Tjh 2018 1 by LookUs Scientific

Issue 1

March 2018

80 TL

ISSN 1300-7777

Volume 35

Review Invasive Fungal Infections in Patients with Hematological Malignancies: Emergence of Resistant Pathogens and New Antifungal Therapies Maria N. Gamaletsou, et al.; Leeds, United Kingdom; New York, USA; Athens, Greece

Research Articles A National Registry of Thalassemia in Turkey: Demographic and Disease Characteristics of Patients, Achievements, and Challenges in Prevention Yeşim Aydınok, et al.; Hemoglobinopathy Study Group, Turkey

Biological Features of Bone Marrow Mesenchymal Stromal Cells in Childhood Acute Lymphoblastic Leukemia Stella Genitsari, et al.; Crete, Athens, Greece

Juvenile Myelomonocytic Leukemia in Turkey: A Retrospective Analysis of Sixty-five Patients

Özlem Tüfekçi, et al.; İzmir, Ankara, Samsun, Kayseri, İstanbul, Kocaeli, Antalya, Konya, Bursa, Trabzon, Turkey

Transformation of Mycosis Fungoides/Sezary Syndrome: Clinical Characteristics and Prognosis Seçil Vural, et al.; Ankara, Turkey

The Effect of Bone Marrow Mesenchymal Stem Cells on the Granulocytic Differentiation of HL-60 Cells Hossein Nikkhah, et al.; Tabriz, Sari, Iran; Minnesota, USA

NPM1 Mutation Analysis in Acute Myeloid Leukemia: Comparison of Three Techniques – Sanger Sequencing, Pyrosequencing, and Real-Time Polymerase Chain Reaction

Dushyant Kumar, et al.; Guwahati, New Delhi, India

Incomplete Antibodies May Reduce ABO Cross-Match Incompatibility: A Pilot Study Mehmet Özen, et al.; Ankara, Turkey

Cover Picture: Jakub Debski et al. Ascites in the Course of Plasma Cell Myeloma Complicated by AL Amyloidosis

International Review Board

Editor-in-Chief Reyhan Küçükkaya

İstanbul, Turkey rkucukkaya@hotmail.com

Associate Editors Ayşegül Ünüvar

İstanbul, Turkey aysegulu@hotmail.com

Cengiz Beyan TOBB University of Economics and Technology, Ankara, Turkey cengizbeyan@hotmail.com

Hale Ören

Dokuz Eylül University, İzmir, Turkey hale.oren@deu.edu.tr

İbrahim C. Haznedaroğlu

Hacettepe University, Ankara, Turkey haznedar@yahoo.com

M. Cem Ar

İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey mcemar68@yahoo.com

Selami Koçak Toprak

Ankara University, Ankara, Turkey sktoprak@yahoo.com

Semra Paydaş

Çukurova University, Adana, Turkey sepay@cu.edu.tr

Assistant Editors A. Emre Eşkazan

İstanbul University Cerrahpaşa Faculty of Medicine, İstanbul, Turkey

Ali İrfan Emre Tekgündüz

Dr. A. Yurtaslan Ankara Oncology Training and Research Hospital, Ankara, Turkey

Claudio Cerchione

University of Naples Federico II Napoli, Campania, Italy

Elif Ünal İnce

Ankara University, Ankara, Turkey

İnci Alacacıoğlu

Nejat Akar Görgün Akpek  Serhan Alkan  Çiğdem Altay  Koen van Besien  Ayhan Çavdar M. Sıraç Dilber  Ahmet Doğan  Peter Dreger  Thierry Facon Jawed Fareed  Gösta Gahrton  Dieter Hoelzer  Marilyn Manco-Johnson Andreas Josting Emin Kansu  Winfried Kern  Nigel Key  Korgün Koral Abdullah Kutlar Luca Malcovati  Robert Marcus  Jean Pierre Marie Ghulam Mufti Gerassimos A. Pangalis Antonio Piga Ananda Prasad Jacob M. Rowe Jens-Ulrich Rüffer Norbert Schmitz Orhan Sezer  Anna Sureda Ayalew Tefferi Nükhet Tüzüner Catherine Verfaillie Srdan Verstovsek Claudio Viscoli

TOBB Economy Technical University Hospital, Ankara, Turkey Maryland School of Medicine, Baltimore, USA  Cedars-Sinai Medical Center, USA  Ankara, Turkey Chicago Medical Center University, Chicago, USA Ankara, Turkey  Karolinska University, Stockholm, Sweden  Mayo Clinic Saint Marys Hospital, USA Heidelberg University, Heidelberg, Germany Lille University, Lille, France  Loyola University, Maywood, USA  Karolinska University Hospital, Stockholm, Sweden Frankfurt University, Frankfurt, Germany Colorado Health Sciences University, USA  University Hospital Cologne, Cologne, Germany  Hacettepe University, Ankara, Turkey  Albert Ludwigs University, Germany  University of North Carolina School of Medicine, NC, USA Southwestern Medical Center, Texas, USA Georgia Health Sciences University, Augusta, USA  Pavia Medical School University, Pavia, Italy  Kings College Hospital, London, UK  Pierre et Marie Curie University, Paris, France  King’s Hospital, London, UK  Athens University, Athens, Greece  Torino University, Torino, Italy  Wayne State University School of Medicine, Detroit, USA Rambam Medical Center, Haifa, Israel  University of Köln, Germany  AK St Georg, Hamburg, Germany  Memorial Şişli Hospital, İstanbul, Turkey  Santa Creu i Sant Pau Hospital, Barcelona, Spain  Mayo Clinic, Rochester, Minnesota, USA  İstanbul Cerrahpaşa University, İstanbul, Turkey  University of Minnesota, Minnesota, USA The University of Texas MD Anderson Cancer Center, Houston, USA San Martino University, Genoa, Italy

Past Editors Erich Frank Orhan Ulutin Hamdi Akan Aytemiz Gürgey

Language Editor Leslie Demir

Senior Advisory Board Yücel Tangün Osman İlhan Muhit Özcan Teoman Soysal Ahmet Muzaffer Demir

Editorial Office İpek Durusu Bengü Timoçin

Dokuz Eylül University, İzmir, Turkey

Müge Sayitoğlu

İstanbul University, İstanbul, Turkey

Nil Güler

Ondokuz Mayıs University, Samsun, Turkey

Olga Meltem Akay

Koç University, İstanbul, Turkey

Şule Ünal

Hacettepe University, Ankara, Turkey

Veysel Sabri Hançer

İstinye University, İstanbul, Turkey

Zühre Kaya

Gazi University, Ankara, Turkey

A-I

Publishing Services

Statistic Editor Hülya Ellidokuz

GALENOS PUBLISHER Molla Gürani Mah. Kaçamak Sk. No: 21/1, Fındıkzade, İstanbul, Turkey Phone: +90 212 621 99 25 • Fax: +90 212 621 99 27 • www. galenos.com.tr

Contact Information Editorial Correspondence should be addressed to Dr. Reyhan Küçükkaya E-mail : rkucukkaya@hotmail.com

All Inquiries Should be Addressed to TURKISH JOURNAL OF HEMATOLOGY Address Phone Fax E-mail

: Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.) No: 8 06550 Çankaya, Ankara / Turkey : +90 312 490 98 97 : +90 312 490 98 68  : info@tjh.com.tr

ISSN: 1300-7777

Publishing Manager Sorumlu Yazı İşleri Müdürü Muhlis Cem Ar

Management Address Yayın İdare Adresi

Publishing House / Yayınevi

Türk Hematoloji Derneği Turan Güneş Bulv. İlkbahar Mah. Fahreddin Paşa Sokağı (eski 613. Sok.) No: 8 06550 Çankaya, Ankara / Turkey

Molla Gürani Mah. Kaçamak Sk. No: 21, 34093 Fındıkzade, İstanbul, Turkey Tel: +90 212 621 99 25 Fax: +90 212 621 99 27 E-mail: info@galenos.com.tr

Online Manuscript Submission

Print: Creative Basım Ltd. Şti.

http://mc.manuscriptcentral.com/tjh

Litros Yolu 2. Matbaacılar Sit. ZD1 Topkapı, İstanbul-Turkey

Web page

Phone: +90 212 709 75 25 www.Creativebasim.com

www.tjh.com.tr

Printing Date / Basım Tarihi 25.02.2018

Owner on behalf of the Turkish Society of Hematology Türk Hematoloji Derneği adına yayın sahibi

Cover Picture

Güner Hayri Özsan

Jakub Debski et al., Ascites in the Course of Plasma Cell Myeloma Complicated by AL Amyloidosis

International scientific journal published quarterly. Üç ayda bir yayımlanan İngilizce süreli yayındır.

Microscopic evaluation of plasmacytes and plasmablasts in an ascitic fluid smear (modified Wright-Giemsa stain, 400x).

Türk Hematoloji Derneği, 07.10.2008 tarihli ve 6 no’lu kararı ile Turkish Journal of Hematology’nin Türk Hematoloji Derneği İktisadi İşletmesi tarafından yayınlanmasına karar vermiştir.

A-II

AIMS AND SCOPE The Turkish Journal of Hematology is published quarterly (March, June, September, and December) by the Turkish Society of Hematology. It is an independent, non-profit peer-reviewed international English-language periodical encompassing subjects relevant to hematology. The Editorial Board of The Turkish Journal of Hematology adheres to the principles of the World Association of Medical Editors (WAME), International Council of Medical Journal Editors (ICMJE), Committee on Publication Ethics (COPE), Consolidated Standards of Reporting Trials (CONSORT) and Strengthening the Reporting of Observational Studies in Epidemiology (STROBE). The aim of The Turkish Journal of Hematology is to publish original hematological research of the highest scientific quality and clinical relevance. Additionally, educational material, reviews on basic developments, editorial short notes, images in hematology, and letters from hematology specialists and clinicians covering their experience and comments on hematology and related medical fields as well as social subjects are published. As of December 2015, The Turkish Journal of Hematology does not accept case reports. Important new findings or data about interesting hematological cases may be submitted as a brief report. General practitioners interested in hematology and internal medicine specialists are among our target audience, and The Turkish Journal of Hematology aims to publish according to their needs. The Turkish Journal of Hematology is indexed, as follows: - PubMed Medline - PubMed Central - Science Citation Index Expanded - EMBASE - Scopus - CINAHL - Gale/Cengage Learning - EBSCO - DOAJ - ProQuest - Index Copernicus - Tübitak/Ulakbim Turkish Medical Database - Turk Medline Impact Factor: 0.686 Open Access Policy Turkish Journal of Hematology is an Open Access journal. This journal provides immediate open access to its content on the principle that making research freely available to the public supports a greater global exchange of knowledge. Open Access Policy is based on the rules of the Budapest Open Access Initiative (BOAI) http://www.budapestopenaccessinitiative.org/. Subscription Information  The Turkish Journal of Hematology is sent free-of-charge to members of Turkish Society of Hematology and libraries in Turkey and abroad. Hematologists, other medical specialists that are interested in hematology, and academicians could subscribe for only 40 $ per printed issue. All published volumes are available in full text free-of-charge online at www. tjh.com.tr.

A-III

Address: İlkbahar Mah., Turan Güneş Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey Telephone: +90 312 490 98 97  Fax: +90 312 490 98 68 Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh  Web page: www.tjh.com.tr  E-mail: info@tjh.com.tr   Permissions  Requests for permission to reproduce published material should be sent to the editorial office. Editor: Professor Dr. Reyhan Küçükkaya Adress: İlkbahar Mah, Turan Günes Bulvarı, 613 Sok., No: 8, Çankaya, Ankara, Turkey  Telephone: +90 312 490 98 97  Fax: +90 312 490 98 68  Online Manuscript Submission: http://mc.manuscriptcentral.com/tjh  Web page: www.tjh.com.tr  E-mail: info@tjh.com.tr Publisher Galenos Yayınevi Molla Gürani Mah. Kaçamak Sk. No:21 34093 Fındıkzade-İstanbul, Turkey Telephone : +90 212 621 99 25 Fax : +90 212 621 99 27 info@galenos.com.tr Instructions for Authors Instructions for authors are published in the journal and at www.tjh.com.tr Material Disclaimer Authors are responsible for the manuscripts they publish in The Turkish Journal of Hematology. The editor, editorial board, and publisher do not accept any responsibility for published manuscripts. If you use a table or figure (or some data in a table or figure) from another source, cite the source directly in the figure or table legend. The journal is printed on acid-free paper. Editorial Policy Following receipt of each manuscript, a checklist is completed by the Editorial Assistant. The Editorial Assistant checks that each manuscript contains all required components and adheres to the author guidelines, after which time it will be forwarded to the Editor in Chief. Following the Editor in Chief’s evaluation, each manuscript is forwarded to the Associate Editor, who in turn assigns reviewers. Generally, all manuscripts will be reviewed by at least three reviewers selected by the Associate Editor, based on their relevant expertise. Associate editor could be assigned as a reviewer along with the reviewers. After the reviewing process, all manuscripts are evaluated in the Editorial Board Meeting. Turkish Journal of Hematology’s editor and Editorial Board members are active researchers. It is possible that they would desire to submit their manuscript to the Turkish Journal of Hematology. This may be creating a conflict of interest. These manuscripts will not be evaluated by the submitting editor(s). The review process will be managed and decisions made by editor-in-chief who will act independently. In some situation, this process will be overseen by an outside independent expert in reviewing submissions from editors.

TURKISH JOURNAL OF HEMATOLOGY INSTRUCTIONS FOR AUTHORS The Turkish Journal of Hematology accepts invited review articles, research articles, brief reports, letters to the editor, and hematological images that are relevant to the scope of hematology, on the condition that they have not been previously published elsewhere. Basic science manuscripts, such as randomized, cohort, cross-sectional, and case-control studies, are given preference. All manuscripts are subject to editorial revision to ensure they conform to the style adopted by the journal. There is a double-blind reviewing system. Review articles are solicited by the Editorin-Chief. Authors wishing to submit an unsolicited review article should contact the Editor-in-Chief prior to submission in order to screen the proposed topic for relevance and priority. The Turkish Journal of Hematology does not charge any article submission or processing charges. Manuscripts should be prepared according to ICMJE guidelines (http:// www.icmje.org/). Original manuscripts require a structured abstract. Label each section of the structured abstract with the appropriate subheading (Objective, Materials and Methods, Results, and Conclusion). Letters to the editor do not require an abstract. Research or project support should be acknowledged as a footnote on the title page. Technical and other assistance should be provided on the title page. Original Manuscripts Title Page Title: The title should provide important information regarding the manuscript’s content. The title must specify that the study is a cohort study, cross-sectional study, case-control study, or randomized study (i.e. Cao GY, Li KX, Jin PF, Yue XY, Yang C, Hu X. Comparative bioavailability of ferrous succinate tablet formulations without correction for baseline circadian changes in iron concentration in healthy Chinese male subjects: A single-dose, randomized, 2-period crossover study. Clin Ther 2011;33:2054-2059). The title page should include the authors’ names, degrees, and institutional/ professional affiliations and a short title, abbreviations, keywords, financial disclosure statement, and conflict of interest statement. If a manuscript includes authors from more than one institution, each author’s name should be followed by a superscript number that corresponds to their institution, which is listed separately. Please provide contact information for the corresponding author, including name, e-mail address, and telephone and fax numbers. Running Head: The running head should not be more than 40 characters, including spaces, and should be located at the bottom of the title page. Word Count: A word count for the manuscript, excluding abstract, acknowledgments, figure and table legends, and references, should be provided and should not exceed 2500 words. The word count for the abstract should not exceed 300 words.

A-IV

Conflict of Interest Statement: To prevent potential conflicts of interest from being overlooked, this statement must be included in each manuscript. In case there are conflicts of interest, every author should complete the ICMJE general declaration form, which can be obtained at http://www.icmje.org/downloads/coi_disclosure.zip Abstract and Keywords: The second page should include an abstract that does not exceed 300 words. For manuscripts sent by authors in Turkey, a title and abstract in Turkish are also required. As most readers read the abstract first, it is critically important. Moreover, as various electronic databases integrate only abstracts into their index, important findings should be presented in the abstract. Objective: The abstract should state the objective (the purpose of the study and hypothesis) and summarize the rationale for the study. Materials and Methods: Important methods should be written respectively. Results: Important findings and results should be provided here. Conclusion: The study’s new and important findings should be highlighted and interpreted. Other types of manuscripts, such as reviews, brief reports, and editorials, will be published according to uniform requirements. Provide 3-10 keywords below the abstract to assist indexers. Use terms from the Index Medicus Medical Subject Headings List (for randomized studies a CONSORT abstract should be provided: http:// www.consort-statement.org). Introduction: The introduction should include an overview of the relevant literature presented in summary form (one page), and whatever remains interesting, unique, problematic, relevant, or unknown about the topic must be specified. The introduction should conclude with the rationale for the study, its design, and its objective(s). Materials and Methods: Clearly describe the selection of observational or experimental participants, such as patients, laboratory animals, and controls, including inclusion and exclusion criteria and a description of the source population. Identify the methods and procedures in sufficient detail to allow other researchers to reproduce your results. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for using them and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. The section should include only information that was available at the time the plan or protocol for the study was devised (https://www.strobe-statement.org/ fileadmin/Strobe/uploads/checklists/STROBE_checklist_v4_combined. pdf). Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify

the reported results. Statistically important data should be given in the text, tables, and figures. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used. Results: Present your results in logical sequence in the text, tables, and figures. Do not present all the data provided in the tables and/or figures in the text; emphasize and/or summarize only important findings, results, and observations in the text. For clinical studies provide the number of samples, cases, and controls included in the study. Discrepancies between the planned number and obtained number of participants should be explained. Comparisons and statistically important values (i.e. p-value and confidence interval) should be provided. Discussion: This section should include a discussion of the data. New and important findings/results and the conclusions they lead to should be emphasized. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by the data. Do not repeat the findings/results in detail; important findings/ results should be compared with those of similar studies in the literature, along with a summarization. In other words, similarities or differences in the obtained findings/results with those previously reported should be discussed. Study Limitations: Limitations of the study should be detailed. In addition, an evaluation of the implications of the obtained findings/ results for future research should be outlined. Conclusion: The conclusion of the study should be highlighted. References Cite references in the text, tables, and figures with numbers in square brackets. Number references consecutively according to the order in which they first appear in the text. Journal titles should be abbreviated according to the style used in Index Medicus (consult List of Journals Indexed in Index Medicus). Include among the references any paper accepted, but not yet published, designating the journal followed by “in press”. Examples of References: 1. List all authors Deeg HJ, O’Donnel M, Tolar J. Optimization of conditioning for marrow transplantation from unrelated donors for patients with aplastic anemia after failure of immunosuppressive therapy. Blood 2006;108:1485-1491. 2. Organization as author Royal Marsden Hospital Bone Marrow Transplantation Team. Failure of syngeneic bone marrow graft without preconditioning in post-hepatitis marrow aplasia. Lancet 1977;2:742-744.

4. Book Chapter Perutz MF. Molecular anatomy and physiology of hemoglobin. In: Steinberg MH, Forget BG, Higs DR, Nagel RI, (eds). Disorders of Hemoglobin: Genetics, Pathophysiology, Clinical Management. New York, Cambridge University Press, 2000. 5. Abstract Drachman JG, Griffin JH, Kaushansky K. The c-Mpl ligand (thrombopoietin) stimulates tyrosine phosphorylation. Blood 1994;84:390a (abstract). 6. Letter to the Editor Rao PN, Hayworth HR, Carroll AJ, Bowden DW, Pettenati MJ. Further definition of 20q deletion in myeloid leukemia using fluorescence in situ hybridization. Blood 1994;84:2821-2823. 7. Supplement Alter BP. Fanconi’s anemia, transplantation, and cancer. Pediatr Transplant 2005;9(Suppl 7):81-86. Brief Reports Abstract length: Not to exceed 150 words. Article length: Not to exceed 1200 words. Introduction: State the purpose and summarize the rationale for the study. Materials and Methods: Clearly describe the selection of the observational or experimental participants. Identify the methods and procedures in sufficient detail. Provide references to established methods (including statistical methods), provide references to brief modified methods, and provide the rationale for their use and an evaluation of their limitations. Identify all drugs and chemicals used, including generic names, doses, and routes of administration. Statistics: Describe the statistical methods used in enough detail to enable a knowledgeable reader with access to the original data to verify the reported findings/results. Provide details about randomization, describe treatment complications, provide the number of observations, and specify all computer programs used. Results: Present the findings/results in a logical sequence in the text, tables, and figures. Do not repeat all the findings/results in the tables and figures in the text; emphasize and/or summarize only those that are most important. Discussion: Highlight the new and important findings/results of the study and the conclusions they lead to. Link the conclusions with the goals of the study, but avoid unqualified statements and conclusions not completely supported by your data. Invited Review Articles Abstract length: Not to exceed 300 words.

3. Book

Article length: Not to exceed 4000 words.

Wintrobe MM. Clinical Hematology, 5th ed. Philadelphia, Lea & Febiger, 1961.

Review articles should not include more than 100 references. Reviews should include a conclusion, in which a new hypothesis or study about the

A-V

subject may be posited. Do not publish methods for literature search or level of evidence. Authors who will prepare review articles should already have published research articles on the relevant subject. The study’s new and important findings should be highlighted and interpreted in the Conclusion section. There should be a maximum of two authors for review articles. Images in Hematology Article length: Not to exceed 200 words. Authors can submit for consideration illustrations or photos that are interesting, instructive, and visually attractive, along with a few lines of explanatory text and references. Images in Hematology can include no more than 200 words of text, 5 references, and 3 figures or tables. No abstract, discussion, or conclusion is required, but please include a brief title. Letters to the Editor Article length: Not to exceed 500 words. Letters can include no more than 500 words of text, 5-10 references, and 1 figure or table. No abstract is required, but please include a brief title. Tables Supply each table in a separate file. Number tables according to the order in which they appear in the text, and supply a brief caption for each. Give each column a short or abbreviated heading. Write explanatory statistical measures of variation, such as standard deviation or standard error of mean. Be sure that each table is cited in the text. Figures Figures should be professionally drawn and/or photographed. Authors should number figures according to the order in which they appear in the text. Figures include graphs, charts, photographs, and illustrations. Each figure should be accompanied by a legend that does not exceed 50 words. Use abbreviations only if they have been introduced in the text. Authors are also required to provide the level of magnification for histological slides. Explain the internal scale and identify the staining method used. Figures should be submitted as separate files, not in the text file. Highresolution image files are not preferred for initial submission as the file sizes may be too large. The total file size of the PDF for peer review should not exceed 5 MB. Authorship Each author should have participated sufficiently in the work to assume public responsibility for the content. Any portion of a manuscript that is critical to its main conclusions must be the responsibility of at least one author. Contributor’s Statement All submissions should contain a contributor’s statement page. Each statement should contain substantial contributions to idea and design, acquisition of data, and analysis and interpretation of findings. All

A-VI

persons designated as an author should qualify for authorship, and all those that qualify should be listed. Each author should have participated sufficiently in the work to take responsibility for appropriate portions of the text. Acknowledgments Acknowledge support received from individuals, organizations, grants, corporations, and any other source. For work involving a biomedical product or potential product partially or wholly supported by corporate funding, a note stating, “This study was financially supported (in part) with funds provided by (company name) to (authors’ initials)”, must be included. Grant support, if received, needs to be stated and the specific granting institutions’ names and grant numbers provided when applicable. Authors are expected to disclose on the title page any commercial or other associations that might pose a conflict of interest in connection with the submitted manuscript. All funding sources that supported the work and the institutional and/or corporate affiliations of the authors should be acknowledged on the title page. Ethics When reporting experiments conducted with humans indicate that the procedures were in accordance with ethical standards set forth by the committee that oversees human subject research. Approval of research protocols by the relevant ethics committee, in accordance with international agreements (Helsinki Declaration of 1975, revised 2013 available at https://www.wma.net/policies-post/wma-declarationof-helsinki-ethical-principles-for-medical-research-involving-humansubjects/), is required for all experimental, clinical, and drug studies. Patient names, initials, and hospital identification numbers should not be used. Manuscripts reporting the results of experimental investigations conducted with humans must state that the study protocol received institutional review board approval and that the participants provided informed consent. Non-compliance with scientific accuracy is not in accord with scientific ethics. Plagiarism: To re-publish, in whole or in part, the contents of another author’s publication as one’s own without providing a reference. Fabrication: To publish data and findings/results that do not exist. Duplication: Use of data from another publication, which includes republishing a manuscript in different languages. Salami slicing: To create more than one publication by dividing the results of a study unnecessarily. We disapprove of such unethical practices as plagiarism, fabrication, duplication, and salami slicing, as well as efforts to influence the review process with such practices as gifting authorship, inappropriate acknowledgments, and references. Additionally, authors must respect participants‘ right to privacy. On the other hand, short abstracts published in congress books that do not exceed 400 words and present data of preliminary research, and

those that are presented in an electronic environment, are not considered as previously published work. Authors in such a situation must declare this status on the first page of the manuscript and in the cover letter. (The COPE flowchart is available at http://publicationethics.org.) We use iThenticate to screen all submissions for plagiarism before publication. Conditions of Publication All authors are required to affirm the following statements before their manuscript is considered: 1. The manuscript is being submitted only to The Turkish Journal of Hematology; 2. The manuscript will not be submitted elsewhere while under consideration by The Turkish Journal of Hematology; 3. The manuscript has not been published elsewhere, and should it be published in The Turkish Journal of Hematology it will not be published elsewhere without the permission of the editors (these restrictions do not apply to abstracts or to press reports for presentations at scientific meetings); 4. All authors are responsible for the manuscript’s content; 5. All authors participated in the study concept and design, analysis and interpretation of the data, and drafting or revising of the manuscript and have approved the manuscript as submitted. In addition, all authors are required to disclose any professional affiliation, financial agreement, or other involvement with any company whose product figures prominently in the submitted manuscript. Authors of accepted manuscripts will receive electronic page proofs and are responsible for proofreading and checking the entire article within two days. Failure to return the proof in two days will delay publication. If the authors cannot be reached by email or telephone within two weeks, the manuscript will be rejected and will not be published in the journal.

Copyright At the time of submission all authors will receive instructions for submitting an online copyright form. No manuscript will be considered for review until all authors have completed their copyright form. Please note, it is our practice not to accept copyright forms via fax, e-mail, or postal service unless there is a problem with the online author accounts that cannot be resolved. Every effort should be made to use the online copyright system. Corresponding authors can log in to the submission system at any time to check the status of any co-author’s copyright form. All accepted manuscripts become the permanent property of The Turkish Journal of Hematology and may not be published elsewhere, in whole or in part, without written permission.

An extensive list of conversion factors can be found at https://www. nist.gov/sites/default/files/documents/pml/wmd/metric/SP1038.pdf. For more details, see http://www.amamanualofstyle.com/oso/public/jama/ si_conversion_table.html.

