Tjh 2017 1 by LookUs Scientific

Issue 1

March 2017

80 TL

ISSN 1300-7777

Volume 34

Review Iron Overload in Hematopoietic Stem Cell Transplantation Erden Atilla, et al.; Ankara, Turkey

Research Articles Predictive Ability of the European Treatment Outcome Study Jing Huang, et al.; Changsha, China

Allogeneic Transplantation in Chronic Myeloid Leukemia

Mehmet Özen, et al.; Ankara, İstanbul, Turkey, Minneapolis, USA

Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms Nur Soyer, et al.; İzmir, Ankara, Sakarya, Gaziantep, Kayseri, Malatya, Turkey

TP53 Alterations in Chronic Lymphocytic Lymphoma Patients İbrahim Kulaç, et al.; Ankara, Turkey, Baltimore, USA

Endocrine Late Complications in Childhood Leukemia Survivors Cengiz Bayram, et al.; Ankara, Turkey

FLAG Therapy in Relapsed/Refractory Childhood Leukemia Şebnem Yılmaz Bengoa, et al.; İzmir, Turkey

Red Blood Cell Transfusion in Greece

Serena Valsami, et al.: Athens, Greece

Evaluation of Schistocyte Quantitation

Elise Schapkaitz and Michael Halefom Mezgebe; Johannesburg, South Africa

Increasing the Awareness of Cryopreserved Platelets in Turkey İbrahim Eker, et al.; Ankara, İstanbul, Turkey

Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia Fehmi Hindilerden, et al.; İstanbul, Turkey

Discrepancies in Lymphoma Diagnosis Over the Years Neval Özkaya, et al.; İstanbul, Turkey, New York, USA

Hypogammaglobulinemia and Poor Performance for Vancomycin-Resistant Enterococci Colonization Elif Gülsüm Ümit, et al.; Edirne, Turkey

Antibacterial Activities of Ankaferd Hemostat Ahmet Koluman, et al.; Ankara, Turkey

Cover Picture: Ahmet Koluman et al. Effect of ABS on Survival of S. Typhimurium (FISH Technique Using Vermicon Kit)

Editor-in-Chief

International Review Board

Reyhan Küçükkaya

Nejat Akar Görgün Akpek  Serhan Alkan  Çiğdem Altay  Koen van Besien  Ayhan Çavdar M. Sıraç Dilber  Ahmet Doğan  Peter Dreger  Thierry Facon Jawed Fareed  Gösta Gahrton  Dieter Hoelzer  Marilyn Manco-Johnson Andreas Josting Emin Kansu  Winfried Kern  Nigel Key  Korgün Koral Abdullah Kutlar Luca Malcovati  Robert Marcus  Jean Pierre Marie Ghulam Mufti Gerassimos A. Pangalis Antonio Piga Ananda Prasad Jacob M. Rowe Jens-Ulrich Rüffer Norbert Schmitz Orhan Sezer  Anna Sureda Ayalew Tefferi Nükhet Tüzüner Catherine Verfaillie Srdan Verstovsek Claudio Viscoli

TOBB Economy Technical University Hospital, Ankara, Turkey Maryland School of Medicine, Baltimore, USA  Cedars-Sinai Medical Center, USA  Ankara, Turkey Chicago Medical Center University, Chicago, USA Ankara, Turkey  Karolinska University, Stockholm, Sweden  Mayo Clinic Saint Marys Hospital, USA Heidelberg University, Heidelberg, Germany Lille University, Lille, France  Loyola University, Maywood, USA  Karolinska University Hospital, Stockholm, Sweden Frankfurt University, Frankfurt, Germany Colorado Health Sciences University, USA  University Hospital Cologne, Cologne, Germany  Hacettepe University, Ankara, Turkey  Albert Ludwigs University, Germany  University of North Carolina School of Medicine, NC, USA Southwestern Medical Center, Texas, USA Georgia Health Sciences University, Augusta, USA  Pavia Medical School University, Pavia, Italy  Kings College Hospital, London, UK  Pierre et Marie Curie University, Paris, France  King’s Hospital, London, UK  Athens University, Athens, Greece  Torino University, Torino, Italy  Wayne State University School of Medicine, Detroit, USA Rambam Medical Center, Haifa, Israel  University of Köln, Germany  AK St Georg, Hamburg, Germany  Memorial Şişli Hospital, İstanbul, Turkey  Santa Creu i Sant Pau Hospital, Barcelona, Spain  Mayo Clinic, Rochester, Minnesota, USA  İstanbul Cerrahpaşa University, İstanbul, Turkey  University of Minnesota, Minnesota, USA The University of Texas MD Anderson Cancer Center, Houston, USA San Martino University, Genoa, Italy

Past Editors Erich Frank Orhan Ulutin Hamdi Akan Aytemiz Gürgey

Language Editor Leslie Demir

Senior Advisory Board Yücel Tangün Osman İlhan Muhit Özcan Teoman Soysal

Editorial Office İpek Durusu Bengü Timoçin

İstanbul, Turkey rkucukkaya@hotmail.com

Associate Editors Ayşegül Ünüvar

İstanbul University, İstanbul, Turkey aysegulu@hotmail.com

Cengiz Beyan TOBB University of Economics and Technology, Ankara, Turkey cengizbeyan@hotmail.com

Hale Ören

Dokuz Eylül University, İzmir, Turkey hale.oren@deu.edu.tr

İbrahim C. Haznedaroğlu

Hacettepe University, Ankara, Turkey haznedar@yahoo.com

M. Cem Ar

İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey mcemar68@yahoo.com

Selami Koçak Toprak

Ankara University, Ankara, Turkey sktoprak@yahoo.com

Semra Paydaş

Çukurova University, Adana, Turkey sepay@cu.edu.tr

Assistant Editors A. Emre Eşkazan

İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey

Ali İrfan Emre Tekgündüz

Dr. A. Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey

Elif Ünal İnce

Ankara University, Ankara, Turkey

İnci Alacacıoğlu

Dokuz Eylül University, İzmir, Turkey

Müge Sayitoğlu

İstanbul University, İstanbul, Turkey

Nil Güler

Ondokuz Mayıs University, Samsun, Turkey

Olga Meltem Akay

Koç University, İstanbul, Turkey

Şule Ünal

Hacettepe University, Ankara, Turkey

Veysel Sabri Hançer

İstanbul Bilim University, İstanbul, Turkey

Zühre Kaya

Gazi University, Ankara, Turkey

A-I

Publishing Services

Statistic Editor Hülya Ellidokuz

GALENOS PUBLISHER Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya E-mail : rkucukkaya@hotmail.com

All Inquiries Should be Addressed to TURKISH JOURNAL OF HEMATOLOGY Address Phone Fax E-mail

: İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No: 8 06550 Çankaya, Ankara / Turkey : +90 312 490 98 97 : +90 312 490 98 68  : info@tjh.com.tr

ISSN: 1300-7777

Publishing Manager Sorumlu Yazı İşleri Müdürü Güner Hayri Özsan

Management Address Yayın İdare Adresi

Publishing House / Yayınevi

Türk Hematoloji Derneği İlkbahar Mahallesi, Turan Güneş Bulvarı 613. Sk. No: 8 06550 Çankaya, Ankara / Turkey

Molla Gürani Mah. Kaçamak Sk. No: 21, 34093 Fındıkzade, İstanbul, Turkey Tel: +90 212 621 99 25 Faks: +90 212 621 99 27 E-posta: info@galenos.com.tr Baskı: Özgün Ofset Ticaret Ltd. Şti.

Online Manuscript Submission

Yeşilce Mah. Aytekin Sk. No: 21 34418 4. Levent / İstanbul

http://mc.manuscriptcentral.com/tjh

Printing Date / Basım Tarihi

Web page

01.03.2017

www.tjh.com.tr

Cover Picture

Owner on behalf of the Turkish Society of Hematology Türk Hematoloji Derneği adına yayın sahibi Ahmet Muzaffer Demir Üç ayda bir yayımlanan İngilizce süreli yayındır. International scientific journal published quarterly. Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish Journal of Hematology’nin Türk Hematoloji Derneği İktisadi İşletmesi tarafından yayınlanmasına karar vermiştir.

A-II

Ahmet Koluman et al., Effect of Ankaferd Blood Stopper (ABS) on survival of Salmonella Typhimurium (fluorescence in situ hybridization technique using Vermicon kit). Top: Survival of Salmonella Typhimurium with 2 mL of sterile distilled water at 37 °C. There is no visible change. Plating of the homogenate indicates the stability in the viable counts. Bottom: Survival of Salmonella Typhimurium with 2 mL of ABS at 37 °C. There is 3 log10 cfu/mL decrease, which indicates a statistical significance (see page 95).

AIMS AND SCOPE The Turkish Journal of Hematology is published quarterly (March, June, September, and December) by the Turkish Society of Hematology. It is an independent, non-profit peer-reviewed international English-language periodical encompassing subjects relevant to hematology. The Editorial Board of The Turkish Journal of Hematology adheres to the principles of the World Association of Medical Editors (WAME), International Council of Medical Journal Editors (ICMJE), Committee on Publication Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and Strengthening the Reporting of Observational Studies in Epidemiology (STROBE). The aim of The Turkish Journal of Hematology is to publish original hematological research of the highest scientific quality and clinical relevance. Additionally, educational material, reviews on basic developments, editorial short notes, images in hematology, and letters from hematology specialists and clinicians covering their experience and comments on hematology and related medical fields as well as social subjects are published. As of December 2015, The Turkish Journal of Hematology does not accept case reports. Important new findings or data about interesting hematological cases may be submitted as a brief report. General practitioners interested in hematology and internal medicine specialists are among our target audience, and The Turkish Journal of Hematology aims to publish according to their needs. The Turkish Journal of Hematology is indexed, as follows: - PubMed Medline - PubMed Central - Science Citation Index Expanded - EMBASE - Scopus - CINAHL - Gale/Cengage Learning - EBSCO - DOAJ - ProQuest - Index Copernicus - Tübitak/Ulakbim Turkish Medical Database - Turk Medline Impact Factor: 0.827 Open Access Policy Turkish Journal of Hematology is an Open Access journal. This journal provides immediate open access to its content on the principle that making research freely available to the public supports a greater global exchange of knowledge. Open Access Policy is based on the rules of the Budapest Open Access Initiative (BOAI) http://www.budapestopenaccessinitiative.org/. Subscription Information  The Turkish Journal of Hematology is sent free-of-charge to members of Turkish Society of Hematology and libraries in Turkey and abroad. Hematologists, other medical specialists that are interested in hematology, and academicians could subscribe for only 40 $ per printed issue. All published volumes are available in full text free-of-charge online at www. tjh.com.tr.

A-III

Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97  Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh  Web page: www.tjh.com.tr  E-mail: info@tjh.com.tr   Permissions  Requests for permission to reproduce published material should be sent to the editorial office. Editor: Professor Dr. Reyhan Küçükkaya Adress: İlkbahar Mah, Turan Günes Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey  Telephone: +90 312 490 98 97  Fax: +90 312 490 98 68  Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh  Web page: www.tjh.com.tr  E-mail: info@tjh.com.tr Publisher Galenos Yayınevi Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey Telephone : +90 212 621 99 25 Fax : +90 212 621 99 27 info@galenos.com.tr Instructions for Authors Instructions for authors are published in the journal and at www.tjh.com.tr Material Disclaimer Authors are responsible for the manuscripts they publish in The Turkish Journal of Hematology. The editor, editorial board, and publisher do not accept any responsibility for published manuscripts. If you use a table or figure (or some data in a table or figure) from another source, cite the source directly in the figure or table legend. The journal is printed on acid-free paper. Editorial Policy Following receipt of each manuscript, a checklist is completed by the Editorial Assistant. The Editorial Assistant checks that each manuscript contains all required components and adheres to the author guidelines, after which time it will be forwarded to the Editor in Chief. Following the Editor in Chief’s evaluation, each manuscript is forwarded to the Associate Editor, who in turn assigns reviewers. Generally, all manuscripts will be reviewed by at least three reviewers selected by the Associate Editor, based on their relevant expertise. Associate editor could be assigned as a reviewer along with the reviewers. After the reviewing process, all manuscripts are evaluated in the Editorial Board Meeting. Turkish Journal of Hematology’s editor and Editorial Board members are active researchers. It is possible that they would desire to submit their manuscript to the Turkish Journal of Hematology. This may be creating a conflict of interest. These manuscripts will not be evaluated by the submitting editor(s). The review process will be managed and decisions made by editor-in-chief who will act independently. In some situation, this process will be overseen by an outside independent expert in reviewing submissions from editors.

TURKISH JOURNAL OF HEMATOLOGY INSTRUCTIONS FOR AUTHORS The Turkish Journal of Hematology accepts invited review articles, research articles, brief reports, letters to the editor, and hematological images that are relevant to the scope of hematology, on the condition that they have not been previously published elsewhere. Basic science manuscripts, such as randomized, cohort, cross-sectional, and case-control studies, are given preference. All manuscripts are subject to editorial revision to ensure they conform to the style adopted by the journal. There is a double-blind reviewing system. Review articles are solicited by the Editorin-Chief. Authors wishing to submit an unsolicited review article should contact the Editor-in-Chief prior to submission in order to screen the proposed topic for relevance and priority. The Turkish Journal of Hematology does not charge any article submission or processing charges. Manuscripts should be prepared according to ICMJE guidelines (http:// www.icmje.org/). Original manuscripts require a structured abstract. Label each section of the structured abstract with the appropriate subheading (Objective, Materials and Methods, Results, and Conclusion). Letters to the editor do not require an abstract. Research or project support should be acknowledged as a footnote on the title page. Technical and other assistance should be provided on the title page. Original Manuscripts Title Page Title: The title should provide important information regarding the manuscript’s content. The title must specify that the study is a cohort study, cross-sectional study, case-control study, or randomized study (i.e. Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability of ferrous succinate tablet formulations without correction for baseline circadian changes in iron concentration in healthy Chinese male subjects: A single-dose, randomized, 2-period crossover study. Clin Ther 2011;33:2054-2059). The title page should include the authors’ names, degrees, and institutional/ professional affiliations and a short title, abbreviations, keywords, financial disclosure statement, and conflict of interest statement. If a manuscript includes authors from more than one institution, each author’s name should be followed by a superscript number that corresponds to their institution, which is listed separately. Please provide contact information for the corresponding author, including name, e-mail address, and telephone and fax numbers. Running Head: The running head should not be more than 40 characters, including spaces, and should be located at the bottom of the title page. Word Count: A word count for the manuscript, excluding abstract, acknowledgments, figure and table legends, and references, should be provided and should not exceed 2500 words. The word count for the abstract should not exceed 300 words.

A-IV

Conflict of Interest Statement: To prevent potential conflicts of interest from being overlooked, this statement must be included in each manuscript. In case there are conflicts of interest, every author should complete the ICMJE general declaration form, which can be obtained at www.icmje.org/downloads/coi_disclosure.pdf. Abstract and Keywords: The second page should include an abstract that does not exceed 300 words. For manuscripts sent by authors in Turkey, a title and abstract in Turkish are also required. As most readers read the abstract first, it is critically important. Moreover, as various electronic databases integrate only abstracts into their index, important findings should be presented in the abstract. Objective: The abstract should state the objective (the purpose of the study and hypothesis) and summarize the rationale for the study. Materials and Methods: Important methods should be written respectively. Results: Important findings and results should be provided here. Conclusion: The study’s new and important findings should be highlighted and interpreted. Other types of manuscripts, such as reviews, brief reports, and editorials, will be published according to uniform requirements. Provide 3-10 keywords below the abstract to assist indexers. Use terms from the Index Medicus Medical Subject Headings List (for randomized studies a CONSORT abstract should be provided: http:// www.consort-statement.org). Introduction: The introduction should include an overview of the relevant literature presented in summary form (one page), and whatever remains interesting, unique, problematic, relevant, or unknown about the topic must be specified. The introduction should conclude with the rationale for the study, its design, and its objective(s). Materials and Methods: Clearly describe the selection of observational or experimental participants, such as patients, laboratory animals, and controls, including inclusion and exclusion criteria and a description of the source population. Identify the methods and procedures in sufficient detail to allow other researchers to reproduce your results. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for using them and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. The section should include only information that was available at the time the plan or protocol for the study was devised (http://www.strobe-statement.org/ fileadmin/Strobe/uploads/checklists/STROBE_checklist_v4_combined. pdf). Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify

the reported results. Statistically important data should be given in the text, tables, and figures. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used. Results: Present your results in logical sequence in the text, tables, and figures. Do not present all the data provided in the tables and/or figures in the text; emphasize and/or summarize only important findings, results, and observations in the text. For clinical studies provide the number of samples, cases, and controls included in the study. Discrepancies between the planned number and obtained number of participants should be explained. Comparisons and statistically important values (i.e. p-value and confidence interval) should be provided. Discussion: This section should include a discussion of the data. New and important findings/results and the conclusions they lead to should be emphasized. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by the data. Do not repeat the findings/results in detail; important findings/ results should be compared with those of similar studies in the literature, along with a summarization. In other words, similarities or differences in the obtained findings/results with those previously reported should be discussed. Study Limitations: Limitations of the study should be detailed. In addition, an evaluation of the implications of the obtained findings/ results for future research should be outlined. Conclusion: The conclusion of the study should be highlighted. References Cite references in the text, tables, and figures with numbers in square brackets. Number references consecutively according to the order in which they first appear in the text. Journal titles should be abbreviated according to the style used in Index Medicus (consult List of Journals Indexed in Index Medicus). Include among the references any paper accepted, but not yet published, designating the journal followed by “in press”. Examples of References: 1. List all authors Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow transplantation from unrelated donors for patients with aplastic anemia after failure of immunosuppressive therapy. Blood 2006;108:1485-1491. 2. Organization as author Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of syngeneic bone marrow graft without preconditioning in post-hepatitis marrow aplasia. Lancet 1977;2:742-744.

4. Book Chapter Perutz MF. Molecular anatomy and physiology of hemoglobin. In: Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin: Genetics, Pathophysiology, Clinical Management. New York, Cambridge University Press, 2000. 5. Abstract Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin) stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract). 6. Letter to the Editor Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further definition of 20q deletion in myeloid leukemia using fluorescence in situ hybridization. Blood 1994;84:2821-2823. 7. Supplement Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant 2005;9(Suppl 7):81-86. Brief Reports Abstract length: Not to exceed 150 words. Article length: Not to exceed 1200 words. Introduction: State the purpose and summarize the rationale for the study. Materials and Methods: Clearly describe the selection of the observational or experimental participants. Identify the methods and procedures in sufficient detail. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for their use and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported findings/results. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used. Results: Present the findings/results in a logical sequence in the text, tables, and figures. Do not repeat all the findings/results in the tables and figures in the text; emphasize and/or summarize only those that are most important. Discussion: Highlight the new and important findings/results of the study and the conclusions they lead to. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by your data. Invited Review Articles Abstract length: Not to exceed 300 words.

3. Book

Article length: Not to exceed 4000 words.

Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961.

Review articles should not include more than 100 references. Reviews should include a conclusion, in which a new hypothesis or study about the

A-V

subject may be posited. Do not publish methods for literature search or level of evidence. Authors who will prepare review articles should already have published research articles on the relevant subject. The study’s new and important findings should be highlighted and interpreted in the Conclusion section. There should be a maximum of two authors for review articles. Images in Hematology Article length: Not to exceed 200 words. Authors can submit for consideration illustrations or photos that are interesting, instructive, and visually attractive, along with a few lines of explanatory text and references. Images in Hematology can include no more than 200 words of text, 5 references, and 3 figures or tables. No abstract, discussion, or conclusion is required, but please include a brief title. Letters to the Editor Article length: Not to exceed 500 words. Letters can include no more than 500 words of text, 5-10 references, and 1 figure or table. No abstract is required, but please include a brief title. Tables Supply each table in a separate file. Number tables according to the order in which they appear in the text, and supply a brief caption for each. Give each column a short or abbreviated heading. Write explanatory statistical measures of variation, such as standard deviation or standard error of mean. Be sure that each table is cited in the text. Figures Figures should be professionally drawn and/or photographed. Authors should number figures according to the order in which they appear in the text. Figures include graphs, charts, photographs, and illustrations. Each figure should be accompanied by a legend that does not exceed 50 words. Use abbreviations only if they have been introduced in the text. Authors are also required to provide the level of magnification for histological slides. Explain the internal scale and identify the staining method used. Figures should be submitted as separate files, not in the text file. Highresolution image files are not preferred for initial submission as the file sizes may be too large. The total file size of the PDF for peer review should not exceed 5 MB. Authorship Each author should have participated sufficiently in the work to assume public responsibility for the content. Any portion of a manuscript that is critical to its main conclusions must be the responsibility of at least one author. Contributor’s Statement All submissions should contain a contributor’s statement page. Each statement should contain substantial contributions to idea and design, acquisition of data, and analysis and interpretation of findings. All

A-VI

persons designated as an author should qualify for authorship, and all those that qualify should be listed. Each author should have participated sufficiently in the work to take responsibility for appropriate portions of the text. Acknowledgments Acknowledge support received from individuals, organizations, grants, corporations, and any other source. For work involving a biomedical product or potential product partially or wholly supported by corporate funding, a note stating, “This study was financially supported (in part) with funds provided by (company name) to (authors’ initials)”, must be included. Grant support, if received, needs to be stated and the specific granting institutions’ names and grant numbers provided when applicable. Authors are expected to disclose on the title page any commercial or other associations that might pose a conflict of interest in connection with the submitted manuscript. All funding sources that supported the work and the institutional and/or corporate affiliations of the authors should be acknowledged on the title page. Ethics When reporting experiments conducted with humans indicate that the procedures were in accordance with ethical standards set forth by the committee that oversees human subject research. Approval of research protocols by the relevant ethics committee, in accordance with international agreements (Helsinki Declaration of 1975, revised 2002 available at http://www.wma.net/en/30publications/10policies/b3/; “Guide for the Care and Use of Laboratory Animals” available at www. nap.edu/catalog/5140.html/), is required for all experimental, clinical, and drug studies. Patient names, initials, and hospital identification numbers should not be used. Manuscripts reporting the results of experimental investigations conducted with humans must state that the study protocol received institutional review board approval and that the participants provided informed consent. Non-compliance with scientific accuracy is not in accord with scientific ethics. Plagiarism: To re-publish, in whole or in part, the contents of another author’s publication as one’s own without providing a reference. Fabrication: To publish data and findings/results that do not exist. Duplication: Use of data from another publication, which includes republishing a manuscript in different languages. Salami slicing: To create more than one publication by dividing the results of a study unnecessarily. We disapprove of such unethical practices as plagiarism, fabrication, duplication, and salami slicing, as well as efforts to influence the review process with such practices as gifting authorship, inappropriate acknowledgments, and references. Additionally, authors must respect participants‘ right to privacy. On the other hand, short abstracts published in congress books that do not exceed 400 words and present data of preliminary research, and

those that are presented in an electronic environment, are not considered as previously published work. Authors in such a situation must declare this status on the first page of the manuscript and in the cover letter.

An extensive list of conversion factors can be found at https://www.unc. edu/~rowlett/units/. For more details, see http://www.amamanualofstyle. com/oso/public/jama/si_conversion_table.html.

(The COPE flowchart is available at http://publicationethics.org.)

Abbreviations and Symbols

We use iThenticate to screen all submissions for plagiarism before publication.

Use only standard abbreviations. Avoid abbreviations in the title and abstract. The full term for an abbreviation should precede its first use in the text, unless it is a standard abbreviation. All acronyms used in the text should be expanded at first mention, followed by the abbreviation in parentheses; thereafter the acronym only should appear in the text. Acronyms may be used in the abstract if they occur 3 or more times therein, but must be reintroduced in the body of the text. Generally, abbreviations should be limited to those defined in the AMA Manual of Style, current edition. A list of each abbreviation (and the corresponding full term) used in the manuscript must be provided on the title page.

Conditions of Publication All authors are required to affirm the following statements before their manuscript is considered: 1. The manuscript is being submitted only to The Turkish Journal of Hematology; 2. The manuscript will not be submitted elsewhere while under consideration by The Turkish Journal of Hematology; 3. The manuscript has not been published elsewhere, and should it be published in The Turkish Journal of Hematology it will not be published elsewhere without the permission of the editors (these restrictions do not apply to abstracts or to press reports for presentations at scientific meetings); 4. All authors are responsible for the manuscript’s content; 5. All authors participated in the study concept and design, analysis and interpretation of the data, and drafting or revising of the manuscript and have approved the manuscript as submitted. In addition, all authors are required to disclose any professional affiliation, financial agreement, or other involvement with any company whose product figures prominently in the submitted manuscript. Authors of accepted manuscripts will receive electronic page proofs and are responsible for proofreading and checking the entire article within two days. Failure to return the proof in two days will delay publication. If the authors cannot be reached by email or telephone within two weeks, the manuscript will be rejected and will not be published in the journal.

Copyright At the time of submission all authors will receive instructions for submitting an online copyright form. No manuscript will be considered for review until all authors have completed their copyright form. Please note, it is our practice not to accept copyright forms via fax, e-mail, or postal service unless there is a problem with the online author accounts that cannot be resolved. Every effort should be made to use the online copyright system. Corresponding authors can log in to the submission system at any time to check the status of any co-author’s copyright form. All accepted manuscripts become the permanent property of The Turkish Journal of Hematology and may not be published elsewhere, in whole or in part, without written permission.

Online Manuscript Submission Process The Turkish Journal of Hematology uses submission software powered by ScholarOne Manuscripts. The website for submissions to The Turkish Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This system is quick and convenient, both for authors and reviewers.

Setting Up an Account New users to the submission site will need to register and enter their account details before they can submit a manuscript. Log in, or click the “Create Account” button if you are a first-time user. To create a new account: After clicking the “Create Account” button, enter your name and e-mail address, and then click the “Next” button. Your e-mail address is very important. Enter your institution and address information, as appropriate, and then click the “Next” Button. Enter a user ID and password of your choice, select your area of expertise, and then click the “Finish” button. If you have an account, but have forgotten your log-in details, go to “Password Help” on the journal’s online submission system and enter your e-mail address. The system will send you an automatic user ID and a new temporary password.

Note: We cannot accept any copyright form that has been altered, revised, amended, or otherwise changed. Our original copyright form must be used as is.

Full instructions and support are available on the site, and a user ID and password can be obtained during your first visit. Full support for authors is provided. Each page has a “Get Help Now” icon that connects directly to the online support system. Contact the journal administrator with any questions about submitting your manuscript to the journal (info@tjh.com.tr). For ScholarOne Manuscripts customer support, click on the “Get Help Now” link on the top right-hand corner of every page on the site.

Units of Measurement

The Electronic Submission Process

Measurements should be reported using the metric system, according to the International System of Units (SI). Consult the SI Unit Conversion Guide, New England Journal of Medicine Books, 1992.

Log in to your author center. Once you have logged in, click the “Submit a Manuscript” link in the menu bar. Enter the appropriate data and answer the questions. You may copy and paste directly from your manuscript.

A-VII

Click the “Next” button on each screen to save your work and advance to the next screen.

Upload Files Click on the “Browse” button and locate the file on your computer. Select the appropriate designation for each file in the drop-down menu next to the “Browse” button. When you have selected all the files you want to upload, click the “Upload Files” button. Review your submission before sending to the journal. Click the “Submit” button when you are finished reviewing. You can use ScholarOne Manuscripts at any time to check the status of your submission. The journal’s editorial office will inform you by e-mail once a decision has been made. After your manuscript has been submitted, a checklist will then be completed by the Editorial Assistant. The Editorial Assistant will check that the manuscript contains all required components and adheres to the author guidelines. Once the Editorial Assistant is satisfied with the manuscript it will be forwarded to the Senior Editor, who will assign an editor and reviewers.

The Review Processs Each manuscript submitted to The Turkish Journal of Hematology is subject to an initial review by the editorial office in order to determine if it is aligned with the journal’s aims and scope and complies with essential requirements. Manuscripts sent for peer review will be assigned to one of the journal’s associate editors that has expertise relevant to the manuscript’s content. All accepted manuscripts are sent to a statistical and English language editor before publishing. Once papers have been reviewed, the reviewers’ comments are sent to the Editor, who will then make a preliminary decision on the paper. At this stage, based on the feedback from reviewers, manuscripts can be accepted or rejected, or revisions can be recommended. Following initial peer-review, articles judged worthy of further consideration often require revision. Revised manuscripts generally must be received within 3 months of the date of the initial decision. Extensions must be requested from the Associate Editor at least 2 weeks before the 3-month revision deadline expires; The Turkish Journal of Hematology will reject manuscripts that are not received within the 3-month revision deadline. Manuscripts with extensive revision recommendations will be sent for further review (usually by the same reviewers) upon their re-submission. When a manuscript is finally accepted for publication, the Technical Editor undertakes a final edit and a marked-up copy will be e-mailed to the corresponding author for review and any final adjustments.

A-VIII

Submission of Revised Papers When revising a manuscript based on the reviewers’ and Editor’s feedback, please insert all changed text in red. Please do not use track changes, as this feature can make reading difficult. To submit revised manuscripts, please log in to your author center at ScholarOne Manuscripts. Your manuscript will be stored under “Manuscripts with Decisions”. Please click on the “Create a Revision” link located to the right of the manuscript title. A revised manuscript number will be created for you; you will then need to click on the “Continue Submission” button. You will then be guided through a submission process very similar to that for new manuscripts. You will be able to amend any details you wish. At stage 6 (“File Upload”), please delete the file for your original manuscript and upload the revised version. Additionally, please upload an anonymous cover letter, preferably in table format, including a point-by-point response to the reviews’ revision recommendations. You will then need to review your paper as a PDF and click the “Submit” button. Your revised manuscript will have the same ID number as the original version, but with the addition of an R and a number at the end, for example, TJH-2011-0001 for an original and TJH-2011-0001.R1, indicating a first revision; subsequent revisions will end with R2, R3, and so on. Please do not submit a revised manuscript as a new paper, as revised manuscripts are processed differently. If you click on the “Create a Revision” button and receive a message stating that the revision option has expired, please contact the Editorial Assistant at info@tjh.com.tr to reactivate the option.

English Language Editing All manuscripts are professionally edited by an English language editor prior to publication.

Online Early The Turkish Journal of Hematology publishes abstracts of accepted manuscripts online in advance of their publication in print. Once an accepted manuscript has been edited, the authors have submitted any final corrections, and all changes have been incorporated, the manuscript will be published online. At that time the manuscript will receive a Digital Object Identifier (DOI) number. Both forms can be found at www.tjh. com.tr. Authors of accepted manuscripts will receive electronic page proofs directly from the printer and are responsible for proofreading and checking the entire manuscript, including tables, figures, and references. Page proofs must be returned within 48 hours to avoid delays in publication.

CONTENTS 1

Review

Research Articles

Current Review of Iron Overload and Related Complications in Hematopoietic Stem Cell Transplantation Erden Atilla, Selami K. Toprak, Taner Demirer

Changing Treatment May Affect the Predictive Ability of European Treatment Outcome Study Scoring for the Prognosis of Patients with Chronic Myeloid Leukemia Jing Huang, Leyan Wang, Lu Chen, He Qun, Xu Yajing, Chen Fangping, Zhao Xielan

Allogeneic Transplantation in Chronic Myeloid Leukemia and the Effect of Tyrosine Kinase Inhibitors on Survival: A Quasi-Experimental Study Mehmet Özen, Celalettin Üstün, Bengi Öztürk, Pervin Topçuoğlu, Mutlu Arat, Mehmet Gündüz, Erden Atilla, Gülşen Bolat, Önder Arslan, Taner Demirer, Hamdi Akan, Osman İlhan, Meral Beksaç, Günhan Gürman, Muhit Özcan

Multicenter Retrospective Analysis of Turkish Patients with Chronic Myeloproliferative Neoplasms Nur Soyer, İbrahim C. Haznedaroğlu, Melda Cömert, Demet Çekdemir, Mehmet Yılmaz, Ali Ünal, Gülsüm Çağlıyan, Oktay Bilgir, Osman İlhan, Füsun Özdemirkıran, Emin Kaya, Fahri Şahin, Filiz Vural, Güray Saydam

27 34

TP53 Staining in Tissue Samples of Chronic Lymphocytic Lymphoma Cases: An Immunohistochemical Survey of 51 Cases İbrahim Kulaç, Çetin Demir, Yahya Büyükaşık, Tezer Kutluk, Ayşegül Üner Evaluation of Endocrine Late Complications in Childhood Acute Lymphoblastic Leukemia Survivors: A Report of a Single-Center Experience and Review of the Literature Cengiz Bayram, Neşe Yaralı, Ali Fettah, Fatma Demirel, Betül Tavil, Abdurrahman Kara, Bahattin Tunç FLAG Regimen with or without Idarubicin in Children with Relapsed/Refractory Acute Leukemia: Experience from a Turkish Pediatric Hematology Center Şebnem Yılmaz Bengoa, Eda Ataseven, Deniz Kızmazoğlu, Fatma Demir Yenigürbüz, Melek Erdem, Hale Ören Red Blood Cell Transfusions in Greece: Results of a Survey of Red Blood Cell Use in 2013 Serena Valsami, Elisavet Grouzi, Abraham Pouliakis, Leontini Fountoulaki-Paparisos, Elias Kyriakou, Maria Gavalaki, Elias Markopoulos, Ekaterini Kontopanou, Ioannis Tsolakis, Argyrios Tsantes, Alexandra Tsoka, Anastasia Livada, Vassiliki Rekari, Niki Vgontza, Dimitra Agoritsa, Marianna Politou, Stavros Nousis, Aspasia Argyrou, Ekaterini Manaka, Maria Baka, Maria Mouratidou, Stavroula Tsitlakidou, Konstantinos Malekas, Dimitrios Maltezos, Paraskevi Papadopoulou, Vassiliki Pournara, Ageliki Tirogala, Emmanouil Lysikatos, Sousanna Pefani, Konstantinos Stamoulis The Clinical Significance of Schistocytes: A Prospective Evaluation of the International Council for Standardization in Hematology Schistocyte Guidelines Elise Schapkaitz, Michael Halefom Mezgebe Generation of Platelet Microparticles after Cryopreservation of Apheresis Platelet Concentrates Contributes to Hemostatic Activity İbrahim Eker, Soner Yılmaz, Rıza Aytaç Çetinkaya, Aysel Pekel, Aytekin Ünlü, Orhan Gürsel, Sebahattin Yılmaz, Ferit Avcu, Uğur Muşabak, Ahmet Pekoğlu, Zerrin Ertaş, Cengizhan Açıkel, Nazif Zeybek, Ahmet Emin Kürekçi, İsmail Yaşar Avcı Rituximab Therapy in Adults with Refractory Symptomatic Immune Thrombocytopenia: Long-Term Follow-Up of 15 Cases Fehmi Hindilerden, İpek Yönal-Hindilerden, Mustafa Nuri Yenerel, Meliha Nalçacı, Reyhan Diz-Küçükkaya Discrepancies in Lymphoma Diagnosis Over the Years: A 13-Year Experience in a Tertiary Center Neval Özkaya, Nuray Başsüllü, Ahu Senem Demiröz, Nükhet Tüzüner

A-IX

Hypogammaglobulinemia and Poor Performance Status are Predisposing Factors for Vancomycin-Resistant Enterococcus Colonization in Patients with Hematological Malignancies Elif Gülsüm Ümit, Figen Kuloğlu, Ahmet Muzaffer Demir Antibacterial Activities of Ankaferd Hemostat (ABS) on Shiga Toxin-Producing Escherichia coli and Other Pathogens Significant in Foodborne Diseases Ahmet Koluman, Nejat Akar, İbrahim C. Haznedaroğlu

Letters to the Editor

100 101 102 103

Comment: In Response to “Megaloblastic Anemia with Ring Sideroblasts is not Always Myelodysplastic Syndrome” Smeeta Gajendra

105

107 109 111

113 114 116 118

120

122

124

Wernicke’s Encephalopathy in a Child with Acute Lymphoblastic Leukemia Hande Kızılocak, Gül Nihal Özdemir, Gürcan Dikme, Zehra Işık Haşıloğlu, Tiraje Celkan

Therapeutic International Normalized Ratio Monitoring Beuy Joob, Viroj Wiwanitkit Iron Overload in Hematopoietic Stem Cell Transplantation Sora Yasri, Viroj Wiwanitkit Sole Infrequent Karyotypic Aberration Trisomy 6 in a Patient with Acute Myeloid Leukemia and Breast Cancer in Remission Mürüvvet Seda Aydın, Süreyya Bozkurt, Gürsel Güneş, Ümit Yavuz Malkan, Tuncay Aslan, Sezgin Etgül, Yahya Büyükaşık, İbrahim Celalettin Haznedaroğlu, Nilgün Sayınalp, Hakan Göker, Haluk Demiroğlu, Osman İlhami Özcebe, Salih Aksu Premarital Genetic Diagnosis Revealed Co-heredity Nature of Beta Globin Gene 25-26 del AA and 3’UTR+101 G-C Variants in Two Beta Thalassemia Heterozygotes Kanay Yararbaş, Yasemin Ardıçoğlu, Nejat Akar Acute Myocardial Infarction Due to Eltrombopag Therapy in a Patient with Immune Thrombocytopenic Purpura Sena Sert, Hasan Özdil, Murat Sünbül Candida-Related Immune Response Inflammatory Syndrome Treated with Adjuvant Corticosteroids and Review of the Pediatric Literature Dildar Bahar Genç, Sema Vural, Nafiye Urgancı, Tuğçe Kurtaraner, Nazan Dalgıç Posttranslational Modifications of Red Blood Cell Ghost Proteins as “Signatures” for Distinguishing between Low- and High-Risk Myelodysplastic Syndrome Patients Klara Pecankova, Pavel Majek, Jaroslav Cermak, Jan E. Dyr Intradiploic Hematoma in a Hemophilic Patient: Hemophilic Pseudotumor of Calvarium Hakan Hanımoğlu, Zafer Başlar The Second and Third Hemoglobin Kansas Cases in the Turkish Population Zeynep Kayra Tanrıverdi, Arzu Akyay, Aşkın Şen, Çağatay Taşkapan, Ünsal Özgen Leukocytoclastic Vasculitis Associated with a New Anticoagulant: Rivaroxaban Nuri Barış Hasbal, Taner Baştürk, Yener Koç, Tuncay Sahutoğlu, Feyza Bayrakdar Çağlayan, Abdülkadir Ünsal

Images in Hematology Bullous Sweet’s Syndrome: Report of an Atypical Case Presenting with Ring-Like, Figurate Lesions Andaç Salman, Aida Berenjian, Ali Eser, Fatma Dilek Kaymakçı, Leyla Cinel, Işık Kaygusuz Atagündüz, Deniz Yücelten, Tülin Ergun Griscelli Syndrome Presented with Status Epilepticus and Hemophagocytic Lymphohistiocytosis Fatih Demircioğlu, Hilal Aydın, Mustafa Erkoçoğlu, Hüseyin Önay, Emine Dağıstan Acute Monoblastic Leukemia Presenting with Multiple Granulocytic Sarcoma Nodules Asude Kara, Aslı Akın Belli, Yelda Dere, Volkan Karakuş, Şükrü Kasap, Erdal Kurtoğlu, Mine Hekimgil Internuclear Bridging of Erythroid Precursors in the Peripheral Blood Smear of a Patient with Primary Myelofibrosis Roger K. Schindhelm, Marije M. van Santen, Arie C. van der Spek

A-X

REVIEW DOI: 10.4274/tjh.2016.0450 Turk J Hematol 2017;34:1-9

Current Review of Iron Overload and Related Complications in Hematopoietic Stem Cell Transplantation Güncel Derleme: Hematopoietik Kök Hücre Naklinde Demir Yüklenmesi ve İlişkili Komplikasyonlar Erden Atilla, Selami K. Toprak, Taner Demirer Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey

Abstract

Öz

Iron overload is an adverse prognostic factor for patients undergoing hematopoietic stem cell transplantation (HSCT). In the HSCT setting, pretransplant and early posttransplant ferritin and transferrin saturation were found to be highly elevated due to high transfusion requirements. In addition to that, post-HSCT iron overload was shown to be related to infections, hepatic sinusoidal obstruction syndrome, mucositis, liver dysfunction, and acute graft-versus-host disease. Hyperferritinemia causes decreased survival rates in both pre- and posttransplant settings. Serum ferritin levels, magnetic resonance imaging, and liver biopsy are diagnostic tools for iron overload. Organ dysfunction due to iron overload may cause high mortality rates and therefore sufficient iron chelation therapy is recommended in this setting. In this review the management of iron overload in adult HSCT is discussed.

Demir yüklenmesi, hematopoietik kök hücre nakli (HKHN) yapılan hastalarda görülen olumsuz prognostik göstergedir. Pretransplant ve erken posttransplant ferritin ve transferrin satürasyonlarının yüksekliği, transfüzyon ihtiyacına bağlıdır. Posttransplant demir yüklenmesi; enfeksiyonlar, hepatik sinüzoidal obstrüksiyon sendromu, mukozit, karaciğer disfonksiyonu ve akut graft versus host hastalığı ile ilişkili olarak bulunmuştur. Hiperferritinemi, pre ve posttransplant sağkalım oranlarında düşüklüğe neden olur. Demir yüklenmesinin tanısında serum ferritin düzeyleri, magnetik rezonans görüntüleme ve karaciğer biyopsisi kullanılır. Demir yüklenmesine bağlı organ disfonksiyonu yüksek mortalite oranlarıyla ilişkilidir ve bu durumda yeterli demir şelasyon tedavisi önerilmektedir. Bu derlemede erişkin HKHN’de demir yüklenmesine yaklaşım tartışılmıştır.

Keywords: Iron overload, Hematopoietic stem cell transplantation, Ferritin, Iron chelation

Anahtar Sözcükler: Demir yüklenmesi, Hematopoietik kök hücre nakli, Ferritin, Demir şelasyonu

Introduction Hematopoietic stem cell transplantation (HSCT) is an established treatment approach in a variety of hematological disorders but is still complicated with excessive mortality and morbidity despite advances in conditioning regimens and infectious disease management [1,2,3,4,5]. Today high-dose therapy and auto-HSCT is a treatment option in selected hematopoietic and nonhematopoietic tumors [4]. The common early complications include infections and mucositis [5]. Allo-HSCT is recommended in congenital or acquired bone marrow failures and hematological malignancies. Sinusoidal obstruction syndrome (SOS), hemorrhagic cystitis, engraftment failure, idiopathic pneumonia syndrome, infection, and graft-versus-host disease (GVHD) are major causes of morbidity and non-relapse mortality (NRM) [6]. Late complications of HSCT mainly involve skin,

oral mucosa, ocular, gastrointestinal, pulmonary, endocrine, metabolic, infectious, renal, neurological, psychosocial, and cardiovascular systems, as well as secondary malignancies [6,7]. Iron overload is a common condition in patients with hematological malignancies and HSCT recipients. The incidence of iron overload in auto-HSCT is around 34%, less frequent than in allo-HSCT [8]. In the allo-HSCT setting, the incidence of iron overload varies between 30% and 60% [9,10]. Sucak et al. retrospectively investigated 24 liver biopsies for evaluation of the cause of liver dysfunction after allo-HSCT. Iron overload was detected in a total of 75% of these liver biopsy samples and as a sole histopathologic abnormality in 33% of recipients [11]. The main factor in the high incidence of iron overload in both transplants is exposure to red blood cell (RBC) transfusions both during initial treatment and in the posttransplant period [10].

Address for Correspondence/Yazışma Adresi: Taner DEMİRER, M.D., Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey Phone : +90 532 325 10 65 E-mail : demirer@medicine.ankara.edu.tr

Received/Geliş tarihi: November 19, 2016 Accepted/Kabul tarihi: December 08, 2016

Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation

This review will focus on normal iron hemostasis and mechanisms of iron overload in HSCT recipients and the effects and management of excess iron in the setting of HSCT.

Iron Homeostasis and the Mechanisms of Iron Overload Iron is an essential element for many enzymatic functions and hemoglobin synthesis. There are four major cell types determining the iron content and distribution: duodenal enterocytes, erythroid precursors, reticuloendothelial macrophages, and hepatocytes. The iron cycle in the body starts with duodenal enterocyte absorption of 1 to 2 mg of iron per day. Iron binds to transferrin and is taken up by erythroid precursors for heme synthesis. Reticuloendothelial macrophages clear erythrocytes and release the iron from heme in order to export it to the circulation and store it in the form of ferritin. Hepatocytes are the major cells for iron storage as ferritin and the production of the peptide hormone hepcidin. However, in the state of an excess of iron, reactive oxygen species (ROS) affect the functions of organs such as the liver, heart, and endocrine glands [12]. In patients receiving regular transfusions, tissue iron deposition can begin within 1-2 years; however, clinically evident cardiac or hepatic dysfunction may not occur for 10 years or more [10]. Excess iron is also associated with the prooxidant effects that contribute to DNA damage and the promotion of oncogenesis. There are many ongoing studies related to erythroid regulators of iron homeostasis. Hepcidin is the main regulator of iron absorption and tissue distribution that controls iron in the plasma by absorption of dietary iron in the intestines, recycling of iron by macrophages, and mobilization from hepatocyte storage. Hepcidin promotes the degradation of ferroportin, leading to retention of iron in iron-exporting cells and decreased flow of iron into the plasma [13]. In inherited anemias with ineffective erythropoiesis, beta-thalassemia, and congenital dyserythropoietic anemia, pathological suppression of hepcidin synthesis and hyperabsorption of dietary iron occurs [14]. In thalassemia, twisted-gastrulation 1 was proposed as pathological suppressors of hepcidin [15]; however, its role was not defined. Kautz et al. [16] reported a new erythroid regulator, which is essential for early suppression of hepcidin after erythropoietic stimulation and named â&#x20AC;&#x153;erythroferroneâ&#x20AC;? (ERFE). If it is confirmed in clinical studies, ERFE neutralization could be a new treatment strategy in iron overload in iron-loading anemias. Several clinical reports showed that iron chelation therapy improved hematopoiesis in iron-overloaded patients with myelodysplastic syndrome (MDS) [17,18]. Recently, for investigating the impact of iron deposition on hematopoiesis, researchers initiated studies in vivo. Okabe et al. examined iron-overloaded mice and hematopoietic parameters as well 2

Turk J Hematol 2017;34:1-9

as the bone marrow microenvironment. They showed that hematopoietic parameters of the peripheral blood did not change; however, myeloid progenitor cells in the bone marrow were increased. The number and the function of erythroid progenitors remained the same. Bone marrow transplantation to iron-overloaded mice resulted in delayed hematopoietic reconstitution. The levels of erythropoietin and thrombopoietin were significantly low in iron-overloaded mice compared to the normal group. The authors concluded that excess iron disrupts the hematopoietic microenvironment [19]. Zhang et al. evaluated the effect of iron overload on the bone marrow microenvironment in mice and found that chemokine stromal cell-derived factor-1, stem cell factor-1, and vascular endothelial growth factor-1 expressions were decreased. The decreased hematopoietic functions were influenced by elevated phosphatidylinositol 3 kinase and reduced forkhead box protein mRNA expression, which could induce generation of ROS. These data showed that iron overload could impair the bone marrow microenvironment [20]. Chai et al. showed that iron overload markedly decreased the ratio and clonogenic function of murine hematopoietic stem and progenitor cells by elevation of ROS [21].

Iron Overload and Related Complications Hematopoietic Stem Cell Transplantation

Iron overload is a prominent problem in HSCT recipients. HSCT recipients receive large RBC transfusions both during the pre- and peritransplant periods. In addition to that prolonged dyserythropoiesis, increased intestinal iron absorption due to chemotherapy-associated mucositis and release of iron from damaged tissues raise iron to undesired levels [10]. Chemotherapy and radiotherapy-associated hepatic damage may also contribute to the release of iron stores and diminish transferrin synthesis [22,23]. In an autologous HSCT mice model, iron overload was detected to be associated with increased melphalan and busulfan toxicities through a pharmacodynamic interaction [24]. In a recent study, the interacting effects of total body irradiation and cell transplantation on the expression of iron regulatory genes had contributed to iron overload in murine recipients [25]. Armand et al. [26] retrospectively analyzed the impact of elevated pretransplant serum ferritin levels in 590 patients undergoing myeloablative stem cell transplantation. In that analysis, a strong relationship was detected between pretransplant ferritin levels and survival rates. The 5-year overall survival (OS) for patients with pretransplant ferritin levels in the first quartile (0-231 ng/mL) was 54% (95% confidence interval [CI], 45%63%); in the second quartile (232-930 ng/mL), it was 50% (95% CI, 41%-59%); in the third quartile (931-2034 ng/mL), it was 37% (95% CI, 27%-46%); and in the fourth quartile (>2034 ng/mL), it was 27% (95% CI, 18%-36%) (p<0.001). The 5-year

Turk J Hematol 2017;34:1-9

disease-free survival rates, from the lowest to highest quartile, were 43% (95% CI, 33%-53%), 44% (95% CI, 35%-54%), 34% (95% CI, 24%-43%), and 27% (95% CI, 19%-36%) (p<0.001). The majority of patients diagnosed with MDS and acute leukemia had an increased risk of mortality (hazard ratio [HR], 2.6, p=0.003; HR, 1.6, p=0.031). The authors also stated that pretransplant ferritin levels in the top quartile were associated with a borderline increase in the risk of veno-occlusive disease (odds ratio [OR], 1.7; 95% CI, 1.0-2.9; p=0.054) [26]. Barba et al. studied the effect of hyperferritinemia in allo-HSCT with reduced intensity conditioning in 201 adult lymphoma patients. In the multivariate analysis, patients with hyperferritinemia at transplantation (>399 ng/mL) showed a lower 4-year OS (HR, 1.8; CI, 1.2-2.8; p=0.008) and higher NRM (HR, 1.8; CI, 1.1-3.2; p=0.03) than those without hyperferritinemia [27]. Mahindra et al. studied hyperferritinemia in an autologous HSCT setting in 315 patients with Hodgkin or non-Hodgkin lymphoma. In multivariate analysis, a pretransplant ferritin level of >685 ng/ mL was associated with significantly lower OS (p=0.002) and relapse-free survival (p=0.021) but increased risk of relapse (p=0.005) and relapse-related mortality (p<0.001) [28]. In a metaanalysis, pre-HSCT iron overload was related to poor OS and higher incidence of NRM [29]. Nakamae et al. showed a significant relation of serum ferritin levels at day 30 and 1 year after HSCT with OS [30]. The prognostic impact of iron overload in the posttransplantation period was determined by Meyer et al. in 290 patients who received myeloablative unmanipulated allo-HSCT. Ferritin and transferrin saturation were elevated before and increased in the first months after transplantation as a result of high transfusion needs. Plasma iron levels were found to be variable depending on food intake and time of day. After a peak in the first 1 to 3 months after transplantation, ferritin levels decreased gradually. Hyperferritinemia had a negative effect on survival in all periods (0 to 6 months, p<0.001; 6 to 12 months, p<0.001; 1 to 2 years, p=0.02; 2 to 5 years, p=0.002) and no relation with RBC transfusion dependency or GVHD [31]. On the other hand,

Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation

Armand et al. evaluated the effect of serum iron parameters as well as liver and cardiac iron deposition by magnetic resonance imaging (MRI) prospectively in 45 patients receiving myeloablative allo-HSCT. They found no significant increase in ferritin levels and liver or cardiac iron content in the 12 months following allo-HSCT. Pretransplant ferritin (as reflected in liver iron content) was not found related to increased mortality, relapse, or GVHD. The authors concluded that prospective studies using direct measurement of iron overload rather than ferritin should be designed [32]. Post-HSCT iron overload was shown to be associated with infections, hepatic SOS, mucositis, liver dysfunction, and acute GVHD [33,34,35,36,37]. Early and late complications of HSCT that have been associated with iron overload are summarized in Table 1. Iron accumulation may cause increased growth and virulence of Aspergillosis species [38]. Maertens et al. showed an association of iron overload with mucormycosis in 5 alloHSCT recipients [39]. Sivgin et al. suggested that higher ferritin levels generally above 1550 ng/mL were associated with invasive fungal pneumonia (IFP) in pretransplant allo-HSCT recipients. Patients with IFP had lower Karnofsky performance status (p<0.05) and poorer OS (39.6 vs. 60.9 months, p=0.015) [40]. Increased risk of hepatosplenic candidiasis was also detected in patients with higher pretransplant ferritin levels [41]. Several other bacterial infections were also detected in iron-overloaded HSCT recipients [10]. Liver dysfunction was evaluated in the allo-HSCT setting with pre- and posttransplant liver biopsies in 25 recipients. Fatal veno-occlusive disease occurred in 2 and biochemical abnormalities in 24 patients. Iron overload was detected increased in posttransplant biopsies (96%, p<0.01) [42]. It was suggested that iron-induced hepatotoxicity is multifactorial and consists of oxidative stress and modulation of gene expression of Kupffer cells [43]. Iron-generated oxyradicals and peroxidation of lipid membranes may also cause cellular injury [44]. It is well known that SOS, which is an important cause of transplantrelated mortality of up to 50%, is characterized by the presence

Table 1. Iron overload-related complications after hematopoietic stem cell transplantation (adapted from Majhail et al. [10]). Complication Early (<1 year) posttransplant period Infections

Comments

Acute GVHD Hepatic sinusoidal obstruction syndrome

Aspergillosis, mucormycosis, invasive fungal pneumonia, candidiasis, other infections No clear evidence Iron overload might increase risk

Late (>1 year) posttransplant period Infections Chronic GVHD Liver function abnormalities Late cardiac effects

Mucormycosis, invasive aspergillosis, and other infections No clear evidence Iron overload increases risk Iron overload might increase risk

GVHD: Graft-versus-host disease.

Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation

of at least 2 of the following features: hyperbilirubinemia, painful hepatomegaly, and weight gain [45]. SOS was diagnosed in 88 patients (21%) at a median of 10 days (range, 2-29 days) in 427 HSCT recipients. Pretransplant serum ferritin level higher than 1000 ng/dL (OR, 1.78; 95% CI, 1.02-3.08) was found to be a risk factor for SOS [46]. This finding was also confirmed by a prospective cohort study of 180 patients receiving HSCT by Morado et al. [34]. Data for determining the role of iron overload in the pathogenesis of GVHD are conflicting and should be confirmed by further studies. Pullarkat et al. evaluated the effect of pretransplant ferritin levels on acute GVHD in a prospective cohort study of 190 allo-HSCT patients. Acute GVHD was more common in patients with high ferritin levels (>1000 ng/mL). The initiating event of pathogenesis was defined as the antigen exposition following increased ROS-mediated tissue injury [35]. However, Mahindra et al. demonstrated the decreased incidence of chronic GVHD associated with pretransplant ferritin levels of >1910 µg/L in 222 patients who underwent myeloablative allo-HSCT [47]. In another study of 264 patients with allo-HSCT, there was no relation detected between serum ferritin levels and acute/chronic GVHD [46]. In fact, elevated pretransplant ferritin levels of >400 µg/L were associated with a lower risk of chronic GVHD (HR, 0.51; 95% CI, 0.33-0.79; p=0.003) in 309 allo-HSCT recipients. The authors hypothesized that ferritin might show an immunosuppressive effect and thus reduce the incidence of GVHD following HSCT [48]. It should be kept in mind that, although advances in supportive care and techniques have improved the survival of HSCT recipients [49,50,51,52], iron overload is still a challenging issue and may be associated with liver fibrosis, heart failure, hypogonadism, diabetes, and an endocrinopathy known as “bronze diabetes” in HSCT recipients as long-term complications [53].

Diagnosis of Iron Overload The European Group for Blood and Marrow Transplantation, Center for International Blood and Marrow Transplant Research, and American Society of Blood and Marrow Transplantation (ASBMT) guidelines promoted screening of serum ferritin levels in the post-HSCT period for determining the risk of iron overload [54]. In the 2012 ASBMT guidelines, ferritin measurement is recommended in patients who received transfusions in the pre- and posttransplant settings. Generally, the threshold for serum ferritin level is accepted as 1000 µg/L for detection of iron overload [55]. It is recommended in these guidelines that patients with high liver function tests, high transfusion needs, or hepatitis C infection should be monitored subsequently until ferritin levels are below 500 ng/mL [53]. 4

Turk J Hematol 2017;34:1-9

Ferritin level continues to be the mainstay for the clinical evaluation of iron overload and macrophages and T cells are the main sources of ferritin. Both over transfusion and inflammatory reactions may accompany high ferritin levels. In addition to inflammation, ineffective erythropoiesis and liver disease can also be associated with high ferritin levels [13,56]. Researchers hypothesized whether highly increased ferritin concentrations might be related to GVHD-associated inflammation in pediatric patients, but they concluded that ferritin could not be a biomarker of chronic or acute GVHD [57]. In fact, serum ferritin levels appeared to have a poor correlation with liver iron concentration (LIC) in pediatric patients with thalassemia and sickle cell disease [58]. There was a modest correlation (p=0.47) detected by Majhail et al. between serum ferritin and LIC by MRI in allo-HSCT recipients. They indicated that ferritin can be a good screening test but a poor predictor of tissue iron overload and they recommended estimation of LIC before initiating chelation therapy [9]. It was reported that ferritin, in combination with transferrin saturation, has superior prognostic value in determining iron overload when compared to ferritin alone [53]. An alternative marker for determining iron overload is nontransferrin-bound iron (NTBI), which is a low-molecularweight form of iron. NTBI is formed when transferrin becomes saturated and unable to bind excess iron [59]. There are studies conducted that showed that the level of NTBI was significantly increased in iron overload and might be used to assess the efficacy of chelation in patients with beta-thalassemia major [60]. However, Goto et al. studied the prevalence of iron overload in adult allo-HSCT patients by serum ferritin and NTBI and stated that ferritin was well correlated with NTBI but NTBI was found to be a weaker marker than ferritin in terms of iron overload outcomes. The major issue for this finding was that NTBI only refers to iron in the plasma binding to ligands other than transferrin. Ferritin was confirmed to be correlated with the number of packed RBCs received in patients without active infection, relapse, or second malignancy [61]. Liver biopsy is the gold standard in evaluating iron overload. LIC exceeding 80 µmol/g of liver dry weight is consistent with iron overload with a hepatic index greater than 1.9 mmol/kg/ year [55]. The hepatic iron index is the ratio of hepatic iron concentration to the age of the patient in years. Even though liver biopsy can exclude an alternative diagnosis of hepatic dysfunction such as GVHD and infections, the use is limited in HSCT patients because the procedure is invasive and patients usually have low platelet counts. LIC measurement by MRI has gained importance since it is noninvasive, rapid, and widely available. Today MRI techniques T2 and R2 are reported to have sensitivity and specificity of 89% and 80% in determination of LIC, respectively [62,63]. Ferritin

Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation

Turk J Hematol 2017;34:1-9

levels of more than 1000 ng/mL were found to be correlated with LIC of >7 mg/g in HSCT survivors [10]. The superconducting quantum interference device (SQUID) can assess total body iron with biomagnetic susceptometry by detecting the paramagnetic materials ferritin and hemosiderin. Although it is the reference standard for estimation of LIC, the technique is complex, expensive, and very limited [64]. Busca et al. showed that LIC measurements obtained by SQUID in the presence of moderate (LIC 1000-2000 µg Fe/g wet weight) or severe (LIC >2000 µg Fe/g wet weight) iron overload were associated with high ferritin levels in 69% of patients [62]. Commonly used diagnostic methods for determining iron overload are summarized in Table 2 [10].

Management of Iron Overload There is no consensus in the literature on when or how to treat iron overload in HSCT settings. Management of iron overload should be individualized based on several factors such as the need for ongoing RBC transfusion therapy, ability to tolerate iron-depleting therapy, cost-effectiveness, or urgency to reduce body iron stores. Therapy may not be needed in mild cases of iron overload; avoidance of alcohol and iron supplements can be recommended [65]. Phlebotomy and iron chelation agents are two treatment approaches for protecting recipients from long-term end-organ toxicities. As a recommendation, patients with LIC of >15 mg/g dry weight should be treated aggressively with both phlebotomy and chelation; when LIC is 7-15 mg/g dry weight, phlebotomy is indicated; and when LIC is under 7 mg/g dry weight treatment is only indicated if there is evidence of liver disease [53]. In adult survivors of allo-HSCT, unlike large pediatric cohorts, case series were reported regarding the safety and feasibility of phlebotomy [63,64]. In a routine phlebotomy program, approximately 250 mg of iron is removed once or twice weekly [54]. Although phlebotomy has the advantage of better compliance, fewer side effects, and lower costs, the efficacy is limited [53]. Phlebotomy did not have a statistically significant effect on the reduction of ferritin levels before chelation treatment compared with ferritin levels after chelation treatment in a small cohort of patients after allo-HSCT [66].

Phlebotomies were repeated every 1-2 weeks until a serum ferritin level of <500 ng/mL in post-HSCT patients and LIC was significantly reduced in a small cohort (median, 1419 µg Fe/g wet weight to 625 µg Fe/g wet weight; p<0.001) [62]. After normalization of transaminases and serum ferritin levels, maintenance phlebotomy is recommended every 3-6 months to prevent reaccumulation [53]. Deferoxamine is an iron-chelating agent available in vials for intramuscular, subcutaneous, and intravenous administration. It chelates iron from ferritin and hemosiderin, but not readily from transferrin. The common adverse events are reported as localized irritation, pain, burning, swelling at the injection site, and systemic allergic reaction [67]. Deferoxamine has proven efficacy and safety in HSCT recipients with a recommended schedule of at least 5 nights delivered by subcutaneous pump for 8-12 h [64]. Neurotoxicity, ocular toxicity, ototoxicity, and growth retardation have been related to overuse [55]. However, parenteral administration is uncomfortable and timeconsuming and it increases the risk of infection; therefore, oral iron chelators have been under investigation. Deferiprone is an oral iron chelator but it has not been investigated in HSCT recipients and is not commercially available in all countries [10]. Deferasirox is an oral iron chelator that was approved by the US Food and Drug Administration in 2005 and improved outcomes in iron overload. The effective dose of deferasirox is between 20 and 40 mg/kg (water soluble tablet: 500 mg). Common side effects include skin rash, nausea, vomiting, diarrhea, and elevation of renal function test results [68]. Deferasirox treatment at a dose of 20 mg/kg/day in hyperferritinemia (ferritin of ≥1000 ng/ mL) was analyzed retrospectively in 23 posttransplant patients. Iron (p=0.003), total iron-binding capacity (p=0.025), ferritin (p=0.001), alanine transaminase (p=0.019), and total bilirubin levels (p=0.001) were significantly decreased after treatment. Eight patients (34.7%) who had hemoglobin levels of >12 g/ dL also underwent phlebotomy. The reductions of ferritin levels were significant between the deferasirox + phlebotomy group compared to the deferasirox + nonphlebotomy group (p=0.025). The most common adverse effects were nausea and vomiting in 13% of patients while no renal dysfunction was observed. The authors concluded that oral deferasirox treatment was safe

Table 2. Diagnostic techniques for determining iron stores. Diagnostic Technique

Advantages

Disadvantages

Serum ferritin and transferrin saturation

Noninvasive, widely available

Sensitive but not specific, may be increased in inflammation and malignancy

Liver biopsy

Gold standard, exclusion of other reasons for liver dysfunction

Invasive, not feasible in patients with thrombocytopenia or coagulopathy

MRI

Good correlation with liver biopsy, noninvasive Variety of MRI techniques, contraindications (e.g., metal implants)

SQUID

Good correlation with liver biopsy, noninvasive Very limited availability, expensive

MRI: Magnetic resonance imaging, SQUID: superconducting quantum interference device.

Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation

and effective with or without phlebotomy in the posttransplant setting [66]. Majhail et al. included only patients with ferritin levels of >1000 ng/mL and LIC of ≥5 mg/g on liver R2 MRI in a prospective study of iron overload management in 147 adult allo-HSCT survivors, and 16 out of 147 patients had significant iron overload. Based on physician and patient preference the patients were divided into 3 different treatment modality groups: 5 of the patients were followed by observation only, 8 patients had phlebotomy, and 3 patients were treated by deferasirox. Deferasirox decreased the LIC after 6 months of therapy in all 3 patients. The authors concluded that phlebotomy and deferasirox appeared to be effective alternative treatments of iron overload in post allo-HSCT [69]. A phase IV open-label study showed a significant reduction in serum ferritin and LIC over 1 year in allo-HSCT recipients treated with deferasirox [70]. In a recent study of 76 nonthalassemic patients, the authors reported a deferasirox-induced negative iron balance in 84% of patients after initiating it at a median of 168 days after HSCT. The drug-related adverse events were increased blood creatinine (26%), nausea (9%), and abdominal discomfort (8%) [71]. Deferasirox has also been tried during the administration of conditioning regimens and it was found to be safe and reduced the appearance of labile plasma iron shortly after allo-HSCT in a preliminary study [72]. The studies of deferasirox in post-HSCT survivors with iron overload are summarized in Table 3. Visani et al. evaluated the effect of deferasirox on the restoration of normal hematopoiesis in 8 HSCT recipients and all patients experienced an increase in hemoglobin levels with a reduction of transfusions, followed by transfusion independence. This Table 3. Management of iron overload with deferasirox in hematopoietic stem cell transplantation recipients. Authors/Year

Number of Patients

Comments

Sivgin et al., 2012 [66]

In the posttransplant setting, median treatment duration was 94 days; significantly reduced iron parameters; 13% of patients had side effects

Majhail et al., 2010 [69] 3

Well tolerated and decreased LIC after 6 months of therapy in all patients

Vallejo et al., 2014 [70]

No drug-related serious adverse events; significant reduction in ferritin and LIC

Jaekel et al., 2016 [71]

Negative iron balance in 84% of patients; serum blood creatinine increased in 26.5% of recipients with a manageable safety profile even in patients receiving cyclosporine

LIC: Liver iron concentration.

Turk J Hematol 2017;34:1-9

interesting result shows us that deferasirox might have a beneficial effect on hematopoietic recovery after allo-HSCT [73]. In conclusion, iron overload is a common complication and this possibility should be considered in all HSCT recipients. Patients will benefit from careful screening and diagnostic tools such as serum ferritin and transferrin saturation levels and LIC by MRI or biopsy. The initiation of phlebotomy and/ or iron chelation therapy if needed will prevent patients from end-organ toxicities. Further studies should be conducted in order to determine better preventive measures and to avoid iron overload, as well as to improve survival in HSCT settings. Authorship Contributions Concept: Erden Atilla, Selami K. Toprak, Taner Demirer; Design: Erden Atilla, Selami K. Toprak, Taner, Demirer; Data Collection or Processing: Erden Atilla, Selami K. Toprak, Taner Demirer; Analysis or Interpretation: Erden Atilla, Selami K. Toprak, Taner Demirer; Literature Search: Erden Atilla, Selami K. Toprak, Taner Demirer; Writing: Erden Atilla, Selami K. Toprak, Taner Demirer. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. De Giorgi U, Rosti G, Slavin S, Yaniv I, Harousseau JL, Ladenstein R, Demirer T, Dini G; European Group for Blood and Marrow Transplantation Solid Tumours and Paediatric Disease Working Parties. Salvage high-dose chemotherapy for children with extragonadal germ-cell tumours. Br J Cancer 2005;93:412-417. 2. Pedrazzoli P, Ferrante P, Kulekci A, Schiavo R, De Giorgi U, Carminati O, Maragolo M, Demirer T, Siena S, Rosti G; European Group for Blood and Marrow Transplantation (EBMT), Solid Tumors Working Party. Autologous hematopoietic stem cell transplantation for breast cancer in Europe: critical evaluation of data from the European Group for Blood and Marrow Transplantation (EBMT) Registry 1990-1999. Bone Marrow Transplant 2003;32:489-494. 3. Pedrazzoli P, Ledermann JA, Lotz JP, Leyvraz S, Aglietta M, Rosti G, Champion KM, Secondino S, Selle F, Ketterer N, Grignani G, Siena S, Demirer T; European Group for Blood and Marrow Transplantation (EBMT) Solid Tumors Working Party. High dose chemotherapy with autologous hematopoietic stem cell support for solid tumors other than breast cancer in adults. Ann Oncol 2006;17:1479-1488. 4. Berry DA, Ueno, NT, Johnson MM, Lei X, Caputo J, Smith DA, Yancey LJ, Crump M, Stadtmauer E, Biron P, Crown JP, Schmid P, Lotz JP, Rosti G, Bregni M, Demirer T. High-dose chemotherapy with autologous hematopoietic stemcell transplantation in metastatic breast cancer: overview of six randomized trials. J Clin Oncol 2011;29:3224-3231. 5. Passweg JR, Halter J, Bucher C, Gerull S, Heim D, Rovo A, Buser A, Stern M, Tichelli A. Hematopoietic stem cell transplantation: a review and recommendation for follow-up care for the general practitioner. Swiss Med Wkly 2012;142:13696. 6. Jagasia MH, Greinix HT, Arora M, Williams KM, Wolff D, Cowen EW, Palmer J, Weisdorf D, Treister NS, Cheng GS, Kerry H, Stratton P, Duarte RF, McDonald

Turk J Hematol 2017;34:1-9

GB, Inamoto Y, Vigorito A, Arai S, Datiles MB, Jacobsohn D, Heller T, Kitko CL, Mitchell SA, Martin PJ, Shulman H, Wu RS, Cutler CS, Vogelsang GB, Lee SJ, Pavletic SZ, Flowers ME. National Institutes of Health Consensus Development Project on Criteria for Clinical Trials in Chronic Graft-versusHost Disease: I. The 2014 Diagnosis and Staging Working Group report. Biol Blood Marrow Transplant 2015;21:389-401. 7. Kröger N, Damon L, Zander AR, Wandt H, Derigs G, Ferrante P, Demirer T, Rosti G; Solid Tumor Working Party of the European Group for Blood and Marrow Transplantation; German Adjuvant Breast Cancer Study Group; University of California, San Francisco. Secondary acute leukemia following mitoxantrone-based high-dose chemotherapy for primary breast cancer patients. Bone Marrow Transplant 2003;32:1153-1157. 8. Majhail NS, DeFor TE, Lazarus HM, Burns LJ. Iron-overload after autologous hematopoietic cell transplantation. Leuk Res 2009;33:578-579. 9. Majhail NS, DeFor T, Lazarus HM, Burns LJ. High prevalence of iron overload in adult allogeneic hematopoietic cell transplant survivors. Biol Blood Marrow Transplant 2008;14:790-794. 10. Majhail NS, Lazarus HM, Burns LJ. Iron overload in hematopoietic cell transplantation. Bone Marrow Transplant 2008;41:997-1003. 11. Sucak GT, Yegin ZA, Ozkurt ZN, Aki SZ, Karakan T, Akyol G. The role of liver biopsy in the workup of liver dysfunction late after SCT: is the role of iron overload underestimated? Bone Marrow Transplant 2008;42:461-467. 12. Fleming RE, Ponka P. Iron overload in human disease. N Eng J Med 2012;366:348-359. 13. Ganz T, Nemeth E. Hepcidin and iron homeostasis. Biochim Biophys Acta 2012;1823:1434-1443. 14. Ramos P, Melchiori L, Gardenghi S, Van-Roijen N, Grady RW, Ginzburg Y, Rivella S. Iron metabolism and ineffective erythropoiesis in betathalassemia mouse models. Ann N Y Acad Sci 2010;1202:24-30. 15. Tanno T, Porayette P, Sripichai O, Noh SJ, Byrnes C, Bhupatiraju A, Lee YT, Goodnough JB, Harandi O, Ganz T, Paulson RF, Miller JL. Identification of TWSG1 as second novel erythroid regulator of hepcidin expression in murine and human cells. Blood 2009;114:181-186. 16. Kautz L, Jung G, Valore EV, Rivella S, Nemeth E, Ganz T. Identification of erythroferrone as an erythroid regulator of iron metabolism. Nat Genet 2014;46:678-684. 17. Di Tucci AA, Murru R, Alberti D, Rabault B, Deplano S, Angelucci E. Correction of anemia in a transfusion-dependent patient with primary myelofibrosis receiving iron chelation therapy with deferasirox (Exjade®, ICL670). Eur J Haematol 2007;78:540-542. 18. Gattermann N, Finelli C, Della Porta M, Fenaux P, Stadler M, Guerci-Bresler A, Schid M, Taylor K, Vassilieff D, Habr D, Marcellari A, Roubert B, Rose C. Hematologic responses to deferasirox therapy in transfusion-dependent patients with myelodysplastic syndromes. Hematologica 2012;97:13641371. 19. Okabe H, Suzuki T, Uehara E, Ueda M, Nagai T, Ozawa K. The bone marrow hematopoietic microenvironment is impaired in iron-overloaded mice. Eur J Haematol 2014;93:118-128. 20. Zhang Y, Zhai W, Zhao M, Li D, Chai X, Cao X, Meng J, Chen J, Xiao X, Li Q, Mu J, Shen J, Meng A. Effects of iron overload on the bone marrow microenvironment in mice. PLoS One 2015;10:0120219. 21. Chai X, Li D, Chao X, Zhang Y, Mu J, Lu W, Xiao X, Li C, Meng J, Chen J, Li Q, Wang J, Meng A, Zhao M. ROS-mediated iron overload injures the hematopoiesis of bone marrow by damaging hematopoietic stem/ progenitor cells in mice. Sci Rep 2015;5:10181. 22. Sahlstedt L, Ebeling F, von Bonsdorff L, Parkkinen J, Ruutu T. Nontransferrin-bound iron during allogeneic stem cell transplantation. Br J Haematol 2001;113:836-838. 23. Dürken M, Nielsen P, Knobel S, Finckh B, Herrnring C, Dresow B, Kohlschütter B, Stocksclader M, Krüger WH, Kohlschütter A, Zander AR. Nontransferrinbound iron in serum of patients receiving bone marrow transplants. Free Radic Biol Med 1997;22:1159-1163.

Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation

24. Boulingand J, Richard C, Valteau-Couanet D, Orear C, Mercier L, Kessari R, Simmonnard N, Munier F, Daudigeous-Dubus E, Tou B, Opolon P, Deroussent A, Paci A, Vassal G. Iron overload exacerbates busulfan-melphalan toxicity through a pharmacodynamic interaction in mice. Pharm Res 2016;33:1913-1922. 25. Karoopongse E, Marcondes AM, Yeung C, Holman Z, Kowdley KV, Campbell JS, Deeg HJ. Disruption of iron regulation after radiation and donor cell infusion. Biol Blood Marrow Transplant 2016;22:1173-1181. 26. Armand P, Kim HT, Cutler CS, Ho VT, Koreth J, Alyea EP, Soiffer RJ, Antin JH. Prognostic impact of elevated pretransplantation serum ferritin in patients undergoing myeloablative stem cell transplantation. Blood 2007;109:45864588. 27. Barba P, Valcarcel D, Perez-Simon JA, Fernandez-Aviles F, Pinana JL, Martino R, Lopez-Anglada L, Rovira M, Garcia-Cadenas I, Novelli S, Carreras E, Lopez Corral L, Sierra J. Impact of hyperferritinemia on the outcome of reducedintensity conditioning allogeneic hematopoietic cell transplantation for lymphoid malignancies. Biol Blood Marrow Transplant 2013;19:597-601. 28. Mahindra A, Bolwell B, Sobecks R, Rybicki L, Pohlman B, Dean R, Andersen S, Sweetenham J, Kalaycio M, Copelan E. Elevated ferritin is associated with relapse after autologous hematopoietic stem cell transplantation for lymphoma. Biol Blood Marrow Transplant 2008;14:1239-1244. 29. Wang Z, Jia M, Zhao H, Cheng Y, Luo Z, Chen Y, Xu X, Tang Y. Prognostic impact of pretransplantation hyperferritinemia in adults undergoing allogeneic hematopoietic SCT: a meta-analysis. Bone Marrow Transplant 2014;49:1339-1340. 30. Nakamae M, Nakamae H, Koh S, Nishimoto M, Nakashima Y, Nakane T, Hirose A, Hino M. Prognostic value and clinical implication of serum ferritin levels following allogeneic hematopoietic cell transplantation. Acta Haematol 2015;133:310-316. 31. Meyer SC, O’Meara A, Buser AS, Tichelli A, Passweg JR, Stern M. Prognostic impact of posttransplantation iron overload after allogeneic stem cell transplantation. Biol Blood Marrow Transplant 2013;19:440-444. 32. Armand P, Sainvil MM, Kim HT, Rhodes J, Cutler C, Ho VT, Koreth J, Alyea EP, Neufeld EJ, Kwong RY, Soiffer RJ, Antin JH. Does iron overload really matter in stem cell transplantation? Am J Hematol 2012;87:569-572. 33. Maertens J, Demuynck H, Verbeken EK, Zachee P, Vandenberghe P, Boogaerts MA. Mucormycosis in allogeneic bone marrow transplant recipients: report of five cases and review of the role of iron overload in the pathogenesis. Bone Marrow Transplant 1999;24:307-312. 34. Morado M, Ojeda E, Garcia-Bustos J, Aguado MJ, Arrieta R, Quevedo E, Navas A, Hernandez-Navarro F. Serum ferritin as risk factor for veno-occlusive disease of the liver: prospective cohort study. Hematology 1999;4:505-512. 35. Pullarkat V, Blanchard S, Tegtmeier B, Dagis A, Patane K, Ito J, Forman SJ. Iron overload adversely affects outcome of allogeneic hematopoietic cell transplantation. Bone Marrow Transplant 2008;42:799-805. 36. Altes A, Remacha AF, Sarda P, Baiget M, Sureda A, Martino R, Briones J, Brunet S, Canals C, Sierra J. Early clinical impact of iron overload in stem cell transplantation. A prospective study. Ann Hematol 2007;86:443-447. 37. Lee SH, Yoo KH, Sung KW, Koo HH, Kwon YJ, Kwon MM, Park HJ, Park BK, Kim YY, Park JA, Im HJ, Seo JJ, Kang HJ, Shin HY, Ahn HS. Hepatic veno-occlusive disease in children after hematopoietic stem cell transplantation: incidence, risk factors and outcome. Bone Marrow Transplant 2010;45:1287-1293. 38. Hissen AH, Wan AN, Warwas ML, Pinto LJ, Moore MM. The Aspergillus fumigatus siderophore biosynthetic gene sidA, encoding L-ornithine N5oxygenase, is required for virulence. Infect Immun 2005;73:5493-5503. 39. Maertens J, Demuynck H, Verbeken EK, Zachee P, Verhoef GE, Vanderberghe P, Boogaerts MA. Mucormycosis in allogeneic bone marrow recipients: report of five cases and review of the role of iron overload in the pathogenesis. Bone Marrow Transplant 1999;24:307-312. 40. Sivgin S, Baldane S, Kaynar L, Kurnaz F, Pala C, Sivgin H. Keklik M, Demiraslan H, Cetin M, Eser B, Unal A. Pretransplant iron overload may be associated with increased risk of invasive fungal pneumonia (IFP) in patients that underwent allogeneic hematopoietic stem cell transplantation (alloHSCT). Transfus Apher Sci 2013;48:103-108.

Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation

41. Tunçsan OG, Yegin ZA, Ozkurt ZN, Erbaş G, Akı SZ, Senol E, Yağcı M, Sucak G. High ferritin levels are associated with hepatosplenic candidiasis in hematopoietic stem cell transplant candidates. Int J Infect Dis 2010;14(Suppl 3):104-107. 42. Azar N, Valla D, Abdel-Samad I, Hoang C, Fretz C, Sutton L, Fournel JJ, Le Charpentier Y, Binet JL, Leblond V. Liver dysfunction in allogeneic bone marrow transplantation recipients. Transplantation 1996;62:56-61. 43. Videla LA, Fernandez V, Tapia G, Varela P. Oxidative stress-mediated hepatotoxicity of iron and copper: role of Kupffer cells. Biometals 2003;16:103-111. 44. Ramm GA, Ruddell RG. Hepatotoxicity of iron overload: mechanisms of iron-induced hepatic fibrogenesis. Semin Liver Dis 2005;25:433-449. 45. Kumar S, DeLeve LD, Kamath PS, Tefferi A. Hepatic veno-occlusive disease (sinusoidal obstruction syndrome) after hematopoietic stem cell transplantation. Mayo Clin Proc 2003;78:589-598. 46. Maradei SC, Maiolino A, de Azevedo AM, Colares M, Bouzas LF, Nucci M. Serum ferritin as risk factor for sinusoidal obstruction syndrome of the liver in patients undergoing hematopoietic stem cell transplantation. Blood 2009;114:1270-1275. 47. Mahindra A, Bolwell B, Sobecks R, Rybicki L, Pohlman B, Dean R, Andresen S, Sweetenham J, Kalaycio M, Copelan E. Elevated pretransplant ferritin is associated with a lower incidence of chronic graft-versus host-disease and inferior survival after myeloablative allogeneic hematopoietic stem cell transplantation. Br J Haematol 2009;146:310-316. 48. Wahlin A, Lorenz F, Fredriksson M, Remberger M, Wahlin BE, Hägglund H. Hyperferritinemia is associated with low incidence of graft versus host disease, high relapse rate and impaired survival in patients with blood disorders receiving allogeneic hematopoietic stem cell grafts. Med Oncol 2011;28:552-558. 49. Demirer T, Gooley T, Buckner CD, Peterson FB, Lilleby K, Rowley S, Sanders J, Storb R, Appelbaum FR, Besinger WI. Influence of total nucleated cell dose from marrow harvests on outcome in patients with acute myelogenous leukemia undergoing autologous transplantation. Bone Marrow Transplant 1995;15:907-913. 50. Demirer T, Celebi H, Arat M, Ustun C, Demirer S, Dilek I, Ozcan M, Ilhan O, Akan H, Gurman G, Koç H. Autoimmune thrombocytopenia in a patient with small cell lung cancer developing after chemotherapy and resolving following autologous peripheral blood stem cell transplantation. Bone Marrow Transplant 1999;24:335-337. 51. De Giorgi U, Demirer T, Wandt H, Taverna C, Siegert W, Bornhauser M, Kozak T, Papiani G, Ballardini M, Rosti G; Solid Tumor Working Party of the European Group for Blood and Marrow Transplantation. Second-line high-dose chemotherapy in patients with mediastinal and retroperitoneal primary non-seminomatous germ cell tumors: the EBMT experience. Ann Oncol 2005;16:146-151. 52. Brunvand MW, Bensinger WI, Soll E, Weaver CH, Rowley SD, Appelbaum FR, Lilleby K, Clift RA, Gooley TA, Press OW, Fefer A, Storb R, Sanders JE, Martin PL, Chauncey T, Maziarz RT, Zuckerman N, Montgomery P, Dorn R, Weiden PL, Demirer T, Holmberg LA, Schiffman K, McSweeney PA, Buckner CD. High-dose fractionated total-body irradiation, etoposide and cyclophosphamide for treatment of malignant lymphoma: comparison of autologous bone marrow and peripheral blood stem cells. Bone Marrow Transplant 1996;18:131-141. 53. Yegin A, Sucak G, Demirer T. Iron overload and hematopoietic stem cell transplantation. In: Demirer T, (ed). Innovations in Stem Cell Transplantation. Rijeka, InTech, 2013. 54. Rizzo JD, Wingard JR, Tichelli A, Lee SJ, Van Lint MT, Burns LJ, Davies SM, Ferrara JL, Socie G. Recommended screening and preventive practices for long-term survivors after hematopoietic cell transplantation: joint recommendations of the European Group for Blood and Marrow Transplantation, the Center for International Blood and Marrow Transplant Research, and the American Society of Blood and Marrow Transplantation. Biol Blood Marrow Transplant 2006;12:138-151.

Turk J Hematol 2017;34:1-9

55. Knovich MA, Storey JA, Coffman LG, Torti SV, Torti FM. Ferritin for the clinician. Blood Rev 2009;23:95-104. 56. Gordon LI, Brown SG, Tallman MS, Rademaker AW, Weitzman SA, Lazarus HM, Kelley CH, Mangan C, Rubin H, Fox RM, Creger RJ, Winter JN. Sequential changes in serum iron and ferritin in patients undergoing high-dose chemotherapy and radiation with autologous bone marrow transplantation: possible implications for treatment related toxicity. Free Radic Biol Med 1995;18:383-389. 57. Großekatthöfer M, Güclü ED, Lawitschka A, Matthes-Martin S, Mann G, Minkov M, Peters C, Seidel MG. Ferritin concentrations correlate to outcome of hematopoietic stem cell transplantation but do not serve as biomarker of graft-versus-host disease. Ann Hematol 2013;92:1121-1128. 58. Brittenham GM, Cohen AR, McLaren CE, Martin MB, Griffith PM, Nienhuis AW, Young NS, Allen CJ, Farrell DE, Harris JW. Hepatic iron stores and plasma ferritin concentration in patients with sickle cell anemia and thalassemia major. Am J Hematol 1993;42:81-85. 59. Breuer W, Ronson A, Slotki IN, Abramov A, Hershko C, Cabantchik ZI. The assessment of serum nontransferrin-bound iron in chelation therapy and iron supplementation. Blood 2000;95:2975-2982. 60. Al-Refaie FN, Wickens DG, Wonke B, Kontoghiorghes GJ, Hoffbrand AV. Serum non-transferrin-bound iron in beta-thalassaemia major patients treated with desferrioxamine and L1. Br J Haematol 1992;82:431-436. 61. Goto T, Ikuta K, Inamoto Y, Kamoshita S, Yokohata E, Koyama D, Onodera K, Seto A, Watanabe K, Imahashi N, Tsukamoto S, Ozawa Y, Sasaki K, Ito M, Kohgo Y, Miyamura K. Hyperferritinemia after adult allogeneic hematopoietic cell transplantation: quantification of iron burden by determining non-transferrin-bound iron. Int J Hematol 2013;97:125-134. 62. Busca A, Falda M, Manzini P, Dántico S, Valfre A, Locatelli F, Calabrese R, Chiappella A, D’Ardia S, Longo F, Piga A. Iron overload in patients receiving allogeneic hematopoietic stem cell transplantation: quantification of iron burden by superconducting quantum interference device (SQUID) and therapeutic effectiveness of phlebotomy. Biol Blood Marrow Transplant 2010;16:115-122. 63. Kamble RT, Selby GB, Mims M, Kharfan-Dabaja MA, Ozer H, George JN. Iron overload manifesting as apparent exacerbation of hepatic graft-versushost disease after allogeneic hematopoietic stem cell transplantation. Biol Blood Marrow Transplant 2006;12:506-510. 64. McKay PJ, Murphy JA, Cameron S, Burnett AK, Campbell M, Tansey P, Franklin IM. Iron overload and liver dysfunction after allogeneic or autologous bone marrow transplantation. Bone Marrow Transplant 1996;17:63-66. 65. Majhail NS, Rizzo JD, Lee SJ, Aljurf M, Atsuta Y, Bonfim C, Burns LJ, Chaudhri N, Davies S, Okamoto S, Seber A, Socie G, Szer J, Van Lint MT, Wingard JR, Tichelli A; Center for International Blood and Marrow Transplant Research (CIBMTR); American Society for Blood and Marrow Transplantation (ASBMT); European Group for Blood and Marrow Transplantation (EBMT); Asia-Pacific Blood and Marrow Transplantation Group (APBMT); Bone Marrow Transplant Society of Australia and New Zealand (BMTSANZ); East Mediterranean Blood and Marrow Transplantation Group (EMBMT); Sociedade Brasileira de Transplante de Medula Ossea (SBTMO). Recommended screening and preventive practices for long-term survivors after hematopoietic cell transplantation. Biol Blood Marrow Transplant 2012;18:348-371. 66. Sivgin S, Eser B, Bahcebasi, Kaynar L, Kurnaz F, Uzer E, Pala C, Deniz K, Ozturk A, Cetin M, Unal A. Efficacy and safety of oral deferasirox treatment in the posttransplant period for patients who have undergone allogeneic hematopoietic stem cell transplantation (alloHSCT). Ann Hematol 2012;91:743-749. 67. Novartis. Deferoxamine, Desferal, Novartis. Package Insert. Basel, Novartis, 2016. 68. Novartis. Deferasirox, Exjade, Novartis. Package Insert. Basel, Novartis, 2016. 69. Majhail NS, Lazarus HM, Burns LJ. A prospective study of iron overload management in allogeneic hematopoietic cell transplantation survivors. Biol Blood Marrow Transplant 2010;16:832-837.

Turk J Hematol 2017;34:1-9

Atilla E, et al: Iron Overload in Hematopoietic Stem Cell Transplantation

70. Vallejo C, Battle M, Vazquez L, Salono C, Sampol A, Duarte R, Hernandez D, Lopez J, Rovira M, Jimenez S, Valcarcel D, Belloch V, Jimenez M, Jarque I; Subcommittee of Non-Infectious Complications of the Grupo Español de Trasplante Hematopoyético (GETH). Phase IV open-label study of efficacy and safety of deferasirox after allogeneic stem cell transplantation. Haematologica 2014;99:1632-1637.

hematopoietic stem cell transplantation. Bone Marrow Transplant 2016;51:89-95.

71. Jaekel N, Lieder K, Albrecht S, Leismann O, Hubert K, Bug G, Kröger N, Platzbecker U, Stadler M, de Haas K, Altamura S, Muckenthaler MU, Niederwieser D, Al-Ali HK. Efficacy and safety of deferasirox in nonthalassemic patients with elevated ferritin levels after allogeneic

72. Fritsch A, Langebrake C, Nielsen P, Bacher U, Baehr M, Dartsch DC, Kroeger N. Deferasirox (Exjade) given during conditioning regimen (FLAMSA/ busulfan/ATG) reduces the appearance of labile plasma iron in patients undergoing allogeneic stem cell transplantation. Blood 2011;118:3023. 73. Visani G, Guiducci B, Giardini C, Loscocco F, Ricciardi T, Isidori A. Deferasirox improves hematopoiesis after allogeneic hematopoietic SCT. Bone Marrow Transplant 2014;49:585-587.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0156 Turk J Hematol 2017;34:10-15

Changing Treatment May Affect the Predictive Ability of European Treatment Outcome Study Scoring for the Prognosis of Patients with Chronic Myeloid Leukemia Kronik Miyeloid Lösemi Hastalarında Tedavinin Değiştirilmesi Avrupa Tedavi İzlem Çalışması Prognoz Skorlamasındaki Tahmin Başarısını Etkileyebilir Jing Huang, Leyan Wang, Lu Chen, He Qun, Xu Yajing, Chen Fangping, Zhao Xielan Xiangya Hospital, Central South University, Department of Hematology, Changsha, China

Abstract

Öz

Objective: Previous studies compared the predictive ability of the European Treatment Outcome Study (EUTOS), Sokal, and Hasford scoring systems and demonstrated inconsistent findings with unknown reasons. This study was conducted to determine a useful scoring system to predict the prognosis of patients with chronic myeloid leukemia (CML) and identify the probable factors that affect the scoring. Materials and Methods: This is a retrospective cohort study. The predictive ability of EUTOS and the factors that affect scoring were analyzed in 234 Chinese chronic-phase CML patients treated with frontline imatinib, including a few patients temporarily administered hydroxyurea for cytoreduction before imatinib. Patients were stratified into different risk groups according to each scoring system to assess the treatment outcomes and the predictive ability of EUTOS scores between patients who received imatinib during the entire followup period and patients who received altered treatment because of intolerance, progression, and treatment failure. Results: Sixty-one (26.0%) patients received altered treatments during the follow-up. In the EUTOS low- and high-risk groups, the 5-year overall survival was 94.6% and 84.7% (p=0.011), 5-year eventfree survival was 92.6% and 77.6% (p=0.001), and 5-year progressionfree survival (PFS) was 95.3% and 82.4% (p=0.001), respectively. The predictive ability of EUTOS was better than that of the Sokal and Hasford scores (p=0.256, p=0.062, p=0.073) without statistical significance. All three scoring systems were valid in predicting early optimal response. Kaplan-Meier analysis showed a high association between overall PFS and the EUTOS scores in the standard-dose imatinib group (p<0.001). Conclusion: This study suggests that the EUTOS scoring system could predict the outcome of chronic-phase CML patients treated with standard-dose imatinib. Altered treatment is a crucial factor that affects the prognostic impact of EUTOS scoring. Achieving complete cytogenetic response at 18 months is an essential factor in predicting the prognosis of patients with CML. Keywords: Imatinib, Sokal score, Hasford score, European Treatment Outcome Study Score

Amaç: Avrupa Tedavi İzlem Çalışması (EUTOS), Sokal ve Hasford skorlamalarının öngörüsel tahmin başarılarının karşılaştırıldığı çalışmalarda bilinmeyen nedenlerle tutarsız bulgular görülmektedir. Bu çalışma, kronik miyeloid lösemi (KML) hastalarının prognozunu tahmin edecek yararlı bir skorlama sistemi bulma ve skorlamayı etkileyen muhtemel faktörleri ortaya çıkartmak amacıyla yapılmıştır. Gereç ve Yöntemler: Bu çalışma geriye dönük hasta grubunda yapılmıştır. İmatinib tedavisi gören 234 Çinli kronik faz KML hastasında (birkaç hasta imatinib tedavisi öncesi kısa süreli hidroksiüre tedavisi almıştır) EUTOS tahmin skorları ve bu skorlamayı etkileyen faktörler incelenmiştir. Tedavi çıktılarını ve EUTOS skorlarının tahmin başarısını belirlemek amacıyla tüm izlem boyunca imatinib alan ve intolerans, ilerleme ya da tedavi başarısızlığı gibi nedenlerle farklı tedaviler alan hastalar, her skorlama sistemine göre değişik risk gruplarında sınıflandırılmıştır. Bulgular: Takip sürecinde hastaların 61 tanesinde (%26) tedavi değişikliği olmuştur. EUTOS düşük ve yüksek risk gruplarında 5 yıllık genel sağkalım sırasıyla %94,6 ve %84,7 (p=0,011), hastalıksız sağkalım %95,3 ve %82,4 (p=0,001) ve progresyonsuz sağkalım %95,3 ve %77,6 (p=0,001) olarak bulunmuştur. EUTOS tahminleri, istatistiksel olarak anlamlı olmamakla beraber, Sokal ve Hasford skorlarından daha iyi görülmektedir (p=0,256, p=0,062, p=0,073). Her üç skorlama da erken optimal yanıtın değerlendirmesinde geçerli görülmektedir. KaplanMeier analizleri, standart doz imatinib kullanılan gruplarda, genel progresyonsuz sağkalım ve EUTOS skorları arasında yüksek anlamlılıkta bir ilişki göstermektedir (p<0,001). Sonuç: Bu çalışma EUTOS skorlama tahmin sisteminin, standart-doz imatinib ile tedavi edilen kronik faz KML hastalarının yanıtlarının değerlendirmesinde uygun olduğunu göstermektedir. Tedavi değişikliği, EUTOS skorlamasının prognostik değerlendirme sonucunu etkileyen önemli bir faktördür. KML hastalarının prognoz tahminleri etkileyen bir diğer önemli faktör de 18. ayda tam sitogenetik yanıta ulaşılmasıdır. Anahtar Sözcükler: İmatinib, Sokal skoru, Hasford skoru, Avrupa Tedavi İzlem Çalışması skoru

Address for Correspondence/Yazışma Adresi: Zhao XIELAN, M.D., Xiangya Hospital, Central South University, Department of Hematology, Changsha, China Phone : +8673184896157 E-mail : zhaoxuelan@yahoo.com

Received/Geliş tarihi: April 20, 2016 Accepted/Kabul tarihi: August 07, 2016

Turk J Hematol 2017;34:10-15

Huang J, et al: Predictive Ability of the European Treatment Outcome Study

Introduction

with a score greater than 1.2 were assigned to the high Sokal risk group [11]. The Hasford score was calculated as follows: 0.666 (when age >50 years) + (0.042×spleen size) + 1.0956 (when platelet count >1500×109/L) + (0.0584×blast cell count) + 0.20399 (when basophil count >3%) + (0.0413×eosinophil count) × 100. Patients with a score of less than 780 were assigned to the low Hasford risk group, patients with a score from 781 to 1480 were assigned to the intermediate Hasford risk group, and patients with a score higher than 1480 were assigned to the high Hasford risk group [12]. The EUTOS score was calculated as follows: (7×basophil count) + (4×spleen size), where the spleen was measured in centimeters below the costal margin and basophils as a percentage rate. Patients with a EUTOS score higher than 87 were assigned to the high EUTOS risk group, while patients with a EUTOS score of less than or equal to 87 were assigned to the low EUTOS risk group [10].

As the firstline treatment for chronic myeloid leukemia (CML), imatinib is widely used after diagnosis and dramatically improves the overall survival (OS) of CML patients [1]. Predicting the prognosis is significant for the management of CML patients. Currently, the European Treatment Outcome Study (EUTOS), Hasford, and Sokal prognostic scoring systems are used for predicting the prognosis of CML patients [2,3,4]. The EUTOS scoring system is a novel prognostic scoring system that challenges the conventional Sokal and Hasford scoring systems in predicting the outcome of CML patients. However, recent studies examining the effectiveness of the EUTOS scoring system in predicting the prognosis of CML patients showed controversial results. For example, several studies from different regions of the world compared the clinical significance of the three prognostic scoring systems. Five studies found that EUTOS was better than the Hasford and Sokal systems in predicting the prognosis of CML patients [1,2,3,5,6]. In contrast, 3 studies showed that the EUTOS score does not predict prognosis in CML patients [7,8,9]. It is currently unknown what factors caused these controversial findings. The purpose of this study was to compare the predictive ability of the Sokal, Hasford, and EUTOS prognostic scoring systems by stratifying CML-chronic-phase (CP) patients who received firstline imatinib mesylate at diagnosis into different risk groups. The possible factors that affect the prognostic ability of EUTOS were further explored according to the three scoring systems.

Materials and Methods Patients A total of 234 CML-CP patients (162 males, 72 females) who received imatinib mesylate (Novartis Oncology, Novartis Pharma Stein AG, Stein, Switzerland) treatment within 6 months of diagnosis at X Hospital between January 2004 and July 2014 were recruited for this study. CML-CP was diagnosed according to published diagnostic criteria [10], and all patients were treated with a standard dose of imatinib (400 mg/day) over 3 months. No other treatment was given, except for hydroxyurea temporarily administered for cytoreduction before imatinib in 9 patients. Calculations of the Chronic Myeloid Leukemia Prognostic Indexes The Sokal score was calculated using the following formula: Exp 0.0116 × (age in years-43.4) + 0.0345 × (spleen size-7.51) + 0.188 × [(platelet count/700)2-0.563] + 0.0887 × (blast cells-2.10). Patients with a score of less than 0.8 were assigned to the low Sokal risk group, patients with a score from 0.8 to 1.2 were assigned to the intermediate Sokal risk group, and patients

Definitions OS: the length of time from the date of diagnosis to the date of death or final follow-up (1 July 2014). Event-free survival (EFS): the length of time from the date of initiating imatinib therapy to the date of failure according to the European Leukemia Net criteria, the date of stopping treatment due to imatinib intolerance, or the date of last follow-up in patients whose treatments did not fail [13]. Progression-free survival (PFS): the length of time from the date of imatinib therapy initiation to the date of progression to accelerated phase (AP)/blastic phase (BP) or to the date of death. Complete cytogenetic response (CCyR): no Philadelphia chromosome was detected in the patient by G-banding analysis of bone marrow and no Philadelphia cell was detected in the patient when using fluorescence in situ hybridization analysis of peripheral blood. Partial cytogenetic response (PCyR): 1%-35% Philadelphia chromosome in a patient’s bone marrow. Major molecular response (MMR): the achievement of ≥3 logs reduction in BCR-ABL mRNA from the standardized baseline [14,15,16,17]. Statistical Analysis Data were analyzed using SPSS 17.0 (SPSS Inc., Chicago, IL, USA). Normally distributed continuous variables were presented as mean ± standard deviation, and non-normally distributed continuous variables were presented as medians with interquartile ranges. Kaplan-Meier methods and log rank tests were applied to analyze the time-to-event data. The 5-year EFS, PFS, and OS and the cumulative incidence of PCyR, CCyR, 11

Huang J, et al: Predictive Ability of the European Treatment Outcome Study

Turk J Hematol 2017;34:10-15

and MMR were compared using the chi-square test. A value of p<0.05 was considered statistically significant.

Results Baseline Characteristics The mean age at diagnosis was 40.3±13.2 years. Median followup duration of imatinib treatment was 20.5 months (range: 9-120 months) months. The median duration from diagnosis of CML to imatinib initiation was 19 (range: 6-115) days. The CCyR rates at 12 months and 18 months were 56.4% and 65.4%, respectively. According to the EUTOS scoring system, 149 patients (63.7%) were classified as low-risk and 85 patients (36.3%) were classified as high-risk. Using the Sokal scoring system, 66, 70, and 98 patients were classified into low-, intermediate-, and high-risk groups, while 94, 93, and 47 patients were classified into low-, intermediate-, and high-risk groups when the Hasford scoring system was used. The baseline characteristics of patients with CML-CP are shown in Table 1. Outcomes The 5-year OS, EFS, and PFS of the 234 patients were 91.0%, 87.2%, and 90.6%, respectively. The 5-year OS, EFS, and PFS were 94.6% and 84.7% (p=0.011), 92.6% and 77.6% (p=0.001), and 95.3% and 82.4% (p=0.001) for low and high EUTOS risk groups, respectively. Significant differences in 5-year OS, EFS, and PFS were observed between the low EUTOS and high EUTOS risk groups. However, there were no significant differences between groups classified by the Sokal (p=0.137, p=0.106, p=0.110, respectively) and Hasford (p=0.256, p=0.062, p=0.073, respectively) prognostic scoring systems. Moreover, KaplanMeier analysis of OS, EFS, and PFS showed significant differences between the low and high EUTOS risk groups (p<0.001, p<0.001, p<0.001) (Figure 1), but no significant difference was

Figure 1. Overall survival, event-free survival, and progressionfree survival using the European Treatment Outcome Study score system. There was a significant difference in overall survival (A), event-free survival (B), and progression-free survival (C) between the risk groups (p<0.001, p<0.001, p<0.001). EUTOS: European Treatment Outcome Study, OS: overall survival, EFS: event-free survival, PFS: progression-free survival.

Table 1. Clinical characteristics of patients at diagnosis (n=234). Clinical Characteristics

Median (Range)

WBC (/µL)

167,550.0 (6900.0-638,200.0)

Platelet count (/µL)

459,830.0 (68,000.0-1,515,000.0)

Basophils (%)

3.8 (0.0-19.3)

Spleen size (centimeters below the costal margin)

8.0 (0.0-24.0)

Clinical characteristics

Mean±standard deviation

Age (years)

40.3±13.2

Hemoglobin (g/dL)

107.4±22.5

Eosinophils (%)

2.3±2.2

According to the normality test, the statistics of age, hemoglobin, and Eosinophils corresponded to a normal distribution, while white blood cells, platelet cells, blasts, basophils, and spleen size corresponded to a non-normal distribution. WBC: White blood cell.

Turk J Hematol 2017;34:10-15

Huang J, et al: Predictive Ability of the European Treatment Outcome Study

found between Sokal groups (p=0.335, p=0.123, p=0.170 for low, intermediate-, and high-risk groups) or Hasford groups (p=0.135, p=0.057, p=0.052 for low-, intermediate-, and highrisk groups).

There were significant differences in 5-year OS between low and high EUTOS risk score groups in patients that received standard-dose imatinib treatment (97.5% and 89.1%, p=0.03), whereas it was not different in the patients who received altered treatments (83.9% and 76.7%, p=0.479). Furthermore, KaplanMeier analysis showed a high association between overall PFS and EUTOS scores in patients who received standard-dose imatinib treatment (p<0.001), but no significant correlation in patients who received altered treatment (p=0.246) (Figure 2).

The overall rates of PCyR at 3 months, CCyR at 12 months and 18 months, and MMR at 18 months for all CML patients were 18.4%, 56.4%, 65.4%, and 46.2%, respectively. Furthermore, 131 patients (87.9%) and 22 patients (25.9%) achieved CCyR at 18 months in the low and high EUTOS risk groups (p<0.001); 60 patients (90.9%), 59 patients (84.3%), and 34 patients (34.7%) achieved CCyR at 18 months in the low, intermediate, and high Sokal risk groups (p<0.001), respectively; and 84 (89.4%), 57 (61.3%), and 12 patients (25.5%) achieved CCyR at 18 months in the low, intermediate, and high Hasford risk groups (p<0.001), respectively. As shown in Table 2, PCyR was significantly validated at 3 months in all 3 prognostic scoring systems (p<0.001), CCyR was significantly validated at 12 months and 18 months (p<0.001), and MMR was significantly validated at 18 months in all 3 prognostic scoring systems (p<0.001). Overall, of the 234 CML-CP patients, 173 patients (73.9%) were treated with the standard dose (400 mg) of imatinib, while 61 patients (26.0%) received altered treatments because of intolerance, progression, or treatment failure. The rates of 5-year PFS were 97.5% and 87.3% (p=0.012) for patients treated with standard-dose imatinib in the EUTOS low-risk (118, 68.2%) and high-risk (55, 31.7%) groups, but only 87.1% and 73.3% (p=0.176) for patients who received altered treatments in low (31, 50.8%) and high EUTOS risk groups (30, 49.1%), respectively.

Discussion Previous studies presented controversial findings on whether EUTOS is more useful in predicting the survival of CML patients than the Sokal and Hasford scoring systems. This study demonstrated that the EUTOS, Hasford, and Sokal scoring systems were all effective in predicting early optimal response (PCyR at 3 months, CCyR at 12 months and 18 months, and MMR at 18 months) in CML-CP patients who were treated with imatinib as frontline therapy, but the EUTOS scoring system was more effective as a prognostic indicator of OS, EFS, and PFS than the Sokal and Hasford scoring systems. A novel finding in this study is that altered treatment is a key factor that affects the prognostic ability of the EUTOS scoring system. Among the 3 studies not supporting the predictive effect of EUTOS in the prognosis of CML patients [7,8,9], 33.6% of 282 CML-CP patients in the study of Marin et al. were treated with imatinib as frontline therapy, but the treatment was changed to a second-generation tyrosine kinase inhibitor (2nd TKI) [9]. In the study of Jabbour et al. [8], 84.7% of 465 CML-CP patients were

Table 2. Comparison of Sokal, Hasford, and European Treatment Outcome Study scores for curative effects.

n (%)

3m-PCyR (%)

12m-CCyR (%)

18m-CCyR (%)

18m-MMR (%)

EUTOS

p<0.001

Low

149 (63.7)

26.2

75.8

87.9

63.8

High

85 (36.3)

4.7

22.4

25.9

15.3

Sokal

p<0.001

Low

66 (28.2)

36.4

86.4

90.9

72.7

Intermediate

70 (29.9)

21.4

62.9

84.3

58.6

High

98 (41.9)

4.1

31.6

34.7

19.4

Hasford

p<0.001

Low

94 (40.2)

31.9

76.6

89.4

63.8

Intermediate

93 (39.7)

14.0

51.6

61.3

41.9

High

47 (20.1)

25.5

19.1

All patients

234 (100)

18.4

56.4

65.4

46.2

3m-PCyR: Partial cytogenetic response at 3 months, 12m-CCyR and 18m-CCyR: complete cytogenetic response at 12 and 18 months, 18m-MMR: major molecular response at 18 months, EUTOS: European Treatment and Outcome Study.

Huang J, et al: Predictive Ability of the European Treatment Outcome Study

Turk J Hematol 2017;34:10-15

a positive effect of EUTOS, but lower than that of studies supporting a negative effect. In this study, we found that 5-year PFS and OS had no significant correlations with EUTOS scores in patients who received altered treatments, but they were significantly associated with EUTOS scores in patients without altered treatments. Thus, changing treatment may be a key factor that affects the predictive ability of EUTOS. In addition, the percentage of patients in the high EUTOS risk group was small in the three negative studies (11.2% in the Marin et al. [9] study, 8% in the Jabbour et al. [8] study, and 11% in the Yamamoto et al. [7] study), while it was high (36.3%) in the present study. We propose that the small number of patients in the high-risk group in the three negative studies may have caused a bias.

Figure 2. Progression-free survival using European Treatment Outcome Study score for chronic myeloid leukemia-chronicphase patients who received imatinib or altered treatment. (A) Progression-free survival using European Treatment Outcome Study score for chronic myeloid leukemia-chronic-phase patients treated with standard-dose imatinib. There was a significant difference between the risk groups (p<0.001). (B) Progressionfree survival using European Treatment Outcome Study score for chronic myeloid leukemia-chronic-phase patients who received altered treatment. There was no significant difference between the risk groups (p=0.246). treated with high-dose imatinib (44.7%) and a 2nd TKI (40%) at diagnosis. In the study of Yamamoto et al., poor patient adherence to imatinib therapy was mentioned [7]. Among the studies supporting a positive effect of EUTOS in predicting the prognosis of CML patients, only 21.0% of 1288 CML patients in the study of Hoffmann et al. [18] and 25.0% of 2060 patients in the study of Hasford et al. [6] received high-dose imatinib (600-800 mg), while no patients received 2nd TKI therapy. In this study, 26.0% patients received altered treatment during followup (20.5% received low-dose imatinib; 5.5% were switched to a 2nd TKI). The percentage of patients receiving altered treatments in our study is comparable to those of the studies supporting 14

The end-points for assessment of the EUTOS scoring system may also influence the conclusions. The majority of previous studies analyzed the overall CCyR, but only 3 reports [6,7,18] assessed CCyR at 18 months. In this study, the OS, EFS, and PFS were evaluated as long-term response, while PCyR at 3 months, CCyR at 12 months and 18 months, and MMR at 18 months were evaluated as early optimal response according to the 2013 National Comprehensive Cancer Network guidelines. This study demonstrated that the rates of 5-year PFS in patients achieving CCyR at 18 months was significantly higher than that in patients not achieving CCyR at 18 months (99.3% vs. 74.1%, p<0.001). Therefore, CML patients who did not achieve CCyR at 18 months were more likely to progress AP/BP or death and CCyR at 18 months should be considered as an essential end-point to assess the survival of CML patients.

Conclusion In conclusion, the EUTOS prognostic scoring system is an effective prognostic tool in assessing the outcome of CML-CP patients who were treated with standard-dose imatinib. Altered treatment should be considered as a key factor when using the EUTOS scoring system. CCyR at 18 months during therapy is an essential end-point to assess the survival of CML-CP patients. Our findings may have important clinical implications, but they should be confirmed in a larger cohort and validated in a prospective observational study. Acknowledgments We are thankful to Fu Bin for revising the manuscript. This work did not receive any specific grant from any funding agency in the public, commercial, or not-for-profit sector. Ethics Ethics Committee Approval: This is a retrospective cohort study; Informed Consent:Â This is a retrospective cohort study.

Turk J Hematol 2017;34:10-15

Huang J, et al: Predictive Ability of the European Treatment Outcome Study

Authorship Contributions

9. Marin D, Ibrahim AR, Goldman JM. European Treatment and Outcome Study (EUTOS) score for chronic myeloid leukemia still requires more confirmation. J Clin Oncol 2011;29:3944-3945.

Concept: Zhao Xielan; Design: Zhao Xielan; Data Collection or Processing: Jing Huang, Leyan Wang, Lu Chen, He Qun, Xu Yajing, Chen Fangping, Zhao Xielan; Analysis or Interpretation: Jing Huang, Leyan Wang, Lu Chen, He Qun, Xu Yajing, Chen Fangping, Zhao Xielan; Literature Search: Jing Huang; Writing: Jing Huang. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Yahng SA, Jang EJ, Choi SY, Lee SE, Kim SH, Kim DW. Prognostic discrimination for early chronic phase chronic myeloid leukemia in imatinib era: comparison of Sokal, Euro, and EUTOS scores in Korean population. Int J Hematol 2014;100:132-140. 2. Tao Z, Liu B, Zhao Y, Wang Y, Zhang R, Han M, Zhang L, Li C, Ru K, Mi Y, Wang J. EUTOS score predicts survival and cytogenetic response in patients with chronic phase chronic myeloid leukemia treated with first-line imatinib. Leuk Res 2014;38:1030-1035. 3. Bonifacio M, Binotto G, Calistri E, Maino E, Tiribelli M; Gruppo Triveneto LMC. EUTOS score predicts early optimal response to imatinib according to the revised 2013 ELN recommendations. Ann Hematol 2014;93:163-164. 4. Uz B, Buyukasik Y, Atay H, Kelkitli E, Turgut M, Bektas O, Eliacik E, Isik A, Aksu S, Goker H, Sayinalp N, Ozcebe OI, Haznedaroglu IC. EUTOS CML prognostic scoring system predicts ELN-based ‘event-free survival’ better than Euro/Hasford and Sokal systems in CML patients receiving front-line imatinib mesylate. Hematology 2013;18:247-252. 5. Hoffmann V, Baccarani M, Hasford J, Guilhot J, Saussele S, Rosti G, Guilhot F, Porkka K, Ossenkoppele G, Lindoerfer D, Simonsson B, Pfirrmann M, Hehlmann R. The EUTOS CML score aims to support clinical decisionmaking. Blood 2012;119:2966-2967. 6. Hasford J, Baccarani M, Hoffmann V, Guilhot J, Saussele S, Rosti G, Guilhot F, Porkka K, Ossenkoppele G, Lindoerfer D, Simonsson B, Pfirrmann M, Hehlmann R. Predicting complete cytogenetic response and subsequent progression-free survival in 2060 patients with CML on imatinib treatment: the EUTOS score. Blood 2011;118:686-692. 7. Yamamoto E, Fujisawa S, Hagihara M, Tanaka M, Fujimaki K, Kishimoto K, Hashimoto C, Itabashi M, Ishibashi D, Nakajima Y, Tachibana T, Kawasaki R, Kuwabara H, Koharazawa H, Yamazaki E, Tomita N, Sakai R, Fujita H, Kanamori H, Ishigatsubo Y. European Treatment and Outcome Study score does not predict imatinib treatment response and outcome in chronic myeloid leukemia patients. Cancer Sci 2014;105:105-109. 8. Jabbour E, Cortes J, Nazha A, O’Brien S, Quintas-Cardama A, Pierce S, Garcia-Manero G, Kantarjian H. EUTOS score is not predictive for survival and outcome in patients with early chronic phase chronic myeloid leukemia treated with tyrosine kinase inhibitors: a single institution experience. Blood 2012;119:4524-4526.

10. Kantarjian HM, Talpaz M, O’Brien S, Smith TL, Giles FJ, Faderl S, Thomas DA, Garcia-Manero G, Issa JP, Andreeff M, Kornblau SM, Koller C, Beran M, Keating M, Rios MB, Shan J, Resta D, Capdeville R, Hayes K, Albitar M, Freireich EJ, Cortes JE. Imatinib mesylate for Philadelphia chromosomepositive, chronic-phase myeloid leukemia after failure of interferon-alpha: follow-up results. Clin Cancer Res 2002;8:2177-2187. 11. Sokal JE, Cox EB, Baccarani M, Tura S, Gomez GA, Robertson JE, Tso CY, Braun TJ, Clarkson BD, Cervantes F, Rozman C; Italian Cooperative CML Study Group. Prognostic discrimination in “good-risk” chronic granulocytic leukemia. Blood 1984;63:789-799. 12. Hasford J, Pfirrmann M, Hehlmann R, Allan NC, Baccarani M, Kluin-Nelemans JC, Alimena G, Steegmann JL, Ansari H. A new prognostic score for survival of patients with chronic myeloid leukemia treated with interferon alfa. Writing Committee for the Collaborative CML Prognostic Factors Project Group. J Natl Cancer Inst 1998;90:850-858. 13. Baccarani M, Cortes J, Pane F, Niederwieser D, Saglio G, Apperley J, Cervantes F, Deininger M, Gratwohl A, Guilhot F, Hochhaus A, Horowitz M, Hughes T, Kantarjian H, Larson R, Radich J, Simonsson B, Silver RT, Goldman J, Hehlmann R; European LeukemiaNet. Chronic myeloid leukemia: an update of concepts and management recommendations of European LeukemiaNet. J Clin Oncol 2009;27:6041-6051. 14. Ohnishi K, Nakaseko C, Takeuchi J, Fujisawa S, Nagai T, Yamazaki H, Tauchi T, Imai K, Mori N, Yagasaki F, Maeda Y, Usui N, Miyazaki Y, Miyamura K, Kiyoi H, Ohtake S, Naoe T; Japan Adult Leukemia Study Group. Long-term outcome following imatinib therapy for chronic myelogenous leukemia, with assessment of dosage and blood levels: the JALSG CML202 study. Cancer Sci 2012;103:1071-1078. 15. Yagasaki F, Niwa T, Abe A, Ishikawa M, Kato C, Ogura K, Sasaki H, Kyo T, Jinnai I, Bessyo M, Miyamura K. Correlation of quantification of major bcrabl mRNA between TMA (transcription mediated amplification) method and real-time quantitative PCR. Rinsho Ketsueki 2009;50:481-487 (in Japanese with English abstract). 16. O’Brien SG, Guilhot F, Larson RA, Gathmann I, Baccarani M, Cervantes F, Cornelissen JJ, Fischer T, Hochhaus A, Hughes T, Lechner K, Nielsen JL, Rousselot P, Reiffers J, Saglio G, Shepherd J, Simonsson B, Gratwohl A, Goldman JM, Kantarjian H, Taylor K, Verhoef G, Bolton AE, Capdeville R, Druker BJ; IRIS Investigators. Imatinib compared with interferon and low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid leukemia. N Engl J Med 2003;348:994-1004. 17. Langabeer SE, Gale RE, Harvey RC, Cook RW, Mackinnon S, Linch DC. Transcription-mediated amplification and hybridisation protection assay to determine BCR-ABL transcript levels in patients with chronic myeloid leukaemia. Leukemia 2002;16:393-399. 18. Hoffmann VS, Baccarani M, Lindoerfer D, Castagnetti F, Turkina A, Zaritsky A, Hellmann A, Prejzner W, Steegmann JL, Mayer J, Indrak K, Colita A, Rosti G, Pfirrmann M. The EUTOS prognostic score: review and validation in 1288 patients with CML treated frontline with imatinib. Leukemia 2013;27:20162022.

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0346 Turk J Hematol 2017;34:16-26

Allogeneic Transplantation in Chronic Myeloid Leukemia and the Effect of Tyrosine Kinase Inhibitors on Survival: A Quasi-Experimental Study Kronik Myeloit Lösemide Allojenik Nakil ve Tirozin Kinaz İnhibitörlerinin Sağkalıma Etkisi Bir Öncesi-Sonrası Çalışması Mehmet Özen1, Celalettin Üstün2, Bengi Öztürk3, Pervin Topçuoğlu1, Mutlu Arat4, Mehmet Gündüz1, Erden Atilla1, Gülşen Bolat1, Önder Arslan1, Taner Demirer1, Hamdi Akan1, Osman İlhan1, Meral Beksaç1, Günhan Gürman1, Muhit Özcan1 1Ankara University Faculty of Medicine, Department of Hematology and Bone Marrow Transplantation Unit, Ankara, Turkey 2University of Minnesota, Department of Medicine, Division of Hematology-Oncology and Transplantation, Minneapolis, USA 3Ankara University Faculty of Medicine, Department of Internal Medicine, Ankara, Turkey 4Şişli Florence Nightingale Hospital, Clinic of Hematology, İstanbul, Turkey

Abstract

Öz

Objective: Tyrosine kinase inhibitors (TKIs) have changed the indications for allogeneic hematopoietic stem cell transplantation (allo-HSCT) in chronic myeloid leukemia (CML). Therefore, we aimed to evaluate the effect of TKIs on allo-HSCT in CML. Materials and Methods: In this quasi-experimental study, we compared patient, disease, and transplantation characteristics as well as allo-HSCT outcomes between the pre-TKI era (before 2002) and the post-TKI era (2002 and later) in patients with CML. A total of 193 alloHSCTs were performed between 1989 and 2012. Results: Patients in the post-TKI era had more advanced disease (>chronic phase 1) at the time of transplant and more frequently received reduced-intensity conditioning compared to patients in the pre-TKI era. Relapse/progression occurred more frequently in the year ≥2002 group than in the year <2002 group (48% vs. 32% at 5 years, p=0.01); however, overall survival (OS) was similar in these two groups (5-year survival was 50.8% vs. 59.5%, respectively; p=0.3). TKIs (with donor lymphocyte infusions or alone) for treatment of relapse after allo-HSCT were available in the post-TKI era and were associated with improved OS. While the rates of hematologic remission at 3 months after allo-HSCT were similar between TKI eras, patients having remission had better disease-free survival (DFS) [relative risk (RR): 0.15, confidence interval (CI) 95%: 0.09-0.24, p<0.001] and OS (RR: 0.14, CI 95%: 0.09-0.23, p<0.001). Male allo-HSCT recipients had worse DFS (RR: 1.7, CI 95%: 1.2-2.5, p=0.007) and OS (RR: 1.7, CI 95%: 1.1-2.6, p=0.02) than females. Conclusion: TKIs are an effective option for the treatment of relapse after allo-HSCT in CML. Hematologic remission after allo-HSCT is also an important factor for survival in CML patients. Keywords: Chronic myeloid leukemia, Allogeneic transplantation, Tyrosine kinase inhibitors, Hematologic remission

Amaç: Tirozin kinaz inhibitörleri (TKİ) kronik myeloid lösemide (KML) allojenik hematopoetik kök hücre nakli (AHKHN) endikasyonlarını değiştirdi. Bu nedenle de biz KML’de TKİ’nin AHKHN üzerine etkisini değerlendirmeyi amaçladık. Gereç ve Yöntemler: Bu öncesi-sonrası çalışmasında KML’li hastalarda TKİ öncesi dönem (yıl <2002) ve TKİ sonrası dönem (yıl ≥2002) arasında hasta, hastalık ve nakil karakteristikleri ile AHKHN sonuçlarını kıyasladık. Toplamda 193 AHKHN, 1989 ve 2012 arasında yapıldı. Bulgular: TKİ sonrası dönemdeki hastalar, TKİ öncesi döneme göre nakil sırasında daha ileri hastalığa (kronik faz 1’den ileri) sahipti ve daha sık azaltılmış yoğunluklu hazırlık rejimi aldı. Relaps/progresyon ≥2002 grupta <2002 grubundan daha fazlaydı (5 yıllık %32’ye karşın %48; p=0,01); bununla birlikte toplam sağkalım (TS) bu iki grupta benzerdi (5-yıllık-sağkalım sırasıyla %50,8’e karşın %59,5; p=0,3). TKİ tedavisi (verici lenfosit infüzyonu ile birlikte veya tek başına) AHKHN sonrası relaps tedavisinde TKİ sonrası dönemde mevcuttu ve artmış TS ile ilişkiliydi. AHKHN sonrası 3. aydaki hematolojik remisyon oranları TKİ dönemleri arasında benzer iken; remisyonda olan hastalar daha iyi hastalıksız sağkalıma (HsS) [Göreceli risk (GR): 0,15; %95 güven aralığı (GA): 0,09-0,24; p<0,001] ve TS’ye sahipti (GR: 0,14; %95 GA: 0,090,23; p<0,001). Erkek AHKHN alıcılarının HsS (GR: 1,7; %95 GA: 1,22,5; p=0,007) ve TS’leri (GR: 1,7; %95 GA: 1,1-2,6; p=0,02) kadınlardan daha kötüydü. Sonuç: TKİ, KML’de AHKHN sonrası relapsın tedavisinde etkin bir seçenektir. AHKHN sonrası hematolojik remisyon da KML hastalarında sağkalımda önemli bir faktördür. Anahtar Sözcükler: Kronik miyeloid lösemi, Allojenik transplantasyon, Tirozin kinaz inhibitörleri, Hematolojik remisyon

Address for Correspondence/Yazışma Adresi: Muhit ÖZCAN, M.D., Received/Geliş tarihi: October 04, 2015 Ankara University Faculty of Medicine, Department of Hematology and Bone Marrow Transplantation Unit, Ankara, Turkey Accepted/Kabul tarihi: November 30, 2015 Phone : +90-312-466 3550 E-mail : ozcan@hemoterapi.com, muhit.ozcan@medicine.ankara.edu.tr

Turk J Hematol 2017;34:16-26

Introduction Chronic myeloid leukemia (CML) is a clonal disease that originates from a translocation between chromosomes 9 and 22 (Philadelphia chromosome). This translocation fuses ABL1 at 9q34 with BCR at 22q11.2, resulting in a chimeric gene that encodes an abnormal fusion protein. Before the discovery of tyrosine kinase inhibitors (TKIs), the median survival of CML patients in the blastic (BP), accelerated (AP), and chronic (CP) phases of disease who did not undergo transplant was 4-6 months, 1-1.5 years, and 3-8 years, respectively [1]. The only curative therapeutic option for CML was allogeneic hematopoietic stem cell transplantation (allo-HSCT), and all CML patients who had suitable human leukocyte antigen (HLA)-matched donors were considered candidates for allo-HSCT until 2002 [2]. It has been shown that imatinib treatment is superior to interferon alpha and low-dose cytarabine treatments in patients with CML [3], and later, TKI treatment was shown to result in long-term hematologic, cytogenetic, and molecular remission [4,5,6]. Therefore, the therapeutic landscape for CML has changed, and TKIs have become the first-line treatment for patients with CML. In 2002, TKIs became available for CML patients in Turkey [7,8]. Since 2002, allo-HSCT has remained the only proven curative option for CML, but it is currently indicated only for patients who have failed to respond to TKIs, those who have mutations associated with TKI resistance (e.g., T315I), and those who are intolerant to TKIs [8,9]. Although the discovery of TKIs has changed the indications for allo-HSCT in CML patients, allo-HSCT outcomes may have also been affected by the year of allo-HSCT due to the development of more successful transplantation techniques and supportive treatment options [10]. TKIs may also be used after allo-HSCT to treat relapse after transplantation in CML patients. Therefore, in this retrospective study, we compared allo-HSCT outcomes as well as patient, disease, and transplantation characteristics in the pre- and post-TKI eras and pretransplant TKI usage, posttransplant therapeutic TKI usage, and rates of reaching hematologic complete remission (CR) at 3 months in patients with CML.

Materials and Methods We conducted this study after it was approved by the institutional ethics committee. A total of 188 CML patients underwent 193 allo-HSCTs (a second allo-HSCT was performed for five patients) at the Ankara University Department of Hematology and Bone Marrow Transplantation Unit between 1989 and 2012. CML clinical phases were defined according to the 2008 WHO criteria [11]. For this study, we defined the advanced phase as any phase other than CP1 (e.g., >chronic phase 1 (>CP1), AP, or BP). The majority of CML patients in the AP or BP of disease received

Ă&#x2013;zen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia

acute myelogenous leukemia-type induction regimens before undergoing allo-HSCT. We divided the patients into 2 groups: patients receiving alloHSCT before TKIs were available (the pre-TKI era group, before 2002, n=128) and patients receiving allo-HSCT after TKIs were available (the post-TKI era group, 2002 and after, n=65) (Supplement 1). In the post-TKI era, 48 of 65 patients (73%) received TKIs before allo-HSCT. We also evaluated these patients separately with regards to TKI effect on survival with two groups, a TKI-using group and a group not using TKIs, to differentiate the effect of pretransplant TKIs on allo-HSCT (Supplement 1). Details about conditioning regimen, HLA matching status, graft-versus-host disease (GVHD) prophylaxis, definition and treatment of relapse, and supportive therapy are given in Supplement 1. Statistical Analysis Numeric variables are presented as medians. Categorical variables were compared by the chi-square test or Fisher exact test. The nonparametric Mann-Whitney U test was used for noncategorical variables. GVHD was considered a categorical variable. Relapse and transplant-related mortality rates were calculated as time-dependent variables. Overall survival (OS) and disease-free survival (DFS) were calculated from the date of allo-HSCT. OS after relapse was calculated from the date of relapse. The distributions of OS and DFS durations in the two groups were estimated using the Kaplan-Meier method and compared using the log-rank test. Recipient age, recipient sex, donor sex, stem cell source, conditioning regimen intensity, CML clinical phase, hematologic remission 3 months after allo-HSCT, and time from diagnosis to transplant were included in the multivariate analyses of survival. Logistical regression and a Cox model were used for risk factor analysis in DFS and OS. All reported p-values were two-sided, and p<0.05 was considered significant. Statistical analyses were performed using SPSS 16.0.

Results Before 2002, allo-HSCT was performed in 321 patients, 128 of whom (40%) had CML. Between 2002 and 2006, allo-HSCT was performed in 581 patients, 65 of whom (11%) had CML (p<0.001). After 2007, the frequency of CML patients among all patients receiving allo-HSCT further decreased to 5% (n=18/360; p<0.001). The time from diagnosis to transplantation was shorter in the pre-TKI era group than in the post-TKI era group (9.2 months versus 15.8 months, respectively; p<0.001, Table 1). The post17

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia

Turk J Hematol 2017;34:16-26

Table 1. Patient and transplantation characteristics in the pre-tyrosine kinase inhibitor and post-tyrosine kinase inhibitor eras with and without pretransplant tyrosine kinase inhibitor usage. Pre-TKI era (n=128)

Post-TKI era (n=65)

No TKIs used before transplant (n=145)

TKIs used before transplant (n=48)

9.2 (1.6-129)

15.8 (3.3-266)

<0.001

9.0 (1.6-129)

19.0 (4.1-266)

<0.001

34 (14-48)

34 (18-58)

0.3

33 (14-48)

38 (18-58)

0.02

73 (57) 55 (43)

39 (60) 26 (40)

0.7

82 (57) 63 (43)

30 (63) 18 (37)

0.4

118 (92) 10 (8)

43 (66) 22 (34)

<0.001

129 (89) 16 (11)

32 (67) 16 (33)

<0.001

64 (50) 64 (50) 0 (0)

19 (29) 44 (68) 2 (3)

0.009

72 (50) 73 (50) 0 (0)

11 (23) 35 (73) 2 (4)

0.002

4.8±3.5

4.8±2.7

0.5

4.8±3.4

4.9±2.7

0.4

120 (94) 8 (6)

49 (75) 16 (25)

<0.001

131 (90) 14 (10)

38 (79) 10 (21)

0.04

116 (91) 4 (3) 7 (5) 1 (1)

32 (49) 22 (34) 5 (8) 6 (9)

<0.001

129 (89) 5 (3) 10 (7) 1 (1)

19 (40) 21 (44) 2 (4) 6 (12)

<0.001

32 (9-56)

32 (0-65)

0.8

31 (9-56)

36 (0-65)

0.07

72 (56) 56 (44)

34 (52) 31 (48)

0.6

64 (44) 81 (56)

25 (52) 23 (48)

0.6

128 (100) 0 (0)

57 (88) 8 (12)

<0.001

145 (100) 0 (0)

40 (83) 8 (17)

<0.001

Time from diagnosis to transplantation Median (range), months Recipient age Median (range), years Recipient sex Male, n (%) Female, n (%) Intensity of conditioning regimen Ablative, n (%) RIC, n (%) Stem cell source BM, n (%) PB, n (%) CB, n (%) CD34 count in product Mean ± SD, 106/kg GVHD prophylaxis CSA+Mtx, n (%) Others, n (%) Disease status at transplantation 1st CP, n (%) 2nd CP, n (%) AP, n (%) BP, n (%) Donor age Median (range), years Donor sex Male, n (%) Female, n (%) Donor type Related, n (%) Unrelated, n (%)

AP: Accelerated phase, BP: blastic phase, BM: bone marrow, CB: cord blood, CP: chronic phase, CSA: cyclosporine, Mtx: methotrexate, PB: peripheral blood, RIC: reduced-intensity conditioning, SD: standard deviation, TKI: tyrosine kinase inhibitor.

TKI era group more frequently underwent unrelated donor transplantation and received more peripheral blood stem cells (PBSCs); they also more frequently underwent reducedintensity conditioning (RIC) and had more advanced disease (>CP1) (Table 1). Comparing patients for pretransplant TKI usage showed similar results. Patients using pretransplant TKIs had a longer time from diagnosis to transplantation, more unrelated donor transplantation, more received PBSCs, more RIC regimen, and more advanced disease than the group not using TKIs 18

before transplant. The group not using TKIs before transplant also included younger patients than did the group using pretransplant TKIs (Table 1). Rates of reaching hematologic CR at 3 months after allo-HSCT were similar between the pre- and post-TKI eras and between the groups using and not using TKIs before transplant (Table 1). Engraftment, rate of hematologic remission at 3 months after allo-HSCT, rate of sinusoidal obstruction syndrome of the liver,

Ă&#x2013;zen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia

Turk J Hematol 2017;34:16-26

Survival Functions Survival Functions

1.0

0.8

0.6 0.4 0.2

0.0

0.0 0.00

50.00

100.00 150.00 OS_months

200.00

250.00

0.00

Survival Functions

50.00

1.0

0.8

0.6

Cum Survival

Survival Functions Survival Functions

Cum Survival

Cum Survival Cum Survival

0.4 0.2

100.00 150.00 OS_months

200.00

250.00

200.00

250.00

Survival Functions

0.6 0.4 0.2

0.0 0.00

50.00

100.00

150.00

200.00

250.00

DFS_months

0.0 0.00

50.00

100.00 150.00 DFS_months

Figure 1. A. Overall survival in the tyrosine kinase inhibitor era. B. Overall survival in relation to tyrosine kinase inhibitor use. C. Diseasefree survival in the tyrosine kinase inhibitor era. D. Disease-free survival in relation to tyrosine kinase inhibitor use. rate of acute and chronic GVHD, and rate of treatment-related mortality were similar in all groups. Hemorrhagic cystitis was more common in the pre-TKI era group (28.9%) than in the post-TKI era group (13.8%) (p=0.003) and more common in the group not using pretransplant TKIs (27.6%) than in the group using pretransplant TKIs (12.5%) (p=0.01) (Table 2). Outcomes Relapsed/refractory disease after allo-HSCT was observed in 57 patients (relapse in 49 patients and refractory disease in 8 patients). Relapse was more common in the post-TKI era group (Table 2). DFS and OS were similar between the pre- and postTKI era groups and between the groups using and not using TKIs before transplant (Figure 1; Table 2). DFS and OS were also similar in CP1 and AP CML patients between the pre- and post-TKI era groups and between the groups using and not using TKIs before transplant (Table 2). However, pre-TKI patients with disease stage >CP1 had the worst OS rate, and this was significantly different from the OS rates of the other groups of patients (Figure 2). OS after relapse in the post-TKI era group (mean: 94.2 months) was better than that in the pre-TKI era group (mean: 44.4

months). Patients received donor lymphocyte infusion (DLI) or TKIs, DLI plus TKI, or supportive therapy for the treatment of relapse. Most relapses (83%) in the pre-TKI era patients occurred before 2002, during which time TKIs were unavailable. The mean survival rates of patients receiving therapeutic TKI after relapse with DLI (86.8 months) and without DLI (95.5 months) were longer than those for patients receiving DLI alone (58.3 months). Patients who only received supportive treatment had the worst survival (6.5 months) (Table 3). The median OS survival at 5 years after relapse was higher in the post-TKI era patients than in the pre-TKI era patients (respectively 67% vs. 28% in all patients, p=0.003; 83% vs. 32% in patients with CP1 CML, p=0.006; and 53% vs. 0% in patients with advanced disease, p=0.04) (data not shown). Late relapses (9-12 years after allo-HSCT) occurred in 3 patients (one in the post-TKI era group and 2 in the pre-TKI era group). Two of these patients achieved CR with TKI treatment and survived. However, the third patient, who was diagnosed in the pre-TKI era, was resistant to TKI treatment and died. In univariate analysis, recipient sex and phase of CML had a significant impact on DFS and OS (Table 4). Male recipients 19

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia

Turk J Hematol 2017;34:16-26

Table 2. Outcomes of transplantation regarding tyrosine kinase inhibitor era and tyrosine kinase inhibitor use. Pre-TKI (n=128)

Post-TKI (n=65)

No TKIs used before transplant (n=145)

TKIs used before transplant (n=48)

Engraftment, %

94.5

96.9

0.7

94.5

97.9

0.5

Neutrophil engraftment, mean ± SD, days

16±5

17±6

0.8

16±5

17±7

0.8

Platelet engraftment, mean ± SD, days

18±9

18±12

0.2

18±9

18±13

0.4

Acute GVHD in 100 days, %

50.4

50.8

1.0

52.1

45.8

0.5

Grade 2-4 acute GVHD in 100 days, %

33.1

27.7

0.5

34.0

22.9

0.2

Chronic GVHD in 2 years, %

66.1

72.2

0.4

68.0

68.4

1.0

Hemorrhagic cystitis, %

28.9

13.8

0.003

27.6

12.5

0.01

SOS, %

4.7

9.2

0.2

4.1

12.5

0.08

All patients, n (%)

108 (84)

57 (88)

0.5

122 (84)

43 (90)

0.4

CP1, n (%)

99 (85)

31 (97)

0.1

111 (86)

19 (100)

0.1

>CP1, n (%)

9 (75)

26 (79)

1.0

11 (69)

24 (83)

0.5

67.8±4.1 50.8±4.5 47.8±4.6

69.2±5.7 59.5±6.2 56.8±6.4

0.3

69.5±3.8 54.0±4.2 51.3±4.3

64.6±6.9 52.5±7.5 48.1±8.1

0.7

70.5±4.2 54.5±4.8 51.2±4.8

81.2±6.9 68.6±8.2 64.3±8.8

0.2

71.9±4.0 56.9±4.5 53.9±4.6

78.9±9.4 62.7±11.2 NR

0.8

41.7±14.2 16.7±10.8 16.7±10.8

57.6±8.6 49.6±9.2 49.6±9.2

0.07

50.0±12.5 31.2±11.6 31.2±11.6

55.2±9.2 45.3±10.1 NR

0.4

16.4±3.3 27.3±4.0 39.0±4.5

13.8±4.3 23.7±5.4 32.7±6.1

0.5

15.2±3.0 25.9±3.7 36.4±4.2

16.7±5.4 27.9±6.6 38.1±7.4

0.7

13.8±3.2 25.4±4.1 36.8±4.7

6.2±4.3 15.8±6.5 28.9±8.2

0.5

13.2±3.0 23.6±3.8 34.6±4.4

10.5±7.0 21.1±9.4 37.3±11.2

0.6

33.3±13.6 51.2±14.8 63.5±15.3

21.2±7.2 31.4±8.3 35.0±8.6

0.1

31.2±11.6 44.4±12.6 53.4±13.1

21.7±7.5 32.5±9.0 37.7±9.4

0.3

Engraftment

GVHD

Transplantation complications

Hematologic CR after allo-HSCT

Overall survival All patients At 1 year, % ± SE At 5 years, % ± SE At 10 years, % ± SE CP1 patients At 1 year, % ± SE At 5 years, % ± SE At 10 years, % ± SE >CP1 patients At 1 year, % ± SE At 5 years, % ± SE At 10 years, % ± SE TRM All patients At 3 months, % ± SE At 1 year, % ± SE At 5 years, % ± SE CP1 patients At 3 months, % ± SE At 1 year, % ± SE At 5 years, % ± SE >CP1 patients At 3 months, % ± SE At 1 year, % ± SE At 5 years, % ± SE

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia

Turk J Hematol 2017;34:16-26

Table 2. Continued. Relapse/progression All patients At 1 year, % ± SE At 5 years, % ± SE

17.3±3.7 32.4±5.0

31.2±6.2 48.6±7.6

0.01

19.9±3.7 35.7±4.7

27.4±7.2 46.2±9.9

0.3

13.7±3.5 29.0±5.1

23.9±7.9 40.7±9.6

0.07

16.6±3.6 32.1±4.9

12.6±8.4 28.5±12.3

0.7

59.5±17.5 73.0±16.0

37.1±9.5 60.8±13.8

0.3

51.4±15.0 70.8±14.0

38.0±14.3 63.3±16.8

0.4

62.3±4.3 44.3±4.5 41.2±4.6

52.0±6.2 32.9±6.1 22.7±8.0

0.08

61.2±4.1 43.4±4.2 39.5±4.3

51.7±7.3 30.9±7.3 27.1±7.4

0.1

66.2±4.4 47.2±4.8 43.7±4.8

62.5±8.6 40.6±8.7 27.4±10.3

0.3

64.9±4.2 46.4±4.5 42.1±4.6

68.4±10.7 42.1±11.3 NR

0.7

25.0±12.5 16.7±10.8 16.7±10.8

41.7±8.7 23.8±9.3 NR

0.2

31.2±11.6 18.8±9.8 18.8±9.8

40.5±9.2 21.8±10.7 NR

0.4

CP1 patients At 1 year, % ± SE At 5 years, % ± SE >CP1 patients At 1 year, % ± SE At 5 years, % ± SE Disease-free survival All patients At 1 year, % ± SE At 5 years, % ± SE At 10 years, % ± SE CP1 patients At 1 year, % ± SE At 5 years, % ± SE At 10 years, % ± SE >CP1 patients At 1 year, % ± SE At 5 years, % ± SE At 10 years, % ± SE

Allo-HSCT: Allogeneic hematopoietic stem cell transplantation, CP1: first chronic phase, CR: complete remission, GVHD: graft-versus-host disease, SD: standard deviation, SE: standard error, SOS: sinusoidal obstruction syndrome, TKI: tyrosine kinase inhibitor, TRM: treatment-related mortality, NR: Not reached Survival Functions

Survival Functions

1.0

0.8

0.6

Cum Survival

0.6

0.4

0.2

0.0

0.0 0.00

50.00

100.00 150.00 200.00 OS_months

250.00

Survival Functions

0.6 0.4 0.2

0.00

50.00

100.00 150.00 OS_months

200.00

250.00

0.0

0.00

50.00

100.00 150.00 DFS_months

200.00 250.00

Figure 2. A) Overall survival by tyrosine kinase inhibitor era and phase of chronic myeloid leukemia. B) Overall survival by conditioning regimens and phase of chronic myeloid leukemia. C) Disease-free survival by conditioning regimens and phase of chronic myeloid leukemia. receiving grafts from female donors had the worst DFS and OS rates (Table 4), most likely because of the higher incidence of chronic GVHD in those patients (61% vs. 76% for sex-matched and mismatched conditions, respectively, p=0.03). The receipt of RIC regimens did not significantly affect OS but was associated with lower DFS in patients with advanced CML (Figure 2; Table 4). Although allo-HSCT from an unrelated donor was performed only in post-TKI era patients, donor type did not affect DFS or OS (Table 4). Additionally, the univariate analysis showed that

TKI use and era of allo-HSCT did not affect OS or DFS (Tables 2 and 4; Figure 1). Hematologic CR at 3 months after allo-HSCT was also associated with better survival (Table 4). In the multivariate analysis, male recipients (RR: 1.7, CI 95%: 1.22.5, p=0.007) and patients with advanced disease (RR: 1.8, CI 95%: 1.2-2.8, p=0.005) were associated with worse DFS. Male recipients (RR: 1.7, CI 95%: 1.1-2.6, p=0.02) were also associated with worse OS. However, advanced disease phase was not associated with worse OS. DFS and OS rates were similar between the pre- and 21

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia

Turk J Hematol 2017;34:16-26

Table 3. Treatment and survival after relapse. Treatment after relapse

Total, n=57 OS after relapse, mean ± SE

Pre-TKI era relapse, n=32 OS after relapse, mean ± SE

Post-TKI era relapse, n=25 OS after relapse, mean ± SE

DLI alone, n=15

58.3±19.0

42.4±18.2

67.2±17.0

Therapeutic TKI alone, n=10 95.5±18.6

14.9±14.6

117.5±15.6

Therapeutic TKI+DLI, n=18

86.8±14.4

105.7±13.8

82.4±18.5

Supportive therapy, n=14

6.5±2.9

4.7±2.5

11.4±8.6

Total, n=57

72.1±10.4

44.4±11.7

94.2±10.4

p-value for treatment

<0.001

p-value for TKI era

0.003

DLI: Donor lymphocyte infusion, OS: overall survival, SE: standard error, TKI: tyrosine kinase inhibitor.

post-TKI groups. In addition, hematologic CR at 3 months after allo-HSCT was associated with better DFS (RR: 0.15, CI 95%: 0.090.24, p<0.001) and OS (RR: 0.14, CI 95%: 0.09-0.23, p<0.001).

Discussion In this study, we showed that the number of transplants for treatment of CML has significantly declined after TKIs became available (since 2002) and that allo-HSCT indications have changed. After TKIs, more CML patients receiving allo-HSCT had advanced disease. This might be important, especially for many developing countries that have limited beds and health care provider capacity to offer allo-HSCT. With this switch in allo-HSCT indication of CML, patients with more aggressive hematological malignancies can receive allo-HSCT in a more timely manner [16]. The clinical phase of CML is one of the most important factors affecting OS and DFS after allo-HSCT [17,18]. BP and AP patients had inferior outcomes to those of CP1 patients [17,19]. In a study performed during the TKI era, the outcomes of patients in CP1 were superior to the outcomes of patients in >CP1 [20]. Therefore, we defined patients with disease beyond CP1 as having advanced disease. However, we found that advanced disease only affects DFS, not OS. As expected, more patients with advanced disease (>CP1, AP, and BP) underwent allo-HSCT in the post-TKI era in our study. Despite the presence of more difficult cases in the post-TKI era, OS and DFS rates were similar in both eras. Due to the availability of first- and second-generation TKIs, allo-HSCT is performed late in most patients who require transplant; however, the difference between the groups for the time from diagnosis to HSCT was only approximately 6 months. This reasonably short delay may have contributed to the lack of inferior outcomes of patients in the post-TKI era. Pretransplant TKI use did not affect OS or DFS in our study. A study by Khoury et al. [21] obtained similar findings, including no effect of pretransplant TKI use on OS. However, they did not provide the DFS rates of patients who received posttransplant TKIs. In our study, we showed that pretransplant TKI use did not affect DFS or OS in CML patients. 22

Jabbour et al. [22] showed that early complete response after TKI treatment in nontransplanted CML patients is the major determinant of patient outcome. Other studies reported that earlier and deep complete response after TKI treatment is correlated with better survival rates in CML patients [23,24]. However, to our knowledge, there is no study reporting the relationship between any response and overall survival in CML patients after allo-HSCT. Our study showed that early complete hematologic response after allo-HSCT is also one of the major determinants of CML patient survival. The lower OS rates observed after relapse in pre-TKI era patients can easily be explained by the absence of TKIs. TKIs were available for posttransplant relapsed disease in the post-TKI era, and their use was associated with longer survival after CML relapse. Savani et al. [25] reported that DLI with TKI treatment improved survival after allo-HSCT in 33 relapsing CML patients. They excluded BP CML patients within 30 days after DLI, but we included those patients in our study. Chalandon et al. [26] studied the occurrence of GVHD after DLI in CML patients and found that GVHD-related DLI was associated with mortality. Although we did not evaluate the occurrence of GVHD after DLI, we found that after allo-HSCT, TKI treatment (with or without DLI) for CML resulted in longer OS compared to the DLI-only approach. This finding explains the central role of TKIs in the treatment of relapse after allo-HSCT. Improvements in supportive measurements and other developments in the field most likely also contributed to the improved survival in the post-TKI era. Allo-HSCT outcomes of our CML patients may have also been affected by the year of allo-HSCT due to the development of more successful transplantation techniques and supportive treatment options [10]. OS was inferior in male recipients, in particular those who received grafts from female donors. Therefore, male recipients with female donors had the worst OS, most likely due to a higher incidence of chronic GVHD. When excluding male recipients receiving grafts from female donors, there were no significant differences between the OS or DFS rates among the other three groups.

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia

Turk J Hematol 2017;34:16-26

Table 4. Univariate analysis for all patients for disease-free survival and overall survival. DFS 5-year survival, 10-year survival, % ± SD, months % ± SD, months Clinical phase CP1 45.9±4.2 >CP1 23.1±7.1 Hematologic CR at 3 months after allo-HSCT Reached 46.2±4.0 Not reached 0.0±0.0 Stem cell source PB 42.1±5.0 BM 40.0±5.5 TKI era Pre-TKI 44.3±4.5 Post-TKI 32.9±6.1 Pretransplant TKI usage No 43.4±4.2 Yes 30.9±7.3 Recipient sex Male 34.2±4.7 Female 49.3±5.7 Recipient age <35 years 39.1±4.9 35 and above 42.6±5.4 Time from diagnosis to allo-HSCT 1 year or less 44.8±4.9 >1 year 35.2±5.4 Conditioning regimen Ablative 43.1±4.1 RIC 28.1±7.9 Donor type Related 41.1±3.7 Unrelated NR Donor sex Male 43.1±4.9 Female 37.5±5.4 Acute GVHD in 100 days, presence No 47.3±5.3 Yes 34.9±4.9 Grade 2-4 acute GVHD in 100 days, presence No 43.8±4.5 Yes 34.3±6.2 Chronic GVHD in 2 years, presence No 29.1±6.9 Yes 55.1±4.8 Donor/recipient sex match F-M 28.2±6.9 F-F 48.7±8.3 M-M 38.6±6.3 M-F 50.2±7.7

OS 5-year survival, % ± SD, months

10-year survival, % ± SD, months

41.0±4.3 23.1±7.1

<0.001

57.5±4.1 39.3±7.9

54.0±4.3 39.3±7.9

0.03

41.5±4.1 0.0±0.0

<0.001

60.2±3.9 4.3±4.3

56.8±4.0 4.3±4.3

<0.001

35.5±5.2 38.3±5.5

0.9

49.7±5.0 59.5±5.5

45.3±5.2 57.9±5.5

0.1

41.2±4.6 22.7±8.0

0.08

50.8±4.5 59.5±6.2

47.8±4.6 56.8±6.4

0.3

39.5±4.3 27.1±7.4

0.1

54.0±4.2 52.5±7.5

51.3±4.3 48.1±8.1

0.7

30.1±4.7 44.9±6.0

0.01

45.9±4.9 65.0±5.3

40.6±5.0 63.0±5.6

0.008

33.5±5.0 40.0±5.5

0.8

54.0±5.0 52.8±5.5

51.2±5.1 46.6±6.0

0.7

40.4±5.1 31.8±5.4

0.3

56.6±4.9 45.8±5.7

53.9±5.0 45.6±5.9

0.3

38.9±4.2 24.6±7.7

0.048

55.1±4.0 49.6±8.9

51.3±4.2 46.1±8.9

0.5

36.9±3.8 NR

0.3

53.4±3.8 NR

50.4±3.8 NR

1.0

40.1±5.0 32.4±5.5

0.4

58.3±4.9 47.7±5.5

54.1±5.1 46.0±5.6

0.1

43.7±5.5 30.5±4.9

0.09

64.3±5.2 43.6±5.1

61.2±5.4 40.8±5.1

0.004

41.4±4.6 27.0±6.2

0.055

60.3±4.4 39.5±6.4

58.2±4.5 34.9±6.4

0.001

24.3±7.3 50.1±5.0

<0.001

48.8±7.5 68.0±4.5

45.3±7.7 64.5±4.7

0.01

22.2±6.6 44.6±8.6 36.2±6.3 45.7±8.3

0.04

41.9±7.5 54.7±8.2 47.0±6.6 74.1±6.7

38.6±7.6 54.7±8.2 42.4±6.7 70.2±7.4

0.03

Allo-HSCT: Allogeneic hematopoietic stem cell transplantation, BM: bone marrow, CP: chronic phase, CR: complete remission, DFS: disease-free survival, F: female, M: male, NR: not reached, OS: overall survival, PB: peripheral blood, RIC: reduced-intensity conditioning, SD: standard deviation, TKI: tyrosine kinase inhibitor.

