Tjh 2016 4

Issue 4

December 2016

80 TL

ISSN 1300-7777

Volume 33

Research Articles Prognostic Factors and a New Prognostic Index Model for Children and Adolescents with Hodgkin’s Lymphoma Who Underwent Autologous Hematopoietic Stem Cell Transplantation: A Multicenter Study of the Turkish Pediatric Bone Marrow Transplantation Study Group Vural Kesik, et al.; Ankara, Kayseri, İzmir, İstanbul, Antalya, Samsun, Turkey

The Role of Azacitidine in the Treatment of Elderly Patients with Acute Myeloid Leukemia: Results of a Retrospective Multicenter Study Anıl Tombak, et al.; Mersin, Eskişehir, Ankara, Adana, İzmir, Erzurum, Malatya, İstanbul, Kocaeli, Aydın, Denizli, Kayseri, Antalya, Düzce, Turkey

The Prognosis of Adult Burkitt’s Cell Leukemia in Real-Life Clinical Practice Ümit Yavuz Malkan, et al.; Ankara, Turkey

Expression Profiles of the Individual Genes Corresponding to the Genes Generated by Cytotoxicity Experiments with Bortezomib in Multiple Myeloma Mehdi Ghasemi, et al.; Ankara, Turkey

The Effect of Hyperparathyroid State on Platelet Functions and Bone Loss Göknur Yorulmaz, et al.; Eskişehir, Turkey

Warfarin Dosing and Time Required to Reach Therapeutic International Normalized Ratio in Patients with Hypercoagulable Conditions Pushpinderdeep Kahlon, et al.; Detroit, USA; Doha, Qatar; Multan, Pakistan

Early Changes of Mannose-Binding Lectin, H-Ficolin, and Procalcitonin in Patients with Febrile Neutropenia: A Prospective Observational Study Sibel Işlak Mutcalı, et al.; İstanbul, Turkey

Prospective Evaluation of Infection Episodes in Cancer Patients in a Tertiary Care Academic Center: Microbiological Features and Risk Factors for Mortality Nursel Çalık Başaran, et al.; Ankara, Turkey

Effect of Hereditary Hemochromatosis Gene H63D and C282Y Mutations on Iron Overload in Sickle Cell Disease Patients Yunus Kasım Terzi, et al.; Ankara, Turkey

Health-Related Quality of Life, Depression, Anxiety, and Self-Image in Acute Lymphocytic Leukemia Survivors Birol Baytan, et al.; Bursa, Turkey

Cover Picture: Sunset, Lake Bafa Erden Atilla

4

Editor-in-Chief

International Review Board

Reyhan Küçükkaya

Nejat Akar Görgün Akpek Serhan Alkan Çiğdem Altay Koen van Besien Ayhan Çavdar M. Sıraç Dilber Ahmet Doğan Peter Dreger Thierry Facon Jawed Fareed Gösta Gahrton Dieter Hoelzer Marilyn Manco-Johnson Andreas Josting Emin Kansu Winfried Kern Nigel Key Korgün Koral Abdullah Kutlar Luca Malcovati Robert Marcus Jean Pierre Marie Ghulam Mufti Gerassimos A. Pangalis Antonio Piga Ananda Prasad Jacob M. Rowe Jens-Ulrich Rüffer Norbert Schmitz Orhan Sezer Anna Sureda Ayalew Tefferi Nükhet Tüzüner Catherine Verfaillie Srdan Verstovsek Claudio Viscoli

TOBB Economy Technical University Hospital, Ankara, Turkey Maryland School of Medicine, Baltimore, USA Cedars-Sinai Medical Center, USA Ankara, Turkey Chicago Medical Center University, Chicago, USA Ankara, Turkey Karolinska University, Stockholm, Sweden Mayo Clinic Saint Marys Hospital, USA Heidelberg University, Heidelberg, Germany Lille University, Lille, France Loyola University, Maywood, USA Karolinska University Hospital, Stockholm, Sweden Frankfurt University, Frankfurt, Germany Colorado Health Sciences University, USA University Hospital Cologne, Cologne, Germany Hacettepe University, Ankara, Turkey Albert Ludwigs University, Germany University of North Carolina School of Medicine, NC, USA Southwestern Medical Center, Texas, USA Georgia Health Sciences University, Augusta, USA Pavia Medical School University, Pavia, Italy Kings College Hospital, London, UK Pierre et Marie Curie University, Paris, France King’s Hospital, London, UK Athens University, Athens, Greece Torino University, Torino, Italy Wayne State University School of Medicine, Detroit, USA Rambam Medical Center, Haifa, Israel University of Köln, Germany AK St Georg, Hamburg, Germany Memorial Şişli Hospital, İstanbul, Turkey Santa Creu i Sant Pau Hospital, Barcelona, Spain Mayo Clinic, Rochester, Minnesota, USA İstanbul Cerrahpaşa University, İstanbul, Turkey University of Minnesota, Minnesota, USA The University of Texas MD Anderson Cancer Center, Houston, USA San Martino University, Genoa, Italy

Past Editors Erich Frank Orhan Ulutin Hamdi Akan Aytemiz Gürgey

Language Editor Leslie Demir

Senior Advisory Board Yücel Tangün Osman İlhan Muhit Özcan Teoman Soysal

Editorial Office İpek Durusu Bengü Timoçin

İstanbul, Turkey

Associate Editors Ayşegül Ünüvar İstanbul University, İstanbul, Turkey

Cengiz Beyan TOBB University of Economics and Technology, Ankara, Turkey

Hale Ören Dokuz Eylül University, İzmir, Turkey

İbrahim C. Haznedaroğlu Hacettepe University, Ankara, Turkey

M. Cem Ar İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey

Selami Koçak Toprak Ankara University, Ankara, Turkey

Semra Paydaş Çukurova University, Adana, Turkey

Assistant Editors A. Emre Eşkazan İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey

Ali İrfan Emre Tekgündüz Dr. A. Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey

Elif Ünal İnce Ankara University, Ankara, Turkey

İnci Alacacıoğlu Dokuz Eylül University, İzmir, Turkey

Müge Sayitoğlu İstanbul University, İstanbul, Turkey

Nil Güler Ondokuz Mayıs University, Samsun, Turkey

Olga Meltem Akay Koç University, İstanbul, Turkey

Şule Ünal Hacettepe University, Ankara, Turkey

Veysel Sabri Hançer İstanbul Bilim University, İstanbul, Turkey

Zühre Kaya Gazi University, Ankara, Turkey

A-I

Publishing Services

Statistic Editor Hülya Ellidokuz

GALENOS PUBLISHER Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya E-mail : rkucukkaya@hotmail.com

All Inquiries Should be Addressed to TURKISH JOURNAL OF HEMATOLOGY Address Phone Fax E-mail

: İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No:8 06550 Çankaya, Ankara / Turkey : +90 312 490 98 97 : +90 312 490 98 68 : info@tjh.com.tr

ISSN: 1300-7777

Publishing Manager Sorumlu Yazı İşleri Müdürü Güner Hayri Özsan

Management Address Yayın İdare Adresi Türk Hematoloji Derneği İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No: 8 06550 Çankaya, Ankara / Turkey

Publishing House / Yayınevi

Online Manuscript Submission Web page

Molla Gürani Mah. Kaçamak Sk. No: 21, 34093 Fındıkzade, İstanbul, Turkey Tel: +90 212 621 99 25 Faks: +90 212 621 99 27 E-posta: info@galenos.com.tr

www.tjh.com.tr

Baskı: Özgün Ofset Ticaret Ltd. Şti.

http://mc.manuscriptcentral.com/tjh

Yeşilce Mah. Aytekin Sk. No: 21 34418 4. Levent / İstanbul

Owner on behalf of the Turkish Society of Hematology Türk Hematoloji Derneği adına yayın sahibi

Printing Date / Basım Tarihi

Ahmet Muzaffer Demir

Cover Picture

Üç ayda bir yayımlanan İngilizce süreli yayındır.

International scientific journal published quarterly.

Erden Atilla is currently working at the Ankara University Department of Hematology, Ankara, Turkey.

Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish Journal of Hematology’nin Türk Hematoloji Derneği İktisadi İşletmesi tarafından yayınlanmasına karar vermiştir.

A-II

30.11.2016

AIMS AND SCOPE The Turkish Journal of Hematology is published quarterly (March, June, September, and December) by the Turkish Society of Hematology. It is an independent, non-profit peer-reviewed international English-language periodical encompassing subjects relevant to hematology.

The Editorial Board of The Turkish Journal of Hematology adheres to the principles of the World Association of Medical Editors (WAME), International Council of Medical Journal Editors (ICMJE), Committee on Publication Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and Strengthening the Reporting of Observational Studies in Epidemiology (STROBE).

The aim of The Turkish Journal of Hematology is to publish original hematological research of the highest scientific quality and clinical relevance. Additionally, educational material, reviews on basic developments, editorial short notes, images in hematology, and letters from hematology specialists and clinicians covering their experience and comments on hematology and related medical fields as well as social subjects are published. As of December 2015, The Turkish Journal of Hematology does not accept case reports. Important new findings or data about interesting hematological cases may be submitted as a brief report.

General practitioners interested in hematology and internal medicine specialists are among our target audience, and The Turkish Journal of Hematology aims to publish according to their needs. The Turkish Journal of Hematology is indexed, as follows: - PubMed Medline - PubMed Central - Science Citation Index Expanded - EMBASE - Scopus - CINAHL - Gale/Cengage Learning - EBSCO - DOAJ - ProQuest - Index Copernicus - Tübitak/Ulakbim Turkish Medical Database - Turk Medline Impact Factor: 0.827 Subscription Information The Turkish Journal of Hematology is sent free-of-charge to members of Turkish Society of Hematology and libraries in Turkey and abroad.

Hematologists, other medical specialists that are interested in hematology, and academicians could subscribe for only 40 $ per printed issue. All published volumes are available in full text free-of-charge online at www. tjh.com.tr.

Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97 Fax: +90 312 490 98 68

A-III

Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh Web page: www.tjh.com.tr E-mail: info@tjh.com.tr Permissions Requests for permission to reproduce published material should be sent to the editorial office.

Editor: Professor Dr. Reyhan Küçükkaya Adress: İlkbahar Mah, Turan Günes Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97 Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh Web page: www.tjh.com.tr E-mail: info@tjh.com.tr Publisher Galenos Yayınevi Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey Telephone : +90 212 621 99 25 Fax : +90 212 621 99 27 info@galenos.com.tr Instructions for Authors Instructions for authors are published in the journal and at www.tjh.com.tr Material Disclaimer Authors are responsible for the manuscripts they publish in The Turkish Journal of Hematology. The editor, editorial board, and publisher do not accept any responsibility for published manuscripts.

If you use a table or figure (or some data in a table or figure) from another source, cite the source directly in the figure or table legend.

The journal is printed on acid-free paper.

Editorial Policy Following receipt of each manuscript, a checklist is completed by the Editorial Assistant. The Editorial Assistant checks that each manuscript contains all required components and adheres to the author guidelines, after which time it will be forwarded to the Editor in Chief. Following the Editor in Chief’s evaluation, each manuscript is forwarded to the Associate Editor, who in turn assigns reviewers. Generally, all manuscripts will be reviewed by at least three reviewers selected by the Associate Editor, based on their relevant expertise. Associate editor could be assigned as a reviewer along with the reviewers. After the reviewing process, all manuscripts are evaluated in the Editorial Board Meeting.

Turkish Journal of Hematology’s editor and Editorial Board members are active researchers. It is possible that they would desire to submit their manuscript to the Turkish Journal of Hematology. This may be creating a conflict of interest. These manuscripts will not be evaluated by the submitting editor(s). The review process will be managed and decisions made by editor-in-chief who will act independently. In some situation, this process will be overseen by an outside independent expert in reviewing submissions from editors.

TURKISH JOURNAL OF HEMATOLOGY INSTRUCTIONS TO AUTHORS The Turkish Journal of Hematology accepts invited review articles, research articles, brief reports, letters to the editor, and hematological images that are relevant to the scope of hematology, on the condition that they have not been previously published elsewhere. Basic science manuscripts, such as randomized, cohort, cross-sectional, and case control studies, are given preference. All manuscripts are subject to editorial revision to ensure they conform to the style adopted by the journal. There is a double blind kind of reviewing system. Review articles are solicited by the Editor in Chief.

Authors wishing to submit an unsolicited. Review Article should contact the Editor in Chief prior to submission in order to screen the proposed topic for relevance and priority.

Manuscripts should be prepared according to ICMJE guidelines (http:// www.icmje.org/). Original manuscripts require a structured abstract. Label each section of the structured abstract with the appropriate subheading (Objective, Materials and Methods, Results, and Conclusion). Letters to the editor do not require an abstract. Research or project support should be acknowledged as a footnote on the title page. Technical and other assistance should be provided on the title page.

Original Manuscripts Title Page Title: The title should provide important information regarding the manuscript’s content. The title must specify that the study is a cohort study, cross-sectional study, case control study, or randomized study (i.e.

Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability of ferrous succinate tablet formulations without correction for baseline circadian changes in iron concentration in healthy Chinese male subjects: A single-dose, randomized, 2-period crossover study. Clin Ther. 2011; 33: 2054-2059).

The title page should include the authors’ names, degrees, and institutional/ professional affiliations, a short title, abbreviations, keywords, financial disclosure statement, and conflict of interest statement. If a manuscript includes authors from more than one institution, each author’s name should be followed by a superscript number that corresponds to their institution, which is listed separately. Please provide contact information for the corresponding author, including name, e-mail address, and telephone and fax numbers.

Running Head: The running head should not be more than 40 characters, including spaces, and should be located at the bottom of the title page.

Word Count: A word count for the manuscript, excluding abstract, acknowledgments, figure and table legends, and references, should be provided not exceed 2500 words. The word count for an abstract should be not exceed 300 words.

Conflict-of-Interest Statement: To prevent potential conflicts of interest from being overlooked, this statement must be included in each

A-IV

manuscript. In case there are conflicts of interest, every author should complete the ICMJE general declaration form, which can be obtained at: http://www.icmje.org/coi_disclose.pdf.

Abstract and Keywords: The second page should include an abstract that does not exceed 300 words. For manuscripts sent by authors in Turkey, a title and abstract in Turkish are also required. As most readers read the abstract first, it is critically important. Moreover, as various electronic databases integrate only abstracts into their index, important findings should be presented in the abstract.

Objective: The abstract should state the objective (the purpose of the study and hypothesis) and summarize the rationale for the study.

Materials and Methods: Important methods should be written respectively.

Results: Important findings and results should be provided here.

Conclusion: The study’s new and important findings should be highlighted and interpreted.

Other types of manuscripts, such as reviews, perspectives, and editorials, will be published according to uniform requirements.

Provide 3-10 keywords below the abstract to assist indexers. Use terms from the Index Medicus Medical Subject Headings List (for randomized studies a CONSORT abstract should be provided (http:// www.consort-statement.org).

Introduction: The introduction should include an overview of the relevant literature presented in summary form (one page), and what ever remains interesting, unique, problematic, relevant, or unknown about the topic must be specified. The introduction should conclude with the rationale for the study, its design, and its objective(s).

Materials and Methods: Clearly describe the selection of observational or experimental participants, such as patients, laboratory animals, and controls, including inclusion and exclusion criteria and a description of the source population. Identify the methods and procedures in sufficient detail to allow other researchers to reproduce your results. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for using them and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. The section should include only information that was available at the time the plan or protocol for the study was devised (http://www.strobe-statement.org/ fileadmin/Strobe/uploads/checklists/STROBE_checklist_v4_combined. pdf).

Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported results. Statistically important data should be given in the

text, tables and figures. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used.

Results: Present your results in logical sequence in the text, tables, and figures. Do not present all the data provided in the tables and/or figures in the text; emphasize and/or summarize only important findings, results, and observations in the text. For clinical studies provide the number of samples, cases, and controls included in the study. Discrepancies between the planned number and obtained number of participants should be explained. Comparisons, and statistically important values (i.e. P value and confidence interval) should be provided.

Discussion: This section should include a discussion of the data. New and important findings/results, and the conclusions they lead to should be emphasized. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by the data. Do not repeat the findings/results in detail; important findings/ results should be compared with those of similar studies in the literature, along with a summarization. In other words, similarities or differences in the obtained findings/results with those previously reported should be discussed.

Study Limitations: Limitations of the study should be detailed. In addition, an evaluation of the implications of the obtained findings/ results for future research should be outlined.

Conclusion: The conclusion of the study should be highlighted.

References Cite references in the text, tables, and figures with numbers in parentheses.

Number references consecutively according to the order in which they first appear in the text. Journal titles should be abbreviated according to the style used in Index Medicus (consult List of Journals Indexed in Index Medicus). Include among the references any paper accepted, but not yet published, designating the journal and followed by, in press.

Examples of References: 1. List all authors.

Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow transplantation from unrelated donors for patients with aplastic anemia after failure immunosuppressive therapy. Blood 2006;108:1485-1491.

2. Organization as author Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of syngeneic bone marrow graft without preconditioning in post-hepatitis marrow aplasia. Lancet 1977;2:742-744.

4. Book Chapter Perutz MF. Molecular anatomy and physiology of hemoglobin. In: Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin: Genetics, Pathophysiology, Clinical Management. New York, Cambridge University Press, 2000.

5. Abstract Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin) stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract).

6. Letter to the Editor Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further definition of 20q deletion in myeloid leukemia using fluorescence in situ hybridization. Blood 1994;84:2821-2823.

7. Supplement Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant.

2005;9(Suppl 7):81-86 Brief Reports Abstract length: Not to exceed 150 words.

Article length: Not to exceed 1200 words.

Introduction: State the purpose and summarize the rationale for the study.

Materials and Methods: Clearly describe the selection of the observational or experimental participants. Identify the methods and procedures in sufficient detail. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for their use and an evaluation of their limitations.

Identify all drugs and chemicals used, including generic names, doses, and routes of administration.

Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported findings/results. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used.

Results: Present the findings/results in a logical sequence in the text, tables, and figures. Do not repeat all the findings/results in the tables and figures in the text; emphasize and/or summarize only those that are most important.

Discussion: Highlight the new and important findings/results of the study and the conclusions they lead to. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by your data.

Invited Review Articles

3. Book

Abstract length: Not to exceed 300 words.

Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961.

Article length: Not to exceed 4000 words.

A-V

Review articles should not include more than 100 references. Reviews

should include a conclusion, in which a new hypothesis or study about the subject may be posited. Do not publish methods for literature search or level of evidence. Authors who will prepare review articles should already have published research articles on therel evant subject. The study’s new and important findings should be highlighted and interpreted in the Conclusion section. There should be a maximum of two authors for review articles.

Images in Hematology Article length: Not exceed 200 words.

Authors can submit for consideration an illustration and photos that is interesting, instructive, and visually attractive, along with a few lines of explanatory text and references. Images in Hematology can include no more than 200 words of text, 5 references, and 3 figure or table. No abstract, discussion or conclusion are required but please include a brief title.

Letters to the Editor Article length: Not to exceed 500 words.

Letters can include no more than 500 words of text, 5-10 references, and 1 figure or table. No abstract is required, but please include a brief title.

Tables Supply each table on a separate file. Number tables according to the order in which they appear in the text, and supply a brief caption for each. Give each column a short or abbreviated heading. Write explanatory statistical measures of variation, such as standard deviation or standard error of mean. Be sure that each table is cited in the text.

Figures Figures should be professionally drawn and/or photographed. Authors should number figures according to the order in which they appear in the text. Figures include graphs, charts, photographs, and illustrations. Each figure should be accompanied by a legend that does not exceed 50 words.

Use abbreviations only if they have been introduced in the text. Authors are also required to provide the level of magnification for histological slides. Explain the internal scale and identify the staining method used.

Figures should be submitted as separate files, not in the text file. Highresolution image files are not preferred for initial submission as the file sizes may be too large. The total file size of the PDF for peer review should not exceed 5 MB. Authorship Each author should have participated sufficiently in the work to assume public responsibility for the content. Any portion of a manuscript that is critical to its main conclusions must be the responsibility of at least 1 author.

acquisition of data, or analysis and interpretation of findings. All persons designated as an author should qualify for authorship, and all those that qualify should be listed. Each author should have participated sufficiently in the work to take responsibility for appropriate portions of the text.

Acknowledgments Acknowledge support received from individuals, organizations, grants, corporations, and any other source. For work involving a biomedical product or potential product partially or wholly supported by corporate funding, a note stating, “This study was financially supported (in part) with funds provided by (company name) to (authors’ initials)”, must be included. Grant support, if received, needs to be stated and the specific granting institutions’ names and grant numbers provided when applicable.

Authors are expected to disclose on the title page any commercial or other associations that might pose a conflict of interest in connection with the submitted manuscript. All funding sources that supported the work and the institutional and/or corporate affiliations of the authors should be acknowledged on the title page.

Ethics When reporting experiments conducted with humans indicate that the procedures were in accordance with ethical standards set forth by the committee that oversees human experimentation. Approval of research protocols by the relevant ethics committee, in accordance with international agreements (Helsinki Declaration of 1975, revised 2002 available at http://www.wma.net/e/policy/b3.htm, “Guide for the Care and use of Laboratory Animals” www.nap.edu/catalog/5140.html/), is required for all experimental, clinical, and drug studies. Patient names, initials, and hospital identification numbers should not be used. Manuscripts reporting the results of experimental investigations conducted with humans must state that the study protocol received institutional review board approval and that the participants provided informed consent.

Non-compliance with scientific accuracy is not in accord with scientific ethics. Plagiarism: To re-publish-whole or in part-the contents of another author’s publication as one’s own without providing a reference.

Fabrication: To publish data and findings/results that do not exist.

Duplication: Use of data from another publication, which includes re-publishing a manuscript in different languages. Salamisation: To create more than one publication by dividing the results of a study preternaturally.

Contributor’s Statement

We disapprove of such unethical practices as plagiarism, fabrication, duplication, and salamisation, as well as efforts to influence the review process with such practices as gifting authorship, inappropriate acknowledgements, and references. Additionally, authors must respect participant right to privacy.

All submissions should contain a contributor’s statement page. Each manuscript should contain substantial contributions to idea and design,

On the other hand, short abstracts published in congress books that do not exceed 400 words and present data of preliminary research, and

A-VI

those that are presented in an electronic environment are not accepted pre-published work. Authors in such situation must declare this status on the first page of the manuscript and in the cover letter.

(The COPE flowchart is available at: http://publicationethics.org) We use iThenticate to screen all submissions for plagiarism before publication.

Turkish Journal of Hematology uses plagiarism screening service to verify the originality of content submitted before publication.

Conditions of Publication All authors are required to affirm the following statements before their manuscript is considered: 1. The manuscript is being submitted only to The Turkish Journal of Hematology; 2. The manuscript will not be submitted elsewhere while under consideration by The Turkish Journal of Hematology; 3. The manuscript has not been published elsewhere, and should it be published in The Turkish Journal of Hematology it will not be published elsewhere without the permission of the editors (these restrictions do not apply to abstracts or to press reports for presentations at scientific meetings); 4. All authors are responsible for the manuscript’s content; 5. All authors participated in the study concept and design, analysis and interpretation of the data, drafting or revising of the manuscript, and have approved the manuscript as submitted. In addition, all authors are required to disclose any professional affiliation, financial agreement, or other involvement with any company whose product figures prominently in the submitted manuscript.

Authors of accepted manuscripts will receive electronic page proofs and are responsible for proofreading and checking the entire article within two days. Failure to return the proof in two days will delay publication. If the authors cannot be reached by email or telephone within two weeks, the manuscript will be rejected and will not be published in the journal.

Copyright At the time of submission all authors will receive instructions for submitting an online copyright form. No manuscript will be considered for review until all authors have completed their copyright form. Please note, it is our practice not to accept copyright forms via fax, e-mail, or postal service unless there is a problem with the online author accounts that cannot be resolved. Every effort should be made to use the online copyright system. Corresponding authors can log in to the submission system at any time to check the status of any co-author’s copyright form.

All accepted manuscripts become the permanent property of The Turkish Journal of Hematology and may not be published elsewhere-in whole or in part-without written permission.

Note: We cannot accept any copyright that has been altered, revised, amended, or otherwise changed. Our original copyright form must be used as is.

A-VII

Units of Measurement Measurements should be reported using the metric system, according to the International System of Units (SI). Consult the SI Unit Conversion Guide, New England Journal of Medicine Books, 1992.

An extensive list of conversion factors can be found at http://www.unc. edu/~rowlett/units/scales/clinical_data.html. For more details, see http:// www.amamanualofstyle.com/oso/public/jama/si_conversion_table.html.

Example for CBC. Hematology component

SI units

RBC

6.7-11 x 1012/L

WBC

5.5-19.5 x109/L

Hemoglobin

116-168 g/L

PCV

0.31-0.46 L/L

MCV

39-53 fL

MCHC

300-360 g/L

MCH

19.5-25 pg

Platelets

300-700 x 109/L

Source: http://www.vetstream.com/felis/Corporate/993fhtm/ha-mat.htm

Abbreviations and Symbols Use only standard abbreviations. Avoid abbreviations in the title and abstract. The full term for an abbreviation should precede its first use in the text, unless it is a standard abbreviation. All acronyms used in the text should be expanded at first mention, followed by the abbreviation in parentheses; thereafter the acronym only should appear in the text.

Acronyms may be used in the abstract if they occur 3 or more times therein, but must be reintroduced in the body of the text. Generally, abbreviations should be limited to those defined in the AMA Manual of Style, current edition. A list of each abbreviation (and the corresponding full term) used in the manuscript must be provided on the title page.

Online Manuscript Submission Process The Turkish Journal of Hematology uses submission software powered

by ScholarOne Manuscripts. The website for submissions to The Turkish Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This system is quick and convenient, both for authors and reviewers.

Setting up an account New users to the submission site will need to register and enter their account details before they can submit a manuscript. Log in, or click the “Create Account” button if you are a first-time user. To create a new account: After clicking the “Create Account” button, enter your name and e-mail address, and then click the “Next” button. Your e-mail address is very important. Enter your institution and address information,

as appropriate, and then click the “Next” Button. Enter a user ID and password of your choice, select your area of expertise, and then click the “Finish” button.

If you have an account, but have forgotten your log-in details, go to “Password Help” on the journal’s online submission system and enter your e-mail address. The system will send you an automatic user ID and a new temporary password.

Full instructions and support are available on the site, and a user ID and password can be obtained during your first visit. Full support for authors is provided. Each page has a “Get Help Now” icon that connects directly to the online support system. Contact the journal administrator with any questions about submitting your manuscript to the journal (info@tjh. com.tr). For ScholarOne Manuscripts customer support, click on the “Get Help Now” link on the top right hand corner of every page on the site.

The Electronic Submission Process Log in to your author center. Once you have logged in, click the “Submit a Manuscript” link in the menu bar. Enter the appropriate data and answer the questions. You may copy and paste directly from your manuscript.

Click the “Next” button on each screen to save your work and advance to the next screen.

Upload Files Click on the “Browse” button and locate the file on your computer. Select the appropriate designation for each file in the drop-down menu next to the “Browse” button. When you have selected all the files you want to upload, click the “Upload Files” button. Review your submission before sending to the journal. Click the “Submit” button when you are finished reviewing. You can use ScholarOne Manuscripts at any time to check the status of your submission. The journal’s editorial office will inform you by e-mail once a decision has been made. After your manuscript has been submitted, a checklist will then be completed by the Editorial Assistant. The Editorial Assistant will check that the manuscript contains all required components and adheres to the author guidelines. Once the Editorial Assistant is satisfied with the manuscript it will be forwarded to the Senior Editor, who will assign an editor and reviewers.

The Review Process Each manuscript submitted to The Turkish Journal of Hematology is subject to an initial review by the editorial office in order to determine if it is aligned with the journal’s aims and scope, and complies with essential requirements. Manuscripts sent for peer review will be assigned to one of the journal’s associate editors that has expertise relevant to the manuscript’s content. All accepted manuscripts are sent to a statistical and English language editor before publishing. Once papers have been reviewed, the reviewers’ comments are sent to the Editor, who will then make a preliminary decision on the paper. At this stage, based on the feedback from reviewers, manuscripts can be accepted, rejected, or

A-VIII

revisions can be recommended. Following initial peer-review, articles judged worthy of further consideration often require revision. Revised manuscripts generally must be received within 3 months of the date of the initial decision. Extensions must be requested from the Associate Editor at least 2 weeks before the 3-month revision deadline expires; The Turkish Journal of Hematology will reject manuscripts that are not received within the 3-month revision deadline. Manuscripts with extensive revision recommendations will be sent for further review (usually by the same reviewers) upon their re-submission. When a manuscript is finally accepted for publication, the Technical Editor undertakes a final edit and a marked-up copy will be e-mailed to the corresponding author for review and to make any final adjustments.

Submission of Revised Papers When revising a manuscript based on the reviewers’ and Editor’s feedback, please insert all changed text in red. Please do not use track changes, as this feature can make reading difficult. To submit revised manuscripts, please log into your author center at ScholarOne Manuscripts. Your manuscript will be stored under “Manuscripts with Decisions”. Please click on the “Create a Revision” link located to the right of the manuscript title.

A revised manuscript number will be created for you; you will then need to click on the “Continue Submission” button. You will then be guided through a submission process very similar to that for new manuscripts.

You will be able to amend any details you wish. At stage 6 (“File Upload”), please delete the file for your original manuscript and upload the revised version. Additionally, please upload an anonymous cover letter, preferably in table format, including a point-by-point response to the reviews’ revision recommendations. You will then need to review your paper as a PDF and click the “Submit” button. Your revised manuscript will have the same ID number as the original version, but with the addition of an R and a number at the end, for example, TJH-2011-0001 for an original and TJH-2011-0001.R1, indicating a first revision; subsequent revisions will end with R2, R3, and so on. Please do not submit a revised manuscript as a new paper, as revised manuscripts are processed differently. If you click on the “Create a Revision” button and receive a message stating that the revision option has expired, please contact the Editorial Assistant at info@tjh.com.tr to reactivate the option.

English Language Editing All manuscripts are professionally edited by an English language editor prior to publication.

Online Early The Turkish Journal of Hematology publishes abstracts of accepted manuscripts online in advance of their publication in print. Once an accepted manuscript has been edited, the authors have submitted any final corrections, and all changes have been incorporated, the manuscript will be published online. At that time the manuscript will receive a Digital Object Identifier (DOI) number. Both forms can be found at www.tjh.

CONTENTS

265

Research Articles

293

The Effect of Hyperparathyroid State on Platelet Functions and Bone Loss Göknur Yorulmaz, Ayşen Akalın, Olga Meltem Akay, Garip Şahin, Cengiz Bal

Prognostic Factors and a New Prognostic Index Model for Children and Adolescents with Hodgkin’s Lymphoma Who Underwent Autologous Hematopoietic Stem Cell Transplantation: A Multicenter Study of the Turkish Pediatric Bone Marrow Transplantation Study Group

Vural Kesik, Erman Ataş, Musa Karakükcü, Serap Aksoylar, Fatih Erbey, Nurdan Taçyıldız, Alphan Küpesiz, Haldun Öniz,

Ekrem Ünal, Savaş Kansoy, Gülyüz Öztürk, Murat Elli, Zühre Kaya, Emel Ünal, Volkan Hazar, Şebnem Yılmaz Bengoa,

Gülsün Karasu, Didem Atay, Ayhan Dağdemir, Hale Ören, Ülker Koçak, M. Akif Yeşilipek 273 The Role of Azacitidine in the Treatment of Elderly Patients with Acute Myeloid Leukemia: Results of a Retrospective Multicenter Study

Anıl Tombak, Mehmet Ali Uçar, Aydan Akdeniz, Eyüp Naci Tiftik, Deniz Gören Şahin, Olga Meltem Akay, Murat Yıldırım,

Oral Nevruz, Cem Kis, Emel Gürkan, Şerife Medeni Solmaz, Mehmet Ali Özcan, Rahşan Yıldırım, İlhami Berber, Mehmet Ali Erkurt,

Tülin Fıratlı Tuğlular, Pınar Tarkun, İrfan Yavaşoğlu, Mehmet Hilmi Doğu, İsmail Sarı, Mustafa Merter, Muhit Özcan,

Esra Yıldızhan, Leylagül Kaynar, Özgür Mehtap, Ayşe Uysal, Fahri Şahin, Ozan Salim, Mehmet Ali Sungur 281 The Prognosis of Adult Burkitt’s Cell Leukemia in Real-Life Clinical Practice

Ümit Yavuz Malkan, Gürsel Güneş, Hakan Göker, İbrahim C. Haznedaroğlu, Kadir Acar, Eylem Eliaçık, Sezgin Etgül, Tuncay Aslan,

Seda Balaban, Haluk Demiroğlu, Osman I. Özcebe, Nilgün Sayınalp, Salih Aksu, Yahya Büyükaşık 286 Expression Profiles of the Individual Genes Corresponding to the Genes Generated by Cytotoxicity Experiments with Bortezomib in

Multiple Myeloma

Mehdi Ghasemi, Semih Alpsoy, Seyhan Türk, Ümit Y. Malkan, Şükrü Atakan, İbrahim C. Haznedaroğlu, Gürsel Güneş,

Mehmet Gündüz, Burak Yılmaz, Sezgin Etgül, Seda Aydın, Tuncay Aslan, Nilgün Sayınalp, Salih Aksu, Haluk Demiroğlu,

Osman İ. Özcebe, Yahya Büyükaşık, Hakan Göker

299

304

311

320

326

Warfarin Dosing and Time Required to Reach Therapeutic International Normalized Ratio in Patients with Hypercoagulable Conditions Pushpinderdeep Kahlon, Shahzaib Nabi, Adeel Arshad, Absia Jabbar, Ali Haythem Early Changes of Mannose-Binding Lectin, H-Ficolin, and Procalcitonin in Patients with Febrile Neutropenia: A Prospective Observational Study Sibel Işlak Mutcalı, Neşe Saltoğlu, İlker İnanç Balkan, Reşat Özaras, Mücahit Yemişen, Bilgül Mete, Fehmi Tabak, Ali Mert, Recep Öztürk, Seniz Öngören, Zafer Başlar, Yıldız Aydın, Burhan Ferhanoğlu, Teoman Soysal Prospective Evaluation of Infection Episodes in Cancer Patients in a Tertiary Care Academic Center: Microbiological Features and Risk Factors for Mortality Nursel Çalık Başaran, Ergun Karaağaoğlu, Gülşen Hasçelik, Mine Durusu Tanrıöver, Murat Akova Effect of Hereditary Hemochromatosis Gene H63D and C282Y Mutations on Iron Overload in Sickle Cell Disease Patients Yunus Kasım Terzi, Tuğçe Bulakbaşı Balcı, Can Boğa, Zafer Koç, Zerrin Yılmaz Çelik, Hakan Özdoğu, Sema Karakuş, Feride İffet Şahin

Health-Related Quality of Life, Depression, Anxiety, and Self-Image in Acute Lymphocytic Leukemia Survivors Birol Baytan, Çiğdem Aşut, Arzu Çırpan Kantarcıoğlu, Melike Sezgin Evim, Adalet Meral Güneş

Brief Reports

331

Clinical Courses of Two Pediatric Patients with Acute Megakaryoblastic Leukemia Harboring the CBFA2T3-GLIS2 Fusion Gene Mayu Ishibashi, Tomoko Yokosuka, Masakatsu D. Yanagimachi, Fuminori Iwasaki, Shin-ichi Tsujimoto, Koji Sasaki, Masanobu Takeuchi, Reo Tanoshima, Hiromi Kato, Ryosuke Kajiwara, Fumiko Tanaka, Hiroaki Goto, Shumpei Yokota

A-IX

335

339

Evaluation of Insulin-like Growth Factor-1 and Insulin-like Growth Factor Binding Protein-3 Expression Levels in Patients with Chronic Lymphocytic Leukemia Mesut Ayer, Abdullah Sakin, Selim Ay, Aylin Ayer, Elif Gökçen Sazak, Melih Aktan The Frequency of HLA-A, HLA-B, and HLA-DRB1 Alleles in Patients with Acute Lymphoblastic Leukemia in the Turkish Population: A Case-Control Study Türkan Patıroğlu, H. Haluk Akar

346

Varicella-Zoster Virus Infections in Pediatric Malignancy Patients: A Seven-Year Analysis Mine Düzgöl, Gülcihan Özek, Nuri Bayram, Yeşim Oymak, Ahu Kara, Bengü Demirağ, Tuba Hilkay Karapınar, Yılmaz Ay, Canan Vergin, İlker Devrim

349

Images in Hematology

351

Chediak-Higashi Syndrome in Accelerated Phase Masquerading as Acute Leukemia Mili Jain, Ashutosh Kumar, Uma Shankar Singh, Rashmi Kushwaha Auer Rod-Like Inclusions in Reactive Plasma Cells in a Case of Acute Myeloid Leukemia Sarita Pradhan

353

Coexistence of Chronic Lymphocytic Leukemia and Acute Myeloid Leukemia Ivana Milosevic

355

Letters to the Editor

356

358

Therapeutic Plasma Exchange Ameliorates Incompatible Crossmatches Mehmet Özen, Sinan Erkul, Gülen Sezer Alptekin Erkul, Özlem Genç, Engin Akgül, Ahmet Hakan Vural Megaloblastic Anemia with Ring Sideroblasts Is Not Always Myelodysplastic Syndrome Neha Chopra Narang, Mrinalini Kotru, Kavana Rao, Meera Sikka

360

Annular Erythematous Patches as the Presenting Sign of Extranodal Natural Killer/T-Cell Lymphoma Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı, Zeynep Topkarcı, Özgür Demir, Nesimi Büyükbabani

362

Presentation of Diffuse Large B-Cell Lymphoma Relapse as a Penile Mass Birgül Öneç, Kürşad Öneç, Ali Ümit Esbah, Onur Esbah

363

Successful Treatment of Disseminated Fusariosis with the Combination of Voriconazole and Liposomal Amphotericin B Nur Efe İris, Serkan Güvenç, Tülay Özçelik, Aslıhan Demirel, Safiye Koçulu, Esin Çevik, Mutlu Arat

365

NOS3 27-bp and IL4 70-bp VNTR Polymorphisms Do Not Contribute to the Risk of Sickle Cell Crisis Henu Verma, Hrishikesh Mishra, P. K. Khodiar, P. K. Patra, L. V. K. S. Bhaskar

367

Comment: In Response to “Auer Rod-Like Inclusions in Reactive Plasma Cells in a Case of Acute Myeloid Leukemia” Smeeta Gajendra

368

Reply: “Auer Rod-Like Inclusions in Reactive Plasma Cells in a Case of Acute Myeloid Leukemia” Sarita Pradhan

368

Auer Rods Are Not Seen in Non-Neoplastic Cells İrfan Yavaşoğlu, Zahit Bolaman

370

Iron and Zinc Treatment in Iron Deficiency Beuy Joob, Viroj Wiwanitkit

Evaluation of Knowledge of Patients with Hemophilia Regarding Their Diseases and Treatment in Iran Mehran Karimi, Tahereh Zarei, Sezaneh Haghpanah, Zohreh Zahedi

A-X

Advisory Board of This Issue (December 2016) Aaron Reitman, USA Abbas Abdulsalam, Iraq Ahmet Emre Eşkazan, Turkey Ana Boban, Croatia Ateş Kara, Turkey Athanasios D. Giannoukas, Greece Aurore Keutgens, Belgium Ban Hock Tan, Singapore Betül Tavil, Turkey Brenda Cooper, USA Bülent Eser, Turkey Burhan Ferhanoğlu, Turkey David Yang, Canada Deniz Arıca, Turkey Deniz Karapınar, Turkey Dongjin Wang, China Elena Cassinerio, Italy Elif Ünal İnce, Turkey Fahri Şahin, Turkey Gerwin Huls, Netherlands

Hamdi Akan, Turkey Heidrun Karlic, Austria Hyun-Jeong Cho, Korea İlknur Kozanoğlu, Turkey Javier Fernandez Torres, Mexico John Bennett, USA Jose Perdomo, Australia Kaan Kavaklı, Turkey Levent Ündar, Turkey Marie Ambroise, India Mehmet Ali Ergün, Turkey Mehmet Turgut, Turkey Meliha Nalçacı, Turkey Meral Beksaç, Turkey Müge Sayitoğlu, Turkey Muhlis Cem Ar, Turkey Murat Akova, Turkey Nazan Sarper, Turkey Nil Güler, Turkey Ning Lou, China

Pasquale Niscola, Italy Pervin Topçuoğlu, Turkey Peter Bronnum Nielsen, Denmark Prakas Mandal, India Pranaw Kumar Jha, India Rahajeng Tunjungputri, Netherlands Sandeep Dhindsa, USA Selami Koçak Toprak, Turkey Sema Anak, Turkey Sevgi Kalayoğlu Beşışık, Turkey Shamsher Singh, Australia Suar Çakı Kılıç, Turkey Tahsin Özpolat, USA Tülay Tecimer, Turkey Türkan Patıroğlu, Turkey Valerio Cecinatl, Italy Veysel Sabri Hançer, Turkey Yasemin Işık Balcı, Turkey

6th International Congress on

Leukemia Lymphoma Myeloma May 11 - 13

2017

İSTANBUL TURKEY

Radison Blu Hotel, Şişli

www.icllm2017.org

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0280 Turk J Hematol 2016;33:265-272

Prognostic Factors and a New Prognostic Index Model for Children and Adolescents with Hodgkin’s Lymphoma Who Underwent Autologous Hematopoietic Stem Cell Transplantation: A Multicenter Study of the Turkish Pediatric Bone Marrow Transplantation Study Group Otolog Hematopoetik Kök Hücre Nakli Uygulanmış Hodgkin Lenfomalı Çocuk ve Adölesanlarda Prognostik Faktörler ve Yeni Bir Prognostik İndeks Modeli: Türk Pediatrik Kemik İliği Nakli Çalışma Grubundan Çok Merkezli Çalışma Vural Kesik1, Erman Ataş1, Musa Karakükcü2, Serap Aksoylar3, Fatih Erbey4, Nurdan Taçyıldız5, Alphan Küpesiz6, Haldun Öniz7, Ekrem Ünal2, Savaş Kansoy3, Gülyüz Öztürk4, Murat Elli8, Zühre Kaya9, Emel Ünal5, Volkan Hazar6, Şebnem Yılmaz Bengoa10, Gülsün Karasu11, Didem Atay4, Ayhan Dağdemir8, Hale Ören10, Ülker Koçak9, M. Akif Yeşilipek11 1Gülhane Training and Research Hospital Clinic of Pediatric Oncology, Ankara, Turkey 2Erciyes University Faculty of Medicine, Department of Pediatric Hematology-Oncology and Bone Marrow Transplantation Unit, Kayseri, Turkey

Öz

3Ege University Faculty of Medicine, Department of Pediatric Oncology and Bone Marrow Transplantation Unit, İzmir, Turkey 4Medical Park Bahçelievler Hospital, Pediatric Bone Marrow Transplantation Unit, İstanbul, Turkey 5Ankara University Faculty of Medicine, Department of Pediatric Oncology and Bone Marrow Transplantation Unit, Ankara, Turkey 6Akdeniz University Faculty of Medicine, Department of Pediatric Hematology-Oncology and Bone Marrow Transplantation Unit, Antalya, Turkey 7Tepecik Training and Research Hospital, Clinic of Pediatric Oncology and Bone Marrow Transplantation Unit, İzmir, Turkey 8Ondokuz Mayıs University Faculty of Medicine, Department of Pediatric Oncology and Bone Marrow Transplantation Unit, Samsun, Turkey 9Gazi University Faculty of Medicine, Department of Pediatric Hematology and Bone Marrow Transplantation Unit, Ankara, Turkey 10Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology and Bone Marrow Transplantation Unit, İzmir, Turkey 11Medical Park Göztepe Hospital, Pediatric Bone Marrow Transplantation Unit, İstanbul, Turkey

Abstract

Öz

Objective: The prognostic factors and a new childhood prognostic index after autologous hematopoietic stem cell transplantation (AHSCT) in patients with relapsed/refractory Hodgkin’s lymphoma (HL) were evaluated.

Amaç: Relaps/refrakter Hodgkin lenfomanın (HL) otolog hematopoetik kök hücre nakli (OHKHN) sonrasındaki prognozunu gösterecek belirteçler ve çocukluk çağında yeni bir prognostik skorlama araştırıldı.

Materials and Methods: The prognostic factors of 61 patients who underwent AHSCT between January 1990 and December 2014 were evaluated. In addition, the Age-Adjusted International Prognostic Index and the Childhood International Prognostic Index (CIPI) were evaluated for their impact on prognosis.

Gereç ve Yöntemler: Bu çalışmada, Ocak 1990-Aralık 2014 tarihleri arasında OHKHN uygulanan 61 hastanın OHKHN sonrası prognozunu etkileyen faktörlerin sağkalım üzerine etkisi araştırıldı. Aynı zamanda Yaşa Göre Düzeltilmiş Uluslararası Prognostik İndeks ve Çocukluk Dönemi Uluslararası Prognostik İndeks’lerinin (ÇDUPİ) prognoz üzerindeki etkisi değerlendirildi.

Results: The median age of the 61 patients was 14.8 years (minimummaximum: 5-20 years) at the time of AHSCT. There were single relapses in 28 patients, ≥2 relapses in eight patients, and refractory disease in 25 patients. The chemosensitivity/chemorefractory ratio was 36/25. No pretransplant radiotherapy, no remission at the time of

Bulgular: Altmış bir hastanın ortanca yaşı OHKHN sırasında 14,8 yıl (5-20 yıl) idi. Hastalardan, 28 olguda bir relaps, 8 olguda ≥2 relaps ve 25 olguda refrakter hastalık vardı. Kemosensitivite/kemoterapiye dirençlilik oranı 36/25 idi. Nakil öncesi radyoterapi almamak, nakil öncesi remisyonda olmamak, nakil sonrası beyaz kan hücresi sayısının

Address for Correspondence/Yazışma Adresi: Vural KESİK, M.D., Gülhane Training and Research Hospital Clinic of Pediatric Oncology, Ankara, Turkey Phone : +90 312 304 43 94 E-mail : vural73@yahoo.com

Received/Geliş tarihi: July 29, 2015 Accepted/Kabul tarihi: November 02, 2015

265

Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation

transplantation, posttransplant white blood cell count over 10x103/ µL, posttransplant positron emission tomography positivity at day 100, and serum albumin of <2.5 g/dL at diagnosis were correlated with progression-free survival. No remission at the time of transplantation, bone marrow positivity at diagnosis, and relapse after AHSCT were significant parameters for overall survival.

Turk J Hematol 2016;33:265-272

10x103/µL üzerinde olması, nakil sonrası 100. gün pozitron emisyon tomografisi pozitifliği, tanıda 2,5 g/dL’den düşük serum albümin düzeyi progresyonsuz sağkalım üzerinde etkili belirteçler iken transplantasyon zamanı remisyonda olmamak, tanıda kemik iliği pozitifliği ve OHKHN sonrası relaps ise genel sağkalım üzerinde etkili parametreler olarak bulundu.

Conclusion: The major factors affecting the progression-free and overall survival were clearly demonstrated. A CIPI that uses a lactate dehydrogenase level of 500 IU/L worked well for estimating the prognosis. We recommend AHSCT at first complete remission for relapsed cases, and it should also be taken into consideration for patients with high prognostic scores at diagnosis.

Sonuç: Relaps/refrakter HL’li çocuklarda progresyonsuz ve genel sağkalımı etkileyen faktörler açıkça gösterildi. Serum laktat dehidrogenaz üst sınırını 500 IU/L olarak kullanan ÇDUPİ prognozu göstermede etkili bulundu. Relaps hastalarda ilk tam remisyonda OHKHN yapılmasını ve tanı anında yüksek prognostik skoru olan olguların da OHKHN açısından değerlendirmeye alınmasını önermekteyiz.

Keywords: Childhood Hodgkin’s lymphoma, Prognosis, Autologous hematopoietic stem cell transplantation, Prognostic index

Anahtar Sözcükler: Çocukluk çağı Hodgkin lenfoma, Prognoz, Otolog hematopoetik kök hücre nakli, Prognostik indeks

Introduction Children with Hodgkin’s lymphoma (HL) have an excellent prognosis, and their survival rates are satisfactory. The survival rates for HL have increased from 81% to 95% for children and adolescents, even those with advanced-stage disease [1].

Approximately 15% of patients cannot be cured and experience relapse after first-line treatment [2]. The relapse rate is increased up to 30% in advanced stages, and most relapses of HL occur within the first 2 years after completing treatment [3,4]. Autologous hematopoietic stem cell transplantation (AHSCT) is recommended for patients with refractory disease during therapy or disease relapse within 1 year after completing therapy [5,6]. However, some patients who undergo AHSCT develop recurrence within 1 year [7].

There has been much research on the prognostic parameters of patients who get worse [8,9,10,11,12]. These prognostic parameters and scores include the International Prognostic Index (IPI) and the Age-Adjusted IPI (AAIPI), which have been proven to show a close relationship between relapse and a poor prognosis [13]. However, most of these parameters and scores are for newly diagnosed and adult patients. Thus, in this multicenter study, we evaluated the effect of various factors and prognostic indexes, at diagnosis and pre- and posttransplant, on the relapse rate and survival of children with HL who undergo AHSCT. In addition, we aimed to create and develop a new international prognostic index that is specific to children with newly diagnosed advanced Hodgkin’s disease in order to evaluate the prognosis even after AHSCT.

Materials and Methods This was a multicenter and retrospective study. Eleven pediatric stem cell transplant centers in different cities around Turkey participated, and the data were recorded retrospectively for 61 patients between January 1990 and December 2014. Three patients had undergone AHSCT before the year 2000, while 58 had undergone AHSCT after that point. Approval for the study 266

was obtained from the local ethics committee. Exclusion criteria for the subjects included lymphomas other than HL and missing data. In four cases of an unknown pathologic subgroup of HL, the histologic slides were re-reviewed.

Participants’ Characteristics Sixty-one children from 11 centers, who underwent AHSCT for refractory or recurrent HL, were included and retrospectively analyzed. They showed some significant index values at diagnosis, pretransplant, and posttransplant for survival and event status after AHSCT. Age, sex, concomitant diseases such as immune deficiency syndromes, and risk factors were analyzed. At diagnosis, risk factors were based on age, sex, primary tumor localization, number of relapses, time to relapse from diagnosis until completing the treatment, response to salvage chemotherapy, stage of disease, Karnofsky/Lansky score, pathologic HL type, bulky tumor, spleen involvement, extranodal involvement, bone or bone marrow involvement, B symptoms, hemoglobin, white blood cell (WBC) count, lymphocytes, monocytes, mean platelet volume (MPV), ferritin, albumin, lactate dehydrogenase (LDH), and sedimentation rate. Pretransplant risk factors were based on positron emission tomography-computed tomography (PETCT) positivity, number of chemotherapy regimens, radiotherapy (RT), conditioning regimen, and disease status at the time of transplantation. After transplant, the risk factors were based on lymphocyte counts on posttransplant days 15 and 100, WBC counts, neutrophils, monocytes, platelets, MPV, neutrophil/ lymphocyte ratio (NLR), platelet/lymphocyte ratio (PLR), LDH, and positivity of PET-CT on posttransplant day 100.

Description of Features Chemosensitivity: Susceptibility to the action of the chemotherapy protocol with a complete or very good response.

Staging: HL was graded using the Cotswold modification of the Ann Arbor staging system. Bulky disease is defined as the

Turk J Hematol 2016;33:265-272

Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation

largest deposit being >10 cm or the mediastinum being wider than one-third of the chest on chest X-ray [14].

Time to relapse: Refractory disease was defined as occurring within 3 months after completion of therapy or during therapy.

Early relapse was defined as disease recurring within 3-12 months, and late relapse was defined as disease occurring more than 12 months from the end of therapy [5].

Prognostic Indexes Karnofsky/Lansky a Status The Karnofsky/Lansky performance status is used to determine the functional status of the patient and is essential for all outcome-based analyses. The Karnofsky scale is designed for patients aged 16 years and older, and the Lansky scale is designed for those under 16 years. The Karnofsky/Lansky scores range from 100 to 0, with 100 indicating ‘perfect’ health and 0 representing death [15].

Childhood International Prognostic Index The original AAIPI incorporates serum LDH levels, Eastern Cooperative Oncology Group (ECOG) performance status, and Ann Arbor clinical stage at diagnosis. Based on these factors, patients are divided into four risk groups: 0, low risk; 1, lowintermediate risk; 2, high-intermediate risk; and 3, high risk [13].

We adapted the AAIPI for children according to an LDH level of 500 IU/L instead of 250 IU/L because of its high prognostic predictively in childhood HL, and we used the Cotswold modification of the Ann Arbor clinical stage at diagnosis with an ECOG modification score according to the pretransplant Karnofsky/Lansky performance score [15] and the Childhood International Prognostic Index (CIPI).

Types of Outcome Measures The definitions used as survival terms were as follows: 1) overall survival (OS) was calculated from the start of the treatment until death from any cause; 2) progression-free survival (PFS) was the achievement of stable disease without signs of progression, calculated from the day of transplant to the date of the next relapse or from the date of randomization for post-complete remission (CR) questions; and 3) event-free survival (EFS) was calculated from the date of the start of treatment to the date of the first event (failure to achieve CR, relapse, or death from any cause).

Statistical Analysis Statistical analyses were performed using SPSS 15.0. Descriptive analyses were presented using medians or mean ± standard deviation for variables. The Kaplan-Meier method and logrank tests were used in the analysis. The risk factors described above were analyzed as prognostic factors for the survival rate

with Cox regression analysis. Variables with values of p<0.05 were shown in the univariate analysis and were included in the multivariate analysis model. A p-value of less than 0.05 was considered to show a statistically significant result.

Results Clinical Features of Patients Sixty-one patients with refractory/relapsed HL were analyzed.

The demographic features are presented in Table 1. The median age was 14.8 years (minimum-maximum: 5-20), and the male/female ratio was 40/21=1.9. The subtypes of HL were lymphocyte-rich in three cases, nodular sclerosis in 32, mixed cellularity in 23, and unclassified in three. The chemosensitivity/ chemorefractory ratio was 36/25. Additional conditions, such as tuberculosis (n=3), hepatitis B, Castleman disease, chronic persistent hepatitis, pericardial effusion, and thymoma, were detected in eight (13.1%) cases. The primary tumor localizations were cervical in 24 (39.3%) cases, mediastinal in 24 (39.3%), abdominal in nine (14.8%), inguinal in three (4.9%), and bone in one (1.6%). There was bulky tumor in 21 (34.4%) cases, extranodal involvement in 27 (44.3%), spleen involvement in 33 (54.1%), bone involvement in 12 (19.7%), and bone marrow involvement in one (1.6%). Stage I disease was detected in nine (14.7%) cases, Stage II in 12 (19.7%), Stage III in 10 (16.4%), and Stage IV in 30 (49.2%). Median (mean ± standard deviation, minimum-maximum) hemoglobin, WBC count, lymphocytes, monocytes, platelets, MPV, ferritin, albumin, LDH, erythrocyte sedimentation rate, and Karnofsky/Lansky score at diagnosis were 10.8 g/L (10.7±1.7 g/L, 5.9-13.1), 11.4x103/µL (11.7±5.7x103/ µL, 3.7-24.2), 1.8x103/µL (2±1.1x103/µL, 0.5-4.7), 0.7x103/µL (1.2±1.1x103/µL, 0.2-6.4), 352x103/µL (425-157x103/µL, 193797), 7.6 fL (7.5±1.1 fL, 5.3-9.7), 165 ng/dL (349±320 ng/dL, 201290), 3.7 mg/dL (3.8±0.8 mg/dL, 1.4-4.9), 419 IU/L (460±192 IU/L, 150-970), 63 mm/h (63±37 mm/h, 10-140), and 90 (88±16, 40-100), respectively.

Forty-two (68.8%) patients underwent RT before AHSCT. At the time of the study, 44 of 61 patients were alive, 15 were dead, and two were lost to follow-up. The causes of death were progressive disease in nine patients, infection in two patients, and other reasons except for relapse in four patients, including posttransplant lymphoproliferative disease in one case, acute myeloid leukemia progression in another, anaplastic large cell lymphoma as a secondary cancer in another, and transplantrelated pulmonary hemorrhage in the last. The nonrelapse mortality rate was 40% (infection in two cases, other causes except for relapse in four cases, and lost to follow-up in two cases). The mortality rate 100 days after AHSCT was 6.5% (4 of 61 cases). The transplant-related mortality rate 100 days after AHSCT was 3.2% (2 of 61 cases; infection in one case and pulmonary hemorrhage in the other). The median relapse time 267

Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation

Table 1. Demographic, clinical, and histopathological features of the patients with relapsed refractory Hodgkin’s lymphoma.

Features

Number

%

Male

40

65.6

Female

21

34.4

Sex

Age (years) 5-10

5

8.2

11-15

26

42.6

>15

30

49.2

Subtype of Hodgkin’s lymphoma Lymphocyte-rich

3

4.9

Nodular sclerosis

32

52.5

Mixed cellularity

23

37.7

Unclassified

3

4.9

Cervical

24

39.3

Mediastinal

24

39.3

Abdominal

9

14.8

Inguinal

3

4.9

Bone

1

1.6

Bulky tumor

21

34.4

Extranodal

27

44.3

Spleen

33

54.1

Bone

12

19.7

Bone marrow

1

1.6

I

9

14.7

II

12

19.7

III

10

16.4

IV

30

49.2

Chemosensitive

36

59.1

Chemorefractory

25

40.9

Refractory

33

54.1

Early

12

19.7

Late

16

26.2

Yes

42

68.8

No

19

31.2

Primary localization

Other features and involvements

Stage

Response to chemotherapy

Type of relapse

Radiotherapy before AHSCT

268

Turk J Hematol 2016;33:265-272

Table 1. Continuation Disease status at AHSCT CR2

28

45.9

≥CR3

8

13.2

Refractory

25

40.9

BEAM

44

72.1

Others

17

27.9

Conditioning regimens

PET-CT positivity before/after day 100 after AHSCT Yes

22/14

37/23

No

49/47

63/77

AHSCT: Autologous hematopoietic stem cell transplantation, CR: complete remission, PET-CT: positron emission tomography-computerized tomography.

was 11 months (minimum-maximum: 1-105). Types of relapse were refractory disease in 33 (54.1%) patients, early relapse in 12 (19.7%), and late relapse in 16 (26.2%). The PFS and OS rates for type of relapse were as follows: the 3-year PFS rates were 93.8% for late relapse, 91.7% for early relapse, and 38.7% for refractory disease (p<0.001); the OS rates were 100% for late relapse, 83.3% for early relapse (death due to other causes except for relapse and infection), and 57.6% for refractory disease (p=0.003). The 3-year survival rates were 57.6% for refractory disease and 88.9% for patients who responded (p=0.001). Threeyear PFS rates were 38.7% for refractory disease and 94.4% for patients who responded (p<0.001).

Features of Treatment All of the patients underwent AHSCT. The disease status at the time of transplantation was as follows: 36 patients were in CR (CR2=28 patients, ≥CR3=8 patients) and 25 patients with refractory disease were not in remission. The 3-year PFS rates were 77.3% for patients with remission and 49.3% for patients without remission (p=0.007), while the OS rates were 91.4% for patients with remission and 59.1% for patients without remission (p=0.01).

The BEAM regimen was used in 44 (72.1%) patients, and other regimens were used in 17 (27.9%). Cyclophosphamide, etoposide, and BCNU in one case; busulphan and melphalan in five cases; busulphan, cyclophosphamide, and etoposide in four cases; fludarabine and busulphan in one case; total body irradiation, cyclophosphamide, and etoposide in three cases; CCNU, ifosfamide, and etoposide in two cases; and CCNU, cyclophosphamide, and etoposide in one case were used as other conditioning regimens. PET positivity and negativity were 37% and 63%, respectively, before AHSCT; however, these rates were 23% and 77% after AHSCT on day 100. Forty-two children (68.8%) received RT before AHSCT.

Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation

Turk J Hematol 2016;33:265-272

Treatment Results The median (mean ± standard deviation, minimum-maximum) level of lymphocyte counts at day 15 after AHSCT was 0.45x103/ µL (0.51±0.38x103/µL, 0.01-1.8). The median (mean ± standard deviation, minimum-maximum) levels of WBCs, lymphocytes, neutrophils, monocytes, platelets, and MPV at day 100 after AHSCT were 3.9x103/µL (4.6±2.7x103/µL, 1.2-14.6), 1.3x103/ µL (1.4±0.9x103/µL, 0.02-5.1), 1.9x103/µL (2.5±2.3x103/µL, 0.312.4), 0.36x103/µL (0.41±0.27x103/µL, 0.04-1.43), 127x103/ µL (131±80x103/µL, 14-308), and 7.5 fL (7.7±1.4 fL, 4.9-11.3), respectively. Three-year OS/PFS rates were 77.3% and 68.5% with a median follow-up of 27 months (minimum-maximum: 1-114 months) for all patients, respectively. The prognostic factors affecting EFS and OS are presented in Tables 2 and 3.

of 2 (p=0.36), while the 3-year OS rates were 80.0% for a score of 0 (death due to infection), 93.3% for a score of 1, and 75.0% for a score of 2 (p=0.46) (Figure 1).

Patients were scored based on a WBC count of >10x103/µL at 100 days after AHSCT (0: no, 1: yes), RT before AHSCT (0: yes, 1: no), remission status at AHSCT (0: yes, 1: no), PET-CT status at 100 days after AHSCT (0: negative, 1: positive), and serum albumin of <2.5 g/dL (0: no, 1: yes). This scoring correlated with

The 3-year PFS and OS rates were 65.2% and 78.4%, respectively, in patients who underwent AHSCT after the year 2000, but of the three cases recorded before the year 2000, two patients relapsed and all died.

With regard to the CIPI scores, the 3-year PFS rates were 100% for a score of 0, 61.3% for a score of 1, and 60.0% for a score

Figure 1. (A) Progression-free and (B) overall survival according to Childhood International Prognostic Index scores [254x135 mm (72x72 DPI)].

Table 2. Effective parameters on relapse of patients with Hodgkin’s lymphoma after autologous hematopoietic stem cell transplantation in univariate and multivariate analysis.

Prognostic factors

Category

Univariate analysis

HR

95% CI

p

Multivariate analysis HR

95% CI

p

Subtype of HL

LR/MC/NS/UC

1.6

1.1-2.6

0.042

-

-

-

WBC at 100 days after AHSCT

≥10x103/µL

5.4

1.5-19.2

0.009

32.8

1.9-544.3

0.015

RT before AHSCT

No

3.1

1.2-7.6

0.019

13.2

1.3-129.5

0.027

Disease status at AHSCT

NR

3.2

1.2-8.2

0.012

18.5

1.4-152.1

0.048

Primary refractory

Yes

4.1

1.5-10.4

0.003

-

-

-

Type of relapse

L/E/VE

0.17

0.06-0.53

0.002

-

-

-

PET-CT status at 100 days after AHSCT

Positive

4.4

1.2-7.6

0.009

137.9

2.1-9093.1

0.021

Serum albumin at diagnosis

<2.5 g/dL

13.1

1.2-14.4

0.035

59.5

1.6-2238.6

0.027

p<0.05 is significant. PET-CT: Positron emission tomography-computed tomography, CI: confidence interval, AHSCT: autologous stem cell transplantation, CR: complete remission, NR: no remission, L: late relapse, E: early relapse, VE: very early relapse, HR: hazard ratio, WBC: white blood cell count, RT: radiotherapy, LR: lymphocyte-rich, MC: mixed cellularity, NS: nodular sclerosing, UC: unclassified, HL: Hodgkin’s lymphoma.

Table 3. Effective parameters on survival of patients with Hodgkin’s lymphoma after AHSCT in univariate and multivariate analysis.

Prognostic factors

Category

Univariate analysis

Multivariate analysis

HR

95% CI

p

HR

95% CI

p

Disease status at AHSCT

NR

3.2

1.2-9.1

0.027

12.4

1.4-107.1

0.022

Type of relapse

L/E/VE

0.11

0.02-0.72

0.002

-

-

Relapse after AHSCT

Yes

7.6

2.1-27.5

0.002

11.2

2.5-50.3

0.002

PET-CT status at 100 days after AHSCT

Positive

4.2

1.1-17.5

0.04

-

-

-

Bone marrow (+) at diagnosis

Yes

11.3

1.3-96.8

0.027

48.4

3.9-586.7

0.002

p<0.05 is significant. PET-CT: Positron emission tomography-computed tomography, CI: confidence interval, AHSCT: autologous hematopoietic stem cell transplantation, CR: complete remission, NR: no remission, L: late relapse, E: early relapse, VE: very early relapse, HR: hazard ratio.

269

Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation

the following 3-year PFS rates: Group 0=100%, Group 1=66.7%, Group 2=50%, and Group >3=0% (p=0.001) (0: low risk, 1: lowintermediate risk, 2: high-intermediate risk, >3: high risk). For 3-year OS, remission status at AHSCT (0: yes, 1: no), relapse after AHSCT (0: no, 1: yes), and bone marrow positivity at diagnosis (0: no, 1: yes) were scored and showed that Group 0=92%, Group 1=78.6%, and Group 2=40% (p<0.001).

Discussion Several prognostic factors affect survival in HL, such as extranodal disease at time of relapse, mediastinal mass at time of transplant, advanced stage at relapse, primary refractory disease, and a positive PET scan prior to AHSCT [2,16,17,18,19].

We found that no pretransplant RT, a posttransplant WBC count of >10x103/µL, posttransplant PET positivity at day 100, serum albumin of <2.5 g/dL at diagnosis, no remission at the time of transplantation, bone marrow positivity at diagnosis, and relapse after AHSCT were significant parameters related to events after AHSCT and OS. In addition, CIPI was significant in estimating survival after AHSCT in HL. RT is an important treatment method for HL. Although there have been several studies on discarding RT in the treatment of HL at earlier stages, its removal has been proven to increase the risk of relapse at later stages [20]. Some centers also tend to give RT after transplantation in order to not waste time before the transplant and to avoid recurrence of the disease. Our results clearly showed that there was a 13.2-fold increased risk of relapse in patients who underwent RT after transplant, but there was no impact on OS. Lowering the tumor volume with RT before AHSCT may improve the prognosis.

The NLR and PLR were reported to indicate disease severity and prognosis in patients with various diseases [21]. However, there is no relationship between pretransplant and posttransplant NLR, PLR, lymphocyte, monocyte, and MPV levels in patients who survive. There is also no relationship between pre- and posttransplant neutrophil, lymphocyte, NLR, PLR, and MPV levels and survival. However, on posttransplant day 100, a WBC count of over 10x103/µL was found to increase the relapse risk 32.8-fold, but it had no impact on OS. Several prognostic indexes have been used to evaluate the survival of patients with lymphoma. The IPI and the AAIPI are the two of the leading methods [13]. Low scores are correlated with a high survival rate and high scores with a low survival rate. Satwani et al. [22] reported that patients with relapsed/ refractory HL in the high-risk group according to prognostic models for PFS have a high progression risk after AHSCT. We used the CIPI and it worked well for estimating survival. The survival rates of our patients were 100%, 59.3%, and 58.3% for events after AHSCT and 80%, 91.7%, and 80% for OS for scores 270

Turk J Hematol 2016;33:265-272

of 0, 1, and 2, respectively. According to our study, the risk of progression increased with the increase of the prognostic score, and this result was compatible with previous studies.

Some pediatric oncology centers may prefer to treat their patients with chemotherapy without AHSCT. However, the outcomes of patients who underwent salvage chemotherapy alone were not found to be satisfactory [23]. Studies about the proper timing of AHSCT are limited in pediatric populations. Stoneham et al. reported that AHSCT did not offer any significant survival advantages over conventional salvage therapy in children with relapsed HL compared to those with primary refractory disease [24]. Ataş et al. did not demonstrate survival improvement after AHSCT in early-relapse HL cases (n=6) when compared to laterelapse cases (n=3). Therefore, AHSCT is advisable regardless of the time of relapse in children with relapsed HL [25]. In our study, relapse occurred in 61 subjects with HL; of these, 33 cases (54.1%) were reported to be refractory to treatment, 12 (19.7%) were early relapses, and 16 (26.2%) were late relapses. Early relapse and refractory disease were three times more common than late relapse, and the OS rates were 100% for late relapse, 83.3% for early relapse, and 57.6% for refractory disease at 3 years.

Metzger et al. reported treatment results after initial salvage therapy according to early relapse (28%), late relapse (42%), and refractory disease (30%). However, inadequate response to initial salvage therapy was the only significant variable with regard to prognosis, and the 5-year OS rate for these patients was 17.9%, compared with 97.2% for the patients who responded [2]. In our study, the 5-year OS rate for patients with chemorefractory disease was 40.3%, compared to 88.9% for patients who responded. Based on these studies, it seems that chemorefractory patients have poor survival rates even after undergoing AHSCT. Disease status at transplantation (with or without CR) is one of the most important risk factors for outcomes. Marcais et al. reported a 39% OS rate and an 18% PFS rate for chemorefractory disease compared to patients in CR, who had a 70%-74% OS rate and a 40%-51% PFS rate at 3 years [26]. In our study, 36 patients were in CR and 25 patients were without remission. The survival rates of patients in remission prior to transplant were two times higher than those of patients without remission (OS: 91.4% vs. 59.1%). The relapse rate was lower in the remission group (PFS: 77.3% vs. 49.3%). If the tumor burden can be lowered sufficiently, the success of AHSCT treatment may increase, with high survival and low relapse rates.

The benefit of stem cell transplantation was mainly seen in PFS for patients with relapsed/refractory HL after first-line therapy [27]. Some authors recommended AHSCT for children with early relapsed and refractory HL [5,6,28]. The 3-year OS rate

Turk J Hematol 2016;33:265-272

Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation

for patients who underwent AHSCT was 77.3% in this study, and their PFS rate was 68.5%. Other studies on AHSCT reported the projected survival rate as 45% to 70% and PFS as 30% to 89% [16,17,18,29]. Despite our short median follow-up period (27 months), our results are comparable to those found in other reports of children with relapsed/refractory HL who received AHSCT.

that showed significance in a univariate but not a multivariate analysis appear to have an influence as well, and might show a stronger correlation in larger trials. Patients with high prognostic factors should be evaluated at diagnosis and may be directed to AHSCT consolidation therapy at the time of the first CR.

Pretreatment factors such as advanced stage of disease (Stage IIB, IIIB, or IV), presence of B symptoms, histology, presence of bulky disease, extranodal extension, elevated erythrocyte sedimentation rate, leukocytosis (WBC count of ≥11.5x103/ µL), anemia (hemoglobin of <10.5-11.0 g/L), male sex, rapidity of response to initial treatment with chemotherapy, fluorodeoxyglucose-PET avidity after two cycles, low serum albumin (<4 g/dL), and low lymphocyte count (<0.6x103/µL or <8% of WBC count) were reported as prognostic factors in previous studies [8,9,10,11,12,30]. Relapsed patients with HL who had localized disease that was treated with chemotherapy alone and/or low-dose involved-field radiation therapy consolidation, and whose relapse occurred ≥12 months after completing therapy, have better survival with intensive conventional chemotherapy [8]. Extranodal disease at relapse, mediastinal mass at time of transplant, advanced stage at relapse, primary refractory disease, and a positive PET scan prior to AHSCT were significant factors in post-AHSCT events [2,16,17,18,19]. Claviez et al. reported that the most important predictors for disease control following AHSCT were time to relapse and disease status at transplantation [5]. We found by multivariate analysis that a WBC count of >10x103/µL at 100 days after AHSCT, no RT before AHSCT, no remission after AHSCT, PET-CT positivity at 100 days after AHSCT, and serum albumin of <2.5 g/dL were significant factors for PFS, and that no remission after AHSCT, relapse after AHSCT, and bone marrow positivity at diagnosis were significant factors for OS.

Ethics Committee Approval: Gülhane Military Medical Academy Ethic Committee 03.02.2015/03, Informed Consent: Retrospective study.