Abbreviations and Symbols Use only standard abbreviations. Avoid abbreviations in the title and abstract. The full term for an abbreviation should precede its first use in the text, unless it is a standard abbreviation. All acronyms used in the text should be expanded at first mention, followed by the abbreviation in parentheses; thereafter the acronym only should appear in the text. Acronyms may be used in the abstract if they occur 3 or more times therein, but must be reintroduced in the body of the text. Generally, abbreviations should be limited to those defined in the AMA Manual of Style, current edition. A list of each abbreviation (and the corresponding full term) used in the manuscript must be provided on the title page.

Online Manuscript Submission Process The Turkish Journal of Hematology uses submission software powered by ScholarOne Manuscripts. The website for submissions to The Turkish Journal of Hematology is http://mc.manuscriptcentral.com/tjh. This system is quick and convenient, both for authors and reviewers.

Setting Up an Account New users to the submission site will need to register and enter their account details before they can submit a manuscript. Log in, or click the “Create Account” button if you are a first-time user. To create a new account: After clicking the “Create Account” button, enter your name and e-mail address, and then click the “Next” button. Your e-mail address is very important. Enter your institution and address information, as appropriate, and then click the “Next” Button. Enter a user ID and password of your choice, select your area of expertise, and then click the “Finish” button. If you have an account, but have forgotten your log-in details, go to “Password Help” on the journal’s online submission system and enter your e-mail address. The system will send you an automatic user ID and a new temporary password.

Units of Measurement

Full instructions and support are available on the site, and a user ID and password can be obtained during your first visit. Full support for authors is provided. Each page has a “Get Help Now” icon that connects directly to the online support system. Contact the journal administrator with any questions about submitting your manuscript to the journal (info@tjh.com.tr). For ScholarOne Manuscripts customer support, click on the “Get Help Now” link on the top right-hand corner of every page on the site.

Measurements should be reported using the metric system, according to the International System of Units (SI). Consult the SI Unit Conversion Guide, New England Journal of Medicine Books, 1992.

Log in to your author center. Once you have logged in, click the “Submit a Manuscript” link in the menu bar. Enter the appropriate data and answer

Note: We cannot accept any copyright form that has been altered, revised, amended, or otherwise changed. Our original copyright form must be used as is.

A-VII

The Electronic Submission Process

the questions. You may copy and paste directly from your manuscript. Click the “Next” button on each screen to save your work and advance to the next screen.

Upload Files Click on the “Browse” button and locate the file on your computer. Select the appropriate designation for each file in the drop-down menu next to the “Browse” button. When you have selected all the files you want to upload, click the “Upload Files” button. Review your submission before sending to the journal. Click the “Submit” button when you are finished reviewing. You can use ScholarOne Manuscripts at any time to check the status of your submission. The journal’s editorial office will inform you by e-mail once a decision has been made. After your manuscript has been submitted, a checklist will then be completed by the Editorial Assistant. The Editorial Assistant will check that the manuscript contains all required components and adheres to the author guidelines. Once the Editorial Assistant is satisfied with the manuscript it will be forwarded to the Senior Editor, who will assign an editor and reviewers.

The Review Processs Each manuscript submitted to The Turkish Journal of Hematology is subject to an initial review by the editorial office in order to determine if it is aligned with the journal’s aims and scope and complies with essential requirements. Manuscripts sent for peer review will be assigned to one of the journal’s associate editors that has expertise relevant to the manuscript’s content. All accepted manuscripts are sent to a statistical and English language editor before publishing. Once papers have been reviewed, the reviewers’ comments are sent to the Editor, who will then make a preliminary decision on the paper. At this stage, based on the feedback from reviewers, manuscripts can be accepted or rejected, or revisions can be recommended. Following initial peer-review, articles judged worthy of further consideration often require revision. Revised manuscripts generally must be received within 3 months of the date of the initial decision. Extensions must be requested from the Associate Editor at least 2 weeks before the 3-month revision deadline expires; The Turkish Journal of Hematology will reject manuscripts that are not received within the 3-month revision deadline. Manuscripts with extensive revision recommendations will be sent for further review (usually by the same reviewers) upon their re-submission. When a manuscript is finally accepted for publication, the Technical Editor undertakes a final edit and a marked-up copy will be e-mailed to the corresponding author for review and any final adjustments.

Submission of Revised Papers When revising a manuscript based on the reviewers’ and Editor’s feedback, please insert all changed text in red. Please do not use track changes, as

A-VIII

this feature can make reading difficult. To submit revised manuscripts, please log in to your author center at ScholarOne Manuscripts. Your manuscript will be stored under “Manuscripts with Decisions”. Please click on the “Create a Revision” link located to the right of the manuscript title. A revised manuscript number will be created for you; you will then need to click on the “Continue Submission” button. You will then be guided through a submission process very similar to that for new manuscripts. You will be able to amend any details you wish. At stage 6 (“File Upload”), please delete the file for your original manuscript and upload the revised version. Additionally, please upload an anonymous cover letter, preferably in table format, including a point-by-point response to the reviews’ revision recommendations. You will then need to review your paper as a PDF and click the “Submit” button. Your revised manuscript will have the same ID number as the original version, but with the addition of an R and a number at the end, for example, TJH-2011-0001 for an original and TJH-2011-0001.R1, indicating a first revision; subsequent revisions will end with R2, R3, and so on. Please do not submit a revised manuscript as a new paper, as revised manuscripts are processed differently. If you click on the “Create a Revision” button and receive a message stating that the revision option has expired, please contact the Editorial Assistant at info@tjh.com.tr to reactivate the option.

English Language and Statistical Editing All manuscripts are professionally edited by an English language editor prior to publication. After papers have been accepted for publication, manuscript files are forwarded to the statistical and English language editors before publishing. Editors will make changes to the manuscript to ensure it adheres to TJH requirements. Significant changes or concerns are referred to corresponding authors for editing.

Online Early The Turkish Journal of Hematology publishes abstracts of accepted manuscripts online in advance of their publication in print. Once an accepted manuscript has been edited, the authors have submitted any final corrections, and all changes have been incorporated, the manuscript will be published online. At that time the manuscript will receive a Digital Object Identifier (DOI) number. Both forms can be found at www.tjh. com.tr. Authors of accepted manuscripts will receive electronic page proofs directly from the printer and are responsible for proofreading and checking the entire manuscript, including tables, figures, and references. Page proofs must be returned within 48 hours to avoid delays in publication.

CONTENTS Review 1 Invasive Fungal Infections in Patients with Hematological Malignancies: Emergence of Resistant Pathogens and New Antifungal Therapies

Maria N. Gamaletsou, Thomas J. Walsh, Nikolaos V. Sipsas; Leeds, United Kingdom; New York, USA; Athens, Greece

Research Articles

A National Registry of Thalassemia in Turkey: Demographic and Disease Characteristics of Patients, Achievements, and Challenges in Prevention Yeşim Aydınok, Yeşim Oymak, Berna Atabay, Gönül Aydoğan, Akif Yeşilipek, Selma Ünal, Yurdanur Kılınç, Banu Oflaz, Mehmet Akın, Canan Vergin, Melike Sezgin Evim, Ümran Çalışkan, Şule Ünal, Ali Bay, Elif Kazancı, Talia İleri, Didem Atay, Türkan Patıroğlu, Selda Kahraman, Murat Söker, Mediha Akcan, Aydan Akdeniz, Mustafa Büyükavcı, Güçhan Alanoğlu, Özcan Bör, Nur Soyer, Nihal Özdemir Karadaş, Ezgi Uysalol, Meral Türker, Arzu Akçay, Süheyla Ocak, Adalet Meral Güneş, Hüseyin Tokgöz, Elif Ünal, Naci Tiftik, Zeynep Karakaş; Hemoglobinopathy Study Group, Turkey

Biological Features of Bone Marrow Mesenchymal Stromal Cells in Childhood Acute Lymphoblastic Leukemia Stella Genitsari, Eftichia Stiakaki, Chryssoula Perdikogianni, Georgia Martimianaki, Iordanis Pelagiadis, Margarita Pesmatzoglou, Maria Kalmanti, Helen Dimitriou; Crete, Athens, Greece

Juvenile Myelomonocytic Leukemia in Turkey: A Retrospective Analysis of Sixty-five Patients Özlem Tüfekçi, Ülker Koçak, Zühre Kaya, İdil Yenicesu, Canan Albayrak, Davut Albayrak, Şebnem Yılmaz Bengoa, Türkan Patıroğlu, Musa Karakükçü, Ekrem Ünal, Elif Ünal İnce, Talia İleri, Mehmet Ertem, Tiraje Celkan, Gül Nihal Özdemir, Nazan Sarper, Dilek Kaçar, Neşe Yaralı, Namık Yaşar Özbek, Alphan Küpesiz, Tuba Karapınar, Canan Vergin, Ümran Çalışkan, Hüseyin Tokgöz, Melike Sezgin Evim, Birol Baytan, Adalet Meral Güneş, Deniz Yılmaz Karapınar, Serap Karaman, Vedat Uygun, Gülsun Karasu, Mehmet Akif Yeşilipek, Ahmet Koç, Erol Erduran, Berna Atabay, Haldun Öniz, Hale Ören; İzmir, Ankara, Samsun, Kayseri, İstanbul, Kocaeli, Antalya, Konya, Bursa, Trabzon, Turkey

Transformation of Mycosis Fungoides/Sezary Syndrome: Clinical Characteristics and Prognosis Seçil Vural, Bengü Nisa Akay, Ayşenur Botsalı, Erden Atilla, Nehir Parlak, Aylin Okçu Heper, Hatice Şanlı; Ankara, Turkey

The Effect of Bone Marrow Mesenchymal Stem Cells on the Granulocytic Differentiation of HL-60 Cells Hossein Nikkhah, Elham Safarzadeh, Karim Shamsasenjan, Mehdi Yousefi, Parisa Lotfinejad, Mehdi Talebi, Mozhde Mohammadian, Farhoud Golafshan, Aliakbar Movassaghpour; Tabriz, Sari, Iran; Minnesota, USA

NPM1 Mutation Analysis in Acute Myeloid Leukemia: Comparison of Three Techniques - Sanger Sequencing, Pyrosequencing, and Real-Time Polymerase Chain Reaction Dushyant Kumar, Anurag Mehta, Manoj Kumar Panigrahi, Sukanta Nath, Kandarpa Kumar Saikia; Guwahati, New Delhi, India

Incomplete Antibodies May Reduce ABO Cross-Match Incompatibility: A Pilot Study Mehmet Özen, Soner Yılmaz, Tülin Özkan, Yeşim Özer, Aliye Aysel Pekel, Asuman Sunguroğlu, Günhan Gürman, Önder Arslan; Ankara, Turkey

Brief Reports

Impact of Fluorescent In Situ Hybridization Aberrations and CLLU1 Expression on the Prognosis of Chronic Lymphocytic Leukemia: Presentation of 156 Patients from Turkey Ümmet Abur, Gönül Oğur, Ömer Salih Akar, Engin Altundağ, Huri Sema Aymelek, Düzgün Özatlı, Mehmet Turgut; Samsun, Turkey Glomerular and Tubular Functions in Children and Adults with Transfusion-Dependent Thalassemia Agageldi Annayev, Zeynep Karakaş, Serap Karaman, Altan Yalçıner, Alev Yılmaz, Sevinç Emre; İstanbul, Turkey

A-IX

Images in Hematology Ascites in the Course of Plasma Cell Myeloma Complicated by AL Amyloidosis Jakub Debski, Lidia Usnarska-Zubkiewicz, Katarzyna Kapelko-Słowik, Aleksander Pawlus, Urszula Zaleska-Dorobisz, Kazimierz Kuliczkowski; Wroclaw, Poland

Pachymeningeal Involvement with Blindness as the Presenting Manifestation of Non-Hodgkin Lymphoma Charanpreet Singh, Arjun Lakshman, Aditya Jandial, Sudha Sharma, Ram Nampoothiri, Gaurav Prakash, Pankaj Malhotra; Chandigarh, India

Letters to the Editor

Cyclic Guanosine Monophosphate-Dependent Protein Kinase I Stimulators and Activators Are Therapeutic Alternatives for Sickle Cell Disease Mohankrishna Ghanta, Elango Panchanathan, Bhaskar VKS Lakkakula; Tamil Nadu, Chhattisgarh, India

Three Factor 11 Mutations Associated with Factor XI Deficiency in a Turkish Family Veysel Sabri Hançer, Zafer Gökgöz, Murat Büyükdoğan; İstanbul, Ankara, Turkey

Participation in Physical and Sportive Activities among Adult Turkish People with Hemophilia: A Single-Center Experience Arni Lehmeier, Muhlis Cem Ar, Sevil Sadri, Mehmet Yürüyen, Zafer Başlar; İstanbul, Turkey

A Lesser Known Side Effect of Tigecycline: Hypofibrinogenemia Fulya Yılmaz Duran, Halil Yıldırım, Emre Mehmet Şen; İzmir, Turkey

Effectiveness of Ankaferd BloodStopper in Prophylaxis and Treatment of Oral Mucositis in Childhood Cancers Evaluated with Plasma Citrulline Levels Türkan Patıroğlu, Nagihan Erdoğ Şahin, Ekrem Ünal, Mustafa Kendirci, Musa Karakükcü, Mehmet Akif Özdemir; Kayseri, Turkey

Late Side Effects of Chemotherapy and Radiotherapy in Early Childhood on the Teeth: Two Case Reports Sevcihan Günen Yılmaz, İbrahim Şevki Bayrakdar, Seval Bayrak, Yasin Yaşa; Antalya, Eskişehir, Bolu, Ordu, Turkey

t(9;19)(q22;p13) in Acute Myelomonocytic Leukemia Moeinadin Safavi, Akbar Safaei, Marzieh Hosseini; Tehran, Shiraz, Iran

Invasive Aspergillosis in Refractory Angioimmunoblastic T-Cell Lymphoma Prakash NP, Anoop TM, Rakul Nambiar, Jaisankar Puthusseri, Swapna B; Thiruvananthapuram, India

Expansion of a Myeloma-associated Lesion from Orbita to the Cerebrum Sinan Demircioğlu, Demet Aydoğdu, Özcan Çeneli; Konya, Turkey

Leukoagglutination, Mycoplasma pneumoniae Pneumonia, and EDTA Acid Blood Beuy Joob, Viroj Wiwanitkit; Bangkok, Thailand, Pune, India

A-X

Advisory Board of This Issue (March 2018) Ana Boban, Croatia Anıl Tombak, Turkey Antonis Kattamis, Greece Aysun Adan, Turkey Berna Ateşağaoğlu, Turkey Beyza Ener, Turkey Burhan Ferhanoğlu, Turkey Caroline Houillier, France Çiğdem Kader, Turkey Deniz Aksu Arıca, Turkey Elif Birtaş Ateşoğlu, Turkey Ergül Berber, Turkey Erol Erduran, Turkey Evgenios Goussetis, Greece Fahri Şahin, Turkey Fatih Demirkan, Turkey Fatma Çağlayan, Turkey

Feride İffet Şahin, Turkey Ferit Avcu, Turkey Gabriela Tanasie, Romania Gülderen Yanıkkaya Demirel, Turkey Hakan Özdoğu, Turkey Hamdi Akan, Turkey Hüseyin Gülen, Turkey Klara Dalva, Turkey Mahmut Bayık, Turkey Mahmut Töbü, Turkey Mehmet Ertem, Turkey Mehmet Özen, Turkey Meral Beksaç, Turkey Meryem Albayrak, Turkey Michael Mitchell, United Kingdom Mutlu Arat, Turkey Müge Sayitoğlu, Turkey

Nil Güler, Turkey Nurdan Taçyıldız, Turkey Olga Meltem Akay, Turkey Priya Vadhana, India Rajive Kumar, India Rein Willemze, The Netherlands Reyhan Küçükkaya, Turkey Sema Anak, Turkey Serena Valsami, Greece Şebnem Yılmaz Bengoa, Turkey Şule Ünal, Turkey Vasilios Berdoukas, China Yaghoub Yazdani, Iran Zehra Çoban, Turkey Zühre Kaya, Turkey

REVIEW DOI: 10.4274/tjh.2018.0007 Turk J Hematol 2018;35:1-11

Invasive Fungal Infections in Patients with Hematological Malignancies: Emergence of Resistant Pathogens and New Antifungal Therapies Hematolojik Kanserleri Olan İnvaziv Mantar Enfeksiyonlu Hastalar: Dirençli Patojenlerin Ortaya Çıkışı ve Yeni Antifungal Tedaviler Maria N. Gamaletsou1, Thomas J. Walsh2,

Nikolaos V. Sipsas3

The Leeds Teaching Hospitals NHS Trust, St James University Hospital, Department of Infection and Travel Medicine, Leeds, United Kingdom Weill Cornell Medicine of Cornell University, Department of Medicine, Pediatrics, and Microbiology and Immunology, New York, United States of America 3 National and Kapodistrian University of Athens Faculty of Medicine, Department of Pathophysiology, Athens, Greece 1 2

Abstract

Öz

Invasive fungal infections caused by drug-resistant organisms are an emerging threat to heavily immunosuppressed patients with hematological malignancies. Modern early antifungal treatment strategies, such as prophylaxis and empirical and preemptive therapy, result in long-term exposure to antifungal agents, which is a major driving force for the development of resistance. The extended use of central venous catheters, the nonlinear pharmacokinetics of certain antifungal agents, neutropenia, other forms of intense immunosuppression, and drug toxicities are other contributing factors. The widespread use of agricultural and industrial fungicides with similar chemical structures and mechanisms of action has resulted in the development of environmental reservoirs for some drug-resistant fungi, especially azole-resistant Aspergillus species, which have been reported from four continents. The majority of resistant strains have the mutation TR34/L98H, a finding suggesting that the source of resistance is the environment. The global emergence of new fungal pathogens with inherent resistance, such as Candida auris, is a new public health threat. The most common mechanism of antifungal drug resistance is the induction of efflux pumps, which decrease intracellular drug concentrations. Overexpression, depletion, and alteration of the drug target are other mechanisms of resistance. Mutations in the ERG11 gene alter the protein structure of C-demethylase, reducing the efficacy of antifungal triazoles. Candida species become echinocandin-resistant by mutations in FKS genes. A shift in the epidemiology of Candida towards resistant non-albicans Candida spp. has emerged among patients with hematological malignancies. There is no definite association between antifungal resistance, as defined by elevated minimum inhibitory concentrations, and clinical outcomes in

İlaca dirençli organizmaların neden olduğu invaziv mantar enfeksiyonları, ağır immün baskılanma altındaki hematolojik kanserli hastalar için bir tehdittir. Profilaktik, Öz ampirik ve önleyici tedaviler gibi güncel anti-fungal tedavi yaklaşımları, direnç gelişiminde büyük bir itici güç olan anti-fungal ajanlara uzun süreli maruz kalma ile sonuçlanmaktadır. Santral venöz kateterlerin uzun süreli kullanımı, bazı anti-fungal ajanların doğrusal olmayan farmakokinetiği, nötropeni, yoğun immün baskılamanın farklı formları ve ilaç toksisitesi direnç gelişimine katkıda bulunan diğer faktörlerdir. Benzer kimyasal yapılara ve etki mekanizmalarına sahip, tarımsal ve endüstriyel fungisitlerin yaygın kullanımı, dört kıtadan bildirilen bazı ilaca dirençli mantarlar, özellikle azole dayanıklı Aspergillus türleri için çevresel kaynakların gelişmesine neden olmaktadır. Dirençli suşların çoğunda bulunan TR34 / L98H mutasyonu, direncin çevresel kaynaklı olduğunu düşündürmektedir. Candida auris gibi doğal dirençli yeni fungal patojenlerin ortaya çıkması, yeni bir halk sağlığı tehdididir. Anti-fungal ilaç direncinin en yaygın mekanizması, hücre içi ilaç konsantrasyonlarını azaltan hücre dışına atım pompalarının uyarılmasıdır. Diğer direnç mekanizmaları arasında ilaç hedefinin aşırı ekspresyonu, tükenmesi ya da değişmesi bulunmaktadır. ERG11 genindeki mutasyonlar, antif-fungal triazollerin etkinliğini azaltarak C-demetilazın protein yapısını değiştirir. Candida türleri, FKS genlerindeki mutasyonlarla ekinokandine dirençli hale gelir. Candida epidemiyolojisinde dirençli olmayan albicans Candida spp. hematolojik kanseri olan hastalar arasında ön plana çıkmaktadır. Bu popülasyondaki hasta grubunda artmış minimum inhibitör konsantrasyonlarla tanımlanan antifungal direnç ile klinik sonuçlar arasında kesin bir ilişki yoktur. Moleküler yöntemlerin kullanımı ile dirence neden olan genlerin veya

Address for Correspondence/Yazışma Adresi: Maria N. GAMALETSOU, M.D., Received/Geliş tarihi: January 04, 2018 The Leeds Teaching Hospitals NHS Trust, St James University Hospital, Department of Infection and Travel Medicine, Leeds, United Kingdom Accepted/Kabul tarihi: January 22, 2018 Phone : +44 1132 066 083 E-mail : magama@med.uoa.gr ORCID-ID: orcid.org/0000-0002-0530-3209

Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections

this population. Detection of genes or mutations conferring resistance with the use of molecular methods may offer better predictive values in certain cases. Treatment options for resistant fungal infections are limited and new drugs with novel mechanisms of actions are needed. Prevention of resistance through antifungal stewardship programs is of paramount importance. Keywords: Invasive fungal infections, Antifungal resistance, Hematological malignancies, New antifungal agents

Introduction Invasive fungal infections (IFIs) are associated with increased morbidity and unacceptably high mortality among patients with hematological malignancies (HMs) [1,2]. However, treatment options are limited, including only four chemical classes: polyenes, triazoles, echinocandins, and flucytosine. The expansion of the use of antifungal agents over the last two decades not unexpectedly contributed to the development of antifungal resistance [3,4,5]. Another factor driving the emergence of resistance is the widespread use of agricultural and industrial fungicides with chemical structures and mechanisms of action similar to those of human antifungal agents, resulting in the development of environmental reservoirs for some drugresistant fungi, especially triazole-resistant Aspergillus species [6,7]. Recently, researchers showed that even the household environment may serve as a potential source of triazoleresistant invasive aspergillosis [8].

Turk J Hematol 2018;35:1-11

mutasyonların saptanması, bazı olgularda daha iyi klinik ön görü sağlayabilir. Dirençli fungal enfeksiyonlara yönelik tedavi seçenekleri sınırlıdır ve yeni mekanizmalara sahip ilaçlara ihtiyaç duyulmaktadır. Anti-fungal idame programlarıyla direncin önlenmesi büyük önem taşır. Anahtar Sözcükler: İnvazif mantar enfeksiyonları, Anti-fungal direnç, Hematolojik kanserler, Yeni anti-fungal ajanlar

surfaces are often infected by pathogenic fungi and the ensuing biofilm formation does not allow drug penetration, thus rendering the infection refractory to treatment [16,17,18,19]. Nonlinear pharmacokinetics of certain antifungal agents, especially certain triazoles, may result in suboptimal antifungal drug levels, favoring the development of resistance [20,21]. Intraabdominal fungal infections in patients with HMs, such as intraabdominal abscesses, can promote drug resistance because antifungal drug delivery in the abdomen is poor and fungi are exposed to possibly subtherapeutic drug concentrations [22]. The emergence of antifungal drug resistance has tremendous clinical implications, as it further restricts the already limited antifungal armamentarium, raising concerns among clinicians that we are close to the “post-antifungal” era, in parallel to the “post-antibiotic” era [4,10]. The outlook is similarly grim, as there is a paucity of new antifungal agents with novel mechanisms of action in development [23].

Antifungal resistance can be either intrinsic or acquired (Table 1) [9,10,11]. Intrinsic drug resistance can occur naturally among certain fungi without previous exposure to antifungal agents, such as fluconazole-resistant Candida krusei [9,12]. The emergence of new fungal species with intrinsic resistance to some or all antifungal agents is a new threat. The recent outbreaks of multidrug-resistant Candida auris [13] in many hematology centers around the world and the increasing reports of infections caused by panresistant Lomentospora prolificans [14,15] are characteristic examples.

The focus of this review will be the emergence of fungal infections with innate or acquired resistance to antifungal agents among patients with HMs. We will visit the many different facets of this complex area, including mechanisms of resistance, epidemiology, clinical implications, and current treatment options. Finally, we will review new antifungal agents in development and the priorities for future research in the field.

Acquired or iatrogenic antifungal resistance is favored by specific risk factors in patients with HMs. Modern early treatment strategies, such as prophylaxis and empirical and preemptive therapy, result in long-term exposure to antifungal agents, which is a major driving force for the development of resistance [5]. Repeated cycles of chemotherapy and/or hematopoietic stem cell transplantation (HSCT) prolong even more the exposure to antifungal agents. Chemotherapyinduced neutropenia limits the pharmacodynamic response to antifungal agents and dictates prolonged therapeutic courses. Indwelling catheters, especially central venous catheters (CVCs), are a major factor for the development of resistance, as their

Triazole-Resistant Aspergillus spp.: Triazoles with activity against Aspergillus spp. (i.e. itraconazole, voriconazole, posaconazole, and isavuconazole) are recommended for the treatment of invasive aspergillosis among patients with HMs. Antifungal triazoles act by inhibiting the cytochrome P450 enzyme sterol 14α-demethylase, which converts lanosterol to ergosterol, and is encoded by the gene CYP51 in filamentous fungi. Inhibition of 14α-demethylase by an azole results in the interruption of biosynthesis of ergosterol, which is fungicidal for molds, as it leads to intracellular accumulation of toxic 14α-methyl sterols and to alterations in cell membrane structure, impairing its permeability and stability and thus the

Antifungal-Resistant Invasive Aspergillosis Mechanisms of Resistance

Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections

Turk J Hematol 2018;35:1-11

Table 1. Inherited and acquired resistance reported among pathogenic fungi infecting patients with hematological malignancies. Fungus

Inherent resistance

Acquired resistance

Yeasts

Candida spp. C. albicans C. parapsilosis C. tropicalis C. glabrata C. krusei C. lusitaniae C. guilliermondii C. auris Non-Candida yeasts Trichosporon spp. Saccharomyces Malassezia spp. Geotrichum Rhodotorula Pichia

None Echinocandins (?) None Triazoles Triazoles Amphotericin B Fluconazole, echinocandins Azoles, amphotericin B

Fluconazole, echinocandins Fluconazole Fluconazole, echinocandins Echinocandins Echinocandins Fluconazole, echinocandins

Echinocandins amphotericin B None Echinocandins Echinocandins Triazoles Fluconazole

Fluconazole

Echinocandins

Fluconazole

Molds Aspergillus spp. A. fumigatus A. terreus A. flavus A. nidulans

Fluconazole Fluconazole, amphotericin B Fluconazole, amphotericin B Fluconazole, amphotericin B

Mucorales

Fluconazole, voriconazole

Hyalohyphomycetes Fusarium solani Scedosporium spp. Lomentospora prolificans

Echinocandins and variably resistant to amphotericin B and triazoles Panresistant*

Voriconazole, isavuconazole Voriconazole, isavuconazole Voriconazole, isavuconazole Voriconazole, isavuconazole

*Panresistant: Consistently resistant to all 4 major classes of systemic antifungal agents: triazoles, polyenes, echinocandins, and fluoropyrimidines.

viability of the fungus. Mutations in the CYP51A fungal gene alter the structure of the 14α-demethylase, leading to reduced azole binding and thus generating triazole-resistant phenotypes [24,25]. The two most common alterations in CYP51A offering resistance to triazoles are tandem repeats in the promoter region of the gene along with gene mutations and point mutations [5]. There are also other non-CYP51 mechanisms associated with azole resistance [24]. The most frequently identified mechanism of triazole resistance in Aspergillus fumigatus involves a 34-bp tandem repeat (TR34) in the promoter region of the CYP51A gene combined with a substitution of leucine 98 to histidine (TR34/L98H). These alterations cause overexpression of the gene [25,26]. Another mechanism of resistance involves a 46-bp tandem repeat in the CYP51A promoter region combined with two substitutions: tyrosine 121 for phenylalanine and threonine 289 for alanine (TR46/Y121F/T289A) [27]. This modification of the CYP51A gene makes Aspergillus fumigatus resistant to voriconazole [28].

