeli olabileceği gözardı edilmeden takiplerinde tam bir sistemik kontrol yapılması zorunludur.

Anahtar Sözcükler: Ekstramedüller plazmasitom, Frontal sinus, Mukosel, Sinonazal neoplazm Address for Correspondence: Ayşegül VERİM, M.D., Haydarpaşa Numune Training and Research Hospital, Clinic of Otorhinolaryngology, İstanbul, Turkey Phone: +90 216 414 45 03 E-mail: aysegulverim@hotmail.com Received/Geliş tarihi : November 20, 2012 Accepted/Kabul tarihi : May 13, 2013

301

Turk J Hematol 2014;31:301-306

Verim A, et al: Extramedullary

Introduction

Plasmacytoma is a neoplasm consisting of proliferated monoclonal plasma cells in either the bone or soft tissue.

It presents either as a single lesion (solitary plasmacytoma) or as multiple lesions localized in bone marrow [multiple myeloma (MM)]. Solitary plasmacytomas most frequently occur in the bone (solitary plasmacytoma of the bone), but they can also be found in the soft tissues as solitary extramedullary plasmacytomas (EMPs).

EMPs are categorized as very rarely seen forms of the non-Hodgkin lymphomas. They represent about 3% of all plasma cell tumors [1]. The tonsils, nasal cavity, paranasal sinuses, nasopharynx, and trachea are the most commonly affected sites. Regional lymph node involvement occurs in 10% to 15% of cases [2].

The median age at diagnosis is 55 to 60 years, and approximately two-thirds of the patients are males [3].

Figure 1. The mass seen through the dehiscent anterior wall of the left frontal sinus

A combination of surgery (for resectable tumors) and radiotherapy is the treatment of choice [4]. Chemotherapy is recommended for patients refractory to radiotherapy [5].

We present herein a 69-year-old woman who was referred to the ear, nose, and throat (ENT) clinic with a left-sided frontal mass and protrusion of the left eyeball due to an EMP originating from the left frontal sinus. A review of the Turkish literature on sinonasal plasmacytomas is also provided.

Case Presentation A 69-year-old woman was referred to the ENT clinic with left frontal swelling for 7 days. Her past medical history was unremarkable except for a chronic headache that had become refractory to analgesics in the last months and hypertension that was kept under control with a betablocker. No additional complaints such as epistaxis or nasal obstruction were presented.

Figure 2. MRI images displaying the mass with extension into the orbit.

On physical examination, a swelling in the left supraorbital region and forward protrusion of the left eyeball were noticed. The mass was smooth, nontender, and 4x3 cm in size. The anterior wall of the left frontal sinus was dehiscent. Visual acuity and eye movements were normal.

Nasal endoscopy was unremarkable. No lymph node swelling was noticed on palpation.

Contrast-enhanced computerized tomography (CT) scanning demonstrated opacification of the left frontal sinus due to a soft tissue mass extending into the orbit (Figure 1). The anterior and inferior walls of the frontal sinus were dehiscent. The left eyeball was displaced anteroinferiorly.

Magnetic resonance imaging (MRI) of the orbits revealed a large mass in the left frontal sinus extending into the orbit, isointense on T1A- and T2A-weighted sequences without involvement of the periorbital fat and extraocular muscles (Figure 2).

302

Figure 3. Images on paranasal sinus CT demonstrating the bony dehiscence.

Turk J Hematol 2014;31:301-306

Verim A, et al: Extramedullary

The patient underwent left osteoplastic flap surgery.

The lesion was nonencapsulated and multilobular (Figure 3). Frozen sectioning of the mass was consistent with plasmacytoma. The tumor was completely excised from the sinus cavity. Histopathological and immunohistochemical staining of the mass confirmed the diagnosis of plasmacytoma.

Postoperatively, the patient was referred to a hematology clinic for further diagnostic work-up, including bone marrow biopsy and aspiration, skeletal X-ray survey, serum electrophoresis, immunoglobulin quantification, serum and urine immunoelectrophoresis, β2-microglobulin assay, chest X-ray, and abdominal ultrasonography. The bone marrow biopsy showed a plasma cell infiltration of less than 5% of all nucleated cells. The absence of hypercalcemia, kidney failure, osteolytic bone lesions, and other organ involvement in a patient with localized disease suggested the diagnosis of solitary EMP. The blood work and urine electrophoresis results are given in Table 1.

The patient was given adjuvant radiotherapy at a dose of 40 Gy in the radiation oncology clinic. She was disease-free at her 18-month follow-up with no progression to MM. Discussion and Review of the Literature EMP of the head and neck most commonly affects the sinonasal cavityâ&#x20AC;&#x2122;s mucosa (in more than 36% of all cases) [6].

The age range of patients is 17-80 years with a preponderance of males to females (2:1) [4].

Table 1. The blood work and urine electrophoresis of the patient.

Hematocrit

36%

Hemoglobin

12 g/dL

White blood cells

5500/mm3

Platelets

220,000/mm3

Erythrocyte sedimentation rate

32 mm/h

β2-Microglobulin concentration

1.40 mg/mL

Gamma globulin

3 g/dL

Serum monoclonal protein

Negative

Na

139 mEq/L

K

4.2 mEq/L

Ca

9.8 mg/dL

Urea

10 mg/dL

Creatinine

1 mg/dL

IgG

1200 mg/dL

IgM

200 mg/dL

Kappa light chain

Negative

Lambda light chain

Negative

Bence Jones protein

Negative

The clinical presentation of paranasal sinus EMP depends on the mass volume and on the site of involvement. Nasal obstruction (80%), soft-tissue swelling, epistaxis, nasal discharge, pain, and proptosis are the main clinical findings observed in decreasing order of frequency. The tumor has a slow-growing nature and becomes symptomatic when the mass fills the cavity several months later. This condition results in treatment delay and transformation into systemic disease (MM). The early referral of the patient in this report was due to the obvious symptoms of the mass, which eroded the frontal sinus wall and pushed the eyeball anteroinferiorly.

Had the sinonasal cavity been involved, the tumor would not have been diagnosed at an early stage and would have progressed into multiple myeloma, which usually has a fatal progression.

CT and MRI are complementary techniques in evaluating the size and location of a tumor and the involvement of the adjacent structures; however, the role of MRI in staging EMPs is not clear [7]. Although nonspecific, CT and MRI images show lobular soft tissue masses or infiltrative lesions with variable enhancement. Bony destruction is displayed depending on the expansion of the tumor [8]. Isointense images on T1-weighted and iso- to hyperintense images on T2-weighted sequences are well demonstrated in MRI assessment. In the current case, CT examination was useful in demonstrating the bony abnormality. MRI was superior to CT in defining the malignant character of the soft tissue mass, but it could not distinguish plasmacytoma from other probable causes (squamous cell or adenocystic carcinoma).

The diagnosis of EMP depends on the morphologic and immunophenotypic analysis of the localized tumoral mass [6]. As is the case in EMPs of the upper aerodigestive tract, sinonasal EMPs localize in the submucosal surface of the sinonasal cavity. Sinus mucosa may be thickened by inflammatory reactions; therefore, care should be taken to obtain deep biopsy specimens for frozen section analysis.

Immunophenotyping with CD15, CD20, CD45RB, CD45RA, epithelial membrane, IgA, IgD, IgG, IgM, IgE, kappa light chain, and lambda light chain antibodies is helpful to differentiate EMP from epithelial tumors [9]. Once the diagnosis was confirmed by histopathological analysis, our patient was referred to a hematology clinic for further diagnostic work-up, including serum and urine protein electrophoresis, immunoelectrophoresis, skeletal survey, and bone marrow biopsy, to look for systemic and bone marrow involvement.

Controversy exists regarding the optimal treatment of EMP. Based on the well-known high radiosensitivity of plasma cells, a dose of 40-50 Gy radiotherapy is advised in the treatment [10]. According to Alexiou et al., sinonasal EMPs with bone destruction should not be treated with radiotherapy or surgery alone, but rather with a combination of both modalities to assure local and systemic 303

Turk J Hematol 2014;31:301-306

Verim A, et al: Extramedullary

control [4]. Galieni et al. reported that surgery in cases of limited and easily resectable masses would be adequate to treat the disease without recurrence. They emphasized that the presence of a monoclonal component at diagnosis was a poor prognostic indicator for higher risk of disease progression [11].

Recently genetic abnormalities have become more apparent in pathogenesis and progression to MM. Additional biological factors related to the proliferative activity of the malignant plasma cells are high levels of angiogenesis and higher histologic grades. Translocations involving the immunoglobulin heavy-chain locus on chromosome 14q32,

Table 2. Information about nasal and sinonasal extramedullary plasmacytomas published in Turkish literature.

Author

Publication

Patient’s demography

Disease Location

Tumour Size

Treatment

Progress to Multiple Myeloma

Survival Time

Ural T.İ

Atatürk Ü

52 y male

Maxillary sinus

Filling the sinus

Surgery and

N/A

N/A

Yes

N/A

N/A

N/A

N/A

1 year follow-up

year N/A Erişir F et al.

Endoskopi

Radiotherapy 25 y female

dergisi 1993

Maxillary sinus

Filling the

Surgery,

Ethmoid,

sinuses,

Chemotherapy

sphenoid sinus

extending to

Radiotherapy

retroorbital region Ayan N et al.

KBB ve BBC

32 y female

Nasal cavity

dergisi 1995 Altaş E et al.

Tr.J.of Medical

50 y male

Nasal cavity

Sciences 1998

Filling the hole

Surgery and

nasal cavity

Radiotherapy

Filling the hole

Surgery and

nasal cavity,

Radiotherapy

survival:

extending to

N/A

nasopharynx İncesulu A

KBB ve BBC

59 y male

Nasal cavity

Filling the hole

Surgery

N/A

2 year follow-up

et al.

dergisi 2000

25 y female

Nasal cavity

nasal cavity,

survival:

extending to

N/A

maxillary sinus Veyseller

KBB Postası

B et al.

2003

N/A

Nasal cavity,

Filling the hole

Maxillary sinus

nasal cavity,

Surgery

N/A

N/A

Surgery and

N/A

N/A

Yes

Died at 1 year

N/A

N/A

No

Follow-up 18

extending to maxillary sinus Ersoy O

Acta

et al.

Otolaryngolo

63 y male

Maxillary sinus

3x1.5 cm

Radiotherapy

gica 2004 Aydın E

Kulak Burun

et al.

Bogaz Ihtis Derg.

70 y male

Sphenoid sinus

Filling the

Surgery and

sphenoid sinus

Radiotherapy

Nasal

Filling half of

Surgery and

the sinus cavity

Radiotherapy

Nasal cavity,

Filling maxillary

Surgery and

maxillary sinus

sinus, nasal

Radiotherapy

2006 Çömez G

Uluslar arası

26 y female

et al.

Hematoloji

cavity,maxillary

Onkoloji dergisi

sinus

2008 Gür Ö.E

KBB ve BBC

et al.

dergisi 2008

64 y female

months

cavity and nasopharynx Özdemir S

J Craniomaxillo-

et al.

fac Surg. 2013

The present

2013

study

304

50 y male

Sphenoid sinus

2 x 5 x 4 cm

Surgery and

Yes

Died after 1 year

No

18 months

Chemotherapy 69 y female

Frontal sinus

4x3 cm

Surgery and Radiotherapy

follow-up

Turk J Hematol 2014;31:301-306

Verim A, et al: Extramedullary

resulting in transcriptional activation of MAF, MMSET, CCND1, CCND3, or MAFB, and numerous structural and copy number alterations are important genetic changes for the pathogenesis of MM. Complex karyotypic abnormalities in MYC, the activation of NRAS and KRAS, mutations in TP53, and inactivation of CDKN2A and CDKN2C are lateonset translocations and gene mutations that promote a higher rate of progression to MM [12,13].

When compared to solitary bone plasmacytoma, EMP demonstrates a relatively low risk of progression to MM. The 10-year overall survival rate was reported to be 70% in EMP cases [14]. In another study, younger age was shown to be an independent good prognostic factor predicting a lower rate of progression to MM [15]. Tumor size of <5 cm, low M protein levels, patient age of <40 years, absence of light chains, and disappearance of M protein after treatment were found to be good prognostic factors [9,16]. Bone morphogenetic proteins (BMPs), members of the transforming growth factor-β superfamily and originally identified as molecules involved in the regulation of osteogenic differentiation, are now defined as tumor suppressors in actively proliferating myeloma cells or plasmablasts. Thus, activation of BMP6 expression is accepted to be a favorable prognostic factor independent of conventional prognostic factors, i.e.

International MM Staging System stage and serum β2microglobulin levels [17].

In the case of persistent M protein after completion of radiotherapy or suppression of normal immunoglobulin classes and suppression of BMP6 expression by intensive methylation of the genes at CpG sites of the BMP6 promoter region by plasma cells, with extremely high levels of serum lactate dehydrogenase, early intensive systemic therapy should be considered to prevent poor prognosis [18].

Because of the bony destruction in the present case, our treatment of choice was surgery combined with a radiotherapy dose of 40 Gy. The patient’s lesion was localized in only one sinus and was totally removed from the cavity. In our opinion, complete surgery with postoperative radiotherapy is more promising in the treatment of solitary EMP. The patient is now in follow-up at hematology and ENT clinics and is still free of disease at 18 months. Factors that influenced the good prognosis in our case were, as per the case-based experience in the literature, the relatively small size of the tumor (<5 cm), early presentation, a single site of involvement, localization (frontal sinus), female sex, and combined modality treatment.

Reports on nasal and paranasal sinus EMPs are rare in the English literature. Few reports have been published in the Turkish literature, as well. A comprehensive search of a Turkish database for patients with nasal and paranasal EMPs identified only 10 reports. Among these 10 reports, only 2 were included in PubMed [19,20]. The case reports on nasal

and paranasal EMPs in the Turkish literature are listed in Table 2. However, follow-up information was missing for most of the patients and therefore we were unable to perform a documented analysis on disease recurrence or progression.

This was the shortcoming of this report.

In summary, solitary EMP usually develops in the head and neck soft tissues but may also involve sites such as the thyroid and brain and may be observed in a large age range (17-80 years). One should always include the possibility of plasma cell tumor in older patients presenting with symptoms of epistaxis, nasal blockage, or facial mass. Deep submucosal biopsies are usually required so as to not miss the lesion in frozen sectioning. This neoplasm is usually treated with radiotherapy or with a combination of surgery and radiotherapy. Progression to MM may occur 3 to 8 years after treatment. Long-term follow-up in terms of disease recurrence and progression is mandatory.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Batsakis JG. Pathology consultation. Plasma cell tumors of the head and neck. Ann Otol Rhinol Laryngol 1983;92:311313.

2. Holland J, Trenkner DA, Wasserman TH, Fineberg B. Plasmacytoma: treatment results and conversion to myeloma. Cancer 1992;69:1513-1517.

3. Frassica DA, Frassica FJ, Schray MF, Sim FH, Kyle RA. Solitary plasmacytoma of bone: Mayo Clinic experience. Int J Radiat Oncol Biol Phys 1989;16:43-48.

4. Alexiou C, Kau RJ, Dietzfelbinger H, Kremer M, Spiess JC, Schratzenstaller B, Arnold W. Extramedullary plasmacytoma: tumor occurrence and therapeutic concepts. Cancer 1999;85:2305-2314.

5. Soutar R, Lucraft H, Jackson G, Reece A, Bird J, Low E, Samson D; Working Group of the UK Myeloma Forum; British Committee for Standards in Haematology; British Society for Haematology. Guidelines on the diagnosis and management of solitary plasmacytoma of bone and solitary extramedullary plasmacytoma. Clin Oncol (R Coll Radiol) 2004;16:405-413.