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia

The complications of allo-HSCT were similar in the pre-TKI and post-TKI era groups, except in regards to hemorrhagic cystitis. Hemorrhagic cystitis occurred more frequently in the pre-TKI era, possibly due to the greater frequency of myeloablative conditioning regimen use during that period [27]. We found that pretransplant administration of TKIs has no negative impact on engraftment. Furthermore, we considered the fact that most of the patients in the post-TKI era group were challenged with an important drug, a TKI. This may have created clinically or biologically difficult cases, as observed in lymphoma patients with disease relapse shortly after being treated with chemotherapy regimens containing rituximab [28].

Conclusion In conclusion, as expected, the frequency of allo-HSCT for CML patients sharply decreased after the introduction of TKIs. In recent years, this rate slightly increased, most likely due to TKI failure. Although CML patients who underwent allo-HSCT in the post-TKI era had more advanced disease, early and late outcomes were comparable between the pre- and post-TKI eras, mostly due to the high efficiency of TKIs for the treatment of relapses after allo-HSCT and advancements in the stem cell transplantation

Turk J Hematol 2017;34:16-26

field. In addition, CR after allo-HSCT has improved survival rates and is the most prominent factor affecting OS and DFS. Ethics Ethics Committee Approval: It was approved by the institutional ethics committee; Informed Consent: Restrospective study. Authorship Contributions Concept: Muhit Özcan; Design: Mehmet Özen, Celalettin Üstün, Bengi Öztürk, Muhit Özcan; Data Collection or Processing: Mehmet Özen, Celalettin Üstün, Bengi Öztürk, Pervin Topçuoğlu, Mutlu Arat, Mehmet Gündüz, Erden Atilla, Gülşen Bolat, Önder Arslan, Taner Demirer, Hamdi Akan, Osman İlhan, Meral Beksaç, Günhan Gürman, Muhit Özcan; Analysis or Interpretation: Mehmet Özen, Celalettin Üstün, Bengi Öztürk, Pervin Topçuoğlu; Literature Search: Mehmet Özen, Celalettin Üstün, Muhit Özcan; Writing: Mehmet Özen, Celalettin Üstün, Muhit Özcan. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Supplement 1. TKI treatment before allogeneic hematopoietic stem cell transplantation. From 2002 to 2006, although TKIs were available for clinical use, their long-term effects were unknown; therefore, allo-HSCT was performed for all CML patients during that time period. After 2006, allo-HSCT was mainly considered for TKI-resistant/intolerant CML patients or CML patients in advanced phases of the disease. In the post-TKI era, allo-HSCT was performed in 65 CML patients: 6 patients in BP, 5 patients in AP, 22 patients in the second chronic phase (CP2), and 32 patients in the first chronic phase (CP1) (7 patients were resistant/intolerant to TKIs, 12 patients were sensitive to TKIs, and 13 patients did not receive TKIs based on the physician’s or patient’s preference due to the lack of knowledge regarding their long-term effects). Most patients using TKIs before allo-HSCT were treated with imatinib alone (n=41), 4 patients received both imatinib and dasatinib, and 3 patients were treated with imatinib, dasatinib, and nilotinib before transplantation. Mutational analysis was performed for 9 patients, and only one patient was positive for the T315I mutation.

Conditioning Regimen The most frequently used myeloablative conditioning (MAC) regimen contained combined cyclophosphamide (CY) (120 mg/kg i.v.) and busulfan (3.2 mg/kg i.v. or 4 mg/kg p.o., 4 days) treatment with or without antithymocyte globulin (ATG) (10 mg/kg/day, 4 days) and combined CY (120 mg/kg) and fractionated total-body irradiation (12 Gy) treatment with or without ATG (10 mg/kg/day, 4 days). Fludarabine-based regimens have been used as RIC regimens: combined fludarabine (30 mg/m2 i.v., 6 days) and busulfan (3.2 mg/kg i.v. or 4 mg/ kg p.o., 2 days) treatment with or without ATG (10 mg/kg/day, 4 days) or combined fludarabine (30 mg/m2, 6 days) and cytarabine (3 g/m2 b.i.d., 4 days) treatment with or without ATG (10 mg/kg/day, 4 days). We did not perform in vitro T-cell depletion; however, in vivo T-cell depletion was accomplished by ATG administration in cases of a mismatched and/or unrelated donor (URD) after both MAC and RIC conditioning regimens.

HLA Matching Status HLA matching status was defined as follows: well matched if recipient/donor pairs had either no identified HLA mismatches and informative data for at least 6 loci or matching alleles at HLA-A, -B, and -DRB1; partially matched if recipient/donor pairs had a defined, single-locus mismatch and/or missing HLA data; and mismatched if recipient/donor pairs had ≥2 allele or antigen mismatches [12,13]. URD was started at our institution after 2002 for patients who had no HLA-matched donor or related donor with 1 allele mismatched and HLA match statuses were studied for URD transplants with at least 10 loci or alleles including HLA-A, -B, -C, -DQ, and -DRB1. After 1998, RIC regimens were administered to 21 patients due to either advanced age (≥50 years) or comorbidity. Eleven patients received RIC transplant in a clinical trial comparing the intensity of conditioning regimens in CP CML patients.

Turk J Hematol 2017;34:16-26

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia

GVHD Prophylaxis GVHD prophylaxis consisted of methotrexate (Mtx) at 15 mg/m2 on day +1 and 10 mg/m2 on days +3 and +6 (and additionally on day +11 for unrelated donor allo-HSCT) and daily cyclosporine (CSA) from day -1 (or -3 for unrelated donor allo-HSCT) to day +180.

Defining and Treating Relapse Relapse after allo-HSCT was defined by molecular, cytogenetic, or hematologic findings. Between 1989 and 1999, patients were followed cytogenetically, and molecular evaluation was not the main technique for remission assessment of CML patients. By 1999, molecular techniques were primarily used in place of cytogenetic techniques. Both molecular and cytogenetic data after allo-HSCT were only available after 1999; thus, these data were not included in the study. After 1999, patients were followed molecularly by testing BCR-ABL transcripts in RNA samples of peripheral blood or bone marrow starting at the time of allo-HSCT using a RQ-PCR method (T922, LightCycler Quantification, Roche Diagnostics, Munich, Germany). The molecular methods for BCR-ABL1 and chimerism studies were performed every 3 months until 1 year, every 6 months until 5 years, and every 1 year until 10 years after allo-HSCT. Logarithmically increasing levels of BCR-ABL transcript levels in at least 2 consecutive tests were defined as molecular relapse. Hematologic complete remission was defined as the detection of leukocytes at <10,000/µL, platelets at <450,000/µL, and basophils at <5%; the absence of myeloblasts, myelocytes, and promyelocytes in peripheral blood; myeloblasts at <5% in bone marrow; and the absence of a palpable spleen on physical examination. Chimerism was analyzed by PCR-based amplification of short tandem repeats (3130 Genetic Analyzer, Applied Biosystems, Foster City, CA, USA). An increase in recipient signals of more than 5% in sequential estimations of molecular chimerism compared to the prior level was considered as graft failure. In patients with graft failure or molecular/hematologic relapse, escalated doses of donor lymphocyte infusions (CD3+ cells in 1x107, 5x107, and 1x108 doses) were administered sequentially each month (if no response had been observed and no GVHD had developed since the previous infusion) and/or TKIs as a therapeutic option were administered.

Supportive Therapy Prophylactic platelet transfusion was given if the platelet count was <20x109/L. Red blood cell transfusion was given if hemoglobin was <7 g/ dL or <10 g/dL depending on the patient’s history of cardiovascular events. All blood products were irradiated and filtered. Infection prophylaxis has not changed since 1988 and includes acyclovir, fluconazole, and trimethoprim/sulfamethoxazole for all patients. Ciprofloxacin was added to these antimicrobials for patients receiving MAC. All patients were treated following the guidelines reported by the Infectious Diseases Society of America [14] and the Turkish National Febrile Neutropenia Study Group [15].

References 1. Lee SJ. Chronic myelogenous leukaemia. Br J Haematol 2000;111:993-1009. 2. Champlin RE, Golde DW. Chronic myelogenous leukemia: recent advances. Blood 1985;65:1039-1047. 3. O’Brien SG, Guilhot F, Larson RA, Gathmann I, Baccarani M, Cervantes F, Cornelissen JJ, Fischer T, Hochhaus A, Hughes T, Lechner K, Nielsen JL, Rousselot P, Reiffers J, Saglio G, Shepherd J, Simonsson B, Gratwohl A, Goldman JM, Kantarjian H, Taylor K, Verhoef G, Bolton AE, Capdeville R, Druker BJ; IRIS Investigators. Imatinib compared with interferon and low-dose cytarabine for newly diagnosed chronic-phase chronic myeloid leukemia. N Engl J Med 2003;348:994-1004. 4. Grigg A, Hughes T. Role of allogeneic stem cell transplantation for adult chronic myeloid leukemia in the imatinib era. Biol Blood Marrow Transplant 2006;12:795-807. 5. Saussele S, Lauseker M, Gratwohl A, Beelen DW, Bunjes D, Schwerdtfeger R, Kolb HJ, Ho AD, Falge C, Holler E, Schlimok G, Zander AR, Arnold R, Kanz L, Dengler R, Haferlach C, Schlegelberger B, Pfirrmann M, Müller MC, Schnittger S, Leitner A, Pletsch N, Hochhaus A, Hasford J, Hehlmann R; German CML Study Group. Allogeneic hematopoietic stem cell transplantation (allo SCT) for chronic myeloid leukemia in the imatinib era: evaluation of its impact within a subgroup of the randomized German CML Study IV. Blood 2010;115:1880-1885. 6. Simon W, Segel GB, Lichtman MA. Early allogeneic stem cell transplantation for chronic myelogenous leukemia in the imatinib era: a preliminary assessment. Blood Cells Mol Dis 2006;37:116-124. 7. Lindoerfer D, Hoffmann VS, Rosti G, Castagnetti F, Saussele S, Guilhot J, Simonsson B, Steegmann JL, Mayer J, Indrak K, Turkina AG, Zaritskey A, Labar B, Zupan IP, Thielen N, Clark RE, Thaler J, Melanthiou F, Everaus H, Porkka K, Bogdanovic AD, Schubert-Fritschle G, Panagiotidis P, Masszi T, Lejniece S, Griskevicius L, Hellmann A, Prejzner W, Sacha T, Almeida A, Dyagil I, Colita A, Mihaylov G, Hehlmann R, Hasford J, Baccarani M. The EUTOS Population-

Based Registry: Evaluation of baseline characteristics and first treatment choices of 2983 newly diagnosed chronic myeloid leukemia (CML) patients from 20 European countries. In: 19th Congress of the European Hematology Association; Milan, Italy; 12-15 June 2014. 8. Baccarani M, Cortes J, Pane F, Niederwieser D, Saglio G, Apperley J, Cervantes F, Deininger M, Gratwohl A, Guilhot F, Hochhaus A, Horowitz M, Hughes T, Kantarjian H, Larson R, Radich J, Simonsson B, Silver RT, Goldman J, Hehlmann R; European LeukemiaNet. Chronic myeloid leukemia: an update of concepts and management recommendations of European LeukemiaNet. J Clin Oncol 2009;27:6041-6051. 9. Jabbour E, Kantarjian H. Chronic myeloid leukemia: 2012 update on diagnosis, monitoring, and management. Am J Hematol 2012;87:1037-1045. 10. O’Meara A, Holbro A, Meyer S, Martinez M, Medinger M, Buser A, Halter J, Heim D, Gerull S, Bucher C, Rovo A, Kühne T, Tichelli A, Gratwohl A, Stern M, Passweg JR. Forty years of haematopoietic stem cell transplantation: a review of the Basel experience. Swiss Med Wkly 2014;144:w13928. 11. National Cancer Institute. Chronic Myelogenous Leukemia Treatment (PDQ) - Stages of Chronic Myelogenous Leukemia. Rockville, MD, USA, NCI, 2015. Available online at http://www.cancer.gov/cancertopics/pdq/treatment/ CML/Patient/page2. 12. Morishima Y, Sasazuki T, Inoko H, Juji T, Akaza T, Yamamoto K, Ishikawa Y, Kato S, Sao H, Sakamaki H, Kawa K, Hamajima N, Asano S, Kodera Y. The clinical significance of human leukocyte antigen (HLA) allele compatibility in patients receiving a marrow transplant from serologically HLA-A, HLA-B, and HLA-DR matched unrelated donors. Blood 2002;99:4200-4206. 13. Petersdorf EW, Kollman C, Hurley CK, Dupont B, Nademanee A, Begovich AB, Weisdorf D, McGlave P. Effect of HLA class II gene disparity on clinical outcome in unrelated donor hematopoietic cell transplantation for chronic myeloid leukemia: the US National Marrow Donor Program Experience. Blood 2001;98:2922-2929.

Özen M, et al: Allogeneic Transplantation in Chronic Myeloid Leukemia

14. Hughes WT, Armstrong D, Bodey GP, Brown AE, Edwards JE, Feld R, Pizzo P, Rolston KV, Shenep JL, Young LS. 1997 guidelines for the use of antimicrobial agents in neutropenic patients with unexplained fever. Infectious Diseases Society of America. Clin Infect Dis 1997;25:551-573. 15. Febril Nötropeni Çalışma Grubu. Febril nötropenik hastalarda tanı ve tedavi kılavuzu. Flora 2004;9:5-28 (in Turkish). 16. Gratwohl A, Baldomero H, Aljurf M, Pasquini MC, Bouzas LF, Yoshimi A, Szer J, Lipton J, Schwendener A, Gratwohl M, Frauendorfer K, Niederwieser D, Horowitz M, Kodera Y; Worldwide Network of Blood and Marrow Transplantation. Hematopoietic stem cell transplantation: a global perspective. JAMA 2010;303:1617-1624. 17. Lee SJ, Kukreja M, Wang T, Giralt SA, Szer J, Arora M, Woolfrey AE, Cervantes F, Champlin RE, Gale RP, Halter J, Keating A, Marks DI, McCarthy PL, Olavarria E, Stadtmauer EA, Abecasis M, Gupta V, Khoury HJ, George B, Hale GA, Liesveld JL, Rizzieri DA, Antin JH, Bolwell BJ, Carabasi MH, Copelan E, Ilhan O, Litzow MR, Schouten HC, Zander AR, Horowitz MM, Maziarz RT. Impact of prior imatinib mesylate on the outcome of hematopoietic cell transplantation for chronic myeloid leukemia. Blood 2008;112:3500-3507. 18. Pavlu J, Szydlo RM, Goldman JM, Apperley JF. Three decades of transplantation for chronic myeloid leukemia: what have we learned? Blood 2011;117:755-763. 19. Speck B, Bortin MM, Champlin R, Goldman JM, Herzig RH, McGlave PB, Messner HA, Weiner RS, Rimm AA. Allogeneic bone-marrow transplantation for chronic myelogenous leukaemia. Lancet 1984;1:665-668. 20. Oyekunle A, Zander AR, Binder M, Ayuk F, Zabelina T, Christopeit M, Stübig T, Alchalby H, Schafhausen P, Lellek H, Wolschke C, Müller I, Bacher U, Kröger N. Outcome of allogeneic SCT in patients with chronic myeloid leukemia in the era of tyrosine kinase inhibitor therapy. Ann Hematol 2013;92:487-496. 21. Khoury HJ, Kukreja M, Goldman JM, Wang T, Halter J, Arora M, Gupta V, Rizzieri DA, George B, Keating A, Gale RP, Marks DI, McCarthy PL, Woolfrey A, Szer J, Giralt SA, Maziarz RT, Cortes J, Horowitz MM, Lee SJ. Prognostic factors for outcomes in allogeneic transplantation for CML in the imatinib era: a CIBMTR analysis. Bone Marrow Transplant 2012;47:810-816. 22. Jabbour E, Kantarjian H, O’Brien S, Shan J, Quintas-Cardama A, Faderl S, Garcia-Manero G, Ravandi F, Rios MB, Cortes J. The achievement of an

Turk J Hematol 2017;34:16-26

early complete cytogenetic response is a major determinant for outcome in patients with early chronic phase chronic myeloid leukemia treated with tyrosine kinase inhibitors. Blood 2011;118:4541-4546. 23. Branford S, Yeung DT, Parker WT, Roberts ND, Purins L, Braley JA, Altamura HK, Yeoman AL, Georgievski J, Jamison BA, Phillis S, Donaldson Z, Leong M, Fletcher L, Seymour JF, Grigg AP, Ross DM, Hughes TP. Prognosis for patients with CML and >10% BCR-ABL1 after 3 months of imatinib depends on the rate of BCR-ABL1 decline. Blood 2014;124:511-518. 24. Hehlmann R, Müller MC, Lauseker M, Hanfstein B, Fabarius A, Schreiber A, Proetel U, Pletsch N, Pfirrmann M, Haferlach C, Schnittger S, Einsele H, Dengler J, Falge C, Kanz L, Neubauer A, Kneba M, Stegelmann F, Pfreundschuh M, Waller CF, Spiekermann K, Baerlocher GM, Ehninger G, Heim D, Heimpel H, Nerl C, Krause SW, Hossfeld DK, Kolb HJ, Hasford J, Saußele S, Hochhaus A. Deep molecular response is reached by the majority of patients treated with imatinib, predicts survival, and is achieved more quickly by optimized high-dose imatinib: results from the randomized CMLstudy IV. J Clin Oncol 2014;32:415-423. 25. Savani BN, Montero A, Kurlander R, Childs R, Hensel N, Barrett AJ. Imatinib synergizes with donor lymphocyte infusions to achieve rapid molecular remission of CML relapsing after allogeneic stem cell transplantation. Bone Marrow Transplant 2005;36:1009-1015. 26. Chalandon Y, Passweg JR, Schmid C, Olavarria E, Dazzi F, Simula MP, Ljungman P, Schattenberg A, de Witte T, Lenhoff S, Jacobs P, Volin L, Iacobelli S, Finke J, Niederwieser D, Guglielmi C; Chronic Leukemia Working Party of European Group for Blood and Marrow Transplantation. Outcome of patients developing GVHD after DLI given to treat CML relapse: a study by the Chronic Leukemia Working Party of the EBMT. Bone Marrow Transplant 2010;45:558-564. 27. Topcuoglu P, Arat M, Ozcan M, Arslan O, Ilhan O, Beksac M, Gurman G. Casematched comparison with standard versus reduced intensity conditioning regimen in chronic myeloid leukemia patients. Ann Hematol 2012;91:577586. 28. Gisselbrecht C, Glass B, Mounier N, Singh Gill D, Linch DC, Trneny M, Bosly A, Ketterer N, Shpilberg O, Hagberg H, Ma D, Brière J, Moskowitz CH, Schmitz N. Salvage regimens with autologous transplantation for relapsed large B-cell lymphoma in the rituximab era. J Clin Oncol 2010;28:4184-4190.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0005 Turk J Hematol 2017;34:27-33

Multicenter Retrospective Analysis of Turkish Patients with Chronic Myeloproliferative Neoplasms Kronik Miyeloproliferatif Neoplazi Tanılı Türk Hastaların Geriye Dönük ve Çok Merkezli Analizi Nur Soyer1, İbrahim C. Haznedaroğlu2, Melda Cömert1, Demet Çekdemir3, Mehmet Yılmaz4, Ali Ünal5, Gülsüm Çağlıyan6, Oktay Bilgir6, Osman İlhan7, Füsun Özdemirkıran8, Emin Kaya9, Fahri Şahin1, Filiz Vural1, Güray Saydam1 1Ege University Faculty of Medicine, Department of Hematology, İzmir, Turkey 2Hacettepe University Faculty of Medicine, Department of Hematology, Ankara, Turkey 3Sakarya University Training and Research Hospital, Clinic of Hematology, Sakarya, Turkey 4Gaziantep University Faculty of Medicine, Department of Hematology, Gaziantep, Turkey 5Erciyes University Faculty of Medicine, Department of Hematology, Kayseri, Turkey 6İzmir Bozyaka Training and Research Hospital, Clinic of Hematology, İzmir, Turkey 7Ankara University Faculty of Medicine Hospital, Department of Hematology, Ankara, Turkey 8İzmir Atatürk Training and Research Hospital, Clinic of Hematology, İzmir, Turkey 9İnönü University Faculty of Medicine Hospital, Department of Hematology, Malatya, Turkey

Abstract

Öz

Objective: Chronic myeloproliferative neoplasms (CMPNs) that include polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (PMF) are Philadelphia-negative malignancies characterized by a clonal proliferation of one or several lineages. The aim of this report was to determine the demographic features, disease characteristics, treatment strategies, and survival rates of patients with CMPNs in Turkey. Materials and Methods: Across all of Turkey, 9 centers were enrolled in the study. We retrospectively evaluated 708 CMPN patients’ results including 390 with ET, 213 with PV, and 105 with PMF. Results: The JAK2V617F mutation was found positive in 86% of patients with PV, in 51.5% of patients with ET, and in 50.4% of patients with PMF. Thrombosis and bleeding at diagnosis occurred in 20.6% and 7.5% of PV patients, 15.1% and 9% of ET patients, and 9.5% and 10.4% of PMF patients, respectively. Six hundred and eight patients (85.9%) received cytoreductive therapy. The most commonly used drug was hydroxyurea (89.6%). Leukemic and fibrotic transformations occurred at rates of 0.6% and 13.2%. The estimated overall survival in PV, ET, and PMF patients was 89.7%, 85%, and 82.5% at 10 years, respectively. There were no significant differences between survival in ET, PV, and PMF patients at 10 years. Conclusion: Our patients’ results are generally compatible with the literature findings, except for the relatively high survival rate in PMF patients. Hydroxyurea was the most commonly used cytoreductive therapy. Our study reflects the demographic features, patient characteristics, treatments, and survival rates of Turkish CMPN patients. Keywords: Chronic myeloproliferative neoplasms, Treatment, Survival, JAK2 mutation

Amaç: Polisitemia vera (PV), esansiyel trombositemi (ET) ve primer miyelofibrozu (PMF) içeren kronik miyeloproliferatif neoplaziler (KMPN), bir ya da birden fazla serinin klonal proliferasyonu ile karakterize Philadelphia kromozomu negatif olan malignitelerdir. Bu çalışmanın amacı, Türkiye’de KMPN’li hastaların demografik özellikleri, hastalık karakteristikleri, tedavi stratejileri ve yaşam oranlarını belirlemektir. Gereç ve Yöntemler: Türkiye’nin her yanından 9 merkez çalışmaya katıldı. Biz geriye dönük olarak ET’li 390, PV’li 213 ve PMF’li 105 hasta olmak üzere toplam 708 KMPN’li hastanın verisini değerlendirdik. Bulgular: JAK-2 mutasyonu PV’li hastaların %86’sında, ET’li hastaların %51,5’inde ve PMF’li hastaların %50,4’ünde pozitif bulundu. Tanıda tromboz ve kanama, PV’li hastaların sırasıyla %20,6 ve %7,5’inde, ET’li hastaların %15,1 ve %9’unda ve PMF’li hastaların %9,5 ve %10,4’ünde saptandı. Altı yüz sekiz hasta (%85,9) sitoredüktif tedavi almıştı. En sık kullanılan ilaç hidroksiüre (%89,6) idi. Lösemik ve fibrotik transformasyon sıklığı %0,6 ve %13,2 idi. 10 yıllık hesaplanan toplam sağkalım PV, ET ve PMF hastalarında sırasıyla %89,7, %85 ve %82,5 idi. 10 yıllık toplam sağkalım açısından ET, PV ve PMF hastalarında anlamlı fark yoktu. Sonuç: Sonuçlarımız, PMF hastalarının yüksek sağkalımı hariç literatürle benzerdir. Hidroksiüre ülkemizdeki en sık kullanılan sitoredüktif ajandır. Bizim çalışmamız, Türk KMPN hastalarının demografik özelliklerini, hastaların karakteristiklerini, tedavilerini ve sağkalım oranlarını yansıtmaktadır. Anahtar Sözcükler: Kronik miyeloproliferatif neoplaziler, Tedavi, Sağkalım, JAK2 mutasyonu

Address for Correspondence/Yazışma Adresi: Nur SOYER, M.D., Ege University Faculty of Medicine, Department of Hematology, İzmir, Turkey Phone : +90 232 390 42 87 E-mail : drakadnur@yahoo.com

Received/Geliş tarihi: January 04, 2016 Accepted/Kabul tarihi: March 25, 2016

Soyer N, et al: Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms

Introduction Chronic myeloproliferative neoplasms (CMPNs) are Philadelphia-negative malignancies characterized by a clonal proliferation of one or several lineages. According to the World Health Organization (WHO) classification, CMPNs include polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (PMF) [1]. Their natural history is marked by thrombohemorrhagic complications and a propensity to transform into myelofibrosis and acute leukemia [2]. The JAK2V617F mutation is present in a majority of PV patients (90%-98%), whereas only about 50% of patients with ET and PMF are affected [3,4]. Mutations other than JAK2 are calreticulin (CALR) and the myeloproliferative leukemia (MPL) virus oncogene. CALR mutations occur in 25%-35% of patients with PMF and 15%-24% with ET. These are rarely seen in PV. MPL mutations occur in 4% of ET patients, 8% of PMF patients, and rarely in PV [5]. Thrombotic complications have been reported in 30%-50% of PV cases and 11%-45% of ET cases [6,7,8]. The incidence of cardiovascular complications was found to be higher in PV patients aged >65 years or with a history of thrombosis than in younger subjects with no history of thrombosis [9]. Leukocytosis was found to be an independent risk factor for arterial thrombosis in both PV and ET [10,11,12,13]. Thrombotic complications have been reported in between 7.2% and 11% of PMF patients [14,15]. Bleeding complications are less common than thrombotic complications in PV. They were reported in 4.2% of 1545 patients with PV and in 3%-25.7% of patients with ET [16,17]. Long-term survival in CMPNs is significantly shorter compared to control populations. In a large study, median survivals were approximately 20 years for ET, 14 years for PV, and 6 years for PMF. The incidence of leukemic transformation was 3.8% for ET, 6.8% for PV, and 14.2% for PMF. Fibrotic transformation rates were reported as 10.3% in ET and 12.5% in PV [18]. History of thrombosis, leukocytosis, and advanced age are responsible for poor survival in both PV and ET [19,20,21,22]. In PMF, poor survival is predicted by advanced age, leukocytosis, anemia, transfusion dependency, thrombocytopenia, circulating blasts, constitutional symptoms, and unfavorable karyotypes [23]. Current treatment in ET and PV is directed primarily at minimizing the risk of thrombosis and secondarily at alleviating vasomotor symptoms. According to these goals, patients with PV and ET are stratified into risk categories and the treatment is tailored to the patient’s risk group [5]. Low-dose aspirin, hydroxyurea, interferon-α, and anagrelide can be used for the treatment of PV and ET. In PMF, the International Prognostic Scoring System (IPSS) and Dynamic IPSS are used for assessing survival at 28

Turk J Hematol 2017;34:27-33

diagnosis and at any time in the disease course, respectively. Therapy is planned according to patients’ risk groups [4]. There has not been a large multicenter study that evaluated the demographic features, treatments, and survival of patients with CMPNs in Turkey. The aim of this report was to determine the demographic features, patient characteristics, treatments, and survival rates of patients with CMPNs in Turkey.

Materials and Methods This study was designed as a retrospective multicenter study from Turkey and was approved by the Ege University Ethics Committee (Number 13-5.1/6). Across all of Turkey, 9 centers were enrolled in the study. The primary objective of the study was to evaluate the demographic features, treatments, and survival of patients with CMPNs in Turkey. For data collection from the centers, a case report form was prepared by the primary investigator. This form consisted of demographic features and patient characteristics, laboratory data at diagnosis, treatments, and the last status of patients. The case report forms were completed by each center’s investigators. Patients of ≥18 years old with the diagnosis of PV, ET, or PMF according to WHO criteria were enrolled in the study [24]. Each center reevaluated their patients who were diagnosed before acceptance of the WHO criteria. The study population was also selected based on the availability of clinical and laboratory information at the time of initial diagnosis. Patients were excluded if they did not fulfill WHO criteria for PV, ET, or PMF and if they did not attend follow-ups regularly. Major arterial thrombosis included transient ischemic attacks, thrombotic cerebrovascular accidents, angina pectoris, myocardial infarction, and peripheral arterial thromboembolism. Major venous thrombosis included deep venous thrombosis of the peripheral vasculature, pulmonary embolism, and abdominal vein thrombosis. Bleeding events included gastrointestinal tract bleeding, intracerebral hemorrhage, and soft tissue hematoma. Cardiovascular risk factors included hypertension, tobacco use, diabetes mellitus, and hyperlipidemia. Patients who were diagnosed with PV without a JAK2V617F assay were evaluated as “not available” (NA) patients. If we excluded NA patients from the analysis, JAK2 mutation status was evaluated in only verified PV patients that had a JAK2V617F assay. Risk factors of PMF patients were evaluated with the IPSS at diagnosis [25]. ET and PV patients were classified into high-risk and low-risk categories according to their age and history of thrombosis [26]. Treatment data were obtained according to specific therapies including cytoreductive therapy, antiplatelet therapy,

Turk J Hematol 2017;34:27-33

Soyer N, et al: Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms

androgens, steroids, thalidomide, erythropoiesis-stimulating agents, splenectomy, ruxolitinib, and red blood cell transfusions. If there was more than one specific treatment in the patient’s history, these therapies were also recorded. If allogeneic stem cell transplantation was performed it was also recorded. Leukemic transformation was defined according to the WHO criteria for acute leukemia [24]. The WHO diagnostic criteria for PMF were applied to assign the disease transformation into post-PV and post-ET myeloproliferative categories. Statistical Analysis All the statistical analyses were performed by using the data obtained from the patients’ files. Demographic and disease characteristics of the patients were summarized for all patients using descriptive statistics. Statistical analyses were performed using SPSS 16.0 and Excel 2007. The variables were first assessed by Kolmogorov-Smirnov/ Shapiro-Wilk testing in terms of normal distribution. The results were provided as mean ± standard deviation for normally distributed variables and as median (minimum-maximum) for abnormally distributed parameters. All analyses were based on the laboratory parameters obtained at the time of diagnosis. All p-values were two-tailed and statistical significance was set at the level of p<0.05. Overall survival (OS) was defined as the time period between the time of diagnosis and death because of any reason or last contact. OS evaluation was performed by using the KaplanMeier method.

Results Seven hundred and eight patients who were diagnosed between 1987 and 2014 were included in the study; 55.1% of all patients had ET, 30.1% had PV, and 14.8% had PMF. The JAK2V617F mutation was found positive in 75.1% of patients with PV, in 51.5% of patients with ET, and in 50.4% of patients with PMF. After exclusion of NA patients with PV, the JAK2V617F mutation was found in 86%. MPL mutation was observed in only 3 (2.6%) of 115 patients with ET. We did not detect MPL mutation in other groups. At diagnosis, thrombosis was observed in 20.65% of PV, 15.12% of ET, and 9.5% of PMF patients and bleeding occurred in 7.5% of PV, 9% of ET, and 10.4% of PMF patients. Thrombosis and bleeding at diagnosis were observed in 21.9% and 7.5% of verified PV patients, respectively. Secondary malignancy history was obtained from 10 (1.44%) of 691 patients at diagnosis. Patients’ clinical and hematological data at diagnosis are shown in Table 1. Cardiovascular risk factors were determined in 258 (42.8%) of 603 patients with ET and PV.

Six hundred and eight patients (85.9%) had been treated with cytoreductive therapy. The most commonly used drug was hydroxyurea (89.6%). Antiplatelet therapy was used in 553 (78.1%) patients. Treatment choices and risk stratification of patients are shown in Table 2. In PV patients, 13.2% of 213 were treated with only therapeutic phlebotomy and antiplatelet therapy. In ET patients, 7.5% of 390 were treated with only antiplatelet therapy and 1.8% of 390 patients were observed without any treatment. In PMF patients, 34.3% of 105 did not receive cytoreductive treatment. Ten (27.8%) of 36 received antiplatelet therapy, 15 (41.7%) of them received red blood cell transfusions, and the others (30.5%) were observed without any treatment. Cytoreductive therapy was changed in 195 patients for various reasons. In second-line treatment, hydroxyurea was changed to anagrelide in 147 patients. Anagrelide and interferon were changed to hydroxyurea in 5 and 9 patients, respectively. Hydroxyurea and anagrelide were changed to interferon in 30 patients and 1 patient, respectively. Three patients were treated with ruxolitinib after hydroxyurea treatment. Two patients and 9 patients received androgen therapy and steroid therapy, respectively. Erythropoiesisstimulating agents were administered to 3 patients. Red blood cell transfusion was performed in 79 patients. Splenectomy was performed in 10 (1.4%) patients. One patient was treated with splenic radiotherapy. Twelve PMF patients (11.4%) were treated with allogeneic stem cell transplantation. During follow-up, secondary malignancy was determined in 7 (0.9%) patients [3 ET (0.7%) and 4 PV (1.9%) patients]. Three and 2 of 7 patients were receiving hydroxyurea and anagrelide, respectively. Other patients did not use any cytoreductive therapy. Leukemic transformation was observed in 4 (0.6%) of all patients. Progression to myelofibrosis was observed in 80 (13.2%) of 603 PV and ET patients. At the end of the study and data collection period, 35 patients were deceased, 648 patients were still alive, and 25 patients had interruptions in their follow-up. The median follow-up was 38 months (range: 0-322) and the estimated OS was 86.7% at 10 years in all patients. Among the 213 PV patients, the median follow-up was 49 months (range: 0-322) and the estimated OS was 89.7% at 10 years. In the verified PV group, the estimated OS was 89.4% at 10 years. In 390 ET patients, the median follow-up was 39 months (range: 0-280) and the estimated OS was 85% at 10 years. Among the 105 PMF patients, the median follow-up was 19 months (range: 0-229) and the estimated OS was 82.5% at 10 years (Figure 1). According to the IPSS, the estimated OS was 100% in the low and intermediate-1 risk group, 92.4% in the intermediate-2 risk group, and 50% in the high risk group at 5 years in PMF (Figure 2). There were no significant differences between survival rates in ET, PV, and PMF patients at 10 years. 29

Soyer N, et al: Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms

Survival Functions

1.0

ET PMF PV ET-consored PMF-consored PV-consored

0.8

1.0 0.8

0.6

Cum Survival

Turk J Hematol 2017;34:27-33

0.4

0.6

0.4 0.2

0.2 0.0 0

0.0 0.00

100.00 200.00 Time (Month)

300.00

400.00

Figure 1. Overall survival of chronic myeloproliferative neoplasm patients.

100 150 Time (Month)

200

250

Figure 2. Overall survival of primary myelofibrosis patients according to the International Prognostic Scoring System.

ET: Essential thrombocythemia, PMF: primary myelofibrosis, PV: polycythemia vera.

Table 1. Clinical and hematological data of patients at diagnosis.

CMPN

PMF

No. of patients

708

213

390

105

Age at diagnosis, years (range)

55.5 (17-89)

47.5 (17-86)

41.5 (17-89)

69.5 (19-87)

Sex, M/F M/F ratio

339/369 1/1.08

132/81 1/0.61

151/239 1/1.58

56/49 1/0.87

Family history, yes/no

14/694

6/207

7/383

1/104

Thrombosis at diagnosis/before diagnosis, yes/no

113/595

44/169

59/331

10/95

Arterial thrombosis

Venous thrombosis

Both arterial and venous

Bleeding at diagnosis, yes/no

62/646

16/197

35/355

11/94

White blood cell count, x109/L (range)

10.2 (1.5-73)

11.05 (3.7-73)

8.25 (2.76-48)

9.45 (2-51.1)

Platelet count, x10 /L (range)

734 (15-2600)

239 (63-1413)

573 (35-2600)

291 (15-2500)

Hemoglobin level, g/L (range)

14.3 (3.4-23.9)

18.5 (9.5-23.9)

14.3 (3.4-18.5)

10.75 (6.6-17.7)

LDH levels, normal/high

341/367

73/140

247/143

21/84

Constitutional symptoms, yes/no

150/558

38/175

67/323

45/60

Pruritus, yes/no

159/549

83/130

55/335

16/89

Splenomegaly, yes/no

307/401

135/78

77/313

95/10

Hepatomegaly, yes/no

129/579

44/169

45/345

40/65

JAK2V617F mutation, positive/negative/NA

414/203/91

160/26/27

201/133/56

53/44/8

MPL mutation, yes/no/NA

3/200/505

0/39/174

3/112/275

0/49/56

History of secondary malignancies, yes/no

10/691

4/206

4/382

2/103

M: Male, F: female, LDH: lactate dehydrogenase, NA: not available, CMPN: chronic myeloproliferative neoplasm PV: polycythemia vera, ET: essential thrombocythemia, PMF: primary myelofibrosis.

Soyer N, et al: Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms

Turk J Hematol 2017;34:27-33

Table 2. First-line treatment choices and risk stratification of patients.

CMPN

PMF

n=708

n=213

n=390

n=105

Cytoreductive therapy, yes

608

85.9

185

86.8

354

90.7

65.7

Hydroxyurea

545

89.6

174

306

86.4

94.2

Anagrelide

4.8

7.6

2.9

Interferon

5.6

6.0

2.9

Antiplatelet therapy

553

78.1

177

327

83.8

46.7

Low

105

49.2

202

51.8

28.5

Intermediate-1

42.9

Intermediate-2

High

108

50.8

188

48.2

7.6

Risk stratification

CMPN: Chronic myeloproliferative neoplasm PV: polycythemia vera, ET: essential thrombocythemia, PMF: primary myelofibrosis.

Discussion The aim of this study was to determine the demographic features, patient characteristics, treatments, and survival rates of patients with CMPNs in Turkey. We evaluated 708 patients from 9 centers across all of Turkey. This study was planned as a multicenter and retrospective trial so that we might evaluate CMPN practices in Turkey. In our study, the incidence of JAK2 mutation, the history of thrombosis, and the median age at diagnosis were lower than in the literature [3,4,9]. After excluding NA patients from analysis, the incidence of JAK2 mutation (86%) was closer to that of other studies. The incidence of bleeding was comparable to that reported in the literature [6,16]. Thrombotic complications were reported in 30% to 50% of PV patients in other studies [6,7]. Epidemiological studies have reported that the incidence of thrombosis increases with age [27]. Lower median age at diagnosis might be related to a lower incidence of thrombosis. Almost all patients with PV harbor a JAK2 mutation that includes JAK2V617F and JAK2 exon 12 [4]. Additionally, JAK2 exon 12 mutation has been associated with younger age at diagnosis [28]. The lower incidence of JAK2V617F in our series might be associated with younger age at diagnosis, preanalytical mistakes, and problems of laboratory analysis, such as the exon 12 mutation not being analyzed in all centers routinely. The type of sample, the cellular fraction of the sample, and the nucleic acid template were considered for the detection of the JAK2 mutation. Additionally, some qualitative methods like the Sanger sequencing method used for detection of the JAK2 mutation underestimated the number of patients harboring the mutation [29]. The inability of qualitative assays to identify those patients with lower allele burdens is another problem. All of these factors seem to be related to low JAK2 mutation positivity.

Another issue is that we determined a low hemoglobin value at diagnosis in one patient who was diagnosed with PV. This patient was evaluated because of portal vein thrombosis and at the time of evaluation had gastrointestinal bleeding due to warfarin use. JAK2V617F mutation was found positive. MPL mutation was reported in approximately 4% of ET patients and 8% of PMF patients [5]. The frequency of MPL mutation in ET patients (2.6%) was similar to rates reported in the literature. We did not detect MPL mutations in our PMF and PV patients. These results might be related to the low number of patients who were detected with this mutation. In our ET patients, median age at diagnosis, the incidence of thrombosis and bleeding at diagnosis, and JAK2 mutation positivity were compatible with literature findings [4,8,17]. In our PMF patients, the incidence of thrombosis and bleeding at diagnosis and JAK2 mutation positivity were compatible with the literature but median age at diagnosis was slightly higher [14,15,18]. The estimated OS was 86.7% at 10 years in our CMPN patients. The 10-year and 3-year OS of CMPN patients was 72% and 80%, respectively [30,31]. The 10-year OS in PV patients was reported to be between 56% and 83% [32,33]. In our ET and PV patients, OS rates were similar to those of previous studies. The 10-year OS in PMF patients (21%-46%) was significantly worse than that of patients with ET or PV [32,33]. In our PMF patients, we found that the 10-year survival was 82.5% with a median 19 months of follow-up. It is important that 71.4% of PMF patients in our study had low or intermediate-1 risk. This finding might explain our high survival rate in PMF patients. Previous studies suggested that survival in myeloproliferative neoplasm patients can be influenced by several factors such as increased age, male sex, and PMF subtype of CMPN, which are associated with decreased survival in myeloproliferative 31

Soyer N, et al: Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms

neoplasms [30,31,32,34,35]. Geography and ethnicity can also impact survival [32,36]. Although approximately 50% of patients with ET and PV were classified into the low risk group according to risk stratification in our series, 86.8% of PV patients and 90.7% of ET patients received cytoreductive therapy. This might be associated with cardiovascular risk factors that were determined in 42.8% of 603 patients with ET and PV. The incidence of secondary malignancy was reported to be between 8% and 20% [37,38]. Our secondary malignancy incidence was lower than that in the literature. It is possible that secondary malignancies were underestimated in our series. In our study, the leukemic transformation rate was lower than in the literature. Leukemic and fibrotic transformation rates were reported as 3.8%-14.2% in CMPNs and 10.3%-12.5% in ET and PV, respectively [18]. The low leukemic transformation rate might be associated with several factors. First, this was a retrospective study, so some data were not found because of inadequate records. Second, PMF incidence is highest in elderly patients. In our study, patients were excluded if they did not have regular follow-ups and this resulted in the exclusion of some patients diagnosed with CMPNs at older ages who could not attend regular appointments because of socioeconomic conditions.

Conclusion Our patients’ results are generally compatible with literature findings, except for the relatively high survival rate in PMF patients. Hydroxyurea was the most commonly used cytoreductive therapy in our study. This study reflects the demographic features, patient characteristics, treatments, and survival rates of patients with CMPNs in Turkey. Ethics Ethics Committee Approval: Ege University Ethics Committee (Number 13-5.1/6); Informed Consent: Retrospective study. Authorship Contributions Concept: Nur Soyer, İbrahim C. Haznedaroğlu, Melda Cömert, Demet Çekdemir, Mehmet Yılmaz, Ali Ünal, Gülsüm Çağlıyan, Oktay Bilgir, Osman İlhan, Füsun Özdemirkıran, Emin Kaya, Fahri Şahin, Filiz Vural, Güray Saydam; Design: Nur Soyer, İbrahim C. Haznedaroğlu, Melda Cömert, Demet Çekdemir, Mehmet Yılmaz, Ali Ünal, Gülsüm Çağlıyan, Oktay Bilgir, Osman İlhan, Füsun Özdemirkıran, Emin Kaya, Fahri Şahin, Filiz Vural, Güray Saydam; Data Collection or Processing: Nur Soyer, İbrahim C. Haznedaroğlu, Melda Cömert, Demet Çekdemir, Mehmet Yılmaz, Ali Ünal, Gülsüm Çağlıyan, Oktay Bilgir, Osman İlhan, Füsun Özdemirkıran, Emin Kaya, Fahri Şahin, Filiz Vural, Güray Saydam; Analysis or Interpretation: Nur Soyer, İbrahim C. Haznedaroğlu, 32

Turk J Hematol 2017;34:27-33

Melda Cömert, Demet Çekdemir, Mehmet Yılmaz, Ali Ünal, Gülsüm Çağlıyan, Oktay Bilgir, Osman İlhan, Füsun Özdemirkıran, Emin Kaya, Fahri Şahin, Filiz Vural, Güray Saydam; Literature Search: Nur Soyer, İbrahim C. Haznedaroğlu, Melda Cömert, Demet Çekdemir, Mehmet Yılmaz, Ali Ünal, Gülsüm Çağlıyan, Oktay Bilgir, Osman İlhan, Füsun Özdemirkıran, Emin Kaya, Fahri Şahin, Filiz Vural, Güray Saydam; Writing: Nur Soyer, İbrahim C. Haznedaroğlu, Melda Cömert, Demet Çekdemir, Mehmet Yılmaz, Ali Ünal, Gülsüm Çağlıyan, Oktay Bilgir, Osman İlhan, Füsun Özdemirkıran, Emin Kaya, Fahri Şahin, Filiz Vural, Güray Saydam. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Tefferi A, Vardiman JW. Classification and diagnosis of myeloproliferative neoplasms: the 2008 World Health Organization criteria and point-of-care diagnostic algorithms. Leukemia 2008;22:14-22. 2. Barbui T, Finazzi G, Falanga A. Myeloproliferative neoplasms and thrombosis. Blood 2013;122:2176-2184. 3. Tefferi A, Vainchenker W. Myeloproliferative neoplasms: molecular pathophysiology, essential clinical understanding, and treatment strategies. J Clin Oncol 2011;29:573-582. 4. Tefferi A. Myeloproliferative neoplasms 2012: the John M. Bennett 80th birthday anniversary lecture. Leuk Res 2012;36:1481-1489. 5. Tefferi A, Barbui T. Polycythemia vera and essential thrombocythemia: 2015 update on diagnosis, risk-stratification and management. Am J Hematol 2015;90:162-173. 6. Marchioli R, Finazzi G, Landolfi R, Kutti J, Gisslinger H, Patrono C, Marilus R, Villegas A, Tognoni G, Barbui T. Vascular and neoplastic risk in a large cohort of patients with polycythemia vera. J Clin Oncol 2005;23:2224-2232. 7. Gruppo Italiano Studio Policitemia. Polycythemia vera: the natural history of 1213 patients followed for 20 years. Ann Intern Med 1995;123:656-664. 8. Elliott MA, Tefferi A. Thrombosis and hemorrhage in polycythemia vera and essential thrombocythemia. Br J Haematol 2005;128:275-290. 9. Landolfi R, Marchioli R, Kutti J, Gisslinger H, Tognoni G, Patrono C, Barbui T; European Collaboration on Low-Dose Aspirin in Polycythemia Vera Investigators. Efficacy and safety of low dose aspirin in polycythemia vera. N Engl J Med 2004;350:114-124. 10. Landolfi R, Di Gennaro L, Barbui T, De Stefano V, Finazzi G, Marfisi R, Tognoni G, Marchioli R; European Collaboration on Low-Dose Aspirin in Polycythemia Vera (ECLAP). Leukocytosis as a major thrombotic risk factor in patients with polycythemia vera. Blood 2007;109:2446-2452. 11. Wolanskyj AP, Schwager SM, McClure RF, Larson DR, Tefferi A. Essential thrombocythemia beyond the first decade: life expectancy, long term complication rates, and prognostic factors. Mayo Clin Proc 2006;81:159166. 12. Carobbio A, Finazzi G, Guerini V, Spinelli O, Delaini F, Marchioli R, Borrelli G, Rambaldi A, Barbui T. Leukocytosis is a risk factor for thrombosis in essential thrombocythemia: interaction with treatment, standard risk factors, and Jak2 mutation status. Blood 2007;109:2310-2313. 13. Palandri F, Polverelli N, Catani L, Ottaviani E, Baccarani M, Vianelli N. Impact of leukocytosis on thrombotic risk and survival in 532 patients with essential thrombocythemia: a retrospective study. Ann Hematol 2011;90:933-938. 14. Cervantes F, Alvarez-Larrán A, Arellano-Rodrigo E, Granell M, Domingo A, Montserrat E. Frequency and risk factors for thrombosis in idiopathic myelofibrosis: analysis in a series of 155 patients from a single institution. Leukemia 2006;20:55-60.

Turk J Hematol 2017;34:27-33

Soyer N, et al: Retrospective Analysis of Patients with Chronic Myeloproliferative Neoplasms

15. Barbui T, Carobbio A, Cervantes F, Vannucchi AM, Guglielmelli P, Antonioli E, Alvarez-Larrán A, Rambaldi A, Finazzi G, Barosi G. Thrombosis in primary myelofibrosis: incidence and risk factors. Blood 2010;115:778-782. 16. Tefferi A, Rumi E, Finazzi G, Gisslinger H, Vannucchi AM, Rodeghiero F, Randi ML, Vaidya R, Cazzola M, Rambaldi A, Gisslinger B, Pieri L, Ruggeri M, Bertozzi I, Sulai NH, Casetti I, Carobbio A, Jeryczynski G, Larson DR, Müllauer L, Pardanani A, Thiele J, Passamonti F, Barbui T. Survival and prognosis among 1545 patients with contemporary polycythemia vera: an international study. Leukemia 2013;27:1874-1881. 17. Chim CS, Kwong YL, Lie AK, Ma SK, Chan CC, Wong LG, Kho BC, Lee HK, Sim JP, Chan CH, Chan JC, Yeung YM, Law M, Liang R. Long-term outcome of 231 patients with essential thrombocythemia: prognostic factors for thrombosis, bleeding, myelofibrosis, and leukemia. Arch Intern Med 2005;165:2651-2658. 18. Tefferi A, Guglielmelli P, Larson DR, Finke C, Wassie EA, Pieri L, Gangat N, Fjerza R, Belachew AA, Lasho TL, Ketterling RP, Hanson CA, Rambaldi A, Finazzi G, Thiele J, Barbui T, Pardanani A, Vannucchi AM. Long-term survival and blast transformation in molecularly annotated essential thrombocythemia, polycythemia vera, and myelofibrosis. Blood 2014;124:2507-2513. 19. Gangat N, Strand J, Li CY, Wu W, Pardanani A, Tefferi A. Leucocytosis in polycythaemia vera predicts both inferior survival and leukaemic transformation. Br J Haematol 2007;138:354-358. 20. Passamonti F, Rumi E, Pungolino E, Malabarba L, Bertazzoni P, Valentini M, Orlandi E, Arcaini L, Brusamolino E, Pascutto C, Cazzola M, Morra E, Lazzarino M. Life expectancy and prognostic factors for survival in patients with polycythemia vera and essential thrombocythemia. Am J Med 2004;117:755-761. 21. Gangat N, Wolanskyj AP, McClure RF, Li CY, Schwager S, Wu W, Tefferi A. Risk stratification for survival and leukemic transformation in essential thrombocythemia: a single institutional study of 605 patients. Leukemia 2007;21:270-276. 22. Passamonti F, Rumi E, Arcaini L, Boveri E, Elena C, Pietra D, Boggi S, Astori C, Bernasconi P, Varettoni M, Brusamolino E, Pascutto C, Lazzarino M. Prognostic factors for thrombosis, myelofibrosis, and leukemia in essential thrombocythemia: a study of 605 patients. Haematologica 2008;93:16451651. 23. Gangat N, Caramazza D, Vaidya R, George G, Begna K, Schwager S, Van Dyke D, Hanson C, Wu W, Pardanani A, Cervantes F, Passamonti F, Tefferi A. DIPSS Plus: A refined Dynamic International Prognostic Scoring System for primary myelofibrosis that incorporates prognostic information from karyotype, platelet count, and transfusion status. J Clin Oncol 2011;29:392397. 24. Vardiman JW, Thiele J, Arber DA, Brunning RD, Borowitz MJ, Porwit A, Harris NL, Le Beau MM, Hellström-Lindberg E, Tefferi A, Bloomfield CD. The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes. Blood 2009;114:937-951. 25. Cervantes F, Dupriez B, Pereira A, Passamonti F, Reilly JT, Morra E, Vannucchi AM, Mesa RA, Demory JL, Barosi G, Rumi E, Tefferi A. New prognostic scoring system for primary myelofibrosis based on a study of the International Working Group for Myelofibrosis Research and Treatment. Blood 2009;113:2895-2901. 26. Barbui T, Barosi G, Birgegard G, Cervantes F, Finazzi G, Griesshammer M, Harrison C, Hasselbalch HC, Hehlmann R, Hoffman R, Kiladjian JJ, Kröger N, Mesa R, McMullin MF, Pardanani A, Passamonti F, Vannucchi AM, Reiter

A, Silver RT, Verstovsek S, Tefferi A; European LeukemiaNet. Philadelphianegative classical myeloproliferative neoplasms: critical concepts and management recommendations from European LeukemiaNet. J Clin Oncol 2011;29:761-770. 27. Landolfi R, Di Gennaro L, Falanga A. Thrombosis in myeloproliferative disorders: pathogenetic facts and speculation. Leukemia 2008;22:20202028. 28. Passamonti F, Elena C, Schnittger S, Skoda RC, Green AR, Girodon F, Kiladjian JJ, McMullin MF, Ruggeri M, Besses C, Vannucchi AM, Lippert E, Gisslinger H, Rumi E, Lehmann T, Ortmann CA, Pietra D, Pascutto C, Haferlach T, Cazzola M. Molecular and clinical features of the myeloproliferative neoplasm associated with JAK2 exon 12 mutations. Blood 2011;117:2813-2816. 29. Langabeer SE, Andrikovics H, Asp J, Bellosillo B, Carillo S, Haslam K, Kjaer L, Lippert E, Mansier O, Oppliger Leibundgut E, Percy MJ, Porret N, Palmqvist L, Schwarz J, McMullin MF, Schnittger S, Pallisgaard N, Hermouet S; MPN&MPNr-EuroNet. Molecular diagnostics of myeloproliferative neoplasms. Eur J Haematol 2015;95:270-279. 30. Hultcrantz M, Kristinsson SY, Andersson TM, Landgren O, Eloranta S, Derolf AR, Dickman PW, Björkholm M. Patterns of survival among patients with myeloproliferative neoplasms diagnosed in Sweden from 1973 to 2008: a population-based study. J Clin Oncol 2012;30:2995-3001. 31. Rollison DE, Howlader N, Smith MT, Strom SS, Merritt WD, Ries LA, Edwards BK, List AF. Epidemiology of myelodysplastic syndromes and chronic myeloproliferative disorders in the United States, 2001-2004, using data from the NAACCR and SEER programs. Blood 2008;112:45-52. 32. Maynadié M, Girodon F, Manivet-Janoray I, Mounier M, Mugneret F, Bailly F, Favre B, Caillot D, Petrella T, Flesch M, Carli PM. Twenty-five years of epidemiological recording on myeloid malignancies: data from the specialized registry of hematologic malignancies of Cote d’Or (Burgundy, France). Haematologica 2011;96:55-61. 33. Malak S, Labopin M, Saint-Martin C, Bellanne-Chantelot C, Najman A; French Group of Familial Myeloproliferative Disorders. Long term follow up of 93 families with myeloproliferative neoplasms: life expectancy and implications of JAK2V617F in the occurrence of complications. Blood Cells Mol Dis 2012;49:170-176. 34. Cervantes F, Dupriez B, Passamonti F, Vannucchi AM, Morra E, Reilly JT, Demory JL, Rumi E, Guglielmelli P, Roncoroni E, Tefferi A, Pereira A. Improving survival trends in primary myelofibrosis: an international study. J Clin Oncol 2012;30:2981-2987. 35. Passamonti F, Rumi E, Pungolino E, Malabarba L, Bertazzoni P, Valentini M, Orlandi E, Arcaini L, Brusamolino E, Pascutto C, Cazzola M, Morra E, Lazzarino M. Life expectancy and prognostic factors for survival in patients with polycythemia vera and essential thrombocythemia. Am J Med 2004;117:755-761. 36. Xu Z, Gale RP, Zhang Y, Qin T, Chen H, Zhang P, Zhang T, Liu L, Qu S, Xiao Z. Unique features of primary myelofibrosis in Chinese. Blood 2012;119:24692473. 37. Khanal N, Giri S, Upadhyay S, Shostrom VK, Pathak R, Bhatt VR. Risk of second primary malignancies and survival of adult patients with polycythemia vera: a United States population-based retrospective study. Leuk Lymphoma 2016;57:129-133. 38. Stein BL, Moliterno AR, Tiu RV. Polycythemia vera disease burden: contributing factors, impact on quality of life, and emerging treatment options. Ann Hematol 2014;93:1965-1976.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0115 Turk J Hematol 2017;34:34-39

TP53 Staining in Tissue Samples of Chronic Lymphocytic Lymphoma Cases: An Immunohistochemical Survey of 51 Cases Kronik Lenfositik Lenfoma Hastalarının Doku Örneklerinde TP53 Boyaması: Elli Bir Hastanın İmmünohistokimya ile Değerlendirilmesi İbrahim Kulaç1*, Çetin Demir2, Yahya Büyükaşık3, Tezer Kutluk2, Ayşegül Üner1 1Hacettepe University Faculty of Medicine, Department of Pathology, Ankara, Turkey 2Hacettepe University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Oncology, Drug Resistance Laboratory, Ankara, Turkey 3Hacettepe University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, Ankara, Turkey

*Author is currently appointed at Johns Hopkins University Faculty of Medicine, Baltimore, USA

Abstract

Öz

Objective: Chronic lymphocytic leukemia (CLL) is the most common lymphoproliferative disease in adults. The aim of this study is to find out if the extent of proliferation centers or the immunohistochemical expression of p53 is related to disease prognosis.

Amaç: Kronik lenfositik lösemi (KLL) erişkin bireylerde en sık görülen lenfoproliferatif hastalıktır. Bu çalışmanın amacı KLL tanısı almış hastaların doku örneklerindeki proliferasyon merkezlerinin yaygınlığı ve p53 ekspresyonu ile prognozları arasında bağlantı olup olmadığını araştırmaktır.

Materials and Methods: In the scope of this study, 54 biopsy specimens from 51 patients (50 of lymph nodes; the others of spleen, tonsil, orbit, and liver) diagnosed with CLL at the Hacettepe University Department of Pathology in 2000-2013 were reevaluated. The clinical and demographic data of the patients were obtained from our patient database. Biopsy samples were assessed semi-quantitatively for the percentage of proliferation center/total biopsy area (PC/TBA) and an immunohistochemical study was performed on representative blocks of tissues for p53 expression. Results: When the patients were divided into two categories according to Rai stage as high and low (stages 0, 1, and 2 vs. stages 3 and 4), it was seen that patients with low Rai stage had a better prognosis than those with high stages (p=0.030). However, there was no statistically significant correlation between overall survival and PC/TBA ratio or p53 expression levels. Conclusion: In our cohort, PC/TBA ratio and immunopositivity of p53 did not show correlations with overall survival. Keywords: TP53, Immunohistochemistry, Chronic lymphocytic lymphoma, Proliferation centers

Gereç ve Yöntemler: Bu çalışma kapsamında Hacettepe Üniversitesi Tıp Fakültesi Hastanesi Patoloji Anabilim Dalı’nda 2000-2013 yılları arasında KLL tanısı almış 51 hastanın 54 biyopsi örneği yeniden değerlendirilmiştir. Hastaların klinik ve demografik verileri hasta veri tabanından elde edilmiştir. Yapılan incelemede biyopsi örneklerinde proliferasyon merkezlerinin tüm biyopsi alanına oranı (PM/TBA) yarı niceleyici olarak değerlendirilmiş ve seçilen temsili bloklardan elde edilen kesitlerde immünohistokimyasal yöntemle p53 ekspresyonuna bakılmıştır. Bulgular: Hastalar Rai evrelerine göre düşük ve yüksek olmak üzere iki gruba ayrıldığında düşük evreli hastaların genel sağkalım sürelerinin yüksek evreli hastalara göre daha uzun olduğu görülmüştür (p=0,030). Ancak, proliferasyon merkezi oranı veya p53 ekspresyon düzeyleri arasında istatistiksel olarak anlamlı ilişki gösterilememiştir. Sonuç: Çalışmamıza dahil edilen hasta grubunda PM/TBA oranı ve p53 immünpozitifliginin sağkalım ile ilişkisi olmadığı görülmüştür. Anahtar Sözcükler: TP53, İmmünohistokimya, Kronik lenfositik lenfoma, Proliferasyon merkezleri

Address for Correspondence/Yazışma Adresi: İbrahim KULAÇ, M.D., Johns Hopkins University Faculty of Medicine, Baltimore, USA Phone : +1 410 502 7354 E-mail : dribrahimkulac@gmail.com

Received/Geliş tarihi: March 20, 2016 Accepted/Kabul tarihi: May 09, 2016

Turk J Hematol 2017;34:34-39

Introduction Chronic lymphocytic leukemia (CLL) is the most common lymphoproliferative disorder of adults in Western countries [1]. A vast majority of the patients present at Rai stage 0 or 1, most incidentally diagnosed during routine blood work-up [2]. Although lymph node biopsy is not a standard first-line diagnostic tool, in some instances such as transformation or an unexpected clinical course, it is indicated. In hematoxylin and eosin-stained sections of involved lymph nodes it is characterized by a diffuse infiltrate of small uniform cells with occasional segregation of relatively larger cells (Figure 1). It is well known that a large percentage of patients will be followed for a long time without progression, but some will eventually progress and require treatment. For decades several different parameters have been used to identify patients with a predisposition to progression. lymphocyte doubling time or several biochemical and flow cytometry-based markers are widely used for this purpose [3,4,5,6]. Though these are still important, novel molecular tests offer a wide range of highly

KulaĂ§ Ä°, et al: TP53 Alterations in Chronic Lymphocytic Lymphoma Patients

impactful markers [7]. Several chromosomal abnormalities have also been shown as considerable prognosticators, such as del13q14, trisomy12, del11q22-23, and del17p13, as well as translocations that include 14q32 and are the most commonly used ones in routine hematology/pathology practice [8,9]. Mutations on the short arm of chromosome 17 have also been studied extensively and shown as some of the most important cytogenetic alterations associated with adverse prognosis [10,11,12]. Patients with 17p13 deletion tend to have the worst outcome compared to patients with any other cytogenetic or mutational anomalies and they also have a better response to certain types of treatments [13,14]. The 17p13 locus harbors TP53, one of the most important genes in cancer pathogenesis. The presence of TP53 alterations in CLL patients has been reported at between 7% and 33% in the literature [14,15,16,17]. Immunohistochemical methods, by using anti-p53 antibody, have been utilized for detection of p53 alterations for years. Although interpretation varies in different tumor types, it is highly reliable as a surrogate marker. However, there are no

Figure 1. Representative images of a lymph node with chronic lymphocytic leukemia involvement. On low power, lightly colored areas represent proliferation centers (A). Proliferation centers are rich in prolymphocytic cells (C). Other areas are predominantly composed of small lymphocytic cells (B and D). 35

Kulaç İ, et al: TP53 Alterations in Chronic Lymphocytic Lymphoma Patients

studies on immunohistochemical assessment of p53 alteration using formalin-fixed paraffin-embedded (FFPE) solid organ samples of CLL patients. In this study, our aim was to identify the frequency and the effect on overall survival (OS) of TP53 abnormalities in FFPE tissue samples in a cohort of 51 patients from a single institution, and we also evaluated the impact of some clinical parameters on clinical outcome.

Materials and Methods Fifty-four solid organ biopsies from 51 patients, which were evaluated between 2000 and 2013 at the Hacettepe University Department of Pathology, were included in the study. Patients’ date of initial diagnosis, date of the biopsy procedure, followup time, date of death if applicable, and platelet, leukocyte, hemoglobin, lactate dehydrogenase, and absolute lymphocyte levels were recorded. Because of potential decalcification artifacts and the paucity of neoplastic cells in bone marrow samples, we decided to use samples from solid organ biopsies (especially lymph nodes), which are larger in size and free of decalcification artifacts. Morphological Evaluation All the biopsy samples were reevaluated by two pathologists (A.Ü., İ.K.). The percentage of the area of proliferation centers (PCs) was determined semi-quantitatively for each biopsy sample using hematoxylin and eosin-stained slides after selecting the

Turk J Hematol 2017;34:34-39

most representative slide. Tru-Cut biopsies and liver and spleen biopsy samples were excluded from this particular scoring. Immunohistochemical Studies For the detection of p53 protein in samples, immunohistochemical studies were performed on sections of 5 µm obtained from one representative block from each sample. All stainings were done automatically by using anti-p53 antibody (ScyTek, Logan, UT, USA; Clone: DO-7, Lot: 23081) and the iViewTM DAB Detection Kit (Ventana, Tucson, AZ, USA) on the Ventana Benchmark XT platform. Figure 2 demonstrates p53 staining of two representative cases. The p53 staining was scored semi-quantitatively as the percentage of nuclear-positive cells among all cells by selecting 10 random areas on each slide, counting at least 500 cells in each selected area, and calculating the mean of each individual value. Statistical Analysis Numeric variables were analyzed by their mean and minimummaximum values, while categorical variables were included in analysis as numbers and percentages. Categorical and continuous data were compared by the chi-square test (or Fisher exact test if required by sample size) and Mann-Whitney U test, respectively. The Spearman correlation coefficient was used for the comparison of two numeric variables. OS was calculated from diagnosis to the date of mortality of any reason. The patients who did not die were censored at the last followup for OS computation. Survival analyses were computed by

Figure 2. p53 expression detected by immunohistochemistry: A) a case with >90% p53 positivity; B) a case with 10% p53 positivity. 36

Kulaç İ, et al: TP53 Alterations in Chronic Lymphocytic Lymphoma Patients

Turk J Hematol 2017;34:34-39

the Kaplan-Meier method. Comparisons of survival rates were done by log-rank test. The statistical significance threshold was accepted as p<0.05. SPSS 15 (SPSS Inc., Chicago, IL, USA) was used for statistical analyses.

Results Clinical Findings Thirty-five (68.6%) of the patients were male and 16 (31.4%) were female. Mean overall follow-up time was 48.4 months (range: 1-135 months). Mean age of the patients at the time of diagnosis was 60.3 years (range: 41-83). At the time of the study, 11 patients were deceased due to events related to CLL. At the time of diagnosis, 4 patients were at Rai stage 0, 21 patients were at Rai stage 1, 5 patients were at Rai stage 2, 2 patients were at Rai stage 3, and 10 patients were at Rai stage 4. Due to a lack of clinical data we were not able to assess the Rai stage of 9 cases. Patients were divided into two groups according to their Rai stages at the time of diagnosis (“low stage” defined as Rai 0, 1, and 2; “high stage” defined as Rai 3 and 4) and survival analysis was performed between these two groups. As shown in Figure 3, patients with low Rai stages had better OS than patients with high Rai stages (p=0.030).

Although there seemed to be a trend for a relatively better outcome for patients with more prevalent PCs, this difference was not statistically significant (log rank, χ2=3.82, p=0.0508). Distribution of percentages of p53 staining is shown in Figure 4 (n=54). Correlation analysis between p53 expression and OS showed no statistically significant result (Spearman’s rho=0.55, p=0.701). Patients were also grouped into two categories according to their p53 scores, using the median value, as ≤5% and >5%. Survival analysis between these two groups did not show a statistically significant difference, as displayed in Figure 5 (log rank, χ2=0.08, p=0.7771). Five of the biopsies showed focal prolymphocytic transformation; while two of these biopsies showed no p53 staining, the other three had p53 scores of 15%, 60%, and 100%. Because the number of biopsies with transformation was small, statistical analysis could not be performed to evaluate the correlation of p53 alteration and prolymphocytic transformation.

Morphological and Immunohistochemical Findings Fifty of the 54 samples were from lymph node biopsies and the rest were from tonsil, liver, orbit, or spleen. Samples were evaluated and the percentages of the area of PCs were recorded using hematoxylin and eosin slides. The percentage of PCs as a continuous variable did not seem to have a relationship with the death rate. Another survival analysis was performed after dividing patients into two groups using a cut-off of 40%. 1.0

Figure 4. Distribution of p53 expression through biopsy samples. 1.0

Early RAI stage Advanced RAI stage

p53 expression ≥5%

0.8

Overall Survival

0.8

Overall Survival

p53 expression <5%

0.6

0.4

0.2

0.6

0.4

0.2

0.0

0.0 0.00

25.00

50.00

150.00

100.00

125.00

Time (months)

Figure 3. Kaplan-Meier graph of the survival of patients grouped by Rai stages.

0.00

25.00

50.00

150.00

100.00

125.00

Time (months)

Figure 5. Kaplan-Meier graph of the survival of patients grouped by p53 staining. 37

Kulaç İ, et al: TP53 Alterations in Chronic Lymphocytic Lymphoma Patients

Discussion CLL is a substantial health problem for the entire world, but specifically for developed countries as it is mainly a disease of the elderly. With the increase of overall life expectancy the number of CLL patients will increase accordingly. Although the vast majority of CLL patients remain in a dormant state, some will rapidly (and sometimes unexpectedly) progress and display an aggressive course. Some prognostic factors have been proposed over the years; among them, alterations in the TP53 gene (including cytogenetic alterations in chromosome 17) stand out as those with the most impact. Among clinical parameters, Rai staging seems to be a reliable and consistent indicator for CLL patients, and in our study, we also showed that advanced Rai stage is associated with a worse disease outcome. PCs in CLL are predominantly composed of larger cells with open chromatin, larger nuclei, and relatively prominent nucleoli. For years, researchers believed that the extent of PCs was associated with worse prognosis since PCs are metabolically and mitotically active zones. So far, however, only a limited number of studies showed findings that supported this hypothesis [18], while others usually failed to demonstrate a correlation between the extent of PCs and prognosis [19,20,21]. In our study, we also could not show a significant correlation. Larger cohorts are needed to clarify this issue. Studies in various tumor types showed variable patterns of p53 staining that correlated with alterations in TP53 at the genomic level. In one study, it was reported that >5% of p53 staining in hepatocellular carcinoma is a reliable surrogate marker for TP53 gene alterations [22]. In a different study published in 2011, Yemelyanova et al. showed that diffuse positivity of p53 staining in ovarian carcinoma cases is highly correlated with TP53 mutation [23]. Thus, setting a threshold for p53 positivity and enabling immunohistochemistry to reflect TP53 mutation requires a high number of cases and a more detailed analysis, but our sample size was not sufficient for such a comprehensive work-up. There are limited numbers of studies focusing on the immunohistochemical evaluation of p53 and clinical outcome in CLL patients. Schlette et al. showed that an extent of 40% or more p53 staining in bone marrow samples of CLL patients correlated with shorter survival [24]. One study by Cordone et al. showed that p53 positivity correlated with a shorter treatment-free interval using neoplastic lymphocytes obtained from peripheral blood and setting a cut-off of 1% of the lymphoid cells [25]. In our study, however, we could not show any significant correlation between p53 immunopositivity in the involved solid organ samples that could be due to problems in specimen handling, tissue fixation, and/or processing, or in 38

Turk J Hematol 2017;34:34-39

short all the steps of the pre-analytic phase of a biopsy. Another possible explanation is that solid organ samples are not as representative as circulating neoplastic cells in the peripheral circulation. Neoplastic cells, which reside in lymph nodes, might represent only a subset of the entire CLL population. In this study we also made a morphological observation that we thought could be interesting. The p53 positivity was stronger and more prevalent in prolymphocytic cells within the PCs compared to small lymphocytic cells. Although this raises the possibility that initial alterations might be originating from the PCs, this observation needs further investigation. There are some weaknesses of our study. We did the p53 scoring semi-quantitatively, although quantitative analysis using image analyzer software would provide a more precise evaluation of p53 expression. Another important point is that a sequence analysis of the p53 gene in the samples could be very helpful for correlation with p53 staining. Our samples were FFPE tissues and some were more than 10 years old, which makes obtaining a good quality of DNA almost impossible.

Conclusion In conclusion, our study is one of the first studies that aimed to assess the impact of p53 staining in solid organ biopsy samples and overall survival in CLL patients. Contrary to the wellconfirmed prognostic value of del17p in FISH analysis, TP53 immunohistochemistry does not have a similar impact. This finding should be confirmed with larger series. Acknowledgment This project was funded by the Hacettepe University Scientific Research Projects Coordination Center (Project No: 012 D09 101 003). Ethics Ethics Committee Approval: This study was approved by Hacettepe University Ethics Committee (Approval Number: 11/44-16); Informed Consent: This study was performed on archived tissue samples. There was no obligation for informed consent. Authorship Contributions Concept: İbrahim Kulaç, Çetin Demir, Yahya Büyükaşık, Tezer Kutluk, Ayşegül Üner; Design: İbrahim Kulaç, Çetin Demir, Yahya Büyükaşık, Tezer Kutluk, Ayşegül Üner; Data Collection or Processing: İbrahim Kulaç and Çetin Demir; Analysis or Interpretation: İbrahim Kulaç, Çetin Demir, Ayşegül Üner; Literature Search: İbrahim Kulaç; Writing: İbrahim Kulaç, Yahya Büyükaşık, Ayşegül Üner.

Turk J Hematol 2017;34:34-39

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

Kulaç İ, et al: TP53 Alterations in Chronic Lymphocytic Lymphoma Patients

as a predictor of response and survival in patients with chronic lymphocytic leukemia: results from the LRF CLL4 trial. J Clin Oncol 2011;29:2223-2229. 13. Badoux XC, Keating MJ, Wierda WG. What is the best frontline therapy for patients with CLL and 17p deletion? Curr Hematol Malig Rep 2011;6:36-46.

References

14. Döhner H, Stilgenbauer S, Benner A, Leupolt E, Kröber A, Bullinger L, Döhner K, Bentz M, Lichter P. Genomic aberrations and survival in chronic lymphocytic leukemia. N Engl J Med 2000;343:1910-1916.

1. Howlader N, Noone AM, Krapcho M, Garshell J, Miller D, Altekruse SF, Kosary CL, Yu M, Ruhl J, Tatalovich Z, Mariotto A, Lewis DR, Chen HS, Feuer EJ, Cronin KA (eds). SEER Cancer Statistics Review, 1975-2012. Bethesda, National Cancer Institute, 2013.

15. Döhner H, Fischer K, Bentz M, Hansen K, Benner A, Cabot G, Diehl D, Schlenk R, Coy J, Stilgenbauer S, Volkman M, Galle PR, Poustka A, Hunstein W, Lichter P. p53 gene deletion predicts for poor survival and non-response to therapy with purine analogs in chronic B-cell leukemias. Blood 1995;85:1580-1589.

2. Hallek M, Cheson BD, Catovsky D, Caligaris-Cappio F, Dighiero G, Döhner H, Hillmen P, Keating MJ, Montserrat E, Rai KR, Kipps TJ; International Workshop on Chronic Lymphocytic Leukemia. Guidelines for the diagnosis and treatment of chronic lymphocytic leukemia: a report from the International Workshop on Chronic Lymphocytic Leukemia updating the National Cancer Institute-Working Group 1996 guidelines. Blood 2008;111:5446-5456.

16. Lai YY, Huang XJ. Cytogenetic characteristics of B cell chronic lymphocytic leukemia in 275 Chinese patients by fluorescence in situ hybridization: a multicenter study. Chin Med J (Engl) 2011;124:2417-2422.