Finally, a 53-bp tandem repeat in the promoter region of the CYP51A gene without any other substitution conferring azole resistance has been detected in environmental [29] and clinical triazole-resistant Aspergillus fumigatus strains [30]. Another mechanism of triazole resistance for Aspergillus spp. is nonsynonymous hot-spot mutations in the CYP51A gene. Numerous amino acid substitutions associated with reduced susceptibility for triazoles have been reported [2 4,31,32,33,34,35,36,37,38,39,40]. Recently, many azoleresistant Aspergillus isolates were found not to have point mutations in CYP51A or promoter duplications, suggesting that alternative mechanisms for azole resistance exist [40,41]. Researchers reported that 43% of 64 azoleresistant Aspergillus isolates did not carry a CYP51A mutation, indicating that other mechanisms must be responsible [42]. Potential mechanisms conferring resistance include activation of efflux pumps [43]; overexpression of transporter genes [44]; loss of the algA gene [45]; the point mutation P88L in HapE, an 3

Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections

important transcription factor [46]; biofilm formation [43,47]; and cholesterol import by Aspergillus fumigatus to overcome ergosterol deprivation [48]. Cryptic Aspergillus spp. may be resistant to voriconazole. For example, Aspergillus calidoustus typically has elevated minimum inhibitory concentrations (MICs) for voriconazole that exceed CLSI and EUCAST interpretive breakpoints. Aspergillus lentulus, which may phenotypically resemble a slowly growing Aspergillus fumigatus, may also have elevated MICs for voriconazole [24]. Polyene-Resistant Aspergillus spp.: Polyene antifungal agents bind to ergosterol on the cell membrane of the fungus and cause formation of intramembrane channels that kill the cell. Amphotericin B is a first-line treatment for invasive aspergillosis in patients with HMs. Although it has been used since 1957, emergence of resistance is usually not an issue and typically involves selection of inherently resistant strains. Development of acquired resistance during therapy is rare [5]. The most common amphotericin B-resistant species include Aspergillus terreus, Aspergillus flavus, Aspergillus nidulans, Aspergillus calidoustus, and Aspergillus lentulus [49,50,51]. The main mechanism of resistance is believed to be the modification of the cell membrane, by diminishing its ergosterol content [51].

Turk J Hematol 2018;35:1-11

been reported in 11 countries, although the prevalence ranged widely, from 0% to 26%, among the participating centers and even among centers from the same country. The overall triazole resistance prevalence was 3.2% [25]. To date, triazole-resistant clinical isolates of Aspergillus fumigatus have been reported in the majority of European counties [24], as well as Turkey [56]. Most reports of triazole-resistant Aspergillus spp. have originated from Europe, but recently researchers from four continents reported increasing numbers of infections caused by resistant Aspergillus strains [34,57,58,59,60,61], suggesting that azole resistance is a global threat.

Clinical Significance

Researchers have found that previous treatment with triazoles also may reduce the amount of membrane ergosterol in Candida spp. resistant to amphotericin B [52]. Reduction of membrane ergosterol renders Cryptococcus neoformans less susceptible to amphotericin B [53]. Whether this mechanism also confers polyene resistance to Aspergillus spp. is uncertain.

Data on the clinical significance of triazole resistance are limited and contradictory. In vitro studies have shown that the presence of triazole resistance mechanisms is associated with reduced susceptibility of Aspergillus fumigatus to all azoles [62], including the recently licensed isavuconazole [63,64,65]. Several studies have shown that triazole resistance is associated with treatment failure, especially among patients with HMs [24,28,29,36,39]. In a study from India, invasive aspergillosis caused by a resistant isolate was associated with a significantly higher mortality rate (88%) compared with that of aspergillosis caused by wild-type isolates (30%-50%) [66]. On the contrary, in a retrospective study from the United States, higher azole MICs were not correlated with outcome of aspergillosis in patients with HMs or HSCT recipients [67]. Clearly, more data are needed to delineate the clinical significance of triazole resistance in Aspergillus spp.

Epidemiology

Treatment

Triazole-resistant Aspergillus fumigatus has been described in the Netherlands since 1999, with an estimated prevalence of 6.0%-12.8% of patients with invasive aspergillosis [6]. In 2007, infections caused by triazoleresistant Aspergillus fumigatus were reported in hematology patients from six different hospitals in the Netherlands [25]. One year later, another Dutch hospital noted that 28.1% of 32 patients with invasive aspergillosis had an azole-resistant isolate of Aspergillus fumigatus [54]. The predominant mechanism of resistance of clinical isolates from patients in different hospitals was TR34/L98H, a finding suggesting that the source of resistance was the environment [54,55]. Subsequent studies from the Netherlands [55] and the United Kingdom [56] showed that, from 1994 to 2009, the incidence of triazole-resistant aspergillosis rapidly increased to 20%. Recently, a prospective study on the prevalence and the mechanisms of azole-resistance was conducted among 22 centers in 19 European countries [25]. Triazole-resistant Aspergillus fumigatus isolates have

Due to the low worldwide prevalence of azole-resistant aspergillosis, there are no clinical studies on its treatment. In 2015, an expert panel published an opinion paper on how to treat azole-resistant aspergillosis [68]. They suggested that in areas with high (>10%) environmental resistance, first-line therapy should be liposomal amphotericin B or a combination of voriconazole and an echinocandin. These suggestions require meticulous surveillance studies to define areas of high resistance; such studies are not always feasible.

Antifungal-Resistant Invasive Candidiasis Mechanisms of Resistance Triazole-Resistant Candida spp.: Antifungal azoles act by inhibiting the enzyme sterol 14α-demethylase, resulting in the interruption of biosynthesis of ergosterol, which is an essential Candida cell membrane component. The inhibition of ergosterol synthesis may be fungicidal for molds, but

Turk J Hematol 2018;35:1-11

only fungistatic for yeasts. Several mechanisms confer azole resistance to Candida spp. [18]. The most common mechanism is the induction of efflux pumps, which decrease the intracellular drug concentration. Efflux pumps are encoded by various genes belonging to the ATP-binding cassette superfamily or to the major facilitator superfamily [69]. The transcription of these genes is regulated by transcription factors, such as Tac1 and Mrr1 for Candida albicans and CgPdr1 for Candida glabrata [69]. Overexpression or alteration of the drug target, 14α-demethylase, is another mechanism of resistance. Numerous point mutations in the ERG11 gene, usually after exposure to fluconazole, can generate structural changes in the active site of the demethylase, causing reduced target affinity and thus triazole resistance [70]. Overexpression of ERG11 [71] and loss of function of the sterol Δ5,6-desaturase gene (ERG3) [72] also confer azole resistance. Loss of function of the sterol Δ5,6-desaturase gene in Candida glabrata may also result in resistance to amphotericin B. These mechanisms can occur either alone or concurrently in a single isolate and may lead to cross-resistance to many azoles. Echinocandin-Resistant Candida spp.: The mechanism of action of the echinocandins is inhibition of (1,3)-β-D-glucan synthesis [73]. Beta-D-glucans are cross-linked to chitin and mannoproteins, providing structural integrity to cell walls of various fungi. Echinocandins are fungicidal for Candida spp., as β-D-glucan accounts for approximately 30%-60% of the cell wall mass in Candida species [73]. Conversely, among filamentous fungi, echinocandins have only fungistatic effects, as the cell wall contains less glucan, concentrated at the apical tips and branching points of hyphae. Echinocandins exert their antifungal activity by binding to the enzyme FKS, which catalyzes the synthesis of (1,3)-β-D-glucans. Glucan synthase has two catalytic subunits, FKS1 and FKS2, encoded by their respective FKS genes. Candida species become echinocandin-resistant by genetic acquisition of mutations in FKS genes, which encode amino acid substitutions in two narrow hot-spot regions of FKS1 for all Candida species and FKS2 for C. glabrata [74]. The most common (>90%) FKS1 substitutions among echinocandin-resistant Candida albicans isolates occur at Ser-641 or Ser-645 [74]. In Candida glabrata, the most common amino acid substitutions occur in FKS2 [75]. Resistance to two or more classes of antifungal agents further augments the threat of Candida glabrata in patients with HMs. Candida glabrata bloodstream isolates from patients with HMs developed cross-resistance to both triazoles and echinocandins [76]. While the molecular events leading to triazole and echinocandin resistance may occur independently, one potential unifying mechanism is the development of DNA

Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections

mismatch-repair gene mutations, which lead to “hypermutable” clinical strains [12]. Polyene-Resistant Candida spp.: Candida species with acquired resistance to polyenes are uncommon, although researchers have reported cases of Candida albicans, Candida krusei, Candida glabrata, Candida tropicalis, Candida rugosa, Candida lusitaniae, and Candida guilliermondii with high MICs to amphotericin B [5,18]. The main mechanism of resistance involves a reduction in cell membrane ergosterol, which is the biological target of amphotericin B. Reduction of ergosterol can be caused by previous treatment with triazoles, which lowers membrane sterol concentrations, or mutations affecting sterol biosynthesis, such as defects in ERG1, ERG2, ERG3, ERG4, ERG6, and ERG11 [18,77]. Biofilm Formation and Candida Resistance: Biofilm formation on artificial devices, especially CVCs, is an essential factor driving the development of drug-resistant Candida spp. in patients with HMs. Antifungal drugs do not achieve therapeutic levels within the biofilm because they are trapped in a glucan-rich matrix polymer. The hypoxic environment within biofilms results in a metabolic stress response that leads to increased MICs to triazoles. Moreover, once the Candida strain is embedded in the biofilm, it may not need to be resistant in order to grow despite adequate antifungal treatment and may cause breakthrough candidemia [19]. Epidemiology Antifungal drug resistance has emerged through the development of acquired resistance and an epidemiological shift in the distribution of Candida species towards inherently less susceptible non-albicans species [16]. In large-scale surveillance studies of bloodstream isolates, the overall prevalence of Candida albicans resistance is less than 1% [78]. Resistance rates are higher among non-albicans Candida species, notably Candida glabrata, reaching 2%-4% in most epidemiological prevalence studies [79]. A trend towards increasing rates of Candida glabrata resistance has been noted, as the proportion of nonsusceptible isolates increased from 4.2% in 2008 to 7.8% in 2014 [80], while some institutions reported resistance rates close to 10% [75]. In hematology patients, a rise in Candida glabrata with echinocandin and azole resistance and crossresistance to two or more antifungal classes (multidrug resistance) has been reported, mainly in the United States, but not in Europe [81]. In a European study of candidemia among hematology patients, in vitro resistance to at least one antifungal agent was observed for 27% of Candida isolates [17]. The problem of antifungal-resistant yeast infections has been aggravated by recent epidemiological changes. A shift in 5

Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections

the distribution of candidemia-associated Candida species towards more resistant non-albicans species, such as Candida parapsilosis, Candida tropicalis, Candida glabrata, and Candida krusei, has been reported among patients with HMs in both the United States and Europe [16,17]. In addition, the recent emergence of Candida auris, an uncommon species that exhibits both multidrug resistance and strong potential for nosocomial transmission, raises concerns worldwide [82]. Cases and hospital outbreaks of Candida auris invasive infections have been reported from four continents, mainly among patients with HMs, with high mortality [82,83]. Clinical Significance There are no clinical studies showing a definite association between in vitro susceptibility testing and outcomes of invasive candidiasis in neutropenic patients [4,18,19], with the exception of Candida glabrata, where clinical studies demonstrated that infection with an echinocandin-resistant strain was associated with worse outcomes [9,75]. Clinical failure was associated with the presence of the FKS mutation and not MIC values [9]. Finally, the recent epidemiological shift of Candida species distribution towards non-albicans species in patients with HMs [16] has an impact on outcomes as many non-albicans species, especially Candida glabrata and Candida krusei, exhibit higher resistance rates and higher mortality [16,17]. Treatment There are no clinical studies on the optimal initial treatment of patients with or at risk for antifungal-resistant invasive Candida infections. Current guidelines for treatment of candidiasis recommend lipid formulation of amphotericin B (3-5 mg/kg daily) for patients with suspected azoleand echinocandin-resistant Candida infections [84]. This recommendation is characterized as “strong” but is based on “low-quality evidence”. Regarding the emerging problem of multidrug-resistant Candida glabrata infection, there are no good clinical data on the optimal treatment. The best strategy for the initial treatment of suspected or documented resistant Candida infection is to be tailored according to individual risk factors and the local epidemiology [18]. Antifungal Resistance in Fungal Infections Caused by Rare Molds and Non-Candida, Non-Cryptococcus Yeasts The frequency of invasive fungal disease caused by resistant filamentous fungi other than Aspergillus is increasing. The majority of these rare molds are Mucorales, hyalohyphomycetes (Fusarium spp., Scedosporium spp.), and dematiaceous fungi and they occur mainly in heavily immunosuppressed patients with HMs [85]. The TRANSNET study reported that among 983 IFIs identified in 875 HSCT recipients, 8% were mucormycosis and 14% of infections were caused by other filamentous fungi 6

Turk J Hematol 2018;35:1-11

[86]. The intrinsic resistance of many of these rare fungi to antifungal agents is of concern. Mucorales species are resistant to some triazoles, while multidrug resistance has been reported for Fusarium spp., Scedosporium spp., and dematiaceous fungi. Although Candida infections comprise the vast majority of yeasts growing in blood cultures, clinicians should be aware that a substantial proportion of fungemia cases are caused by non-Candida, non-Cryptococcus yeasts [87], such as Trichosporon asahii, Magnusiomyces (Blastoschizomyces) capitatus, Saccharomyces cerevisiae, Malassezia spp., Saprochaete (Geotrichum) spp., and Rhodotorula spp. The majority of these rare yeasts are intrinsically resistant to one or more classes of antifungal agents, and infections occur frequently as breakthrough infections in hematology patients receiving antifungals and with a CVC in place [87,88]. For instance, Trichosporon spp. are resistant to echinocandins and to the fungicidal activity of polyenes, while Rhodotorula spp. are resistant to the triazoles [18]. In vitro susceptibility testing is not always useful in patients with infections caused by less frequent opportunistic yeast or mold infections. In these patients, breakpoints are not based on data derived from clinical responses or outcomes but only from epidemiological cut-off values and pharmacokinetic and pharmacodynamic data from animal models [89]. Diagnostic Tests for the Detection of Fungal Resistance Isolation of the infecting fungus through conventional culture of biological fluids and tissues, identification to the species level, and in vitro testing to determine the susceptibility to antifungal agents is the current standard for the diagnosis of IFIs caused by resistant fungi and for decision making [90]. Species identification is time-consuming, prompting physicians to initiate empirical treatment until the results become available. Newer methods, including MALDI-TOF mass spectroscopy and T2 magnetic resonance assay, allow rapid species identification with excellent sensitivity and specificity [90,91]. Antifungal susceptibility testing is recommended for the triazoles against all bloodstream Candida isolates and for the echinocandins against resistant species, such as Candida glabrata and Candida parapsilosis isolates [84]. As mentioned previously, clinical breakpoints are only available for certain species of fungi and are not useful for the diagnosis of resistance, as they do not always correlate with clinical outcomes, especially in patients with HMs [18,19,90]. Thus, a low MIC value does not necessarily predict successful treatment and an elevated MIC does not automatically predict treatment failure. Currently, only polymerase chain reaction (PCR) has the potential for early detection of resistance [92]. Even PCR, though, has its drawbacks, such as low sensitivity for detection of resistance markers and difficulty in differentiating colonization from

Turk J Hematol 2018;35:1-11

invasive infection or a living from a dead organism [93]. Therefore, clinicians should be cautious as to how to interpret these non-culture-based diagnostic tests in everyday clinical practice and for decision making. New molecular detection methods, including HRMA/PCR, microarrays, and metagenomic shotgun sequencing, are under development and hold promise for the future [92]. New Antifungal Agents for Resistant Fungi IFIs caused by drug-resistant organisms are an emerging threat to heavily immunosuppressed patients with HMs. Therefore, there is an urgent need for new antifungals with activity against resistant fungi. It should be underlined, though, that fungi are eukaryotes, just like human cells; thus, discovering new antifungal agents not interfering with human cells is challenging. Recent developments in fungal functional genomics, proteomics, and gene mapping allowed the discovery of potential new drug targets that could offer additional options to treat resistant fungal infections [94]. Cellular and biochemical targets of investigational agents against drug-resistant fungal pathogens include metabolic pathways (such as the glyoxylate cycle, iron metabolism, and heme biosynthesis), cell wall and cell membrane components, signal transduction pathways (such as MAP kinase), and gene expression. However, there is a paucity of novel antifungal compounds in preclinical or clinical development, as the majority of these new antifungal agents are in the very early stages of development. SCY-078 is the first orally bioavailable inhibitor of (1,3)-β-Dglucan synthesis of the fungal cell wall. A triterpene derivative, SCY-078 has demonstrated in vitro and in vivo activity against all tested Candida spp., including Candida auris, as well as triazole-resistant and echinocandin-resistant Candida spp. [94]. Its spectrum includes Aspergillus spp., where it may be particularly effective in combination with anti-mold triazoles. E1210 is a novel isoxazolyl-bis-pyridine wall-active antifungal compound that inhibits inositol acylation of mannosylated cell wall proteins, resulting in arrest of fungal growth [94]. The antifungal spectrum includes most yeast with the exception of Candida krusei and molds, including isolates resistant to triazoles and polyenes. Biafungin (CD101) is a novel, long-acting, semisynthetic echinocandin derivative of anidulafungin that is currently in phase III clinical studies. In vitro susceptibility testing showed that biafungin has activity against caspofungin-resistant Candida strains containing FKS mutations [95]. Other antifungal agents under development include F901318 (dihydroorotate dehydrogenase inhibitor), VT-1598 (metalloenzyme inhibitors of CYP51), and ASP2397 (hydroxamate siderophores-like agent) [94].

Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections

Future Research Directions in Fungal Resistance Invasive infections caused by resistant fungi are emerging global problems of public health, associated with increased morbidity and mortality, particularly among patients with HMs. There are unanswered questions and unmet needs in all areas of knowledge of fungal resistance, including epidemiology, diagnostics, therapeutics, prevention, and education, that require expertise from many different disciplines to be addressed [96]. The emerging epidemiological data raise intriguing questions: why is the prevalence of azole resistance in Aspergillus so variable? The frequency of resistance may vary considerably, not only between continents and countries but also between hospitals within the same country, between departments, or between risk groups within the same hospital [97,98,99]. Is this under- or overreporting, suboptimal sampling, and/or technical issues in Aspergillus fumigatus isolation and resistance detection? Alternatively, are there any geoclimatic factors that create ecological niches favoring the spread of resistance? Obviously, general surveillance studies are not sufficient to capture the problem. In the future, meticulous well-funded epidemiological studies targeted to specific high-risk groups, especially patients with HMs, are necessary. Development and implementation of laboratory diagnostic tools should be a priority for future research in the field of resistant fungal infections, as current technology does not allow rapid species identification and assessment of resistance. Development of interpretive breakpoints for fungal infections in neutropenic patients with HMs is an unmet need. New molecular technologies for the prompt and accurate detection of genes and mutations associated with fungal resistance are urgently needed. The existing antifungal agents are not sufficient to confront the growing trend of resistance. The limited antifungal armamentarium should be enriched with agents with novel mechanisms of action to overcome resistance. A fascinating direction for future research is the development of new antifungal agents that do not kill or inhibit the growth of fungi but impair key virulence properties, such as invasion or adherence. Prevention of fungal resistance should be at the core of future research. Antifungal stewardship programs should ensure that there is an indication for antifungal therapy, that the appropriate antifungal agent is selected, and that the dosage, route of administration, and duration are optimal and that deescalation is implemented when feasible. A robust antifungal stewardship program might have beneficial effects on the prevention of resistance. Understanding the pathophysiology 7

Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections

of biofilm formation and reducing the use of CVCs might also prevent the development of catheter-related resistant fungal infections. Authorship Contributions Concept: M.N.G.; Design: M.N.G., T.J.W., N.V.S.; Data Collection or Processing: M.N.G.; Analysis or Interpretation: M.N.G., T.J.W., N.V.S.; Literature Search: M.N.G.; Writing: M.N.G., T.J.W., N.V.S. Conflict of Interest: MNG reports no conflict of interest for this specific work; TJW reports receiving research grants for experimental and clinical antifungal pharmacotherapeutics from Astellas, Novartis, Merck, and Pfizer; he has served as a consultant to Astellas, Drais, iCo, Novartis, Pfizer, Methylgene, and Sigma-Tau. NVS reports receiving consulting fees, grant support, lecture fees, and honoraria from Astellas Greece, Gilead Greece, MSD Greece, and Pfizer Greece. Financial Disclosure: This work was supported by the Special Account for Research Grants (ELKE) of the National and Kapodistrian University of Athens (grant number 70/3/11724) and by a grant from the Save Our Sick Kids Foundation (http:// soskidsfoundation.org).

References 1. Sipsas NV, Bodey GP, Kontoyiannis DP. Perspectives for the management of febrile neutropenic patients with cancer in the 21st century. Cancer 2005;103:1103-1113. 2. Neofytos D, Horn D, Anaissie E, Steinbach W, Olyaei A, Fishman J, Pfaller M, Chang C, Webster K, Marr K. Epidemiology and outcome of invasive fungal infection in adult hematopoietic stem cell transplant recipients: analysis of Multicenter Prospective Antifungal Therapy (PATH) Alliance registry. Clin Infect Dis 2009;48:265-273. 3. Kontoyiannis DP, Lewis RE. Antifungal drug resistance of pathogenic fungi. Lancet 2002;359:1135-1144. 4. Kontoyiannis DP. Antifungal resistance: an emerging reality and a global challenge. J Infect Dis 2017;216(Suppl 3):431-435. 5. Perlin DS, Rautemaa-Richardson R, Alastruey-Izquierdo A. The global problem of antifungal resistance: prevalence, mechanisms, and management. Lancet Infect Dis 2017;17:383-392. 6. Verweij PE, Snelders E, Kema GH, Mellado E, Melchers WJ. Azole resistance in Aspergillus fumigatus: a side-effect of environmental fungicide use? Lancet Infect Dis 2009;9:789-795. 7. Snelders E, Melchers WJ, Verweij PE. Azole resistance in Aspergillus fumigatus: a new challenge in the management of invasive aspergillosis? Future Microbiol 2011;6:335-347. 8. Lavergne RA, Chouaki T, Hagen F, Toublanc B, Dupont H, Jounieaux V, Meis JF, Morio F, Le Pape P. Home environment as a source of life-threatening azole-resistant Aspergillus fumigatus in immunocompromised patients. Clin Infect Dis 2017;64:76-78. 9. Shields RK, Nguyen MH, Press EG, Kwa AL, Cheng S, Du C, Clancy CJ. The presence of an FKS mutation rather than MIC is an independent risk factor for failure of echinocandin therapy among patients with invasive candidiasis due to Candida glabrata. Antimicrob Agents Chemother 2012;56:48624869. 10. Verweij PE, Chowdhary A, Melchers WJ, Meis JF. Azole resistance in Aspergillus fumigatus: can we retain the clinical use of mold-active antifungal azoles? Clin Infect Dis 2016;62:362-368.