6. Bachar G, Goldstein D, Brown D, Tsang R, Lockwood G, Perez-Ordonez B, Irish J. Solitary extramedullary plasmacytoma of the head and neck long term outcome analysis of 68 cases. Head Neck 2008 30:1012-1019.

7. Toprak SK, Karakuş S, Topçuoğlu P. Extramedullary plasmacytoma presenting as a mediastinal mass. Turk J Hematol 2012;29:307-308.

8. Ching AS, Khoo JB, Chong VF. CT and MR imaging of solitary extramedullary plasmacytoma of the nasal tract.

AJNR Am J Neuroradiol 2002;23:1632-1636.

305

Turk J Hematol 2014;31:301-306

9. Hotz MA, Schwaab G, Bosq J, Munck JN. Extramedullary solitary plasmacytoma of the head and neck. A clinicopathological study. Ann Otol Rhinol Laryngol 1999;108:495-500.

10. Susnerwala SS, Shanks JH, Baneijee SS, Scarife JH, Farrington WT, Slevin NJ. Extramedullary plasmacytoma of the head and neck region: clinicopathological correlation in 25 cases.

Br J Cancer 1997;75:921-927.

11. Galieni P, Cavo M, Pulsoni A, Avvisati G, Bigazzi C, Neri S, Caliceti U, Benni M, Ronconi S, Lauria F. Clinical outcome of extramedullary plasmacytoma. Haematologica 2000;85:47-51.

12. Palumbo A, Anderson K. Multiple myeloma. N Engl J Med 2011;364:1046-1060.

13.

Munshi NC, Avet-Loiseau H. Genomics in multiple myeloma. Clin Cancer Res 2011;17:1234-1242.

14. Dores GM, Landgren O, McGlynn KA, Curtis RE, Linet MS, Devesa SS. Plasmacytoma of bone, extramedullary plasmacytoma, and multiple myeloma: incidence and survival in the United States, 1992-2004. Br J Haematol 2009;144:86-94.

15. Kilciksiz S, Celik OK, Pak Y, Demiral AN, Pehlivan M, Orhan O, Tokatli F, Agaoglu F, Zincircioglu B, Atasoy BM, Ozseker N, Yersal O, Niang U, Haydaroglu A; Turkish Oncology Group-Sarcoma Working Party. Clinical and prognostic features of plasmacytomas: a multicenter study of Turkish Oncology Group-Sarcoma Working Party. Am J Hematol 2008;83:702-707.

306

Verim A, et al: Extramedullary

16. Liu HY, Luo XM, Zhou SH, Zheng ZJ. Prognosis and expression of lambda light chains in solitary extramedullary plasmacytoma of the head and neck: two case reports and a literature review. J Int Med Res 2010;38:282-288.

17. Seckinger A, Meissner T, Moreaux J, Goldschmidt H, Fuhler GM, Benner A, Hundemer M, Rème T, Shaughnessy JD Jr, Barlogie B, Bertsch U, Hillengass J, Ho AD, Pantesco V, Jauch A, De Vos J, Rossi JF, Möhler T, Klein B, Hose D. Bone morphogenic protein 6: a member of a novel class of prognostic factors expressed by normal and malignant plasma cells inhibiting proliferation and angiogenesis.

Oncogene 2009;28:3866-3879.

18. Weber DM. Solitary bone and extramedullary plasmacytoma.

Hematology Am Soc Hematol Educ Program 2005:373376.

19. Ersoy O, Sanlier T, Yigit O, Halefoglu AM, Ucak S, Altuntas Y. Extramedullary plasmacytoma of the maxillary sinus.

Acta Otolaryngol 2004;124:642-644.

20. Özdemir S, Tarkan Ö, Tuncer Ü, Sürmelioğlu Ö, Doğrusöz M, Ergin M. A case of extramedullary plasmacytoma in the sphenoid sinus with unilateral loss of vision. J Craniomaxillofac Surg 2013;41:140-143.

Letter to the Editor

DOI: 10.4274/tjh.2014.0037

Hemophagocytic Lymphohistiocytosis Syndrome Associated with Gaucher Disease Type 2 Tip 2 Gaucher Hastalığı ile İlişkili Hemafagositik Lenfohistiositozis Sendromu Bahoush Gholamreza1, Miri-Aliabad Ghasem2 1Iran

University of Medical Sciences, Ali Asghar Children’s Hospital, Pediatric Hematology-Oncology, Tehran, Iran University of Medical Sciences, Children and Adolescent Health Research Center, Department of Pediatric Hematology-Oncology, Zahedan, Iran 2Zahedan

To the Editor, We present the case of a 5.5-month-old female infant hospitalized because of fever, lethargy, pallor, poor feeding, convulsion, and developmental delay. She was the first child of the family and her parents were relatives. Physical examination revealed hepatosplenomegaly, opisthotonus, and pitting edema. Laboratory studies showed pancytopenia (WBC: 3500/mm3, Hb: 6 g/dL, Plt: 40.000/mm3), coagulopathy (PT: 19.4 s, aPTT: 41 s, fibrin degradation products: 1.8 mg/mL, D-dimer: 4 mg/L), AST of 132 U/L, ALT of 107 U/L, ALP of 313 U/L, triglycerides of 280 mg/ dL, and albumin of 2.7 g/dL. Analysis of the cerebrospinal fluid (CSF) revealed lymphocytic pleocytosis. Serum ferritin level was 1020 ng/mL and fibrinogen level was 150 mg/dL. Other test results, including renal function tests, electrolytes, serum and urine amino acid chromatography, TORCH study, and virology studies (HIV, HCV, HBV, HAV, EBV), were normal. Blood, urine, stool, CSF, and bone marrow cultures were all negative. Bone marrow examination revealed hemophagocytosis caused by macrophages (Figure 1). It also showed an increase in the number of histiocytic cells, which was not typical of Gaucher disease. However, dried blood spot testing showed a drastic reduction of 8.45 pmol/ spot (normal range: 200-2000 pmol/spot in 20 h) in the betaglucosidase enzyme activity and confirmed the diagnosis of Gaucher disease. Since 6 of the 8 criteria of hemophagocytic lymphohistiocytosis (HLH) syndrome were observed in the

Figure 1. A) A macrophage that has phagocytosed a band cell and a lymphocyte B) A macrophage that has engulfed many normoblast. patient, she was subjected to treatment with the HLH 2004 Protocol [2], broad-spectrum antibiotics, and anticonvulsant drugs while supportive measures were also taken. Despite the aforementioned efforts, the patient’s clinical condition gradually worsened and she died 10 days after the beginning of the treatment. It was not possible to study the mutations associated with primary HLH or to measure the level of sIL2R and the activity of NK cells. Informed consent was obtained.

This case is important because it is an example of HLH syndrome associated with Gaucher disease type 2. Gaucher disease is a lysosomal storage disorder that is caused by the deficiency of beta-glucocerebrosidase enzyme. Gaucher disease has 3 types. Type 2, which is known as the acute infantile form, is characterized with neurological symptoms and death in early childhood [1]. HLH syndrome is a rare and rapidly progressive disease that has a primary (familial) and a

Address for Correspondence: Miri-Aliabad GHASEM, M.D., Zahedan University of Medical Sciences, Children and Adolescent Health Research Center, Department of Pediatric Hematology-Oncology, Zahedan, Iran Phone: +985413411250 E-mail: gh_miri@yahoo.com Received/Geliş tarihi : January 26, 2014 Accepted/Kabul tarihi : February 10, 2014

307

Turk J Hematol 2014;31:307-308

secondary (acquired) form. If this disorder is left untreated, it can quickly lead to death [2]. Diagnosis of primary HLH is confirmed by studying the related genetic mutations, such as STX11, UNC13D, and PRF1. The secondary type of HLH also develops after infections or with rheumatologic diseases, Chediak–Higashi syndrome, Griscelli syndrome, X-linked lymphoproliferative disease, malignancies, and inborn errors of metabolism. This potentially fatal disease is caused by uncontrolled over-production of inflammatory cytokines by cytotoxic T lymphocytes and histiocytes [2,3]. HLH syndrome is rarely associated with Gaucher disease. It was Lee et al. that first found erythrophagocytosis in Gaucher cells [4]. Hibbs et al. [5] and Bitton et al. [6] also reported erythrophagocytic activity in Gaucher cells. In another study, similar clinical symptoms were seen in patients with Gaucher disease type 2 and patients with HLH [7]. Approximately 15% of Gaucher cells were found to have abnormal morphologies or significant erythrophagocytic activity [8]. Sharpe et al. reported a female infant with Gaucher disease type 2 manifesting as severe HLH [9]. Only that study addressed the association of these 2 diseases, while other reports have only found erythrophagocytosis in Gaucher cells.

Although it was not possible to study the genetic mutations of HLH in this patient, on the basis of the familial background of her parents, the progressive trend of her disease, and no response of disease to treatment, it can be concluded that the patient possibly suffered from primary HLH. Measurement of the activity of beta-glucosidase enzyme confirmed the diagnosis of Gaucher disease. Due to the presence of severe and rapidly progressive neurologic symptoms, the patient was diagnosed with Gaucher disease type 2. These 2 diseases have many overlapping clinical symptoms. Therefore, in similar occasions, a careful evaluation of the presence of storage diseases such as Gaucher disease is recommended.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

308

Gholamreza B, et al: Hemophagocytic Syndrome Associated with Gaucher Disease

Key Words: Gaucher disease, Hemophagocytic lymphohistiocytosis, Hepatosplenomegaly Anahtar Sözcükler: Gaucher hastalığı, Hemafagositik lenfohistiositozis, Hepatosplenomegali References 1. Oski FA, Brugnara C, Nathan DG. Storage disease of the reticuloendothelial system. In: d’Azzo A, Kolodny EH, Bonton E, Annunziata I. Nathan and Oski’s Hematology of Infancy and Childhood. 7th ed. Philadelphia, Saunders, 2009.

2. Henter JI, Horne A, Aricó M, Egeler RM, Filipovich AH, Imashuku S, Ladisch S, McClain K, Webb D, Winiarski J, Janka G. HLH-2004: diagnostic and therapeutic guidelines for hemophagocytic lymphohistiocytosis. Pediatr Blood Cancer 2007;48:124-131.

3. Kliegman R, Stanton B, St Geme J, Schor NF, Behrman RE (eds). Nelson Text Book of Pediatrics. 19th ed. Philadelphia, Saunders Elsevier, 2011.

4. Lee RE, Balcerzak SP, Westerman MP. Gaucher’s disease: a morphologic study and measurements of iron metabolism.

Am J Med 1967;42:891-898.

5. Hibbs RG, Ferrans VJ, Cipriano PR, Tardiff KJ. A histochemical and electron microscopic study of Gaucher cells. Arch Pathol 1970;89:137-153.

6. Bitton A, Etzell J, Grenert JP, Wang E. Erythrophagocytosis in Gaucher cells. Arch Pathol Lab Med 2004;128:11911192.

7. Mignot C, Doummar D, Maire I, De Villemeur TB; French Type 2 Gaucher Disease Study Group. Type 2 Gaucher disease: 15 new cases and review of the literature. Brain Dev 2006;28:39-48.

8. Machaczka M, Klimkowska M, Regenthal S, Hagglund H. Gaucher disease with foamy transformed macrophages and erythrophagocytic activity. J Inherit Metab Dis 2011;34:233235.

9. Sharpe LR, Ancliff P, Amrolia P, Gilmour KC, Vellodi A. Type II Gaucher disease manifesting as haemophagocytic lymphohistiocytosis. J Inherit Metab Dis 2009;32 Suppl 1:107-110.

Letter to Editor

DOI: 10.4274/tjh.2013.0379

Toxoplasmosis-Associated Hemophagocytosis in a Preterm Newborn Prematüre Bebekte Toksoplazma Enfeksiyonuna Bağlı Hemofagositoz Sema Arayıcı1, Fatma Nur Sarı1, Neşe Yaralı2, Mehmet Yekta Öncel1, Gülsüm Kadıoğlu Şimşek1, Nurdan Uras1, Uğur Dilmen3 1Zekai

Tahir Burak Maternity Teaching Hospital, Division of Neonatology, Ankara, Turkey Children’s Hematology Oncology Training and Research Hospital, Clinic of Pediatric Hematology, Ankara, Turkey 3Yıldırım Beyazıt University Faculty of Medicine, Department of Pediatrics, Ankara, Turkey 2Ankara

To the Editor, Hemophagocytic lymphohistiocytosis (HLH) is a rare, life-threatening disease characterized by inappropriate proliferation and activation of lymphocytes and macrophages in tissues, leading to multi-organ failure [1]. Primary (familial) HLH is inherited in an autosomal recessive manner. The secondary form of HLH occurs in association with infections, malignancies, rheumatologic disorders, and some metabolic diseases [2]. Although primary or secondary forms of HLH presentations during the neonatal period in term newborns have been reported previously, data on the HLH presentations of preterm newborns are scarce.

Herein, we present a 5-day-old prematurely born girl (1770 g) after 33 weeks of gestation from a primigravid mother who was antenatally diagnosed to have hydrocephalus and hepatosplenomegaly. Maternal history included no screening for intrauterine infection such as toxoplasmosis, rubella, cytomegalovirus, herpes simplex virus, and human immunodeficiency virus during pregnancy and no parental consanguinity. Physical examination revealed massive hepatosplenomegaly at birth. Laboratory findings showed hemoglobin of 14.3 g/dL, white blood cell count of 4x109/L (absolute neutrophil count 0.6x109), platelet count of 93x109/L, serum ferritin of 482 ng/mL (25-200 ng/mL),

serum triglyceride of 101 mg/dL, and fibrinogen of 118 mg/ dL (150-450 mg/dL). Serological screening for intrauterine infection (Toxoplasma gondii, cytomegalovirus, rubella, herpes simplex virus types 1 and 2) was negative. Cranial and abdominal ultrasonographic examination revealed hydrocephalus and hepatosplenomegaly, respectively. Since the clinical data were strongly suggestive of an intrauterine infection, further laboratory investigation was performed with polymerase chain reaction (PCR) tests. Repeated blood cultures also grew no bacteria. A bone marrow aspirate examination showed hemophagocytosis. After the diagnosis of hemaphagocytosis intravenous immune globulin was added to the conservative treatment of the newborn. On the third day of life, clinical condition of the patient deteriorated and she required mechanical ventilation and hemodynamic support. On the fifth day, the newborn died of multi-organ failure. After her death, PCR screening results were found to be Toxoplasma gondii-positive.

HLH is a reactive disorder characterized by generalized non-malignant histiocytic proliferation with prominent hemophagocytosis. There are only a few reports about preterm newborns with infection-associated hemophagocytic syndrome in the literature [3,4,5]. To the best of our knowledge, infection-associated hemophagocytic syndrome

Address for Correspondence: Sema ARAYICI, M.D., Zekai Tahir Burak Maternity Teaching Hospital, Division of Neonatology, Ankara, Turkey Gsm: +90 505 8314170 E-mail: semadr@hotmail.com Received/Geliş tarihi : November 8, 2013 Accepted/Kabul tarihi : February 10, 2014

309

Turk J Hematol 2014;31:309-310

Arayıcı S, et al: Hemophagocytosis due to Toxoplasmosis in a Preterm Infant

due to Toxoplasma gondii has not been previously reported in preterm newborns. Informed consent was obtained.