In conclusion, the major factors affecting the prognosis of children with relapsed/refractory HL seem to be tumor load and chemosensitivity. Treatments that significantly decrease the tumor volume before AHSCT may improve the survival rate, as we saw a benefit with RT on EFS when performed before AHSCT. In addition, the survival rates of patients in remission before AHSCT were twice as high as those of patients without remission. AHSCT had a significant benefit on OS, but the timing must be investigated in larger studies. We also suggest different treatment approaches for patients with high IPI and/or CIPI scores to improve EFS and PFS. We suggest that a CIPI that uses an LDH level of 500 IU/L is more useful in childhood. A serum albumin status of <2.5 g/dL at diagnosis had a significant effect on PFS, pointing to the study of the immunologic profile of the patients, and the treatment schedule may be redesigned with this immunologic profile. In addition, the characteristics

Ethics

Authorship Contributions Concept: Vural Kesik, Erman Ataş, Musa Karakükcü, Serap Aksoylar, Fatih Erbey, Nurdan Taçyıldız, Alphan Küpesiz, Haldun Öniz, Ekrem Ünal, Savaş Kansoy, Gülyüz Öztürk, Murat Elli, Zühre Kaya, Emel Ünal, Volkan Hazar, Şebnem Yılmaz Bengoa, Gülsün Karasu, Didem Atay, Ayhan Dağdemir, Hale Ören, Ülker Koçak, M. Akif Yeşilipek; Design: Vural Kesik; Data Collection or Processing: Vural Kesik, Erman Ataş, Musa Karakükcü, Serap Aksoylar, Fatih Erbey, Nurdan Taçyıldız, Alphan Küpesiz, Haldun Öniz, Ekrem Ünal, Savaş Kansoy, Gülyüz Öztürk, Murat Elli, Zühre Kaya, Emel Ünal, Volkan Hazar, Şebnem Yılmaz Bengoa, Gülsün Karasu, Didem Atay, Ayhan Dağdemir, Hale Ören, Ülker Koçak, M. Akif Yeşilipek; Analysis or Interpretation: Vural Kesik, Erman Ataş; Literature Search: Vural Kesik; Writing: Vural Kesik, Erman Ataş.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Smith MA, Seibel NL, Altekruse SF, Ries LA, Melbert DL, O’Leary M, Smith FO, Reaman GH. Outcomes for children and adolescents with cancer: challenges for the twenty-first century. J Clin Oncol 2010;28:2625-2634.

2. Metzger ML, Hudson MM, Krasin MJ, Wu J, Kaste SC, Kun LE, Sandlund JT, Howard SC. Initial response to salvage therapy determines prognosis in relapsed pediatric Hodgkin lymphoma patients. Cancer 2010;116:43764384.

3. Voss SD, Chen L, Constine LS, Chauvenet A, Fitzgerald TJ, Kaste SC, Slovis T, Schwartz CL. Surveillance computed tomography imaging and detection of relapse in intermediate- and advanced-stage pediatric Hodgkin’s lymphoma: a report from the Children’s Oncology Group. J Clin Oncol 2012;30:2635-2640.

4. Kuruvilla J. Standard therapy of advanced Hodgkin lymphoma. Hematology Am Soc Hematol Educ Program 2009;1:497-506.

5. Claviez A, Sureda A, Schmitz N. Haematopoietic SCT for children and adolescents with relapsed and refractory Hodgkin’s lymphoma. Bone Marrow Transplant 2008;42(Suppl 2):16-24.

6. Körholz D, Claviez A, Hasenclever D, Kluge R, Hirsch W, Kamprad F, Dörffel W, Wickmann L, Papsdorf K, Dieckmann K, Kahn T, Mauz-Körholz C, Dannenberg C, Pötter R, Brosteanu O, Schellong G, Sabri O. The concept of the GPOH-HD 2003 therapy study for pediatric Hodgkin’s disease: evolution in the tradition of the DAL/GPOH studies. Klin Padiatr 2004;216:150-156.

271

Kesik V, et al: Prognostic Markers of Hodgkin’s Lymphoma after Autologous Hematopoietic Stem Cell Transplantation

7. Dhakal S, Biswas T, Liesveld JL, Friedberg JW, Phillips GL, Constine LS. Patterns and timing of initial relapse in patients subsequently undergoing transplantation for Hodgkin’s lymphoma. Int J Radiat Oncol Biol Phys 2009;75:188-192.

8. Nachman JB, Sposto R, Herzog P, Gilchrist GS, Wolden SL, Thomson J, Kadin ME, Pattengale P, Davis PC, Hutchinson RJ, White K, Children’s Cancer Group. Randomized comparison of low-dose involved-field radiotherapy and no radiotherapy for children with Hodgkin’s disease who achieve a complete response to chemotherapy. J Clin Oncol 2002;20:3765-3771.

9. Rühl U, Albrecht M, Dieckmann K, Lüders H, Marciniak H, Schellenberg D, Wickmann L, Dörffel W. Response-adapted radiotherapy in the treatment of pediatric Hodgkin’s disease: an interim report at 5 years of the German GPOH-HD 95 trial. Int J Radiat Oncol Biol Phys 2001;51:1209-1218.

10. Smith RS, Chen Q, Hudson MM, Link MP, Kun L, Weinstein H, Billett A, Marcus KJ, Tarbell NJ, Donaldson SS. Prognostic factors for children with Hodgkin’s disease treated with combined-modality therapy. J Clin Oncol 2003;21:2026-2033.

11. Carde P, Koscielny S, Franklin J, Axdorph U, Raemaekers J, Diehl V, Aleman B, Brosteanu O, Hasenclever D, Oberlin O, Bonvin N, Björkholm M. Early response to chemotherapy: a surrogate for final outcome of Hodgkin’s disease patients that should influence initial treatment length and intensity? Ann Oncol 2002;13(Suppl 1):86-91.

12. Metzger ML, Castellino SM, Hudson MM, Rai SN, Kaste SC, Krasin MJ, Kun LE, Pui CH, Howard SC. Effect of race on the outcome of pediatric patients with Hodgkin’s lymphoma. J Clin Oncology 2008;26:1282-1288.

13. No authors listed. A predictive model for aggressive non-Hodgkin’s lymphoma. The International Non-Hodgkin’s Lymphoma Prognostic Factors Project. N Engl J Med 1993;329:987-994.

14. Lister TA, Crowther D, Sutcliffe SB, Glatstein E, Canellos GP, Young RC, Rosenberg SA, Coltman CA, Tubiana M. Report of a committee convened to discuss the evaluation and staging of patients with Hodgkin’s disease: Cotswolds meeting. J Clin Oncol 1989;7:1630-1636.

15. National Marrow Donor Program & The Medical College of Wisconsin.

Forms Manual: Appendix-L-Karnofsky/Lansky Performance Status A00428 Revision 1. 31/01/2009. Available online at http://www.cibmtr. org/DataManagement/TrainingReference/Manuals/DataManagement/ Documents/appendix-l.pdf.

16. Lieskovsky YE, Donaldson SS, Torres MA, Wong RM, Amylon MD, Link MP, Agarwal R. High-dose therapy and autologous hematopoietic stem-cell transplantation for recurrent or refractory pediatric Hodgkin’s disease: results and prognostic indices. J Clin Oncol 2004;22:4532-4540.

17. Akhtar S, Abdelsalam M, El Weshi A, Al Husseini H, Janabi I, Rahal M, Maghfoor I. High-dose chemotherapy and autologous stem cell transplantation for Hodgkin’s lymphoma in the kingdom of Saudi Arabia: King Faisal specialist hospital and research center experience. Bone Marrow Transplant 2008;42(Suppl 1):37-40.

18. Harris RE, Termuhlen AM, Smith LM, Lynch J, Henry MM, Perkins SL, Gross TG, Warkentin P, Vlachos A, Harrison L, Cairo MS. Autologous peripheral blood stem cell transplantation in children with refractory or relapsed lymphoma: results of Children’s Oncology Group study A5962. Biol Blood Marrow Transplant 2011;17:249-258.

19. Jabbour E, Hosing C, Ayers G, Nunez R, Anderlini P, Pro B, Khouri I, Younes A, Hagemeister F, Kwak L, Fayad L. Pretransplant positive positron emission tomography/gallium scans predict poor outcome in patients with recurrent/ refractory Hodgkin lymphoma. Cancer 2007;109:2481-2489.

272

Turk J Hematol 2016;33:265-272

20. Wolden SL, Chen L, Kelly KM, Herzog P, Gilchrist GS, Thomson J, Sposto R, Kadin ME, Hutchinson RJ, Nachman J. Long-term results of CCG 5942: a randomized comparison of chemotherapy with and without radiotherapy for children with Hodgkin’s lymphoma--a report from the Children’s Oncology Group. J Clin Oncol 2012;30:3174-3180.

21. Azab B, Shah N, Radbel J, Tan P, Bhatt V, Vonfrolio S, Habeshy A, Picon A, Bloom S. Pretreatment neutrophil/lymphocyte ratio is superior to platelet/ lymphocyte ratio as a predictor of long-term mortality in breast cancer patients. Med Oncol 2013;30:432.

22. Satwani P, Ahn KW, Carreras J, Abdel-Azim H, Cairo MS, Cashen A, Chen AI, Cohen JB, Costa LJ, Dandoy C, Fenske TS, Freytes CO, Ganguly S, Gale RP, Ghosh N, Hertzberg MS, Hayashi RJ, Kamble RT, Kanate AS, Keating A, Kharfan-Dabaja MA, Lazarus HM, Marks DI, Nishihori T, Olsson RF, Prestidge TD, Rolon JM, Savani BN, Vose JM, Wood WA, Inwards DJ, Bachanova V, Smith SM, Maloney DG, Sureda A, Hamadani M. A prognostic model predicting autologous transplantation outcomes in children, adolescents and young adults with Hodgkin lymphoma. Bone Marrow Transplant 2015;50:1416-1423.

23. Longo DL, Duffey PL, Young RC, Hubbard SM, Ihde DC, Glatstein E, Phares JC, Jaffe ES, Urba WJ, DeVita VT Jr. Conventional-dose salvage combination chemotherapy in patients relapsing with Hodgkin’s disease after combination chemotherapy: the low probability for cure. J Clin Oncol 1992;10:210-218.

24. Stoneham S, Ashley S, Pinkerton CR, Wallace WH, Shankar AG; United Kingdom Children’s Cancer Study Group. Outcome after autologous hemopoietic stem cell transplantation in relapsed or refractory childhood Hodgkin disease. J Pediatr Hematol Oncol 2004;26:740-745.

25. Ataş E, Kesik V, Babacan O, Korkmazer N, Akyüz C. The timing of autologous stem cell transplantation and the prognostic factors affecting the prognosis in children with relapsed Hodgkin lymphoma. Pediatr Transplant 2015;19:380-384.

26. Marcais A, Porcher R, Robin M, Mohty M, Michalet M, Blaise D, Tabrizi R, Clement L, Ceballos P, Daguindau E, Bilger K, Dhedin N, Lapusan S, Bay JO, Pautas C, Garban F, Ifrah N, Guillerm G, Contentin N, Bourhis JH, Yakoub Agha I, Bernard M, Cornillon J, Milpied N. Impact of disease status and stem cell source on the results of reduced intensity conditioning transplant for Hodgkin’s lymphoma: a retrospective study from the French Society of Bone Marrow Transplantation and Cellular Therapy (SFGM-TC). Haematologica 2013;98:1467-1475.

27. Rancea M, Monsef I, von Tresckow B, Engert A, Skoetz N. High-dose chemotherapy followed by autologous stem cell transplantation for patients with relapsed/refractory Hodgkin lymphoma. Cochrane Database Syst Rev 2013;6:CD009411.

28. Schellong G, Dörffel W, Claviez A, Körholz D, Mann G, Scheel-Walter HG, Bökkerink JP, Riepenhausen M, Lüders H, Pötter R, Rühl U; DAL/GPOH. Salvage therapy of progressive and recurrent Hodgkin’s disease: results from a multicenter study of the pediatric DAL/GPOH-HD study group. J Clin Oncol 2005;23:6181-6189.

29. Shafer JA, Heslop HE, Brenner MK, Carrum G, Wu MF, Liu H, Ahmed N, Gottschalk S, Kamble R, Leung KS, Myers GD, Bollard CM, Krance RA. Outcome of hematopoietic stem cell transplant as salvage therapy for Hodgkin’s lymphoma in adolescents and young adults at a single institution.

Leuk Lymphoma 2010;51:664-670.

30. Hasenclever D, Diehl V. A prognostic score for advanced Hodgkin’s disease.

International Prognostic Factors Project on Advanced Hodgkin’s Disease. N Engl J Med 1998;339:1506-1514.

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0203 Turk J Hematol 2016;33:273-280

The Role of Azacitidine in the Treatment of Elderly Patients with Acute Myeloid Leukemia: Results of a Retrospective Multicenter Study Akut Miyeloid Lösemili Yaşlı Hastaların Tedavisinde Azasitidinin Rolü: Retrospektif Çok Merkezli Bir Çalışmanın Sonuçları Anıl Tombak1, Mehmet Ali Uçar1, Aydan Akdeniz1, Eyüp Naci Tiftik1, Deniz Gören Şahin2, Olga Meltem Akay2, Murat Yıldırım3, Oral Nevruz3, Cem Kis4, Emel Gürkan4, Şerife Medeni Solmaz5, Mehmet Ali Özcan5, Rahşan Yıldırım6, İlhami Berber7, Mehmet Ali Erkurt7, Tülin Fıratlı Tuğlular8, Pınar Tarkun9, İrfan Yavaşoğlu10, Mehmet Hilmi Doğu11, İsmail Sarı11, Mustafa Merter12, Muhit Özcan12, Esra Yıldızhan13, Leylagül Kaynar13, Özgür Mehtap9, Ayşe Uysal14, Fahri Şahin14, Ozan Salim15, Mehmet Ali Sungur16 1Mersin University Faculty of Medicine, Department of Hematology, Mersin, Turkey 2Osmangazi University Faculty of Medicine, Department of Hematology, Eskişehir, Turkey 3Gülhane Training and Research Hospital, Clinic of Hematology, Ankara, Turkey 4Çukurova University Faculty of Medicine, Department of Hematology, Adana, Turkey 5Dokuz Eylül University Faculty of Medicine, Department of Hematology, İzmir, Turkey 6Atatürk University Faculty of Medicine, Department of Hematology, Erzurum, Turkey 7İnönü University Faculty of Medicine, Department of Hematology, Malatya, Turkey 8Marmara University Faculty of Medicine, Department of Hematology, İstanbul, Turkey 9Kocaeli University Faculty of Medicine, Department of Hematology, Kocaeli, Turkey 10Adnan Menderes University Faculty of Medicine, Department of Hematology, Aydın, Turkey 11Pamukkale University Faculty of Medicine, Department of Hematology, Denizli, Turkey 12Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey 13Erciyes University Faculty of Medicine, Department of Hematology, Kayseri, Turkey 14Ege University Faculty of Medicine, Department of Hematology, İzmir, Turkey 15Akdeniz University Faculty of Medicine, Department of Hematology, Antalya, Turkey 16Düzce University Faculty of Medicine, Department of Biostatistics, Düzce, Turkey

Abstract Objective: In this study, we aimed to investigate the efficacy and safety of azacitidine (AZA) in elderly patients with acute myeloid leukemia (AML), including patients with >30% bone marrow (BM) blasts.

Materials and Methods: In this retrospective multicenter study, 130 patients of ≥60 years old who were ineligible for intensive chemotherapy or had progressed despite conventional treatment were included.

Results: The median age was 73 years and 61.5% of patients had >30% BM blasts. Patients received AZA for a median of four cycles (range: 1-21). Initial overall response [including complete remission (CR)/CR with incomplete recovery/partial remission] was 36.2%.

Hematologic improvement (HI) of any kind was documented in 37.7% of all patients. HI was also documented in 27.1% of patients who were unresponsive to treatment. Median overall survival (OS) was 18

Öz Amaç: Bu çalışmada, kemik iliğindeki (Kİ) blast oranı >%30 olan olguları da içeren akut miyeloid lösemili (AML) yaşlı hastalarda, azasitidinin (AZA) etkinliğinin ve güvenliğinin araştırılmasını amaçladık.

Gereç ve Yöntemler: Bu geriye dönük, çok merkezli çalışmaya, yoğun kemoterapi için uygun olmayan ya da konvansiyonel tedavilere rağmen hastalığı ilerleyen ≥60 yaştaki 130 hasta dahil edildi.

Bulgular: Ortanca yaş 73 idi, hastaların %61,5’inde Kİ blast oranı >%30 olarak bulundu. Hastalar, ortanca 4 döngü (1-21 aralığında) AZA almıştı. Başlangıç genel yanıt oranı [tam yanıtı (TY)/eksik düzelmenin olduğu TY/kısmi yanıtı içeren] %36,2 idi. Herhangi bir hematolojik düzelme (HD), tüm hastaların %36,2’sinde tespit edildi.

HD tedaviye yanıtsız hastaların %27,1’inde de saptandı. Ortanca genel sağkalım, yanıt verenlerde 18 ay, yanıt vermeyenlerde 12 ay idi (p=0,005). Tedaviye yanıtsız hasta grubunda HD’nin, HD olmayanlara kıyasla genel sağkalımı arttırdığı görüldü (ortanca sağkalım 14 aya

Address for Correspondence/Yazışma Adresi: Anıl TOMBAK, M.D., Mersin University Faculty of Medicine, Department of Hematology, Mersin, Turkey Phone : +90 532 346 07 67 E-mail : aniltombak@mersin.edu.tr

Received/Geliş tarihi: May 17, 2015 Accepted/Kabul tarihi: November 19, 2015

273

Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients

months for responders and 12 months for nonresponders (p=0.005).

In the unresponsive patient group, any HI improved OS compared to patients without any HI (median OS was 14 months versus 10 months, p=0.068). Eastern Cooperative Oncology Group performance status of <2, increasing number of AZA cycles (≥5 courses), and any HI predicted better OS. Age, AML type, and BM blast percentage had no impact.

Conclusion: We conclude that AZA is effective and well tolerated in elderly comorbid AML patients, irrespective of BM blast count, and HI should be considered a sufficient response to continue treatment with AZA. Keywords: Azacitidine, Acute myeloid leukemia, Elderly, Bone marrow blasts, Prognostic factors, Overall survival

Introduction Acute myeloid leukemia (AML) is predominantly a disease of older patients with a median age at diagnosis of ~70 years [1,2]. Older patients with AML have significant comorbidities, a poorer performance status, more unfavorable cytogenetic abnormalities, and a higher incidence of secondary AML than their younger counterparts and only approximately 1/3 of elderly AML patients are eligible for conventional anthracycline/ cytarabine-based intensive chemotherapeutic approaches [3,4,5]. However, overall results of intensive chemotherapy remain poor even for those who do meet inclusion criteria for such treatment [1,3,4,5]. Patients not suitable for intensive chemotherapy or who did not respond to these treatment options are frequently offered best supportive care (BSC) only, and the prognosis is dismal [6,7].

The hypomethylating agents decitabine and azacitidine (AZA) have significant activity in patients with a myelodysplastic syndrome (MDS) [8,9]. The use of AZA was associated with improved survival when compared to BSC or low-dose cytarabine in patients with high-risk MDS, including those with marrow blast counts ranging from 20% to 30%, leading to AZA approval in these disease categories [8,10]. In untreated or relapsed/ refractory AML, a few studies have also shown significant response rates of AZA therapy [11,12,13,14,15]. However, there are limited data showing the efficacy of AZA in AML patients with >30% bone marrow (BM) blasts.

In this retrospective multicenter study, we aimed to investigate the efficacy and safety of AZA in elderly patients with AML (including patients with >30% BM blasts) defined according to the World Health Organization (WHO).

Materials and Methods Patients and Eligibility Criteria Between June 2009 and June 2014, 130 patients of ≥60 years old with AML from 16 specialized centers for hematology in Turkey, defined according to WHO criteria, were included. Eligibility criteria included all ≥60-year-old AML patients who were treated 274

Turk J Hematol 2016;33:273-280

kıyasla 10 ay, p=0,068). Doğu Kooperatif Onkoloji Grubu performans durumunun <2 olması, AZA döngü sayısının artması (≥5 döngü) ve herhangi bir HD olması, daha iyi genel sağkalımı öngörüyordu. Yaşın, AML tipinin, Kİ blast yüzdesinin etkisi yoktu.

Sonuç: AZA, yaşlı, eşlik eden hastalıkları olan AML’li hastalarda, Kİ blast sayısından bağımsız olarak etkindir ve iyi tolere edilmektedir ve HD’nin, AZA ile tedaviye devam etmek için yeterli bir yanıt olduğu göz önünde bulundurulmalıdır.

Anahtar Sözcükler: Azasitidin, Akut miyeloid lösemi, Yaşlı, Kemik iliği blastları, Prognostik faktörler, Genel sağkalım

with at least one dose of AZA. Demographic data, comorbidities (cardiovascular diseases, diabetes mellitus, prior/concomitant malignancies, pulmonary disease, renal insufficiency), Eastern Cooperative Oncology Group (ECOG) status, transfusion dependency, cytogenetic risk status according to the refined Medical Research Council (MRC) criteria [16], treatment prior to AZA, and concomitant treatments were recorded. AZA was administered at 75 mg/m2 subcutaneously daily for 7 days and 100 mg/m2 subcutaneously daily for 7 days. The local ethics committee approved this retrospective analysis.

Efficacy and Safety Assessments Assessment of response was performed after a median of 4 cycles of AZA. BM aspirations/punctures were performed and reviewed by the principal investigator (hematologist) at each center. Overall responses including complete remission (CR), partial remission (PR), CR with incomplete recovery (CRi), and failure were defined according to International Working Group (IWG) criteria for AML [17]. Patients with persisting peripheral blasts following AZA were also classified as nonresponders if BM puncture was not performed. Hematologic improvement (HI) was evaluated using IWG criteria for MDS from the collected transfusion records of the patients [18]. Specific hematologic and nonhematological adverse events were graded according to Common Terminology Criteria for Adverse Events (CTCAE) v4.0, published on 28 May 2009, by the National Cancer Institute.

All data including response, HI, and adverse events were determined and recorded by principal hematologists at the respective centers.

Statistical Analysis Categorical data were analyzed by chi-square or Fisher’s exact test according to expected count rule and summarized as frequency and percentage. Both univariate and multivariate logistic regression analyses were used to obtain the odds ratio (OR) of variables that significantly affected response rate.

Survival times and curves were estimated by Kaplan-Meier method and compared by log-rank test. Both univariate and multivariate Cox regression models were constructed for obtaining the hazard ratio (HR) of variables that significantly

Turk J Hematol 2016;33:273-280

affected survival. Statistical analyses were performed with PASW v.18 software (Predictive Analytics Software is a registered trademark of SPSS Inc.), and p<0.05 was considered statistically significant.

Results Patient Characteristics Patient baseline characteristics are summarized in Table 1. A total of 130 patients with AML (58 women, 72 men) receiving AZA were included in the study. Median age was 73, ranging from 60 to 88 years; 31.5% (n=41) of patients were 60-69 years old, 49.2% (n=64) were 70-79 years old, and 19.2% (n=25) were ≥80 years old. ECOG performance status (ECOG-PS) was ≥2 in 54.6% (n=71) and there were comorbidities in 66.2% (n=86) of the cases; of these, 89.5% (n=77) had <3 and 10.5% (n=9) had ≥3 comorbidities. Lactate dehydrogenase (LDH) level was <225 IU/L in 20.8% (n=27) and was ≥225 IU/L in 75.4% (n=98) of the cases, and 40.8% (n=53) of the patients had a leukocyte count of >10x109/L. Median absolute neutrophil count (ANC) was 1.1x109/L, median hemoglobin concentration was 8.7 g/L, and median platelet count was 57x109/L. Ninety-four (72.3%) patients had peripheral blood blasts and 80 patients (61.5%) had >30% BM blasts. One hundred and twelve patients (86.2%) required erythrocyte and/ or thrombocyte transfusion (transfusion-dependent), while 5.4% had an unfavorable karyotype and 50.8% had an intermediate karyotype according to MRC criteria [16].

Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients

Table 1. Baseline characteristics.

Total number of patients, n

130

Median age, years (range)

73 (60-88)

Age categories, n (%) 60-69 years

41 (31.5)

70-79 years

64 (49.2)

≥80 years

25 (19.2)

Males, n (%)

72 (55.4)

Type of AML, n (%) t-AML

6 (4.6)

AML-RCA

9 (6.9)

AML-MRF

47 (36.2)

AML-NOS

68 (52.3)

Peripheral blood blasts, n (%) 0%

7 (5.4)

>0%

94 (72.3)

Unknown

29 (22.3)

Median (range), %

15 (0-90)

Bone marrow blasts, n (%) 20%-30%

36 (27.7)

>30% (off-label use)

80 (61.5)

Treatment Modalities

Unknown

14 (10.8)

While 54.6% (n=71) of the patients did not receive any treatment prior to AZA, intensive chemotherapy, hydroxyurea, low-dose cytarabine, erythropoietin-stimulating agents, iron chelation therapy, lenalidomide, and granulocyte-colony stimulating factor (G-CSF) were used in 16.9% (n=22), 16.9% (n=22), 5.4% (n=7), 3.1% (n=4), 1.5% (n=2), 0.8% (n=1), and 0.8% (n=1) of the cases, respectively.

Median (range), %

49.5 (20-97)

AZA was administered as first-line therapy in 79.2% of patients (n=103). No CR or early relapse after conventional (intensive) chemotherapy and after other disease-modifying treatments was the reason for AZA treatment in 13.8% (n=18) and 6.9% (n=9) of patients, respectively. AZA was administered at 75 mg/m2 subcutaneously daily for 7 days and 100 mg/m2 subcutaneously daily for 7 days in 81.5% and 18.5% of the patients, respectively. A median number of 4 (range: 1-21) AZA courses were given in 28-day intervals. In all AZA cycles, hydroxyurea (11.5%) or G-CSF (7.7%) was given concomitantly when deemed necessary by the treating physician.

Hb (g/L), median (range)

8.7 (4.2-14)

Platelet count (109/L), median (range)

57 (5-786)

Any type of TD

Response to Azacitidine and Survival

RBC-TD

18 (13.8)

Initial overall response (including CR/CRi/PR according to IWG) was evaluated after a median of 4 cycles of AZA. While there was no response in 53.8% (n=70) of patients, CR, CRi, and PR

PLT-TD

112 (86.2)

RBC-TD + PLT-TD

40 (30.7)

WBC count (109/L), n (%) ≤10x109/L

77 (59.2)

>10x109/L

53 (40.8)

Median (range), %

4.9 (0.7-146)

ANC

(109/L),

median (range)

1.1 (0.05-142.7)

LDH (IU/L) <225

≥225

27 (20.8)

Unknown

98 (75.4)

Transfusion dependency (TD), n (%)

5 (3.8)

No

275

Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients

Turk J Hematol 2016;33:273-280

Table 2. Response to azacitidine according to International Working Group criteria.

Table 1. Continuation MRC cytogenetic risk, n (%)

Response

n (%)

No response

70 (53.8)

Overall response1

47 (36.2)

CR

17 (13.1)

1 (0.8)

CRi

8 (6.2)

Comorbidities, n (%)

66 (50.8)

PR

22 (16.9)

Number of comorbidities, n (%)

7 (5.4)

Not evaluable

13 (10)

<3

86 (66.2)

HI

n (%)

≥3

77 (89.5)

No HI

81 (62.3)

Any HI

49 (37.7)

Neutrophil response

24 (18.5)

Erythroid response

5 (3.8)

Platelet response

20 (15.4)

Not evaluable

14 (10.7)

Good

58 (44.6)

Intermediate

56 (43.1)

High

ECOG-PS score, n (%) ECOG <2

9 (10.5)

ECOG ≥2

52 (40)

Unknown

71 (54.6)

Treatment prior to azacitidine, n (%)

7 (5.4)

None

71 (54.6)

Reason for treatment, n (%) First-line treatment

103 (79.2)

No CR to/early relapse after intensive chemotherapy

18 (13.8)

No CR to other prior treatments

9 (6.9)

t-AML: Treatment-related acute myeloid leukemia, AML-RCA: acute myeloid leukemia with recurrent cytogenetic abnormalities, AML-MRF: acute myeloid leukemia with MDS-related features, AML-NOS: acute myeloid leukemia not otherwise specified, WBC: white blood cell, ANC: absolute neutrophil count, Hb: hemoglobin, LDH: lactate dehydrogenase, RBC: red blood cell, PLT: platelet, MRC: myelodysplastic syndromerelated cytogenetics, ECOG: Eastern Cooperative Oncology Group, G-CSF: granulocytecolony stimulating factor, CR: complete remission.

were documented in 13.1% (n=17), 6.2% (n=8), and 16.9% (n=22) of the cases, respectively (Table 2). Any HI according to IWG criteria was documented in 37.7% (n=49) of the patients; neutrophil, erythroid, and platelet responses were observed in 18.5% (n=24), 3.8% (n=5), and 15.4% (n=20) of the patients, respectively (Table 2). HI was also documented in 27.1% (n=19) of 70 patients who were unresponsive to treatment.

Median overall survival (OS) was 12.3 [95% confidence interval (CI): 10.1-14.6] months as of the first diagnosis of AML. Diseasefree survival (DFS) and event-free survival (EFS) were 16.2 (95% CI: 6.7-25.7) and 8.3 (95% CI: 6.1-10.6) months, respectively.

Median OS was 18 (95% CI: 10.6-25.4) months for responders (defined as CR/CRi/PR) and 12 (95% CI: 9.2-14.8) months for nonresponders (p=0.005). In addition, median OS was 14 (95% CI: 4.1-23.9) months in patients unresponsive to treatment (without CR/CRi/PR) but with any HI (n=19), and was 10 (95% CI: 4.1-15.9) months in patients unresponsive to treatment and also without any HI (n=51) (p=0.068). Median OS of the patients who received AZA as a rescue after intensive chemotherapy was 24 (95% CI: 13.3-34.7) months as of the first diagnosis of AML. 276

1Overall

response includes CR, CRi, and PR. CR: Complete response, CRi: complete response with incomplete recovery, PR: partial response, HI: hematologic improvement.

In univariate analysis the following parameters had a significant effect on both treatment response and OS: ECOG-PS score, number of AZA cycles, and any HI. However, sex, age, absolute number of comorbidities, presence of peripheral blasts, AML type, leukocyte count at the time of diagnosis, treatment prior to AZA, and BM blast count had no significant impact on treatment response and OS (Table 3). Since the number of patients with good (n=1) and poor-risk cytogenetics (n=7) was low, the effect of cytogenetics on response to treatment and OS was not evaluated. Similarly, since the number of patients receiving AZA at 100 mg/m2 was low (n=24), the impact of altered dosing schedules of AZA was not evaluated.

In multivariate analysis, all variables with p<0.05 in univariate analysis were included, and it was found that increasing number of AZA cycles (≥5) was associated with a better response rate and ECOG-PS score of ≥2 was a significant predictor of shorter OS (Table 4).

Toxicity and Adverse Events A total of 351 adverse events were documented. CTCAE grade 3-4 neutropenia, thrombocytopenia, and anemia were documented in 34.6%, 40.8%, and 39.2% of patients, respectively. Febrile neutropenia was documented in 60.8% of the patients. Other nonhematological toxicities were usually mild, the most common adverse events being mucositis, diarrhea, injection site pain, and nausea.

Discussion Incidence of AML increases with age and most patients are deemed unsuitable for intensive treatment options. Outcomes

Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients

Turk J Hematol 2016;33:273-280

following conventional chemotherapeutic approaches are poor.

AZA is a hypomethylating agent, and owing to its acceptable tolerability profiles and emerging evidence of clinical efficacy, it may provide an exciting approach to the treatment of elderly patients with AML. It is licensed for patients with 20%-30% blasts and it confers a survival benefit in these patients [14]; studies suggest 10%-20% CR rates with AZA [14,19,20,21] and

these patients have OS rates equivalent or superior to other conventional treatments [14,19,21]. However, data on AZA activity in AML patients with BM blast counts of >30% are limited and the drug can be used off-label in these patients, although several analyses have also suggested that AZA is active and well tolerated in patients with >30% BM blasts as well [11,12,15,20].

Table 3. Univariate analysis for response and overall survival.

Overall response rate, %

p-value

Median overall survival, months, and 95% CI

p-value

Sex, Female/Male

44.4/36.5

0.383

12.3/13.3 10.3-14.3/9.1-17.6

0.303

Age, 60-69/70-79/≥80 years

44.7/37.9/38.1

0.783

19/12.3/15 3.9-34.1/10.2-14.5/1.2-28.9

0.057

Absolute number of comorbidities, <3/≥3

33.8/55.6

0.273

13/9 10.2-15.8/1.6-16.4

0.662

Peripheral blasts, 0%/>0%

42.9/36.4

0.706

12.3/12.3 6.2-12.3/10.1-14.5

0.379

BM blast count, 20%-30%/>30%

41.7/39.1

0.801

13/12.3 7.8-18.2/9.6-15.1

0.929

AML type, t-AML/AML-RCA/AML-MRF/AML-NOS

50.0/43.2/57.1/35.0

0.592

7/11.3/6/14.1 4.4-9.6/9.2-13.4/3.5-12.9/11.9-16.2

0.091

Treatment prior to AZA, No/Yes

47.6/30.2

0.056

12.3/13.2 9.1-15.6/9.9-16.4

0.158

Leukocyte count at diagnosis, ≤10x109/ L/>10x109/L

40.3/40.0

0.976

14/10.5 8.9-19.1/7.8-13.1

0.225

LDH, ≥225/<225 IU/L

41.9/38.5

0.758

11/19 8.6-13.4/12.1-25.9

0.018

ECOG, ≥2/<2

29.7/53.2

0.012

10/14.1 8.1-11.9/7.8-20.3

0.034

Number of AZA cycles, ≥5/<5

61.9/28

0.001

14.1/9 8.5-19.6/4.0-14.0

0.011

Transfusion dependency, Yes/No

36.3/66.7

0.025

12.3/20 9.8-14.8/4.2-35.9

0.077

Any HI, Yes/No

59.6/27.1

0.001

18/10 10.0-26.0/5.1-14.9

0.002

CI: Confidence interval, BM: bone marrow, t-AML: treatment-related acute myeloid leukemia, AML-RCA: acute myeloid leukemia with recurrent cytogenetic abnormalities, AML-MRF: acute myeloid leukemia with MDS-related features, AML-NOS: acute myeloid leukemia not otherwise specified, LDH: lactate dehydrogenase, ECOG: Eastern Cooperative Oncology Group, AZA: azacitidine, HI: hematologic improvement.

Table 4. Multivariate analysis for response and overall survival.

Response

OR (95% CI)

p-value

Overall survival HR (95% CI)

p-value

LDH, ≥225/<225 IU/L

0.715 (0.248-2.058)

0.533

1.862 (0.977-3.549)

0.059

ECOG, ≥2/<2

2.360 (0.969-5.748)

0.059

1.677 (1.020-2.758)

0.042

Number of AZA cycles, ≥5/<5

0.312 (0.123-0.793)

0.014

0.576 (0.332-1.001)

0.050

Transfusion dependency, yes/no

3.165 (0.790-12.683)

0.104

1.509 (0.650-3.505)

0.339

Any HI, yes/no

0.311 (0.125-0.776)

0.012

0.621 (0.359-1.077)

0.090

OR: Odds ratio, CI: confidence interval, HR: hazard ratio, LDH: lactate dehydrogenase, ECOG: Eastern Cooperative Oncology Group, AZA: azacitidine, HI: hematologic improvement.

277

Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients

In the current study, we retrospectively analyzed the efficacy and toxicity of AZA in 130 patients with AML who were ≥60 years of age, and this cohort also included 80 patients (61.5% of the cases) with >30% BM blasts. We found a CR rate similar to the CR rates of recent studies [14,19,20,21], which was documented in 13.1% of our patient cohort. Median OS was 12.3 months and OS was longer in responders compared to nonresponders.

We also showed that AZA was effective in the group with >30% BM blasts and that BM blast count of 20%-30% versus >30% has no significant impact on response rate or OS. In addition, although the response rate and OS were somewhat poor with the presence of peripheral blasts, these results were not statistically significant. In a study conducted by van der Helm et al. it was shown that BM blast percentage had no impact on OS as well [22]. In a recent phase 3 study of AZA versus conventional care regimens in newly diagnosed AML patients of ≥65 years with >30% BM blasts, Dombret et al. confirmed the clinical observation that AZA can have meaningful clinical activity (e.g., transfusion independency) and improve survival, even though no CR is achieved [23]. Thus, we recommend that AML patients with >30% BM blasts should not be precluded from treatment with AZA and the presence of peripheral blasts should not be a reason for therapy cessation.

HI was found to be a predictor of prolonged survival; significantly longer OS was observed in patients achieving any kind of HI compared to patients without any HI (p=0.002), and similar results have been shown in recent AML patient cohorts [15,20].

However, interestingly, we also found that in the unresponsive (without CR/CRi/PR) patient group, OS was significantly longer for patients who achieved HI compared to those without any HI (p=0.068). In other words, although this was not a statistically significant result, HI without CR/CRi or PR was also associated with a better OS. If commonly used AML response criteria were to be applied [17], patients who experience HI without CR, CRi, or PR would be called nonresponders and treatment with AZA would be discontinued. With these results, we can conclude that, since cytopenias are the cause of mortality in the majority of patients with AML, the goal of therapy with AZA should not just be CR or PR, and therapy should be continued in patients with any HI although there is not any simultaneous BM response.

Another result of our study was that, as the number of AZA courses increased, response rate and OS increased. This is not a surprise, because the epigenetic therapeutic effects of AZA are dependent on the S-phase of the cell cycle and each cycle of therapy can only affect the fraction of the malignant clone that enters the S-phase. Thus, the best responses can occur after as many as 12 cycles of therapy, with a median of 3-3.5 cycles [24]. Therefore, the treatment should not be interrupted in the early stages of therapy and it should be continued as long as the response is durable and/or until overt clinical progression occurs.

278

Turk J Hematol 2016;33:273-280

We confirm the results of previous studies [15,20,25] that WHOAML type, treatment prior to AZA, sex, and age had no significant effect on OS. Not the age but rather the absolute number of comorbidities may adversely affect OS. In our study, a cut-off of <3/≥3 comorbidities was analyzed and there was a trend for reduced OS for patients with ≥3 comorbidities, which was, however, not statistically significant (p=0.662). Similarly, LDH of ≥225 IU/L was associated with reduced OS (p=0.018), but it had no impact on treatment response (p=0.758). Importantly, ECOGPS of ≥2 was found to be the only baseline factor affecting OS in both univariate and multivariate analysis. Recently, an Austrian group reported that the absolute number of comorbidities and LDH of ≥225 IU/L were independent adverse predictors of OS in their larger cohort (n=302) [15] and borderline significant in their previously published smaller cohort (n=155) [20]. As we found in our study, ECOG-PS of ≥2 was an independent adverse predictor of OS in both of the Austrian studies [15,20], and in a French study as well [25]. In our opinion, older age, WHOAML type, prior treatments, and LDH level should not lead to a decision to withhold treatment of AZA in favor of BSC if the patient has an ECOG-PS score of <2.

Elevated leukocyte count had no impact on OS in our study, but conflicting results exist in the literature. Both aforementioned Austrian publications showed that leukocyte count of neither >10x109/L nor >15x109/L significantly affected OS [15,20], but the French publication showed a significant effect of leukocyte count of >15x109/L on OS [25]. We think that AML patients with high leukocyte counts should not be precluded from treatment with AZA, and cytoreduction with hydroxyurea or low-dose cytarabine may be an appropriate approach in such patients.

As expected, transfusion dependence prior to AZA was associated with reduced OS in our study in univariate analysis, which was, however, not statistically significant (p=0.077).

Transfusion dependence was not a predictor of reduced OS in the multivariate analysis of the Austrian studies, as well [15,20].

The most commonly observed toxicity was febrile neutropenia, at a rate higher than seen in the literature [12,13,15]. Other nonhematological toxicities were mild. However, due to the retrospective nature of this analysis, toxicities in general were probably underestimated.

Certainly, our study has several shortcomings, since it was a retrospective study, the patient population was heterogeneous, and the effect of cytogenetics on response to treatment was not evaluated.

In conclusion, AZA is effective and well tolerated in elderly comorbid AML patients with fewer required erythrocyte and platelet transfusions, irrespective of BM blast count. HI should be considered a sufficient response to continue treatment with AZA and treatment should not be interrupted since OS and

Turk J Hematol 2016;33:273-280

response to treatment increase with increasing numbers of AZA cycles.

Ethics Ethics Committee Approval: This study was approved by Mersin University Ethics Committee, Informed Consent: It is a retrospective study.

Authorship Contributions Concept: Anıl Tombak, Design: Anıl Tombak, Data Collection and Processing: Anıl Tombak, Mehmet Ali Uçar, Aydan Akdeniz, Eyüp Naci Tiftik, Deniz Gören Şahin, Olga Meltem Akay, Murat Yıldırım, Oral Nevruz, Cem Kis, Emel Gürkan, Şerife Medeni Solmaz, Mehmet Ali Özcan, Rahşan Yıldırım, İlhami Berber, Mehmet Ali Erkurt, Tülin Fıratlı Tuğlular, Pınar Tarkun, İrfan Yavaşoğlu, Mehmet Hilmi Doğu, İsmail Sarı, Mustafa Merter, Muhit Özcan, Esra Yıldızhan, Leylagül Kaynar, Özgür Mehtap, Ayşe Uysal, Fahri Şahin, Ozan Salim, Mehmet Ali Sungur; Analysis or Interpretation: Anıl Tombak, Mehmet Ali Uçar, Aydan Akdeniz, Eyüp Naci Tiftik, Deniz Gören Şahin, Olga Meltem Akay, Murat Yıldırım, Oral Nevruz, Cem Kis, Emel Gürkan, Şerife Medeni Solmaz, Mehmet Ali Özcan, Rahşan Yıldırım, İlhami Berber, Mehmet Ali Erkurt, Tülin Fıratlı Tuğlular, Pınar Tarkun, İrfan Yavaşoğlu, Mehmet Hilmi Doğu, İsmail Sarı, Mustafa Merter, Muhit Özcan, Esra Yıldızhan, Leylagül Kaynar, Özgür Mehtap, Ayşe Uysal, Fahri Şahin, Ozan Salim, Mehmet Ali Sungur; Literature Search: Anıl Tombak, Mehmet Ali Uçar, Aydan Akdeniz, Eyüp Naci Tiftik, Deniz Gören Şahin, Olga Meltem Akay, Murat Yıldırım, Oral Nevruz, Cem Kis, Emel Gürkan, Şerife Medeni Solmaz, Mehmet Ali Özcan, Rahşan Yıldırım, İlhami Berber, Mehmet Ali Erkurt, Tülin Fıratlı Tuğlular, Pınar Tarkun, İrfan Yavaşoğlu, Mehmet Hilmi Doğu, İsmail Sarı, Mustafa Merter, Muhit Özcan, Esra Yıldızhan, Leylagül Kaynar, Özgür Mehtap, Ayşe Uysal, Fahri Şahin, Ozan Salim, Mehmet Ali Sungur; Writing: Anıl Tombak.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Klepin HD, Balducci L. Acute myelogenous leukemia in older adults.

Oncologist 2009;14:222-232.

2. Appelbaum FR, Gundacker H, Head DR, Slovak ML, Willman CL, Godwin JE, Anderson JE, Petersdorf SH. Age and acute myeloid leukemia. Blood 2006;107:3481-3485.

3. Anderson JE, Kopecky KJ, Willman CL, Head D, O’Donnell MR, Luthardt FW, Norwood TH, Chen IM, Balcerzak SP, Johnson DB, Appelbaum FR. Outcome after induction chemotherapy for older patients with acute myeloid leukemia is not improved with mitoxantrone and etoposide compared to cytarabine and daunorubicin: a Southwest Oncology Group study. Blood 2002;100:3869-3876.

4. Kantarjian H, O’Brien S, Cortes J, Giles F, Faderl S, Jabbour E, Garcia-Manero G, Wierda W, Pierce S, Shan J, Estey E. Results of intensive chemotherapy

Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients

in 998 patients age 65 years or older with acute myeloid leukemia or highrisk myelodysplastic syndrome: predictive prognostic models for outcome.

Cancer 2006;106:1090-1098.

5. Menzin J, Lang K, Earle CC, Kerney D, Mallick R. The outcomes and costs of acute myeloid leukemia among the elderly. Arch Intern Med 2002;162:15971603.

6. Deschler B, de Witte T, Mertelsmann R, Lübbert M. Treatment decision-making for older patients with high-risk myelodysplastic syndrome or acute myeloid leukemia: problems and approaches. Haematologica 2006;91:1513-1522.

7. Kantarjian H, Ravandi F, O’Brien S, Cortes J, Faderl S, Garcia-Manero G, Jabbour E, Wierda W, Kadia T, Pierce S, Shan J, Keating M, Freireich EJ. Intensive chemotherapy does not benefit most older patients (age 70 years or older) with acute myeloid leukemia. Blood 2010;116:4422-4429.

8. Fenaux P, Mufti GJ, Hellstrom-Lindberg E, Santini V, Finelli C, Giagounidis A, Schoch R, Gattermann N, Sanz G, List A, Gore SD, Seymour JF, Bennett JM, Byrd J, Backstrom J, Zimmerman L, McKenzie D, Beach C, Silverman LR; International Vidaza High-Risk MDS Survival Study Group. Efficacy of azacitidine compared with that of conventional care regimens in the treatment of higher-risk myelodysplastic syndromes: a randomised, openlabel, phase III study. Lancet Oncol 2009;10:223-232.

9. Itzykson R, Thépot S, Quesnel B, Dreyfus F, Beyne-Rauzy O, Turlure P, Vey N, Recher C, Dartigeas C, Legros L, Delaunay J, Salanoubat C, Visanica S, Stamatoullas A, Isnard F, Marfaing-Koka A, de Botton S, Chelghoum Y, Taksin AL, Plantier I, Ame S, Boehrer S, Gardin C, Beach CL, Adès L, Fenaux P; Groupe Francophone des Myelodysplasies (GFM). Prognostic factors for response and overall survival in 282 patients with higher-risk myelodysplastic syndromes treated with azacitidine. Blood 2011;117:403411.

10. Silverman LR, McKenzie DR, Peterson BL, Holland JF, Backstrom JT, Beach CL, Larson RA; Cancer and Leukemia Group B. Further analysis of trials with azacitidine in patients with myelodysplastic syndrome: studies 8421, 8921, and 9221 by the Cancer and Leukemia Group B. J Clin Oncol 2006;24:38953903.

11. Al-Ali HK, Jaekel N, Junghanss C, Maschmeyer G, Krahl R, Cross M, Hoppe G, Niederwieser D. Azacitidine in patients with acute myeloid leukemia medically unfit for or resistant to chemotherapy: a multicenter phase I/II study. Leuk Lymphoma 2012;53:110-117.

12. Maurillo L, Venditti A, Spagnoli A, Gaidano G, Ferrero D, Oliva E, Lunghi M, D’Arco AM, Levis A, Pastore D, Di Renzo N, Santagostino A, Pavone V, Buccisano F, Musto P. Azacitidine for the treatment of patients with acute myeloid leukemia: report of 82 patients enrolled in an Italian Compassionate Program. Cancer 2012;118:1014-1022.

13. Sudan N, Rossetti JM, Shadduck RK, Latsko J, Lech JA, Kaplan RB, Kennedy M, Gryn JF, Faroun Y, Lister J. Treatment of acute myelogenous leukemia with outpatient azacitidine. Cancer 2006;107:1839-1843.

14. Fenaux P, Mufti GJ, Hellström-Lindberg E, Santini V, Gattermann N, Germing U, Sanz G, List AF, Gore S, Seymour JF, Dombret H, Backstrom J, Zimmerman L, McKenzie D, Beach CL, Silverman LR. Azacitidine prolongs overall survival compared with conventional care regimens in elderly patients with low bone marrow blast count acute myeloid leukemia. J Clin Oncol 2010;28:562-569.

15. Pleyer L, Burgstaller S, Girschikofsky M, Linkesch W, Stauder R, Pfeilstocker M, Schreder M, Tinchon C, Sliwa T, Lang A, Sperr WR, Krippl P, Geissler D, Voskova D, Schlick K, Thaler J, Machherndl-Spandl S, Theiler G, Eckmüllner O, Greil R. Azacitidine in 302 patients with WHO-defined acute myeloid leukemia: results from the Austrian Azacitidine Registry of the AGMT-Study Group. Ann Hematol 2014;93:1825-1838.

16. Grimwade D, Hills RK, Moorman AV, Walker H, Chatters S, Goldstone AH, Wheatley K, Harrison CJ, Burnett AK; National Cancer Research Institute Adult Leukaemia Working Group. Refinement of cytogenetic classification in acute myeloid leukemia: determination of prognostic significance of rare recurring chromosomal abnormalities among 5876 younger adult patients treated in the United Kingdom Medical Research Council trials. Blood 2010;116:354-365.

279

Tombak A, et al: Azacitidine and Elderly Acute Myeloid Leukemia Patients

17. Cheson BD, Bennett JM, Kopecky KJ, Büchner T, Willman CL, Estey EH, Schiffer CA, Doehner H, Tallman MS, Lister TA, Lo-Coco F, Willemze R, Biondi A, Hiddemann W, Larson RA, Löwenberg B, Sanz MA, Head DR, Ohno R, Bloomfield CD; International Working Group for Diagnosis, Standardization of Response Criteria, Treatment Outcomes, and Reporting Standards for Therapeutic Trials in Acute Myeloid Leukemia. Revised recommendations of the International Working Group for Diagnosis, Standardization of Response Criteria, Treatment Outcomes, and Reporting Standards for Therapeutic Trials in Acute Myeloid Leukemia. J Clin Oncol 2003;21:46424649.

18. Cheson BD, Bennett JM, Kantarjian H, Pinto A, Schiffer CA, Nimer SD, Löwenberg B, Beran M, de Witte TM, Stone RM, Mittelman M, Sanz GF, Wijermans PW, Gore S, Greenberg PL; World Health Organization (WHO) International Working Group. Report of an international working group to standardize response criteria for myelodysplastic syndromes. Blood 2000;96:3671-3674.

19. Quintas-Cardama A, Ravandi F, Liu-Dumlao T, Brandt M, Faderl S, Pierce S, Borthakur G, Garcia-Manero G, Cortes J, Kantarjian H. Epigenetic therapy is associated with similar survival compared with intensive chemotherapy in older patients with newly diagnosed acute myeloid leukemia. Blood 2012;120:4840-4845.

20. Pleyer L, Stauder R, Burgstaller S, Schreder M, Tinchon C, Pfeilstocker M, Steinkirchner S, Melchardt T, Mitrovic M, Girschikofsky M, Lang A, Krippl P, Sliwa T, Egle A, Linkesch W, Voskova D, Angermann H, Greil R. Azacitidine in patients with WHO-defined AML - results of 155 patients from the Austrian Azacitidine Registry of the AGMT-Study Group. J Hematol Oncol 2013;6:32.

280

Turk J Hematol 2016;33:273-280

21. Radujkovic A, Dietrich S, Bochtler T, Krämer A, Schöning T, Ho AD, Dreger P, Luft T. Azacitidine and low-dose cytarabine in palliative patients with acute myeloid leukemia and high bone marrow blast counts--a retrospective single-center experience. Eur J Haematol 2014;93:112-117.

22. van der Helm LH, Veeger NJ, van Marwijk Kooy M, Beeker A, de Weerdt O, de Groot M, Alhan C, Hoogendoorn M, Laterveer L, van de Loosdrecht AA, Koedam J, Vellenga E, Huls G. Azacitidine results in comparable outcome in newly diagnosed AML patients with more or less than 30% bone marrow blasts. Leuk Res 2013;37:877-882.

23. Dombret H, Seymour JF, Butrym A, Wierzbowska A, Selleslag D, Jang JH, Kumar R, Cavenagh J, Schuh AC, Candoni A, Récher C, Sandhu I, Bernal del Castillo T, Al-Ali HK, Martinelli G, Falantes J, Noppeney R, Stone RM, Minden MD, McIntyre H, Songer S, Lucy LM, Beach CL, Döhner H. International phase 3 study of azacitidine vs conventional care regimens in older patients with newly diagnosed AML with >30% blasts. Blood 2015;126:291-299.

24. Gore SD. New ways to use DNA methyltransferase inhibitors for the treatment of myelodysplastic syndrome. Hematology Am Soc Hematol Educ Program 2011;2011:550-555.

25. Thepot S, Itzykson R, Seegers V, Recher C, Raffoux E, Quesnel B, Delaunay J, Cluzeau T, Marfaing Koka A, Stamatoullas A, Chaury MP, Dartigeas C, Cheze S, Banos A, Morel P, Plantier I, Taksin AL, Marolleau JP, Pautas C, Thomas X, Isnard F, Beve B, Chait Y, Guerci A, Vey N, Dreyfus F, Ades L, Ifrah N, Dombret H, Fenaux P, Gardin C; Groupe Francophone des Myélodysplasies (GFM), Acute Leukemia French Association (ALFA); Groupe Ouest-Est des Leucémies Aiguës; Maladies du Sang (GOELAMS). Azacitidine in untreated acute myeloid leukemia: a report on 149 patients. Am J Hematol 2014;89:410-416.

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0088 Turk J Hematol 2016;33:281-285

The Prognosis of Adult Burkitt’s Cell Leukemia in Real-Life Clinical Practice Erişkin Burkitt Hücreli Löseminin Klinik Pratikteki Seyri Ümit Yavuz Malkan1, Gürsel Güneş1, Hakan Göker1, İbrahim C. Haznedaroğlu1, Kadir Acar2, Eylem Eliaçık1, Sezgin Etgül1, Tuncay Aslan1, Seda Balaban1, Haluk Demiroğlu1, Osman İ. Özcebe1, Nilgün Sayınalp1, Salih Aksu1, Yahya Büyükaşık1 1Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey 2Gazi University Faculty of Medicine, Department of Hematology, Ankara, Turkey

Abstract

Öz

Objective: Many studies reported an improved prognosis in patients with Burkitt’s lymphoma obviating the need of stem cell transplantation. However, prognosis of the advanced disease [i.e.

Burkitt’s cell leukemia (BCL)] has not been reported with current treatment modalities except for a few prospective trials. The aim of this study is to compare the prognoses of BCL patients with similarly treated and nontransplanted patients with other types of acute lymphoblastic leukemia (ALL) and with ALL patients that underwent allogeneic stem cell transplantation (ASCT) in their first remissions.

Amaç: Yapılan birçok çalışmada Burkitt lenfomanın seyrinin düzeldiği, hatta kemik iliği nakli ihtiyacının ortadan kalktığı ileri sürülmektedir.

Ancak birkaç ileriye dönük çalışma haricinde, güncel tedavi yöntemleri altında hastalığın lösemik formunun seyri hakkında araştırma yapılmamıştır. Bu çalışmanın amacı Burkitt hücreli lösemi (BHL) hastalarının klinik seyrinin, benzer tedavi alan ve transplantasyon uygulanmayan diğer akut lenfoblastik lösemi (ALL) hastaları ve ilk remisyonlarında allojenik kök hücre nakli (AKHN) uygulanan ALL hastalarıyla kıyaslanmasıdır.

Materials and Methods: In this retrospective analysis, BCL patients aged between 16 and 63 who were admitted between 2000 and 2014 to the hospitals of Hacettepe or Gazi University and were treated with intensive therapies aimed at cure were included. All ALL patients who were treated with a similar protocol not including transplantation during the same period (NT-ALL group) and all ALL patients who underwent ASCT in the first complete remission during the same period (T-ALL group) served as control groups.

Gereç ve Yöntemler: Geriye dönük olarak tasarlanan bu çalışmaya yaşları 16 ile 63 arasında değişen, 2000 ile 2014 yılları arasında Hacettepe ve Gazi Üniversitesi Hastaneleri’ne başvurup kür amacıyla intensif tedavi verilen BHL hastaları alınmıştır. Transplantasyon haricinde benzer tedavi protokolüyle tedavi edilen tüm ALL hastaları (NT-ALL) ve aynı dönemde ilk tam remisyonlarında AKHN uygulanan hastalar (T-ALL) kontrol grupları olarak çalışmaya alınmışlardır.

Results: The central nervous system or extramedullary involvement rates, lactate dehydrogenase levels, and white blood cell counts at diagnosis were higher in the BCL group than the NT-ALL group and these differences were significant. BCL patients had disease-free survival (DFS) durations comparable with the T-ALL cohort but NTALL patients had significantly shorter DFS durations. Both cumulative relapse incidence and cumulative nonrelapse mortality were higher in NT-ALL patients compared to the T-ALL group and BCL patients.

Conclusion: DFS in BCL patients treated with a widely accepted modern regimen, R-HyperCVAD, is comparable to results in other ALL patients receiving allogeneic transplantation. Our results are in agreement with a few prospective noncomparative studies suggesting no further need for stem cell transplantation in BCL. Keywords: Burkitt’s cell leukemia, Prognosis

Bulgular: Santral sinir sistemi ya da ekstra medüller tutulum hızları, tanı anındaki laktat dehidrogenaz düzeyleri ve beyaz küre sayısı BHL hastalarında NT-ALL hastalarına göre istatistiksel olarak anlamlı olacak şekilde daha yüksekti. BHL hastaları T-ALL hastalarıyla benzer hastalıksız sağkalım (HS) süresine sahip olmakla beraber, NTALL hastalarında HS süresi önemli oranda azalmıştı. Kümülatif nüks insidansı ve kümülatif nüks dışı ölümler NT-ALL hastalarında T-ALL ve BHL hastalarında kıyasla daha fazlaydı.

Sonuç: Sonuç olarak, geniş kabul gören modern bir rejim olan R-HyperCVAD ile tedavi edilen BHL hastalarında HS süresi allojenik transplantasyon uygulanmış diğer ALL hastaları ile benzer bulundu.

Bizim çalışmamızın sonuçları, literatürde ileri dönük dizayn edilmiş ancak kontrol grupları ile karşılaştırma olmadan yapılmış ve BHL’de transplantasyon gerekmediğini öne süren az sayıdaki çalışma ile örtüşmektedir.

Anahtar Sözcükler: Burkitt hücreli lösemi, Prognoz

Address for Correspondence/Yazışma Adresi: Ümit Yavuz MALKAN, M.D., Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey Phone : +90 532 778 00 87 E-mail : umitmalkan@hotmail.com

Received/Geliş tarihi: February 23, 2015 Accepted/Kabul tarihi: December 14, 2015

281

Malkan ÜY, et al: The Prognosis of Adult Burkitt’s Cell Leukemia

Introduction In the last decade, many studies reported an improved prognosis in patients with Burkitt’s lymphoma obviating the need for stem cell transplantation. There is a general consensus that the prognosis of Burkitt’s lymphoma is closely related to the disease stage and degree regarding the involvement of bone marrow and peripheral blood. However, prognosis of the advanced disease (i.e. Burkitt’s cell leukemia) specifically has not been reported with current treatment modalities except for a few prospective trials, which may not reflect everyday real-life clinical practices with their own limitations.

The aim of this study is to compare the prognoses of Burkitt’s cell leukemia patients with similarly treated and nontransplanted patients with other types of acute lymphoblastic leukemia and with acute lymphoblastic leukemia patients that underwent allogeneic stem cell transplantation in their first remissions.

Materials and Methods Study Population In this retrospective analysis, Burkitt’s cell leukemia patients aged between 16 and 63 years who were admitted between 2000 and 2014 to the hospitals of Hacettepe or Gazi University and treated with intensive therapies aimed at cure were included in the study. Twenty-five patients who were treated with HyperCVAD ± rituximab were included in the study; as only one patient was treated with the R-EPOCH regimen, that patient was excluded from the study. The diagnosis of Burkitt’s cell leukemia was made based on the presence of characteristic morphological (FAB L3 morphology and >95% Ki-67 proliferation index) or cytogenetic/molecular (specific translocations involving MYC at band 8q24 or MYC rearrangement in fluorescence in situ hybridization analysis) properties and mature B-cell immunophenotype (TdT negativity plus sIg positivity of >20% or κ/λ light-chain clonality). The minimal criterion for the diagnosis of a leukemic disease condition was more than 25% bone marrow involvement. All acute lymphoblastic leukemia patients who were treated with a similar protocol not including transplantation during the same period (NT-ALL group) and all acute lymphoblastic leukemia patients who underwent allogeneic stem cell transplantation in the first complete remission during the same period (T-ALL group) served as control groups.

Treatment Protocols Specifics of the HyperCVAD ± rituximab regimen, including central nervous system (CNS) prophylaxis and treatment strategies, were as described by Thomas et al. [1]. Chemotherapy consisted of 8 alternating courses without maintenance therapy.

When given, rituximab was administered during courses 1 to 4.

282

Turk J Hematol 2016;33:281-285

Odd courses (1, 3, 5, 7) were HyperCVAD. When given, rituximab was administered at 375 mg/m2 i.v. over 2 to 6 h on days 1 and 11 of HyperCVAD and on days 2 and 8 of MTX and ara-C, during the first 4 courses.

Study End-Points and Statistical Analysis Numerical descriptive data were expressed as median (minimummaximum). Continuous and categorical data were compared with the t-test and chi-square test, respectively. Primary endpoints of the study were complete remission (CR) rate, disease-free survival (DFS), and overall survival (OS). OS was calculated from diagnosis to the date of mortality of any reason. DFS was analyzed in CR patients from date of CR attainment to relapse or death in remission. The patients who did not die and those who did not relapse or die in remission at last follow-up were censored at this time for OS and DFS computations, respectively.

Cumulative relapse (CRI) and cumulative nonrelapse mortality incidences (CNRMI) were computed for patients who attained CR, from the date of CR until relapse or nonrelapse mortality (NRM), respectively. The patients who did not relapse or die in remission at last follow-up were censored at this time. Relapse was considered a competing risk for NRM, and NRM was considered a competing risk for relapse during CRI and CNRMI computations. Categorical and continuous data were compared by the chi-square and independent-samples t-test, respectively.

Survival analyses were computed by the Kaplan-Meier method.

Comparisons of survival rates were done by the log-rank test.

CRI and CNRMI were calculated according to Gray’s test [2] as described by Scrucca et al. [3]. Cumulative incidences were calculated by means of the statistical software environment R, Version 2.15.2 (The R Foundation for Statistical Computing, Vienna, Austria) [4]. SPSS 17.0 (SPSS Inc., Chicago, IL, USA) was used for other statistical analyses.

Results T-ALL patients were frequently referred after remission attainment from other centers. Some of these patients’ baseline parameters were missing. There were 25, 44, and 48 patients in the Burkitt’s cell leukemia, NT-ALL, and T-ALL groups, respectively. Important baseline characteristics of Burkitt’s cell leukemia and NT-ALL patients are presented in Table 1. All 25 Burkitt’s cell leukemia patients had been treated with the HyperCVAD ± rituximab regimen and were not transplanted. Rituximab treatments were given to most of the Burkitt’s cell leukemia patients; only 3 Burkitt’s cell leukemia patients had not received rituximab. Only nontransplanted acute lymphoblastic leukemia (NT-ALL) patients who were treated with HyperCVAD were selected as controls.

Median numbers of HyperCVAD ± rituximab regimens given to Burkitt’s and NT-ALL patients were 8 and 7.5, respectively. The CNS or extramedullary involvement rate, lactate dehydrogenase levels, and white blood cell count at diagnosis were higher in

Turk J Hematol 2016;33:281-285

the Burkitt’s group than the NT-ALL group and these differences were significant (p=0.008, p=0.016, and p=0.036, respectively).

We also analyzed the chemotherapy intervals between treatment cycles. There was no significant difference between the intervals of treatment cycles for the Burkitt’s cell leukemia and NT-ALL groups. The median (95% confidence interval) OS time for all 25 Burkitt’s cell leukemia patients was 31.1 (3.159.1) months. The mean (95% confidence interval) DFS time for Burkitt’s cell leukemia patients was 50.0 (30.9-69.2) months (median not reached). After analyzing the prognosis, we further analyzed the induction chemotherapy results and OS in the patients with Burkitt’s cell leukemia receiving HyperCVAD and similarly treated nontransplanted acute lymphoblastic leukemia patients. Transplanted acute lymphoblastic leukemia patients were preferentially not included in this analysis because the majority of them had been referred after remission attainment from other centers. After the induction therapy, 5 patients died, 19 patients achieved CR, and 1 patient had no response in the Burkitt’s cell leukemia group. Four patients died, 33 patients achieved CR, and 7 patients had no response in the NT-ALL group. We achieved a 76% CR rate in the Burkitt’s group and a 75% CR rate in the NT-ALL group (p=0.182). The median (95% confidence interval) OS time for the Burkitt’s and NT-ALL groups were 31.1 (3.1-59.1) and 12.1 (7.0-17.3) months, respectively (p=0.261). There was no significant difference between the two groups (Figure 1). After obtaining these results, we analyzed the DFS, CRI, and CNRMI in the 3 groups. The mean DFS time for the Burkitt’s, NT-ALL, and T-ALL groups was 50.0±9.7, 31.4±6.7, and 83.3±9.1 months, respectively (p=0.002). There was a significant statistical difference between these 3 groups (Figure 2). Burkitt’s cell leukemia patients had DFS durations comparable with the T-ALL cohort (50.0±9.7 vs. 83.3±9.1 months, respectively; p=0.17), but NT-ALL patients had significantly inferior DFS durations compared to the T-ALL group (31.4±6.7 vs. 83.3±9.1 months, respectively; p=0.001). Both CRI (45.4% [standard error, SE: 9.8%], 38.2% [SE: 7.8%], and 35.7% [SE: 12.5%] at the 80th month; p=0.04) and CNRMI (28.5% [SE: 8.8%], 6.8% [SE: 3.9%],

Figure 1. Overall survival time for Burkitt and NTxALL groups.

Malkan ÜY, et al: The Prognosis of Adult Burkitt’s Cell Leukemia

and 11.5% [SE: 8%] at the 80th month; p=0.03) were higher in NT-ALL patients compared to the T-ALL group and Burkitt’s cell leukemia patients (Figure 3).

Discussion As stem cell transplantation for Burkitt’s cell leukemia has been abandoned in the modern era, we preferred to evaluate success of current treatment in these cases by comparing them with similarly treated NT-ALL and T-ALL patients. Currently, allogeneic stem cell transplantation is deemed necessary in adult acute lymphoblastic leukemia during the first complete remission.

We thought that in the absence of possibilities of evaluating the value of allogeneic stem cell transplantation in Burkitt’s cell leukemia by a randomized study or by using a currently transplanted Burkitt’s cohort, the necessity of treatment could be weighed by comparison of Burkitt’s cell leukemia cases with T-ALL and NT-ALL patients. Transplanted acute lymphoblastic leukemia patients had the best DFS, significantly better than that of nontransplanted patients. However, no DFS advantage could be observed in transplanted patients compared to Burkitt’s cell leukemia patients.

Figure 2. Disease-free survival time of Burkitt, NTxALL, and TxALL groups.

Figure 3. Cumulative relapse and cumulative nonrelapse mortality incidences of Burkitt, NTxALL, and TxALL groups.

283

Malkan ÜY, et al: The Prognosis of Adult Burkitt’s Cell Leukemia

Turk J Hematol 2016;33:281-285

Table 1. Main baseline characteristics and follow-up durations of Burkitt’s cell leukemia and similarly treated non-transplant acute lymphoblastic leukemia patients.

Parameters

Burkitt’s Cell Leukemia Group

Non-Transplant ALL Group p-value

Number of cases

25

44

Sex (Male/Female)

18/7

23/21

0.086

ECOG performance score (0/1/2/3/4)

3/16/3/3/0

12/21/4/5/2

0.438

Age (Median, range)

39 (16-63)

31 (16-63)

0.192

LDH at diagnosis (U/L)

2035 (499-12000)

919 (331-9820)

0.016

Hemoglobin at diagnosis (g/dL)

10.0 (4.9-14.0)

9.1 (4.0-15.5)

0.920

Leucocyte count at diagnosis (x109/L)

9.6 (1.7-24.7)

8.8 (0.8-216.4)

0.036

Platelet count at diagnosis (x109/L)

103.5 (11-631)

53.5 (8-560)

0.141

Chemotherapy Interval 1-2nd, days

26.5 (18-33)

28.0 (17.0-45.0)

0.521

Chemotherapy Interval 2-3rd, days

26.5 (20.0-33.0)

26.0 (19.0-34.0)

0.878

Chemotherapy Interval 3-4th, days

24.0 (20.0-44.0)

26.0 (21.0-37.0)

0.613

Chemotherapy Interval 4-5th, days

25.0 (19.0-49.0)

25.0 (20.0-46.0)

0.676

Chemotherapy Interval 5-6th, days

30.0 (24.0-46.0)

29.0 (22.0-43.0)

0.395

Chemotherapy Interval 6-7th, days

37.5 (27.0-42.0)

29.0 (23.0-40.0)

0.087

Chemotherapy Interval 7-8th, days

31.0 (24.0-45.0)

29.0 (22.0-40.0)

0.148

Central Nervous System or Extramedullary involvement (Y/N)

12/14

7/37

0.008

Blasts in peripheral blood film (Y/N)

8/4

15/12

0.515

Blasts in marrow <25%, 25%-50%, >50%

1/0/11

0/1/24

0.275

Follow-up time for surviving patients, months

22.7 (1.4-88.5)

38.6 (0.5-90.7)

LDH: Lactate dehydrogenase, ECOG: The Eastern Cooperative Oncology Group, Y/N: Yes/No

In our study, we achieved a 76% CR rate after induction therapy in Burkitt’s cell leukemia cases. In a study conducted by a German group, an 86% CR rate was achieved in Burkitt’s cell leukemia patients [5]. In another study conducted in Italy, investigators obtained a 79% CR, 8% no-response rate, and 13% death rate in Burkitt’s lymphoma and leukemia patients after induction chemotherapy [6]. In our study, we obtained 76% CR, 20% death, and 4% no-response rates in Burkitt’s cell leukemia patients. The induction death rate in our study was higher than that of the Italian study. The reason for this difference may be that participants were in an advanced stage of disease (Burkitt’s cell leukemia) in our study, whereas patients in the Italian study had both Burkitt’s lymphoma and leukemia.

Furthermore, in the Italian study, investigators found a relapse rate of only 7% in patients treated with an intercycle interval of ≤25 days. We found the CRI of Burkitt’s cell leukemia patients as 35.7%, which was much higher. The intercycle interval could be the reason for this difference, because in our study the mean duration of all chemotherapy intercycles was longer than 25 days. It is known that men are more commonly affected by Burkitt’s disease with a 3-4:1 ratio [7]. Similarly, in our cohort, men were more common, with a ratio of 2.5:1.

In reported clinical trials, the prognosis for Burkitt’s lymphoma is generally favorable, with median survivals of 75%-90% with modern chemoimmunotherapy regimens [1,8]. An analysis of the Surveillance Epidemiology and End Results (SEER) database 284

was less encouraging, however, with a 5-year OS rate of 56% and better survival seen in younger patients with lowerrisk disease (87% and 71% for patients aged 0-19 years and for patients with low-risk disease, respectively) [9,10]. The impact of age on outcomes is likely multifactorial and reflects increased treatment toxicity or decreased treatment intensity in older individuals, as well as the potential misclassification of disease in this population. In our study the mean OS time for all 25 Burkitt’s cell leukemia patients was 43.6±9.2 months.

Burkitt’s lymphoma principally involves the lymph nodes, bone marrow, and CNS, but it may also present with peripheral blood involvement [11]. In our study, peripheral blood involvement was present in 66% of cases. A limitation of our study is that in the T-ALL group DFS duration after first CR was found comparable but OS duration was not calculable.

In conclusion, DFS in Burkitt’s cell leukemia patients treated with a widely accepted modern regimen, R-HyperCVAD, is comparable to that of allogeneic transplanted patients of acute lymphoblastic leukemia. Although this study has some disadvantages inherent to its retrospective design, use of nonBurkitt’s control groups, and a limited patient numbers, we think that a better comparative study design is practically impossible due to the absence of a large transplanted Burkitt’s cohort and ethical issues in planning a prospective study including transplantation in these patients. Our results are in agreement with the few prospective noncomparative studies [12,13],

Turk J Hematol 2016;33:281-285

suggesting no further need for stem cell transplantation in Burkitt’s cell leukemia.