Turk J Hematol 2018;35:1-11

11. Chowdhary A, Sharma C, Meis JF. Azole-resistant aspergillosis: epidemiology, molecular mechanisms and treatment. J Infect Dis 2017;216(Suppl 3):436444. 12. Healey KR, Zhao Y, Perez WB, Lockhart SR, Sobel JD, Farmakiotis D, Kontoyiannis DP, Sanglard D, Taj-Aldeen SJ, Alexander BD, JimenezOrtigosa C, Shor E, Perlin DS. Prevalent mutator genotype identified in fungal pathogen Candida glabrata promotes multi-drug resistance. Nat Commun 2016;7:11128. 13. Lockhart SR, Etienne KA, Vallabhaneni S, Farooqi J, Chowdhary A, Govender NP, Colombo AL, Calvo B, Cuomo CA, Desjardins CA, Berkow EL, Castanheira M, Magobo RE, Jabeen K, Asghar RJ, Meis JF, Jackson B, Chiller T, Litvintseva AP. Simultaneous emergence of multidrug-resistant Candida auris on 3 continents confirmed by whole-genome sequencing and epidemiological analyses. Clin Infect Dis 2017;64:134-140. 14. Lamaris GA, Chamilos G, Lewis RE, Safdar A, Raad II, Kontoyiannis DP. Scedosporium infection in a tertiary care cancer center: a review of 25 cases from 1989-2006. Clin Infect Dis 2006;43:1580-1584. 15. Park BJ, Pappas PG, Wannemuehler KA, Alexander BD, Anaissie EJ, Andes DR, Baddley JW, Brown JM, Brumble LM, Freifeld AG, Hadley S, Herwaldt L, Ito JI, Kauffman CA, Lyon GM, Marr KA, Morrison VA, Papanicolaou G, Patterson TF, Perl TM, Schuster MG, Walker R, Wingard JR, Walsh TJ, Kontoyiannis DP. Invasive non-Aspergillus mold infections in transplant recipients, United States, 2001-2006. Emerg Infect Dis 2011;17:1855-1864. 16. Sipsas NV, Lewis RE, Tarrand J, Hachem R, Rolston KV, Raad II, Kontoyiannis DP. Candidemia in patients with hematologic malignancies in the era of new antifungal agents (2001-2007): stable incidence but changing epidemiology of a still frequently lethal infection. Cancer 2009;115:47454752. 17. Gamaletsou MN, Walsh T, Zaoutis T, Pagoni M, Kotsopoulou M, Voulgarelis M, Panayiotidis P, Vassilakopoulos T, Angelopoulou MK, Marangos M, Spyridonidis A, Kofteridis D, Pouli A, Sotiropoulos D, Matsouka P, Argyropoulou A, Perloretzou S, Leckerman K, Manaka A, Oikonomopoulos P, Daikos G, Petrikkos G, Sipsas NV. A prospective, cohort, multicenter study of candidemia in hospitalized adult patients with hematological malignancies. Clin Microbiol Infect 2014;20:50-57. 18. Farmakiotis D, Kontoyiannis DP. Epidemiology of antifungal resistance in human pathogenic yeasts: current viewpoint and practical recommendations for management. Int J Antimicrob Agents 2017;50:318-324. 19. Gamaletsou MN, Daikos GL, Walsh TJ, Perlin DS, Ortigosa CJ, Psaroulaki A, Pagoni M, Argyropoulou A, Nepka M, Perivolioti E, Kotsopoulou M, Perloretzou S, Marangos M, Kofteridis D, Grammatikou M, Goukos D, Petrikkos G, Sipsas NV. Breakthrough candidemia caused by phenotypically susceptible Candida spp. in patients with hematological malignancies does not correlate with established interpretive breakpoints. Int J Antimicrob Agents 2014;44:248-255. 20. Siopi M, Neroutsos E, Zisaki K, Gamaletsou M, Piroynaki M, Tsirigotis P, Sipsas N, Dokoumetzidis A, Goussetis E, Zerva L, Valsami G, Meletiadis J. Bioassay for determining voriconazole serum levels in patients receiving combination therapy with echinocandins. Antimicrob Agents Chemother 2015;60:632-636. 21. Walsh TJ, Driscoll T, Milligan PA, Wood ND, Schlamm H, Groll AH, Jafri H, Arrieta AC, Klein NJ, Lutsar I. Pharmacokinetics, safety, and tolerability of voriconazole in hospitalized immunocompromised children. Antimicrob Agents Chemother 2010;54:4116-4123. 22. Shields RK, Nguyen MH, Press EG, Clancy CJ. Abdominal candidiasis is a hidden reservoir of echinocandin resistance. Antimicrob Agents Chemother 2014;58:7601-7615. 23. Osherov N, Kontoyiannis DP. The anti-Aspergillus drug pipeline: is the glass half full or empty? Med Mycol 2017;55:118-124. 24. Chowdhary A, Sharma C, Meis JF. Azole-resistant aspergillosis: epidemiology, molecular mechanisms, and treatment. J Infect Dis 2017;216(Suppl 3):436444. 25. van der Linden JW, Arendrup MC, Warris A, Lagrou K, Pelloux H, Hauser PM, Chryssanthou E, Mellado E, Kidd SE, Tortorano AM, Dannaoui E, Gaustad

Turk J Hematol 2018;35:1-11

P, Baddley JW, Uekötter A, Lass-Flörl C, Klimko N, Moore CB, Denning DW, Pasqualotto AC, Kibbler C, Arikan-Akdagli S, Andes D, Meletiadis J, Naumiuk L, Nucci M, Melchers WJ, Verweij PE. Prospective multicenter international surveillance of azole resistance in Aspergillus fumigatus. Emerg Infect Dis 2015;21:1041-1044. 26. Verweij PE, Mellado E, Melchers WJ. Multiple-triazole-resistant aspergillosis. N Engl J Med 2007;356:1481-1483. 27. Mellado E, Garcia-Effron G, Alcázar-Fuoli L, Melchers WJ, Verweij PE, Cuenca-Estrella M, Rodríguez-Tudela JL. A new Aspergillus fumigatus resistance mechanism conferring in vitro cross-resistance to azole antifungals involves a combination of cyp51A alterations. Antimicrob Agents Chemother 2007;51:1897-1904. 28. van der Linden JW, Camps SM, Kampinga GA, Arends JP, Debets-Ossenkopp YJ, Haas PJ, Rijnders BJ, Kuijper EJ, van Tiel FH, Varga J, Karawajczyk A, Zoll J, Melchers WJ, Verweij PE. Aspergillosis due to voriconazole highly resistant Aspergillus fumigatus and recovery of genetically related resistant isolates from domiciles. Clin Infect Dis 2013;57:513-520. 29. Le Pape P, Lavergne RA, Morio F, Alvarez-Moreno C. Multiple fungicidedriven alterations in azole-resistant Aspergillus fumigatus, Colombia, 2015. Emerg Infect Dis 2016;22:156-157. 30. Hodiamont CJ, Dolman KM, Ten Berge IJ, Melchers WJ, Verweij PE, Pajkrt D. Multiple-azole-resistant Aspergillus fumigatus osteomyelitis in a patient with chronic granulomatous disease successfully treated with long-term oral posaconazole and surgery. Med Mycol 2009;47:217-220.

Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections

41. Moye-Rowley WS. Multiple mechanisms contribute to the development of clinically significant azole resistance in Aspergillus fumigatus. Front Microbiol 2015;6:70. 42. Bueid A, Howard SJ, Moore CB, Richardson MD, Harrison E, Bowyer P, Denning DW. Azole antifungal resistance in Aspergillus fumigatus: 2008 and 2009. J Antimicrob Chemother 2010;65:2116-2118. 43. Rajendran R, Mowat E, McCulloch E, Lappin DF, Jones B, Lang S, Majithiya JB, Warn P, Williams C, Ramage G. Azole resistance of Aspergillus fumigatus biofilms is partly associated with efflux pump activity. Antimicrob Agents Chemother 2011;55:2092-2097. 44. Paul S, Diekema D, Moye-Rowley WS. Contributions of both ATP-binding cassette transporter and Cyp51A proteins are essential for azole resistance in Aspergillus fumigatus. Antimicrob Agents Chemother 2017;61:e0274816. 45. Wei X, Chen P, Gao R, Li Y, Zhang A, Liu F, Lu L. Screening and characterization of the non-cyp51A mutation Afcox10 conferring azole resistance in Aspergillus fumigatus. Antimicrob Agents Chemother 2017;61:e02101-16. 46. Camps SM, Dutilh BE, Arendrup MC, Rijs AJ, Snelders E, Huynen MA, Verweij PE, Melchers WJ. Discovery of a hapE mutation that causes azole resistance in Aspergillus fumigatus through whole genome sequencing and sexual crossing. PLoS One 2012;7:e50034. 47. Ramage G, Mowat E, Jones B, Williams C, Lopez-Ribot J. Our current understanding of fungal biofilms. Crit Rev Microbiol 2009;35:340-355.

31. Howard SJ, Arendrup MC. Acquired antifungal drug resistance in Aspergillus fumigatus: epidemiology and detection. Med Mycol 2011;49 (Suppl 1):9095.

48. Xiong Q, Hassan SA, Wilson WK, Han XY, May GS, Tarrand JJ, Matsuda SP. Cholesterol import by Aspergillus fumigatus and its influence on antifungal potency of sterol biosynthesis inhibitors. Antimicrob Agents Chemother 2005;49:518-524.

32. Mann PA, Parmegiani RM, Wei SQ, Mendrick CA, Li X, Loebenberg D, DiDomenico B, Hare RS, Walker SS, McNicholas PM. Mutations in Aspergillus fumigatus resulting in reduced susceptibility to posaconazole appear to be restricted to a single amino acid in the cytochrome P450 14α-demethylase. Antimicrob Agents Chemother 2003;47:577-581.

50. Alastruey-Izquierdo A, Cuesta I, Houbraken J, Cuenca-Estrella M, Monzon A, Rodriguez-Tudela JL. In vitro activity of nine antifungal agents against clinical isolates of Aspergillus calidoustus. Med Mycol 2010;48:97-102.

33. Mellado E, Garcia-Effron G, Alcazar-Fuoli L, Cuenca-Estrella M, RodriguezTudela JL. Substitutions at methionine 220 in the 14α-sterol demethylase (Cyp51A) of Aspergillus fumigatus are responsible for resistance in vitro to azole antifungal drugs. Antimicrob Agents Chemother 2004;48:2747-2750. 34. Chen J, Li H, Li R, Bu D, Wan Z. Mutations in the cyp51A gene and susceptibility to itraconazole in Aspergillus fumigatus serially isolated from a patient with lung aspergilloma. J Antimicrob Chemother 2005;55:31-37. 35. Bellete B, Raberin H, Morel J, Flori P, Hafid J, Manhsung RT. Acquired resistance to voriconazole and itraconazole in a patient with pulmonary aspergilloma. Med Mycol 2010;48:197-200. 36. Krishnan Natesan S, Wu W, Cutright JL, Chandrasekar PH. In vitro-in vivo correlation of voriconazole resistance due to G448S mutation (cyp51A gene) in Aspergillus fumigatus. Diagn Microbiol Infect Dis 2012;74:272277. 37. Paul RA, Rudramurthy SM, Meis JF, Mouton JW, Chakrabarti A. A novel Y319H substitution in CYP51C associated with azole resistance in Aspergillus flavus. Antimicrob Agents Chemother 2015;59:6615-6619.

49. Balajee SA, Gribskov JL, Hanley E, Nickle D, Marr KA. Aspergillus lentulus sp. nov., a new sibling species of A. fumigatus. Eukaryot Cell 2005;4:625-632.

51. Walsh TJ, Petraitis V, Petraitiene R, Field-Ridley A, Sutton D, Ghannoum M, Sein T, Schaufele R, Peter J, Bacher J, Casler H, Armstrong D, EspinelIngroff A, Rinaldi MG, Lyman CA. Experimental pulmonary aspergillosis due to Aspergillus terreus: pathogenesis and treatment of an emerging fungal pathogen resistant to amphotericin B. J Infect Dis 2003;188:305-319. 52. Vazquez JA, Arganoza MT, Boikov D, Yoon S, Sobel JD, Akins RA. Stable phenotypic resistance of Candida species to amphotericin B conferred by preexposure to subinhibitory levels of azoles. J Clin Microbiol 1998;36:26902695. 53. Perfect JR, Cox GM. Drug resistance in Cryptococcus neoformans. Drug Resist Updat 1999;2:259-269. 54. Snelders E, van der Lee HA, Kuijpers J, Rijs AJ, Varga J, Samson RA, Mellado E, Donders AR, Melchers WJ, Verweij PE. Emergence of azole resistance in Aspergillus fumigatus and spread of a single resistance mechanism. PLoS Med 2008;5:e219. 55. Snelders E, Huis In ‘t Veld RA, Rijs AJ, Kema GH, Melchers WJ, Verweij PE. Possible environmental origin of resistance of Aspergillus fumigatus to medical triazoles. Appl Environ Microbiol 2009;75:4053-4057.

38. Arendrup MC, Jensen RH, Grif K, Skov M, Pressler T, Johansen HK, Lass-Flörl C. In vivo emergence of Aspergillus terreus with reduced azole susceptibility and a Cyp51a M217I alteration. J Infect Dis 2012;206:981-985.

56. Özmerdiven GE, Ak S, Ener B, Ağca H, Cilo BD, Tunca B, Akalın H. First determination of azole resistance in Aspergillus fumigatus strains carrying the TR34/L98H mutations in Turkey. J Infect Chemother 2015;21:581-586.

39. Howard SJ, Cerar D, Anderson MJ, Albarrag A, Fisher MC, Pasqualotto AC, Laverdiere M, Arendrup MC, Perlin DS, Denning DW. Frequency and evolution of azole resistance in Aspergillus fumigatus associated with treatment failure. Emerg Infect Dis 2009;15:1068-1076.

57. Hsueh PR, Lau YJ, Chuang YC, Wan JH, Huang WK, Shyr JM, Yan JJ, Yu KW, Wu JJ, Ko WC, Yang YC, Liu YC, Teng LJ, Liu CY, Luh KT. Antifungal susceptibilities of clinical isolates of Candida species, Cryptococcus neoformans, and Aspergillus species from Taiwan: surveillance of multicenter antimicrobial resistance in Taiwan program data from 2003. Antimicrob Agents Chemother 2005;49:512-517.

40. Albarrag AM, Anderson MJ, Howard SJ, Robson GD, Warn PA, Sanglard D, Denning DW. Interrogation of related clinical pan-azole-resistant Aspergillus fumigatus strains: G138C, Y431C, and G434C single nucleotide polymorphisms in cyp51A, upregulation of cyp51A, and integration and activation of transposon Atf1 in the cyp51A promoter. Antimicrob Agents Chemother 2011;55:5113-5121.

58. Lockhart SR, Frade JP, Etienne KA, Pfaller MA, Diekema DJ, Balajee SA. Azole resistance in Aspergillus fumigatus isolates from the ARTEMIS global surveillance study is primarily due to the TR/L98H mutation in the cyp51A gene. Antimicrob Agents Chemother 2011;55:4465-4468.

Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections

Turk J Hematol 2018;35:1-11

59. Wiederhold NP, Gil VG, Gutierrez F, Lindner JR, Albataineh MT, McCarthy DI, Sanders C, Fan H, Fothergill AW, Sutton DA. First detection of TR34 L98H and TR46 Y121F T289A Cyp51 mutations in Aspergillus fumigatus isolates in the United States. J Clin Microbiol 2016;54:168-171.

76. Bailly S, Maubon D, Fournier P, Pelloux H, Schwebel C, Chapuis C, Foroni L, Cornet M, Timsit JF. Impact of antifungal prescription on relative distribution and susceptibility of Candida spp.- trends over 10 years. J Infect 2016;72:103-111.

60. Gonçalves SS. Global aspects of triazole resistance in Aspergillus fumigatus with focus on Latin American countries. J Fungi 2017;3:5.

77. Hull CM, Bader O, Parker JE, Weig M, Gross U, Warrilow AG, Kelly DE, Kelly SL. Two clinical isolates of Candida glabrata exhibiting reduced sensitivity to amphotericin B both harbor mutations in ERG2. Antimicrob Agents Chemother 2012;56:6417-6421.

61. Kidd SE, Goeman E, Meis JF, Slavin MA, Verweij PE. Multi-triazole-resistant Aspergillus fumigatus infections in Australia. Mycoses 2015;58:350-355. 62. van Ingen J, van der Lee HA, Rijs TA, Zoll J, Leenstra T, Melchers WJ, Verweij PE. Azole, polyene and echinocandin MIC distributions for wild-type, TR34/L98H and TR46/Y121F/T289A Aspergillus fumigatus isolates in the Netherlands. J Antimicrob Chemother 2015;70:178-181. 63. Howard SJ, Lass-Flörl C, Cuenca-Estrella M, Gomez-Lopez A, Arendrup MC. Determination of isavuconazole susceptibility of Aspergillus and Candida species by the EUCAST method. Antimicrob Agents Chemother 2013;57:5426-5431. 64. Gregson L, Goodwin J, Johnson A, McEntee L, Moore CB, Richardson M, Hope WW, Howard SJ. In vitro susceptibility of Aspergillus fumigatus to isavuconazole: correlation with itraconazole, voriconazole, and posaconazole. Antimicrob Agents Chemother 2013;57:5778-5780. 65. Steinmann J, Hamprecht A, Vehreschild MJ, Cornely OA, Buchheidt D, Spiess B, Koldehoff M, Buer J, Meis JF, Rath PM. Emergence of azoleresistant invasive aspergillosis in HSCT recipients in Germany. J Antimicrob Chemother 2015;70:1522-1526. 66. Chowdhary A, Kathuria S, Xu J, Sharma C, Sundar G, Singh PK, Gaur SN, Hagen F, Klaassen CH, Meis JF. Clonal expansion and emergence of environmental multiple-triazole-resistant Aspergillus fumigatus strains carrying the TR34/L98H mutations in the cyp51A gene in India. PLoS One 2012;7:e52871. 67. Heo ST, Tatara AM, Jiménez-Ortigosa C, Jiang Y, Lewis RE, Tarrand J, Tverdek F, Albert ND, Verweij PE, Meis JF, Mikos AG, Perlin DS, Kontoyiannis DP. Changes in in vitro susceptibility patterns of Aspergillus to triazoles and correlation with aspergillosis outcome in a tertiary care cancer center, 1999-2015. Clin Infect Dis 2017;65:216-225. 68. Verweij PE, Ananda-Rajah M, Andes D, Arendrup MC, Brüggemann RJ, Chowdhary A, Cornely OA, Denning DW, Groll AH, Izumikawa K, Kullberg BJ, Lagrou K, Maertens J, Meis JF, Newton P, Page I, Seyedmousavi S, Sheppard DC, Viscoli C, Warris A, Donnelly JP. International expert opinion on the management of infection caused by azole-resistant Aspergillus fumigatus. Drug Resist Updat 2015;21-22:30-40. 69. Cowen LE, Sanglard D, Howard SJ, Rogers PD, Perlin DS. Mechanisms of antifungal drug resistance. Cold Spring Harb Perspect Med 2015;5:a019752. 70. Sagatova AA, Keniya MV, Wilson RK, Monk BC, Tyndall JD. Structural insights into binding of the antifungal drug fluconazole to Saccharomyces cerevisiae lanosterol 14α-demethylase. Antimicrob Agents Chemother 2015;59:4982-4989. 71. Flowers SA, Barker KS, Berkow EL, Toner G, Chadwick SG, Gygax SE, Morschhäuser J, Rogers PD. Gain-of-function mutations in UPC2 are a frequent cause of ERG11 upregulation in azole-resistant clinical Isolates of Candida albicans. Eukaryotic Cell 2012;11:1289-1299. 72. Vale-Silva LA, Coste AT, Ischer F, Parker JE, Kelly SL, Pinto E, Sanglard D. Azole resistance by loss of function of the sterol Δ5,6-desaturase gene (ERG3) in Candida albicans does not necessarily decrease virulence. Antimicrob Agents Chemother 2012;56:1960-1968. 73. Douglas CM. Fungal beta(1,3)-D-glucan synthesis. Med Mycol 2001;39(Suppl 1):55-66.

78. Pfaller MA, Messer SA, Woosley LN, Jones RN, Castanheira M. Echinocandin and triazole antifungal susceptibility profiles for clinical opportunistic yeast and mold isolates collected from 2010 to 2011: application of new CLSI clinical breakpoints and epidemiological cutoff values for characterization of geographic and temporal trends of antifungal resistance. J Clin Microbiol 2013;51:2571-2581. 79. Pham CD, Iqbal N, Bolden CB, Kuykendall RJ, Harrison LH, Farley MM, Schaffner W, Beldavs ZG, Chiller TM, Park BJ, Cleveland AA, Lockhart SR. Role of FKS mutations in Candida glabrata: MIC values, echinocandin resistance, and multidrug resistance. Antimicrob Agents Chemother 2014;58:4690-4696. 80. Vallabhaneni S, Cleveland AA, Farley MM, Harrison LH, Schaffner W, Beldavs ZG, Derado G, Pham CD, Lockhart SR, Smith RM. Epidemiology and risk factors for echinocandin non-susceptible Candida glabrata bloodstream infections: data from a large multisite population-based candidemia surveillance program, 2008-2014. Open Forum Infect Dis 2015;2:ofv163. 81. Klotz U, Schmidt D, Willinger B, Steinmann E, Buer J, Rath PM, Steinmann J. Echinocandin resistance and population structure of invasive Candida glabrata isolates from two university hospitals in Germany and Austria. Mycoses 2016;59:312-318. 82. McCarthy MW, Walsh TJ. Containment strategies to address the expanding threat of multidrug-resistant Candida auris. Expert Rev Anti Infect Ther 2017;15:1095-1099. 83. Calvo B, Melo AS, Perozo-Mena A, Hernandez M, Francisco EC, Hagen F, Meis JF, Colombo AL. First report of Candida auris in America: clinical and microbiological aspects of 18 episodes of candidemia. J Infect 2016;73:369374. 84. Pappas PG, Kauffman CA, Andes DR, Clancy CJ, Marr KA, Ostrosky-Zeichner L, Reboli AC, Schuster MG, Vazquez JA, Walsh TJ, Zaoutis TE, Sobel JD. Executive summary: Clinical practice guideline for the management of candidiasis: 2016 update by the Infectious Diseases Society of America. Clin Infect Dis 2016;62:409-417. 85. Slavin M, van Hal S, Sorrell TC, Lee A, Marriott DJ, Daveson K, Kennedy K, Hajkowicz K, Halliday C, Athan E, Bak N, Cheong E, Heath CH, Orla Morrissey C, Kidd S, Beresford R, Blyth C, Korman TM, Owen Robinson J, Meyer W, Chen SC; Australia and New Zealand Mycoses Interest Group. Invasive infections due to filamentous fungi other than Aspergillus: epidemiology and determinants of mortality. Clin Microbiol Infect 2015;21:490. 86. Kontoyiannis DP, Marr KA, Park BJ, Alexander BD, Anaissie EJ, Walsh TJ, Ito J, Andes DR, Baddley JW, Brown JM, Brumble LM, Freifeld AG, Hadley S, Herwaldt LA, Kauffman CA, Knapp K, Lyon GM, Morrison VA, Papanicolaou G, Patterson TF, Perl TM, Schuster MG, Walker R, Wannemuehler KA, Wingard JR, Chiller TM, Pappas PG. Prospective surveillance for invasive fungal infections in hematopoietic stem cell transplant recipients, 20012006: overview of the Transplant-Associated Infection Surveillance Network (TRANSNET) Database. Clin Infect Dis 2010;50:1091-1100.

74. Arendrup MC, Perlin DS. Echinocandin resistance: an emerging clinical problem? Curr Opin Infect Dis 2014;27:484-492.

87. Fernández-Ruiz M, Guinea J, Puig-Asensio M, Zaragoza Ó, Almirante B, Cuenca-Estrella M, Aguado JM; CANDIPOP Project; GEIH-GEMICOMED (SEIMC) and REIPI. Fungemia due to rare opportunistic yeasts: data from a population-based surveillance in Spain. Med Mycol 2017;55:125-136.

75. Alexander BD, Johnson MD, Pfeiffer CD, Jiménez-Ortigosa C, Catania J, Booker R, Castanheira M, Messer SA, Perlin DS, Pfaller MA. Increasing echinocandin resistance in Candida glabrata: clinical failure correlates with presence of FKS mutations and elevated minimum inhibitory concentrations. Clin Infect Dis 2013;56:1724-1732.

88. Bretagne S, Renaudat C, Desnos-Ollivier M, Sitbon K, Lortholary O, Dromer F; French Mycosis Study Group. Predisposing factors and outcome of uncommon yeast species-related fungaemia based on an exhaustive surveillance programme (2002-14). J Antimicrob Chemother 2017;72:17841793.

Turk J Hematol 2018;35:1-11

89. Espinel-Ingroff A, Turnidge J. The role of epidemiological cutoff values (ECVs/ECOFFs) in antifungal susceptibility testing and interpretation for uncommon yeasts and moulds. Rev Iberoam Micol 2016;33:63-75. 90. Ostrosky-Zeichner L, Andes D. The role of in vitro susceptibility testing in management of fungal infections. J Infect Dis 2017;216(Suppl 3):452-457. 91. Mylonakis E, Clancy CJ, Ostrosky-Zeichner L, Garey KW, Alangaden GJ, Vazquez JA, Groeger JS, Judson MA, Vinagre YM, Heard SO, Zervou FN, Zacharioudakis IM, Kontoyiannis DP, Pappas PG. T2 magnetic resonance assay for the rapid diagnosis of candidemia in whole blood: a clinical trial. Clin Infect Dis 2015;60:892-899. 92. Perlin DS, Wiederhold NP. Culture-independent molecular methods for detection of antifungal resistance mechanisms and fungal identification. J Infect Dis 2017;216(Suppl 3):458-465. 93. Alanio A, Bretagne S. Performance evaluation of multiplex PCR including Aspergillus-not so simple! Med Mycol 2017;55:56-62. 94. McCarthy MW, Kontoyiannis DP, Perfect J, Cornely OS, Walsh TJ. Novel agents and drug targets to meet the challenges of resistant fungi. J Infect Dis 2017;216(Suppl 3):474-483.

Gamaletsou MN, et al: Antifungal-Resistant Fungal Infections

95. Pfaller MA, Messer SA, Rhomberg PR, Jones RN, Castanheira M. Activity of a long-acting echinocandin, CD101, determined using CLSI and EUCAST reference methods, against Candida and Aspergillus spp., including echinocandin- and azole-resistant isolates. J Antimicrob Chemother 2016;71:2868-2873. 96. McCarthy MW, Denning DW, Walsh TJ. Future research priorities in fungal resistance. J Infect Dis 2017;216(Suppl 3):484-492. 97. Verweij PE, Lestrade PP, Melchers WJ, Meis JF. Azole resistance surveillance in Aspergillus fumigatus: beneficial or biased? J Antimicrob Chemother 2016;71:2079-2082. 98. Alanio A, Denis B, Hamane S, Raffoux E, Peffault de la Tour R, Touratier S, Bergeron A, Bretagne S. New therapeutic strategies for invasive aspergillosis in the era of azole resistance: how should the prevalence of azole resistance be defined? J Antimicrob Chemother 2016;71:2075-2078. 99. Lestrade PP, Meis JF, Arends JP, van der Beek MT, de Brauwer E, van Dijk K, de Greeff SC, Haas PJ, Hodiamont CJ, Kuijper EJ, Leenstra T, Muller AE, Oude Lashof AM, Rijnders BJ, Roelofsen E, Rozemeijer W, Tersmette M, Terveer EM, Verduin CM, Wolfhagen MJ, Melchers WJ, Verweij PE. Diagnosis and management of aspergillosis in the Netherlands: a national survey. Mycoses 2016;59:101-107.

RESEARCH ARTICLE DOI: 10.4274/tjh.2017.0039 Turk J Hematol 2018;35:12-18

A National Registry of Thalassemia in Turkey: Demographic and Disease Characteristics of Patients, Achievements, and Challenges in Prevention Türkiye Ulusal Talasemi Kaydı: Hastaların Demografik ve Hastalık Özellikleri, Kontrol Programının Başarısı ve Sorunları Yeşim Aydınok, Yeşim Oymak, Berna Atabay, Gönül Aydoğan, Akif Yeşilipek, Selma Ünal, Yurdanur Kılınç, Banu Oflaz, Mehmet Akın, Canan Vergin, Melike Sezgin Evim, Ümran Çalışkan, Şule Ünal, Ali Bay, Elif Kazancı, Talia İleri, Didem Atay, Türkan Patıroğlu, Selda Kahraman, Murat Söker, Mediha Akcan, Aydan Akdeniz, Mustafa Büyükavcı, Güçhan Alanoğlu, Özcan Bör, Nur Soyer, Nihal Özdemir Karadaş, Ezgi Uysalol, Meral Türker, Arzu Akçay, Süheyla Ocak, Adalet Meral Güneş, Hüseyin Tokgöz, Elif Ünal, Naci Tiftik, Zeynep Karakaş Hemoglobinopathy Study Group, Turkey

Abstract

Öz

Objective: The Turkish Society of Pediatric Hematology set up a National Hemoglobinopathy Registry to demonstrate the demographic and disease characteristics of patients and assess the efficacy of a hemoglobinopathy control program (HCP) over 10 years in Turkey.

Amaç: Türk Pediatrik Hematoloji Derneği, Türkiye’de 10 yıldır devam eden Hemoglobinopati Kontrol Programı’nın (HCP) etkinliğini değerlendirmek ve hemoglobinopati hastalarının demografik ve hastalık özelliklerini ortaya koymak üzere bir Ulusal Hemoglobinopati Kayıt Programı oluşturdu.