Key Words: Hemophagocytosis, Preterm, Toxoplasma gondii

In our case, positive findings including splenomegaly, bicytopenia, hypofibrinogenemia, hyperferritinemia, and hemophagocytosis are considered to be associated with HLH. Although cytopenia may also be related to organomegaly associated with Toxoplasma infection, differentiation of the cause of cytopenia could not be done because of the short life span of the patient.

Anahtar Sözcükler: Toxoplasma gondii

Although the diagnostic criteria of HLH are well defined [3], HLH in preterm newborns might not fulfill these criteria in the presence of disease since these patients usually do not have fever and, additionally, clinicians may not think of HLH diagnosis since cytopenias are a common finding of prematurity. The severe course of Toxoplasma infection in our patient, ending in mortality, may be related to the accompanying HLH. The criteria for HLH may not be fulfilled in preterm newborns and a high degree of suspicion may prevent some of the morbidity and mortalities by earlier therapeutic interventions.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

310

Hemofagositoz,

Prematüre,

References 1. Uchiyama A, Kusuda S, Imashuku S, Sakuma I, Yamasaki C, Ichiyama T, Nishida H. Fatal hemophagocytic lymphohistiocytosis in an extremely-low-birthweight infant. Pediatr Int 2010;52:661-663.

2. Janka GE, Schneider EM. Modern management of children with haemophagocytic lymphohistiocytosis. Br J Haematol 2004;124:4-14.

3. Aygun C, Tekinalp G, Gurgey A. Infection-associated hemophagocytic syndrome due to Pseudomonas aeruginosa in preterm infants. J Pediatr Hematol Oncol 2003;25:665667.

4. Maruyama K, Koizumi T, Hirato J. Cytomegalovirus infections associated hemophagocytic lymphohistiocytosis in a premature infant. Pediatr Int 2006;48:648-650.

5. Edner J, Rudd E, Zheng C, Dahlander A, Eksborg S, Schneider EM, Edner A, Henter JI. Severe bacteria-associated hemophagocytic lymphohistiocytosis in an extremely premature infant. Acta Paediatr 2007;96:1703-1706.

DOI: 10.4274/tjh.2014.0068

Letter to the Editor

Thalassemia Intermedia and Acute Lymphoblastic Leukemia: Is it a Coincidental Double Diagnosis?

Talasemi İntermedia ve Akut Lenfoblastik Lösemi Rastlantısal Çift Tanı mı?

Deniz Tuğcu1, Zeynep Karakaş2, Müge Gökçe1, Leyla Ağaoğlu2, Ayşegül Ünüvar2, Ebru Sarıbeyoğlu2, Arzu Akçay1, Ömer Devecioğlu2 1Kanuni Sultan Süleyman Education and Research Hospital, Clinic of Pediatric Haematology-Oncology, İstanbul, Turkey 2İstanbul University, İstanbul Faculty of Medicine, Department of Pediatric Haematology-Oncology, İstanbul, Turkey

To the Editor, Beta-thalassemia is not a rare disease in Turkey [1].

‘Thalassemia intermedia’ describes the patients whose clinical phenotype is placed between thalassemia major and the thalassemia trait despite having homozygote betagene mutation. These patients are generally identified with mild-to-moderate anemia later in life than the patients with thalassemia major [2].

A 12-year-old boy presented with headache, pallor, and abdominal distension. Physical examination yielded cervical and inguinal lymphadenopathies, ecchymoses in the lower extremities, and prominent hepatosplenomegaly. Complete blood count revealed hyperleukocytosis (210x109/L), microcytic anemia (Hb: 7.2 g/dL, MCV: 66.9 fL), thrombocytopenia (30x109/L), and mild reticulocytosis (4.3%). Peripheral blood smear showed normoblasts (14%) with 60% blasts. The Coombs test was negative. Viral serology including EBV, CMV, and HIV was negative. Serum ferritin level was 1210 ng/ mL. Bone marrow aspiration confirmed the diagnosis of acute lymphoblastic leukemia (ALL) of FrenchAmerican-British L2 type (90% blasts) and common ALL antigen (+) B ALL was seen with flow cytometry (CD10: 75%, CD19: 86%, CD22: 75%, TdT: 44%). Cytogenetic evaluation revealed 46;XY. Polymerase chain reaction showed negative t(9;22), t(4;11), t(1;19), and t(12;21).

No lymphoblasts were demonstrated in the cerebrospinal fluid. He was enrolled in the medium-risk arm of ALL chemotherapy protocol.

From his medical history it was learned that he had a diagnosis of anemia at 5 years of age. Hemoglobin electrophoresis in our clinic showed HbF of 82%, HbA2 of 4%, and HbA of 14%. He had never been transfused to date. Beta-gene analysis revealed homozygote IVS-I-6 (T-C) mutation, pointing to thalassemia intermedia [1].

Chemotherapy was started according to the Children’s Cancer Group. He achieved remission at the end of the phase 1.

The coexistence of thalassemia with cancers such as Hodgkin disease, lymphoma, seminoma, and leukemia has been reported [3,4,5,6,7]. This coexistence could be explained by either genetic or environmental interactions, or it might be thought of as just a coincidence.

Panich et al. reported that the incidence of malignancies in patients with thalassemia was up to 9.4% [8]. Zurlo et al. also reported the death of 8 thalassemia major patients due to malignancy [9]. Such reports suggest the possible association between thalassemia and malignancy. Iron burden, continuous oxidative damage, and viral infections due to transfusions might play roles in the development of malignancy [10].

Address for Correspondence: Deniz TUĞCU, M.D., Kanuni Sultan Süleyman Education and Research Hospital, Clinic of Pediatric Haematology-Oncology, İstanbul, Turkey Gsm: +90 532 286 03 18 E-mail: deniztugcu@superonline.com Received/Geliş tarihi : February 12, 2014 Accepted/Kabul tarihi : March 13, 2014

311

Turk J Hematol 2014;31:311-312

Tuğcu D, et al: Thalassemia Intermedia and Acute Lymphoblastic Leukemia

Whether the above theories hold true or not, one should suspect the possibility of malignancy in patients with thalassemia who develop suggestive signs and symptoms including worsening anemia and splenomegaly.

We did not find any relationship between iron overload and cancer in this case. This child was not transfused and did not have evidence of iron overload. Additionally, there were no infections that might have been linked to cancer in this patient. Further studies are needed in order to identify the association between thalassemia and malignancy.

Whether all the above theories hold true or not, one should suspect the possibility of malignancy in patients with thalassemia who develop suggestive signs and symptoms including worsening anemia and splenomegaly. We did not find any relationship between iron overload and cancer in this case. This child was not transfused and did not have evidence of iron overload. Also, there were no any infections that might have been linked to cancer in this patient. Further studies are needed in order to identify the association between thalassemia and malignancy.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Key Words: Thalassemia intermedia, Leukemia, Cancer Anahtar Sözcükler: Talasemi intermedia, Lösemi, Kanser References 1. Altay C. The frequency and distribution pattern of beta-thalassemia mutations in Turkey. Turk J Hematol 2002;19:309-315.

312

2. Taher A, Isma’eel H, Cappellini MD. Thalassemia intermedia: Revisited. Blood Cells Mol Dis 2006; 37:12-20.

3. Benetatos L, Alymara V, Vassou A, Bourantas L. Malignancies in β-thalassemia patients: a single-center experience and a concise review of the literature. Int J Lab Hematol 2008;30:167-172.

4. Schiliro G, Russo A, Marino S, Musumeci S, Russo G. Occurrence of lymphoma with bone marrow involvement in a boy with beta+ thalassaemia major. Clin Lab Haematol 1979;1:325-328.

5. Chehal A, Loutfi R, Taher A. Beta-thalassemia intermedia and non-Hodgkin’s lymphoma. Hemoglobin 2002;26:219225.

6. Otrock Zaher K, Shamseddine A, Taher A. Non-Hodgkin Disease in Beta -Thalassemia Major. American J of Hematol 2006;81:62-64.

7. Karimi M, Giti R, Haghpanah S, Azarkeivan A, Hoofar H, Eslami M. Malignancies in patients with beta-thalassemia major and beta-thalassemia intermedia: a multicenter study in Iran. Pediatr Blood Cancer 2009;53:1064-1067.

8. Panich V, Na-Nakorn S, Piankijagum A. Hemoglobinopathies and G6PD deficiency inlymphoma. J Med Assoc Thailand 1974;57:1-10.

9. Zurlo MG, De Stefano P, Borgna-Pignatti C, Di Palma A, Piga A, Melevendi C, Di Gregorio F, Burattini MG, Terzoli S. Survival and causes of death in thalassaemia major. Lancet 1989;2:27-30.

10. Stevens RG, Jones DY, Micozzi MS, Taylor PR. Body iron storesand the risk of cancer. N Engl J Med 1988;319:10471052.

Letter to the Editor

DOI: 10.4274/tjh.2013.0282

A Rare Cause of Recurrent Oral Lesions: ChediakHigashi Syndrome Yineleyen Oral Lezyonların Nadir Bir Nedeni: Chediak Higashi Sendromu Müsemma Karabel1, Selvi Kelekçi1, Velat Şen1, Duran Karabel1, Çiğdem Aliosmanoğlu1, Murat Söker2 1Dicle 2Dicle

University Faculty of Medicine, Department of Pediatrics, Diyarbakır, Turkey University Faculty of Medicine, Department of Pediatrics, Division of Hematology Oncology, Diyarbakır, Turkey

To the Editor, Chediak-Higashi syndrome (CHS) is a rare autosomal recessive disorder characterized by oculocutaneous albinism, recurrent bacterial infections, and giant granules in peripheral blood leukocytes or bone marrow cells.

There are 2 phases of the disease. The first is the stable phase, which is characterized by recurrent infections such as periodontitis and gingivitis due to neutropenia and/or neutrophil dysfunction and hypopigmentation of the hair, skin, and eyes. It typically develops in infancy or early childhood in most patients with CHS. The second phase is the accelerated phase, which is characterized by persistent fever, hepatosplenomegaly, lymphadenopathy, pancytopenia, and bone marrow infiltration and hemophagocytosis by histiocytes, similar to findings of hemophagocytic syndrome (HLH) [1,2,3,4]. In this letter, we report a very rare presentation of CHS in an 11-year-old girl who was in the accelerated phase of the syndrome and presented with recurrent oral ulcers and periodontitis when she was 1 year old.

An 11-year-old girl with complaints of recurrent oral ulcers for 10 years and persistent fever, abdominal pain, and fatigue for 2 weeks was admitted to our clinic. She also had a history of photophobia with a gradual decrease in vision, generalized weakness, and weight loss over the past few years. Physical examination revealed a pale, lethargic child with mental retardation and developmental delay.

She had oral cavity ulcers, gingivitis, periodontitis, silvery

hair, whitish eyebrows and eyelashes, and hypopigmented and hyperpigmented spots on areas of the skin exposed to the sun (Figure 1). She had also hepatosplenomegaly, lymphadenopathy, and neurological abnormalities such as decreased deep tendon reflexes and muscle weakness in the lower extremities.

Laboratory investigations showed pancytopenia with hemoglobin concentration of 7.3 g/dL, platelet count of 57x109/L, white blood cell count of 1.99x109/L, absolute neutrophil count of 157/L, prothrombin time-international normalized ratio of 1.28, activated partial thromboplastin time of 45 s, and lactate dehydrogenase level of 1122 U/L (normal range: 0-250). The levels of serum triglyceride and total/direct bilirubin levels were 378 mg/dL and 1.7/1.1 mg/dL, respectively. Alanine and aspartate transaminase levels were 180 and 200 IU/L, respectively. Serum ferritin and plasma fibrinogen levels were 586 µg/L and 120 mg/ dL, respectively. Total immunoglobulin G levels were found to be elevated for the patient’s age (2650 mg/dL). In the peripheral blood smear, the presence of several abnormal giant inclusion bodies in the neutrophils (Figure 2) and single large inclusion bodies in most lymphocytes was observed. Bone marrow smear showed giant granules in the cytoplasm of the myeloid and monocytic cell series and revealed no blasts or hemophagocytoses. Although hemophagocytosis could not be demonstrated, the patient fulfilled the diagnostic criteria of HLH [5]. Thus, the accelerated phase of CHS was diagnosed on the basis of the

Address for Correspondence: Müsemma KARABEL, M.D., Dicle University Faculty of Medicine, Department of Pediatrics, Diyarbakır, Turkey Phone: +90 412 224 88 40 E-mail: musemma.alagoz@gmail.com Received/Geliş tarihi : August 21, 2013 Accepted/Kabul tarihi : November 5, 2013

313

Turk J Hematol 2014;31:313-314

Karabel M, et al: A Rare Cause of Recurrent Oral Lesions: Chediak-Higashi Syndrome

Figure 1. Decreased pigmentation in hair and skin.

The diagnosis of CHS should be considered in any child with recurrent unexplained gingivitis and periodontitis along with hypopigmentation of the hair, skin, and eyes, as in the presented case. These findings should alert physicians to the need to investigate giant granules in peripheral blood and bone marrow smears. Finally, early diagnosis and treatment of CHS in the stable phase is very important to prevent severe hematological and neurological complications later.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Key Words: Child, Chediak-higashi syndrome, Oral lesions Anahtar Sözcükler: Çocuk, Chediak-higashi sendromu, Oral lezyonlar References 1. Kumar P, Rao KS, Shashikala P, Chandrashekar HR, Banapurmath CR. Chediak-Higashi syndrome. Indian J Pediatr 2000:67:595-597.

2. Henter JI, Horne A, Aricó M, Egeler RM, Filipovich AH, Imashuku S, Ladisch S, McClain K, Webb D, Winiarski J, Janka G. HLH-2004: Diagnostic and therapeutic guidelines for hemophagocytic lymphohistiocytosis. Pediatr Blood Cancer 2007;48:124-131.

Figure 2. A neutrophil showing giant granules. clinical presentation and hematologic findings. The patient was treated with appropriate antibiotics and replacement therapy. She is currently under observation with continued symptomatic treatment and awaiting bone marrow transplantation. Informed consent was obtained.

The early diagnosis of recurrent oral lesions in CHS, particularly in relation with the stable phase, is still unclear.

Although recurrent infections, developmental delay, and progressive muscle weakness were present in our case since 1 year of age, it was striking that the main complaint of the patient was recurrent aphthous lesions in the mouth and sore gums. The patient had oral lesions since 1 year of age but was diagnosed in the accelerated phase of CHS at 11 years of age, which was very late compared to other patients with recurrent oral lesions [3,6]. Rezaei et al. [6] reported recurrent oral ulcers in 2/5 cases of CH1S with moderate neutropenia.

314

3. Kaya Z, Ehl S, Albayrak M, Maul-Pavicic A, Schwarz K, Kocak U, Ergun MA, Gursel T. A novel single point mutation of the LYST gene in two siblings with different phenotypic features of Chediak Higashi syndrome. Pediatr Blood Cancer 2011;56:1136-1139.

4. Dinauer MC, Newburger PE. The phagocyte system and disorders of granulopoiesis and granulocyte function. In: Orkin SH, Nathan DG, Ginsburg D, Look AT, Fisher DE, Lux SE (eds). Nathan and Oski’s Hematology of Infancy and Childhood. 7th ed. Philadelphia, Saunders Elsevier, 2009.

5.

Filipovich AH. Hemophagocytic lymphohistiocytosis (HLH) and related disorders. Hematology Am Soc Hematol Educ Program 2009:127-131.

6. Rezaei N, Farhoudi A, Ramyar A, Pourpak Z, Aghamohammadi A, Mohammadpour B, Moin M, Gharagozlou M, Movahedi M, Ghazi BM, Izadyar M, Mahmoudi M. Congenital neutropenia and primary immunodeficiency disorders: a survey of 26 Iranian patients.