Ethics Informed Consent was taken during the hospital admission of the patients, additional Ethics Committee Approval was not applicable based on the nature of this retrospective analysis.

Authorship Contributions Medical Practices: Ümit Yavuz Malkan, Gürsel Güneş, Hakan Göker, İbrahim C. Haznedaroğlu, Kadir Acar, Eylem Eliaçık, Sezgin Etgül, Tuncay Aslan, Seda Balaban, Haluk Demiroğlu, Osman İ. Özcebe, Nilgün Sayınalp, Salih Aksu, Yahya Büyükaşık; Concept: Ümit Yavuz Malkan, Yahya Büyükaşık; Design: Ümit Yavuz Malkan, Yahya Büyükaşık; Data Collection or Processing: Ümit Yavuz Malkan, Gürsel Güneş, Hakan Göker, İbrahim C. Haznedaroğlu, Kadir Acar, Eylem Eliaçık, Sezgin Etgül, Tuncay Aslan, Seda Balaban, Haluk Demiroğlu, Osman İ. Özcebe, Nilgün Sayınalp, Salih Aksu, Yahya Büyükaşık; Analysis or Interpretation: Ümit Yavuz Malkan, Yahya Büyükaşık; Literature Search: Ümit Yavuz Malkan; Writing: Ümit Yavuz Malkan.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Thomas DA, Faderl S, O’Brien S, Bueso-Ramos C, Cortes J, Garcia-Manero G, Giles FJ, Verstovsek S, Wierda WG, Pierce SA, Shan J, Brandt M, Hagemeister FB, Keating MJ, Cabanillas F, Kantarjian H. Chemoimmunotherapy with hyper-CVAD plus rituximab for the treatment of adult Burkitt’s and Burkitt’s-type lymphoma or acute lymphoblastic leukemia. Cancer 2006;106:1569-1580.

2. Gray RJ. A class of K-sample tests for comparing the cumulative incidence of a competing risk. Ann Stat 1988;16:1141-1154.

3. Scrucca L, Santucci A, Aversa F. Competing risk analysis using R: an easy guide for clinicians. Bone Marrow Transplant 2007;40:381-387.

Malkan ÜY, et al: The Prognosis of Adult Burkitt’s Cell Leukemia

4. Team RDC. R: A Language and Environment for Statistical Computing.

Vienna, Austria, R Foundation for Statistical Computing, 2012.

5. Hoelzer D, Walewski J, Döhner H, Schmid M, Hiddemann W, Baumann A, Serve H, Dührsen U, Hüttmann A, Thiel E, Dengler J, Kneba M, Schuler M, Schmidt-Wolf I, Beck J, Hertenstein B, Reichle A, Domanska-Czyz K, Fietkau R, Horst HA, Rieder H, Schwartz S, Burmeister T, Goekbuget N. Substantially improved outcome of adult Burkitt’s non-Hodgkin lymphoma and leukemia patients with rituximab and a short-intensive chemotherapy; report of a large prospective multicenter trial. Blood 2012;120:667a (abstract).

6. Intermesoli T, Rambaldi A, Rossi G, Delaini F, Romani C, Pogliani EM, Pagani C, Angelucci E, Terruzzi E, Levis A, Cassibba V, Mattei D, Gianfaldoni G, Scattolin AM, Di Bona E, Oldani E, Parolini M, Gökbuget N, Bassan R. High cure rates in Burkitt’s lymphoma and leukemia: a Northern Italy Leukemia Group study of the German short intensive rituximab-chemotherapy program. Haematologica 2013;98:1718-1725.

7. Morton LM, Wang SS, Devesa SS, Hartge P, Weisenburger DD, Linet MS. Lymphoma incidence patterns by WHO subtype in the United States, 19922001. Blood 2006;107:265-276.

8. Magrath I, Adde M, Shad A, Venzon D, Seibel N, Gootenberg J, Neely J, Arndt C, Nieder M, Jaffe E, Wittes RA, Horak ID. Adults and children with small non-cleaved-cell lymphoma have a similar excellent outcome when treated with the same chemotherapy regimen. J Clin Oncol 1996;14:925-934.

9. Castillo JJ, Winer ES, Olszewski AJ. Population-based prognostic factors for survival in patients with Burkitt’s lymphoma: an analysis from the Surveillance, Epidemiology, and End Results database. Cancer 2013;119:3672-3679.

10. Costa LJ, Xavier AC, Wahlquist AE, Hill EG. Trends in survival of patients with Burkitt’s lymphoma/leukemia in the USA: an analysis of 3691 cases. Blood 2013;121:4861-4866.

11. Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J, Vardiman JW. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. Lyon, France, IARC Press, 2008.

12. Maramattom LV, Hari PN, Burns LJ, Carreras J, Arcese W, Cairo MS, Costa LJ, Fenske TS, Lill M, Freytes CO, Gale RP, Gross TG, Hale GA, Hamadani M, Holmberg LA, Hsu JW, Inwards DJ, Lazarus HM, Marks DI, Maloney DG, Maziarz RT, Montoto S, Rizzieri DA, Wirk B, Gajewski JL. Autologous and allogeneic transplantation for Burkitt lymphoma outcomes and changes in utilization: a report from the Center for International Blood and Marrow Transplant Research. Biol Blood Marrow Transplant 2013;19:173-179.

13. Maruyama D, Watanabe T, Maeshima AM, Nomoto J, Taniguchi H, Azuma T, Mori M, Munakata W, Kim SW, Kobayashi Y, Matsuno Y, Tobinai K. Modified cyclophosphamide, vincristine, doxorubicin, and methotrexate (CODOX-M)/ ifosfamide, etoposide, and cytarabine (IVAC) therapy with or without rituximab in Japanese adult patients with Burkitt lymphoma (BL) and B cell lymphoma, unclassifiable, with features intermediate between diffuse large B cell lymphoma and BL. Int J Hematol 2010;92:732-743.

285

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0145 Turk J Hematol 2016;33:286-292

Expression Profiles of the Individual Genes Corresponding to the Genes Generated by Cytotoxicity Experiments with Bortezomib in Multiple Myeloma Multipl Miyelomda Bortezomib ile Yapılan Sitotoksisite Çalışmalarında Ortaya Çıkan Genlere Karşılık Gelen Özgün Genlerin Ekspresyon Profili Mehdi Ghasemi1,2, Semih Alpsoy1,3, Seyhan Türk4, Ümit Y. Malkan5, Şükrü Atakan1,2, İbrahim C. Haznedaroğlu5, Gürsel Güneş5, Mehmet Gündüz6, Burak Yılmaz1, Sezgin Etgül5, Seda Aydın5, Tuncay Aslan5, Nilgün Sayınalp5, Salih Aksu5, Haluk Demiroğlu5, Osman İ. Özcebe5, Yahya Büyükaşık5, Hakan Göker5 1Sentegen Biotechnology, Ankara, Turkey 2Bilkent University Faculty of Science, Department of Molecular Biology and Genetics, Ankara, Turkey 3METU Graduate School of Informatics Institute, Health Informatics Program, Clinic of Bioinformatics, Ankara, Turkey 4Hacettepe University Faculty of Pharmacy, Department of Biochemistry, Ankara, Turkey 5Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey 6Atatürk Training and Research Hospital, Clinic of Hematology, Ankara, Turkey

Abstract

Öz

Objective: Multiple myeloma (MM) is currently incurable due to refractory disease relapse even under novel anti-myeloma treatment.

In silico studies are effective for key decision making during clinicopathological battles against the chronic course of MM. The aim of this present in silico study was to identify individual genes whose expression profiles match that of the one generated by cytotoxicity experiments for bortezomib.

Amaç: Multipl miyelom (MM) günümüzde uygulanan yeni MM tedavilerine rağmen, refrakter hastalığın relapsı nedeniyle kür edilemeyen bir hastalıktır. In silico çalışmalar, MM’nin kronik seyrine karşı verilen klinikopatolojik savaşta alınan kararlar açısından oldukça önemlidir. Buradaki in silico çalışmanın amacı, bortezomib için yapılmış sitotoksisite çalışmalarında ortaya çıkan genlerle eşleşen özgün genleri ortaya koymaktır.

Materials and Methods: We used an in silico literature mining approach to identify potential biomarkers by creating a summarized set of metadata derived from relevant information. The E-MTAB-783 dataset containing expression data from 789 cancer cell lines including 8 myeloma cell lines with drug screening data from the Wellcome Trust Sanger Institute database obtained from ArrayExpress was “Robust Multi-array analysis” normalized using GeneSpring v.12.5. Drug toxicity data were obtained from the Genomics of Drug Sensitivity in Cancer project. In order to identify individual genes whose expression profiles matched that of the one generated by cytotoxicity experiments for bortezomib, we used a linear regressionbased approach, where we searched for statistically significant correlations between gene expression values and IC50 data. The intersections of the genes were identified in 8 cell lines and used for further analysis.

Gereç ve Yöntemler: Biz bu çalışmada, potansiyel biyobelirteçleri ortaya koymak için araştırma konusuna uygun bir şekilde türetilmiş özetleyici veri seti üreterek in silico literatür taraması gerçekleştirdik.

“Wellcome Trust Sanger” enstitüsünün 8 miyelom hücre serisi de olmak üzere toplam 789 kanser hücre serisini ilaç tarama verileriyle beraber içeren E-MTAB-783 veri seti ArrayExpress’den elde edilip, GeneSpring v.12.5 kullanılarak “Robust Multi-array analysis” normalize edildi. İlaç toksisite verisi “Genomics of Drug Sensitivity in Cancer” projesinden elde edildi. Biz bu çalışmada, eşleşen genleri saptamak amacıyla, gen ekspresyon değerleri ve IC50 verileri arasındaki istatistiksel açıdan anlamlı korelasyonları lineer regresyon temelli yaklaşım uygulayarak araştırdık. Sekiz hücre serisinde gen kesişimi tespit edildi ve bu hücre serileri ileri analiz için kullanıldı.

Results: Our linear regression model identified 73 genes and some genes expression levels were found to very closely correlated with bortezomib IC50 values. When all 73 genes were used in a hierarchical

Bulgular: Kullandığımız lineer regresyon modeli sayesinde 73 genin ve bazı gen ekspresyon düzeylerinin, bortezomibin IC50 değeri ile çok yakın korelasyon gösterdiğini tespit ettik. Tüm 73 geni hiyerarşik küme analizi ile incelediğimizde, iki ana kümede toplanan hücrelerin, görece duyarlı ve dirençli hücreler olduğunu gördük. Bütün önemli genlerin

Address for Correspondence/Yazışma Adresi: İbrahim C. HAZNEDAROĞLU, M.D., Received/Geliş tarihi: April 02, 2015 Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey Accepted/Kabul tarihi: February 08, 2016 Phone : +90 312 305 15 43 E-mail : ichaznedaroglu@gmail.com

286

Turk J Hematol 2016;33:286-292

cluster analysis, two major clusters of cells representing relatively sensitive and resistant cells could be identified. Pathway and molecular function analysis of all the significant genes was also investigated, as well as the genes involved in pathways.

Conclusion: The findings of our present in silico study could be important not only for the understanding of the genomics of MM but also for the better arrangement of the targeted anti-myeloma therapies, such as bortezomib.

Ghasemi M, et al: Identification of Individual Genes for Bortezomib

moleküler yolak ve fonksiyon analizi, yolaklara dahil olan genlerle beraber incelenmiştir.

Sonuç: Gerçekleştirdiğimiz bu in silico çalışmada ortaya konan veriler, MM genomiğinin anlaşılması ve bortezomib gibi hedefe yönelik miyelom tedavilerinin daha iyi yönetilebilmesi açısından önemlidir.

Anahtar Sözcükler: Miyelom ve diğer plazma hücre diskrazileri, Neoplazi, Sitogenetik, Gen terapisi, Moleküler hematoloji

Keywords: Myeloma and other plasma cell dyscrasias, Neoplasia, Cytogenetics, Gene therapy, Molecular hematology

Introduction Multiple myeloma (MM) is clinically, cytogenetically, and molecularly a very heterogeneous complicated neoplastic hematological disorder [1]. Numerous intra- and intercellular interactions, soluble/membrane-bound factors, and cell cycle machineries [2] represent potential targets of drug treatments in patients with MM [3]. Therefore, virtual drug treatments aimed at different targets can be explored using the computational models. Bortezomib is a targeted therapeutic drug for MM with high affinity, specificity, and selectivity for catalytic activity of proteasome. Bortezomib induces apoptosis in MM, inhibits the activation of nuclear factor-κB, suppresses survival of MM cells, and inhibits interleukin-6 triggered MM-cell proliferation, as well as inhibiting MM-cell adhesion in the bone marrow microenvironment [3,4,5,6,7]. Accurate preclinical predictions of the clinical efficacy of anti-MM drugs are needed.

MM is currently incurable due to refractory disease relapse even under novel anti-myeloma treatment [8]. Current challenges for the management of MM, including bortezomib drug treatment, are resistance development to drugs, increased unsustainable cost [9,10], lack of standardization in the therapeutic steps including stem cell transplantation, and morbidity and mortality due to drugs and/or ongoing resistant incurable neoplastic myeloma disease [4,5,11,12,13]. In silico studies are effective for key decision making during clinicopathological battles against the chronic course of MM [3,7,14,15]. The aim of this present in silico study is to identify individual genes whose expression profiles match that of the one generated by cytotoxicity experiments for bortezomib. Elucidation of the gene expression profiles (GEP) of the proteasome inhibitors in the pharmacobiological basis of MM is extremely important for the clinical activity of anti-MM drugs with regards to effectivity, safety, tolerability, toxicity, and pharmacoeconomy. The use of predictive simulation technology seems to be vital in designing therapeutics for targeting novel biological mechanisms using existing or novel chemistry [16].

Materials and Methods Public Expression and Drug Cytotoxicity Data The myeloma cell line expression data were retrieved from ArrayExpress (E-MTAB-783) and consisted of transcriptomic

profiles of 789 cancer cell lines from various types of cancer.

Seven myeloma cell lines (ARH-77, IM-9, LP-1, L-363, OPM2, RPMI-8226, and SK-MM-2) among the 789 cell lines were selected to be used in analyses after quality control. The drug cytotoxicity data of bortezomib, on the other hand, were retrieved from the Genomics of Drug Sensitivity in Cancer database of the Wellcome Trust Sanger Institute (http://www. cancerrxgene.org).

Expression Data Preprocessing GeneSpring software version 12.5 was used to extract raw data and background corrected gene expression data were generated.

Further preprocessing was done using the Affy package for R and “Robust Multi-array analysis” normalization was applied to the data according to the Affy procedure.

In Silico Classification of Myeloma Cell Lines and Identification of Candidate Gene Biomarkers We used an in silico literature mining approach to identify potential biomarkers by creating a summarized set of metadata derived from relevant information [17,18,19]. To do that, a linear regression model was used to discover genes whose expression profiles correlated with bortezomib sensitivity as measured for 7 myeloma cell lines by IC50 values from the Genomics of Drug Sensitivity in Cancer database. All genes with a Pearson’s correlation coefficient related p-value below 0.01 and Pearson product-moment correlation coefficient value (r-value) higher than 0.9 were considered as candidate biomarker genes.

Myeloma cell lines (SK-MM-2, OPM-2, U-266, RPMI-8226, ARH-77, L-363, IM-9, and LP-1) were hierarchically clustered based on determined biomarker genes, with Euclidian distance measures for both genes and arrays and complete linkage, using Cluster 3.0 software. In addition, we mapped these genes in biological pathways by using the Protein ANalysis THrough Evolutionary Relationships (PANTHER) classification system tool. The gene expression levels of cell lines were correlated with drug screening data (IC50 data) of bortezomib from the Wellcome Trust Sanger Institute Database. Drug toxicity data were obtained from the Genomics of Drug Sensitivity in Cancer project (http://www.cancerrxgene.org).

287

Ghasemi M, et al: Identification of Individual Genes for Bortezomib

Turk J Hematol 2016;33:286-292

Results In order to identify individual genes whose expression profiles matched that of the one generated by cytotoxicity experiments for bortezomib, we used a linear regression-based approach, where we searched for statistically significant correlations between gene expression values and IC50 data [17,18,19]. The intersections of the genes were identified in 7 cell lines and used for further analysis. IC50 values of 7 MM cell lines after 72 h of treatment with bortezomib are shown in Figure 1. In this figure cells are sorted based on their sensitivity to bortezomib.

Our linear regression model identified 73 genes. Genes with very good concordance between expression levels and bortezomib IC50 values are shown in Figure 2. When all 73 genes were used in a hierarchical cluster analysis, two major clusters of cells representing relatively sensitive and resistant cells could be identified, as seen in Figure 3. Pathway and molecular function analysis of all the significant genes is shown in Figure 4. Table 1 shows the genes involved in pathways. Table 1 also presents the families and subfamilies of these genes, suggesting that other members of these families might have effects on and responsibility for drug resistance. All of the proteins coded by these genes have key roles in cancer progression and some in metastasis.

Figure 3. Clustering of multiple myeloma cell lines based on candidate gene biomarkers. Hierarchical clustering of myeloma cell lines according to 73 genes whose expressions show significant association with bortezomib chemosensitivity. Two major clusters are demonstrable, one containing relatively resistant cells and one containing less sensitive cells.

Figure 1. IC50 values for myeloma cell lines. As can be seen, the most resistant cell line to bortezomib is IM-9, while OPM-2 presents the most sensitive profile.

Figure 2. The correlation between gene expression and bortezomib IC50 values. Fifty-three genes are positively correlated with drug resistance while the rest show negative correlations.

288

Figure 4. Biological pathway and molecular function analysis: A) biological pathway analysis of the genes whose expressions are correlated with bortezomib resistance in multiple myeloma cell lines; B) molecular function analyses of 73 genes that show a significant correlation with bortezomib resistance in multiple myeloma cell lines.

Fibroblast growth factor 2 (PTHR11486:SF68) GTPase KRAS (PTHR24070:SF186)

GTPase KRas; KRAS; ortholog

KRAS Cadherin-5 (PTHR24027:SF89) Casein kinase II subunit alpha’ (PTHR24054:SF3)

Cadherin 5; CDH5; ortholog Casein kinase II subunit al pha’; CSNK2A2; ort

CDHS

CSNK2A2

Guanine nucleotide-binding protein

Guanine nudeotide-binding protein G(o) subunit

GNAO1

FGF2: Fibroblast growth factor 2.

Wnt signaling pathway

Ubiquitin proteasome pathway

Beta-arrestin-2 (PTHR11792:SF20) Cadherin-5 (PTHR24027:SF89) Mothers against decapentaplegic homolog 4 Casein kinase II subunit alpha’ (PTHR24054:SF3)

Cadherin 5; CDH5; ortholog Mothers against decapentaplegic omolog Casein kinase II subunit al pha’; CSNK2A2; ort

CDHS

SMAD4

CSNK2A2

26S Proteasome non-atpase regulatory

Beta-arrestin-2; ARRB2; ortholog

26S proteasome non- ATPase regulatory subunit

ARRB2

PSMD8

GTPase KRAS (PTHR24070:SF186)

GTPase KRas; KRAS; ortholog

KRAS

GTPase KRAS (PTHR24070:SF186)

GTPase KRas; KRAS; ortholog

KRAS

Collagen alpha- 2(I) chain (PTHR24023:SF441)

Guanine nucleotide binding protein

Guanine nucleotide binding protein G (0) subunit

GNAO1

Collagen alpha-2(I) chain; COL1A2; ortholog

Regulator of G protein signaling 4 (PTHR10845:SF40)

Regulator of G protein signaling 4

RGS4

COL1A2

Beta-arrestin-2 (PTHR11792:SF20)

Beta-arrestin-2; ARRB2; ortholog

ARRB2

Iflammation mediated by chemokine and cytokine signaling pathway

Mothers against decapentaplegic homolog 4

Mothers against decapentaplegic homolog

SMAD4

Gonadotropin releasing hormone receptor pathway

Integrin signalling pathway

PANTHER Family/Subfamily

FGF2; ortholog

Gene Name/Gene Symbol

FGF2

Mapped ID

Cadherin signaling pathway

Angiogenesis

Pathway

Transcription factor

Cell junction protein; cadherin

Enzyme modulator

Enzyme modulator

Small GTPase

Transporter; surfactant; receptor; extracellular matrix

Small GTPase

Heterotrimeric G protein

G protein modulator

Enzyme modulator

Heterotrimeric G- protein

Transcription factor

Cell junction protein; cadherin

Small GTPase

Growth factor

PANTHER Protein Class

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Homo sapiens

Species

Table 1. List of genes involved in specific pathways. The genes presented in this table are outcomes of Pearson correlation analysis done by using bortezomib chemosensitivity data and gene expression data for the multiple myeloma cell lines.

Turk J Hematol 2016;33:286-292 Ghasemi M, et al: Identification of Individual Genes for Bortezomib

289

Ghasemi M, et al: Identification of Individual Genes for Bortezomib

Discussion In this in silico study, the hierarchical clustering of myeloma cell lines according to bortezomib hemosensitivity biomarker genes has been described. The heat map represented the clustering of 8 myeloma cell lines based on 73 genes disclosing either bortezomib resistance or less sensitive myeloma cells. Likewise, the concordances between gene expression and IC50 values of 8 myeloma cell lines are shown for 73 genes. Furthermore, the relevant biological pathway analyses of the genes whose expressions are concordant with bortezomib cytotoxicity were explored via the molecular functional analyses of the 73 genes (Figures 2, 3, and 4). The genes involved in specific pathways regarding the proteasome inhibitors, and particularly bortezomib, are related to the critical pathological events of MM such as tumor angiogenesis and neoplastic signaling pathways (cadherin, integrin, Wnt, GnRH, ubiquitin), as well as chemokine-mediated inflammation (Table 1). Those pathways are essentially important in the biology of myeloma, such as the ubiquitin proteasome system, which plays a role in the regulation of most cellular pathways, and its deregulation in MM represents a target for proteasome inhibition via bortezomib [20]. Proliferation and apoptosis pathways are pathologically regulated by the ubiquitin-proteasome system, resulting in cellular neoplastic transformation in MM [21]. Targeting pathological angiogenesis in MM via bortezomib may delay tumor growth and reduce cytokine paracrine loops mediated by angiogenic factors [22].

Meanwhile, the signal transducers and activators of transcription proteins represent a family of cytoplasmic transcription factors that regulate a pleiotropic range of biological processes in MM [23]. Cell-cell interactions and cancer-initiating cells further complicate the biology of MM [24]. A previous study, in accordance with our present results, examined gene ontogeny related to bortezomib and suggested involvement in cellular development and carcinogenesis [25].

In the present study, by performing in silico correlation analysis, we determined genes whose expressions are correlated with bortezomib chemosensitivity in MM cell lines. Among 73 genes that are highly correlated with drug-resistant response (absolute Pearson r-value of >0.80), 20 genes showed a reverse correlation with chemosensitivity to bortezomib. This means that overexpression of these genes makes cancer cells more sensitive to bortezomib and the expressions of these genes are associated with good prognosis. Conversely, 53 genes are positively correlated to bortezomib response and make cells more resistant to drug treatment, and overexpression of these genes is associated with poor prognosis (supplementary data). We also tried to determine the pathways in which these genes are involved and figure out the relation between outcome and MM drug resistance profile by using another classification system. The PANTHER classification system was designed to classify proteins and their genes in order to facilitate high-throughput analysis. Proteins have been classified according to family and subfamily, molecular function, biological 290

Turk J Hematol 2016;33:286-292

process, and pathway. Further in vitro and clinical validation studies are needed to determine and validate the exact role of each gene or panel of genes that are suggested in the present study as gene biomarkers for bortezomib-resistant response in MM cancer.

In 2007 Mulligan et al. assessed the feasibility of prospective pharmacogenomics research in multicenter international clinical trials of bortezomib in MM [26]. They tried to highlight those genes whose expressions are related to drug response and survival using bone marrow clinical samples by performing gene set enrichment analysis, analysis of clinical response, and overall survival analysis.

The present study has two main differences from that study in terms of genomic approach and databases used. Our database came from established MM cell lines and the genomic approach was analysis of correlations between gene expression and drug response. Despite the two different approaches, we can see that many genes in this study and in that of Mulligan et al. overlap. On the other hand, our analysis shows some other genes that are able to predict response to bortezomib.

Cancer cell lines have a notable role in cancer drug discovery.

Jaeger et al. found that drug sensitivity in cancer cell lines is not tissue-specific and recommended that, to get the most trustable results using cell lines, it will be necessary to include those cell lines’ molecular characteristics [27]. Similarly, in this experiment we did integrate those data into biological analysis, such as pathway analysis and hierarchical clustering.

The overall results of the present data mining study reveal the complicated nature of MM [28] and locate the drug bortezomib at the critical crossroads of the pathobiology of the disease, driving the clinical course of MM. For instance, the LP-1 cell line was found to be resistant to bortezomib in our present study (Figure 3). A previous study suggested that the expression of Apaf-1 might be predictive of the response to proteasome inhibition [29]. Based on our present results, patients with MM mimicking the molecular profile/behavior of LP-1 at any clinical evaluation point during the long-term clinical course of MM will be candidates for therapeutic regimens other than bortezomib. Ideally, those multiresistant MM patients should be single- or multiple-transplanted based on individual clinical responses [14]. We intend to test these hypotheses in future experiments designed to examine genomic profiles of the biological samples obtained from our MM patient cohort.

The results of our present study represent the rational basis for future molecular studies dealing with biological myeloma samples (peripheral blood and/or bone marrow) obtained from ‘real-life’ patients with MM. This issue is not just academically important since the proper selection of anti-myeloma drugs in everyday clinical practice during the long-term incurable advanced clinical forms of MM is challenging even to the most skilled clinicians. Randomized clinical trials (RCTs) usually compare drugs but do not decide on treatment strategies and proper selection of drug combinations [30], particularly for

Ghasemi M, et al: Identification of Individual Genes for Bortezomib

Turk J Hematol 2016;33:286-292

the handicapped myeloma patients with already present organ toxicities that are usually excluded from RCTs [12,13,31]. For reallife myeloma clinics, the pharmacobiological profile of the antimyeloma drug together with the resistance profile [32] should be determined with the corresponding pathobiology of the MM disease course. This molecular approach could be particularly important for making decisions about hematopoietic stem cell transplantation for MM [14].

MM is a very heterogeneous disease [1]. Genetic changes could play a major role in prognosis in MM. However, in contrast to leukemias, no “good-risk” abnormalities have been described. Molecular analyses using GEP dissected the genetic basis of MM. Although various GEP-based signatures have been reported to identify highrisk myeloma disease and predict prognosis, the inability of GEP to predict clinical response in MM is also evident [1].

Barlogie et al., Shaughnessy et al., and Shaughnessy et al. showed the advantages of using GEP data to elucidate the molecular basis of resistance to chemotherapy as well as classification of MM patients in terms of poor prognosis and risk of relapse [33,34,35].

In this study, we determined those genes whose expressions are in correlation with bortezomib using GEP data.

Khin et al. generated patient-individualized estimations of initial response to chemotherapeutic agents in MM and time to relapse [36]. They designated an experimental platform with the specific intent of generating experimental parameters for a computational clinical model of personalized therapy in MM, while taking into consideration the limitations of working with patient primary cells and the need to incorporate elements of the myeloma tumor microenvironment. They suggested that myeloma patient-specific computational models, parameterized by in vitro platforms, could be combined with genomic datasets to better understand drug resistance in MM. Wang et al. developed a computational model of MM-bone marrow microenvironment interactions and clarified that intercellular signaling mechanisms implemented in this model appropriately drive MM disease progression [37]. Our findings in the present study also indicated that an understanding of the genomic myeloma dynamics might be useful for predictions of disease prognosis, as well as for proposing better therapeutic strategies for each patient with MM. Bortezomib is able to induce tumor cell death by degradation of key proteins. It is employed as a first-line treatment in relapsed or resistant MM patients. However, bortezomib often induces a doselimiting toxicity in the form of painful sensory neuropathy, which can mainly be reduced by subcutaneous administration or dose modification. Richardson et al. showed that some of the genes that are shown to related to bortezomib resistancy in the present study are also interestingly related to bortezomib-associated neurotoxicity [38]. It is suggested that those genes are involved in the pathways that control toxicity and resistancy [26,38].

The findings of our present in silico study could be important not only for the understanding of the genomics of MM but also

for the better arrangement of targeted anti-myeloma therapies, such as bortezomib. Improvement in the understanding of MM pathogenesis will refine the molecular dissection of the disease, especially in the context of novel anti-myeloma drugs affecting the disease course. Genomics, proteomics, transcriptomics, and metabolomics studies (in silico, in vitro, in vivo) should be integrated to understand their significance in the management of MM, as well as to offer better therapeutics and treatment strategies to patients with MM. Ethics Ethics Committee Approval: The research was performed in an in silico setting. Therefore, evaluation of the ethics committee was not required; Informed Consent: N/A. Authorship Contributions Concept: Mehdi Ghasemi, Semih Alpsoy, Seyhan Türk, Ümit Y. Malkan, Şükrü Atakan, İbrahim C. Haznedaroğlu, Gürsel Güneş, Mehmet Gündüz, Burak Yılmaz, Sezgin Etgül, Seda Aydın, Tuncay Aslan, Nilgün Sayınalp, Salih Aksu, Haluk Demiroğlu, Osman İ. Özcebe, Yahya Büyükaşık, Hakan Göker; Design: Mehdi Ghasemi, Semih Alpsoy, Seyhan Türk, Ümit Y. Malkan, Şükrü Atakan, İbrahim C. Haznedaroğlu, Gürsel Güneş, Mehmet Gündüz, Burak Yılmaz, Sezgin Etgül, Seda Aydın, Tuncay Aslan, Nilgün Sayınalp, Salih Aksu, Haluk Demiroğlu, Osman İ. Özcebe, Yahya Büyükaşık, Hakan Göker; Data Collection or Processing: Mehdi Ghasemi, Semih Alpsoy, Seyhan Türk, Ümit Y. Malkan, Şükrü Atakan, İbrahim C. Haznedaroğlu, Gürsel Güneş, Mehmet Gündüz, Burak Yılmaz, Sezgin Etgül, Seda Aydın, Tuncay Aslan, Nilgün Sayınalp, Salih Aksu, Haluk Demiroğlu, Osman İ. Özcebe, Yahya Büyükaşık, Hakan Göker; Analysis or Interpretation: Mehdi Ghasemi, Semih Alpsoy, Seyhan Türk, Ümit Y. Malkan, Şükrü Atakan, İbrahim C. Haznedaroğlu, Gürsel Güneş, Mehmet Gündüz, Burak Yılmaz, Sezgin Etgül, Seda Aydın, Tuncay Aslan, Nilgün Sayınalp, Salih Aksu, Haluk Demiroğlu, Osman İ. Özcebe, Yahya Büyükaşık, Hakan Göker; Literature Search: Mehdi Ghasemi, Semih Alpsoy, Seyhan Türk, Ümit Y. Malkan, Şükrü Atakan, İbrahim C. Haznedaroğlu, Gürsel Güneş, Mehmet Gündüz, Burak Yılmaz, Sezgin Etgül, Seda Aydın, Tuncay Aslan, Nilgün Sayınalp, Salih Aksu, Haluk Demiroğlu, Osman İ. Özcebe, Yahya Büyükaşık, Hakan Göker; Writing: Mehdi Ghasemi, Semih Alpsoy, Seyhan Türk, Ümit Y. Malkan, Şükrü Atakan, İbrahim C. Haznedaroğlu, Gürsel Güneş, Mehmet Gündüz, Burak Yılmaz, Sezgin Etgül, Seda Aydın, Tuncay Aslan, Nilgün Sayınalp, Salih Aksu, Haluk Demiroğlu, Osman İ. Özcebe, Yahya Büyükaşık, Hakan Göker.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Corre J, Munshi N, Avet-Loiseau H. Genetics of multiple myeloma: another heterogeneity level? Blood 2015;125:1870-1876.

2. Liu YH, Bi JX, Zeng AP, Yuan JQ. A population balance model describing the cell cycle dynamics of myeloma cell cultivation. Biotechnol Prog 2007;23:1198-1209.

291

Ghasemi M, et al: Identification of Individual Genes for Bortezomib

3. Wang Y, Lin B. In silico investigations of potential anabolic treatments in multiple myeloma-induced bone disease. Bone 2013;55:132-149.

4. Merin NM, Kelly KR. Clinical use of proteasome inhibitors in the treatment of multiple myeloma. Pharmaceuticals (Basel) 2014;8:1-20.

5. Möller J, Nicklasson L, Murthy A. Cost-effectiveness of novel relapsed-refractory multiple myeloma therapies in Norway: lenalidomide plus dexamethasone vs bortezomib. J Med Econ 2011;14:690-697.

6. Niewerth D, Jansen G, Assaraf YG, Zweegman S, Kaspers GJ, Cloos J. Molecular basis of resistance to proteasome inhibitors in hematological malignancies.

Drug Resist Updat 2015;18:18-35.

7. Sung MH, Simon R. In silico simulation of inhibitor drug effects on nuclear factor-κB pathway dynamics. Mol Pharmacol 2004;66:70-75.

8. Su J, Zhang L, Zhang W, Choi DS, Wen J, Jiang B, Chang CC, Zhou X. Targeting the biophysical properties of the myeloma initiating cell niches: a pharmaceutical synergism analysis using multi-scale agent-based modeling. PLoS One 2014;9:e85059.

9. Brown RE, Stern S, Dhanasiri S, Schey S. Lenalidomide for multiple myeloma: cost-effectiveness in patients with one prior therapy in England and Wales. Eur J Health Econ 2013;14:507-514.

10. Saret CJ, Winn AN, Shah G, Parsons SK, Lin PJ, Cohen JT, Neumann PJ. Value of innovation in hematologic malignancies: a systematic review of published costeffectiveness analyses. Blood 2015;125:1866-1869.

11. Arikian SR, Milentijevic D, Binder G, Gibson CJ, Hu XH, Nagarwala Y, Hussein M, Corvino FA, Surinach A, Usmani SZ. Patterns of total cost and economic consequences of progression for patients with newly diagnosed multiple myeloma. Curr Med Res Opin 2015;31:1105-1115.

12. Serefhanoglu S, Haznedaroglu IC, Goker H, Buyukasik Y, Ozcebe OI. Multiple bulky cutaneous plasmacytomas with CNS relapse without bone marrow involvement during the course of a lambda light chain myeloma. Onkologie 2009;32:662-664.

13. Serefhanoglu S, Sayinalp N, Haznedaroglu IC, Goker H, Cetiner D, Aksu S, Buyukasik Y, Ozcebe OI. Extramedullary plasmacytomas of the thyroid and pericardium as initial presentation of multiple myeloma. Ann Hematol 2008;87:853-854.

14. Dingli D, Pacheco JM, Dispenzieri A, Hayman SR, Kumar SK, Lacy MQ, Gastineau DA, Gertz MA. In vivo and in silico studies on single versus multiple transplants for multiple myeloma. Cancer Sci 2007;98:734-739.

15. Wang Y, Lin B. In silico investigations of the anti-catabolic effects of pamidronate and denosumab on multiple myeloma-induced bone disease. PLoS One 2012;7:e44868.

16. Doudican NA, Mazumder A, Kapoor S, Sultana Z, Kumar A, Talawdekar A, Basu K, Agrawal A, Aggarwal A, Shetty K, Singh NK, Kumar C, Tyagi A, Singh NK, Darlybai JC, Abbasi T, Vali S. Predictive simulation approach for designing cancer therapeutic regimens with novel biological mechanisms. J Cancer 2014;5:406416.

17. Garnett MJ, Edelman EJ, Heidorn SJ, Greenman CD, Dastur A, Lau KW, Greninger P, Thompson IR, Luo X, Soares J, Liu Q, Iorio F, Surdez D, Chen L, Milano RJ, Bignell GR, Tam AT, Davies H, Stevenson JA, Barthorpe S, Lutz SR, Kogera F, Lawrence K, McLaren-Douglas A, Mitropoulos X, Mironenko T, Thi H, Richardson L, Zhou W, Jewitt F, Zhang T, O’Brien P, Boisvert JL, Price S,Hur W, Yang W, Deng X, Butler A, Choi HG, Chang JW, Baselga J, Stamenkovic I, Engelman JA, Sharma SV, Delattre O, Saez-Rodriguez J, Gray NS, Settleman J, Futreal PA, Haber DA, Stratton MR, Ramaswamy S, McDermott U, Benes CH. Systematic identification of genomic markers of drug sensitivity in cancer cells. Nature 2012;483:570575.

18. Mi H, Muruganujan A, Thomas PD. PANTHER in 2013: modeling the evolution of gene function, and other gene attributes, in the context of phylogenetic trees.

Nucleic Acids Res 2013;41:D377-386.

19. Thomas PD, Kejariwal A, Guo N, Mi H, Campbell MJ, Muruganujan A, LazarevaUlitsky B. Applications for protein sequence-function evolution data: mRNA/ protein expression analysis and coding SNP scoring tools. Nucleic Acids Res 2006;34:W645-650.

20. Landre V, Rotblat B, Melino S, Bernassola F, Melino G. Screening for E3-ubiquitin ligase inhibitors: challenges and opportunities. Oncotarget 2014;5:7988-8013.

21. Zuo J, Bi C, Fan Y, Buac D, Nardon C, Daniel KG, Dou QP. Cellular and computational studies of proteasome inhibition and apoptosis induction in human cancer cells by amino acid Schiff base-copper complexes. J Inorg Biochem 2013;118:83-93.

292

Turk J Hematol 2016;33:286-292

22. Silva AS, Gatenby RA. Adaptation to survival in germinal center is the initial step in onset of indolent stage of multiple myeloma. Mol Pharm 2011;8:2012-2020.

23. Page BD, Croucher DC, Li ZH, Haftchenary S, Jimenez-Zepeda VH, Atkinson J, Spagnuolo PA, Wong YL, Colaguori R, Lewis AM, Schimmer AD, Trudel S, Gunning PT. Inhibiting aberrant signal transducer and activator of transcription protein activation with tetrapodal, small molecule Src homology 2 domain binders: promising agents against multiple myeloma. J Med Chem 2013;56:7190-7200.

24. Peng T, Peng H, Choi DS, Su J, Chang CC, Zhou X. Modeling cell-cell interactions in regulating multiple myeloma initiating cell fate. IEEE J Biomed Health Inform 2014;18:484-491.

25. Nagji AS, Cho SH, Liu Y, Lee JK, Jones DR. Multigene expression-based predictors for sensitivity to Vorinostat and Velcade in non-small cell lung cancer. Mol Cancer Ther 2010;9:2834-2843.

26. Mulligan G, Mitsiades C, Bryant B, Zhan F, Chng WJ, Roels S, Koenig E, Fergus A, Huang Y, Richardson P, Trepicchio WL, Broyl A, Sonneveld P, Shaughnessy JD Jr, Bergsagel PL, Schenkein D, Esseltine DL, Boral A, Anderson KC. Gene expression profiling and correlation with outcome in clinical trials of the proteasome inhibitor bortezomib. Blood 2007;109:3177-3188.

27. Jaeger S, Duran-Frigola M, Aloy P. Drug sensitivity in cancer cell lines is not tissue-specific. Mol Cancer 2015;14:40.

28. Uz B, Tatonyan SÇ, Sayitoğlu M, Erbilgin Y, Hatırnaz O, Aksu S, Büyükaşık Y, Sayınalp N, Göker H, Ozcebe Oİ, Ozbek U, Haznedaroğlu IC. Local reninangiotensin system in normal hematopoietic and multiple myeloma-related progenitor cells. Turk J Haematol 2014;31:136-142.

29. Ottosson-Wadlund A, Ceder R, Preta G, Pokrovskaja K, Grafström RC, Heyman M, Söderhäll S, Grandér D, Hedenfalk I, Robertson JD, Fadeel B. Requirement of apoptotic protease-activating factor-1 for bortezomib-induced apoptosis but not for Fas-mediated apoptosis in human leukemic cells. Mol Pharmacol 2013;83:245-255.

30. Usmani SZ, Lonial S. Novel drug combinations for the management of relapsed/refractory multiple myeloma. Clin Lymphoma Myeloma Leuk 2014;14(Suppl):S71-77.

31. Kocabeyoglu S, Mocan MC, Haznedaroglu IC, Uner A, Uzunosmanoglu E, Irkec M. In vivo confocal microscopic characteristics of crystalline keratopathy in patients with monoclonal gammopathy: report of two cases. Indian J Ophthalmol 2014;62:938-940.

32. Peng H, Peng T, Wen J, Engler DA, Matsunami RK, Su J, Zhang L, Chang CC, Zhou X. Characterization of p38 MAPK isoforms for drug resistance study using systems biology approach. Bioinformatics 2014;30:1899-1907.

33. Barlogie B, Anaissie E, van Rhee F, Pineda-Roman M, Zangari M, Shaughnessy J, Epstein J, Crowley J. The Arkansas approach to therapy of patients with multiple myeloma. Best Pract Res Clin Haematol 2007;20:761-781.

34. Shaughnessy JD Jr, Qu P, Usmani S, Heuck CJ, Zhang Q, Zhou Y, Tian E, Hanamura I, van Rhee F, Anaissie E, Epstein J, Nair B, Stephens O, Williams R, Waheed S, Alsayed Y, Crowley J, Barlogie B. Pharmacogenomics of bortezomib testdosing identifies hyperexpression of proteasome genes, especially PSMD4, as novel high-risk feature in myeloma treated with Total Therapy 3. Blood 2011;118:3512-3524.

35. Shaughnessy JD, Zhan F, Huang Y, Barlogie B. In vivo changes in gene expression profiles (GEP) after bortezomib (V) for multiple myeloma (MM): differential effects on plasma cells (PC) and micro-environment (ME). J Clin Oncol 2006;24:7603 (abstract).

36. Khin ZP, Ribeiro ML, Jacobson T, Hazlehurst L, Perez L, Baz R, Shain K, Silva AS. A preclinical assay for chemosensitivity in multiple myeloma. Cancer Res 2014;74:56-67.

37. Wang Y, Pivonka P, Buenzli PR, Smith DW, Dunstan CR. Computational modeling of interactions between multiple myeloma and the bone microenvironment.

PLoS One 2011;6:e27494.

38. Richardson PG, Sonneveld P, Schuster MW, Irwin D, Stadtmauer EA, Facon T, Harousseau JL, Ben-Yehuda D, Lonial S, Goldschmidt H, Reece D, San-Miguel JF, Bladé J, Boccadoro M, Cavenagh J, Dalton WS, Boral AL, Esseltine DL, Porter JB, Schenkein D, Anderson KC; Assessment of Proteasome Inhibition for Extending Remissions (APEX) Investigators. Bortezomib or high-dose dexamethasone for relapsed multiple myeloma. N Engl J Med 2005;352:2487-2498.

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0087 Turk J Hematol 2016;33:293-298

The Effect of Hyperparathyroid State on Platelet Functions and Bone Loss Hiperparatiroidi Durumun Trombosit Fonksiyonları ve Kemik Kaybı Üzerine Olan Etkisi Göknur Yorulmaz1, Aysen Akalın2, Olga Meltem Akay3, Garip Şahin4, Cengiz Bal5 1Eskişehir State Hospital, Clinic of Endocrinology, Eskişehir, Turkey 2Eskişehir Osmangazi University Faculty of Medicine, Department of Endocrinology, Eskişehir, Turkey 3Eskişehir Osmangazi University Faculty of Medicine, Department of Hematology, Eskişehir, Turkey 4Eskişehir Osmangazi University Faculty of Medicine, Department of Nephrology, Eskişehir, Turkey 5Eskişehir Osmangazi University Faculty of Medicine, Department of Biostatistics and Medical Informatics, Eskişehir, Turkey

Abstract

Öz

Objective: Coagulation and fibrinolysis defects were reported in primary hyperparathyroid patients. However, there are not enough data regarding platelet functions in this group of patients. Our aim was to evaluate the platelet functions in primary and secondary hyperparathyroid patients and to compare them with healthy subjects.

Amaç: Koagülasyon ve fibrinoliz bozuklukları primer hiperparatiroidili hastalarda rapor edilmekle beraber bu hasta grubunda trombosit işlevlerine ilişkin yeterli veri yoktur. Bu nedenle primer ve sekonder hiperparatiroidisi olan hastalarda ve sağlıklı kontrol grubunda trombosit fonksiyonlarını değerlendirmeyi ve gruplar arasında farkı karşılaştırmayı amaçladık.

Materials and Methods: In our study 25 subjects with primary hyperparathyroidism (PHPT), 25 subjects with secondary hyperparathyroidism (SHPT), and 25 healthy controls were included.

Platelet functions of the subjects were evaluated by using plateletrich plasma and platelet aggregation tests induced with epinephrine, adenosine diphosphate (ADP), collagen, and ristocetin. Serum P selectin levels, which indicate platelet activation level, were measured in all subjects. Bone mineral densitometry was performed for all patients.

Results: There was no significant difference between the groups with PHPT and SHPT and the control group regarding the platelet aggregation tests and serum P selectin levels. There was also no significant correlation between parathormone levels and aggregation parameters (ristocetin, epinephrine, collagen, and ADP: respectively p=0.446, 0.537, 0.346, and 0.302) and between P selectin (p=0.516) levels. When we separated the patients according to serum calcium levels, there was also no significant difference between aggregation parameters and serum P selectin levels between the patients with hypercalcemia and the patients with normocalcemia. We could not find any significant correlation between aggregation parameters, P selectin levels, and serum calcium levels in this group of patients.

Bone loss was greater in patients with PHPT.

Gereç ve Yöntemler: Çalışmamıza 25 primer hiperparatiroidisi (PHPT) olan hasta, 25 sekonder hiperparatiroidisi (SHPT) olan hasta ve 25 kontrol grubu dahil edildi. Trombosit fonksiyonları trombositten zengin plazma ve epinefrin, adenozin difosfat (ADP), kollajen ve ristosetinle trombosit agregasyon testleri yapılarak değerlendirildi.

Trombosit aktivasyon düzeyini gösteren serum P selektin düzeyleri tüm hastalarda ölçüldü. Kemik mineral dansitometresi tüm hastalarda değerlendirildi.

Bulgular: PHPT ve SHPT’li hastalar ve kontrol grubunun trombosit fonksiyon testleri ve serum P selektin düzeyleri arasında istatistiksel açıdan anlamlı bir fark saptanmadı. Parathormon düzeyi ile agregasyon parametreleri (ristosetin, epinefrin, kollajen, ve ADP: sırasıyla p=0,446, 0,537, 0,346 ve 0,302) ve P selektin (p=0,516) düzeyi arasında da anlamlı bir korelasyon saptanmadı. Hastalar kalsiyum düzeylerine göre hiperkalsemik ve normokalsemik olarak ayrıldıklarında da agregasyon parametreleri ve P selektin düzeyleri arasında anlamlı fark saptanmadı. Hasta gruplarımızda trombosit fonksiyonları, P selektin düzeyi, serum kalsiyum düzeyileri arasında istatistiksel açıdan anlamlı fark bulunmadı. Kemik kaybı PHPT’li olan grupta daha belirgindi.

Conclusion: There is no significant effect of PHPT or SHPT and serum calcium levels on platelet functions when evaluated by aggregation tests.

Sonuç: Agregasyon testleri ile değerlendirildiğinde PHPT veya SHPT ve serum kalsiyum düzeylerinin trombosit fonksiyonları üzerine belirgin etkisi yoktur.

Keywords: Hyperparathyroidism, Platelet function, P selectin, Calcium, Bone loss

Anahtar Sözcükler: Hiperparatiroidism, Trombosit fonksiyonları, P selektin, Kalsiyum, Kemik kaybı

Address for Correspondence/Yazışma Adresi: Göknur YORULMAZ, M.D., Eskişehir State Hospital, Clinic of Endocrinology, Eskişehir, Turkey Phone : +90 505 866 58 83 E-mail : goknuryorulmaz@hotmail.com

Received/Geliş tarihi: February 20, 2015 Accepted/Kabul tarihi: June 15, 2015

293

Yorulmaz G, et al: Hyperparathyroidism and Platelet Functions

Introduction Hemostasis is regulated by a balance between stimulators and inhibitors of platelet functions. The deterioration of the balance between inhibitors and stimulators of platelet functions results in thrombosis or bleeding. Platelets are involved in primary hemostasis, which includes the formation of a plug by the adhesion and activation of platelets in response to vascular damage or the loss of integrity of the vascular wall. Many physiological stimuli can activate platelets both in vivo and in vitro, such as collagen, proteolytic enzymes, and low-molecularweight compounds. Clinically platelet functions are evaluated by platelet aggregation and activation tests [1,2]. The use of platelet agonists such as collagen, adenosine diphosphate (ADP), epinephrine, and ristocetin triggers classical platelet response and a great deal of information can be obtained from platelet aggregation. P selectin is a membrane glycoprotein within platelets and endothelial cells that is mobilized to the plasma membrane following cell activation and it is used to evaluate platelet activation [3,4].

It is well known that primary hyperparathyroidism (PHPT) is associated with a high risk of cardiovascular disease and increased mortality and morbidity related to cardiovascular problems [5,6,7]. There are also studies that relate hyperparathyroidism with a potential tendency toward hypercoagulation [8,9].

There are some cases of thrombotic events seen in the course of hyperparathyroidism [10]. However, knowledge about the effects of hyperparathyroidism on platelet functions is unsatisfactory and conflicting. Whereas elevated parathormone (PTH) levels and hypercalcemia are significant features of PHPT, PTH elevation does not accompany hypercalcemia in secondary hyperparathyroidism (SHPT). There are studies investigating the effect of serum calcium levels on platelet aggregation, coagulation, and thromboelastography in healthy people [11].

However, it is not clear whether hyperparathyroidism disturbs platelet function and if so whether it is related to the high PTH levels per se or to the accompanying hypercalcemia.

In this study we aimed to evaluate platelet functions in patients with both PHPT and SHPT.

Materials and Methods Twenty-five subjects with PHPT, 25 subjects with SHPT, and 25 healthy age-matched control subjects were included in the study. The diagnosis of PHPT was based on clinical assessment and laboratory findings. Parathyroid adenomas were shown in all of the PHPT patients on both parathyroid ultrasound and 99m technetium scans of the parathyroids. Elevated PTH levels in the case of normal or low serum calcium level, vitamin D deficiency, and decreased urinary calcium excretion were regarded as signs of SHPT. Twenty-five healthy age- and sex-matched subjects with normal values of biochemical parameters were used as controls.

294

Turk J Hematol 2016;33:293-298

The purpose and the procedure of the tests were explained to the subjects and written informed consent was obtained from each participant. The experimental protocol was designed and performed according to the principles of the Declaration of Helsinki and it was approved by the Ethics Committee of the EskiĹ&#x;ehir Osmangazi University Medical Faculty.

Serum calcium, phosphorus, albumin, chloride, and creatinine levels were measured for each of the subjects. Serum intact PTH was measured from venous blood samples at a central laboratory using a solid-phase two-site chemiluminescent enzyme-labeled immunometric assay with a reference range of 15-65 pg/ mL. Serum calcium, phosphorus, and creatinine levels were measured colorimetrically. Serum albumin levels were measured by immunoturbidimetric assay and serum creatinine levels were measured by using an ion-selective electrode. Twenty-four hour urine collections were used in order to calculate urinary calcium excretion rates. Creatinine clearance (Ccr) levels were calculated according to the Cockroft-Gault formula. Patients with serum creatinine level above 1.2 mg/dL or Ccr level below 70 mL/min were not included in the study in order to exclude the confounding effects of renal failure on platelet functions.

Tubular reabsorption of phosphate was calculated as TRP=[1(up/pp)x(pcr/ucr)]x100.

Platelet functions of the subjects were evaluated by using platelet-rich plasma and platelet aggregation tests with epinephrine, ADP, collagen, and ristocetin. Serum P selectin levels, which indicate platelet activation level, were also measured in all subjects. Groups were matched with respect to age. Exclusion criteria included patients with known bleeding or other systemic disorders such as hepatic and endocrine diseases, acute infections, autoimmune disorders, or cancer, and a platelet count of less than 150x109/L or more than 450x109/L and a hemoglobin level of less than 10 g/dL. The patients did not receive agents that could affect platelet functions such as acetylsalicylic acid, ticlopidine, dipyridamole, or nonsteroidal antiinflammatory drugs in the 10 days prior to the platelet aggregation studies.

Sample Collection and Laboratory Methods Citrated blood was collected under light tourniquet through 19-gauge needles into 4.5-mL vacutainers (Becton Dickinson, USA) containing 3.2% trisodium citrate in a 9:1 blood/ anticoagulant ratio. The collection was performed early in the morning after overnight fasting. Samples for blood counts were drawn into Becton Dickinson anticoagulated tubes and complete counts were made with a Beckman Coulter Gen-S SM (USA) automated blood counting device. Coagulation tests were performed with an ACL TOP Coagulation Analyzer (Instrumentation Laboratory, USA). Prothrombin time (PT) was measured with a HemosIL RecombiPlasTin kit (Instrumentation

Yorulmaz G, et al: Hyperparathyroidism and Platelet Functions

Turk J Hematol 2016;33:293-298

Laboratory), activated partial thromboplastin time (aPTT) was measured with a HemosIL SynthASil kit (Instrumentation Laboratory), and fibrinogen was measured with a HemosIL Fibrinogen-C XL kit (Instrumentation Laboratory). The normal ranges for these tests in our laboratory are: aPTT, 24-36 s; PT, 8-13 s; and fibrinogen, 200-400 mg/dL.

normal distribution. Comparisons between 2 different groups were assessed by independent t-test and changes of variables within groups were assessed by paired samples t-test. Pearson correlation analysis was used to evaluate the relationships between variables. P<0.05 was accepted as indicating statistical significance. Results are given as mean ± SD.

Platelet aggregation studies were performed with a whole blood lumi-aggregometer (Model 540-Ca, Chrono-log Corporation, USA) using an optical method according to the manufacturer’s instructions. Whole-blood specimens were centrifuged for 10 min at 200xg to obtain platelet-rich plasma. Plateletpoor plasma was obtained from the remaining specimens by recentrifugation at 200xg for 15 min. A platelet count was performed on the platelet-rich plasma and was adjusted to 300x103/µL with platelet-poor plasma. Next, 450 µL of this platelet-rich plasma was transferred into cuvettes (Chronolog No: P/N 312), each containing a disposable siliconized bar.

After agonist addition, platelet aggregation was measured over 6 min and expressed as a percentage of the maximal amplitude in platelet-rich plasma. The agonists used and their final concentrations were: ADP (Chrono Par 384), 5 µM; collagen (Chrono Par 385), 2 µg/mL; ristocetin (Chrono Par 396), 1.25 mg/ mL; and epinephrine (Chrono Par 393), 5 µM. A commercially available ELISA method was used to determine serum P selectin levels (BBE6 catalog number, R&D Systems, USA). All analyses were performed in duplicate, and the mean value was used for statistical calculations. The levels of osteocalcin (2-22 ng/ mL) and deoxypyridinoline (2.3-5.4 nM DPD/mM creatine) were measured. The bone mineral densitometry of the patients was studied and T scores were evaluated.

Results

All statistical analysis was performed using SPSS 15 and SigmaStat 3.5. The distibution of variables was checked initially

by Shapiro-Wilk test. Parametric tests were applied to data having

Basic characteristics of the study population are shown in Table 1. PTH levels of the patients with primary and SHPT were significantly higher than those of the control group (p<0.01).

Serum calcium levels of the patients with PHPT were higher than those of both the patients with SHPT and the control group, as expected (p<0.001). There was no significant difference between hematological parameters such as hemoglobin, leukocyte and platelet counts, and PT levels among the groups. PTT and D-dimer levels were higher in patients with SHPT (Tables 1 and 2).

Patients with primary and SHPT are compared in Tables 1 and 3. PTH, serum calcium, urinary calcium excretion, and chloride/ phosphorus ratios were higher in patients with PHPT when compared with SHPT (p<0.001). Tubular phosphate levels were low in patients with PHPT (p<0.001). When bone mineral densitometries were evaluated, femur neck bone density was lower in patients with PHPT (p<0.05). Osteocalcin levels were higher in patients with PHPT (p<0.001).

Platelet functions of the patients with primary and SHPT and the control group are shown in Table 2. Platelet functions evaluated by platelet aggregation induced by epinephrine, ADP, collagen, and ristocetin were not statistically different from each other. There was also no significant difference of P selectin levels among the groups. There was no significant correlation between either PTH or P selectin levels and platelet aggregation parameters.

Table 1. Baseline characteristics and serum laboratory parameters of the study population.

Baseline Characteristics and Laboratory Parameters

PHPT, n=25

SHPT, n=25

Controls, n=25

p

Age

57.2±12.9

54.3±11.6

49.6±17.9

NS

13.11±1.4

13.02±1.55

13.2±1.68

NS

Hemoglobin (g/dL) Leukocytes

(x103/mL)

6072±1706

6996±1430

7004±1510

NS

Platelets (x103/µL)

237±36

239±60

243±60

NS

PTH (pg/mL)

178 (105-431)

131 (112-177)

31 (38-58)

<0.01 (1-3, 2-3)

Calcium (mg/dL)

11.18±0.71

9.4±0.56

9.59±0.4

<0.01 (1-2, 1-3)

Phosphorus (mg/dL)

2.2±0.52

3.1±0.58

3.3±0.69

<0.001 (1-2, 1-3)

Chloride/phosphorus

46.7 (40.7-53.2)

31.4 (34.5-37.8)

29.9 (32.2-33.4)

<0.001 (1-2, 1-3)

Urine calcium

360 (255-476)

62 (35-110)

-

<0.001 (1-2)

Tubular phosphate reabsorption (%)

70 (56-85)

85 (78-92)

-

<0.001 (1-2)

Ccr (mL/min)

96±21.3

96.8±37.28

-

NS (1-2)

PHPT: Primary hyperparathyroidism, SHPT: secondary hyperparathyroidism, Ccr: creatinine clearance, NS: nonsignificant.

295

Yorulmaz G, et al: Hyperparathyroidism and Platelet Functions

Patients with primary and SHPT were divided into two groups according to serum calcium levels (Table 4). The first group included the patients with serum calcium levels equal to or higher than 10.5 mg/dL and the second group included the patients with serum calcium levels lower than 10.5 mg/dL. There was no significant difference between the two groups in respect to platelet aggregation studies induced by epinephrine, ADP, collagen, and ristocetin. P selectin levels also did not differ significantly between the groups. We could not find any significant correlation between aggregation parameters, P selectin levels, and serum calcium levels in this group of patients. Statistical values did not differ when serum calcium corrected for serum albumin level was used.

Discussion Recent studies suggest that hyperparathyroidism has many systemic effects other than those on bone and mineral metabolism. PTH excess is strongly associated with prevalent and incident cardiovascular risk factors such as hypertension, diabetes, and cardiovascular diseases. There is also evidence connecting adverse cardiovascular outcomes, including death and incident coronary artery disease and myocardial infarction, to PTH excess [6,12,13,14]. Two biochemical features of hyperparathyroidism, namely elevated PTH levels and elevated serum calcium levels, may be implicated with those adverse outcomes. Although there are some studies suggesting that

Turk J Hematol 2016;33:293-298

severe PHPT could impair vascular compliance and PTH rather than serum calcium levels being the casual factor, it is still uncertain which of the parameters is the main offending mediator in those circumstances [15].

Abnormalities in coagulation and fibrinolysis pathways have also been detected in PHPT, mostly supported by small casecontrol studies, and the evidence is still conflicting [8,9].

There are some case reports of thrombotic events associated with PHPT in which high serum calcium is accused of being a causative factor. In those cases, renal vein thrombosis and dermal necrosis due to thrombosis were encountered during the course of hyperparathyroidism [10,16,17]. Thrombotic events were reported also in SHPT [17]. The high incidence of vascular thrombosis seen in patients with hyperparathyroidism may represent a potential for hypercoagulation and may explain the increased cardiovascular morbidity in those patients.

In an early study on this topic, bovine PTH was shown in vitro to inhibit platelet aggregation and activation strongly [18]. Later, however, another study showed that platelet functions were not affected by synthetically manufactured PTH. The irregular platelet functions in the previous study were attributed by the authors to the additives used during the preparation of the bovine PTH [19].

In symptomatic primary hyperparathyroid patients, significantly higher plasma levels of tissue plasminogen activator and lower

Table 2. Platelet aggregation studies and P selectin levels of the patients and the control group.

Platelet Aggregation Parameters and P Selectin Levels

PHPT, n=25

SHPT, n=25

Controls, n=25

p

Ristocetin (ohm)

93.0 (84.2-101.25)

96.0 (84.25-101.25)

98 (92-103)

NS

Epinephrine (ohm)

92.0 (83-106)

99 (92.8-105)

100 (90.5-103)

NS

Collagen (ohm)

96 (89.5-100.3)

98 (98-100.3)

99 (97-104)

NS

ADP (ohm)

95 (90.5-109)

99 (93.7-104.3)

104 (95-108)

NS

Serum P selectin (ng/mL)

31.4 (23.6-38.3)

31.2 (24.4-38.6)

29.2 (20.9-36.6)

NS

PT (s)

10.78 (11.2-11.5)

10.85 (11.3-11.9)

10.7 (11.0-11.2)

NS

aPTT (s)

28.6±3.14

28.99±2.85

27.0±2.24

<0.05 (2-3)

Fibrinogen (mg/dL)

319±52

297±93

290±59

NS

D-dimer (µg/dL)

99.75 (129-180.7)

128 (170-262.2)

65.6 (109-210.5)

<0.05 (2-3)

PT: Prothrombin time, PTT: partial thromboplastin time, PHPT: primary hyperparathyroidism, SHPT: secondary hyperparathyroidism, ADP: adenosine diphosphate, NS: nonsignificant.

Table 3. Comparison of bone mineral densitometry values, osteocalcin, and urine deoxypyridinoline levels of patients with primary hyperparathyroidism and secondary hyperparathyroidism.

BMD Areas, Osteocalcin, and Urine Deoxypyridinoline Levels

PHPT, n=25

SHPT, n=25

p

L1-4

-3.19 (-3.6 to 1.92)

-2.1 (-3.3 to 1.42)

NS

Femur neck

-2.2 (-3.23 to 1.49)

-1.8 (-2.5 to 0.94)

<0.05

Osteocalcin (2-22 ng/mL)

8.1 (5.4-10.3)

3.4 (1.57-5.09)

<0.01

Urine deoxypyridinoline (2.3-5.4 nM DPD/mM creatine)

7.0 (6.0-10.7)

8.7 (5.5-25.5)

NS

BMD: Bone mineral densitometry, NS: nonsignificant, PHPT: primary hyperparathyroidism, SHPT: secondary hyperparathyroidism, femur neck and L1-4 (lumbar), T score.

296

Yorulmaz G, et al: Hyperparathyroidism and Platelet Functions

Turk J Hematol 2016;33:293-298

Table 4. Platelet functions of the patients classified according to serum calcium levels.

Platelet Aggregation Parameters and P Selectin Serum Calcium ≥10.5 mg/dL, n=22 Levels

Serum Calcium <10.5 mg/dL, n=28

p

Platelet aggregation

-

-

-

Ristocetin (%)

88.90±23.90

91.85±17.31

NS

Epinephrine (%)

92.95±16.57

95.64±17.55

NS

Collagen (%)

97.72±13.02

89.75±23.82

NS

ADP (%)

103.04±19.92

96.96±10.84

NS

Serum P selectin (ng/m)

35.10±20.80

32.40±10.02

NS

ADP: Adenosine diphosphate, NS: nonsignificant.

platelet activator inhibitor-1 (PAI-1) and tissue factor pathway inhibitor F levels compared to controls matched for age, sex, and body mass index were reported. Elevated PAI-1 levels found in patients with PHPT were proposed to be the causative factor for the tendency to thromboembolic events by lowering fibrinolytic activity. Those findings were suggested to represent a potential hypercoagulable and hypofibrinolytic state [9]. Increased platelet count, higher activities of factor VII and IX, and increased levels of D-dimer were also found in PHPT patients compared to healthy controls [8]. In another study, a positive relationship was found between PTH and PAI-1 levels in patients with PHPT without manifest cardiovascular disease [20]. However, hemostatic and fibrinolytic disorders of hyperparathyroidism are very rarely studied fields of research in the literature and there are not enough data on this subject. Platelet functions induced by ristocetin, ADP, collagen, and epinephrine were not studied in hyperparathyroid patients before and there is no study to date evaluating P selectin levels in hyperparathyroid patients. Moreover, all the studies evaluating the fibrinolysis and coagulation cascades were performed in patients with PHPT and do not indicate whether the elevated PTH levels or the high calcium levels were responsible for the results.

In our study, we could not find any significant differences among groups regarding platelet activation and aggregation studies.

There was no significant correlation between PTH levels and aggregation parameters or serum P selectin levels. According to these results we concluded that primary and SHPT did not notably affect platelet functions. In this respect, this is the first study to show platelet aggregation and activation levels in both primary and SHPT. Contrary to the mentioned studies, D-dimer levels were higher in patients with SHPT, which make us think that high levels of PTH may cause a trend toward thrombosis independent of calcium levels. Another result of our study shows that lumbar and femoral bone loss was more pronounced in patients with PHPT. According to other studies bone mineral densitometry is decreased in hyperparathyroidism, and after parathyroidectomy bone mineral densitometry improves [21].

However, platelet functions could be affected by the levels of serum calcium of the patients independently of PTH levels.

Therefore, we also evaluated the patients by separating the patients according to their serum calcium levels and compared the platelet functions of the patients with high serum calcium levels (≥10.5 mg/dL) with the patients with normal serum calcium levels (<10.5 mg/dL). Hypercalcemia almost always accompanies PHPT, but patients with SHPT are usually normocalcemic. Calcium levels are known to play a key role in the regulation of platelet functions. In a previous study, the effects of extracellular calcium concentrations on platelet aggregation, coagulation, and thromboelastography were studied in vitro in blood samples collected from healthy subjects [11]. In that study it was shown that high calcium levels could inhibit platelet aggregation, coagulation factor activity, and blood coagulation; the level of calcium found to affect platelet functions was ≥15 mg/dL [11]. In our study, we could not show any significant difference regarding platelet aggregation studies and serum P selectin levels between the patients with high and normal serum calcium levels. We concluded that serum calcium levels did not significantly alter platelet functions. However, it is possible that our findings might be related to the fact that our patients’ average calcium levels were not as high as in the previous study. In our patient group the highest serum calcium level was 12.4 mg/dL, and when corrected according to serum albumin level, this reached 13.9 mg/dL at most. Moreover, in the previous study, in vitro calcium levels were used. In another study mean platelet volume was used to evaluate thrombocyte activation in patients with PHPT and platelet activation was found to be increased [22]. However, mean platelet volume is not a valuable measure for platelet activation.

In conclusion, in this study we showed that platelet aggregation did not change in either primary or SHPT. However, since we did not study platelet aggregation inhibition, we cannot say clearly with the existing data whether there is a tendency toward thrombosis or not in hyperparathyroidism.

Ethics Ethics Committee Approval: Eskişehir Osmangazi University Ethics Committee 29 May 2009 (approval number: 11); Informed Consent: It was taken.

297

Yorulmaz G, et al: Hyperparathyroidism and Platelet Functions

Authorship Contributions Medical Practices: Göknur Yorulmaz; Concept: Göknur Yorulmaz, Aysen Akalın; Design: Göknur Yorulmaz, Aysen Akalın, Olga Meltem Akay; Data Collection or Processing: Göknur Yorulmaz, Aysen Akalın, Olga Meltem Akay, Garip Şahin, Cengiz Bal; Analysis or Interpretation: Göknur Yorulmaz, Aysen Akalın, Olga Meltem Akay, Garip Şahin; Literature Search: Göknur Yorulmaz, Aysen Akalın, Olga Meltem Akay, Garip Şahin, Cengiz Bal; Writing: Göknur Yorulmaz, Aysen Akalın, Olga Meltem Akay, Garip Şahin, Cengiz Bal. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Shebuski RJ, Kilgore KS. Role of inflammatory mediators in thrombogenesis.

J Pharmacol Exp Ther 2002;300:729-735.

2. Hayward CP, Pai M, Liu Y, Moffat KA, Seecharan J, Webert KE, Cook RJ, Heddle NM. Diagnostic utility of light transmission platelet aggregometry: results from a prospective study of individuals referred for bleeding disorder assessments. J Thromb Haemost 2009;7:676-684.

3. Rand ML, Leung R, Packham MA. Platelet function assays. Transfus Apher Sci 2003;28:307-317.

Turk J Hematol 2016;33:293-298

9. Erem C, Kocak M, Nuhoglu I, Yilmaz M, Ucuncu O. Increased plasma activator inhibitor-1, decreased tissue factor pathway inhibitor, and unchanged thrombin-activatable fibrinolysis inhibitor levels in patients with primary hyperparathyroidism. Eur J Endocrinol 2009;160:863-868.

10. Franchello A, Camandona M, Gasparri G. Acute hyperparathyroidism and vascular thrombosis: an unrecognized association. J Endocrinol Invest 2010;33:683.

11. Li ZL, Chen XM, Yang LC, Deng XL, Fu SH, Cai LL, Zhou Y, Chen J, Bai J, Cong YL. Effects of extracellular calcium concentration on platelets aggregation, coagulation indices and thromboelastography. Zhonghua Yi Xue Za Zhi 2010;90:1547-1550.

12. Anderson JL, Vanwoerkum R, Horne BD, Bair TL, May HT, Lappe DL, Muhlestein JB. Parathyroid hormone, vitamin D, renal dysfunction, and cardiovascular disease: dependent or independent risk factors? Am Heart J 2011;162:331-339.

13. Han D, Trooskin S, Wang X. Prevalence of cardiovascular risk factors in male and female patients with primary hyperparathyroidism. J Endocrinol Invest 2012;35:548-552.

14. Kiernan TJ, O’Flynn AM, McDermott JH, Kearney P. Primary hyperparathyroidism and the cardiovascular system. Int J Cardiol 2006;113:E89-92.

15. Walker MD, Fleischer J, Rundek T, McMahon DJ, Homma S, Sacco R, Silverberg SJ. Carotid vascular abnormalities in primary hyperparathyroidism. J Clin Endocrinol Metab 2009;94:3849-3856.

16. Smallman LA. Renal vein thrombosis complicating hyperparathyroidism. Postgrad Med J 1982;58:441-442.

primary

17. Huertas VE, Maletz RM, Weller JM. Dermal necrosis due to thrombosis in severe secondary hyperparathyroidism. Arch Intern Med 1976;136:712-716.

4. Zucker MB, Nachmias VT. Platelet activation. Arteriosclerosis 1985;5:2-18.

18. Remuzzi G, Benigni A, Dodesini P, Schieppati A, Livio M, Poletti E, Mecca G, de Gaetano G. Parathyroid hormone inhibits human platelet function.

Lancet 1981;12:1321-1323.

5. Hedback G, Tisell LE, Bengtsson BA, Hedman I, Oden A. Premature death in patients operated on for PHPT. World J Surg 1990;14:829-835.

19. Leithner C, Kovarik J, Sinzinger H, Woloszcuk W. Parathyroid hormone does not inhibit platelet aggregation. Lancet 1984;18:367-368.

6. Hedback G, Oden A. Increased risk of death from primary hyperparathyroidism: an update. Eur J Clin Invest 1998;28:271-276.

20. Chertok-Shacham E, Ishay A, Lavi I, Luboshitzky R. Biomarkers of hypercoagulability and inflammation in primary hyperparathyroidism. Med Sci Monit 2008;14:628-632.

7. Stefenelli T, Mayr H, Berger-Klein J, Globits S, Wolosczcuk W, Niederle B. Primary hyperparathyroidism: incidence of cardiac abnormalities and partial reversibility after successful parathyroidectomy. Am J Med 1993;95:197-202.

8. Erem C, Kocak M, Hacihasanoglu A, Yilmaz M, Saglam F, Ersoz HO. Blood coagulation, fibrinolysis and lipid profile in patients with primary hyperparathyroidism: increased plasma factor VII and X activities and D-dimer levels. Exp Clin Endocrinol Diabetes 2008;116:619-624.

298

21. Sitges-Serra A, García L, Prieto R, Peña MJ, Nogués X, Sancho JJ. Effect of parathyroidectomy for primary hyperparathyroidism on bone mineral density in postmenopausal women. Br J Surg 2010;97:1013-1019.