Materials and Methods: A total of 2046 patients from 27 thalassemia centers were registered, of which 1988 were eligible for analysis. This cohort mainly comprised patients with β-thalassemia major (n=1658, 83.4%) and intermedia (n=215, 10.8%). Results: The majority of patients were from the coastal areas of Turkey. The high number of patients in Southeastern Anatolia was due to that area having the highest rates of consanguineous marriage and fertility. The most common 11 mutations represented 90% of all β-thalassemia alleles and 47% of those were IVS1-110(G->A) mutations. The probability of undergoing splenectomy within the first 10 years of life was 20%, a rate unchanged since the 1980s. Iron chelators were administered as monotherapy regimens in 95% of patients and deferasirox was prescribed in 81.3% of those cases. Deferasirox administration was the highest (93.6%) in patients aged <10 years. Of the thalassemia major patients, 5.8% had match-related hemopoietic stem cell transplantation with a success rate of 77%. Cardiac disease was detected as a major cause of death and did not show a decreasing trend in 5-year cohorts since 1999. Conclusion: While the HCP has been implemented since 2003, the affected births have shown a consistent decrease only after 2009, being at lowest 34 cases per year. This program failure resulted from a lack of premarital screening in the majority of cases. Additional problems were unawareness of the risk and misinformation of the

Gereç ve Yöntemler: Toplam 27 talasemi merkezinden 2046 hasta kaydedildi ve bunların 1988’i analize uygun bulundu. Kayıtların çoğunluğunu β-talasemi majör (n=1658, %83,4) ve intermedia (n=215, %10,8) olguları oluşturdu. Bulgular: Hastaların büyük çoğunluğu kıyı bölgelerde bulunuyordu. Güneydoğu Anadolu’da yüksek hasta sayısına, bu bölgede en yüksek görülen akraba evliliği ve yüksek doğum oranının etkisi olabilirdi. En sık 11 talasemi mutasyonu, tüm β-talasemi allellerinin %90’ını oluşturuyordu ve bunların %47’si IVS1-110(G->A) mutasyonu idi. Yaşamın ilk 10 yılında splenektomi olasılığı %20 idi ve bu oran 1980’lerden beri değişmemişti. Demir şelasyonu hastaların %95’inde monoterapi olarak uygulanmaktaydı ve %81,3’ünü deferasiroks oluşturuyordu. Deferasiroks uygulaması en yüksek (%93,6) 10 yaştan küçük hastalarda bulundu. Talasemi majör olgularının %5,8’i hemopoetik kök hücre nakli olmuştu ve başarı oranı %77 idi. Kardiyak hastalık ölümlerin majör nedeni idi ve beşer yıllık kohortlarda, 1999’dan beri azalma eğilimi göstermiyordu. Sonuç: HCP 2003 yılından beri uygulanmakla beraber, yeni hastaların doğumu ancak 2009’dan itibaren azalma eğilimi gösteriyordu ve en düşük yılda 34 yeni hasta saptandı. Program başarısızlığı, çiftlerin çoğunda, evlilik öncesi tarama yapılmamasından kaynaklanmaktaydı. Bir kısmında ise riskin farkında olunmaması ve çiftlerin hatalı

Address for Correspondence/Yazışma Adresi: Yeşim AYDINOK, M.D., Ege University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey Phone : +90 532 396 27 46 E-mail : yesim.aydinok@ege.edu.tr ORCID-ID: orcid.org/0000-0001-8463-2723

Received/Geliş tarihi: January 28, 2017 Accepted/Kabul tarihi: April 11, 2017

Aydınok Y, et al: A National Registry of Thalassemia in Turkey

Turk J Hematol 2018;35:12-18

at-risk couples. In addition, prenatal diagnosis was either not offered to or was not accepted by the at-risk families. This study indicated that a continuous effort is needed for optimizing the management of thalassemia and the development of strategies is essential for further achievements in the HCP in Turkey.

bilgilendirilmesi nedenliydi. Sonuç olarak, risk ailelerine prenatal tanı önerilmemesi veya prenatal tanının reddi diğer nedenleri oluşturuyordu. Bu çalışma, Türkiye’de talasemi tedavisinin optimizasyonu için çabanın sürdürülmesine ve HCP’nin daha yüksek başarısı için gelişen stratejilere gereksinim olduğunu gösterdi.

Keywords: Thalassemia, Hemoglobinopathies, Splenectomy, Registries, Iron chelators, β-thalassemia mutations, Turkey

Anahtar Sözcükler: Talasemi, Hemoglobinopatiler, Splenektomi, Kayıt, Demir şelatörleri, β-talasemi mutasyonları, Türkiye

Introduction

from marriages after 2003 were also investigated and relevant information was collected.

Better management of thalassemia by regular and adequate red cell transfusions, close monitoring of iron loading, and appropriate iron chelation therapy (ICT) with deferoxamine (DFO) has changed the prognosis of the disease worldwide [1]. Furthermore, there was a revolutionary development in the management of the disease at the beginning of the twentyfirst century with the introduction of magnetic resonance imaging (MRI) as a measure of tissue-specific iron loading and the availability of oral iron chelators deferiprone (DFP) and deferasirox (DFX) [2,3]. In parallel, DFP and DFX were registered in Turkey in 2004 and 2006, respectively, and gradually replaced DFO. However, the dissemination of cardiac T2* MRI as a useful tool for the monitoring and management of iron overload has remained limited. The cornerstone of relevant public health policies in Turkey was the recognition of thalassemia as a common health problem in 1993. Eventually, a comprehensive national hemoglobinopathy control program (HCP) was implemented by law and came into force on 24 October 2002 in 33 provinces of Turkey. In 2012, the Turkish Society of Pediatric Hematology set up the National Registry for Hemoglobinopathies to collate the demographic and disease characteristics of patients, and also quantified and assessed the efficacy of the HCP over 10 years in Turkey.

Results The overall population with a major hemoglobinopathy comprised 2046 patients from 27 thalassemia centers (TCs) participating in the study. A total of 56 double and one triple registration were excluded. A total of 1988 patients were analysed. Distribution of Patients Throughout Turkey The majority of patients came from TCs in the Aegean (n=622), Marmara (n=518), Mediterranean (n=348), and Southeastern Anatolia (n=338) regions. A total of 139 patients were registered from TCs in Central Anatolia and 23 patients were from a single TC serving the whole of Eastern Anatolia. There was no TC in the Black Sea region where a few patients may be living and receiving health care from the nearest TCs outside the region (Table 1). The highest number of registered patients lived in İstanbul (n=265), İzmir (n=207), and Şanlıurfa (n=201) provinces. Table 1. Regional distribution of the registered patients. Regions

Provinces

Centers (n)

Patients (n)

İstanbul

416

Bursa

102

Ankara

Kayseri

Eskişehir

Konya

Şanlıurfa

187

Southeastern Anatolia Diyarbakır

105

Gaziantep

İzmir

495

Denizli

Aydın

Antalya

Mersin

Adana

Hatay

Isparta

Erzurum

Marmara

Central Anatolia

Materials and Methods A website was prepared to conduct this observational prospective cohort study. The website was launched after receiving the approval of the ethics committee in October 2012 (B.30.2.EGE.0.20.05.00/OY/1747-723 decision number: 125.2/11) and remained active until June 2015. The investigators received a secure entrance to the website. The electronic case report form for each patient with a thalassemia disease and variant hemoglobins and the signed informed consent form were completed by the investigators. The system was able to detect repeated registries for any patient receiving health care in more than one center. The demographic features and disease characteristics of the patients were reported. Affected births

Aegean

Mediterranean

Eastern Anatolia

Aydınok Y, et al: A National Registry of Thalassemia in Turkey

Demographic Characteristics of Patients This was a relatively young cohort (51% male), of which 72% of individuals were below 20 years old (Figure 1). A total of 378 subjects (19%) in the cohort were of preschool age (<6 years). The majority of subjects aged ≥6 years were students (n=981, 67%). A total of 480 subjects (33%) were not attending school. Just over half of these (n=256, 53%) were >18 years old and employed, whereas 224 (47%) were unemployed and 214 of those were >18 years old. Of the unemployed patients 57% had only completed the 8-year primary education, whereas 33% had graduated from high school and 10% from university. The schooling or employment status was not obtained from 149 subjects. All patients, except for 1%, were covered by social security regardless of their social status. Consanguineous marriage was reported for 48% of parents and 51% of those were first-cousin marriages. Consanguineous marriages accounted for 75% of parents from Şanlıurfa, which was the city with the third highest number of thalassemic patients on the registry. In comparison, consanguineous marriages were reported in 38.5% and 29% of parents from İstanbul and İzmir, respectively. Furthermore, the average number of children born to parents with an affected child was 4 in Şanlıurfa but 2 in İstanbul and İzmir. A total of 214 families in the registry had more than one thalassemic child. Disease Characteristics The majority of subjects (95%) had homozygous β-thalassemia (Table 2). A total of 1385 β-thalassemia alleles reported from 724 patients contained 22 different β-thalassemia mutations. The most common 11 mutations represented 90% of all β-thalassemia alleles. IVS1-110(G->A) was the most prevalent mutation (Table 3). Although β-thalassemia intermedia (TI) was reported in 215 (11.5%) of 1873 patients with β-thalassemia, only one-third of subjects (33.3%) were entirely transfusion-free. Regular (>8 times/year), frequent (5-8 times/year), and occasional (0-4 times/year) transfusions were reported in 79 (37.6%), 30 (14.3%), and 31 (14.8%) patients, respectively.

Turk J Hematol 2018;35:12-18

Splenectomy had been performed in 79 (38%) of 207 patients with TI and 590 (37%) of 1594 patients with β-thalassemia major (TM). The patients were divided into four age cohorts by decades and splenectomy indication during the first decade was compared between age cohorts II, III, and IV. The splenectomy frequency in age cohort III displayed a slight decrease compared to cohort IV and simply shifted to the second decade. However, the frequency of splenectomy did not change in age cohort II compared to III (Table 4). A total of 115 patients with TM were aged <2 years at the time of registration and had not met the criteria for starting ICT. A total of 150 patients with TI, hemoglobin H (HbH) disease, Table 2. The diagnosis of registered patients. Diagnosis

β-thalassemia major

1658

83.4

β-thalassemia intermedia

215

10.8

β/S-thalassemia

0.8

S/S disease

3.9

HbH disease

1.1

HbH: hemoglobin H

Table 3. The most common β-thalassemia mutations in the cohort. βT mutation

Homozygous

Compound heterozygous

Total

IVSI-110(G->A)

234

184

652

47.1

IVSI-1(G->A)

105

7.6

IVSI-6(T->C)

104

7.5

Codon 39(C->T)

5.7

IVSII-745(C->G)

5.6

IVSII-1(G->A)

5.5

Codon 8(-AA)

5.2

Codon 44(-C)

3.3

Codon 5(-CT)

3.0

-30 (T->A)

2.4

IVSI-5(G->C)

2.1

βT allele

Table 4. Changes in frequency and age of splenectomy in age cohorts by decades. Age of

Age cohorts of patients I (0-10 years),

II (10-20 years),

III (20-30 years),

IV (30-40 years),

n=685 (%)

n=716 (%)

n=366 (%)

n=129 (%)

0-10

37 (5.5)

135 (19)

73 (20)

33 (26)

10-20

105 (15)

137 (37)

36 (29)

20-30

22 (6)

18 (15)

30-40

2 (1.5)

splenectomy (years)

Aydınok Y, et al: A National Registry of Thalassemia in Turkey

Turk J Hematol 2018;35:12-18

sickle-cell disease (SCD), and β/S thalassemia were not receiving ICT. The history of ICT was not obtained for 78 patients. Overall, 1561 of 1645 patients (95%) with TM (n=1473), TI (n=128), SCD (n=31), β/S thalassemia (n=9), and HbH disease (n=4) were receiving a monotherapy regimen. DFX was the most prevalent chelator, prescribed to 1337 (81.3%) patients, followed by DFO to 131 (8%) and DFP to 93 (5.7%) patients. Combined therapy of DFO+DFP was reported in 58 (3.5%), DFX+DFO in 20 (1.2%), and DFX+DFP in 6 (0.3%) patients. The highest DFX administration of 93.6% was reported in patients aged <10 years and it remained the most prevalent chelator in all age cohorts. The use of DFO and DFP was lowest in patients aged <10 years and increased gradually in older age cohorts (Table 5). Hemopoietic stem cell transplantation (HSCT) was reported in 96 patients, of which all but one with SCD had TM. The average age at HSCT was 8.1 years (median: 7 years) and the oldest patient was 18 years old. The source of HSCT was matched sibling donor (MSD) in 87 of 92 patients, whereas three family and two unrelated-donor transplantations were reported. Overall, 70 of 91 patients (77%) had thalassemia-free survival after HSCT, whereas 20 patients had graft rejection with autologous recovery (22%) and 1 died (1.1%). There were 115 patients with an MSD who had not yet had HSCT, of whom 84 were <17 years old. Furthermore, there were 417 patients with a healthy sibling whose human leukocyte antigen (HLA) compatibility had not

been evaluated. There were 34 deaths (5%) out of 680 patients from 3 TCs. The causes of death were heart disease (n=17), infections (n=8), hepatic failure (n=2), anemia (n=1), HSCT (n=1), and unknown causes (n=5). The earliest cardiac death was at 11 years old. The rates of cardiac deaths in the population at risk (age of >10 years) improved gradually in 5-year cohorts since 1999 (Table 6). The Impact of the Hemoglobinopathy Control Program on Thalassemic Births There were 619 thalassemic births after 2004. The number of new cases has shown a consistent decrease only since 2009 (Figure 2). The year of marriage was recorded for 482 of 619 parents, of whom 242 had been married since 2003 or later. According to the statements of couples, overall 142 of those 242 (58.7%) had married in provinces covered by the HCP but did not receive premarital screening. The remaining 100 couples had premarital screening but 40% of those either received no feedback information (n=25) or were misinformed (n=15) regarding screening results and 60% had been informed of being couples at risk of having thalassemic offspring but those parents either had not had a prenatal diagnosis (n=49) or had knowingly given birth to a thalassemic child (n=11). Sixty-two of these 242 (25.6%) couples were married in Şanlıurfa. Premarital screening was performed for only 17 (27%) of these 62 couples. Although 12 out of those 17 were informed that they were at-risk couples, only one had a prenatal diagnosis but knowingly gave birth to an affected child. Nineteen (7.8%) of the 242 couples were married in İzmir, of whom 15 (79%) had premarital screening and 10 of those 15 were informed that they were at-risk couples, but only 5 of those had a prenatal Table 5. Changes over time in percentage of chelator use in patients with hemoglobinopathies.

Figure 1. The age distribution of the registered patients.

Age (years)

DFO (%)

DFP (%)

DFX (%)

DFP + DFO (%)

0-10

486

3.3

93.6

1.1

11-20

637

21-30

317

11.3

69.4

7.3

31-40

112

21.4

14.2

4.5

DFX: Deferasirox, DFO: deferoxamine, DFP: deferiprone.

Table 6. Changes over time in the number and age of cardiac deaths.

Figure 2. The number of affected births prior to and after the implementation of the hemoglobinopathy control program.

Average age

% of deaths,

(years)

at-risk population

17.2±5.9

3.26

1999-2003

13.7±2.3

1.98

2004-2008

19.8±4.0

1.53

2009-2013

23.3±3.5

0.85

Cardiac deaths

1994-1998

Aydınok Y, et al: A National Registry of Thalassemia in Turkey

diagnosis.

Discussion Previous epidemiological studies from Turkey reported that the Çukurova region was the most prevalent for hemoglobin S (HbS) carriers (up to 10%) and the majority of patients with SCD were from that region [4,5,6]. Because the TCs that participated from Çukurova had not registered patients with SCD, the current registry mainly included patients with homozygous β-thalassemia. TI accounted for 11.5% of the cohort and the majority of those individuals were receiving transfusions. It remains to be determined whether the milder forms have been missed. Although the prevalence of β-thalassemia carriers was stated as 2.1% overall in Turkey [7], the epidemiological data demonstrated regional differences, with a higher prevalence in coastal areas [5,8,9,10]. In concordance with this, the majority of patients came from the Marmara, Aegean, and Mediterranean regions. Although epidemiological data from Southeastern Anatolia did not indicate a high prevalence of thalassemia carriers [11,12], homozygous forms in the region were found to be as high as those in the coastal areas, most probably because of the higher number of consanguineous marriages and the higher fertility rate. The considerable number of families with more than one affected child indicated that preventive measures have not been implemented even for the families with a proven risk. After implementation of the HCP, the highest number of affected children were born in Şanlıurfa. It was revealed that the majority of these couples had not had premarital screening and, furthermore, prenatal diagnosis was either not offered or not accepted by the at-risk families. The number of newborns with thalassemia and hemoglobinopathies was reported as being reduced from 272 in 2002 to 25 in 2010, which accounted for a 90% reduction over these years [13]. We consider that report with caution since in the current registry 79 affected births were reported from 27 TCs in Turkey in 2010. This inconsistency can be explained by insufficient reporting of new cases to the official registry system used by the Ministry of Health in Turkey. Nevertheless, the number of affected newborns per year demonstrated a trend towards a consistent decrease since 2009. This achievement can be improved by auditing all components of the program carefully and applying appropriate corrective measures. This was a relatively young cohort as 72% of the registry was <20 years old and they were mostly either of preschool age (19%) or students (67%). Approximately one-half of the remaining thalassemic subjects were employed while just under half were neither employed nor in education or training (NEET). 16

Turk J Hematol 2018;35:12-18

The Organisation for Economic Co-operation and Development (OECD) reported that nearly 30% of young people in Turkey aged 15-29 were NEET, which is well above the OECD average of 15%, and low skills were a key barrier to achieving better labor market outcomes for youth in Turkey [14]. In fact, 57% of NEET individuals in the registry were early school-leavers. Although the patients were covered by social security regardless of their social status, effective policies are needed to improve the education, job, and career prospects of the patients up to at least the average of their peers. Taking into account that most children and adolescents in this cohort will be moving from childhood to adulthood in the near future, the transition from pediatric to adult care should also be adjusted appropriately. The wide molecular heterogeneity of Turkish thalassemic subjects has been confirmed by this registry. The most common seven mutations accounted for less than 80% of all thalassemia alleles, consistent with previous reports from Turkey [15,16,17,18,19,20]. The IVS-I-110(G->A) substitution was the most common defect with a frequency of 47% within all β-thalassemia alleles in the cohort. Five of the seven most common β-thalassemia alleles were either β0 (codon 39[C->T], IVSI-1[G->A], FSC8[-AA]) or severe β+ thalassemia (IVSI-110[G>A], IVSII-745[C->G]), whereas only two prevalent alleles (IVSI6[T->C], IVSII-1[G->T]) were related to mild β++-thalassemia mutations. It is suggested that improved tissue oxygenation by adequate transfusion regimens has considerably reduced the incidence of splenectomy within the first 10 years of life in thalassemic patients [21,22]. The unchanged needs for splenectomy in our patients from the mid-1970s to mid-2000s may be related to the low transfusion rates in Turkey. All guidelines provide age-specific recommendations for the initiation of ICT. In children <6 years old, all guidelines recommend DFO as the first-line choice and DFX as the second-line option for patients where DFO is ineffective or not tolerated. DFP is recommended for children >6 years old and/or as a second-line option if patients are resistant or intolerant to DFX [21,23]. Under the regulations of Turkey, all chelators have been approved as first-line treatment at the age of ≥2 years and DFX has been the first-line choice for more than 90% of patients. HSCT has remained the only curative treatment for TM. The Turkish Pediatric Bone Marrow Transplantation Group specifically collected the data of 245 thalassemic children who underwent HSCT and of whom 68% achieved thalassemia-free survival [24]. In this registry, only 96 patients were reported as having undergone HSCT. The missing registration data may result from the loss of follow-up of these patients because their health

Turk J Hematol 2018;35:12-18

care is usually moved from the TC to the transplantation center after HSCT. Nevertheless, there were 115 TM patients with an MSD but not yet transplanted and a further 417 patients with healthy sibling(s) with unknown HLA compatibility. These data indicate that the awareness of physicians and parents about this curative option should be increased. The widespread implementation of cardiac T2* MRI and appropriate intensification of chelation in those with cardiac iron overload reduced cardiac mortality significantly [2,3]. Survival data from three major TCs indicated that despite a gradual improvement in cardiac deaths in the at-risk population in 5-year cohorts since 1994, cardiac disease is still a major cause of early deaths and a sustained effort in dissemination of cardiac T2* MRI and optimum use of ICT should be maintained. The compliance with ICT remained the most important factor in ensuring the desired outcome for thalassemic patients and that may be strengthened by individualized treatment, careful monitoring, and continuous psychosocial support [2,25].

Aydınok Y, et al: A National Registry of Thalassemia in Turkey

Study Design: Y.A.; Data Collection or Processing: Y.A., Y.O., B.A., G.A., A.Y., S.Ü., Y.K., B.O., M.A., C.V., M.E., Ü.Ç., Ş.Ü., A.B., E.K., T.İ., D.A., T.P., S.K., M.S., M.A., A.A., M.B., G.A., Ö.B., N.S., N.K., E.U., M.T., A.A., S.O., A.M., H.T., Z.U., M.A.Ö., N.T., Z.K.; Analysis or Interpretation: Y.A.; Literature Search: Y.A.; Writing: Y.A. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Ehlers KH, Giardina PJ, Lesser ML, Engle MA, Hilgartner MW. Prolonged survival in patients with beta-thalassemia major treated with deferoxamine. J Pediatr 1991;118:540-545. 2. Modell B, Khan M, Darlison M, Westwood MA, Ingram D, Pennell DJ. Improved survival of thalassaemia major in the UK and relation to T2* cardiovascular magnetic resonance. J Cardiovasc Magn Reson 2008;10:42. 3. Borgna-Pignatti C, Cappellini MD, De Stefano P, Del Vecchio GC, Forni GL, Gamberini MR, Ghilardi R, Piga A, Romeo MA, Zhao H, Cnaan A. Cardiac morbidity and mortality in deferoxamine or deferiprone-treated patients with thalassemia major. Blood 2006;107:3733-3737.

Conclusion

4. Altay C, Yetgin S, Ozsoylu S, Kutsal A. Hemoglobin S and some other hemoglobinopathies in Eti-Turks. Hum Hered 1978;28:56-61.

In conclusion, many efforts have been directed toward optimizing patients’ management and implementing a prevention program in Turkey in the new millennium. The current data indicate that these efforts should be maintained to achieve further improvement in the survival and quality of life associated with better integration into social life for thalassemic patients. The developing strategies are also essential for further achievements in the prevention program.

5. Koçak R, Alparslan ZN, Ağridağ G, Başlamisli F, Aksungur PD, Koltaş S. The frequency of anaemia, iron deficiency, hemoglobin S and beta thalassemia in the south of Turkey. Eur J Epidemiol 1995;11:181-184.

Acknowledgments The authors thank Çağlar Serdar, Aylin Gökduman, and Tolga Turgay of Plexus Information Technologies for their website support. The current study and the work presented here are from an Investigator Initiated Trial, which was sponsored by the Ege Children’s Foundation and funded by Novartis Pharmaceuticals Corporation. Ethics Ethics Committee Approval: The website was launched after receiving the approval of the Ege University Faculty of Medicine Ethics Committee in October 2012 (B.30.2.EGE.0.20.05.00/ OY/1747-723 decision number: 12-5.2/11) and remained active until June 2015. Informed Consent: The electronic case report form for each patient with a thalassemia disease and variant hemoglobins and the signed informed consent form were completed by the investigators. Authorship Contributions

6. Canatan D, Kose MR, Ustundag M, Haznedaroglu D, Ozbas S. Hemoglobinopathy control program in Turkey. Community Genet 2006;9:124-126. 7. Cavdar AO, Arcasoy A. The incidence of-thalassemia and abnormal hemoglobins in Turkey. Acta Haematol 1971;45:312-318. 8. Dinçol G, Aksoy M, Erdem S. Beta-thalassaemia with increased haemoglobin A2 in Turkey. A study of 164 thalassaemic heterozygotes. Hum Hered 1979;29:272-278. 9. Bircan I, Sişli S, Güven A, Cali S, Yeğin O, Ertuğ H, Güven AG, Akar N. Hemoglobinopathies in the district of Antalya, Turkey. Pediatr Hematol Oncol 1993;10:289-291. 10. Aydinok Y, Oztop S, Nişli G, Kavakli K. Prevalence of beta-thalassaemia trait in 1124 students from Aegean region of Turkey. J Trop Pediatr 1997;43:184-185. 11. Koç A, Kösecik M, Vural H, Erel O, Ataş A, Tatli MM. The frequency and etiology of anemia among children 6-16 years of age in the southeast region of Turkey. Turk J Pediatr 2000;42:91-95. 12. Kilinç M, Yüregir GT, Ekerbiçer H. Anaemia and iron-deficiency anaemia in south-east Anatolia. Eur J Haematol 2002;69:280-283. 13. Canatan D. Thalassemias and hemoglobinopathies in Turkey. Hemoglobin 2014;38:305-307. 14. OECD. Employment Outlook 2016. Paris, OECD Publishing, 2016. 15. Nişli G, Kavakli K, Aydinok Y, Oztop S, Cetingül N. Beta-thalassemia alleles in Aegean region of Turkey: effect on clinical severity of disease. Pediatr Hematol Oncol 1997;14:59-65. 16. Tadmouri GO, Tüzmen S, Ozçelik H, Ozer A, Baig SM, Senga EB, Başak AN. Molecular and population genetic analyses of beta-thalassemia in Turkey. Am J Hematol 1998;57:215-220. 17. Cürük MA, Arpaci A, Attila G, Tuli A, Kilinç Y, Aksoy K, Yüreğir GT. Genetic heterogeneity of beta-thalassemia at Cukurova in southern Turkey. Hemoglobin 2001;25:241-245. 18. Ayçiçek A, Koç A, Özdemir ZC, Bilinç H, Koçyiğit A, Dilmeç F. Beta-globin gene mutations in children with beta-thalassemia major from Şanlıurfa province, Turkey. Turk J Haematol 2011;28:264-268.

Aydınok Y, et al: A National Registry of Thalassemia in Turkey

19. Aldemir O, Izmirli M, Kaya H. The spectrum of β-thalassemia mutations in Hatay, Turkey: reporting three new mutations. Hemoglobin 2014;38:325-328. 20. Ozkinay F, Onay H, Karaca E, Arslan E, Erturk B, Ece Solmaz A, Tekin IM, Cogulu O, Aydinok Y, Vergin C. Molecular basis of β-thalassemia in the population of the Aegean region of Turkey: identification of a novel deletion mutation. Hemoglobin 2015;39:230-234. 21. Cappellini MD, Cohen A, Porter J, Viprakasit V. Guidelines for the Management of Transfusion Dependent Thalassaemia (TDT), 3rd ed. Nicosia, Thalassaemia International Federation, 2014. 22. Piga A, Serra M, Longo F, Forni G, Quarta G, Cappellini MD, Galanello R. Changing patterns of splenectomy in transfusion-dependent thalassemia patients. Am J Hematol 2011;86:808-810.