J Pediatr Hematol Oncol 2005;27:351-356.

DOI: 10.4274/tjh.2014.0013

Letter to the Editor

Renal Infiltration of Follicular Lymphoma Folliküler Lenfomada Renal İnfiltrasyon Ivan Petković1, Miljan Krstić2,3, Ivica Pejcić1,3, Svetislav Vrbić1,3, Slavica Stojnev2,3, Ana Cvetanović1, Mirjana Balić1, Mirjana Todorović1 1Niš

University Clinical Center, Clinic of Oncology, Department of Hematological Malignancies, Niš, Serbia University Clinical Center, Institute of Pathology, Niš, Serbia 3Niš University Faculty of Medicine, Niš, Serbia 2Niš

To the Editor, We present a case of renal infiltration of grade 3A follicular lymphoma (FL) mimicking renal cell carcinoma (RCC).

Chronic renal failure (CRF) was diagnosed in a 63-yearold male during routine health controls. Ultrasonography results emphasized a left renal mass. Multislice computed tomography (MSCT) confirmed the prior findings of a solid multilobular mass (48x46x79 mm), reduced kidney parenchyma, and intact surrounding lymph nodes (LNs) mimicking RCC. Without previous oncological evaluation, urologists performed nephrectomy. Histopathology revealed FL of grade 3A, with perirenal infiltration.

Immunohistochemistry was typical: CD79α+, CD20+, CD10+, MUM1-, Bcl-2+, Bcl-6+, cyclin D1-, CD23-, CD3, CD5-, CK AE1/AE3-, and EMA-, with a Ki-67 index of 20% (Figure 1). After surgery, the patient underwent a lymphoma staging procedure at our clinic. MSCT scans, bone marrow biopsy, and blood analysis results were within normal ranges. Only residual CRF was maintained and β2microglobulin level was 6.2 mg/L. The performed PET/ CT detected left-sided paravertebral (Th4, Th5) and axilla LNs [standardized uptake value (SUV) max: 7.4]. Since it was high-grade advanced FL with a Follicular International Prognostic Index (FLIPI) score of 2, we conducted 8 R-CHOP induction cycles (left ventricular ejection fraction: 70%). Posttreatment PET/CT verified complete response.

Informed consent was obtained from the patient.

Primary renal lymphoma (PRL) is defined as lymphoma arising in the renal parenchyma and not invasion from an adjacent lymphomatous mass [1]. Since the kidney is not a lymphoid organ, proposed mechanisms may include dissemination from subcapsular lymphatics, retroperitoneal lymphoma extension, or lymphoplasmacytic infiltrative inflammatory kidney disease [2]. PRL may be associated with some acute or chronic diseases (chronic pyelonephritis, Sjögren’s syndrome, systemic erythematous lupus, or Epstein–Barr virus infection) [3].

PRL is a systemic disease manifesting initially in the kidneys, with poor outcome even if localized. It disseminates rapidly and mean survival is less than 1 year after diagnosis [4]. Renal involvement is seen in disseminated disease or in relapse. PRL is mostly of diffuse large B-cell lymphoma (DLBCL) type, while FL is exceptionally unusual, with scarce literature data.

Standardized PRL treatment is undefined. R-CHOP could be the elective treatment according to experience and some recently published studies [5,6]. Improved overall survival (OS) in FL with the addition of rituximab to conventional chemotherapy is well documented. High-grade FL and SUV were our major arguments for applying anthracyclines. We expected a better response rate (OS not improved) and reduced risk of FL transformation into DLBCL. The patient’s transforming status was speculated. Cardiotoxicity (early/ delayed) and salvage therapy selection were the opposing arguments.

Address for Correspondence: Ivan PETKOVIC, M.D., Niš University Clinical Center, Clinic of Oncology, Department of Hematological Malignancies, Niš, Serbia Phone: +381 063 80 20 581 E-mail: ivan76.unsu@yahoo.com Received/Geliş tarihi : January 10, 2014 Accepted/Kabul tarihi : March 17, 2014

315

Turk J Hematol 2014;31:315-316

Petković I, et al: Renal Infiltration of Follicular Lymphoma

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Key Words: Primary renal lymphoma, Follicular lymphoma, Treatment option Figure 1. A, B, C) Representative H&E stain photomicrographs of the kidney with grade 3A FL: A) typical follicular growth pattern in the kidney with FL, 40x; B) glomeruli immersed in diffuse lymphomatous mass of FL, 100x; C) glomerulus and renal diffuse lymphoma infiltration, 400x. D, E, F) Immunohistochemical staining representative for FL, 200x: D) diffuse positivity to CD20; E) intense staining of germinal center of neoplastic follicle with Bcl-2; F) Ki-67 proliferative activity (about20%), 339x169 mm (72x72 DPI).

Long-term survivors occasionally have been reported after combined complete resection surgery/chemotherapy treatment, with longer disease-free survival and OS, but only one with kidney involvement [1,7]. The above-mentioned option is not the standard treatment. We advise that solid renal masses undergo biopsy and teamwork consideration (oncologists, radiologists, urologists) prior to eventual nephrectomy decisions.

In conclusion, solid renal lesions mimicking RCC may suggest underlying renal lymphoma infiltration. Although exceptionally uncommon, renal FL may be the pathological subtype. No standardized therapy exists in this specific situation. Rituximab with its documented survival benefit in FL is recommended to be included in the treatment regimen. The accompanying chemotherapy may depend on many variables, including ECOG performance status, patient age, FL grade, FLIPI index, and single-center decision.

316

Anahtar Sözcükler: Primer renal lenfoma, Foliküler lenfoma, Tedavi seçeneği References 1. Okuno SH, Hoyer JD, Ristow K, Witzig TE. Primary renal non-Hodgkin’s lymphoma. An unusual extranodal site.

Cancer 1995;75:2258-2261.

2. Omer HA, Hussein MR. Primary renal lymphoma.

Nephrology (Carlton) 2007;12:314-315.

3. Stallone G, Infante B, Manno C, Campobasso N, Pannarale G, Schena FP. Primary renal lymphoma does exist: case report and review of the literature. J Nephrol 2000;13:367372.

4. Skarin A. Uncommon presentation of non-Hodgkin’s lymphoma. Case 3. Primary renal lymphoma. J Clin Oncol 2003;21:564-569.

5. Belbaraka R, Elyoubi MB, Boutayeb S, Errihani H. Primary renal non-Hodgkin lymphoma: an unusual diagnosis for a renal mass. Indian J Cancer 2011;48:255-256.

6. Vazquez Alonso F, Sanchez Ramos C, Vicente Prados FJ, Pascual Geler M, Ruiz Carazo E, Becerra Massare P, Funes Padilla C, Rodriguez Herrera F, Cozar Olmo JM, Tallada Bunuel M. Primary renal lymphoma: report of three new cases and literature review. Arch Esp Urol 2009;62:461465.

7. Cupisti A, Riccioni R, Carulli G, Paoletti S, Tognetti A, Meola M, Francesca F, Barsotti G, Petrini M. Bilateral primary renal lymphoma treated by surgery and chemotherapy. Nephrol Dial Transplant 2004;19:1629-1633.

DOI: 10.4274/tjh.2014.0102

Letter to the Editor

Hemoglobin Lansing (Alpha) [HBA2 CD87 (HIS>GLU) (C>A)] in a Turkish Individual Resulting from Another Nucleotide Substitution Bir Türk Bireyde Başka Bir Nükleotid Substitusyonu Sonucu Gelişen Hemoglobin Lansing (Alpha) [HBA2 CD87 (HIS>GLU) (C>A)] Nejat Akar1, Didem Torun2, Ayşenur Öztürk2 1TOBB-ETU 2Ankara

Hospital, Clinic of Pediatrics, Ankara, Turkey University Faculty of Medicine, Department of Pediatric Molecular Genetics, Ankara, Turkey

To the Editor, Several hemoglobin variants, including novel ones, have been reported in the Turkish population [1,2,3]. Herein, we describe a novel nucleotide alteration of the alpha-2 chain variant, hemoglobin (Hb) Lansing CD87 (HIS>GLU).

The index case was a 21-year-old Turkish woman living in Ankara. She was admitted to the TOBB-ETU University Pediatrics Outpatient Department for premarital counseling. Her physical examination was normal.

Hemoglobin, hematocrit, and MCV values were 13.1 g/dL, 42.7%, and 95 fL, respectively. Levels of Hb A1, Hb A2, and Hb X were observed as 65.5%, 1.88%, and 22.24%, respectively, with high-pressure liquid chromatography.

Written informed consent for genetic analysis was obtained from the patient.

DNA was isolated from a peripheral blood sample with the phenol-chloroform protocol. All of the exons of the HBB, HBA1, and HBA2 genes were amplified by polymerase chain reaction (PCR). The entire coding and intronic sequences of the alpha-1 and alpha-2 globin genes were amplified as one amplicon each. While the forward primer was the same for the 2 genes, the reverse primers were specific to the alpha-1 and alpha-2 genes. These amplicons were

sequenced using internal primers as described previously [4,5]. PCR products were cleaned with a PCR purification kit (Roche, Germany) and then samples were sequenced using an automatic DNA Sequencer (Beckman Coulter, USA). The DNA was also tested for the -α3.7, -α4.2, -MED, and -α20.5 deletions using multiplex PCR according to the described methods [6,7].

Figure 1. HbA2 gene 264 C>A transition at exon 2.

84 85 86 87 88 89

Address for Correspondence: Didem TORUN, M.D., Ankara University Faculty of Medicine, Department of Pediatric Molecular Genetics, Ankara, Turkey E-mail: didemtorun@gmail.com Received/Geliş tarihi : March 4, 2014 Accepted/Kabul tarihi : April 14, 2014

317

Turk J Hematol 2014;31:317-318

A novel missense mutation was found in codon 87 (CAC>CAA) in the heterozygous state. The sequencing data showed the variant as a mutation at codon 87 of C changing to A, leading to histidine substitution to glutamine, which was not previously described (Figure 1).

There is only one mutation reported at codon 87 of the alpha-2 gene by Sarikonda et al. They reported a missense mutation at alpha-2 gene codon 87 with substitution of CAC to CAG (His>Gln) and they named this variant Hb Lansing [5]. The reported patient showed the heterozygous form and was asymptomatic with low pulse oximeter readings in the index case. Arterial blood gas showed an O2 saturation of 98% on room air [8]. The proportion of the variant in family members was between 10.6% and 24.2% [6]. Our patient was also asymptomatic. However, we did not have the chance to further investigate the patient for these above-mentioned clinical symptoms. Other than this, in Asia, Ishitsuka et al. reported a case of Hb Lansing detected by false low oxygen saturation on pulse oximetry [7].

The variant that we describe is identical in its protein structure to Hb Lansing. In both cases, the nucleotide change in codon 87 leads to a glutamine residue: CAA in our case and CAG in Hb Lansing. In human coding regions, CAG is much more common in terms of frequency of usage per thousand (32.95) and relative frequency among synonymous codons (0.73). For CAA, these values are 11.94 and 0.27, respectively.

Therefore, this case is described with codon usage bias [8]. A similar situation was also reported previously in the case of Hb Niigata. Hb Niigata is an alteration of valine to leucine at beta-globin gene codon 1 with a nucleotide change of G>C/T, which was reported in a Japanese and a Romanian.

Moradkhani et al. named the variant of the Romanian individual Hb Niigata (C) [9,10]. Located in different genes, the Hb Niigata and Hb Lansing variants can be explained by the wobble hypothesis. According to the wobble hypothesis, base pairs are relaxed at the third position, so a base can pair with more than one complementary base. In these variants, changes occur in the third base (CAA>CAG) [11].

As Hb Lansing was reported previously, we named this new variant Hb Lansing (A).

Since Turkey is located at the intersection of 3 continents, it is not surprising that many different hemoglobin variants are observed.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

318

Akar N, et al: Hb Lansing (A) [HBA2 CD87 (HIS>GLU) (C>A)]

Key Words: Hb Lansing, Abnormal hemoglobin, Alpha-globin Anahtar Sözcükler: Hb Lansing, Anormal hemoglobin, Alfa globin References 1. Dungul DC, Ozdag H, Akar N. Hemoglobin alpha 2 gene +861 G>A polymorphism in Turkish population. Egyptian Journal of Medical Human Genetics 2011;12:59-62.

2. Akar E, Ozdemir S, Timur IH, Akar N. First observation of homozygous hemoglobin Hamadan (B 56 (D7) GLYARG) and beta thalassemia (-29 G>A)-hemoglobin Hamadan combination in a Turkish family. Am J Hematol 2003;74:280-282.

3. Oron-Karni V, Filon D, Oppenheim A, Rund D. Rapid detection of the common Mediterranean alpha-globin deletions/rearrangements using PCR. Am J Hematol 1998;58:306-310.

4. Tan AS, Quah TC, Low PS, Chong SS. A rapid and reliable 7-deletion multiplex polymerase chain reaction assay for α-thalassemia. Blood 2001;98:250-251.

5. Sarikonda KV, Ribeiro RS, Herrick JL, Hoyer JD. Hemoglobin Lansing: a novel hemoglobin variant causing falsely decreased oxygen saturation by pulse oximetry. Am J Hematol 2009;84:541.

6. Pennsylvania State University. Globin Gene Server. http:// globin.bx.psu.edu/cgi-bin/hbvar/.

7. Ishitsuka K, Uchino J, Kato J, Ikuta M, Watanabe K, Matsunaga A, Tamura K. First reported case of hemoglobin Lansing in Asia detected by false low oxygen saturation on pulse oximetry. Int J Hematol 2012;95:731-773.

8. Guigo R. DNA composition, codon usage and exon prediction. In: Bishop MJ (ed). Genetic Databases. San Diego, CA, USA, Academic Press, 1999.

9. Ohba Y, Hattori Y, Sakata S, Yamashiro Y, Okayama N, Hirano T, Nakanishi T, Miyazaki A, Shimizu A. Hb Niigata [β1 (NA1) Val-->Leu]: the fifth variant with retention of the initiator methionine and partial acetylation. Hemoglobin 1997;21:179-186.

10. Moradkhani K, Henthorn J, Riou J, Phelan L, Prehu C, Wajcman H. Hb Niigata [β1(NA1)Val-->Leu] in a Romanian individual resulting from another nucleotide substitution than that found in the Japanese. Hemoglobin 2007;31:477-482.

11.

Crick FHC. Codon-anticodon pairing: the wobble hypothesis. J Mol Biol 1966;19:548-555.

DOI: 10.4274/tjh.2014.0027

Letter to the Editor

First Observation of Hemoglobin Jabalpur [Beta 3 (NA3) Leu>Pro] in the Turkish Population Türk Toplumunda İlk Gözlemlenen Hemoglobin Jabalpur [Beta 3 (NA3) Leu>Pro] Ayfer Çolak1, Burak Toprak1, Kanay Yararbaş2, Fatma Akyol1, Cengiz Ceylan3 1Tepecik

Teaching and Research Hospital, Clinic of Clinical Biochemistry, İzmir, Turkey Laboratory Group, İstanbul, Turkey 3Tepecik Teaching and Research Hospital, Clinic of Hematology, İzmir, Turkey 2Düzen

To the Editor, Hemoglobin Jabalpur [beta 3(NA3) Leu>Pro] is a rare hemoglobin variant previously described in the HBVar database of the Globin Gene Server [1]. In the present paper we report Hb Jabalpur identified in a Turkish family. This is the first report of Hb Jabalpur in the Turkish population.