22. Yilmaz H. Assessment of mean platelet volume (MPV) in primary hyperparathyroidism: effects of successful parathyroidectomy on MPV levels. Endocr Regul 2014;48:182-188.

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0271 Turk J Hematol 2016;33:299-303

Warfarin Dosing and Time Required to Reach Therapeutic International Normalized Ratio in Patients with Hypercoagulable Conditions Hiperkoagülabilite Durumları Olan Hastalarda Terapötik Uluslararası Düzeltme Oranına Ulaşmak için Gerekli Warfarin Doz ve Süresi Pushpinderdeep Kahlon1, Shahzaib Nabi1, Adeel Arshad2, Absia Jabbar3, Ali Haythem4 1Wayne State University, Henry Ford Health System, Clinic of Internal Medicine, Detroit, USA 2Weill Cornell University, Hamad Medical Corporation, Clinic of Internal Medicine, Doha, Qatar 3Nishtar Hospital, University of Health Science, Multan, Pakistan 4Wayne State University, Henry Ford Health System, Clinic of Hematology-Oncology, Detroit, USA

Abstract

Öz

Objective: The purpose of this study was to analyze the difference in duration of anticoagulation and dose of warfarin required to reach a therapeutic international normalized ratio [(INR) of 2 to 3] in patients with hypercoagulable conditions as compared to controls. To our knowledge, this study is the first in the literature to delineate such a difference.

Amaç: Bu çalışmanın amacı kontrollerle karşılaştırıldığında hiperkoagülabilite durumları olan hastalarda terapötik uluslararası düzeltme oranında (INR) 2 ile 3 aralığına ulaşmak için gerekli warfarin doz ve antikoagülan süresindeki farklılığı analiz etmektir. Bildiğimiz kadarıyla; bu farklılığı tarifleyen literatürdeki ilk çalışmadır.

Materials and Methods: A retrospective chart review was performed in a tertiary care hospital. The total study population was 622.

Cases (n=125) were patients with a diagnosis of a hypercoagulable syndrome who developed venous thromboembolism. Controls (n=497) were patients with a diagnosis of venous thromboembolism in the absence of a hypercoagulable syndrome and were matched for age, sex, and race.

Gereç ve Yöntemler: Retrospektif dosya taraması 3. basamak hastanede yapıldı. Toplam çalışmaya alınan hasta sayısı 622 idi. Venöz tromboembolizmi olan bu hastalardan 125’inin hiperkoagülabilite sendromu olup yaş, cins ve etnik kökeni aynı 497 kontrol hastasında hiperkoagülabilite sendromu yoktu.

Results: The total dose of warfarin required to reach therapeutic INR in cases was higher (50.7±17.6 mg) as compared to controls (41.2±17.7 mg). The total number of days required to reach therapeutic INR in cases was 8.9±3.5 days as compared to controls (6.8±2.9 days). Both of these differences were statistically significant (p<0.001).

Bulgular: Hastalarda terapötik INR’ye ulaşmak için gerekli total warfarin dozu (50,7±17,6 mg) kontrollerin dozu (41,2±17,7 mg) ile karşılaştırıldığında yüksekti. Terapötik INR’ye ulaşmak için gerekli total gün sayısı hastalarda 8,9±3,5 gün olup kontrollerde 6,8±2,9 gün idi. Her iki karşılaştırmada da istatistiksel farklılık anlamlı bulundu (p<0,001).

Conclusion: Patients with hypercoagulable conditions require approximately 10 mg of additional total warfarin dose and also require, on average, 2 extra days to reach therapeutic INR as compared to controls.

Sonuç: Hiperkoagülabilite durumları olan hastalarda terapötik INR’ye ulaşmak için kontrollere göre yaklaşık 10 mg ek total warfarin dozu ve ortalama 2 ek gün gereklidir.

Keywords: International normalized ratio, Warfarin, Hypercoagulable conditions, Venous thromboembolism

Anahtar Sözcükler: Uluslararası düzeltme oranı, Hiperkoagülabilite durumları, Venöz tromboembolizm

Address for Correspondence/Yazışma Adresi: Shahzaib NABİ, M.D., Wayne State University, Henry Ford Health System, Clinic of Internal Medicine, Detroit, USA Phone : +1-313-482-8768 E-mail : shahzaib.nabi@ucdenver.edu

Warfarin,

Received/Geliş tarihi: July 14, 2015 Accepted/Kabul tarihi: October 06, 2015

299

Kahlon P, et al: Therapeutic International Normalized Ratio in Hypercoagulable Conditions

Introduction It has been well documented that both acquired and hypercoagulable conditions play an important role in thrombophilia development. Studies suggest that important genetic factors that have notable significance include factor V Leiden mutation, prothrombin gene mutation, deficiency of protein S or protein C, antithrombin III deficiency, and hyperhomocysteinemia. Acquired hypercoagulability factors include non-modifiable factors, such as age and antiphospholipid antibodies, and modifiable factors, such as pregnancy, oral contraceptive and hormone replacement therapy, recent travel, and obesity, as well other factors such as malignancy, recent surgery, trauma, and prolonged immobility [1].

Once a patient develops venous thromboembolism (VTE), the main mode of treatment has been warfarin, with recent advent of newer medications such as rivaroxaban [2]. Warfarin still remains one of the most commonly used medications for VTE in the United States. Previously there have been a few studies that have investigated warfarin dosing in specific hypercoagulable conditions, such as antiphospholipid antibodies and highversus low-intensity warfarin efficacy in recurrent deep vein thrombosis (DVT) prevention [3]. However, it is not known if a difference exists in the total dose and time of warfarin therapy necessary to reach a therapeutic international normalized ratio (INR) in patients with hypercoagulable conditions. The goal of this study was to determine the difference in the time and dose of warfarin required to reach therapeutic INR (i.e. INR of 2 to 3) in patients with hypercoagulable conditions as compared to controls.

Materials and Methods The study was approved by our institutional review board. A retrospective chart review was performed for patients seen in our tertiary care facility from January 2002 to December 2012. The inclusion criteria for cases were patients with hypercoagulable conditions, which included patients with factor V Leiden mutation, prothrombin gene mutation, protein S or protein C deficiency, antithrombin III deficiency, dysfibrinogenemia, and antiphospholipid antibodies who developed unprovoked VTE (DVT, pulmonary embolism, or both). The diagnostic tests used were venous duplex for DVT and computed tomography angiogram or ventilation/perfusion lung scan for pulmonary embolism. Controls were age-, sex-, and race-matched patients who developed VTE but did not have a hypercoagulable syndrome. Confounding factors were assessed in both cases and controls and included end-stage renal disease, malignancies, recent surgery (within 1 month of development of VTE), and oral contraceptive use. Therapeutic INR was defined as an INR of 2-3 on 2 consecutive blood draws separated by a 24-h duration.

All subjects received an initial 5-mg loading dose of warfarin 300

Turk J Hematol 2016;33:299-303

and all of them received heparin at the time of diagnosis of VTE (bridging therapy). The total dose of warfarin required to reach a therapeutic INR and the number of days required to reach a therapeutic INR were analyzed.

Statistical analysis with a primary aim of comparing cases to controls was performed. Data were described using standard descriptive statistics, i.e. counts, percentages, means, and standard deviations. Crude (unadjusted) odds ratios were obtained from univariate logistic regression models. All variables with a univariate p-value of <0.2 were placed in a multivariable logistic regression and stepwise selection with stay criteria of p≤0.05 were used to arrive at a final model. Statistical significance was set at p<0.05 and all analyses were performed using SAS 9.4 (SAS Institute Inc., Cary, NC, USA).

Results A total of 622 patients were analyzed in this study. Of these, 125 were cases and 497 were controls. The mean age at the time of diagnosis of VTE in both cases and controls was 53 years. In all, 58% of the patients were female. The male to female ratios for both the cases and controls were roughly the same. The most common race was Caucasian (59%), followed by African American (32%); other races constituted 9% of the total study population. Among the patient population, 39% developed a DVT, 42% developed a pulmonary embolism, and 18% developed both a DVT and a pulmonary embolism.

The total number of days required to reach therapeutic INR was 8.9±3.5 days in cases, whereas in controls it was 6.8±2.9 days.

The difference was found to be statistically significant (p<0.001).

The total dose of warfarin required to reach therapeutic INR was 50.7±17.6 mg in cases as compared to 41.2±17.7 mg in controls. The difference remained statistically significant after multivariate regression analysis (p<0.001).

A multivariable model was built starting with all variables with a univariate p-value of <0.2. Stepwise selection was then used to arrive at the final model given in Table 1. We found that every 1-day increase in the number of days to therapeutic INR was associated with 19% increased odds of being a case, and every 1-unit increase in warfarin dose to therapeutic INR was associated with 1% increased odds of being a case.

Discussion For the last 60 years, warfarin has been the mainstay of management of thromboembolism in a variety of both hereditary and acquired conditions [4]. Even with its narrow therapeutic index, meticulous monitoring, dire adverse effects, and interactions with an array of foods, drugs, and herbs, warfarin is still the most widely used oral anticoagulant in North America with over 25 million prescriptions in the United States in 2010 [4,5].

Kahlon P, et al: Therapeutic International Normalized Ratio in Hypercoagulable Conditions

Turk J Hematol 2016;33:299-303

Warfarin acts by interfering with the enzyme vitamin K epoxide reductase, which modulates the gamma carboxylation of procoagulant factors II, VII, IX, and X and anticoagulant proteins C, S, and Z [6]. Because of the latter action, warfarin has the potential of exerting a transient procoagulant effect early in therapy. To counter that, heparin ‘bridging’ is recommended for a minimum of 5 days and until the INR is 2.0 or above for at least 24 h [7]. As the antithrombotic effect of warfarin necessitates the inhibition of factor II, which has a very long half-life (60-72 h) as compared to other factors (6-24 h), it takes approximately 6 days for warfarin to exert its full efficacy even though the earliest changes in INR can be seen after 24 to 36 h [8,9,10,11].

The average number of days to achieve therapeutic INR after starting warfarin is reported to be 5-6 days [12].

Selection of an appropriate dose for warfarin initiation is challenging and controversial because of interpersonal variability in its pharmacokinetic and pharmacodynamic parameters. Kovacs et al. found that patients who were initiated

with 10 mg of warfarin achieved therapeutic INR 1.4 days earlier than those who received 5 mg [13]. One study concluded that initiation with 5 mg of warfarin was associated with 5.6 days of bridging with low-molecular-weight heparin [14]. The American College of Chest Physicians recommends initiation with 10 mg in patients healthy enough to be treated as outpatients, with dose modifications done as per the INR after 2 days [7]. From a practical point of view, adjusting the warfarin dose to achieve and maintain therapeutic INR is a challenging task that we face regularly during our day-to-day clinical encounters. A myriad of factors lead to this commonly observed interpatient variation in the warfarin dose requirement and number of days required to achieve the therapeutic INR. Our study compared these 2 variables in patients with and without hypercoagulable conditions. We found that patients with hypercoagulable conditions on average require higher doses and more days to achieve the target INR as compared to those without any hypercoagulable conditions. To our knowledge, this study is one of the first in the literature to delineate such a difference.

Table 1. Patient characteristics along with univariate and multivariate analysis.

Variable

Response

Cases (n=125)

Controls (n=497)

Univariate Analysis OR (95% CI)

p-value

Multivariate Analysis OR (95% CI)

p-value

Age

Mean ± SD

60.4±15.0

60.5±16.0

1.00 (0.98, 1.01)

0.939

Sex

Male Female

55 (44%) 70 (56%)

207 (42%) 290 (58%)

1.10 (0.74, 1.64)

0.634

Race

Caucasian African American Other1

72 (58%) 38 (30%) 15 (12%)

293 (59%) 160 (32%) 44 (9%)

1.04 (0.67, 1.60) 1.44 (0.72, 2.85)

0.556

VTE

DVT PE Both

44 (35%) 53 (42%) 28 (22%)

201 (40%) 211 (42%) 85 (17%)

0.66 (0.39, 1.14) 0.76 (0.45, 1.29)

0.326

Age at time of VTE

Mean ± SD

53.0±14.9

53.5±15.0

0.99 (0.98, 1.01)

0.747

Cancer

No Yes

122 (98%) 3 (2%)

450 (91%) 47 (9%)

0.24 (0.07, 0.77)

0.009

0.26 (0.08, 0.87)

0.029

End-stage renal No disease Yes

122 (98%) 3 (2%)

489 (98%) 8 (2%)

1.50 (0.39, 5.75)

0.549

Surgery

No Yes

118 (94%) 7 (6%)

371 (75%) 126 (25%)

0.18 (0.08, 0.38)

<0.001

0.13 (0.06, 0.31)

<0.001

Antibiotics

No Yes

102 (82%) 23 (18%)

407 (82%) 90 (18%)

1.02 (0.61, 1.69)

0.940

Oral contraceptive pills

No Yes

122 (98%) 3 (2%)

478 (96%) 19 (4%)

0.62 (0.18, 2.12)

0.441

Total days to Mean ± SD therapeutic INR

8.9±3.5 (5.4 to 12.4)

6.8±2.9 (3.9 to 9.7)

1.22 (1.15, 1.29)

<0.001

1.19 (1.10, 1.28)

<0.001

Total dose to Mean ± SD therapeutic INR

50.7±17.6 (33.1 to 68.3)

41.2±17.7 (23.5 to 58.9)

1.03 (1.02, 1.04)

<0.001

1.01 (1.00, 1.03)

0.034

1All

other races except Caucasian and African American, SD: Standard deviation, VTE: venous thromboembolism, INR: international normalized ratio, CI: confidence interval, OR: odds ratio, DVT: deep vein thrombosis.

301

Kahlon P, et al: Therapeutic International Normalized Ratio in Hypercoagulable Conditions

As described earlier, other factors might also affect the variables under study, which could have been potential confounders in our study. The elderly and females require a smaller weekly dose of warfarin than their counterparts. Even though there are no convincing data, it is generally preferred that the elderly be started on a low-dose warfarin regimen because of the exaggeration of anticoagulation response in this age group [15].

One of the strongest and statistically significant patient-specific factors that can influence the warfarin dose requirement is the concomitant use of drugs that affect cytochrome P450 (17.2 mg additional dosage of warfarin per week) [16]. From antibiotics to anticonvulsants, ginger to ginseng, and spinach to spices, a tiring list of drugs, herbs, and foods is reported to interact with warfarin by multiple mechanisms, which can involve its absorption, bioavailability, metabolism, and excretion. Recent surgery was also assessed as a variable in this study. It should be noted that surgeries are generally considered to be transiently hypercoagulable states. Surgeries involving lower extremities (such as hip/knee replacement) carry the highest risk of VTE and should be managed carefully in patients with hypercoagulable states.

Even though not recommended for general testing, genetic mutations can lead to variations in the dosage requirement of warfarin among different patients, which ultimately affects the number of days required to achieve the therapeutic INR. Polymorphism in the VKORC1 gene, which codes for the target enzyme for warfarin, results in 2 haplotypes: A, which makes the patient sensitive to smaller doses, and B, which necessitates administration of higher doses to achieve and maintain the same range of INR. The Asp36Tyr missense mutation in VKORC1, found in 15% of the Ethiopian population in one study, was strongly associated with a warfarin requirement of >70 mg/week. On the other hand, CYP2C9 (and less commonly CYP1A1, CYPCA1, and CYP3A4), which metabolizes the more potent enantiomer of the warfarin molecule, has been found to have 2 relatively common variant forms with reduced activity (CYP2CP*2 and CYP2C9*3).

Patients with these variants have less rapid clearance of warfarin, thus requiring lower dosage administrations [17]. In one study, VKORC1 was significantly associated with the time required to achieve the first therapeutic INR while CYP2C9 predicted the time to reach an INR above 4, which predisposes the patient to hemorrhagic complications [18,19].

Gene polymorphisms are found to be more common in African Americans than Asians and Caucasians, which affects the number of days and the dose needed to achieve the first target INR. Other patient-specific factors that can affect the variables under study include body mass index/body surface area (especially height), poor compliance, comorbid conditions, and true warfarin resistance, which is a quite rare occurrence (0.01%) [19].

302

Turk J Hematol 2016;33:299-303

The major limitation of this study is that it was a single-center, retrospective study and the results might not be applicable to the general population. Moreover, our ‘cases’ group was relatively small, likely secondary to the rarity of the above-mentioned hypercoagulable conditions. However, to compensate for this relatively small sample size, we used a large ‘control’ group to increase the power of the study. Every effort was made during data collection to avoid bias as much as possible.

Conclusion In summary, this study lays the foundation of a novel idea of comparing warfarin dosage and the time required to achieve therapeutic INR in patients with and without known hypercoagulability conditions. The likely mechanism of the observed difference is inherent thrombogenic potential in hypercoagulable states with more natural resistance towards anticoagulation. With a few confounders playing a role, this proposition needs further consolidation with large-scale trials that might help us in predicting the initial dose to start with in patients with and without a procoagulant condition. The observed effect can, in another way, be studied retrospectively to understand the difference in the pathophysiology of the thromboembolism in these 2 populations, which may explain the etiological aspects of the results noticed.

Acknowledgment We would like to acknowledge the great efforts of our exceptionally hard-working librarian, Stephanie Stebens, who helped us in the final editing of this manuscript. Her suggestions played a huge role in finalizing this manuscript.

Ethics Ethics Committee Approval: The study was approved by the IRB/ Ethics Committee; Informed Consent: Was not needed as this was a retrospective chart review.

Authorship Contributions Concept: Pushpinderdeep Kahlon, Shahzaib Nabi, Adeel Arshad, Absia Jabbar, Ali Haythem; Design: Pushpinderdeep Kahlon, Shahzaib Nabi, Adeel Arshad, Absia Jabbar, Ali Haythem; Data Collection or Processing: Shahzaib Nabi and Pushpinderdeep Kahlon; Analysis or Interpretation: Pushpinderdeep Kahlon, Shahzaib Nabi, Adeel Arshad, Absia Jabbar, Ali Haythem; Literature Search: Pushpinderdeep Kahlon, Shahzaib Nabi, Adeel Arshad, Absia Jabbar, Ali Haythem; Writing: Pushpinderdeep Kahlon, Shahzaib Nabi, Adeel Arshad, Absia Jabbar, Ali Haythem.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2016;33:299-303

Kahlon P, et al: Therapeutic International Normalized Ratio in Hypercoagulable Conditions

References 1. Varga EA, Kujovich JL. Management of inherited thrombophilia: guide for genetics professionals. Clin Genet 2012;81:7-17.

2. EINSTEIN Investigators, Bauersachs R, Berkowitz SD, Brenner B, Buller HR, Decousus H, Gallus AS, Lensing AW, Misselwitz F, Prins MH, Raskob GE, Segers A, Verhamme P, Wells P, Agnelli G, Bounameaux H, Cohen A, Davidson BL, Piovella F, Schellong S. Oral rivaroxaban for symptomatic venous thromboembolism. N Engl J Med 2010;363:2499-2510.

3. Crowther MA, Ginsberg JS, Julian J, Denburg J, Hirsh J, Douketis J, Laskin C, Fortin P, Anderson D, Kearon C, Clarke A, Geerts W, Forgie M, Green D, Costantini L, Yacura W, Wilson S, Gent M, Kovacs MJ. A comparison of two intensities of warfarin for the prevention of recurrent thrombosis in patients with the antiphospholipid antibody syndrome. N Engl J Med 2003;349:1133-1138.

4. Johnson JA. Warfarin pharmacogenetics: a rising tide for its clinical value.

Circulation 2012;125:1964-1966.

5. Holbrook AM, Pereira JA, Labiris R, McDonald H, Douketis JD, Crowther M, Wells PS. Systematic overview of warfarin and its drug and food interactions. Arch Intern Med 2005;165:1095-1106.

6. Whitlon DS, Sadowski JA, Suttie JW. Mechanism of coumarin action: significance of vitamin K epoxide reductase inhibition. Biochemistry 1978;17:1371-1377.

7. Guyatt GH, Akl EA, Crowther M, Gutterman DD, SchuĂźnemann HJ; American college of chest physicians antithrombotic therapy and prevention of thrombosis panel. executive summary: antithrombotic therapy and prevention of thrombosis, 9th ed: American College of Chest Physicians Evidence-Based Clinical Practice Guidelines. Chest 2012;141(Suppl 2):7-47.

to inactivation by antithrombin III-independent inhibitors. J Clin Invest 1990;86:385-391.

10. Wessler S, Gitel SN. Warfarin. From bedside to bench. N Engl J Med 1984;311:645-652.

11. Kuruvilla M, Gurk-Turner C. A review of warfarin dosing and monitoring.

Proc (Bayl Univ Med Cent) 2001;14:305-306.

12. Harrison L, Johnston M, Massicotte MP, Crowther M, Moffat K, Hirsh J. Comparison of 5-mg and 10-mg loading doses in initiation of warfarin therapy. Ann Intern Med 1997;126:133-136.

13. Kovacs MJ, Rodger M, Anderson DR, Morrow B, Kells G, Kovacs J, Boyle E, Wells PS. Comparison of 10-mg and 5-mg warfarin initiation nomograms together with low-molecular-weight heparin for outpatient treatment of acute venous thromboembolism. A randomized, double-blind, controlled trial. Ann Intern Med 2003;138:714-719.

14. Deerhake JP, Merz JC, Cooper JV, Eagle KA, Fay WP. The duration of anticoagulation bridging therapy in clinical practice may significantly exceed that observed in clinical trials. J Thromb Thrombolysis 2007;23:107113.

15. Gurwitz JH, Avorn J, Ross-Degnan D, Choodnovskiy I, Ansell J. Aging and the anticoagulant response to warfarin therapy. Ann Intern Med 1992;116:901904.

16. Whitley HP, Fermo JD, Chumney EC, Brzezinski WA. Effect of patientspecific factors on weekly warfarin dose. Ther Clin Risk Manag 2007;3:499504.

17. Higashi MK, Veenstra DL, Kondo LM, Wittkowsky AK, Srinouanprachanh SL, Farin FM, Rettie AE. Association between CYP2C9 genetic variants and anticoagulation-related outcomes during warfarin therapy. JAMA 2002;287:1690-1698.

8. Zivelin A, Rao LV, Rapaport SI. Mechanism of the anticoagulant effect of warfarin as evaluated in rabbits by selective depression of individual procoagulant vitamin K-dependent clotting factors. J Clin Invest 1993;92:2131-2140.

18. Li T, Lange LA, Li X, Susswein L, Bryant B, Malone R, Lange EM, Huang TY, Stafford DW, Evans JP. Polymorphisms in the VKORC1 gene are strongly associated with warfarin dosage requirements in patients receiving anticoagulation. J Med Genet 2006;43:740-744.

9. Weitz JI, Hudoba M, Massel D, Maraganore J, Hirsh J. Clot-bound thrombin is protected from inhibition by heparin-antithrombin III but is susceptible

19. Sinxadi P, Blockman M. Warfarin resistance. Cardiovasc J Afr 2008;19:215217.

303

RESEARCH ARTICLE DOI: 10.4274/tjh.2014.0385 Turk J Hematol 2016;33:304-310

Early Changes of Mannose-Binding Lectin, H-Ficolin, and Procalcitonin in Patients with Febrile Neutropenia: A Prospective Observational Study Febril Nötropeni Olgularında Mannoz Bağlayan Lektin, H-Fikolin ve Prokalsitonin Düzeylerinde Erken Dönem Değişimleri Sibel Işlak Mutcalı1, Neşe Saltoğlu1, İlker İnanç Balkan1, Reşat Özaras1, Mücahit Yemişen1, Bilgül Mete1, Fehmi Tabak1, Ali Mert2, Recep Öztürk1, Şeniz Öngören3, Zafer Başlar3, Yıldız Aydın3, Burhan Ferhanoğlu4, Teoman Soysal3 1İstanbul University Cerrahpaşa Faculty of Medicine, Department of Infectious Diseases and Clinical Microbiology, İstanbul, Turkey 2Medipol University Faculty of Medicine, Department of Internal Medicine, İstanbul, Turkey 3İstanbul University Cerrahpaşa Faculty of Medicine, Department of Hematology, İstanbul, Turkey 4Koç University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey

Abstract

Öz

Objective: The significance of mannose-binding lectin (MBL) and H-ficolin deficiency in febrile neutropenic (FN) patients and the correlation of these markers along with consecutive C-reactive protein (CRP) and procalcitonin (PCT) levels during the infectious process are investigated.

Materials and Methods: Patients with any hematological malignancies who were defined to have “microbiologically confirmed infection”, “clinically documented infection”, or “fever of unknown origin” were included in this single-center prospective observational study. Serum levels of CRP, PCT, MBL, and H-ficolin were determined on 3 separate occasions: at baseline (between hospital admission and chemotherapy), at the onset of fever, and at the 72nd hour of fever.

Results: Forty-six patients (54% male, mean age 41.7 years) with 61 separate episodes of FN were evaluated. Eleven patients (23.9%) had “microbiologically confirmed infection”, 17 (37%) had “clinically documented infection”, and 18 (39.1%) had “fever of unknown origin”.

Fourteen (30.4%) patients had low (<500 ng/mL) initial MBL levels and 7 (15.21%) had low (<12,000 ng/mL) H-ficolin levels. Baseline MBL and H-ficolin levels did not significantly change on the first and third days of fever (p=0.076). Gram-negative bacteremia more frequently occurred in those with low initial MBL levels (p=0.006). PCT levels were significantly higher in those with microbiologically documented infections. Mean and median PCT levels were significantly higher in cases with bacteremia. There was no significant difference between hemoculture-positive and-negative patients in terms of CRP levels.

Conclusion: Monitoring serum H-ficolin levels was shown to be of no benefit in terms of predicting severe infection. Low baseline MBL levels were correlated with high risk of gram-negative bacteremia; however, no significant correlation was shown in the follow-up. Close monitoring of PCT levels is warranted to provide more accurate and specific data while monitoring cases of bacteremia.

Keywords: Febrile neutropenia, Infection, Mannose-binding lectin, H-ficolin, Procalcitonin, C-reactive protein

Amaç: Febril nötropenik (FEN) hastalarda mannoz-bağlayıcı lektin Öz ve bu belirteçlerin enfeksiyon (MBL) ve H-fikolin eksikliğinin önemi atağı sırasında ardışık C-reaktif protein (CRP) ve prokalsitonin (PCT) ölçümleri ile korelasyonu araştırılmıştır.

Gereç ve Yöntemler: Bu tek merkezli prospektif gözlemsel çalışmaya, hematolojik malignite nedeniyle izlenen ve “mikrobiyolojik olarak doğrulanmış enfeksiyon”, “klinik olarak dökümante edilmiş enfeksiyon” veya “nedeni bilinmeyen ateş” tanıları konulan hastalar dahil edilmiştir.

Serum CRP, PCT, MBL ve H-fikolin düzeyleri; başlangıçta (hastaneye başvuru ile kemoterapi başlangıcı arasında), ateş atağının başında ve 72. saatinde olmak üzere üç ayrı zamanda ölçülmüştür.

Bulgular: Kırk altı (%54 erkek, ortalama yaş 41,7) hastada gelişen 61 ayrı FEN atağı değerlendirildi. Hastaların 11’inde (%23,9) “mikrobiyolojik doğrulanmış enfeksiyon”, 17’sinde (%37) “klinik dökümante enfeksiyon”, 18’inde (%39,1) ise nedeni bilinmeyen ateş mevcut idi. Başlangıç MBL düzeyi (<500 ng/mL) yedi hastada, H-fikolin düzeyi ise (<12,000 ng/mL) 14 hastada düşük bulundu. Bazal MBL ve H-fikolin düzeylerinin ateşin birinci ve üçüncü gününde anlamlı olarak değişmediği belirlendi (p=0,076). Başlangıç MBL düzeyi düşük olan hastalarda gram-negatif bakteremilerin daha sık ortaya çıktığı saptandı (p=0,006). PCT düzeyleri “mikrobiyolojik olarak doğrulanmış” enfeksiyonu bulunanlarda anlamlı olarak daha yüksekti. Medyan PCT düzeyleri tüm FEN epizodlarında anlamlı olarak yükselmiş bulundu.

Sonuç: Ciddi bakteremilerin ön görülmesi açısından serum H-fikolin düzeylerinin izlenmesinin yararı olmadığı gösterildi. Düşük bazal MBL düzeyleri ile yüksek gram-negatif bakteremi riski arasında ilişkili olduğu belirlenmekle birlikte izlemde anlamlı korelasyon gösterilemedi. Bakteremi olgularının izleminde daha hızlı ve özgül veriler elde edebilmek için PCT düzeylerinin yakın izleminin gerekli olduğu sonucuna varıldı.

Anahtar Sözcükler: Febril nötropeni, Enfeksiyon, Mannoz-bağlayıcı lektin, H-fikolin, Prokalsitonin, C-reaktif protein

Address for Correspondence/Yazışma Adresi: İlker İnanç BALKAN, M.D., İstanbul University Cerrahpaşa Faculty of Medicine, Department of Infectious Diseases and Clinical Microbiology, İstanbul, Turkey Phone : +90 212 414 30 00 E-mail : ilkerinancbalkan@hotmail.com

304

Received/Geliş tarihi: September 26, 2014 Accepted/Kabul tarihi: April 13, 2015

Turk J Hematol 2016;33:304-310

Işlak Mutcalı S, et al: Early Changes in MBL, H-Ficolin, Procalcitonin in Febrile Neutropenia

Introduction Blood stream infections (BSIs) due to invasive bacterial and fungal pathogens are major causes of infection related mortality.

Gram-negative and gram-positive bacteremia account for 50%-60% of BSIs during febrile neutropenia (FN) episodes [1,2,3]. Nonspecific signs and symptoms and conventional microbiologic methods pose some problems in the diagnosis of severe infections in neutropenic patients. Hemoculture is still the standard diagnostic method, but the positivity rate is only about 20-50% in FN episodes [4] and microbial identification takes 2-6 days [1]. Definition of early diagnostic markers that will guide antimicrobial treatment is critical [5].

In current practice, antibacterial therapy is initiated immediately after blood cultures are obtained and before any other diagnostic procedures, in accordance with guidelines.

Leukocytes and differential blood count, hemoglobin, platelets, serum glutamate oxaloacetate transaminase, serum glutamate pyruvate transaminase, lactate dehydrogenase, alkaline phosphatase, gamma glutamyltransferase, bilirubin, uric acid, creatinine, sodium, potassium, partial thromboplastin time, and C-reactive protein (CRP) are measured twice a week before and during therapy in the routine practice of our hematology section. Procalcitonin (PCT) is measured weekly throughout the neutropenic episode.

Mannose-binding lectin (MBL) is a plasma collectin (C-type lectin with a collagen-like domain) thought to have an important role in innate immunity [6]. Its lectin domain recognizes sugar patterns typical of microbial surfaces, while its collagen-like region facilitates microbial uptake by phagocytic cells. MBL can activate the complement by a mechanism similar to the classical pathway, but using MBL-associated serine proteases instead of C1r and C1s. The complement system provides immediate defense against infection and has proinflammatory effects.

MBL deficiency is defined as a serum level of <500 ng/mL. It is a laboratory finding that does not necessarily equate to a clinical disorder. MBL deficiency is associated with a large and heterogeneous group of disease processes. However, subnormal levels are also found in healthy people. To date, there is no consensus on the clinical relevance of MBL deficiency or its treatment [7].

According to the results of the largest adult cohort, MBL deficiency is not correlated with more frequent or more prolonged febrile episodes during myelosuppressive chemotherapy in adults with hematological cancer, but severe infections are more frequent in MBL-deficient patients and first severe infection develops earlier in this group compared with nondeficient patients [8].

In this prospective study we aimed to confirm or refute these findings and to extend the investigation to one of the plasma ficolins, the Hakata antigen (H-ficolin). Ficolins share with

collectins an overall quaternary structure resembling C1q and bind to bacteria and activate the complement using the lectin pathway of complement activation [9]. H-ficolin might therefore be a potentially useful marker of innate immunity. In this respect, the significance of MBL and H-ficolin deficiency in FN patients and the role of consecutive CRP and PCT measurements in the etiological differentiation of fever and in establishing a follow-up protocol are investigated.

Materials and Methods The study was planned and conducted with a prospective methodology. All patients were consecutively evaluated and included in the relevant predefined case groups. Patients hospitalized in the hematology and hematopoietic stem cell transplantation units of the Cerrahpaşa Medical School Training Hospital with any hematological malignancies and who developed at least one episode of FN between February 2011 and July 2012 were included in the study. Patients were divided into 3 diagnostic groups as “microbiologically confirmed infection”, “clinically documented infection”, and “fever of unknown origin” according to German guidelines [10]. The patients were reevaluated at the end of the neutropenic episode and assigned to the relevant groups by the principle investigator, who was blinded to the laboratory results at that time.

Study Protocol Three separate blood samples were obtained from the patients on 3 separate occasions: at baseline (between hospital admission and chemotherapy), at the onset of fever, and 72 h after the first febrile spike. Empirical antipseudomonal antimicrobial treatment (piperacillin tazobactam or cefoperazone/sulbactam for the first episode and carbapenem for recurrent episodes or in case of increased risk of extended-spectrum beta-lactamaseproducing gram-negative bacteria) was initiated in accordance with the FN guidelines [10] following hemoculture. Some patients with prolonged neutropenia developed more than one febrile episode and data were recorded separately for each.

Data Collection All required data were recorded on case follow-up forms from the first day of hospitalization. Demographic and clinical features including age, sex, comorbidities, vital signs, status of clinical sepsis, radiological data, microbiological data, antimicrobial treatment, and response data were recorded.

Clinical and laboratory improvement within 96 h of treatment was defined as response to the antimicrobials.

Inclusion Criteria Patients with hematologic malignancies who developed an episode of FN were included. Neutropenia was defined as an absolute neutrophil count of ≤500/mm3 or 500-1000/mm3 but 305

Işlak Mutcalı S, et al: Early Changes in MBL, H-Ficolin, Procalcitonin in Febrile Neutropenia

Turk J Hematol 2016;33:304-310

expected to fall below ≤500/mm3 within 24-48 h. Fever was defined as a single measurement of tympanic fever of ≥38 °C or at least 2 consecutive measurements of tympanic fever of ≥37.8 °C measured with 4 h intervals within 24 h of monitoring.

years. Distribution of diagnoses and number of FN episodes per diagnosis and patient are shown in Table 1.

Exclusion Criteria

1. Microbiologically + clinically documented infection: 11 cases (23.9%),

Patients lacking any of the 3 blood samples during follow-up were excluded, along with those under 18 years or pregnant.

Antimicrobial Treatment There was no off-protocol intervention regarding antimicrobial use in FN episodes during the study period.

Laboratory Analysis Blood cultures were incubated for 7 days in an automated hemoculture system (BacT ALERT 3D, bioMérieux, France).

Conventional biochemical methods and automated systems (API automation pour identification, bioMérieux) were used for identification.

Antimicrobial susceptibility tests were performed using the disk diffusion method in accordance with the relevant Clinical and Laboratory Standards Institute recommendations [11].

Blood samples were stored at -80 °C in accordance with the manufacturer’s recommendations (B.R.A.H.M.S., Hycult) and were tested after being thawed and centrifuged for 1 min.

MBL, H-ficolin, and PCT levels were measured using Hycult MBL, enzyme-linked immunosorbent assay, and B.R.A.H.M.S. VIDAS methods, respectively.

Statistical Analysis SPSS 16.0 was used for statistical analyses. Categorical variables were analyzed with chi-square tests and continuous variables were analyzed with Student t or Mann-Whitney U tests. The Spearman correlation test was used to evaluate correlation between continuous variables. A p-value of <0.05 was accepted as statistically significant.

Ethical Approval This single-center, prospective, observational study was approved by the Institutional Review Board of Cerrahpaşa Medical School.

All collected data were kept confidential.

Results A total of 82 patients were registered. Sixty-one FN episodes in 46 patients were included in the study after excluding 36 patients lacking any of the 3 serum samples or not fulfilling the inclusion criteria. Twenty-five (54%) of the patients were male and the mean age was 41.7, ranging between 19 and 81 306

The clinical manifestations of the cases with FN episodes are defined below:

2. Only clinically documented infection: 17 cases (37%), 3. Fever of unknown origin: 18 cases (39.1%).

Eight (8/11) of the patients with microbiologically + clinically documented infection had primary bacteremia, 2 had bacteremia due to urinary tract infection, and 1 had urinary infection. Six of the pathogens isolated from blood cultures were gram-positive cocci and 4 were gram-negative bacilli. The most common gram-positive bacteria were methicillin-resistant coagulase negative staphylococci and the most common gramnegative bacterium was Escherichia coli.

Among those 17 cases with clinically documented infections, the source of infection was skin and soft tissue in 4, perianal abscess in 3, catheter exit site in 3, tooth abscess in 2, pneumonia in 1, myositis in 1, tracheostomy site in 1, surgical site in 1, and tonsillitis in 1. The rate of gram-negative bacteremia was significantly higher in cases with lower MBL levels when compared to cases with normal MBL levels (p=0.006) (Table 2).

The average level of MBL was 3.060 ng/mL. Average levels of MBL did not significantly vary between the 3 measurements (MBL-0, MBL-1, and MBL-2) during the episodes of FN (p=0.076) (Figure 1a). Similarly, there was no significant difference between baseline, first day of fever, and third day of fever levels of H-ficolin (p>0.05) (Figure 1b). The average H-ficolin level of the cases was measured as 18.470 ng/mL. Median baseline CRP level (CRP-0) was measured as 24 mg/L (normal range: 0-5 mg/L). The average CRP level was elevated to 84.8 mg/L on the first day of FN episodes (CRP-1) and to 98 mg/L on the third day (CRP-2) (Figure 1c). This increase in the serial CRP levels was statistically significant (p<0.0001).

Table 1. Hematological diagnoses of patients and number of febrile neutropenia episodes.

Diagnosis

Patients

FN Episodes

FN Episodes Per Patient

n

%

n

%

n

AML

16

34.78

25

40.98

1.56

ALL

15

32.61

21

34.43

1.4

NHL

7

15.22

7

11.48

1

HL

4

8.7

4

6.56

1

Others

4

8.7

4

6.56

1

Total

46

100

61

100

AML: Acute myeloid leukemia, ALL: acute lymphoblastic leukemia, NHL: non-Hodgkin lymphoma, HL: Hodgkin lymphoma, FN: febrile neutropenic.

Işlak Mutcalı S, et al: Early Changes in MBL, H-Ficolin, Procalcitonin in Febrile Neutropenia

Turk J Hematol 2016;33:304-310

Median PCT levels (normal range: <0.5 ng/mL) were also significantly elevated in FN episodes (baseline PCT-0: 2.13 ng/ mL, first day of fever PCT-1: 6.69 ng/mL, third day of fever PCT2: 6.20 ng/mL; p<0.0001) (Figure 1d).

significantly higher in those with microbiologically documented infections. Median PCT levels according to FN subgroups are shown in detail in Table 3 and Figure 2. The correlations between CRP, PCT, MBL, and H-ficolin levels during FN episodes were examined with Spearman correlation analysis. A strongly positive correlation was found between PCT-2 and CRP-2 values (p=0.008, r=0.39). CRP and PCT trajectories on the third day of fever were found to be parallel to each other. Similarly, there was a significant correlation between H-ficolin-2 and CRP-2 values (p=0.026, r=0.33).

As shown in Table 3, PCT-1 was increased with borderline significance (p=0.055), while PCT-2 was significantly higher (p=0.028) when compared to baseline levels in cases with microbiologically documented infection. Kruskal-Wallis variance analysis revealed no significant difference in terms of CRP levels between predefined subgroups, while median PCT levels were 3.5

3.13

3.06

18.47

17.88

H-ficolin-0

H-ficolin-1

While there was no significant difference between hemoculturepositive and hemoculture-negative patients in terms of CRP levels, mean and median PCT levels were significantly higher in cases with bacteremia (Table 3).

19.3

2.67

3 2.5 2 1.5 1 0.5 0

a

Mortality occurred in 9 (19.6%) of the 46 cases during the study period, 7 of which involved refractory hematologic malignancies and 2 bacteremia due to multiple-drug resistant gram-negative strains, one of which was carbapenemase-producing.

H-ficolin-2

b 98.2

6.59

84.8

6.2

2 2.13

24

1.5 1 0,5

d

c

0

Figure 1. Serum mannose-binding lectin (a), H-ficolin (b), C-reactive protein (c), and procalcitonin (d) levels in patients.

Figure 2. Median procalcitonin levels in febrile neutropenic patient subgroups.

0=at initial (between hospital admission and before chemotherapy), 1=at the onset of fever, and 2=at the 72nd hour of fever.

MBL: Mannose-binding lectin, PCT: procalcitonin, CRP: C-reactive protein.

FUO: Fever of unknown origin, PCT: procalcitonin.

Table 2. Rates and distribution of bacteremia according to mannose-binding lectin levels.

MBL Level (ng/mL)

No. of Patients

Gram (+) Growth in Hemoculture

Gram (-) Growth in Hemoculture

Positive Hemocultures n %

<500

14

1

4

5

38.5

≥500

32

5

0

5

15.1

Total

46

6

4

10

21.7

p-value

0.006

MBL: Mannose-binding lectin.

Table 3. Median serum procalcitonin and C-reactive protein levels in three patient groups with febrile neutropenia.

Fever of Unknown Origin (n=18)

Only Clinically Documented (n=17)

Microbiologically and Clinically Documented (n=11)

p-value

PCT-0

0.05

0.05

0.07

0.794

PCT-1

0.1

0.29

0.67

0.055

PCT-2

0.17

0.25

1.73

0.028

CRP-0

8.5

4

15

0.307

CRP-1

62.5

94

44

0.126

CRP-2

109.5

55

86

0.355

PCT: Procalcitonin, CRP: C-reactive protein.

PCT-0, CRP-0: baseline serum PCT and CRP levels, PCT-1, CRP-1: serum PCT and CRP levels on the first day of febrile episode, PCT-2, CRP-2: serum PCT and CRP levels 72 h after the first peak of fever.

307

Işlak Mutcalı S, et al: Early Changes in MBL, H-Ficolin, Procalcitonin in Febrile Neutropenia

Discussion Early diagnostic markers would ideally reflect the severity of the infection, help classify FN episodes as low-risk and high-risk in terms of likelihood of septic complications, and not be affected by the number of leukocytes and the course of underlying disease. CRP, as an acute phase marker and the most wellknown biochemical marker of inflammation in patients with FN, was not found to be useful in the differential diagnosis of fever of unknown origin, bacteremia, and clinically documented infections in neutropenic patients. Similar to our study, CRP was found to be of no use in differential diagnosis in other studies [12,13,14]. False negativity that can be recognized in certain patient groups such as patients with leukemia, viral infections, systemic lupus erythematosus, progressive systemic sclerosis, dermatomyositis, ulcerative colitis, Sjögren’s syndrome, and cerebral infarction is an additional drawback for CRP as an acute phase marker [15].

Although the levels of serum PCT were determined to be lower in neutropenic patients when compared to those with intact immune systems, studies have shown that neutropenic patients had significantly higher PCT levels on days 0 and 2 in the case of sepsis [16]. The relationship between CRP and PCT levels during FN episodes was investigated in our study, and it was found that CRP is not a sensitive marker of early infection in neutropenic patients, while PCT would be preferred in the early diagnosis of sepsis. The rise of CRP or PCT from day 1 to day 3 in any patient group was evaluated as the expected peak serum levels related to the severity of infection rather than an ongoing uncontrolled sepsis. In our study, a slightly significant difference (p=0.055) was found between the first-day PCT levels (PCT1) of FN episodes in bacteremic and nonbacteremic patients.

Patients who had a microbiologically documented infection had significantly higher PCT levels on the third day (PCT-2) of the FN episode (p<0.05). CRP levels had no correlation with the clinical subcategories of FN episode, but higher PCT levels on the first day of fever (>0.5 ng/mL) and 72 h after the first peak of fever (with a cut point of >3-fold rise) were correlated with bacteremia, and particularly with gram-negative bacteremia. Although Svaldi et al. [17] reported that PCT levels did not significantly differ whether gram-negative or gram-positive bacteria were present when leukocyte count was <1.0x109/L, PCT levels were found to be higher in bacteremic patients than nonbacteremic patients and were more rapidly decreased in nondocumented infections in the studies of Akçay [13] and Secmeer et al. [18].

Nevertheless, de Bont et al. [19] reported similar levels of initial PCT levels at the onset of fever in bacteremic and nonbacteremic patients in a cohort of 66 patients. In the same study, cases with coagulase-negative staphylococci bacteremia were found not to have significant rises in PCT levels. Similar to our study, Fleischhack et al. [20] reported that children with FN infected 308

Turk J Hematol 2016;33:304-310

with gram-negative bacteremia had higher PCT levels than did gram-positive cases [21].

It was concluded in a review published by Sakr et al. [21] of 30 studies that PCT levels were useful to distinguish the febrile episodes of systemic infection from noninfectious causes of fever. However, the capability to differentiate gram-negative and gram-positive bacteria in the etiology was limited.

MBL deficiency is defined as a serum level of <0.1 mg/L and was found in 5-10% of healthy adults. In a prospective study [21] evaluating 255 adult patients with hematologic malignancies and neutropenia, MBL levels were measured prior to the initiation of chemotherapy and on the first day of a febrile episode. MBL deficiency (<500 ng/mL) was detected in 62 (24%) of the patients.

The incidence of severe infection was higher among MBLdeficient patients than among non-MBL-deficient patients. In our study, MBL levels did not show any significant change in the first 3 days of FN. MBL levels were within normal ranges in 32 (69.5%) patients, 5 (15.1%) of whom had bacteremia due to gram-positive cocci. MBL levels were low (<500 ng/mL) in 14 (30.5%) of patients. Patients with low levels of MBL had a significantly higher rate of gram-negative bacteremia compared to patients with normal MBL levels (p=0.006), suggesting a correlation between MBL levels and risk of gram-negative infection.

In the review by Frakking et al. [22] investigating the correlation of infection in pediatric oncology patients with MBL deficiency and/or severity of infection, no relationship was found between low MBL levels and presence of sepsis, bacteremia, or fungal infection in 3 of the 5 studies, while the results of the other 2 studies were to the contrary. Although there are a variety of studies with different results in the literature [23,24,25,26,27], Peterslund et al. [28] showed a significant correlation between low levels of MBL and the development of bacteremia in adult patients with hematological malignancies.

In the study of Neth et al. [29] comparing 24 children with MBL levels of <1000 μg/L and 38 children with MBL levels of ≥1000 μg/mL, those with lower MBL levels developed FN episodes significantly more frequently. Schlapbach et al. [23] detected significantly more episodes of severe bacterial infections in patients with low MBL levels (<100 μg/mL), while those with higher MBL levels (>1000 μg/mL) had more frequent FN episodes due to microbiologically nondefined etiology. Kilpatrick et al.

[24] demonstrated that patients with MBL of ≤0.1 mg/mL had significantly more major infections than no infections within the follow-up period (p<0.05). Deficiency of MBL (≤0.1 µg/ mL) was significantly more frequent in patients with serious infections when compared to those with no infection within the

Turk J Hematol 2016;33:304-310

Işlak Mutcalı S, et al: Early Changes in MBL, H-Ficolin, Procalcitonin in Febrile Neutropenia

follow-up period (p<0.05) [6] in a cohort of 128 patients with hematological malignancies treated by chemotherapy alone or combined with bone marrow transplantation. In the study of Bergmann et al. [25], no significant correlation between low MBL levels and the development of infection was detected in the FN episodes of patients with acute leukemia. Nevertheless, Horiuchi et al. [26] showed that low levels of a particular MBL genotype were related to severe bacterial infection. The dramatic differences reported in the studies of Peterslund et al. [28], Neth et al. [29], and Schlapbach et al. [23] in median MBL concentrations were virtually identical to those of the other patient categories. The studies of Klostergaard et al. [27], Frakking et al. [22], and Schlapbach et al. [23] revealed that infections due to gram-positive bacteria were more commonly observed in cases with low MBL levels.

bacteremia, and are preferable to CRP as a follow-up marker. No significant relation was found with baseline H-ficolin levels and risk of infection, and no significant change in serum level was detected during an emerging infection. Treatment of MBL deficiency would be a useful research topic to decrease the risk of severe infections, particularly due to gram-negative bacteria in cases with neutropenia.

MBL is one of the factors that may influence susceptibility to infection [6]. MBL variant alleles (implying low levels of circulating MBL) were found to be associated with major infections in recipients of allogeneic hemopoietic stem cell transplants [30]. Measuring the baseline MBL levels might be useful to define any predisposition to infections, particularly due to gram-negative bacteria, as a conclusion of our study.

Baseline MBL levels might help categorize patients into highrisk and low-risk groups. A further study investigating how baseline MBL levels correlate with Multinational Association of Supportive Care in Cancer (MASCC) scores would be of great value. Given the easy treatment of its deficiency, baseline MBL will probably be a surrogate marker for the MASCC score, despite the current cost of the test.

Ethics

H-ficolin was the other collectin investigated in our study.

Seven patients had low levels of H-ficolin, 2 of whom developed gram-positive and 1 of whom developed gram-negative bacteremia. Due to the small number of patients in this group, no correlation was established between low H-ficolin levels and development of infection. In 4 of the 7 patients who had lower H-ficolin levels, MBL was also low. Two of these 4 patients had bacteremia.

In our study, MBL and H-ficolin levels did not show any significant variability in any subgroup of patients within the first 3 days of FN episodes. Different studies revealed different results owing to different patient groups, use of different chemotherapy regimens, and varying features of nosocomial causative agents within centers.

Conclusion Obtaining baseline MBL levels seems to be useful to predict severe infections, particularly due to gram-negative bacteria, in FN patients. Consecutive PCT levels are much more correlated with microbiologically documented infections, including

Acknowledgments We would like to express our sincere thanks to Professor Bekir Kocazeybek, MD, and Pelin Yüksel, MD, PhD, for laboratory and technical support. We are grateful to Dana Clutter, MD, for her contributions and revision of the manuscript in terms of language. This study was financially supported by the İstanbul University Research and Projects Unit (Project no: 3847).

Ethics Committee Approval: İstanbul University Cerrahpaşa Faculty of Medicine Ethics Committee (approval number: 2009/22079) (15.07.2009); Informed Consent: It was taken.

Authorship Contributions Infection Consultation Practices: Sibel Işlak Mutcalı, Neşe Saltoğlu, İlker İnanç Balkan, Reşat Özaras, Mücahit Yemişen, Bilgül Mete, Fehmi Tabak, Ali Mert, Recep Öztürk; Hematological follow-up: Şeniz Öngören, Zafer Başlar, Yıldız Aydın, Burhan Ferhanoğlu, Teoman Soysal; Design: Sibel Işlak Mutcalı, Neşe Saltoğlu, İlker İnanç Balkan; Laboratory and Technical Support: Bekir Kocazeybek, Pelin Yüksel, Sibel Işlak Mutcalı; Data Collection or Processing: Sibel Işlak Mutcalı; Analysis or Interpretation: Sibel Işlak Mutcalı, Neşe Saltoğlu, İlker İnanç Balkan, Reşat Özaras; Literature Search: Sibel Işlak Mutcalı, Neşe Saltoğlu; Writing: Sibel Işlak Mutcalı, Neşe Saltoğlu, İlker İnanç Balkan, Reşat Özaras, Mücahit Yemişen, Bilgül Mete, Fehmi Tabak, Ali Mert, Recep Öztürk, Şeniz Öngören, Zafer Başlar, Yıldız Aydın, Burhan Ferhanoğlu, Teoman Soysal.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Chen SC, Kontoyiannis DP. New molecular and surrogate biomarker-based tests in the diagnosis of bacterial and fungal infection in febrile neutropenic patients. Curr Opin Infect Dis 2010;23:567-577.

2. Einsele H, Loeffler J. Contribution of new diagnostic approaches to antifungal treatment plans in high-risk hematology patients. Clin Microbiol Infect 2008;14(Suppl 4):37-45.

3. Pfaller MA, Diekema DJ. Epidemiology of invasive candidiasis: a persistent public health problem. Clin Microbiol Rev 2007;20:133-163.

4. Hsu DI, Nguyen M, Nguyen L, Law A, Wong-Beringer A. A multicentre study to evaluate the impact of timing of caspofungin administration on outcomes of invasive candidiasis in non-immunocompromised adult patients. J Antimicrob Chemother 2010;65:1765-1770.

309

Işlak Mutcalı S, et al: Early Changes in MBL, H-Ficolin, Procalcitonin in Febrile Neutropenia

Turk J Hematol 2016;33:304-310

5. Mancini N, Clerici D, Diotti R, Perotti M, Ghidoli N, De Marco D, Pizzorno B, Emrich T, Burioni R, Ciceri F, Clementi M. Molecular diagnosis of sepsis in neutropenic patients with hematological malignancies. J Med Microbiol 2008;57:601-604.

18. Secmeer G, Devrim I, Kara A, Ceyhan M, Cengiz B, Kutluk T, Buyukpamukcu M, Yetgin S, Tuncer M, Uludag AK, Tezer H, Yildirim I. Role of procalcitonin and CRP in differentiating a stable from a deteriorating clinical course in pediatric febrile neutropenia. J Pediatr Hematol Oncol 2007;29:107-111.

6. Kilpatrick DC. Mannan-binding lectin and its role in innate immunity.

Transfus Med 2002;12:335-352.

19. de Bont ES, Vellenga E, Swaanenburg J, Kamps W. Procalcitonin: a diagnostic marker of bacterial infection in neutropenic cancer patients with fever?

Infection 2000;28:398-400.

7. Bronkhorst MW, Bouwman LH. Mannose-binding lectin deficiency. 2014.

Available online at http://www.uptodate.com/contents/mannose-bindinglectin-deficiency. Accessed on 27 January 2015.

8. Vekemans M, Robinson J, Georgala A, Heymans C, Muanza F, Paesmans M, Klastersky J, Barette M, Meuleman N, Huet F, Calandra T, Costantini S, Ferrant A, Mathissen F, Axelsen M, Marchetti O, Aoun M. Low mannosebinding lectin concentration is associated with severe infection in patients with hematological cancer who are undergoing chemotherapy. Clin Infect Dis 2007;44:1593-1601.

9. Matsushita M, Fujita T. The role of ficolins in innate immunity.

Immunobiology 2002;205:490-497.

10. Link H, Böhme A, Cornely OA, Höffken K, Kellner O, Kern WV, Mahlberg R, Maschmeyer G, Nowrousian MR, Ostermann H, Ruhnke M, Sezer O, Schiel X, Wilhelm M, Auner HW; Diseases Working Party (AGIHO) of the German Society of Hematology and Oncology (DGHO); Group Interventional Therapy of Unexplained Fever, Arbeitsgemeinschaft Supportivmassnahmen in der Onkologie (ASO) of the Deutsche Krebsgesellschaft (DKG-German Cancer Society). Antimicrobial therapy of unexplained fever in neutropenic patients-guidelines of the Infectious Diseases Working Party (AGIHO) of the German Society of Hematology and Oncology (DGHO), Study Group Interventional Therapy of Unexplained Fever, Arbeitsgemeinschaft Supportivmassnahmen in der Onkologie (ASO) of the Deutsche Krebsgesellschaft (DKG-German Cancer Society). Ann Hematol 2003;82(Suppl 2):S105-S117.

11. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing, Twentieth Informational Supplement.

M100-S20. Wayne, PA, USA, CLSI, 2010.

12. Riikonen P, Saarinen UM, Teppo AM, Metsarinne K, Fyhrquist F, Jalanko H. Cytokine and acute-phase reactant levels in serum of children with cancer admitted for fever and neutropenia. J Infect Dis 1992;166:432-436.

13. Akçay A. Association of serum levels of proinflammatory cytokines, C-reactive protein, procalcitonin and bacterial sepsis in febrile neutropenic children with cancer. Specialty thesis on pediatric hematology, İstanbul Medical School, Department of Children’s Health and Diseases, İstanbul, Turkey, 2009.

14. von Lilienfeld-Toal M, Dietrich MP, Glasmacher A, Lehmann L, Breig P, Hahn C, Schmidt-Wolf IG, Marklein G, Schroeder S, Stuber F. Markers of bacteremia in febrile neutropenic patients with hematological malignancies: procalcitonin and IL-6 are more reliable than C-reactive protein. Eur J Clin Microbiol Infect Dis 2004;23:539-544.

15. Kawai T. Inflammatory markers, especially the mechanism of increased CRP. Rinsho Byori 2000;48:719-721a (in Japanese with English abstract).

16. Al-Nawas B, Shah PM. Procalcitonin in patients with and without immunosuppression and sepsis. Infection 1996;24:434-436.

17. Svaldi M, Hirber J, Lanthaler AI, Mayr O, Faes S, Peer E, Mitterer M. Procalcitonin reduced sensitivity and specificity in heavily leucopenic and immunosuppressed patients. Br J Haematol 2001;115:53-57.

310

20. Fleischhack G, Kambeck I, Cipic D, Hasan C, Bode U. Procalcitonin in paediatric cancer patients: its diagnostic relevance is superior to that of C-reactive protein, interleukin 6, interleukin 8, soluble interleukin 2 receptor and soluble tumour necrosis factor receptor II. Br J Haematol 2000;111:1093-1102.

21. Sakr Y, Sponholz C, Tuche F, Brunkhorst F, Reinhart K. The role of procalcitonin in febrile neutropenic patients: review of the literature.

Infection 2008;36:396-407.

22. Frakking FN, Israëls J, Kremer LC, Kuijpers TW, Caron HN, van de Wetering MD. Mannose-binding lectin (MBL) and the risk for febrile neutropenia and infection in pediatric oncology patients with chemotherapy. Pediatr Blood Cancer 2011;57:89-96.

23. Schlapbach LJ, Aebi C, Otth M, Luethy AR, Leibundgut K, Hirt A, Ammann RA. Serum levels of mannose binding lectin and the risk of fever in neutropenia pediatric cancer patients. Pediatr Blood Cancer 2007;49:11-16.

24. Kilpatrick DC, McLintock LA, Allan EK, Copland M, Fujita T, Jordanides NE, Koch C, Matsushita M, Shiraki H, Stewart K, Tsujimura M, Turner ML, Franklin IM, Holyoake TL. No strong relationship between mannan binding lectin or plasma ficolins and chemotherapy-related infections. Clin Exp Immunol 2003;134:279-284.

25. Bergmann OJ, Christiansen M, Laursen I, Bang P, Hansen NE, Ellegaard J, Koch C, Andersen V. Low levels of mannose-binding lectin do not affect occurrence of severe infections or duration of fever in acute myeloid leukaemia during remission induction therapy. Eur J Haematol 2003;70:9197.

26. Horiuchi T, Gondo H, Miyagawa H, Otsuka J, Inaba S, Nagafuji K, Takase K, Tsukamoto H, Koyama T, Mitoma H, Tamimoto Y, Miyagi Y, Tahira T, Hayashi K, Hashimura C, Okamura S, Harada M. Association of MBL gene polymorphisms with major bacterial infection in patients treated with highdose chemotherapy and autologous PBSCT. Genes Immun 2005;6:162-166.

27. Klostergaard A, Steffensen R, Møller JK, Peterslund N, Juhl-Christensen C, Mølle I. Sepsis in acute myeloid leukaemia patients receiving high-dose chemotherapy: no impact of chitotriosidase and mannose-binding lectin polymorphism. Eur J Haematol 2010;85:58-64.

28. Peterslund NA, Koch C, Jensenius JC, Thiel S. Association between deficiency of mannose-binding lectin and severe infections after chemotherapy.

Lancet 2001;358:637-638.

29. Neth O, Hann I, Turner MW, Klein NJ. Deficiency of mannose-binding lectin and burden of infection in children with malignancy: a prospective study.

Lancet 2001;358:614-618.

30. Mullighan CG, Heatley S, Doherty K, Szabo F, Grigg A, Hughes TP, Schwarer AP, Szer J, Tait BD, Bik To L, Bardy PG. Mannose-binding lectin gene polymorphisms are associated with major infection following allogeneic hemopoietic stem cell transplantation. Blood 2002;99:3524-3529.

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0216 Turk J Hematol 2016;33:311-319

Prospective Evaluation of Infection Episodes in Cancer Patients in a Tertiary Care Academic Center: Microbiological Features and Risk Factors for Mortality Kanser Hastalarındaki Enfeksiyon Ataklarının Prospektif Değerlendirmesi: Mikrobiyolojik Özellikler ve Mortalite için Risk Faktörleri Nursel Çalık Başaran1, Ergun Karaağaoğlu2, Gülşen Hasçelik3, Mine Durusu Tanrıöver1, Murat Akova4 1Hacettepe University Faculty of Medicine, Department of Internal Medicine, Ankara, Turkey 2Hacettepe University Faculty of Medicine, Department of Biostatistics, Ankara, Turkey 3Hacettepe University Faculty of Medicine, Department of Basic Microbiology, Ankara, Turkey 4Hacettepe University Faculty of Medicine, Department of Infectious Diseases and Clinical Microbiology, Ankara, Turkey

Abstract

Öz

Objective: We aimed to determine the frequency, type, and etiology of infections and the risk factors for infections and mortality in hospitalized cancer patients.

Amaç: Enfeksiyonlar, kanser hastalarında önde gelen morbidite ve mortaliteleri nedeni olmuşlardır. Bu çalışmada hastanede yatan kanser hastalarında enfeksiyonların sıklığını, tiplerini, etiyolojilerini ve enfeksiyon gelişimi ve mortalite için risk faktörlerini belirlemeyi amaçladık.

Materials and Methods: We prospectively enrolled adult cancer patients hospitalized in the internal medicine wards of a tertiary care academic center between January and August 2004. Patients were followed during their hospitalization periods for neutropenia, infections, culture results, and mortality.

Results: We followed 473 cancer patients with 818 hospitalization episodes and 384 infection episodes in total. Seventy-nine percent of the infections were nosocomial, and febrile neutropenia (FN) was observed in 196 (51%) of the infection episodes. Bacteremia was found in 29% of FN episodes and in 8% of nonneutropenic patients.

Gram-positive bacteria were the leading cause of bacteremia in both neutropenic and nonneutropenic cases (70% and 58%, respectively).

Presence of an indwelling central catheter increased bacteremia risk by 3-fold. The overall mortality rate was 17%, whereas 34% of the patients with bloodstream infections died. Presence of bacteremia and advanced disease stage increased overall mortality by 6.1-fold and 3.7-fold, respectively.

Conclusion: Nearly half of the cancer patients developed an infection during their hospital stays, with gram-positive bacteria being the predominant etiologic microorganisms. This demonstrates the changing trends in infections considering that, until 2004, gramnegative bacteria were the most predominant microorganisms among cancer patients in our institute.

Gereç ve Yöntemler: Üçüncü basamak bir üniversite hastanesinin iç hastalıkları servislerinde Ocak-Ağustos 2004 tarihleri arasında izlenmiş olan erişkin kanser hastaları dahil edildi. Yatış süreleri boyunca nötropeni, enfeksiyonlar, kültür sonuçları ve mortalite açısından prospektif olarak izlendiler.

Bulgular: Toplam 473 kanser hastasının 818 hastaneye yatış atağı izlendi. Toplam 818 yatış atağı sırasında 384 (%46) enfeksiyon atağı gözlendi- %79’u nozokomiyaldi. Febril nötropeni (FN) tüm atakların 196’sında (%51) görüldü. Bakteremi, FN ataklarının %29’unda ve nötropenik olmayan hastaların %8’inde görüldü. Gram-pozitifler hem nötropenik olan hem de olmayan hastalardaki bakteremilerin önde gelen etkeni olarak görüldü (%70 ve %58, sırasıyla). Santral kateter varlığının bakteremi riskini 3 kat artırdığı görüldü. Toplam mortalite %17 iken bakteremisi olan hastalarda mortalite %34 saptandı.

Bakteremi varlığı ve ileri evre hastalık toplam mortaliteyi, sırasıyla, 6,1 ve 3,7 kat artırmaktaydı.

Sonuç: Hastanede yatan kanser hastalarının neredeyse yarısında en azından bir enfeksiyon gelişmektedir ve bu enfeksiyonlarda grampozitifler hakimdir. Bu bilgiler, 2004 yılına kadar kanser hastalarında en sık görülen mikroorganizmaların gram-negatif mikroorganizmalar olduğu göz önüne alındığında, enfeksiyonlarda değişen eğilimler olduğunu göstermektedir.

Anahtar Sözcükler: Febril nötropeni, Kanser, Mortalite, Risk faktörleri

Keywords: Febrile neutropenia, Cancer, Mortality, Risk factors

Address for Correspondence/Yazışma Adresi: Nursel ÇALIK BAŞARAN, M.D., Hacettepe University Faculty of Medicine, Department of Internal Medicine, Ankara, Turkey Phone : +90 312 305 30 29 E-mail : nurselcbasaran@gmail.com

Received/Geliş tarihi: May 25, 2015 Accepted/Kabul tarihi: January 11, 2016

311

Çalık Başaran N, et al: Infection Episodes in Cancer Patients

Introduction Infections have become the leading cause of mortality and morbidity of cancer while supportive and curative treatment strategies prolong life [1,2]. Cancer and its treatment suppress the immune system, and long and recurrent hospitalizations predispose patients to various infections.

Predominant infectious pathogens have been variable in time with changing cancer treatment strategies, antibacterial prophylaxis practices, and emerging resistance patterns in bacteria. Until the 1980s, the leading microorganisms in cancer patients were enteric gram-negative bacteria and Pseudomonas aeruginosa. As of the 1980s, gram-positive bacteria became the most common pathogens in these patients [1,3,4]. However, recently, nonfermenting gram-negative bacteria have emerged as the leading pathogens in cancer patients.

It is important to know the risk factors for infections, changing epidemiology, and resistance patterns of pathogenic microorganisms for the proper management of infections in cancer patients. In this study, we aimed to determine the frequency, type, and etiology of infections and the risk factors for infections and mortality in hospitalized cancer patients.

Materials and Methods Study Design and Patients This study was done in the internal medicine wards of a tertiary care university hospital. The institutional review board approved the study and adult cancer patients hospitalized between January and August 2004 were enrolled and followed prospectively.

Demographic data, cancer type and stage, previous stem cell transplantation history and type, comorbidities, and presence of antibacterial utilization in the previous month were recorded upon admission. Presence of indwelling catheters (central or peripheral venous, arterial, urinary, or drainage), presence of parenteral nutrition, requirement of intensive care unit and mechanical ventilation, therapy for cancer (chemotherapy, radiation, corticosteroids), vital signs, infections, antibiotic usage, culture results, and neutrophil counts were recorded throughout the admission episode. Descriptive data and further analyses were done based on the admission episodes unless otherwise specified. One patient might have had more than one admission. The infectious diseases department followed the patients and the researchers did not intervene in the diagnostic and therapeutic processes.

Neutropenia was defined as an absolute neutrophil count below 500/mm3 or below <1000/mm3 and expected to decline rapidly. Neutropenic infections were classified as clinically or microbiologically documented infection, bloodstream infection (BSI), or fever of unknown origin [5]. Infections were 312

Turk J Hematol 2016;33:311-319

classified as nosocomial according to the 1998 definitions of the Centers for Disease Control and Prevention [6]. Metastatic solid tumors, newly diagnosed hematological malignancies with poor prognosis, and relapsed or treatment-resistant hematological malignancies were defined as advanced disease stage. Corticosteroid use was defined as the use of prednisolone at a dose of >20 mg/day (or equivalent) or over a period of 10 days whatever the dose was. Antifungal prophylaxis was defined as oral fluconazole/itraconazole used in prophylactic doses.

Microbiological Methods All the cultures were collected from different parts of the body according to the presumed infections. They were inoculated onto suitable media and incubated at 37 °C for 24-48 h. Catheter cultures were studied quantitatively. For blood cultures, a BD BACTEC 9000 Blood Culture System (Becton Dickinson Diagnostic Systems, Sparks, MD, USA) was used. All the microorganisms were identified by gram staining, conventional microbiological tests (such as hemolysis, catalase, oxidase, and coagulase reaction), and the Phoenix System (Becton Dickinson Diagnostic Systems).

Antibiotic susceptibility tests were conducted with the Phoenix System and for Streptococcus pneumoniae by E-test (AB BIODISK, Solna, Sweden). Results were evaluated according to the Clinical and Laboratory Standards Institute 2004 standards.

Statistical Analysis Data were analyzed by SPSS 11.5 for Windows (SPSS Inc., Chicago, IL, USA). Distribution of data was analyzed by Kolmogorov-Smirnov test. Normally distributed data are presented as mean ± standard deviation, while abnormally distributed data are presented as median (minimum-maximum).

Categorical variables were compared by chi-square test and Fischer’s exact test where appropriate, and continuous variables were analyzed by Student’s t-test. Risk analysis was performed

by Fisher’s exact chi-square test and parameters that were found to be significant were introduced into a multivariate logistic regression model. Relative risk was computed for possible risk factors with 95% confidence interval and p<0.05 was accepted as statistically significant.

Results During the study period, 473 cancer patients between 16 and 82 years of age were enrolled and 818 hospitalization episodes were followed prospectively. Of these patients, 286 (60%) were male and the mean age was 51 years (16-82 years). Chronic diseases accompanying admission episodes were as follows: 4.8% coronary artery disease, 2.7% chronic renal failure, 10.2% diabetes mellitus, and 13.4% hypertension. Solid organ cancer was seen in 254 (53%) patients while the remaining had hematological diseases (Table 1). Hematopoietic stem cell transplantation (HSCT) was done in 49 patients with 63

Çalık Başaran N, et al: Infection Episodes in Cancer Patients

Turk J Hematol 2016;33:311-319

admission episodes (7.7%) and half of them were allogeneic HSCTs. In the course of 818 hospitalization episodes, a total of 384 (46%) infection episodes were observed and 79% of these were nosocomial. Febrile neutropenia (FN) was observed in 126 patients having 196 (51%) infection episodes. Acute myeloid leukemia was the most common underlying disease (n=35, 35/126, 27%) in patients with FN. Mean duration of

neutropenia was longer in patients with an infection (16.2 days) when compared to those without an infection (8.2 days) (p=0.002). Bacteremia was found in 29% of FN episodes and in 8% of nonneutropenic infections (p<0.05). Sites of infections in neutropenic and nonneutropenic patients are shown in Table 2.

The mean hospitalization duration was three times longer for patients with infection (38±31 days) when compared to the mean of the total hospitalization episodes (13±23 days).

Table 1. Demographic features of all patients and particularly patients with an infection.

Patient Characteristics

All Patients (n=473) n (%)

Patients with Infection (n=272) n (%)

Age (years)*

51±16

51±16

Male sex

286 (60.5)

161 (59.2)

Duration of hospitalization (days)*

13±23

38±31

Malignancy

Hematological diseases

219 (46.3)

158 (58)

Non-Hodgkin lymphoma

82 (17)

54 (19.9)

Acute myeloblastic leukemia

43 (9.1)

36 (13.2)

Acute lymphoblastic leukemia

17 (3.6)

14 (5.1)

Multiple myeloma

35 (7.4)

23 (8.5)

Hodgkin disease

12 (2.5)

8 (2.9)

Chronic lymphocytic leukemia

13 (2.8)

6 (2.2)

Chronic myelocytic leukemia

5 (1.1)

5 (1.8)

Myelodysplastic syndrome

8 (1.7)

8 (2.9)

Aplastic anemia

4 (0.8)

4 (1.5)

Solid organ malignancies

254 (53.7)

114 (41.9)

Lung cancer/malignant pleural mesothelioma

69 (14.6)

30 (11)

Colorectal carcinoma

37 (7.8)

15 (5.5)

Head and neck cancer

24 (5)

5 (1.8)

Esophagus/gastric cancer

23 (4.9)

9 (3.3)

Breast cancer

16 (3.4)

8 (2.9)

Cancer of unknown primary origin

13 (2.7)

6 (2.2)

Pancreas cancer

9 (1.9)

5 (1.8)

Ovarian cancer

8 (1.7)

4 (1.5)

Testicular cancer

7 (1.5)

5 (1.8)

Thyroid/adrenal/neuroendocrine tumor

5 (1.1)

2 (0.7)

Sarcoma

5 (1.1)

4 (1.5)

Malign mesenchymal tumor

4 (0.8)

2 (0.7)

Endometrium cancer

3 (0.6)

2 (0.7)

Cervical cancer

4 (0.8)

3 (1.1)

Bladder cancer

3 (0.6)

3 (1.1)

Prostate cancer

1 (0.2)

1 (0.4)

Renal cell cancer

4 (0.8)

2 (0.7)

Intracranial tumor

3 (0.6)

3 (1.1)

Malignant melanoma

3 (0.6)

1 (0.4)

*Mean ± standard deviation.