Turk J Hematol 2018;35:12-18

23. Musallam KM, Angastiniotis M, Eleftheriou A, Porter JB. Cross-talk between available guidelines for the management of patients with beta-thalassemia major. Acta Haematol 2013;130:64-73. 24. Yesilipek MA, Ertem M, Cetin M, Öniz H, Kansoy S, Tanyeli A, Anak S, Kurekci E, Hazar V. HLA-matched family hematopoetic stem cell transplantation in children with beta thalassemia major: the experience of the Turkish Pediatric Bone Marrow Transplantation Group. Pediatr Transplant 2012;16:846-851. 25. Musallam K, Cappellini MD, Taher A. Challenges associated with prolonged survival of patients with thalassemia: transitioning from childhood to adulthood. Pediatrics 2008;121:1426-1429.

RESEARCH ARTICLE DOI: 10.4274/tjh.2017.0209 Turk J Hematol 2018;35:19-26

Biological Features of Bone Marrow Mesenchymal Stromal Cells in Childhood Acute Lymphoblastic Leukemia Çocukluk Çağı Akut Lenfoblastik Lösemisinde Kemik İliği Mezenkimal Stroma Hücrelerinin Biyolojik Özellikleri Stella Genitsari1, Eftichia Stiakaki1, Chryssoula Perdikogianni2, Pesmatzoglou1, Maria Kalmanti5, Helen Dimitriou1

Georgia Martimianaki3,

Iordanis Pelagiadis4,

Margarita

Crete University Faculty of Medicine, University Hospital of Heraklion, Department of Pediatric Hematology and Oncology, Crete, Greece Crete University Faculty of Medicine, Department of Pediatrics, Crete, Greece 3 Crete University Faculty of Medicine, Division of Mother and Child Health, Crete, Greece 4 Metropolitan Hospital, N. Faliro, Athens, Greece 5 Private Sector 1 2

Abstract

Öz

Objective: Mesenchymal stromal cells (MSCs) have a supportive role in hematopoiesis and as components of the bone marrow (BM) microenvironment may present alterations during acute lymphoblastic leukemia (ALL) and be affected by chemotherapeutic agents. We examined the biological and functional characteristics of MSCs in ALL diagnosis and treatment and their effect on MSC qualitative properties. Materials and Methods: Immunophenotypic characterization, evaluation of clonogenicity, and proliferative capacity were measured. Apoptotic features, cell-cycle analysis, and stromal cell-derived factor 1α and angiopoietin-1 levels in MSC supernatant at diagnosis and in different phases of treatment were assessed. Chemotherapy was administered according to the Berlin-Frankfurt-Munster-2000 protocol. BM samples from children with solid tumors without BM involvement were used as the control group. Results: The morphology, the immunophenotypic profile, and the apoptotic characteristics of the MSCs were not affected by leukemia. The secretion of factors involved in the trafficking of hematopoietic cells in the BM seems to be upregulated at diagnosis in comparison to the treatment phases. MSCs are influenced by the disease in terms of their functional characteristics such as clonogenicity and proliferation rate. These effects cease as soon as treatment is initiated. Chemotherapy does not seem to exert any effect on any of the MSC features examined. Conclusion: MSCs from children with ALL are affected by their interaction with the leukemic environment, but this phenomenon ceases upon treatment initiation, while no effect is observed by chemotherapy itself. Keywords: Bone marrow microenvironment, Childhood leukemia, Mesenchymal stromal cells, Stromal cell-derived factor 1α

Amaç: Mezenkimal stroma hücreleri (MSH) hematopoezde destek rolü oynar, kemik iliği (Kİ) mikroçevresinin parçası olduklarından akut lenfoblastik lösemide (ALL) değişikliğe uğrayabilir ve kemoterapötik ajanlardan etkilenebilirler. Bu çalışmada, ALL’de tanı anında ve tedavide MSH’lerin biyolojik ve fonksiyonel özellikleri ile bunların MSH’lerin niteliksel özellikleri üzerine olan etkilerini araştırdık. Gereç ve Yöntemler: İmmünofenotipik özellikler, klonalite değerlendirilmesi ve çoğalma kapasitesi ölçümleri yapıldı. Tanıda ve tedavinin değişik evrelerinde MSH süpernatanında apoptotik özellikler, hücre döngüsü analizi ve stromal hücre türevi factor-1α ile anjiyopoietin-1 düzeyleri değerlendirildi. Kemoterapi olarak BerlinFrankfurt-Munster-2000 protokolü uygulandı. Solid tümörü olan ve Kİ tutulumu bulunmayan hastaların Kİ örnekleri kontrol grubu olarak kullanıldı. Bulgular: MSH’lerin morfoloji, immünofenotipik profil ve apoptotik özellikleri açısından lösemiden etkilenmediği görüldü. Hematopoetik hücrelerinin Kİ’de yer değiştirmesi üzerine etkisi olabilen faktörlerinin salınımının tanıda, tedavi evrelerine göre upregüle olduğu tespit edildi. MSH’ler hastalıktan klonalite ve çoğalma hızı gibi fonksiyonel özellikler kapsamında etkilenmekteydi. Bu etkiler tedavi başlanması ile duraklamaktaydı. Kemoterapinin incelenen MSH özelliklerinden hiçbiri üzerine bir etkisi olmadığı görüldü. Sonuç: ALL’si olan çocuklardaki MSH’ler lösemik çevre ile ilişkilerden etkilenir, ancak bu fenomen tedavi başlanması ile duraklar ve bu çalışmada kemoterapinin bunun üzerine bir etkisi gözlenmemiştir. Anahtar Sözcükler: Kemik iliği mikroçevresi, Çocukluk çağı lösemisi, Mezenkimal stroma hücreleri, Stromal hücre türevi factor-1α

Address for Correspondence/Yazışma Adresi: Helen DIMITRIOU, PhD, Crete University Faculty of Medicine, University Hospital of Heraklion, Department of Pediatric Hematology and Oncology, Crete, Greece Phone : +30 2810 394 674 E-mail : lena.dimitriou@uoc.gr ORCID-ID: orcid.org/0000-0001-9142-907X

Received/Geliş tarihi: May 24, 2017 Accepted/Kabul tarihi: September 08, 2017

Genitsari S, et al: MSCs in Childhood ALL

Introduction Mesenchymal stromal cells (MSCs) constitute part of the bone marrow (BM) microenvironment where the survival, proliferation, and differentiation of hematopoietic stem cells (HSCs) take place [1]. Despite the large amount of information on the nature of MSCs, they have not been fully characterized so far. The in vivo counterparts or possibly precursors of culturedeveloped MSCs are currently considered to be perivascular cells, namely pericytes. These two-cell populations share similar properties in terms of marker expression, ability to self-renew, and potential to differentiate into multiple cell types such as adipocytes, chondrocytes, osteocytes, and myocytes under specified culture conditions [2,3]. The BM microenvironment is believed to play a pivotal role in the development and progression of leukemia [4]; thus, it is reasonable to speculate that MSCs may also be involved in the perturbation of normal hematopoiesis. Their putative role in oncogenesis and leukemogenesis has not been fully clarified and the results from the studies already published are contradictory. In vitro studies have shown that MSCs from newly diagnosed adult patients with leukemia (acute myeloid leukemia and acute lymphoblastic leukemia) are less efficient for supporting normal hematopoietic progenitor cell survival and this functional capacity is partially restored after chemotherapy [5]. Their implication in childhood ALL has only recently being addressed, revealing that ALLMSCs display reduced proliferative capacity and ability to support long-term hematopoiesis in vitro while those isolated at diagnosis did not differ from those obtained during treatment [6]. The detection of leukemia-associated genetic aberrations in MSCs implied a clonal relationship between MSCs and leukemia cells in childhood ALL and suggested the involvement of MSCs in the pathogenesis of the disease [7]. Involvement of MSCs in various malignancies via deregulation of the secretion of chemokines [8,9,10] implies that they mediate cell migration and homing [11]. Stromal cellderived factor 1α (SDF-1α or CXCL12) was found to retain and support the HSCs in the BM via the SDF-1α/CXCR4 axis [12,13]. CXCL12 is constitutively secreted by marrow stromal cells, being the major source for CXCL12 in adults [14]. Less is known about its role in hematological malignancies and how it could be affected during chemotherapy. The existing studies have come to conflicting results [8,15]. Angiopoietin-1 (Ang1), initially known for its role in both embryonic and postnatal angiogenesis, has recently been reported to interact with HSCexpressed Tie-2 [3,16], enhancing the maintenance of HSCs in a quiescent state within the BM, and Ang-1 is thereby part of the network regulating the “stemness” of HSCs [17]. MSCs have been considered promising candidates for cell therapies and, in view of their potential, there are many ongoing studies to understand their properties, mechanisms of action, and putative role in hematological malignancies [7,18,19,20]. So 20

Turk J Hematol 2018;35:19-26

far MSCs from different sources have been shown to exhibit different properties [21]. Moreover, BM MSCs from children seem to be different from their adult counterparts [22]. The aim of this study is to characterize MSCs derived from the BM of children with ALL at the onset of the disease in order to evaluate the leukemic effect, if any, on their biological/ functional properties. In addition, an attempt was made to compare this population with the MSCs derived from the BM during different treatment phases for the assessment of the effect of chemotherapy on these features.

Materials and Methods Patients BM samples from children with B-lineage ALL and >90% BM infiltration at diagnosis, hospitalized from 2006 to 2010 at the Department of Pediatric Hematology and Oncology, University Hospital of Heraklion, were studied. They included samples at diagnosis (d, n=28), day 15 (d15, n=12), day 33 of induction therapy (d33, n=20) when remission was achieved, at intensification-consolidation (consol, n=33), during maintenance (maint, n=19) therapy, and at the end of treatment (end, n=20), all in remission. MSCs examined at different phases of ALL treatment are not necessarily in all cases from the same patients. Patients were treated according to the ALL BerlinFrankfurt-Munster-2000 protocol and their risk stratification [medium risk (MR) and high risk (HR)] according to the same protocol was considered in some of the employed assays. The control group (n=15) consisted of BM samples from children with solid tumors without BM involvement. Patients’ ages ranged from 1.2 to 18 years (median: 6 years). The study was approved by the Ethical Committee of the University Hospital of Heraklion. Methods are described in more detail in the Appendix (Supplementary Materials and Methods). BM Mononuclear Cells (MNCs) Isolation and MSC Culture and Expansion BM MNCs, following Ficoll-Hypaque separation (1077 g/mL; Lymphoprep, Nycomed, Oslo, Norway), were cultured in a-MEM as described previously for MSC development [22]. MSCs were maintained for up to five passages. Assays were performed at any of P1 to P4 depending on the cell availability. Immunophenotyping Evaluation Phenotypic characterization of MSCs was performed by flow cytometry at various passages using hematopoietic cell and MSC-specific monoclonal antibodies (BD Biosciences, San Jose, CA, USA). One hundred thousand cells were stained with the markers as described previously [23]. At least 10,000 events were acquired for each analysis.

Genitsari S, et al: MSCs in Childhood ALL

Turk J Hematol 2018;35:19-26

than 0.05 were considered as statistically significant. Analysis was performed using SPSS 18.0 (SPSS Inc., Chicago, IL, USA).

Cell Doubling Time (DT) DT was calculated according to the formula DT=t/n=t×log(2)/log (cells harvested/cells inoculated), where t is the time between initial plating and harvest for the respective passage.

Results Morphology and Immunophenotypic Profile

Colony Forming Units-Fibroblast (CFU-F) Formation

BM MSCs from all groups were expanded until the fifth passage and all displayed the characteristic spindle-shape morphology. Immunophenotypic assays at P2 and P4 did not identify any differences among groups. MSCs at diagnosis expressed CD90 (99.67±0.09%), CD105 (97.39±0.72%), CD146 (59.55±2.84%), CD29 (99.1±0.12%), CD44 (98.07±1.39%), CD95 (90.25±2.85%), and CD73 (99.4±0.4%), while there was no expression of hematopoietic markers such as CD34, CD45, and CD14. The same immunophenotypic profile was also observed at all treatment phases and in the control group.

At day 0, 1x105 MNCs were seeded in each well of a 24-well plate (in triplicate) in the absence of fibroblast growth factor-2 (FGF2). At subsequent passages, MSCs were plated in 20-cm2 petri plates at a concentration of 10 cells/cm2 (in duplicate). The colonies that developed were categorized according to their size as small (S), medium (M), and large (L, highly proliferating) CFU-F. The sum of all sizes is denoted as CFU-F. Cell-Cycle Analysis - Apoptosis MSCs at either P2 or P3 were stained with propidium iodide in order to estimate the percentage of cells in each phase of the cell cycle. Cell-cycle analysis was performed using WinMDI software version 2.8 [24].

Growth Rate of MSCs (DT) MSCs within the MNC fraction (d0) at diagnosis reached confluency in approximately 20.71±1.24 days, whereas at the end of chemotherapy they required 15.10±0.63 days. The DT at

Apoptotic MSCs at passages P2 and P4 were detected by flow cytometry and 7-amino-actinomycin D (7-AAD; Sigma, St. Louis, MO, USA) staining [25]. Detection of SDF-1α and Ang-1 (ELISA) A quantitative sandwich enzyme-linked immunosorbent assay technique (ELISA) was employed for the determination of both SDF-1α and Ang-1 (R&D Systems, Minneapolis, MN, USA) in the supernatant of MSCs at any of P1 to P3 cultures (and of MNCs at d0) within the leukemia group only, at diagnosis, and during treatment phases following the instructions of the manufacturer.

Figure 1. Days required for mesenchymal stromal cells in the mononuclear cells fraction (d0) to reach confluency. The doubling time at diagnosis differs from that of the phases of chemotherapy (p: d15=0.042, d33=0.007, consol=0.001, maint=0.022, end=0.002) and of the control (p=0.011). This defect subsides with the progression of culture (*: ss in comparison to the d group).

Statistical Analysis Results are expressed as mean ± standard error of the mean mean (SEM). Differences between groups were assessed using the nonparametric Mann-Whitney U-test and p-values lower

Table 1. Doubling time of mesenchymal stromal cells of all groups in the different passages (P1-P5). P1

3.30±0.41

3.07±0.58

4.20±0.80

5.37±1.06

4.75±0.95

d15

2.39±0.31

5.49±1.18

4.80±1.22

3.83±0.97

3.82±0.69

d33

2.57±0.24

2.86±0.35

3.47±0.42

3.85±0.61

3.82±0.41

Consol

2.59±0.19

2.72±0.23

3.24±0.30

4.12±0.61

4.50±0.93

Maint

3.44±0.53

5.98±1.17

3.57±0.49

3.18±0.52

4.21±0.50

End

2.49±0.20

2.59±0.25

2.57±0.32

3.41±0.38

3.73±0.40

CTL

2.34±0.11

3.03±0.31

2.42±0.25

4.41±1.07

4.47±2.13

Data are expressed as mean ± SEM.

Genitsari S, et al: MSCs in Childhood ALL

Turk J Hematol 2018;35:19-26

diagnosis was statistically different compared to all the phases of treatment (Figure 1). At subsequent passages, DT was similar among all groups (Table 1). This finding indicates that MSCs present in the MNC fraction at diagnosis, which was mainly constituted of lymphoblasts, expanded more slowly compared to treatment phases and the control group, but this defect subsided with the progression of culture (more advanced P). No difference was observed among all passages in all other studied groups. As the culture progressed, DT increased in all groups and the control.

constant finding, observed at subsequent passages as well (Table 2). Culture progression resulted in lower colony development, the control included, and this became statistically significant at the later passages (P1 vs. P4 or P5, p<0.001). MSCs at diagnosis formed fewer small, medium, and large colonies compared to all other groups. Larger colonies prevailed at early passages, while at the later ones, the CFU-F population consisted of mainly small colonies (Supplementary Figure 1). Cell-Cycle Analysis - Apoptosis Most of the MSCs were in quiescence, presenting a higher percentage of cells in the G0G1 phase compared to the control group (Figure 3). The study of apoptosis in all phases of disease and treatment at P2 and P4 confirmed the stability of BM-MSCs under long-term culture expansion through serial passages. Spontaneous apoptosis was detected at P2 and it did not change at P4 in all groups (Table 3).

CFU-F Development At day 0, the CFU-F formation at diagnosis appeared to be impaired compared to the other groups (Figure 2), a result attributed to the lower number of the medium and the large-sized colonies. The impaired clonogenicity of MSCs at the time of diagnosis was a

Figure 3. Analysis of the cell-cycle phases. Most of the mesenchymal stromal cells are in quiescence as the highest percentage of cells are in the G0G1 phase.

Figure 2. Colony forming units-fibroblast development of mesenchymal stromal cells in the mononuclear cells fraction (d0) from all studied groups. The number of colonies at diagnosis is lower than that of the other groups (d vs. end, control: p<0.0001). Culture progression resulted in lower colony development, becoming significant at the later passages.

Data are expressed as mean ± SEM. SDF-1α and Ang-1

Data are expressed as mean ± SEM (*: p<0.05 compared to diagnosis).

SDF-1α in the MSC supernatants at diagnosis was variably expressed (median: 5334.63 pg/mL, range: 1066.70-22,480.86 pg/mL)

CFU-F: Colony forming units.

Table 2. Colony forming units-fibroblast development of mesenchymal stromal cells from all studied groups (P1-P5). P1

26.80±2.79

21.39±3.63

19.61±4.69

23.59±3.45

19.46±3.55

d15

45.08±5.72*

34.96±5.44*

37.73±6.01*

17.59±3.48

7.82±2.21

d33

38.52±3.52*

41.40±2.87*

32.06±3.51*

21.11±2.90

17.11±2.41

Consol

47.10±3.10*

34.47±2.68*

26.78±2.30*

24.83±3.33

27.94±3.25

Maint

46.15±3.28*

33.63±3.99*

31.93±2.63*

26.50±3.32

15.12±2.02

End

48.34±4.43*

41.23±4.48*

34.20±4.28*

24.50±3.52

29.00±3.30

CTL

57.27±4.47*

43.53±3.71*

37.38±5.40*

35.67±3.2*

38.83±6.05*

Data are expressed as mean ± SEM. *Statistical significance in comparison to the d group.

Genitsari S, et al: MSCs in Childhood ALL

Turk J Hematol 2018;35:19-26

Supplementary Figure 1. Colony forming units-fibroblast (CFU-F) colonies of large (L), medium (M), and small (S) size at the initial (P1) and last (P5) passages of the study. Larger colonies prevail at early passages while at the later ones the CFU-F population consists of mainly small colonies. Table 3. Spontaneous apoptosis, evaluated by flow cytometry after 7-amino-actinomycin D staining of mesenchymal stromal cells at diagnosis and during treatment at passages 2 and 4 (P2, P4). Study group

P2 (%)

P4 (%)

4.92±2.38

2.5±0.94

3.47±0.97

2.37±1.15

d15

2.48±0.86

1.97±1.21

2.82±0.65

1.97±1.21

d33

2.65±0.59

1.07±0.56

1.42±0.27

0.52±0.25

Consol

2.01±0.45

1.4±0.38

2.2±0.32

1.05±0.21

Maint

1.97±0.38

0.97±0.57

1.2±0.65

1.67±1.2

End

2.94±0.93

3.78±1.33

1.62±0.77

1.45±1.02

CTL

1.75±0.29

0.58±0.16

0.92±0.37

0.27±0.14

Values are expressed as mean ± SEM. A: Apoptotic cells, D: dead cells.

and did not differ in comparison with the treatment phases. Its levels were higher in the HR group compared to the MR group (HR=9205.77±2721.82, MR=6686.11±4006.34, p=0.021). As far as Ang-1 expression is concerned, in the two cell subpopulations of MNCs and MSCs, our results showed that, similar to SDF-1α, stromal cells secreted statistically significant higher amounts of this growth factor (Figure 4). No difference was found in the comparison of diagnosis with treatment groups.

Discussion MSCs are described as fibroblast-like cells, displaying a characteristic spindle shape, and all of our cells exhibited this feature. As in vitro culture progresses, cells enter senescence and MSCs become larger with irregular and flat shapes [26], not observed in our samples. Our source though was the BM of children, albeit leukemic BM, and our culture was followed up to P5 [27]. 23

Genitsari S, et al: MSCs in Childhood ALL

Turk J Hematol 2018;35:19-26

that leukemic cells do not confer to MSCs any preferential ability to proliferate, but they rather promote a deficient capacity, opposing the hypothesis that MSC populations might be crucial for the efficient promotion of the survival and proliferation of blasts [30]. Treatment does not affect the clonogenicity as the number of colonies produced at any time-point is similar to that of the controls. Another factor involved in colony development is the duration of the culture. Interestingly, the decrease of colony number throughout passages is more profound in largeand medium-sized colonies. Considering that large colonies derive from more primitive cells, it becomes obvious that older cultures contain more mature MSCs. Altogether, the above indicate that the presence of leukemia cells at diagnosis, but not chemotherapeutic agents, modifies BM-MSC properties.

Figure 4. The stromal cell-derived factor-1α (SDF-1α) and angiopoietin-1 (Ang-1) expressions by both mesenchymal stromal cells (MSCs) and mononuclear cells (MNCs) at diagnosis and treatment. Stromal cells secrete higher amounts of both these factors. A) Variability in their expression was noticed at diagnosis, which became more uniform in treatment phases. B) No difference in angiopoietin-1 levels between diagnosis and treatment groups. MSC: Mesenchymal stromal cell, MNC: mononuclear cell, Ang-1: angiopoietin-1, SDF-1α: stromal cell-derived factor-1α.

MSCs from all groups at different passages were highly expressing MSC-related markers and lacking the hematopoietic markers, as proposed by the International Society for Cell Therapy [28,29]. This indicates that the MSC cultures were homogeneous, in agreement with Conforti et al. [6], and neither disease nor treatment had any influence on them. Clonogenicity and proliferation potential were lower at diagnosis and decreased as the culture progressed, in partial agreement with the only study, so far, examining the characteristics of pediatric ALL-MSCs [6]. The lowest number of colonies was developed at diagnosis. Although this result does not stand alone to support that it is an intrinsic defect (because of the effect of the disease on MSCs) rather than a quantitative one, due to the lower frequency of MSCs in BM infiltrated by leukemic cells combined, with the fact that it continues to be seen in subsequent passages, where the same number of MSCs are used to initiate the culture, it is more suggestive of the hypothesis that the microenvironment (as expressed by BM MSCs) is also affected by the leukemic process. This result favors the observation of Conforti et al. [6] 24

Cell-cycle analysis revealed that most of the MSCs are in quiescence while about 20% of the cells of the control group are at the S phase, compared to less than 10% of the rest of the groups. Further analysis is required in order to fully clarify this difference found under identical culture conditions. Apoptosis remained unaltered throughout passages, a finding reported for BM-MSCs from children with benign hematological disorders [26]. Conforti et al. [6] reported different results, but they evaluated apoptosis for many passages and reported data for the latest one (P18). Finally, we evaluated the levels of SDF-1α and Ang-1, recently revealed as major regulators in the crosstalk between hematopoietic progenitors and their microenvironment [31,32]. Data reporting the expression of SDF-1α by BM MSCs in patients with hematological malignancies are limited. SDF-1α in the supernatant of MSCs at diagnosis of ALL was slightly increased compared to that from treatment phases, although this difference was not statistically verified. Interestingly, HR patients exhibited higher levels compared to the MR ones, a difference no longer occurring upon treatment initiation. Reduced extracellular levels of SDF-1α were assessed in hematological malignancies of adults [33,34]. Others found increased SDF-1α secretion from MSCs at diagnosis in adolescents and young adults with ALL, reversed by chemotherapy [6]. In pediatric patients with acute leukemia, SDF-1α serum levels differed depending on whether they were evaluated in PB or BM serum (decreased expression) or MSC supernatants at diagnosis (decrease not evident) compared to the remission and control groups [15]. The above, combined with our findings, further support the notion that leukemic cells do not affect CXCL12 production and the decrease reported in serum cannot be attributed to the productive capacity of MSCs. We found that the lowest amount of Ang-1 was expressed in MSC culture supernatant from diagnosis, albeit not statistically differently from treatment phases. There is one more study to date, on the effect of Ang-1 in childhood ALL [35], in which the authors claimed similar findings in the MSC supernatant and low levels of Ang-1 and Ang-2 in BM serum at diagnosis. Nevertheless, other factors such as age-related

Genitsari S, et al: MSCs in Childhood ALL

Turk J Hematol 2018;35:19-26

post-transcriptional effect on the expression of proteins or the exposure of BM MSCs to fetal bovine serum and FGF-b [36] have to be taken into consideration in order to fully exploit the role of these molecules in leukemia. Study Limitation A limitation of our study is that the samples examined at different phases of ALL are not necessarily from the same patients longitudinally. This approach ensures a reasonable number of samples within a reasonable timeframe for each group for a rather rare pediatric entity and hence a stronger statistical result.

Conclusion In conclusion, biological characteristics and functional properties of MSCs are affected at the onset of leukemia. Most defects persist throughout passages. MSCs recover after treatment initiation and remission achievement and are not affected by chemotherapy. Their secretory profile remains unaltered by the disease. The summing of these data clearly indicates that any effect on MSCs from the leukemic clones in childhood ALL is transient and ceases upon treatment initiation. A standard hurdle in the comparison of our data to other studies continues to be the diversity of working protocols used for MSC cultures and further evaluation. Acknowledgments The authors would like to thank Kaparou Maria and Fillipides Anthi for their contributions in the performance of a number of experiments, Choumerianou Despina for her contribution in experiments and helpful suggestions, and Koutala Helen for technical advice and support in flow cytometry. Ethics Ethics Committee Approval: The study was approved by the Ethical Committee of the University Hospital of Heraklion. Authorship Contributions Medical Practices: E.S., M.K., C.P.; Concept: H.D., I.P., C.P., E.S.; Design: H.D., I.P., C.P., E.S.; Data Collection or Processing: S.G., H.D., G.M., I.P., M.P.; Analysis or Interpretation: S.G., M.P., H.D., I.P., C.P., E.S., M.K.; Literature Search: S.G., I.P., H.D., G.M., Writing: H.D.; S.G., C.P. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included. Financial Disclosure: This work was partially supported by the European 6th Framework Program GENOSTEM (contract no: 503161) and the University of Crete Secretariat Research Committee (KA 3769).