The patient was an asymptomatic 19-year-old male who presented to the outpatient hematology clinic for further evaluation of mild anemia. On physical examination the patient’s liver and spleen were not palpable. The patient’s complete blood cell count showed a hemoglobin level of 116 g/L (Table 1). Cation-exchange high-performance liquid chromatography, which was performed using the Primus Ultra2 Hb variant analyzer (Trinity Biotech, Dublin, Ireland), showed abnormal hemoglobin amounting to 30.9% of total hemoglobin. Hb Jabalpur was eluted immediately before Hb A0 in the Hb A window.

Using direct Sanger sequencing (ABI 3130 Genetic Analyzer, Applied Biosystems, Foster City, CA, USA), we characterized the Hb variant as resulting from a CTG>CCG (c.11T>C, p.L4P, rs63750720, NCBI refSeq: NG_000007.3) replacement at codon 3 of the β-globin chain, corresponding to a Leu→Pro amino acid substitution (Figure 1). This mutation is not listed in the Human Gene Mutation Database as a disease-causing mutation, while it is present in the Hemoglobin Variation Database (HbVar: A Database

of Human Hemoglobin Variants and Thalassemias) as Hb variant Jabalpur. Informed consent was obtained.

The parents of the patient were also available for evaluation. DNA sequencing and chromatography analysis revealed that the mother also had Hb Jabalpur. The mother was found to have mild anemia (Hb: 107g/L) and no clinical symptoms were detected (Table 1).

The index patient and his mother were living in İzmir, in the Aegean region of Turkey. Hb Jabalpur was detected in another patient of Pakistani origin with compound heterozygous beta zero thalassemia, and moderate anemia (Hb: 97g/L) was also observed in that patient (Gallivan M 2010, personal communication). In the present report, both the index patient and his mother presented with mild anemia.

It is known that the prevalence of the beta-thalassemia carrier state is high in Turkey; furthermore, several rare hemoglobin variants were previously reported. Hb Jabalpur and many rare hemoglobin variants generally do not produce clinical symptoms, but the consequences of the interaction between Hb variants and beta-thalassemia may be clinically important.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Address for Correspondence: Burak TOPRAK, M.D., Tepecik Teaching and Research Hospital, Department of Clinical Biochemistry, İzmir, Turkey Phone: +90 232 469 69 69 E-mail: beiot@hotmail.com Received/Geliş tarihi : January 20, 2014 Accepted/Kabul tarihi : April 18, 2014

319

Turk J Hematol 2014;31:319-320

Çolak A, et al: Hb Jabalpur in a Turkish Male

Figure 1. DNA sequencing data showing Hb Jabalpur.

Table 1. Hematological data of index patient and his mother.

Hb (g/L)

RBC (1012/L)

MCV (fL) MCH (pg)

MCHC (g/dL) RDW (%)

Index patient

116

4.88

76

23.7

31.2

14.1

Mother

107

3.99

84.8

26.8

31.6

15

Key Words: Hemoglobinopathy, Hb Jabalpur, Highperformance liquid chromatography Anahtar Sözcükler: Hemoglobinopati, Hb Jabalpur, Yüksek performanslı sıvı kromatografisi References 1. Hardison RC, Chui DH, Giardine B, Riemer C, Patrinos GP, Anagnou N, Miller W, Wajcman H. HbVar: a relational database of human hemoglobin variants and thalassemia mutations at the globin gene server. Hum Mutat 2002;19:225-233.

320

DOI: 10.4274/tjh.2013.0315

Letter to the Editor

Multiple Liver and Muscle Abscesses and Sepsis with Bacillus pantothenticus in a Leukemia Patient Bir Lösemi Hastasında Bacillus pantothenticus ile Multipl Karaciğer ve Kas Abseleri Elif Gülsüm Ümit1, Hasan Celalettin Ümit2, Figen Kuloğlu3, Ahmet Muzaffer Demir1 1Trakya

University Faculty of Medicine, Department of Hematology, Edirne, Turkey University Faculty of Medicine, Department of Gastroenterology, Edirne, Turkey 2Trakya University Faculty of Medicine, Department of Infectious Diseases, Edirne, Turkey 2Trakya

To the Editor, Bacilli infections in patients with hematological disorders have been reported, although rare, and subtypes such as Bacillus pantothenticus have been reported in immunocompetent patients with liver abscess [1]. Here we present a case of acute myeloid leukemia and multiple liver and muscle abscesses and sepsis with B. pantothenticus during the neutropenic period, treated successfully with meropenem. Informed consent was obtained.

A 49-year-old male patient diagnosed with acute myeloid leukemia was started on remission induction chemotherapy with cytosine arabinoside and idarubicin (7+3). On day 8 of treatment, he had severe neutropenia (40/mm3) and fever (40.0 °C). His physical examination was normal, without organomegaly or tenderness, revealing no hints regarding the source of infection. According to the American Society of Clinical Oncology guidelines for febrile neutropenia, cefepime was started empirically at 2 g 3 times daily after blood and urine samples for culture had been obtained. After 48 h, the patient still had fever (38.3 to 39.4 °C) as tested 6 times a day. The antibiotherapy was switched to meropenem at 1 g 3 times daily following a second set of samples for culture.

Fever persisted despite 48 h of meropenem treatment. Serum galactomannan antigen was negative. Thorax computerized tomography revealed no lung infection but multiple masses were seen in the liver (the largest being 3 cm). Magnetic

resonance imaging indicated multiple liver abscesses with central necrosis and peripheral contrast enhancement with a single focus of abscess localized in the right paravertebral muscle groups with similar properties (Figure 1).

Figure 1. A-B-C: Multiple liver abscesses are seen D: Single focus of abscessin the left paravertebral muscle is seen.

Address for Correspondence: Elif Gülsüm ÜMİT, M.D., Trakya University Faculty of Medicine, Department of Hematology, Edirne, Turkey Phone: +90 505 396 39 96 E-mail: egulsumumit@trakya.edu.tr Received/Geliş tarihi : September 14, 2013 Accepted/Kabul tarihi : December 16, 2013

321

Turk J Hematol 2014;31:321-322

Ümit GE, et al: Multiple Liver and Muscle Abscesses and Sepsis with Bacillus pantothenticus in a Leukemia Patient

Percutaneous drainage was performed. A purulent, odorous material was obtained, showing polymorphonucleated neutrophils. The first set of blood cultures of the material remained negative. The second set of cultures was positive for B. pantothenticus susceptible to carbapenems, chloramphenicol, and vancomycin. The first set was incubated for 7 days only, which may be too short for slow-growing bacteria such as B. pantothenticus. On day 28 of meropenem treatment, follow-up magnetic resonance imaging showed no abscesses and only post-inflammatory changes.

Kuloğlu contributed analytic tools, and AM Demir analyzed and edited the paper.

Infections with bacilli in patients with hematological disorders have been reported, although subtypes such as B. pantothenticus are extremely rare [2]. During the neutropenic period, abscess formation is not common and it usually occurs after neutrophil recovery.

References

B. pantothenticus is a rare pathogen probably showing a tendency towards liver and muscle tissues, spreading in a hematogenous fashion; it may cause infection in both immunocompetent and immunocompromised hosts.

Author Contributions: EG Ümit performed the research and wrote the paper, HC Ümit contributed diagnostic tools, F

322

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Key Words: Leukemia, Infection, Liver abscess Anahtar Sözcükler: Lösemi, İnfeksiyon, Karaciğer absesi

1. Na JS, Kim TH, Kim HS, Park SH, Song HS, Cha SW, Yoon HJ. Liver abscess and sepsis with Bacillus pantothenticus in an immunocompetent patient: a first case report. World J Gastroenterol 2009;15:5360-5363.

2. Ozkocaman V, Ozcelik T, Ali R, Ozkalemkas F, Ozkan A, Ozakin C, Akalin H, Ursavas A, Coskun F, Ener B, Tunali A. Bacillus spp. among hospitalized patients with haematological malignancies: clinical features, epidemics and outcomes. J Hosp Infect 2006;64:169-176.

DOI: 10.4274/tjh.2013.0318

Letter to the Editor

A Systemic Lupus Erythematosus Patient with Isolated Neutropenia and Diminished Expression of CD55 and CD59 Similar to Paroxysmal Nocturnal Hemoglobinuria Nötropenisi Olan Sistemik Lupus Eritematodesli Bir Hastada Paroksismal Noktürnal Hemoglobinüri’ne Benzer Şekilde Azalmış CD55 ve CD59 İfadelenmesi Abdülkerim Yıldız, Merih Kızıl Çakar, Elif Suyanı, Gülsan Türköz Sucak Gazi University Faculty of Medicine, Department of Hematology, Ankara, Turkey

To the Editor, The association of systemic lupus erythematosus (SLE) and paroxysmal nocturnal hemoglobinuria (PNH) has been rarely reported [1,2]. However, diminished expression of CD55 and CD59 on red blood cells and lymphocytes has been demonstrated in SLE patients in the absence of PNH [3,4,5,6].

A 30-year-old female with a history of SLE was diagnosed with pulmonary artery embolism after being admitted to the hospital with sudden-onset dyspnea. She was treated with heparin, which was followed by warfarin. She also had a previous history of deep venous thrombosis of the left lower extremity while on oral contraceptives 2 years prior to the diagnosis of SLE. After the diagnosis of SLE, steroids and hydroxychloroquine were begun, which she stopped taking on her own. Blood cell counts revealed neutropenia with a white blood cell count of 2.32x109/L, neutrophil count of 0.94x109/L, lymphocyte count of 0.93x109/L, hemoglobin of 137 g/L, and platelet count of 254x109/L. Serum biochemistries were within normal limits. Immunological tests revealed positive antinuclear antibodies (3 positive, thin granular, spotted) and anti-dsDNA at a level of 587 IU/mL. Tests for antiphospholipid syndrome including

lupus anticoagulants, β2-glycoprotein I antibodies, and anticardiolipin and antiphospholipid antibodies were all negative. Genetic mutations for factor V Leiden and the prothrombin gene were negative. Proteins C and S and

Figure 1a. Diminished expression of CD59 on patient erythrocytes.

Address for Correspondence: Gülsan TÜRKÖZ SUCAK, M.D., Gazi University Faculty of Medicine, Department of Hematology, Ankara, Turkey Phone: +90 312 202 63 17 E-mail: aysucak@gazi.edu.tr Received/Geliş tarihi : September 16, 2013 Accepted/Kabul tarihi : November 01, 2013

323

Turk J Hematol 2014;31:323-324

Yıldız A, et al: A SLE Patient with Isolated Neutropenia and Diminished Expression of CD55 and CD59 Similar to PNH

lysis and might have contributed to the development of neutropenia. Our patient also had concomitant pulmonary embolism. To the best of our knowledge, diminished expression of CD55 and/or CD59 was not reported before in SLE patients with isolated neutropenia in the absence of PNH. Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Key Words: SLE, CD55, CD59, PNH Anahtar Sözcükler: SLE, CD55, CD59, PNH Figure 1b. Diminished expression of CD55 and CD59 on patient neutrophils. antithrombin III antigens were all within the reference range.

Flow cytometry analysis showed diminished expression of CD59 and CD55 in the neutrophils and erythrocytes in the absence of a discrete clone (Figures 1a and 1b).

The expressions of CD59 and CD55 on lymphocytes were normal. Informed consent was obtained.

PNH is characterized by the deficiency of glycosyl phosphatidylinositol-anchored proteins CD55 and CD59, leading to increased susceptibility to complement-mediated lysis of erythrocytes, leukocytes, and platelets. Diminished expression of CD55 and/or CD59 was previously reported in SLE patients with lymphopenia [4,5] and hemolytic anemia [3,6]. Antibodies against lymphocytes are claimed to cause lymphopenia via mechanisms including antibody-dependent cellular cytotoxicity, opsonization, surface receptor blockage, or apoptosis [5]. However, diminished expression of CD55 and/or CD59 leading to enhanced susceptibility to complement-mediated lysis might also have caused lymphopenia. Our patient had neutropenia with a normal lymphocyte count and did not seem to have PNH as she had no discrete PNH clone, despite diminished expression of CD59 on erythrocytes and CD55-CD59 expression on neutrophils. We think that the diminished expression of complement regulatory proteins in the presented patient might be secondary to SLE-derived autoantibodies, which might lead to complement-mediated cell (neutrophil)

324

References 1. Gupta A, Al Fulaij R, Gupta RK, Gupta G, Marouf R. Development of paroxysmal nocturnal haemoglobinuria in systemic lupus erythematosus: an unusual cause of portal vein thrombosis. Lupus 2009;18:743-746.

2. Tomizuka H, Hatake K, Kitagawa S, Yamashita K, Arai H, Miura Y. Portal vein thrombosis in paroxysmal nocturnal haemoglobinuria. Acta Haematol 1999;101:149-152.

3. Ruiz-Delgado GJ, Vázquez-Garza E, Méndez-Ramírez N, Gómez-Almaguer D. Abnormalities in the expression of CD55 and CD59 surface molecules on peripheral blood cells are not specific to paroxysmal nocturnal hemoglobinuria.

Hematology 2009;14:33-37.

4. García-Valladares I, Atisha-Fregoso Y, Richaud-Patin Y, JakezOcampo J, Soto-Vega E, Elías-López D, Carrillo-Maravilla E, Cabiedes J, Ruiz-Argüelles A, Llorente L. Diminished expression of complement regulatory proteins (CD55 and CD59) in lymphocytes from systemic lupus erythematosus patients with lymphopenia. Lupus 2006;15:600-605.

5. Ruiz-Argüelles A, Llorente L. The role of complement regulatory proteins (CD55 and CD59) in the pathogenesis of autoimmune hemocytopenias. Autoimmun Rev 2007;6:155-161.

6. Richaud-Patin Y, Pérez-Romano B, Carrillo-Maravilla E, Rodriguez AB, Simon AJ, Cabiedes J, Jakez-Ocampo J, Llorente L, Ruiz-Argüelles A. Deficiency of red cell bound CD55 and CD59 in patients with systemic lupus erythematosus. Immunol Lett 2003;88:95-99.

DOI: 10.4274/tjh.2013.0297

Letter to the Editor

Clofarabine Experience in Children with Multi-Relapsed Acute Leukemia Çoklu Relaps Yapan Akut Lösemili Çocuklarda Klofarabin Tecrübemiz Zeynep Karakaş, Begüm Şirin Koç, Serap Karaman, Sema Anak, Ayşegül Ünüvar, Ezgi Uysalol, Ömer Devecioğlu, Leyla Ağaoğlu, Gülyüz Öztürk İstanbul University İstanbul Faculty of Medicine, Department of Pediatric Hematology, Division Oncology, İstanbul, Turkey

To the Editor, Although clofarabine is known as an effective novel agent in relapsed acute leukemia [1,2,3,4,5], determining the optimum combination with other agents and the optimum time to use remains a challenge. Clofarabine is recommended to be used after 2 protocol regimens in patients with relapsed leukemia [1]. We want to add our experience with clofarabine in children with multi-relapsed acute lymphoblastic and myeloblastic leukemia. We analyzed the data of 12 children (1-13 years old) treated with the CLOVE protocol [clofarabine (4 mg/m2), cyclophosphamide (440 mg/m2), and etoposide (100 mg/m2) for 5 days] [2,3,4] for relapsed or refractory acute leukemia between 2009 and 2013. We used this therapy in a third or more of cases of relapsed acute leukemia. Bone marrow relapses were eligible for the treatment protocol. Seven of 12 patients had acute lymphoblastic leukemia (ALL) and 5 had acute myeloid leukemia (AML) (Table 1). Patients with relapsed ALL were treated with 1 or 2 cycles of FLAG after applying the BFM-95 REZ protocol. Patients with no response were administered clofarabine. Patients with relapsed AML were treated with 2 cycles of FLAG after applying the MRC protocol. Patients without response were given clofarabine in 1 or 2 cycles. The required permission for all patients was received from the Ministry of Health.

stem cell transplantation (HSCT) (Table 1). Of these 3 patients who had allogeneic HSCT after remission with the CLOVE protocol, all of them relapsed after the HSCT. One of them received a second allogeneic HSCT after the remission with the second therapy protocol with clofarabine; she relapsed again after the second HSCT. One patient had previously received allogeneic HSCT due to Ph (+) ALL; he relapsed after the HSCT and was unresponsive to the therapy protocol with clofarabine. Although clofarabine was effective to induce remission, overall survival was poor in our study. The 3-month and 12-month overall survival rates

Response to the Protocol Therapy with Clofarabine Clofarabine was effective at inducing remission in 6 patients (50%) and half of them received hematopoietic

Figure 1. The overall survival rates from start of clofarabine treatment.