313

Çalık Başaran N, et al: Infection Episodes in Cancer Patients

Turk J Hematol 2016;33:311-319

Fluconazole as antifungal prophylaxis was given in 63 (7.7%) episodes as a part of the stem cell transplantation regimen.

Corticosteroids were used in 215 (26.4%) of the admission episodes. Radiation therapy was performed in 5.1% (42) of hospitalization episodes. Unfortunately, we had no data about granulocyte colony-stimulating factor use in this study.

Nonneutropenic episodes constituted 71.4% of all the hospitalization episodes and in 77.3% of these cases an immunosuppressive treatment, including corticosteroids, was used. As expected, there was an immunosuppressive treatment in 94% of neutropenic episodes (p<0.001). Among the nonneutropenic episodes, infections were more frequently seen in those patients receiving any immunosuppressive treatment than in episodes with no immunosuppressive treatment (p<0.001). However, there was no difference in terms of mortality (p=0.111).

At least one pathogenic microorganism was isolated from culture specimens obtained from patients during 187 (48.6%) infection episodes. Blood cultures were positive in 29.6% of all the patients and in 60.6% of neutropenic patients. Gram-negative microorganisms were the most common (51%) isolates among all the specimens, whereas gram-positive microorganisms were the most common (65%) among blood culture isolates (Table 3). Fungi were isolated in 5% of all the specimens and 9% of the specimens from neutropenic patients. When bacteremic episodes were considered, gram-positive bacteria were the leading cause in both neutropenic and nonneutropenic cases (70% and 58%, respectively; p<0.05) (Table 4).

Table 2. Distribution of infection sites in neutropenic and nonneutropenic patients.

Infection sites

n (%)

Neutropenic episodes (n=206)

Fever of unknown origin

72 (34)

Bloodstream infection

59 (29)

Microbiologically documented infection (other than bloodstream)

14 (7)

Clinical infection

61 (30)

Nonneutropenic episodes (n=279)

Respiratory infection

94 (3)

Urinary tract infection

64 (22.9)

Gastrointestinal system infection

52 (18)

Skin and soft tissue infection

42 (15)

Bloodstream infection

21 (8)

Central nervous system infection

4 (1.4)

Skeletal system infection

2 (0.7)

Some patients may have had more than one neutropenic episode within one hospital admission. “n” refers to number of infection episodes and % is the percentage within neutropenic or nonneutropenic episodes.

314

The resistance patterns of Staphylococcus aureus, Staphylococcus epidermidis, Escherichia coli, Klebsiella spp., and Pseudomonas spp. are listed in Table 5. In neutropenic patients, rates of extended-spectrum β-lactamase (ESBL)producing E. coli and Klebsiella spp. were found to be high compared to nonneutropenic patients (p<0.05).

Table 3. The results of blood cultures and all cultures.

Blood Cultures

All Cultures

Name of microorganism

n (%)

n (%)

Staphylococcus aureus

8 (5)

26 (4.8)

Staphylococcus aureus (MR)

2 (1.2)

9 (1.6)

Coagulase-negative staphylococci

11 (7)

17 (3.1)

Coagulase-negative staphylococci (MR)

67 (42)

103 (19.2)

Streptococcus pneumoniae

1 (0.6)

7 (1.3)

Streptococcus viridans

2 (1.2)

4 (0.7)

Streptococcus pyogenes

3 (1.9)

1 (0.1)

Streptococcus agalactiae

2 (1.2)

5 (0.9)

Enterococcus faecalis

2 (1.2)

30 (5.5)

Enterococcus faecium

3 (1.9)

9 (1.6)

Enterococcus gallinarum/casseliflavus

0

2 (0.3)

Corynebacterium spp.

1 (0.6)

2 (0.3)

Gram-positive bacteria: total

102 (65)

215 (40)

Moraxella catarrhalis

0

1 (0.1)

Haemophilus influenza

1 (0.6)

8 (1.4)

Escherichia coli

8 (5)

80 (14.9)

Escherichia coli (ESBL+)

6 (3.8)

33 (6.1)

Klebsiella pneumoniae

2 (1.2)

19 (3.5)

Klebsiella oxytoca

4 (2.5)

17 (3.1)

Klebsiella pneumoniae (ESBL+)

4 (2.5)

9 (1.6)

Klebsiella oxytoca (ESBL+)

0

2 (0.3)

Proteus vulgaris

0

7 (1.3)

Enterobacter spp.

2 (1.2)

15 (2.7)

Salmonella spp.

3 (1.9)

3 (0.5)

Pseudomonas aeruginosa

11 (7)

49 (9.1)

Acinetobacter baumannii

2 (1)

13 (2.4)

Other Acinetobacter spp.

0

3 (0.5)

Stenotrophomonas maltophilia

3 (1.9)

9 (1.6)

Aeromonas spp.

1 (0.6)

3 (0.5)

Citrobacter spp.

0

2 (0.3)

Gram-negative bacteria: total

47 (30)

273 (51)

Candida albicans

6 (3.8)

41 (7.6)

Candida tropicalis

0

2 (0.3)

Trichosporon spp.

2 (1.2)

2 (0.3)

Aspergillus spp.

0

1 (0.1)

Candida glabrata/krusei

0

2 (0.3)

Fungi: total

8 (5)

48 (9)

MR: Methicillin-resistant, ESBL+: extended-spectrum β-lactamase positive.

Çalık Başaran N, et al: Infection Episodes in Cancer Patients

Turk J Hematol 2016;33:311-319

Possible risk factors for infection in cancer patients were analyzed by univariate analysis and then the risk factors found to increase the occurrence of an infection were introduced into a multivariate logistic regression model (Table 6). We found that advanced disease stage, neutropenia for more than 7 days, and radiation were related to an increased frequency of infection in cancer patients (p<0.05). Presence of an indwelling central catheter increased bacteremia risk by 3-fold (Table 6).

The overall mortality rate was 17%, whereas 34% of patients with BSIs died (p<0.05). Among patients with FN, the mortality rate was 18.4%, and the occurrence of a BSI increased the mortality rate to 41%. Presence of bacteremia increased overall mortality 6.1 times and advanced disease stage increased overall mortality 3.7 times. On the other hand, usage of prophylactic antifungal therapy decreased mortality 3.3-fold, but the p-value was found to be statistically insignificant (p=0.055)

(Table 6). Comorbid chronic diseases had no significant effect on infection or mortality.

Discussion This study is a landmark study to show the shift of infectious etiologies in cancer patients from gram-negative to grampositive bacteria. Afterwards, a long-term multicentric study was established in Turkey for microbiological surveillance of FN patients. Such surveillance studies are valuable to implement systemic changes in individual institutions and countries.

In this prospective observational study we found that 46% of all cancer patients developed at least one infection and 85% of neutropenic patients developed at least one FN attack during their index hospital stay. Among the neutropenic attacks, 65% were documented clinically or microbiologically, and the

Table 4. Isolates of blood cultures in neutropenic and nonneutropenic patients.

Microorganisms

Neutropenic, n (%)

Nonneutropenic, n (%)

p-value

Coagulase-negative staphylococci (MR)

58 (50.8)

9 (21)

<0.05

Coagulase-negative staphylococci

6 (5.3)

5 (12)

0.4

Staphylococcus aureus

3 (2.6)

5 (12)

Streptococcus pyogenes

3 (2.6)

0

Enterococcus faecalis

3 (2.6)

1 (2)

Staphylococcus aureus (MR)

2 (1.75)

0

Enterococcus faecium

2 (1.75)

2 (4.6)

Viridans group streptococci

1 (0.9)

1 (2)

Streptococcus agalactiae

1 (0.9)

1 (2)

Corynebacterium spp.

1 (0.9)

0

Streptococcus pneumoniae

0

1 (2)

Gram-positive bacteria: total

80 (70)

25 (58)

<0.05

Escherichia coli

6 (5.3)

2 (4.6)

Escherichia coli (ESBL+)

4 (3.5)

2 (4.6)

Pseudomonas aeruginosa

6 (5.3)

5 (12)

Klebsiella pneumoniae (ESBL+)

4 (3.5)

0

Klebsiella pneumoniae

2 (1.75)

0

Stenotrophomonas maltophilia

3 (2.6)

0

Enterobacter cloaca

2 (1.75)

0

Klebsiella oxytoca

1 (0.9)

3 (7)

Acinetobacter baumannii

1 (0.9)

1 (2)

Aeromonas spp.

1 (0.9)

0

Haemophilus influenzae

0

1 (2)

Gram-negative bacteria: total

30 (26.5)

14 (33)

<0.05

Candida spp.

4 (3.5)

2 (4.6)

Trichosporon spp.

0

2 (4.6)

Fungi: total

4 (3.5)

4 (9)

Total

114 (100)

43 (100)

<0.05

MR: Methicillin-resistant, ESBL: extended-spectrum β-lactamase.

315

Çalık Başaran N, et al: Infection Episodes in Cancer Patients

Turk J Hematol 2016;33:311-319

Table 5. Resistance patterns of microorganisms in neutropenic and nonneutropenic patients.

Escherichia coli Klebsiella spp.

Staphylococcus aureus Staphylococcus epidermidis Pseudomonas aeruginosa

Resistance

Total, n (%)

Nonneutropenic, n (%)

Neutropenic, n (%)

p-value

ESBL (-)

80 (70.7)

72 (75.7)

8 (44.4)

ESBL(+)

33 (29.3)

23 (24.3)

10 (55.6)

<0.05

ESBL (-)

36 (76.5)

30 (85.7)

6 (50)

ESBL (+)

11 (23.5)

5 (14.3)

6 (50)

<0.05

MS

26 (74)

18 (72)

8 (80)

MR

9 (26)

7 (28)

2 (20)

NA

MS

2 (3.7)

2 (10.5)

0 (0)

MR

52 (96.3)

17 (89.5)

35 (100)

NA

MDR (-)

23 (71.8)

18 (75)

5 (62.5)

MDR (+)

9 (28.2)

6 (25)

3 (37.5)

NA

ESBL: Extended-spectrum β-lactamase, MR: methicillin-resistant, MS: methicillin-sensitive, MDR: multidrug-resistant.

Table 6. Risk factors for infection, bloodstream infection, and mortality.

Infection

Bloodstream Infection

Mortality

RR (95% CI)

p-value

RR (95% CI)

p-value

RR (95% CI)

p-value

Advanced disease stage

3.1 (1.3-7.3)

0.009

-

-

3.7 (1.2-11.6)

0.021

Duration of neutropenia >7 days

3.9 (1.6-9.5)

0.002

-

-

-

-

Radiation

3.5 (1.2-7.6)

0.017

-

-

-

-

Indwelling central venous catheter

-

-

3.0 (1.0-8.0)

0.042

-

-

Antifungal prophylaxis

-

-

-

-

0.3 (0.09-1.0)

0.055

Bloodstream infection

-

-

-

-

6.1 (2.8-13.2)

<0.001

RR: Relative risk, CI: confidence interval.

BSI rate was 29% among the FN attacks, comparable to that reported in numerous other studies [5,7,8,9]. Compared to previous surveillance data from our hospital, both documented clinical infection and BSI rates were increased, which might be attributed to increased awareness of FN and appropriate blood culture techniques [10,11]. The definition of BSI may also have an influence on infection rates; the criteria used for skin flora organisms to be pathogens may be a reason for increased BSI rate.

Methicillin-resistant coagulase-negative staphylococci (MRCoNS) were the most commonly isolated microorganisms from overall and blood culture specimens. The predominance of grampositive bacteria and MR-CoNS in BSIs in this cohort was parallel to findings in the literature. In cancer patients BSIs were due to gram-negative enteric bacteria and Pseudomonas aeruginosa in the 1960s and 1970s, but by the middle of the 1980s grampositive bacteria had become predominant [12,13]. Memorial Sloan-Kettering Cancer Center reported that the incidence of gram-positive BSIs increased from 14% to 23% between 1977 and 1987 [1,8]. During the same time period, both the European Organisation for Research and Treatment of Cancer (EORTC) and the Febrile Neutropenia Study Group reported that 55%-60% of BSIs were due to gram-positive microorganisms [14]. In 2003, 316

Wisplinghoff et al. reported that in cancer patients nosocomial BSIs in 32% of neutropenic cases and 33% of nonneutropenic cases were due to CoNS [3]. Srinivasan et al. reported that in stem cell transplantation recipients, gram-positive bacteria, and especially members of skin flora such as Staphylococcus epidermidis, were predominant in BSIs [9]. Mikulska et al. reported the gram-positive to gram-negative ratio as 60%:40% in BSI infections of cancer patients [15]. In our study, the MR-CoNS ratio was the ratio between the blood cultures, so repetitive isolations from a patient should be kept in mind. We also accepted a CoNS as a pathogen when ≥1 blood culture was positive in the presence of fever or hypothermia, hypotension, indwelling catheter, or antibiotics, which could differ from other studies in the literature [1].

Recent studies revealed that in hematological malignancies gram-negative microorganisms have again become the most relevant microorganisms in BSIs. Cattaneo et al. reported a predominance of gram-negative bacteria (57.3%) in hematological malignancies between 2004 and 2010 [16].

Gudiol et al. reported that 49% of BSIs in hematological malignancies were due to gram-negative microorganisms and it was concluded that gram-positive microorganisms had decreased after quinolone prophylaxis [17]. A recently published

Çalık Başaran N, et al: Infection Episodes in Cancer Patients

Turk J Hematol 2016;33:311-319

paper by Trecarichi et al. also reported the shift from grampositive to gram-negative bacteria in BSIs in hematologic malignancies and again they pointed out the increasing resistance among gram-negative bacteria [18]. Several studies demonstrated gram-negative predominance either in blood or other specimen cultures in hematologic or solid cancer patients, with a frequency ranging between 24.7% and 75.8% in different geographic places with high resistance rates, including ESBLpositive Enterobacteriaceae, multidrug-resistant Pseudomonas aeruginosa, Acinetobacter spp., and Stenotrophomonas maltophilia [19,20,21,22]. According to surveillance data between 2005 and 2009 from our institution, gram-negative bacteria became the predominant BSI etiology in hematological malignancies with high resistance patterns [23]. Our study differs from these other studies in two major points: first, in our study, we followed both hematological and solid cancer patients, and second, we accepted at least one positive culture with CoNS in the presence of fever or central venous catheter.

The growing resistance problems, especially among gramnegative pathogens, require special efforts in infection control measures and rational antibiotic usage in cancer patients.

In this study ESBL-positive E. coli (55%) and Klebsiella spp. (50%) were more frequent in neutropenic cases than nonneutropenic cases. A literature review revealed that ESBL positivity in cancer patients ranged from 12% to 75% for E. coli and K. pneumoniae in different studies [23,24,25,26,27,28,29]. It was also shown that ESBL positivity negatively affects mortality and morbidity [26,30,31]. Unfortunately, due to low case numbers, we could not analyze the mortality effect of resistant gram-negative bacteria.

We found that patients who were neutropenic for 7 or more days were prone to infection 3.9-fold more so than others. Poor prognosis and advanced stage solid or hematologic cancers were also related to an increased infection risk by 3.1-fold.

Radiation was another risk factor for infection. This might be explained by the characteristics of the patient group that received radiotherapy: poor performance status, palliation in advanced disease, advanced age, or total body radiation prior to stem cell transplantation.

Indwelling central catheter was a risk factor for BSIs. In the last 30 years, increased use of persistent indwelling catheters has brought about an increased infection risk, especially for CoNS BSIs [1,12,32,33]. Moreover, BSI was a risk factor for mortality in our study. In previous studies mortality in cancer patients with BSIs ranged between 20% and 35% and this changed according to the pathogenic microorganisms [21,34,35,36,37,38]. This also points to the importance of implementing catheter bundles to decrease catheter-associated BSI rates.

Antifungal prophylaxis was part of the prophylaxis regimen in HSCT patients and it seemed to lower the mortality, although we could not show statistical significance. There are some reports showing azole-resistant breakthrough fungemia, but a recent study from the EORTC revealed that antifungal prophylaxis was protective in fungemia in cancer patients [39]. As there are various studies on different oral antifungal prophylaxes with different outcomes favoring posaconazole, itraconazole, or fluconazole use in high-risk patients, further studies are required about which drug to use for which patient and how long these drugs must be used [40,41,42].

Conclusion Nearly half of the cancer patients developed an infection during their hospital stays, with gram-positive bacteria being the predominant etiologic microorganisms. This demonstrates the changing trends in infections considering that, until 2004, gramnegative bacteria were the most predominant microorganisms among cancer patients in our institute. Each patient must be evaluated individually for risk factors, and while antibiotic treatment is being planned, current local surveillance data and the resistance patterns of the microorganisms should be taken into account along with individual risk factors.

Acknowledgment A part of this study was presented as a poster presentation at the Febrile Neutropenia Symposium, February 2005, Ankara, Turkey, and the Interscience Conference on Antimicrobial Agents and Chemotherapy, December 2005, Washington, DC, USA. Ethics Ethics Committee Approval: LUT 05/15; Informed Consent: It was taken.

Authorship Contributions Concept: Nursel Çalık Başaran, Ergun Karaağaoğlu, Gülşen Hasçelik, Mine Durusu Tanrıöver, Murat Akova; Design: Nursel Çalık Başaran, Ergun Karaağaoğlu, Gülşen Hasçelik, Mine Durusu Tanrıöver, Murat Akova; Data Collection or Processing: Nursel Çalık Başaran, Ergun Karaağaoğlu, Gülşen Hasçelik, Mine Durusu Tanrıöver, Murat Akova; Analysis or Interpretation: Nursel Çalık Başaran, Ergun Karaağaoğlu, Gülşen Hasçelik, Mine Durusu Tanrıöver, Murat Akova; Literature Search: Nursel Çalık Başaran, Ergun Karaağaoğlu, Gülşen Hasçelik, Mine Durusu Tanrıöver, Murat Akova; Writing: Nursel Çalık Başaran, Ergun Karaağaoğlu, Gülşen Hasçelik, Mine Durusu Tanrıöver, Murat Akova.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, 317

Çalık Başaran N, et al: Infection Episodes in Cancer Patients

and/or affiliations relevant to the subject matter or materials included.

References 1. Koll BS, Brown AE. The changing epidemiology of infections at cancer hospitals. Clin Infect Dis 1993;17(Suppl 2):S322-328.

2. Soave R, Sepkowitz KZ. The immunocompromised host. In: Reese RE, Betts RF (eds). A Practical Approach to Infectious Diseases, 3rd ed. Boston, Little, Brown & Co., 1991.

3. Wisplinghoff H, Seifert H, Wenzel RP, Edmond MB. Current trends in the epidemiology of nosocomial bloodstream infections in patients with hematological malignancies and solid neoplasms in hospitals in the United States. Clin Infect Dis 2003;36:1103-1110.

4. Pizzo PA. Management of fever in patients with cancer and treatmentinduced neutropenia. N Engl J Med 1993;328:1323-1332.

5. Serody JS. Fever in immunocompromised patients. N Engl J Med 2000;342:217-218.

6. Crowe MJ, Cooke EM. Review of case definitions for nosocomial infection-towards a consensus. Presentation by the Nosocomial Infection Surveillance Unit (NISU) to the Hospital Infection Liaison Group, subcommittee of the Federation of Infection Societies (FIS). J Hosp Infect 1998;39:3-11.

7. Klastersky J. Management of fever in neutropenic patients with different risks of complications. Clin Infect Dis 2004;39(Suppl 1):S32-37.

8. Madani TA. Clinical infections and bloodstream isolates associated with fever in patients undergoing chemotherapy for acute myeloid leukemia.

Infection 2000;28:367-373.

9. Srinivasan A, Wang C, Srivastava DK, Burnette K, Shenep JL, Leung W, Hayden RT. Timeline, epidemiology, and risk factors for bacterial, fungal, and viral infections in children and adolescents after allogeneic hematopoietic stem cell transplantation. Biol Blood Marrow Transplant 2013;19:94-101.

10. Akova M, Akan H, Korten V, Biberoğlu K, Hayran M, Ünal S, Kars A, Kansu E. Comparison of meropenem with amikacin plus ceftazidime in the empirical treatment of febrile neutropenia: a prospective randomised multicentre trial in patients without previous prophylactic antibiotics. Meropenem Study Group of Turkey. Int J Antimicrob Agents 1999;13:15-19.

11. Erman M, Akova M, Akan H, Korten V, Ferhanoğlu B, Köksal I, Çetinkaya Y, Uzun Ö, Ünal S; Febrile Neutropenia Study Group of Turkey. Comparison of cefepime and ceftazidime in combination with amikacin in the empirical treatment of high-risk patients with febrile neutropenia: a prospective, randomized, multicenter study. Scand J Infect Dis 2001;33:827-831.

12. Gonzalez-Barca E, Fernandez-Sevilla A, Carratala J, Granena A, Gudiol F. Prospective study of 288 episodes of bacteremia in neutropenic cancer patients in a single institution. Eur J Clin Microbiol Infect Dis 1996;15:291296.

13. Whimbey E, Kiehn TE, Brannon P, Blevins A, Armstrong D. Bacteremia and fungemia in patients with neoplastic disease. Am J Med 1987;82:723-730.

14. EORTC International Antimicrobial Therapy Cooperative Group. Grampositive bacteraemia in granulocytopenic cancer patients. Eur J Cancer 1990;26:569-574.

15. Mikulska M, Del Bono V, Raiola AM, Bruno B, Gualandi F, Occhini D, di Grazia C, Frassoni F, Bacigalupo A, Viscoli C. Blood stream infections in allogeneic hematopoietic stem cell transplant recipients: reemergence of Gram-negative rods and increasing antibiotic resistance. Biol Blood Marrow Transplant 2009;15:47-53.

16. Cattaneo C, Antoniazzi F, Casari S, Ravizzola G, Gelmi M, Pagani C, D’Adda M, Morello E, Re A, Borlenghi E, Manca N, Rossi G. P. aeruginosa bloodstream infections among hematological patients: an old or new question? Ann Hematol 2012;91:1299-1304.

17. Gudiol C, Bodro M, Simonetti A, Tubau F, Gonzalez-Barca E, Cisnal M, Domingo-Domenech E, Jimenez L, Carratala J. Changing aetiology, clinical features, antimicrobial resistance, and outcomes of bloodstream infection in neutropenic cancer patients. Clin Microbiol Infect 2013;19:474-479.

318

Turk J Hematol 2016;33:311-319

18. Trecarichi EM, Pagano L, Candoni A, Pastore D, Cattaneo C, Fanci R, Nosari A, Caira M, Spadea A, Busca A, Vianelli N, Tumbarello M; HeMABIS RegistrySEIFEM Group, Italy. Current epidemiology and antimicrobial resistance data for bacterial bloodstream infections in patients with hematologic malignancies: an Italian multicentre prospective survey. Clin Microbiol Infect 2015;21:337-343.

19. Chen CY, Tsay W, Tang JL, Tien HF, Chen YC, Chang SC, Hsueh PR. Epidemiology of bloodstream infections in patients with haematological malignancies with and without neutropenia. Epidemiol Infect 2010;138:1044-1051.

20. Ghosh I, Raina V, Kumar L, Sharma A, Bakhshi S, Thulkar S, Kapil A. Profile of infections and outcome in high-risk febrile neutropenia: experience from a tertiary care cancer center in India. Med Oncol 2012;29:1354-1360.

21. Samonis G, Vardakas KZ, Maraki S, Tansarli GS, Dimopoulou D, Kofteridis DP, Andrianaki AM, Falagas ME. A prospective study of characteristics and outcomes of bacteremia in patients with solid organ or hematologic malignancies. Support Care Cancer 2013;21:2521-2526.

22. Poon LM, Jin J, Chee YL, Ding Y, Lee YM, Chng WJ, Chai LY, Tan LK, Hsu LY. Risk factors for adverse outcomes and multidrug-resistant Gramnegative bacteraemia in haematology patients with febrile neutropenia in a Singaporean university hospital. Singapore Med J 2012;53:720-725.

23. Kara Ö, Zarakolu P, Aşçıoğlu S, Etgül S, Uz B, Büyükaşık Y, Akova M. Epidemiology and emerging resistance in bacterial bloodstream infections in patients with hematologic malignancies. Infect Dis (Lond) 2015;47:686693.

24. Gudiol C, Tubau F, Calatayud L, Garcia-Vidal C, Cisnal M, Sanchez-Ortega I, Duarte R, Calvo M, Carratala J. Bacteraemia due to multidrug-resistant Gram-negative bacilli in cancer patients: risk factors, antibiotic therapy and outcomes. J Antimicrob Chemother 2011;66:657-663.

25. Kim SH, Kwon JC, Choi SM, Lee DG, Park SH, Choi JH, Yoo JH, Cho BS, Eom KS, Kim YJ, Kim HJ, Lee S, Min CK, Cho SG, Kim DW, Lee JW, Min WS. Escherichia coli and Klebsiella pneumoniae bacteremia in patients with neutropenic fever: factors associated with extended-spectrum beta-lactamase production and its impact on outcome. Ann Hematol 2013;92:533-541.

26. Trecarichi EM, Tumbarello M, Spanu T, Caira M, Fianchi L, Chiusolo P, Fadda G, Leone G, Cauda R, Pagano L. Incidence and clinical impact of extendedspectrum-β-lactamase (ESBL) production and fluoroquinolone resistance in bloodstream infections caused by Escherichia coli in patients with hematological malignancies. J Infect 2009;58:299-307.

27. Wang SS, Lee NY, Hsueh PR, Huang WH, Tsui KC, Lee HC, Wu CJ, Chang CM, Huang CC, Huang CF, Ko WC. Clinical manifestations and prognostic factors in cancer patients with bacteremia due to extended-spectrum β-lactamaseproducing Escherichia coli or Klebsiella pneumoniae. J Microbiol Immunol Infect 2011;44:282-288.

28. Mikulska M, Viscoli C, Orasch C, Livermore DM, Averbuch D, Cordonnier C, Akova M; Fourth European Conference on Infections in Leukemia Group (ECIL-4), a joint venture of EBMT, EORTC, ICHS, ELN and ESGICH/ESCMID. Aetiology and resistance in bacteraemias among adult and paediatric haematology and cancer patients. J Infect 2014;68:321-331.

29. Zarakolu P, Metan G, Hasçelik G, Akova M. Prevalence of extended-spectrum beta-lactamases in nosocomial Escherichia coli and Klebsiella spp. strains isolated from blood cultures. Mikrobiyol Bul 2007;41:579-584a (in Turkish with English abstract).

30. Du B, Long Y, Liu H, Chen D, Liu D, Xu Y, Xie X. Extended-spectrum beta-lactamase-producing Escherichia coli and Klebsiella pneumoniae bloodstream infection: risk factors and clinical outcome. Intensive Care Med 2002;28:1718-1723.

31. Kang CI, Chung DR, Ko KS, Peck KR, Song JH; Korean Network for Study of Infectious Diseases. Risk factors for infection and treatment outcome of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae bacteremia in patients with hematologic malignancy. Ann Hematol 2012;91:115-121.

32. Eggimann P, Sax H, Pittet D. Catheter-related infections. Microbes Infect 2004;6:1033-1042.

33. Rosa RG, Goldani LZ, dos Santos RP. Risk factors for multidrug-resistant

Turk J Hematol 2016;33:311-319

Çalık Başaran N, et al: Infection Episodes in Cancer Patients

bacteremia in hospitalized cancer patients with febrile neutropenia: a cohort study. Am J Infect Control 2014;42:74-76.

and outcomes in 528 episodes in a single cancer center. Medicine (Baltimore) 2014;93:143-149.

34. Anatoliotaki M, Valatas V, Mantadakis E, Apostolakou H, Mavroudis D, Georgoulias V, Rolston KV, Kontoyiannis DP, Galanakis E, Samonis G. Bloodstream infections in patients with solid tumors: associated factors, microbial spectrum and outcome. Infection 2004;32:65-71.

39. Cornely OA, Gachot B, Akan H, Bassetti M, Uzun O, Kibbler C, Marchetti O, de Burghgraeve P, Ramadan S, Pylkkanen L, Ameye L, Paesmans M, Donnelly JP; EORTC Infectious Diseases Group. Epidemiology and outcome of fungemia in a cancer cohort of the Infectious Diseases Group (IDG) of the European Organization for Research and Treatment of Cancer (EORTC 65031). Clin Infect Dis 2015;61:324-331.

35. Mrázová-Studená M, Drgona L, Spánik S, Krúpová I, Baláz M, Pichna P, Koren P, Sufliarsky J, Mardiak J, Kunová A, Trupl J, Krcméry V Jr. Bacteremia in neutropenic versus nonneutropenic cancer patients: etiology and outcome in 401 episodes. Neoplasma 1997;44:314-318.

36. Velasco E, Byington R, Martins CA, Schirmer M, Dias LM, Goncalves VM. Comparative study of clinical characteristics of neutropenic and nonneutropenic adult cancer patients with bloodstream infections. Eur J Clin Microbiol Infect Dis 2006;25:1-7.

40. Chan TS, Marcella SW, Gill H, Hwang YY, Kwong YL. Posaconazole versus fluconazole or itraconazole for prevention of invasive fungal diseases in patients with acute myeloid leukemia or myelodysplastic syndrome: a costeffectiveness analysis in an Asian teaching hospital. J Med Econ 2016;19:77-83.

37. Marin M, Gudiol C, Ardanuy C, Garcia-Vidal C, Jimenez L, DomingoDomenech E, Perez FJ, Carratala J. Factors influencing mortality in neutropenic patients with haematologic malignancies or solid tumours with bloodstream infection. Clin Microbiol Infect 2015;21:583-590.

41. El-Cheikh J, Crocchiolo R, Vai A, Furst S, Bramanti S, Sarina B, Granata A, Faucher C, Mohty B, Harbi S, Bouabdallah R, Vey N, Santoro A, Chabannon C, Castagna L, Blaise D. Comparison of three distinct prophylactic agents against invasive fungal infections in patients undergoing haploidentical hematopoietic stem cell transplantation and post-transplant cyclophosphamide. Mediterr J Hematol Infect Dis 2015;7:e2015048.

38. Marin M, Gudiol C, Garcia-Vidal C, Ardanuy C, Carratala J. Bloodstream infections in patients with solid tumors: epidemiology, antibiotic therapy,

42. Bow EJ, Vanness DJ, Slavin M, Cordonnier C, Cornely OA, Marks DI, Pagliuca A, Solano C, Cragin L, Shaul AJ, Sorensen S, Chambers R, Kantecki M, Weinstein D,

319

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0254 Turk J Hematol 2016;33:320-325

Effect of Hereditary Hemochromatosis Gene H63D and C282Y Mutations on Iron Overload in Sickle Cell Disease Patients Orak Hücreli Anemi Hastalarında Herediter Hemokromatozis Geni H63D ve C282Y Mutasyonlarının Demir Birikimi Üzerindeki Etkisi Yunus Kasım Terzi1, Tuğçe Bulakbaşı Balcı1, Can Boğa2, Zafer Koç3, Zerrin Yılmaz Çelik1, Hakan Özdoğu2, Sema Karakuş2, Feride İffet Şahin1 1Başkent University Faculty of Medicine, Department of Medical Genetics, Ankara, Turkey 2Başkent University Faculty of Medicine, Department of Hematology, Ankara, Turkey 3Başkent University Faculty of Medicine, Department of Radiology, Ankara, Turkey

Abstract

Öz

Objective: Hemochromatosis is an autosomal recessive disease that is one of the most important reasons for iron overload. Sickle cell disease is a hemoglobinopathy that occurs as a result of a homozygous mutation in the hemoglobin gene. Erythrocyte transfusion is frequently used in the treatment of this disease. Iron overload as a result of transfusion is important in the mortality and morbidity of sickle cell anemia patients as well as in other hemoglobinopathies.

In this study, the effect of hemochromatosis gene (HFE) p.H63D and p.C282Y mutations on transfusion-related cardiac and liver iron overload in sickle cell disease patients who carry homozygous hemoglobin S mutation has been investigated.

Amaç: Hemokromatozis, demir birikiminin önemli nedenlerinden biri olan otozomal resesif bir hastalıktır. Orak hücreli anemi, hemoglobin genindeki homozigot mutasyon sonucu ortaya çıkan bir hemoglobinopatidir. Eritrosit transfüzyonu, bu hastalığın tedavisinde sıklıkla kullanılmaktadır. Transfüzyonun yarattığı demir yükü diğer hemoglobinopatilerde olduğu gibi orak hücreli anemi hastalarının mortalite ve morbiditesinde önem kazanmaktadır. Bu çalışmada hemokromatozis geni (HFE) p.H63D ve p.C282Y mutasyonlarının, homozigot hemoglobin S mutasyonu taşıyan orak hücreli anemi hastalarında, kalp ve karaciğerde transfüzyonla ilişkili demir yüklenmesine olan etkisi araştırılmıştır.

Materials and Methods: This is a prospective single-center crosssectional study in patients with homozygous hemoglobin S mutation between the years 2008 and 2013. The patients were divided into two groups. The first group (group A, n=31) was receiving chelation therapy and the second group (group B, n=13) was not. Direct and indirect iron loads were analyzed by magnetic resonance imaging and biochemically, respectively. HFE gene mutations were analyzed by polymerase chain reaction-restriction fragment length polymorphism method. Statistical analyses were performed by independent samples t-test.

Gereç ve Yöntemler: Bu çalışma, homozigot hemoglobin S mutasyonu olan hastalarda 2008-2013 yıllarını kapsayan prospektif, tek merkezli kesitsel bir çalışmadır. Hastalar şelasyon tedavisi alan (n=31) ve almayan (n=13) olarak iki gruba ayrıldı. Hastalarda direk ve endirekt demir yükü sırasıyla manyetik rezonans görüntüleme ve biyokimyasal olarak analiz edildi. HFE geni mutasyon analizi polimeraz zincir reaksiyonu-restriksiyon fragment uzunluk polimorfizmi yöntemleri ile gerçekleştirildi. İstatistik analizi Independent samples t-testi uygulanarak gerçekleştirildi.

Results: p.H63D mutation was detected in 10 (32.3%) patients in group A and in only 1 patient (7.7%) in group B. When the 2 groups were compared for iron overload, iron deposition in the liver was significantly higher in group B (p=0.046). In addition, in group A, iron deposition was significantly higher in HFE mutation carriers compared to patients without the mutation (p=0.05).

Bulgular: p.H63D mutasyonu grup A’da 10 hastada (%32,3), grup B’de ise sadece 1 (%7,7) hastada saptandı. Demir birikimi açısından gruplar karşılaştırıldığında karaciğerde demir birikiminin grup B’de istatistiksel olarak anlamlı derecede yüksek olduğu görülmüştür (p<0,05). Grup A’da, mutasyonu olan bireylerde olmayanlara göre karaciğerdeki demir birikiminin istatistiksel olarak anlamlı derecede yüksek olduğu görülmüştür (p=0,05).

Conclusion: Results of this study showed that HFE gene mutations are important in iron deposition in the liver in patients with sickle cell disease.

Sonuç: Bu çalışmanın sonucu HFE genindeki mutasyonların, orak hücreli anemi hastalarında karaciğerde demir birikimi üzerinde etkili olduğunu göstermektedir.

Keywords: Hemochromatosis, HFE gene, Iron overload, p.C282Y, p.H63D, Sickle cell anemia

Anahtar Sözcükler: Hemokromatozis, HFE geni, Demir birikimi, p.C282Y, p.H63D, Orak hücreli anemi

Address for Correspondence/Yazışma Adresi: Feride İffet ŞAHİN, M.D., Başkent University Faculty of Medicine, Department of Medical Genetics, Ankara, Turkey Phone : +90 312 232 44 00 E-mail : feridesahin@hotmail.com

320

Received/Geliş tarihi: June 27, 2015 Accepted/Kabul tarihi: September 15, 2015

Turk J Hematol 2016;33:320-325

Introduction Hereditary hemochromatosis (HH) is an autosomal recessive disease that is one of the important reasons for transfusionunrelated iron deposition [1]. The hemochromatosis (HFE) gene, encoding a transferrin receptor binding protein that regulates iron absorption from the intestine, is responsible for the disease and its point mutations result in increased iron absorption and accumulation [2,3].

The penetrance of the disease is low, as only 1% of p.C282Y homozygous individuals have clinical presentations. The disease phenotype results from primary or secondary causes.

Primary (hereditary) hemochromatosis is usually due to gene mutations including the HFE gene as well as other genes including transferrin receptor-2 and ferroportin. Secondary hemochromatosis is a result of inherited or acquired anemia requiring frequent erythrocyte transfusions [1]. The hereditary causes of secondary hemochromatosis include thalassemia, hereditary spherocytosis, and sideroblastic anemia, and the acquired diseases include anemia due to blood loss [1].

Sickle cell anemia is a hemoglobinopathy resulting from a homozygous point mutation in the hemoglobin gene characterized by sickling of erythrocytes [4]. Sickling results in vaso-occlusion, hemolysis, and chronic anemia, which results in increased cardiac output due to volume overload and hypoxia as a result of vaso-occlusion, which ends with organ dysfunction [5]. Erythrocyte and blood transfusions are frequently used in the treatment of the disease. Transfusion-related iron overload is important in mortality and morbidity of sickle cell anemia patients like in other hemoglobinopathies [3,6]. Mutation frequencies are known to be different between ethnic groups.

In the current study, the relationship between HFE gene p.H63D and p.C282Y mutations and iron deposition occurring during sickle cell anemia progress and their effect on cardiac and liver iron overload have been investigated.

Materials and Methods Patients The study was performed as a prospective, single-center, crosssectional study on homozygous hemoglobin S mutation patients followed in the adult hematology department between 2008 and 2013. A total of 45 patients aged between 20 and 42 years were enrolled in the study and divided into two groups according to administration of chelation treatment. Patients in group A (n=31) were receiving chelation treatment and those in group B (n=13) were not. There were 21 male and 10 female patients in group A and 4 male and 9 female patients in group B. Patients in group A received deferasirox (Exjade, Novartis, Switzerland) therapy when they had evidence of chronic transfusional iron

Terzi YK, et al: HFE Mutations and Iron Overload

overload. This evidence included the transfusion of at least 100 mL/kg of packed red blood cells, or a serum ferritin level consistently greater than 1000 µg/L. Initial daily dose was 20 mg/kg, per os. All patients required escalation of 5 to 10 mg/kg per daily dose to keep serum ferritin from consistently falling from baseline. If the serum ferritin fell below 500 µg/L, the therapy was interrupted. Duration of therapy was 30 months (range: 18-44 months).

Patients with contraindications for magnetic resonance imaging (MRI) were excluded from the study. Clinical and laboratory information of the patients was obtained from the hospital information management system (Nucleus v9.3.39, Monad Ltd., Ankara, Turkey).

Hematological and Biochemical Analyses Blood cell count and aspartate aminotransferase and alanine aminotransferase levels were analyzed by automatized methods in the laboratory. Serum iron concentration (normal range: 59158 µg/dL), transferrin saturation (normal range: 15%-75%), serum ferritin (normal range: 40-340 ng/mL for males and 14-150 ng/mL for females), and C-reactive protein levels were detected by enzyme-linked immunosorbent assays.

Magnetic Resonance Imaging Analyses All imaging analyses were performed as described previously with slight modifications, and a 1.5T MRI system was used for these analyses (Avanto, Siemens, Erlangen, Germany) [7,8,9].

Briefly, liver and myocardial measurements included T2* value screenings. Screening time was 14 s. The scan duration was 14 s. The T2* of the heart was assessed by a cardiac gated single breath-hold multiecho technique. Midventricular short-axis images were obtained using a gradient-echo sequence (FOV, 440 mm; TR, 120 ms; TE, 3.0-21.7 ms [8 echo times]; flip angle, 20; slice thickness, 10 mm; matrix, 256x104; number of averages, 1; bandwidth in Hz/pixel, 814). To measure the liver iron concentration (LIC), phased-array torso coils were used for signal detection. The lung was excluded on the axial plane as much as possible. Liver T2* values were assessed by single breathhold multiecho technique. Axial images through the liver were obtained using a gradient-echo sequence (FOV, 400; TR, 120 ms; TE, 4.3-20.2 ms [6 echo times]; flip angle, 20; slice thickness, 10 mm; matrix, 256x80; number of averages, 1; bandwidth in Hz/ pixel, 814). T2* measurements were performed with Thalassemia Tools (Cardiovascular Imaging Solutions, London, UK). A fullthickness region of interest was drawn in the interventricular septum. The signal intensity of this region for each echo time was measured and plotted as an exponential signal decay curve.

The lower limit of normal for T2* in the detection of myocardial iron deposition has been reported as 20 ms, and this value was used as the cut-off in this study [7,8,9]. A T2* value of >20 ms indicated no cardiac iron overload, and ≤20 ms indicated 321

Terzi YK, et al: HFE Mutations and Iron Overload

Turk J Hematol 2016;33:320-325

cardiac iron overload [10]. Liver iron deposition was evaluated

by R2* value (R2*=1000/T2*). The R2* value was converted to a liver biopsy equation by using the calibration curve drawn during the study [11]. LIC in dry tissue of >1.6 mg Fe/g was regarded as hepatic siderosis.

A, liver iron deposition was significantly higher in patients with mutations compared to the patients without mutations (p=0.05) (Table 4). C282Y mutation was not observed in any of the patients included in the study (Table 3).

Discussion

HFE Gene p.H63D and p.C282Y Mutation Analyses DNA isolation was done from peripheral blood samples of the patients who were included in the study and signed the informed consent form. HFE gene p.H63D and p.C282Y mutations were analyzed by polymerase chain reaction (PCR)-restriction fragment length polymorphism. Primer sequences and product sizes for p.H63D and p.C282Y mutations are shown in Table 1.

PCR conditions were 15 min at 95 °C for initial denaturation, followed by 35 cycles of 45 s at 94 °C, 30 s at 58 °C, and 30 s at 72 °C. The PCR was completed after a final elongation step of 7 min at 72 °C. PCR products were digested with BclI and RsaI restriction endonucleases for H63D and C282Y mutation analyses, respectively. The band lengths after digestion are shown in Table 1. A gel image of the digested products is shown in Figure 1.

Statistical Analysis

Humans do not have a physiologic mechanism to excrete excess iron absorbed from the intestine. Iron metabolism is strictly controlled by intestinal absorption [12]. In the case of increased iron absorption, iron deposits occur in all organs. As iron accumulation is a problem directly influencing the prognosis in sickle cell disease patients, we proposed that coexisting HFE mutations could contribute to the deposition process in these cases.

HH is characterized by hepatic fibrosis, cirrhosis, diabetes, skin pigmentation, hypogonadism, and articular and cardiac disorders and, in advanced stages of the disease, iron deposition in other organs as a result of increased iron absorption from the intestines [10]. The disease occurs as a result of HFE gene H63D and C282Y mutations [13].

The Kolmogorov-Smirnovtest was used to show the normal distribution of the data. Significant differences between groups were determined using t tests. Data were expressed as means.

All statistical analyses and tests were performed with the SPSS statistical package (SPSS 17.0, Chicago, IL, USA) and p<0.05 was regarded as statistically significant.

Results A total of 45 patients aged between 20 and 42 years were enrolled in the study. There were 20 male and 11 female patients in group A and 5 male and 9 female patients in group B. All patients were homozygous for the hemoglobin S mutation. Biochemical and MRI results of group A and group B patients are shown in Table 2. When the 2 groups were compared for iron deposition in the liver, iron deposition was found to be significantly lower in group A (p=0.05). In addition, platelet count was found to be significantly higher in group A (p<0.03). We did not observe a statistically significant difference between the 2 groups when other MRI and biochemical values were compared.

HFE gene H63D mutation was detected in 10 (32.3%) patients in group A and in 1 (7.7%) patient in group B (Table 3). In group

Figure 1. Gel image of H63D and C282Y mutations analyzed by polymerase chain reaction-restriction fragment length polymorphism. Lanes 1 and 5 are uncut polymerase chain reaction products, lanes 2 and 3 are samples from patients normal for H63D mutation, and lane 4 is a heterozygous patient sample.

Lanes 6-8 are normal patient samples for C282Y mutation.

Table 1. Primer sequences, amplicon lengths, and restriction enzymes used in the study.

Mutation

Forward Primer (5’-3’)

Reverse Primer (5’-3’)

Amplicon (bp)

Restriction Endonuclease Enzyme

p.H63D

ACATGGTTAAGGCCTGTTGC

GCCACATCTGGCTTGAAATT

208

BclI

p.C282Y

TGGCAAGGGTAACAGATCC

CTCAGGCACTCCTCTCAACC

387

RsaI

322

Terzi YK, et al: HFE Mutations and Iron Overload

Turk J Hematol 2016;33:320-325

Table 2. Biochemical and magnetic resonance imaging results of patients in group A and group B. Liver iron deposition and platelet count were found to be significantly different in group A compared to group B (*p<0.05). t-test Mean

Distributions

Group A

Group B

Highest

Lowest

p-value

Cardiac MRI (T2*, ms)

20.4

27.7

-19.78

5.03

0.238

Liver MRI (Fe, mg/g)

1.2

2.1

-1.83

-0.02

0.046*

Ferritin (ng/mL)

547.9

809.6

-734.08

210.76

0.259

Transferrin saturation (%)

46.7

27.8

-0.47

38.35

0.055

CRP (mg/L)

14.8

16.1

-15.04

12.44

0.845

ALT (U/L)

23.1

31.0

-20.99

5.10

0.209

AST (U/L)

40.6

48.9

-27.95

11.53

0.377

Leukocyte count (x103/µL)

12.5

11.0

-1.37

4.42

0.290

Platelet number (x103/µL)

430.1

329.6

10.27

190.64

0.030*

Serum albumin (g/dL)

3.9

3.7

-0.57

1.03

0.543

Creatinine (mg/dL)

0.8

0.9

-0.62

0.30

0.483

Hemoglobin (g/dL)

9.2

9.3

-1.32

1.00

0.782

MCV (fL)

89.3

89.9

-11.26

10.02

0.905

MRI: Magnetic resonance imaging, CRP: C-reactive protein, ALT: alanine aminotransferase, AST: aspartate aminotransferase, MCV: mean corpuscular volume.

Table 3. Genotype and allele frequencies of patients in the 2 groups.

p.H63D

p.C282Y

Group A

Genotype

Allele frequency (%)

CC

21

GG

31

CG

9

GA

-

GG

1

AA

-

C

82.3

G

100

G

17.7

A

0

CC

13

GG

14

CG

1

GA

-

GG

-

AA

-

C

96.4

G

100

G

3.6

A

0

Group B

Genotype

Allele frequency (%)

Sickle cell anemia is one of the most frequent hereditary anemias resulting from a homozygous point mutation in the hemoglobin gene [14]. Endothelial cell activation and microvascular ischemia may cause tissue damage in sickle cell anemia, and the spectrum of clinical outcomes and tissue damage severity varies among individuals. Because of the above findings, it was suggested that although sickle cell anemia is a single-gene disease, it should be assessed as a multifactorial disorder [15]. Blood transfusion and blood change, used frequently in the treatment of the disease, cause a decrease in erythrocyte number and sickle cell hemoglobin polymer formation. However, as a result of treatment, iron deposition and organ damage occur in patients [12,16]. In our study, the relationship between iron deposition

and HFE gene H63D and C282Y mutations has been investigated.

A total of 45 patients were enrolled in the study.

HFE gene mutations have been investigated in another hemoglobinopathy, thalassemia, and the presence of a single mutation was not found to affect iron overload [3]. The effect of the presence of these mutations has been also investigated in sickle cell anemia and they were not found to affect the degree of iron overload [13,14].

C282Y mutation was observed in 90% of hemochromatosis patients previously [10]. We did not observe this mutation in our patients. On the other hand, we observed H63D mutation in a heterozygous state in 9 patients (29%) and in a homozygous state in 1 (3%) patient in group A. The mutation was observed in a heterozygous state in only 1 patient in group B (Table 3).

The effect of H63D mutation on iron deposition has not yet been clearly identified. Iron deposition in the liver was found to be significantly higher in group B (p<0.05). In the literature, in some sickle cell patients who received chelating agents, iron deposition in tissues was observed, whereas in others it was not [1,4]. Our results show that genetic backgrounds of patients affect the results of the treatment and clinical benefits from treatment.

The C282Y mutation has been reported to be more effective in iron absorption equilibrium than the H63D mutation [2,10].

As we did not find the C282Y mutation in our patients, we concluded that the H63D mutation could also be effective on iron absorption even in the heterozygous state.

323

Terzi YK, et al: HFE Mutations and Iron Overload

Turk J Hematol 2016;33:320-325

Table 4. Biochemical and magnetic resonance imaging measurement results of patients in group A. Liver iron deposition was found to be significantly higher (*p=0.05) in patients with HFE mutations compared to the patients without HFE mutations.

Mean

t-test Distributions

Highest

p-value

HFE Mutation-negative

HFE Mutation-positive

Lowest

Cardiac MRI (T2*, ms)

19.429

11.061

-7.43

24.17

0.283

Liver MRI (Fe, mg/g)

0.892

2

-1.44

0.00

0.050*

Ferritin (ng/mL)

444.533

599.083

-675.17

366.07

0.528

Transferrin saturation (%)

44.625

35

-56.17

75.42

0.740

CRP (mg/L)

20.652

10

-13.22

34.67

0.364

ALT (U/L)

21.350

20.857

-6.55

7.54

0.886

AST (U/L)

34.650

47.500

-39.96

14.26

0.292

Leukocyte count (x103/µL)

12.271

12.549

-4.48

3.93

0.890

Thrombocyte number (x103/µL)

427.333

434.125

-179.93

166.34

0.932

Serum albumin (g/dL)

3.999

3.823

-1.46

1.81

0.781

Creatinine (mg/dL)

0.893

0.566

-0.31

0.96

0.277

Hemoglobin (g/dL)

9.255

9

-1.31

1.45

0.917

MCV (fL)

90.300

84.025

-8.60

21.15

0.370

MRI: Magnetic resonance imaging, CRP: C-reactive protein, ALT: alanine aminotransferase, AST: aspartate aminotransferase, MCV: mean corpuscular volume, HFE: Hemochromatosis gene.

Although determination of ferritin level is an indirect method, it is one of the most valuable tools for follow-up of iron overload in patients with hemoglobinopathy. The source of the ferritin in the blood may be different. In the case of high levels of ferritin (3000 µg/L), the possible source is blood and bone marrow; however, if the measurable level of ferritin is below 3000 µg/L, the possible source of ferritin is the reticuloendothelial system. Fluctuation of the measured ferritin level may be observed in the case of infection or inflammations. It has already been shown that the most accurate indicator of total body ferritin load is liver ferritin level [9]. Although liver biopsy was not performed for the patients to determine the ferritin load of the liver, and this may be considered as a weakness of the study, MRI is one of the other valuable tools to determine ferritin load in the liver and heart, and reproducibility is one of the strong features of this method [11].

Conclusion HFE gene mutations are effective on iron deposition in the liver in sickle cell disease patients. In patients for whom recurrent erythrocyte transfusions are required, genotyping of the HFE gene will be helpful while management with chelating agents is being planned.

Acknowledgments This study was approved by the Başkent University Institutional Review Board (Project No: KA09/254) and supported by the Başkent University Research Fund.

324

Ethics Ethics Committee Approval: This study was approved by Başkent University Institutional Review Board (Project no: KA09/254); Informed Consent: Written informed consent was obtained from all patients.

Authorship Contributions Surgical and Medical Practices: Can Boğa, Hakan Özdoğu, Sema Karakuş, Zafer Koç; Concept: Tuğçe Bulakbaşı Balcı, Feride İffet Şahin, Zerrin Yılmaz Çelik, Can Boğa, Hakan Özdoğu, Sema Karakuş; Design: Tuğçe Bulakbaşı Balcı, Feride İffet Şahin, Zerrin Yılmaz Çelik, Can Boğa, Hakan Özdoğu, Sema Karakuş, Zafer Koç; Data Collection or Processing: Feride İffet Şahin, Zerrin Yılmaz Çelik, Can Boğa, Hakan Özdoğu, Sema Karakuş, Zafer Koç, Yunus Kasım Terzi; Analysis or Interpretation: Yunus Kasım Terzi, Feride İffet Şahin, Can Boğa, Hakan Özdoğu, Zafer Koç; Literature Search: Tuğçe Bulakbaşı Balcı, Feride İffet Şahin, Zerrin Yılmaz Çelik, Can Boğa, Hakan Özdoğu, Zafer Koç, Yunus Kasım Terzi; Writing: Feride İffet Şahin, Yunus Kasım Terzi, Can Boğa, Zafer Koç.

Conflict of Interest: No conflict of interest was declared by the authors.

Financial Disclosure: Support provided by Başkent University Research Foundation (Project no: KA09/254).

Turk J Hematol 2016;33:320-325

References 1. Beutler E, Hoffbrand AV, Cook JD. Iron deficiency and overload. Hematology Am Soc Hematol Educ Program 2003:40-61.

2. Press RD. Hereditary hemochromatosis: impact of molecular and iron-based testing on the diagnosis, treatment, and prevention of a common, chronic disease. Arch Pathol Lab Med 1999;123:1053-1059.

3. Longo F, Zecchina G, Sbaiz L, Fischer R, Piga A, Camaschella C. The influence of hemochromatosis mutations on iron overload of thalassemia major.

Haematologica 1999;84:799-803.

4. Harmatz P, Butensky E, Quirolo K, Williams R, Ferrell L, Moyer T, Golden D, Neumayr L, Vichinsky E. Severity of iron overload in patients with sickle cell disease receiving chronic red blood cell transfusion therapy. Blood 2000;96:76-79.

5. Karakaş MF, Büyükkaya E, Kurt M, Çelik M, Karakaş E, Büyükkaya S, Akçay AB, Sen N. Left ventricular dyssynchrony is an early manifestation of heart involvement in sickle cell anemia. Echocardiography 2013;30:521-526.

6. Boga C, Kozanoglu I, Ozdogu H, Ozyurek E. Plasma exchange in critically ill patients with sickle cell disease. Transfus Apher Sci 2007;37:17-22.

7. Anderson LJ. Assessment of iron overload with T2* magnetic resonance imaging. Prog Cardiovasc Dis 2011;54:287-294.

8. Bayraktaroğlu S, Aydinok Y, Yildiz D, Uluer H, Savaş R, Alper H. The relationship between the myocardial T2* value and left ventricular volumetric and functional parameters in thalassemia major patients. Diagn Interv Radiol 2011;17:346-351.

Terzi YK, et al: HFE Mutations and Iron Overload

9. Wood JC, Enriquez C, Ghugre N, Tyzka JM, Carson S, Nelson MD, Coates TD. MRI R2 and R2* mapping accurately estimates hepatic iron concentration in transfusion-dependent thalassemia and sickle cell disease patients. Blood 2005;106:1460-1465.

10. Yönal O, Hatirnaz O, Akyüz F, Ozbek U, Demir K, Kaymakoglu S, Okten A, Mungan Z. HFE gene mutation, chronic liver disease, and iron overload in Turkey. Dig Dis Sci 2007;52:3298-3302.

11. Garbowski MW, Carpenter JP, Smith G, Roughton M, Alam MH, He T, Pennell DJ, Porter JB. Biopsy-based calibration of T2* magnetic resonance for estimation of liver iron concentration and comparison with R2 Ferriscan. J Cardiovasc Magn Reson 2014;16:40.

12. Bozkaya H, Bektas M, Metin O, Erkan O, Ibrahimoglu D, Dalva K, Akbiyik F, Gurel S, Bozdayi AM, Akay C, Yurdaydin C, Aslan O, Uzunalimoglu O. Screening for hemochromatosis in Turkey. Dig Dis Sci 2004;49:444-449.

13. Trent RJ, Le H, Yu B, Young G, Bowden DK. DNA testing for haemochromatosis: diagnostic, predictive and screening implications. Pathology 2000;32:274279.

14. Raghupath R, Manvani D, Little JA. Iron overload in sickle cell disease. Adv Hematol 2010;2010:272940.

15. Kutlar A. Sickle cell disease: a multigenic perspective of a single gene disorder. Hemoglobin 2007;31:209-224.

16. Jeng MR, Adams-Graves P, Howard TA, Whorton MR, Li CS, Ware RE. Identification of hemochromatosis gene polymorphisms in chronically transfused patients with sickle cell disease. Am J Hematol 2003;74:243-248.

325

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0356 Turk J Hematol 2016;33:326-330

Health-Related Quality of Life, Depression, Anxiety, and Self-Image in Acute Lymphocytic Leukemia Survivors Akut Lenfoblastik Lösemi Tedavisi Almış Çocuklarda Yaşam Kalitesi, Depresyon, Anksiyete ve Kendilik İmajı Değerlendirmesi Birol Baytan1, Çiğdem Aşut2, Arzu Çırpan Kantarcıoğlu1, Melike Sezgin Evim1, Adalet Meral Güneş1 1Uludağ University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Bursa, Turkey 2Uludağ University Faculty of Medicine, Department of Pediatrics, Bursa, Turkey

Abstract

Öz

Objective: With increasing survival rates in childhood acute lymphocytic leukemia (ALL), the long-term side effects of treatment have become important. Our aim was to investigate health-related quality of life, depression, anxiety, and self-image among ALL survivors.

Amaç: Akut lenfoblastik lösemide (ALL) sağkalım oranlarının artmasıyla tedavinin uzun süreli yan etkileri önemli hale gelmiştir.

Bu çalışmanın amacı da ALL sağkalanlarında, sağlıkla ilişkili yaşam kalitesi, depresyon, anksiyete ve kendilik imajını incelemektir.

Materials and Methods: Fifty patients diagnosed with ALL and their siblings were enrolled. The Kovacs Children’s Depression Inventory, State-Trait Anxiety Inventory, Offer Self-Image Questionnaire, and Pediatric Quality of Life InventoryTM were used for collecting data.

ANOVA tests were used to determine if there were any significant differences between groups.

Gereç ve Yöntemler: ALL tanısı almış 50 çocuk ile onların aynı sayıdaki sağlıklı kardeşleri çalışmaya dahil edilmiştir. Verileri toplamak için, Kovaks Çocuklar için Depresyon Anketi, Durumluluk-Sürekli Kaygı Envanteri, Offer Kendilik İmajı anketi ve Pediatric Quality of Life InventoryTM kullanılmıştır. Gruplar arası farklar ANOVA yöntemi kullanılarak araştırılmıştır.

Results: ALL survivors had higher depression, more anxiety symptoms, lower quality of life, and more negative self-image when compared to their siblings.

Conclusion: Continuous diagnostic and interventional mental health services might be necessary for possible emotional side effects of treatment during and after the treatment. Rehabilitation and followup programs should be implemented for children during and after treatment for ALL. Keywords: Childhood leukemia, Depression, Anxiety, Self-image, Health-related quality of life

Introduction Acute lymphoblastic leukemia (ALL) is the most common type of childhood cancer. Over the past decades, survival rates have improved substantially [1,2]. Among the advances in ALL treatment, Health-related quality of life (HRQL), which is a multidimensional construct that encompasses several domains such as physical, cognitive, social, and emotional functioning, was recognized as an important outcome measure of ALL survivors [3].

Bulgular: ALL sağkalanlarının, kardeşlerine göre, depresyon ve anksiyete puanları anlamlı olarak fazladır. Ayrıca, benlik imajlarının daha olumsuz, yaşam kalitelerinin daha düşük idi.

Sonuç: ALL tedavisi sırasında ve sonrasında olası duygusal yan etkiler için sürekli tanısal ve girişimsel mental sağlık servisleri gerekli olabilir.

Tedavi sırasında ve sonrasında ALL’li çocuklar için rehabilitasyon ve izlem programları uygulanmalıdır.

Anahtar Sözcükler: Çocukluk çağı lösemisi, Depresyon, Anksiyete, Kendilik imajı, Sağlıkla ilişkili yaşam kalitesi

Bansal et al. [4] found that children with ALL have significantly poorer social, physical, and emotional health and well-being than their peers and siblings. All treatment protocols of ALL contain higher cumulative doses of asparaginase, vincristine, and corticosteroids. Significant treatment-related toxicities might develop during the treatment period. These treatment outcomes might affect HRQL adversely [5].

Besides poorer HRQL, behavioral and emotional problems, including withdrawal, depression, anxiety, and attention problems, have been reported among children with ALL [6].

Address for Correspondence/Yazışma Adresi: Birol BAYTAN, M.D., Uludağ University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Bursa, Turkey Phone : +90 224 295 06 03 E-mail : baytanbirol@yahoo.com

326

Received/Geliş tarihi: October 12, 2015 Accepted/Kabul tarihi: January 11, 2016

Turk J Hematol 2016;33:326-330

Some studies determined that long-term survivors of childhood cancer experience a great number of problems with social competence and symptoms of depression compared to healthy children and siblings [7,8].

Another important area of psychological outcome that has not been studied widely is the impact of cancer on the survivor’s self-image. This has been defined as a set of self-attitudes that reflect a description and an evaluation of one’s own behavior and attributes [9]. Self-image may be influenced by a chronic illness during childhood that affects physical appearance and opportunities for social interaction [10]. Having negative selfimage could be predictive of those survivors with adjustment problems [11].

In the course of intensive therapy for ALL, there is a significant impairment in quality of life in the physical and psychosocial domains, but it improves significantly after a period of time [4]. Our study includes ALL patients in remission for 2-13 years.

We analyzed the time periods in 3 different groups (2-5 years, 6-10 years, and more than 10 years of survival) to determine the effect of the time after treatment on behavior and HRQL. The aim of this study, therefore, was to investigate HRQL, selfimage, depression, anxiety behaviors, and the impact of time period after treatment among ALL survivors.

Materials and Methods The study group contained 50 children in the complete remission period of ALL. The control group consisted of ALL patients’ siblings. The study group (standard and medium risk group) had no history of cranial radiation. The patients were treated with the BFM-9 leukemia protocol. Intrathecal methotrexate was given for central nervous system prophylaxis. The study group was composed of 27 (54%) female and 23 (46%) male participants. The age of the groups ranged between 13 and 18 years, and the average age of the study group was 15.8±1.8 years. The average age of the control group was 14.2±0.8 years.

The control group was chosen from age- and sex-matched siblings because they shared similar social environmental and genetic features with the study group, apart from not having been diagnosed with ALL. If the family’s monthly income was under 2000 Turkish lira (TL), participants were considered as a lower income group. If it was between 2000 and 5000, they were considered as a middle income group, and if it was above 5000 TL, they were considered as a higher income group.

The data of the study were gathered from 4 psychometrically validated self-report instruments. All of them were administered in one session to each participant separately.

Baytan B, et al: Emotional Status and Health Quality in Childhood ALL

The Kovacs Children’s Depression Inventory (KCDI) is filled out by the adolescent. In this 27-item scale, there are three choices for each item. The patient is asked to choose the most relevant choice for considering the last 2 weeks. Reliability and validity study of the Turkish version of the KCDI was carried out by Öy [12] and a score of 19 was identified as the cut-off level.

The State-Trait Anxiety Inventory assesses the anxiety levels of the participants. It consists of two parts. The State Anxiety Inventory (SAI) requires the individual to describe how she/ he feels at a given moment and under certain conditions and to respond to the items considering her/his feelings related to that specific condition. On the other hand, the Trait Anxiety Inventory (TAI) makes individuals express how they feel in general. The total score of each scale ranges between 20 and 80. There are 4 choices for each item. High scores (more than 41 points) indicate high anxiety levels. The reliability and validity of the Turkish version of the SAI and TAI were studied by Öner and Le Compte [13].

The Offer Self-Image Questionnaire (OSIQ) was developed to identify the opinions of adolescents on self-esteem and sense of identity. Developed by Offer, Ostrov, Howard, and Dolan in 1989, the OSIQ is a 6-point Likert-type scale (choosing the answer that the individual identifies with best) and measures individuals’ adaptation in 11 different areas. The 99-item questionnaire form analyzes the self-image of adolescents in five dimensions (psychological, social, sexual, familial, and coping). Low scores (50 points and below) indicate low self-esteem. The reliability and validity of the Turkish version of the OSIQ were studied by Savaşır and Şahin [14].

The Pediatric Quality of Life Inventory (PedsQL) examines individuals’ physical, psychological, and spiritual functioning, which are the characteristics of general well-being as defined by the World Health Organization. In addition to these, the scale also emphasizes school functioning. It consists of two subscales, which are the total physical health score (TPHS) and total score of psychosocial health (TSPH), and there is a total scale score, which is the combination of these two subscales. This scale does not include a cut-off level but lower scores indicate poor quality of life. The reliability and validity of the Turkish version of the PedsQL was studied by Çakın Memik et al. [15].

This research was approved by the Uludağ University Medical Ethics Committee and therefore the research was performed in accordance with the ethical standards of the Helsinki Declaration.

SPSS 22.00 and ANOVA were used to determine if there were any significant differences between the groups.

Results The results from patients’ and siblings’ reports are summarized in Table 1.

327

Baytan B, et al: Emotional Status and Health Quality in Childhood ALL

Mean scores of the study and the control groups for self-report instruments are shown in Table 2.

Quality of life and self-image scores of ALL survivors were lower and depression and anxiety scores were higher than in the siblings. Table 3 shows the comparison of the quality of life, depression, anxiety, and self-image scores in the groups.

There were significant differences between groups. The study group had more depression and anxiety symptoms and negative selfTable 1. The demographic features of the study and control groups.

Study Group

Control Group

n

50

50

Sex

27 girls 23 boys

54% 48%

27 girls 23 boys

54% 48% 18% 18% 54% 8% 2%

Education Non-educated Primary school High school Undergraduate Graduate

9 5 30 5 1

18% 10% 60% 10% 2%

9 9 27 4 1

Income Low Medium High

9 39 2

18% 78% 4%

9 39 2

18% 78% 4%

Employment status Employed 6 Unemployed 44

12% 88%

7 43

14% 86%

Turk J Hematol 2016;33:326-330

image. Additionally, physical, psychological, and total qualities of life were lower than in their siblings. Table 4 shows mean scores of the depression, anxiety, quality of life, and self-image of survivors in different time periods after ALL treatment. Comparison of the depression, anxiety, quality of life, and self-image scores between ALL survivors and siblings is shown in Table 5.

There were significant differences between the groups’ TvPHS, STS, TSPH, and KCDI scores according to time period after ALL treatment. Depression and quality of life scores were lower in the group of survivors 2-5 years after treatment.

Discussion According to our study, the total quality of life score of the ALL survivors was significantly lower compared to their siblings and they had significantly lower self-concept (including the psychological, social, sexual, and familial self domains). Our study also showed that ALL survivors had significantly higher depression and anxiety symptoms than their siblings. Finally, our research revealed that the quality of life and depression scores were significantly lower among survivors 2-5 years after treatment when compared to 6-9 years and 10 years or more.

Liew et al. [16] reported that adult long-term ALL survivors had a global HRQL score similar to the general population. van Litsenburg et al. [8] reported clinically important impaired HRQL scores of ALL survivors compared to the norms. ALL treatment impairs daily activities, family life, and school success, leading to low quality of life [17]. It is known that hospitalization for chemotherapy leads to problems such as social alienation and

Table 2. Mean scores of the study and control groups for self-report instruments.

Groups

TPHS

TSPH

STS

KCDI

SAI

TAI

OSIQ

Study (n=50)

Mean

79.36

79.70

80.18

29.56

50.92

51.82

238.16

Standard deviation

16.73

15.15

13.52

5.75

7.31

5.24

50.02

Control (n=50)

Mean

95.10

85.46

90.06

22.80

41.58

42.22

281.08

Standard deviation

6.61

11.67

8.17

4.70

4.55

3.89

38.23

TPHS: Total physical health score, TSPH: total score of psychosocial health, STS: scale total score, KCDI: Kovacs Children’s Depression Inventory, SAI: State Anxiety Inventory, TAI: Trait Anxiety Inventory, OSIQ: Offer Self-Image Questionnaire.

Table 3. The comparison of groups’ quality of life, depression, anxiety, and self-image scores.

Source

Sum of Squares

df

Mean Squares

F

p

TPHS between groups

6193.69

1

6193.693

38.25

0.00*

2440.36

1

2440.36

19.54

0.00*

TSPH between groups

829.44

1

829.44

4.53

0.00*

KCDI between groups

1142.44

1

1142.40

41.34

0.00*

SAI between groups

2180.89

1

2180.89

58.69

0.00*

TAI between groups

2304

1

2304

107.83

0.00*

OSIQ between groups

46,053.16

1

46,053.16

23.23

0.00*

*: p≤0.05, F: F distribution, df: degrees of freedom, TPHS: total physical health score, TSPH: total score of psychosocial health, KCDI: Kovacs Children’s Depression Inventory, SAI: State Anxiety Inventory, TAI: Trait Anxiety Inventory, OSIQ: Offer Self-Image Questionnaire.

328

Baytan B, et al: Emotional Status and Health Quality in Childhood ALL

Turk J Hematol 2016;33:326-330

Table 4. Mean scores of depression, anxiety, quality of life, and self-image regarding period after acute lymphocytic leukemia treatment.

Period after ALL Treatment

TPHS

STS

TSPH

KCDI

SAI

TAI

OSIQ

Mean 2-5 years SD n=12

64.58 15.10

67.33 14.74

68.91 4.63

36 5.66

51.50 5.14

52.500 20.94

232.25 41.01

Mean 6-9 years SD n=24

81.33 16.72

83.08 11.34

81.33 11.88

28.75 4.96

52.08 8.19

52.54 5.54

234.79 44.91

Mean 10 and more years SD n=14

87.78 8.88

86.14 8.31

86.07 9.26

25.42 2.31

48.43 6.81

50 4.71

249 65.29

ALL: Acute lymphocytic leukemia, SD: standard deviation, TPHS: total physical health score, TSPH: total score of psychosocial health, STS: scale total score, KCDI: Kovacs Children’s Depression Inventory, SAI: State Anxiety Inventory, TAI: Trait Anxiety Inventory, OSIQ: Offer Self-Image Questionnaire.

Table 5. Comparison of the depression, anxiety, quality of life, and self-image scores regarding period after acute lymphocytic leukemia treatment.

Source

Sum of Squares

df

Mean Squares

F

p

TPHS between groups

3760.91

2

1880.45

8.87

0.00*

STS between groups

2680.51

2

1340.25

10.08

0.00*

TSPH between groups

2027.70

2

1013.85

5.19

0.01*

KCDI between groups

752.39

2

376.19

20.28

0.00*

SAI between groups

64.42

2

32.21

5.19

0.31

TAI between groups

123.42

2

61.71

1.16

0.32

OSI between groups

2336.51

2

1168.27

0.46

0.64

*: p≤0.05, F: F distribution, df: degrees of freedom, TPHS: total physical health score, TSPH: total score of psychosocial health, STS: scale total score, KCDI: Kovacs Children’s Depression Inventory, SAI: State Anxiety Inventory, TAI: Trait Anxiety Inventory.

loneliness. For a child, quality of life is likely to be compromised by the pain of the illness and treatment, lack of energy to enjoy everyday activities, and fears about the future [18]. After cancer treatment, we usually observe that children do not want to attend to school again. Parents also usually have fears about their children contracting infections in school. The idea that their children are still vulnerable might be the reason for social isolation (according to our interviews with parents, ALL survivors are rarely allowed to join social activities outside the home), which might affect children’s quality of life negatively.

Self-concept findings are similar to those of other studies, such as research on self-esteem among 578 pediatric ALL survivors compared to control groups [9]. According to some other studies, adult survivors of a variety of childhood cancers were found to have significantly lower self-esteem [18,19]. However, according to Maggiolini et al. [20], long-term adolescent ALL survivors had a more positive and mature self-image compared to a healthy student group. According to our study, self-image components such as coping capacity and individual values of

these children were stronger when compared to their siblings.

These results indicate that patients undergoing a long and difficult treatment period, as in leukemia, may be damaged in some self-image domains, but at the same time that period may improve their capacity to cope with the problems that they encounter.