3. Gentile M, Cutrona G, Neri A, Molica S, Ferrarini M, Morabito F. Predictive value of β2-microglobulin (β2-m) levels in chronic lymphocytic leukemia since Binet A stages. Haematologica 2009;94:887-888.

18. Giné E, Martinez A, Villamor N, López-Guillermo A, Camos M, Martinez D, Esteve J, Calvo X, Muntañola A, Abrisqueta P, Rozman M, Rozman C, Bosch F, Campo E, Montserrat E. Expanded and highly active proliferation centers identify a histological subtype of chronic lymphocytic leukemia (“accelerated” chronic lymphocytic leukemia) with aggressive clinical behavior. Haematologica 2010;95:1526-1533.

4. Hallek M, Wanders L, Ostwald M, Busch R, Senekowitsch R, Stern S, Schick HD, Kuhn-Hallek I, Emmerich B. Serum β2-microglobulin and serum thymidine kinase are independent predictors of progression-free survival in chronic lymphocytic leukemia and immunocytoma. Leuk Lymphoma 1996;22:439-447. 5. Hallek M; German CLL Study Group. Prognostic factors in chronic lymphocytic leukemia. Ann Oncol 2008;19(Suppl 4):51-53. 6. Reinisch W, Willheim M, Hilgarth M, Gasché C, Mader R, Szepfalusi S, Steger G, Berger R, Lechner K, Boltz-Nitulescu G, Schwarzmeier JD. Soluble CD23 reliably reflects disease activity in B-cell chronic lymphocytic leukemia. J Clin Oncol 1994;12:2146-2152. 7. Pflug N, Bahlo J, Shanafelt TD, Eichhorst BF, Bergmann MA, Elter T, Bauer K, Malchau G, Rabe KG, Stilgenbauer S, Döhner H, Jäger U, Eckart MJ, Hopfinger G, Busch R, Fink AM, Wendtner CM, Fischer K, Kay NE, Hallek M. Development of a comprehensive prognostic index for patients with chronic lymphocytic leukemia. Blood 2014;124:49-62. 8. Zenz T, Frohling S, Mertens D, Döhner H, Stilgenbauer S. Moving from prognostic to predictive factors in chronic lymphocytic leukaemia (CLL). Best Pract Res Clin Haematol 2010;23:71-84. 9. Dunphy CH. Molecular Pathology of Hematolymphoid Diseases, 1st ed. New York, Springer, 2010. 10. Zenz T, Eichhorst B, Busch R, Denzel T, Häbe S, Winkler D, Bühler A, Edelmann J, Bergmann M, Hopfinger G, Hensel M, Hallek M, Döhner H, Stilgenbauer S. TP53 mutation and survival in chronic lymphocytic leukemia. J Clin Oncol 2010;28:4473-4479. 11. Zenz T, Kröber A, Scherer K, Häbe S, Bühler A, Benner A, Denzel T, Winkler D, Edelmann J, Schwänen C, Döhner H, Stilgenbauer S. Monoallelic TP53 inactivation is associated with poor prognosis in chronic lymphocytic leukemia: results from a detailed genetic characterization with long-term follow-up. Blood 2008;112:3322-3329. 12. Gonzalez D, Martinez P, Wade R, Hockley S, Oscier D, Matutes E, Dearden CE, Richards SM, Catovsky D, Morgan GJ. Mutational status of the TP53 gene

17. Tam CS, Shanafelt TD, Wierda WG, Abruzzo LV, Van Dyke DL, O’Brien S, Ferrajoli A, Lerner SA, Lynn A, Kay NE, Keating MJ. De novo deletion 17p13.1 chronic lymphocytic leukemia shows significant clinical heterogeneity: the M. D. Anderson and Mayo Clinic experience. Blood 2009;114:957-964.

19. Ciccone M, Agostinelli C, Rigolin GM, Piccaluga PP, Cavazzini F, Righi S, Sista MT, Sofritti O, Rizzotto L, Sabattini E, Fioritoni G, Falorio S, Stelitano C, Olivieri A, Attolico I, Brugiatelli M, Zinzani PL, Saccenti E, Capello D, Negrini M, Cuneo A, Pileri S. Proliferation centers in chronic lymphocytic leukemia: correlation with cytogenetic and clinicobiological features in consecutive patients analyzed on tissue microarrays. Leukemia 2012;26:499-508. 20. Asplund SL, McKenna RW, Howard MS, Kroft SH. Immunophenotype does not correlate with lymph node histology in chronic lymphocytic leukemia/ small lymphocytic lymphoma. Am J Surg Pathol 2002;26:624-629. 21. Garcia CF, Hunt KE, Kang H, Babb A, Gale JM, Vasef MA, Reichard KK. Most morphologic features in chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL) do not reliably predict underlying FISH genetics or immunoglobulin heavy chain variable region somatic mutational status. Appl Immunohistochem Mol Morphol 2010;18:119-127. 22. Lee SN, Park CK, Sung CO, Choi JS, Oh YL, Cho JW, Yoo BC. Correlation of mutation and immunohistochemistry of p53 in hepatocellular carcinomas in Korean people. J Korean Med Sci 2002;17:801-805. 23. Yemelyanova A, Vang R, Kshirsagar M, Lu D, Marks MA, Shih IM, Kurman RJ. Immunohistochemical staining patterns of p53 can serve as a surrogate marker for TP53 mutations in ovarian carcinoma: an immunohistochemical and nucleotide sequencing analysis. Mod Pathol 2011;24:1248-1253. 24. Schlette EJ, Admirand J, Wierda W, Abruzzo L, Lin KI, O’Brien S, Lerner S, Keating MJ, Tam C. p53 expression by immunohistochemistry is an important determinant of survival in patients with chronic lymphocytic leukemia receiving frontline chemo-immunotherapy. Leuk Lymphoma 2009;50:1597-1605. 25. Cordone I, Masi S, Mauro FR, Soddu S, Morsilli O, Valentini T, Vegna ML, Guglielmi C, Mancini F, Giuliacci S, Sacchi A, Mandelli F, Foa R. p53 expression in B-cell chronic lymphocytic leukemia: a marker of disease progression and poor prognosis. Blood 1998;91:4342-4349.

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0332 Turk J Hematol 2017;34:40-45

Evaluation of Endocrine Late Complications in Childhood Acute Lymphoblastic Leukemia Survivors: A Report of a Single-Center Experience and Review of the Literature Akut Lenfoblastik Lösemili Çocuklarda Endokrin Geç Komplikasyonların Değerlendirilmesi: Tek Merkez Deneyimi ve Literatür Derlemesi Cengiz Bayram1, Neşe Yaralı1, Ali Fettah1, Fatma Demirel2, Betül Tavil1, Abdurrahman Kara1, Bahattin Tunç1 1Ankara Children’s Hematology and Oncology Hospital, Clinic of Pediatric Hematology, Ankara, Turkey 2Private Doctor

Abstract

Öz

Objective: Improvement in long-term survival in patients with acute lymphoblastic leukemia (ALL) in childhood has led to the need for monitorization of treatment-related morbidity and mortality. In the current study, we aimed to evaluate endocrine side effects of treatment in ALL survivors who were in remission for at least 2 years. Materials and Methods: Sixty patients diagnosed with ALL, who were in remission for at least 2 years, were cross-sectionally evaluated for long-term endocrine complications. Results: The median age of the patients at the time of diagnosis, at the time of chemotherapy completion, and at the time of the study was 5 years (minimum-maximum: 1.7-13), 8 years (minimummaximum: 4.25-16), and 11.7 years (minimum-maximum: 7-22), respectively, and median follow-up time was 4 years (minimummaximum: 2-10.1). At least one complication was observed in 81.6% of patients. Vitamin D insufficiency/deficiency (46.6%), overweight/ obesity (33.3%), and dyslipidemia (23.3%) were the three most frequent endocrine complications. Other complications seen in our patients were hyperparathyroidism secondary to vitamin D deficiency (15%), insulin resistance (11.7%), hypertension (8.3%), short stature (6.7%), thyroid function abnormality (5%), precocious puberty (3.3%), and decreased bone mineral density (1.7%). There were no statistically significant correlations between endocrine complications and age, sex, and radiotherapy, except vitamin D insufficiency/deficiency, which was significantly more frequent in pubertal ALL survivors compared to prepubertal ALL survivors (57.5% and 25%, respectively, p=0.011). Conclusion: A high frequency of endocrine complications was observed in the current study. The high frequency of late effects necessitates long-term surveillance of this population to better understand the incidence of late-occurring events and the defining of high-risk features that can facilitate developing intervention strategies for early detection and prevention. Keywords: Acute lymphoblastic leukemia, Endocrine, Late effects, Children

Amaç: Akut lenfoblastik lösemili (ALL) hastalardaki sağ kalım oranlarının artışı, tedavi sonrası ortaya çıkan morbidite ve mortalite problemlerinin takip edilme ihtiyacını beraberinde getirmiştir. Çalışmamızda, en az iki yıldır remisyonda olan ALL’li hastalarda, tedavi sonrası ortaya çıkabilecek endokrin komplikasyonların değerlendirilmesi amaçlandı. Gereç ve Yöntemler: ALL tanısı ile tedavi almış ve tedavisi üzerinden en az iki yıl geçmiş ve remisyonda olan 60 hastada endokrin geç komplikasyonlar kesitsel olarak değerlendirildi. Bulgular: Hastaların tanı aldıkları andaki median yaşları 5 yıl (minimum-maksimum: 1,7-13), kemoterapi sonlandırıldığı andaki median yaşları 8 yıl (minimum-maksimum: 4,25-16), çalışma sırasındaki median yaşları ise 11,7 yıl (minimum-maksimum: 7-22) olarak tespit edildi. Hastaların tedavi sonrası median takip süresi ise 4 yıl (minimum-maksimum: 2-10,1) idi. Hastaların %81,6’sında en az bir endokrin komplikasyon geliştiği görüldü. D vitamini eksikliği/ yetersizliği (%46,6), obezite/fazla kiloluluk (%33,3) ve dislipidemi (%23,3) en sık gelişen üç komplikasyon olarak tespit edildi. D vitamini eksikliğine sekonder gelişen hiperparatiroidi (%15), insülin direnci (%11,7), hipertansiyon (%8,3), boy kısalığı (%6,7), tiroid fonksiyon bozukluğu (%5), puberte prekoks (%3,3) ve azalmış kemik mineral yoğunluğu (%1,7) gelişen diğer endokrin komplikasyonlardı. Hastalarda gelişen endokrin komplikasyonlar arasında cinsiyet, yaş, radyoterapi bakımından farklılık saptanmaz iken, D vitamini yetersizliği/eksikliği saptanan hasta sayısı pubertal grupta, prepubertal gruba göre anlamlı derecede fazlaydı (%57,5 ve %25, sırasıyla, p=0,011). Sonuç: Çalışmamızda yüksek oranda endokrin komplikasyon saptandı. Bu komplikasyonlar, geç yan etkilerin ortaya çıkmasına neden olabilecek yüksek risk özellikleri ve sıklığı tanımlayabilmek, erken tanı ve önleyici stratejileri geliştirmek açısından hastaların uzun dönem izlenmelerini gerektirmektedir. Anahtar Sözcükler: Akut lenfoblastik lösemi, Endokrin, Geç yan etkiler, Çocuk

Address for Correspondence/Yazışma Adresi: Cengiz BAYRAM, M.D., Ankara Children’s Hematology and Oncology Hospital, Clinic of Pediatric Hematology, Ankara, Turkey Phone : +90 505 839 60 92 E-mail : cengizbayram2013@gmail.com

Received/Geliş tarihi: September 21, 2015 Accepted/Kabul tarihi: November 18, 2015

Turk J Hematol 2017;34:40-45

Introduction Despite the increase in the prevalence of childhood malignancies, the 5-year survival rate for acute lymphoblastic leukemia (ALL) in childhood has approached 90% as a result of advances in chemotherapy and supportive care. This increase in survival has increased the importance of long-term treatment-related morbidity and mortality [1]. One of the consequences of cancer or its therapy is that many long-term survivors of childhood cancer are at an increased risk of developing chronic physical or psychosocial problem [2]. It is estimated that about two-thirds of cancer survivors will experience at least one late adverse effect and more than 40% may have a severe, disabling, or lifethreatening condition or may die 30 years after the cancer is diagnosed [3]. There have been numerous chemotherapy agents used for the treatment of ALL; however, a few of them have been implicated as causing late effects, including anthracyclines (e.g., doxorubicin, daunorubicin), oxazaphosphorine alkylating agents (e.g., cyclophosphamide), corticosteroids (e.g., prednisone, dexamethasone), and high-dose methotrexate [2]. The adverse effects of prophylactic cranial irradiation, including acute neurotoxicity, neurocognitive deficits, endocrinopathies, secondary malignant disease, and excess late mortality, have led to its reduction or elimination from treatment protocols for ALL [4,5,6]. Endocrine complications during therapy for ALL include bone demineralization, disordered growth, adrenocortical insufficiency, diabetes mellitus, the syndrome of inappropriate secretion of antidiuretic hormone, and changes in thyroid hormone concentration, whereas late complications, those that occur after completion of all radiation and chemotherapy, include bone demineralization, short stature, growth hormone deficiency, obesity, hypothyroidism, gonadal dysfunction, and infertility [7]. The present study aimed to evaluate long-term endocrine complications in ALL survivors that were in remission for at least 2 years.

Materials and Methods Sixty patients diagnosed with ALL between January 2003 and February 2009 at the Pediatric Hematology Clinic of Ankara Children’s Hematology and Oncology Education and Research Hospital, who were in remission for at least 2 years, were included in the study and were evaluated cross-sectionally. All patients with ALL were treated according to the St. Jude TotalXIIIA protocol [8] and received 12 or 18 cGy cranial radiotherapy (CRT) as a part of prophylaxis or treatment as appropriate. Pubertal status was assessed at the time of the study using Tanner staging and patients were divided into two groups as pubertal or prepubertal. Body weight and height were measured and evaluated according to Turkish children’s growth data [9].

Bayram C, et al: Endocrine Late Complications in Childhood Leukemia Survivors

Body mass index (BMI) was calculated as weight in kilograms divided by the square of the height in meters. Overweight was defined as BMI for age and sex between the 85th and 95th percentiles, and BMI for age and sex higher than the 95th percentile was defined as obesity. Hormonal analysis was carried out by the chemiluminescence method using a BIO-DPC hormone autoanalyzer with commercial kits, and a Roche/Hitachi Modular P Chemistry Analyzer was used for biochemical analysis. Serum lipid profiles, including cholesterol, triglyceride, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), and blood glucose, were obtained after at least 8 h of fasting. Dyslipidemia was defined as cholesterol of >200 mg/dL, or triglyceride of >150 mg/dL, or LDL-C of >130 mg/dL, or HDL-C of <40 [10]. The homeostasis model assessment (HOMA) score was calculated using the following formula: [fasting glucose (mmol/L) × insulin (mmol/L)]/22.5. A HOMA score above 2.5 for prepubertal patients and above 3.2 for pubertal patients was accepted as evidence of insulin resistance [11,12]. Metabolic syndrome was defined as the presence of three or more of the following: 1) hypertension, 2) glucose intolerance, 3) hypertriglyceridemia, 4) decreased HDL level, and 5) central abdominal obesity [13]. Low free thyroxine (T4) and thyroid-stimulating hormone (TSH) level of >10 µU/mL with clinical symptoms were defined as hypothyroidism, and normal free T4 level and TSH level between 5 and 10 µU/mL without clinical symptoms were defined as subclinical (compensated) hypothyroidism [14]. Parathyroid hormone (PTH) values between 6 and 65 pg/mL were accepted as normal. High PTH levels with vitamin D deficiency were diagnosed as “secondary hyperparathyroidism”. Patients having hypocalcemia, hyperphosphatemia, and decreased PTH levels were diagnosed with “primary hypoparathyroidism”. Serum adrenocorticotropic hormone (ACTH) and cortisol levels were simultaneously measured at 09:00 hours. ACTH levels between 7 and 28 pg/mL for prepubertal children and between 2 and 49 pg/mL for postpubertal children were accepted as normal. Cortisol levels between 8 and 22 µg/dL were accepted as normal, whereas <8 µg/dL was accepted as adrenal insufficiency [15]. Serum 25-OH-vitamin D levels less than 15 ng/mL were diagnosed as a sign of vitamin D deficiency (normal: 20-100 ng/mL) and values between 15 and 20 ng/mL were considered as vitamin D insufficiency [16]. Bone mineral density (BMD) was measured by using dual energy X-ray absorptiometry from the L1-L4 lumbar vertebrae and was assessed according to bone ages appropriately for Turkish children’s data [17]. Ageand sex-adjusted Z-scores of less than -2 were considered as evidence of decreased BMD. The study was approved by the hospital ethics committee, and informed consent was obtained from the parents of all participating subjects. 41

Bayram C, et al: Endocrine Late Complications in Childhood Leukemia Survivors

Continuous variables are expressed as median (minimummaximum) and categorical variables as number (percentage). The clinical parameters and laboratory values of the patients were evaluated using the chi-square method and Student’s t-test, as appropriate. All statistical tests were two-sided and p<0.05 was considered statistically significant. Statistical analysis was performed using SPSS 18.0 for Windows (SPSS Inc., Chicago, IL, USA).

Results Of the 60 ALL survivors, 31 (51.7%) were male and 29 (48.3%) were female. Fifty-five patients (91.7%) were diagnosed with pre-B-cell ALL and five (8.3%) were diagnosed with T-cell ALL. Overall, 21 patients (35%) received 12 or 18 cGy CRT as a part of prophylaxis or treatment as appropriate. The median age of the patients at the time of diagnosis, at the time of chemotherapy completion, and at the time of the study was 5 years (minimummaximum: 1.7-13), 8 years (minimum-maximum: 4.25-16), and 11.7 years (minimum-maximum: 7-22), respectively, and median follow-up time was 4 years (minimum-maximum: 2-10.1). Demographic data of patients are summarized in Table 1. One or more adverse events occurred in 81.6% of the 60 ALL survivors; 25 patients (41.6%) had one endocrine complication, 17 patients (28.3%) had two endocrine complications, 5 patients (8.3%) had three endocrine complications, and 2 patients (3.3%) had four endocrine complications. Vitamin D insufficiency/deficiency (46.6%), overweight/obesity (33.3%), and dyslipidemia (23.3%) were the three most frequent endocrine complications, followed by hyperparathyroidism Table 1. Patient characteristics. Sex, n (%)

Male

31 (51.7)

Female

29 (48.3)

Leukemia type, n (%)

B-cell

55 (91.7)

T-cell

5 (8.3)

Median age, years (minimum-maximum)

At the time of diagnosis

5 (1.7-13)

At the time of chemotherapy completion

8 (4.25-16)

At the time of the study

11.7 (7-22)

Median follow-up time, years (range)

4 (2-10.1)

Chemotherapy protocol, n (%)

St. Jude Total-XIIIA protocol Cranial radiotherapy, n (%)

60 (100)

CRT+

21 (35)

CRT-

39 (65)

CRT+: Received cranial radiotherapy, CRT-: did not receive cranial radiotherapy.

Turk J Hematol 2017;34:40-45

secondary to vitamin D deficiency (15%), insulin resistance (11.7%), hypertension (8.3%), short stature (6.7%), thyroid function abnormality (5%), precocious puberty (3.3%), and decreased BMD (1.7%). There were no patients diagnosed with adrenal insufficiency, as serum ACTH and cortisol levels were within the normal ranges for all patients (Table 2). There were four patients (6.6%) with three components of metabolic syndrome, seven patients (11.6%) with two components of metabolic syndrome, and 18 patients (30%) with one component of metabolic syndrome. Of the seven patients with insulin resistance, five had overweight or obesity, and two patients had normal BMI. In the present study, long-term endocrine complications in 60 ALL survivors were also assessed with respect to age (<5 years versus >5 years), sex (male versus female), pubertal status (pubertal versus prepubertal), and either CRT administered or not. No significant differences were observed with respect to age, sex, and cranial radiotherapy, whereas vitamin D insufficiency/deficiency was significantly more frequent in pubertal ALL survivors (57.5%) as compared to prepubertal ALL survivors (25%) (Table 3).

Discussion Despite the increase in the prevalence of childhood cancer, with a 0.6% increase in incidence rates for all childhood cancers noted during 1975-2002, a reduction in the mortality rate has been achieved through multimodal chemotherapy and enhanced supportive care [18]. However, as a consequence of treatment-related complications, recurrence of primary cancer, and subsequent malignancies, approximately two-thirds of this population is reported to have one or more late adverse effects [18,19,20,21]. In concordance with previous reports, one or more adverse events occurred in 81.6% of the present study’s ALL survivors. Vitamin D insufficiency/deficiency (46.6%) was the most frequent endocrine complication in the current study. ALL survivors are at increased risk of developing Table 2. Endocrine complications. Endocrine complications, n (%)

n=60

Vitamin D insufficiency/deficiency

28 (46.6)

Overweight/obesity

20 (33.3)

Dyslipidemia

14 (23.3)

Hyperparathyroidism secondary to vitamin D deficiency

9 (15)

Insulin resistance

7 (11.7)

Hypertension

5 (8.3)

Short stature

4 (6.6)

Thyroid function abnormality

3 (5)

Precocious puberty

2 (3.3)

Decreased bone mineral density

1 (1.7)

Bayram C, et al: Endocrine Late Complications in Childhood Leukemia Survivors

Turk J Hematol 2017;34:40-45

Table 3. Correlation between endocrine complications and pubertal status. Endocrine complications, n (%)

Total (n=60)

Pubertal (n=40)

Prepubertal (n=20)

Vitamin D insufficiency/deficiency

28 (46.6)

23 (57.5)

5 (25)

0.011*

Overweight/obesity

20 (33.3)

12 (30)

8 (40)

0.439

Dyslipidemia

14 (23.3)

10 (25)

4 (20)

0.666

Hyperparathyroidism secondary to vitamin D deficiency

9 (15)

7 (17.9)

2 (10)

0.443

Insulin resistance

7 (11.7)

5 (12.5)

2 (10)

0.591

Hypertension

5 (8.3)

4 (10)

1 (5)

0.509

Short stature

4 (6.6)

2 (5)

2 (10)

0.464

Thyroid function abnormality

1 (1.7)

2 (5)

1 (5)

*Significant.

BMD deficits compared to the general population, associated with their treatment, including high cumulative doses of steroids/methotrexate and radiation therapy. Because vitamin D has a positive influence on calcium balance for building bone and attaining peak bone mass, vitamin D deficiency or insufficiency can contribute to BMD deficit [22]. The prevalence of 25-hydroxyvitamin D (25-OH-D) insufficiency is reported to be 14-49% in the general population and was reported to be between 33.5% and 40% in healthy Turkish children and adolescents in two recent studies [23,24,25,26]. In a recent study of 484 childhood cancer survivors, 17.6% of whom had leukemia, Choudhary et al. reported a prevalence of 29% of 25-OH-D insufficiency, and the risk factors for 25-OH-D insufficiency were race, pubertal status, and seasonality [27]. The prevalence of 25-OH-D deficiency or insufficiency was 46.6% in our study, which was higher than in the latter study and two recent studies from Turkey but similar to what has been described in the general population. Pubertal status was the only significant risk factor in the present study, while 23 of 28 patients (82.1%) with 25-OH-D deficiency or insufficiency were pubertal ALL survivors. Forty percent of bone mass is obtained during puberty, and by the end of puberty, 90% of total adult bone mass has already been acquired in the normal population [22]. In this regard, in addition to chemotherapy agents and radiation therapy, 25-OH-D deficiency or insufficiency can additionally contribute to failure to recover to a normal BMD after completion of therapy, and thus surveillance and intervention strategies should also include assessment of 25OH-D levels during puberty. Overweight or obesity has been identified as a potential late adverse effect of therapy in childhood ALL survivors [2,3]. The largest study evaluating the risk of being overweight in ALL survivors was conducted by the Childhood Survivor Cancer Study. That study showed that survivors who received greater than 20 Gy CRT were significantly more likely than their siblings to be overweight, and female survivors treated before the age of 4 years were also more likely to be overweight in comparison with siblings [28]. Studies about the risk of being overweight

or obese in ALL survivors have conflicting results. In a study of 618 ALL survivors, reported by Dalton et al., they found that children treated before the age of 13 years had a significant decrease in their height z-scores and an increase in their BMI z-scores, regardless of cranial radiation therapy [29]. Razzouk et al. observed that young age (<6 years) and overweight/obesity at diagnosis were the best predictors of obesity at adult height in a study of 456 childhood ALL and lymphoma survivors, 431 of whom had ALL [30]. That study further concluded that BMI weight category at diagnosis, rather than type of CNS treatment received, predicted adult weight in long-term survivors of childhood hematologic malignancies. Zhang et al. reported that weight status at diagnosis and BMI z-score at diagnosis were both significant predictors for being overweight/obese at the end of treatment in pediatric ALL survivors [31]. They found that patients who were overweight/obese at diagnosis were 11.9 times more likely to be overweight/obese at the end of treatment than those who were underweight or had healthy weight at diagnosis. Moreover, sex, receiving CRT, and age at diagnosis were not significant predictors of BMI z-score in survivors of pediatric ALL during or after treatment. In the present study, we also did not observe any significant correlation between the risk of being overweight or obese and age at diagnosis, CRT, and sex. Additionally, Asner et al. showed an association between abnormal maternal BMI and overweight/obesity in long-term survivors of childhood ALL, except for overweight/obesity at diagnosis, while age at diagnosis, sex, cumulative dose of steroids, and paternal BMI showed no association [32]. In a previous study of 33 ALL survivors, 25 of whom were female, it was found that 56% of female survivors were obese and 59% of them had an obese mother [33]. Considering the risk of longterm excessive weight gain in childhood ALL survivors including overweight/obesity at diagnosis and abnormal maternal BMI, rather than CRT, corticosteroids, age at diagnosis, and sex, the patientâ&#x20AC;&#x2122;s familial and genetic characteristics are likely to be risk factors leading to overweight/obesity for this population. ALL survivors are reported to have a 4-fold excess risk of mortality secondary to cardiovascular events compared to the 43

Bayram C, et al: Endocrine Late Complications in Childhood Leukemia Survivors

general population. In addition to cardiomyopathy associated with anthracyclines, ALL survivors have also been shown to have atherosclerotic disease, which led to an investigation of conventional risk factors for cardiovascular disease including diabetes mellitus, dyslipidemia, obesity, and metabolic syndrome [13]. In the present study, the second and third most common endocrine complications were overweight/obesity (33.3%) and dyslipidemia (23.3%), whereas insulin resistance (11.7%) and hypertension (8.3%) were the fourth and fifth most common endocrine complications. Because childhood ALL survivors will be young at the time of completion of treatment, as in the present study (median age: 11.7 years), many treatment-related adverse events may not become clinically apparent until the survivor gets older in the context of cardiovascular disease development, and thus preventive strategies including medical interventions and lifestyle modifications such as eating a healthful diet, regular physical activity, and avoiding cancer-associated habits including smoking or excessive alcohol consumption can help reduce the risk factors leading to cardiovascular late events. ALL survivors treated with conventional CRT doses do not usually develop other central endocrinopathies, such as central adrenal insufficiency, hyperprolactinemia, gonadotropin insufficiency, or central (secondary) hypothyroidism. However, primary hypothyroidism can occur after cranial, craniospinal, and total body irradiation because of direct exposure of the thyroid gland to radiation, even at low doses [2]. Precocious puberty is another late effect of CRT in doses of 18 to 24 Gy, and it is more common in girls. However, most female ALL survivors experience menarche at a normal age, which was confirmed in two large cohorts [34,35]. Reduction or elimination of CRT in treatment of childhood ALL in recent protocols is another reason for favorable outcome in the context of central endocrinopathy development [4,5,6]. In the present study, there were no patients diagnosed with adrenal insufficiency, and the frequency of patients with hypothyroidism and subclinical hypothyroidism (compensated) was 1.7% and 3.3%, respectively. Only two of 60 ALL survivors developed precocious puberty; both were girls and one received CRT.

Conclusion In conclusion, a high frequency of endocrine long-term adverse events occurred in the current study. In achieving >90% of 5-year survival rates for children with ALL diagnosed at 14 years of age or younger, there has been an increase in the number of children and adolescents cured of ALL. In this context, considering the high prevalence of late adverse effects as a consequence of ALL or its therapy as compared to the general population, long-term surveillance of this population is important to better understand the incidence of late-occurring events and define high-risk features that can facilitate the development of intervention strategies for early detection and 44

Turk J Hematol 2017;34:40-45

prevention, which can lead to an improvement of care and quality of life for this growing population. Ethics Ethics Commitee Approval: The research has been approved by Ankara Children’s Hematology and Oncology Hospital’s ethics commitee (approval number 2013-051) and informed consent was obtained from the parents of the patients. The manuscript has been seen and approved by all of the authors. Author Contributions Concept: Cengiz Bayram, Neşe Yaralı, Betül Tavil; Design: Cengiz Bayram, Neşe Yaralı, Betül Tavil, Fatma Demirel; Data Collection or Processing: Cengiz Bayram, Neşe Yaralı, Ali Fettah, Fatma Demirel; Analysis or Interpretation: Cengiz Bayram, Neşe Yaralı, Ali Fettah, Fatma Demirel; Literature Search: Cengiz Bayram, Neşe Yaralı, Ali Fettah, Fatma Demirel, Betül Tavil, Abdurrahman Kara, Bahattin Tunç; Writing: Cengiz Bayram, Neşe Yaralı, Ali Fettah, Fatma Demirel, Betül Tavil, Abdurrahman Kara, Bahattin Tunç. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Ness KK, Armenian SH, Kadan-Lottick N, Gurney JG. Adverse effects of treatment in childhood acute lymphoblastic leukemia: general overview and implications for long-term cardiac health. Expert Rev Hematol 2011;4:185197. 2. Nathan PC, Wasilewski-Masker K, Janzen LA. Long-term outcomes in survivors of childhood acute lymphoblastic leukemia. Hematol Oncol Clin North Am 2009;23:1065-1082. 3. Shankar SM, Marina N, Hudson MM, Hodgson DC, Adams MJ, Landier W, Bhatia S, Meeske K, Chen MH, Kinahan KE, Steinberger J, Rosenthal D; Cardiovascular Disease Task Force of the Children’s Oncology Group. Monitoring for cardiovascular disease in survivors of childhood cancer: report from the Cardiovascular Disease Task Force of the Children’s Oncology Group. Pediatrics 2008;121:e387-396. 4. Inaba H, Greaves M, Mullighan CG. Acute lymphoblastic leukaemia. Lancet 2013;381:1943-1955. 5. Veerman AJ, Kamps WA, van den Berg H, van den Berg E, Bökkerink JP, Bruin MC, van den Heuvel-Eibrink MM, Korbijn CM, Korthof ET, van der Pal K, Stijnen T, van Weel Sipman MH, van Weerden JF, van Wering ER, van der Does-van den Berg A; Dutch Childhood Oncology Group. Dexamethasonebased therapy for childhood acute lymphoblastic leukaemia: results of the prospective Dutch Childhood Oncology Group (DCOG) protocol ALL-9 (1997-2004). Lancet Oncol 2009;10:957-966. 6. Pui CH, Campana D, Pei D, Bowman WP, Sandlund JT, Kaste SC, Ribeiro RC, Rubnitz JE, Raimondi SC, Onciu M, Coustan-Smith E, Kun LE, Jeha S, Cheng C, Howard SC, Simmons V, Bayles A, Metzger ML, Boyett JM, Leung W, Handgretinger R, Downing JR, Evans WE, Relling MV. Treating childhood acute lymphoblastic leukemia without cranial irradiation. N Engl J Med 2009;360:2730-2741. 7. Howard SC, Pui CH. Endocrine complications in pediatric patients with acute lymphoblastic leukemia. Blood Rev 2002;16:225-243.

Turk J Hematol 2017;34:40-45

8. Pui CH, Boyett JM, Rivera GK, Hancock ML, Sandlund JT, Ribeiro RC, Rubnitz JE, Behm FG, Raimondi SC, Gajjar A, Razzouk B, Campana D, Kun LE, Relling MV, Evans WE. Long-term results of Total Therapy studies 11, 12 and 13A for childhood acute lymphoblastic leukemia at St Jude Children’s Research Hospital. Leukemia 2000;14:2286-2294. 9. Neyzi O, Furman A, Bundak R, Gunoz H, Darendeliler F, Bas F. Growth references for Turkish children aged 6 to 18 years. Acta Paediatr 2006;95:1635-1641. 10. William AN. Disorders of lipoprotein metabolism and transport. In: Kliegman RM, Stanton BF, St. Geme JW, Schor NF, Behrman RE, (eds). Nelson Textbook of Pediatrics, 19th ed. Philadelphia, Elsevier Saunders, 2011. 11. Kurtoğlu S, Hatipoğlu N, Mazıcıoğlu M, Kendirici M, Keskin M, Kondolot M. Insulin resistance in obese children and adolescents: HOMA-IR cut-off levels in the prepubertal and pubertal periods. J Clin Res Pediatr Endocrinol 2010;2:100-106. 12. Keskin M, Kurtoglu S, Kendirci M, Atabek ME, Yazici C. Homeostasis model assessment is more reliable than the fasting glucose/insulin ratio and quantitative insulin sensitivity check index for assessing insulin resistance among obese children and adolescents. Pediatrics 2005;115:e500-503. 13. Nottage KA, Ness KK, Li C, Srivastava D, Robison LL, Hudson MM. Metabolic syndrome and cardiovascular risk among long-term survivors of acute lymphoblastic leukaemia - from the St. Jude Lifetime Cohort. Br J Haematol 2014;165:364-374. 14. Canaris GJ, Manowitz NR, Mayor G, Ridgway EC. The Colorado Thyroid Disease Prevalence Study. Arch Int Med 2000;160:526-534. 15. Greenspan FS. Greenspan’s Basic & Clinical Endocrinology, 9th ed. New York, McGraw-Hill Medical, 2011. 16. Misra M, Pacaud D, Petryk A, Collett-Solberg PF, Kappy M; Drug and Therapeutics Committee of the Lawson Wilkins Pediatric Endocrine Society. Vitamin D deficiency in children and its management: review of current knowledge and recommendations. Pediatrics 2008;122:398-417. 17. Goksen D, Darcan S, Coker M, Kose T. Bone mineral density of healthy Turkish children and adolescents. J Clin Densitom 2006;9:84-90. 18. Haddy TB, Mosher RB, Reaman GH. Late effects in long-term survivors after treatment for childhood acute leukemia. Clin Pediatr (Phila) 2009;48:601608. 19. Oeffinger KC, Mertens AC, Sklar CA, Kawashima T, Hudson MM, Meadows AT, Friedman DL, Marina N, Hobbie W, Kadan-Lottick NS, Schwartz CL, Leisenring W, Robison LL; Childhood Cancer Survivor Study. Chronic health conditions in adult survivors of childhood cancer. N Engl J Med 2006;355:1572-1582. 20. Geenen MM, Cardous-Ubbink MC, Kremer LC, van den Bos C, van der Pal HJ, Heinen RC, Jaspers MW, Koning CC, Oldenburger F, Langeveld NE, Hart AA, Bakker PJ, Caron HN, van Leeuwen FE. Medical assessment of adverse health outcomes in long-term survivors of childhood cancer. JAMA 2007;297:2705-2715.

Bayram C, et al: Endocrine Late Complications in Childhood Leukemia Survivors

21. Blaauwbroek R, Groenier KH, Kamps WA, Meyboom-de Jong B, Postma A. Late effects in adult survivors of childhood cancer: the need for life-long follow-up. Ann Oncol 2007;18:1898-1902. 22. Wasilewski-Masker K, Kaste SC, Hudson MM, Esiashvili N, Mattano LA, Meacham LR. Bone mineral density deficits in survivors of childhood cancer: long-term follow-up guidelines and review of the literature. Pediatrics 2008;121:e705-e713. 23. Looker AC, Dawson-Hughes B, Calvo MS, Gunter EW, Sahyoun NR. Serum 25-hydroxyvitamin D status of adolescents and adults in two seasonal subpopulations from NHANES III. Bone 2002;30:771-777. 24. Saintonge S, Bang H, Gerber LM. Implications of a new definition of vitamin D deficiency in a multiracial US adolescent population: the National Health and Nutrition Examination Survey III. Pediatrics 2009;123:797-803. 25. Akman AO, Tumer L, Hasanoglu A, Ilhan M, Caycı B. Frequency of vitamin D insufficiency in healthy children between 1 and 16 years of age in Turkey. Pediatr Int 2011;53:968-973. 26. Andıran N, Çelik N, Akça H, Doğan G. Vitamin D deficiency in children and adolescents. J Clin Res Pediatr Endocrinol 2012;4:25-29. 27. Choudhary A, Chou J, Heller G, Sklar C. Prevalence of vitamin D insufficiency in survivors of childhood cancer. Pediatr Blood Cancer 2013;60:1237-1239. 28. Oeffinger KC, Mertens AC, Sklar CA, Yasui Y, Fears T, Stovall M, Vik TA, Inskip PD, Robison LL; Childhood Cancer Survivor Study. Obesity in adult survivors of childhood acute lymphoblastic leukemia: a report from the Childhood Cancer Survivor Study. J Clin Oncol 2003;21:1359-1365. 29. Dalton VK, Rue M, Silverman LB, Gelber RD, Asselin BL, Barr RD, Clavell LA, Hurwitz CA, Moghrabi A, Samson Y, Schorin M, Tarbell NJ, Sallan SE, Cohen LE. Height and weight in children treated for acute lymphoblastic leukemia: relationship to CNS treatment. J Clin Oncol 2003;21:2953-2960. 30. Razzouk BI, Rose SR, Hongeng S, Wallace D, Smeltzer MP, Zacher M, Pui CH, Hudson MM. Obesity in survivors of childhood acute lymphoblastic leukemia and lymphoma. J Clin Oncol 2007;25:1183-1189. 31. Zhang FF, Rodday AM, Kelly MJ, Must A, MacPherson C, Roberts SB, Saltzman E, Parsons SK. Predictors of being overweight or obese in survivors of pediatric acute lymphoblastic leukemia (ALL). Pediatr Blood Cancer 2014;61:1263-1269. 32. Asner S, Ammann RA, Ozsahin H, Beck-Popovic M, von der Weid NX. Obesity in long-term survivors of childhood acute lymphoblastic leukemia. Pediatr Blood Cancer 2008;51:118-122. 33. Shaw MP, Bath LE, Duff J, Kelnar CJ, Wallace WH. Obesity in leukemia survivors: the familial contribution. Pediatr Hematol Oncol 2000;17:231-237. 34. Mills JL, Fears TR, Robison LL, Nicholson HS, Sklar CA, Byrne J. Menarche in a cohort of 188 long-term survivors of acute lymphoblastic leukemia. J Pediatr 1997;131:598-602. 35. Chow EJ, Friedman DL, Yasui Y, Whitton JA, Stovall M, Robison LL, Sklar CA. Timing of menarche among survivors of childhood acute lymphoblastic leukemia: a report from the Childhood Cancer Survivor Study. Pediatr Blood Cancer 2008;50:854-858.

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0411 Turk J Hematol 2017;34:46-51

FLAG Regimen with or without Idarubicin in Children with Relapsed/Refractory Acute Leukemia: Experience from a Turkish Pediatric Hematology Center Nüks/Refrakter Akut Lösemili Çocuklarda İdarubisin Eklenerek veya Eklenmeden FLAG Tedavisi: Bir Türk Pediatrik Hematoloji Merkezi Deneyimi Şebnem Yılmaz Bengoa, Eda Ataseven, Deniz Kızmazoğlu, Fatma Demir Yenigürbüz, Melek Erdem, Hale Ören Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey

Abstract

Öz

Objective: The optimal therapy to achieve higher rates of survival in pediatric relapsed/refractory acute leukemia (AL) is still unknown. In developing countries, it is difficult to obtain some of the recent drugs for optimal therapy and mostly well-known drugs proven to be effective are used. We assessed the efficacy of the combination of fludarabine, high-dose cytarabine, and granulocyte colonystimulating factor (FLAG regimen) with or without idarubicin (IDA) in children with relapsed/refractory acute lymphoblastic leukemia and acute myeloid leukemia.

Amaç: Nüks/refrakter akut lösemili (AL) çocuklarda daha yüksek sağkalımı sağlayabilecek en uygun tedavi yaklaşımı halen bilinmemektedir. Gelişmekte olan ülkelerde bu hasta grubunda etkin olduğu iyi bilinen ve yakın zamanda geliştirilmiş bazı ilaçlara ulaşımda güçlük yaşanmaktadır. Biz relaps/refrakter akut lenfoblastik lösemili ve akut miyeloid lösemili çocuklarda idarubisin (İDA) eklenmiş veya eklenmemiş, fludarabin, yüksek doz sitarabin ve granülosit koloni stimüle edici faktör (FLAG tedavisi) kombinasyonunun etkinliğini değerlendirdik.

Materials and Methods: Between September 2007 and May 2015, 18 children with refractory/relapsed AL attending our center, treated with a FLAG regimen with or without IDA, were included. The primary end point was the remission status of the bone marrow sampled after the first/second course of chemotherapy. The second end point was the duration of survival after hematopoietic stem cell transplantation (HSCT). Results: Complete remission (CR) was achieved in 7 patients (38.8%) after the first cycle, and at the end of the second cycle the total number of patients in CR was 8 (42.1%). All patients in CR underwent HSCT. The CR rate in patients who had IDA in combination therapy was 28.6%, and it was 50% in patients treated without IDA (p=0.36). Mean survival duration in transplanted patients was 24.7±20.8 months (minimum-maximum: 2-70, median: 25 months), and it was 2.7±1.64 months (minimum-maximum: 0-5, median: 3 months) in nontransplanted patients. Five of them (27.7%) were still alive at the end of the study and in CR. The median time of follow-up for these patients was 33 months (minimum-maximum: 25-70 months).

Gereç ve Yöntemler: Çalışmaya Eylül 2007 ve Mayıs 2015 arasında merkezimizde izlenen, İDA eklenmiş veya eklenmemiş FLAG tedavisi verilen, 18 relaps/refrakter AL’li çocuk dahil edilmiştir. Birincil sonlanım noktası kemoterapi sonrası alınan kemik iliği örneğinin remisyon durumu ve ikinci sonlanım noktası ise hematopoetik kök hücre nakli (HKHN) sonrası sağkalım süresi olarak belirlenmiştir. Bulgular: Çocukların yedisinde (%38,8) ilk siklus, toplam olarak sekizinde (%42,1) ise ikinci siklus sonrasında tam remisyon (TR) elde edildi. TR’deki tüm hastalara HKHN yapıldı. Kombinasyon tedavisine IDA eklenmiş olan hastalarda TR oranı %28,6, İDA eklenmemiş olanlarda %50 idi (p=0,36). HKHN yapılmış hastalarda ortalama sağkalım süresi 24,7±20,8 ay (minimum-maksimum: 2-70, medyan: 25 ay), yapılmamış olanlarda 2,7±1,64 ay (minimum-maksimum: 0-5, medyan: 3 ay) idi. Bu hastaların beşi (%27,7) halen sağ ve TR’dedir. Yaşayan hastaların median izlem süresi 33 ay (minimum-maksimum: 25-70 ay) idi.

Conclusion: FLAG regimens with or without IDA produced a CR of >24 months in 27.7% of children with relapsed/refractory AL and can be recommended as therapeutic options prior to HSCT in developing countries.

Sonuç: IDA eklenmiş veya eklenmemiş FLAG tedavisi nüks/refrakter AL’li çocukların %27,7’sinde 24 aydan daha uzun süreli sağkalım sağlamıştır ve gelişmekte olan ülkelerde HKHN öncesi tedavi seçeneği olarak önerilebilir.

Keywords: Relapsed/refractory Chemotherapy, Childhood

Anahtar Sözcükler: Nüks/refrakter lösemi, FLAG tedavisi, Kemoterapi, Çocukluk çağı

leukemia,

FLAG

regimen,

Address for Correspondence/Yazışma Adresi: Şebnem YILMAZ BENGOA, M.D., Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey Phone : +90 505 5252163 E-mail : sebnemyilmaz14@yahoo.com

Received/Geliş tarihi: November 30, 2015 Accepted/Kabul tarihi: December 25, 2015

Turk J Hematol 2017;34:46-51

Introduction Despite the improved prognosis in pediatric acute leukemias (ALs), survival rates are low for patients with relapsed or refractory disease [1,2]. Treatment approaches for these patients are not uniform. Effective reinduction regimens are needed and it has been shown that hematopoietic stem cell transplantation (HSCT) can offer long survival times [2,3]. In developing countries, it is difficult to obtain some of the more recent drugs for optimal therapy, and mostly well-known drugs proven to be effective are used. Regimens with the combination of fludarabine (FL), cytarabine, idarubicin (IDA), and granulocyte colony-stimulating factor (G-CSF) have been widely used for poor-risk acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), and relapsed or refractory acute lymphoblastic leukemia (ALL) in adults [4,5]. Pediatric series of AL cases with poor prognosis treated with these regimens are limited in the literature [6,7,8,9]. FL, a fluorinated purine analog, and high-dose cytarabine are effective in the treatment of ALs [10]. The combination of FL with cytarabine appears to have a synergistic effect. A positive correlation has been found between the intracellular level of the active metabolite of cytarabine, Ara-C 5’-triphosphate (Ara-CTP), and remission rates. FL triphosphate, the active metabolite of FL, inhibits ribonucleotide reductase and increases intracellular Ara-CTP. Administration of fludarabine prior to cytarabine may enhance the clinical efficacy of cytarabine [11]. IDA has also been added to the combination to increase the antileukemic effect [6,7,8,9]. G-CSF prior to FL may increase the efficacy of chemotherapy by increasing the fraction of leukemic cells in the S-phase [12]. The combination regimen of FL, high-dose cytarabine, and G-CSF (FLAG) with or without IDA has been used in relapsed/ refractory acute AML and ALL patients since 2007 in our clinic. Our aim was to evaluate the rate of complete remission (CR) and duration of survival after HSCT with this regimen.

Materials and Methods Patients Between September 2007 and May 2015, 18 children (15 boys and 3 girls) with refractory/relapsed AL attending our center were treated with a FLAG regimen with or without IDA. The median age at treatment was 12 years (minimum-maximum: 9 months to 17 years). Ten patients had a diagnosis of ALL (6 precursor B-cell and 4 T-cell ALL) and 8 had AML (2 AML-M2, 2 AML-M4, 1 AML-M5, 2 secondary AML, and 1 myeloid sarcoma). Of the 10 children with ALL, 3 cases were primary refractory, 3 first-relapsed, and 4 second-relapsed (all of them were refractory to the ALL relapse protocol), while of the 8 children with AML, 5 cases were first-relapsed and 3 primary refractory.

Yılmaz Bengoa Ş, et al: FLAG Therapy in Relapsed/Refractory Childhood Leukemia

One patient with myeloid sarcoma received the FLAG regimen after his first relapse, underwent allogeneic HSCT, relapsed 20 months after transplantation, and received the second course of the FLAG regimen. At the time of treatment 13 patients had isolated bone marrow infiltration, 3 had isolated extramedullary disease, and 3 had combined disease. The extramedullary disease site was the central nervous system in 4 patients, testis in 1 patient, and lymph node in 1 patient. All parents signed written informed consent forms before the start of the regimens. Treatment Fludarabine at 30 mg/m2/day was administered intravenously over 30 min and cytarabine at 2 g/m2/day was administered intravenously over 3 h starting 3.5 h after completing the fludarabine infusion for 4 consecutive days (days 1-4). IDA was given at 12 mg/m2/day by a 1-h infusion for 3 consecutive days (days 2-4) starting 1 h before the cytarabine infusion [7]. G-CSF was given at 200 or 400 µg/m2/day from day 0 to the first day of absolute neutrophil count (ANC) of >1000/µL in 10 patients, while it was started 48 h after completion of treatment in 8 patients. Nineteen courses and 30 cycles were administered to 18 patients. In 9 courses 1 cycle, in 9 courses 2 cycles, and in 1 course 3 cycles of treatment regimen were administered. Detailed information is given in Table 1. IDA was not given to the previously heavily treated 12 patients to decrease the rate of cardiotoxicity. If CR could not be achieved after the first cycle, then IDA was added to the FLAG regimen. All patients routinely received trimethoprim/sulfamethoxazole and antifungal prophylaxis. Patients with response to treatment underwent allogeneic HSCT if they had an eligible donor. The toxicity of the regimen was assessed according to the Common Toxicity Criteria of the World Health Organization [13]. Assessment of Response Bone marrow examination was performed when ANC was >1000/µL or at day 30 after chemotherapy. CR was defined as the absence of physical signs of leukemia, no extramedullary blasts, no blasts in peripheral blood, <5% blasts in bone marrow (BM) with evidence of normal hematopoiesis, and no blasts in the cerebrospinal fluid. Partial remission (PR) was defined as marrow blasts between 5% and 25%. Aplasia was defined as blasts <5% in BM or peripheral blood, no extramedullary blasts, no evidence of hematopoietic regeneration, and no regeneration in peripheral blood count [14]. 47

16/M 7/M 12/F

14/M

12/M

11.5/M

15/M

14/F

16/M

14/M

4.5/M

15/M

9/F

8.5/M

0.8/M

5/M

15/M

11.5/M

14/M

1 2 3

18, first course

18, second course

AML

Myelosarcoma/first relapse

AML-M2/first relapse

AML secondary to MDS/refractory

AML-M5/first relapse

AML secondary to MDS/refractory

AML-M4

AML-M2/first relapse

AML-M4/first relapse

T-cell ALL/first relapse

T-cell ALL/refractory

Precursor B-cell ALL/second relapse

T-cell ALL/refractory

Precursor B-cell ALL/first relapse

Precursor B-cell ALL/second relapse

T-cell ALL/refractory

Precursor B-cell ALL/first relapse Precursor B-cell ALL/first relapse Precursor B-cell ALL/refractory after first relapse

Diagnosis

20 months

36 months

9 months

10.5 months

2.5 months

10 months

9 months

18 months/17 months

23 months

21 months/16 months

12 months 17 months 10 months

Duration of remission before relapse (first/ second relapse)

24 months

70 months

1 FLAG: Aplasia Allo-HSCT 1st FLAG-IDA: CR 2nd FLAG: CR Allo-HSCT 1st FLAG: CR 2nd FLAG: CR Allo-HSCT 1st FLAG: CR 2nd FLAG: CR 3rd FLAG: Relapsed st

33 months

5 months

33 months

2 months

25 months

10 months

_ _ _

5 months/died with relapse and infection

After 20 months of posttransplant remission, he relapsed with AML

70 months/alive

25 months/alive

3 months/died with refractory leukemia and infection 2 months/died with relapse

4 months/died with refractory leukemia and infection

- / died with infection

33 months/alive

5 months/died with infection and multiorgan failure

33 months/alive

2 months/died with GVHD and infection

25 months/alive

10 months/died with GVHD and infection

3 months/died with infection

3 months/died with relapse 4 months/died with relapse 3 months/died with relapse and infection - /died with infection

Duration of Duration of remission after survival/outcome FLAG/FLAGIDA

1st FLAG: No response

1st FLAG: Not evaluated, died at 15th day after chemotherapy 1st FLAG: PR 2nd FLAG-IDA: Aplasia 1st FLAG: CR Allo-HSCT 1st FLAG: CR 2nd FLAG: CR Allo-HSCT 1st FLAG: CR 2nd FLAG: CR Allo-HSCT 1st FLAG: CR 2nd FLAG: CR Allo-HSCT 1st FLAG: No response 2nd FLAG-IDA: CR Allo-HSCT 1st FLAG: CR 2nd FLAG: CR Allo-HSCT 1st FLAG-IDA: Not evaluated, died at 17th day after chemotherapy 1st FLAG: No response 2nd FLAG: No response 1st FLAG-IDA: No response

1st FLAG-IDA: Aplasia 1st FLAG: No response 1st FLAG-IDA: Aplasia

Treatment regimen and response

M: Male, F: female, AML: acute myeloid leukemia, ALL: acute lymphoblastic leukemia, CR: complete remission, Allo-HSCT: allogeneic hematopoietic stem cell transplantation, IDA: idarubicin

Age at FLAG course (years)/sex

Patient No.

Table 1. Patient characteristics, treatment regimen, response to treatment, duration of survival, and outcome. Yılmaz Bengoa Ş, et al: FLAG Therapy in Relapsed/Refractory Childhood Leukemia Turk J Hematol 2017;34:46-51

Turk J Hematol 2017;34:46-51

The primary end point was status of the bone marrow sampled after the first/second course of chemotherapy. The second end point was the duration of survival after HSCT. Duration of survival was calculated from the start of the treatment regimen up to the last follow-up or mortality. Statistical Analysis SPSS 15.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analysis. Analytical characteristics were given as percentage, mean and SD, or median. Data were analyzed for statistically significant differences using the Mann-Whitney U test and the chi-square test. Group differences with p<0.05 were considered to be statistically significant. Duration of survival and time of follow-up were calculated with descriptive statistics. With a total of only 18 cases the use of further statistical methods was limited.

Results Treatment Response Thirty cycles were administered in 18 patients. Age, sex, diagnosis, remission duration before relapses, treatment regimen and response, remission duration after treatment regimen, and duration of survival/outcome of patients are shown in Table 1. After the first cycle, CR was achieved in 7 (38.8%) patients, PR was achieved in 1 (5.3%), remission was not observed in 5 (26.3%), and aplasia was found in 3 (15.7%). Two patients could not be evaluated for response because of early death after the first FLAG treatment. After the second cycle, one nonresponder achieved CR. CR rate in patients who did not receive G-CSF starting with the chemotherapy was 50% and CR rate in patients who received G-CSF with the beginning of chemotherapy was 36.4%; the difference was not significant (p=0.563). CR rate in patients who had IDA in the combination therapy was 28.6% and CR rate was 50% in patients treated without IDA (p=0.360). There was no difference in CR rate according to the duration of remission before the treatment (p=0.770). Toxicity All children had severe myelosuppression and were intensively supported with blood products. The median time of neutrophil recovery (>500/µL) was 24 days (minimum-maximum: 1545), and that of platelet recovery (>20,000/µL) was 20 days (minimum-maximum: 15-73). Febrile neutropenia (FN) occurred after 26 (86.6%) cycles of regimens. FN was observed after 6 (85.7%) cycles with additional IDA and after 20 (87%) cycles without IDA. There was no difference in FN rate according to additional IDA (p=0.677). Most patients developed grade 3-4 mucositis. Seven children had transient mild hepatotoxicity (36.8%). There was no serious cardiotoxicity. Two patients (11.1%) had documented infections (blood cultures showed

Yılmaz Bengoa Ş, et al: FLAG Therapy in Relapsed/Refractory Childhood Leukemia

Escherichia coli and a yeast-like organism in 1 patient, and Klebsiella pneumoniae in 1 patient). Two patients, a primary refractory T-cell ALL patient and a relapsed AML patient with documented infection, died before the time of remission evaluation. Two patients (11.1%) had pulmonary invasive fungal infection. Duration of Survival All patients in CR and one patient with AML secondary to MDS who had aplasia after the regimen, in total 9 (50%) patients, underwent subsequent allogeneic HSCT. Four patients were transplanted from matched sibling donors, 2 from matched unrelated donors, and 3 from haploidentical donors. Four patients died after HSCT; in 3 patients, the cause of death was infection. The fourth patient (case 18) relapsed after HSCT and had a second course with 3 cycles of FLAG; he was in remission after the first 2 cycles but relapsed after the third cycle and died. Mean duration of survival in transplanted patients was 24.7±20.8 months (minimum-maximum: 2-70, median: 25 months) and it was 2.7±1.64 months (minimum-maximum: 0-5, median: 3 months) in the nontransplanted patients. As a result, 5 (27.7%) patients who underwent HSCT are still alive and in CR. Two patients underwent allogeneic HSCT from their siblings, 2 underwent allogeneic HSCT from unrelated matched donors, and 1 underwent haploidentical HSCT from his mother. The median time of follow-up for these patients was 33 months (minimum-maximum: 25-70 months). Three were AML (one case secondary to MDS) and 2 were ALL patients.

Discussion The treatment of children with relapsed or refractory AL is still challenging. Regimens containing FL and high-dose cytarabine with or without IDA have been used in this patient group, and the first results were published in 1996 [6]. In our study, the CR rate after 2 cycles was 42.1% (most of these patients were in CR after the first cycle), all of these patients could proceed to HSCT, and 27.7% survived. Fleischhack et al. reported a CR rate of 73.9% in patients with poor-prognosis AML; 47.8% underwent HSCT and 39.1% remained in CR [7]. In the study conducted by McCarthy et al., in a group of ALL, AML, and biphenotypic AL patients using the FLAG regimen the CR rate was 70%; 68.4% of the patients underwent HSCT and 36.8% were alive at the end of the study [15]. Tavil et al. from Turkey presented the results of 25 relapsed/refractory AL patients. The CR rate was 60%, 49% of their patients could proceed to HSCT, and 20% survived [8]. Yalman et al., also from Turkey, reported a CR rate of only 17.6% in 17 poor-prognosis AL patients; 2 underwent HSCT and only 1 child with a previous HSCT survived after donor lymphocyte infusion [9]. 49

Yılmaz Bengoa Ş, et al: FLAG Therapy in Relapsed/Refractory Childhood Leukemia

The CR rate in our patients who had IDA in combination therapy was 28.6% and it was 50% in patients treated without IDA; the difference was not statistically significant. Patients who received IDA-FLAG were mostly those who had refractory disease. This might be the reason for the lower response rate. All of our patients experienced severe myelosuppression, FN developed after 86.6% of the cycles, and 2 patients (11.1%) died early with infection, shortly after chemotherapy (15th and 17th days). The addition of IDA to the FLAG regimen did not change the risk of FN. Invasive fungal infection was observed in a total of 3 patients (16.6%). The reported toxicity of these regimens is similar to rates reported in the literature [8,15]. In some recent studies, it was demonstrated that with the addition of agents like liposomal forms of daunorubicin and doxorubicin instead of IDA to treatment regimens containing FL and high-dose cytarabine, CR can be achieved in higher rates with less systemic toxicity in children with refractory/relapsed AL [16,17]. In developing countries such as Turkey, liposomal forms of these anthracyclines are not available and cannot be used due to economic reasons. Because of the increased use of unrelated and haploidentical donors nowadays, even when a suitable family donor is lacking, the chance of transplantation with alternative stem cell sources in a short time after CR is better. Therefore, achieving CR in poor-prognosis AL with effective treatment regimens may result in better outcomes. Five of our patients achieved a CR of >24 months after HSCT. The role of G-CSF in the management of relapsed/refractory AL has been tested widely and remains controversial [18]. Most of the trials demonstrated a modest reduction in the duration, but not the depth, of neutropenia [16,18,19]. The effects of G-CSF on duration of survival, incidence of severe infection, and duration of hospitalization are variable, but in developing countries, the death rates due to FN are higher than in developed countries, and G-CSF given with chemotherapy or after chemotherapy is still common. Even though a trend towards an increased incidence of relapses with G-CSF treatment in children with AML that overexpress the differentiation-defective G-CSFR isoform IV has been reported, the number of these cases is very low and G-CSF continues to be a part of the FLAG regimen [16,20]. We used G-CSF in all of our patients since the FN risk is high in our clinic. We did not find any statistically significant difference in CR rate whether we started G-CSF at day 0 or after completion of chemotherapy.

Conclusion In conclusion, FLAG regimens with or without IDA produced a CR of >24 months in 27.7% of children with refractory/relapsed AL and can be recommended as a therapeutic option prior to 50

Turk J Hematol 2017;34:46-51

HSCT with appropriate supportive measurements in developing countries. Ethics Ethics Committee Approval: The study was a retrospective analysis, and we used data from hospital records; Informed Consent: All parents signed written informed consent forms before the start of the regimens. Authorship Contributions Concept: Şebnem Yılmaz Bengoa, Hale Ören; Design: Şebnem Yılmaz Bengoa; Data Collection or Processing: Şebnem Yılmaz Bengoa, Eda Ataseven, Deniz Kızmazoğlu, Fatma Demir Yenigürbüz, Melek Erdem; Analysis or Interpretation: Şebnem Yılmaz Bengoa, Hale Ören; Literature Search: Şebnem Yılmaz Bengoa; Writing: Şebnem Yılmaz Bengoa, Hale Ören. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Stahnke K, Ritter J, Schellong G, Beck JD, Kabisch H, Lampert F, Creutzig U. Treatment of recurrence of acute myeloid leukemia in childhood. A retrospective analysis of recurrence in the AML-BFM-83 study. Klin Padiatr 1992;204:253-257. 2. Einsiedel HG, von Stackelberg A, Hartmann R, Fengler R, Schrappe M, JankaSchaub G, Mann G, Hählen K, Göbel U, Klingebiel T, Ludwig WD, Henze G. Long-term outcome in children with relapsed ALL by risk-stratified salvage therapy: results of trial acute lymphoblastic leukemia-relapse study of the Berlin-Frankfurt-Münster Group 87. J Clin Oncol 2005;23:7942-7950. Erratum in: J Clin Oncol. 2008;26:2238. 3. Sander A, Zimmermann M, Dworzak M, Fleischhack G, von Neuhoff C, Reinhardt D, Kaspers GJ, Creutzig U. Consequent and intensified relapse therapy improved survival in pediatric AML: results of relapse treatment in 379 patients of three consecutive AML-BFM trials. Leukemia 2010;24:14221428. 4. Virchis A, Koh M, Rankin P, Mehta A, Potter M, Hoffbrand AV, Prentice HG. Fludarabine, cytosine arabinoside, granulocyte-colony stimulating factor with or without idarubicin in the treatment of high risk acute leukaemia or myelodysplastic syndromes. Br J Haematol 2004;124:26-32. 5. Yavuz S, Paydas S, Disel U, Sahin B. IDA-FLAG regimen for the therapy of primary refractory and relapse acute leukemia: a single-center experience. Am J Ther 2006;13:389-393. 6. Fleischhack G, Graf N, Hasan C, Ackermann M, Breu H, Zernikow B, Bode U. IDA-FLAG (idarubicin, fludarabine, high dosage cytarabine and G-CSF)-an effective therapy regimen in treatment of recurrent acute myelocytic leukemia in children and adolescents. Initial results of a pilot study. Klin Padiatr 1996;208:229-235. 7. Fleischhack G, Hasan C, Graf N, Mann G, Bode U. IDA-FLAG (idarubicin, fludarabine, cytarabine, G-CSF), an effective remission-induction therapy for poor-prognosis AML of childhood prior to allogeneic or autologous bone marrow transplantation: experiences of a phase II trial. Br J Haematol 1998;102:647-655. 8. Tavil B, Aytac S, Balci YI, Unal S, Kuskonmaz B, Yetgin S, Gurgey A, Tuncer M, Gumruk F, Uckan D, Cetin M. Fludarabine, cytarabine, granulocyte colonystimulating factor, and idarubicin (FLAG-IDA) for the treatment of children

Turk J Hematol 2017;34:46-51

with poor-prognosis acute leukemia: the Hacettepe experience. Pediatr Hematol Oncol 2010;27:517-528. 9. Yalman N, Sarper N, Devecioğlu O, Anak S, Eryilmaz E, Can M, Yenilmez H, Ağaoğlu L, Gedikoğlu G. Fludarabine, cytarabine, G-CSF and idarubicin (FLAG-IDA) for the treatment of relapsed or poor risk childhood acute leukemia. Turk J Pediatr 2000;42:198-204. 10. Keating MJ, O’Brien S, Robertson LE, Kantarjian H, Dimopoulos M, McLaughlin P, Cabanillas F, Gregoire V, Li YY, Gandhi V, Estey E, Plunkett W. The expanding role of fludarabine in hematologic malignancies. Leuk Lymphoma 1994;14:11-16. 11. Gandhi V, Estey E, Keating MJ, Plunkett W. Fludarabine potentiates metabolism of cytarabine in patients with acute myelogenous leukemia during therapy. J Clin Oncol 1993;11:116-124. 12. Tosi P, Visani G, Ottaviani E, Manfori S, Zinzani PL, Tura S. Fludarabine + Ara-C + G-CSF: cytotoxic effect and induction of apoptosis on fresh acute myeloid leukemia cells. Leukemia 1994;8:2076-2082. 13. National Cancer Institute. Common Terminology Criteria for Adverse Events (CTCAE) Version 4.0. Available online at: http://evs.nci.nih.gov/ftp1/CTCAE/ CTCAE_4.03_2010-06-14_QuickReference_5x7.pdf. 14. Redner A. Leukemias. In: Lanzkowsky P, (ed). Manual of Pediatric Hematology and Oncology, 5th ed. New York, Academic Press, 2011. 15. McCarthy AJ, Pitcher LA, Hann IM, Oakhill A. FLAG (fludarabine, high-dose cytarabine, and G-CSF) for refractory and high-risk relapsed acute leukemia in children. Med Pediatr Oncol 1999;32:411-415. 16. Kaspers GJ, Zimmermann M, Reinhardt D, Gibson BE, Tamminga RY, Aleinikova O, Armendariz H, Dworzak M, Ha SY, Hasle H, Hovi L, Maschan

Yılmaz Bengoa Ş, et al: FLAG Therapy in Relapsed/Refractory Childhood Leukemia

A, Bertrand Y, Leverger GG, Razzouk BI, Rizzari C, Smisek P, Smith O, Stark B, Creutzig U. Improved outcome in pediatric relapsed acute myeloid leukemia: results of a randomized trial on liposomal daunorubicin by the International BFM Study Group. J Clin Oncol 2013;31:599-607. 17. Quarello P, Berger M, Rivetti E, Galletto C, Masetti R, Manicone R, Barisone E, Pession A, Fagioli F. FLAG-liposomal doxorubicin (Myocet) regimen for refractory or relapsed acute leukemia pediatric patients. J Pediatr Hematol Oncol 2012;34:208-216. 18. Milligan DW, Wheatley K, Littlewood T, Craig JI, Burnett AK; NCRI Haematological Oncology Clinical Studies Group. Fludarabine and cytosine are less effective than standard ADE chemotherapy in high-risk acute myeloid leukemia, and addition of G-CSF and ATRA are not beneficial: results of the MRC AML-HR randomized trial. Blood 2006;107:4614-4622. 19. Usuki K, Urabe A, Masaoka T, Ohno R, Mizoguchi H, Hamajima N, Miyazaki T, Niitsu Y, Yoshida Y, Miura A, Shibata A, Abe T, Miura Y, Ikeda Y, Nomura T, Nagao T, Saitou H, Shirakawa S, Ohkuma M, Matsuda T, Nakamura T, Horiuchi A, Kuramoto A, Kimura I, Irino S, Niho Y, Takatsuki K, Tomonaga M, Uchino H, Takaku F; Gran AML Study Group. Efficacy of granulocyte colonystimulating factor in the treatment of acute myelogenous leukaemia: a multicentre randomized study. Br J Haematol 2002;116:103-112. 20. Ehlers S, Herbst C, Zimmermann M, Scharn N, Germeshausen M, von Neuhoff N, Zwaan CM, Reinhardt K, Hollink IH, Klusmann JH, Lehrnbecher T, Roettgers S, Stary J, Dworzak M, Welte K, Creutzig U, Reinhardt D. Granulocyte colony-stimulating factor (G-CSF) treatment of childhood acute myeloid leukemias that overexpress the differentiation-defective G-CSF receptor isoform IV is associated with a higher incidence of relapse. J Clin Oncol 2010;28:2591-2597.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0188 Turk J Hematol 2017;34:52-58

Red Blood Cell Transfusions in Greece: Results of a Survey of Red Blood Cell Use in 2013 Yunanistan’da Eritrosit Transfüzyonu: 2013’de Eritrosit Kullanımı Anketinin Sonuçları Serena Valsami, Elisavet Grouzi, Abraham Pouliakis, Leontini Fountoulaki-Paparisos, Elias Kyriakou, Maria Gavalaki, Elias Markopoulos, Ekaterini Kontopanou, Ioannis Tsolakis, Argyrios Tsantes, Alexandra Tsoka, Anastasia Livada, Vassiliki Rekari, Niki Vgontza, Dimitra Agoritsa, Marianna Politou, Stavros Nousis, Aspasia Argyrou, Ekaterini Manaka, Maria Baka, Maria Mouratidou, Stavroula Tsitlakidou, Konstantinos Malekas, Dimitrios Maltezos, Paraskevi Papadopoulou, Vassiliki Pournara, Ageliki Tirogala, Emmanouil Lysikatos, Sousanna Pefani, Konstantinos Stamoulis On Behalf of the Working Committee of Transfusion Medicine & Apheresis of the Hellenic Society of Hematology

Abstract

Öz

Objective: Greece is ranked as the second highest consumer of blood components in Europe. For an effective transfusion system and in order to reduce variability of transfusion practice by implementing evidence-based transfusion guidelines it is necessary to study and monitor blood management strategies. Our study was conducted in order to evaluate the use of red blood cell units (RBC-U) in nationwide scale mapping parameters that contribute to their proper management in Greece. Materials and Methods: The survey was conducted by the Working Committee of Transfusion Medicine&Apheresis of the Hellenic Society of Hematology from January to December 2013. The collected data included the number, ABO/D blood group, patients’ department, and storage age of RBC-U transfused. Results: The number of RBC-U evaluated was 103,702 (17.77%) out of 583,457 RBC-U transfused in Greece in 2013. RBC-U transfused by hospital department (mean percentage) was as follows: Surgery 29.34%, Internal Medicine 29.48%, Oncology/Hematology 14.65%, Thalassemia 8.87%, Intensive Care Unit 6.55%, Nephrology 1.78%, Obstetrics/Gynecology 1.46%, Neonatal&Pediatric 0.31%, Private Hospitals 8.57%. RBC-U distribution according to ABO/D blood group was: A: 39.02%, B: 12.41%, AB: 5.16%, O: 43.41%, D+: 87.99%, D-: 12.01%. The majority of RBC-U (62.46%) was transfused in the first 15 days of storage, 25.24% at 16 to 28 days, and 12.28% at 29-42 days. Conclusion: Despite a high intercenter variability in RBC transfusions, surgical and internal medicine patients were the most common groups of patients transfused with an increasing rate for internal medicine patients. The majority of RBC-U were transfused within the first 15 days of storage, which is possibly the consequence of blood supply insufficiency leading to the direct use of fresh blood. Benchmarking transfusion activity may help to decrease the inappropriate use of blood products, reduce the cost of care, and optimize the use of the voluntary donor’s gift. Keywords: Red blood cell, Transfusion practice, Blood storage age

Amaç: Avrupa’daki kan bileşenlerini en çok tüketen ülkeler arasında Yunanistan ikinci sıradadır. Etkili bir transfüzyon sistemi için ve transfüzyon uygulamasının değişkenliğini azaltmak için kanıta dayalı transfüzyon kılavuzlarını uygulayarak kan yönetimi stratejilerini incelemek ve izlemek gereklidir. Çalışmamız, Yunanistan’da doğru kan transfüzyon yönetimine katkıda bulunmak için, ülke çapında ölçek eşleştirme parametrelerinde eritrosit süspansiyonu (ES) kullanımını değerlendirmek amacıyla yürütülmüştür. Gereç ve Yöntemler: Anket, Ocak-Aralık 2013 tarihleri arasında Hellenic Hematoloji topluluğunun, Transfüzyon Tıbbı ve Aferez Çalışma Komitesi tarafından yürütülmüştür. Toplanan veriler, ABO/D kan grubu, hasta bölümleri ve transfüze edilen ES depolama yaşını içermektedir. Bulgular: 2013 yılında Yunanistan’da transfüzyon yapılan 583,457 ES’nin, ES sayısı 103,702 (%17,77) idi. Hastanedeki bölümlerde transfüze edilen ES (ortalama oran) şöyleydi: Cerrahi %29,34, Dahiliye %29,48, Onkoloji/Hematoloji %14,65, Talasemi %8,87, Yoğun bakım ünitesi %6,55, Nefroloji %1,78, Kadın Hastalıkları ve Doğum %1,46, Yenidoğan ve Çocuk bölümü %0,31, Özel Hastaneler %8,57. ABO/D kan grubuna göre ES dağılımıysa şöyleydi: A: %39,02, B: %12,41, AB: %5,16, O: %43,41, D+: %87,99, D-: %12,01. ES’nin çoğunluğu (%62,46) depolamanın ilk 15 günü, 16 ile 28 günleri arası %25,24’ü ve 29 ile 42 gün arasında ise %12,28’i, transfüze edildi. Sonuç: Eritrosit transfüzyonlarında merkezler arası yüksek değişkenliğe rağmen, en fazla transfüzyon yapılan hasta grubunu cerrahi ve dahili tıp hastaları oluşturmaktaydı, dahili tıp hastalarında transfüzyon oranları daha yüksekti. ES’nin çoğunluğu depolamanın ilk 15 gününde transfüze edildi; bu da muhtemelen kan depolamadaki yetersizliğinin sonucunda taze kan kullanımına yol açtı. Transfüzyon aktivitesinin standartları, kan ürünlerinin uygun olmayan kullanımını azaltmaya, bakım maliyetini düşürmeye ve gönüllü vericilerin hediye kullanımını optimize etmeye yardımcı olabilir. Anahtar Sözcükler: Kırmızı kan hücresi, Transfüzyon uygulamaları, Kan depolama yaşı

Address for Correspondence/Yazışma Adresi: Serena VALSAMI, M.D., Aretaieio Hospital, Kapodistrian University of Athens Medical School, Department of Blood Transfusion, Athens, Greece Phone : +306944602629 E-mail : serenavalsami@yahoo.com

Received/Geliş tarihi: May 24, 2016 Accepted/Kabul tarihi: November 15, 2016

Valsami S, et al: Red Blood Cell Transfusion in Greece

Turk J Hematol 2017;34:52-58

Introduction Greece is a member of the European Union, which has established guidelines for blood donation and inspection of blood establishments, but so far no uniform rules for treatment with blood and blood products have been adopted by the European Union. Accordingly, Greek authorities and blood donor associations adhere strictly to the principle of selfsufficiency that was laid out by the Council of Europe. The only source of blood in Greece is non-remunerated blood donors. In a blood system based on voluntary donation the potential for blood shortage is an ongoing risk [1]. A number of emergency scenarios, including natural or man-made disasters, pandemic outbreaks, extremes of weather, and seasonal variations of blood donations, could contribute to extremely low blood inventory levels. It seems clear that the proportion of the population eligible to donate blood is likely to fall over the coming decades while the proportion requiring these products is likely to rise. Further attention is therefore required both to manage the supply and influence the demand for existing blood and blood products. Greece is ranked as the second highest consumer of blood components in Europe. Blood utilization in Greece exceeds 600,000 red blood cell (RBC) units annually according to data provided by the national competent authority (Hellenic National Blood Transfusion Center). Adequate transfusion practice is essential in order to cover transfusion demands. Assessing data regarding RBC units transfused at medical institutions nationally could provide the data needed for developing plans to manage the demand and supply for blood units [2,3,4]. The aim of our study was to assess and evaluate the use of RBC units in Greece in order to identify parameters that contribute to proper RBC management, which can ensure blood sufficiency, taking into account the geographical particularities of our country, the large number of transfusion-dependent thalassemia patients, and the large number of car accident victims.