References 1. El Marsafy S, Larghero J, Bennaceur-Griscelli A, Turhan A. Mesenchymal stem cells: pivotal players in hematopoietic stem cell microenvironment. J Stem Cell Res Ther 2014;4:225. 2. Wong SP, Rowley JE, Redpath AN, Tilman JD, Fellous TG, Johnson JR. Pericytes, mesenchymal stem cells and their contributions to tissue repair. Pharmacol Ther 2015;151:107-120. 3. Sacchetti B, Funari A, Michienzi S, Di Cesare S, Piersanti S, Saggio I, Tagliafico E, Ferrari S, Robey PG, Riminucci M, Bianco P. Self-renewing osteoprogenitors in bone marrow sinusoids can organize a hematopoietic microenvironment. Cell 2007;131:324-336. 4. Sanchez-Aguilera A, Mendez-Ferrer S. The hematopoietic stem-cell niche in health and leukemia. Cell Mol Life Sci 2017;74:579-590. 5. Sorokina T, Shipounova I, Bigildeev A, Petinati N, Drize N, Turkina A, Chelysheva E, Shukhov O, Kuzmina L, Parovichnikova E, Savchenko V. The ability of multipotent mesenchymal stromal cells from the bone marrow of patients with leukemia to maintain normal hematopoietic progenitor cells. Eur J Haematol 2016;97:245-252. 6. Conforti A, Biagini S, Del Bufalo F, Sirleto P, Angioni A, Starc N, Li Pira G, Moretta F, Proia A, Contoli B, Genovese S, Ciardi C, Avanzini MA, Rosti V, Lo-Coco F, Locatelli F, Bernardo ME. Biological, functional and genetic characterization of bone marrowderived mesenchymal stromal cells from pediatric patients affected by acute lymphoblastic leukemia. PLoS One 2013;8:e76989. 7. Shalapour S, Eckert C, Seeger K, Pfau M, Prada J, Henze G, Blankenstein T, Kammertoens T. Leukemia-associated genetic aberration in mesenchymal stem cells of children with acute lymphoblastic leukemia. J Mol Med (Berl) 2010;88:249-265. 8. Ge J, Hu Y, Gui Y, Hou R, Yang M, Zeng Q, Xia R. Chemotherapy-induced alteration of SDF-1/CXCR4 expression in bone marrow-derived mesenchymal stem cells from adolescents and young adults with acute lymphoblastic leukemia. J Pediatr Hematol Oncol 2014;36:617-623. 9. Azab AK, Runnels JM, Pitsillides C, Moreau AS, Azab F, Leleu X, Jia X, Wright R, Ospina B, Carlson AL, Alt C, Burwick N, Roccaro AM, Ngo HT, Farag M, Melhem MR, Sacco A, Munshi NC, Hideshima T, Rollins BJ, Anderson KC, Kung AL, Lin CP, Ghobrial IM. CXCR4 inhibitor AMD3100 disrupts the interaction of multiple myeloma cells with the bone marrow microenvironment and enhances their sensitivity to therapy. Blood 2009;113:4341-4351. 10. Noh YH, Yim YS, Kim DH, Lee MW, Kim DS, Kim HR, Lee SH, Chueh HW, Choi SJ, Oh WI, Yang YS, Jung HL, Yoo KH, Sung KW, Koo HH. Correlation between chemokines released from umbilical cord blood-derived mesenchymal stem cells and engraftment of hematopoietic stem cells in nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice. Pediatr Hematol Oncol 2011;28:682-690. 11. Fouillard L, Francois S, Bouchet S, Bensidhoum M, Elm’selmi A, Chapel A. Innovative cell therapy in the treatment of serious adverse events related to both chemoradiotherapy protocol and acute myeloid leukemia syndrome: the infusion of mesenchymal stem cells post-treatment reduces hematopoietic toxicity and promotes hematopoietic reconstitution. Curr Pharm Biotechnol 2013;14:842-848. 12. Van Overstraeten-Schloge N, Beguin Y, Gothot A. Role of stromal derived factor-1 in the hematopoietic-supporting activity of human mesenchymal stem cells. Eur J Haematol 2006:76:488-493. 13. Sharma MB, Limaye LS, Kale VP. Mimicking the functional hematopoietic stem cell niche in vitro: recapitulation of marrow physiology by hydrogel-based threedimensional cultures of mesenchymal stromal cells. Haematologica 2012;97:651660. 14. Burger JA, Kipps TJ. CXCR4: a key receptor in the crosstalk between tumor cells and their microenvironment. Blood 2006;107:1761-1767. 15. Van den Berk LC, van der Veer A, Willemse ME, Theeuwes MJ, Luijendijk MW, Tong WH, van der Sluis IM, Pieters R, den Boer ML. Disturbed CXCR4/CXCL12 axis in paediatric precursor B-cell acute lymphoblastic leukaemia. Br J Haematol 2014;166:240-249. 16. Fukuhara S, Sako K, Noda K, Nagao K, Miura K, Mochizuki N. Tie2 is tied at the cell-cell contacts and to extracellular matrix by angiopoietin-1. Exp Mol Med 2009;41:133-139. 17. Arai F, Hirao A, Ohmura M, Sato H, Matsuoka S, Takubo K, Ito K, Koh GY, Suda T. Tie2/ angiopoietin-1 signaling regulates hematopoietic stem cell quiescence in the bone marrow niche. Cell 2004;118:149-161.

Genitsari S, et al: MSCs in Childhood ALL

18. Blau O, Hofmann WK, Baldus CD, Thiel G, Serbent V, Schümann E, Thiel E, Blau IW. Chromosomal aberrations in bone marrow mesenchymal stroma cells from patients with myelodysplastic syndrome and acute myeloblastic leukemia. Exp Hematol 2007;35:221-229. 19. Menendez P, Catalina P, Rodriguez R, Melen GJ, Bueno C, Arriero M, García-Sánchez F, Lassaletta A, García-Sanz R, García-Castro J. Bone marrow mesenchymal stem cells from infants with MLL-AF4+ acute leukemia harbor and express the MLL-AF4 fusion gene. J Exp Med 2009;206:3131-3141. 20. Zhao Z, Tang X, You Y, Li W, Liu F, Zou P. Assessment of bone marrow mesenchymal stem cell biological characteristics and support hematopoiesis function in patients with chronic myeloid leukemia. Leuk Res 2006;30:993-1003. 21. Karaöz E, Çetinalp Demircan P, Erman G, Güngörürler E, Eker Sarıboyacı A. Comparative analyses of immune-suppressive characteristics of bone-marrow, Wharton’s jelly, and adipose tissue-derived human MSCs. Turk J Hematol 2017;34:213-225. 22. Choumerianou DM, Martimianaki G, Stiakaki E, Kalmanti L, Kalmanti M, Dimitriou H. Comparative study of stemness characteristics of mesenchymal cells from bone marrow of children and adults. Cytotherapy 2010;12:881-887. 23. Dimitriou H, Linardakis E, Martimianaki G, Stiakaki E, Perdikogianni CH, Charbord P, Kalmanti M. Properties and potential of bone marrow mesenchymal stromal cells from children with hematologic diseases. Cytotherapy 2008;10:125-133.

Turk J Hematol 2018;35:19-26

27. Stolzing A, Jones E, McGonagle D, Scutt A. Age-related changes in human bone marrow-derived mesenchymal stem cells: consequences for cell therapies. Mech Ageing Dev 2008;129:163-173. 28. Horwitz EM, Le Blanc K, Dominici M, Mueller I, Slaper-Cortenbach I, Marini FC, Deans RJ, Krause DS, Keating A; International Society for Cellular Therapy. Clarification of the nomenclature for MSC: the International Society for Cellular Therapy position statement. Cytotherapy 2005;7:393-395. 29. Lv FJ, Tuan RS, Cheung KM, Leung VY. Concise review: the surface markers and identity of human mesenchymal stem cells. Stem Cells 2014;32:1408-1419. 30. Nagasawa T. Microenvironmental niches in the bone marrow required for B-cell development. Nat Rev Immunol 2006;6:107-116. 31. Gomes AC, Gomes MS. Hematopoietic niches, erythropoiesis and anemia of chronic infection. Exp Hematol 2016;44:85-91. 32. Nie Y, Han YC, Zou YR. CXCR4 is required for the quiescence of primitive hematopoietic cells. J Exp Med 2008;205:777-783. 33. Ge J, Hou R, Liu Q, Zhu R, Liu K. Stromal-derived factor-1 deficiency in the bone marrow of acute myeloid leukemia. Int J Hematol 2011;93:750-759.

24. Nicoletti I, Migliorati G, Pagliacci MC, Grignani F, Riccardi C. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J Immunol Methods 1991;139:271-279.

34. Khandany BK, Hassanshahi G, Khorramdelazad H, Balali Z, Shamsizadeh A, Arababadi MK, Ostadebrahimi H, Fatehi A, Rezazadeh M, Ahmadi Z, Karimabad MN. Evaluation of circulating concentrations of CXCL1 (Gro-α), CXCL10 (IP-10) and CXCL12 (SDF1) in ALL patients prior and post bone marrow transplantation. Pathol Res Pract 2012;208:615-619.

25. Lecoeur H, Ledru E, Prevost MC, Gougeon ML. Strategies for phenotyping apoptotic peripheral human lymphocytes comparing ISNT, annexin V and 7-AAD cytofluorometric staining methods. J Immunol Methods 1997;209:111-123.

35. Karakurt N, Aksu T, Koksal Y, Yarali N, Tunc B, Uckan-Cetinkaya D, Ozguner M. Angiopoietins in the bone marrow microenvironment of acute lymphoblastic leukemia. Hematology 2016;21:325-331.

26. Wagner W, Horn P, Castoldi M, Diehlmann A, Bork S, Saffrich R, Benes V, Blake J, Pfister S, Eckstein V, Ho AD. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One 2008;3:e2213.

36. Pelagiadis I, Stiakaki E, Choulaki C, Kalmanti M, Dimitriou H. The role of children’s bone marrow mesenchymal stromal cells in the ex vivo expansion of autologous and allogeneic hematopoietic stem cells. Cell Biol Int 2015;39:1099-1110.

Appendix: Supplementary Materials and Methods BM MNC Isolation and MSC Culture and Expansion BM MNCs, following separation with Ficoll-Hypaque (1077 g/mL; Lymphoprep, Nycomed, Oslo, Norway), were cultured in a-MEM without nucleotides in the presence of 10% lot-selected fetal calf serum (Invitrogen Ltd., Paisley, UK) as described previously [21]. They were seeded at a concentration of 5x104 cells/cm2 in the presence of 1 ng/ mL FGF-2 (FGF-2; Abcys SA, Paris, France). A complete medium change was performed twice a week. When layers became confluent at ~90%, cells were detached using 0.25% trypsin/1 mM EDTA (Invitrogen Ltd.) and then replated at a concentration of 1x103 cells/ cm2 (passage 1, P1). MSCs were maintained in culture for up to five passages. Assays were performed at any of P1 to P4 depending on the cell availability. Immunophenotyping Evaluation Phenotypic characterization of MSCs was performed by flow cytometry at various passages using the following monoclonal antibodies: CD105-phycoerythrin (PE) CD146-PE, CD73-PE CD29-fluorescein isothiocyanate (FITC), CD44-FITC, CD90-FITC, CD14-FITC, CD45-FITC, CD34-PE, and CD95-FITC (BD Biosciences, San Jose, CA, USA). One hundred thousand cells were stained with the markers as described previously [21]. At least 10,000 events were acquired for each analysis. Cell-Cycle Analysis - Apoptosis MSCs, at either P2 or P3, after detachment by trypsinization (trypsin/EDTA 0.25%) were centrifuged at 150 x g for 10 min at 4 °C and washed with PBS. In order to estimate the percentage of cells in each phase of the cell cycle, 1x106 MSCs were stained with 1 mL of propidium iodide staining solution (50 µg/mL propidium iodide, 1 mg/mL RNAse in PBS without Ca++/Mg++, pH 7.4) for 30 min at room temperature. After the acquisition of at least 10,000 events for each sample, cells were gated according to forward vs. side scatter (FSC/SSC) characteristics. Cell-cycle analysis was performed using WinMDI software, version 2.8 [22]. Apoptotic MSCs at passages P2 and P4 were detected by flow cytometry and 7-aminoactinomycin D (7-AAD; Sigma, St. Louis, MO, USA) staining [23]. They were initially

gated according to their morphology (FSC/SSC). Then a scattergram was generated by combining FSC with 7-AAD fluorescence to quantitate 7-AADnegative (alive), 7-AADlow (early apoptotic), and 7-AADhigh (late apoptotic/dead) cells. Cell DT DT was calculated according to the formula DT=t/n=t×log(2)/log (cells harvested/cells inoculated), where t is the time between initial plating and harvest for the respective passage. CFU-F Formation At day 0, 1x105 MNCs were seeded in each well of a 24-well plate (in triplicate) in the absence of FGF-2. At subsequent passages, MSCs were plated in 20-cm2 petri plates at a concentration of 10 cells/cm2 (in duplicate). Following 14 days of culture at 37 °C and 5% CO2, CFU-F was quantified after staining with Giemsa stain and categorized according to size as small CFU-F (S: <50 cells), medium CFU-F (M: 50-500 cells), and large CFU-F (highly proliferating; L: >500 cells). The sum of CFU-F of all sizes is denoted as CFU-F. Detection of SDF-1α and Ang-1 (ELISA) A quantitative sandwich ELISA was employed for the determination of both SDF-1α and Ang-1 in the supernatant of MSCs at any of P1 to P3 cultures (and of MNCs at d0) within the leukemia group only. All subgroups were examined for the evaluation of these factors through the whole course of the disease, diagnosis, and treatment. The ELISA kits were purchased from R&D Systems, and the instructions of the manufacturer were followed. More specifically, 100 µL for SDF-1α (50 µL for Ang-1) of standard or sample per well was added and incubated for 2 h at room temperature on a shaker. After well aspiration and washing, 200 µL of the corresponding conjugate was added. Incubation was continued for 2 h further under the same conditions. After washing, 200 µL of substrate solution was added to each well for 30 min at room temperature and then 50 µL of stop solution terminated the reaction. The optical density of each well was determined at 450 nm with wavelength correction at 570 nm.

RESEARCH ARTICLE DOI: 10.4274/tjh.2017.0021 Turk J Hematol 2018;35:27-34

Juvenile Myelomonocytic Leukemia in Turkey: A Retrospective Analysis of Sixty-five Patients Türkiye’de Juvenil Miyelomonositik Lösemi: Altmış Beş Hastanın Retrospektif Analizi Özlem Tüfekçi1, Ülker Koçak2, Zühre Kaya2, İdil Yenicesu2, Canan Albayrak3, Davut Albayrak3, Şebnem Yılmaz Bengoa1, Türkan Patıroğlu4, Musa Karakükçü4, Ekrem Ünal4, Elif Ünal İnce5, Talia İleri5, Mehmet Ertem5, Tiraje Celkan6, Gül Nihal Özdemir6, Nazan Sarper7, Dilek Kaçar8, Neşe Yaralı8, Namık Yaşar Özbek8, Alphan Küpesiz9, Tuba Karapınar10, Canan Vergin10, Ümran Çalışkan11, Hüseyin Tokgöz11, Melike Sezgin Evim12, Birol Baytan12, Adalet Meral Güneş12, Deniz Yılmaz Karapınar13, Serap Karaman14, Vedat Uygun15, Gülsun Karasu15, Mehmet Akif Yeşilipek15, Ahmet Koç16, Erol Erduran17, Berna Atabay18, Haldun Öniz18, Hale Ören1 Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey Gazi University Faculty of Medicine, Department of Pediatric Hematology, Ankara, Turkey 3 Ondokuz Mayıs University Faculty of Medicine, Department of Pediatric Hematology, Samsun, Turkey 4 Erciyes University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Kayseri, Turkey 5 Ankara University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Ankara, Turkey 6 İstanbul University Cerrahpaşa Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey 7 Kocaeli University Faculty of Medicine, Department of Pediatric Hematology, Kocaeli, Turkey 8 Ankara Children’s Hematology and Oncology Training and Research Hospital, Ankara, Turkey 9 Akdeniz University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Antalya, Turkey 10 Dr. Behçet Uz Children Training and Research Hospital, Clinic of Pediatric Hematology and Oncology, İzmir, Turkey 11 Necmettin Erbakan University Meram Faculty of Medicine, Department of Pediatric Hematology, Konya, Turkey 12 Uludağ University Faculty of Medicine, Department of Pediatric Hematology, Bursa, Turkey 13 Ege University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey 14 Şişli Hamidiye Etfal Training and Research Hospital, Clinic of Pediatric Hematology and Oncology, İstanbul, Turkey 15 Bahçeşehir University Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey 16 Marmara University Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey 17 Karadeniz Technical University Faculty of Medicine, Department of Pediatric Hematology and Oncology, Trabzon, Turkey 18 Tepecik Training and Research Hospital, Clinic of Pediatric Hematology and Oncology, İzmir, Turkey 1 2

Abstract

Öz

Objective: This study aimed to define the status of juvenile myelomonocytic leukemia (JMML) patients in Turkey in terms of time of diagnosis, clinical characteristics, mutational studies, clinical course, and treatment strategies.

Amaç: Türkiye’deki juvenil miyelomonositik lösemi (JMML) hastalarının durumunu, tanı zamanı, klinik özellikler, mutasyon çalışmaları, klinik gidiş ve tedavi stratejileri açısından ortaya koymaktır.

Materials and Methods: Data including clinical and laboratory characteristics and treatment strategies of JMML patients were collected retrospectively from pediatric hematology-oncology centers in Turkey. Results: Sixty-five children with JMML diagnosed between 2002 and 2016 in 18 institutions throughout Turkey were enrolled in the study. The median age at diagnosis was 17 months (min-max: 2-117 months). Splenomegaly was present in 92% of patients at the time of diagnosis. The median white blood cell, monocyte, and platelet counts were 32.9x109/L, 5.4x109/L, and 58.3x109/L, respectively. Monosomy

Gereç ve Yöntemler: Ülkemizdeki pediatrik hematoloji ve onkoloji kliniklerinden veri istenerek, JMML tanısı ile takip ve tedavisi yapılan hastaların klinik ve laboratuvar bulguları geriye dönük olarak değerlendirildi. Bulgular: On sekiz merkezden, 2002-2016 tarihleri arasında JMML tanısı alan toplam 65 hasta çalışmaya dahil edildi. Ortanca tanı yaşı 17 ay idi (2-117 ay). Splenomegali tanıda %92 hastada vardı. Ortanca lökosit, monosit ve trombosit sayıları sırasıyla 32,9x109/L, 5,4x109/L ve 58,3x109/L idi. Monozomi 7, %18 hastada saptanmıştı. JMML mutasyonları 32 hastada (%49) çalışılmış olup, en sık rastlanan mutasyon PTPN11 idi. Hematopoetik kök hücre nakli (HKHN)

Address for Correspondence/Yazışma Adresi: Özlem TÜFEKÇİ, M.D., Dokuz Eylül University Faculty of Medicine, Department of Pediatric Hematology, İzmir, Turkey Phone : +90 232 412 61 50 E-mail : ozlemtufekci@hotmail.com ORCID-ID: orcid.org/0000-0002-0721-1025

Received/Geliş tarihi: January 19, 2017 Accepted/Kabul tarihi: February 07, 2017

Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey

7 was present in 18% of patients. JMML mutational analysis was performed in 32 of 65 patients (49%) and PTPN11 was the most common mutation. Hematopoietic stem cell transplantation (HSCT) could only be performed in 28 patients (44%), the majority being after the year 2012. The most frequent reason for not performing HSCT was the inability to find a suitable donor. The median time from diagnosis to HSCT was 9 months (min-max: 2-63 months). The 5-year cumulative survival rate was 33% and median estimated survival time was 30±17.4 months (95% CI: 0-64.1) for all patients. Survival time was significantly better in the HSCT group (log-rank p=0.019). Older age at diagnosis (>2 years), platelet count of less than 40x109/L, and PTPN11 mutation were the factors significantly associated with shorter survival time. Conclusion: Although there has recently been improvement in terms of definitive diagnosis and HSCT in JMML patients, the overall results are not satisfactory and it is necessary to put more effort into this issue in Turkey.

Turk J Hematol 2018;35:27-34

hastaların ancak %44’üne uygulanabilmiş olup, nakillerin büyük bir oranı 2012 yılından sonra yapılmıştı. Nakil yapılamamasının en sık nedeni uygun donör bulunamamasıydı. Tanı aldıktan nakile kadar geçen ortalama süre 9 ay (2-63 ay) olarak saptandı. Tüm hastalarda 5 yıllık kümülatif sağkalım oranı %33, ortanca tahmini yaşam süresi ise 30±17,4 ay (%95 CI: 0-64,1) olarak bulundu. Sağkalım süresi HKHN yapılan hastalarda anlamlı olarak daha uzundu (log-rank p=0,019). Tanıda 2 yaşın üstünde olmak, trombosit sayısının 40x109/L’nin altında saptanması ve PTPN11 mutasyon varlığı yaşam süresini anlamlı olarak kısaltan faktörler olarak bulundu. Sonuç: Ülkemizde her ne kadar son dönemlerde JMML hastalarında kesin tanı ve HKHN açısından iyileşme kaydedilmiş olsa da genel sonuç tatminkar değildir ve bu konu ile ilgili daha fazla çaba göstermeye gerek vardır. Anahtar Sözcükler: Hematopoetik kök hücre nakli, Juvenil miyelomonositik lösemi, Türkiye

Keywords: Hematopoietic stem cell transplantation, Juvenile myelomonocytic leukemia, Turkey

Introduction Juvenile myelomonocytic leukemia (JMML) is a chronic malignant myeloproliferative disease of early childhood [1]. The World Health Organization classifies JMML in the group of myelodysplastic/myeloproliferative disorders owing to both myelodysplastic and proliferative features of the disease [2]. It is a rare disease comprising 2%-3% of all pediatric leukemias with a yearly incidence of 1.2 per million children [3,4]. Symptoms and signs of the disease result from infiltration of different organs including the spleen, liver, lungs, and gastrointestinal tract by leukemic cells [5,6]. Affected children generally present at a median age of 1.8 years with pallor, fever, infection, skin bleeding, cough, skin rash, marked splenomegaly, and sometimes diarrhea [5,7]. Leukocytosis with marked monocytosis, circulating myeloid/erythroid precursors, varying degrees of myelodysplasia and thrombocytopenia in peripheral blood, and an elevated hemoglobin F (HbF) corrected for age are common findings that are important for diagnosis. Bone marrow aspirate findings are not diagnostic per se but rather supportive with the presence of hypercellularity, predominance of granulocytic cells, and fewer than 20% blasts [5,6,7,8,9,10,11]. Monosomy 7 is the major cytogenetic anomaly found in 20%-25% of patients [5,7]. The majority of genetic mutations identified in JMML cause pathologic activation of the RAS-RAF-MAPK signaling pathway. These genes include NF1, KRAS, NRAS, and PTPN1. NF1 and CBL are found in approximately 90% of patients [1,6,8]. The advances that have been achieved in the molecular characterization of JMML are important not only in diagnosis, but also in the management and prognosis of the disease, addressing a crucial phenotype-genotype relationship [1,2,8,12,13]. Some mutation types have been associated with mild clinical phenotypes and spontaneous remission rates, but the disease 28

follows an aggressive course in the majority of cases if not treated [8,13,14,15,16,17]. Chemotherapy approaches have not been successful; the only curative treatment known so far is hematopoietic stem cell (HSCT) transplantation [7,8,9,11]. The characteristics of the disease together with problems in finding a suitable donor for HSCT make the disease management difficult, especially in a developing country. In this context, we aimed to define the status of JMML patients in Turkey in terms of time of diagnosis, clinical characteristics, mutational analysis, clinical course, and treatment strategies. We think that identifying the problems in the management of this specific group of patients will help us achieve better care for them by taking the necessary precautions.

Materials and Methods Sixty-five children with JMML diagnosed between 2002 and 2016 in 18 institutions throughout Turkey were enrolled in the study. The diagnosis of JMML was based on previously published criteria [2,18,19,20]. Data including patient and disease characteristics and transplantation outcome were collected by standardized questionnaires for each patient. Due to the retrospective nature of the study, several patients had some missing data for some of the parameters. Clinical Assessment Data including age, sex, presenting symptoms at first diagnosis, presence of recurrent fever, respiratory and gastrointestinal problems, rash, hepatosplenomegaly, and additional findings in physical examination were all noted. The details of the management of the disease for each patient including chemotherapy and HSCT were all noted.

TĂźfekĂ§i Ă&#x2013;, et al: Juvenile Myelomonocytic Leukemia in Turkey

Turk J Hematol 2018;35:27-34

Laboratory Measurements, Bone Marrow, and Genetic Studies

Clinical Features

Hematologic data including initial complete blood count, hemoglobin electrophoresis, analysis of peripheral blood smears, and bone marrow aspiration slides as well as cytogenetic and molecular genetic studies from the bone marrow aspirates were all noted.

The clinical characteristics of the patients are detailed in Table 1.

JMML mutations including PTPN11, NRAS, KRAS, and CBL were all studied at the University of Freiburg in the European Working Group on Myelodysplastic Syndromes in Childhood (EWOG-MDS) center. Analyses for CBL mutations were started after the year 2011. Statistical Analysis All statistical analyses were performed using SPSS 22 (IBM Corp., Armonk, NY, USA). Overall survival for all patients was defined as the time from diagnosis to death or last follow-up. Survival probabilities were estimated by Kaplan-Meier method and comparisons between different patient groups were performed using two-sided log-rank tests. Prognostic factors for the length of survival were analyzed by using the log-rank chi-square test. The choice of variables tested was based on our own results and other studies, and p<0.05 was considered statistically significant.

Results A total of 65 children were enrolled in the study. Only six had received the diagnosis of JMML between 2002 and 2006. The majority of the study patients (92%) had received the diagnosis of JMML in the last 10 years (2007-2016); 52 of them (80%) received the diagnosis after the year 2010 (Figure 1).

Figure 1. The distribution of newly diagnosed juvenile myelomonocytic leukemia patients and the number of juvenile myelomonocytic leukemia patients for whom hematopoietic stem cell transplantation was performed according to years. JMML: Juvenile myelomonocytic leukemia, HSCT: hematopoietic stem cell transplantation.

The median age at diagnosis was 17 months (min-max: 2-117 months). Only three patients (4%) were older than 5 years old, the eldest being 9.7 years old. There was a male predominance with a male/female ratio of 2.25:1. The most common symptom at presentation was fever, followed by frequent infection, recurrent pulmonary symptoms, abdominal distension, and skin rash. Pallor was a presenting symptom in only 12% of patients. Splenomegaly was present in 92% at the time of diagnosis, whereas lymphadenopathy was noted in 18%. Four children (6%) had the clinical diagnosis of neurofibromatosis type 1. Laboratory Features The hematologic data are given in Table 2. The median white blood cell (WBC), monocyte, and platelet counts were 32.9x109/L, 5.4x109/L, and 58.3x109/L, respectively. The hemoglobin level was below 10 g/dL in 55 (84%) patients. Table 1. Clinical characteristics of the patients. n=65 Median age at diagnosis, months (minimummaximum)

17 (2-117)

Male/female

45/20

Symptoms at diagnosis

n (%)

Fever

36 (55)

Recurrent fever

30 (46)

Frequent infection

28 (43)

Recurrent pulmonary symptoms

23 (35)

Abdominal distension

21(32)

Skin rash

15 (23)

Gastrointestinal system symptoms

14 (21)

Pallor

8 (12)

Signs at diagnosis

n (%)

Splenomegaly

60 (92)

Hepatosplenomegaly

49 (75)

Lymphadenopathy

12 (18)

Clinical diagnosis of neurofibromatosis type 1

4 (6)

Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey

The percentage of blasts in the bone marrow was less than 5% in the majority (69%) of patients. Cytogenetics and JMML Mutation Analysis Cytogenetic study of the bone marrow was available in 49 patients; of those, 9 patients (18%) were found to have monosomy 7 positivity (Table 2). Complex karyotypes were seen in three patients. The remaining 37 patients (75%) had normal karyotypes. JMML mutation analysis was performed in 32 of 65 patients (49%). The most common mutation was PTPN11, followed by NRAS, KRAS, and CBL, respectively (Table 3). Seven patients were found to have none of the screened mutations. The mutations were all somatic, except for one germline CBL mutation. Treatment Strategies Treatment, either in the form of mild cytoreductive or acute myeloid leukemia (AML)-like intensive chemotherapy, was given to 46 of 61 patients (75%) with or without subsequent HSCT. The combination of low-dose cytarabine (40 mg/m2/day) and 6-mercaptopurine was the most frequent treatment given to 11 patients (23%), followed by high dose cytarabine+etoposide in 7 patients (16%) and 6-mercaptopurine in 6 patients (15%). The Table 2. Hematologic data of the patients at diagnosis. Peripheral blood

n=65 Median (minimummaximum)

Median hemoglobin at diagnosis, g/dL

8.8 (3.3-12.3)

Median leukocytes at diagnosis, x109/L

32.9 (0.3-325)

Median monocytes at diagnosis, x109/L

5.4 (1-49.1)

Median thrombocytes at diagnosis, x109/L

58.3 (5-925)

Median percentage of myeloid precursors

10 (0-59)

Median percentage of HbF

8 (0-63)

Bone marrow

n=58 (%)

Bone marrow blasts: <5%

40 (69)

Bone marrow blasts: 5%-20%

18 (31)

Bone marrow cytogenetics

n=49 (%)

Normal karyotype

37 (75)

Monosomy 7

9 (18)

Karyotype abnormality other than monosomy 7

3 (6)

HbF: Fetal hemoglobin.