Psychological problems among cancer patients are commonly reported. Acute stress symptoms, anxiety, depression, panic attacks, and post-traumatic stress symptoms might be observed among cancer patients [21,22]. Myers et al. [5] reported that anxiety was a significant problem in a subpopulation of patients with ALL immediately after diagnosis, whereas depression remained a significant problem for at least 1 year.

Kanellopoulos et al. [23] reported that levels of anxiety and depression remained significantly associated with poor quality of life. Although major psychiatric disturbances are not common among survivors of ALL, a few earlier studies showed that this population has increased risk for mental health and adjustment problems [24,25,26]. Some studies indicate that the period after treatment is characterized by a higher risk of psychosocial problems compared with the actual treatment period. Children and adolescents who were off treatment reported higher levels of depression and anxiety.

The quality of life is worse at the time of diagnosis [7]. The period after treatment is characterized by a higher risk of psychosocial problems compared with the actual treatment period. Children and adolescents who were off treatment reported higher levels of depression [27,28].

There are some limitations of this research. First of all, besides the siblings who were our control group, a randomized peer group should have also participated in this research. Meanwhile, the ALL survivors who participated in this research came from the local area. A more widespread participant group would give more information about results.

329

Baytan B, et al: Emotional Status and Health Quality in Childhood ALL

Conclusion Despite the improved survival rates, cancer still remains a potentially life-threatening condition and a major challenge for both the child and the family. During and after the course of treatment, most children experience unpleasant physical and emotional side effects. The difficulties faced by children during and after treatment affect their quality of life, social life, and emotional status negatively. Continuous diagnostic and interventional mental health services might be necessary for possible emotional side effects during and after the treatment.

Rehabilitation and follow-up programs should be implemented for these children both in the course of treatment and in the long-term follow-up period.

Ethics Ethics Committee Approval: The study was approved by the Uludağ University Local Ethics Committee (protocol number: 2014-2/15).

Authorship Contributions Concept: Adalet Meral Güneş, Arzu Çırpan Kantarcıoğlu; Design: Birol Baytan, Arzu Çırpan Kantarcıoğlu; Data Collection or Processing: Çiğdem Aşut; Analysis or Interpretation: Arzu Çırpan Kantarcıoğlu; Literature Search: Çiğdem Aşut, Melike Sezgin Evim; Writing: Adalet Meral Güneş, Birol Baytan.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Lanzkowsky P. Leukemias. In: Lanzkowsky P (ed). Manual of Pediatric Hematology and Oncology. New York, Churchill Livingstone Press, 2010.

2. Yarış N. Adölesan kanserlerinin epidemiyolojisi. J Curr Pediatr 2007;5:105110 (in Turkish).

3. Efficace F, Novik A, Vignetti M, Mandelli F, Cleeland CS. Health-related quality of life and symptom assessment in clinical research of patients with hematologic malignancies: where are we now and where do we go from here? Haematologica 2007;92:1596-1598.

4. Bansal M, Sharma KK, Bakhshi S, Vatsa M. Perception of Indian parents on health-related quality of life of children during maintenance therapy of acute lymphoblastic leukemia: a comparison with siblings and healthy children. J Pediatr Hematol Oncol 2014;36:130-136.

5. Myers RM, Balsamo L, Lu X, Devidas M, Hunger SP, Carroll WL, Winick NJ, Moloney KW, Kadan-Lottick NS. A prospective study of anxiety, depression, and behavioural changes in the first year after a diagnosis of childhood acute lymphoblastic leukemia. Cancer 2014;120:1417-1425.

6. Sharan P, Mehta M, Chaundry VP. Psychiatric morbidity in children suffering from acute lymphoblastic leukemia. Pediatr Hematol Oncol 1999;16:49-54.

7. Eiser C, Eiser RJ, Stride CB. Quality of life in children newly diagnosed with cancer and their mothers. Health Qual Life Outcomes 2005;3:29.

330

Turk J Hematol 2016;33:326-330

8. van Litsenburg RR, Huisman J, Raat H, Kaspers GJ, Gemke RJ. Health-related quality of life and utility scores in short-term survivors of pediatric acute lymphoblastic leukemia. Qual Life Res 2012;22:677-681.

9. Seitzman RL, Glover DA, Meadows AT, Mills JL, Nicholson HS, Robison LL, Byrne J, Zeltzer LK. Self-concept in adult survivors of childhood acute lymphoblastic leukemia: a cooperative Children’s Cancer Group and National Institutes of Health study. Pediatr Blood Cancer 2004;42:230-240.

10. Eiser C, Havermans T. Long term social adjustment after treatment for childhood cancer. Arch Dis Child 1994;70:66-70.

11. Zeltzer LK, Chen E, Weiss R, Guo MD, Robison LL, Meadows AT, Mills JL, Nicholson HS, Byrne J. Comparison of psychological outcome in adult survivors of childhood acute lymphoblastic leukemia versus sibling controls: a cooperative Children’s Cancer Group and National Institutes of Health study. J Clin Oncol 1997;15:547-556.

12. Öy B. Çocuklar için depresyon ölçeği; geçerlik ve güvenirlik çalışması. Türk Psikiyatri Dergisi 1991;2:132-136 (in Turkish).

13. Öner N, Le Compte A. Durumluk-Sürekli Kaygı Envanteri El Kitabı. 1st ed. İstanbul, Boğaziçi Üniversitesi Yayınları, 1993 (in Turkish).

14. Savaşır I, Şahin NH. Bilişsel ve Davranışçı Terapilerde Değerlendirme: Sık Kullanılan Ölçekler. 1st ed. Ankara, Türk Psikologlar Derneği Yayınları, 1997 (in Turkish).

15. Çakın Memik N, Ağaoğlu B, Çaşkun A, Üneri Ö, Karakaya I. Çocuklar için yaşam kalitesi ölçeğinin 13-18 yaş ergen formunun geçerlik ve güvenirliği.

Türk Psikiyatri Dergisi 2007;184:353-363 (in Turkish).

16. Liew E, Thyagu S, Atenafu EG, Alibhai SMH, Brandwein JM. Quality of life following completion of treatment for adult acute lymphoblastic leukemia with a pediatric-based protocol. Leuk Res 2013;37:1632-1635.

17. Hamidah A, Wong CY, Tamil AM, Zarina LA, Zulkifli ZS, Jamal R. Healthrelated quality of life (HRQOL) among pediatric leukemia patients in Malaysia. Pediatr Blood Cancer 2011;57:105-109.

18. Greenberg HS, Kazak AE, Meadows AT. Psychologic functioning in 8- to 16-year-old cancer survivors and their parents. J Pediatr 1989;114:488-493.

19. Koocher GP, O’Malley JE. The Damocles Syndrome. 2nd ed. New York, McGraw-Hill, 1989.

20. Maggiolini A, Grassi R, Adamoli L, Corbetta A, Charmet GP, Provantini K, Frascihini D, Jankovic M, Lia R, Spinetta J, Masera G. Self-image of adolescent survivors of long-term childhood leukemia. J Pediatr Hematol Oncol 2000;22:417-421.

21. Rabineau KM, Mabe PA, Vega RA. Parenting stress in pediatric oncology populations. J Pediatr Hematol Oncol 2008;30:358-365.

22. Myers RM, Balsamo L, Lu X, Devidas M, Hunger SP, Carroll WL, Winick NJ, Maloney KL, Kadan-Lottick NS. A prospective study of anxiety, depression, and behavioral changes in the first year after a diagnosis of childhood acute lymphoblastic leukemia. Cancer 2014;120:1417-1425.

23. Kanellopoulos A, Hamre HM, Dahl AA, Fosså SD, Ruud E. Factors associated with poor quality of life in survivors of childhood acute lymphoblastic leukemia and lymphoma. Pediatr Blood Cancer 2013;60:849-855.

24. Mackie E, Hill J, Kondryn H, McNally R. Adult psychosocial outcomes in long-term survivors of acute lymphoblastic leukaemia and Wilms’ tumour a controlled study. Lancet 2000;355:1310-1314.

25. Wallander JL, Thompson RJ Jr. Psychosocial adjustment of children with chronic physical conditions. In: Roberts MC, Steele RG (eds). Handbook of Pediatric Psychology. New York, Guilford Press, 2010.

26. Shelby MD, Nagle RJ, Barnett-Queen LL, Quattlebaum PD, Wuori DF. Parental reports of psychosocial adjustment and social competence in child survivors of acute lymphocytic leukemia. Childrens Health Care 1998;27:113-129.

27. von Essen L, Enskår K, Kreuger A, Larsson B, Sjøden PO. Self-esteem, depression and anxiety among Swedish children and adolescents on and off treatment. Acta Paediatr 2000;89:229-236.

28. Reinfjell T, Lofstad GE, Nordahl HM, Vikan A, Diseth TH. Children in remission from acute lymphoblastic leukaemia: mental health psychological adjustment and parental functioning. Eur J Cancer Care (Engl) 2009;18:364370.

BRIEF REPORT DOI: 10.4274/tjh.2016.0008 Turk J Hematol 2016;33:331-334

Clinical Courses of Two Pediatric Patients with Acute Megakaryoblastic Leukemia Harboring the CBFA2T3-GLIS2 Fusion Gene CBFA2T3-GLIS2 Füzyon Geni Taşıyan İki Pediatrik Akut Megakaryoblastik Lösemi Hastasının Klinik Seyri Mayu Ishibashi1, Tomoko Yokosuka1,2, Masakatsu D. Yanagimachi1, Fuminori Iwasaki2, Shin-ichi Tsujimoto1, Koji Sasaki1, Masanobu Takeuchi1, Reo Tanoshima1, Hiromi Kato1, Ryosuke Kajiwara1, Fumiko Tanaka1, Hiroaki Goto1,2, Shumpei Yokota1 1Yokohama City University Faculty of Medicine, Department of Pediatrics, Yokohama, Japan 2Kanagawa Children’s Medical Center, Clinic of Hematology/Oncology and Regenerative Medicine, Yokohama, Japan

Abstract

Öz

Acute megakaryoblastic leukemia (AMKL) in children without Down syndrome (DS) has an extremely poor outcome with 3-year survival of less than 40%, whereas AMKL in children with DS has an excellent survival rate. Recently, a novel recurrent translocation involving CBFA2T3 and GLIS2 was identified in about 30% of children with non-DS AMKL, and the fusion gene was reported as a strong poor prognostic factor in pediatric AMKL. We report the difficult clinical courses of pediatric patients with AMKL harboring the CBFA2T3-GLIS2 fusion gene.

Down sendromu (DS) olmayan çocuklarda akut megakaryoblastik löseminin (AMKL) prognozu çok kötü ve 3 yıllık sağkalım %40’ın altında iken, DS’li çocuklarda AMKL’nin sağkalım oranı mükemmeldir. Yakın zamanda, DS olmayan AMKL’li çocukların yaklaşık %30’unda CBFA2T3 ve GLIS2’yi içeren yeni bir tekrarlayan translokasyon tanımlandı ve füzyon geninin pediatrik AMKL olgularında kötü prognoz ile ilişkili güçlü bir prognostik belirteç olduğu bildirildi. CBFA2T3-GLIS2 füzyon genini taşıyan AMKL tanılı pediatrik hastalarda sorunlu klinik seyri bildiriyoruz.

Keywords: Acute megakaryoblastic leukemia without Down syndrome, CBFA2T3-GLIS2 fusion gene

Anahtar Sözcükler: Down sendromu olmayanlarda megakaryoblastik lösemi, CBFA2T3-GLIS2 füzyon geni

Introduction Acute megakaryoblastic leukemia (AMKL) is classified as M7 in the FAB (French-American-British) classification. AMKL accounts for approximately 10% of pediatric acute myeloid leukemia (AML) cases and 1% of adult AML cases [1,2,3].

Pediatric AMKL is divided into two subgroups: AMKL arising in patients with Down syndrome (DS-AMKL), and AMKL arising in patients without DS (non-DS-AMKL). Although patients with DS-AMKL have an excellent survival rate, patients with nonDS-AMKL have an extremely poor outcome with 3-year survival of less than 40% [1,2,4]. Recently, two studies identified a novel recurrent translocation involving CBFA2T3 and GLIS2 in about 30% of children with non-DS-AMKL. The CBFA2T3-GLIS2 fusion gene was reported as a strong poor prognostic factor in pediatric AMKL [5,6]. We report the difficult clinical courses of

akut

two pediatric patients with AMKL harboring the CBFA2T3-GLIS2 fusion gene.

Case Presentation Between 2003 and 2012, six patients were diagnosed with AMKL at the Department of Pediatrics of Yokohama City University Hospital. We analyzed the fusion gene, CBFA2T3GLIS2, in the six leukemic samples at the time of diagnosis by reverse transcription polymerase chain reaction (PCR) and direct sequencing, according to a previous report [5]. We compared characteristics between the patients who were diagnosed with AMKL with or without the CBFA2T3-GLIS2 fusion gene.

Two patients had DS-AMKL harboring a GATA1 mutation and four had non-DS-AMKL. None of them had inv(16)/t(16;16)

Address for Correspondence/Yazışma Adresi: Masakatsu D. YANAGIMACHI, M.D., Yokohama City University Faculty of Medicine, Department of Pediatrics, Yokohama, Japan Phone : +81-45-787-2800 E-mail : m.yanagimachi@gmail.com

Received/Geliş tarihi: January 07, 2016 Accepted/Kabul tarihi: April 04, 2016

331

Ishibashi M, et al: CBFA2T3-GLIS2 Fusion Gene

332

Alive (5 years) Chemotherapy PBMC None N/E 47XY,+21 70 42.5 M 21 DS 6

BM: Bone marrow, PBMC: peripheral bone marrow cells, DS: Down syndrome, non-DS: patients without Down syndrome, F: female, M: male.

Alive (6 years) Chemotherapy PBMC None 35.5 47,XY,add(5)(p11),add(q11.2), +der(21) t(1;21)(q12;q22)ins(21;?)(q22;?)

15 21 20 DS 5

M

Alive (7 years) Chemotherapy PBMC None 0 46XXdel(7)(q?),del(11)(p?), t(12;14) (q13;p32),16,+mar1 Dry tap 42 20 Non-DS 4

F

Dead (23 months) UR-BMT BM Positive 98.1 46,XX,add(3)(p21),add(4)(q11)14,add(17) (q25), add(19)(p13),20,+21,+der(?)t(?;14) (?;q1)/92, idem X2 46, idem, t(1;16) (q32;p13) 76 5.5 13 Non-DS 3

F

Alive (4 years) UR-BMT, in 1st CR PBMC None 24.3 46XX,-7,add(11) (p11.2) ,-7,21,22, +mar1,+mar2,+mar3,+mar4 14.5 19.5 20 Non-DS 2

F

CBSCTx2, R-BMTx2 BM Positive 82.7 73,XXX,+X,+8,-12,+14,-15,+19,+20,+21 92 9 11 Non-DS 1

Sex Age at Onset (Months) Patient No.

Table 1. Patient details.

Figure 1. Clinical courses of two Acute megakaryoblastic leukemia patients with the CBFA2T3-GLIS2 fusion gene. A) Reverse transcription polymerase chain reaction for the CBFA2T3GLIS2 fusion gene in our patients. Two patients with non-Down syndrome-acute megakaryoblastic leukemia (patients 1 and 3) had the CBFA2T3-GLIS2 fusion gene. NC: Negative control. B) Direct sequencing for the polymerase chain reaction product of the CBFA2T3-GLIS2 fusion gene in patient 1 revealed that exon 11 of CBFA2T3 was fused to exon 3 of GLIS2. C) Clinical course of patient 1. FLAG: Fludarabine, cytarabine, G-CSF; FK506: tacrolimus. D) Magnetic resonance imaging of patient 1 revealed an extramedullary lesion at the thoracic spinal cord (Th9). E) Clinical course of patient 3. CAG: Cytarabine, aclarubicin, G-CSF; GO: gemtuzumab ozogamicin; IDA: idarubicin; VPL: vincristine, prednisolone, L-asparaginase.

Blasts Blasts (%, PB) (%, BM)

Karyotype

CD56 (%)

CBFA2T3-GLIS2

Patient 1 with the CBFA2T3-GLIS2 fusion gene was treated under the AML05 protocol of the Japanese Pediatric Leukemia/ Lymphoma Study Group [7] and could not achieve CR after induction 1 therapy (Figure 1C). After induction 2 therapy, Patient 1 under non-CR conditions was treated with unrelated cord blood SCT (CBSCT) after a myeloablative conditioning regimen.

Three months after CBSCT, her AMKL relapsed. She underwent two courses of chemotherapy. She received a haploidentical SCT

F

Sample Clinical Course

Outcome

chromosomal abnormalities upon G-band karyotyping. Two patients with non-DS-AMKL (Patient 1 and Patient 3) had the CBFA2T3-GLIS2 fusion gene (Table 1). Reverse transcription PCR and direct sequencing revealed that exon 11 of CBFA2T3 was fused to exon 3 of GLIS2 in both cases (Figures 1A and 1B). Neither of them achieved complete remission (CR) after induction therapies. They died from the primary disease after stem cell transplantation (SCT). The other 4 patients remain alive in CR (Table 1).

Dead (30 months)

Turk J Hematol 2016;33:331-334

Ishibashi M, et al: CBFA2T3-GLIS2 Fusion Gene

Turk J Hematol 2016;33:331-334

(haplo-SCT) from her mother under non-CR conditions. After the second transplant, she had leg paralysis and bladder and rectal disturbance from an extramedullary lesion at the thoracic spinal cord (Th9) (Figure 1D). Although she underwent radiation therapy for the Th9 mass, the mass did not disappear. While she received a second CBSCT and haplo-SCT, she failed to engraft and died 30 months after the fourth SCT. Patient 3 with the CBFA2T3-GLIS2 fusion gene was treated under the AML99 protocol [8] and could not achieve CR after induction A therapy (Figure 1E). She did not achieve CR even after several types of chemotherapy. Thereafter, she underwent chemotherapy with vincristine, prednisolone, and L-asparaginase (VPL), which is commonly used in therapy for acute lymphoblastic leukemia (ALL). After the VPL therapy, the percentage of blastic cells in the bone marrow decreased.

She received unrelated bone marrow transplantation after a reduced-intensity conditioning regimen. She maintained remission for about 180 days and thereafter relapsed. Despite treatment with drugs including imatinib and L-asparaginase, she died 23 months after bone marrow transplantation.

Discussion It was reported that CBFA2T3-GLIS2 fusion gene-positive cases account for about 30% of pediatric patients with AMKL [5,6,9].

In addition, the overall survival rate and the event-free survival rate were lower in patients with the CBFA2T3-GLIS2 fusion gene than in those without this fusion gene [5,9,10,11]. There is little information about the clinical course of these patients.

We encountered two AMKL patients with poor prognostics harboring the CBFA2T3-GLIS2 fusion gene, even though neither of them had inv(16)/t(16;16) chromosomal abnormalities upon G-band karyotyping. Therefore, evaluation of AMKL patients with this fusion gene without inv(16)/t(16;16) is needed.

CD56 was expressed in leukemic blasts of the two CBFA2T3GLIS2-positive patients with AMKL but not in the two CBFA2T3GLIS2-negative patients among the non-DS-AMKL patients in our cohort (Table 1). It was reported that CD41 and CD56 were positive and CD56 was drastically more highly expressed in patients with CBFA2T3-GLIS2-positive AMKL [6]. Higher expression of the CD56 antigen was reported as a poor prognostic marker [9,12,13,14,15,16,17]. Some investigators demonstrated that patients with CD56 positivity in blasts showed a higher incidence of extramedullary manifestations [12,13,14,18].

Among our patients with AMKL, CD56 was also more highly expressed in the two CBFA2T3-GLIS2-positive patients with AMKL with poor outcomes, and Patient 1 had extramedullary manifestation that did not regress after irradiation. High CD56 expression may be a surrogate marker of CBFA2T3-GLIS2 positivity in AMKL.

In Patient 3 with CBFA2T3-GLIS2-positive AMKL, chemotherapy regimens used to treat AML were not effective, but chemotherapy with VPL, commonly used to treat ALL, seemed to be more effective. When some of the treatment strategies commonly used to treat AML are not effective, the type of chemotherapy used to treat ALL might be effective in a subpopulation of patients with AMKL. There is a possibility that the conventional treatment commonly used to treat ALL may be effective for AMKL with this fusion gene. Eventually, the AMKL in both of the CBFA2T3-GLIS2-positive patients in our cohort became intractable to treatment, including SCT. Despite some chemotherapy regimens and SCT, the two patients with the CBFA2T3-GLIS2 fusion gene had poor prognosis. As previously reported, CBFA2T3-GLIS2 expression enhances BMP2/BMP4 signaling [5]. The development of treatments including novel targeted therapy drugs is desired.

Conclusion Clinical courses of pediatric patients with AMKL harboring the CBFA2T3-GLIS2 fusion gene are poor due to resistance to chemotherapies and SCT. New treatment strategies are necessary.

Ethics Ethics Committee Approval: The protocol of this survey and research plan has been approved by the Clinical Ethics Committee of Yokohama City University (A130725002), Informed Consent: It was taken from patients and/or their parents.

Authorship Contributions Concept: Masakatsu D.Yanagimachi; Design: Masakatsu D. Yanagimachi, Hiroaki Goto, Shumpei Yokota; Data Collection or Processing: Mayu Ishibashi, Tomoko Yokosuka, Masakatsu D. Yanagimachi, Fuminori Iwasaki, Shin-ichi Tsujimoto, Koji Sasaki, Masanobu Takeuchi, Reo Tanoshima, Hiromi Kato, Ryosuke Kajiwara, Fumiko Tanaka, Hiroaki Goto, Shumpei Yokota; Analysis or Interpretation: Mayu Ishibashi, Tomoko Yokosuka, Masakatsu D. Yanagimachi; Literature Search: Mayu Ishibashi, Tomoko Yokosuka, Masakatsu D. Yanagimachi, Fuminori Iwasaki, Shin-ichi Tsujimoto, Koji Sasaki, Masanobu Takeuchi, Reo Tanoshima, Hiromi Kato, Ryosuke Kajiwara, Fumiko Tanaka, Hiroaki Goto, Shumpei Yokota; Writing: Mayu Ishibashi, Tomoko Yokosuka, Masakatsu D. Yanagimachi, Fuminori Iwasaki, Shinichi Tsujimoto, Koji Sasaki, Masanobu Takeuchi, Reo Tanoshima, Hiromi Kato, Ryosuke Kajiwara, Fumiko Tanaka, Hiroaki Goto, Shumpei Yokota.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

333

Ishibashi M, et al: CBFA2T3-GLIS2 Fusion Gene

References 1. Athale UH, Razzouk BI, Raimondi SC, Tong X, Behm FG, Head DR, Srivastava DK, Rubnitz JE, Bowman L, Pui CH, Ribeiro RC. Biology and outcome of childhood acute megakaryoblastic leukemia: a single institution’s experience. Blood 2001;97:3727-3732.

2. Barnard DR, Alonzo TA, Gerbing RB, Lange B, Woods WG; Children’s Oncology Group. Comparison of childhood myelodysplastic syndrome, AML FAB M6 or M7, CCG 2891: report from the Children’s Oncology Group.

Pediatr Blood Cancer 2007;49:17-22.

3. Tallman MS, Neuberg D, Bennett JM, Francois CJ, Paietta E, Wiernik PH, Dewald G, Cassileth PA, Oken MM, Rowe JM. Acute megakaryocytic leukemia: the Eastern Cooperative Oncology Group experience. Blood 2000;96:2405-2411.

4. Creutzig U, Zimmermann M, Ritter J, Reinhardt D, Hermann J, Henze G, Jurgens H, Kabisch H, Reiter A, Riehm H, Gadner H, Schellong G. Treatment strategies and long-term results in paediatric patients treated in four consecutive AML-BFM trials. Leukemia 2005;19:2030-2042.

5. Gruber TA, Larson Gedman A, Zhang J, Koss CS, Marada S, Ta HQ, Chen SC, Su X, Ogden SK, Dang J, Wu G, Gupta V, Andersson AK, Pounds S, Shi L, Easton J, Barbato MI, Mulder HL, Manne J, Wang J, Rusch M, Ranade S, Ganti R, Parker M, Ma J, Radtke I, Ding L, Cazzaniga G, Biondi A, Kornblau SM, Ravandi F, Kantarjian H, Nimer SD, Döhner K, Döhner H, Ley TJ, Ballerini P, Shurtleff S, Tomizawa D, Adachi S, Hayashi Y, Tawa A, Shih LY, Liang DC, Rubnitz JE, Pui CH, Mardis ER, Wilson RK, Downing JR. An Inv(16)(p13.3q24.3)-encoded CBFA2T3-GLIS2 fusion protein defines an aggressive subtype of pediatric acute megakaryoblastic leukemia. Cancer Cell 2012;22:683-697.

6. Thiollier C, Lopez CK, Gerby B, Ignacimouttou C, Poglio S, Duffourd Y, Guegan J, Rivera-Munoz P, Bluteau O, Mabialah V, Diop M, Wen Q, Petit A, Bauchet AL, Reinhardt D, Bornhauser B, Gautheret D, Lecluse Y, LandmanParker J, Radford I, Vainchenker W, Dastugue N, de Botton S, Dessen P, Bourquin JP, Crispino JD, Ballerini P, Bernard OA, Pflumio F, Mercher T. Characterization of novel genomic alterations and therapeutic approaches using acute megakaryoblastic leukemia xenograft models. J Exp Med 2012;209:2017-2031.

7. Zhu HH, Zhang XH, Qin YZ, Liu DH, Jiang H, Chen H, Jiang Q, Xu LP, Lu J, Han W, Bao L, Wang Y, Chen YH, Wang JZ, Wang FR, Lai YY, Chai JY, Wang LR, Liu YR, Liu KY, Jiang B, Huang XJ. MRD-directed risk stratification treatment may improve outcomes of t(8;21) AML in the first complete remission: results from the AML05 multicenter trial. Blood 2013;121:4056-4062.

8. Tsukimoto I, Tawa A, Horibe K, Tabuchi K, Kigasawa H, Tsuchida M, Yabe H, Nakayama H, Kudo K, Kobayashi R, Hamamoto K, Imaizumi M, Morimoto

334

Turk J Hematol 2016;33:331-334

A, Tsuchiya S, Hanada R. Risk-stratified therapy and the intensive use of cytarabine improves the outcome in childhood acute myeloid leukemia: the AML99 trial from the Japanese Childhood AML Cooperative Study Group. J Clin Oncol 2009;27:4007-4013.

9. Alegretti AP, Bittar CM, Bittencourt R, Piccoli AK, Schneider L, Silla LM, Bo SD, Xavier RM. The expression of CD56 antigen is associated with poor prognosis in patients with acute myeloid leukemia. Rev Bras Hematol Hemoter 2011;33:202-206.

10. Masetti R, Pigazzi M, Togni M, Astolfi A, Indio V, Manara E, Casadio R, Pession A, Basso G, Locatelli F. CBFA2T3-GLIS2 fusion transcript is a novel common feature in pediatric, cytogenetically normal AML, not restricted to FAB M7 subtype. Blood 2013;121:3469-3472.

11. Masetti R, Togni M, Astolfi A, Pigazzi M, Manara E, Indio V, Rizzari C, Rutella S, Basso G, Pession A, Locatelli F. DHH-RHEBL1 fusion transcript: a novel recurrent feature in the new landscape of pediatric CBFA2T3-GLIS2positive acute myeloid leukemia. Oncotarget 2013;4:1712-1720.

12. Graf M, Reif S, Hecht K, Pelka-Fleischer R, Kroell T, Pfister K, Schmetzer H. High expression of costimulatory molecules correlates with low relapsefree survival probability in acute myeloid leukemia (AML). Ann Hematol 2005;84:287-297.

13. Iizuka Y, Aiso M, Oshimi K, Kanemaru M, Kawamura M, Takeuchi J, Horikoshi A, Ohshima T, Mizoguchi H, Horie T. Myeloblastoma formation in acute myeloid leukemia. Leuk Res 1992;16:665-671.

14. Kuwabara H, Nagai M, Yamaoka G, Ohnishi H, Kawakami K. Specific skin manifestations in CD56 positive acute myeloid leukemia. J Cutan Pathol 1999;26:1-5.

15. Rego EM. The expression of the CD56 antigen is associated with poor prognosis in patients with acute myeloid leukemia. Rev Bras Hematol Hemoter 2011;33:176-177.

16. Yang DH, Lee JJ, Mun YC, Shin HJ, Kim YK, Cho SH, Chung IJ, Seong CM, Kim HJ. Predictable prognostic factor of CD56 expression in patients with acute myeloid leukemia with t(8:21) after high dose cytarabine or allogeneic hematopoietic stem cell transplantation. Am J Hematol 2007;82:1-5.

17. Raspadori D, Damiani D, Michieli M, Stocchi R, Gentili S, Gozzetti A, Masolini P, Michelutti A, Geromin A, Fanin R, Lauria F. CD56 and PGP expression in acute myeloid leukemia: impact on clinical outcome. Haematologica 2002;87:1135-1140.

18. Liang C, Chan KH, Yoon PJ, Lovell MA. Clinicopathological characteristics of extramedullary acute megakaryoblastic leukemia (AMKL): report of a case with initial mastoid presentation and review of literature to compare extramedullary AMKL and non-AMKL cases. Pediatr Dev Pathol 2012;15:385-392.

BRIEF REPORT DOI: 10.4274/tjh.2016.0075 Turk J Hematol 2016;33:335-338

Evaluation of Insulin-like Growth Factor-1 and Insulin-like Growth Factor Binding Protein-3 Expression Levels in Patients with Chronic Lymphocytic Leukemia Kronik Lenfositik Lösemi Hastalarında İnsülin-benzeri Büyüme Faktörü-1 ve İnsülin-benzeri Büyüme Faktörü Bağlayıcı Protein-3 Düzeylerinin Değerlendirilmesi Mesut Ayer1, Abdullah Sakin2, Selim Ay3, Aylin Ayer3, Elif Gökçen Sazak4, Melih Aktan4 1Haseki Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey 2Okmeydanı Training and Research Hospital, Clinic of Internal Medicine, Oncology Unit, İstanbul, Turkey 3Haseki Training and Research Hospital, Clinic of Internal Medicine, İstanbul, Turkey 4İstanbul University İstanbul Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey

Abstract

Öz

Objective: Chronic lymphocytic leukemia (CLL) is a disease of nonproliferating and mature-appearing B lymphocytes. Insulin-like growth factor-1 (IGF-1) is a small peptide hormone and has mitogenic and antiapoptotic effects, and insulin-like growth factor binding protein-3 (IGFBP-3) has antiproliferative effects on cells. In this study, we investigated plasma levels of both IGF-1 and IGFBP-3 in patients with CLL compared with controls, and we compared these plasma levels according to prognostic factors.

Materials and Methods: Patients with newly diagnosed CLL who were being followed at the Haseki Training and Research Hospital, İstanbul, Turkey, and volunteers were included in this study. Patients were stratified according to the Rai staging system. Statistical analysis was conducted using SPSS 17.0 for Windows.

Results: Forty-three patients [16 women (37%) and 27 men (63%)] were enrolled in this study. Twenty-one volunteers (11 women, 10 men) were included in the control group. The median age of the patients was 65±9 years (range: 18-63 years), and subjects in the control group were 68±8 years old (range: 18-63 years). Even though the plasma levels of IGF-1 were higher and those of IGFBP-3 were lower and the ratio of IGF-I/IGFBP-3 was higher in comparison with the control group, these differences were not statistically significant (p>0.05). In the study group, IGF-1 levels appeared to be increased in parallel to more advanced Rai stages. There were no significant differences between the other groups (p=0.105).

Conclusion: Plasma IGF-I levels were found higher in patients than in the control group and plasma IGFBP-3 levels were lower; however, neither result was statistically significant. Plasma IGF level increment was observed in concordance with Rai staging. These results prompted us to think that plasma IGF-1 levels in CLL patients are correlated with tumor burden and Rai staging and therefore could be a valuable prognostic factor. Further comprehensive studies are required to support our results.

Keywords: Chronic lymphocytic leukemia, Insulin-like growth factor-1, Insulin-like growth factor binding protein-3

Amaç: Kronik lenfositik lösemi (KLL) olgun görünümlü B lenfositlerin hastalığıdır. İnsülin-benzeri büyüme faktörü-1 (IGF-1), mitojenik ve antiapoptotik etkili küçük peptid hormondur ve insülin-benzeri büyüme faktörü bağlayıcı protein-3 (IGFBP-3) ise hücre üzerinde antiproliferative etki gösterir. Çalışmamızda, KLL hasta grubu ve kontrol grubunda plazma IGF-1 ve IGFBP-3 düzeylerini ve prognostik faktörlerle ilişkisini karşılaştırdık.

Gereç ve Yöntemler: Haseki Eğitim ve Araştırma Hastanesi, Hematoloji Bölümü’nde takip edilen yeni tanı almış KLL hastaları ile kontrol grubu çalışmaya dahil edilmiştir. Hastalar Rai sistemine göre evrelendirilmiştir. İstatistiksel analiz SPSS for Windows version 17.0 kullanılarak yapılmıştır.

Bulgular: Kırk üç hasta [16 kadın (%37) ve 27 erkek (%63)] çalışmaya alınmıştır. Kontrol grubu 21 kişiden (11 kadın, 10 erkek) oluşmuştur.

Hasta grubunda ortanca yaş 65±9 (18-63), kontrol grubunda 68±8’dir (18-63). Kontrol grubu ile karşılaştırıldığında; çalışma grubunda plazma IGF-1 düzeyi yüksek; IGFBP-3 düzeyi düşük, IGF-I/IGFBP-3 oranı ise yüksek olarak bulunmasına rağmen istatistiksel yönden anlamlı değildi (p>0,05). Çalışma grubunda plazma IGF-1 düzeyi yüksekliği ile Rai ileri evresi paralellik gösteriyordu. Diğer gruplarla istatistiksel yönden anlamlı farklılık yoktu (p=0,105).

Sonuç: Çalışma grubunda, plazma IGF-1 düzeyi kontrol grubundan daha yüksek, IGFBP-3 düzeyi ise düşük bulundu, bununla beraber istatistiksel yönden anlamlı farklılık yoktu. Plazma IGF-1 düzeyi yüksekliği ile Rai ileri evresi uyumlu idi. Bu sonuçlar bize, IGF-1 düzeyinin KLL hastalarında tümor yükü ve Rai evresi ile ilişkili olduğunu ve prognostik faktör olarak değerli olabileceğini düşündürmüştür.

Bu sonuçları destekleyebilmek için daha geniş kapsamlı çalışmalara ihtiyaç vardır.

Anahtar Sözcükler: Kronik lenfositik lösemi, İnsülin-benzeri büyüme faktörü-1, insülin benzeri büyüme faktörü bağlayıcı protein-3

Address for Correspondence/Yazışma Adresi: Mesut AYER, M.D., Haseki Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey Phone : +90 212 529 44 00/2048 E-mail : mesutayerdr@hotmail.com

Received/Geliş tarihi: February 22, 2016 Accepted/Kabul tarihi: April 08, 2016

335

Ayer M, et al: Evaluation of IGF-1 and IGFBP-3 Expression Levels in Patients with Chronic Lymphocytic Leukemia

Introduction Chronic lymphocytic leukemia (CLL) is a disease of nonproliferating and mature-appearing B lymphocytes. Most patients with CLL are elderly; just 10% are aged less than 50 years. In the evaluation of the prognosis of patients with CLL, mutations and cytogenetic abnormalities are crucial and independent markers in addition to clinical classifications [1,2].

Insulin-like growth factor (IGF) has a pivotal role in the normal development of fetuses and children. In adulthood, this growth factor has a role in the inhibition of cell proliferation and apoptosis, in addition to its role in cellular metabolism.

IGF-1 is a small peptide hormone that has mitogenic and antiapoptotic effects, but IGF-binding protein 3 (IGFBP-3) has an antiproliferative effect and negates the mitogenic effects of IGF-1 by stimulating apoptosis. In several types of tumors, it has been shown that IGF-1 levels are increased and IGFBP-3 levels are decreased [3,4].

In this study, we investigated plasma levels of both IGF-1 and IGFBP-3 in patients with CLL compared with controls and we compared these plasma levels according to prognostic factors.

Materials and Methods Patients who were newly diagnosed with CLL at the Haseki Training and Research Hospital and healthy volunteers were included in this study. Patients with the following conditions were excluded from the study: chronic renal disease, decompensated heart failure, chronic hepatitis, coronary artery disease, diabetes mellitus with organ damage or uncontrolled plasma glucose levels, chronic inflammatory disease, and major trauma in the last the year. Twenty-one volunteers were included in the control group.

Plasma samples were obtained after centrifugation at 3500 rpm for 8 min and stored at -80 °C until analysis. Plasma IGF-I detection was performed using an ELISA kit (DRG International, USA) in accordance with the manufacturer’s protocol. The sensitivity of the kit was 0.15 ng/mL. IGFBP-3 levels were measured using a BioSource ELISA Kit with solid-phase enzyme immunoassay (BioSource, Belgium). The analytical sensitivity of the kit was 10 μg/mL. Samples were measured using an ELISA microplate reader (DV-990 BV4, N.T. Laboratory, Italy).

Statistical analysis was conducted using SPSS 17.0 for Windows (SPSS Inc., Chicago, IL, USA). The Kolmogorov-Smirnov test was used to determine whether the samples were from a population with normal distribution. In the comparison of values between two groups, Student’s t-test was used if the group was distributed normally. If the group was not normally distributed, the MannWhitney U test was used. In the analysis of proportional data, the chi-square test was used. Pearson and Spearman correlation 336

Turk J Hematol 2016;33:335-338

tests were used to compare numerical parameters. One-way ANOVA testing was used to compare more than two groups; post hoc Bonferroni testing was used for multiple comparisons.

In all statistical assessments, the cut-off level of statistical significance was assumed as p<0.05.

Study assessment and methods were approved by the local institutional ethics committee. Patient demographics and laboratory data were obtained from patient records upon obtaining oral informed consent from the patients and their information was recorded.

Results Forty-three patients [16 women (37%) and 27 men (63%)] were enrolled in the study. Twenty-one control subjects who were demographically compatible (11 women, 10 men) were included in the control group. The median age of the patient and control groups was 65±9 years (range: 18-63 years) and 68±8 years (range: 18-63 years), respectively. There was no statistical demographic difference between the two groups (p>0.05).

Among the patients, 44% (n=19) had CLL of Rai stage 0, 11% (n=5) stage I, 20% (n=9) stage II, 16% (n=7) stage III, and 6% (n=3) stage IV. Compared with the control group, IGF-1 levels were found to be higher in the study group (531±246 ng/mL), and IGF-1 levels were also detected to be subsequently higher in every Rai stage (Rai stage 0, 1… etc.). However, this difference was not statistically significant (p>0.05). IGFBP-3 levels were found lower in the study group (3890±324 ng/mL) and IGFBP-3 levels were also found lower in each sequential Rai stage (Rai stage 0, 1… etc.), but this was not statistically significant (p>0.05). The IGF-I/IGFBP-3 ratio was higher in the study group (0.32±0.60 ng/mL), although the difference was not statistically significant (p=0.5) (Table 1).

In patients with CLL, we observed that IGF-1 levels had a positive correlation with Rai stages (Rs=0.411; p<0.01). The same correlation was not observed for IGFBP-3 levels (Rs=0.075; p=0.6). IGF-1 levels in the patients with CLL appeared to increase in parallel with more advanced Rai stages. There were no significant differences among Rai stages (p=0.105). When IGFBP-3 levels were compared according to stage, there were also no statistical significant differences (p=0.3) (Figures 1 and 2).

Table 1. Insulin-like growth factor-1 and insulin-like growth factor binding protein-3 values.

Control Subjects

Study Patients

p

IGF-1 (ng/mL)

517±173

531±246

0.8

IGFBP-3 (ng/mL)

4314±1996

3890±324

0.4

IGF-1/IGFBP-3

0.23±0.37

0.32±0.60

0.5

IGF-1: Insulin-like growth factor, IGFBP-3: insulin-like growth factor binding protein-3.

Turk J Hematol 2016;33:335-338

Ayer M, et al: Evaluation of IGF-1 and IGFBP-3 Expression Levels in Patients with Chronic Lymphocytic Leukemia

In our study, the mean plasma IGF-I levels of the patients were found higher than those of the control group, but the difference was not statistically significant. Plasma IGFBP-3 level was lower than in the control group, but this was also not statistically significant. However, plasma IGF level increments were in parallel with Rai stages. A reverse correlation was not observed for IGFBP-3 levels.

Figure 1. Mean insulin-like growth factor-1 values in Rai stages.

Molica et al. measured serum levels of IGF-1 and IGFBP-3 in 77 patients with CLL and found them to be statistically significantly lower than in the control group. However, no significant correlation was found between serum levels of either IGF-1 or IGFBP-3 and clinicohematologic variables including age, sex, Rai clinical stages, serum levels of lactate dehydrogenase and beta-2 microglobulin, peripheral blood lymphocyte count, and lymphocyte doubling time [11].

In our study IGF-1 and IGFBP-3 levels were lower in patients with Rai stage 0 compared with the control group. Although IGF-1 levels were found lower in early stages, they increased significantly in parallel with more advanced Rai stages.

In conclusion, plasma IGF-I levels in CLL patients were found higher than in the control group and plasma IGFBP-3 levels were lower. However, neither result was statistically significant.

The increments of plasma IGF-1 level were in parallel with Rai staging.

Figure 2. Insulin-like growth factor binding protein-3 values in Rai stages.

Discussion The IGF system plays a pivotal role in normal growth throughout fetal and childhood development. In adult life, this system continues to function by regulating normal cellular metabolism, proliferation, and differentiation and it protects against apoptotic signals. However, aberrant stimulation can contribute to the development and progression of malignant growth [4,5,6].

It has been shown in cell cultures that IGFBP-3 inhibits DNA synthesis without IGF. It has been claimed that IGFBP-3 may link p53 to potential novel autocrine/paracrine signaling pathways and to processes regulated by or dependent on IGF(s), such as cellular growth, transformation, and survival. It has also been asserted that induction of IGFBP-3 gene expression by wildtype, but not mutant, p53 was associated with enhanced secretion of an active form of IGFBP-3 capable of inhibiting mitogenic signaling by IGF-1 [7].

Many studies have reported that high levels of IGF-I, low levels of IGFBP-3, or increments of the molar ratio of IGF-I/IGFBP-3 were associated with various types of cancers [8,9,10,11].

These results suggest that plasma IGF-1 levels in patients with CLL are correlated with tumor burden and Rai staging and therefore might be a valuable prognostic factor. Further comprehensive studies are required to support our results.

Ethics Ethics Committee Approval: Study assessment and methods were approved by the local institutional ethics committee (21.01.2009/11); Informed Consent: Patient demographics and laboratory data were obtained from patient records upon obtaining oral informed consent from the patients and their information was recorded.

Authorship Contributions Concept: Mesut Ayer; Design: Mesut Ayer; Data Collection or Processing: Mesut Ayer, Selim Ay, Abdullah Sakin, Aylin Ayer; Analysis or Interpretation: Mesut Ayer, Melih Aktan; Literature Search: Mesut Ayer, Abdullah Sakin, Selim Ay, Aylin Ayer, Elif Gökçen Sazak, Melih Aktan; Writing: Mesut Ayer, Abdullah Sakin, Selim Ay, Aylin Ayer, Elif Gökçen Sazak, Melih Aktan.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

337

Ayer M, et al: Evaluation of IGF-1 and IGFBP-3 Expression Levels in Patients with Chronic Lymphocytic Leukemia

References 1. Ishibe N, Sgambati MT, Fontaine L, Goldin LR, Jain N, Weissman N, Marti GE, Caporaso NE. Clinical characteristics of familial B-CLL in the National Cancer Institute Familial Registry. Leuk Lymphoma 2001;42:99-108.

2. Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, Döhner H, Hillmen P, Keating MJ, Montserrat E, Rai KR, Kipps TJ; International Workshop on Chronic Lymphocytic Leukemia. Guidelines for the diagnosis and treatment of chronic lymphocytic leukemia: a report from the International Workshop on Chronic lymphocytic Leukemia updating the National Cancer Institute-Working Group 1996 guidelines. Blood 2008;111:5446-5456.

3. LeRoith D, Baserga R, Helman L, Roberts CT Jr. Insulin-like growth factors and cancer. Ann Intern Med 1995;122:54-59.

4. Fürstenberger G, Senn HJ. Insulin-like growth factors and cancer. Lancet Oncol 2002;3:298-302.

5. Rai KR, Sawitsky A, Cronkite EP, Chanana AD, Levy RN, Pasternack BS. Clinical staging of chronic lymphocytic leukemia. Blood 1975;46:219-234.

6. Jerome L, Shiry L, Leyland-Jones B. Deregulation of the IGF axis in cancer: epidemiological evidence and potential therapeutic interventions. Endocr Relat Cancer 2003;10:561-578.

338

Turk J Hematol 2016;33:335-338

7. Buckbinder L, Talbott R, Velasco-Miguel S, Takenaka I, Faha B, Seizinger BR, Kley N. Induction of the growth inhibitor IGF-binding protein 3 by p53.

Nature 1995;377:646-649.

8. Wu X, Yu H, Amos CI, Hong WK, Spitz MR. Joint effect of insulin-like growth factors and mutagen sensitivity in lung cancer risk. J Natl Cancer Inst 2000;92:737-743.

9. Harman SM, Metter EJ, Blackman MR, Landis PK, Carter HB; Baltimore Longitudinal Study on Aging. Serum levels of insulin-like growth factor I (IGF-I), IGF-II, IGF-binding protein-3, and prostate-specific antigen as predictors of clinical prostate cancer. J Clin Endocrinol Metab 2000;85:42584265.

10. Keleş M, Gündoğdu M, Erdem F, Türkeli M, Yıldız L, Turhan H. IGF-1 and IGFBP-3 levels in patients with non-Hodgkin’s lymphoma. Fırat Tıp Dergisi 2006;11:98-102 (in Turkish with English abstract).

11. Molica S, Vitelli G, Mirabelli R, Digiesu G, Giannarelli D, Cuneo A, Ribatti D, Vacca A. Serum insulin-like growth factor is not elevated in patients with early B-cell chronic lymphocytic leukemia but is still a prognostic factor for disease progression. Eur J Haematol 2006;76:51-57.

BRIEF REPORT DOI: 10.4274/tjh.2016.0102 Turk J Hematol 2016;33:339-345

The Frequency of HLA-A, HLA-B, and HLA-DRB1 Alleles in Patients with Acute Lymphoblastic Leukemia in the Turkish Population: A Case-Control Study Akut Lenfoblastik Lösemili Hastalarda HLA-A, HLA-B, ve HLA-DRB1 Alellerinin Türk Toplumundaki Sıklığı: Olgu-Kontrol Çalışması Türkan Patıroğlu1,2 , H. Haluk Akar1 1Erciyes University Faculty of Medicine, Department of Pediatric Immunology, Kayseri, Turkey 2Erciyes University Faculty of Medicine, Human Leukocyte Antigen Tissue Typing Laboratory, Kayseri, Turkey

Abstract

Öz

We studied the frequencies of human leukocyte antigen alleles (A, B, and DRB1) in 90 patients with acute lymphoblastic leukemia (ALL) and then compared them with 126 controls in this study. Although the frequencies of the A*03 allele, the DRB1*03 allele, the DRB1*04 allele, the A*02/B*35/DRB1*13 haplotype, and homozygosity of A*02 were higher in patients (p=0.006, p=0.003, p=0.002, p=0.01, and p=0.02, respectively), the frequencies of the A*23, B*13, B*40, and DRB1*13 alleles were lower (p=0.002, p=0.07, p=0.002, and p=0.003, respectively) in patients than controls. The frequencies of the DRB1*04 and DRB1*07 alleles were higher in patients in the high-risk group and standard-risk group, respectively (p=0.009 and p=0.007, respectively).

This study indicated that the frequency of the A*03 allele, the DRB1*03 allele, the DRB1*04 allele, the A*02/B*35/DRB1*13 haplotype, and A*02 homozygosity may play a predisposing role in patients with ALL in the Turkish population. The frequency of the DRB1*04 and DRB1*07 alleles may also be associated with high risk and standard risk in patients with ALL, respectively.

Bu çalışmada akut lenfoblastik lösemili (ALL) hastalarda insan lökosit antijeni alellerinin (A, B, ve DRB1) Türk toplumundaki dağılımını araştırdık. Çalışmaya 90 ALL hastası ve 126 sağlıklı kontrol dahil edildi.

Kontrollerle karşılaştırdığımızda ALL hastalarında A*03, DRB1*03, DRB1*04 alellerinin, A*02/B*35/DRB1*13 haplotipinin ve homozigot olarak A*02 alelinin daha sık olarak (sırası ile p=0,006, p=0,003, p=0,002, p=0,01 ve p=0,02) dağıldığını gözlemledik. Aksine A*23, B*13, B*40 ve DRB1*13 alelleri (sırası ile p=0,002, p=0,07, p=0,002 ve p=0,003) ise kontrol grubunda daha fazla olarak saptandı. Ayrıca DRB1*04 ve DRB1*07 alelleri (sırası ile p=0,009 ve p=0,007) risk gruplarına göre yapılan karşılaştırmada sırası ile yüksek ve standart riskli hastalarda daha fazla bulundu. Bu çalışma ile ALL hastalarında Türk toplumu için A*03, DRB1*03, DRB1*04 alelleri, A*02/B*35/DRB1*13 haplotipi ve homozigot formdaki A*02 alelinin bir risk faktörü olabileceği gözlemlendi. Ayrıca DRB1*04 ve DRB1*07 alellerinin risk gruplarının oluşmasında sırası ile yüksek ve standart risk gruplarında daha fazla bulunabileceği tespit edildi.

Keywords: Acute lymphoblastic leukemia, Human leukocyte antigen alleles, Risk groups

Anahtar Sözcükler: Akut lenfoblastik lösemi, İnsan lökosit antijeni alelleri, Risk grupları

Introduction Acute leukemia is an uncontrolled clonal disease due to the increasing of immature hematopoietic cells with a rate of at least 25% in the bone marrow [1]. Acute lymphoblastic leukemia (ALL) is the most common cancer in pediatric populations [2]. The incidence of ALL is about 30 cases per million persons younger than 20 years. It is also the most common cause of death among

cancers in children [3,4]. Patients with ALL can be classified into 3 risk groups as follows: a standard-risk group (SRG), a moderate-risk group (MRG) with adequate early treatment response, and a high-risk group (HRG) with inadequate response to induction treatment or Philadelphia chromosome-positive ALL [4,5]. Human leukocyte antigen (HLA) genes encode cell surface glycoproteins associated with antigen presentation that selectively interact with short peptide fragments derived from

Address for Correspondence/Yazışma Adresi: H. Haluk Akar, M.D., Erciyes University Faculty of Medicine, Department of Pediatric Immunology, Kayseri, Turkey Phone : +90 352 207 66 66/25300 E-mail : himmetakar@gmail.com

Received/Geliş tarihi: March 13, 2016 Accepted/Kabul tarihi: April 20, 2016

339

Patıroğlu T and Akar HH; HLA (A, B, and DRB1) Alleles and Acute Lymphoblastic Leukemia

non-self and self-proteins. The HLA class I molecules (A, B, and C) present intracellular antigens to CD8+ T cells, while class II molecules (DR, DQ, and DP) present extracellular antigens to CD4+ T cells, which activate macrophages and B cells. HLA has a major role in regulating host responses to infections. It has been hypothesized that the HLA alleles may have an important role in predisposal to ALL [6]. The HLA genes are the most polymorphic genes in the human genome [7]. An association between ALL and HLA alleles has been shown in the literature; however, the data are not conclusive so far [8,9,10,11,12,13]. There are no identified consistent leukemia-associated HLA class I genes to date, but investigations of HLA class II genes such as DRB3, DRB4, and DRB5 have demonstrated consistent associations in patients with leukemia [14]. Genome-wide association studies have also identified some other risk alleles in different genes such as CDKN2A, PIP4K2A, GATA3, ARID5B, and CEBPE in patients with ALL [15]. In this study, we aimed to evaluate the association of HLA alleles, haplotypes, and homozygosity in patients with ALL.

Materials and Methods Study Population This retrospective study was performed at the HLA Tissue Typing Laboratory of Erciyes University in Kayseri, Turkey. Ninety pediatric ALL patients (58 male patients and 32 female patients, 76 patients with B-cell and 14 patients with T-cell ALL, aged 7 months to 16 years) and 126 age- and sex-matched unrelated healthy controls (72 males and 54 females, aged 1-18 years) were enrolled in this study, all of Turkish ethnic origin. Participants in the control group were selected from among unrelated healthy donors who were studied for HLA alleles for transplantation (for solid organ

Turk J Hematol 2016;33:339-345

or hematological malignancies). In the 90 patients with ALL, risk groups were as follows: 29 patients in the SRG, 37 in the MRG, and 24 in the HRG. Human Leukocyte Antigen Typing Whole venous blood specimens were collected in 2KE tubes with EDTA for all participants. Genomic DNAs were obtained using the BioRobot EZ1 (QIAGEN, Hilden, Germany). Genotyping of HLA alleles was done as low-resolution typing by the polymerase chain reaction with sequence-specific oligonucleotide probe (PCR-SSOP) method (Gen-Probe Lifecodes, Stanford, CA, USA).

MATCH IT DNA software version 1.2.0 was used for HLA allele interpretation.

Statistical Analysis Statistical analyses were performed using SPSS 22. The association of alleles, haplotypes, and homozygosity was compared with the chi-square test (χ2). Two groups were in accordance with HardyWeinberg equilibrium (p>0.005). The Bonferroni correction test was performed for multiple comparisons in risk groups. A value of p≤0.05 was accepted to be statistically significant.

Results The frequencies of A, B, and DRB1 alleles are shown as 2n in Tables 1, 2, and 3. Although the frequencies of the A*03, DRB1*03, and DRB1*04 alleles were observed to be higher (p=0.006, p=0.003, and p=0.002, respectively) in patients with ALL, the frequencies of A*23, B*13, B*40, and DRB1*13 (p=0.002, p=0.07, p=0.002, and p=0.003, respectively) were observed to be lower. In the second step, we evaluated the frequency of haplotypes (Table 4). The A*02/B*35/DRB1*13 haplotype was found to be higher in

Table 1. The frequency of HLA-A alleles.

HLA-A A*01 A*02 A*03 A*11 A*23 A*24 A*25 A*26 A*29 A*30 A*31 A*32 A*33 A*68

ALL (2n=180)

Controls (2n=252)

n

Frequency (%)

n

Frequency (%)

18 30 33 13 2 30 3 6 7 4 4 12 8 10

10 16.7 18.8 7.2 1.1 16.7 1.7 3.3 3.9 2.2 2.2 6.7 4.4 5.6

29 47 23 16 18 48 1 9 9 6 4 7 10 21

11.5 18.7 9.1 6.3 7.1 19 0.4 3.6 3.6 2.4 1.6 2.8 4.0 8.3

ALL: Acute lymphoblastic leukemia, CI: confidence interval, NS: nonsignificant, OR: odds ratio.

340

p-value

OR (95% CI)

NS NS 0.006 NS 0.002 NS NS NS NS NS NS NS NS NS

NS NS 0.45 (0.25-0.79) NS 6.84 (1.57-29.90) NS NS NS NS NS NS NS NS NS

Patıroğlu T and Akar HH; HLA (A, B, and DRB1) Alleles and Acute Lymphoblastic Leukemia

Turk J Hematol 2016;33:339-345

Table 2. The frequency of HLA-B alleles.

HLA-B B*07 B*08 B*13 B*14 B*15 B*17 B*18 B*22 B*27 B*35 B*38 B*39 B*40 B*41 B*44 B*45 B*49 B*50 B*51 B*52 B*55 B*56 B*57 B*58

ALL (2n=180)

Controls (2n=252)

n

Frequency (%)

n

Frequency (%)

10 4 4 4 5 1 16 2 7 40 2 2 2 4 10 1 7 9 29 6 4 5 2 4

5.6 2.2 2.2 2.2 2.8 0.6 8.9 1.1 3.9 22.2 1.1 1.1 1.1 2.2 5.6 0.6 3.9 5 16.1 3.3 2.2 2.8 1.1 2.2

11 13 21 5 6 2 13 3 6 50 2 3 18 7 10 3 11 12 28 7 6 2 4 5

4.4 5.3 8.3 2.8 3.3 1.1 5.2 1.7 2.4 19.8 0.8 1.2 7.1 2.8 5.6 1.7 4.4 4.8 11.1 2.8 2.4 0.8 1.6 2.0

p-value

OR (95% CI)

NS NS 0.007 NS NS NS NS NS NS NS NS NS 0.002 NS NS NS NS NS NS NS NS NS NS NS

NS NS 4.0 (1.35-11.86) NS NS NS NS NS NS NS NS NS 6.8 (1.57-29.90) NS NS NS NS NS NS NS NS NS NS NS

ALL: Acute lymphoblastic leukemia, CI: confidence interval, NS: nonsignificant, OR: odds ratio.

Table 3. The frequency of HLA-DRB1 alleles.

HLA-DRB1 DRB1*01 DRB1*03 DRB1*04 DRB1*07 DRB1*08 DRB1*09 DRB1*10 DRB1*11 DRB1*12 DRB1*13 DRB1*14 DRB1*15 DRB1*16

ALL (2n=180)

Controls (2n=180)

n

Frequency (%)

n

Frequency (%)

16 20 60 29 7 3 8 33 4 6 6 12 6

8.9 11.1 33.3 16.1 3.9 1.7 4.4 18.3 2.2 3.3 3.3 6.7 3.3

19 11 50 28 7 3 5 54 3 28 14 19 11

7.5 4.4 19.8 11.1 2.8 1.2 2.0 21.4 1.2 11.1 5.6 7.5 4.4

p-value

OR (95% CI)

NS 0.003 0.002 NS NS NS NS NS NS 0.003 NS NS NS

NS 0.36 (0.17-0.78) 0.50 (0.32-0.77) NS NS NS NS NS NS 3.62 (1.47-8.95) NS NS NS

ALL: Acute lymphoblastic leukemia, CI: confidence interval, NS: nonsignificant, OR: odds ratio.

frequency in patients with ALL (7.8% vs. 0.8%, p=0.01; Table 4).

In the third step, we investigated the homozygosity of HLA alleles (Table 5). The most homozygous alleles were A*02 (6.7% vs. 0.8%, p=0.02) and DRB1*11 (6.7% vs. 4%). The frequency of HLA alleles

was compared among patients according to risk groups in the last step (Table 6). Although DRB1*04 frequency was observed to be higher in patients in the HRG (p=0.009), DRB1*07 frequency was found to be higher in patients in the SRG (p=0.007).

341

Patıroğlu T and Akar HH; HLA (A, B, and DRB1) Alleles and Acute Lymphoblastic Leukemia

Turk J Hematol 2016;33:339-345

Table 4. The frequency of HLA-A, -B, and -DRB1 haplotypes.

Haplotype

ALL (n=90)

A*01/B*08/DRB1*03 A*01/B*18/DRB1*11 A*01/B*35/DRB1*11 A*02/B*08/DRB1*03 A*02/B*14/DRB1*01 A*02/B*35/DRB1*04 A*02/B*35/DRB1*13 A*02/B*40/DRB1*04 A*02/B*44/DRB1*07 A*02/B*44/DRB1*11 A*02/B*50/DRB1*07 A*02/B*51/DRB1*04 A*03/B*35/DRB1*11 A*03/B*51/DRB1*04 A*11/B*51/DRB1*14 A*24/B*18/DRB1*11 A*24/B*35/DRB1*11 A*24/B*51/DRB1*04 A*24/B*51/DRB1*11 A*32/B*35/DRB1*11 A*68/B*35/DRB1*11

Controls (n=126)

n

Frequency (%)

n

Frequency (%)

3 3 1 2 3 2 7 1 0 1 0 1 1 2 1 3 1 1 2 2 1

3.3 3.3 1.1 2.2 3.3 2.2 7.8 1.1 0 1.1 0 1.1 1.1 2.2 1.1 3.3 1.1 1.1 2.2 2.2 1.1

4 1 0 3 1 2 1 2 1 2 1 1 4 2 2 0 2 0 4 2 3

3.2 0.8 0 2.4 0.8 1.6 0.8 1.6 0.8 1.6 0.8 0.8 3.2 1.6 1.6 0 1.6 0 3.2 1.6 2.4

p-value

OR (95% CI)

NS NS NS NS NS NS 0.01 NS NS NS NS NS NS NS NS NS NS NS NS NS NS

NS NS NS NS NS NS 0.095 (0.011-0.785) NS NS NS NS NS NS NS NS NS NS NS NS NS NS

ALL: Acute lymphoblastic leukemia, CI: confidence interval, NS: nonsignificant, OR: odds ratio.

Table 5. The homozygosity of HLA alleles.

Homozygosity A*01/A*01 A*02/A*02 A*03/A*03 A*11/A*11 A*23/A*23 A*24/A*24 B*07/B*07 B*18/B*18 B*27/B*27 B*35/B*35 B*38/B*38 B*39/B*39 B*40/B*40 B*44/B*44 B*50/B*50 B*51/B*51 DRB1*03/DRB1*03 DRB1*04/DRB1*04 DRB1*07/DRB1*07 DRB1*11/DRB1*11 DRB1*13/DRB1*13 DRB1*15/DRB1*15

ALL (n=90)

Controls (n=126)

n

Frequency (%)

n

Frequency (%)

1 6 4 0 1 4 1 1 0 4 1 0 0 1 1 4 3 2 2 6 2 0

1.1 6.7 4.4 0 1.1 4.4 1.1 1.1 0 4.4 1.1 0 0 1.1 1.1 4.4 3.3 2.2 2.2 6.7 2.2 0

0 1 2 1 0 4 0 0 1 3 0 1 1 0 0 2 2 3 0 5 0 1

0 0.8 1.6 1.1 0 3.2 0 0 0.8 2.4 0 0.8 0.8 0 0 1.6 1.6 2.4 0 4 0 0.8

ALL: Acute lymphoblastic leukemia, CI: confidence interval, NS: nonsignificant, OR: odds ratio.

342

p-value

OR (95% CI)

NS 0.02 NS NS NS NS NS NS NS NS NS NS NS NS NS NS NS NS NS NS NS NS

NS 0.112 (0.13-0.94) NS NS NS NS NS NS NS NS NS NS NS NS NS NS NS NS NS NS NS NS

Patıroğlu T and Akar HH; HLA (A, B, and DRB1) Alleles and Acute Lymphoblastic Leukemia

Turk J Hematol 2016;33:339-345

Table 6. The frequency of HLA alleles in risk groups.

ALL (2n=180)

HLA

Allele frequencies in HRG (2n=48)

Allele frequencies in MRG (2n=74)

Allele frequencies in SRG (2n=58)

p-value

A*01

4 (8.3%)

10 (13.5%)

4 (6.7%)

NS

A*02

12 (25%)

15 (20.2%)

13 (22.4%)

NS

A*03

7 (14.5%)

11 (14.9%)

10 (17.2%)

NS

A*11

5 (10.4%)

3 (4%)

5 (8.6%)

NS

A*23

1 (2%)

1 (1.3%)

1 (1.7%)

NS

A*24

7 (14.5%)

14 (18.9%)

9 (15.5%)

NS

A*25

1 (2%)

1 (1.3%)

1 (1.7%)

NS

A*26

1 (2%)

3 (4%)

3 (5.8%)

NS

A*29

1 (2%)

3 (4%)

3 (5.8%)

NS

A*30

1 (2%)

2 (2.7%)

1 (1.7%)

NS

A*31

0

2 (2.7%)

2 (3.4%)

NS

A*32

3 (6.25%)

6 (8.1%)

3 (5.8%)

NS

A*33

1 (2%)

1 (1.3%)

1 (1.7%)

NS

A*66

0

0

0

NS

A*68

4 (8.3%)

2 (2.7%)

2 (3.4%)

NS

A*69

0

0

0

NS

B*07

1 (2%)

2 (2.7%)

2 (3.4%)

NS

B*08

1 (2%)

2 (2.7%)

1 (1.7%)

NS

B*13

1 (2%)

2 (2.7%)

1 (1.7%)

NS

B*14

2 (4.1%)

2 (2.7%)

0

NS

B*15

1 (2%)

2 (2.7%)

2 (3.4%)

NS

B*17

0

0

1 (1.7%)

NS

B*18

2 (4.1%)

9 (12.7%)

5 (8.6%)

NS

B*22

0

1 (1.3%)

0

NS

B*27

2 (4.1%)

3 (4%)

2 (3.4%)

NS

B*35

10 (21%)

17 (22.3%)

13 (22.4%)

NS

B*38

4 (8.3%)

5 (6.8%)

4 (6.7%)

NS

B*39

1 (2%)

0

1 (1.7%)

NS

B*40

0

1 (1.3%)

1 (1.7%)

NS

B*41

1 (2%)

2 (2.7%)

1 (1.7%)

NS

B*44

2 (4.1%)

3 (4%)

5 (8.6%)

NS

B*45

1 (2%)

0

0

NS

B*49

1 (2%)

2 (2.7%)

2 (3.4%)

NS

B*50

2 (4.1%)

2 (2.7%)

5 (8.6%)

NS

B*51

10

9 (12.7%)

10 (17.2%)

NS

B*52

3 (6.25%)

2 (2.7%)

1 (1.7%)

NS

B*55

0

1 (1.3%)

0

NS

B*56

1 (2%)

3 (4%)

1 (1.7%)

NS

343

PatÄąroÄ&#x;lu T and Akar HH; HLA (A, B, and DRB1) Alleles and Acute Lymphoblastic Leukemia

Turk J Hematol 2016;33:339-345

Table 6. Continuation B*57

0

1 (1.3%)

0

NS

B*58

1 (2%)

1 (1.3%)

0

NS

B*60

0

1 (1.3%)

0

NS

B*62

1 (2%)

0

0

NS

B*65

0

1 (1.3%)

0

NS

DRB1*01

2 (4.1%)

5 (6.8%)

2 (3.4%)

NS

DRB1*03

5 (10.4%)

7 (9.5%)

6 (10.3%)

NS

DRB1*04

14 (29.2%)a

12 (16.2%)a,b

4 (6.7%)b

0.009

DRB1*07

3 (6.25%)a

6 (8.1%)a

14 (24.1%)b

0.007

DRB1*08

1 (2%)

2 (2.7%)

1 (1.7%)

NS

DRB1*09

1 (2%)

1 (1.3%)

2 (3.4%)

NS

DRB1*10

0

2 (2.7%)

2 (3.4%)

NS

DRB1*11

9 (18.8%)

14 (18.9%)

10 (17.2%)

NS

DRB1*12

0

2 (2.7%)

2 (3.4%)

NS

DRB1*13

5 (6.25%)

8 (10.8%)

5 (8.6%)

NS

DRB1*14

2 (4.1%)

5 (6.8%)

3 (5.8%)

NS

DRB1*15

4 (8.3%)

5 (6.8%)

4 (6.7%)

NS

DRB1*16

2 (4.1%)

5 (6.8%)

3 (5.8%)

NS

HLA: Human leukocyte antigen, ALL: acute lymphoblastic leukemia, HRG: high-risk group, MRG: moderate-risk group, SRG: standard-risk group, NS: nonsignificant; a, b: superscripted letters show statistical significance.

Discussion The underlying mechanisms are not well defined in patients with ALL [1,16]. The presence of genetic effects on the development of leukemia was observed in monozygotic twins [16,17]. Some studies have shown that some HLA alleles may be involved in the development of leukemia [14,17]. The first HLA association was reported in 1967, with increased frequency of the A*02 allele in patients with ALL [18]. On this topic, however, the data remain insufficient. Several associations have been reported between leukemia and HLA genes such as DRB3, DRB4, and DRB5 so far [14]. There are some inconsistencies among studies in the literature. The frequency of DRB1*13 as a protective allele was reported to be lower in some previously reported studies, as it was in our study [10,12]. This similarity for the DRB1*13 allele among studies may be explained by geographic proximity and interactions between Iranian [10] and Turkish populations [12]. In another Turkish study, the frequency of DRB1*04 was reported to be higher and the frequency of A*23 was reported to be lower in patients with ALL, as in our study [11]. In that study, inconsistent with our data, B*07 frequency was observed to be lower in patients with ALL. In another Turkish study, a positive association was reported in some alleles such as A*11 and DRB1*01, which is inconsistent with our results in patients with ALL [12]. These discrepancies among Turkish studies may result from the size of study populations. In this study, we 344

also observed a positive association with A*03, DRB1*03, and DRB1*04 alleles in patients with ALL. In contrast to our study, Fernandes et al. [19] reported a negative association between ALL and DRB1*04 in an adult population. Our results contribute some new information to the literature about HLA associations in patients with ALL for the Turkish population. For example, the frequency of A*03, B*13, B*40, and DRB1*03 was inconsistent with the results of other reported Turkish studies [11,12]. In the literature, some HLA haplotypes have also been accepted as important risk factors for developing leukemia [10,19]. For example, a negative association with the A*02/B*35/DRB1*13 haplotype was observed in patients with ALL [12]. On the contrary, A*02/B*35/DRB1*13 haplotype frequency was observed to be higher in our study as a predisposing factor. Homozygosity of DRB4*01 was also reported to be a risk factor in children with leukemia [20]. In this study, the homozygosity of A*02 was observed to be higher in patients as a predisposing factor. In the last step of our research, although the frequency of DRB1*04 was observed to be higher in patients with high risk, the frequency of the DRB1*07 allele was found to be higher in patients with standard risk. As a limitation, the number of participants in our study was not large enough to make conclusive decisions about HLA association, which may lead to some discrepancies from other Turkish studies of patients with ALL. Additionally, some odd ratios (OR) in this study were calculated as lower than zero (<0.00), such as those for DRB1*03 (OR=0.36), DRB1*04

Turk J Hematol 2016;33:339-345

Patıroğlu T and Akar HH; HLA (A, B, and DRB1) Alleles and Acute Lymphoblastic Leukemia

(OR=0.50), the A*02/B*35/DRB1*13 haplotype (OR=0.09), and A*02/A*02 homozygosity (OR=0.11). The lower OR values can most likely be explained by the small importance of these data among the genetic factors predisposing to ALL. In conclusion, although A*03, DRB1*03, and DRB1*04 were observed to be susceptible alleles, A*23, B*13, B*40, and DRB1*13 were found to be protective alleles in patients with ALL. Although some results of our study support earlier findings, others are inconsistent. The increasing frequency of DRB1*04 and the decreasing frequency of A*23 and DRB1*13 alleles support results of earlier Turkish studies [11,12]. As new data, the frequencies of the A*02/B*35/DRB1*13 haplotype and A*02 homozygosity were observed to be higher as predisposing factors in patients with ALL. The frequency of DRB1*07 and DRB1*04 was observed to higher in the SRG and HRG, respectively, as additional predisposing factors.

Ethics Ethics Committee Approval: Retrospective study; Informed Consent: It was not required.

Authorship Contributions Concept: Türkan Patıroğlu, H. Haluk Akar; Design: Türkan Patıroğlu, H. Haluk Akar; Data Collection or Processing: H. Haluk Akar; Analysis or Interpretation: Türkan Patıroğlu; Literature Search: H. Haluk Akar; Writing: Türkan Patıroğlu, H. Haluk Akar.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Wintrobe MM. Clinical Hematology. 20th ed. Philadelphia, Wolters KluwerLippincott Williams & Wilkins, 2009.

2. Greaves M. Infection, immune responses and the aetiology of childhood leukaemia. Nat Rev Cancer 2006;6:193-203.

3. Hunger SP, Mullighan CG. Acute lymphoblastic leukemia in children. N Engl J Med 2015;373:1541-1552.

leukemia despite reduced use of anthracyclines and cranial radiotherapy: results of trial ALL-BFM 90. German-Austrian-Swiss ALL-BFM Study Group.

Blood 2000;95:3310-3322.

6. Hosking FJ, Leslie S, Dilthey A, Moutsianas L, Wang Y, Dobbins SE, Papaemmanuil E, Sheridan E, Kinsey SE, Lightfoot T, Roman E, Irving JA, Allan JM, Taylor M, Greaves M, McVean G, Houlston RS. MHC variation and risk of childhood B-cell precursor acute lymphoblastic leukemia. Blood 2011;117:1633-1640.