Materials and Methods The study was conducted by the Working Committee of Transfusion Medicine&Apheresis of the Hellenic Society of Hematology. A preprinted data collection form was used and all transfusion services in hospitals all over Greece were invited to participate in the study. The survey was conducted from January to December 2013. Data collection was prospective, using preprinted forms that were filled out monthly by the participating transfusionists. Monthly collected data included the number of RBC units transfused, the ABO/D blood group, and the departments of the patients who received the RBC units. According to storage age (SA) on the day of transfusion the RBC units were sorted into groups as SA1: 0-15 days (SA on the day of transfusion), SA2: 16-28 days, and SA3: 29-42 days

[5,6]. Data regarding national RBC transfusion supplies were provided by the Hellenic National Blood Transfusion Center. Data forms were manually entered into an electronic database (Excel 2007, Microsoft Corp., Redmond, WA, USA), which was also used to perform part of the analysis. Additional statistical analysis was performed using SAS software (version 9.3 for Windows, SAS Institute Inc., Cary, NC, USA) [7,8]. Proportion comparisons were performed via the Z-test, and mean values were compared via the t-test, the accepted significance level was p<0.05.

Results From among the 94 services initially invited, transfusion services in 23 hospitals all over Greece accepted the invitation and were eligible to participate in the study. Twelve of those 23 hospitals are located in Athens and the remaining 11 were general hospitals located in cities outside of Athens (Agrinio, Messologgi, Kavala, Zakynthos, Kefalonia, Livadia, Trikala, Larissa, Edessa, Xanthi, Florina) (Table 1). Thirteen of the 23 hospitals (56.52%) provided data for 12 months, 9 hospitals (39.13%) for 5-8 months, and one hospital (4.35%) for 1 month. The mean number of monthly reports from the participating blood banks was 9.2±3.5 and this showed a declining trend over the course of the year (20 reports were received in January 2013, while 15 reports were received in December 2013). It is worth noting that participating hospitals were sending their reports on a voluntary basis. The total number of RBC units evaluated was 103,702 out of 583,457 [103,702/583,457=17.77±0.10%, 95% confidence interval (CI)] RBC units transfused during 2013 in Greece. The number of units reported by the 12 hospitals in Athens was 76,068 (73.35±0.29%, 95% CI) while the units reported by the 11 hospitals outside of Athens was 27,634 (26.65±0.27%, 95% CI). More than 64% (66,293/103,702, ±0.29%, 95% CI) of the total RBC units were transfused at five tertiary and general hospitals, four of which are located in Athens and account for 55.72±0.30% (57,784/103,702, 95% CI) of the annual blood issued, along with one hospital outside of Athens (University Hospital of Larissa), as shown in Table 1. The percentage of RBC units in each SA group (SA1, SA2, and SA3) varied depending on the participating hospital (SA1: 4.94%-91.08%, SA2: 5.83%-76.01%, SA3: 0.74%-45.49%), as shown in Table 2 and Figure 1. The majority of RBC units, 64,799 (62.46±0.29%, 95% CI), were transfused in the first 15 days of storage, while 26,171 (25.24±0.26%, 95% CI) were transferred at 16 to 28 days and 12,732 (12.28±0.20%, 95% CI) were transferred at 29 to 42 days (Table 2). In order to investigate the different policies applied in large tertiary university hospitals located in urban centers and 53

Valsami S, et al: Red Blood Cell Transfusion in Greece

Turk J Hematol 2017;34:52-58

Table 1. Number of red blood cell units transfused, percentages, and confidence intervals for the participating hospitals in declining order according to blood consumption. Participating Hospital

RBC Units Transfused (n)

Number of Beds

AH1

20,133

19.4±0.2

947

AH2

14,152

13.6±0.2

562

AH3

13,357

12.9±0.2

615

AH4

10,142

9.8±0.2

596

HOA1

8509

8.2±0.2

566

AH5

4440

4.3±0.1

346

HOA2

4045

3.9±0.1

256

AH6

3983

3.8±0.1

279

HOA3

3682

3.6±0.1

303

AH7

3194

3.1±0.1

380

AH8

3136

3.0±0.1

150

HOA4

2268

2.2±0.1

161

AH9

2255

2.2±0.1

268

AH10

2242

2.2±0.1

736

AH11

2228

2.1±0.1

106

HOA5

2139

2.1±0.1

394

HOA6

1163

1.1±0.1

136

HOA7

895

0.9±0.1

155

HOA8

837

0.8±0.1

HOA9

409

0.4±0.0

120

HOA10

271

0.3±0.0

HOA11

135

0.1±0.0

HOA12

0.1±0.0

102

TOTAL

103,702

100%

7450

AH: Athens Hospital, HOA: Hospital Outside Athens, AH1: Evangelismos Hospital, AH2: Laikon Hospital, AH3: General Hospital “Saint Panteleimon”, AH4: General Hospital “ATTIKON”, HOA1: Larissa University Hospital, AH5: St. Savvas Oncology Hospital, HOA2: General Hospital of Xanthi, AH6: General Hospital Nea Ionia “Agia Olga”, HOA3: General Hospital of Trikala, AH7: Thriasio Hospital, AH8: Aretaieio University Hospital, HOA4: General Hospital Edessa, AH9: “Amalia Fleming” Hospital, AH10: “Sotiria” Hospital, AH11: “Saints Anargyroi” Hospital, HOA5: General Hospital of Kavala, HOA6: General Hospital of Agrinio, HOA7: General Hospital of Messologgi, HOA8: General Hospital of Livadia, HOA9: General Hospital of Florina, HOA10: General Hospital of Zakynthos, HOA11: General Hospital of Kalymnos, HOA12: General Hospital of Kefalonia, RBC: red blood cell.

peripheral, small non-university hospitals (100-300 beds), two groups were created: university urban hospitals (AH1, AH2, and AH4) and general peripheral hospitals (HOA2, HOA3, HOA4, HOA5, HOA6, HOA7, and HAO9). The number of units transfused in urban university hospitals was 44,427 and in peripheral hospitals it was 14,601. Interestingly, university hospitals consumed “fresher” blood compared to peripheral hospitals (SA1 group: 78.9% vs. 38.2%, p<0.05), and accordingly 54

peripheral hospitals used “older” blood (SA3 group: 15.8% vs. 6.8%, p<0.05). As depicted in Table 2, regarding the total number of RBC units transfused by hospital department, the classification was as follows: Surgery departments: 30,421 (29.34±0.28%, 95% CI), Internal medicine departments: 30,567 (29.48±0.28%, 95% CI), Oncology/Hematology departments: 14,159 (14.65±0.22%, 95% CI), Thalassemia departments: 9195 (8.87±0.17%, 95% CI), Intensive care units: 6796 (6.55±0.15%, 95% CI), Nephrology departments: 1850 (1.78±0.08%, 95% CI) Obstetrics/Gynecology departments: 1512 (1.46±0.07%, 95% CI), Neonatal and Pediatric departments: 319 (0.31±0.03%, 95% CI), and private hospitals: 8883 (8.57±0.17%, 95% CI). It is worth mentioning that significant differences were observed regarding the number of RBC units per department between participating hospitals (data not shown). The proportion of RBC units transfused in surgery departments of urban university hospitals was greater than that of peripheral hospitals (32.7% vs. 24.2%, p<0.05). A similar pattern was observed in Oncology/Hematology departments (17.6% vs. 0.5%, p<0.05), while in internal medicine departments the percentages were 31.0% and 46.7%, respectively (p<0.05). Regarding thalassemia patients, only 4.4% of RBC units were transfused in urban university hospitals and 17.2% in peripheral general hospitals. The SA group (SA1, SA2, and SA3) of RBC units transfused by hospital department classification is shown in Table 2 and Figure 1. Neonates and thalassemia patients received “fresh” RBC units of the SA1 group in a higher proportion than patients in the rest of the departments; specifically, 84.95% and 87.31% of cases of neonates and thalassemia patients respectively received SA1 RBC units while the percentage of the total studied population that received SA1 RBC units was 62.49%. This difference was statistically significant both for neonates (difference: 22.46%, 95% CI: 17.623%-26.516%, χ2=57.18, p<0.05) and for thalassemia patients (difference: 24.82%, 95% CI: 23.984%25.632%,χ2=1938.95, p<0.05). The distribution of RBC units transfused according to ABO and RhD blood groups was: A: 40,461 (39.02±0.30%, 95% CI), B: 12,868 (12.41±0.20%, 95% CI), AB: 5355 (5.16±0.13%, 95% CI), O: 45,018 (43.41±0.30%, 95% CI), D (+): 91,248 (87.99±0.20%, 95% CI), D (-): 12,454 (12.01±0.20%, 95% CI). This reflects the ABO/D distribution in the Greek population [9,10]. RBC units per ABO/D blood group and SA group distribution are depicted in Table 3. The distributions among SA1, SA2, and SA3 SA groups were similar for all ABO/D blood groups. In particular, the transfusion practice applied to O RhD-negative blood units was identical to other blood groups, as 63.2% of O RhD-negative units were transfused in the first 2 weeks while the percentage

Valsami S, et al: Red Blood Cell Transfusion in Greece

Turk J Hematol 2017;34:52-58

of RBC units of the SA1 group for the rest of the RBC types was 62.4% (difference: 0.76%, p=0.26). The mean number of RBC units transfused per month in all hospitals was 8642±604 (CI=95%). Monthly distribution of transfusions and SA data, as depicted in Table 4, show that older blood (SA3) was issued during the summer months of May, June, and July. Specifically, 4615 SA3 RBC units were issued during these three months [mean: 1538.3, standard deviation (SD): 349.3], while 8117 SA3 RBC units were issued during the rest of the year (mean: 901.9, SD: 295.6) (p<0.05). Additionally, in terms of consumption, the months of May, June, and July presented increased requirements for transfusions (mean units/ month: 9213), while for the rest of the year a mean of 8451 units/month were used, reflecting an increment of about 9% (p<0.05).

Discussion Effective blood management is affected not only by donor deficit but also by the complexity of managing inventories of blood products and availability within hospitals and health

systems. Overuse or inappropriate use of blood products is a less-recognized problem that presents significant patient safety issues [11,12]. Assessing the RBC transfusion trends in various clinical settings, especially at the national level, has evolved into a major tool for promotion and development of best practices for hemotherapy [2]. In this setting we conducted a benchmark study for RBC use across Greece. The legal and regulatory framework governing the organization and functioning of Greek blood services reflects the transposition of EU dedicated directives. Attention at the decision-making level focused mainly on strengthening vigilance and the safety of blood supplies [13]. Blood transfusion services in Greece continue to be decentralized, are located in almost every hospital, and are responsible for the whole blood transfusion chain. Blood supplies come from voluntary non-remunerated donors (51%) and replacement donors (49%). Greece has 32 blood donors/1000 inhabitants, which is close to the median range of the EU average [1,14]. The total blood collection figure for 2013 was of 590,000 units and this proved insufficient to cover consumption at the national level, according to data

Table 2. Percentages, totals, and confidence intervals for red blood cell consumption for the different hospital departments. Hospital Department

SA1 (0-15 days)

SA2 (16-28 days)

SA3 (29-42 days)

Thalassemia Departments

87.3±0.7%

9.0±0.6%

3.7±0.4%

9195

8.9±0.2

Pediatrics-Neonates

84.5±3.9%

14.1±3.8%

0.9±1.0%

319

0.3±0.0

Oncology/Hematology

66.9±0.8%

20.8±0.7%

12.4±0.5%

14,159

13.7±0.2

Nephrology

62.2±1.2%

26.0±2.0%

11.8±1.5%

1850

1.8±0.1

Surgery

61.7±0.6%

26.9±0.5%

11.4±0.4%

30,421

29.3±0.3

Private Hospitals

59.4±1.0%

20.3±0.8%

20.2±0.8%

8883

8.6±0.2

Intensive Care Units

58.2±1.2%

27.3±1.1%

14.5±0.8%

6796

6.6±0.2

Internal Medicine

56.1±0.6%

31.1±0.5%

12.8±0.4%

30,567

29.5±0.3

Gynecology/Obstetrics

47.7±2.5%

36.4±2.4%

15.9±1.8%

1512

1.5±0.1

Total

62.5±0.3%

25.2±0.3%

12.3±0.2%

103,702

100.00

Table 3. Number of red blood cell units, percentages, and confidence intervals according to ABO and RhD blood group for the three storage age groups (SA1, SA2, and SA3). SA1 (0-15 days)

SA2 (16-28 days)

SA3 (29-42 days)

Total

% (± CI)

A+

23,452

65.3±0.5

8757

24.4±0.4

3718

10.3±0.3

35,927

34.6±0.3

A-

2234

49.3±1.5

1323

29.2±1.3

977

21.5±1.2

4534

4.4±0.1

B+

6444

55.7±0.9

3257

28.2±0.8

1867

16.1±0.7

11,568

11.2±0.2

B-

584

44.9±2.7

368

28.3±2.5

348

26.8±2.4

1300

1.3±0.1

AB+

2411

55.2±1.5

1070

24.5±1.3

883

20.2±1.2

4364

4.2±0.1

AB-

662

66.8±2.9

221

22.3±2.6

108

10.9±1.9

991

1.0±0.1

O+

25,454

64.6±0.5

9901

25.1±0.4

4034

10.2±0.3

39,389

38.0±0.3

O-

3558

63.2±1.3

1274

22.6±1.1

797

14.2±0.9

5629

5.4±0.1

Total

64,799

62.5±0.3

26,171

25.2±0.3

12,732

12.3±0.2

103,702

100.0

ABO/D

Valsami S, et al: Red Blood Cell Transfusion in Greece

Turk J Hematol 2017;34:52-58

Figure 1. Percentages of red blood cell consumption for the three storage age groups (SA1: 0-15 days, SA2: 16-28 days, and SA3: 29-42 days) for the participating hospitals. Abbreviations: AH: Athens Hospital, HOA: Hospital Outside Athens, AH1: Evangelismos Hospital, AH2: Laikon Hospital, AH3: General Hospital “Saint Panteleimon”, AH4: General Hospital “ATTIKON”, HOA1: Larissa University Hospivtal, AH5: St. Savvas Oncology Hospital, HOA2: General Hospital of Xanthi, AH6: General Hospital Nea Ionia “Agia Olga”, HOA3: General Hospital of Trikala, AH7: Thriasio Hospital, AH8: Aretaeio University Hospital, HOA4: General Hospital Edessa, AH9: “Amalia Fleming” Hospital, AH10: “Sotiria” Hospital, AH11: “Saints Anargyroi” Hospital, HOA5: General Hospital of Kavala, HOA6: General Hospital of Agrinio, HOA7: General Hospital of Messologgi, HOA8: General Hospital of Livadia, HOA9: General Hospital of Florina, HOA10: General Hospital of Zakynthos, HOA11: General Hospital of Kalymnos, HOA12: General Hospital of Kefalonia. Table 4. Red blood cell units transfused, percentages, and confidence intervals for each month during the study and the storage age groups (SA1, SA2, and SA3). Month

SA1 (0-15 days)

SA2 (16-28 days)

SA3 (29-42 days)

January

68.9±0.1%

19.9±0.7%

11.2±0.7%

8224

7.9±0.2%

February

73.6±1.0%

20.9±0.9%

5.5±0.5%

8317

8.0±0.2%

March

62.0±1.0%

25.5±0.9%

12.6±0.7%

8499

8.2±0.2%

April

58.5±1.1%

26.9±1.0%

14.6±0.8%

8108

7.8±0.2%

May

54.2±1.0%

27.7±0.9%

18.1±0.8%

9011

8.7±0.2%

June

58.2±1.0%

29.9±0.9%

12.0±0.7%

9618

9.3±0.2%

July

44.3±1.0%

35.4±1.0%

20.3±0.8%

9011

8.7±0.2%

August

61.7±1.1%

26.1±1.0%

12.2±0.7%

7874

7.6±0.2%

September

78.7±0.9%

15.7±0.8%

5.6±0.5%

7847

7.6±0.2%

October

71.2±0.9%

21.0±0.8%

7.8±0.5%

9610

9.3±0.2%

November

64.1±1.0%

23.7±0.9%

12.2±0.7%

8807

8.5±0.2%

December

57.1±1.0%

28.6±0.0%

14.3±0.7%

8776

8.5±0.1%

Total

62.5±0.29%

25.2±0.3%

12.3±0.2%

103,702

100%

provided by the Hellenic National Blood Transfusion Center.

demands but also to poor implementation of patient blood

Blood insufficiency in Greece is related not only to increased

management programs, and to the fact that central inventory

Valsami S, et al: Red Blood Cell Transfusion in Greece

Turk J Hematol 2017;34:52-58

management (i.e. an online system) across the country has not been applied yet. In our study, data from 23 blood transfusions services regarding 103,702 RBC units transfused during the year 2013 were evaluated. The sample size was considered representative and thus the analysis led to safe conclusions (with a 95% confidence interval, margin of error was 0.28%). The number of units reported by the 12 hospitals in Athens was 2.75 times greater than the units reported by the 11 hospitals outside Athens (73.35% vs. 26.65%). Interestingly, the majority of RBCs were transfused in the first 15 days of storage (62.49±0.29). In this case, the use of fresh blood possibly highlights the problem of blood sufficiency in our country, which leads to the direct use of fresh blood. Transfusion of blood in the first 15 days of storage (SA1) was a phenomenon more pronounced in hospitals with the highest blood consumption, mainly urban university hospitals (Figure 1). These hospitals have extended Surgical departments also treating multipletrauma patients as reference centers. However, according to the last census results of 2011, Athens contains 35% of the population of Greece [15]. This reverse percentage in relation to the population is indicative of the fact that health care services focus on the country’s capital. Accordingly, increased consumption of “older” blood (SA3) takes place mainly in small hospitals, including countryside ones, with limited inventory that mostly treat chronic patients. These small hospitals often use RBC units close to the expiry date supplied by other hospitals in order to decrease time expiry losses, according to data provided by the Hellenic National Blood Transfusion Center. Regarding the total number of RBC units transfused by hospital department and despite intercenter variability, reflecting the existing variability in transfusion practice in our country, the vast majority of RBC units i.e. 75,138 units (73.47±0.27%, 95% CI) were transfused for patients in Surgery and Internal medicine departments, including Hematology/Oncology patients. The lack of strong evidence supporting specific transfusion practices could explain the overuse of blood products in specific patient populations [16,17]. Neonates and thalassemia patients received RBCs of the younger SA group in a statistically significant higher proportion (p<0.05), which has been considered as good transfusion practice by several studies for both patient populations [3,18,19]. Blood consumption in multiple-trauma patients could not be assessed due to the establishment plan of public hospitals in Greece that does not include an independent Accident and Emergency department. The similar distribution of ABO/D blood groups across RBC units of the three SA groups (Table 3) highlights the lack of an established policy for appropriate use of group O RhD-negative RBC units as in other developed countries. An additional

explanation could also be that there has not yet been established a centralized targeted recruitment of O RhD-negative universal donors. Provision of O RhD-negative RBCs can be a challenge for blood services, especially in times of short supply or increased demand [2,20]. According to Table 4, depicting monthly distribution of transfusions and SA data, older blood is issued during summer. May, June, July, and August are the months of summer holidays in Greece, with an impact on RBC stocks due to the decline in blood donation. Consequently, the system reacts by providing stocked RBCs of higher SA groups (SA2 and SA3). In addition, during the summer, many tourists visit Greece. The population increase along with car accident victims results in higher blood transfusion demands. Thus, implementing more intensive voluntary blood donation campaigns could help more intensively to meet the increased demands during these months, as in other developed countries [2].

Conclusion According to our study, and despite a high intercenter variability in RBC transfusions, surgical and internal medicine patients continue to be the most common group of patients transfused with an increasing rate for internal medicine patients. Additionally, it was revealed that the majority of RBC units were transfused within the first 15 days of storage. The applied blood transfusion trend in our country seems to follow the European practice regarding the transfusion of fresh blood in certain specific patient populations such as neonates and multi-transfused thalassemia patients. However, the increased use of fresh blood possibly reveals the problem of blood sufficiency, which leads to the direct use of fresh blood due to increased demand. The conduction of a larger survey that incorporates the determinants of patient blood management with the geographical particularities related to blood transport difficulties, hospital capacity variation, data regarding RBC wastage, and blood units supplied by other hospitals could provide more data and conclusions needed for developing and implementing an integrated evidence-based transfusion strategy and structure. Ethics Ethics Committee Approval: Ethics Committee of the Hellenic Society of Hematology, January 2013; Informed Consent: It was taken. Authorship Contributions Concept: Serena Valsami; Design: Serena Valsami, Elisavet Grouzi, Abraham Pouliakis, Leontini Fountoulaki-Paparisos, Elias Kyriakou, Maria Gavalaki, Konstantinos Stamoulis; Data Collection or Processing: Serena Valsami, Elisavet Grouzi, 57

Valsami S, et al: Red Blood Cell Transfusion in Greece

Abraham Pouliakis, Elias Markopoulos, Ekaterini Kontopanou, Ioannis Tsolakis, Argyrios Tsantes, Alexandra Tsoka, Anastasia Livada, Vassiliki Rekari, Niki Vgontza, Dimitra Agoritsa, Marianna Politou, Stavros Nousis, Aspasia Argyrou, Ekaterini Manaka, Maria Baka, Maria Mouratidou, Stavroula Tsitlakidou, Konstantinos Malekas, Dimitrios Maltezos, Paraskevi Papadopoulou, Vassiliki Pournara, Ageliki Tirogala, Emmanouil Lysikatos, Sousanna Pefani; Analysis or Interpretation: Serena Valsami, Elisavet Grouzi, Abraham Pouliakis, Elias Kyriakou, Maria Gavalaki, Konstantinos Stamoulis; Literature Search: Serena Valsami, Elisavet Grouzi, Konstantinos Stamoulis; Writing: Serena Valsami, Elisavet Grouzi, Konstantinos Stamoulis. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. World Health Organization. Global Database on Blood Safety. Summary Report 2011. Geneva, WHO, 2011. 2. Cotton S. Blood Stocks Management Scheme Annual Report 2010/11. Summary Report. 2011 ed. London, BSMS, 2011. 3. Kim V, Kim H, Lee K, Chang S, Hur M, Kang J, Kim S, Lee SW, Kim YE. Variation in the numbers of red blood cell units transfused at different medical institution types from 2006 to 2010 in Korea. Ann Lab Med 2013;33:331342.

Turk J Hematol 2017;34:52-58

8. SAS Institute. SAS User Guide. Cary, SAS Institute, 2014. 9. Lialiaris T, Digkas E, Kareli D, Pouliliou S, Asimakopoulos B, Pagonopoulou O, Simopoulou M. Distribution of ABO and Rh blood groups in Greece: an update. Int J Immunogenet 2011;38:1-5. 10. Valsami S, Papakonstantinou M, Papadopoulos G, Katsadorou E, Stefanakou S, Kourenti K. ABO and RH(D) phenotype frequencies of blood donors in Greece. Poster Abstracts. Vox Sang 2007;93:54-274. 11. Roubinian NH, Escobar GJ, Liu V, Swain BE, Gardner MN, Kipnis P, Triulzi DJ, Gottschall JL, Wu Y, Carson JL, Kleinman SH, Murphy EL; NHLBI Recipient Epidemiology and Donor Evaluation Study (REDS-III). Trends in red blood cell transfusion and 30-day mortality among hospitalized patients. Transfusion 2014;54:2678-2686. 12. Fischer DP, Zacharowski KD, Müller MM, Geisen C, Seifried E, Müller H, Meybohm P. Patient blood management implementation strategies and their effect on physicians’ risk perception, clinical knowledge and perioperative practice -the Frankfurt Experience. Transfus Med Hemother 2015;42:91-97. 13. European Council. Directive 2002/98/EC of the European Parliament and of the Council of 27 January 2003 Setting Standards of Quality and Safety for the Collection, Testing, Processing, Storage and Distribution of Human Blood and Blood Components and Amending. Brussels, European Council, 2003. 14. Politou M, Gialeraki A, Valsami S, Nearchakos N, Tsantes A, Travlou A, Maniatis A. Integration in groups of donors may modify attitudes towards blood donation. Blood Transfus 2015;13:336-337. 15. Hellenic Statistical Authority. 2011 Population-Housing Census. Athens, Hellenic Statistical Authority, 2016. 16. Carson JL, Carless PA, Hebert PC. Transfusion thresholds and other strategies for guiding allogeneic red blood cell transfusion. Cochrane Database Syst Rev 2012;4:CD002042.

4. Tinegate H, Chattree S, Iqbal A, Plews D, Whitehead J, Wallis JP; Northern Regional Transfusion Committee. Ten-year pattern of red blood cell use in the North of England. Transfusion 2013;53:483-489.

17. Valero-Elizondo J, Spolverato G, Kim Y, Wagner D, Ejaz A, Frank SM, Pawlik TM. Sex- and age-based variation in transfusion practices among patients undergoing major surgery. Surgery 2015;158:1372-1381.

5. Thurer RL, Precopio T, Popovsky A. Age of blood transfused in the United States: data for 166,208 transfusions. Transfusion 2012;52:53.

18. Priddee NR, Pendry K, Ryan KE. Fresh blood for transfusion in adults with beta thalassaemia. Transfus Med 2011;21:417-420.

6. Desmarets M, Bardiaux L, Benzenine E, Dussaucy A, Binda D, Tiberghien P, Quantin C, Monnet E. Effect of storage time and donor sex of transfused red blood cells on 1-year survival in patients undergoing cardiac surgery: an observational study. Transfusion 2016;56:1213-1222.

19. Quinn K, Quinn M, Moreno C, Soundar E, Teruya J, Hui SK. Neonatal transfusion models to determine the impact of using fresh red blood cells on inventory and exposure. Blood Transfus 2015;13:595-599.

7. DiMaggio C. SAS for Epidemiologists: Applications and Methods. New York, Springer-Verlag, 2013.

20. National Blood Transfusion Committee, National Health Service. The Appropriate Use of Group O RhD Negative Red Cells. London, National Blood Transfusion Committee, 2008.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0359 Turk J Hematol 2017;34:59-63

The Clinical Significance of Schistocytes: A Prospective Evaluation of the International Council for Standardization in Hematology Schistocyte Guidelines Şistositlerin Klinik Önemi: Hematoloji Standardizasyon Uluslararası Komitesi Şistosit Kılavuzlarının Prospektif Bir Değerlendirmesi Elise Schapkaitz, Michael Halefom Mezgebe University of Witwatersrand Medical School, Department of Molecular Medicine and Hematology, Johannesburg, South Africa

Abstract

Öz

Objective: The presence of ≥1% schistocytes on a peripheral blood smear (PBS) is an important criterion for the diagnosis of thrombotic microangiopathy (TMA). The reporting of schistocytes has been standardized by the International Council for Standardization in Hematology (ICSH). Despite the availability of guidelines, however, the assessment of schistocytes remains subjective. More recently, the automated fragmented red cell (FRC) parameter has been evaluated. However, local studies are not available. Materials and Methods: A prospective study was performed at the Charlotte Maxeke Johannesburg Academic Hospital in order to evaluate the ICSH recommendations for schistocyte measurement in 146 PBSs with schistocytes. Schistocytes were evaluated by microscopy and ADVIA 2120 automated hematology analyzers. Results: Schistocytes were frequently observed in patients with TMA (n=76), infection (n=20), hematologic malignancy (n=10), renal failure (n=5), and hemoglobinopathy (n=15), and in neonates (n=11). Schistocytes were ≥1% in all PBSs with TMA (n=76) with a mean of 3.44±1.84. Schistocytes of ≥1% were also observed in cases of renal failure and hemoglobinopathy, and in neonates. In these conditions, schistocytes were mainly observed in conjunction with moderate red blood cell changes. The agreement between two morphologists gave a correlation coefficient of 0.63 [confidence interval (CI): 0.52-0.75], while the correlation coefficient between the average of the morphologists and the FRC percentage was -1.97 (CI: -1.60 to -2.34). The ADVIA 2120 underestimated the schistocyte count in patients with TMA. Conclusion: Observer bias can be decreased by implementing the standardized procedures recommended by the ICSH. However, estimation of schistocytes by the ADVIA 2120 analyzer requires further evaluation as a screening tool. A higher threshold for schistocytes in thrombotic thrombocytopenic purpura is recommended to distinguish this hematological emergency from other conditions associated with ≥1% schistocytes. Keywords: Schistocyte, thrombotic microangiopathy, Microscopy, ADVIA 2120, Standardization

Amaç: Periferk kan yaymasında (PKY) ≥%1 şistosit varlığı trombotik mikroanjiopati (TMA) tanısı için önemli bir kriterdir. Şistositlerin raporlanması Hematoloji Standardizasyon Uluslararası Komitesi [International Council for Standardization in Hematology (ICSH)] tarafından standardize edilmiştir. Kılavuzların mevcudiyetine Öz yine de subjektif kalmaktadır. rağmen, şistositlerin değerlendirmesi Son zamanlarda, otomatize fragmente eritrosit (FE) parametresi değerlendirilmektedir. Ne var ki, lokal çalışmalar mevcut değildir. Gereç ve Yöntemler: ICSH önerilerini değerlendirmek için, Charlotte Maxeke Johannesburg Akademik Hastanesi’nde şistosit saptanan 146 PKY’da şistosit ölçümünü değerlendiren prospektif bir çalışma gerçekleştirildi. Şistositler mikroskop ve ADVIA 2120 otomatize hematoloji analizörü ile değerlendirildi. Bulgular: Şistositler, TMA (n=76), enfeksiyon (n=20), hematolojik malignite (n=10), renal yetmezlik (n=5) ve hemoglobinopati (n=15) hastalarında ve yenidoğanlarda (n=11) sıklıkla izlendi. Tüm TMA’lı hastaların (n=76) PKY’lerinde şistositler 3,44±1,84 ortalama ile ≥%1 idi. Şistositler ayrıca renal yetmezlik ve hemoglobinopati olguları ve yenidoğanlarda ≥%1 olarak izlendi. Bu durumlarda, şistositler çoğunlukla ılımlı eritrosit değişiklikleri ile ilişkili olarak gözlendi. İki morfolojist arasındaki anlaşma 0,63 [güven aralığı (GA): 0,52-0,75] korelasyon katsayısı verirken, morfolojistlerin ortalaması ve FE yüzdesi arasındaki korelasyon katsayısı -1.97 (GA: -1,60 - -2,34) idi. ADVIA 2120 ile TMA’lı hastalarda şistosit sayısı daha düşük ölçüldü. Sonuç: ICSH tarafından önerilen standardize prosedürlerin uygulanması ile gözlemci önyargısı azaltılabilir. Ne var ki, tarama aracı olarak ADVIA 2120 analizörü ile şistosit ölçümü daha ileri değerlendirme gerektirmektedir. Trombotik trombositopenik purpurada, şistositlerin ≥%1 olduğu diğer durumlardan bu hematolojik acili ayırt etmek için daha yüksek bir şistosit eşik değeri önerilmektedir. Anahtar Sözcükler: Şistosit, trombotik mikroanjiopati, Mikroskop, ADVIA 2120, Standardizasyon

Address for Correspondence/Yazışma Adresi: Elise SCHAPKAITZ, M.D., Received/Geliş tarihi: September 05, 2016 University of Witwatersrand Medical School, Department of Molecular Medicine and Hematology, Johannesburg, South Africa Accepted/Kabul tarihi: October 24, 2016 Phone : +27824592238 E-mail : elise.schapkaitz@nhls.ac.za

Schapkaitz E and Mezgebe MH: Evaluation of Schistocyte Quantitation

Turk J Hematol 2017;34:59-63

Introduction

Study Protocol

Schistocytes are red blood cell (RBC) fragments. The presence of schistocytes on a peripheral blood smear (PBS) according to laboratory policies is a hematological emergency that requires prompt review and investigation for thrombotic microangiopathy (TMA). Schistocytes, however, are not specific to TMA [1]. Fragmentation of RBCs is produced by mechanical damage in the circulation and can also be seen in patients with mechanical heart valves or those receiving dialysis. In addition, schistocytes occur in cytoskeletal RBC abnormalities such as acquired and inherited RBC disorders in association with marked anisopoikilocytosis.

Laboratory Methods

Furthermore, observer bias has been described when identifying and enumerating schistocytes by microscopy [2]. Recently, the identification and diagnostic value of schistocytes was standardized by the International Council for Standardization in Hematology (ICSH) Schistocyte Working Group. According to the ICSH recommendations, the presence of ≥1% schistocytes on a PBS in the absence of other moderate RBC changes is an important criterion for the diagnosis of TMA [3]. Despite the availability of guidelines, laboratory surveys in France indicated that the morphologic identification of schistocytes remained difficult and subjective [4]. More recently, measurement of the automated fragmented red cell (FRC) parameter has been evaluated. Studies have demonstrated that the automated FRC parameter offers advantages such as improved precision, immediate availability, and good agreement with microscopy [5,6,7]. As such, the ICSH Working Group recommended the automated counting of RBC fragments as a useful routine screening tool in the laboratory [3]. A study was performed at the Charlotte Maxeke Johannesburg Academic Hospital (CMJAH) in order to evaluate the ICSH recommendations for schistocyte identification and enumeration in referred PBSs with schistocytes.

Schistocytes were identified on PBSs stained according to the May-Grünwald-Giemsa technique. Schistocytes were defined and counted according to ICSH recommendations [3]. Blinded review of the studied PBSs was independently performed by two competent morphologists (ES and MHM). The schistocyte percentage was estimated by counting 10,000 RBCs at 50x power magnification. The microscopic schistocyte percentage was compared with the automated FRC percentage measured by ADVIA 2120 hematology analyzers. The automated FRC percentage was determined from measurement of light scatter at two different angles. This corresponded to the refractive index and volume on the platelet scatter plot, which allowed for distinction between platelets and small RBCs. The threshold for the automated FRC parameter was a volume of <30 fL and a refractive index of >1.4 above a threshold of 10,000 events/µL. The percentage of schistocytes was determined from the number of RBCs measured by the analyzer (reference interval for FRC parameter: between 0.2% and 0.3%) [5]. The FBC parameters were measured using ADVIA 2120 hematology analyzers. Statistical Analysis Statistical analysis was performed using the intraclass correlation coefficient (ICCC) as determined by the Bland and Altman method. Statistical comparisons were performed using the parametric paired t-test and nonparametric Wilcoxon matched pairs test for continuous parameters depending upon normality between the TMA and non-TMA groups. Statistical significance was set at a p-value of 0.05 or less. Ethics This study was approved by the Human Research Ethics Committee of the University of the Witwatersrand (M090688).

Materials and Methods

Results

Study Design

The average age of the patients in the study was 26±21 years, with a male-to-female ratio of 1:1.4. Patients were categorized according to diagnosis. Schistocytes were observed in patients with TMA (n=76), infection (n=20), hematologic malignancy (n=10), mechanical heart valves (n=2), renal failure (n=10), hemoglobinopathy (n=15), iron deficiency anemia (n=1), and megaloblastic anemia (n=1) and in neonates (n=11) (Table 1). Patients with TMA had diagnoses such as thrombotic thrombocytopenic purpura (TTP), hemolytic uremic syndrome (HUS), disseminated intravascular coagulopathy (DIC), and hemolysis with elevated liver enzymes and low platelets (HELLP).

A laboratory-based prospective study of the PBSs referred for microscopy was performed at the National Health Laboratory Service Hematology Laboratory at the CMJAH, South Africa, from November 2015 to June 2016. One hundred and fortysix PBSs with schistocytes were included. Aged samples were excluded. Clinical information was obtained from the laboratory information system, namely patient characteristics and diagnoses and laboratory investigations including lactate dehydrogenase (LDH) and full blood count (FBC). 60

Schapkaitz E and Mezgebe MH: Evaluation of Schistocyte Quantitation

Turk J Hematol 2017;34:59-63

The schistocyte counts were normally distributed in the TMA and non-TMA groups with mean (±SD) values of 3.44±1.84% and 1.11±0.83%, respectively (p<0.0001). In addition, the mean

Figure 1. Graphical representation of the comparison of schistocyte percentages between the morphologists.

values for hemoglobin and platelet count were significantly lower in the TMA group (p<0.049 and p<0.001 respectively). The red cell distribution width (RDW) was significantly higher in the TMA group, whereas there was no difference for LDH (Table 2). Schistocytes were ≥1% in all PBSs reviewed from patients with TMA (n=76). The mean schistocyte percentages of PBSs from cases of TTP (n=68), HUS (n=1), DIC (n=1), and HELLP (n=5) were 3.51±1.88%, 3.50%, 4.1%, and 2.42±1.6%, respectively. Schistocytes in DIC are frequently observed at lower percentages [8]. In this study, the patient with DIC had concomitant conditions associated with increased schistocytes such as metastatic carcinoma and severe postoperative infection. Schistocytes were observed in the absence of moderate RBC abnormalities in the PBSs reviewed from cases of TMA (with the exception of a case of HUS with moderate crenated cells). Schistocytes of ≥1% were also observed in other conditions, namely renal failure and hemoglobinopathy, and in neonates. In contrast, schistocytes in the non-TMA group were observed in conjunction with other moderate RBC abnormalities including crenated cells, poikilocytes, sickle cells, target cells, and nucleated RBCs in 46 cases (64.79%). In the observer bias part of the study, the correlation coefficient between the two morphologists was 0.63 [confidence interval (CI): 0.52-0.75] (Figure 1). The mean schistocyte percentage of the morphologists was 2.3±1.86%. This was significantly higher than the FRC percentage of 1.05±1.33% (p<0.0001). The ICCC between the average of the morphologists and the FRC percentage was -1.97 (CI: -1.60 to -2.34) (Figure 2). Patients with TMA represented the majority of patients. The ADVIA underestimated the schistocyte count in patients with TMA. An overestimation of the schistocyte count was also noted in particular in the hemoglobinopathy group. This was owing to the presence of other moderate RBC abnormalities.

Discussion Figure 2. Graphical representation of the comparison of schistocyte percentages between the morphologists and the analyzer.

The ICSH recommendations for the laboratory measurement of schistocytes were implemented at the CMJAH laboratory. The

Table 1. Microscopic and automated schistocyte percentages for each specific diagnosis. Diagnosis (n=146)

Microscopic Schistocyte, % (Mean ± standard deviation)

Automated Fragmented Red Cell Count (Mean ± standard deviation)

p-value

Thrombotic microangiopathies (76)

3.44±1.84

0.84±0.62

<0.001*

Sepsis (20)

0.87±0.67

0.88±0.7

0.963

Neonates

1.55±0.90

1.01±0.53

Term (4)

1.81±0.98

0.81±0.23

Preterm (7)

1.39±0.72

1.14±0.65

Hematologic malignancy (10)

0.70±0.41

0.61±0.66

0.718

Mechanical heart valves (2)

0.43±0.32

Renal failure (10)

1.1±0.5

0.75±0.47

0.124

Hemoglobinopathies (15)

1.2±0.78

2.5±3.11

0.128

0.102

Schapkaitz E and Mezgebe MH: Evaluation of Schistocyte Quantitation

Turk J Hematol 2017;34:59-63

Table 2. Presentation laboratory investigations (n=146). Presentation Laboratory Investigations

Patients with TMA (n=76)

Patients without TMA (n=70)

p-value

Hemoglobin (g/L)

93.5±24.8

85.6±23.4

0.049*

Platelet count (x10 /L)

122±103

187±103

0.001*

Red cell distribution width (%)

22.34±4.29

19.83±3.21

0.0001*

Lactate dehydrogenase (IU/L)

368 (range: 201-2093)

292 (range: 164-980)

0.256

TMA: Thrombotic microangiopathy. Parametric tests are expressed as mean ± standard deviation, nonparametric tests are expressed as median (range). *: Statistically significant.

CMJAH is the second largest university hospital in Africa that offers specialist medical and surgical treatment including hematology and oncology. In this study, the ICSH recommendations for schistocyte identification and enumeration in 146 referred PBSs with schistocytes were evaluated. In South Africa, there is a high incidence of TTP secondary to human immunodeficiency virus [9]. If the diagnosis is delayed, its clinical course can be rapidly fatal. According to the ICSH recommendations, the presence of ≥1% schistocytes on a PBS in the absence of other moderate RBC changes is a clinically significant criterion for the diagnosis of a TMA [3]. In this study, the mean schistocyte percentage in the TMA group (n=76) was 3.44±1.84%. This included 68 patients with a diagnosis of TTP. Studies have demonstrated that PBSs with the diagnosis of TTP present higher schistocyte counts when compared with other TMAs [2]. Schistocytes of ≥1% were, however, also observed in other nonfatal conditions. The mean schistocyte percentages of PBSs with the diagnosis of renal failure (n=10) or hemoglobinopathy (n=15) and in neonates (preterm, n=7; term, n=4) were 1.1±0.55%, 1.2±0.78%, and 1.55±0.8%, respectively. However, in the majority of the aforementioned conditions, schistocytes were observed in conjunction with additional moderate RBC abnormalities. This is consistent with the findings of Huh et al. [1]. Schistocytes in neonates are not pathological. A higher percentage is usually found in preterm neonates owing to liver immaturity. However, in this study, the term neonates presented with concomitant conditions that resulted in a slightly higher percentage than previously reported [1]. The diagnosis of TTP is based on clinical history, examination, and PBS review. However, according to the revised diagnostic criteria, the diagnosis of TTP should be considered in the presence of thrombocytopenia and microangiopathic hemolytic anemia alone [10]. In this study, the platelet count was significantly lower in the TMA group (p<0.001). The RDW was significantly higher in the TMA group whereas there was no difference for LDH. In this study, LDH isoenzyme fractions were not analyzed. Cohen et al. demonstrated that only LDH isoenzyme one and two fractions, the principal isoenzymes in RBCs, are significant markers of intravascular hemolysis [11]. In the TMA group the mean RDW was 22.34±4.29 (p<0.0001). Several authors have 62

reported that RDW, a measure of anisocytosis, is an excellent screening tool for the presence of schistocytes, which is consistent with the findings of this study [12]. Although the presence of >1% schistocytes is a robust indicator of TMA, microscopic counts are variable among individual morphologists. In this study, the observer bias of two competent morphologists was analyzed for schistocyte enumeration according to the ICSH recommendations. Zini et al. proposed estimating the schistocyte percentage by counting a minimum of 1000 RBCs [3]. Although labor-intensive, in this study, it was necessary to count a minimum of 10,000 RBCs in order to estimate a precise count, as suggested by Rümke [13]. The authors were able to successfully reduce the observer bias by implementing the standardized procedures recommended by the ICSH. The correlation coefficient between the two morphologists was 0.63 (CI: 0.52-0.75). Nevertheless, subjectivity was found between the two morphologists in identifying ‘real’ schistocytes in the presence of anisopoikilocytosis. The ICSH defined specific morphology features of schistocytes: helmet cells; small, irregular, triangular, or crescent-shaped cells; pointed projections; and lack of central pallor [3]. The schistocyte counts between the morphologists showed discrepancies in the presence of acanthocytes, echinocytes, sickle cells, and crenated RBCs, as these RBC can be difficult to distinguish from schistocytes. In contrast to microscopy, the automated FRC percentage is not dependent on the shape of the RBCs. The average microscopic schistocyte percentage was compared to the automated FRC percentage measured by ADVIA 2120 hematology analyzers. The mean schistocyte percentage of the morphologists was 2.3±1.86%. This was significantly higher than the automated FRC percentage of 1.05±1.33% (p<0.0001). The findings of this study differ from the findings reported by Lesesve et al. [6]. In that study by Lesesve et al., a range of normal and pathological specimens were included. In contrast, a limitation of this study is that only specimens with fragments were analyzed. The results of this study show that the ADVIA 2120 analyzer underestimated the schistocyte count in patients with TMA in the absence of other RBC abnormalities. An overestimation of the schistocyte count was also noted in the presence of anisopoikilocytosis. This is consistent with other reports that found that the ADVIA and Sysmex (Roche Diagnostics, Kobe,

Turk J Hematol 2017;34:59-63

Schapkaitz E and Mezgebe MH: Evaluation of Schistocyte Quantitation

Japan) analyzers underestimated the schistocyte count after a threshold of 1.5% [6,7,14]. However, conditions such as hemoglobinopathies and renal failure represented a small percentage of the study population. Other studies also reported platelet interference in samples after platelet transfusions as another cause for overestimation of the automated FRC [14]. The automated FRC percentage requires further evaluation as a screening test.

References

Conclusion

4. Lesesve JF, El Adssi H, Watine J, Oosterhuis W, Regnier F. Evaluation of ICSH schistocyte measurement guidelines in France. Int J Lab Hematol 2013;35:601-607.

In conclusion, this study confirms that observer bias can be decreased by implementing the standardized procedures recommended by the ICSH. However, estimation of schistocytes by the ADVIA 2120 automated analyzer requires further evaluation as a routine diagnostic tool. A higher threshold for schistocytes in TTP should be considered in order to distinguish this hematological emergency from other conditions associated with ≥1% schistocytes.

1. Huh HJ, Chung JW, Chae SL. Microscopic schistocyte determination according to International Council for Standardization in Hematology recommendations in various diseases. Int J Lab Hematol 2013;35:542-547. 2. Lesesve JF, Salignac S, Lecompte T. Laboratory measurement of schistocytes. Int J Lab Hematol 2007;29:149-151. 3. Zini G, d’Onofrio G, Briggs C, Erber W, Jou JM, Lee SH, McFadden S, VivesCorrons JL, Yutaka N, Lesesve JF; Internatiol Council for Standardization in Haematology (ICSH). ICSH recommendations for identification, diagnostic value, and quantitation of schistocytes. Int J Lab Hematol 2012;34:107-116.

5. Banno S, Ito Y, Tanaka C, Hori T, Fujimoto K, Suzuki T, Hashimoto T, Ueda R, Mizokami M. Quantification of red blood cell fragmentation by the automated hematology analyzer XE-2100 in patients with living donor liver transplantation. Clin Lab Haematol 2005;27:292-296. 6. Lesesve JF, Salignac S, Alla F, Defente M, Benbih M, Bordigoni P, Lecompte T. Comparative evaluation of schistocyte counting by an automated method and by microscopic determination. Am J Clin Pathol 2004;121:739-745.

Ethics

7. Saigo K, Jiang M, Tanaka C, Fujimoto K, Kobayashi A, Nozu K, Lijima K, Ryo R, Sugimoto T, Imoto S, Kumagai S. Usefulness of automatic detection of fragmented red cells using a hematology analyzer for diagnosis of thrombotic microangiopathy. Clin Lab Haematol 2002;24:347-351.

Ethics Committee Approval: Human Research Ethics Committee of the University of the Witwatersrand (M090688).

8. Lesesve JF, Martin M, Banasiak C, Andre-Kerneis E, Bardet V, Lusina D, Kharbach A, Genevieve F, Lecompte T. Schistocytes in disseminated intravascular coagulation. Int J Lab Hematol 2014;36:439-443.

Authorship Contributions

9. Opie J. Haematological complications of HIV infection. S Afr Med J 2012;102:465-468.

Concept: Elise Schapkaitz, Michael Halefom Mezgebe; Design: Elise Schapkaitz, Michael Halefom Mezgebe; Data Collection or Processing: Elise Schapkaitz, Michael Halefom Mezgebe; Analysis or Interpretation: Elise Schapkaitz, Michael Halefom Mezgebe; Literature Search: Elise Schapkaitz, Michael Halefom Mezgebe; Writing: Elise Schapkaitz, Michael Halefom Mezgebe. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

10. Moake JL. Thrombotic microangiopathies. N Engl J Med 2002;347:589-600. 11. Cohen JA, Brecher ME, Bandarenko N. Cellular source of serum lactate dehydrogenase elevation in patients with thrombotic thrombocytopenic purpura. J Clin Apher 1998;13:16-19. 12. Yoo JH, Lee J, Roh KH, Kim HO, Song JW, Choi JR, Kim YK, Lee KA. Rapid identification of thrombocytopenia-associated multiple organ failure using red blood cell parameters and a volume/hemoglobin concentration cytogram. Yonsei Med J 2011;52:845-850. 13. Rümke CL. The statistically expected variability in differential counting. In: Koepke JA, (ed). Differential Leukocyte Counting CAP Conference/Aspen, 1977. Skokie, College of American Pathologists, 1978. 14. Lesesve JF, Asnafi V, Braun F, Zini G. Fragmented red blood cells automated measurement is a useful parameter to exclude schistocytes on the blood film. Int J Lab Hematol 2012;34:566-576.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0049 Turk J Hematol 2017;34:64-71

Generation of Platelet Microparticles after Cryopreservation of Apheresis Platelet Concentrates Contributes to Hemostatic Activity Aferez Trombosit Konsantrelerinin Kriyoprezervasyonu Sonrası Ortaya Çıkan Trombosit Kaynaklı Mikropartiküllerin Hemostatik Aktivite ile İlişkisi İbrahim Eker1, Soner Yılmaz2, Rıza Aytaç Çetinkaya3, Aysel Pekel4, Aytekin Ünlü5, Orhan Gürsel1, Sebahattin Yılmaz3, Ferit Avcu6, Uğur Muşabak4,*, Ahmet Pekoğlu3, Zerrin Ertaş7, Cengizhan Açıkel8,*, Nazif Zeybek5, Ahmet Emin Kürekçi1,*, İsmail Yaşar Avcı9 1University of Health Sciences Gülhane Faculty of Medicine, Division of Pediatric Hematology, Ankara, Turkey 2University of Health Sciences Gülhane Faculty of Medicine, Blood Training Center and Blood Bank, Ankara, Turkey 3University of Health Sciences Gülhane Faculty of Medicine, Haydarpaşa Sultan Abdülhamid Training and Research Hospital, Department of

Infectious Disease, İstanbul, Turkey 4University of Health Sciences Gülhane Faculty of Medicine, Division of Immunology and Allergy, Ankara, Turkey 5University of Health Sciences Gülhane Faculty of Medicine, Department of General Surgery, Ankara, Turkey 6Memorial Hospital, Division of Hematology, Ankara, Turkey 7University of Health Sciences Gülhane Faculty of Medicine, Division of Hematology, Ankara, Turkey 8University of Health Sciences Gülhane Faculty of Medicine, Division of Biostatistics, Ankara, Turkey 9University of Health Sciences Gülhane Faculty of Medicine, Department of Infectious Disease and Clinical Microbiology, Ankara, Turkey *Retired

Abstract

Öz

Objective: In the last decade, substantial evidence has accumulated about the use of cryopreserved platelet concentrates, especially in trauma. However, little reference has been made in these studies to the morphological and functional changes of platelets. Recently platelets have been shown to be activated by cryopreservation processes and to undergo procoagulant membrane changes resulting in the generation of platelet-derived microparticles (PMPs), platelet degranulation, and release of platelet-derived growth factors (PDGFs). We assessed the viabilities and the PMP and PDGF levels of cryopreserved platelets, and their relation with thrombin generation.

Amaç: Son on yıl içerisinde, dondurulup saklanan trombositlerin özellikle travma hastalarında kullanımı ile ilgili önemli bir bilgi birikimi oluşmuştur. Bununla birlikte bu çalışmalarda trombositlerin morfolojik ve fonksiyonel değişikliklerinden çok az bahsedilmektedir. Son zamanlarda dondurulup saklanan trombositlerin aktive olarak trombosit kaynaklı mikropartikül (TKM) oluşumu ve trombosit kaynaklı büyüme faktörü (TKBF) salınımı ile sonuçlanan prokoagulan membran değişiklikleri olduğu saptanmıştır. Çalışmamızda dondurulup saklanan trombositlerin canlılıkları, TKM ve TKBF düzeyleri incelenerek trombin olumuyla ilişkileri değerlendirildi.

Materials and Methods: Apheresis platelet concentrates (APCs) from 20 donors were stored for 1 day and cryopreserved with 6% dimethyl sulfoxide. Cryopreserved APCs were kept at -80 °C for 1 day. Thawed APCs (100 mL) were diluted with 20 mL of autologous plasma and specimens were analyzed for viabilities and PMPs by flow cytometry, for thrombin generation by calibrated automated thrombogram, and for PDGFs by enzyme-linked immunosorbent assay testing.

Gereç ve Yöntemler: Yirmi bağışçıdan alınan aferez trombosit süspansiyonları (ATS) bir gün bekletildikten sonra %6 dimetil sülfoksid ile dondurularak -80 °C’de bir gün saklandı. Trombositler eritildikten sonra 20 mL. otolog, plazma ile seyreltildi ve alınan örneklerden incelemeler yapıldı.

Results: The mean PMP and PDGF levels in freeze-thawed APCs were significantly higher (2763±399.4/µL vs. 319.9±80.5/µL, p<0.001 and 550.9±73.6 pg/mL vs. 96.5±49 pg/mL, p<0.001, respectively), but the viability rates were significantly lower (68.2±13.7% vs. 94±7.5%, p<0.001) than those of fresh APCs. The mean endogenous thrombin

Bulgular: Dondurulup çözülmüş ATS’lerdeki TKM seviyeleri tazeATS’lerdekinden anlamlı düzeyde daha yüksekti (2763±399,4/µL ve 319,9±80,5/µL; p<0,001). Dondurulup çözülmüş ATS’lerdeki PDGF seviyeleri de taze ATS’lerdekinden anlamlı düzeyde daha yüksekti (550,9±73,6 pg/mL ve 96,5±49 pg/mL; p<0,001). Bununla birlikte dondurulup çözülmüş ATS’lerin canlılıkları taze ATS’lere göre anlamlı düzeyde düşüktü (68,2±13,7% ve 94±7,5%, p<0,001). Dondurulup

Address for Correspondence/Yazışma Adresi: Soner YILMAZ, M.D., University of Health Sciences Gülhane Faculty of Medicine, Blood Training Center and Blood Bank, Ankara, Turkey Phone : +90 312 304 4902 E-mail : drsoneryilmaz@gmail.com This study was honored with an award for clinical laboratory hematology at the 41st National Hematology Congress of Turkey.

Received/Geliş tarihi: January 31, 2016 Accepted/Kabul tarihi: April 15, 2016

Turk J Hematol 2017;34:64-71

Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey

potential (ETP) of freeze-thawed APCs was significantly higher than that of the fresh APCs (3406.1±430.4 nM.min vs. 2757.6±485.7 nM.min, p<0.001). Moreover, there was a significant positive poor correlation between ETP levels and PMP levels (r=0.192, p=0.014).

çözülmüş ATS’lerin ortalama endojen thrombin potensiyelleri (ETP) taze ATS’lerinkinden istatiksel olarak anlamlı düzeyde yüksekti (3406,1±430,4 nM.min ve 2757,6±485,7 nM.min, p<0,001). Ayrıca ETP ile TKM düzeyleri arasında istatiksel olarak anlamlı zayıf pozitif korelasyon mevcuttu (r=0,192, p=0,014).

Conclusion: Our results showed that, after cryopreservation, while levels of PMPs were increasing, significantly higher and earlier thrombin formation was occurring in the samples analyzed despite the significant decrease in viability. Considering the damage caused by the freezing process and the scarcity of evidence for their in vivo superiority, frozen platelets should be considered for use in austere environments, reserving fresh platelets for prophylactic use in blood banks. Keywords: Platelet, Cryopreservation, Microparticle generation, Hemostatic activity

Sonuç: Çalışmamızdaki sonuçlar dondurulup çözüldükten sonra ATS’lerdeki trombositlerin canlılıklarında önemli düzeyde azalma olsa da, daha erken ve daha yüksek trombin oluşumunun gerçekleştiğini ve bunun da dondurma işlemi sonrası anlamlı düzeyde artan TKM’ler ile ilişkili olarak meydana geldiğini göstermektedir. Dondurma işlemi ile trombositlerde hasarlanmalar meydana gelmektedir ve dondurulmuş trombositlerin in vivo kullanımlarının taze trombositlere göre üstünlüğü ile ilgili bilimsel kanıtlar yetersizdir. Bu sebeple dondurulmuş trombosit süspansiyonlarının travma şartlarında kullanılmalarının ve taze trombosit süspansiyonlarının ise kan bankalarında, profilaktik kullanım amacıyla bulundurulmalarının daha uygun olacağı değerlendirilmiştir. Anahtar Sözcükler: Trombosit, Kriyoprezervasyon, Mikropartikül, Hemostatik aktivite

Introduction In blood banking practice, platelet concentrates prepared from apheresis devices or whole blood donations have a shelf life of up to 7 days. In order to overcome short shelf life-related logistic problems, Klein et al. investigated the use of previously cryopreserved platelets in a bleeding thrombocytopenic patient. Their study was carried out in the 1950s. Since then, numerous in vivo and in vitro studies have been published [1,2]. Dimethyl sulfoxide (DMSO) is the most common method for freezing platelets, but the removal of DMSO can be done before freezing or after thawing platelets. After thawing, platelet concentrate may be diluted with plasma, normal saline, or platelet additive solutions. These processes may yield an in vitro platelet recovery of 70%-80% [3]. While fresh liquid platelets have a short shelf life, frozen platelets can be stored for up to 3 years [4]. Autologous, allogenic, ABO, and human leukocyte antigen-compatible platelet transfusions are benefits of cryopreserved platelets in patients with refractoriness to prophylactic platelet transfusion. Natural disasters and large-scale military conflicts may cause austere environments in which cryopreserved platelets may serve as the sole platelet resources for the treatment of trauma-associated coagulopathy. Moreover, platelet leukocyte antigen 1 negative and type-specific platelet stores for human leukocyte antigen compatibility tests are among the numerous benefits [5]. Due to the ease of transportation and because no laboratory tests are required for their transfusion in emergency settings, various countries store cryopreserved platelets as part of their national contingency plans for natural disasters, terror attacks, and large-scale military conflicts. Extensive use of frozen platelets has been adopted by various armies, including in Australia [6]

and Spain [7], which have published their experiences. However, scientific evidence for their efficacy is scarce. Besides the advantages of the transfusion of frozen platelets on hemostatic activity, there are deleterious effects that the freezing and thawing processes exert on platelet functions, which become manifest by in vitro tests. A recently reported deleterious effect of platelet cryopreservation is the activation and procoagulant membrane changes of platelets, resulting in the generation of plateletderived microparticles (PMPs). Platelet activation also leads to the degranulation and release of platelet-derived growth factors (PDGFs) [3,8]. Information on the contribution of the activation and procoagulant membrane changes of platelets after cryopreservation to the hemostatic activity and to the PDGF content of the platelet concentrates is scarce in the literature. As such, the purpose of our study was to explore whether and to what extent the activation and procoagulant changes of platelet membranes after cryopreservation affect the in vitro hemostatic activity and PDGF content of apheresis platelet concentrates (APCs).

Materials and Methods In August 2013, University of Health Sciences Gülhane Faculty of Medicine Ethics Committee approval was received for the assessment of in vitro hemostatic activity of cryopreserved APCs. Platelet concentrates were obtained using the apheresis method (Trima, CaridianBCT, Inc., Lakewood, CO, USA) from 20 donors that met the national blood and blood products criteria for the donation of APCs. A total of 200 mL of APCs was collected in acid-citrate-dextrose (ACD, NIH, Formula A, Baxter Healthcare Corp., Deerfield, IL, USA) at a ratio of 1 volume of ACD to 10 volumes of blood. APCs were divided into two volume 65

Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey

packs of 100 mL each. Before freezing, APCs were preserved in an automatic shaker (horizontal plane, at 20-24 °C) for 1 day. Freezing Process of Apheresis Platelet Concentrates Due to the fact that plasma-reconstituted cryopreserved platelets are more procoagulant than those reconstituted in PAS-G or 0.9% NaCl [3], all of the APCs were collected/stored and diluted with autologous plasma rather than the additive solution used for the cryopreservation procedure. The methods used for freezing in our study were based on the previously published methods of Valeri et al. [9]. Plasma collected by apheresis from each donor (41 mL) and 9 mL of 27% DMSO were mixed in an empty blood bag located on a rigid ice pack. The resultant 50 mL mixture and 100 mL of APCs were collected in a 750 mL ethyl vinyl acetate freezing bag through a sterile hose combining device. The final DMSO concentration in the freezing bag was 6% and the bag was centrifuged at 22 °C and 1250 g for 10 min (Thermo Fisher Scientific RC12BP, Asheville, NC, USA). A platelet pellet of 20-25 mL was obtained after removal of the supernatant and the bag was put in a cardboard freezing box and stored at -80 °C [9]. Thawing of Frozen Apheresis Platelet Concentrates Cryopreserved platelets were stored for 24 h at -80 °C and then thawed by immersion in 37 °C water for 10 min. According to Valeri et al. [9], 50 mL of plasma is to be added after the thawing of 200-300 mL of cryopreserved APCs. However, in the current study, the volume of the APCs that underwent cryopreservation was 100 mL. Thus, we added 20 mL of freshly thawed plasma. Prior to testing, the thawed platelets were kept at room temperature for 30 min without agitation, as explained by Valeri et al. [9]. In Vitro Measurements All analyses were performed in the fresh state before freezing and after diluting the APCs in the post-thaw period. The fresh and frozen APCs were analyzed for the determination of platelet counts with a whole blood analyzer device (ABX Pentra XL80, HORIBA ABX SAS, Montpellier, France). Thrombin Generation Testing Thrombin generation tests (TGTs) were performed with a calibrated automated thrombogram (CAT®, Thrombinoscope BV, Maastricht, the Netherlands) device that uses a slow-acting fluorogenic substrate instead of a chromogenic substrate for the latest TGTs. Thrombin generation closely correlates with platelet concentration. Thus, prior to testing, the platelet counts were normalized for the TGT. In TGTs, thrombin generation occurs in the presence of both phospholipid and tissue factor, 66

Turk J Hematol 2017;34:64-71

which are present in either the platelet supernatant and/or the reagents. The platelet-rich plasma reagent (Thrombinoscope BV, the Netherlands) contains 1 pmol/L tissue factor and is used to assess the presence of phospholipid in the sample. The thrombin generation assays were performed 30 min after the thawing process. A sample of 80 µL was collected from both dilution groups. Each sample was transferred to three different microtitrated plates (Immulon 2HB, Thermo Electron Corporation, Milford, MA, USA) that involved 20 µL of platelet-rich plasma reactant and 20 µL of thrombin calibrator. After the incubation of the mixture at 37 °C for 15 min, a sample of 20 µL was collected and added to 20 µL of Fluo-Buffer® solution, and the reaction was monitored with a fluorometer. Using the Trombinoscope® program, thrombogram curves, endogenous thrombin potentials (ETPs), and peak heights were measured. The area under the curve, which indicates the total amount of endogenous thrombin generated, was recorded as nmol/L x minute. The peak height, which indicates the highest thrombin value measured, was shown as nmol/L [10]. Isolation and Quantitation of Microparticles Flow cytometric analysis was used to quantify and characterize PMPs, which were identified by their size and the use of monoclonal antibodies (mAb) to determine the cellular origin. Analysis of PMPs was performed by adding 20 µL of CD41a fluorescein isothiocyanate (FITC; BD, USA) and CD62P phycoerythrin (PE; BD, USA) antibodies and 50 µL of sample to Trucount tubes (BD, USA). Tubes were incubated in the dark at room temperature for 20 min. After incubation, samples were suspended with 1 mL of phosphate buffered saline, which contained 1% paraformaldehyde. All samples were analyzed immediately with a FACSCanto II flow cytometer and FACSDiva software (Becton Dickinson, USA). The platelet microparticles express phosphatidylserine, which is detected by annexin V labeling [3]. During the process with the Annexin V Apoptosis Detection Kit (BioLegend, USA), 5 µL of annexin V and 10 µL of 7-AAD solutions were added over 100 µL of sample and incubated in the dark at room temperature for 15 min. Annexin V binding buffer (400 µL) was added and analyzed by flow cytometry. Flow cytometric determination of PMPs was performed by using 1.0 µL beads (LB 8, Sigma, St. Louis, MO, USA). These beads were used to mark microparticle gates in order to confirm the PMP size. Forward scatter (FSC) and side scatter (SSC) were set to logarithmic gain for sample assessment. For the calculation of PMP absolute number, 20,000 event measurements were performed in Trucount tubes. Annexin V-positive, CD41apositive, and CD62P-negative microparticles were defined as PMPs (Figure 1). The absolute number of PMPs per µL was

Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey

Turk J Hematol 2017;34:64-71

calculated from the appropriate dot-plot values entered into the following formula [11]: Number of events in the PMP region (P1) x Total number of beads per tube Number of beads collected (P2) x Test volume (µL) Viability Evaluation Assays Assays were performed with 7-AAD (actinomycin D analog), which binds to DNA and was initially used in chromosome analysis, cell cycle studies, and the quantification of apoptosis. To date, 7-AAD staining followed by flow cytometry analysis is one of the most widely established assays for viability evaluation. 7-AAD has the ability to penetrate the cell membrane and complex; the DNA of dead cells, however, cannot be penetrated. Platelets do not contain a nucleus, but they are rich in mitochondria [12]. Cell death and injury often lead to release or exposure of intracellular molecules called damageassociated molecular patterns (DAMPs) or cell death-associated molecules. The mitochondrial DNA (mtDNA) can also function

as a DAMP [13]. The mtDNA is released from dying or dead cells, with which 7-AAD has the ability to complex [14]. Cell viability was assessed by an assay using FITC-conjugated annexin V and 7-AAD. Briefly, samples were suspended in 100 µL of annexin binding buffer containing 5 µL of FITC-conjugated annexin V (1:5 dilution) and 10 µL of 7-AAD (100 µg/mL) and incubated at room temperature for 15 min. After the incubation period, 400 µL of annexin binding buffer was added. Samples were then immediately analyzed with a FACSCanto II flow cytometer and FACSDiva software (Becton Dickinson, USA) (Figure 2). In the total cell population analyzed, cells unstained and stained with 7-AAD were reported as a percentage of live and dead cells, respectively (Table 1). Platelet-Derived Growth Factors An enzyme-linked immunosorbent assay (ELISA) test was performed to analyze PDGFs by using Human PDGF-BB ELISA kits (RayBiotech, Norcross, GA, USA). Absorbance of the ELISA plate was read and concentrations were assessed on an EL800x microplate reader [15].

Figure 1. Isolation and quantitation of microparticles in freeze-thawed apheresis platelet concentrate samples. A) P1 is showing the gate of annexin-bound microparticles, which are selected in comparison with 1.0 µm latex beads (P2). B) Q1 is showing CD62P (+) and CD41a (-) platelet-derived microparticles, Q4 is showing CD62P (-) and CD41a (+) platelet-derived microparticles. C) Q4 is showing CD62P (-) and CD41a (+) and annexin V (+) platelet-derived microparticles. Table 1. Comparison of the test results of fresh and freeze-thawed apheresis platelet concentrates. Apheresis Platelet Suspensions Test

Parameter

Fresh (n=20)

Freeze-Thawed (n=20)

p-value

Thrombin Generation Tests

Lag time (s)

9±2.2

7.5±6.3

<0.001

ETP (nM.min)

2757.6±485.7

3406.1±430.4

<0.001

Peak (nM)

282.1±29.4

288.8±71.3

0.07

Time to peak (s)

14.3±2.5

12.6±5.4

<0.001

PMP (absolute count/µL)

319.9±80.5

2763±399.4

<0.001

Viability (%)

94±7.5

68.2±13.7

<0.001

PDGF (pg/mL)

96.4±49

550.96±73.6

<0.001

Flow Cytometry Tests ELISA Tests

ETP: Endogenous thrombin potential, PDGF: platelet-derived growth factor, PMP: platelet-derived microparticle, ELISA: enzyme-linked immunosorbent assay.

Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey

Statistical Analysis Data were analyzed using computer software (IBM SPSS Statistics 22, licensed SPSS program of University of Health Sciences Gülhane Faculty of Medicine). Descriptive statistics were reported as frequencies and percentages for categorical variables and as mean ± standard deviation (SD) for continuous variables. As the one-sample Kolmogorov-Smirnov test showed that the variables were normally distributed, parametric analyses were performed. The Student t-test was used to compare continuous variables between groups. The Pearson correlation coefficient was calculated to evaluate the relationships between variables. Statistical significance was set at 0.05.

Turk J Hematol 2017;34:64-71

fresh APCs. According to ELISA test results, the mean PDGF levels of freeze-thawed APCs were statistically significantly higher (550.96±73.6 pg/mL vs. 96.4±49 pg/mL, respectively; p<0.001) than those of fresh APCs (Table 1). Moreover, there were statistically significantly positive poor correlations between the PMP levels and the ETP levels of freeze-thawed APCs (r=0.192, p=0.014) (Figure 3A). There were also statistically significant negative correlations between the PMP levels and time to peak thrombin levels of freeze-thawed APCs (r=-0.172, p=0.029) (Figure 3B). These results showed that, after cryopreservation, while levels of PMPs were increasing, significantly higher

Results

Figure 2. Viability evaluation assays showing the 7-AAD (-) unstained freeze-thawed platelets. Platelet-derived microparticule (absolute number / mL)

Platelet derived microparticule (absolute number / mL)

There was no significant difference between the mean platelet counts of APCs before and after cryopreservation [(1195.2±153.5) x103/µL and (1167±158.9)x103/µL, respectively]. According to the TGT results, the mean ETP levels of freeze-thawed APCs were statistically significantly higher (3406.1±430.4 nM.min vs. 2757.6±485.7 nM.min, p<0.001), mean lag times were statistically significantly shorter (7.5±6.3 s vs. 9±2.2 s, p<0.001), and mean times to peak thrombin levels were statistically significantly shorter (12.6±5.4 s vs. 14.3±2.5 s, p<0.001) than those of the fresh APCs. According to the flow cytometric test results, the mean PMP levels of freeze-thawed APCs were statistically significantly higher (2763±399.4 absolute count/ µL vs. 319.9±80.5 absolute count/µL, respectively; p<0.001), but the mean viability rate was statistically significantly lower (68.2±13.7% vs. 94±7.5%, respectively; p<0.001) than that of

A 6.0

6.0

4.0

2.0

0 1500

2000

2500 3000 ETP (nM.minute)

3500

4000

2.0

0 9.00

12.00

15.00 18.00 Time to peak (second)

21.00

Figure 3. Correlation analyses related to platelet-derived microparticles. A) Scatterplot with linear fit graph of correlation analysis between platelet-derived microparticle levels and endogenous thrombin potential levels of freeze-thawed apheresis platelet concentrates. B) Scatterplot with linear fit graph of correlation analysis between platelet-derived microparticle levels and time to peak thrombin levels of freeze-thawed apheresis platelet concentrates. 68

Turk J Hematol 2017;34:64-71

and earlier thrombin formation was occurring in the samples analyzed despite the significant decrease in viability.

Discussion In this study, platelets were cryopreserved in 6% DMSO at -80 °C and reconstituted in plasma upon thawing. Results demonstrated that cryopreserved platelets generate high numbers of annexin V (phosphatidylserine)-expressing microparticles and PDGFs. Furthermore, our results suggest that cryopreservation of APCs increases their hemostatic activity via the PMP-related formation of significantly earlier and higher thrombin, despite the significant decrease in their viabilities. It was demonstrated that phosphatidylserine-expressing PMPs support normal coagulation through the assembly of the FXaand thrombin-generating coagulation enzyme complexes [16]. It has also been suggested that PMPs are up to 100-fold more procoagulant than platelets [17]. Our results, similar to those of Johnson et al. [3], confirmed the contribution of PMPs to the global coagulation potential of cryopreserved APCs. TGTs have been used for identifying bleeding and hypercoagulability disorders in patients [18]. Our results suggest that cryopreserved platelets are hypercoagulable, as evidenced by a reduced lag time and time to peak and an increased thrombin generation potential (ETP) compared to the prefreeze period. Moreover, there were statistically significantly positive correlations between the ETPs and PMPs, as well as statistically significantly negative correlations between PMP levels and time to peak thrombin. Thus, our results showed that, after cryopreservation, while levels of PMPs were increasing, significantly higher and earlier thrombin formation was occurring in the samples analyzed. Besides the generation of PMPs, platelet activation via the cryopreservation process also leads to the release of granule contents within platelets. These granules are repositories for PDGFs and many coagulation factors [3,8,19]. After the freezing/thawing process, the levels of PDGFs in the APCs were 5.6-fold higher than those of the fresh APCs. Our results, similar to those of Ronci et al., also provide a rationale for using cryopreserved platelets in regenerative medicine [20]. Ronci et al. studied the release kinetics of PDGFs in homologous platelet-rich plasma, which was obtained from a platelet-apheresis procedure, and used it for the treatment of persistent ocular epithelial defects. To activate the platelets, they only used a cycle of freezing/thawing, without using a fibrin matrix as a support element or calcium chloride or thrombin for platelet activation. Similar to the results of our study, the levels of PDGF in the homologous platelet-rich plasma obtained from the platelet-apheresis procedure were 6.3-fold higher

Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey

than the levels before the freezing/thawing process. All patients improved clinically during the follow-up period and the authors suggested that high levels of platelet counts were not required to treat corneal lesions when platelet-rich plasma was activated by a cycle of freezing/thawing. While our study and that of Johnson et al. [3] suggest that cryopreserved platelets may have greater hemostatic potential than liquid-stored platelets, there are deleterious effects that the processes of freezing and thawing have on platelet functions, as demonstrated by in vitro tests. Frozen platelet adhesion is significantly decreased when compared to both fresh platelets and platelets stored for >5 days [21]. Recovery, survival, and other in vitro function markers, such as stimulus-response coupling, aggregation, granule release, and pH, are also impaired in frozen platelets [22,23,24]. It has also recently been reported that frozen and thawed platelets showed reduced surface expression of GPIIb and GPIbα and diminished aggregation response to agonists [25]. In a more recent study designed to evaluate the in vitro hemostatic efficacy of frozen versus fresh platelet transfusions by rotational thromboelastometry, a dual effect in frozen platelet transfusion was found: a hypercoagulable state (shortening of clotting time) and a more predominant impairment of frozen platelet functions when compared to fresh platelets (shorter maximum clot firmness/maximum clot elasticity and longer clot formation time) [26]. Despite these conflicting results, cryopreserved platelets have been used with great success in military operations since 2001, with more than 1000 units transfused to at least 333 patients [27]. Khuri et al. reported that the in vivo hemostatic functions of cryopreserved platelets in cardiopulmonary bypass surgery patients were superior to those of fresh liquid-preserved platelets [28]. On the other hand, cryopreserved platelets have also been transfused prophylactically [2,29], and although increments in platelet counts were reported, it is not clear whether the platelets were hemostatically active and safe. The possible failure of traditional in vitro indicators to truly represent the in vivo potential may be the cause of this discrepancy between the results of in vivo and in vitro studies on cryopreserved platelets. In 2013, Dumont et al.’s randomized controlled study provided support for this hypothesis [30]. They evaluated the recovery and survival of 6% dimethyl sulfoxidefrozen autologous platelets in healthy volunteers. They showed that there were no significant differences in functional, morphologic, or in vivo 24-h recovery rates of cryopreserved platelets derived from fresh or 2-day-old irradiated apheresis platelets. They suggested that the accumulating literature knowledge supports proceeding with additional studies to evaluate the clinical effectiveness of cryopreserved platelets 69

Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey

[30]. In 2016, Cid et al. revealed that cryopreserved platelets present a phenotype supporting a moderate increase in the rate of clot formation, form stable platelet clots, and do not present a hypercoagulable phenotype during in vitro functional tests [31].