Address for Correspondence: Begüm Şirin KOÇ, M.D., İstanbul University İstanbul Faculty of Medicine, Department of Pediatric Hematology, Division Oncology, İstanbul, Turkey Gsm: +90 505 906 27 91 E-mail: begumsirins@hotmail.com Received/Geliş tarihi : September 3, 2013 Accepted/Kabul tarihi : November 16, 2013

325

Turk J Hematol 2014;31:325-327

Karakaş Z, et al: Clofarabine Experience in Children with ALL

Table 1. Response summary of the patients.

Age at Lifetime No. clofarabine Sex Disease Remission HSCT after 1st therapy relapse

Lifetime after initial diagnosis

Lifetime from Outcome start of clofarabine

1

5 years

F

ALL

+

-

10 months

2 years

2.5 months

Ex

2

2.5 years

M

ALL

-

-

4 months

2 years

19 days

Ex

3

13 years

M

AML

+

+

3 years

4 years

15 months

Ex

4

11 years

M

AML

-

-

2 months

2 years

23 days

Ex

5

4 years

F

ALL

+

+

1.5 years

3 years

12 months

Ex

6

8 years

M

ALL

-

-

9 months

3 years

4.5 months

Ex

7

3 years

M

AML

+

-

7 months

2 years

7 months

Ex

8

2 years

M

AML

+

+

6 months

2 years

53 days

Ex

9

8 years

M

ALL

-

-

3 months

1 years

2.5 months

Ex

10

15 years

M

ALL

-

+

4 months

2 years

108 days

Ex

11

12 years

M

ALL

+

-

2 years

7 years

3 months

Ex

12

7 years

M

AML

-

-

6 months

6 months

30 days

Ex

from the start of clofarabine treatment were 45.5% and 9.1%, respectively (Figure 1). All of the patients relapsed again and eventually all of them died. Even though our remission rate is higher than the rate given in an earlier French study [6] (50% vs. 37%), we agree with that study about the earlier use of clofarabine.

Our experience with the adverse effects of a combination regimen with clofarabine was similar to that of Cooper et al. [1]. Toxicities were similar to those of other intensive chemotherapy regimens. The most common adverse event was prolonged neutropenia, which caused severe infections. The median length of absolute neutrophil count recovery was 40 days. All of the patients had severe bacterial (such as gram-negative septic shock) and invasive fungal infections. Only one patient died from severe infection, while the others were successfully treated. We also observed elevated liver enzymes in most of our patients (11/12); generally, the enzymes increased to 4-fold on day 5 and decreased to normal ranges after 2 weeks. One patient with refractory AML needed pediatric intensive care due to severe hepatotoxicity and veno-occlusive disease after clofarabine therapy.

Finally, no patient was alive at the end of our study.

All patients except one died from relapsed/refractory leukemia even though 4 of them had HSCT. Although we provided longer lifetimes using the therapy protocol with clofarabine for multi-relapsed acute leukemia, the patients 326

subsequently died from uncontrolled leukemia. Therefore, we suggest that clofarabine can be used at the first relapse in leukemia with minimal residual disease determination to obtain better results. The main question that remains is whether better outcomes could be obtained with earlier clofarabine therapy.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Key Words: Clofarabine, Multi-relapsed Leukemia, Children, Relaps Anahtar Sözcükler: Clofarabine, Çoklu relaps lösemi, Çocuk, Relaps References 1. Cooper TM, Razzouk BI, Gerbing R, Alonzo TA, Adlard K, Raetz E, Gamis AS, Perentesis J, Whitlock JA. Phase I/II trial of clofarabine and cytarabine in children with relapsed/ refractory acute lymphoblastic leukemia (AAML0523): report from the Children’s Oncology Group. Pediatr Blood Cancer 2013;60:1141-1147.

2. Hijiya N, Gaynon P, Berry E, Silverman L, Thomson B, Chu R, Cooper T, Kadota R, Rytting M, Steinherz P, Shen V, Jeha S, Abichandani R, Carroll WL. A multi-center phase 1 study of clofarabine, etoposide and cyclophosphamide in

Karakaş Z, et al: Clofarabine Experience in Children with ALL

combination in pediatric patients with refractory or relapsed acute leukemia. Leukemia 2009;23:2259-2264.

3. Miano M, Pistorio A, Putti MC, Dufour C, Messina C, Barisone E, Ziino O, Parasole R, Luciani M, Lo Nigro L, De Rossi G, Varotto S, Bertorello N, Petruzziello F, Calvillo M, Micalizzi C. Clofarabine, cyclophosphamide and etoposide for the treatment of relapsed or resistant acute leukemia in pediatric patients. Leuk Lymphoma 2012;53:1693-1698.

4. Locatelli F, Testi AM, Bernardo ME, Rizzari C, Bertaina A, Merli P, Pession A, Giraldi E, Parasole R, Barberi W, Zecca M. Clofarabine, cyclophosphamide and etoposide as single-

Turk J Hematol 2014;31:325-327

course re-induction therapy for children with refractory/ multiple relapsed acute lymphoblastic leukaemia. Br J Haematol 2009;47:371-378.

5. Hijiya N, Barry E, Arceci RJ. Clofarabine in pediatric acute leukemia: current findings and issues. Pediatr Blood Cancer 2012;59:417-422.

6. Trioche P, Nelken B, Michel G, Pellier I, Petit A, Bertrand Y, Rohrlich P, Schmitt C, Sirvent N, Boutard P, Margueritte G, Pautard B, Ducassou S, Plantaz D, Robert A, Thomas C, Desseaux K, Chevret S, Baruchel A. French “real life” experience of clofarabine in children with refractory or

327

DOI: 10.4274/tjh.2012.0198

Letter to the Editor

HBV and HCV Coinfection Associated with WarmType Autoimmune Hemolytic Anemia: A Case Report HBV ve HCV Koenfeksiyonu ile İlişkili Sıcak Tip Otoimmün Hemolitik Anemi: Bir Olgu Sunumu Quan-le Zhang1, Li-juan Jia1, Jin-biao Zhang2, Wei-min Li1, Yuan-kai Bo1, Jing-Li1 1Cangzhou 2Cangzhou

Hospital of Integrated Traditional Chinese and Western Medicine, Department of Internal Medicine, Cangzhou, Hebei, China Hospital of Integrated Traditional Chinese and Western Medicine, Clinical Laboratory, Cangzhou, Hebei, China

To the Editor, The hepatitis virus may play an important role in autoimmune hemolytic anemia (AIHA). We herein report the case of a patient presented to our hospital with hepatitis B virus (HBV) and hepatitis C virus (HCV) coinfection who developed warm-type AIHA. The anemia improved, followed by declined viral levels, after rituximab plus antiviral therapy.

To the best of our knowledge, this is the first reported case of HBV and HCV coinfection associated with warm-type AIHA. Written informed consent was obtained from the patient.

A 66-year-old woman presented to the department of internal medicine of our hospital on 31 August 2010 with jaundice, inappetence, dizziness, palpitation, and fatigue. A month before admission, the patient complained of fatigue and palpitation, particularly aggravated after exercise, but she did not pay attention to it due to relief of these symptoms at rest. Three weeks later, the patient felt inappetence and dizziness, and her fatigue and palpitation did not go into remission at rest. Her daughter noticed her jaundice at this point and directed her to our hospital. She did not have past medical history of diffuse connective disease, lymphoproliferative disease, transfusion, favism, or allergic contact dermatitis. She had no related social history of cigarette, alcohol, or drug use. Her general physical examination revealed icteric skin and sclerae. Her abdominal examination showed a slightly increased spleen located in

the left-upper abdomen. Complete blood count showed severe decrease of red blood cell count (1.39x1012/L), hemoglobin (53 g/L), and platelet count (73x109/L), in addition to significantly increased reticulocyte percentage (19%). Blood biochemistry revealed elevated total bilirubin (6.62 mg/dL), unconjugated bilirubin (4.95 mg/dL), and lactic dehydrogenase (528 U/L), with remarkable decrease of haptoglobin (0.3 g/L). The immunological test displayed

Figure 1. Characteristics of the bone marrow cell morphology: active myelosis and erythropoiesis (stain, Wright; original magnification, 100x).

Address for Correspondence: Yuan-kai BO, M.D., Cangzhou Hospital of Integrated Traditional Chinese and Western Medicine, Department of Internal Medicine, Cangzhou, Hebei, China Phone: ++86-317-3521970 E-mail: zhangquanle2008@hotmail.com Received/Geliş tarihi : December 15, 2012 Accepted/Kabul tarihi : April 30, 2013

328

Turk J Hematol 2014;31:328-331

Zhang Q, et al: A Case Report on HBV and HCV Coinfection with AIHA

positive direct or indirect Coombs results, with warm-type IgG titer against surface antigens of red blood cells elevated.

Serologic tests revealed positive HBs-antigen and HCVantibody, whereas rubella virus, cytomegalovirus, herpes simplex virus, and hepatitis A and E virus were all negative.

Subsequently, the quantitative virus analysis showed a significant increase in HBV DNA copies (1.57x107 copies/ mL) and HCV RNA copies (1.03x106 copies/mL). Serology testing was negative for factors such as ANA, SMA, antidsDNA, anti-RNP, or anti-PNCA (Table 1). Ultrasound of the abdomen showed mild splenomegaly. No imaging characteristic of lymphadenovarix was displayed. The bone marrow aspirate revealed active myelosis and erythropoiesis (Figure 1). Liver biopsy was not performed.

After much consideration, the initial treatment strategy was steroid medication. Oral prednisone at 50 mg/day (1.0 mg/kg) was thus begun. In light of the possibility of aggravated symptoms stemming from single replication of HBV or HCV, or concurrent replication by prednisone, we recommended that the patient meanwhile take oral lamivudine (100 mg/day) and ribavirin (800 mg/day). The patient’s clinical manifestation improved at first. However, it then deteriorated with bilirubin, reticulocyte percentage, and lactic dehydrogenase increasing and red blood cell count, hemoglobin, and haptoglobin decreasing at day 5.

Review immunological testing displayed a higher IgG titer, but no significant change of HBV or HCV quantification was demonstrated. Most likely, the treatment failure could

Table 1. Laboratory data.

Index

Day 1

Day 5

Day 12

Day 33

Month 2 Month 6 Month 20

RBC (1012/L)

1.39

1.12

3.25

4.58

4.12

4.3

4.79

Hb (g/L)

53

41

79

120

115

132

121

Platelets (10 /L)

73

67

74

111

267

201

273

Haptoglobin (g/L)

0.3

0.1

1.2

1.4

1.1

0.9

1.2

Reticulocyte percentage (%)

19

23

4

1.2

0.7

0.9

1.3

Total bilirubin (mg/dL)

6.62

11.61

4.59

1.91

0.61

0.75

0.66

Unconjugated bilirubin (mg/ dL)

4.95

7.97

2.09

1.24

0.33

0.48

0.42

Conjugated bilirubin (mg/dL)

1.67

3.64

2.50

0.67

0.28

0.27

0.24

LDH (U/L)

528

719

428

201

187

238

192

Rubella virus

negative

—

—

—

—

—

—

Cytomegalovirus

negative

—

—

—

—

—

—

Herpes simplex virus

negative

—

—

—

—

—

—

HAV-antibody

negative

—

—

—

—

—

—

HBs-antigen

positive

—

—

positive

positive

positive

positive

HCV-antibody

positive

—

—

positive

positive

positive

positive

HEV-antibody

negative

—

—

—

—

—

—

HBV-DNA quantification (copies/mL)

1.57x107

1.24x107

—

4.25x104

2.31x103

<1000

<1000

HCV-RNA quantification (copies/mL)

1.03x106

1.22x106

—

5.24x105

1.74x105

7.81x103

1.79x103

Direct or indirect Coombs test

positive

positive

negative

negative

negative

negative

negative

IgG titer

1:128

1:256

—

—

—

—

—

ANA

negative

—

—

—

—

—

—

anti-dsDNA

negative

—

—

—

—

—

—

anti-RNP

negative

—

—

—

—

—

—

anti-PNCA

negative

—

—

—

—

—

—

9

329

Turk J Hematol 2014;31:328-331

be ascribed to the potential steroid resistance in this case.

Rituximab was recommended for this patient because of refusal of other immunosuppressants (azathioprine, cyclosporine, or MMF) or intravenous immunoglobulin upon informed consent. An impressive rapid remission of clinical manifestations occurred in the patient after this amended treatment, and laboratory data were improved at day 12 after admission, which allowed us to discharge her to home as an outpatient for further management.

Rituximab was not ceased until follow-up day 33, when the anemia disappeared and Coombs testing became negative.

At 20 months of follow-up, as of present, antiviral therapy still continued although the loads of the 2 viruses were significantly lower than on initial admission (Table 1).

An association between virus infection and AIHA has long been recognized. A few reports have analyzed the role of hepatitis virus in the initiation or development of AIHA. Tibble et al. [1] presented the first reported case of acute hepatitis A that resulted in acute autoimmune hemolytic anemia. Chiao et al. [2] presented 90 cases of AIHA among 120,908 US veterans with HCV. Yoshioka et al. [3] reported on a 2-year-old Japanese boy diagnosed with warm-type AIHA as an asymptomatic carrier of HBV. However, hepatitis virus coinfection associated with AIHA has rarely been reported. In particular, there is a lack of relevant reports on the relationship between HBV/HCV coinfection and AIHA, in addition to its treatment, although coinfection may have happened via shared routes of transmission in the course of blood exposure in some HBV/HCV-prevailing countries, such as China, Turkey, or Japan. For this patient, we speculated that the occurrence and development of AIHA most likely originated in HBV or HCV infection, for the following reasons. First of all, the patient had no past medical or social history. Second, laboratory data revealed positive HBs-antigen and HCV-antibody, and elevated copies of HBV or HCV, excluding coinfection with other viruses (e.g., HAV, HDV, or HEV). Ultrasound examination did not reveal characteristics of lymphadenovarix. Finally, previous reports have illustrated that HBV or HCV may exert significant roles in the development of AIHA. Nevertheless, it is not yet clear whether HBV or HCV has a synergistic effect in the pathogenesis of AIHA. The primary management of AIHA is via corticosteroid medication [4,5]. Unfortunately, our patient’s clinical manifestation deteriorated at day 5 after admission. We ascribed the treatment failure to potential steroid resistance in this case. It was necessary to resort to other therapy options. In consideration of more recent data showing that patients with AIHA respond well to rituximab (375 mg/m2) treatment, irrespective of the type of prior treatments that they have received [6,7], rituximab was recommended for our patient. An expedited remission of clinical manifestation occurred in the patient, and laboratory data were improved at day 12 after admission.