7. Clayton J, Lonjou C. Allele and haplotype frequencies for HLA loci in various ethnic groups. In: Charron D, (ed). Genetic Diversity of HLA. Functional and Medical Implications. Paris, Medical and Scientific International, 1997.

8. Khosravi F, Amirzargar A, Sarafnejad A, Nicknam MH, Alimoghadam K, Dianat S, Solgi G, Nikbin B. HLA class II allele and haplotype frequencies in Iranian patients with leukemia. Iran J Allergy Asthma Immunol 2007;6:137142.

9. Taylor M, Hussain A, Urayama K, Chokkalingam A, Thompson P, Trachtenberg E, Buffler P. The human major histocompatibility complex and childhood leukemia: an etiological hypothesis based on molecular mimicry. Blood Cells Mol Dis 2009;42:129-135.

10. Yari F, Sobhani M, Sabaghi F, Zaman-Vaziri M, Bagheri N, Talebian A. Frequencies of HLA-DRB1 in Iranian normal population and in patients with acute lymphoblastic leukemia. Arch Med Res 2008;39:205-208.

11. Ozdilli K, Oguz FS, Anak S, Kekik C, Carin M, Gedikoglu G. The frequency of HLA class I and II alleles in Turkish childhood acute leukaemia patients. J Int Med Res 2010;38:1835-1844.

12. Uçar F, Sönmez M, Erkut N, Balcı M, Yücel B, Yılmaz M, Erduran E, Ovalı E. Relation of HLA-A, -B, -DRB1 alleles and haplotypes in patients with acute leukemia: a case control study. Arch Med Res 2011;42:305-310.

13. Taylor GM, Hussain A, Lightfoot TJ, Birch JM, Eden TO, Greaves MF. HLAassociated susceptibility to childhood B-cell precursor ALL: definition and role of HLA-DPB1 supertypes. Br J Cancer 2008;98:1125-1131.

14. Urayama KY, Thompson PD, Taylor M, Trachtenberg EA, Chokkalingam AP. Genetic variation in the extended major histocompatibility complex and susceptibility to childhood acute lymphoblastic leukemia: a review of the evidence. Front Oncol 2013;3:300.

15. Walsh KM, de Smith AJ, Welch TC, Smirnov I, Cunningham MJ, Ma X, Chokkalingam AP, Dahl GV, Roberts W, Barcellos LF, Buffler PA, Metayer C, Wiemels JL. Genomic ancestry and somatic alterations correlate with age at diagnosis in Hispanic children with B-cell acute lymphoblastic leukemia.

Am J Hematol 2014;89:721-725.

16. Greaves MF, Maia AT, Wiemels JL, Ford AM. Leukemia in twins: lessons in natural history. Blood 2003;102:2321-2333.

17. Schumacher HR, Alvares CJ, Blough RI, Mazzella F. Acute leukemia. Clin Lab Med 2002;22:153-192.

18. Curtoni ES, Mattiuz PL, Tosi RM, (eds). Histocompatibility Testing.

Copenhagen, Munksgaard, 1967.

4. Bradshaw G, Hinds PS, Lensing S, Gattuso JS, Razzouk BI. Cancer-related deaths in children and adolescents. J Palliat Med 2005;8:86-95.

19. Fernandes TA, Fukai R, Souza CA, Lorand-Metze I, Magna LA, Kraemer MH. Molecular identification of the HLA-DRB1-DQB1 for diagnosis and followup of acute leukemias. Blood Cells Mol Dis 2010;44:69-73.

5. Schrappe M, Reiter A, Ludwig WD, Harbott J, Zimmermann M, Hiddemann W, Niemeyer C, Henze G, Feldges A, Zintl F, Kornhuber B, Ritter J, Welte K, Gadner H, Riehm H. Improved outcome in childhood acute lymphoblastic

20. Dorak MT, Lawson T, Machulla HK, Darke C, Mills KI, Burnett AK. Unraveling an HLA-DR association in childhood acute lymphoblastic leukemia. Blood 1999;94:694-700.

345

BRIEF REPORT DOI: 10.4274/tjh.2016.0046 Turk J Hematol 2016;33:346-348

Varicella-Zoster Virus Infections in Pediatric Malignancy Patients: A Seven-Year Analysis Pediatrik Malignite Hastalarında Varicella Zoster Virüs Enfeksiyonları: Yedi Yıllık Analiz Mine Düzgöl1, Gülcihan Özek2, Nuri Bayram1, Yeşim Oymak2, Ahu Kara1, Bengü Demirağ2, Tuba Hilkay Karapınar2, Yılmaz Ay2, Canan Vergin2, İlker Devrim1 1Dr. Behçet Uz Children Training and Research Hospital, Clinic of Pediatric Infectious Diseases, İzmir, Turkey 2Dr. Behçet Uz Children Training and Research Hospital, Clinic of Pediatric Hematology and Oncology, İzmir, Turkey

Abstract

Öz

Primary varicella-zoster virus (VZV) infection is a benign self-limited disease. In this study, we review our experience in focusing on the outcome and treatment of VZV infection in pediatric malignancy patients. During the study period, a total of 41 patients with pediatric malignancy had been hospitalized with the diagnosis of VZV infection.

All the patients were treated with intravenous acyclovir for a median of 7 days (ranging from 5 to 21 days). The calculated attributable delay of chemotherapy due to VZV infections was 8 days (ranging from 2 to 60 days). VZV-related complications were observed in 3 of 41 patients (7%) who suffered from acute respiratory distress syndrome, and one of them with hemophagocytic lymphohistiocytosis died due to respiratory failure despite acyclovir and broad-spectrum antimicrobial treatment plus supportive treatment. VZV infections are still important contagious diseases in pediatric cancer patients, because they cause not only significant mortality but also a delay in chemotherapy.

Primer varisella zoster virüs (VZV) enfeksiyonu benign, kendi kendini sınırlayan bir hastalıktır. Bu çalışmada pediatrik malignitesi olan hastalarda VZV enfeksiyonu ve tedavisine odaklı tecrübelerimizi gözden geçirmeyi amaçladık. Çalışma süresi boyunca; VZV enfeksiyonu tanısı alan pediatrik maligniteli toplam 41 hasta hastaneye yatırıldı.

Tüm hastalar ortalama 7 gün (5 ila 21 gün arasında değişen) intravenöz asiklovir ile tedavi edildi. VZV enfeksiyonlarına bağlı olarak hesaplanan atfedilebilir kemoterapi gecikmesi ortalama 8 gündü (2 ile 60 gün arasında değişen). VZV enfeksiyonuna bağlı komplikasyonlar 41 hastadan 3’ünde (%7) akut solunum distres sendromu olarak görüldü ve bu hastalardan hemofagositik lenfohistiyositozu olan bir tanesi asiklovir, geniş spektrumlu antibiyotik ve destekleyici tedaviye rağmen solunum yetmezliği nedeniyle kaybedildi. VZV enfeksiyonları, pediatrik malignite hastalarında hala önemli bulaşıcı hastalıklardan biridir, çünkü sadece ciddi mortaliteye sebep olmakla kalmayıp kemoterapi başlangıcını da geciktirmektedir.

Keywords: Varicella, Malignancy, Pediatric patient

Anahtar Sözcükler: Varisella, Malignite, Çocuk hasta

Introduction

Materials and Methods

Immunocompromised children are at greater risk of suffering

A retrospective cohort study design was used to evaluate pediatric cancer patients with VZV infections who were hospitalized in the Pediatric Hematology-Oncology and Infectious Diseases Units of the Dr. Behçet Uz Children’s Hospital from December 2008 to March 2015. In this study, the attending physician’s clinical diagnosis of VZV infection was based on case definitions set by the United States Centers for Disease Control and Prevention and the Council of State and Territorial Epidemiologists guidelines reported in 2009 [6,7]. Therapy with intravenous acyclovir (1500

from severe, prolonged, and complicated varicella-zoster virus (VZV) infection [1]. Before introduction of antiviral therapy, the mortality rate of VZV infections in children with cancer was reported to be 7%, with numbers reaching up to 55% in cases with visceral involvement [2,3,4,5]. In this study, we aimed to review our experience in focusing on the outcome and treatment of VZV infections in pediatric malignancy patients.

Address for Correspondence/Yazışma Adresi: Mine DÜZGÖL, M.D., Dr. Behçet Uz Children Training and Research Hospital, Clinic of Pediatric Infectious Diseases, İzmir, Turkey Phone : +90 232 489 56 56 E-mail : mineduzgol@gmail.com

346

Received/Geliş tarihi: January 27, 2016 Accepted/Kabul tarihi: March 28, 2016

Turk J Hematol 2016;33:346-348

mg/m2/day) in 3 divided doses was started on the first day of the onset of rash. VZV infection-related complications were defined as a condition or event occurring within 14 days of the onset of VZV infection [2]. Statistical analysis was done using SPSS 16.0 (SPSS Inc., Chicago, IL, USA).

Results During the study period, a total of 41 patients with pediatric malignancy had been hospitalized with the diagnosis of VZV infection. Among them, 14 (34.1%) were female and 27 (65.9%) were male. The mean age was 58.8±32.4 months (within the range of 8 months to 12 years of age). Of the patients, 29 had acute lymphoblastic leukemia (ALL) (70.7%), followed by 2 cases of acute myeloblastic leukemia (4.9%), 3 cases of Wilms tumor (7.3%), 2 cases of hemophagocytic lymphohistiocytosis (HLH) (4.9%), 2 cases of rhabdomyosarcoma (4.9%), 2 cases of neuroblastoma (4.9%), and 1 case of hepatoblastoma (2.4%).

Among the ALL patients, 8 (27.5%) of them were in the induction phase of chemotherapy (ALL REZ-Berlin-FrankfurtMünster protocol), 19 (65.5%) of them were in a maintenance phase, and 2 patients (6.8%) had relapsed ALL. Only 2 children (4.9%) had a known exposure to siblings in the household who had developed chickenpox.

Among the 41 patients, neutropenia was present in 18 patients (43.9%), lymphopenia was present in 27 (65.9%) patients, thrombocytopenia was present in 10 patients (24.4%), and anemia was present in 23 (56.1%) patients. Twenty-one patients had associated fever at the time of diagnosis of VZV infection.

Active vesicular rashes were present in all of the patients at the time of diagnosis and the median duration of active VZV infection was 7 days (ranging from 5 to 21 days). All patients had been admitted to our hospital within the first day of the onset of rash.

All the patients were treated with intravenous acyclovir for a median of 7 days (ranging from 5 to 21 days). During acyclovir treatment, no serious adverse effects including elevation in blood creatinine and urea levels or hematuria were observed, while 2 patients (4.8%) had nausea and vomiting that could not be explained with other reasons.

The median hospital stay was 7 days (ranging from 3 to 35 days) and the calculated attributable delay of chemotherapy due to VZV infections was 8 days (ranging from 2 to 60 days). Thirtyeight patients (93%) showed no complications, but 3 patients (7%) suffered from Acute respiratory distress syndrome (ARDS).

Two of them required mechanical ventilation and one required noninvasive ventilation; the patient with HLH (1%) died due to respiratory failure despite acyclovir and broad-spectrum antimicrobial treatment plus supportive treatment.

Düzgöl M, et al: Varicella Infections in Pediatric Malignancy Patients

Discussion Secondary attack rates among susceptible household contacts of people with VZV are as high as 90%; i.e. 9 out of 10 susceptible household contacts will become infected [8]. In this study, only 2 children (4.9%) had a known exposure to siblings in the household who had developed chickenpox. The majority of the patients had no known exposure; it was reported that for half of the ALL cases with varicella infections, the source of infection was unknown [9]. Our findings suggest that, regarding the high secondary attack rates of VZV infection, precautions should be taken for preventing possible contact of malignancy patients with VZV patients, especially in outpatient clinics including elevators, playgrounds, etc.

In our study, the most common underlying malignant disease was ALL (70.7%), supporting the findings of a previous report [10]. Patients with an underlying diagnosis of ALL and children less than 5 years of age were reported to develop complications more than any other age group, which was consistent with other studies [2]. In our study the ages of the most complicated cases were above 5 years, which showed that patients in every age group were at risk of serious VZV infection.

Immunocompromised patients develop serious complications, such as secondary bacterial infection with invasive Streptococcus pyogenes [11]. However, in our study, we experienced Streptococcus pneumoniae sepsis only in one ALL patient who required noninvasive mechanical ventilation support. In our study, our patients who underwent intensive chemotherapy faced complications and even death. Previous reports showed higher mortality rates than our study, such as 7% in 60 patients who were undergoing chemotherapy due to primary VZV pneumonitis, with or without acute encephalitis [11]. Before the introduction of specific antiviral therapy, the mortality rate of VZV infections in children with cancer was reported to be 7%-10%, with rates reaching up to 55% in cases with visceral involvement [2,3,4,5]. Children with acute leukemia who had VZV infections were reported to have a high risk for VZV pneumonia, which might occur in up to one-third of patients with a fatality rate of about 10% [12]. In our study, three patients (7%) with low absolute neutrophil count suffered from ARDS and one of them died because of respiratory failure.

The fatality rate was about 2%.

Our study showed that the complicated cases were not homogeneously distributed regarding their primary diseases. This visceral dissemination was thought not be related to the type or status of the malignancy or to the duration of specific anticancer therapy. VZV was more likely to disseminate in children with absolute lymphopenia, less than 500 cells per cubic millimeter, than in patients with higher lymphocyte counts. Patients with lymphopenia or poor cell-mediated immune responses during 347

Düzgöl M, et al: Varicella Infections in Pediatric Malignancy Patients

Turk J Hematol 2016;33:346-348

VZV infection are said to be at risk for persistent, severe, or even fatal VZV [13]. Our patients with complicated clinical features had lymphopenia and neutropenia, suggesting a correlation between immune status and poor outcome.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Immunocompromised children, particularly those with leukemia, have more numerous lesions, often with a hemorrhagic base, and healing takes nearly three times longer than in healthy children with VZV infections. These patients were reported to suffer from severe progressive VZV infections characterized by continuing eruption of lesions and high fever persisting into the second week of illness [14]. In our study, despite the median duration of the active chickenpox rash being 7 days, in some cases active hemorrhagic vesicular lesions were observed until 21 days of disease. During our study the median hospital stay was 7 days, similar to a previous report of 7.96±3.57 days [13].

Effective treatment with acyclovir is thought to be a significant factor in reducing the severity and mortality of infection [15]; however, mortality is not the only problem with cancer patients.

One of the most important findings in our study was that, regardless of the primary disease and chemotherapy protocol, chemotherapy was delayed for at least for 2 days with a median of 8 days, which could cause undesirable effects on the overall chemotherapy protocol in children.

References

In conclusion, VZV infections are still important contagious diseases in pediatric cancer patients because they cause not only significant mortality but also a delay in chemotherapy. Thus, infection control preventions should be taken in hospitals and maximum efforts for preventing possible exposure of pediatric cancer patients to VZV-infected children should be made.

1. Gunawan S, Linardi P, Tawaluyan K, Mantik MF, Veerman AJ. Varicella outbreak in a pediatric oncology ward: the Manado experience. Asian Pac J Cancer Prev 2010;11:289-292.

2. Feldman S, Hughes WT, Daniel CB. Varicella in children with cancer: seventyseven cases. Pediatrics 1975;56:388-397.

3. Katsimpardi K, Papadakis V, Pangalis A, Parcharidou A, Panagiotou JP, Soutis M, Papandreou E, Polychronopoulou S, Haidas S. Infections in a pediatric patient cohort with acute lymphoblastic leukemia during the entire course of treatment. Support Care Cancer 2006;14:277-284.

4. Matsuzaki A, Suminoe A, Koga Y, Kusuhara K, Hara T, Ogata R, Sata T, Hara T. Fatal visceral varicella-zoster virus infection without skin involvement in a child with acute lymphoblastic leukemia. Pediatr Hematol Oncol 2008;25:237-242.

5. Meir HM, Balawi IA, Meer HM, Nayel H, Al-Mobarak MF. Fever and granulocytopenia in children with acute lymphoblastic leukemia under induction therapy. Saudi Med J 2001;22:423-427.

6. Centers for Disease Control and Prevention. Epidemiology and Prevention of Vaccine-Preventable Diseases, 10th ed. Washington DC, Public Health Foundation, 2008.

7. Council of State and Territorial Epidemiologists. Public Health Reporting and National Notification for Varicella. Atlanta, Council of State and Territorial Epidemiologists, 2012.

8. Centers for Disease Control and Prevention. Epidemiology and Prevention of Vaccine-Preventable Diseases, 13th ed. Washington DC, Public Health Foundation, 2015.

9. Buda K, Tubergen DG, Levin MJ. The frequency and consequences of varicella exposure and varicella infection in children receiving maintenance therapy for acute lymphoblastic leukemia. J Pediatr Hematol Oncol 1996;18:106-112.

Ethics

10. Alam MM, Qamar FN, Khan ZW, Kumar V, Mushtaq N, Fadoo Z. Risk factors for complicated varicella infection in pediatric oncology patients at a tertiary health care facility in Pakistan. J Infect Dev Ctries 2014;8:215-220.

Ethics Committee Approval: Retrospective study; Informed Consent: Retrospective study.

11. Ben-Abraham R, Keller N, Vered R, Harel R, Barzilay Z, Paret G. Invasive group A streptococcal infections in a large tertiary center: epidemiology, characteristics and outcome. Infection 2002;30:81-85.

Authorship Contributions

12. Feldman S, Lott L. Varicella in children with cancer: impact of antiviral therapy and prophylaxis. Pediatrics 1987;80:465-472.

Concept: Mine Düzgöl, Gülcihan Özek, Nuri Bayram, Yeşim Oymak, Ahu Kara, Bengü Demirağ, Tuba Hilkay Karapınar, Yılmaz Ay, Canan Vergin, İlker Devrim; Design: Mine Düzgöl, İlker Devrim; Data Collection or Processing: Mine Düzgöl, İlker Devrim; Analysis or Interpretation: Mine Düzgöl, İlker Devrim; Literature Search: Mine Düzgöl; Writing: Mine Düzgöl.

13. Escaño-Gallardo ET, Bravo LC. Varicella in immunocompromised children at the Philippine general hospital: a six-year review. PIDSP Journal 2011;12:27-39.

348

14. Cherry J. Feigin and Cherry’s Textbook of Pediatric Infectious Diseases, 5th ed. Philadelphia, W.B. Saunders, 2004.

15. Carcao MD, Lau RC, Gupta A, Huerter H, Koren G, King SM. Sequential use of intravenous and oral acyclovir in the therapy of varicella in immunocompromised children. Pediatr Infect Dis J 1998;17:626-631.

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.2015.0446 Turk J Hematol 2016;33:349-350

Chediak-Higashi Syndrome in Accelerated Phase Masquerading as Acute Leukemia Akut Lösemiyi Taklit Eden Akselere Fazda Chediak Higashi Sendromu Mili Jain, Ashutosh Kumar, Uma Shankar Singh, Rashmi Kushwaha King George’s Medical University, Department of Pathology, Uttar Pradesh, India

Figure 1. Peripheral blood smear with Leishman stain at 400x: giant granules in neutrophils and lymphocytes.

Figure 2. Hair follicles at 400x with irregularly sized melanosomes.

We present a 3-year-old female born of a consanguineous marriage with the complaints of high-grade fever, petechial spots, abdominal distension, and lymphadenopathy for 20 days. She had pallor, hypopigmented hairs, petechial rashes, and palpable lymph nodes (up to 1 cm) in the bilateral inguinal and cervical region. Systemic examination revealed hepatosplenomegaly. Her hematological profile was as follows: hemoglobin of 8.4 g/dL, normocytic normochromic red cell indices, platelet count of 11x109/L, total leukocyte count of 7x109/L with increased lymphocytes (68.5%), and lactate dehydrogenase raised at 796 IU/L. The peripheral blood smear examination revealed giant granules in neutrophils, lymphocytes, and monocytes (Figure 1). Bone marrow examination revealed similar granules in myeloid precursors

with moderate hemophagocytosis. Examination of the hair shafts showed large melanin granules (Figure 2). Her liver function tests, kidney function tests, and chest X-ray results were within reference ranges. She was diagnosed with ChediakHigashi syndrome (CHS) in the accelerated phase.

CHS is a rare autosomal recessive disorder (gene CHS1/LYST) [1].

The clinical picture includes partial oculocutaneous albinism, abnormal bleeding time, peripheral neuropathy, and recurrent severe bacterial infection [2]. The giant lysosomal granules (formed as a result of cytoplasmic injury, phagocytosis, and fusion due to microtubular defects) in white blood cells are pathognomonic for diagnosis [3].

Address for Correspondence/Yazışma Adresi: Mili JAIN, M.D., King George’s Medical University, Department of Pathology, Uttar Pradesh, India Phone : 522 407 59 89 E-mail : milijain786@gmail.com

Received/Geliş tarihi: December 25, 2015 Accepted/Kabul tarihi: January 20, 2016

349

Jain M, et al. Chediak-Higashi Syndrome in Accelerated Phase Masquerading as Acute Leukemia

Keywords: Chediak Immunodeficiency

Higashi

syndrome,

Giant

granules,

Anahtar Sözcükler: Chediak Higashi sendromu, Dev granüller, İmmün yetmezlik Authorship Contributions Concept: Mili Jain; Design: Mili Jain, Ashutosh Kumar, Uma Shankar Singh, Rashmi Kushwaha; Data Collection or Processing: Mili Jain, Ashutosh Kumar, Uma Shankar Singh, Rashmi Kushwaha; Analysis or Interpretation: Mili Jain, Ashutosh Kumar, Uma Shankar Singh, Rashmi Kushwaha; Literature Search: Mili Jain; Writing: Mili Jain.

350

Turk J Hematol 2016;33:349-350

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Antunes H, Pereira A, Cunha I. Chediak-Higashi syndrome: pathognomonic feature. Lancet 2013;382:1514.

2. Bharti S, Bhatia P, Bansal D, Varma N. The accelerated phase of ChediakHigashi syndrome: the importance of hematological evaluation. Turk J Hematol 2013;30:85-87.

3. Usha HN, Prabhu PD, Sridevi M, Baindur K, Balakrishnan CM. ChediakHigashi syndrome. Indian Pediatr 1994;34:1115-1119.

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.2015.0399 Turk J Hematol 2016;33:351-352

Auer Rod-Like Inclusions in Reactive Plasma Cells in a Case of Acute Myeloid Leukemia Akut Miyeloid Lösemili Bir Olguda Reaktif Plazma Hücresinde Auer-Rod Benzeri İnklüzyonlar Sarita Pradhan

Institute of Medical Sciences and Sum Hospital, Laboratory of Hematology, Bhubaneswar, India

Figure 1. Myeloblasts and plasma cells containing Auer rod-like inclusions.

Figure 2. Plasma cell showing Auer rod-like inclusions.

Figure 3. A Mott cell.

Address for Correspondence/Yazışma Adresi: Sarita PRADHAN, M.D., Institute of Medical Sciences and Sum Hospital, Laboratory of Hematology, Bhubaneswar, India Phone : 9 776 243 866 E-mail : dr.sarita26@gmail.com

Received/Geliş tarihi: November 17, 2015 Accepted/Kabul tarihi: February 23, 2016

351

Pradhan S: Auer Rod-Like Inclusions in Plasma Cells

Turk J Hematol 2016;33:351-352

A 61-year-old female presented with decreasing hemoglobin for the past 6 months. She had a history of multiple transfusions in the recent past. Laboratory investigations showed hemoglobin of 8.6 g/dL, total blood leukocyte count of 1.13x109/L, and platelets of 80x109/L with the presence of occasional circulating blasts. Bone marrow examination revealed the presence of 63% myeloblasts with prominent Auer rods and mild reactive plasmacytosis (6%). Some of the plasma cells showed Auer rod-like thin slender inclusions (Figures 1, 2, and 3). She was diagnosed with acute myeloid leukemia. Serum protein electrophoresis was done, which showed a normal pattern.

Keywords: Auer rods, Acute myeloid leukemia, Plasma cells

Presence of Auer rod-like inclusions has been described in rare cases of multiple myeloma [1,2], but Auer rod-like inclusions in reactive plasma cells in a case of acute myeloid leukemia have not been reported in the literature. The reported patients either had IgA kappa myeloma or IgG myeloma. Rare cases of Auer rod-like inclusions in aplastic anemia have been reported [3]. However, the exact nature of these inclusions needs to be studied further.

1. Parmentier S, Radke J. Pseudo Auer rods in a patient with newly diagnosed

352

Anahtar Sözcükler: Auer cismi, Akut miyeloid lösemi, Plazma hücreleri Conflict of Interest: The author of this paper has no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References IgG myeloma. Blood 2012;119:650.

2. Hütter G, Nowak D, Blau IW, Thiel E. Auer rod like intracytoplasmic inclusions in multiple myeloma. A case report and review of literature. Int J Lab Hematol 2009;31:236-240.

3. Lemez P. Auer rod-like inclusions in cells of B-lymphocytic lineage. Acta Haematol 1988;80:177-178.

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.2016.0106 Turk J Hematol 2016;33:353-354

Coexistence of Chronic Lymphocytic Leukemia and Acute Myeloid Leukemia Kronik Lenfositik Lösemi ile Akut Myeloid Lösemi Birlikteliği Ivana Milosevic University of Novi Sad Faculty of Medicine, Clinical Center of Vojvodina, Novi Sad, Serbia

Figure 1. Chronic lymphocytic leukemia cells and acute myeloid leukemia cells in the peripheral blood smear.

A 76-year-old man presented with leukocytosis (86x109/L), fever, pneumonia, and significant weight loss. He had a history of chronic lymphocytic leukemia diagnosed 5 years earlier and he responded with partial remission to treatment with continuous low doses of chlorambucil.

Analysis of the blood smear, bone marrow aspiration, and bone marrow biopsy revealed the predomination of small lymphocytes, but 22% of the cells were blasts negative with cytochemical staining (Figure 1). Flow cytometric analysis showed two distinct populations: 65% of cells were small to moderate in size and CD19+, CD45+, CD5+, and CD20+/-, while 30% of cells were large, CD34+, CD13+, HLA DR+, CD65+, CD45+, and MPO weakly positive and CD33, CD14, CD15, and CD16 negative. Immunophenotyping confirmed the coexistence of chronic lymphocytic leukemia and poorly differentiated

acute myeloid leukemia. Conventional cytogenetic testing did not show any chromosomal abnormalities.

The patient was treated with intensive antibiotherapy and received one course of chemotherapy, but he did not achieve remission and died 2 months later.

The coexistence of chronic lymphocytic leukemia and acute myeloid leukemia is rare [1]. Therapy-related acute myeloid leukemia can develop after treatment of chronic lymphocytic leukemia with alkylating agents, nucleoside analogs, or combination chemotherapy, but the two leukemias can also originate independently [2,3].

Keywords: Chronic lymphocytic leukemia, Acute myeloid leukemia, Therapy

Address for Correspondence/Yazışma Adresi: Ivana MILOSEVIC, M.D., University of Novi Sad Faculty of Medicine, Clinical Center of Vojvodina, Novi Sad, Serbia E-mail : ivana.milosevic@mf.uns.ac.rs

ivana.ml@mts.rs

Received/Geliş tarihi: March 16, 2016 Accepted/Kabul tarihi: March 23, 2016

353

Milosevic I: Coexistence of Chronic Lymphocytic Leukemia and Acute Myeloid Leukemia

Turk J Hematol 2016;33:353-354

Anahtar Sözcükler: Kronik lenfositik lösemi, Akut miyeloid lösemi, Tedavi

WG. Outcomes for patients with chronic lymphocytic leukemia and acute leukemia or myelodysplastic syndrome. Leukemia 2016;30:325330.

Conflict of Interest: The author of this paper has no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

2. Morrison VA, Rai KR, Peterson BL, Kolitz JE, Elias L, Appelbaum FR, Hines JD, Shepherd L, Larson RA, Schiffer CA. Therapy-related myeloid leukemias as are observed in patients with chronic lymphocytic leukemia after treatment with fludarabine and chlorambucil: results of an intergroup study, Cancer and Leukemia Group B 9011. J Clin Oncol 2002;15:38783884.

References 1. Tambaro FP, Garcia-Manero G, O’Brien SM, Faderl SH, Ferrajoli A, Burger JA, Pierce S, Wang X, Do KA, Kantarjian HM, Keating MJ, Wierda

354

3. Leone G, Pagano L, Ben-Yehuda D, Voso MT. Therapy-related leukemia and myelodysplasia: susceptibility and incidence. Haematologica 2007;92:13891398.

LETTERS TO THE EDITOR Turk J Hematol 2016;33:355-370

Evaluation of Knowledge of Patients with Hemophilia Regarding Their Diseases and Treatment in Iran İran’daki Hemofili Hastalarının Hastalıkları ve Tedavileri Hakkında Bilgilerinin Değerlendirilmesi Mehran Karimi, Tahereh Zarei, Sezaneh Haghpanah, Zohreh Zahedi Shiraz University of Medical Sciences, Hematology Research Center, Shiraz, Iran

To the Editor, Hemophilia A and B are hereditary X-chromosomal recessive disorders affecting 1 in 5000 male births [1,2]. Hemophilia is classified as severe at F VIII / F IX <1 kIU L-1, moderate at 1-5 kIU L-1, and mild at >5-25 kIU L-1 [3].

During the mid-1970s hemophilia care underwent substantial improvement to provide more optimal disease management for bleeding prevention strategies and education programs. This led to better educational strategies for disease management [4,5].

Home therapy can be used to manage mild and moderate bleeding episodes and can help to achieve optimal treatment, resulting in decreased pain and hospital admissions for complications [6].

In this cross-sectional study, 30 patients with hemophilia A and B who were registered at the Hemophilia Center of Shiraz, Fars Province, southern Iran, were investigated between March and October of 2013. The data collection form consisted of two parts including demographic data and 22 specific questions regarding assessment of knowledge of the patients regarding the disease and treatment. In this latter section specific topics included appropriate treatment, disease transmission, physiotherapy application, management of bleeding, and the most common symptoms of bleeding.

The correct answer to questions had a sum of 1 to 4 points.

Some of the questions had more than one correct answer.

Total knowledge scores were categorized into three grades: scores of 1-14 (poor knowledge), 15-29 (fair knowledge), and 30-41 (good knowledge).

This study was approved by the Ethics Committee of Shiraz University of Medical Sciences.

Data were analyzed by SPSS 17 using the Mann-Whitney U test and the Pearson correlation test, and p<0.05 was considered as statistically significant.

Demographic characteristics of the patients including disease severity and educational level are shown in Table 1.

Participants included 3 female patients and 27 male patients; 26 patients had hemophilia type A and 4 patients had hemophilia type B. The median age of the patients was 23.5±6.1 years, ranging from 8 to 37 years old. Seven patients had a mild/moderate and 23 had a severe form of hemophilia.

Overall, the mean knowledge score of the patients was determined as 14.7±4.5 (range: 4-26). Considering the three levels of knowledge classification, all patients fell into the first category of poor knowledge (score of <30). There was no significant correlation between the knowledge of the patients and their ages (p=0.094). The results also revealed no significant association between the knowledge of patients and disease severity (p=0.446) or educational level (p>0.999).

There are limited studies that assess the knowledge level of individual patients regarding the management of hemophilia [7,8,9]. An important finding of this study was that patients’ knowledge was not correlated with age, educational level, or disease severity.

Table 1. Demographic characteristics of the patients with hemophilia, including severity and educational level.

Variables

Median (Interquartile Range)

p-value

Severity Severe Moderate/mild

15 (5.50) 14 (5)

0.446

Education level High school Diploma Undergraduate Diploma

15 (5.63) 15.5 (11.13)

>0.999

355

LETTERS TO THE EDITOR

Hemophilia associations should be recommended for educational programs for patients and caregivers. Hematologists and nongovernmental organizations can work together for lifelong educational programs. Finally, we recommend holding patient workshops twice a year as well as publishing simple books or brochures in each local language to improve the knowledge and therefore the quality of life of these patients.

Keywords: Knowledge, Hemophilia, Treatment, Disease Anahtar Sözcükler: Bilgi, Hemofili, Tedavi, Hastalık Ethics Ethics Committee Approval: This study was approved by the Ethics Committee of Shiraz University of Medical Sciences.

Authorship Contributions Concept: Mehran Karimi; Design: Mehran Karimi; Editing the Manuscript: Mehran Karimi; Data Collection or Processing: Zohreh Zahedi; Analysis or Interpretation: Sezaneh Haghpanah; Literature Search: Tahereh Zarei; Writing: Tahereh Zarei.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Turk J Hematol 2016;33:355-370

References 1. Stachnik J. Hemophilia: etiology, complications, and current options in management. Formulary 2010;45:218.

2. Lee CA, Berntorp EE, Hoots WK. Textbook of Hemophilia. New York, John Wiley & Sons, 2011.

3. White GC 2nd, Rosendaal F, Aledort LM, Lusher JM, Rothschild C, Ingerslev J; Factor VIII and Factor IX Subcommittee. Definitions in hemophilia. Recommendation of the Scientific Subcommittee on Factor VIII and Factor IX of the Scientific and Standardization Committee of the International Society on Thrombosis and Haemostasis. Thromb Haemost 2001;85:560.

4. Smith PS, Levine PH. The benefits of comprehensive care of hemophilia: a five-year study of outcomes. Am J Public Health 1984;74:616-617.

5. Soucie JM, Nuss R, Evatt B, Abdelhak A, Cowan L, Hill H, Kolakoski M, Wilber N. Mortality among males with hemophilia: relations with source of medical care. Blood 2000;96:437-442.

6. Teitel J, Barnard D, Israels S, Lillicrap D, Poon MC, Sek J. Home management of haemophilia. Haemophilia 2004;10:118-133.

7. Lindvall K, Colstrup L, Wollter IM, Klemenz G, Loogna K, Grönhaug S, Thykjaer H. Compliance with treatment and understanding of own disease in patients with severe and moderate haemophilia. Haemophilia 2006;12:4751.

8. Nazzaro AM, Owens S, Hoots WK, Larson KL. Knowledge, attitudes, and behaviors of youths in the US hemophilia population: results of a national survey. Am J Public Health 2006;96:1618-1622.

9. Miller K, Guelcher C, Taylor A. Haemophilia A: patients’ knowledge level of treatment and sources of treatment‐related information. Haemophilia 2009;15:73-77.

Address for Correspondence/Yazışma Adresi: Mehran KARIMI, M.D., Shiraz University of Medical Sciences, Hematology Research Center, Shiraz, Iran Phone : 00987136473239 E-mail : karimim@suns.ac.ir

Received/Geliş tarihi: January 24, 2016 Accepted/Kabul tarihi: June 02, 2016 DOI: 10.4274/tjh.2016.0041

Therapeutic Plasma Exchange Ameliorates Incompatible Crossmatches Çapraz Karşılaştırma Uyumsuzluklarını Ortadan Kaldıran Tedavi Edici Plazma Değişimi Mehmet Özen1, Sinan Erkul2, Gülen Sezer Alptekin Erkul2, Özlem Genç3, Engin Akgül2, Ahmet Hakan Vural2 1Dumlupınar University Faculty of Medicine, Department of Hematology, Kütahya, Turkey 2Dumlupınar University Faculty of Medicine, Department of Cardiac Surgery, Kütahya, Turkey 3Dumlupınar University Faculty of Medicine, Blood Bank Unit, Kütahya, Turkey

To the Editor, Red blood cell (RBC) transfusion is a risk factor for mortality and morbidity in coronary artery bypass graft (CABG) surgery, and transfusion-related adverse effects may be catastrophic in these patients [1,2,3,4]. Unfortunately, there are no recommendations for these patients regarding how to proceed in the case of incompatible crossmatch tests against donors’ blood. To our

356

knowledge, there is no report about the role of therapeutic plasma exchange (TPE) in resolving incompatible crossmatches.

A 73-year-old man was admitted to our hospital because of chest pain. He had no previous medical history of coronary artery disease or any other diseases, including hemolytic disease and recent infection. In addition, he used no medication and had not received blood transfusions. After coronary angiography, a

LETTERS TO THE EDITOR

Turk J Hematol 2016;33:355-370

CABG was planned for the patient. Because of critical coronary artery lesions, he had to undergo the operation as soon as possible. His laboratory tests revealed mild normocytic anemia with hemoglobin of 12.8 g/dL, mean corpuscular volume of 82.2 fL, white blood cell count of 9200/µL, and platelet count of 281,000/µL. His biochemical results were normal for renal and liver function tests. The patient’s blood group was B Rh D positive based on forward and reverse grouping. Whole blood transfusion was planned for the CABG procedure by the surgeons as a part of their conventional approach. However, cross match results revealed 3+ reactions against B Rh D positive donors’ whole blood and other B Rh D positive RBCs in the blood bank (Figure 1A). Direct Coombs test results were 2+ AHG and IgG (Figure 1B). Due to the urgency of the planned CABG, we did not wait for detailed antibody screening test results, and TPE (Infomed, Geneva, Switzerland) was performed. Total body plasma was exchanged with fresh frozen plasma within 2 h. After one TPE procedure, the cross-reaction to donors’ whole blood was 2+.

TPE was performed again 1 day later, and after the second TPE, the crossmatches were compatible (Figures 1C and 1D). There was no adverse effect due to TPE. We operated after the second TPE, used a regular erythrocyte suspension and whole blood, administered 40 mg/day intravenous methylprednisolone for 4 days, and discharged the patient 1 week after the operation.

Two weeks after the operation, he had no hematological or antibody-related disease and he had a normal complete blood count with compatible crossmatches. He also had no antibodies related to incompatible crossmatches.

In a patient undergoing CABG, an incompatible blood transfusion can lead to perioperative hemolysis and increased mortality [5,6]. Defining the antibodies and finding compatible blood for a patient with incompatible crossmatches can be a challenging and time-consuming problem [5,7].

TPE is an important treatment modality for many autoimmune conditions and helps by removing autoantibodies [8]. Our patient did not have time to wait and needed CABG urgently. Therefore, we assumed that the patient had antibody-related autoimmune hemolytic anemia and treated him with TPE. We report that this approach may be efficient for patients with incompatible crossmatch results even if they do not have autoimmune hemolytic anemia. Therefore, TPE might be reserved for urgent conditions or when identification of antibodies is inconclusive.

Keywords: Cardiac surgery, Apheresis, Crossmatch, Transfusion medicine Anahtar Sözcükler: Kalp cerrahisi, Aferez, Çapraz karşılaştırma, Transfüzyon tıbbı Authorship Contributions Concept: Mehmet Özen, Sinan Erkul; Design: Mehmet Özen, Ahmet Hakan Vural; Data Collection or Processing: Özlem Genç, Sinan Erkul, Gülen Sezer Alptekin Erkul, Engin Akgül; Analysis or Interpretation: Mehmet Özen, Ahmet Hakan Vural; Writing: Mehmet Özen.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Evanovitch D. A primer in pretransfusion testing. Transfus Apher Sci 2012;46:281-286.

2. Santos AA, Silva JP, Silva Lda F, Sousa AG, Piotto RF, Baumgratz JF. Therapeutic options to minimize allogeneic blood transfusions and their adverse effects in cardiac surgery: a systematic review. Rev Bras Cir Cardiovasc 2014;29:606-621.

3. Senay S, Toraman F, Karabulut H, Alhan C. Is it the patient or the physician who cannot tolerate anemia? A prospective analysis in 1854 non-transfused coronary artery surgery patients. Perfusion 2009;24:373-380.

Figure 1. A) Crossmatch before therapeutic plasma exchange (TPE), B) direct Coombs test before TPE, C) crossmatch after one TPE, D) crossmatch after two TPEs. All tests were performed with DG gel cards (Grifols) and used the Wadiana automated blood bank (Grifols, SantCugat del Valles, Barcelona, Spain).

4. Society of Thoracic Surgeons Blood Conservation Guideline Task Force, Ferraris VA, Ferraris SP, Saha SP, Hessel EA 2nd, Haan CK, Royston BD, Bridges CR, Higgins RS, Despotis G, Brown JR; Society of Cardiovascular Anesthesiologists Special Task Force on Blood Transfusion, Spiess BD, ShoreLesserson L, Stafford-Smith M, Mazer CD, Bennett-Guerrero E, Hill SE, Body S. Perioperative blood transfusion and blood conservation in cardiac surgery: the Society of Thoracic Surgeons and the Society of Cardiovascular Anesthesiologists clinical practice guidelines. Ann Thorac Surg 2007;83(5 Suppl):27-86.

357

LETTERS TO THE EDITOR

Turk J Hematol 2016;33:355-370

5. White MJ, Hazard SW 3rd, Frank SM, Boyd JS, Wick EC, Ness PM, Tobian AA. The evolution of perioperative transfusion testing and blood ordering.

Anesth Analg 2015;120:1196-1203.

7. Sanz C, Nomdedeu M, Belkaid M, Martinez I, Nomdedeu B, Pereira A. Red blood cell alloimmunization in transfused patients with myelodysplastic syndrome or chronic myelomonocytic leukemia. Transfusion 2013;53:710-715.

6. Rakic S, Belic B, Erceg S, Jovanovic R, Kulic Z, Stefanovic N, Belic A, Uzurov V, Spasojevic J. Complications in the use of blood transfusions-alloimmunization in polytransfused patients. Med Pregl 1999;52:375378.

8. Sengul Samanci N, Ayer M, Gursu M, Ar MC, Yel K, Ergen A, Dogan EE, Karadag S, Cebeci E, Toptas M, Kazancioglu R, Ozturk S. Patients treated with therapeutic plasma exchange: a single center experience. Transfus Apher Sci 2014;51:83-89.

Address for Correspondence/Yazışma Adresi: Mehmet ÖZEN, M.D., Dumlupınar University Faculty of Medicine, Department of Hematology, Kütahya, Turkey Phone : +90 274 231 66 60 E-mail : kanbilimci@gmail.com

Received/Geliş tarihi: February 06, 2016 Accepted/Kabul tarihi: June 06, 2016 DOI: 10.4274/tjh.2016.0056

Megaloblastic Anemia with Ring Sideroblasts is not Always Myelodysplastic Syndrome Halka Sideroblastlı Megaloblastik Anemi Her Zaman Miyelodisplastik Sendrom Olmayabilir Neha Chopra Narang1, Mrinalini Kotru2, Kavana Rao1, Meera Sikka1 1University College of Medical Sciences, Department of Pathology, Delhi, India 2University College of Medical Sciences, Department of Hematopathology, Delhi, India

To the Editor, Ring sideroblasts are morphological hallmarks of hereditary and acquired sideroblastic anemias [1]. The International Working Group on Morphology of Myelodysplastic syndrome (MDS) defined ring sideroblasts as erythroblasts in which a minimum of five siderotic granules cover at least one-third of the circumference of the nucleus.

We present the case of an 18-year-old female who had lowgrade fever, jaundice, nausea, vomiting, and shortness of breath for 25 days. The patient was not an alcoholic and not on any drugs. On examination she appeared pale and icteric; however, no hepatosplenomegaly was noted. A complete blood count (CBC) and bone marrow examination were performed.

The CBC revealed Hb: 75 g/L, PCV: 0.232%, RBC: 2.15x1012/L, MCV: 108 fL, MCH: 34.8 pg, MCHC: 32.2 g/dL, total leukocyte count: 2.6x109/L, platelet count: 87x109/L, reticulocyte count: 0.8%, and differential leukocyte count: N74 L26. A peripheral smear revealed pancytopenia with dimorphic anemia. No coarse basophilic stippling was noted (as seen in lead poisoning). Bone marrow aspirate was particulate and hypercellular for age with erythroid hyperplasia, showing megaloblastic maturation and dyserythropoiesis (Figure 1). Giant myeloid forms were seen. Megakaryocytes appeared adequate and were normal in morphology. Bone marrow iron was increased (grade 3) and showed 6%-7% ring sideroblasts (Figure 2). A final diagnosis

358

of megaloblastic anemia with ring sideroblasts was made after excluding various other causes of the same symptoms. The patient was put on a therapeutic trial of hematinics (vitamin B12, folic acid, and pyridoxine) and showed improvement.

After therapy, a CBC revealed Hb: 122 g/L, PCV: 0.432%, RBC: 4.15x1012/L, MCV: 85 fL, MCH: 30.8 pg, MCHC: 31.2 g/dL, total leukocyte count: 5.6x109/L, and platelet count: 177x109/L. However, a repeat bone marrow examination could not be performed as the patient did not comply.

Figure 1. Bone marrow aspiration: megaloblastic maturation with dyserythropoiesis and giant myelocyte (1000x).

LETTERS TO THE EDITOR

Turk J Hematol 2016;33:355-370

vitamin B12 and folic acid [8]. The presence of ring sideroblasts does not always point towards impending MDS. The development of ring sideroblasts in the above case was related to an absolute or relative deficiency of pyridoxine associated with vitamin B12 and folate deficiency.

Keywords: Ring sideroblasts, Myelodysplastic syndrome

Megaloblastic

anemia,

Anahtar Sözcükler: Halka sideroblastlar, Megaloblastik anemi, Miyelodisplastik sendrom Authorship Contributions

Figure 2. Ring sideroblasts; Perl’s stain on bone marrow aspirate (1000x).

Ring sideroblasts are found exclusively in pathological conditions and should not be confused with ferritin sideroblasts, which are present in normal bone marrow. The latter are normal erythroblasts that, upon Prussian blue staining, show a few blue granules scattered in the cytoplasm, representing endosomes filled with excess iron not utilized for heme synthesis (siderosomes). While the iron of ferritin sideroblasts is stored in cytosolic ferritin, whose subunits are encoded by the FTH1 and FTL genes, the iron of ring sideroblasts is stored in mitochondrial ferritin, encoded by the FTMT gene [2]. There are two forms of sideroblastic anemia: congenital sideroblastic anemia and acquired sideroblastic anemia. Most acquired sideroblastic anemia cases were included within MDS. Acquired sideroblastic anemia in MDS is categorized either as refractory cytopenia with multilineage dysplasia or refractory anemia with ring sideroblasts, depending on the level of dysplasia [3]. Causes of acquired reversible sideroblastic anemia include alcohol use (most common), pyridoxine deficiency, lead poisoning, copper deficiency, excess zinc that can indirectly cause sideroblastic anemia by decreasing absorption and increasing excretion of copper, and antimicrobials like isoniazid, chloramphenicol, linezolid, and cycloserine [1,4].

Impaired heme synthesis in sideroblastic anemias is associated with abnormal vitamin B6 metabolism at the level of the mitochondrion. Megaloblastic anemia due to folic acid deficiency and ringed sideroblastic anemia have been reported in alcohol abusers [1,5,6,7]. Vitamin B6 deficiency is associated with the development of ring sideroblasts in these patients. Patients with megaloblastic anemia showing the presence of ring sideroblasts should therefore be supplemented with pyridoxine in addition to

Concept: Neha Chopra Narang, Mrinalini Kotru; Design: Neha Chopra Narang, Mrinalini Kotru, Kavana Rao, Meera Sikka; Data Collection or Processing: Neha Chopra Narang, Kavana Rao; Analysis or Interpretation: Neha Chopra Narang, Mrinalini Kotru, Kavana Rao, Meera Sikka; Literature Search: Neha Chopra Narang, Mrinalini Kotru, Kavana Rao, Meera Sikka; Writing: Neha Chopra Narang, Mrinalini Kotru, Kavana Rao, Meera Sikka.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Hines JD. Reversible megaloblastic and sideroblastic marrow abnormalities in alcoholic patients. Br J Haematol 1969;16:87-101.

2. Cazzola M, Invernizzi R. Ring sideroblasts and sideroblastic anemia.

Haematologica 2011;96:789-792.

3. Ohba R, Furuyama K, Yoshida K, Fujiwara T, Fukuhara N, Onishi Y, Manabe A, Ito E, Ozawa K, Kojima S, Ogawa S, Harigae H. Clinical and genetic characteristics of congenital sideroblastic anemia: comparison with myelodysplastic syndrome with ring sideroblast (MDS-RS). Ann Hematol 2013;92:1-9.

4. Willekens C, Dumezy F, Boyer T, Renneville A, Rossignol J, Berthon C, Cotteau-Leroy A, Mehiaoui L, Quesnel B, Preudhomme C. Linezolid induces ring sideroblasts. Haematologica 2013;98:e138-140.

5. Iwama H, Iwase O, Hayashi S, Nakano M, Toyama K. Macrocytic anemia with anisocytosis due to alcohol abuse and vitamin B6 deficiency. Rinsho Ketsueki 1998;39:1127-1130.

6. Solomon LR, Hillman RS. Vitamin B6 metabolism in idiopathic sideroblastic anaemia and related disorders. Br J Haematol 1979;42:239-253.

7. Lindenbaum J, Roman MJ. Nutritional anemia in alcoholism. Am J Clin Nutr 1980;33:2727-2735.

8. Dawson AM, Holdsworth CD, Pitcher CS. Sideroblastic anaemia in adult coeliac disease. Gut 1964;5:304-308.

Address for Correspondence/Yazışma Adresi: Mrinalini KOTRU, M.D., University College of Medical Sciences, Department of Pathology, Delhi, India Phone : +91 981 034 52 36 E-mail : mrinalinikotru@gmail.com

Received/Geliş tarihi: March 05, 2016 Accepted/Kabul tarihi: July 28, 2016 DOI: 10.4274/tjh.2016.0090

359

LETTERS TO THE EDITOR

Turk J Hematol 2016;33:355-370

Annular Erythematous Patches as the Presenting Sign of Extranodal Natural Killer/T-Cell Lymphoma Ekstranodal Doğal Öldürücü/T-Hücreli Lenfomanın Bulgusu Olarak Anüler Eritematöz Yamalar Can Baykal1, Algün Polat Ekinci1, Şule Öztürk Sarı2, Zeynep Topkarcı3, Özgür Demir1, Nesimi Büyükbabani2 1İstanbul University İstanbul Faculty of Medicine, Department of Dermatology and Venereology, İstanbul, Turkey 2İstanbul University İstanbul Faculty of Medicine, Department of Pathology, İstanbul, Turkey 3Bakırköy Dr. Sadi Konuk Training and Research Hospital, Clinic of Dermatology, İstanbul, Turkey

To the Editor, Extranodal natural killer/T-cell lymphoma (ENKTL) is a distinct type of lymphoma strongly associated with Epstein-Barr virus (EBV) infection and showing an aggressive course [1]. It usually presents as a localized disease in the upper aerodigestive tract, from the nasal cavity to the hypopharynx [2,3], but it may rapidly extend to the neighboring tissues and disseminate to various organs such as the small intestine, epiglottis, testes, adrenal gland, kidneys, and breasts [4,5]. As nasal/upper aerodigestive tract involvement may only cause nonspecific symptoms in the early period, diagnosis may be initially established based upon skin lesions [6]. We present two ENKTL patients with unusual dermatological findings.

Patient 1, a 44-year-old male, presented with a widespread eruption on the trunk, scalp, and arms consisting of annular erythematous patches (Figure 1a) and hyperpigmented/purpuric patches circumscribed with erythematous rings (Figure 1b). A biopsy revealed neoplastic infiltration of atypical lymphocytes expressing CD56 and granzyme-B but negative for CD2, CD3, CD8, and CD20. Nasopharyngeal involvement was suspected with radiologic imaging (magnetic resonance imaging) and ENKTL was diagnosed after a nasopharyngeal biopsy. Bone marrow biopsy was normal. Following CHOP chemotherapy, most of the cutaneous lesions resolved with slight hyperpigmentation, but complete clearance was not achieved during the 3-month follow-up period.

Patient 2, a 39-year-old male having a history of infectious mononucleosis 5 months earlier, presented with widespread infiltrated plaques on the nose, cheeks, (Figure 1c), forehead, scalp, trunk, and arms and a deep nodule on the hard palate for 2 months. Annular erythema and purpuric patches circumscribed with annular rims were remarkable on the back (Figure 1d).

Serum EBV-PCR and EBV VCA-IgG tests revealed positive results.

Punch biopsies performed from both erythematous patches on the back and infiltrated plaques showed neoplastic lymphocytic infiltration with EBV-encoded RNA (EBER) positivity by in situ hybridization, which confirmed the diagnosis of ENKTL (Figures 1e and 1f). A PET-CT examination revealed nasopharynx, palate, 360

and tonsil involvements and metastatic parenchymatous nodules in both lungs.

A broad spectrum of skin lesions such as erythematous indurated plaques, painful subcutaneous nodules, persistent cellulitis-like or abscess-like swellings, panniculitis-like lesions, mycosis fungoides-like lesions, and nonhealing ulcers can be seen in patients with ENKTL [7,8,9]. Three ENKTL cases were reported in which patients presented with skin lesions on the trunk and extremities described as infiltrated erythema, edematous erythema, and dark red erythema, one of them showing an annular configuration [8]. An ENKTL case also involving erythematous patches that developed and regressed over the course of chemotherapy was reported [10]. However, this was considered as a possible paraneoplastic sign.

Both of our patients had unusual lesions for cutaneous lymphoma, namely erythematous patches mostly showing annular configurations besides the more typical infiltrated plaques of Patient 2. From a clinical standpoint, the appearance of these erythematous lesions is like an inflammatory disease and may be a paraneoplastic sign. However, the lesions were

Figure 1. a, b) Widespread eruption on the trunk consisting of annular erythematous patches (Patient 1). c) Infiltrated plaque on the forehead extending to the scalp (Patient 2). d) Annular erythematous patches and purpuric patches circumscribed with a thin erythematous ring (Patient 2). e) Dense neoplastic infiltration of atypical lymphocytes on the mid-deep dermis (hematoxylin and eosin, 200x). f) In situ hybridization for EBER shows positive signals (EBER, 100x) (Patient 2).

LETTERS TO THE EDITOR

Turk J Hematol 2016;33:355-370

nonmigratory and had persisted for a long time, in contrast to the expected course of possible reactive inflammatory dermatoses.

Moreover, in both cases histopathologic examination showed neoplastic infiltration of ENKTL. In conclusion, persistent erythematous patches with annular shape may be among the skin involvement patterns of ENKTL and awareness of this peculiar finding may avoid delay in its diagnosis.

Keywords: Extranodal natural killer/T cell lymphoma, Erythematous indurated plaques, Annular erythematous patch, Annular erythema

and/or affiliations relevant to the subject matter or materials included.

References 1. Chan JK, Sin VC, Wong KF, Ng CS, Tsang WY, Chan CH, Cheung MM, Lau WH. Nonnasal lymphoma expressing the natural killer cell marker CD56: a clinicopathologic study of 49 cases of an uncommon aggressive neoplasm.

Blood 1997;89:4501-4513.

2. Miyazato H, Nakatsuka S, Dong Z, Takakuwa T, Oka K, Hanamoto H, Tatsumi Y, Kanamaru A, Aozasa K; Osaka Lymphoma Study Group. NK-cell related neoplasms in Osaka, Japan. Am J Hematol 2004;76:230-235.

3. Oshimi K, Kawa K, Nakamura S, Suzuki R, Suzumiya J, Yamaguchi M, Kameoka J, Tagawa S, Imamura N, Ohshima K, Kojya S, Iwatsuki K, Tokura Y, Sato E, Sugimori H; NK-cell Tumor Study Group. NK-cell neoplasms in Japan. Hematology 2005;10:237-245.

Anahtar Sözcükler: Ekstranodal doğal öldürücü/T hücreli lenfoma, Eritemli indüre plaklar, Anuler eritemli yama, Anuler eritem

4. Lim ST, Hee SW, Quek R, Lim LC, Yap SP, Loong EL, Sng I, Tan LH, Ang MK, Ngeow J, Tham CK, Ngo L, Tan MH, Tao M. Comparative analysis of extranodal NK/T-cell lymphoma and peripheral T-cell lymphoma: significant differences in clinical characteristics and prognosis. Eur J Haematol 2008;80:55-60.

Authorship Contributions

5. Li S, Feng X, Li T, Zhang S, Zuo Z, Lin P, Konoplev S, Bueso-Ramos CE, Vega F, Medeiros LJ, Yin CC. Extranodal NK/T-cell lymphoma, nasal type: a report of 73 cases at MD Anderson Cancer Center. Am J Surg Pathol 2013;37:14-23.

Concept: Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı, Zeynep Topkarcı, Özgür Demir, Nesimi Büyükbabani; Design: Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı, Zeynep Topkarcı, Özgür Demir, Nesimi Büyükbabani; Data Collection or Processing: Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı, Zeynep Topkarcı, Özgür Demir, Nesimi Büyükbabani; Analysis or Interpretation: Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı, Zeynep Topkarcı, Özgür Demir, Nesimi Büyükbabani; Literature Search: Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı, Zeynep Topkarcı, Özgür Demir, Nesimi Büyükbabani; Writing: Can Baykal, Algün Polat Ekinci, Şule Öztürk Sarı, Zeynep Topkarcı, Özgür Demir, Nesimi Büyükbabani.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships,

6. Zheng Y, Jia J, Li W, Wang J, Tian Q, Li Z, Yang J, Dong X, Pan P, Xiao S. Extranodal natural killer/T-cell lymphoma, nasal type, involving the skin, misdiagnosed as nasosinusitis and a fungal infection: a case report and literature review. Oncol Lett 2014;8:2253-2262.

7. Lee WJ, Jung JM, Won CH, Chang SE, Choi JH, Chan Moon K, Park CS, Huh J, Lee MW. Cutaneous extranodal natural killer/T-cell lymphoma: a comparative clinicohistopathologic and survival outcome analysis of 45 cases according to the primary tumor site. J Am Acad Dermatol 2014;70:1002-1009.

8. Miyamoto T, Yoshino T, Takehisa T, Hagari Y, Mihara M. Cutaneous presentation of nasal/nasal type T/NK cell lymphoma: clinicopathological findings of four cases. Br J Dermatol 1998;139:481-487.

9. Cerroni L. Skin Lymphoma: The Illustrated Guide, Fourth Edition. Singapore, Blackwell, 2014.

10. Türker B, Uz B, Işık M, Bektaş O, Demiroğlu H, Sayınalp N, Uner A, Ozcebe Oİ. Nasal natural killer/T-cell lymphoma with skin, eye, and peroneal nerve involvement. Turk J Hematol 2012;29:413-419.

Address for Correspondence/Yazışma Adresi: Algün POLAT EKİNCİ, M.D., İstanbul University İstanbul Faculty of Medicine, Department of Dermatology and Venereology, İstanbul, Turkey Phone : +90 212 635 29 39 E-mail : algunekinci@yahoo.com

Received/Geliş tarihi: February 19, 2016 Accepted/Kabul tarihi: July 20, 2016 DOI: 10.4274/tjh.2016.0071

361

LETTERS TO THE EDITOR

Turk J Hematol 2016;33:355-370

Presentation of Diffuse Large B-Cell Lymphoma Relapse as a Penile Mass Penil Kitle ile Başvuran Diffüz Büyük B Hücreli Lenfoma Nüksü Birgül Öneç1, Kürşad Öneç2, Ali Ümit Esbah3, Onur Esbah4 1Düzce University Faculty of Medicine, Department of Hematology, Düzce, Turkey 2Düzce University Faculty of Medicine, Department of Nephrology, Düzce, Turkey 3Düzce University Faculty of Medicine, Department of Anesthesia and Intensive Care, Düzce, Turkey 4Düzce University Faculty of Medicine, Department of Medical Oncology, Düzce, Turkey

To the Editor, Penile malignant tumors constitute less than 1% of all malignancies in men but penile lymphoma is even rarer in this population [1]. Presentation with a primary penile mass is extremely rare for lymphomas, as reported only in case reports in the literature [2,3,4,5,6,7]. Here we report a case of recurrent lymphoma presenting with a penile mass lesion.

A 51-year-old man was admitted with the appearance of swelling and ulcerations of the penis that had started 2 weeks earlier. His history revealed that he was diagnosed with stage IIIB diffuse large B-cell lymphoma (DLBCL) 7 years ago, received 6 courses of R-CHOP, and was assumed to be cured after 5 uneventful years of follow-up. Swelling at the penis increased within 2 weeks with the addition of continuous pain, superficial ulcerations, and frequent and painful urination. Physical examination revealed a diffuse and indurated swelling at the shaft of the penis with an ulcer. An enlarged left inguinal lymph node was also palpable. Magnetic resonance imaging revealed a solid lesion of 55x37 mm in size, almost completely filling the penile corpus and significantly narrowing the penile urethra, extending to the glans penis. TruCut biopsy of the penile lesion was consistent with DLBCL. He was staged as Ann Arbor IIIE with positron emission tomographycomputed tomography revealing F-18 fluorodeoxyglucose involvement in the deep cervical left inguinal lymph nodes and a solid mass in the corpus penis (Figure 1). Treatment with R-CHOP started immediately and his complaints rapidly reduced after the first course. The patient is still having chemotherapy without

complications and autologous stem cell transplantation will be considered for consolidation after complete remission.

Although most DLBCL patients have nodal presentation at admission, extranodal involvements are also common. The classical extranodal involvements sites are the breast, central nervous system, and testes. Penile involvement is a rare entity reported in case reports [2,5,7,8,9,10]. Chu et al. reviewed penile lymphomas and reported only 48 cases, among which DLBCL was the most frequent subtype with 14 cases [5]. The most common symptom of penile lymphoma was a painless mass lesion or nodule in the penis followed by ulcerations [5,7].

Surgery remains the best approach for penile cancers, whereas no standard treatment modality has been established for penile lymphomas. Systemic chemotherapy according to the subtype is a good treatment option because it preserves penile functions [2]. In our patient, R-CHOP therapy was initiated within 2 weeks after admission and obstructive symptoms were relieved immediately after the first course. Disease-free survival was reported to be between 6 and 48 months in previous case series [5], clearly indicating better outcomes than in cases of metastatic carcinomas.

In conclusion, the possibility of lymphoma involvement should be kept in mind in patients admitting with penile mass lesions, especially in patients who have a history of aggressive lymphomas, in order to avoid aggressive surgical interventions.

It is important to initiate systemic chemotherapy immediately in order to prevent complications related to urethra obstruction and to preserve erectile functions.

Keywords: Penis, Lymphoma, Non-Hodgkin lymphoma, Diffuse large B-cell lymphoma, Penile mass Anahtar Sözcükler: Penis, Lenfoma, Non-Hodgkin lenfoma, Diffüz büyük B hücreli lenfoma, Penil kitle

Figure 1. Transaxial fused positron emission tomographycomputed tomography (A) and computed tomography (B) images showing the penile soft tissue mass with intense F-18 fluorodeoxyglucose uptake (arrows).

362

Authorship Contributions Concept: Birgül Öneç, Kürşad Öneç, Ali Ümit Esbah, Onur Esbah; Design: Birgül Öneç, Kürşad Öneç; Data Collection or Processing: Birgül Öneç, Kürşad Öneç; Analysis or Interpretation: Birgül

LETTERS TO THE EDITOR

Turk J Hematol 2016;33:355-370

Öneç, Onur Esbah; Literature Search: Birgül Öneç, Ali Ümit Esbah; Writing: Birgül Öneç, Ali Ümit Esbah.

4. Gong Z, Zhang Y, Chu H, Lian P, Zhang L, Sun P, Chen J. Priapism as the initial symptom of primary penile lymphoma: a case report. Oncol Lett 2014;8:1929-1932.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

5. Chu L, Mao W, Curran Vikramsingh K, Liu X, Qiu HM, Zheng JH, Wang Y, Yu GP, Xu Q. Primary malignant lymphoma of the glans penis: a rare case report and review of the literature. Asian J Androl 2013;15:571-572.

References 1. Schniederjan SD, Osunkoya AO. Lymphoid neoplasms of the urinary tract and male genital organs: a clinicopathological study of 40 cases. Mod Pathol 2009;22:1057-1065.

2. Stamatiou K, Pierris N. Lymphoma presenting as cancer of the glans penis: a case report. Case Rep Pathol 2012;2012:948352.

3. Gentile G, Broccoli A, Brunocilla E, Schiavina R, Borghesi M, Romagnoli D, Bianchi L, Derenzini E, Agostinelli C, Franceschelli A, Colombo F, Zinzani PL. An isolated penile mass in a young adult turned out to be a primary marginal zone lymphoma of the penis. A case report and a review of literature. Anticancer Res 2013;33:2639-2642.

6. Karki K, Mohsin R, Mubarak M, Hashmi A. Primary Non-Hodgkin’s lymphoma of penis masquerading as a non-healing ulcer in the penile shaft. Nephrourol Mon 2013;5:840-842.

7. Wang GC, Peng B, Zheng JH. Primary penile malignant lymphoma: report of a rare case. Can Urol Assoc J 2012;6:E277-279.

8. Marks D, Crosthwaite A, Varigos G, Ellis D, Morstyn G. Therapy of primary diffuse large cell lymphoma of the penis with preservation of function. J Urol 1988;139:1057-1058.

9. Kim HY, Oh SY, Lee S, Lee DM, Kim SH, Kwon HC, Hong SH, Yoon JH, Kim HJ. Primary penile diffuse large B cell lymphoma treated by local excision followed by rituximab-containing chemotherapy. Acta Haematol 2008;120:150-152.

10. Jabr FI. Recurrent lymphoma presenting as a penile ulcer in a patient with AIDS. Dermatol Online J 2005;11:29.

Address for Correspondence/Yazışma Adresi: Birgül ÖNEÇ, M.D., Düzce University Faculty of Medicine, Department of Hematology, Düzce, Turkey Phone : +90 505 242 81 83 E-mail : birgulonec@gmail.com

Received/Geliş tarihi: March 29, 2016 Accepted/Kabul tarihi: April 13, 2016 DOI: 10.4274/tjh.2016.0132

Successful Treatment of Disseminated Fusariosis with the Combination of Voriconazole and Liposomal Amphotericin B Vorikonazol ve Lipozomal Amphoterisin B ile Başarıyla Tedavi Edilen Dissemine Fusariosis Olgusu Nur Efe İris1, Serkan Güvenç2, Tülay Özçelik2, Aslıhan Demirel1, Safiye Koçulu1, Esin Çevik1, Mutlu Arat2 1İstanbul Bilim University Faculty of

Medicine, Department of Infectious Diseases and Clinical Microbiology, İstanbul, Turkey

2İstanbul Bilim University Faculty of Medicine, Department of Hematology, İstanbul, Turkey

To the Editor, Fusarium species are important causes of disseminated infections in patients with prolonged, severe neutropenia.

Clinical presentation includes refractory fever, skin lesions, and sinopulmonary infections [1,2]. Disseminated Fusarium infection (DFI) carries a poor prognosis, which is related to the angiotropism of Fusarium and its capacity for adventitious sporulation in tissues [3] and resistance to many antifungal agents [4].

Here we report a hematopoietic stem cell transplant (HSCT) recipient with acute myeloid leukemia (AML) and disseminated fusariosis who was successfully treated using both liposomal amphotericin B and voriconazole.

A 24-year-old male patient underwent allogeneic HSCT from his HLA-matched brother for AML in the first remission. At 21 months after HSCT he had extramedullary relapse with a mass over his humerus. He received radiotherapy plus the FLAG-IDA salvage regimen. After 4 months, medullary relapse occurred.

When he was hospitalized for the medullary relapse, he received clofarabine with ARA-C, which caused severe neutropenia and fever. According to in-house protocol for neutropenia, piperacillin-tazobactam was initiated. However, on the third day, he was still febrile and neutropenic, so treatment was changed to meropenem and 2 days later amikacin was added.

Because of hypotension, we broadened the spectrum with vancomycin. He was still febrile and he had rectal carbapenemresistant Klebsiella pneumoniae colonization. Antibiotherapy was reordered with colistin plus meropenem and vancomycin.

363

LETTERS TO THE EDITOR

According to thorax computed tomography findings that showed a nodule on the base of the left lung and sphenoidal sinusitis, 3 mg/kg liposomal amphotericin B was added empirically to his treatment. On follow-up, new papular and nodular skin lesions appeared on his face, head, arms, legs, feet, and anteriorposterior trunk. Some of these papules had central necrosis and eschar formations on his feet (Figure 1). These papules and especially the nodules were extremely painful, and he also had myalgia. Blood cultures revealed Fusarium solani by the VITEK system and MALDI-TOF. The diagnosis of DFI was established and we decided to augment the antifungal therapy on the seventh day by adding intravenous voriconazole as Fusarium is a resistant pathogen and the prognosis is especially poor in neutropenic patients. There were no antifungal susceptibility test results for amphotericin B or voriconazole. The skin lesions were not biopsied or cultured. Five days later his skin lesions began to resolve and on the sixth day of combined antifungal therapy his fever subsided. He was neutropenic at the time and neutrophil levels resolved 5 days later when he was afebrile.

Clinical improvement was evident 5 days before the resolution of neutropenia. Parenteral antifungal treatment was continued for 21 days and the patient was discharged on oral voriconazole treatment. After combined antifungal therapy, blood cultures obtained on the fifth day were negative.

We added voriconazole to the antifungal treatment of this patient because disseminated fusariosis has a very poor prognosis.

Some investigators have stated that antifungal therapy is rarely effective and recovery depends on neutrophil recovery, but we achieved effective control of fusariosis with combined antifungal therapy before neutrophil recovery [5,6,7,8,9,10].

In conclusion, using combination therapy such as amphotericin B and voriconazole may be considered as early as possible in patients who are not responding to antifungal monotherapy.

Turk J Hematol 2016;33:355-370

Keywords: Invasive fungal infection, Fusariosis, Combined antifungal treatment, Lyposomal amphotericin B, Voriconazole, Acute myeloid leukemia Anahtar Sözcükler: İnvazif mantar enfeksiyonu, Fusariosis, Kombine antifungal tedavi, Lipozomal amfoterisin B, Vorikonazol, Akut myeloid lösemi Authorship Contributions Concept: Nur Efe İris; Design: Nur Efe İris, Mutlu Arat; Data Collection or Processing: Nur Efe İris, Serkan Güvenç; Analysis or Interpretation: Nur Efe İris, Tülay Özçelik, Safiye Koçulu, Aslıhan Demirel, Esin Çevik; Literature Search: Nur Efe İris; Writing: Nur Efe İris, Serkan Güvenç.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Nelson PE, Dignani MC, Anaissie EJ. Taxonomy, biology and clinical aspects of Fusarium species. Clin Microbiol Rev 1994;7:479-504.

2. Dignani MC, Anaissie E. Human fusariosis. Clin Microbiol Infect 2004;10(Suppl 1):67-75.

3. Liu K, Howell DN, Perfect JR, Schnell WA. Morphologic criteria for the preliminary identification of Fusarium, Paecilomyces, and Acremonium species by histopathology. Am J Clin Pathol 1998;109:45-54.

4. Jossi M, Ambrossioni J, Macedo-Vinas Garbino J. Invasive fusariosis with prolonged fungemia in a patient with acute lymphoblastic leukemia; case report and review of the literature. Int J Inf Dis 2010;14:e394-e356.

5. Consigny S, Dhedin N, Datry A, Choquet S, Leblond V, Chosidow O. Successful voriconazole treatment of disseminated Fusarium infection in an immunocompromised patient. Clin Infect Dis 2003;37:311-313.

6. Bodey G, Boutati EL, Anaissie E. Fusarium, a significant emerging pathogen in patients with hematologic malignancy: ten years of experience at a cancer center and implications for management. Blood 1997;3:999-1008.

7. Velasso E, Martis C, Nucci M. Successful treatment of catheter related fusarial infection in immunocompromised children. Eur J Clin Microbiol Infect Dis 1995;14:697-699.

8. Dobougogne A, de Hoog S, Lozniewski A, Machounant M. Amphotericin B and voriconazole susceptibility profiles for the Fusarium solani species complex: comparison between the E-test and CLSIM38A2 microdilution methodology. Eur J Clin Microbiol Infect Dis 2012;31:615-618.

9. Compo M, Lewis RE, Kontoyiannis DP. Invasive fusariosis in patients with hematologic malignancies at a cancer center: 1998-2009. J Infect 2010;60:331-337.

Figure 1. Eschar formation on the foot and papules over the leg.