Conclusion Considering the damage caused by the freezing process and scarce evidence for in vivo superiority, perhaps frozen platelets should be recommended for austere environments such as combat casualty care, reserving fresh platelets for daily use in blood banks. Therefore, establishment of cryopreserved platelet banks as a part of national contingency plans (natural disasters, large-scale military conflicts, etc.) may be an appropriate strategy. If the utilities of cryopreserved platelets are to be expanded beyond the treatment of combat trauma, such as prophylactic platelet transfusions or regenerative medicine, prospective clinical studies are required to determine their safety and efficacy in well-defined patient cohorts. Ethics Ethics Committee Approval: University of Health Sciences Gülhane Faculty of Medicine Ethics Committee, Decision of session dated in August 2013; Informed Consent: It was taken. Authorship Contributions Concept: İbrahim Eker, Soner Yılmaz; Design: Orhan Gürsel, Ferit Avcu, Nazif Zeybek, Ahmet Emin Kürekçi, İsmail Yaşar Avcı; Data Collection or Processing: Rıza Aytaç Çetinkaya, Cengizhan Açıkel; Analysis or Interpretation: Aysel Pekel, Zerrin Ertaş, Ahmet Pekoğlu; Literature Search: Sebahattin Yılmaz, Uğur Muşabak; Writing: Aytekin Ünlü, İbrahim Eker, Soner Yılmaz. Conflict of Interest: No conflict of interest was declared by the authors. Financial Disclosure: We are grateful to the Turkish Society of Hematology for the full funding of this study.

References

Turk J Hematol 2017;34:64-71

6. Neuhaus SJ, Wishaw K, Lelkens C. Australian experience with frozen blood products on military operations. Med J Aust 2010;192:203-205. 7. Navarro Suay R, Tamburri Bariain R, Vírseda Chamorro I, Pérez Ferrer A. Use of frozen platelets in massive limb trauma. Rev Esp Anestesiol Reanim 2015;62:233-234. 8. Klüter H, Bubel S, Kirchner H, Wilhelm D. Febrile and allergic transfusion reactions after the transfusion of white cell-poor platelet preparations. Transfusion 1999;39:1179-1184. 9. Valeri CR, Ragno G, Khuri S. Freezing human platelets with 6 percent dimethyl sulfoxide with removal of the supernatant solution before freezing and storage at -80 °C without postthaw processing. Transfusion 2005;45:1890-1898. 10. Dargaud Y, Wolberg AS, Luddington R, Regnault V, Spronk H, Baglin T, Lecompte T, Ten Cate H, Negrier C. Evaluation of a standardized protocol for thrombin generation measurement using the calibrated automated thrombogram: an international multicenter study. Thromb Res 2012;130:929-934. 11. Raynel S, Padula MP, Marks DC, Johnson L. Cryopreservation alters the membrane and cytoskeletal protein profile of platelet microparticles. Transfusion 2015;55:2422-2432. 12. Collins ML, Eng S, Hoh R, Hellerstein MK. Measurement of mitochondrial DNA synthesis in vivo using a stable isotope-mass spectrometric technique. J Appl Physiol 2003;94:2203-2211. 13. Krysko DV, Agostinis P, Krysko O, Garg AD, Bachert C, Lambrecht BN, Vandenabeele P. Emerging role of damage-associated molecular patterns derived from mitochondria in inflammation. Trends Immunol 2011;32:157164. 14. Lecoeur H, de Oliveira-Pinto LM, Gougeon ML. Multiparametric flow cytometric analysis of biochemical and functional events associated with apoptosis and oncosis using the 7-aminoactinomycin D assay. J Immunol Methods 2002;265:81-96. 15. Kaetzel DM Jr, Morgan D 3rd, Reid JD 4th, Fenstermaker RA. Site-directed mutagenesis of the N-linked glycosylation site in platelet-derived growth factor B-chain results in diminished intracellular retention. Biochim Biophys Acta 1996;1298:250-260. 16. Keuren JF, Magdeleyns EJ, Govers-Riemslag JW, Lindhout T, Curvers J. Effects of storage-induced platelet microparticles on the initiation and propagation phase of blood coagulation. Br J Haematol 2006;134:307-313. 17. Sinauridze EI, Kireev DA, Popenko NY, Pichugin AV, Panteleev MA, Krymskaya OV, Ataullakhanov FI. Platelet microparticle membranes have 50- to 100fold higher specific procoagulant activity than activated platelets. Thromb Haemost 2007;97:425-434. 18. Al Dieri R, De Laat B, Hemker HC. Thrombin generation: what have we learned? Blood Rev 2012;26:197-203. 19. Blair P, Flaumenhaft R. Platelet alpha-granules: basic biology and clinical correlates. Blood Rev 2009;23:177-189.

1. Klein E, Toch R, Farber S, Freeman G, Fiorentino R. Hemostasis in thrombocytopenic bleeding following infusion of stored, frozen platelets. Blood 1956;11:693-698.

20. Ronci C, Ferraro AS, Lanti A, Missiroli F, Sinopoli S, Del Proposto G, Cipriani C, De Felici C, Ricci F, Ciotti M, Cudillo L, Arcese W, Adorno G. Platelet-rich plasma as treatment for persistent ocular epithelial defects. Transfus Apher Sci 2015;52:300-304.

2. Schiffer CA, Aisner J, Wiernik PH. Clinical experience with transfusion of cryopreserved platelets. Br J Haematol 1976;34:377-385.

21. Owens M, Cimino C, Donnelly J. Cryopreserved platelets have decreased adhesive capacity. Transfusion 1991;31:160-163.

3. Johnson L, Coorey CP, Marks DC. The hemostatic activity of cryopreserved platelets is mediated by phosphatidylserine-expressing platelets and platelet microparticles. Transfusion 2014;54:1917-1926.

22. Valeri CR. The current state of platelet and granulocyte cryopreservation. Crit Rev Clin Lab Sci 1981;14:21-74.

4. Valeri CR, Srey R, Lane JP, Ragno G. Effect of WBC reduction and storage temperature on PLTs frozen with 6 percent DMSO for as long as 3 years. Transfusion 2003;43:1162-1167. 5. Valeri CR, Ragno G. Cryopreservation of human blood products. Transfus Apher Sci 2006;34:271-287.

23. Dullemond-Westland AC, Van Prooijen HC, Riemens MI, Akkerman JW. Cryopreservation disturbs stimulus-response coupling in a platelet subpopulation. Br J Haematol 1987;67:325-333. 24. Spector JI, Skrabut EM, Valeri CR. Oxygen consumption, platelet aggregation and release reactions in platelets freeze-preserved with dimethylsulfoxide. Transfusion 1977;17:99-109.

Turk J Hematol 2017;34:64-71

Eker İ, et al: Increasing the Awareness of Cryopreserved Platelets in Turkey

25. Johnson LN, Winter KM, Reid S, Hartkopf-Theis T, Marks DC. Cryopreservation of buffy-coat-derived platelet concentrates in dimethyl sulfoxide and platelet additive solution. Cryobiology 2011;62:100-106.

transfusions of cryopreserved and liquid preserved platelets on hemostasis and blood loss after cardiopulmonary bypass. J Thorac Cardiovasc Surg 1999;117:172-183.

26. Pérez-Ferrer A, Navarro-Suay R, Viejo-Llorente A, Alcaide-Martín MJ, de Vicente-Sánchez J, Butta N, de Prádena Y Lobón JM, Povo-Castilla J. In vitro thromboelastometric evaluation of the efficacy of frozen platelet transfusion. Thromb Res 2015;136:348-353.

29. Rumjantseva V, Hoffmeister KM. Novel and unexpected clearance mechanisms for cold platelets. Transfus Apher Sci 2010;42:63-70.

27. Noorman F, Badloe J. -80°C frozen platelets, efficient logistics: available, compatible, safe and effective in the treatment of trauma patients with or without massive blood loss in military theatre. Transfusion 2012;52(Suppl):33A. 28. Khuri S, Healey N, MacGregor H, Barnard MR, Szymanski IO, Birjiniuk V, Michelson AD, Gagnon DR, Valeri CR. Comparison of the effects of

30. Dumont LJ, Cancelas JA, Dumont DF, Siegel AH, Szczepiorkowski ZM, Rugg N, Pratt PG, Worsham DN, Hartman EL, Dunn SK, O’Leary M, Ransom JH, Michael RA, Macdonald VW. A randomized controlled trial evaluating recovery and survival of 6% dimethyl sulfoxide-frozen autologous platelets in healthy volunteers. Transfusion 2013;53:128-137. 31. Cid J, Escolar G, Galan A, López-Vilchez I, Molina P, Díaz-Ricart M, Lozano M, Dumont LJ. In vitro evaluation of the hemostatic effectiveness of cryopreserved platelets. Transfusion 2016;56:580-586.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0086 Turk J Hematol 2017;34:72-80

Rituximab Therapy in Adults with Refractory Symptomatic Immune Thrombocytopenia: Long-Term Follow-Up of 15 Cases Refrakter Semptomatik İmmün Trombositopeni Tanılı Erişkinlerde Rituksimab Tedavisi: 15 Olgunun Uzun Süreli İzlemi Fehmi Hindilerden1, İpek Yönal-Hindilerden2, Mustafa Nuri Yenerel², Meliha Nalçacı², Reyhan Diz-Küçükkaya3 1Bakırköy Sadi Konuk Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey 2İstanbul University İstanbul Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey 3İstanbul Bilim University Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey

Abstract

Öz

Objective: This paper prospectively evaluates the long-term followup [mean ± standard deviation (SD) duration: 89.7±19.4 months] data of 15 patients (13 females and 2 males) with refractory symptomatic immune thrombocytopenia (ITP) treated with rituximab.

Amaç: Çalışmamızda rituksimab ile tedavi edilen refrakter semptomatik immün trombositopeni (İTP) tanılı 15 olgunun (13 kadın ve 2 erkek) uzun süreli izlemi sonucundaki [ortalama ± SD (standart deviasyon) süresi: 89,7±19,4 ay] verileri incelenmiştir.

Materials and Methods: Rituximab was administered at 375 mg/m2 weekly for a total of 4 doses. Complete response (CR) was defined as a platelet count of ≥100,000/mm3 and partial response (PR) as a platelet count of ≥30,000/mm3 but less than 100,000/mm3. Early response (ER) and late response (LR) were defined as response within 42 days and after 42 days of initiation of rituximab therapy, respectively. Sustained response (SR) was defined as response lasting for at least 6 months.

Gereç ve Yöntemler: Rituksimab haftada bir 375 mg/m2 dozunda toplam 4 doz uygulanmıştır. Tam yanıt (TY) trombosit sayısının ≥100,000/mm3 olması ve parsiyel yanıt (PY) trombosit sayısının ≥30,000/mm3 olması fakat 100,000/mm3’ün altında olması olarak tanımlanmıştır. Erken yanıt (EY) ve geç yanıt (GY) ise sırasıyla rituksimab başlangıcından 42 gün içinde ve 42 gün sonra yanıt elde edilmesi olarak tanımlanmıştır. Sürekli yanıt (SY), yanıtın en az 6 ay sürmesi olarak tanımlanmıştır.

Results: Mean age (±SD) at the start of rituximab was 46.6±11.3 years. Mean platelet count (±SD) prior to rituximab treatment was 17,400±8878/mm3. The mean time (±SD) between rituximab therapy and response to rituximab in early responders and late responders was 1.8±1.3 weeks and 10±2.8 weeks, respectively. Mean durations (±SD) of ER and LR were 51±47.2 months and 6±4.2 months, respectively. Seven of the 15 patients (46.7%) showed an initial response to rituximab (5 ER and 2 LR). The rate of SR over 6 months was 26.7% (4/15). Among the responders to rituximab, 3 (3/7, 42.9%) maintained their response 1 year after rituximab treatment and 2 (2/7, 28.6%) had ongoing response 5 years after initiation of rituximab. Two of the 7 patients (28.6%) still maintained their response 98 months after initiation of rituximab. All 5 initial responders with subsequent relapse achieved response from subsequent treatment modalities (3 CR, 2 PR).

Bulgular: Rituksimab tedavisinin başladığı sırada ortalama yaş (±SD) 46,6±11,3 yıldır. Rituksimab tedavisi öncesinde ortalama trombosit sayısı (±SD) 17,400±8878/mm3’dür. Erken ve geç yanıt edilen olgularda rituksimab başlangıcı ile yanıta kadar geçen ortalama süre (±SD) sırasıyla 1,8±1,3 hafta ve 10±2,8 hafta olarak saptanmıştır. EY ve GY elde edilen olgularda ortalama yanıt süresi sırasıyla 51±47,2 ay ve 6±4,2 aydır. On beş olgunun 7’sinde (%46,7) rituximab tedavisine başlangıçta yanıt elde edilmiştir (5 EY, 2 GY). SY oranı %26,7’dir (4/15). Rituksimab tedavisine yanıt veren olgular arasında 3’ü (3/7, %42,9) yanıtını bir yıldan fazla ve 2’si (2/7, %28,6) yanıtını 5 yıldan fazla sürdürmüştür. Yedi olgunun ikisi (%28,6) rituksimab başlangıcından 98 ay sonra halen yanıtını korumaktadır. Başlangıçta yanıt veren 5 olgunun hepsi relaps sonrasında ardışık tedavilere yanıt vermiştir (3 TY, 2 PY).

Conclusion: Our data confirm, over a long period of observation, that rituximab is safe and effective in the management of patients with chronic refractory primary ITP.

Sonuç: Çalışmamız uzun bir gözlem sonucunda kronik refrakter primer İTP olgusunda rituksimab tedavisinin güvenilir ve etkili olduğunu desteklemektedir.

Keywords: Immune thrombocytopenia, Rituximab, Early response, Late response, Sustained response

Anahtar Sözcükler: İmmün trombositopeni, Rituksimab, Erken yanıt, Geç yanıt, Sürekli yanıt

Address for Correspondence/Yazışma Adresi: Fehmi HİNDİLERDEN, M.D., Bakırköy Sadi Konuk Training and Research Hospital, Clinic of Hematology, İstanbul, Turkey Phone : +90 212 414 71 71 E-mail : drfehmi_hindi@yahoo.com

Received/Geliş tarihi: March 01, 2016 Accepted/Kabul tarihi: March 28, 2016

Turk J Hematol 2017;34:72-80

Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia

Introduction Immune thrombocytopenia (ITP) is an autoantibody-mediated disorder characterized by a plateletcount of less than 100,000/ mm3 and increased risk of bleeding [1]. B cells play an important role in the pathophysiology of ITP, making B-cell depletion with rituximab a rational therapeutic option [2]. Glucocorticosteroids still remain the standard initial therapy for patients with symptomatic disease. Second-line treatment options include splenectomy, azathioprine, cyclosporine A, cyclophosphamide, danazol, mycophenolate mofetil, rituximab, and thrombopoietin-receptor (TPO-receptor) agonists [3]. In approximately 80% of patients, splenectomy results in response maintained at 10 years in 70% of patients, but it is associated with a life long infection risk in 1%-3% of patients [4]. Chronic refractory ITP has been defined as failure to respond to splenectomy [5]. There is no standard of care for patients with refractory or relapsing ITP after splenectomy. Although spontaneous remissions may occur in some cases, these patients carry a significant risk of bleeding and have increased morbidity and mortality [5]. Further treatment is considered in chronic refractory ITP patients with low platelet counts and bleeding symptoms [5]. Over the last decades, rituximab has been widely used to treat primary ITP patients resistant to one or more treatment lines [6,7,8,9,10,11,12,13,14,15]. Rituximab is still used off-label as a second- or third-line option in many countries. Only a few systematic reviews on the efficacy of rituximab for adult ITP patients have been published [6,16]. In the meta-analysis by Arnold et al., overall response (OR) and complete response (CR) rates with rituximab were 62.5% and 46.2%, respectively, with a median response duration of 10.5 months and a median followup of 9.5 months [6]. In a recent systematic review and metaanalysis including non-splenectomized ITP patients treated with rituximab, a CR rate of 46.8% was reported after a median follow-up of 6 months [16]. Khellaf et al. conducted a prospective multicenter registry of adult patients with ITP who were refractory to corticosteroids (97%), IVIG (71%), and splenectomy (10%) and were treated with rituximab [17]. After a median follow-up of 24 months, 61% showed an overall initial response and 39% had sustained response (SR) [17]. Data on the long-term efficacy of rituximab in adult ITP are limited [13,18,19,20,21]. Several studies reported SR rates ranging from 21% to 40% after a median follow-up period ranging from 2 to 5 years [13,18,19,20,21]. Here we prospectively assess the overall initial response and SR rates to rituximab in 15 chronic refractory symptomatic ITP patients with a follow-up duration of 7 years.

Materials and Methods We prospectively evaluated 15 patients (13 females and 2 males) diagnosed with chronic refractory ITP, all of whom

had been treated with corticosteroids and splenectomy and received various immunosuppressive agents. Rituximab was offered to the sepatients as an off-label treatment following the approval of the Ministry of Health. Informed consent for study participation was obtained from all patients. Rituximab was administered intravenously at 375 mg/m2 once weekly for 4 weeks between November 2007 and March 2008. Selective spleen scintigraphy was performed to rule out accessory spleens. Baseline platelet count spriortoinitial administration of rituximab and before each weekly infusion were recorded. During the follow-upperiod, platelet counts were obtained at the 1st, 3rd, 6th, 12th, 18th, 24th, 32nd, 40th, 48th, 56th, 64th, 72nd, 80th, 88th, and 96th months of rituximab therapy. CR was defined as any platelet count of at least 100,000/mm3 and the absence of bleeding, partial response (PR) as any platelet count between 30,000 and 100,000/mm3 and absence of bleeding, and no response (NR) as any platelet count lower than 30,000/mm3 or the presence of bleeding [1]. Early response (ER) was defined as a response within 42 days of rituximab infusion and late response (LR) was defined as response occurring 42 days after initiation of rituximab. OR to rituximab was the summation of ER and LR. SR was defined as response lasting for a minimum of 6 months [11,22]. Loss of response was defined as losing response to rituximab with any platelet count lower than 30,000/mm3 or the presence of bleeding and need for other therapy during follow-up. Time to response was defined as time from commencement of treatment to either CR or PR. Duration of response was defined as time from CR or PR until loss of CR or PR. Statistical Analysis Data were processed using SPSS 21 (University of Sussex). Characteristics of patients were described with mean ± standard deviation. Comparisons between groups were performed by chisquare test and Fisher’s exact test. The analysis of continuous variables among the groups was performed using the MannWhitney U test. Odds ratios are accompanied by Cornfield 95% confidence interval limits (CIs). A curve showing the proportion of patients with continuing response to rituximab was constructed by the Kaplan-Meier method. A general linear model for repeated measures was used to compare platelet values after the initiation of rituximab in responders vs. nonresponders. Probability values of p<0.05 were considered significant.

Results Patient characteristics are summarized in Table 1. There was no response to initial corticosteroid treatment in 7 patients (46.7%) and 8 patients (53.3%) lost their response to corticosteroids during follow-up. All patients were already splenectomized before rituximab therapy but 5 (33.3%) had an accessory spleen prior to rituximab infusion. The mean number of previous treatments 73

Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia

Turk J Hematol 2017;34:72-80

Table 1. Characteristics of the patients. Characteristics

Mean ± SD

Number of patients Sex Female Male Age at diagnosis (years) Age at the time of splenectomy (years) Age at rituximab infusion (years) Actual age (years) Number of previous therapies Previous therapies, n (%) Steroids Splenectomy Azathioprine Vincristine IVIG Other therapies Accompanying diseases, n (%) Diabetes mellitus Hypertension Response to initial corticosteroid treatment, n (%) NR R Presence of accessory spleen before rituximab, n (%) Initial response to rituximab therapy, n (%) NR ER LR

Loss of response to rituximab, n (%) SR to rituximab therapy, n (%) Disease status at final observation, n (%) CR PR NR Deceased Platelet count at diagnosis (/mm3) Hemoglobin level at diagnosis (g/dL) WBC count at diagnosis (/mm3) Platelet count before rituximab treatment (/mm3) Platelet count at 1st month after the initial dose of rituximab (/mm3) Time from diagnosis to splenectomy (months) Time from splenectomy to rituximab therapy (months) Time from diagnosis to rituximab therapy (months) Time to response to rituximab of early responders (weeks) Time to response to rituximab of late responders (weeks) Duration of ER (months) Duration of LR (months) Duration of OR (ER+LR) (months) Follow-up period after rituximab treatment (months) Death

13 (86.7%) 2 (13.3%) 29.6±15.8 31.7±16 46.6±11.3 54±11.6 3.6±1.04 15 (100%) 15 (100%) 11 (73.3%) 5 (33.3%) 2 (13.3%) 5 (33.3%) 3 (20%) 3 (20%) 7 (46.7%) 8 (53.3%) 5 (33.3%) 8 (53.3%) 5 (33.3%) 2 (13.3%) 5/7 (71.4%) 4 (26.7%) 5 (33.3%) 6 (40%) 2 (13.3%) 2 (13.3%) 10100±4251 11.2±1.01 8513±2146 17,400±8878 68,733±95,213 24.6±19.3 179±103.8 204±106.2 1.8±1.3 10±2.8 51±47.2 6±4.2 38.1±44.4 89.7±19.4 2 (13.3%)

NR: No response, R: response, ER: early response, LR: late response, SR: sustained response, CR: complete response, PR: partial response, OR: overall response, SD: standard deviation.

Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia

Turk J Hematol 2017;34:72-80

Table 2. List of responders to rituximab therapy (n=7). Early responders to rituximab therapy (n=5) Number Sex

Actual Previous therapies age

TTR (weeks)

Relapse

DOR (months)

FU period after first R therapy (months)

Treatment after R therapy

ITP final status

Steroids, splenectomy

Yes

Steroids, IVIG

Steroids, splenectomy, IVIG

Steroids, splenectomy

Steroids, splenectomy, azathioprine, vincristine, danazol

Yes

Steroids, azathioprine, vincristine, eltrombopag

Steroids, splenectomy, azathioprine, vincristine

Yes

Steroids

Late responders to rituximab therapy (n=2) Number

Sex

Actual age

Previous therapies

TTR (weeks)

Relapse

DOR (months)

FU period after first R therapy (months)

Treatment after R therapy

ITP final status

Steroids, splenectomy, azathioprine, vincristine, danazol

Yes

Steroids, danazol

Steroids, splenectomy, azathioprine

Yes

Eltrombopag

TTR: Time to response, DOR: duration of response, FU: follow-up, R: rituximab, CR: complete response, PR: partial response, ITP: immune thrombocytopenia.

was 3.6±1.04. The mean duration of follow-up after rituximab was 89.7±19.4 months. Seven of the patients (46.7%) showed an initial response (5 ER and 2 LR). The cumulative response rate was 46.7%. Four of the 15 patients (26.7%) achieved SR with a duration of more than 6 months. Patients with SR included 3 early responders and 1 late responder. During follow-up, 2 of the patients who obtained SR lost their response 9 months and 52 months after the initiation of rituximab, respectively. Durations of ER and LR were 51±47.2 months and 6±4.2 months, respectively. The duration of OR (ER+LR) was 38.1±44.4 months. One patient succumbed to intracranial hemorrhage and another to myocardial infarction. Patient characteristics of early and late responders are summarized in Table 2. Comparison of Immune Thrombocytopenia Patients According to Their Response Status to Rituximab Therapy Clinical and laboratory features of ITP patients stratified by response status to rituximab are outlined in Table 3. The presence of comorbid diseases was more frequent in non-responders

compared to responders, but the difference was not statistically significant (62.5% and 14.3%, respectively, p=0.117). The presence of response did not correlate with actual age, age at diagnosis, age at time of splenectomy, age at initiation of rituximab, sex, hemoglobin level and platelet count at diagnosis, initial response to corticosteroids, number of previous therapies, interval between diagnosis and initiation of rituximab, and time between splenectomy and rituximab therapy (r<0.2). A weak positive correlation was detected between the presence of response and the interval between diagnosis and splenectomy (r=0.281). A moderate positive correlation was found between the presence of response and WBC count at diagnosis (r=0.464). We showed a moderate inverse correlation between the presence of response and comorbid diseases (r=-0.423). Clinical Course Of the 7 patients with response to rituximab, 5 (3 in ER and 2 in LR) relapsed after a response duration ranging from 2 to 75

Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia

Turk J Hematol 2017;34:72-80

Table 3. Comparison of characteristic features of immune thrombocytopenia patients stratified by response status to rituximab therapy. Chronic refractory ITP patients

Patients with OR, n=7 (Mean ± SD)

Patients with NR, n=8 (Mean ± SD)

Age, at diagnosis, years

26.1±13.9

32.7±17.7

0.602

Actual age, years

51±8.8

56.7±13.6

0.685

Age at the time of splenectomy, years

28.7±13.5

34.3±18.4

0.817

Age at rituximab infusion, years

44.2±8.4

48.7±13.7

0.772

Female, n (%)

6 (85.7%)

7 (87.5%)

Hemoglobin at diagnosis, g/dL

11.4±0.9

11±1

0.363

WBC count at diagnosis, /mm

9514±2150

7637±1837

0.083

Platelet count at diagnosis, /mm3

10,428±4613

9812±4208

0.861

Number of previous therapies

3.4±1.2

3.8±0.83

0.435

Time from diagnosis to splenectomy, months

30±22.5

19.8±16.1

0.293

Time from diagnosis to rituximab therapy, months

217±140

192±73.6

0.728

Time from splenectomy to rituximab therapy, months

187.8±130

171.2±82.8

0.728

Presence of accessory spleen before rituximab, n (%)

2 (28.6%)

3 (37.5%)

Response to initial corticosteroids, n (%) R (n, %) NR (n, %)

7 (100%) 3 (42.9%) 4 (57.1%)

8 (100%) 5 (62.5%) 3 (37.5%)

0.619 -

Accompanying diseases, n (%) Hypertension (n, %) Diabetes mellitus (n, %)

1 (14.3%) 0 1 (14.3%)

5 (62.5%) 3 (37.5%) 2 (25%)

0.117 -

Follow-up period after rituximab treatment, m

97.1±30.1

83.2±25.4

0.282

Death, n (%)

2 (25%)

0.467

ITP: Immune thrombocytopenia, WBC: white blood cell, OR: overall response, NR: no response, R: response.

Status of Patients at the Final Observation

Figure 1. Proportion of patients with ongoing response during long-term follow-up. Two of the 7 patients (28.6%) still maintained their response 98 months after initiation of rituximab. 52 months (Figure 1). Figure 2 demonstrates the mean platelet counts in the whole population after initiation of rituximab. The mean platelet counts showed a trend to be higher in initial rituximab responders (n=7) compared to non-responders (n=8) (112,201±29,008/mm3 vs. 33,750±31,332/mm3, p=0.060, odds ratio: 7.8; 95% CI 35,212-176,049) (Figure 3). 76

Seven of the 15 patients (46.7%) showed an initial response (5 ER and 2 LR). However, 3 of the 5 early responders (20%) and all of the late responders lost their response, leaving 2 patients with long-lasting remissions with a mean follow-up of 89.7±19.4 months. Relapsed patients and patients with NR subsequently received various types of treatment, including steroids (n=12), eltrombopag (n=4), azathioprine (n=2), vincristine (n=1), danazol (n=1), IVIG (n=1), and accessory spleen operation (n=1). All of the initial 7 responders to rituximab achieved long-term remission even after relapse (5 CR, 2 PR), irrespective of subsequent treatment modalities (4: steroids, 2: eltrombopag, 1: azathioprine, 1: vincristine, 1: danazol, 1: IVIG) (Figure 4). In contrast, of the 8 non-responders, 2 patients still showed NR and 2 died (1 of intracranial hemorrhage and 1 of myocardial infarction). In total, 11 of the 15 patients (73.3%) achieved CR or PR during long-term observation with a mean follow-up time of 89.7±19.4 months.

Discussion The algorithm for managing adult ITP has changed with the advent of rituximab and TPO-receptor agonists as options

Number of patients

Ref.

Stasi et al. [11]

Cooper et al. [7]

Peñalver et al. [24]

Braendstrup et al. [12]

Santoro et al. [13]

Zaja et al. [25]

Aleem et al. [26]

Zaja et al. [27]

Pasa et al. [28]

Present study

Median: 3 (1-8)

At least one treatment

Median: 3 (2-6)

Several different treatments

Median: 5 (2-13)

Median: 3 (2-8)

2-5 different regimens

Previous therapies

Mean±SD: 204±106.2 months

Mean±SD: 3.6±1.04

Median: 5 (3-11)

Median: 34.5 months At least a full course of steroid (1-264) therapy

Median: 2.1 years (0.33-33.1)

Median: 49 months (1-288)

Median: 31 months (1-305)

Median: 34 months (3-360)

Median: 22 months (9-56)

ITP duration before rituximab

15 (100%)

17 (100%)

5 (13.5%)

11 (45.8%)

2 (10%)

2 (10.5%)

16 (45.7%)

47 (53%)

31 (54%)

8 (32%)

12 (13.4%) for more than 1 year

17 (29.8%) for more than 1 year

7 (28%) for more than 6 months

Sustained response

9 (45%) at last follow-up

6 (31.6%) at last follow-up

7 (46.7%)

14 (82.3%)

27 (73%)

4 (26.7%) for more than 6 months

10 (58.8%) for more than 6 months

15 (40.5%) at last follow-up

19/29 treatments (66%) 10 (24%) for more than 6 months

13 (65%)

9 (47.4%)

17/39 treatments (40%) 5/39 treatments (12.8%) for more than 1 year

49 (55.1%)

31 (54%)

13 (52%)

Splenectomizedpatients Overall response

Table 4. Review of the published data and our results in adults with immune thrombocytopenia treated with rituximab.

Mean±SD: 38.1±44.4 months

Median: 19 months (9-41)

Median: 13 weeks (1 week to 55 months)

Median: 47 weeks

Median: 72.5 weeks (24-165)

Duration of response

Mean±SD: 89.7±19.4 months

Median: 25 months (3-55) in responding patients

Median: 180 days (60-480)

Median: 53.2 months (9.292.9)

Median: 9 months (2-42)

Follow-up duration

Turk J Hematol 2017;34:72-80 Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia

Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia

Figure 2. Mean platelet counts in the whole study group after initiation of rituximab. Relapsed patients and non-responders were treated with various other therapies. Mean platelet counts at times of first, second, third, and fourth doses of rituximab and 1st, 3rd, 6th, 12th, 18th, 24th, 32no, 40th, 48th, 56th, 64th, 72nd, 80th, 88th, and 96th months of rituximab (±SD) were 17,400±8878/mm3, 70,666±122,495/mm3, 42,266±53,518/mm3, 53,533±79,974/mm3, 68,733±95,213/mm3, 54,333±81,260/mm3, 50,400±85,816/mm3, 50,266±79,408/mm3, 62,666±110,205/mm3, 59,880±116,443/mm3, 62,920±103,727/mm3, 76,746±101,374/mm33, 94,707±103,763/mm3, 118,607±128,846/ mm3, 108,315±119,597/mm3, 83,384±107,987/mm3, 95,230±104,396/ mm3, 97,846±98,858/mm3, and 99,153±99,049/mm3, respectively. for second-line treatment. The lack of studies comparing splenectomy to other second-line therapy options presents an important dilemma. Rituximab may be a curative therapy with an initial response in 50%-60% of ITP patients and a SR of 3-5 years in 20% of patients [23]. The primary aim of our study was to evaluate the long-term efficacy of rituximab treatment in 15 patients with chronic refractory ITP. The patients described in this study had persistent, severe ITP and had received a mean of 3.6±1.04 previous therapies. Table 4 summarizes our results as well the results of previous studies describing adult ITP patients treated with rituximab. Seven of our 15 patients achieved an initial response to rituximab (46.7%) (5 ER and 2 LR). Various studies have used different criteria to define response to ITP treatment. Our results are comparable with those of several studies that reported response rates between 40% and 55.1% [7,11,12,13,24]. However, our results are less favorable compared to several other reports [6,25,26,27,28]. In the systematic review by Arnold et al., the overall platelet count response to rituximab was 62.5% in adult ITP patients [6]. Zaja et al. in 2 different studies reported an initial response rate of 65% (13/20 patients) and 73% (27/37 patients), respectively [25,27]. The latter study hypothesized that earlier administration of rituximab enables higher rates of long-lasting response in adult ITP [27]. Moreover, our results are inferior to those of other studies reporting an OR of 66% and 82.3%, respectively [26,28]. 78

Turk J Hematol 2017;34:72-80

Figure 3. Comparison of mean platelet counts in responders and non-responders following rituximab therapy. There was a trend towards higher mean platelet counts (±SD) in initial rituximab responders (n=7) compared to non-responders (n=8) (112,201±29,008/mm3 vs. 33,750±31,332/mm3, p=0.06, odds ratio: 7.8; 95% CI 35,212-176,049). In rituximab responders mean platelet counts at times of first, second, third, and fourth doses of rituximab and 1st, 3rd, 6th, 12th, 18th, 24th, 32nd, 40th, 48th, 56th, 64th, 72nd, 80th, 88th,and 96th months of rituximab (±SD) were 20,000±2905/mm3, 110,000±47,594/mm3, 73,000±18,886/mm3, 98,000±28,684/mm3, 132,714±30,811/mm3, 90,000±31,195/mm3, 83,857±33,795/mm3, 82,428±31,051/mm3, 115,428±41,586/mm3, 98,028±46,959/mm3, 111,571±39,294/mm3, 127,342±37,568/ mm3, 142,657±35,001/mm3, 137,228±50,189/mm3, 150,571±43,329/mm3, 125,571±38,298/mm3, 145,142±34,753/ mm3, 142,428±33,638/mm3, and 145,857±33,156/mm3, respectively. In non-responders mean platelet counts at times of first, second, third, and fourth doses of rituximab and 1st, 3rd, 6th, 12th, 18th, 24th, 32nd, 40th, 48th, 56th, 64th, 72nd, 80th, 88th, and 96th months of rituximab (±SD) were 15,000±3138/mm3, 22,500±51,407/mm3, 18,166±20,399/mm3, 17,666±30,983/mm3, 13,666±33,279/mm3, 28,833±33,695/mm3, 23,666±36,502/mm3, 26,500±33,539/mm3, 20,166±44,918/mm3, 32,500±50,722/mm3, 25,633±42,442/mm3, 40,633±40,578/mm3, 38,766±37,805/mm3, 96,883±54,210/mm3, 59,016±46,800/mm3, 34,166±41,367/mm3, 37,000±37,537/mm3, 45,833±36,334/mm3, and 44,666±35,812/ mm3, respectively.

Figure 4. Algorithm of long-term outcome of 15 adults with immune thrombocytopenia after treatment with rituximab. ER, LR, CR, PR, and NR denote early response, late response, complete response, partial response, and no response, respectively.

Turk J Hematol 2017;34:72-80

Hindilerden F, et al: Rituximab Therapy in Refractory Symptomatic Immune Thrombocytopenia

The strength of our study lies in the long follow-up period of our patients with a mean duration of 89.7±19.4 months. We showed that 5 of the 7 responding patients (71.4%) (3/5 ER, 2/2 LR) relapsed after 2, 3, 5, 9, and 52 months, respectively. Four relapses occurred within 1 year after initial response. These findings are largely in line with previous data [9,29]. Patel et al. reported late relapses 2 years after the initiation of rituximab in adults and suggested that regular follow-up at 3-month intervals is indicated at least for the first 5 years in adults [20]. In our study, 2 adult patients showed continued response after 98 months and 1 patient relapsed 52 months after initiation of rituximab. A higher relapse rate occurred among our patients with LR compared to those with ER (100% vs. 60%). However, due to the small size of our study population, patients with ER and LR could not be compared. This issue will be the subject of our further studies. We evaluated the relationship between clinical and laboratory variables and response to rituximab. Our results are in line with findings of several studies, which reported that splenectomy, age, sex, number of previous treatments, and pretreatment platelet count were not associated with response to rituximab [7,12]. In line with the study by Santoro et al., we demonstrated that the time between diagnosis and the start of rituximab therapy did not correlate with response to rituximab [13]. Further studies are needed to determine the best scheduling of rituximab in the course of ITP. Considering the entire population, the SR rate in our study was 26.7% (4/15 patients) with a duration over 6 months and a mean follow-up of 89.7±19.4 months. The disease-free survival of these 4 patients at 98 months was 50%. Several other authors reported SR rates ranging from 28% to 40.5% [7,11,13,19,27]. Garcia-Chaves et al. reported a SR rate of 67% over a duration of 6 months, a finding superior to our results [30]. In that study, the mean number of therapies was 5.5 and 83% of patients had failed to respond to splenectomy [30]. In the pilot study by Arnold et al., the OR rate to rituximab at 6 months in non-splenectomized adults with newly diagnosed or relapsed primary ITP was 62.5% [31]. The aforementioned study is crucial in evaluating whether rituximab could be a valuable therapeutic alternative to splenectomy [31]. Godeau et al. evaluated the efficacy of rituximab in adult chronic ITP patients who had received at least 1 previous therapy and were potential candidates for splenectomy and reported that at 2 years the response rate was 40% [19]. Patel et al., in their study on long-term outcome after initiation of rituximab, reported that 21% of adults maintained response for at least 5 years [20]. Expert consensuses reported that 80% of ITP patients respond to splenectomy, and the response is sustained in approximately two-thirds of patients over 5-10 years [10,32]. Taking into account our results and literature review on efficacy and longlasting response rate, we think that rituximab treatment has a role in a subset of chronic ITP patients.

Conclusion To conclude, in 15 chronic refractory ITP patients, we showed an initial response rate and SR of 46.7% and 26.7%, respectively, while 71.4% of responders subsequently relapsed in a mean follow-up period of 89.7 months. The continuing effect of rituximab had declined to 13.3% (2/15 patients) at the last followup. Of importance in clinical practice is the observation that all initial responders to rituximab achieved long-lasting remission even after relapse, independent of subsequent therapies. Over a very long period of immunosuppression, we did not record any serious adverse events. In the era of TPO-receptor agonists, we think that rituximab still has a role in the treatment of chronic refractory ITP. Our data, based on a long period of observation, confirm the efficacy of rituximab in refractory primary ITP. Future randomized studies including large case series are needed to determine the optimal role of rituximab and which subgroup of ITP patients can most benefit from this therapy. Ethics Ethics Committee Approval: Rituximab was offered to these patients as an off-label treatment following the approval of the Ministry of Health; Informed Consent: Informed consent for study participation was obtained from all patients. Authorship Contributions Research Design: Fehmi Hindilerden, İpek Yönal-Hindilerden, Meliha Nalçacı, Reyhan Diz-Küçükkaya; Concept: Fehmi Hindilerden, Mustafa Nuri Yenerel, Reyhan Diz-Küçükkaya; Data Collection or Processing: Fehmi Hindilerden, İpek YönalHindilerden; Analysis or Interpretation: Fehmi Hindilerden; Literature Search: Fehmi Hindilerden, İpek Yönal-Hindilerden; Writing: Fehmi Hindilerden, İpek Yönal-Hindilerden, Mustafa NuriYenerel, Meliha Nalçacı, Reyhan Diz-Küçükkaya. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Rodeghiero F, Stasi R, Gernsheimer T, Michel M, Provan D, Arnold DM, Bussel JB, Cines DB, Chong BH, Cooper N, Godeau B, Lechner K, Mazzucconi MG, McMillan R, Sanz MA, Imbach P, Blanchette V, Kühne T, Ruggeri M, George JN. Standardization of terminology, definitions and outcome criteria in immune thrombocytopenic purpura of adults and children: report from an international working group. Blood 2009;113:2386-2393. 2. Godeau B, Stasi R. Is B-cell depletion still a good strategy for treating immune thrombocytopenia? Presse Med 2014;43:e79-85. 3. George JN, Woolf SH, Raskob GE, Wasser JS, Aledort LM, Ballem PJ, Blanchette VS, Bussel JB, Cines DB, Kelton JG, Lichtin AE, McMillan R, Okerbloom JA, Regan DH, Warrier I. Idiopathic thrombocytopenic purpura: a practice guideline developed by explicit methods for the American Society of Hematology. Blood 1996;88:3-40.

Hindilerden F, et al: w Therapy in Refractory Symptomatic Immune Thrombocytopenia

4. Kojouri K, Vesely SK, Terrell DR, George JN. Splenectomy for adult patients with idiopathic thrombocytopenic purpura: a systematic review to assess long-term platelet count responses, prediction of response, and surgical complications. Blood 2004;104:2623-2634. 5. George JN. Management of patients with refractory immune thrombocytopenic purpura. J Thromb Haemost 2006;4:1664-1672. 6. Arnold DM, Dentali F, Crowther MA, Meyer RM, Cook RJ, Sigouin C, Fraser GA, Lim W, Kelton JG. Systematic review: efficacy and safety of rituximab for adults with idiopathic thrombocytopenic purpura. Ann Intern Med 2007;146:25-33. 7. Cooper N, Stasi R, Cunningham-Rundles S, Feuerstein MA, Leonard JP, Amadori S, Bussel JB. The efficacy and safety of B-cell depletion with antiCD20 monoclonal antibody in adults with chronic immune thrombocytopenic purpura. Br J Haematol 2004;125:232-239. 8. Zaja F, Iacona I, Masolini P, Russo D, Sperotto A, Prosdocimo S, Patriarca F, de Vita S, Regazzi M, Baccarani M, Fanin R. B-cell depletion with rituximab as treatment for immune hemolytic anemia and chronic thrombocytopenia. Haematologica 2002;87:189-195. 9. Bennett CM, Rogers ZR, Kinnamon DD, Bussel JB, Mahoney DH, Abshire TC, Sawaf H, Moore TB, Loh ML, Glader BE, McCarthy MC, Mueller BU, Olson TA, Lorenzana AN, Mentzer WC, Buchanan GR, Feldman HA, Neufeld EJ. Prospective phase 1/2 study of rituximab in childhood and adolescent chronic immune thrombocytopenic purpura. Blood 2006;107:2639-2642. 10. Provan D, Stasi R, Newland AC, Blanchette VS, Bolton-Maggs P, Bussel JB, Chong BH, Cines DB, Gernsheimer TB, Godeau B, Grainger J, Greer I, Hunt BJ, Imbach PA, Lyons G, McMillan R, Rodeghiero F, Sanz MA, Tarantino M, Watson S, Young J, Kuter DJ. International consensus report on the investigation and management of primary immune thrombocytopenia. Blood 2010;115:168-186. 11. Stasi R, Pagano A, Stipa E, Amadori S. Rituximab chimeric anti-CD20 monoclonal antibody treatment for adults with chronic idiopathic thrombocytopenic purpura. Blood 2001;98:952-957. 12. Braendstrup P, Bjerrum OW, Nielsen OJ, Jensen BA, Clausen NT, Hansen PB, Andersen I, Schmidt K, Andersen TM, Peterslund NA, Birgens HS, Plesner T, Pedersen BB, Hasselbalch HC. Rituximab chimeric anti-CD20 monoclonal antibody treatment for adult refractory idiopathic thrombocytopenic purpura. Am J Hematol 2005;78:275-280.

Turk J Hematol 2017;34:72-80

20. Patel VL, Mahévas M, Lee SY, Stasi R, Cunningham-Rundles S, Godeau B, Kanter J, Neufeld E, Taube T, Ramenghi U, Shenoy S, Ward MJ, Mihatov N, Patel VL, Bierling P, Lesser M, Cooper N, Bussel JB. Outcomes 5 years after response to rituximab therapy in children and adults with immune thrombocytopenia. Blood 2012;119:5989-5995. 21. Zaja F, Volpetti S, Chiozzotto M, Puglisi S, Isola M, Buttignol S, Fanin R. Longterm follow-up analysis after rituximab salvage therapy in adult patients with immune thrombocytopenia. Am J Hematol 2012;87:886-889. 22. Gudbrandsdottir S, Birgens HS, Frederiksen H, Jensen BA, Jensen MK, Kjeldsen L, Klausen TW, Larsen H, Mourits-Andersen HT, Nielsen CH, Nielsen OJ, Plesner T, Pulczynski S, Rasmussen IH, Rønnov-Jessen D, Hasselbalch HC. Rituximab and dexamethasone vs dexamethasone monotherapy in newly diagnosed patients with primary immune thrombocytopenia. Blood 2013;121:1976-1981. 23. Ghanima W, Godeau B, Cines DB, Bussel JB. How I treat immune thrombocytopenia: the choice between splenectomy or a medical therapy as a second-line treatment. Blood 2012;120:960-969. 24. Peñalver FJ, Jiménez-Yuste V, Almagro M, Alvarez-Larrán A, Rodríguez L, Casado M, Gallur L, Giraldo P, Hernández R, Menor D, Rodríguez MJ, Caballero D, González R, Mayans J, Millán I, Cabrera JR; Multi-institutional Retrospective Spanish Study Group on the Use of Rituximab in Refractory ITP. Rituximab in the management of chronic immune thrombocytopenic purpura: an effective and safe therapeutic alternative in refractory patients. Ann Hematol 2006;85:400406. 25. Zaja F, Vianelli N, Sperotto A, De Vita S, Iacona I, Zaccaria A, Masolini P, Tomadini V, Tani M, Molinari AL, Baccarani M, Fanin R. B-cell compartment as the selective target for the treatment of immune thrombocytopenias. Haematologica 2003;88:538-546. 26. Aleem A, Alaskar AS, Algahtani F, Rather M, Almahayni MH, Al-Momen A. Rituximab in immune thrombocytopenia: transient responses, low rate of sustained remissions and poor response to further therapy in refractory patients. Int J Hematol 2010;92:283-288.

13. Santoro C, Biondo F, Baldacci E, De Propris MS, Guarini A, Paoloni F, Foà R, Mazzucconi MG. Rituximab in previously treated primary immune thrombocytopenia patients: evaluation of short- and long-term efficacy and safety. Acta Haematol 2014;132:24-29.

27. Zaja F, Vianelli N, Battista M, Sperotto A, Patriarca F, Tomadini V, Filì C, Tani M, Baccarani M, Fanin R. Earlier administration of rituximab allows higher rate of long-lasting response in adult patients with autoimmune thrombocytopenia. Exp Hematol 2006;34:571-572.

14. Schweizer C, Reu FJ, Ho AD, Hensel M. Low rate of long-lasting remissions after successful treatment of immune thrombocytopenic purpura with rituximab. Ann Hematol 2007;86:711-717.

28. Pasa S, Altintas A, Cil T, Danis R, Ayyildiz O. The efficacy of rituximab in patients with splenectomized refractory chronic idiopathic thrombocythopenic purpura. J Thromb Thrombolysis 2009;27:329-333.

15. Al-Habsi K, Al-Khabori M, Al-Muslahi M, Pathare A, Al-Farsi K, Al-Huneini M, Al-Lamki S, Al-Kindi S. Rituximab leads to long remissions in patients with chronic immune thrombocytopenia. Oman Med J 2015;30:111-114. 16. Chugh S, Darvish-Kazem S, Lim W, Crowther MA, Ghanima W, Wang G, Heddle NM, Kelton JG, Arnold DM. Rituximab plus standard of care for treatment of primary immune thrombocytopenia: a systematic review and meta-analysis. Lancet Haematol 2015;2:e75-81. 17. Khellaf M, Charles-Nelson A, Fain O, Terriou L, Viallard JF, Cheze S, Graveleau J, Slama B, Audia S, Ebbo M, Le Guenno G, Cliquennois M, Salles G, Bonmati C, Teillet F, Galicier L, Hot A, Lambotte O, Lefrère F, Sacko S, Kengue DK, Bierling P, Roudot-Thoraval F, Michel M, Godeau B. Safety and efficacy of rituximab in adult immune thrombocytopenia: results from a prospective registry including 248 patients. Blood 2014;124:3228-3236. 18. Medeot M, Zaja F, Vianelli N, Battista M, Baccarani M, Patriarca F, Soldano F, Isola M, De Luca S, Fanin R. Rituximab therapy in adult patients with relapsed or refractory immune thrombocytopenic purpura: long-term follow-up results. Eur J Haematol 2008;81:165-169. 19. Godeau B, Porcher R, Fain O, Lefrère F, Fenaux P, Cheze S, Vekhoff A, Chauveheid MP, Stirnemann J, Galicier L, Bourgeois E, Haiat S, Varet B, Leporrier M, Papo T, Khellaf M, Michel M, Bierling P. Rituximab efficacy and safety in adult splenectomy candidates with chronic immune thrombocytopenic purpuvra: results of a prospective multicenter phase 2 study. Blood 2008;112:999-1004.

29. Mueller BU, Bennett CM, Feldman HA, Bussel JB, Abshire TC, Moore TB, Sawaf H, Loh ML, Rogers ZR, Glader BE, McCarthy MC, Mahoney DH, Olson TA, Feig SA, Lorenzana AN, Mentzer WC, Buchanan GR, Neufeld EJ; Pediatric Rituximab/ ITP Study Group; Glaser Pediatric Research Network. One year follow-up of children and adolescents with chronic immune thrombocytopenic purpura (ITP) treated with rituximab. Pediatr Blood Cancer 2009;52:259-262. 30. Garcia-Chavez J, Majluf-Cruz A, Montiel-Cervantes L, Esparza MG, Vela-Ojeda J; Mexican Hematology Study Group. Rituximab therapy for chronic and refractory immune thrombocytopenic purpura: a long-term follow-up analysis. Ann Hematol 2007;86:871-877. 31. Arnold DM, Heddle NM, Carruthers J, Cook DJ, Crowther MA, Meyer RM, Liu Y, Cook RJ, McLeod A, MacEachern JA, Mangel J, Anderson D, Vickars L, Tinmouth A, Schuh AC, Kelton JG. A pilot randomized trial of adjuvant rituximab or placebo for nonsplenectomized patients with immune thrombocytopenia. Blood 2012;119:1356-1362. 32. Neunert C, Lim W, Crowther M, Cohen A, Solberg L Jr, Crowther MA; American Society of Hematology. The American Society of Hematology 2011 evidencebased practice guideline for immune thrombocytopenia. Blood 2011;117:41904207.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0344 Turk J Hematol 2017;34:81-88

Discrepancies in Lymphoma Diagnosis Over the Years: A 13-Year Experience in a Tertiary Center Lenfoma Tanısında Üst Merkezle Olan Tutarsızlıklarda Yıllar İçinde Gözlenen Değişiklikler: Konsültasyon Merkezinin 13 Yıllık Deneyimi Neval Özkaya¹*, Nuray Başsüllü², Ahu Senem Demiröz¹, Nükhet Tüzüner¹ 1İstanbul University Cerrahpaşa Faculty of Medicine, Department of Pathology, İstanbul, Turkey 2İstanbul Bilim University Faculty of Medicine, Department of Pathology, İstanbul, Turkey

*The current affiliation for N.Ö. is Department of Pathology, Memorial Sloan Kettering Cancer Center, New York, USA

Abstract

Öz

Objective: In the past, accurate diagnosis of lymphoma was challenging since there were multiple competing classification systems that caused confusion and debate. After establishment of the World Health Organization lymphoma classification, lymphomas still remain a diagnostic challenge among general pathologists. The purpose of this study was to examine whether the discordance among centers has declined over the years.

Amaç: Geçmiş yıllarda, farklı birçok lenfoma sınıflandırma sisteminin yarattığı karmaşa nedeniyle doğru bir lenfoma tanısına ulaşmak tüm patologlar için uğraşı gerektirmekteydi. Dünya Sağlık Örgütü’nün lenfoma sınıflandırmasıyla birlikte lenfoma tanı ve sınıflamasına büyük ölçüde açıklık getirilmesine rağmen genel patologlar için doğru lenfoma tanısı hala bir uğraşı nedenidir. Bu çalışmanın amacı değişik merkezlerdeki tanı farklılıklarının zaman içinde azalıp azalmadığını araştırmaktır.

Materials and Methods: All lymphoma or lymphoma-suspected specimens that had been sent to the Cerrahpaşa Faculty of Medicine between 2000 and 2013 for a second opinion were deemed eligible. To evaluate the change in the discrepancy rates over time we compared the rates of revision between 2000-2008 and 2009-2013. Results: A total of 1824 patients in two time periods met the inclusion criteria. The overall discordance rate was 45.6%. This rate showed significant variations between different histologic subtypes. Discordance rates also varied significantly over time and decreased from 51.3% in 2000-2008 to 38.7% in 2009-2013 (p<0.0001). Conclusion: The high discordance rate, especially in the second period, indicates the need for easily accessible hematopathology consultation centers. Keywords: Diagnosis of lymphoma, World Health Organization lymphoma classification, Discrepancies in diagnosis, Hematopathology

Gereç ve Yöntemler: 2000-2013 yılları arasında Cerrahpaşa Tıp Fakültesi, Patoloji Anabilim Dalı’na lenfoma tanı ve/veya şüphesi ile konsültasyona gönderilen tüm olgular çalışma kapsamına alındı. Lenfoma tanısında, konsültasyon merkezi ile tutarsızlık oranlarındaki değişimleri değerlendirmek amacı ile 2000-2008 ve 2009-2013 yılları arasındaki tanı tutarsızlık oranları karşılaştırıldı. Bulgular: Çalışma kapsamına giren 1824 hastada genel uyumsuzluk oranı %45,6 olup değişik histolojik alt tipler arasında önemli farklılıklar saptandı. Tanılar arasındaki tutarsızlık oranları 2000-2008 yılları arasında %51,3 iken 2009-2013 arasında %38,7’ye gerileyerek zaman içinde anlamlı ölçüde azalma gösterdi (p<0,0001) ancak hala çok yüksekti. Sonuç: Özellikle 2009-2013 yılları arasında hala tanılar arasındaki tutarsızlık oranlarının yüksek oluşu, genel patologlar ve hematolog/ onkologların kolayca ulaşabilecekleri hematopatoloji konsültasyon merkezlerinin önemini vurgulamaktadır. Anahtar Sözcükler: Lenfoma tanısı, Dünya Sağlık Örgütü lenfoma sınıflaması, Tanı tutarsızlıkları, Hematopatoloji

Address for Correspondence/Yazışma Adresi: Nükhet TÜZÜNER, M.D., İstanbul University Cerrahpaşa Faculty of Medicine, Department of Pathology, İstanbul, Turkey Phone : +90 532 686 63 70 E-mail : tuzunern@yahoo.com

Received/Geliş tarihi: August 24, 2016 Accepted/Kabul tarihi: December 08, 2016

Özkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years

Introduction Accurate histologic diagnosis is the most crucial step for the appropriate management of patients with lymphoma. In the past this was challenging since there were numerous competing classification systems, which caused conflict and discussion [1,2]. In 2000, a new unified diagnostic classification system was recommended by the World Health Organization (WHO) based on the Revised European-American Classification of Lymphoid Neoplasms (REAL) with an emphasis on the importance of morphologic, immunophenotypic, molecular, and genetic features in defining different subtypes of disease [3,4]. The WHO classification was updated in 2008, further reinforcing the integration of these four elements in the diagnosis of lymphoma [5]. The WHO lymphoma classification is now well known and widely used by hematopathologists, making the approach to diagnosis more consistent. However, lymphomas still remain a diagnostic challenge among general pathologists. The literature on this topic reveals that widely varying agreement values have been reported recently [6,7,8,9,10]. These studies encompassed short periods and/or assessed relatively small numbers of cases. Furthermore, a vast majority of these studies included case samples from 2008 and before; therefore, information regarding the situation for more recent years is not known. We thus designed our study to investigate the situation in Turkey with many more cases to cover a longer period. The İstanbul University Cerrahpaşa Faculty of Medicine (CFM) Hematopathology Service is a reference center receiving specimens from several hospitals. In order to test the validity of the hypothesis that adoption of the WHO classification by pathologists resulted in less discrepancy among centers in correctly diagnosing lymphoma, we carried out a retrospective study by reviewing all lymphoma or lymphoma-suspected specimens that had been sent to our laboratory for a second opinion between 2000 and 2013.

Materials and Methods All specimens that had been referred to the CFM between 2000

and 2013 (excluding those with cutaneous biopsies only) for a second opinion were deemed eligible if the records of the original biopsy results were available. Biopsy specimens with a definite or suspected initial diagnosis of lymphoma were reevaluated at the CFM by an expert in hematopathology (N.T.). Initial diagnoses were not considered discordant if they defined the lymphoma type correctly but failed to give additional features related to grade (e.g., follicular lymphoma grades 1 to 2) or subtype [e.g., germinal center vs. activated B-cell types of diffuse large B-cell lymphoma (DLBCL)]. Divergent diagnoses among subtypes of T-cell lymphomas were not considered discordant since they would only minimally affect the clinical approach. 82

Turk J Hematol 2017;34:81-88

During the course of this study, 206 benign samples were received. These typically were cases in which the primary pathologist could not definitively rule out lymphoma or cases in which the patient had a history of lymphoma and displayed suggestive clinical features. To evaluate whether diagnostic discrepancy had an effect on the clinical management of the patients, we reviewed the discordant samples and confined them into one of three groups according to the differences between the referral and revised diagnoses (Table 1). Cases were grouped depending on whether the revisions would alter treatment and management according to the National Comprehensive Cancer Network guidelines, as previously described [6,11,12]. Cases where the primary pathologist or second opinion failed to reach a definitive diagnosis were also included in the study and classified as non-diagnostic. A case that was initially diagnosed as non-diagnostic was included in group B if it received a benign diagnosis upon second opinion and in group C if it received a malignant diagnosis, since it caused a delay in the commencement of therapy. Cases classified as non-diagnostic after a second opinion were considered neither concordant nor discordant and were not included in statistical analysis. To evaluate the change in the discrepancy rates of lymphoma diagnosis over time we compared the rates of revision between 2000-2008 (group 1) and 2009-2013 (group 2). Specimens from 1 January 2000 to 31 December 2008 (group 1) and from 1 January 2009 to 31 December 2013 (group 2) were evaluated using the WHO 2001 and 2008 classifications, respectively. However, our purpose in doing so was not to compare the two WHO classifications, which are essentially very similar, but rather to assess the adoption of the WHO classification by general pathologists over time. Statistical analysis was done using SPSS 15.0 for Windows. The comparison of the diagnostic revision rates was carried out using chi-square or Fisher’s exact tests.

Results A total of 1824 patients in two time periods (1008 between 2000 and 2008 and 816 between 2009 and 2013) met the inclusion criteria and were assessed. A definite diagnosis could not be attributed to 126 cases after a second opinion due to various reasons. These cases were not included in the statistical analysis. Analyses were conducted based on 1698 cases that had a definitive diagnosis following a second opinion. Initially 1372 patients had an initial diagnosis of one of the lymphoid malignancies. This number increased to 1450 after revision at the CFM. All cases diagnosed as lymphoma after a second opinion are listed together with the initial diagnoses in Table 2.

Ă&#x2013;zkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years

Turk J Hematol 2017;34:81-88

Table 1. Grouping of discrepant diagnoses according to their effect on treatment. Group

Effect of second opinion

Major revisions are those associated with definite changes in clinical management according to National Comprehensive Cancer Network guidelines [6,11,12]:Â the initial diagnosis would lead to suboptimal treatment or overtreatment.

Minor revisions are those with possible changes in clinical management: the secondary diagnosis would not lead to a major change of rendered therapy.

Delayed treatment: the initial diagnosis provided inadequate information to allow possible treatment to be started safely. Example: Specimen diagnosed as unspecified lymphoma or atypical lymphoid infiltration.

Table 2. Referral and final pathologic diagnoses in period of 2000-2008 (n=810) (A) and period of 2009-2013 (n=640) (B). Table 2A. Referral and final pathologic diagnoses in 2000-2008 (n=810). Diagnosis

Total

1 DLBCL

1266

146

2 cHL

144

185

3 TCL

4 BL

5 FL G1-2

6 FL G3

7 LBL

8 CLL/SLL

9 MZL

10 NLPHL

11 LL-NOS

12 MCL

13 GZL

14 PCN

15 L-NOS

16 LPL

17 HL-NOS

18 IL-NOS

19 Benign

20 ALI

21 UMT

22 Non-lym

23 B-NHL

24 Non dx

Total cases

278

203

810

Conc (%)

The majority of group A was composed of lymphoma typing discrepancies in both periods (Table 3). Even with the improved concordance rate in histological subtypes over time, the histological subtypes that frequently mimic these diagnoses were generally similar. DLBCLs, the most common diagnosis,

were frequently misdiagnosed as classical Hodgkin lymphoma (cHL) (n=24) in both periods. All of those cases were T-cell rich B-cell lymphoma (TCRBCL), a subtype of DLBCL. cHL, the second most common diagnosis, was frequently misdiagnosed as T-cell lymphoma (TCL) (n=11) in both periods. The majority of those 83

Ă&#x2013;zkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years

Turk J Hematol 2017;34:81-88

Table 2. Referral and final pathologic diagnoses in period of 2000-2008 (n=810) (A) and period of 2009-2013 (n=640) (B). Table 2B. Referral and final pathologic diagnoses in 2009-2013 (n=640). Final diagnosis Diagnosis

Total

1 DLBCL

1226

155

2 cHL

121

134

3 TCL

4 BL

5 FL G1-2

6 FL G3

7 LBL

8 CLL/SLL

9 MZL

10 NLPHL

11 LL-NOS

12 MCL

13 GZL

14 PCN

15 L-NOS

16 LPL

17 HL-NOS

18 IL-NOS

19 Benign

20 ALI

21 UMT

22 Non-lym

23 B-NHL

24 Non dx

Total cases

209

147

640

Conc (%)

27 52

LBL: Lymphoblastic lymphoma, CLL/SLL: chronic lymphocytic leukemia/small lymphocytic lymphoma, LPL: lymphoplasmacytic lymphoma, PCN: plasma cell neoplasia, MZL: marginal zone lymphoma, FL G1-2: follicular lymphoma grades 1 and 2, FL G3: follicular lymphoma grade 3, MCL: mantle cell lymphoma, DLBCL: diffuse large B-cell lymphoma, BL: Burkitt lymphoma, TCL: T-cell and NK-cell lymphomas, NLPHL: nodular lymphocyte predominant Hodgkin lymphoma, cHL: classical Hodgkin lymphoma, GZL: gray zone lymphoma, HL-NOS: high-grade lymphoma not otherwise specified, IL-NOS: intermediate-grade lymphoma not otherwise specified, ALI: atypical lymphoid infiltration, LL-NOS: low-grade lymphoma not otherwise specified, L-NOS: lymphoma not otherwise specified, UMT: undifferentiated malign tumor, Non-lym: non-lymphoid malign tumor, B-NHL: B-cell non-Hodgkin lymphoma, Non dx: non-diagnostic, Conc: concordance.

Özkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years

Turk J Hematol 2017;34:81-88

Table 3. Summary of the diagnostic discrepancies in lymphoma diagnosis by category in 2000-2008 and 2009-2013. 2000-2008 (n=927)

2009-2013 (n=771)

Group A

n=229 (24.7%)

n=114 (14.8%)

<0.0001

I. Lymphoma typing discrepancy:

165 (17.8%)

75 (9.7%)

0.0001

- NHL

→ HL

27 (2.9%)

7 (0.9%)

- HL

→ NHL

34 (3.7%)

11 (1.4%)

- cHL

→ NLPHL

8 (0.9%)

3 (0.4%)

- NLPHL

→ cHL

6 (0.6%)

2 (0.3%)

- Less Aggressive

→ Aggressive

37 (4%)

19 (2.5%)

- Aggressive

→ Less Aggressive

24 (2.6%)

23 (3%)

- Aggressive

→ Aggressive

2 (0.2%)

1 (0.1%)

- B Cell

→ T Cell

2 (0.2%)

2 (0.3%)

- T Cell

→ B Cell

4 (0.4%)

1 (0.1%)

- HL

→ GZL

9 (1%)

1 (0.1%)

- GZL

→ HL

2 (0.2%)

- NHL

→ GZL

5 (0.5%)

2 (0.3%)

- GZL

→ NHL

4 (0.4%)

1 (0.1%)

2 (0.3%)

II. Changes from lymphoma to benign:

16 (1.7%)

13 (1.7%)

III. Changes from benign to lymphoma:

22 (2.4%)

15 (1.9%)

IV. Non-lymphoid tumors revised as lymphoma:

16 (1.7%)

5 (0.6%)

V. Lymphoid tumors revised as non-lymphoid tumors:

8 (0.9%)

4 (0.5%)

VI. Non-lymphoid tumors revised as benign lymphoid lesion:

2 (0.2%)

1 (0.1%)

VII. Non-lymphoid tumors revised as non-lymphoid hematologic malignancy:

1 (0.1%)

- Other

Group B

n=62 (6.7%)

n=52 (6.7%)

I. Typing of low-grade B-NHL group:

23 (2.5%)

15 (1.9%)

II. Ambiguous/non-diagnostic report revised

18 (1.9%)

15 (1.9%)

III. Typing of benign lymphoid diseases:

7 (0.8%)

2 (0.3%)

IV. Typing of DLBCL:

4 (0.4%)

9 (1.2%)

VI. DLBCL report revised as FL G3 or vice versa:

6 (0.6%)

1 (0.1%)

Group C:

n=184 (19.8%)

n=132 (17.1%)

I. Ambiguous/ non-diagnostic report revised as lymphoid malignancy:

181 (19.5%)

131 (17%)

II. Ambiguous/ non-diagnostic report revised as non-lymphoid hematologic malignancy:

3 (0.3%)

0.96

VII. Other:

cases were the anaplastic large cell lymphoma (ALCL) subtype. Nodular lymphocyte-predominant Hodgkin lymphoma (NLPHL) was frequently misdiagnosed as cHL (n=11) in both periods. While TCL cases were frequently misdiagnosed as cHL, with

0.16

1 (0.1%)

10 such cases in the first period, this situation was completely improved in the second period (n=0). In the second period, the most common histologic type, revised as TCL, was TCRBCL with two cases. 85

Özkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years

Table 4. Comparison of distributions of diagnostic revision, 2000-2008 and 2009-2013. Category

2000-2008

2009-2013

229 (24.7%)

114 (14.7%)

<0.0001

62 (6.7%)

52 (6.7%)

0.96

184 (19.8%)

132 (17.1%v)

0.16

Concordant cases

452 (48.7%)

473 (61.3%)

<0.0001

Total

927

771

The majority of group B was composed of typing deficiency of the low-grade B-cell lymphoma group (Table 3). Fifty-two of the 57 cases diagnosed as low-grade lymphoma not otherwise specified (LL-NOS) were revised as lymphoma. The majority of group C, including changes that may lead to delay in treatment, was composed of ambiguous diagnoses. Of the 129 cases of unspecified lymphoma (L-NOS) as initial diagnosis, 109 were revised as lymphoma. After expert review, the majority of cases were reclassified as DLBCL (n=49). There were some cases called atypical lymphoid infiltration (ALI) that did not specify a fully benign or malignant diagnosis. Fifty-six and 61 such cases were received in the first and second periods, respectively. Thirty-seven and 34 of those cases were identified as lymphoma after expert review, respectively. While cHL (n=12) was the most diagnosed subtype in the first period, cHL (n=8) and DLBCL (n=8) were equal in the second period. The majority of the remaining cases were classified as benign diagnoses (n=25). After review, 2 cases were reclassified as nonlymphoid lesions: granulocytic sarcoma and histiocytosis. Thirty-three and 18 cases in the first and second periods had been received with a diagnosis of undifferentiated malignant tumor (UMT), respectively. Only one of the cases was also diagnosed as UMT after expert review. Twenty-eight of the remaining cases were reclassified as lymphoma after expert review in the first period. The most frequently diagnosed histological subtype was DLBCL (n=17). After revision there were also two nonlymphoma diagnoses, which were lymphoma-like lesion of the cervix (n=1) and granulocytic sarcoma (n=1). For the remaining two cases, it was inappropriate to make a diagnosis with the given materials. All of the cases (n=18) in the second period were classified as lymphoma after revision. The most frequently diagnosed lymphoma subtype was DLBCL (n=11). Twenty-nine samples had an initial diagnosis of lymphoma, which was changed to benign/reactive. These were 20 cases of reactive hyperplasia (RH), 2 thymoma, 1 necrosis, 2 Kikuchi’s disease, 2 progressive transformation of germinal centers (PTGC), 1 Castleman’s disease, and 1 lymphoepithelial sialadenitis (LESA). 86

Turk J Hematol 2017;34:81-88

Of the 20 cases diagnosed as RH at our center, 1 case was called ALCL at the referring center. This lesion was developed after a purified protein derivative test. One case was called Burkitt lymphoma (BL), but this lesion had occurred after bee stings. Other cases were plasma cell neoplasia (PCN) (n=1), L-NOS (n=4), MCL (n=1), NLPHL (n=1), high grade B-cell lymphoma (HL-NOS) (n=1), FL G2 (n=1), FL G1 (n=2), cHL (n=5), and unspecified B-cell lymphoma (B-NHL) (n=2). Of the 2 cases diagnosed as thymoma at our center, one was assigned as B-NHL and the other TCL at the referring centers. Of the two cases diagnosed as Kikuchi’s disease at our center, one was assigned as L-NOS and the other as cHL. Of the two cases diagnosed as PTGC at our center, one was assigned as FL G2 and the other as NLPHL. The case diagnosed as Castleman’s disease at our center was assigned as LL-NOS. The case diagnosed as necrosis at our center was assigned as B-NHL. The case diagnosed as LESA at our center was assigned as HL-NOS at the referring center. Of the 206 samples with an initial diagnosis of a reactive or benign condition, 37 were changed to lymphoid malignancy after expert review (Table 2). Fourteen samples had an initial diagnosis of lymphoma, which was changed to a non-lymphoid diagnosis. Nine of the cases in the first period and 5 of the cases in the second period were sent with a histologic type of lymphoma diagnosis. Of the 3 cases with a referral diagnosis of cHL, 2 were reclassified as carcinoma and 1 as histiocytosis. Two cases had a referral diagnosis of HL-NOS, where 1 was reclassified as carcinoma and the other as granulocytic sarcoma. Four cases with the initial diagnosis of L-NOS were reclassified, 2 as carcinoma and 1 each as granulocytic sarcoma and choriocarcinoma. There were 3 cases with a referral diagnosis of TCL, and 1 had the diagnosis revised to thymoma, 1 was reclassified as nasopharyngeal carcinoma, and 1 was reclassified as small cell lung carcinoma (it was sent with a diagnosis of “NK cell leukemia/lymphoma”). One case with a referral diagnosis of B-NHL was reclassified as thymoma. One case with a referral diagnosis of DLBCL was reclassified as nasopharyngeal carcinoma. Twenty-one cases with a primary diagnosis of non-lymphoid malignancy were defined as lymphoma after a second opinion. The most common malignancy mimicking lymphoma was poorly differentiated/undifferentiated carcinoma. The overall discordance rate was 45.6% (774 of 1698 samples). This rate showed significant variations between different histologic subtypes. In 343 of the 774 patients with discordant diagnoses, a second review would lead to a considerable change in the clinical management of the patient (group A). In 114 patients the revised result would have only minimal impact on the patient care (group B), while in 316 patients the insufficient primary diagnoses would lead to delayed or potentially

Turk J Hematol 2017;34:81-88

inappropriate treatment without the second opinion review (group C). Discordance rates also varied substantially over time. The overall discordance rate decreased from 51.3% in 2000-2008 to 38.7% in 2009-2013 (p<0.0001). The discordance rate in group A decreased from 24.7% to 14.7% (p<0.0001). Changes in other categories (groups B and C) were not statistically significant (Table 4). In this study, 189 relapsed cases were also sent for consultation. A definite diagnosis could not be attributed to 15 of these cases with the given materials. In these relapsed cases, major changes (32.8%, n=62, p<0.0001) and overall discrepancy rate (59.8%, n=98, p=0.1) were higher when compared to the overall study. There was a higher rate of major revision in diagnoses from non-academic centers (257/1142, 22.5%) compared to academic centers (63/302, 20.9%). However, the rates were not significantly different (p=0.59).

Discussion This article reports the experience at the CFM with secondopinion pathology review, showing an overall concordance rate of 54.4%. Compared to studies in other regions, the discordance rate of this study is higher, especially compared to Western countries where rates of less than 20%-30% have been recorded [6,7,8]. Some of the most important reasons for this are probably the recent initiation of widespread use of immunohistochemistry (IHC), deficiencies in selection of the right IHC staining panels, evaluation and implementation in primary centers, and the lack of an official training system for hematopathology in Turkey. The study that is most similar to ours in terms of selection of cases, by Matasar et al. in 2006, reported a major revision rate of 18.6% [6], and Chang et al. reported a rate of 55% [9]. In our study, we found revision rates that could change clinical management (groups A and C) as 44.2% in the first period and 31.5% in the second.

Özkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years

It was seen that grading of follicular lymphoma, and especially of FL G3, is still difficult for many pathologists, despite being one of the more common subtypes of lymphoma. This suggests the necessity of getting a second opinion from an expert hematopathologist in at least the grading of FL, and, in our opinion, in cases of low-grade lymphoma unclassified. In our analysis, we found a surprisingly high discordance rate for mantle cell lymphomas. Because of the availability of ancillary tests such as cyclin D1 in mantle cell lymphoma, it can be considered an “easy” diagnosis. However, the pathologist must recognize certain features in histopathology in order to use this ancillary test. A retrospective look revealed that 7 out of 40 discordant cases did not have IHC utilized in the initial diagnosis, and this may be one of the factors decreasing the concordance. One major concern is that we found a higher rate of major discrepancies in relapsed cases. Unfortunately, the majority of these patients had received treatment for a while before being sent for a second opinion. Therefore, it can be said that these patients were treated with an inappropriate regimen for a while. There are some limitations to our study. First, the second review was performed by one expert pathologist. Another limitation of our study is that the pathologist was not blinded to the initial diagnoses. In conclusion, in countries where widespread use of ancillary techniques like IHC and fluorescent in situ hybridization by general pathologists is a recent development, and therefore the effect of WHO classification is newly starting to be seen, the level of discordance is greater. Despite this, rates were still high in the second period, which may be caused by technical insufficiency and incorrect evaluation of IHC. The higher rate of diagnostic divergence especially in the second period indicates the need for easily accessible hematopathology consultation centers, and based on our results, we would advocate that a hematopathology fellowship education system be established.

Clinically meaningful discrepancies for every subtype of lymphoma were seen and varied considerably between lymphoma subtypes. Surprisingly, the rate of discordance of the most common subtype in Turkey, DLBCL, was high.

Ethics

TCLs are relatively rare in our geographic area and this prevents pathologists from gaining experience related to this entity. Although we grouped all mature TCLs into one category and excluded cutaneous lymphomas, there was still a high discordance rate. As indicated in the study of Herrera et al. [13], current and future therapeutic approaches target subsets of TCLs, and accurate diagnosis and distinguishing between TCL subtypes promises to become even more important. This suggests the necessity of getting a second opinion from an expert hematopathologist in cases of TCLs.

Authorship Contributions

Ethics Committee Approval: Retrospective study; Informed Consent: Retrospective study.

Concept: Nükhet Tüzüner; Design: Nükhet Tüzüner; Data Collection or Processing: Neval Özkaya, Nuray Başsüllü, Ahu Senem Demiröz, Nükhet Tüzüner; Analysis or Interpretation: Neval Özkaya, Nükhet Tüzüner; Literature Search: Neval Özkaya, Nuray Başsüllü, Ahu Senem Demiröz, Nükhet Tüzüner; Writing: Neval Özkaya, Nükhet Tüzüner. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, 87

Özkaya N, et al: Discrepancies in Lymphoma Diagnosis Over the Years

and/or affiliations relevant to the subject matter or materials included.