330

Zhang Q, et al: A Case Report on HBV and HCV Coinfection with AIHA

It is generally accepted that viruses may be reactivated by immunosuppressants, including corticosteroids. Thus, antiviral therapy was deemed a necessary treatment measure for HBV-infected patients in the course of immunosuppressive therapy, as evidenced by many related studies that revealed that anti-HBV therapy can reduce the high risk of virus reactivation, all other factors being equal. In addition, on the basis of the above-mentioned assumption that the etiology of the patient is HBV or HCV infection, antiviral therapy, as a therapeutic method that can eliminate or inhibit pathogens, seems to be of great importance. However, there were no associated reports in terms of antiviral therapy in HBV and HCV coinfection. A study by Dufour et al. [8] revealed that important management of AIHA associated with viral infection entailed antiviral therapy. Additionally, the current evidence suggests that ribavirin might be tolerated in treatment of HCV infection in thalassemia major patients [9]. Consequently, lamivudine, together with low-dose ribavirin, was applied to treat our patient.

However, pegylated alpha-2a interferon was not used, because pegylated alpha-2a interferon can induce lifethreatening autoimmune hemolytic anemia. The index of improved anemia was related to the decrease of virus load by continued antiviral medication after withdrawal of rituximab therapy, which fit our expectations.

In closing, we have herein reported the case of a patient with warm-type AIHA that derived from HBV and HCV coinfection. The anemia improved and viral load rapidly declined after rituximab with antiviral therapy. To the best of our knowledge, this is the first reported case of HBV and HCV coinfection with AIHA. More importantly, it is hoped that the treatment strategy in this case might provide a reference for similar cases.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Key Words: HBV, HCV, Autoimmune hemolytic anemia Anahtar Sözcükler: HBV, HCV, Otoimmün hemolitik anemi References 1. Tibble JA, Ireland A, Duncan JR. Acute auto immune haemolytic anaemia secondary to hepatitis A infection. Clin Lab Haematol 1997;19:73-75.

2. Chiao EY, Engels EA, Kramer JR, Pietz K, Henderson L, Giordano TP, Landgren O. Risk of immune thrombocytopenic purpura and autoimmune hemolytic anemia among 120,908 US veterans with hepatitis C virus infection. Arch Intern Med 2009;23:357-363.

Zhang Q, et al: A Case Report on HBV and HCV Coinfection with AIHA

3. Yoshioka K, Miyata H. Autoimmune haemolytic anaemia in an asymptomatic carrier of hepatitis B virus. Arch Dis Child 1980;55:233-234.

4. Valent P, Lechner K. Diagnosis and treatment of autoimmune haemolytic anaemias in adults: a clinical review. Wien Klin Wochenschr 2008;120:136-151.

5. Michel M. Classification and therapeutic approaches in autoimmune hemolytic anemia: an update. Expert Rev Hematol 2011;4:607-618.

6. Garvey B. Rituximab in the treatment of autoimmune haematological disorders. Br J Haematol 2008;141:149169.

Turk J Hematol 2014;31:328-331

8. Dufour JF, Pradat P, Ruivard M, Hot A, Dumontet C, Broussolle C, Trepo C, Seve P. Severe autoimmune cytopenias in treatment-naive hepatitis C virus infection: clinical description of 16 cases. Eur J Gastroenterol Hepatol 2009;21:245-253.

9. Tabatabaei SV, Alavian SM, Keshvari M, Behnava B, Miri SM, Karimi Elizee P, Zamani F, Amini Kafiabad S, Gharehbaghian A, Hajibeigy B, Lankarani KB. Low dose ribavirin for treatment of hepatitis C virus infected thalassemia major patients; new indications for combination therapy. Hepat Mon 2012;12:372-381.

7. Zaja F, Iacona I, Masolini P, Russo D, Sperotto A, Prosdocimo S, Patriarca F, de Vita S, Regazzi M, Baccarani M, Fanin R. B-cell depletion with rituximab as treatment for immune hemolytic anemia and chronic thrombocytopenia.

Haematologica 2002;87:189-195.

331

DOI: 10.4274/tjh.2013.0432

Letter to the Editor

Central Nervous System Involvement in Primary Adrenal Non-Hodgkin Lymphoma Primer Böbrek Üstü Bezi Hodgkin Dışı Lenfomasında Merkezi Sinir Sistemi Tutulumu Padhi Somanath1, Sahoo Jayaprakash2 1Pondicherry 2Jawaharlal

Institute of Medical Sciences (P.I.M.S), Department of Pathology, Pondicherry, India Institute of Postgraduate Medical Education and Research, Department of Endocrinology and Metabolism, Pondicherry, India

To the Editor, We read with great interest the case report of central nervous system (CNS) involvement in primary adrenal lymphoma (PAL) in an elderly, HIV-seronegative male patient

by Aydın et al. in the December issue of your journal [1]. In spite of initial partial regression of the CNS lesion, the patient succumbed to progressive CNS disease after rituximabbased chemotherapy and whole-brain radiotherapy. Though the pathogenesis and therapeutic aspects of this lymphoma at both anatomic sites were highlighted, there was a lack of precise information regarding adrenal function (prior autoimmune adrenalitis) and detailed immunophenotype of PAL (germinal center or non-germinal center), which could have also influenced the clinical outcome in this patient.

PAL is an enigmatic entity with nearly 200 cases reported in the world literature up to 2013 [2,3]. Out of all parameters studied, adrenal insufficiency, high lactate dehydrogenase (LDH), B symptoms, and initiation of chemotherapy have been reported to be the significant independent predictors of poor prognosis in PAL. Secondary CNS involvement is known to occur in 2%-10% cases of diffuse large B-cell lymphoma (DLBCL) and confers a poor prognosis [3]. Of all reported cases of PAL (1980-2013, including the case by Aydın et al.), 18 patients had CNS involvement [7 (39%) at presentation, 11 (61%) at relapse (within 6 months of diagnosis)]. Their mean age was 63.8 years (range: 42 to 82

years), 17/18 (94.5%) were male, 16/16 (100%) had bilateral PAL, 10/13 (77%) had a mean lesion size of 5 cm or more, 3/18 (16.6%) had disseminated disease at presentation, 1/18 (5.5%) had coexistent secondary involvement of thyroid, 9/11 (82%) had adrenal insufficiency, 11/13 (84.6%) had elevated LDH, and 11/14 (78.5%) had B symptoms. Thirteen of 18 (72%) had DLBCL, 2 had peripheral T-cell lymphoma, 1 had Burkitt-like lymphoma, and the remaining 2 (11%) had non-Hodgkin lymphoma unclassified [2,3] (Table 1).

Though patients with PAL are at risk of CNS involvement, there has been no consensus, at present, regarding CNSdirected prophylaxis in these patients. As most of the reported CNS events in PAL cases occurred prior to the rituximab era, larger in-depth prospective studies in the post-rituximab era will, hopefully, throw more light on this topic in future.

Conflict of Interest Statement The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Address for Correspondence: Padhi SOMANATH, M.D., Pondicherry Institute of Medical Sciences (P.I.M.S), Department of Pathology, Pondicherry, India Phone: +591-413-2025212 Received/Geliş tarihi : December 26, 2013 Accepted/Kabul tarihi : December 30, 2013

332

Key Words: Primary adrenal non-Hodgkin lymphoma, Central nervous system, Prognosis, Therapy Anahtar Sözcükler: Primer adrenal non-Hodgkin lenfoma, Merkezi sinir sistemi, Prognoz, Terapi

Somanath P, et al: Central Nervous System Involvement in Primary Adrenal Non-Hodgkin Lymphoma

Turk J Hematol 2014;31:332-334

Table 1. Central nervous system involvement in primary adrenal non-Hodgkin lymphoma (PAL): review of literature (1980-2013, n=18).

Case no., year, place

Age (years)/ sex

Adrenal lesion

Mean size (cm)

AI/LDH†/B symptoms

1, 1983, USA

58/M

B/L

NA

NA

+

2, 1983, Japan

44/M

B/L

NA

NA

3, 1986, USA

74/M

B/L

<5

+

CNS involvement

Histology

Therapy

Outcome

+

At presentation

NHL, widespread

None

Death

NA

-

At presentation

NHL, widespread

None

Death

NA

+

At presentation

PTCL,

None

Death

CHOP, IF, E,

Death (9

MTx

months)

widespread 4, 1996,

42/M

B/L

NA

+

+

+

Canada 5, 1998, Japan 6, 2000, USA

At relapse

PTCL

(5 months) 55/M 82/F

B/L B/L

10.5 8.5

+ NA

+ +

+ +

At relapse (4

DLBCL (thyroid

BACOD-E,

Death (7

months)

+)

CHOP

months)

At relapse (10

DLBCL

CHOP

Death (10

months) 7, 2001, Israel

60/M

B/L

5

NA

NA

+

At relapse (6

months) DLBCL

months) 8, 2002, Korea

61/M

B/L

5.8

+

+

-

At relapse (2

DLBCL

months) 9, 2003,

55/M

B/L

9

+

+

-

Australia 10, 2003,

67/M

NA

NA

NA

+

NA

70/M

NA

NA

NA

+

NA

80/M

B/L

9.5

+

+

+

51/M

B/L

4.5

+

NA

NA

74/M

B/L

6.8

+

NA

NA

China 15, 2010,

months)

CT

Death (6

At relapse (6

DLBCL

CT

At relapse (3

58/M

B/L

10

+

+

+

DLBCL

R-CHOP

Burkitt-like

months)

lymphoma

At presentation

DLBCL

At relapse (6

DLBCL

R-CNOP

B/L

3

-

-

+

At presentation

Death (2 months)

MVBP, IT-

Death (16

MTx, ACVBP

months)

CHOP

Death (6 months)

DLBCL

R-CHOP, XRT

months) 81/M

Death (3 months)

At relapse (2

At relapse (6

Death (6 months)

months)

Japan 16, 2013, USA

CR (6

relapse

months)

France 14, 2008,

CEOP; XRT at

months)

Greece 13, 2005,

months)

months)

Canada 12, 2004,

DLBCL

Death (14

XRT at relapse

months)

Canada 11, 2003,

At relapse (6

CHOP; MTx,

Death (8 months)

DLBCL

None

Death (3 months)

17, 2013,

75/M

B/L

5.3

-

-

+

At presentation

DLBCL

R-CHOP, XRT

Turkey 18, 2013, Japan

Death (6 months)

62/M

B/L

6.3

NA

+

+

At presentation

DLBCL

R-MPV, WBRT,

Alive (40

IT-MTx

months)

AI: adrenal insufficiency, LDH: serum lactate dehydrogenase, †: level above normal reference range, CNS: central nervous system, M: male, F: female, B/L: bilateral, NA: data not available, +: present, -: absent, NHL: non-Hodgkin lymphoma, PTCL: peripheral T-cell lymphoma, CHOP: cyclophosphamide, doxorubicin, vincristine, prednisone, IF: ifosfamide, E: etoposide, MTx: methotrexate, DLBCL: diffuse large B-cell non-Hodgkin lymphoma, BACOD-E: bleomycin, doxorubicin, cyclophosphamide, vincristine, dexamethasone-etoposide, XRT: radiotherapy, CEOP: cytoxan, epirubicin, vincristine, prednisolone, CR: complete remission, CT: chemotherapy, R: rituximab, CNOP: cyclophosphamide, mitoxantrone, vincristine, prednisolone, MVBP: methotrexate, etoposide, BCNU, prednisone, IT: intrathecal, ACVBP: adriamycin, cyclophosphamide, vindesine, bleomycin, prednisone, MPV: high-dose methotrexate, procarbazine, vincristine, WBRT: whole-brain radiotherapy. Cases 7, 8, 12, 13, 14, and 17 were reviewed by Aydın et al. [1].

333

Turk J Hematol 2014;31:332-334

Somanath P, et al: Central Nervous System Involvement in Primary Adrenal Non-Hodgkin Lymphoma

References 1. Aydın K, Okutur K, Bozkurt M, Aydın Ö, Namal E, Öztürk A, Pilancı KN, Küçükkaya RD, Demir OG. Primary adrenal lymphoma with secondary central nervous system involvement: a case report and review of the literature. Turk J Hematol 2013;30:405-408.

2. Rashidi A, Fisher SI. Primary adrenal lymphoma: a systematic review. Ann Hematol 2013;92:1583-1593.

334

3. Ichikawa S, Fukuhara N, Inoue A, Katsushima H, Ohba R, Katsuoka Y, Onishi Y, Yamamoto J, Sasaki O, Nomura J, Fukuhara O, Ishizawa K, Ishinohasama R, Harigae H. Clinicopathological analysis of primary adrenal diffuse large B-cell lymphoma: effectiveness of rituximabcontaining chemotherapy including central nervous system prophylaxis. Exp Hematol Oncol 2013;2:19.

Images in Hematology

DOI: 10.4274/tjh.2013.0405

1. Quiz in Hematology A 2-year-old patient was admitted to the hospital on the fifth day of his life with hypocalcemic seizure. When he was 3 months of age, blindness and hepatosplenomegaly were noticed. His leukocyte count was 36.8x10³/µL, hemoglobin level was 8 g/dL, and platelet level was 103x10³/µL; he was referred with suspicion of infantile leukemia. His peripheral smear demonstrated several immature myeloid cells and normoblasts, while no blastic cells were observed. Chest radiograph showed a generalized increase in bone density (Figure 1). Radiographs of the skull and limbs showed generalized increase in bone density (Figures 2 and 3).

Figure 1. Posteroanterior chest X-ray revealed a uniform increase in bone density.

Figure 2. Radiograph of limbs shows Erlenmeyer flask deformity of distal femur and generalized increased bone density with the obliteration of the marrow cavity.

Figure 3. Radiograph of skull showing sclerosis and thickening of orbital rims.

335

Turk J Hematol 2014;31:335-336

Quiz in Hematology

Diagnosis: Infantile Malign Osteopetrosis Tanı: Malign İnfantil Osteopetrosis The patient was diagnosed with osteopetrosis, which was confirmed due to mutation in the TCIRG1 gene [g.11279G>A(IVS18+1) paternal allele, g.8280_9560del (ex. 11-12-12), p.Ala389AspfsX151 maternal allele].

Osteopetrosis originates from reduced or complete lack of osteoclast function and, as a consequence, impairment of bone resorption [1]. At least 10 genes have been identified as causative in humans [2]. Osteopetrosis varies in its presentation and severity. The autosomal recessive form is the most severe form, with life-threatening complications such as bone marrow failure; it is usually diagnosed before 1 year of age and can mimic leukemia [1,3]. The bone seems to be the only affected tissue and the defect can be almost completely reversed by hematopoietic stem cell transplantation [1,3].

Key Words: Hypocalcemic seizure, Infantile malign osteopetrosis, TCIRG1 gene mutation Anahtar Sözcükler: Hipokalsemik nöbet, Malign infantil osteopetrosis, TCIRG1 gen mutasyonu Sevgin Taner, Ali Fettah, Neşe Yaralı, Sevde Seçer, Özge Ağlamış, Bahattin Tunç Ankara Children’s Hematology and Oncology Research Hospital, Clinic of Pediatric Hematology, Ankara, Turkey Ali FETTAH M.D., E-mail: alifettah@gmail.com Received/Geliş tarihi

: December 3, 2013

Accepted/Kabul tarihi : December 27, 2013 References 1. Balemans W, Van Wesenbeeck L, Van Hul W. A clinical and molecular overview of the human osteopetroses. Calcif Tissue Int 2005;77:263-274.