Address for Correspondence/Yazışma Adresi: Nur EFE İRİS, M.D., Istanbul Bilim University Faculty of Medicine, Department of Infectious Diseases and Clinical Microbiology, Istanbul, Turkey Phone : +90 212 361 88 00 E-mail : nurefeiris@yahoo.com

364

10. Avelino-Silva VI, Ramos JF, Leal FE, Tastograssa L, Novis YS. Disseminated Fusarium infection in autologous stem cell transplant recipient. Braz J Infect Dis 2015;19:90-93.

Received/Geliş tarihi: March 25, 2016 Accepted/Kabul tarihi: June 17, 2016

DOI: 10.4274/tjh.2016.0128

LETTERS TO THE EDITOR

Turk J Hematol 2016;33:355-370

NOS3 27-bp and IL4 70-bp VNTR Polymorphisms Do Not Contribute to the Risk of Sickle Cell Crisis NOS3 27-bp ve IL4 70-bp VNTR Polimorfizmleri Orak Hücreli Anemide Kriz Riskine Katkıda Bulunmaz Henu Verma1, Hrishikesh Mishra1, P. K. Khodiar2, P. K. Patra1,2, L. V. K. S. Bhaskar1 1Sickle Cell Institute Chhattisgarh, Division of Research, Raipur, India 2Pt. JNM Medical College, Department of Biochemistry, Raipur, India

To the Editor, A great deal of data support the direct involvement of the vascular endothelium, complex cellular interactions, and global inflammation-mediated cell activation in triggering vasoocclusive crisis (VOC) in sickle cell disease (SCD) [1]. In the transgenic mice model for SCD, it has been shown that nitric oxide (NO) protects the mice from VOC [2]. Elevated plasma levels of certain proinflammatory cytokines support a role for cytokine-driven inflammation in SCD. The aim of the present study was to evaluate the role of the NOS3 27-bp variable number tandem repeat (VNTR) and IL4 intron-3 VNTR functional polymorphisms in the development of crisis in Indian SCD patients. The study protocol was approved by the Institutional Ethics Committee of the Sickle Cell Institute Chhattisgarh, Raipur, India. Written informed consent was obtained from the study participants. A total of 256 individuals with SCD (55.5% men) were divided into two groups based on the history of VOC. The patients hospitalized with recurrent VOC were considered as the frequent crisis (FC) group (n=140; 54.7%) and patients who had not experienced any VOC during the past 1 year were considered as the infrequent crisis (IFC) group (n=116; 45.3%).

Genotyping of the NOS3 27-bp VNTR [3] and IL4 intron-3 VNTR [4] functional polymorphisms was performed and results were compared between the FC and IFC groups.

The genotype frequencies were in agreement with HardyWeinberg equilibrium for both the NOS3 27-bp (p=0.063) and the IL4 70-bp (p=0.614) VNTR. The genotype frequencies were not significantly different between the FC and IFC groups (Table 1). Similarly, the risk of frequent crisis was not found to be different between male and female SCD patients or between SCD patients with different HbF levels or different age groups (Table 1). Several lines of evidence suggest that there is vascular dysfunction and impaired NO bioactivity in SCD. Although no significant differences were observed in plasma NO metabolites between controls and SCD patients in the steady state, a significant reduction was noticed during VOC or acute chest syndrome [5]. Analysis of three NOS3 gene

polymorphisms did not reveal a significant association with severe clinical manifestations in Brazilian SCD patients [6].

In contrast to this, in another study a significant association of NOS3 variants with VOC in SCD patients was reported [7].

However, our results indicate that the NOS3 27-bp VNTR polymorphism is not associated with the risk of frequent crises. Although the role of IL4 in SCD is controversial, increased serum IL4 levels were found in steady-state SCD patients compared to normal healthy controls [8]. Remarkably elevated levels of IL4 were noted in a VOC group compared to steady-state SCD patients and healthy controls [9]. IL4 levels correlated well with SCD status in Jamaicans, while exhibiting an ethnic difference between British and Jamaican children [10]. So far there are no published studies concerning IL4 SNPs and SCD or its complications. As these results conflict with the biological plausibility that NO and interleukin levels modulate SCD, they deserve careful interpretation and further exploration.

Keywords: Sickle cell disease, Crisis, NOS3, IL4 Anahtar Sözcükler: Orak hücre hastalığı, Kriz, NOS3, IL4 Ethics Ethics Committee Approval: The study protocol was approved by the Institutional Ethics Committee of the Sickle Cell Institute Chhattisgarh, Raipur, India, Informed Consent: Written informed consent was obtained from the study participants.

Authorship Contributions Concept: L. V. K. S. Bhaskar, P. K. Patra; Design: L. V. K. S. Bhaskar, P. K. Patra; Data Collection or Processing: Henu Verma, L. V. K. S. Bhaskar; Analysis or Interpretation: L. V. K. S. Bhaskar; Literature Search: P. K. Khodiar, Henu Verma, Hrishikesh Mishra; Writing: Henu Verma, L. V. K. S. Bhaskar.

Conflict of Interest: No conflict of interest was declared by the authors.

365

LETTERS TO THE EDITOR

Turk J Hematol 2016;33:355-370

Table 1. Association between NOS3 27-bp and IL4 70-bp VNTR polymorphisms and development of vaso-occlusive crisis in sickle cell disease.

Unadjusted

Vaso-Occlusive Crisis Genotype

FC

IFC

OR (95% CI)

4bb

101 (72.1)

89 (76.7)

Reference

4ab

39 (27.9)

26 (22.4)

4aa

0 (0)

3R3R

Adjusted for Age and Sex p-value

OR (95% CI)

p-value

1.32 (0.75-2.34)

0.339

1.32 (0.75-2.35)

0.338

1 (0.9)

-

-

-

-

83 (59.3)

67 (57.8)

Reference

2R3R

51 (36.4)

39 (33.6)

1.06 (0.62-1.79)

0.840

1.04 (0.61-1.76)

0.897

2R2R

6 (4.3)

10 (8.6)

0.48 (0.17-1.40)

0.181

0.49 (0.17-1.41)

0.184

Male

78 (55.7)

64 (55.2)

Reference

Female

62 (44.3)

52 (44.8)

0.98 (0.60-1.61)

0.931

0.97 (0.59-1.59)

0.896

>20.1%

66 (47.1)

60 (51.7)

Reference

10.1%-20%

59 (42.1)

43 (37.1)

1.25 (0.74-2.11)

0.140

1.27 (0.75-2.16)

0.374

<10%

15 (10.7)

13 (11.2)

0.105 (0.46-2.38)

0.909

1.05 (0.46-2.40)

0.916

<10 years

32 (22.9)

20 (17.2)

Reference

10.1-20 years

65 (46.41)

76 (65.5)

0.54 (0.28-1.02)

0.059

0.53 (0.27-1.02)

0.056

>20.1 years

43 (30.7)

20 (17.2)

1.34 (0.62-2.90)

0.452

1.33 (0.61-2.88)

0.457

NOS3 27-bp VNTR

IL4 70-bp VNTR

Sex

HbF

Age

4b: NOS3 VNTR wild-type allele, 4a: NOS3 VNTR mutant allele, 2R: IL4 VNTR 2 repeats, 3R: IL4 VNTR 3 repeats, HbF: fetal hemoglobin, FC: frequent crisis, IFC: infrequent crisis, VNTR: variable number tandem repeat.

Financial Disclosure: The authors acknowledge funding from the Sickle Cell Institute Chhattisgarh, Government of Chhattisgarh, and CCOST, Government of Chhattisgarh (Project Ref. No. 2740/ CCOST/MRP/2015).

5. Stuart MJ, Setty BN. Sickle cell acute chest syndrome: pathogenesis and rationale for treatment. Blood 1999;94:1555-1560.

6. Vargas AE, da Silva MA, Silla L, Chies JA. Polymorphisms of chemokine receptors and eNOS in Brazilian patients with sickle cell disease. Tissue Antigens 2005;66:683-690.

References 1. Bunn HF. Pathogenesis and treatment of sickle cell disease. N Engl J Med 1997;337:762-769.

7. Tantawy AA, Adly AA, Ismail EA, Aly SH. Endothelial nitric oxide synthase gene intron 4 VNTR polymorphism in sickle cell disease: relation to vasculopathy and disease severity. Pediatr Blood Cancer 2015;62:389-394.

2. Wu D, He L, Chen L. Apelin/APJ system: a promising therapy target for hypertension. Mol Biol Rep 2014;41:6691-6703.

8. Raghupathy R, Haider MZ, Azizieh F, Abdelsalam R, D’Souza TM, Adekile AD. Th1

3. Yoon Y, Song J, Hong SH, Kim JQ. Plasma nitric oxide concentrations and nitric oxide synthase gene polymorphisms in coronary artery disease. Clin Chem 2000;46:1626-1630.

9. Musa BO, Onyemelukwe GC, Hambolu JO, Mamman AI, Isa AH. Pattern of

4. Jha AN, Singh VK, Kumari N, Singh A, Antony J, van Tong H, Singh S, Pati SS, Patra PK, Singh R, Toan NL, Song LH, Assaf A, Messias-Reason IJ, Velavan TP, Singh L, Thangaraj K. IL-4 haplotype -590T, -34T and intron-3 VNTR R2 is associated with reduced malaria risk among ancestral Indian tribal populations. PLoS One 2012;7:e48136.

Address for Correspondence/Yazışma Adresi: L. V. K. S. BHASKAR, PhD, Sickle Cell Institute Chhattisgarh, Division of Research, Raipur, India E-mail : lvksbhaskar@gmail.com

366

and Th2 cytokine profiles in sickle cell disease. Acta Haematol 2000;103:197-202. serum cytokine expression and T-cell subsets in sickle cell disease patients in vaso-occlusive crisis. Clin Vaccine Immunol 2010;17:602-608.

10. Knight-Madden J, Vergani D, Patey R, Sylvester K, Hussain MJ, Forrester T, Greenough A. Cytokine levels and profiles in children related to sickle cell disease and asthma status. J Interferon Cytokine Res 2012;32:1-5.

Received/Geliş tarihi: May 5, 2016 Accepted/Kabul tarihi: July 11, 2016 DOI: 10.4274/tjh.2016.0166

LETTERS TO THE EDITOR

Turk J Hematol 2016;33:355-370

Comment: In Response to “Auer Rod-Like Inclusions in Reactive Plasma Cells in a Case of Acute Myeloid Leukemia” “Akut Miyeloid Lösemili Olguda Reaktif Plazma Hücrelerinde Auer-Rod Benzeri İnkülüzyonlar” Adlı Makale ile İlgili Yorum Smeeta Gajendra Medanta-The Medicity, Department of Pathology and Laboratory Medicine, Gurgaon, India

To the Editor, I read the article “Auer Rod-Like Inclusions in Reactive Plasma Cells in a Case of Acute Myeloid Leukemia” by Pradhan when it was first published online (http://www.journalagent.com/tjh/ pdfs/TJH-09216-IMAGES_IN_HEMATOLOGY-PRADHAN.pdf).

The manuscript is well written with the description of a rare presence of Auer rod-like inclusions in reactive plasma cells in a case of acute myeloid leukemia (AML). However, it is not the first case of Auer rod-like inclusions in reactive plasma cells in a case of AML in the literature as was claimed by the author in the article. Sharma et al. had already described a case of the presence of this type of plasma cell inclusion in a case of therapy-related AML. Needle-like or Auer rod-like intracytoplasmic inclusions in plasma cells were first described

by Steinmann in 1940. A few cases of multiple myeloma with intracytoplasmic plasma cell inclusions are described in the literature [1]. Other conditions associated with these crystalline intracytoplasmic inclusions are plasmacytoma, chronic lymphocytic leukemia, lymphoplasmacytic lymphoma, mucosa-associated lymphoid tissue lymphomas, and, rarely, high-grade lymphomas [2]. Lemez reported a very rare case of Auer rod-like inclusions in reactive plasma cells in a patient with aplastic anemia [3]. Some postulations were described in the literature that these inclusions are related to abnormal synthesis, trafficking, or excretion of the immunoglobulin or immunoglobulin light chains that accumulate in excess within the cytoplasm [4], but immunocytochemical examinations revealed no reaction with antibodies against immunoglobulins, light chains, or amyloid A antibodies inside the inclusions [5].

These are positive for α-naphthyl acetate esterase (sensitive to sodium fluoride treatment) and β-glucuronidase, suggesting a lysosomal origin [1]. Plasmacytosis in AML occurs in about 7% of cases and the number of plasma cells may vary from 5% to 16%. This plasmacytosis is due to increased production of IL-6 by leukemic blasts, causing stimulation of plasma cells resulting in marrow plasmacytosis [6]. A rare case of Auer rod-

like inclusions in reactive plasma cells in a case of AML was reported by Sharma et al. [7]. This should be diagnosed with caution to exclude the coexistence of multiple myeloma with AML. Not only serum and urine protein electrophoresis with immunofixation but also serum free light-chain assay should be performed to exclude associated nonsecretory myeloma.

Keywords: Plasma cell, Inclusion, Reactive plasmacytosis Anahtar Sözcükler: Plazma hücre, İnkülüzyon, Reaktif plazmositoz Conflict of Interest: The author of this paper has no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Hütter G, Nowak D, Blau IW, Thiel E. Auer rod-like intracytoplasmic inclusions in multiple myeloma. A case report and review of the literature.

Int J Lab Hematol 2009;31:236-240.

2. Gupta A, Gupta M, Handoo A, Vaid A. Crystalline inclusions in plasma cells.

Indian J Pathol Microbiol 2011;54:836-837.

3. Lemez P. Auer-rod-like inclusions in cells of B-lymphocytic lineage. Acta Haematol 1988;80:177-178.

4. Jennette JC, Wilkman AS, Benson JD. IgD myeloma with intracytoplasmic crystalline inclusions. Am J Clin Pathol 1981;75:231-235.

5. Metzgeroth G, Back W, Maywald O, Schatz M, Willer A, Hehlmann R, Hastka J. Auer rod-like inclusions in multiple myeloma. Ann Hematol 2003;82:5760.

6. Rosenthal NS, Farhi DC. Reactive plasmacytosis and lymphocytosis in acute myeloid leukemia. Hematol Pathol 1994;8:43-51.

7. Sharma S, Malhan P, Pujani M, Pujani M. Auer rod-like inclusions in reactive plasmacytosis seen with acute myeloid leukemia. J Postgrad Med 2009;55:197.

Address for Correspondence/Yazışma Adresi: Smeeta GAJENDRA, M.D., Medanta-The Medicity, Department of Pathology and Laboratory Medicine, Gurgaon, India Phone : 0901 359 08 75 E-mail : drsmeeta@gmail.com

Received/Geliş tarihi: March 31, 2016 Accepted/Kabul tarihi: April 05, 2016 DOI: 10.4274/tjh.2016.0139

367

LETTERS TO EDITOR

Turk J Hematol 2016;33:355-370

Reply: “Auer Rod-Like Inclusions in Reactive Plasma Cells in a Case of Acute Myeloid Leukemia” Cevap: “Akut Myeloid Lösemi Tanılı Bir Olguda Reaktif Plazma Hücrelerinde Auer Rod Benzeri İnklüzyonlar” Sarita Pradhan Institute of Medical Sciences and Sum Hospital, Laboratory of Hematology, Bhubaneswar, India

To the Editor, First I would like to thank Smeeta Gajendra for scrutinizing my article in her ‘Comment: In Response to “Auer Rod-Like Inclusions in Reactive Plasma Cells in a Case of Acute Myeloid Leukemia”’ published online and for bringing to light the missing reference of Sharma et al. [1], who reported a case of Auer rodlike inclusions in plasma cells in a case of therapy-related AML. I sincerely regret missing that article in my literature search but I would also like to clarify a few points.

My presented case was not secondary AML and the patient had no prior history of chemotherapy, unlike the case reported by Sharma et al. [1]. The aim of my publication was to highlight a rare and interesting morphological finding, but within a limit of

200 words it was not possible to acknowledge all hematological malignancies showing similar inclusions in plasma cells.

In conclusion, I would like to again thank Dr. Gajendra for the elaborate and informative additions made in the commentary.

Conflict of Interest: The author of this paper has no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Reference 1. Sharma S, Malhan P, Pujani M, Pujani M. Auer rod-like inclusions in reactive plasmacytosis seen with acute myeloid leukemia. J Postgrad Med 2009;55:197.

Address for Correspondence/Yazışma Adresi: Sarita PRADHAN, M.D., Institute of Medical Sciences and Sum Hospital, Laboratory of Hematology, Bhubaneswar, India Phone : 9 776 243 866 E-mail : dr.sarita26@gmail.com

Received/Geliş tarihi: May 12, 2016 Accepted/Kabul tarihi: May 24, 2016 DOI: 10.4274/tjh.2016.0172

Auer Rods Are Not Seen in Non-Neoplastic Cells Auer Cismi Neoplastik Olmayan Hücrelerde Görülmez İrfan Yavaşoğlu, Zahit Bolaman Adnan Menderes University Faculty of Medicine, Division of Hematology, Aydın, Turkey

To the Editor, The article entitled “Auer Rod in a Neutrophil in a Nonmalignant Condition”, written by Chandra et al. [1] and published in a recent issue of your journal, was quite interesting. Here we would like to emphasize some relevant points.

This article demonstrates why peripheral smears, bone marrow examination, and genetic tests are mandatory. Acute myeloid leukemia must be excluded. Electron microscopic analyses

368

would be helpful. The title is overly assertive. It may be called an Auer rod-like image.

It is not known why Auer rods are not seen in non-neoplastic cells. However, there have been some hypotheses on the genesis of Auer rods, including infectious microorganisms, abnormal nucleoplasm segregation, pathologic forms of azurophilic granules, and cytoplasmic pH alteration. Unsuccessful results in Auer body inoculation experiments led to the elimination of the infectious microorganism theory. Although the conditions

LETTERS TO EDITOR

Turk J Hematol 2016;33:355-370

for pH alteration are not known, Ackerman [2] suggested that cytoplasmic pH alteration occurred in specific leukemia cells, which allowed the granules to unite into crystal-like rods [3].

Reply

Additionally, a titration rate of 1/200 or higher in O antigen should be considered positive for acute infection diagnosis.

Salmonella Typhi isolation in culture is the gold standard for diagnosis [4].

The authors are thankful for considering their manuscript entitled “Auer Rod in a Neutrophil in a Nonmalignant Condition” interesting enough for critical analysis. However, the authors would like to clarify few points:

Keywords: Auer rods, Non-neoplastic cells

1. The authors have clearly stated in the manuscript the presence of Auer rod-like inclusions on peripheral examination.

Anahtar Sözcükler: Auer cismi, Neoplastik olmayan hücreler Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Chandra H, Chandra S, Gupta V, Mahajan D. Auer rod in a neutrophil in a nonmalignant condition. Turk J Hematol 2016;33:167.

2. Ackerman GA. Microscopic and histochemical studies on the Auer bodies in leukemic cells. Blood 1950;5:847-863.

3. Yoshida Y, Oguma S, Ohno H. John Auer and Auer rods; controversies revisited. Leuk Res 2009;33:614-616.

4. Mogasale V, Ramani E, Mogasale VV, Park J. What proportion of Salmonella Typhi cases are detected by blood culture? A systematic literature review.

Ann Clin Microbiol Antimicrob 2016;15:32.

Dear Sir,

2. In view of the presence of Auer rods bone marrow examination was done and which showed only unremarkable features of normoblastic maturation. There was presence of no leukemia cells. This clearly excluded the possibility of malignant condition and nonmalignant diagnosis was considered. Moreover the patient also responded well to an antibiotic course after diagnosis of typhoid.

3. Genetic studies were however not done as firstly it was not considered necessary in view of absolutely normal bone marrow and secondly also due to financial constraints.

4. The Salmonella Typhi O antigen titre of 1: 160 dilution was considered positive and patient responded very well to course of antibiotics. Her clinical follow up was unremarkable and thus chance of any leukemic process was completely eliminated.

5. The authors agree with the various hypotheses that have been enlisted by Yavaşoğlu and Bolaman for genesis of Auer rod in infectious conditions. In the background of these theories and findings, the presence of clear rod-like structure due to condensation of azurophilic granules in neutrophil in typhoid infection led to the consideration of Auer rod in nonmalignant condition.

Thanking you, Harish Chandra, Smita Chandra, Vibha Gupta, Divyaa Mahajan

Address for Correspondence/Yazışma Adresi: İrfan YAVAŞOĞLU, M.D., Adnan Menderes University Faculty of Medicine, Division of Hematology, Aydın, Turkey Phone : +90 256 212 00 20 E-mail : dr_yavas@yahoo.com

Received/Geliş tarihi: May 19, 2016 Accepted/Kabul tarihi: May 24, 2016 DOI: 10.4274/tjh.2016.0179

369

LETTERS TO EDITOR

Turk J Hematol 2016;33:355-370

Iron and Zinc Treatment in Iron Deficiency Demir Eksikliğinde Demir ve Çinko Tedavisi Beuy Joob1, Viroj Wiwanitkit2 1Sanitation 1 Medical Academic Center, Bangkok, Thailand 2Hainan Medical University, Hainan, China

To the Editor,

References

The recent report by Özhan et al. was very interesting [1]. Özhan et al. concluded that “iron and zinc treatment instead of only iron replacement may be considered in cases of iron deficiency” [1]. The results from their study might support this suggestion.

Nevertheless, we would like to add some comments. First, there was no complete nutritional evaluation in the patient and control groups, and there might have been some effects due to differences of intake among the subjects. In addition, it is not doubted that the patients had iron deficiency, but there is still the chance of the coexistence of other hemoglobin disorders. In Southeast Asia, concurrent iron deficiency and hemoglobinopathy are very common and can be misdiagnosed and incorrectly managed [2]. Iron supplementation in the case of combined iron deficiency and hemoglobinopathy has to be carefully considered [2,3]. Focusing on the serum zinc level, there is still no pathogenesis to explain the problem in the case of iron deficiency, but there is already a report confirming that hemoglobinopathy can result in low serum zinc levels [4]. Hence, to apply the recommendation of Özhan et al., further studies are required for validation, and attention to possible concomitant hemoglobinopathy is necessary [1].

1. Özhan O, Erdem N, Aydoğdu İ, Erkurt A, Kuku İ. Serum zinc levels in iron deficient women: a case-control study. Turk J Hematol 2016;33:156-158.

Keywords: Iron, Zinc, Treatment, Deficiency Anahtar Sözcükler: Demir, Çinko, Tedavi, Eksiklik Authorship Contributions Concept: Beuy Joob, Viroj Wiwanitkit; Design: Beuy Joob, Viroj Wiwanitkit; Data Collection or Processing: Beuy Joob, Viroj Wiwanitkit; Analysis or Interpretation: Beuy Joob, Viroj Wiwanitkit; Literature Search: Beuy Joob, Viroj Wiwanitkit; Writing: Beuy Joob, Viroj Wiwanitkit.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

Address for Correspondence/Yazışma Adresi: Beuy JOOB, M.D., Sanitation 1 Medical Academic Center, Bangkok, Thailand E-mail : beuyjoob@hotmail.com

370

2. Pansuwan A, Fucharoen G, Fucharoen S, Himakhun B, Dangwiboon S. Anemia, iron deficiency and thalassemia among adolescents in Northeast Thailand: results from two independent surveys. Acta Haematol 2011;125:186-192.

3. Burdick C. Combined iron deficiency and thalassemia minor. Am J Clin Pathol 2013;139:260.

4. Fung EB, Gildengorin G, Talwar S, Hagar L, Lal A. Zinc status affects glucose homeostasis and insulin secretion in patients with thalassemia. Nutrients 2015;7:4296-4307.

Reply Dear Dr Joob, Thank you for your comments and recommendations. We had evaluated the zinc deficiency in iron deficiency anemia, not in all anemia types. Serum iron, ferritin, and transferrin saturation levels were used in diagnosis and whether or not hemoglobinopathy exists, these patients were diagnosed iron deficiency anemia. And for possible mechanisms, there are some theories mentioned in the article. One of them is increase in production of Zn-protoporphyrin and usage of zinc instead of iron in the protoporphyrin structure [1], which can explain zinc deficiency in iron deficiency. And in another study, histopathological changes causing iron and zinc deficiency in intestinal mucosa were reversed with zinc treatment and the absorption of zinc and iron was improved [2]. But still as you mentioned and as we mentioned in our article, further studies are needed.

References 1. Hastka J, Lassere JJ, Schwarzbeck, Hehlmann R. Central role of zinc protoporphyrin in staging iron deficiency. Clin Chem 1994;40:768-773.

2. Arcasoy A. İnsan sağlığında çinkonun önemi. TÜBİTAK Bilim ve Teknik Dergisi 1996;12:56 (in Turkish).

Received/Geliş tarihi: June 27, 2016 Accepted/Kabul tarihi: June 27, 2016 DOI: 10.4274/tjh.2016.0249

33rd Volume Index / 33. Cilt Dizini SUBJECT INDEX - KONU DİZİNİ 2016

Acute Leukemia

Chronic lymphocytic leukemia / Kronik lenfositik lösemi, 8, 202, 248, 335, 353 Non-Hodgkin’s lymphoma / Non-Hodgkin lenfoma, 8 Cancer / Kanser, 8, 311 Thrombosis / Tromboz, 8, 84 T-cell neoplasms / T-hücreli neoplaziler, 8 B-cell neoplasms / B-hücreli neoplaziler, 8 Acute leukemia / Akut lösemi, 8, 84, 170 Myelodysplastic syndromes / Myelodisplastik sendromlar, 8, 81, 119, 359 Chronic leukemia / Kronik lösemi, 8 HEPA filter / YEPE filtre, 41 Infection / Enfeksiyon, 41, 244, 304 Invasive fungal infection / İnvaziv fungal enfeksiyon, 41, 364 Thiamine / Tiamin, 78 Wernicke’s encephalopathy / Wernicke ensefalopatisi, 78 Acute myeloid leukemia / Akut miyeloid lösemi, 78, 135, 273, 351, 364, 369 Sepsis / Sepsis, 84 Acute lymphoblastic leukemia / Akut lenfoblastik lösemi, 131, 339 Lymphoid cell neoplasm / Lenfoid hücreli neoplazi, 131 Hematopoiesis / Hematopoiez, 131 Chemotherapy / Kemoterapi, 131 Soluble urokinase plasminogen activator receptor / Solubl ürokinaz plazminojen aktivatör reseptörü, 135 Prognosis / Prognoz, 135, 281 B-cell lymphoblastic lymphoma / B-hücreli lenfoblastik lenfoma, 168 Thoracic spine / Torasik vertebra, 168 Spinal cord compression / Spinal kord basısı, 168 Hepatitis B / Hepatit B, 231 Vaccine / Aşılama, 231 Hematological malignancies / Hematolojik malignite, 231 Azacitidine / Azasitidin, 273 Elderly / Yaşlı, 273 Bone marrow blasts / Kemik iliği blastları, 273 Prognostic factors / Prognostik faktörler, 273 Overall survival / Genel sağkalım, 273 Burkitt’s cell leukemia / Burkitt hücreli lösemi, 281 Childhood leukemia / Çocukluk çağı lösemisi, 326 Depression / Depresyon, 326 Anxiety / Anksiyete, 326 Self-image / Benlik imajı, 326 Health-related quality of life / Sağlıkla ilişkili yaşam kalitesi, 326 Acute megakaryoblastic leukemia without Down syndrome / Down sendromu olmayanlarda akut megakaryoblastik lösemi, 331 CBFA2T3-GLIS2 fusion gene / CBFA2T3-GLIS2 füzyon geni, 331 Insulin-like growth factor-1 / İnsülin-benzeri büyüme faktörü-1, 335 Insulin-like growth factor binding protein-3 / İnsülin benzeri büyüme faktörü bağlayıcı protein-3, 335 Human leukocyte antigen alleles / İnsan lökosit antijeni alelleri, 339 Risk groups / Risk grupları, 339 Chediak Higashi syndrome / Chediak Higashi sendromu, 349 Giant granules / Dev granüller, 349 Immunodeficiency / İmmün yetmezlik, 349 Auer rods / Auer cismi, 167, 351, 369

Plasma cells / Plazma hücreleri, 367 Therapy / Tedavi, 353 Ring sideroblasts / Halka sideroblastlar, 359 Megaloblastic anemia / Megaloblastik anemi, 359 Myelodysplastic syndrome / Miyelodisplastik sendrom, 8, 81, 119, 359 Non-neoplastic cells / Neoplastik olmayan hücreler, 369

Anemia

Anemia / Anemi, 86, 156, 263 Elliptocytosis / Eliptositoz, 86 Pyropoikilocytosis / Piropoikilositoz, 86 Iron / Demir, 156, 370 Zinc / Çinko, 156, 370 Women / Kadın, 156 Iron deficiency / Demir eksikliği, 156 Iron deficiency anemia / Demir eksikliği anemisi, 257 Unicentric plasma-cell type / Unisentrik plazma hücreli tip, 257 Castleman’s disease / Castleman hastalığı, 257 Fanconi / Fanconi, 263 Congenital lobar emphysema / Konjenital lober amfizem, 263 Ring sideroblasts / Halka sideroblastlar, 359 Megaloblastic anemia / Megaloblastik anemi, 359 Myelodysplastic syndrome / Miyelodisplastik sendrom, 8, 81, 119, 359 Sickle cell disease / Orak hücre hastalığı, 365 Crisis / Kriz, 365 NOS3 / NOS3, 365 IL4 / IL4, 365

Bleeding Disorders

Bleeding / Kanama, 48 Ankaferd / Ankaferd, 48 Chitosan / Chitosan, 48 Hemostasis / Hemostaz, 48 Platelet aggregation / Trombosit agregasyonu, 127 Chronic myeloid leukemia / Kronik miyelositer lösemi, 127 Imatinib mesylate / İmatinib mesilat, 127 Hyperparathyroidism / Hiperparatiroidism, 293 Platelet function / Trombosit fonksiyonları, 293 P selectin / P selektin, 293 Calcium / Kalsiyum, 293 Bone loss / Kemik kaybı, 293

Chronic Leukemia

Platelet aggregation / Trombosit agregasyonu, 127 Chronic myeloid leukemia / Kronik miyelositer lösemi, 127 Imatinib mesylate / İmatinib mesilat, 127 ZAP70 / ZAP70, 202 Interleukin-4 / İnterlökin-4, 202 Interferon gamma / İnterferon gama, 202 T cells / T hücreleri, 202 B cells / B hücreleri, 202 Chronic lymphocytic leukemia / Kronik lenfositik lösemi, 8, 202, 248, 335, 353 Radiation / Radyasyon, 248 Tumor lysis syndrome / Tümör lizis sendromu, 248 Acute myeloid leukemia / Akut miyeloid lösemi, 78, 135, 273, 351, 364, 369 Therapy / Tedavi, 353

33rd Volume Index / 33. Cilt Dizini SUBJECT INDEX - KONU DİZİNİ 2016

Coagulation

Angiogenesis / Anjiyogenez, 88 Haemophilic arthropathy / Hemofilik artropati, 88 Vascular endothelial growth factor / Vasküler endoteliyal büyüme faktörü, 88 Haemophilia / Hemofili, 88 Infant / Süt çocuğu, 163 Adult / Erişkin, 163 Microparticle / Mikropartikül, 163 Thrombin / Trombin, 163 Superwarfarin / Süpervarfarin, 251 Acquired coagulopathies / Kazanılmış koagülopatiler, 251 Vitamin K / K vitamin, 251 Endothelium / Endotel, 261 Ankaferd / Ankaferd, 261 Estradiol / Estradiol, 261 International normalized ratio / Uluslararası düzeltme oranı, 299 Warfarin / Warfarin, 299 Hypercoagulable conditions / Hiperkoagülabilite durumları, 299 Venous thromboembolism / Venöz tromboembolizm, 299 Knowledge / Bilgi, 356 Hemophilia / Hemofili, 356 Treatment / Tedavi, 187, 356, 370 Disease / Hastalık, 356

Hematological Malignancies

Colonization / Kolonizasyon, 244 Infection / Enfeksiyon, 41, 244, 304 Pediatric malignancy / Pediatrik malignite, 244 Vancomycinresistant enterococci / Vankomisine dirençli enterokok, 244

Immunohematology

Antiphospholipid syndrome / Antifosfolipid sendromu, 1 Complement inhibition / Komplaman inhibisyonu, 1 Eculizumab / Eculizumab, 1 Thrombotic angiopathy / Trombotik anjiyopati, 1 Cardiac surgery / Kalp cerrahisi, 357 Apheresis / Aferez, 357 Crossmatch / Çapraz karşılaştırma, 357 Transfusion medicine / Transfüzyon tıbbı, 148, 357

Iron Disorder

Iron overload / Demir birikimi, 21, 320 Liver / Karaciğer, 21 Pancreas / Pankreas, 21 R2* / R2*, 21 Magnetic resonance imaging-proton density fat fraction / Manyetik rezonans görüntüleme-proton dansite yağ oranı, 21 Hemochromatosis / Hemokromatozis, 320 HFE gene / HFE geni, 320 p.C282Y / p.C282Y, 320 p.H63D / p.H63D, 320 Sickle cell anemia / Orak hücreli anemi, 320 Iron / Demir, 156, 370 Zinc / Çinko, 156, 370 Treatment / Tedavi, 187, 356, 370 Deficiency / Eksiklik, 370

Infection Disorders

HEPA filter / YEPE filtre, 41 Infection / Enfeksiyon, 41, 244, 304 Invasive fungal infection / İnvaziv fungal enfeksiyon, 41, 364 Antifungal treatment / Antifungal tedavi, 53 Diagnosis / Teşhis, 53 Stem cell transplantation / Kemik iliği transplantasyonu, 53 Neutropenia / Nötropeni, 102 D-index / D-indeks, 102 Cumulative-D-index / Kümülatif-D-indeks, 102 Hematological malignancies / Hematolojik malignite, 102 Invasive fungal infections / İnvaziv fungal enfeksiyon, 102 Coagulation / Koagülasyon, 112 Sepsis / Sepsis, 112 Enoxaparin / Enoksaparin, 112 Acute leukemia / Akut lösemi, 8, 84, 170 Stevens-Johnson syndrome / Stevens-Johnson sendromu, 170 Toxic epidermal necrolysis / Toksik epidermal nekrolizis, 170 Hematopoietic stem cell transplantation / Hematopoetik kök hücre nakli, 216 Bloodstream infection / Kan akımı enfeksiyonu, 216 Epidemiology / Epidemiyoloji, 216 Resistance / Direnç, 216 Central venous catheter / Santral venöz kateter, 216 BK virus / BK virüs, 223 Hemorrhagic cystitis / Hemorajik sistit, 223 Allogeneic stem cell transplantation/ Allojenik kök hücre transplantasyonu, 223 Leflunomide / Leflunomid, 223 Hepatitis B / Hepatit B, 231 Vaccine / Aşılama, 231 Hematological malignancies / Hematolojik malignite, 231 Colonization / Kolonizasyon, 244 Infection / Enfeksiyon, 41, 244, 304 Pediatric malignancy / Pediatrik malignite, 244 Vancomycinresistant enterococci / Vankomisine dirençli enterokok, 244 Febrile neutropenia/ Febril nötropeni, 304 Infection/ Enfeksiyon, 41, 244, 304 Mannose-binding lectin/ Mannoz-bağlayıcı lektin, 304 H-ficolin/ H-fikolin, 304 Procalcitonin/ Prokalsitonin, 304 C-reactive protein / C-reaktif protein, 304 Febrile neutropenia / Febril nötropeni, 311 Cancer / Kanser, 8, 311 Mortality / Mortalite, 311 Risk factors / Risk faktörleri, 311 Varicella / Varisella, 346 Malignancy / Malignite, 346 Pediatric patient / Çocuk hasta, 346 Invasive Fungal Infection / İnvazif mantar enfeksiyonu, 41, 364 Fusariosis / Fusariosis, 364 Combined antifungal treatment / Kombine antifungal tedavi, 364 Lyposomal amphotericin B / Lipozomal amfoterisin B, 364 Voriconazole / Vorikonazol, 364 Acute myeloid leukemia / Akut myeloid lösemi, 78, 135, 273, 351, 364, 369

33rd Volume Index / 33. Cilt Dizini SUBJECT INDEX - KONU DİZİNİ 2016

Lymphoma

Chronic lymphocytic leukemia / Kronik lenfositik lösemi, 8, 202, 248, 335, 353 Non-Hodgkin’s lymphoma / Non-Hodgkin lenfoma, 8 Cancer / Kanser, 8, 311 Thrombosis / Tromboz, 8 T-cell neoplasms / T-hücreli neoplaziler, 8 B-cell neoplasms / B-hücreli neoplaziler, 8 Acute leukemia / Akut lösemi, 8, 84 Myelodysplastic syndromes / Myelodisplastik sendromlar, 8, 81, 119, 359 Chronic leukemia / Kronik lösemi, 8 Secondary neoplasms / İkincil neoplaziler, 66 Chemoradiotherapy / Kemoradyoterapi, 66 Hodgkin’s lymphoma / Hodgkin lenfoması, 66 Extranodal natural killer/T-cell lymphoma / Ekstranodal natural killer/Thücreli lenfoma, 74, 361 Non-Hodgkin lymphoma / Hodgkin dışı lenfoma, 74 Parotid gland / Parotis bezi, 75 T-Cell lymphoma / T-Hücreli lenfoma, 75 Auricula / Aurikula, 75 Lymphoma / Lenfoma, 141, 159, 362 Expression / Ekspresyon, 141 Polymorphism / Polimorfizm, 141 Rho-kinase / Rho-kinaz, 141 Acute kidney injury / Akut böbrek hasarı, 159 Hematuria / Hematüri, 159 Renal biopsy / Renal biyopsi, 159 Renal masses / Renal kitle, 159 Diffuse large B-cell lymphoma/ Diffüz büyük B-hücreli lenfoma, 164 Downgraded lymphoma / Geriletilmiş lenfoma, 164 Relapsed/refractory lymphoma / Nüks/dirençli lenfoma, 209 Hematopoietic stem cell transplantation / Hematopoetik kök hücre nakli, 209 Conditioning regimen / Hazırlama rejimi, 209 bone lymphoma / Primer kemik lenfoma, 254 Ocular adnexal lymphoma / Oküler adneks lenfoma, 254 Diffuse large B-cell lymphoma / Diffüz büyük B hücreli lenfoma, 254 Non-Hodgkin’s lymphoma / Hodgkin dışı lenfoma, 259 Vaginal B-cell lymphoma / Vajinal B-hücreli lenfoma, 259 Postmenopausal bleeding / Postmenopozal kanama, 259 Vaginal discharge / Vajinal akıntı, 259 Childhood Hodgkin’s lymphoma / Çocukluk çağı Hodgkin lenfoma, 265 Prognosis / Prognoz, 265 Autologous hematopoietic stem cell transplantation / Otolog hematopoetik kök hücre nakli, 265 Prognostic index / Prognostik indeks, 265 Extranodal natural killer/T cell lymphoma / Ekstranodal doğal öldürücü/T hücreli lenfoma, 74, 361 Erythematous indurated plaques/ Eritemli indüre plaklar, 361 Annular erythematous patch / Anuler eritemli yama, 361 Annular erythema / Anuler eritem, 361 Penis / Penis, 362 Non-Hodgkin lymphoma / Hodgkin dışı lenfoma, 362 Diffuse large B-cell lymphoma / Diffüz büyük B hücreli lenfoma, 362 Penile mass / Penil kitle, 362

Molecular Hematology

Chronic lymphocytic leukemia / Kronik lenfositik lösemi, 8, 202, 248, 335, 353

Non-Hodgkin’s lymphoma / Non-Hodgkin lenfoma, 8

Cancer / Kanser, 8, 311

Thrombosis / Tromboz, 8

T-cell neoplasms / T-hücreli neoplaziler, 8

B-cell neoplasms / B-hücreli neoplaziler, 8

Acute leukemia / Akut lösemi, 8, 84

Myelodysplastic syndromes / Myelodisplastik sendromlar, 8, 81, 119, 359

Chronic leukemia / Kronik lösemi, 8

BACH1 / BACH1, 15

Gene expression / Gen sunumu, 15

Hemoglobin E/β-thalassemia / Hemoglobin E/β-talasemi, 15

Oxidative stress / Oksidatif stres, 15

Red blood cell parameters / Eritrosit değişkenleri, 15

Chronic myeloid leukemia / Kronik myeloid lösemi, 60

Variant Philadelphia / Varyant Philadelphia, 60

Tyrosine kinase inhibitors / Tirozin kinaz inhibitörleri, 60

Prognosis / Prognoz, 60 JAK2V617F mutation / JAK2V617F mutasyonu, 94

Essential thrombocythemia / Esansiyel trombositemi, 94

Primary myelofibrosis / Primer miyelofibrozis, 94

Acute leukemia / Akut lösemi, 8, 84, 170

Stevens-Johnson syndrome / Stevens-Johnson sendromu, 170

Toxic epidermal necrolysis / Toksik epidermal nekrolizis, 170

Genetic variation / Genetik varyasyon, 172

Sequencing / Dizileme, 172

Genomic data / Genomik data, 172

Clinical interpretation / Klinik yorum, 172

ZAP70 / ZAP70, 202

Interleukin-4 / İnterlökin-4, 202

Interferon gamma / İnterferon gama, 202

T cells / T hücreleri, 202

B cells / B hücreleri, 202

Hemochromatosis / Hemokromatozis, 320

HFE gene / HFE geni, 320

Iron overload / Demir birikimi, 320

p.C282Y / p.C282Y, 320

p.H63D / p.H63D, 320

Sickle cell anemia / Orak hücreli anemi, 320

Acute megakaryoblastic leukemia without Down syndrome / Down sendromu olmayanlarda akut megakaryoblastik lösemi, 331

CBFA2T3-GLIS2 fusion gene / CBFA2T3-GLIS2 füzyon geni, 331

Chronic lymphocytic leukemia / Kronik lenfositik lösemi, 8, 202, 248, 335, 353 Insulin-like growth factor-1 / İnsülin-benzeri büyüme faktörü-1, 335

Insulin-like growth factor binding protein-3 / İnsülin benzeri büyüme faktörü bağlayıcı protein-3, 335

Acute lymphoblastic leukemia / Akut lenfoblastik lösemi, 131, 339

Human leukocyte antigen alleles / İnsan lökosit antijeni alelleri, 339

Risk groups / Risk grupları, 339

Sickle cell disease / Orak hücre hastalığı, 365

Crisis / Kriz, 365

NOS3 / NOS3, 365

33rd Volume Index / 33. Cilt Dizini SUBJECT INDEX - KONU DİZİNİ 2016

IL4 / IL4, 365

Multiple Myeloma

Myeloma and other plasma cell dyscrasias / Miyelom ve diğer plazma hücre diskrazileri, 286 Neoplasia / Neoplazi, 286 Cytogenetics / Sitogenetik, 286 Gene therapy / Gen terapisi, 286 Molecular hematology / Moleküler hematoloji, 286

Myelodysplastic Syndromes

Erythema annulare centrifugum / Eritem annuler santrifuj, 81 Azacitidine / Azasitidin, 81 Myelodysplastic syndrome / Miyelodisplastik sendrom, 8, 81, 119, 359 International Prognostic Scoring System / Uluslararası Prognostik Skorlama Sistemi, 119 MD Anderson Prognostic Scoring System / MD Anderson Prognostik Skorlama Sistemi, 119 World Health Organization Classification-Based Prognostic Scoring System / Dünya Sağlık Örgütü Sınıflandırması Bazlı Prognostik Skorlama Sistemi, 119 Revised International Prognostic Scoring System / Yeniden Düzenlenmiş Uluslararası Prognostik Skorlama Sistemi, 119

Myeloproliferative Disorders JAK2V617F mutation / JAK2V617F mutasyonu, 94

Essential thrombocythemia / Esansiyel trombositemi, 94

Primary myelofibrosis / Primer miyelofibrozis, 94

Calreticulin mutation / Kalretikülin mutasyonu, 180

Myeloproliferative neoplasms / Miyeloproliferatif neoplazi, 180

Leukemia / Lösemi, 180

Myeloproliferative neoplasms / Miyeloproliferatif hastalıklar, 187

Survival / Sağkalım, 187

Thrombosis / Tromboz, 187

Treatment / Tedavi, 187, 356, 370

Neutropenia

Febrile neutropenia / Febril nötropeni, 304 Infection / Enfeksiyon, 41, 244, 304 Mannose-binding lectin / Mannoz-bağlayıcı lektin, 304 H-ficolin / H-fikolin, 304 Procalcitonin / Prokalsitonin, 304 C-reactive protein / C-reaktif protein, 304

Stem Cell Transplantation

Hematopoietic stem cell transplantation / Hematopoetik kök hücre nakli, 34 Exhaled nitric oxide / Ekshale nitrik oksit, 34 Pulmonary complications / Pulmoner komplikasyonlar, 34 Mortality / Mortalite, 34 Antifungal treatment / Antifungal tedavi, 53 Diagnosis / Teşhis, 53 Stem cell transplantation / Kemik iliği transplantasyonu, 53 Eosinophilia/ Eozinofili,196 Allogeneic hematopoietic stem cell transplantation/ Allojenik hematopoetik kök hücre nakli, 196 Corticosteroid therapy/ Kortikosteroid tedavisi, 196 Prognostic factor/ Prognostik faktör, 196 Graft versus-host disease/ Graft versus-host hastalığı, 196 Relapsed/refractory lymphoma / Nüks/dirençli lenfoma, 209

Hematopoietic stem cell transplantation / Hematopoetik kök hücre nakli, 209 Conditioning regimen / Hazırlama rejimi, 209 Hematopoietic stem cell transplantation / Hematopoetik kök hücre nakli, 216 Bloodstream infection / Kan akımı enfeksiyonu, 216 Epidemiology / Epidemiyoloji, 216 Resistance / Direnç, 216 Central venous catheter / Santral venöz kateter, 216 BK virus / BK virüs, 223 Hemorrhagic cystitis / Hemorajik sistit, 223 Allogeneic stem cell transplantation/ Allojenik kök hücre transplantasyonu, 223 Leflunomide / Leflunomid, 223 Childhood Hodgkin’s lymphoma / Çocukluk çağı Hodgkin lenfoma, 265 Prognosis / Prognoz, 265 Autologous hematopoietic stem cell transplantation / Otolog hematopoetik kök hücre nakli, 265 Prognostic index / Prognostik indeks, 265

Thalassemia

BACH1 / BACH1, 15 Gene expression / Gen sunumu, 15 Hemoglobin E/β-thalassemia / Hemoglobin E/β-talasemi, 15 Oxidative stress / Oksidatif stres, 15 Red blood cell parameters / Eritrosit değişkenleri, 15 Thalassemia / Talasemi,56 Hemoglobinopathy / Hemoglobinopati, 56 Hemoglobin H disease / Hemoglobin H hastalığı, 56 Abnormal hemoglobins / Anormal hemoglobinler, 71 Hemoglobin G-Waimanalo / Hemoglobin G-Waimanalo, 71 Hemoglobin Fontainebleau / Hemoglobin Fontainebleau, 71 Thalassemia major / Talasemi majör, 72 Thalassemia minor / Talasemi minör, 72 Serum lipids / Serum lipidleri, 72 Deletional mutations/ Delesyonel mutasyonlar, 107 Turkish inversion/deletion (δβ)0 mutation/ Türk tipi inversiyon/ delesyon (δβ)0 mutasyonu, 107 Gap-PCR, β-Globin gene cluster / Gap-PCR, Beta-globin gen kümesi, 107

Thrombosis

Antiphospholipid syndrome / Antifosfolipid sendromu, 1 Complement inhibition / Komplaman inhibisyonu, 1 Eculizumab / Eculizumab, 1 Thrombotic angiopathy / Trombotik anjiyopati, 1 Microangiopathy / Mikroanjiopati, 83 Kidney functions / Böbrek fonksiyonları, 83 Hemolytic anemia / Hemolitik anemi, 83 Acute leukemia / Akut lösemi, 8, 84 Sepsis / Sepsis, 84 Thrombosis / Tromboz, 84 Intracranial mass / İntrakranial kitle, 255 Cerebral sinovenous thrombosis / Serebral sinovenöz tromboz, 255 Increased intracranial pressure / Artmış intrakranial basınç, 255

Thrombocytopenia

33rd Volume Index / 33. Cilt Dizini SUBJECT INDEX - KONU DİZİNİ 2016

Idiopathic thrombocytopenic purpura / İdiyopatik immün trombositopeni, 77 Glucose-6-phosphate dehydrogenase deficiency / Glukoz-6-fosfat dehidrogenaz eksikliği, 77 Thrombopoietin mimetic peptide / Trombopoetin uyarıcı peptit, 77 TMP mimetic peptide / TPO uyarıcı peptit, 77 Idiopathic thrombocytopenic purpura/ İdiyopatik trombositopenik purpura, 153 Regulatory T cells/ Düzenleyici T hücreleri, 153 Chediak Higashi syndrome / Chediak Higashi sendromu, 349 Giant granules / Dev granüller, 349 Immunodeficiency / İmmün yetmezlik, 349

Other

Oxalosis / Oksalozis, 79 Hyperoxaluria / Hiperoksalüri, 79 Bone marrow / Kemik iliği, 79 Thalassemia / Talasemi, 166 Tumor necrosis factor / Tümör nekrozis faktör, 166 Splenectomy / Splenektomi, 166 Pediatric Quality of Life Inventory/ Çocuklar için Yaşam Kalitesi Ölçeği, 236 Validity / Geçerlilik, 236 Reliability / Güvenirlik, 236 Children / Çocuk, 236 Cancer / Kanser, 236

Pathology

Oxalosis / Oksalozis, 79 Hyperoxaluria / Hiperoksalüri, 79 Bone marrow / Kemik iliği, 79 Auer rods / Auer cismi, 167, 351, 369 Neutrophil / Nötrofil, 167

Typhoid fever / Tifo, 167 Iron deficiency anemia / Demir eksikliği anemisi, 257 Unicentric plasma-cell type / Unisentrik plazma hücreli tip, 257 Castleman’s disease / Castleman hastalığı, 257 Non-neoplastic cells / Neoplastik olmayan hücreler, 369 Acute myeloid leukemia / Akut miyeloid lösemi, 78, 135, 273, 351, 364, 369 Plasma cells / Plazma hücreleri, 367 Inclusion / İnkülüzyon, 367 Reactive plasmacytosis / Reaktif plazmositoz, 367

Autoimmune Disorders

Antiphospholipid syndrome / Antifosfolipid sendromu, 1 Complement inhibition / Komplaman inhibisyonu, 1 Eculizumab / Eculizumab, 1 Thrombotic angiopathy / Trombotik anjiyopati, 1 Idiopathic thrombocytopenic purpura / İdiyopatik immün trombositopeni, 77 Glucose-6-phosphate dehydrogenase deficiency / Glukoz-6-fosfat dehidrogenaz eksikliği, 77 Thrombopoietin mimetic peptide / Trombopoetin uyarıcı peptit, 77 TMP mimetic peptide / TPO uyarıcı peptit, 77 Idiopathic thrombocytopenic purpura/ İdiyopatik trombositopenik purpura, 153 Regulatory T cells/ Düzenleyici T hücreleri, 153

Transfusion

Frozen platelets / Dondurulmuş trombositler, 28 Flow-cytometric analysis / Akım-sitometri testi, 28 In vivo thrombin generation test / İn vivo thrombin jenerasyon testi, 28 Medical audit / Tıbbi denetleme, 148 Transfusion medicine / Transfüzyon tıbbı, 148, 357 Donor selection / Donör seçimi, 148

33rd Volume Index / 33. Cilt Dizini AUTHOR INDEX - YAZAR DİZİNİ 2016

Abdel Galil M. Abdel Gader........................ 112 Abdul Kareem Al Momen........................... 112 Abdulaziz H. Alzeer..................................... 112 Abdullah Sakin............................................ 335 Abdullah T. Demiryürek............................. 141 Absia Jabbar................................................. 299 Adalet Meral Güneş..................................... 326 Adeel Arshad............................................... 299 Afak Durur Karakaya.................................. 263 Ahmet Emre Eşkazan.................................. 216 Ahmet Hakan Vural..................................... 356 Ahmet Menteşe............................................ 135 Ahmet Pekoğlu ..............................................28 Ahu Kara..................................................... 346 Akif Selim Yavuz............................................94 Albane Ledoux-Pilon.................................. 259 Alev Akyol Erikçi........................................ 153 Alexandra Agapidou.......................................88 Algün Polat Ekinci....................................... 360 Ali Alkan..................................................... 248 Ali Bay............................................................56 Ali Erkurt.................................................... 156 Ali Fettah..................................................... 263 Ali Haythem................................................ 299 Ali Kaya....................................................... 209 Ali Mert............................................... 216, 304 Ali Pamir.........................................................66 Ali Ümit Esbah............................................ 362 Ali Zahit Bolaman........................................ 187 Alpay Azap.................................................. 102 Alper Koç........................................................75 Alphan Küpesiz........................................... 265 Ammara Arslan........................................... 131 Andrea Tendas................................................77 Anıl Tombak................................................ 273 Arzu Çırpan Kantarcıoğlu........................... 326 Arzu Yaşar................................................... 248 Ashutosh Kumar......................................... 349 Asım Örem.................................................. 135 Aslı Özdemir............................................... 244 Aslıhan Demirel........................................... 363 Atilla Çayır.................................................. 263 Atilla Elhan.................................................. 102 Atsuo Maruta............................................... 196 Aydan Akdeniz............................................ 273 Ayhan Çavdar.................................................66 Ayhan Dağdemir.......................................... 265 Aylin Ayer.................................................... 335 Aynur Dağlar-Aday.........................................94 Ayper Somer................................................ 244 Aysel Pekel......................................................28 Aysen Akalın................................................ 293 Ayşe Hiçsönmez.......................................... 248

Ayşe Işık....................................................... 119 Ayşe Salihoğlu............................................. 216 Ayşe Uysal................................................... 273 Ayşegül Sümer............................................. 135 Ayşegül Tetik............................................... 209 Ayşegül Üner............................................... 119 Ayşegül Ünüvar........................................... 244 Aytekin Ünlü .................................................28 Bahattin Işık...................................................48 Barış Malbora..................................................56 Başak Akadam-Teker......................................94 Başak Doğanavşargil.......................................79 Belgin Coşkun....................................... 41, 102 Bengi Öztürk..................................................41 Bengü Demirağ............................................ 346 Berna Ateşağaoğlu....................................... 251 Betül Ulukol................................................ 163 Beuy Joob..................................................... 370 Bilgül Mete.......................................... 216, 304 Birgül Erkmen................................................28 Birgül Öneç........................................... 75, 362 Birol Baytan................................................. 326 Burak Uz.............................................. 119, 164 Burak Yılmaz............................................... 286 Burhan Ferhanoğlu............................. 216, 304 Bülent Karagöz............................................ 153 Can Acıpayam................................................56 Can Baykal................................................... 360 Can Boğa..................................................... 320 Can Polat Eyigün............................................28 Canan Vergin............................................... 346 Cécile Moluçon-Chabrot............................. 259 Cem Kis....................................................... 273 Cengiz Bal.................................................... 293 Ceyda Aslan................................................. 254 Ceylan Yılmaz................................................94 Chul Soo Kim.............................................. 223 Chunyan Ji.................................................. 180 Cihan Gündoğan......................................... 254 Çiğdem Aşut................................................ 326 Çiğdem Tokyol............................................ 168 Damla Eyüpoğlu.............................................60 Daniil F. Gluzman.............................................8 Daoxin Ma................................................... 180 Deniz Gören Şahin...................................... 273 Deniz Güven...................................................60 Deniz Sünnetçi.................................................8 Derya Aydın................................................. 244 Derya Özyörük.............................................255 Didar Yanardağ Açık................................... 141 Didem Atay.................................................. 265 Divyaa Mahajan........................................... 167 Doruk Erkan.....................................................1

Turk J Hematol 2016;33:323-328

Füsun Özdemirkıran et al. IL-18 Polymorphisms in CML and CLL Patients

33rd Volume Index / 33. Cilt Dizini

AUTHOR INDEX - YAZAR DİZİNİ 2016

Duran Canatan...............................................71 Durdu Mehmet Köş........................................75 Ebru Karcı................................................... 248 Eda Ataseven......................................... 84, 170 Edip Gali........................................................56 Efthymia Vlachaki..........................................88 Ekrem Ünal................................................. 265 Elif Gökçen Sazak........................................335 Elif Nisa Ünlü.................................................75 Elif Suyanı..................................... 34, 231, 254 Elizabeth George............................................15 Emel Gürkan............................................... 273 Emel Ünal.............................................. 66, 265 Emin Kürekçi.................................................28 Emre Tekgündüz......................................... 209 Engin Akgül................................................ 356 Ercüment Ünlü...............................................78 Erden Atilla............................................. 41, 53 Erdoğan Işıkman............................................66 Erdoğan Nohuz........................................... 259 Eren Yağcı.................................................... 187 Ergun Karaağaoğlu...................................... 311 Eriko Ogusa................................................. 196 Erman Ataş.................................................. 265 Esin Aktaş Çetin.......................................... 202 Esin Çevik................................................... 363 Esra Sarıbacak Can.........................................74 Esra Turan Erkek...........................................81 Esra Yıldızhan............................................. 273 Evren Üstüner............................................. 159 Eylem Eliaçık...................................... 119, 281 Eyüp Naci Tiftik.......................................... 273 Fahri Şahin.................................................. 273 Farja Al Gahtani.......................................... 112 Fatih Beşışık................................................ 257 Fatih Büyükcam.............................................48 Fatih Erbey.................................................. 265 Fatma Deniz Sargın........................................94 Fatma Gümrük ................................. 21, 72, 86 Fatma Yıldırım................................................34 Fehmi Hindilerden...................................... 257 Fehmi Tabak........................................ 216, 304 Feride İffet Şahin......................................... 320 Ferit Avcu.......................................................28 Fevzi Altuntaş.............................................. 209 Feyzullah Akyüz.......................................... 168 Fezan Mutlu................................................ 127 Filiz Şimşek Orhon..................................... 163 Fumiko Tanaka........................................... 331 Fuminori Iwasaki........................................ 331 Gamze Durgun............................................ 209 Garip Şahin.................................................. 293 Gökçe Pınar Reis......................................... 263

Göknur Yorulmaz........................................ 293 Gönül Oktay...................................................56 Gül İlhan........................................................56 Gülcihan Özek............................................ 346 Gülden Yılmaz....................................... 41, 102 Gülen Sezer Alptekin Erkul........................ 356 Gülsan Türköz Sucak.....................................34 Gülsan Yavuz..................................................66 Gülsüm Pamuk...............................................78 Gülsüm Yazıcı................................................71 Gülsün Karasu............................................. 265 Gülşah Kaygusuz......................................... 159 Gülşen Hasçelik........................................... 311 Gülyüz Öztürk............................................ 265 Güngör Utkan............................................. 248 Günhan Gürman............................................41 Günnur Deniz............................................. 202 Gürsel Güneş....................................... 281, 286 H. Haluk Akar............................................. 339 Hacer Aktürk............................................... 244 Hadil A. Al Otair......................................... 112 Hakan Göker............................... 119, 281, 286 Hakan Özdoğu............................................ 320 Hakan Savlı.......................................................8 Haldun Öniz................................................ 265 Hale Ören...................................... 84, 170, 265 Haluk Deda.....................................................66 Haluk Demiroğlu......................... 119, 281, 286 Hamdi Akan.................................... 41, 53, 102 Handan Güleryüz...........................................84 Harika Okutan................................................74 Harish Chandra........................................... 167 Hasan Mücahit Özbaş.................................. 135 Heiwa Kanamori.......................................... 196 Henu Verma................................................. 365 Hiroaki Goto............................................... 331 Hiromi Kato................................................. 331 Hossam A.H. Abdelrazik............................. 112 Hrishikesh Mishra....................................... 365 Hüseyin Yaman..............................................75 Hyeon Gyu Yi.............................................. 223 Itır Şirinoğlu Demiriz.................................. 209 Ivana Milosevic............................................ 353 İbrahim Celalettin Haznedaroğlu......... 60, 119, ..................................................... 261, 281, 286 İbrahim Eker .................................................28 İbrahim Keser........................................ 71, 107 İbrahim Öner Doğan................................... 257 İbrahim Sarı................................................. 141 İlhami Berber............................................... 273 İlhan Ünlü......................................................75 İlkay S. İdilman .............................................21 İlker Devrim................................................ 346

33rd Volume Index / 33. Cilt Dizini AUTHOR INDEX - YAZAR DİZİNİ 2016

İlker İnanç Balkan............................... 216, 304 İpek Kıvılcım Oğuzülgen...............................34 İpek Yönal Hindilerden......................... 94, 257 İrfan Kuku................................................... 156 İrfan Yavaşoğlu.................... 166, 187, 273, 368 İsmail Balık.....................................................41 İsmail Haluk Gökçora....................................66 İsmail Sarı.................................................... 273 İsmail Yaşar Avcı ............................................28 İsmet Aydoğdu............................................ 156 Jameela Sathar................................................15 Jane E. Salmon..................................................1 Jianguo Hao................................................. 180 Jingyi Wang................................................. 180 Joo Han Lim................................................ 223 Kadir Acar........................................... 164, 281 Kavana Rao.................................................. 358 Kemal Aydın...................................................48 Kenan Keven............................................... 159 Kenji Matsumoto......................................... 196 Koji Sasaki................................................... 331 Koray Ceyhan.................................................66 Kutay Sarsar................................................ 244 Kürşad Öneç................................................ 362 L. V. K. S. Bhaskar........................................ 365 Lai Kuan Teh..................................................15 Laura Scaramucci...........................................77 Leylagül Kaynar........................................... 273 Lilia M. Sklyarenko..........................................8 Logeswaran Muniandy...................................15 Luisa De Simone.......................................... 259 M. Akif Yeşilipek................................. 107, 265 M. Cem Ar................................................... 216 Maël Albaut................................................. 259 Maha Abdullah...............................................15 Mahmut Subaşı............................................ 263 Manolya Acar.............................................. 244 Marco Giovannini..........................................77 Maria Haroon.............................................. 131 Masakatsu D. Yanagimachi.......................... 331 Masanobu Takeuchi.................................... 331 Mashael Al Shaikh....................................... 112 Massimiliano Palombi....................................77 Mayu Ishibashi............................................ 331 Meera Sikka................................................. 358 Mehdi Ghasemi........................................... 286 Mehmet Ali Erkurt...................................... 273 Mehmet Ali Özcan...................................... 273 Mehmet Ali Sungur..................................... 273 Mehmet Ali Uçar......................................... 273 Mehmet Gündüz........................... 41, 251, 286 Mehmet Hilmi Doğu........................... 254, 273 Mehmet Özen........................................ 41, 356

Mehmet Sezgin Pepeler............................... 168 Mehmet Sönmez.......................................... 135 Mehmet Yılmaz........................................... 141 Mehran Karimi............................................ 355 Mei I Lai.........................................................15 Melih Aktan......................................... 202, 335 Meliha Nalçacı................................................94 Melike Sezgin Evim..................................... 326 Meral Beksaç................................................ 251 Mesut Ayer.................................................. 335 Metin Uyanık .................................................28 Michael P. Zavelevich ......................................8 Mili Jain....................................................... 349 Mine Durusu Tanrıöver............................... 311 Mine Düzgöl................................................ 346 Mine Hekimgil................................................79 Mithat Haliloğlu ............................................21 Moon Hee Lee............................................. 223 Mrinalini Kotru........................................... 358 Mualla Çetin................................................ 236 Muhammed Evvah Karakılıç..........................48 Muhammet Maden.........................................78 Muhit Özcan.......................................... 41, 273 Murat Akova................................................ 311 Murat Albayrak..............................................74 Murat Duman.................................................84 Murat Elli.................................................... 265 Murat Sezak....................................................79 Murat Sütçü................................................. 244 Murat Yıldırım............................................. 273 Musa Karakükcü......................................... 265 Mustafa Merter.................................... 251, 273 Mustafa Ünübol........................................... 187 Muşturay Karçaaltıncaba ...............................21 Mutlu Arat................................................... 363 Mücahit Yemişen................................. 216, 304 Müge Aydoğdu...............................................34 Müge Sayitoğlu............................................ 172 Mümtaz Yılmaz..............................................79 Münci Yağcı................................................. 231 Na He........................................................... 180 Nabeel Khan Afridi...................................... 131 Naci Çine..........................................................8 Nadir Ali...................................................... 131 Nahide Konuk................................................41 Naila Raza.................................................... 148 Namık Kemal Altınbaş................................ 159 Nazan Özsan..................................................79 Neha Chopra Narang.................................. 358 Nejat Akar..................................... 56, 163, 261 Nergiz Erkut................................................ 135 Nesimi Büyükbabani................................... 360 Neslihan Andıç............................................ 187

Turk J Hematol 2016;33:323-328

Füsun Özdemirkıran et al. IL-18 Polymorphisms in CML and CLL Patients

33rd Volume Index / 33. Cilt Dizini

AUTHOR INDEX - YAZAR DİZİNİ 2016

Neslihan Erdem........................................... 156 Neşe Saltoğlu....................................... 216, 304 Nilay Ermantaş............................................ 135 Nilgün Işıksaçan.......................................... 202 Nilgün Sayınalp........................... 119, 281, 286 Nur Efe İris.................................................. 363 Nuran Ahu Baysal....................................... 168 Nuran Salman.............................................. 244 Nurdan Köktürk.............................................34 Nurdan Taçyıldız................................... 66, 265 Nuri Bayram................................................ 346 Nursel Çalık Başaran................................... 311 Oğuz Bilgi.................................................... 153 Oğuzhan Erol.............................................. 168 Olga Meltem Akay............... 127, 187, 273, 293 Onur Esbah......................................... 209, 362 Onur Özhan................................................ 156 Oral Nevruz................................................. 273 Osman İlhami Özcebe................. 119, 281, 286 Osman İlhan...................................................41 Osman Yokuş............................................... 254 Ozan Salim.................................................. 273 Ömer Özden...................................................84 Ömer Uluoğlu................................................66 Ömür Kayıkçı.............................................. 209 Önder Arslan..................................................41 Özden Altıok Clark..................................... 107 Özgür Demir............................................... 360 Özgür Mehtap............................................. 273 Özlem Genç................................................. 356 Özlen Bektaş................................................ 119 P. K. Khodiar................................................ 365 P. K. Patra..................................................... 365 Panagiotis Anagnostis....................................88 Paolo de Fabritiis............................................77 Pasquale Niscola.............................................77 Pervin Topçuoğlu...........................................41 Pınar Tarkun............................................... 273 Pushpinderdeep Kahlon.............................. 299 Rafet Eren.................................................... 254 Rahşan Yıldırım........................................... 273 Ramis Ufuk Akkoyunlu....................................8 Rashmi Kushwaha....................................... 349 Rauf Haznedar............................................. 231 Recep Öztürk....................................... 216, 304 Reo Tanoshima............................................ 331 Reşat Özaras........................................ 216, 304 Rıza Aytaç Çetinkaya .....................................28 Ryosuke Kajiwara........................................ 331 Saba Kiremitçi............................................. 159 Safiye Koçulu............................................... 363 Saleem Ahmed Khan................................... 131 Salih Aksu.................................... 119, 281, 286

Salih Subari.................................................. 141 Sarita Pradhan..................................... 351, 368 Savaş Kansoy............................................... 265 Sebahattin Yılmaz ..........................................28 Seda Aydın................................................... 286 Seda Balaban................................................ 281 Selim Ay....................................................... 335 Selma Ünal.....................................................56 Sema Anak................................................... 244 Sema Karakuş.............................................. 320 Semih Alpsoy............................................... 286 Seniz Öngören............................................. 304 Serap Aksoylar............................................. 265 Serap Karaman............................................ 244 Serdar Öztuzcu............................................ 141 Serkan Abacıoğlu............................................48 Serkan Aktürk............................................. 159 Serkan Güvenç............................................ 363 Serkan Tapan .................................................28 Serpil Delibaş..................................................71 Sevgi Başkan................................................ 163 Sevgi Gözdaşoğlu...........................................66 Sevgi Kalayoğlu Beşışık......................... 81, 257 Seyhan Türk................................................ 286 Sezaneh Haghpanah.................................... 355 Sezgin Etgül................................. 119, 281, 286 Shahzaib Nabi.............................................. 299 Shan E. Rauf................................................ 131 Sharif Kullab................................................ 259 Shin-ichi Tsujimoto.................................... 331 Shumpei Yokota.......................................... 331 Sibel Işlak Mutcalı....................................... 304 Simge Erbil.....................................................79 Sinan Erkul.................................................. 356 Sinem Civriz Bozdağ................................... 209 Smeeta Gajendra.......................................... 367 Smita Chandra............................................. 167 Soner Sertan Kara........................................ 263 Soner Yılmaz .................................................28 Sophia Vakalopoulou.....................................88 Stella V. Koval...................................................8 Suzan Çınar................................................. 202 Süreyya Bozkurt.................................... 60, 119 Syed M. Khurshid........................................ 112 Şahika Zeynep Akı.........................................34 Şebnem Yılmaz Bengoa................. 84, 170, 265 Şeniz Öngören............................................. 216 Şerife Kocubaba........................................... 209 Şerife Medeni Solmaz.................................. 273 Şinasi Özsoylu................................................83 Şiyar Erdoğmuş........................................... 159 Şule Öztürk Sarı.......................................... 360 Şule Ünal................................................. 72, 86

33rd Volume Index / 33. Cilt Dizini AUTHOR INDEX - YAZAR DİZİNİ 2016

Şükrü Atakan................................................286 Tahereh Zarei.............................................. 355 Taner Demirer................................................41 Tayfur Toptaş..................................................56 Tekin Aksu.................................................. 263 Teoman Soysal..................................... 216, 304 Thomas Stavrakis...........................................88 Tiraje Celkan..................................................56 Tomoko Yokosuka....................................... 331 Tuba Hilkay Karapınar................................ 346 Tuğçe Bulakbaşı Balcı.................................. 320 Tuğçe Kütük................................................ 248 Tuncay Aslan....................................... 281, 286 Turan Bayhan.................................................86 Tülay Özçelik.............................................. 363 Tülin Düger................................................. 236 Tülin Fıratlı Tuğlular.................................. 273 Türkan Patıroğlu......................................... 339 Türker Bilgen........................................ 71, 107 Tze Yan Lee....................................................15 Uğur Muşabak................................................28 Uğur Şahin................................................... 251 Uma Shankar Singh..................................... 349 Ural Kaya........................................................48 Ülker Koçak................................................ 265 Ümit Yavuz Malkan............................. 281, 286 Ünsal Han.......................................................74 Vefki Gürhan Kadıköylü............................. 187 Vesile Yıldız Kabak...................................... 236 Vibha Gupta................................................ 167 Vildan Çiftçi...................................................71 Viroj Wiwanitkit......................................... 370 Volkan Hazar............................................... 265

Vural Kesik.................................................. 265 Wataru Yamamoto....................................... 196 Xavier Durando........................................... 259 Yahya Büyükaşık................... 60, 119, 281, 286 Yahya Çelik.....................................................78 Yasemin Ardıçoğlu...................................... 261 Yasemin Işık Balcı...........................................72 Yavuz Yakut................................................. 236 Yelda Dere......................................................79 Yeşim Oymak......................................... 56, 346 Yıldız Aydın................................................. 304 Yılmaz Ay..................................................... 346 Yonca Eğin................................................... 163 Yoshiaki Ishigatsubo.................................... 196 Young Hoon Park........................................ 223 Yunus Kasım Terzi...................................... 320 Zafer Başlar.......................................... 216, 304 Zafer Gülbaş................................................ 127 Zafer Koç..................................................... 320 Zahit Bolaman............................................. 368 Zehra Narlı Özdemir................................... 251 Zerrin Yılmaz Çelik..................................... 320 Zeynel A. Sayıner........................................ 141 Zeynep Arzu Yeğin.........................................34 Zeynep Karakaş........................................... 244 Zeynep Kendi Çelebi................................... 159 Zeynep Öztürk............................................ 107 Zeynep Topkarcı.......................................... 360 Zohair A. Al Aseri........................................ 112 Zohreh Zahedi............................................. 355 Zübeyde Nur Özkurt............................. 34, 231 Zühre Kaya.................................................. 265

Füsun Özdemirkıran et al. IL-18 Polymorphisms in CML and CLL Patients

382

Turk J Hematol 2016;33:323-328