References 1. No authors listed. National Cancer Institute sponsored study of classifications of non-Hodgkin’s lymphomas: summary and description of a working formulation for clinical usage. The Non-Hodgkin’s Lymphoma Pathologic Classification Project. Cancer 1982;49:2112-2135. 2. No authors listed. Classification of non-Hodgkin’s lymphomas. Reproducibility of major classification systems. NCI non-Hodgkin’s Classification Project Writing Committee. Cancer 1985;55:91-95. 3. Harris NL, Jaffe ES, Diebold J, Flandrin G, Muller-Hermelink HK, Vardiman J. Lymphoma classification--from controversy to consensus: the R.E.A.L. and WHO Classification of lymphoid neoplasms. Ann Oncol 2000;11(Suppl 1):310. 4. Harris NL, Jaffe ES, Diebold J, Flandrin G, Muller-Hermelink HK, Vardiman J, Lister TA, Bloomfield CD. The World Health Organization classification of hematological malignancies report of the Clinical Advisory Committee Meeting, Airlie House, Virginia, November 1997. Mod Pathol 2000;13:193207. 5. Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H, Thiele J, Vardiman JW. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. Lyon, IARC, 2008. 6. Matasar MJ, Shi W, Silberstien J, Lin O, Busam KJ, Teruya-Feldstein J, Filippa DA, Zelenetz AD, Noy A. Expert second-opinion pathology review of lymphoma in the era of the World Health Organization classification. Ann Oncol 2012;23:159-166. 7. Proctor IE, McNamara C, Rodriguez-Justo M, Isaacson PG, Ramsay A. Importance of expert central review in the diagnosis of lymphoid malignancies in a regional cancer network. J Clin Oncol 2011;29:1431-1435.

Turk J Hematol 2017;34:81-88

8. LaCasce AS, Kho ME, Friedberg JW, Niland JC, Abel GA, Rodriguez MA, Czuczman MS, Millenson MM, Zelenetz AD, Weeks JC. Comparison of referring and final pathology for patients with non-Hodgkin’s lymphoma in the National Comprehensive Cancer Network. J Clin Oncol 2008;26:51075112. 9. Chang C, Huang SW, Su IJ, Chang KC. Hematopathologic discrepancies between referral and review diagnosis: a gap between general pathologists and hematopathologists. Leuk Lymphoma 2014;55:1023-1030. 10. Bowen JM, Perry AM, Laurini JA, Smith LM, Klinetobe K, Bast M, Vose JM, Aoun P, Fu K, Greiner TC, Chan WC, Armitage JO, Weisenburger DD. Lymphoma diagnosis at an academic centre: rate of revision and impact on patient care. Br J Haematol 2014;127:464-473. 11. Hoppe RT, Advani RH, Ai WZ, Ambinder RF, Aoun P, Bello CM, Bierman PJ, Blum KA, Chen R, Dabaja B, Duron Y, Forero A, Gordon LI, HernandezIlizaliturri FJ, Hochberg EP, Maloney DG, Mansur D, Mauch PM, Metzger M, Moore JO, Morgan D, Moskowitz CH, Poppe M, Pro B, Winter JN, Yahalom J, Sundar H; National Comprehensive Cancer Network. Hodgkin lymphoma, version 2.2012 featured updates to the NCCN guidelines. J Natl Compr Canc Netw 2012;10:589-597. 12. Zelenetz AD, Abramson JS, Advani RH, Andreadis CB, Byrd JC, Czuczman MS, Fayad L, Forero A, Glenn MJ, Gockerman JP, Gordon LI, Harris NL, Hoppe RT, Horwitz SM, Kaminski MS, Kim YH, Lacasce AS, Mughal TI, Nademanee A, Porcu P, Press O, Prosnitz L, Reddy N, Smith MR, Sokol L, Swinnen L, Vose JM, Wierda WG, Yahalom J, Yunus F. NCCN clinical practice guidelines in oncology: non-Hodgkin’s lymphomas. J Natl Compr Canc Netw 2010;8:288334. 13. Herrera AF, Crosby-Thompson A, Friedberg JW, Abel GA, Czuczman MS, Gordon LI, Kaminski MS, Millenson MM, Nademanee AP, Niland JC, Rodig SJ, Rodriguez MA, Zelenetz AD, LaCasce AS. Comparison of referring and final pathology for patients with T-cell lymphoma in the National Comprehensive Cancer Network. Cancer 2014;120:1993-1999.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0108 Turk J Hematol 2017;34:89-92

Hypogammaglobulinemia and Poor Performance Status are Predisposing Factors for Vancomycin-Resistant Enterococcus Colonization in Patients with Hematological Malignancies Hematolojik Maliniteli Hastalarda Hipogamaglobulinemi ve Kötü Performans Durumu Vankomisin Dirençli Enterokok Kolonizasyonu için Bir Risk Faktörüdür Elif Gülsüm Ümit1, Figen Kuloğlu2, Ahmet Muzaffer Demir1 1Trakya University Faculty of Medicine, Department of Hematology, Edirne, Turkey 2Trakya University Faculty of Medicine, Department of Infectious Diseases, Edirne, Turkey

Abstract

Öz

Objective: Vancomycin-resistant enterococci (VRE) are common pathogens of hospital-acquired infection. Long hospitalization periods, use of broadspectrum antibiotics, and immunosuppression are major risks for VRE colonization. We aimed to evaluate patients’ characteristics and factors that may contribute to VRE colonization. Materials and Methods: Data of 66 patients with colonization and 112 patients without colonization who were hospitalized in the hematology clinic were collected. Hematological malignancies, preexisting gastrointestinal complaints, the presence of hypogammaglobulinemia at the time of diagnosis, complications like neutropenic enterocolitis (NEC), and Eastern Cooperative Oncology Group (ECOG) and Karnofsky performance statuses were recorded. Results: Ages of the patients ranged between 19 and 95 years (mean: 55.99). Karnofsky and ECOG scores were statistically related to VRE colonization (p<0.000 and p<0.000), though only the Karnofsky score was significant based on logistic regression analysis. Almost all patients with acute leukemia (45 patients) had been on antibiotics (piperacillin-tazobactam, ceftazidime, and meropenem), while no patients with myelodysplastic syndrome, myeloma, or benign diseases and 2 patients with lymphoma and 1 with chronic myeloid leukemia were on antibiotics. Median time for colonization regardless of antibiotic use and diagnosis was 4.5 days (range: 3-11 days). In the VRE-colonized group, 40.9% of patients had NEC development, while in the non-colonized group, only 1.7% had NEC development. In the VRE-colonized group 46 patients (69.7%) and in the non-colonized group 27 patients (24.1%) had hypogammaglobulinemia at diagnosis; among these patients, 23 patients in the VRE-colonized group (50%) had a B-cell malignancy (lymphoma, myeloma, or chronic lymphocytic leukemia). Conclusion: Besides already anticipated diseases like leukemia, B-cell malignancies are also at high risk for colonization. This proclivity may be attributed to lack of gastrointestinal IgA due to hypogammaglobulinemia. Prolonged hospitalization (>7 days) may also be accepted as a risk factor, independent of diagnosis or antibiotic use. Performance status is also an important factor for colonization, which may be related to poorer hygiene and increased external help. Keywords: Hypogammaglobulinemia, Leukemia, Lymphoma, Myeloma, Vancomycin-resistant Enterococcus

Amaç: Vankomisin dirençli enterokok (VRE), sıklığı giderek artan ve tedavisi güç olan hastane kökenli enfeksiyon etkenlerindendir. Hastanede yatmak, geniş spektrumlu antibiyotiklerin kullanılması ve immünsüpresyon varlığı VRE kolonizasyonu için majör risk faktörlerindendir. Çalışmamızda VRE kolonizasyonu için önemli olabilecek risk faktörü ve hastaların özellikleri ile kolonizasyon arasındaki ilişkileri değerlendirmeyi amaçladık. Gereç ve Yöntemler: Ağustos 2012 ile Ağustos 2015 tarihleri arasında fakültemiz hematoloji kliniğinde yatan ve VRE anal kolonizasyonu saptanan 66 hasta çalışmaya alındı. VRE açısından düzenli sürveyans yapılmakta olduğundan VRE pozitifliği saptanan hastaların demografik verileri ve birincil hastalıklarına ilişkin veriler dosyalarından kayıt edildi. Bulgular: Hastalar 19-95 yaş aralığında idi (ortalama: 55,99). Karnofsky ve Doğu Kooperatifi Onkoloji Grubu skorları VRE kolonizasyonu ile ilişkili bulundu (p<0,000 ve p<0,000), ancak yalnızca Karnofsky skoru lojistik regresyon analizi ile istatitiksel anlamlılık göstermekte idi. Akut lösemili hastaların hemen tümü antibiyotik altında iken (piperasilin-tazobaktam, seftazidim ve meropenem), miyelodisplastik sendrom, miyelom ya da selim hematolojik hastalar ile 2 lenfoma ve 1 kronik miyeloid lösemi hastası antibiyotik almakta idi. Antibiyotik kullanımı ve tanıdan bağımsız olarak ortalama kolonizasyon süresi 4,5 gün (3-11 gün) idi. VRE kolonize grupta %40,9 hastada nötropenik enterokolit gelişimi gözlenir iken kolonize olmayan hastaların yalnızca %1,7’sinde nötropenik enterokolit geliştiği gözlendi. VRE kolonize hastalardan 46’sında (%69,7) ve kolonize olmayan hastaların 27’sinde (%24,1) tanı sırasında hipogamaglobulinemi var iken bu hastalarda VRE kolonize grubun %50’sinin B hücre kökenli malinitesi olduğu gözlendi (lenfoma, miyelom ya da kronik lenfositik lösemi). Sonuç: VRE kolonizasyonu, hematoloji/onkoloji kliniklerinde hızlı yayılan ve kontrol altına alınması güç bir problemdir. Hastaneye yatış sayısından ziyade, tanı sırasında hipogamaglobulinemi bulunması, performansın düşük olması ve remisyona girmemek kolonize olmaya ilişkin risk faktörüdür. Hematolojik maliniteler ve tedavileri seyrinde nötropenik eterokolit ve diyare gibi ciddi ve hayatı tehdit edici komplikasyonlar VRE kolonize olan hastalarda daha sıklıkla gözlenmiştir. Anahtar Sözcükler: Hipogamaglobulinemi, Lösemi, Lenfoma, Miyelom, Vankomisin dirençli enterokok

Address for Correspondence/Yazışma Adresi: Elif Gulsum ÜMİT, M.D., Trakya University Faculty of Medicine, Department of Hematology, Edirne, Turkey Phone : +90 284 235 76 41-2687 E-mail : egugur@yahoo.com

Received/Geliş tarihi: March 16, 2016 Accepted/Kabul tarihi: August 15, 2016

Ă&#x153;mit EG, et al: Hypogammaglobulinemia and Poor Performance for Vancomycin-Resistant Enterococci Colonization

Introduction Vancomycin-resistant enterococci (VRE) cause colonization or infection, especially in immunocompromised patients. Risk factors of VRE colonization include long periods of hospital stay, socioeconomic status, use of broad-spectrum antibiotics, and immunosuppression (neutropenia or immunosuppressive therapy) [1,2]. Since the treatment options for VRE infections are very limited, building up effective approaches to prevent VRE colonization is vital. Intensified infection-control measures like mandatory alcohol-based hand sanitation and use of disposable gloves and gowns, patient cohorting and isolation of colonized patients thorough VRE screening (for rectal colonization), and regular training of the staff and patients are crucial. First described in the 1980s, the prevalence of VRE infections increased from 4.6 to 9.4 hospitalizations per 100,000 population in 2003-2006 [3]. Related to adverse outcomes, mortality is significantly higher in infections with resistant isolates [1]. From this point of view, we aimed to evaluate additional risk factors for VRE colonization in patients with hematological malignancies and contribute our perspective.

Materials and Methods Trakya University Hospital is a 1042-bed tertiary-care teaching hospital in Edirne with an annual inpatient admission of 23,000. The annual rate of hospitalization in the hematology inpatient clinic is 550-600. The first case of VRE colonization in our hospital was recognized in 2007 in the intensive care unit. We reviewed all cases of VRE colonization in the hematology inpatient clinic between 2011 and 2014. Systematic surveillance was performed in our hospital for the detection of VRE colonization. Routine swabs for cultures were obtained from the rectum of all patients on admission and twice weekly until discharge. Colonization of VRE was defined as positive results at any time during hospitalization. Decolonization or a negative test was defined as two consecutive negative cultures. Medical records of patients were reviewed and data regarding age, sex, primary diagnosis for hospitalization, the presence of hypogammaglobulinemia at the time of diagnosis, total leukocyte count, Eastern Cooperative Oncology GroupÂ (ECOG) [4] and Karnofsky performance statuses [5] at the time of hospitalization, previous antibiotic use, and history of gastrointestinal complaints were recorded. Statistical analysis was performed with IBM SPSS Software. Categorical variables were compared using chi-square and Fisher exact tests while non-parametric variables were analyzed with the Mann-Whitney U test. Logistic regression was performed for all significant values and p-values <0.05 were accepted as significant. 90

Turk J Hematol 2017;34:89-92

Approval from the local ethics committee was obtained for this retrospective study.

Results Ages of the patients ranged between 19 and 95 years (mean: 55.99) and 78 patients were female (43.8%) while 100 were male (56.2%). Thirty-seven patients (20.8%) had acute myeloid leukemia (AML), 12 (6.7%) had acute lymphoblastic leukemia (ALL), 48 (27%) had lymphoma, 27 (15.2%) had myeloma, 18 (10.1%) had chronic lymphocytic leukemia (CLL), 5 (2.8%) had chronic myeloid leukemia (CML), 19 (10.7%) had myelodysplastic syndrome (MDS), and 12 patients (6.7%) had a benign hematological disease (immune thrombocytopenia or autoimmune hemolytic anemia). Almost all patients with acute leukemia (45 patients, 68%) had been using antibiotics for febrile neutropenia (23 patients piperacillin-tazobactam, 21 ceftazidime, and 1 meropenem). Median time for colonization, from the first day of antibiotic use to determination of colonization, was 7 days (mean: 4-11). Only 2 patients with lymphoma and 1 CML patient were on antibiotics (ampicillinsulbactam for non-neutropenic fever) and time for colonization after the use of antibiotics was >7 days. Patients with MDS, myeloma, and benign hematologic diseases with colonization were not taking antibiotics. Mean time from hospitalization (and also a hematological diagnosis) to colonization was 8.5 days (3-14 days). Performance statuses of the patients were evaluated by the ECOG and Karnofsky performance systems. Forty-six of the VRE-colonized patients (69.66%) had ECOG scores of 3 or 4 while 25 of the not-colonized group (22%) had ECOG scores of 3 or 4 (p<0.005). Fifty patients (83.3%) in the VRE-colonized group and 16 patients in the not-colonized group (14.2%) had Karnofsky performance scores of 40% or lower (p<0.005). According to the initial complaints, 28 patients in the VREcolonized group (42.42%) and 5 in the not-colonized group (4.46%) had preexisting gastrointestinal problems (diarrhea, constipation, irritable bowel syndrome) (p<0.005). Within the whole group, neutropenic enterocolitis (NEC) developed in 29 patients (16.29%). In the VRE-colonized group, 40.9% had NEC development, while in the not-colonized group, only 1.7% had NEC development (p<0.005). In the VRE-colonized group 46 patients (69.7%) and in the not-colonized group 27 patients (24.1%) had hypogammaglobulinemia at the time of diagnosis (p<0.005). Among VRE-positive patients with hypogammaglobulinemia, 23 patients in the VRE-colonized group (50%) had B-cell lineage malignancies (lymphoma, myeloma, and CLL). Within the whole group, 88 patients were observed to not be in remission (49.4%). Among VRE-positive patients, 46 patients

Turk J Hematol 2017;34:89-92

Ümit EG, et al: Hypogammaglobulinemia and Poor Performance for Vancomycin-Resistant Enterococci Colonization

were not in remission (69.69%), while among the not-colonized group, 42 patients (37.5%) were not in remission (p<0.000). Two patients died of causes related to VRE infection (3%). Characteristics of the patients are summarized in Table 1. With logistic regression analysis, odds ratios for hypogammaglobulinemia, NEC development, preexisting gastrointestinal complaints, ECOG and Karnofsky performance scores, and remission status were 4.62, 39.35, 2.31, 1.7, 29.0, and 1.8, respectively, suggesting a strong relation with hypogammaglobulinemia, NEC development, and Karnofsky performance scores. Data regarding statistical analysis are summarized in Table 2.

Discussion Infection with VRE typically follows colonization, mainly of the gastrointestinal tract. Colonization may last for a long period without causing any symptoms and may play a role like a reservoir for the transmission of VRE from one patient to another. Active surveillance for VRE in high-risk clinics such as intensive care units, transplantation units, and hematologyoncology clinics is crucial for preventing infections and further transmission. Risk factors of patients for VRE colonization are

well described as being immunocompromised or receiving multiple and prolonged courses of antibiotics and cytotoxic treatments, which all cause impairment of the gastrointestinal mucosa, gastrointestinal flora, and systemic immune system [6]. In our study, especially in patients with leukemia, antibiotic use was significant for colonization, though the duration of hospitalization was not as significant as expected. Most patients with VRE colonization will remain colonized for long periods. Spontaneous decolonization occurs infrequently and there is no treatment to eliminate colonization. Antimicrobials like oral bacitracin, novobiocin, and ramoplanin are reported to have limited effects in eliminating VRE [7,8]. Since eliminating and eradicating VRE is almost impossible once colonization occurs, controlling and preventing transmission should be the main goal of surveillance. VRE may survive (>1 week) in the environment, can be transferred by hands, and may be isolated from almost every object in health care facilities. Maintaining infection control measures is vital, such as educating staff and patients to use single-use disposable gloves and gowns and frequent hand sanitation. A more detailed list of control measures is available from the Centers for Disease Control and Prevention [9].

Table 1. General features of the patients with vancomycin-resistant Enterococcus colonization.

VRE colonization, positive

VRE colonization, negative

Total

Age (Mean, years)

56.7

54.4

55.9

Sex (Female/Male)

28 (42.42%) / 38 (57.57%)

50 (44.6%) / 62 (55.3%)

78 (43.8%) / 100 (56.2%)

Diagnosis (Number of patients)

AML

ALL

Lymphoma

Myeloma

CLL

CML

MDS

Benign

Total

112

Total

178

VRE: Vancomycin-resistant enterococci, AML: acute myeloid leukemia, ALL: acute lymphoblastic leukemia, CLL: chronic lymphocytic leukemia CML: chronic myeloid leukemia, MDS: myelodysplastic syndrome, NEC: neutropenic enterocolitis.

Table 2. Performance status, hypogammaglobulinemia, and vancomycin-resistant Enterococcus colonization.

VRE colonization, positive

VRE colonization, negative

p-values

Logistic regression odds ratio

Hypogammaglobulinemia

46 (69.6%)

27 (24.1%)

0.000

4.62

NEC development

27 (24.1%)

2 (1.7%)

0.000

39.35

Preexisting gastrointestinal complaints

28 (42.4%)

5 (4.4%)

0.000

2.31

ECOG performance ≥3

46 (69.6%)

25 (22.3%)

0.000

1.7

Karnofsky performance ≤40%

50 (757%)

16 (14.2%)

0.000

29.0

Remission status (not in remission)

46 (69.6%)

42 (37.5%)

0.000

1.8

VRE: Vancomycin-resistant enterococci, ECOG: Eastern Cooperative Oncology Group, NEC: neutropenic enterocolitis.

Ümit EG, et al: Hypogammaglobulinemia and Poor Performance for Vancomycin-Resistant Enterococci Colonization

Besides the known risk factors, hypogammaglobulinemia is a distinct state of immunodeficiency, with various causes and manifestations and complications. A common and important clinical consequence of hypogammaglobulinemia is predisposition toward infections that are otherwise prevented by antibody-related immune responses (including encapsulated bacteria Streptococcus pneumoniae and Haemophilus influenzae). Acquired or secondary major causes of hypogammaglobulinemia include drugs, renal and gastrointestinal protein loss, B-cell-related malignancies, and severe burns. The majority of renal diseases leading to hypogammaglobulinemia are nephrotic syndrome, where IgG is lost accompanied by albumin. Gastrointestinal conditions include protein-losing enteropathy and intestinal lymphangiectasia. The clinical manifestations are related to the type and severity of the immunoglobulin lost. In general, hypogammaglobulinemia results in recurrent infections with encapsulated bacteria primarily localized to the upper or lower airways. An agent used in both lymphoproliferative and rheumatic diseases, rituximab, an anti-CD20 antibody, was recently reported to cause significant hypogammaglobulinemia [10]. In our study, hypogammaglobulinemia was observed in 69.7% of the patients at the time of diagnosis. In hypogammaglobulinemic patients, 50% had a B-cell-related lineage malignancy, such as lymphoma or myeloma. Without the burden of treatment, hypogammaglobulinemia is observed to be an independent risk factor in VRE colonization. Assessment of performance of a patient brings many potential benefits. First, it helps physicians to document how the disease affects the daily living abilities of a person and to determine appropriate risk-adapted treatment and also predict the prognosis. The most generally used performance scores are the Karnofsky and ECOG scores [4,5]. Performance status is also related to a lack of personal hygiene and requirements for constant assistance. Since colonization of VRE is associated with the caregiver’s use of hospital equipment and the surroundings, the increase of colonization in patients with poorer performance is to be expected. There are limitations of our study. First of all, the number of patients is small. In a larger patient group, both positive and negative colonization groups may demonstrate more credible results. The second limitation is the lack of globulin quantitation. Since the study was not designed as a prospective study in the first place, quantitative immunoglobulin analysis was not performed. Finally, the most important limitation may be the study design. A prospective observational study with a large number of patients is needed to assess our findings.

Conclusion In clinics dealing with patients with VRE colonization, isolation of the patient as well as related materials, the extra work of disinfecting, active surveillance, and repeated education of staff 92

Turk J Hematol 2017;34:89-92

complicates the management, both economically and socially. Prevention of colonization must be the first goal of all hospitals. Ethics Ethics Committee Approval: Approval from the local ethics committee was obtained for this retrospective study; Informed Consent: Retrospective study. Authorship Contributions Concept: Elif Gülsüm Ümit; Design: Elif Gülsüm Ümit; Data Collection or Processing: Elif Gülsüm Ümit, Figen Kuloğlu; Analysis or Interpretation: Elif Gülsüm Ümit, Figen Kuloğlu, Ahmet Muzaffer Demir; Literature Search: Elif Gülsüm Ümit; Writing: Elif Gülsüm Ümit. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Diaz Granados CA, Jernigan JA. Impact of vancomycin resistance on mortality among patients with neutropenia and enterococcal bloodstream infection. J Infect Dis 2005;191:588-595. 2. Padiglione AA, Wolfe R, Grabsch EA, Olden D, Pearson S, Franklin C, Spelman D, Mayall B, Johnson PD, Grayson ML. Risk factors for new detection of vancomycin-resistant enterococci in acute-care hospitals that employ strict infection control procedures. Antimicrob Agents Chemother 2003;47:24922498. 3. Ramsey AM, Zilberberg MD. Secular trends of hospitalization with vancomycin-resistant enterococcus infection in the United States, 20002006. Infect Control Hosp Epidemiol 2009;30:184-186. 4. Oken MM, Creech RH, Tormey DC, Horton J, Davis TE, McFadden ET, Carbonne PP. Toxicity and response criteria of the Eastern Cooperative Oncology Group. Am J Clin Oncol 1982;5:649-655. 5. Karnofsky DA, Burchenal JH. The clinical evaluation of chemotherapeutic agents in cancer. In: MacLeod CM, (ed). Evaluation of Chemotherapeutic Agents. New York, Columbia University Press, 1949. 6. Murray BE. Vancomycin-resistant enterococcal infections. N Engl J Med 2000;342:710-721. 7. Wong MT, Kauffman CA, Standiford HC, Linden P, Fort G, Fuchs HJ, Porter SB, Wenzel RP; Ramoplanin VRE2 Clinical Study Group. Effective suppression of vancomycin-resistant Enterococcus species in asymptomatic gastrointestinal carriers by a novel glycolipodepsipeptide, ramoplanin. Clin Infect Dis 2001;33:1476-1482. 8. Rand KH, Houck H. Daptomycin synergy with rifampicin and ampicillin against vancomycin-resistant enterococci. J Antimicrob Chemother 2004;53:530-532. 9. Knelson LP, Williams DA, Gergen MF, Rutala WA, Weber DJ, Sexton DJ, Anderson DJ; Centers for Disease Control and Prevention Epicenters Program. A comparison of environmental contamination by patients infected or colonized with methicillin-resistant Staphylococcus aureus or vancomycin-resistant enterococci: a multicenter study. Infect Control Hosp Epidemiol 2014;35:872-875. 10. Casulo C, Maragulia J, Zelenetz AD. Incidence of hypogammaglobulinemia in patients receiving rituximab and the use of intravenous immunoglobulin for recurrent infections. Clin Lymphoma Myeloma Leuk 2013;13:106-111.

RESEARCH ARTICLE DOI: 10.4274/tjh.2015.0073 Turk J Hematol 2017;34:93-98

Antibacterial Activities of Ankaferd Hemostat (ABS) on Shiga Toxin-Producing Escherichia coli and Other Pathogens Significant in Foodborne Diseases Ankaferd Hemostat’ın (ABS) Shiga Toksijenik Escherichia coli ve Diğer Gıda Patojenleri Üzerine Antibakteriyel Etkisi Ahmet Koluman1, Nejat Akar2, İbrahim C. Haznedaroğlu3 1Republic of Turkey Ministry of Food, National Food Reference Laboratory, Department of Mineral Analyses, Agriculture, and Livestock, Ankara,

Turkey 2TOBB-ETU Hospital, Clinic of Pediatric Hematology, Ankara, Turkey 3Hacettepe University Faculty of Medicine, Department of Adult Hematology, Ankara, Turkey

Abstract

Öz

Objective: Ankaferd hemostat (Ankaferd Blood Stopper®, ABS)induced pharmacological modulation of essential erythroid proteins can cause vital erythroid aggregation via acting on fibrinogen gamma. Topical endoscopic ABS application is effective in the controlling of gastrointestinal (GI) system hemorrhages and/or infected GI wounds. Escherichia coli O157:H7, the predominant serotype of enterohemorrhagic E. coli, is a cause of both outbreaks and sporadic cases of hemorrhagic colitis. The aim of this study is to examine the effects of ABS on 6 different Shiga toxigenic E. coli serotypes including O26, O103, O104, O111, O145, and O157 and on other pathogens significant in foodborne diseases, such as Salmonella Typhimurium, Campylobacter jejuni, and Listeria monocytogenes, were also assessed.

Amaç: Ankaferd hemostat (Ankaferd Blood Stopper®, ABS) gamma fibrinojene etki ederek eritroid agregasyonuna neden olan farmakolojik modülasyondur. Topikal endoskopik ABS uygulaması gastrointestinal (Gİ) kanamalarda ve enfekte Gİ yaralarında etkili olmaktadır. Escherichia coli O157:H7, en sık karşılaşılan enterohemorajik Escherichia coli tipi olup sporadik veya salgınlar şeklinde hemorajik kolitin önemli bir etkenidir. Bu çalışmanın amacı ABS ile 6 farklı Shiga Toksijenik Escherichia coli serotipi (O26, O103, O104, O111, O145 ve O157) ve diğer önemli gıda kaynaklı patojenlerden Salmonella, Campylobacter ve Listeria monocytogenes üzerine etkisi değerlendirilmiştir. Gereç ve Yöntemler: Tüm patojenler hazırlanarak ABS’nin farklı miktarları uygulanmış ve antimikrobiyel etki izlenmiştir. Salmonella canlılığı floresan in situ hibridizasyon tekniği ile izlenmiştir.

Materials and Methods: All strains were applied with different amounts of ABS and antimicrobial effect was screened. S. Typhimurium groups were screened for survival using the fluorescence in situ hybridization technique.

Bulgular: ABS uygulamalarının sadece Escherichia coli O157 ve nonO157’ler üzerine değil aynı zamanda diğer patojenlerde de logaritmik azalma tetiklediği izlenmiştir. Bu çalışmada ABS ile farklı patojenler üzerine antibakteriyel etki gözlemlenmiştir.

Results: The relative efficacy of ABS solutions to achieve significant logarithmic reduction in foodborne pathogens E. coli O157:H7 and non-O157 serogroups and other emerging foodborne pathogens is demonstrated in this study. ABS has antibacterial effects.

Sonuç: Bu çalışma özellikle trombositopenik purpura, hemolitik üremik sendrom ve hemorajik kolit yönünden önemli Escherichia coli O157:H7’nin üzerine ABS’nin antimikrobiyel etkisi olduğunu belirleyen ilk çalışmadır. ABS uygulamalarının kolitis, enfeksiyon ve hemostaz ilişkisi daha ileri seviyede araştırılmalıdır.

Conclusion: Our present study indicated for the first time that ABS may act against E. coli O157:H7, which is a cause of thrombotic thrombocytopenic purpura, hemolytic-uremic syndrome, and hemorrhagic colitis. The interrelationships between colitis, infection, and hemostasis within the context of ABS application should be further investigated in future studies.

Anahtar Sözcükler: Ankaferd Blood Stopper, Shigatoksijenik Escherichia coli, Salmonella, Campylobacter, Listeria monocytogenes

Keywords: Ankaferd Blood Stopper, Shiga-toxigenic Escherichia coli, Salmonella, Campylobacter, Listeria monocytogenes ©Copyright 2017 by Turkish Society of Hematology Turkish Journal of Hematology, Published by Galenos Publishing House

Address for Correspondence/Yazışma Adresi: Ahmet KOLUMAN, M.D., Republic of Turkey Ministry of Food, National Food Reference Laboratory, Department of Mineral Analyses, Agriculture, and Livestock, Ankara, Turkey E-mail : ahmetkoluman@hotmail.com

Received/Geliş tarihi: February 05, 2015 Accepted/Kabul tarihi: May 04, 2015

Koluman A, et al: Antibacterial Activities of Ankaferd Hemostat

Introduction Ankaferd hemostat [Ankaferd Blood Stopper®, (ABS)]; http:// www.ncbi.nlm.nih.gov/pubmed/?term=ankaferd) is the first topical hemostatic agent regarding red blood cell (RBC)fibrinogen interactions tested in clinical trials [1]. ABS is composed of standardized plant extracts including Alpinia officinarum, Glycyrrhiza glabra, Thymus vulgaris, Urtica dioica, and Vitis vinifera [2]. ABS-induced pharmacological modulation of essential erythroid proteins (ankyrin, spectrin, actin) can cause vital erythroid aggregation by acting on fibrinogen gamma [3]. ABS also has pleiotropic effects, particularly in tissue healing, and has significant antiinfective properties [4,5,6,7,8]. The use of ABS in gastrointestinal (GI) system hemorrhages to control bleeding and/or infected GI wounds is also evident [9]. Escherichia coli O157:H7, the predominant serotype of enterohemorrhagic E. coli (EHEC), is a cause of both outbreaks and sporadic cases of hemorrhagic colitis [10]. Infection with E. coli O157:H7 presents with many complicated clinically abnormal hemostatic manifestations such as bloody diarrhea, hemolytic-uremic syndrome, or thrombotic thrombocytopenic purpura [11]. The aim of this study is to determine the effects of ABS on 6 different Shiga toxigenic E. coli (STEC) serotypes including O26, O103, O104, O111, O145, and O157. Moreover, the effects of ABS on other pathogens significant in foodborne diseases, such as Salmonella Typhimurium, Campylobacter jejuni, and Listeria monocytogenes, were also assessed. Elucidation of the effects of ABS on enterohemorrhagic bacteria is clinically important since there is a close pathobiological interrelationship between hemorrhages and hemostasis in terms of both diagnosis and management.

Materials and Methods Thirty milliliters of ABS (Immune Drug Company, İstanbul, Turkey) was transferred to the laboratory under cold chain in a residue-free sterile tube. The sample was used for analyses within 30 min of arrival. Six different STEC serotypes, including O26, O103, O104, O111, O145, and O157 ATCC 43895 (obtained from Istituto Superiore di Sanita, Rome, and the Public Health Institution of Turkey), and Salmonella typhimurium ATCC 14028 (Microbiologics, UK), Campylobacter jejuni ATCC 33560 (Microbiologics, UK), and Listeria monocytogenes ATCC 19115 (Microbiologics, UK) were used in this study in order to assess the effects of ABS. The cultures were stored at -80 °C. After thawing on ice, each strain (excluding Campylobacter jejuni) was incubated separately in 5x10 mL of brain-heart infusion (BHI) broth (Oxoid, UK) at 37 °C overnight. The cultures were passaged in BHI 3 times. The final cultures (5x10 mL) were centrifuged 94

Turk J Hematol 2017;34:93-98

(Eppendorf) at 4200 rpm and 4 °C for 5 min. The supernatants were discarded, and pellets were resuspended and washed with 10 mL of sterile 0.9% NaCl. After washing, all suspensions were recentrifuged to remove organic residues. The resulting pellets were resuspended using sterile normal saline, and all strains were collected separately in a single tube. This stock culture was further diluted with 50 mL of sterile BHI broth to achieve a target level of 107 to 108 cfu/mL, which is accepted as sufficient for decontamination studies. Campylobacter jejuni was streaked on 10 plates with charcoal cefoperazone deoxycholate modified agar (Oxoid, UK) with a sterile swab and incubated under microaerophilic conditions (Campygen, Oxoid, UK) at 42 °C for 48 h. The grayish colonies were collected into a centrifuge tube with a swab and the mixtures were centrifuged (Eppendorf) at 4200 rpm and 4 °C for 5 min. The supernatants were discarded, and pellets were resuspended and washed with 10 mL of sterile 0.9% NaCl. After washing, all pellets were recentrifuged to remove organic residues. The resulting pellets were resuspended using sterile normal saline, and all strains were collected separately in a single tube. This stock culture was further diluted with 50 mL of sterile Bolton broth (Oxoid, UK) to achieve a target level of 107 to 108 cfu/mL, which is accepted as sufficient for decontamination studies. All tubes were labeled and grouped into 2 separate groups. Tubes in group 1 were inoculated with 500 µL of ABS (per 50 mL, 1% v/v), and tubes in group 2 were inoculated with 1000 µL of ABS (per 50 mL, 2% v/v). All tubes were incubated at 37 °C under microaerophilic conditions to demonstrate the gut conditions, and samplings from these tubes were made at 5, 15, 30, and 60 min after inoculation. Next, 100 µL of these mixtures were spread-plated using a Spiral Plater (IUL, UK) on duplicate petri dishes of xylose lysine deoxycholate agar (Oxoid, UK) for Salmonella; MacConkey agar with sorbitol, cefixime, and tellurite agar (Oxoid, UK) for STEC; and chromogenic Listeria agar (Oxoid, UK) for L. monocytogenes and incubated at 37 °C aerobically for 24 h for all strains except Campylobacter jejuni, which was incubated under microaerophilic conditions (Campygen, Oxoid, UK) at 42 °C for 48 h. At the end of incubation period all typical colonies were counted and recorded. S. Typhimurium groups were screened for survival using the fluorescence in situ hybridization (FISH) technique. Vermicon kits were used for this step. The study was composed of 3 independent trials and 9 tubes were analyzed at each step. The numbers of pathogens were converted to log10 cfu/g. The data were subjected to one-way analysis of variance (ANOVA) according to a (pathogen x treatment) 9x2 factorial design. The means were separated using Fisher’s least square differences method according to general linear models. Statistical significance level was accepted as 0.05. Statistical analyses were performed using Statistical Analysis System Software version 8 (SAS Inc., USA).

Koluman A, et al: Antibacterial Activities of Ankaferd Hemostat

Turk J Hematol 2017;34:93-98

Results The results indicating the effects of ABS on the studied bacteria are depicted in Tables 1 and 2. The relative efficacy of ABS solutions to achieve significant logarithmic reduction in foodborne pathogens E. coli O157:H7 and non-O157 serogroups and other emerging foodborne pathogens is also presented in Tables 1 and 2. According to the tables, 1% (v/v) application of ABS is not sufficient to obtain a significant decrease in the numbers of pathogens. On the contrary, 2% (v/v) application causes a dramatic decrease of the pathogens of concern. It was shown that by the end of the 60th minute of application 2% (v/v) ABS causes a 4 log10 cfu/mL decrease, which was significant for all pathogens. The most significant decrease was recorded in Campylobacter jejuni, which is known for higher susceptibility to environmental and chemical changes. In Figure 1, photographs of two different applications on S. Typhimurium are provided. In the first group it can be clearly seen that sterile distilled water application had no effect on the survival of the pathogen. On the contrary, the second group of images clearly indicates the death of the pathogens with 2 mL of ABS.

Figure 1. Effect of Ankaferd Blood Stopper, (ABS) on survival of S. Typhimurium (fluorescence in situ hybridization technique using Vermicon kit): a) Survival of S. Typhimurium with 2 mL of sterile distilled water at 37 °C. There is no visible change. Plating of the homogenate indicates the stability in the viable counts. b) Survival of S. Typhimurium with 2 mL of ABS at 37 °C. There is 3 log10 cfu/mL decrease, which indicates a statistical significance.

Table 1. The Shiga toxigenic Escherichia coli results of the study in group 1 (sterile distilled water application) and group 2 [Ankaferd hemostat (ABS) application]. Group 1 STEC

Time (min) 0

O103

7.74±0.03A

7.47±0.29A

7.38±0.53A

6.65±0.15B

5.59±0.28C

O104

7.65±0.04A

7.49±0.18A

7.41±0.38A

6.60±0.30B

5.64±0.24C

O111

7.92±0.03A

7.72±0.19A

7.33±0.49A

6.68±0.12B

5.58±0.23C

O145

7.85±0.03A

7.59±0.29A

7.34±0.52A

6.51±0.51B

5.68±0.21C

O157

7.84±0.02A

7.59±0.27A

7.27±0.27AB

6.70±0.17B

5.51±0.24C

O26

7.63±0.33A

7.58±0.26A

7.46±0.39A

6.53±0.24B

5.51±0.21C

O103

7.75±0.03A

6.83±0.07B

6.48±0.33B

5.14±0.40C

3.45±0.23D

O104

7.74±0.09A

6.62±0.26B

6.11±0.23B

4.96±0.70C

3.55±0.26D

O111

7.92±0.02A

6.77±0.15B

6.09±0.34B

4.93±0.38C

3.41±0.19D

O145

7.83±0.02A

6.61±0.24B

6.12±0.18B

5.16±0.33C

3.43±0.30D

O157

7.83±0.03A

6.49±0.30B

6.11±0.26B

5.32±0.34C

3.43±0.27D

O26

7.86±0.03A

6.62±0.19B

6.28±0.19B

5.06±0.59C

3.57±0.21D

Group 2 STEC

Time (min)

ABCD: These legends are applied to show statistical difference between results shown in the same column (vertical difference) (p<0.05). STEC: Shiga toxigenic Escherichia coli.

Koluman A, et al: Antibacterial Activities of Ankaferd Hemostat

Turk J Hematol 2017;34:93-98

Table 2. The in vitro results regarding Salmonella Typhimurium, Listeria monocytogenes, and Campylobacter jejuni in group 1 (sterile distilled water application) and group 2 [Ankaferd hemostat (ABS) application]. S. Typhimurium Volume of ABS Applied

Time (min) 0

Group 1

7.85±0.04AX

7.70±0.18AX

7.35±0.29ABX

6.77±0.10BX

5.60±0.25CX

Group 2

7.82±0.09AX

6.62±0.24BY

5.94±0.34CY

5.08±0.46DY

3.33±0.43EY

Group 1

7.94±0.04AX

7.80±0.16AX

7.40±0.51AX

6.25±0.36BX

5.52±0.29BX

Group 2

7.94±0.02AX

6.58±0.26BY

6.01±0.50BY

4.65±0.13CY

3.65±0.33DY

Listeria monocytogenes Volume of ABS Applied

Time (min)

Campylobacter jejuni Volume of ABS Applied

Time (min) 0

Group 1

7.23±0.02

Group 2

7.25±0.03AX

6.93±0.10

6.65±0.34

6.04±0.21

5.48±0.30BX

6.55±0.29BX

5.59±0.38CY

4.51±0.76DY

2.56±0.35EY

ABX

ABCDE: These legends are applied to show statistical difference between results shown in the same column (vertical difference) (p<0.05). XYZ: These legends are applied to show statistical difference between results shown in the same row (horizontal difference) (p<0.05).

Discussion In this study, ABS was found to be effective against 6 different STEC serotypes, including O26, O103, O104, O111, O145, and O157, and Salmonella typhimurium and Listeria monocytogenes. Previous studies indicated that ABS might be used as a supportive agent together with antituberculous drugs during debridement of osteomyelitis and lymphadenitis lesions caused by multidrug-resistant Mycobacterium tuberculosis [4]. Oral/endoscopic ABS administration has already been performed in GI hemorrhages [9,12,13,14,15,16,17,18,19,20,21,22, 23]. Moreover, ABS is active against multiresistant bacteria, such as methicillin-resistant Staphylococcus aureus, Enterococcus spp., generic E. coli, Klebsiella spp., Acinetobacter spp., and Pseudomonas spp., as well as fungi such as Aspergillus spp., Mucor spp., and Candida albicans [4,5,6,7,8]. Our findings in this study further support previous research findings that ABS has antibacterial effects. EHEC O157:H7 is associated with hemorrhagic colitis, thrombotic thrombocytopenic purpura, and hemolytic-uremic syndrome in humans [24]. EHEC O157:H7 infection can masquerade as GI bleeding of noninfectious cause, and the antecedent diarrhea may be resolved and forgotten by the time the hemolytic uremic syndrome or thrombotic thrombocytopenic purpura is diagnosed [25]. On the other hand, ABS represents an effective alternative treatment modality for GI bleeding, either as a primary or an adjuvant agent to conventional antihemorrhagic methods. The 96

ABS GI data from published reports with encouraging results proved the safety and efficiency of ABS as a hemostatic agent for distinct states of GI bleeding. ABS is clinically effective in bleeding individuals with normal hemostatic parameters and in patients with deficient primary hemostasis and/or secondary hemostasis [9,12,13,14,15,16,17,18,19,20,21,23,26,27,28,29,30, 31,32,33,34,35,36]. ABS may act as a topical biological response modifier as well as having antihemorrhagic actions. Our present study indicates for the first time that ABS may act against E. coli O157:H7, which is a cause of hemorrhagic colitis [10]. Difficult cases of infected bleeding radiation colitis have already been managed with ABS [9,19,36,37,38]. The interrelationships between colitis, infection, and hemostasis within the context of ABS application remain to be elucidated. Infection, hemostasis, and wound healing are closely related pathobiological events to each other [39]. Next-generation RBC-related hemostatics, such as ABS nanohemostat, have been designated in the essential treatment of life-threatening bleedings by restoring physiological hemostasis via acting on RBCs [40]. Prohemostatic and antithrombin activities of ABS are linked to fibrinogen gamma chain and prothrombin by functional proteomic analyses. Those unique hemostatic properties of ABS provide a balanced hemostasis, representing a basis for physiological wound healing [3]. The proteomics of the structural and functional properties of the proteins related to the wound healing should also be matched with the already established proteomics of ABS [41]. Experimental trials indicated

Turk J Hematol 2017;34:93-98

that ABS is effective in wound healing [39,42,43,44,45,46,47]. The results of our present study disclosed that ABS has antimicrobial effects against bacteria that are active in wound and burn complications. The use of plant extracts and phytochemicals with established antimicrobial properties could be of great significance in preventive and/or therapeutic approaches. The increasing prevalence of multidrug-resistant strains of bacteria and the recent appearance of strains with reduced susceptibility to antibiotics raised the specter of “untreatable” bacterial infections and adds urgency to the search for new infectionfighting strategies. Besides broad-spectrum activity against gram-positive and gram-negative bacteria, including human pathogens and food-spoilage bacteria, ABS was found to be more stable than nisin in different heat and enzyme treatments by Akkoç et al. [5,48]. Furthermore, as indicated by Akkoç et al., the antibacterial activity of ABS can proceed in extreme environmental conditions such as the potential use of the preparation for the therapy of infectious diseases and preservation of different types of foods from foodborne pathogens or food-spoilage bacteria [5,48]. Our present results support the idea that the antiinfective properties of ABS should be tested in in vivo experiments [4,5,6,7,8]. The mechanism of action regarding the antiinfective actions of ABS is currently unknown. Several proteins (Homo sapiens malic enzyme 1, dynactin 5, cofilin, utrophin, mucin16 (CD164sialomucin-like-2 protein), chalcone flavanone isomerase 1, chalcone flavanone isomerase 2, helezonal bundle transporter protein-141, hypothetical protein LOC283638 isoform 1, hypothetical protein LOC283638 isoform 2, complex 1 intermedia related protein 30) in ABS functional proteomic analyses represent an important step to elucidate how ABS biologically affects the components of numerous pathogens [41]. Comparative molecular studies covering proteomics, genomics, transcriptomics, and metabolomics of ABS are essentially important to shed light on this extremely vital area.

Conclusion The pleiotropic effects of ABS on the vascular endothelium, blood cells, angiogenesis, cellular proliferation, vascular dynamics, and cellular mediators should be investigated to determine its potential role in many pathological states, including infectious diseases, wound healing, and inflammation. ABS, as a unique hemostatic agent within many crossroads of hemostasis, infection, and neoplasia, casts future experimental and clinical research to be placed into clinical management.

Koluman A, et al: Antibacterial Activities of Ankaferd Hemostat

Authorship Contributions Microbiological Analyses: Ahmet Koluman; Concept: Ahmet Koluman, Nejat Akar, İbrahim C. Haznedaroğlu; Design: Ahmet Koluman, Nejat Akar, İbrahim C. Haznedaroğlu; Data Collection or Processing: Ahmet Koluman, Nejat Akar, İbrahim C. Haznedaroğlu; Analysis or Interpretation: Ahmet Koluman, Nejat Akar, İbrahim C. Haznedaroğlu; Literature Search: Ahmet Koluman, Nejat Akar, İbrahim C. Haznedaroğlu; Writing: Ahmet Koluman, Nejat Akar, İbrahim C. Haznedaroğlu. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Haznedaroglu BZ, Beyazit Y, Walker SL, Haznedaroglu IC. Pleiotropic cellular, hemostatic, and biological actions of Ankaferd hemostat. Crit Rev Oncol Hematol 2012;83:21-34. 2. Beyazit Y, Kurt M, Kekilli M, Goker H, Haznedaroglu IC. Evaluation of hemostatic effects of Ankaferd as an alternative medicine. Altern Med Rev 2010;15:329-336. 3. Ozel-Demiralp D, İğci N, Ayhan B, Eğin Y, Haznedaroglu IC, Akar N. Prohemostatic and antithrombin activities of Ankaferd hemostat are linked to fibrinogen gamma chain and prothrombin by functional proteomic analyses. Clin Appl Thromb Hemost 2012;18:604-610. 4. Deveci A, Çoban AY, Tanrıverdi Çaycı Y, Acicbe Ö, Taşdelen Fışgın N, Akgüneş A, Ozatlı D, Uzun M, Durupınar B. In vitro effect of Ankaferd Blood Stopper®, a plant extract against Mycobacterium tuberculosis isolates. Mikrobiyol Bul 2013;47:71-78. 5. Akkoç N, Akçelik M, Haznedaroğlu İC, Göker H, Turgut M, Aksu S, Kirazlı Ş, Fırat HC. In vitro anti-bacterial activities of Ankaferd medicinal plant extract. Turkiye Klinikleri J med Sci 2009;29:410-415. 6. Ciftci S, Keskin F, Keceli Ozcan S, Erdem MA, Cankaya B, Bingol R, Kasapoglu C. In vitro antifungal activity of Ankaferd Blood Stopper against Candida albicans. Curr Ther Res Clin Exp 2011;72:120-126. 7. Tasdelen Fisgin N, Tanriverdi Cayci Y, Coban AY, Ozatli D, Tanyel E, Durupinar B, Tulek N. Antimicrobial activity of plant extract Ankaferd Blood Stopper®. Fitoterapia 2009;80:48-50. 8. Saribas Z, Sener B, Haznedaroglu IC, Hascelik G, Kirazli S, Goker H. Antimicrobial activity of Ankaferd Blood Stopper® against nosocomial bacterial pathogens. Cent Eur J Med 2010;5:198-202. 9. Beyazit Y, Kekilli M, Haznedaroglu IC, Kayacetin E, Basaranoglu M. Ankaferd hemostat in the management of gastrointestinal hemorrhages. World J Gastroenterol 2011;17:3962-3970. 10. Cohen MB, Giannella RA. Hemorrhagic colitis associated with Escherichia coli O157:H7. Adv Intern Med 1992;37:173-195. 11. Su C, Brandt LJ. Escherichia coli O157:H7 infection in humans. Ann Intern Med 1995;123:698-714. 12. Barkun AN, Moosavi S, Martel M. Topical hemostatic agents: a systematic review with particular emphasis on endoscopic application in GI bleeding. Gastrointest Endosc 2013;77:692-700.

Ethics

13. Beyazit Y, Kekilli M, Kurt M, Sayilir A, Haznedaroglu IC. Ankaferd hemostat for the management of tumoral GI bleeding. Gastrointest Endosc 2011;73:1072-1073.

Ethics Committee Approval: Is not needed for microbiological studies; Informed Consent: Not needed in this study.

14. Boškoski I, Familiari P, Costamagna G. New and emerging endoscopic therapies for gastrointestinal bleeding. Curr Opin Gastroenterol 2014;30:439-443.

Koluman A, et al: Antibacterial Activities of Ankaferd Hemostat

15. Jacques J, Legros R, Chaussade S, Sautereau D. Endoscopic haemostasis: an overview of procedures and clinical scenarios. Digest Liver Dis 2014;46:766-776. 16. Karaman A, Baskol M, Gursoy S, Torun E, Yurci A, Çelikbilek M, Guven K, Ozbakir O, Yucesoy M. Endoscopic topical application of Ankaferd Blood Stopper® in gastrointestinal bleeding. J Altern Complem Med 2012;18:6568.

Turk J Hematol 2017;34:93-98

32. Ozaslan E, Purnak T, Yildiz A, Haznedaroglu IC. A new practical alternative for tumoural gastrointestinal bleeding: Ankaferd blood stopper. Digest Liver Dis 2010;42:594-595. 33. Ozaslan E, Purnak T, Yildiz A, Haznedaroglu IC. The effect of a new hemostatic agent for difficult cases of non-variceal gastrointestinal bleeding: Ankaferd Blood Stopper. Hepatogastroenterology 2010;57:191-194.

17. Kurt M, Akdogan M, Onal IK, Kekilli M, Arhan M, Shorbagi A, Aksu S, Kurt OK, Haznedaroglu IC. Endoscopic topical application of Ankaferd Blood Stopper for neoplastic gastrointestinal bleeding: a retrospective analysis. Digest Liver Dis 2010;42:196-199.

34. Ozseker B, Shorbagi A, Efe C, Haznedaroglu IC, Bayraktar Y. Controlling of upper gastrointestinal bleeding associated with severe immune thrombocytopenia via topical adjunctive application of Ankaferd blood stopper. Blood Coagul Fibrinolysis 2012;23:464.

18. Kurt M, Disibeyaz S, Akdogan M, Sasmaz N, Aksu S, Haznedaroglu IC. Endoscopic application of Ankaferd blood stopper as a novel experimental treatment modality for upper gastrointestinal bleeding: a case report. Am J Gastroenterol 2008;103:2156-2158.

35. Purnak T, Ozaslan E, Beyazit Y, Haznedaroglu IC. Upper gastrointestinal bleeding in a patient with defective hemostasis successfully treated with Ankaferd Blood Stopper. Phytother Res 2011;25:312-313.

19. Kurt M, Onal I, Akdogan M, Kekilli M, Arhan M, Sayilir A, Oztas E, Haznedaroglu I. Ankaferd Blood Stopper for controlling gastrointestinal bleeding due to distinct benign lesions refractory to conventional antihemorrhagic measures. Can J Gastroenterol 2010;24:380-384. 20. Ozaslan E, Purnak T, Haznedaroglu IC. Ankaferd Blood Stopper in GI bleeding: alternative for everything? Gastrointest Endosc 2011;73:185-186. 21. Ozaslan E, Purnak T, Yildiz A, Haznedaroglu IC. A new candidate as a hemostatic agent for difficult situations during variceal bleeding: Ankaferd Blood Stopper. Saudi J Gastroenterol 2011;17:145-148. 22. ASGE Technology Committee, Wong Kee Song LM, Banerjee S, Barth BA, Bhat Y, Desilets D, Gottlieb KT, Maple JT, Pfau PR, Pleskow DK, Siddiqui UD, Tokar JL, Wang A, Rodriguez SA. Emerging technologies for endoscopic hemostasis. Gastrointest Endosc 2012;75:933-937. 23. Yarali N, Oruc M, Bay A, Dalgıc B, Bozkaya IO, Arıkoglu T, Kara A, Tunc B. Correction to: A new haemostatic agent—Ankaferd Blood Stopper: management of gastrointestinal bleeding in an infant and other experiences in children. Pediatr Hemal Oncol 2014;31:107. 24. Wan CS, Zhou Y, Yu Y, Peng LJ, Zhao W, Zheng XL. B-cell epitope KT-12 of enterohemorrhagic Escherichia coli O157:H7: a novel peptide vaccine candidate. Microbiol Immunol 2011;55:247-253. 25. Griffin PM, Ostroff SM, Tauxe RV, Greene KD, Wells JG, Lewis JH, Blake PA. Illnesses associated with Escherichia coli O157:H7 infections. A broad clinical spectrum. Ann Intern Med 1988;109:705-712. 26. Aslan E, Akyüz Ü, Pata C. The use of Ankaferd in diverticular bleeding: two case reports. Turk J Gastroenterol 2013;24:441-443. 27. Beyazit Y, Köklü S, Akbal E, Kurt M, Kekilli M, Haznedaroglu IC. Successful treatment of endoscopic sphincterotomy-induced early hemorrhage with application of Ankaferd Blood Stopper. Gastrointest Endosc 2010;72:13251326. 28. Beyazit Y, Kurt M, Sayilir A, Suvak B, Ozderin YO. Successful application of Ankaferd Blood Stopper in a patient with lower gastrointestinal bleeding. Saudi J Gastroenterol 2011;17:424-425. 29. Beyazit Y, Onder FO, Torun S, Tas A, Purnak T, Tenlik I, Turhan N. Topical application of Ankaferd hemostat in a patient with gastroduodenal amyloidosis complicated with gastrointestinal bleeding. Blood Coagul Fibrinolysis 2013;24:762-765. 30. Kurt M, Akdogan M, Ibis M, Haznedaroglu IC. Ankaferd Blood Stopper for gastrointestinal bleeding. J Invest Surg 2010;23:239. 31. Kurt M, Oztas E, Kuran S, Onal IK, Kekilli M, Haznedaroglu IC. Tandem oral, rectal, and nasal administrations of Ankaferd Blood Stopper to control profuse bleeding leading to hemodynamic instability. Am J Emerg Med 2009;27:631.

36. Shorbagi A, Sivri B. Successful management of a difficult case of radiation proctopathy with Ankaferd Blood Stopper: a novel indication (with video). Gastrointest Endosc 2010;72:666-667. 37. Ozaslan E, Purnak T, Özyigit G, Akyol F, Yildiz A, Haznedaroglu IC. No prolonged effect of Ankaferd Blood Stopper on chronic radiation proctitis. Endoscopy 2010;42:E271-E272. 38. Ozaslan E, Purnak T, Yildiz A, Akar T, Avcioglu U, Haznedaroglu IC. The effect of Ankaferd blood stopper on severe radiation colitis. Endoscopy 2009;41:E321-E322. 39. Aktaş A, Er N, Korkusuz P, Zeybek D, Onur MA, Tan G, Özdemir O, Karaismailoğlu E, Karabulut E. Ankaferd-induced early soft tissue wound healing in an experimental rat model. Turkiye Klinikleri J Med Sci 2013;33:1344-1353. 40. Huri E, Beyazit Y, Mammadov R, Toksoz S, Tekinay AB, Guler MO, Ustun H, Kekilli M, Dadali M, Celik T, Astarci M, Haznedaroglu IC. Generation of chimeric “ABS Nanohemostat” complex and comparing its histomorphological in vivo effects to the traditional Ankaferd hemostat in controlled experimental partial nephrectomy model. Int J Biomater 2013;2013:949460. 41. Özel Demiralp D, Haznedaroğlu İC, Akar N. Functional proteomic analysis of Ankaferd® Blood Stopper. Turk J Hematol 2010;27:70-77. 42. Akalin C, Kuru S, Barlas AM, Kismet K, Kaptanoglu B, Demir A, Astarci HM, Ustun H, Ertas E. Beneficial effects of Ankaferd Blood Stopper on dermal wound healing: an experimental study. Int Wound J 2014;11:64-68. 43. Cancan G, Teksoz S, Aytac E, Arikan AE, Erman H, Uzun H, Ozden F, Aydin O, Ozcan M. Effects of Ankaferd on anastomotic healing of colon. J Invest Surg 2014;27:1-6. 44. İşler SC, Demircan S, Cakarer S, Cebi Z, Keskin C, Soluk M, Yüzbaşioğlu E. Effects of folk medicinal plant extract Ankaferd Blood Stopper® on early bone healing. J Appl Oral Sci 2010;18:409-414. 45. Kaya H, Gokdemir MT, Sogut O, Demir T, Koçarslan S. Effects of folk medicinal plant extract Ankaferd Blood Stopper on burn wound healing. Acta Medica Mediterr 2013;29:497-502. 46. Tek M, Akkas I, Toptas O, Ozan F, Sener I, Bereket C. Effects of the topical hemostatic agent Ankaferd Blood Stopper on the incidence of alveolar osteitis after surgical removal of an impacted mandibular third molar. Niger J Clin Pract 2014;17:75-80. 47. Yüce S, Çandirli C, Yenidünya S, Muslu B. New hemostatic agent: the effect of Ankaferd Blood Stopper on healing wounds in experimental skin incision model. Turk J Med Sci 2014;44:288-294. 48. Akkoç N, Akçelik M, Haznedaroglu I, Goker H, Aksu S, Kirazli S, Fırat HC. In vitro anti-bacterial activities of Ankaferd blood stopper. Int J Lab Hematol 2008;30:95.

LETTERS TO THE EDITOR Turk J Hematol 2017;34:99-117

Wernicke’s Encephalopathy in a Child with Acute Lymphoblastic Leukemia Akut Lenfoblastik Lösemili Bir Çocuk Hastada Wernicke Ensefalopatisi Hande Kızılocak1, Gül Nihal Özdemir1, Gürcan Dikme1, Zehra Işık Haşıloğlu2, Tiraje Celkan1 1İstanbul University Cerrahpaşa Faculty of Medicine, Department of Pediatric Hematology-Oncology, İstanbul, Turkey 2İstanbul University Cerrahpaşa Faculty of Medicine, Department of Radiology, İstanbul, Turkey

To the Editor, We read with great interest the article “A rare complication developing after hematopoietic stem cell transplantation: Wernicke’s encephalopathy” by Solmaz et al. [1]. Wernicke’s encephalopathy (WE) is an acute syndrome requiring emergent treatment to prevent death and neurologic morbidity [2]. While most often associated with alcoholism, WE also occurs in the setting of prolonged intravenous feeding without adequate thiamine supplementation, prolonged starvation or unbalanced nutrition, gastrointestinal surgery, systemic malignancy, and transplantation [3]. The classic triad of WE includes encephalopathy, oculomotor dysfunction, and gait ataxia. In their article, Solmaz et al. reported a patient who developed WE following hematopoietic stem cell transplantation (HSCT) and they concluded that this was due to prolonged total parental supplementation and lack of thiamine supplementation. The only other suggested cause was the use of busulfan in the conditioning regimen. In the literature there is a link of WE to HSCT, malignancies, or chemotherapies. Here we report a new patient who developed WE during acute lymphoblastic leukemia (ALL) treatment. A 13-year-old female patient diagnosed with intermediate risk group ALL developed severe neutropenia after a high-dose methotrexate block and oral Purinethol (BFM protocol M). Ceftazidime and fluconazole treatment was started due to fever. After 3 days the patient had poor oral intake and received total parenteral nutrition (TPN) containing protein and dextrose. On the 6th day of TPN she had fever, abdominal pain, nausea, and bilious vomiting. Her abdominal ultrasound revealed typhlitis. Ceftazidime-fluconazole treatment was switched to meropenem and L-amphotericin and oral intake was stopped. On the 8th day of TPN, the patient developed confusion, altered mental status, horizontal nystagmus, and lateral gaze paralysis in the right eye. Her brain computed tomography (CT) was normal. However, brain magnetic resonance imaging (MRI) showed increased signal in the bilateral thalamic pulvinar and

mammillary bodies in the axial fluid-attenuated inversion recovery (FLAIR) sequence (Figure 1). These were concluded to be classic findings of WE [4]. Intramuscular thiamine at 200 mg three times a day for the first 3 days (600 mg/day total), 100 mg two times a day for the next 3 days (200 mg/day total), and 100 mg thiamine daily for the last 3 days was given. A rapid improvement of neurologic symptoms was observed on the third day of thiamine treatment. The patient’s thiamine level was 55 mg/L and 125 mg/L before and after the treatment, respectively (normal range: 25-75 mg/L). She was discharged from the hospital with good oral intake and normal neurological examination.

Figure 1. Increased signal in the bilateral thalamic pulvinar and mammillary bodies in the axial fluid-attenuated inversion recovery sequence.

LETTERS TO THE EDITOR

WE is primarily a clinical diagnosis. Response to treatment may be diagnostic. The sensitivity and specificity of serum thiamine level in symptomatic patients is unclear, as the blood level may not reflect the brain thiamine level. A normal blood thiamine level, as in our patient, does not exclude the possibility of WE with MRI findings [5]. MRI is more sensitive than CT in WE [6]. In conclusion, all at-risk patients with undiagnosed altered mental status, oculomotor disorders, or ataxia must be evaluated for WE. Further studies are needed for examining the possible role of chemotherapeutics in the development of WE. Keywords: Wernicke’s encephalopathy, Thiamine deficiency, Pediatric leukemia

Turk J Hematol 2017;34:99-117

and/or affiliations relevant to the subject matter or materials included.

References 1. Solmaz S, Gereklioğlu Ç, Tan M, Demir Ş, Yeral M, Korur A, Boğa C, Özdoğu H. A rare complication developing after hematopoietic stem cell transplantation: Wernicke’s encephalopathy. Turk J Hematol 2015;32:367370. 2. Park SW, Yi YY, Han JW, Kim HD, Lee JS, Kang HC. Wernicke’s encephalopathy in a child with high dose thiamine therapy. Korean J Pediatr 2014;57:496499. 3. Parkin AJ, Blunden J, Rees JE, Hunkin NM. Wernicke-Korsakoff syndrome of nonalcoholic origin. Brain Cogn 1991;15:69-82. 4. Beh SC, Frohman TC, Frohman EM. Isolated mammillary body involvement on MRI in Wernicke’s encephalopathy. J Neurol Sci 2013;334:172-175.

Anahtar Sözcükler: Wernicke ensefalopatisi, Tiamin eksikliği, Pediatrik lösemi

5. Davies SB, Joshua FF, Zagami AS. Wernicke’s encephalopathy in a nonalcoholic patient with a normal blood thiamine level. Med J Aust 2011;194:483-484.

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships,

6. Elefante A, Puoti G, Senese R, Coppolo C, Russo C, Tortoro F, de Divitiis O, Brunetti A. Non-alcoholic acute Wernicke’s encephalopathy: role of MRI in non typical cases. Eur J Radiol 2012;81:4099-4104.

Address for Correspondence/Yazışma Adresi: Hande KIZILOCAK, M.D., İstanbul University Cerrahpaşa Faculty of Medicine, Department of Pediatric Hematology-Oncology, İstanbul, Turkey Phone : +90 533 648 21 88 E-mail : handekizilocak2@yahoo.com

Received/Geliş tarihi: January 25, 2016 Accepted/Kabul tarihi: September 06, 2016 DOI: 10.4274/tjh.2016.0044

Comment: In Response to “Megaloblastic Anemia with Ring Sideroblasts is not Always Myelodysplastic Syndrome” Yorum: “Halka Sideroblastlı Megaloblastik Anemi Her Zaman Miyelodisplastik Sendrom Olmayabilir”e Yanıt Smeeta Gajendra Medanta-the Medicity, Department of Pathology and Laboratory Medicine, Gurgaon, India

To the Editor, I read the letter “Megaloblastic Anemia with Ring Sideroblasts is not Always Myelodysplastic Syndrome” by Narang et al., recently published in this journal [1]. The manuscript is well written with a description of a very informative case of megaloblastic anemia with ring sideroblasts in a young female of 18 years old. Ring sideroblasts are associated with abnormal expression of several genes of heme synthesis or mitochondrial iron processing [2]. After exclusion of non-neoplastic causes of ring sideroblasts such as congenital/hereditary sideroblastic anemia and acquired reversible sideroblastic anemia (drugs, toxins, or nutritional deficiency), myelodysplastic syndrome (MDS) can be strongly suspected, particularly in elderly patients. The presence of ring sideroblasts alone is not sufficient for a diagnosis

100

MDS; the presence of refractory cytopenia(s) is a prerequisite. Refractoriness can only be established after exclusion of secondary causes, most importantly nutritional deficiencies. After that, a complete evaluation of the erythroid, myeloid, and megakaryocytic lineages of bone marrow is essential. At least 15% ring sideroblasts are required for the diagnosis of MDS with ring sideroblasts (MDS-RS) in cases lacking mutations in the spliceosome gene SF3B1. SF3B1 mutations are found in 60%-80% of patients with refractory anemia with ring sideroblasts (RARS) or RARS with thrombocytosis (RARS-T) and are associated with favorable prognosis [3]. In the recent World Health Organization (WHO) 2016 classification, cases with ring sideroblasts and multilineage dysplasia without excess blasts or isolated del (5q) abnormality are categorized as MDS-RS. Recent

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

studies have shown that the percentage of ring sideroblasts in MDS is not prognostically important. Thus, in the revised WHO classification, a diagnosis of MDS-RS may be made even in the presence of only 5% of ring sideroblasts in cases with SF3B1 mutation. MDS-RS cases will be subdivided into cases with single lineage dysplasia (previously classified as RARS) and cases with multilineage dysplasia (previously classified as refractory cytopenia with multilineage dysplasia). Furthermore, RARS-T has been accepted as an entity and termed MDS/ myeloproliferative neoplasm (MPN) with ring sideroblasts and thrombocytosis (MDS/MPN-RS-T) in the 2016 classification. Unlike MDS-RS, the number of ring sideroblasts required for a diagnosis of MDS/MPN-RS-T is 15%, irrespective of the presence or absence of a SF3B1 mutation [4]. As described in the case of Narang et al., in a young female of 18 years old without a history of persistent refractory cytopenia(s), a diagnosis of MDS can only be established after exclusion of secondary causes such as nutritional deficiencies [1]. An adequate trial with hematinics (vitamin B12, folic acid, and pyridoxine) is needed in such cases. After exclusion of secondary causes, if cytopenia(s) still persists, a repeat bone marrow examination with cytogenetic and molecular studies can be considered to establish the diagnosis of a clonal hematopoietic disease such as MDS or MDS/MPN. Keywords: Refractory anemia with ring sideroblasts, RARS with thrombocytosis, Myelodysplastic syndrome/myeloproliferative neoplasm with ring sideroblasts and thrombocytosis

Anahtar Sözcükler: Halka sideroblastlı refrakter anemi, Trombositoz ile birlikte RARS, Halka sideroblast ve trombositoz ile birlikte miyelodisplastik sendrom/miyeloproliferatif neoplazi Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Narang NC, Kotru M, Rao K, Sikka M. Megaloblastic anemia with ring sideroblasts is not always myelodysplastic syndrome. Turk J Hematol 2016;33:358-359. 2. Cazzola M, Invernizzi R. Ring sideroblasts and sideroblastic anemias. Haematologica 2011;96:789-792. 3. Papaemmanuil E, Cazzola M, Boultwood J, Malcovati L, Vyas P, Bowen D, Pellagatti A, Wainscoat JS, Hellstrom-Lindberg E, Gambacorti-Passerini C, Godfrey AL, Rapado I, Cvejic A, Rance R, McGee C, Ellis P, Mudie LJ, Stephens PJ, McLaren S, Massie CE, Tarpey PS, Varela I, Nik-Zainal S, Davies HR, Shlien A, Jones D, Raine K, Hinton J, Butler AP, Teague JW, Baxter EJ, Score J, Galli A, Della Porta MG, Travaglino E, Groves M, Tauro S, Munshi NC, Anderson KC, El-Naggar A, Fischer A, Mustonen V, Warren AJ, Cross NC, Green AR, Futreal PA, Stratton MR, Campbell PJ; Chronic Myeloid Disorders Working Group of the International Cancer Genome Consortium. Somatic SF3B1 mutation in myelodysplasia with ring sideroblasts. N Engl J Med 2011;365:1384-1395. 4. Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM, Bloomfield CD, Cazzola M, Vardiman JW. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood 2016;127:2391-2405.

Address for Correspondence/Yazışma Adresi: Smeeta GAJENDRA, M.D., Medanta-the Medicity, Department of Pathology and Laboratory Medicine, Gurgaon, India Phone : +09013590875 E-mail : drsmeeta@gmail.com

Received/Geliş tarihi: December 02, 2016 Accepted/Kabul tarihi: December 06, 2016 DOI: 10.4274/tjh.2016.0466

Therapeutic International Normalized Ratio Monitoring Terapötik Uluslararası Normalleştirilmiş Oran İzlemi Beuy Joob1, Viroj Wiwanitkit2 1Sanitation 1 Medical Academic Center, Bangkok, Thailand 2Hainan Medical University, Haikou, China

To the Editor, The report on “Warfarin dosing and time required to reach therapeutic international normalized ratio in patients with hypercoagulable conditions” was very interesting [1]. Kahlon et al. concluded that “Patients with hypercoagulable conditions require approximately 10 mg of additional total warfarin dose and also require, on average, 2 extra days to reach therapeutic international normalized ratio (INR) as compared to controls.”

The big concern in this report regards the technique used for INR measurement. Kahlon et al. did not mention this and might not have noted the problem of measurement of INR in the followup of the patient. The quality control of the measurement is very important and measurements from different laboratory techniques and settings can be a factor leading to error in laboratory results [2,3]. It is noted that the local calibration in correcting the variability in INR determination and the difference between batches has to be controlled [4]. 101

LETTERS TO THE EDITOR

Keywords: Monitoring, Hemostasis

Turk J Hematol 2017;34:99-117

International

normalized

ratio,

Anahtar Sözcükler: İzlem, Uluslararası normalleştirilmiş oran, Hemostaz Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Kahlon P, Nabi S, Arshad A, Jabbar A, Haythem A. Warfarin dosing and time required to reach therapeutic international normalized ratio in patients with hypercoagulable conditions. Turk J Hematol 2016;33:299-303. 2. Favaloro EJ, McVicker W, Lay M, Ahuja M, Zhang Y, Hamdam S, Hocker N. Harmonizing the international normalized ratio (INR): standardization of methods and use of novel strategies to reduce interlaboratory variation and bias. Am J Clin Pathol 2016;145:191-202. 3. Sølvik UØ, Petersen PH, Monsen G, Stavelin AV, Sandberg S. Discrepancies in international normalized ratio results between instruments: a model to split the variation into subcomponents. Clin Chem 2010;56:1618-1626. 4. Wongtiraporn W, Opartkiattikul N, Tientadakul P. The value of local ISI calibration in correcting the variability in INR determination. Siriraj Hosp Gaz 2003;55:381-384.

Address for Correspondence/Yazışma Adresi: Beuy JOOB, M.D., Sanitation 1 Medical Academic Center, Bangkok, Thailand E-mail : beuyjoob@hotmail.com

Received/Geliş tarihi: December 03, 2016 Accepted/Kabul tarihi: December 06, 2016 DOI: 10.4274/tjh.2016.0467

Iron Overload in Hematopoietic Stem Cell Transplantation Hematopoetik Kök Hücre Transplantasyonunda Aşırı Demir Yüklenmesi Sora Yasri1, Viroj Wiwanitkit2 1KMT Primary Care Center, Bangkok, Thailand 2Wiwanitkit House, Bangkok, Thailand

To the Editor, We read the publication entitled “Current Review of Iron Overload and Related Complications in Hematopoietic Stem Cell Transplantation” with great interest [1]. As summarized by Atilla et al. [1], “Organ dysfunction due to iron overload may cause high mortality rates and therefore a sufficient iron chelation therapy is recommended”. We would like to share the experience from our settings where there is a very high prevalence of thalassemia and transplantation is the only curative treatment. Iron overload is common among transfusion-dependent thalassemia patients and transfusion during transplantation might increase the risk of the complication of iron overload. However, in clinical practice, the problem is not common and improvement of the patients after transplantation is reported. According to the recent report by Inati et al. [2], with standard chelation therapy, the outcome of thalassemic patients undergoing stem cell transplantation is usually favorable. The use of the standard dosage of deferoxamine, with or without phlebotomy, accompanied with close iron status monitoring can be effective [2,3]. It can be seen that stem cell transplantation can be problematic despite there being a need of hypertransfusion 102

during the process even though the patient might have an underlying severe iron overload condition such as thalassemia. Keywords: Iron, Transplantation

Overload,

Hematopoietic

stem

cell,

Anahtar Sözcükler: Demir, Aşırı yüklenme, Hematopoietik kök hücre, Transplantasyon Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Atilla E, Toprak SK, Demirer T. Current review of iron overload and related complications in hematopoietic stem cell transplantation. Turk J Hematol 2016 [Epub ahead of print]. 2. Inati A, Kahale M, Sbeiti N, Cappellini MD, Taher AT, Koussa S, Nasr TA, Musallam KM, Abbas HA, Porter JB. One-year results from a prospective randomized trial comparing phlebotomy with deferasirox for the treatment of iron overload in pediatric patients with thalassemia major following curative stem cell transplantation. Pediatr Blood Cancer 2017;64:188-196. 3. Angelucci E, Pilo F. Management of iron overload before, during, and after hematopoietic stem cell tranplantation for thalassemia major. Ann N Y Acad Sci 2016;1368:115-121.

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

Reply Dear Sora Yasri, Thank you very much for your valuable comments and sharing your experience. We agree for your contribution. In thalassemia patients, several transplantation centers categorised risk factors prior to allogenic hematopoietic stem cell transplantation. Pesaro classification assigned patients to three arms according to the absence or presence of one, two or three risk factors: hepatomegaly > 2 cm, portal fibrosis, and irregular chelation history [1]. It should be kept in mind that in a study by Ghavamzadeh et al., liver iron overload did not change after transplant (p=0.61) but hepatic fibrosis progressed (p=0.01) [2]. Allogeneic stem cell transplantation did not reduce liver iron overload and in fact liver fibrosis increased. Also steps for reducing iron overload should be taken in the post transplant setting [3]. Iron overload is still an essential issue in both pre

and post transplant settings. Survival in transfusion-dependent thalassemia patients can be improved with proper understanding of the pathophysiology of thalassemia and iron toxicity. Regards, Erden Atilla, Selami K. Toprak, Taner Demirer

References 1. Lucarelli G, Weatherall DJ. FFor debate: bone marrow transplantation for severe thalassaemia (1). The view from Pesaro (2). To be or not to be. Br J Haematol 1991;78:300-303. 2. Ghavamzadeh A, Mirzania M, Kamalian N, Sedighi N, Azimi P. Hepatic iron overload and fibrosis in patients with beta thalassemia major after hematopoietic stem cell transplantation: a pilot study. Int J Hematol Oncol Stem Cell Res 2015;9:55-59. 3. Bayanzay K, Alzoebie L. Reducing the iron burden and improving survival in transfusion-dependent thalassemia patients: current perspectives. J Blood Med 2016;7:159-169.