2. Stark Z, Savarirayan R. Osteopetrosis. Orphanet J Rare Dis 2009;4:5.

336

3. Gerritsen EJ, Vossen JM, van Loo IH, Hermans J, Helfrich MH, Griscelli C, Fischer A. Autosomal recessive osteopetrosis: variability of findings at diagnosis and during the natural course. Pediatrics 1994;93:247-253.

Images in Hematology

DOI: 10.4274/tjh.2013.0158

2. Clinical Pictures in Hematology Unusual Manifestations of Vincristine Neuropathy: Report of Two Cases of Hodgkin Lymphoma Vinkristin N繹ropatisinin Nadir Manifestasyonlar覺: Hodgkin Lenfomal覺 襤ki Olgu Raporu A

B

C

D

Figure 1. Videolaryngoscopy reveals immobile left vocal cord (A) and normal moving vocal cords (B) in case 1. Plain X-ray shows free air beneath the diaphragm (C) and abdominal CT shows dilated loops with intestinal pneumonitis (D) in case 2.

Case 1 An 81-year-old man presented with a 6-month history of progressive cervical mass and weight loss. A biopsy specimen from a right supraclavicular lymph node was suggestive of

Hodgkin disease of mixed cellularity/lymphocyte-depleted type. The clinical stage was IIB and the patient was started on combination chemotherapy with doxorubicin, bleomycin, vincristine (since vinblastine was not available on the market), 337

Turk J Hematol 2014;31:337-338

Clinical Pictures in Hematology

and dacarbazine (ABVD). Two milligrams of vincristine was administered on days 1 and 14 of each 28-day cycle. After 2 courses (8 mg of vincristine), the patient complained of hoarseness. He noted weakness in his voice. Videolaryngoscopy revealed left vocal cord immobility with structurally normal-appearing cords (Figure 1A). His clinical profile and videolaryngoscopic findings were consistent with vinca alkaloid-induced vocal cord paralysis. Vincristine was omitted from the chemotherapy protocol and the patient’s hoarseness resolved gradually. Five months after stopping vincristine, the patient’s voice was much improved and his hoarseness disappeared. Repeat videolaryngoscopy showed normal vocal cords that moved freely (Figure 1B). Informed consent was obtained.

Case 2 A 43-year-old woman presented with a 3-month history of progressive dyspnea. Biopsy of a right supraclavicular lymph node showed classical-type mixed cellularity Hodgkin disease. The clinical stage was IIIA and the patient was started on combination chemotherapy with ABVD. Two milligrams of vincristine was administered on days 1 and 14 of each 28-day cycle. After 3 courses (12 mg of vincristine), the patient complained of mild abdominal pain and distension with constipation.

Five days later, despite supportive care, her abdominal distension increased markedly and bowel sounds were not heard. An upright film of the chest revealed free air under the diaphragm (Figure 1C) and abdominal CT showed dilated loops with intestinal pneumonitis (Figure 1D). She underwent an emergent exploratory laparotomy. Since she had a perforation in the cecum measuring approximately 2 cm as well as small and large bowel dilatation, right hemicolectomy/ileotransverstomy was performed. A diagnosis of paralytic ileus due to autonomic neuropathy induced by vincristine was made. Due to severe sepsis, the patient rapidly deteriorated postoperatively and died 2 weeks after the operation.

Vocal cord paralysis is an unusual manifestation of vincristine neurotoxicity. Most cases present with unilateral nerve palsy, and hoarseness of voice is the most common presenting symptom [1,2,3,4]. Vinca alkaloid-induced myenteric nerve damage may contribute to paralytic ileal and cecal distension that further enhances intestinal ischemia [5]. Since these complications are not always realized, prompt recognition is imperative for avoiding severe dysfunction of several organ systems. Informed consent was obtained.

Key Words: Vincristine, Neuropathy, Vocal cord paralysis, Paralytic ileus Anahtar Sözcükler: Vinkristin, Nöropati, Vokal kord paralizi, Paralitik ileus Olga Meltem Akay1, Eren Gündüz1, Ercan Kaya2, Mahmut Kebapcı3, Zafer Gülbaş4 1Osmangazi

University Faculty of Medicine, Department of Hematology, Eskişehir, Turkey

2Osmangazi

University Faculty of Medicine, Department of Otolaryngology, Head and Neck Surgery, Eskişehir, Turkey

3Osmangazi

University Faculty of Medicine, Department of Radiology, Eskişehir, Turkey

4Anadolu

Health Center, Bone Marrow Transplantation Center, Kocaeli, Turkey

Olga Meltem AKAY M.D., Phone: +90 222 2398466 E-mail: olga.akay@hotmail.com Received/Geliş tarihi : May 6, 2013 Accepted/Kabul tarihi : May 27, 2013

References 1. Whittaker JA, Griffith IP. Recurrent laryngeal nerve paralysis in patients receiving vincristine and vinblastine. Br Med J 1977;1:1251-1252.

4. Harris C, Blanchaert RH. Bilateral recurrent laryngeal nerve palsy resulting from treatment with vincristine. J Oral Maxillofac Surg 2006;64:738-739.

2. Delaney P. Vincristine-induced laryngeal nerve paralysis.

Neurology 1982;32:1285-1288.

5. Ito S. Drug induced bowel injury. In: Kleinman RE, Goutlet O, Mieli-Vergani G, Sanderson IR, Sherman PM, Shneider BL, editors. Walker’s Pediatric Gastrointestinal Disease. 5th ed. Hamilton, Canada, BC Decker, 2008.

3. Rezvani K, Bain BJ, Coulter CAE. Loss of singing ability caused by vincristine. Clin Lab Haematol 1998;20:47-48.

338

Images in Hematology

DOI: 10.4274/Tjh.2012.0145

3. Clinical Pictures in Hematology Isolated Zinc Deficiency Causing Severe Microcytosis and Sideroblastic Anemia Ağır Mikrositoz ve Sideroblastik Anemiye Neden Olan İzole Çinko Eksikliği

Figure 1. Bone marrow iron stain showing increased iron with ringed sideroblasts.

339

Turk J Hematol 2014;31:339-341

Clinical Pictures in Hematology

Figure 2. Bone marrow aspiration showing erythroid hyperplasia.

A 59-year-old Middle Eastern man with no significant past medical history was referred to the hematology clinic of our hospital for incidentally detected anemia on routine blood examination. When seen, he complained of chronic mild fatigue for 1 year. The rest of the review of systems was unremarkable. He did not take any medications and did not smoke or drink alcohol. His diet was significant for his daily intake of liver. Physical exam showed normal vital signs and was otherwise unremarkable except for pallor.

A complete blood count revealed hemoglobin of 73 g/L, total RBC count of 4.41x1012/L, MCV of 54.2 fL (low), MCH of 16.5 pg (low), MCHC of 304 g/L, RDW of 29.9%, and platelet count of 262x109/L. The reticulocyte count was 2.3% with a low reticulocyte production index, suggesting a hypoproliferative anemia. Serum ferritin level was 1336 ng/mL (normal: 24-336 ng/mL), serum vitamin B12 level was 302 pg/mL (normal: 180-914 pg/mL), and folic acid level was 4.5 ng/ mL (normal: 3.5-16.1 ng/mL). A hemoglobin electrophoresis test was normal and the sickle test was negative. Erythrocyte sedimentation rate was 2 mm/h. A bone marrow aspiration/biopsy was performed, which showed a hypercellular marrow with trilineage hematopoiesis with maturation. There was microcytic anemia with erythroid hyperplasia, increased stainable iron, and 60% ringed sideroblasts, consistent with sideroblastic anemia (Figures 1, 2). There was adequate granulopoiesis and megakaryopoiesis. The flow cytometry of the bone marrow sample was negative. Fluorescent in situ hybridization was negative for chromosomal abnormalities and cytogenetic analysis showed a normal male karyotype. Based on the above findings, a working diagnosis of myelodysplastic syndrome (MDS; refractory anemia with ringed sideroblasts) was made. It was decided to observe his counts on a regular basis. Informed consent was obtained.

In the meantime, the patient started taking over-the-counter micronutrient and mineral supplements that contained copper and zinc amongst others. At the 6-month follow-up when a complete blood count was repeated, it showed a muchimproved hemoglobin level of 127 g/L with MCV of 80.4 fL and normal MCH of 26.3 pg, raising the possibility of a reversible process causing sideroblastic anemia. Since the counts had corrected to near normal, he was observed. On the subsequent visit 6 months later, the patient was seen in the clinic, and he had not been taking his micronutrient and minerals pills for 3 weeks.

His hemoglobin fell to 107 g/L and MCV to 66.3 fL. At that time, a test of copper and zinc levels was done, which revealed low zinc levels of 129.99 µmol/L (normal: 154.75-495.2 µmol/L) and a normal copper level of 1.4 µmol/L (normal: 1.3-2.89 µmol/L). The mineral pill was restarted, and his hemoglobin improved to 117 g/L and MCV to 73.8 fL after 2 months. He continues to be asymptomatic with stable blood counts.

340

Clinical Pictures in Hematology

Key Words: Microcytosis, Sideroblastic anemia, Zinc deficiency Anahtar Sözcükler: Mikrositoz, Sideroblastik anemi, Çinko eksikliği

Turk J Hematol 2014;31:339-341

Gupta SHWETA M.D., Tel: +1 312 864 7250 Received/Geliş tarihi : October 8, 2012 Accepted/Kabul tarihi : January 14, 2013

Gupta Shweta, Jain Prantesh, Sukhal Shashvat John H Stroger Jr Hospital of Cook County, Department of Hematology-Oncology, Chicago, United States

341

Memorial: Prof. Dr. Burhan (Mehmet Burhanettin) SAY (1923-2014) Prof. Dr. Burhan SAY, one of the founding members of the Turkish Society of Hematology, died at 91 years of age in Tulsa, Oklahoma, USA, from multiple organ dysfunction on August 3, 2014.

Dr. Say was born in İstanbul on February 26, 1923 as the second child of his family. He attended elementary school in İstanbul, continued his education at Ankara Atatürk Lisesi, and graduated from the İstanbul Medical Faculty in 1946. He accomplished his pediatric residency at the Ankara (recently called Sami Ulus) Children’s Hospital between 1947 and 1950. He repeated his pediatric residency between 1950 and 1953 at Hubbard Hospital in Nashville, Tennessee (USA), did a pediatric hematology fellowship at St. Christopher Hospital for Children under Chief Waldo Nelson at Temple University (Philadelphia, Pennsylvania, USA) between 1953 and 1954, and served as an assistant professor of pediatrics at Meharry Medical College (Nashville) between 1954 and 1957. In 1957, he returned to Ankara and joined the İhsan Doğramacı (previously called Hacettepe) Children’s Hospital of the Ankara University Medical Faculty in 1958. He served as a pediatric consultant at İhsan Doğramacı Children’s Hospital for a year and became an associate professor in 1959; he completed his docent thesis on coagulation dysfunctions in malnourished children. He became chief of pediatric hematology in 1962 at the same institution and professor of pediatrics and hematology in 1964 at the Hacettepe Medical Faculty (of Ankara University and then Hacettepe University).

He continued his medical genetics education at Boston Children’s Hospital (Harvard University) between 1966 and 1968 with a Fulbright scholarship. He then returned again to İhsan Doğramacı Children’s Hospital, where he established the first pediatric genetics section in Turkey.

He returned to the USA in 1973 to the Oklahoma Pediatric Center as a director of the medical genetics section until 1982. Then he became the director of the H.A. Chapman Institute of Medical Genetics and clinical professor of pediatrics at Oklahoma University’s Tulsa Medical Center until his retirement in 2005.

Dr. Say joined the Turkish Board of Pediatrics in 1950, American Board of Pediatrics in 1956, and American Board of Medical Genetics in 1982. He received the Doğramacı Science Achievement Award in 1975. Dr. Say was a member of the American Pediatric Society, American Association for

Achievement for the Advancement of Science, American Society of Human Genetics, American Medical Association, American College of Medical Genetics, Great Plains Clinical Genetic Society, Oklahoma Medical State Society, Tulsa County Medical Society, Turkish National Pediatric Society, International Hemophilia Society, Turkish Society of Hematology, European Teratology Society, and European Society of Pediatric Hematology and Immunology. He was also a member of the Executive Committee of the Great Plains Genetic Society Network, Board of Directors of the Children’s Medical Center of Tulsa, Board of Directors of the H.A. Chapman Institute of Tulsa, Executive Committee of the H.A. Chapman Institute of Tulsa, Board of Directors of the Tulsa Association of Retarded Children, and Advisory Board of the March of Dimes in Tulsa.

He published over 275 articles (about 80 in Turkish) and wrote chapters for four books.

Dr. Say married Jean (Eugenia Elizabeth Jackson) in 1955, who died about 20 years ago. They had two sons.

Dr. Say’s wisdom, tolerance, and love for his patients and friends were extraordinary. He never showed anger to anyone. He had a very intellectual mind and practical approaches to daily life and patient care. He was a role model in teaching and pediatric care. He was a brilliant pediatrician, hematologist, educator, and rejuvenator in clinical genetics. He diagnosed his own heart attack a day after having a medulla spinalis structure operation and called a nurse. The nurse replied that he was not a physician but rather a patient at that moment. Dr. Say replied to her: “Please call the doctor immediately, telling him his patient is having a heart attack.”

He was also a great patriot and a helping hand to all Turkish physicians and researchers, giving them opportunities at his institution and helping them to continue their educations at appropriate institutions by arranging suitable conditions for them. He love to learn and share anecdotes. Everyone coming to him loved and respected him, especially my children. I lost my big brother; I wish him the best. I already miss his wonderful personality and thought-provoking anecdotes. Şinasi Özsoylu Retired Professor of Pediatrics, Hematology, Hepatology, Hacettepe University, Ankara, Turkey

A-XI

Advisory Board of This Issue (September 2014) Achille Pich, Italy Ahmet Emre Eşkazan, Turkey Ahmet Koç, Turkey Ahmet Muzaffer Demir, Turkey Ali İrfan Emre Tekgündüz, Turkey Ayşegül Ünüvar, Turkey Aytemiz Gürgey, Turkey Bülent Eser, Turkey Bülent Kantarcıoğlu, Turkey Cengiz Beyan, Turkey Elif Ünal, Turkey Emel Özyürek, Turkey Ergül Berber, Turkey Erol Atalay, Turkey Erol Erduran, Turkey Ferit Avcu, Turkey

Güray Saydam, Turkey Gürhan Kadıköylü, Turkey Hamdi Akan, Turkey Han-Mou Tsai, USA İbrahim C. Haznedaroğlu, Turkey İrfan Yavaşoğlu, Turkey Mahmut Bayık, Turkey Mehmet Sönmez, Turkey Mustafa Nuri Yenerel, Turkey Naci Tiftik, Turkey Nazar Sarper, Turkey Nejat Akar, Turkey Nil Güler, Turkey Önder Arslan, Turkey Petra Muus, The Netherlands Rahul Naithani, India

Reyhan Diz Küçükkaya, Turkey Selami Koçak Toprak, Turkey Serap Aksoylar, Turkey Sevgi Beşışık Kalayoğlu, Turkey Shylendra Sreenivasappa, USA Şinasi Özsoylu, Turkey Şule Ünal, Turkey Süleyman Sami Kartı, Turkey Tunç Fışgın, Turkey Ülker Koçak, Turkey Vahap Okan, Turkey Veysel Sabri Hançer, Turkey Yi Le, China Yusuf Baran, Turkey Zübeyde Özkurt, Turkey Zühre Kaya, Turkey