Received/Geliş tarihi: December 23, 2016 Accepted/Kabul tarihi: December 26, 2016

Address for Correspondence/Yazışma Adresi: Sora YASRI, M.D., KMT Primary Care Center, Bangkok, Thailand Phone: 6622578963 E-mail : sorayasri@outlook.co.th

DOI: 10.4274/tjh.2016.0493

Sole Infrequent Karyotypic Aberration Trisomy 6 in a Patient with Acute Myeloid Leukemia and Breast Cancer in Remission Akut Miyeloid Lösemi ve Remisyonda Meme Kanserli Hastada Nadir İzole Karyotipik Bozukluk Mürüvvet Seda Aydın1, Süreyya Bozkurt2, Gürsel Güneş1, Ümit Yavuz Malkan1, Tuncay Aslan1, Sezgin Etgül1, Yahya Büyükaşık1, İbrahim Celalettin Haznedaroğlu1, Nilgün Sayınalp1, Hakan Göker1, Haluk Demiroğlu1, Osman İlhami Özcebe1, Salih Aksu1 1Hacettepe University Faculty of Medicine, Department of Adult Hematology, Ankara, Turkey 2Hacettepe University Cancer Institute, Basic Oncology, Ankara, Turkey

To the Editor, Cytogenetic abnormalities play important roles in the diagnosis and prognosis of leukemias [1]. Trisomy 6 as the sole karyotypic aberration is infrequent in leukemias [1,2]. A 50-year-old female patient presented with fatigue. She had been treated by mastectomy and given chemotherapy (no further information available) for breast cancer 3 years ago. She had been using tamoxifen for 3 years. Her breast cancer was in remission. Physical examination was consistent with a pale appearance. Hemoglobin, neutrophils, and platelet count were 8.5 g/dL, 900/ µL, and 11,000/µL, respectively, on admission. In the peripheral blood smear, there were dysplastic features in monocytes and a few blasts were reported. In flow cytometry, CD13, CD33, CD34, CD45, CD117 (c-kit), HLA-DR, and MPO were positive. Bone marrow aspiration and biopsy revealed hypercellularity with

dysplastic and megaloblastic features in erythroid series, grade 1/3 reticulin fibrosis, and 24% blasts without ring sideroblasts, which in turn with cytometry findings were accepted as evidence of acute myeloid leukemia (AML). Bone marrow cytogenetic analysis revealed trisomy 6 (47,XX, +6 [20]) in all the metaphases (Figure 1). The patient was not in remission after the first induction treatment and she passed away due to septic shock during the second induction treatment. Chromosome aberrations detected in therapy-related AML (t-AML) and de novo AML cases are identical but their frequencies may differ [3]. In a series at the University of Chicago, normal karyotypes were seen in 9.6% of t-AML cases [4]. In the report of Godley and Larson, among 306 patients with t-AML, 32 had solid breast cancer as the primary diagnosis [5]. Alkylating exposures and topoisomerase II inhibitors are associated with 103

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

that there were no direct correlations between the number of blasts and the percentage of abnormal metaphases. They could not identify any correlation between morphology or prognosis and trisomy 6 [7]. Under these circumstances, as in our case, we lack information on the impact of trisomy 6 on prognosis in secondary AML patients. Keywords: Trisomy 6, acute myeloid leukemia, Breast cancer Anahtar Sözcükler: Trizomi 6, Akut miyeloid lösemi, Meme kanseri

Figure 1. Bone marrow cytogenetic analysis revealed trisomy 6 (47,XX, +6 [20]) in all the metaphases. t-AML [3,6]. Godley and Larson mentioned granulocyte colonystimulating factor usage as a risk factor in t-AML after breast cancer [5]. Unfortunately, we do not know which agents were given for our patient’s breast cancer. Autosomal trisomies have been described in several hematologic malignancy cases. The first case of sole trisomy 6 was reported in aplastic anemia. Other reports showed that trisomy 6 was associated with hypoplastic bone marrow, dyserythropoiesis, and AML [7]. Mohamed et al. reviewed 7 patients with trisomy 6. Patients presenting with overt AML had hyperplastic marrows [8]. Our patient had hypercellular marrow, as well. Mohamed et al. also reviewed the literature and found 4 MDS cases among 22 patients with trisomy 6 [8]. The marrow examination of this case revealed secondary dysplastic leukemia. The patient of Gupta et al. had de novo AML and did not respond to the first remission induction treatment [1]. Yu et al. reviewed ten reports in PubMed describing 18 cases of AML presenting with trisomy 6 as the sole karyotypic abnormality along with 3 cases of their own [7]. They concluded

References 1. Gupta M, Radhakrishnan N, Mahapatra M, Saxena R. Trisomy chromosome 6 as a sole cytogenetic abnormality in acute myeloid leukemia. Turk J Hematol 2015;32:77-79. 2. Choi J, Song J, Kim SJ, Choi JR, Kim SJ, Min YH, Park TS, Cho SY, Kim MJ. Prognostic significance of trisomy 6 in an adult acute myeloid leukemia with t(8;21). Cancer Genet Cytogenet 2010;202:141-143. 3. Pedersen-Bjergaard J, Andersen MT, Andersen MK. Genetic pathways in the pathogenesis of therapy-related myelodysplasia and acute myeloid leukemia. Hematology Am Soc Hematol Educ Program 2007:392-397. 4. Qian Z, Joslin JM, Tennant TR, Reshmi SC, Young DJ, Stoddart A, Larson RA, Le Beau MM. Cytogenetic and genetic pathways in therapy-related acute myeloid leukemia. Chem Biol Interact 2010;184:50-57. 5. Godley LA, Larson RA. Therapy-related myeloid leukemia. Semin Oncol 2008;35:418-429. 6. Zhang L, Wang SA. A focused review of hematopoietic neoplasms occurring in the therapy-related setting. Int J Clin Exp Pathol 2014;7:3512-3523. 7. Yu S, Kwon MJ, Lee ST, Woo HY, Park H, Kim SH. Analysis of acute myeloid leukemia in Korean patients with sole trisomy 6. Ann Lab Med 2014;34:402404. 8. Mohamed AN, Varterasian ML, Dobin SM, McConnell TS, Wolman SR, Rankin C, Willman CL, Head DR, Slovak ML. Trisomy 6 as a primary karyotypic aberration in hematologic disorders. Cancer Genet Cytogenet 1998;106:152-155.

Address for Correspondence/Yazışma Adresi: Mürüvvet Seda AYDIN, M.D., Hacettepe University Faculty of Medicine, Department of Adult Hematology, Ankara, Turkey E-mail : muruvvetseda.balaban@hacettepe.edu.tr

104

Received/Geliş tarihi: January 17, 2016 Accepted/Kabul tarihi: November 15, 2016 DOI: 10.4274/tjh.2016.0030

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

Premarital Genetic Diagnosis Revealed Co-heredity Nature of Beta Globin Gene 25-26 del AA and 3’UTR+101 G-C Variants in Two Beta Thalassemia Heterozygotes İki Heterozigot Beta Talasemi Taşıyıcısında Evlilik Öncesi Genetik Tanı ile Beta Globin Geni 2526 del AA ve 3’UTR+101GC Varyant Kalıtımının Gösterilmesi Kanay Yararbaş1, Yasemin Ardıçoğlu2, Nejat Akar3 1Düzen Laboratories Group, Ankara, Turkey 2TOBB-ETU Hospital, Clinic of Biochemistry and Clinical Biochemistry, Ankara, Turkey 3TOBB-ETU Hospital, Clinic of Pediatrics, Ankara, Turkey

To the Editor, Over 2000 gene variants were reported in the beta globin gene, including hemoglobin variants. These variants are important from clinical and genetic counseling points of view [1,2]. Recently a genetically related Turkish couple was referred to our department for genetic counseling for beta thalassemia carrier status. During premarital screening they were both diagnosed as beta thalassemia carriers by high pressure liquid chromatography analysis and whole blood count (Table 1). Genomic DNAs of both patients were extracted using the QIAamp DNA Blood Midi Kit (QIAGEN, Germany). The HBB gene was amplified using the following polymerase chain reaction (PCR) primers: forward (5’GCCAAGGACAGGTACGGCTG3’), reverse (5’CCCTTCCTATGACATGAACTTAACCAT3’) and forward (5’CAATGTATCATGCCTCTTTGCACC3’), reverse (5’GAGTCAAGGCTGAGGATGCGGA3’). Purifications were done using the ExoSAP purification program (Affymetrix Inc., USA). The BigDye Sequencing PCR technique was used for the analysis (Applied Biosystems, USA). Samples were analyzed with the SeqScape v2.5 analysis program. Common alpha globin gene deletions were analyzed according to the previously reported technique [3,4].

Two different gene alterations were found in the beta globin gene of both partners (Table 1). One of them was a deletion at 25-26AA (rs35497102) (Figure 1). The other gene alteration was a single nucleotide polymorphism at 3’UTR+101 G-C +233 relative to the termination codon (rs12788013) (Figure 2). Neither of the individuals carried the common alpha thalassemia deletions. Beta globin gene 3’UTR+101 G-C alteration is a single nucleotide polymorphism that was not previously classified and reported as a pathogenic variant [1,2]. It seems that carrying 3’UTR+101 G-C does not cause any additional clinical features in 25-26 del AA carriers. In this situation there is certainly more than one possibility to be mentioned in genetic counseling. 3’UTR+101 G-C being a single nucleotide variant resulting in a decreased expression of the gene causing the beta thalassemia major clinical picture is the most likely one. This is more evident when combined with a disease causing mutation, as previously reported by us and others [3,4,5,6,7]. However, from our family’s data, this is not valid, because they are beta thalassemia carriers. The main problem in this case is that an expression study was not performed for these individuals.

Table 1. Whole blood count, hemoglobin A2 levels, and HBB gene mutation profile of the couple.

RBC

MCV

MCH

MCHC

RDW

HbA2

HbF

HBB gene variant

Male

10.7

5.78

55.5

18.5

33.3

18.5

4.8

1.4

Variant 1: c.25_26AA (rs35497102) Variant 2: 3’UTR+101 G-C +233 relative to termination codon (rs12788013)

Female

11.3

5.93

56.8

19.1

33.5

18.2

4.4

2.9

Variant 1: c.25_26AA (rs35497102) Variant 2: 3’UTR+101 G-C +233 relative to termination codon (rs12788013)

Hb: Hemoglobin, RBC: red blood cell, MCV: mean corpuscular volume, MCH: mean corpuscular hemoglobin, MCHC: mean corpuscular hemoglobin concentration, RDW: red cell distribution width.

105

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

Figure 1. Sequencing data of the deletion at 25-26 AA (rs35497102).

Figure 2. Single nucleotide polymorphism at 3’ UTR +101 G-C (+233 relative to termination codon).

One of the possibilities for the inheritance pattern in this situation is that these two gene variants will be inherited in the “cis” position. In this case, from the genetic point of view, “in cis” is the only acceptable solution for the fetus, which will be similar to the parents. However, if it does not come in the “cis” position, there will be a possibility that the fetus may inherit 3’UTR+101 G-C in the homozygous state (from both parents). Unfortunately, not many publications have discussed similar conditions. For prenatal screening of the fetus, only the del 2526 AA /3’UTR+101 G-C heterozygote state should be accepted as normal.

This case report highlights the need for investigating partnered beta thalassemia carriers by complete sequencing analysis of the beta globin gene if only one pathogenic mutation is detected by first-tier methods for the possibility of providing appropriate genetic counseling for couples at risk during prenatal genetic diagnosis. Keywords: Thalassemia, Variant, Genetic counseling, Prenatal diagnosis, Beta globin gene, Turkish Anahtar Sözcükler: Talasemi, Varyant, Genetik danışmanlık, Prenatal tanı, Beta globin geni, Türk Address for Correspondence/Yazışma Adresi: Nejat AKAR, M.D., TOBB-ETU Hospital, Clinic of Pediatrics, Ankara, Turkey Phone: +90 532 285 73 14 E-mail : akar@medicine.ankara.edu.tr

106

References 1. HbVar: A Database of Human Hemoglobin Variants and Thalassemias. Available online at http://globin.bx.psu.edu/hbvar/menu.html. 2. Human Gene Mutation Database (HGMD) Professional Version 2016.1. Available online at https://portal.biobase-international.com/hgmd/pro/ gene.php?gene=HBB. 3. Oron-Karni V, Filon D, Oppenheim A, Rund D. Rapid detection of the common Mediterranean alpha-globin deletions/rearrangements using PCR. Am J Hematol 1998;58:306-310. 4. Tan AS, Quah TC, Low PS, Chong SS. A rapid and reliable 7-deletion multiplex polymerase chain reaction assay for alpha-thalassemia. Blood 2001;98:250-251. 5. Başak AN, Ozer A, Kirdar B, Akar N. A novel 13 Bp deletion in the 3’UTR of the beta-globin gene causes beta-thalassemia in a Turkish patient. Hemoglobin 1993;17:551-555. 6. Vinciguerra M, Passarello C, Leto F, Cassarà F, Cannata M, Maggio A, Giambona A. Identification of three new nucleotide substitutions in the β-globin gene: laboratoristic approach and impact on genetic counseling for beta-thalassemia. Eur J Haematol 2014;92:444-449. 7. Bilgen T, Clark OA, Ozturk Z, Akif Yesilipek M, Keser I. Two novel mutations in the 3’ untranslated region of the beta-globin gene that are associated with the mild phenotype of beta thalassemia. Int J Lab Hematol 2013;35:26-30. Received/Geliş tarihi: February 18, 2016 Accepted/Kabul tarihi: October 03, 2016 DOI: 10.4274/tjh.2016.0069

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

Acute Myocardial Infarction Due to Eltrombopag Therapy in a Patient with Immune Thrombocytopenic Purpura İmmün Trombositopenik Purpurası Olan Bir Hastada Eltrombopag Tedavisine Bağlı Akut Miyokard İnfarktüsü Sena Sert, Hasan Özdil, Murat Sünbül Marmara University Faculty of Medicine, Department of Cardiology, İstanbul, Turkey

To the Editor, Immune thrombocytopenic purpura (ITP) is an autoimmune disease characterized by anti-platelet antibody-mediated platelet destruction and anti-megakaryocyte antibody-mediated impairment of platelet production, which may cause bleeding [1]. Coexistence of ITP and coronary artery disease (CAD) is rare. Patients with ITP have increased risk of thrombosis and atherosclerosis associated with larger platelets more adhesive to vascular surfaces, direct endothelial damage [2], and negative effects of therapy with steroids [3] or intravenous immunoglobulin [4]. We present here a 61-year-old male patient who was diagnosed with ITP and presented with acute myocardial infarction while undergoing eltrombopag therapy. A 61-year-old man was admitted to our emergency room with typical chest pain lasting for last 3 days. He had been diagnosed with ITP 5 years ago. His medical history was remarkable for splenectomy 6 months after the diagnosis of ITP. He was in remission for 4 years after the splenectomy and he was not on any medication for 5 years. Four months before, during a routine check-up, relapse of disease had been noticed. Steroid therapy was initiated after relapse and administered with a tapering dosage for 3 months. The clinician did not observe adequate increase in the amount of platelets; therefore, eltrombopag (1x50 mg tablet) was initiated as a newline therapy 1 month ago. In the first 3 weeks, the platelet count did not increase adequately (platelets were about 13,000/mL), but in the last week before his admission to the emergency room his platelet count escalated to about 105,000/mL. The patient was admitted to our emergency room with typical chest pain. His baseline cardiovascular risk factors, among smoking, hyperlipidemia, hypertension, diabetes mellitus, and family history, were not remarkable. The patient was not on any medication apart from eltrombopag therapy. On his admission, electrocardiography showed ST segment elevation in leads DII-III-AVF and V5-6 with pathological Q waves, which gave rise to consideration of sub-acute inferolateral myocardial infarction. Primary percutaneous coronary intervention (PCI) was performed immediately. Coronary angiography demonstrated the anomalous origin of the coronary artery. The circumflex coronary artery (CX) originated from the right aortic root. There was plaque on the proximal and middle portion of the left anterior descending

artery and proximal portion of the CX, and subtotal occlusion at the distal portion of the right coronary artery (RCA). A bare metal stent was implanted at the lesion site and post-dilatation was performed (Figures 1A-1D). After PCI, thrombolysis in myocardial infarction grade 3 flow was obtained as an optimal angiographic result in the RCA. Platelet counts were assessed daily and showed a stable trend. At the suggestion of the hematology department, the eltrombopag therapy was stopped. The patient was examined for an underlying hypercoagulable state. His homocysteine level was within normal limits. Antinuclear antibodies, antiphospholipid and anticardiolipin antibodies, lupus-like anticoagulant, and mutations of factor V Leiden were negative. The patient was discharged on the 5th day with a platelet count of 125,000/mL, with advice to continue dual anti-platelet therapy (acetylsalicylic acid 100 mg and clopidogrel 75 mg). There was no relapse for ITP during the 1-year follow-up period (Table 1).

Figure 1. A) Non-critical plaque on the proximal and middle portion of the left anterior descending artery, B) arrow shows sub-total occlusion at the distal portion of the right coronary artery, C) circumflex coronary artery originates from the right aortic root, D) bare metal stent (3.0x20 mm) was implanted at the lesion site and post-dilatation was performed with a noncompliant balloon (3.5x15 mm). 107

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

Table 1. The relationship between medical treatments and platelet counts during follow-up periods. Time

4 months ago

2 months ago

1 month ago

2 weeks ago

1 week ago

Admission to ED

5 days later

1 month later

6 months later

1 year later

Platelet Count

60,000

93,000

5000

13,000

105,000

107,000

125,000

105,000

272,000

292,000

Therapy

P-16 mg initiated

P-64 mg

E-50 mg initiated

E-50 mg

C-75 mg, ASA-100 mg

C-75 mg, C-75 mg ASA-100 mg

C-75 mg

Events

Relapse

Follow-up

Newline therapy

Followup

Myocardial infarction

Discharge

Follow-up

P: Prednisolone; E: eltrombopag; C: clopidogrel; ASA: acetylsalicylic acid; ED: emergency department.

Eltrombopag is an orally available, small, non-peptide organic molecule that enhances platelet production by binding to and activating c-Mpl, the thrombopoietin receptor, on megakaryocytes and their progenitors [5]. The main issue in our case is that, as we mentioned the importance of evaluating risk factors, our patient had no risk factors for CAD and we recognized the coincidence between acute coronary syndrome and the beginning of a new agent of thrombopoietin receptor agonist (TPO-A) therapy. TPO-A therapy has important side effects including thromboembolic events [6,7,8]. A recent study demonstrated that an important percentage of ITP patients undergoing eltrombopag therapy achieve complete response after cessation of the therapy. There is no reliable marker for predicting this response so far [9]. Coexistence of ITP and CAD presents complex problems. The crucial point in handling these problems is a balance between hemorrhagic risk and prevention of thrombotic events. Although eltrombopag is more effective in the treatment of patients with ITP, clinicians should pay more attention to side effects including thrombotic events, as we demonstrated in our case report. Keywords: Acute myocardial infarction, Immune thrombocytopenic purpura, Eltrombopag Anahtar Sözcükler: Akut miyokard trombositopenik purpura, Eltrombopag

infarktüsü,

İmmün

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Cines DB, Bussel JB, Liebman HA, Luning Prak ET. The ITP syndrome: pathogenic and clinical diversity. Blood 2009;113:6511-6521. 2. Fruchter O, Blich M, Jacob G. Fatal acute myocardial infarction during severe thrombocytopenia in a patient with idiopathic thrombocytopenic purpura. Am J Med Sci 2002;323:279-280. 3. Paolini R, Zamboni S, Ramazzina E, Zampieri P, Cella G. Idiopathic thrombocytopenic purpura treated with steroid therapy does not prevent acute myocardial infarction: a case report. Blood Coagul Fibrinolysis 1999;10:439-442. 4. Elkayam O, Paran D, Milo R, Davidovitz Y, Almoznino-Sarafian D, Zeltser D, Yaron M, Caspi D. Acute myocardial infarction associated with high dose intravenous immunoglobulin infusion for autoimmune disorders. A study of four cases. Ann Rheum Dis 2000;59:77-80. 5. Erickson-Miller CL, DeLorme E, Tian SS, Hopson CB, Landis AJ, Valoret EI, Sellers TS, Rosen J, Miller SG, Luengo JI, Duffy KJ, Jenkins JM. Preclinical activity of eltrombopag (SB-497115), an oral, nonpeptide thrombopoietin receptor agonist. Stem Cells 2009;27:424-430. 6. Saleh MN, Bussel JB, Cheng G, Meyer O, Bailey CK, Arning M, Brainsky A; EXTEND Study Group. Safety and efficacy of eltrombopag for treatment of chronic immune thrombocytopenia: results of the long-term, open-label EXTEND study. Blood 2013;121:537-545. 7. Hassn AMF, Al-Fallouji MA, Ouf TI, Saad R. Portal vein thrombosis following splenectomy. Br J Surg 2000;87:362-373. 8. Harker LA, Hunt P, Marzec UM, Kelly AB, Tomer A, Hanson SR, Stead RB. Regulation of platelet production and function by megakaryocyte growth and development factor in nonhuman primates. Blood 1996;87:1833-1844. 9. González-López TJ, Pascual C, Álvarez-Román MT, Fernández-Fuertes F, Sánchez-González B, Caparrós I, Jarque I, Mingot-Castellano ME, Hernández-Rivas JA, Martín-Salces M, Solán L, Beneit P, Jiménez R, Bernat S, Andrade MM, Cortés M, Cortti MJ, Pérez-Crespo S, Gómez-Núñez M, Olivera PE, Pérez-Rus G, Martínez-Robles V, Alonso R, Fernández-Rodríguez A, Arratibel MC, Perera M, Fernández-Miñano C, Fuertes-Palacio MA, VázquezPaganini JA, Gutierrez-Jomarrón I, Valcarce I, de Cabo E, Sainz A, Fisac R, Aguilar C, Paz Martínez-Badas M, Peñarrubia MJ, Calbacho M, de Cos C, González-Silva M,Coria E, Alonso A, Casaus A, Luaña A, Galán P, FernándezCanal C, Garcia-Frade J, González-Porras JR. Successful discontinuation of eltrombopag after complete remission in patients with primary immune thrombocytopenia. Am J Hematol 2015;90:40-43.

Address for Correspondence/Yazışma Adresi: Murat SÜNBÜL, M.D., Marmara University Faculty of Medicine, Department of Cardiology, İstanbul, Turkey Phone: +90 506 581 90 15 E-mail : drsunbul@yahoo.com.tr

108

Received/Geliş tarihi: May 10, 2016 Accepted/Kabul tarihi: December 06, 2016 DOI: 10.4274/tjh.2016.0169

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

Candida-Related Immune Response Inflammatory Syndrome Treated with Adjuvant Corticosteroids and Review of the Pediatric Literature Adjuvan Kortikosteroid ile Tedavi Edilen Candida-İlişkili İmmün Yanıt Enflamatuvar Sendromu ve Pediatrik Literatür Derlemesi Dildar Bahar Genç1, Sema Vural1, Nafiye Urgancı2, Tuğçe Kurtaraner3, Nazan Dalgıç4 1Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatric Oncology, İstanbul, Turkey 2Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatric Gastroenterology, İstanbul, Turkey 3Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatrics, İstanbul, Turkey 4Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatric Infectious Disease, İstanbul, Turkey

To the Editor, Chronic disseminated candidiasis (CDC) is a potentially fatal complication observed in febrile neutropenia [1]. The diagnosis is usually made after neutrophil recovery and microbiological proof has been often negative [2]. Granulomatous histopathology, radiological lesions coincident with resolution of granulocytopenia, and rapid response to corticosteroids favors immune-mediated pathogenesis. Recently, CDC has been suggested to be related to Immune response inflammatory syndrome (IRIS), an exacerbated response to a preexisting antigenic stimulus in patients with rapid immune restoration [1,3]. IRIS has been mostly documented in HIV-infected patients with immune recovery after antiretroviral therapy [4]. Here, we present a case of Candida-related IRIS and review the current literature on children. A male, aged 6 years and 7 months, with B-cell acute lymphoblastic leukemia was treated for presumed typhlitis with meropenem, teicoplanin, and amphotericin B during induction

Figure 1. Coronal and axial computed tomography images (a, b); coronal and axial magnetic resonance images of circumscribed typical hepatic Candida lesions (c, d).

therapy. Thoracoabdominal CT scans revealed hepatosteatosis/ hepatomegaly. Fever subsided on the 2nd day. During steroid tapering and on the 8th day of antibiotics, the patient developed fever and abdominal pain with marked elevation of liver enzymes, predominantly of GGT. Bone marrow examination showed no evidence of blasts or hemophagocytosis and the blood count was normal. Control imaging showed typical widespread hepatic bull’s eye lesions (Figure 1). The liver biopsy demonstrated granulomatous inflammation, but no fungus was detectable. According to European Organization for Research and Treatment of Cancer/Mycoses Study Group criteria, the diagnosis was possible invasive fungal infection, most likely candidiasis. Reappearance of symptoms after neutrophil recovery indicated IRIS. We empirically administered dexamethasone for 14 days. Fever disappeared after 24 h and liver function tests improved in 1 week. He was discharged with oral voriconazole. During vincristine therapy, voriconazole was replaced with amphotericin B to avoid toxicity. In the 13th month of voriconazole, the liver lesions showed partial regression and calcification. As re-biopsy was negative for microorganisms and showed only rare microgranulomas, we stopped the voriconazole. The patient completed chemotherapy and has been without any exacerbation for 32 months since the initial diagnosis of IRIS. Clinical and/or radiological deterioration after neutrophil recovery is a well-known entity in patients treated for opportunistic infections [4]. The immune system shifts towards Th-1 type response and amplifies proinflammatory cascades [1]. Therefore, the severity of radiological/clinical findings might depend on the immune status of the patient [5,6]. IRIS is a diagnosis of exclusion; other possible causes of persistent fever should be evaluated. If the clinical scenario is not consistent with preexisting disease, treatment side effects, or a possible newly acquired pathogen, IRIS deserves diagnostic consideration. In the previous Candidarelated IRIS reports on children with cancer, all patients had fever and liver dysfunction accompanying normal neutrophil counts. Liver biopsies showed granuloma formation. Tissue cultures for fungi were negative in all samples except one. The 109

110

10 hematological malignancies

Median: 18.6 (2-65)

16 months

Legrand et al. [3]

Bayram et al. [7]

ALL

(-)

2750

WBC: 36,100

Median: 19,372

Blood culture (+), 1/10; stool culture (+), 7/10; urine culture (+), 1/10

(-)

12,000

Unknown

2580

2800

ANC/mm3

Candida serology (+)

Candida antigen and serology (+)

Proof of Candida

(+)

Granulomatous lesion, Candida (-)

(+)

Yeast positive in smear (5/10), culture positive (1/10), granulomas

(-)

(+)

Mostly (+)

(+)

Liver Dysfunction

Granulomatous lesion, pseudomycelia (+)

Unknown

Granulomatous lesion, Candida (-)

Biopsy

Fever disappeared in 24 h, liver function tests improved in 1 week. Radiological improvement in 2 months.

DXM 0.5 mg/kg, 14 days

L-AmB DXM (3 mg/kg), then 0.4 mg/kg, 14 days voriconazole

Fluconazole, voriconazole

Fever disappeared in 3 days, liver tests normalized in 7 days, USG findings normalized in 30 days.

Fever disappeared in 24 h, clinical improvement in 7 days, radiological improvement in 6 weeks.

Fever and pain disappeared in 2 days. radiological improvement in 30 days.

Radiological improvement in 30 days. At 24 h, fever and pain disappeared and liver dysfunction improved.

Outcome

Clinical improvement at median 4.5 days (1-30). Radiological improvement in 107 days (mean: 30-210 days).

Pred 1 mg/kg, 120 days

Mean: 1 mg/kg/day* Median: 1.5 (1-10 months)

Pred 1 mg/kg, 90 days

Pred 1 mg/kg, 60 days

Steroid Dose and Duration

Median** 0.66 mg/kg/day (0.4-2) Median 109 (49-240 days)

AmB (1 mg/kg)

L-AmB (3 mg/kg)

AmB (1 mg/kg)

Antifungal Treatment

*Case series studies, i.e. details unspecified. ALL: Acute lymphoblastic leukemia, ANC: absolute neutrophil count, AmB: amphotericin B, L-AmB: liposomal amphotericin B, Pred: prednisolone, DXM: dexamethasone, **: prednisone equivalent.

6.5

Lymphoma

Conter et al. [8]

Current case

14 mixed

Median: 46 (2-76)

De Castro et al. [10]

ALL

SaintFaust et al. [11]

AML

Diagnosis

Age (years)

SaintFaust et al. [11]

Authors

Table 1. Review of pediatric cases of Candida-related Immune response inflammatory syndrome treated with corticosteroids.

LETTERS TO THE EDITOR Turk J Hematol 2017;34:99-117

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

most commonly administered antifungal agent was amphotericin B. Details of steroid therapy and the outcomes are presented in Table 1 [3,7,8,9,10,11]. Increased susceptibility to infection might be a drawback for prolonged corticotherapy. However, neither Candida reactivation nor other new opportunistic infections have been reported [3]. Candida-related IRIS has been rarely reported in children. Early recognition and appropriate management of IRIS might prevent unnecessary diagnostic procedures, antibiotic usage, and chemotherapy delays. Acknowledgment This work was partially presented at the 9th Biennial Childhood Leukemia Symposium, Prague, Czech Republic, 28-29 April 2014. Keywords: Leukemia, Febrile neutropenia, Candida, Immune response inflammatory syndrome Anahtar Sözcükler: Lösemi, Febril nötropeni, Candida, İmmün yanıt enflamatuvar sendromu Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

2. Fleischhacker M, Schulz S, Jöhrens K, von Lilienfeld-Toal M, Held T, Fietze E, Schewe C, Petersen I, Ruhnke M. Diagnosis of chronic disseminated candidosis from liver biopsies by a novel PCR in patients with haematological malignancies. Clin Microbiol Infect 2012;18:1010-1016. 3. Legrand F, Lecuit M, Dupont B, Bellaton E, Huerre M, Rohrlich PS, Lortholary O. Adjuvant corticosteroid therapy for chronic disseminated candidiasis. Clin Infect Dis 2008;46:696-702. 4. Manabe YC, Campbell JD, Sydnor E, Moore RD. Immune reconstitution inflammatory syndrome: risk factors and treatment implications. J Acquir Immune Defic Syndr 2007;46:456-462. 5. Karthaus M, Huebner G, Geissler RG, Heil G, Ganser A. Hepatic lesions of chronic disseminated systemic candidiasis in leukemia patients may become visible during neutropenia: value of serial ultrasound examinations. Blood 1998;91:3087-3089. 6. Pestalozzi BC, Krestin GP, Schanz U, Jacky E, Gmür J. Hepatic lesions of chronic disseminated candidiasis may become invisible during neutropenia. Blood 1997;90:3858-3864. 7. Bayram C, Fettah A, Yarali N, Kara A, Azik FM, Tavil B, Tunc B. Adjuvant corticosteroid therapy in hepatosplenic candidiasis-related iris. Mediterr J Hematol Infect Dis 2012;4:e2012018. 8. Conter CD, Thiesse P, Bienvenu A. Persistent fever and hepatosplenic candidiasis, efficiency of a corticoid therapy. J Mycol Med 2007;17:194197. 9. Chaussade H, Bastides F, Lissandre S, Blouin P, Bailly E, Chandenier J, Gyan E, Bernard L. Usefulness of corticosteroid therapy during chronic disseminated candidiasis: case reports and literature review. J Antimicrob Chemother 2012;67:1493-1495.

References

10. De Castro N, Mazoyer E, Porcher R, Raffoux E, Suarez F, Ribaud P, Lortholary O, Molina JM. Hepatosplenic candidiasis in the era of new antifungal drugs: a study in Paris 2000-2007. Clin Microbiol Infect 2012;18:185-187.

1. Rammaert B, Desjardins A, Lortholary O. New insights into hepatosplenic candidosis, a manifestation of chronic disseminated candidosis. Mycoses 2012;55:74-84.

11. Saint-Faust M, Boyer C, Gari-Toussaint M, Deville A, Poiree M, Weintraub M, Sirvent N. Adjuvant corticosteroid therapy in 2 children with hepatosplenic candidiasis-related IRIS. J Pediatr Hematol Oncol 2009;31:794-796.

Address for Correspondence/Yazışma Adresi: Dildar Bahar GENÇ, M.D., Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatric Oncology, İstanbul, Turkey Phone: +90 212 373 66 57 E-mail : baharbeker@yahoo.com

Received/Geliş tarihi: June 20, 2016 Accepted/Kabul tarihi: October 03, 2016 DOI: 10.4274/tjh.2016.0237

Posttranslational Modifications of Red Blood Cell Ghost Proteins as “Signatures” for Distinguishing between Low- and High-Risk Myelodysplastic Syndrome Patients

Düşük ve Yüksek Risk Miyelodisplastik Sendrom Hastalarını Ayıran “İşaretler” Olarak Kırmızı Kan Hücre Zarı Proteinlerinin Posttranslasyonel Modifikasyonları Klara Pecankova, Pavel Majek, Jaroslav Cermak, Jan E. Dyr Institute of Hematology and Blood Transfusion, Prague, Czech Republic

To the Editor, Myelodysplastic syndrome (MDS) comprises a heterogenic

oxidative stress. However, it is unclear whether oxidative stress is a cause of MDS or an effect of other pathological mechanisms.

group of oncohematological diseases that affect hematopoiesis.

Red blood cells (RBCs) are the first cells exposed to stress stimuli.

Although the precise cause of MDS is unknown, multiple factors

They are highly vulnerable to free radical accumulation, which

are involved, one of the most widely implicated of which is

leads to the oxidative stress that induces damage in proteins and 111

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

other biomacromolecules [1]. In MDS, the RBC proteome can be affected by effects of the peripheral blood environment and/or by abnormal processes possibly caused by oxidative stress during hematopoiesis in bone marrow. Therefore, we chose red cell membranes (ghosts) as a model biological material. Patient characteristics are summarized in Table 1. All individuals tested agreed to participate in the study on the basis of informed consent. All samples were obtained and analyzed in accordance with the Ethics Committee regulations of the Institute of Hematology and Blood Transfusion. The RBCs were isolated from whole blood by differential centrifugation and frozen at -80 °C. The red cell ghosts were isolated according to the method of Dodge et al. [2]. Proteins were separated using 2D SDS-PAGE followed by silver staining [3]. The gels were digitized and processed using Progenesis SameSpots software. Significantly differing spots (p<0.05) were submitted for protein identification by tandem mass spectrometry coupled to a Nano LC system. By comparing the high- and low-risk MDS ghost proteomes, we found 22 significantly differing spots that corresponded to 16 unique proteins, particularly spectrin and its interaction partners in the membrane skeleton meshwork (actin, tropomodulin, tropomyosin, ankyrin, protein 4.1). To determine whether the changes were caused by protein expression level alterations or by posttranslational modifications, we analyzed the LC-MS data using Progenesis LC-MS software. No significant changes in Table 1. Patient characteristics. Risk

Low risk

High risk

Sample Diagnosis

Sex

Sex (%)

RCMD

RARS

RCMD

RARS

RCMD

RARS

RCMD

RAEB-1

RAEB-2

RAEB-1

Age (years)

Median age

Because the impact of RBC protein modifications is clear, our preliminary data suggest that it might be possible to profile MDS patients according to the type of modification. Such modifications could thus be considered characteristic signatures of MDS or its progression. As such, they might help in the earlier diagnosis and treatment of MDS patients. Acknowledgments This study was supported by the Czech Science Foundation’s P205/12/G118 and by a state project (Ministry of Health, Czech Republic) for the conceptual development of the research organization (Institute of Hematology and Blood Transfusion).

KP and PM performed research. KP, PM, JC, and JED designed the study. JC provided samples. KP, PM, JC, and JED drafted the manuscript. All authors read and approved the final manuscript. 61

51 75

Keywords: Myelodysplastic syndromes, Proteomics, Red blood cell ghosts, Posttranslational modifications, Erythrocytes, Electrophoresis Anahtar Sözcükler: Miyelodisplastik sendrom, Proteomik, Kırmızı kan hücre zarı, Posttranslasyonel modifikasyon, Eritrosit, Elektroforez

References

65 63

RCMD: Refractory anemia with multilineage dysplasia, RARS: refractory anemia with ringed sideroblasts, RA: refractory anemia, RAEB-1: refractory anemia with excess of blasts type 1, RAEB-2: refractory anemia with excess of blasts type 2, F: Female, M: Male.

112

It is well known that RBC function may be radically affected by membrane protein posttranslational modifications. For example, the increased phosphorylation of spectrin, the protein crucial for cytoskeletal stability, worsens the mechanical properties of the RBC membrane [4], and the phosphorylation of protein 4.1 leads to RBC osmotic fragility. Moreover, increased protein 4.1 mobility, suggesting the presence of other modifications, has been observed in MDS patients. The production of abnormal protein 4.1 may result in the dysregulation of spectrin-actin interaction and may cause both RBC shape change and membrane instability [5]. In addition, altered membrane morphology, including holes and thorn-like structures, was described for the RBCs of MDS and acute myeloid leukemia patients [6].

Contributors’ Statement

protein expression levels were observed. Therefore, the changes between the low- and high-risk MDS cohorts were caused by protein modifications.

1. Pandey KB, Rizvi SI. Biomarkers of oxidative stress in red blood cells. Pap Med Fac Univ Palacky Olomouc Czech Repub 2011;155:131-136. 2. Dodge JT, Mitchell C, Hanahan DJ. The preparation and chemical characteristics of hemoglobin-free ghosts of human erythrocytes. Arch Biochem Biophys 1963;100:119-130. 3. Chevallet M, Luche S, Diemer H, Strub JM, Van Dorsselaer A, Rabilloud T. Sweet silver: a formaldehyde-free silver staining using aldoses as developing agents, with enhanced compatibility with mass spectrometry. Proteomics 2008;8:4853-4861.

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

4. Manno S, Takakuwa Y, Nagao K, Mohandas N. Modulation of erythrocyte membrane mechanical function by beta-spectrin phosphorylation and dephosphorylation. J Biol Chem 1995;270:5659-5665. 5. Ideguchi H, Yamada Y, Kondo S, Tamura K, Makino S, Hamasaki N. Abnormal erythrocyte band 4.1 protein in myelodysplastic syndrome with

elliptocytosis. Br J Haematol 1993;85:387-392. 6. Majumder D, Banerjee D, Chandra S, Banerjee S, Chakrabarti A. Red cell morphology in leukemia, hypoplastic anemia and myelodysplastic syndrome. Pathophysiology 2006;13:217-225.

Address for Correspondence/Yazışma Adresi: Klara PECANKOVA, M.D., Institute of Hematology and Blood Transfusion, Prague, Czech Republic Phone: +420 221 977 349 E-mail : klara.pecankova@uhkt.cz

Received/Geliş tarihi: June 28, 2016 Accepted/Kabul tarihi: September 06, 2016 DOI: 10.4274/tjh.2016.0251

Intradiploic Hematoma in a Hemophilic Patient: Hemophilic Pseudotumor of Calvarium Hemofilik Bir Hastada İntradiploik Hematom: Kraniyumun Hemofilik Psödotümörü Hakan Hanımoğlu1, Zafer Başlar2 1İstanbul Bilim University Faculty of Medicine, Department of Neurosurgery, İstanbul, Turkey 2İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey

To the Editor, Pseudotumors are results of repeated hemorrhage into soft tissues, the subperiosteum, or a site of bone fracture with inadequate resorption of the extravasated blood. We describe a patient with a huge hemophilic pseudotumor of calvarium, which occurs very rarely.

of seizures and a CT scan of the patient showed that acceptable calvarial remodeling had occurred (Figure 1, C-1 and C-2). Proximal pseudotumors may destroy the soft tissues, erode the bone, and cause serious vascular and/or nerve damage [1].

A 14-year-old boy with mild hemophilia A (FVIII coagulant activity: 5.8%) without inhibitor presented with epileptic seizure 7 years ago. The patient was known to be hemophiliac from birth after a birth injury and brain damage had occurred. He was mentally retarded and had habitual head-hitting behavior. His family noticed progressively enlarging painless scalp swelling on his head. There was obvious asymmetry of the head and face (Figure 1, A-3). His neurological examination was normal and radiological investigations did not reveal any other pathology. A computed tomography (CT) scan showed a large lesion with a mass effect over the underlying brain (Figure 1, A-1 and A-2). Surgery was carried out with coagulation factor replacement (FVIII). During surgery a skin flap was done and the thinned outer table was incised (Figure 1, B-1). Mud-like material and a liquefied clot were evacuated (Figure 1, B-2). The thin and elastic inner wall was not removed to avoid postoperative complications (Figure 1, B-3). Following surgery, antiepileptic medication was continued and short-term prophylaxis (30 IU/kg, three times a week) was applied for 8 weeks. At the 7-year follow-up of the patient, he was free

Figure 1. A-1, A-2, A-3: Multidetector computed tomography scan with reconstruction shows large lytic intradiploic lesion with expansion and scalloping of the bony margins; please note that the inner and outer tables are separated and destructed. B-1, B-2, B-3: Intraoperative images; evacuated lesion was mudlike, inner table was protected. C1, C2: Sagittal and coronal computed tomography images after 7 years; good and acceptable remodeling of the calvarium is seen. 113

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

Reduction of the pseudotumor and chronic joint disease is achieved by prophylactic treatment in severe hemophilia.

Keywords: Hemophilia A, Intradiploic hematoma, Coagulopathy, Intraosseous

Calvarial localization of a pseudotumor is unusual [2]. Inflammation due to hematoma causes immune reaction and affects nearby tissues. The skull tables provide natural protection from soft tissues being eroded [3]. All intradiploic lesions should be suspected to be hematomas unless proven otherwise in patients with coagulopathies [2].

Anahtar Sözcükler: Hemofili Koagülopati, İntraosseoz

Total surgical removal of the hematoma is the treatment of choice. Some authors recommend cosmetic cranioplasty within the same surgical procedure [4]. However, most of them prefer to preserve the intact inner table [5]. According to us, the elastic inner table must be preserved to avoid postoperative complications. Acceptable bone remodeling was seen in the seventh year of follow-up in control CT images. However, a noncompressible inner table must be excised.

References

In summary, intradiploic hematoma must be expected when an intradiploic lesion is seen with hemophilia. The main part of the surgery is the preservation of the inner table of the cranium in hemophilic patients. Bone remodeling gives good results with time.

İntradiploik

hematom,

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

1. Rodriguez-Merchan EC. Musculo-skeletal manifestations of haemophilia. Blood Rev 2016;30:401-409. 2. Mobbs RJ, Gollapudi PR, Fuller JW, Dahlstrom JE, Chandran NK. Intradiploic hematoma after skull fracture: case report and literature review. Surg Neurol 2000;54:87-91. 3. Reeves A, Brown M. Intraosseous hematoma in a newborn with factor VIII deficiency. AJNR Am Neuroradiol 2000;21:308-309. 4. Tokmak M, Ozek E, Iplikçioğlu C. Chronic intradiploic hematomas of the skull without coagulopathy: report of two cases. Neurocirugia (Astur) 2015;26:302-306. 5. Dange N, Mahore A, Avinash KM, Joshi V, Kawale J, Goel A. Chronic intradiploic hematoma in patients with coagulopathy. J Clin Neurosci 2010;17:1047-1049.

Address for Correspondence/Yazışma Adresi: Hakan HANIMOĞLU, M.D., İstanbul Bilim University Faculty of Medicine, Department of Neurosurgery, İstanbul, Turkey Phone: +90 533 544 69 00 E-mail : drhakanhanimoglu@hotmail.com

Received/Geliş tarihi: June 29, 2016 Accepted/Kabul tarihi: September 09, 2016 DOI: 10.4274/tjh.2016.0254

The Second and Third Hemoglobin Kansas Cases in the Turkish Population Türk Popülasyonundaki İkinci ve Üçüncü Hemoglobin Kansas Olguları Zeynep Kayra Tanrıverdi1, Arzu Akyay2, Aşkın Şen3, Çağatay Taşkapan4, Ünsal Özgen2 1İnönü University Faculty of Medicine, Department of Pediatrics, Malatya, Turkey 2İnönü University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Malatya, Turkey 3Fırat University Faculty of Medicine, Department of Medical Genetics, Elazığ, Turkey 4İnönü University Faculty of Medicine, Department of Biochemistry, Malatya, Turkey

To the Editor, We read with great interest the article by Keser et al. [1] regarding the first observation of hemoglobin Kansas in Turkey. The authors described a patient from Malatya as the first case of hemoglobin Kansas in the Turkish population. After the publication of this paper, we had two other hemoglobin Kansas cases from the Malatya region. Case 1: A 16-year-old female patient was admitted with the 114

complaint of cyanosis of her lips and nails since birth, but she had no problems in her daily life. In her family history, there were other relatives who had the same complaints (Figure 1a). Physical examination of our patient indicated slight cyanosis of her lips, nail beds, and skin (Figure 2). Other system examinations were normal. Transcutaneous oxygen saturation was detected as 50%. Her complete blood count, electrocardiogram, echocardiogram, methemoglobin level, and peripheral blood smear were normal. In blood gas values, pH was 7.39, PCO2 was 41.1 mmHg, PO2 was 66.3 mmHg, and the P50 value was 66.94 (normal value: 24-

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

Figure 1. a) Family tree of the patients (transcutaneous oxygen saturations of the affected individuals are shown in parentheses); b) hemoglobin Kansas in DNA sequencing of case 1; c) hemoglobin Kansas in DNA sequencing of case 2. 29). Hemoglobin electrophoresis revealed HbA1 of 56.3%, HbA2 of 43.5%, and HbF of 2%. In beta-globulin gene DNA sequence analysis, c.308 A>C (β102(G4) Asn>Thr) (Hb Kansas) mutation was detected (Figure 1b). Case 2: A 43-year-old patient, the mother of Case 1, was admitted with the same complaints as her daughter. Transcutaneous oxygen saturation showed low oxygen levels (PO2 57%). Complete blood count, blood chemistry, and cardiac echocardiography were within normal limits. High-performance liquid chromatography results were as follows: HbA1 57.2%, HbA2 42.5%, HbF 0.2%. DNA sequencing revealed the same A to C substitution at nucleotide position 308 as in the first case (Figure 1c). Hemoglobin Kansas is a rare, unstable, abnormal hemoglobin variant with low oxygen affinity in which asparagine is replaced with threonine in the 102nd position of the β-globin chain [2,3]. In these patients, hemoglobin leaves more than the normal amount of oxygen to extrapulmonary tissues. Therefore, tissues get oxygenated even at low hematocrit levels and patients appear to be healthy. However, cyanosis is seen because the unsaturated hemoglobin amount in the capillaries and veins is higher than 5 g/ dL [4]. The P50 values of these patients are also high [5,6]. In total, six hemoglobin Kansas cases were reported from 1968 to date in the world literature [2,3,4,5]. The first hemoglobin Kansas case in Turkey was reported in 2015 [1]. Our patients and 17 other family members who had the same phenotype are more than all of the reported cases in the world literature. We could not perform hemoglobin electrophoresis and genetic evaluations of the other 17 family members because they were living in other

Figure 2. A photograph of case 1 showing cyanosis of her lips. cities. However, these patients had low transcutaneous oxygen saturations, as shown in parentheses in Figure 1a. Hemoglobin Kansas and other unstable hemoglobinopathies with low oxygen affinity should be considered in the differential diagnosis of patients with unexplained peripheral cyanosis. Keywords: Abnormal hemoglobins, Hb Kansas Anahtar Sözcükler: Anormal hemoglobinler, Hb Kansas Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

References 1. Keser İ, Öztaş A, Bilgen T, Canatan D. First observation of hemoglobin Kansas [β102(G4)Asn→Thr, AAC>ACC] in the Turkish population. Turk J Hematol 2015;32:371-375. 2. Bonaventura J, Riggs A. Hemoglobin Kansas, a human hemoglobin with a neutral amino acid substitution and an abnormal oxygen equilibrium. J Biol Chem 1968;243: 980-991. 3. Morita K, Fukuzawa J, Onodera S, Kawamura Y, Sasaki N, Fujisawa K, Ohba Y, Miyaji T, Hayashi Y, Yamazaki N. Hemoglobin Kansas found in a patient with polycythemia. Ann Hematol 1992;65:229-231. 4. Bonini-Domingos CR, Calderan PH, Siqueira FA, Naoum PC. Hemoglobin Kansas found by electrophoretic diagnosis in Brazil. Rev Bras Hematol Hemoter 2002;24:37-39. 5. Zimmermann-Baer U, Capalo R, Dutly F, Saller E, Troxler H, Kohler M, Frischknecht H. Neonatal cyanosis due to a new Gγ-globin variant causing low oxygen affinity: Hb F-Sarajevo [Gγ102 (G4) Asn→ Thr, AAC> ACC]. Hemoglobin 2012;36:109-113. 6. Riggs A, Gibson QH. Oxygen equilibrium and kinetics of isolated subunits from hemoglobin Kansas. Proc Natl Acad Sci U S A 1973;70:1718-1720.

Address for Correspondence/Yazışma Adresi: Arzu AKYAY, M.D., İnönü University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Malatya, Turkey Phone: +90 422 341 06 60/5319 E-mail : arzuakyay@yahoo.com

Received/Geliş tarihi: July 29, 2016 Accepted/Kabul tarihi: January 03, 2017 DOI: 10.4274/tjh.2016.0297

115

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

Leukocytoclastic Vasculitis Associated with a New Anticoagulant: Rivaroxaban Yeni bir Antikoagülanla İlişkili Lökositoklastik Vaskülit: Rivaroksaban Nuri Barış Hasbal, Taner Baştürk, Yener Koç, Tuncay Sahutoğlu, Feyza Bayrakdar Çağlayan, Abdülkadir Ünsal Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Nephrology, İstanbul, Turkey

To the Editor, Rivaroxaban, an oral direct factor Xa inhibitor, is one of the nonvitamin K antagonist anticoagulants and has been approved for various thrombotic diseases. Here we present a patient who developed leukocytoclastic vasculitis (LCV) associated with rivaroxaban as a rare non-bleeding side effect. A 28-year-old man who was being treated with diltiazem (60 mg/ day) and oral methylprednisolone (32 mg on alternate days) (6th month of Pozzi protocol [1]) for IgA nephropathy was admitted to our hospital with bilateral lower extremity non-blanching palpable purpura that occurred 10 days following the addition of 20 mg of rivaroxaban once daily for acute deep venous thrombosis in the right popliteal vein by another physician. There was no significant finding in the physical examination except for purpura. The complete blood count, metabolic panel, urine analysis, coagulation studies, infectious serologies, rheumatologic work-up, and serum immunoglobulin E level were all within normal limits. Rivaroxaban was replaced with subcutaneous enoxaparin sodium at 6000 IU twice a day, and the skin lesions disappeared within 1 week. Two weeks later, the patient was prescribed rivaroxaban at 10 mg a day again by the same physician who was following the patient for deep venous thrombosis because of the rarity of LCV due to rivaroxaban in the literature. Bilateral lower extremity purpura (Figure 1) reoccurred within 3 days of retreatment and a skin biopsy revealed neutrophil-predominant infiltrations within and surrounding the dermal small vessels, nuclear dust, vessel wall damage, erythrocyte extravasation, and fibrin deposition concurrent with vasculitis. Rivaroxaban was discontinued and enoxaparin was administered again, and the skin lesions resolved. The patient was in a clinically steady state for IgA nephropathy during the two episodes of vasculitis. LCV is associated with the deposition of the immune complex in small vessels that brings about loss of vessel wall integrity and extravasation of erythrocytes by immune response resulting in purpura. Although drugs and infections are the most common etiologies for LCV, idiopathic forms of the disease account for approximately half of all cases [2]. Connective tissue diseases, other systemic diseases, and hematologic or solid organ malignancies are other remaining causes of LCV [3]. The interval between 116

administration of the suspected agent and the onset of symptoms is variable, symptoms mostly occur 7 to 10 days after exposure. Treatment of LCV starts with cessation of the causative drug and palliation of symptoms after systemic involvement is excluded. Systemic therapies such as colchicine, dapsone, corticosteroids, and some other immunosuppressive medications are used for managing serious and refractory disease [3,4]. There is only one similar report in the literature, from Chaaya et al., in which they presented a 68-year-old male patient with multiple comorbidities who developed signs of LCV after 7 days of rivaroxaban treatment due to deep venous thrombosis [5]. In that report, the findings of LCV disappeared within 1 week following the discontinuation of rivaroxaban and allopurinol plus a short course of intravenous methylprednisolone. In conclusion, this report is the second case of rivaroxabanassociated LCV in the literature and this adverse event should be included in the list of significant adverse reactions to rivaroxaban.

Figure 1. Non-blanching palpable purpura is seen on the right lower leg.

LETTERS TO THE EDITOR

Turk J Hematol 2017;34:99-117

All procedures performed in this study involving human

References

participants were in accordance with the ethical standards of the

1. Pozzi C, Bolasco PG, Fogazzi GB, Andrulli S, Altieri P, Ponticelli C, Locatelli F. Corticosteroids in IgA nephropathy: a randomised controlled trial. Lancet 1999;353:883-887.

institutional research committee and the 1964 Helsinki Declaration and its later amendments or comparable ethical standards. Keywords: Vasculitis, Anticoagulants, Rivaroxaban

2. Carlson JA, Ng BT, Chen KR. Cutaneous vasculitis update: diagnostic criteria, classification, epidemiology, etiology, pathogenesis, evaluation and prognosis. Am J Dermatopathol 2005;27:504-528.

Anahtar Sözcükler: Vaskülit, Antikoagülan, Rivaroksaban

3. Micheletti RG, Werth VP. Small vessel vasculitis of the skin. Rheum Dis Clin North Am 2015;41:21-32.

Conflict of Interest: The authors of this paper have no conflicts of

4. Grau RG. Drug-induced vasculitis: new insights and a changing lineup of suspects. Curr Rheumatol Rep 2015;17:71.

interest, including specific financial interests, relationships, and/ or affiliations relevant to the subject matter or materials included.

5. Chaaya G, Jaller-Char J, Ghaffar E, Castiglioni A. Rivaroxaban-induced leukocytoclastic vasculitis: a challenging rash. Ann Allergy Asthma Immunol 2016;116:577-578.

Address for Correspondence/Yazışma Adresi: Nuri Barış HASBAL, M.D., Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Nephrology, İstanbul, Turkey E-mail : nbhasbal@gmail.com

Received/Geliş tarihi: October 31, 2016 Accepted/Kabul tarihi: August 31, 2016 DOI: 10.4274/tjh.2016.0353

117

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.2015.0202 Turk J Hematol 2017;34:118-119

Bullous Sweet’s Syndrome: Report of an Atypical Case Presenting with Ring-Like, Figurate Lesions Büllöz Sweet Sendromu: Halka Benzeri, Figüre Lezyonlarla Ortaya Çıkan Atipik Bir Olgu Sunumu Andaç Salman1, Aida Berenjian1, Ali Eser2, Fatma Dilek Kaymakçı3, Leyla Cinel3, Işık Kaygusuz Atagündüz2, Deniz Yücelten1, Tülin Ergun1 1Marmara University Faculty of Medicine, Department of Dermatology, İstanbul, Turkey 2Marmara University Faculty of Medicine, Department of Hematology, İstanbul, Turkey 3Marmara University Faculty of Medicine, Department of Pathology, İstanbul, Turkey

Figure 1. Widespread, erythematous, ring-like plaques with peripheral blisters on the trunk (A and B).

Figure 2. Dermal infiltrate rich in neutrophils with subepidermal blister formation (H&E, 20x).

A 68-year-old woman presented with a 2-month history of erythematous, blistering lesions refractory to systemic antibiotic treatment. Her medical history was insignificant except for longstanding diabetes mellitus, hepatitis C infection, and recently diagnosed myelodysplastic syndrome, refractory anemia with excess blasts-1 (MDS-RAEB-1). She denied any recent intake of drugs prior to the onset of skin lesions. Dermatological examination revealed widespread, erythematous, concentric, circinate large plaques with peripheral bullae formation over the trunk and extremities (Figures 1A and 1B). Laboratory tests disclosed leukocytosis (32x109/L) with neutrophilia (7.2x109/L), anemia (hemoglobin: 76 g/L), thrombocytopenia (16x109/L),

elevated levels of C-reactive protein (1133.36 nmol/L) and erythrocyte sedimentation rate (111 mm/h), normal levels of aspartate aminotransferase (0.17 µkat/L) and alanine aminotransferase (0.22 µkat/L), and hepatitis C virus-ribonucleic acid (HCV-RNA) negativity. A punch biopsy was obtained with a differential diagnosis of bullous Sweet’s syndrome (SS) and erythema gyratum repens. Histopathology showed diffuse, dermal inflammatory infiltrate rich in neutrophils with subepidermal blister formation (Figure 2). Clinical and laboratory findings confirmed the diagnosis of bullous SS associated with MDS-RAEB-1. In addition to topical corticosteroids and oral colchicine, treatment with azacitidine led to rapid resolution of

Address for Correspondence/Yazışma Adresi: Andaç SALMAN M.D., Marmara University Faculty of Medicine, Department of Dermatology, İstanbul, Turkey Phone : +90 216 657 06 06-3533 E-mail : asalmanitf@gmail.com, andac.salman@marmara.edu.tr

118

Received/Geliş tarihi: May 16, 2015 Accepted/Kabul tarihi: June 15, 2015

Salman A, et al: Bullous Sweet’s Syndrome

Turk J Hematol 2017;34:118-119

the lesions. There was no recurrence of SS until the patient’s death before the second azacitidine cycle.

Anahtar Sözcükler: Büllöz, Figüre eritem, Miyelodisplastik sendrom, Sweet sendromu

SS is characterized by erythematous, tender plaques and papules involving the head, neck, and upper extremities [1,2]. It may be associated with infections, hematologic malignancies, inflammatory bowel disease, and drugs [2]. SS may also be associated with chronic active hepatitis; however, normal liver function tests, HCV-RNA negativity, and the temporal relationship between skin lesions and hematological findings in our case make this unlikely. Although pseudovesicular appearance due to severe edema can be seen in SS, bullae formation with figurate and ring-like lesions is rare [3,4,5]. Figurate lesions without bullae in SS were previously reported in a patient with no associated disease [3]. In conclusion, the diagnosis of SS should be kept in mind in patients with erythema gyratum repens-like or concentric blistering lesions.

Keywords: Bullous, Figurate syndrome, Sweet’s syndrome

5. Voelter-Mahlknecht S, Bauer J, Metzler G, Fierlbeck G, Rassner G. Bullous variant of Sweet’s syndrome. Int J Dermatol 2005;44:946-947.

erythema,

Myelodysplastic

References 1. Anzalone CL, Cohen PR. Acute febrile neutrophilic dermatosis (Sweet’s syndrome). Curr Opin Hematol 2013;20:26-35. 2. Paydas S. Sweet’s syndrome: a revisit for hematologists and oncologists. Crit Rev Oncol Hematol 2013;86:85-95. 3. Behm B, Schreml S, Landthaler M, Babilas P. Sweet’s syndrome masquerading as figurate erythema. Int J Dermatol 2012;51:1101-1103. 4. Neoh CY, Tan AWH, Ng SK. Sweet’s syndrome: a spectrum of unusual clinical presentations and associations. Br J Dermatol 2007;156:480-485.

119

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.2015.0416 Turk J Hematol 2017;34:120-121

Griscelli Syndrome Presented with Status Epilepticus and Hemophagocytic Lymphohistiocytosis Status Epileptikus ve Hemofagositik Lenfohistiyositoz ile Başvuran Griscelli Sendromu Fatih Demircioğlu1, Hilal Aydın2, Mustafa Erkoçoğlu3, Hüseyin Önay4, Emine Dağıstan5 1Abant İzzet Baysal University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Bolu, Turkey 2Abant İzzet Baysal University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Neurology, Bolu, Turkey 3Abant İzzet Baysal University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Immunology and Allergy, Bolu, Turkey 4Ege University Faculty of Medicine, Department of Molecular Biology and Genetics, İzmir, Turkey 5Abant İzzet Baysal University Faculty of Medicine, Department of Radiology, Bolu, Turkey

Figure 1. (a) Partial albinism with silvery gray hair. (b) Bone marrow examination showing hemophagocytosis. (c) Hair examination showing irregularly scanty melanin pigments.

A 12-month-old female infant was referred to our hospital with prolonged fever and status epilepticus. Her weight and height were below the 5th percentile for age. Physical examination revealed marked hypotonia, fever, pallor, partial albinism with silvery gray hair, and hepatosplenomegaly (Figure 1A). Laboratory investigations showed anemia, thrombocytopenia, hypofibrinogenemia, hyperferritinemia, and hemophagocytosis at bone marrow examination (Figure 1B).

Figure 2. Griscelli syndrome: cerebral involvement. (a) Axial T1weighted magnetic resonans (MR) image shows bilateral lowsignal-intensity areas in white matter of cerebellum. (b) Axial fluid attenuation inversion recovery MR image demonstrates high-signal-intensity in this area. (c) Axial T2-weighted MR image at lateral ventricle level. (d, e) Axial and coronal T2-weighed images showing cerebral atrophy and diffuse high-signalintensity in cerebral white matter. (f) Contrast-enhanced coronal T1-weighted MR image demonstrates no contrast uptake.

Lymphocyte subsets and serum immunoglobulin levels were normal. Hair examination showed irregularly scanty melanin pigments (Figure 1C). Electroencephalographic study revealed encephalopathic findings, including decreased background activity with continuous slow wave discharges. Brain magnetic resonance imaging showed diffuse cerebral involvement (Figure 2). RAB27A encoding gene C.149delG mutation was detected. We diagnosed Griscelli syndrome (GS) with

Address for Correspondence/Yazışma Adresi: Fatih DEMİRCİOĞLU, M.D. Received/Geliş tarihi: December 03, 2015 Abant İzzet Baysal University Faculty of Medicine, Department of Pediatrics, Division of Pediatric Hematology, Bolu, Turkey Accepted/Kabul tarihi: January 15, 2015 Phone : +90 374 270 45 75-3463 E-mail : fatih_demircioglu@yahoo.com

120

Turk J Hematol 2017;34:120-121

Demercioğlu F, et al. Griscelli Syndrome Presented with Status Epilepticus and Hemophagocytic Lymphohistiocytosis

hemophagocytic lymphohistiocytosis (HLH). She received the HLH-2004 treatment protocol. The patient showed complete hematological response to treatment and was discharged after 1 month with persistent neurological involvement. Although bone marrow transplantation is the only curative therapy for GS, we did not plan bone marrow transplantation due to the severe neurological sequela. The patient died due to progressive disease after 6 months. GS is an autosomal recessive disorder characterized by the silvery gray sheen of the hair and hypopigmentation of the skin, which can be associated with neurological impairment, psychomotor retardation, HLH, and immunodeficiency [1]. Both GS and Chediak-Higashi syndrome may present with oculocutaneous albinism, neutropenia, immune dysfunction, and accelerated phase. In differential diagnosis, the absence of bleeding disorders and giant granules in leukocytes, and finally gene analysis, helped us to exclude Chediak-Higashi syndrome [2]. GS type 1 is caused by a mutation in the myosin Va (MYO5A) gene, GS type 2 is caused by mutations in the RAB27A encoding gene, and GS type 3 is due to mutations in the MLPH gene, which forms a protein complex with Rab27a and myosin Va [3,4]. Hematopoietic stem cell transplantation is the only curative treatment for GS with HLH [3,4].

Keywords: Children, Griscelli syndrome, Status epilepticus, Hemophagocytic lymphohistiocytosis Anahtar Sözcükler: Çocuk, Griscelli sendromu, epileptikus, Hemofagositik lenfohistiyositoz

Status

References 1. Patıroğlu T, Özdemir MA, Patıroğlu TE. Griscelli’s syndrome: clinical and immunological features of two siblings. Turk J Hematol 2000;17:85-87. 2. Dotta L, Parolini S, Prandini A, Tabellini G, Antolini M, Kingsmore SF, Badolato R. Clinical, laboratory and molecular signs of immunodeficiency inpatients with partial oculo-cutaneous albinism. Orphanet J Rare Dis 2013;8:168. 3. Aslan D, Sari S, Derinöz O, Dalgiç B. Griscelli syndrome: description of a case with Rab27A mutation. Pediatr Hematol Oncol 2006;23:255-261. 4. Meeths M, Bryceson YT, Rudd E, Zheng C, Wood SM, Ramme K, Beutel K, Hasle H, Heilmann C, Hultenby K, Ljunggren HG, Fadeel B, Nordenskjöld M, Henter JI. Clinical presentation of Griscelli syndrome type 2 and spectrum of RAB27A mutations. Pediatr Blood Cancer 2010;54:563-572.

121

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.2015.0354 Turk J Hematol 2017;34:122-123

Acute Monoblastic Leukemia Presenting with Multiple Granulocytic Sarcoma Nodules Granülositik Sarkom Nodülleri ile Ortaya Çıkan Bir Akut Monoblastik Lösemi Olgusu Asude Kara1, Aslı Akın Belli1, Yelda Dere2, Volkan Karakuş3, Şükrü Kasap4, Erdal Kurtoğlu5, Mine Hekimgil6 1Muğla Sıtkı Koçman University Training and Research Hospital, Department of Dermatology, Muğla, Turkey 2Muğla Sıtkı Koçman University Faculty of Medicine, Department of Pathology, Muğla, Turkey 3Muğla Sıtkı Koçman University Training and Research Hospital, Department of Hematology, Muğla, Turkey 4Muğla Sıtkı Koçman University Faculty of Medicine, Department of Plastic Surgery, Muğla, Turkey 5Antalya Training and Research Hospital, Clinic of Hematology, Antalya, Turkey 6Ege University Faculty of Medicine, Department of Pathology, İzmir, Turkey

Figure 1. Violaceous nodules with central pustules and scaling on the right leg.

Figure 2. (A) Bone marrow biopsy showing hypercellularity (H&E, 100x). (B) Bone marrow aspiration smear showing erythroblasts and blastic cells with nuclear indentation (Giemsa, 400x). (C) CD34 (+) blastic cells (200x). (D) Myeloperoxidase (+) blastic cells (200x).

A 76-year-old male presented to the department of plastic surgery with multiple nodules on his legs for 1 month. On examination, there were five discrete, violaceous nodules with a size of 0.5-3 cm on the legs (Figure 1). Laboratory tests revealed the following: white blood cell count of 3.6x109/L, red blood cell count of 1.54x1012/L, platelet count of 82x109/L, hemoglobin of 4.45 g/dL, and lactate dehydrogenase of 266 U/L. Due to pancytopenia, the patient was referred to the department of

hematology before the excision. Peripheral blood smear showed 50% neutrophils, 40% lymphocytes, 8% monocytes, and 2% atypical cells. An excisional biopsy of skin lesions and a bone marrow biopsy (BMB) were performed. The BMB revealed monoblastic cell infiltration (40%) and immunohistochemical stains were positive with CD34 and myeloperoxidase (Figures 2A-2D). CD13, CD34, CD117, CD4, CD33, myeloperoxidase, CD38, and CD11c were detected in the blastic cells, which

Address for Correspondence/Yazışma Adresi: Yelda DERE, M.D., Muğla Sıtkı Koçman University Faculty of Medicine, Department of Pathology, Muğla, Turkey Phone : +90 505 465 31 98 E-mail : yeldamorgul@gmail.com

122

Received/Geliş tarihi: October 09, 2015 Accepted/Kabul tarihi: January 09, 2016

Turk J Hematol 2017;34:122-123

Kara A, et al: Acute Monoblastic Leukemia Presenting with Multiple Granulocytic Sarcoma Nodules

lymphoplasmacytic infiltration in the dermis, including occasional blastic cells with morphologic features similar to the BMB findings like folded nuclei (Figures 3A-3D), was detected and diagnosed as granulocytic sarcoma (GS). However, the patient refused chemotherapy with azacitidine. Since cutaneous involvement of GS is rare and indicates poor prognosis, GS should be remembered in the differential diagnosis of suddenly emerging nodules and pustules [1,2]. Keywords: Granulocytic sarcoma, Acute monoblastic leukemia, CD34, Myeloperoxidase Anahtar Sözcükler: Granülositik sarkom, Akut monoblastik lösemi, CD34, Miyeloperoksidaz Figure 3. (A) Ulceration and pseudo-epitheliomatous hyperplasia in the epidermis, and inflammatory infiltration with capillary vessel proliferation under the epidermis (H&E, 40x). (B, C) Occasional blastic cells with folded nuclei that show monoblastic morphology similar to the bone marrow and plasma cells with thin-walled capillaries (H&E, 400x). (D) CD34 staining showing positivity in the endothelial cells intensely and scattered blasts (400x). formed 31.4% of the population, by flow cytometry. The results were compatible with monoblastic leukemia and no genetic abnormalities were found. Histopathologically reactive

References 1. Yilmaz AF, Saydam G, Sahin F, Baran Y. Granulocytic sarcoma: a systematic review. Am J Blood Res 2013;3:265-270. 2. Hurley MY, Ghahramani GK, Frisch S, Armbrecht ES, Lind AC, Nguyen TT, Hassan A, Kreisel FH, Frater JL. Cutaneous myeloid sarcoma: natural history and biology of an uncommon manifestation of acute myeloid leukemia. Acta Derm Venereol 2013;93:319-324.

123

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.2016.0258 Turk J Hematol 2017;34:124-125

Internuclear Bridging of Erythroid Precursors in the Peripheral Blood Smear of a Patient with Primary Myelofibrosis Primer Miyelofibroz Tanılı Bir Hastanın Çevre Kanı Yaymasında Eritroid Öncüllerin Nükleuslar Arası Köprüleşmesi Roger K. Schindhelm1, Marije M. van Santen2, Arie C. van der Spek3 1Northwest Clinics, Department of Clinical Chemistry, Hematology and Immunology, Den Helder, the Netherlands 2Symbiant Pathology Expert Center, Alkmaar, the Netherlands 3Northwest Clinics, Department of Internal Medicine, Den Helder, the Netherlands

Figure 1. Bone marrow biopsy showing marked increase in reticulin fibers, especially in the areas of megakaryocyte clustering (Gomori, 10x).

Figure 2. Blood smear demonstrating teardrop cells, erythroid precursor with internuclear bridging, and one blast cell (MayGrünwald-Giemsa, 50x).

An 84-year-old male diagnosed with primary myelofibrosis based on WHO grade 2-3 fibrosis (Figure 1) and the presence of the JAK2-V617F mutation was treated with supportive care. During 2 years of follow-up, his hemoglobin level was maintained at approximately 6.5 mmol/L and platelet count declined from 128x109/L at presentation to 50x109/L. White blood cells did not exceed 12.0x109/L, while the fraction of blast cells increased to 10%. Elevated levels of teardrop cells were observed and the nucleated red blood cell count gradually increased from non-detectable to 2.4x1012/L. Recent peripheral

blood smears showed bi- and tri-nucleated red blood cells, and even more notably, erythroid precursors with internuclear chromatin and cytoplasmic bridging (Figures 2 and 3). In concurrence with laboratory findings, physical examination revealed progressive splenomegaly (8 cm palpable below the rib margin) and weight loss. Erythroid precursors with internuclear bridging in a blood smear is a rare morphological finding and is considered a diagnostic morphologic feature in patients with congenital dyserythropoietic anemia type I and a morphological manifestation of dyserythropoiesis in

Address for Correspondence/Yazışma Adresi: Roger K. SCHINDHELM Ph.D., Northwest Clinics, Department of Clinical Chemistry, Hematology and Immunology, Den Helder, the Netherlands Phone : +31 72 548 44 44 E-mail : r.k.schindhelm@nwz.nl

124

Received/Geliş tarihi: July 04, 2016 Accepted/Kabul tarihi: September 19, 2016

Turk J Hematol 2017;34:124-125

Schindhelm RK, et al: Erythroid Precursors’ Internuclear Bridging

patients with myelodysplastic syndrome [1,2]. In patients with myeloproliferative neoplasms, erythroid precursors’ internuclear bridging may indicate the transition to a more aggressive phase. Keywords: Primary myelofibrosis, Internuclear bridging, Erythrocytes Anahtar Sözcükler: Primer miyelofibroz, Nükleuslar arası köprüleşme, Eritrositler Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References Figure 3. Blood smear demonstrating erythroid precursor with internuclear and cytoplasmic bridging (May-Grünwald-Giemsa, 100x).

1. Iolascon A, Esposito MR, Russo R. Clinical aspects and pathogenesis of congenital dyserythropoietic anemias: from morphology to molecular approach. Haematologica 2012;97:1786-1794. 2. Head DR, Kopecky K, Bennett JM, Grenier K, Morrison FS, Miller KB, Grever MR. Pathogenetic implications of internuclear bridging in myelodysplastic syndrome. An Eastern Cooperative Oncology Group/Southwest Oncology Group Cooperative Study. Cancer 1989;64:2199-2202.

125

Advisory Board of This Issue (March 2017) Ahmet Emre Eşkazan, Turkey Akif Selim Yavuz, Turkey Alphan Küpesiz, Turkey Amir Steinberg, USA Antonio Perez-Ferrer, Spain Ayşegül Ünüvar, Turkey Aytemiz Gürgey, Turkey Burak Deveci, Turkey Burak Uz, Turkey Burhan Ferhanoğlu, Turkey Cem Ar, Turkey Ceyhun Bozkurt, Turkey Deniz Karapınar, Turkey Dimitrios Tsakiris, Switzerland Emre Tekgündüz, Turkey Erol Erduran, Turkey Francesco Onida, Italy Gerard Chaaya, USA Giuseppe Saglio, Italy Gonce Gökdemir, Turkey Guillaume Moulis, France Gülden Gökçay, Turkey

Gwo-Shing Chen, Taiwan Halis Akalın, Turkey Işınsu Kuzu, Turkey Jan Stasko, Slovakia Jean François Lesesve, France Joan Cid, Spain John Bennett, USA Kaan Kavaklı, Turkey Lacey Johnson, Australia Malgorzata Kus-Liskiewicz, Poland Maria Papaioannou, UK Marie Ambroise, India Meltem Aylı, Turkey Murat Akova, Turkey Mutlu Arat, Turkey Nil Güler, Turkey Nükhet Tüzüner, Turkey Ovidlu Oprea, Romania Ozan Salim, Turkey Pervin Topçuoğlu, Turkey Piotr Szweda, Poland Qianli Jiang, China

Rıdvan Ali, Turkey Semra Paydaş, Turkey Serap Karaman, Turkey Serdar Şıvgın, Turkey Sergey Kulikov, Russia Steven Lane, UK Şule Ünal, Turkey Tahsin Özpolat, Turkey Tamojit Chaudhuri, India Tiraje Celkan, Turkey Tomas Jose Gonzalez Lopez, Spain Tunç Fışgın, Turkey Türkan Patıroğlu, Turkey Vildan Özkocaman, Turkey Wolfgang Sperr, Austria Yeşim Aydınok, Turkey Yuh-Tai Wang, Taiwan Yuhong Shi, USA Zahit Bolaman, Turkey Zeynep Karakaş, Turkey Zühre Kaya, Turkey