Turk J Hematol 2018;35:27-34

other less commonly used agents in treatment were azacitidine, cis-retinoic acid, hydroxyurea, and cytarabine, alone or in various combinations. HSCT was planned for 63 of 65 patients but could only be performed in 28 (44%) patients. Five other patients (8%) were also found to have suitable donors, but they were still waiting for HSCT at the time of data collection. The most frequent reason for not performing HSCT was the inability to find a suitable donor (21 patients: 33%). Patient/family incompatibility in 5 patients (8%) and death due to disease in 4 patients while planning HSCT (6%) were other reasons for not performing HSCT. “Watch and wait” was the main treatment strategy for those two patients for whom HSCT was not planned. One of them was a female patient with CBL mutation and the other was a male patient with NRAS mutation. The median time from diagnosis to HSCT was 9 months (minmax: 2-63 months). HSCT was performed in 28 patients (44%). Three patients were transplanted twice and two patients were transplanted three times due to relapse. The distribution of the transplanted patients according to years is shown in Figure 1. HSCT was performed for 50% of the newly diagnosed JMML patients after the year 2012. Donor type was matched sibling donor in 18 patients (64%), matched unrelated donor in 8 patients (28%), haploidentical donor in one patient, and unrelated cord blood in one patient.

Figure 2. Survival of patients with or without hematopoietic stem cell transplantation (patients with hematopoietic stem cell transplantation: n=25, patients without hematopoietic stem cell transplantation: n=40). HSCT: Hematopoietic stem cell transplantation.

Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey

Turk J Hematol 2018;35:27-34

Survival The 5-year cumulative survival rate of the whole group was 33%. The mean estimated survival time was 72.4±12.9 months (95% CI: 46.9-97.9) and median estimated survival time was 30±17.4 months (95% CI: 0-64.1) for all patients. Survival time was significantly better in the HSCT group (log-rank p=0.019) (Figure 2). Relapse after HSCT occurred in 10 of 28 (35%) patients. Death occurred in 31 of 62 patients (50%); of those, 12 were in the HSCT (44%) group and 19 (54%) were in the non-HSCT group. The causes of death were HSCT toxicity (50%) and sepsis/organ failure due to relapse (50%) in the HSCT group. In all patients in the non-HSCT group, the cause of death was sepsis/organ failure due to progressive disease. Factors Influencing Survival Older age at diagnosis (>2 years old), platelet count at diagnosis of less than 40x109/L, and PTPN11 mutation were the factors associated with shorter survival time (Figures 3, 4, and 5; Table 4). Sex, fetal hemoglobin (HbF) percentage (<10% or ≥10%), presence of monosomy 7, and bone marrow blast percentage at diagnosis did not influence survival significantly (Table 4).

Figure 4. Survival of patients according to platelet count at diagnosis (platelets <40x109/L: n=21, platelets ≥40x109/L: n=44).

Figure 5. Survival of patients according to PTPN11 mutation status in patients for whom JMML mutation analysis was conducted (n=32) (PTPN11 mutation: n=9, NRAS/KRAS/CBL/no mutation: n=23). Figure 3. Survival of patients according to age at diagnosis (age <2 years: n=38 , age ≥2 years: n=27). Table 3. The distribution of juvenile myelomonocytic leukemia mutations in 32 patients. n=32 (%) PTPN11

9 (28)

NRAS

8 (25)

KRAS

7 (22)

CBL

1 (3)

Mutation not detected

7 (22)

Discussion This retrospective clinical study reflects the diagnosis, treatment strategies, and prognosis of 65 JMML patients from Turkey. The clinical features of the patients were highly similar to those reported in the literature [3,5,10,12]. In our study, the median time of diagnosis was found as 17 months and almost all of the patients (95%) were younger than 5 years old. The median age of diagnosis in the previous studies was reported within a range of 17-24 months old and more than 90% of patients were reported to be younger than 5 years old. The male predominance that was reported in other studies has also been observed in our study with a male:female ratio of 2.2 [4,5,7,12,21]. 31

Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey

Turk J Hematol 2018;35:27-34

Table 4. Factors influencing survival in patients with juvenile myelomonocytic leukemia. Variable

Number of patients

Mean estimated survival time

95% CI

Log-rank p

(months), ± SE Age Younger than 2 years 2 years and older

38 27

94±19 29±6

56-132 16-41

0.014

Sex Male Female

40 18

36±4 96±21

27-45 55-137

0.449

Platelet count at diagnosis Below 40x109/L 40x109/L or above

21 44

22±4 87±15

12-31 56-118

0.024

Mutational status PTPN11 mutation NRAS/KRAS/CBL/no mutation

9 23

14±3 83±11

7-22 61-105

0.004

HbF level Less than 10% 10% or more

26 15

97±21 38±9

55-140 20-56

0.162

Monosomy 7 Positive Negative

9 40

32±6 59±9

19-45 39-78

Bone marrow blasts Less than 5% 5%-20%

38 16

94±16 29±6

62-125 17-41

0.903

0.165

Patients with JMML have been commonly reported to present with symptoms of pallor, fever, infection, skin bleeding, cough, skin rash, and sometimes diarrhea [5,7]. The major presenting symptoms were fever and recurrent infection in the present study. Recurrent pulmonary infections and gastrointestinal symptoms were also seen in a substantial number of patients in this study. However, pallor was not a common symptom, which was reported as the major frequent symptom in the EWOG-MDS study [5]. In fact, the median hemoglobin level was 8.1 g/dL in our study and 84% of patients had an initial hemoglobin value of less than 10 g/dL. This was a retrospective study collecting data from patients’ records and so pallor might have been overlooked. The presence of splenomegaly is a hallmark in the diagnosis of JMML; nevertheless, it has been reported that 7% of patients do not have splenomegaly at the time of diagnosis [6]. Similarly, splenomegaly was present in 92% of our patients at the time of diagnosis. Lymphadenopathy, on the other hand, was not as frequent in our patients as reported by the EWOG-MDS study [5]. Neurofibromatosis type 1 has been well recognized to have a 200- to 500-fold increased risk for development of JMML and has been reported in 8%-14% of JMML patients [5,10,22,23,24]. It was present in 4 patients (6%) in our study. Patients with JMML generally present with leukocytosis, monocytosis, and thrombocytopenia [5,6,7,8]. The hematologic 32

data in our study were highly similar to those reported in the literature [5,7,12]. In our study, the median WBC, monocyte, and platelet counts were 32.9x109/L, 5.4x109/L, and 58.3x109/L, respectively. The median HbF value was 8%. Locatelli et al. [7] reported the median WBC, monocyte, and platelet counts as 34x109/L, 5.5x109/L, and 65x109/L, respectively, and the HbF value as 9%. These data show that although there might be some differences in the clinical presentation, hematologic data do not differ significantly among JMML patients. Major advances have been achieved in defining the genomic landscape of JMML in recent years [1,6,11,12,13,14,15,16,17]. Progress in the discovery of the underlying mutations helped in the definitive diagnosis of the patients and also led physicians to establish a phenotype-genotype relationship, predict the clinical outcome, and determine a treatment strategy. In JMML, for patients with NF1 and somatic mutations of PTPN11 and K-RAS, and for the majority of patients with somatic NRAS mutations, HSCT is recommended as the first treatment option [8]. As patients with germline CBL and a few patients with somatic NRAS mutations were reported to have had spontaneous remission, careful follow-up rather than HSCT is recommended in the first place for those patients [8,14,15,16,17]. In our study, mutational analysis was done for only 32 patients (49%) at the EWOG-MDS center. PTPN11 mutation was the most frequently seen mutation (28%) and was also associated with significantly

Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey

Turk J Hematol 2018;35:27-34

lower survival rates compared to other mutations. Somatic PTPN11 mutations constitute ~35% of all JMML mutations and in some series have been reported to be associated with lower survival rates compared to other mutations [12,25,26]. Given the fact that the majority of the patients in this study had the diagnosis of JMML after 2010, mutational analysis was possible for most of them. In this respect, we hope that this study increases the awareness of JMML among physicians in terms of diagnosis as well as mutational analysis in order to outline a treatment strategy and to start a donor screening program immediately for HSCT if indicated.

alive being 40 months (min-max: 6-44) [7]. In our study, the 5-year cumulative survival rate of all patients was 33%, the median estimated time of survival was 30±17.4 months, and the most common cause of death was sepsis/organ failure due to progressive disease. This low survival rate in our patients obviously results from the low transplantation rate. Relapse after allogeneic stem cell transplantation has been a great problem in patients with JMML, occurring in one-third of transplanted patients [7,27,29]. The relapse rate was 35% in our study, and half of the relapsed patients had received more than one transplant.

The only curative treatment approach in JMML to date has been HSCT [7,8,27,28,29]. HSCT was planned for all but two patients but could only be performed in 44% of the patients and it was associated with better survival time compared to those who were not transplanted. Mild cytoreductive or AML-like intensive chemotherapy was given to the majority of patients. Approximately one-third of the patients lacked a suitable donor for transplantation. The median time from the time of diagnosis to HSCT has been reported as between 6 and 10 months in various studies [7,27,28]. It was 9 months in our study, comparable to other studies, but 6% of the patients died while waiting for HSCT. It seems that besides finding a suitable donor we also had problems in performing HSCT. However, Turkey has made great progress in stem cell transplantation in the recent years. Besides the tremendous increase in the number of well-equipped stem cell transplantation centers in the last 5 years, difficulties in finding suitable donors have been mainly overcome. A national bone marrow bank, called Turkey Stem Cell Coordination Center, was established by the Turkish Ministry of Health in 2014 and has reached a substantial number of volunteer donors over time [30]. Along with these developments, most of our patients had stem cell transplantation in the recent years. Indeed, much effort has been needed, as HSCT remains the only curative treatment for this disease.

Conclusion

Factors associated with poor prognosis other than mutational status have been reported as older age at diagnosis (>2 years), platelet count of <33-40x109/L, and increased HbF level at diagnosis [4,5]. Consistent with the literature, besides PTPN11 mutation, age older than 2 years and platelet count of less than 40x109/L were associated with lower survival rates in our study. Patients with HbF level greater than 10%, as well as male sex and higher bone marrow blast percentage (5%-20%) at diagnosis, seemed to have worse outcomes, but the statistical differences were not significant. The natural course of JMML is aggressive and the great majority of patients die if the disease is left untreated [4,5,10]. The 5-year overall survival rate in JMML patients has been reported as 30%-40% in older studies [4,10]. However, with HSCT, the EWOG-MDS study reported the 5-year probability of overall survival as 64%, with the median observation time of patients

In summary, the genotype-phenotype relationship becomes increasingly important in JMML. As a result, mutational analysis is important not only for definitive diagnosis of the disease but also to determine the indication and urgency for HSCT, and to promptly initiate donor screening if necessary. Although there is a possibility of spontaneous remission with certain types of mutations, HSCT still remains the only curative treatment for this disease. As the main reason for not performing HSCT was the inability to find a suitable donor in this study, we think that it is necessary to put more effort into this issue in Turkey. Ethics Ethics Committee Approval: Retrospective study. Informed Consent: Not applicable. Authorship Contributions Surgical and Medical Practices: Ö.T., Ü.K., Z.K., İ.Y., C.A., D.A., Ş.Y.B., T.P., M.K., E.Ü., E.Ü.İ., T.İ., M.E., T.C., G.N.Ö., N.S., D.K., N.Y., N.Y.Ö., A.K., T.K., C.V., Ü.Ç., H.T., M.S.E., B.B., A.M.G., D.Y.K., S.K., V.U., G.K., M.A.Y., A.K., E.E., B.A., H.Ö., H.Ö.; Concept: Ö.T., H.Ö.; Design: Ö.T., H.Ö.; Data Collection or Processing: Ö.T., Ü.K., Z.K., İ.Y., C.A., D.A., Ş.Y.B., T.P., M.K., E.Ü., E.Ü.İ., T.İ., M.E., T.C., G.N.Ö., N.S., D.K., N.Y., N.Y.Ö., A.K., T.K., C.V., Ü.Ç., H.T., M.S.E., B.B., A.M.G., D.Y.K., S.K., V.U., G.K., M.A.Y., A.K., E.E., B.A., H.Ö., H.Ö.; Analysis or Interpretation: Ö.T., Ş.Y., H.Ö.; Literature Search: Ö.T.; Writing: Ö.T., Ş.Y., H.Ö. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Chang TY, Dvorak CC, Loh ML. Bedside to bench in juvenile myelomonocytic leukemia: insights into leukemogenesis from a rare pediatric leukemia. Blood 2014;124:2487-2497. 2. Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM, Bloomfield CD, Cazzola M, Vardiman JW. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood 2016;127:2391-2405.

Tüfekçi Ö, et al: Juvenile Myelomonocytic Leukemia in Turkey

Turk J Hematol 2018;35:27-34

3. Hasle H, Wadsworth LD, Massing BG, McBride M, Schultz KR. A populationbased study of childhood myelodysplastic syndrome in British Columbia, Canada. Br J Haematol 1999;106:1027-1032.

Russell RC, Sybingco SS, Ohh M, Braun BS, Flotho C, Loh ML. Germline CBL mutations cause developmental abnormalities and predispose to juvenile myelomonocytic leukemia. Nat Genet 2010;42:794-800.

4. Passmore SJ, Chessells JM, Kempski H, Hann IM, Brownbill PA, Stiller CA. Paediatric myelodysplastic syndromes and juvenile myelomonocytic leukemia in the UK: a population based study of incidence and survival. Br J Haematol 2003;121:758-767.

17. Matsuda K, Taira C, Sakashita K, Saito S, Tanaka-Yanagisawa M, Yanagisawa R, Nakazawa Y, Shiohara M, Fukushima K, Oda M, Honda T, Nakahata T, Koike K. Long-term survival after nonintensive chemotherapy in some juvenile myelomonocytic leukemia patients with CBL mutations, and the possible presence of healthy persons with the mutations. Blood 2010;115:54295431.

5. Niemeyer CM, Arico M, Basso G, Biondi A, Cantu Rajnoldi A, Creutzig U, Haas O, Harbott J, Hasle H, Kerndrup G, Locatelli F, Mann G, StollmannGibbels B, van’t Veer-Korthof ET, van Wering E, Zimmermann M. Chronic myelomonocytic leukemia in childhood: a retrospective analysis of 110 cases. European Working Group on Myelodysplastic Syndromes in Childhood (EWOG-MDS). Blood 1997;89:3534-3543. 6. Loh ML. Recent advances in the pathogenesis and treatment of juvenile myelomonocytic leukaemia. Br J Haematol 2011;152:677-687. 7. Locatelli F, Nöllke P, Zecca M, Korthof E, Lanino E, Peters C, Pession A, Kabisch H, Uderzo C, Bonfim CS, Bader P, Dilloo D, Stary J, Fischer A, Révész T, Führer M, Hasle H, Trebo M, van den Heuvel-Eibrink MM, Fenu S, Strahm B, Giorgiani G, Bonora MR, Duffner U, Niemeyer CM; European Working Group on Childhood MDS; European Blood and Marrow Transplantation Group. Hematopoietic stem cell transplantation (HSCT) in children with juvenile myelomonocytic leukemia (JMML): results of the EWOG-MDS/ EBMT trial. Blood 2005;105:410-419. 8. Locatelli F, Niemeyer CM. How I treat juvenile myelomonocytic leukemia. Blood 2015;125:1083-1090. 9. Niemeyer CM, Kratz CP. Paediatric myelodysplastic syndromes and juvenile myelomonocytic leukaemia: molecular classification and treatment options. Br J Haematol 2008;140:610-624. 10. Passmore SJ, Hann IM, Stiller CA, Ramani P, Swansbury GJ, Gibbons B, Reeves BR, Chessells JM. Pediatric myelodysplasia: a study of 68 children and a new prognostic scoring system. Blood 1995;85:1742-1750. 11. Sakashita K, Matsuda K, Koike K. Diagnosis and treatment of juvenile myelomonocytic leukemia. Pediatr Int 2016;58:681-690. 12. Yoshida N, Yagasaki H, Xu Y, Matsuda K, Yoshimi A, Takahashi Y, Hama A, Nishio N, Muramatsu H, Watanabe N, Matsumoto K, Kato K, Ueyama J, Inada H, Goto H, Yabe M, Kudo K, Mimaya J, Kikuchi A, Manabe A, Koike K, Kojima S. Correlation of clinical features with the mutational status of GMCSF signaling pathway-related genes in juvenile myelomonocytic leukemia. Pediatr Res 2009;65:334-340. 13. Matsuda K, Shimada A, Yoshida N, Ogawa A, Watanabe A, Yajima S, Iizuka S, Koike K, Yanai F, Kawasaki K, Yanagimachi M, Kikuchi A, Ohtsuka Y, Hidaka E, Yamauchi K, Tanaka M, Yanagisawa R, Nakazawa Y, Shiohara M, Manabe A, Kojima S, Koike K. Spontaneous improvement of hematologic abnormalities in patients having juvenile myelomonocytic leukemia with specific RAS mutations. Blood 2007;109:5477-5480. 14. Flotho C, Kratz CP, Bergsträsser E, Hasle H, Starý J, Trebo M, van den HeuvelEibrink MM, Wójcik D, Zecca M, Locatelli F, Niemeyer CM; European Working Group of Myelodysplastic Syndromes in Childhood. Genotype-phenotype correlation in cases of juvenile myelomonocytic leukemia with clonal RAS mutations. Blood 2008;111:966-967. 15. Loh ML, Sakai DS, Flotho C, Kang M, Fliegauf M, Archambeault S, Mullighan CG, Chen L, Bergstraesser E, Bueso-Ramos CE, Emanuel PD, Hasle H, Issa JP, van den Heuvel-Eibrink MM, Locatelli F, Stary J, Trebo M, Wlodarski M, Zecca M, Shannon KM, Niemeyer CM. Mutations in CBL occur frequently in juvenile myelomonocytic leukemia. Blood 2009;114:1859-1863. 16. Niemeyer CM, Kang MW, Shin DH, Furlan I, Erlacher M, Bunin NJ, Bunda S, Finklestein JZ, Gorr TA, Mehta P, Schmid I, Kropshofer G, Corbacioglu S, Lang PJ, Klein C, Schlegel PG, Heinzmann A, Schneider M, Starý J, van den Heuvel-Eibrink MM, Hasle H, Locatelli F, Sakai D, Archambeault S, Chen L,

18. Pinkel D. Differentiating juvenile myelomonocytic leukemia from infectious disease. Blood 1998;91:365-367. 19. Hasle H, Niemeyer CM, Chessells JM, Baumann I, Bennett JM, Kerndrup G, Head DR. A pediatric approach to the WHO classification of myelodysplastic and myeloproliferative diseases. Leukemia 2003;17:277-282. 20. Chan RJ, Cooper T, Kratz CP, Weiss B, Loh ML. Juvenile myelomonocytic leukemia: a report from the 2nd International JMML Symposium. Leuk Res 2009;33:355-362. 21. Yoshida N, Hirabayashi S, Watanabe S, Zaike Y, Tsuchida M, Yoshimi A, Masunaga A, Otsuka Y, Ito M, Kojima S, Nakahata T, Manabe A. Prognosis of 75 patients with juvenile myelomonocytic leukemia: prospective study by MDS committee in the Japanese Society of Pediatric Hematology. Rinsho Ketsueki 2011;52:1853-1858. 22. Bader JL, Miller RW. Neurofibromatosis and childhood leukemia. J Pediatr 1978;92:925-929. 23. Stiller CA, Chessells JM, Fitchett M. Neurofibromatosis and childhood leukaemia/lymphoma: a population-based UKCCSG study. Br J Cancer 1994;70:969-972. 24. Side L, Taylor B, Cayouette M, Conner E, Thompson P, Luce M, Shannon K. Homozygous inactivation of the NF1 gene in bone marrow cells from children with neurofibromatosis type 1 and malignant myeloid disorders. N Engl J Med 1997;336:1713-1720. 25. Tartaglia M, Niemeyer CM, Fragale A, Song X, Buechner J, Jung A, Hählen K, Hasle H, Licht JD, Gelb BD. Somatic mutations in PTPN11 in juvenile myelomonocytic leukemia, myelodysplastic syndromes and acute myeloid leukemia. Nat Genet 2003;34:148-150. 26. Park HD, Lee SH, Sung KW, Koo HH, Jung NG, Cho B, Kim HK, Park IA, Lee KO, Ki CS, Kim SH, Yoo KH, Kim HJ. Gene mutations in the Ras pathway and the prognostic implication in Korean patients with juvenile myelomonocytic leukemia. Ann Hematol 2012;91:511-517. 27. Manabe A, Okamura J, Yumura-Yagi K, Akiyama Y, Sako M, Uchiyama H, Kojima S, Koike K, Saito T, Nakahata T; MDS Committee of the Japanese Society of Pediatric Hematology. Allogeneic hematopoietic stem cell transplantation for 27 children with juvenile myelomonocytic leukemia diagnosed based on the criteria of the International JMML Working Group. Leukemia 2002;16:645-649. 28. Smith FO, King R, Nelson G, Wagner JE, Robertson KA, Sanders JE, Bunin N, Emaunel PD, Davies SM; National Marrow Donor Program. Unrelated donor bone marrow transplantation for children with juvenile myelomonocytic leukaemia. Br J Haematol 2002;116:716-724. 29. Locatelli F, Niemeyer C, Angelucci E, Bender-Götze C, Burdach S, Ebell W, Friedrich W, Hasle H, Hermann J, Jacobsen N, Klingebiel T, Kremens B, Mann G, Pession A, Peters C, Schmid HJ, Stary J, Suttorp M, Uderzo C, van’t VeerKorthof ET, Vossen J, Zecca M, Zimmermann M. Allogeneic bone marrow transplantation for chronic myelomonocytic leukemia in childhood: a report from the European Working Group on Myelodysplastic Syndrome in Childhood. J Clin Oncol 1997;15:566-573. 30. Türk Kızılay. Kök Hücre Bağış. Available online at http://www.kanver.org/ sayfa/kan-hizmetleri/kok-hucre-bagisi/53.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0502 Turk J Hematol 2018;35:35-41

Transformation of Mycosis Fungoides/Sezary Syndrome: Clinical Characteristics and Prognosis Mikozis Fungoides/Sezary Sendromunda Transformasyon: Klinik Özellikler ve Prognoz Seçil Vural1,

Bengü Nisa Akay1,

Ayşenur Botsalı1,

Erden Atilla2,

Nehir Parlak1,3,

Aylin Okçu Heper4,

Hatice Şanlı1

1Ankara University Faculty of Medicine, Department of Dermatology, Ankara, Turkey 2Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey 3Etimesgut Şehit Sait Ertürk State Hospital, Clinic of Dermatology, Ankara, Turkey 4Ankara University Faculty of Medicine, Department of Pathology, Ankara, Turkey

Abstract

Öz

Objective: Transformed mycosis fungoides (T-MF) is a rare variant of MF with an aggressive course. In this study, we aimed to describe characteristics of MF/Sezary syndrome (SS) patients with transformation.

Amaç: Transforme mikozis fungoides (T-MF) MF nadir görülen agresif seyirli bir alt tipidir. Bu çalışmada transformasyon gelişen MF/ Sezary sendromu (SS) hastalarının klinik ve laboratuvar özelliklerinin değerlendirilmesi amaçlanmıştır.

Materials and Methods: Patients diagnosed with T-MF among MF/ SS patients between 2000 and 2014 in a tertiary single center were evaluated retrospectively. Demographic data, clinical data, laboratory data, immunophenotype features, response to treatment, survival, and histopathologic features were analyzed.

Gereç ve Yöntemler: Bu çalışmada tek bir referans merkezde 20002014 yılları arasında takip edilen MF/SS hastaları arasından T-MF geliştirenler retrospektif olarak değerlendirilmiştir. Demografik, klinik ve laboratuvar veriler, immünfenotiplendirme, tedavi yanıtları, histopatolojik özellikler ve sağkalım analiz edilmiştir.

Results: Among 254 MF patients, 25 patients with T-MF were identified (10.2%) and included in the study. The male-to-female ratio was 2.6/1. The median time between MF diagnosis and transformation was 32 months (range: 0-192). Nine (36%) patients were diagnosed initially with T-MF. Advanced disease stage and high serum lactate dehydrogenase (LDH) levels were indicators of poor prognosis and treatment response. Five of the 18 patients with progressive disease had undergone allogeneic hematopoietic stem cell transplantation (allo-HSCT). Allo-HSCT resulted in complete remission in three (60%) patients. Ten (40%) patients died as a result of disease progression. Mean survival time was 25.2±14.9 (2-56) months after transformation.

Bulgular: Takip edilen 254 MF hastası içerisinde 25 T-MF saptanarak (%10,2) çalışmaya dahil edilmiştir. Erkek kadın oranı 2,6/1’dir. MF tanısı ile T-MF tanısı arasında geçen sürenin medianı 32 ay olarak tespit edilmiştir (0-192). Dokuz hastada (%36) tanı anında transformasyon bulunmaktadır. İleri hastalık evresi ve yüksek serum laktat dehidrogenaz (LDH) düzeyleri kötü prognoz ve tedavi yanıtı göstergesi olarak saptanmıştır. Tedaviye dirençli 18 ileri evre hastadan beşine allojenik hematopoetik kök hücre transplantasyonu (allo-HKHT) yapılmıştır. Bunlardan üçünde tam remisyon sağlanmıştır. İzlemde toplam 10 hasta hastalık progresyonu nedeniyle kaybedilmiştir. T-MF sonrası ortalama sağkalım 25,2±14,9 (2-56) aydır.

Conclusion: Advanced stage, high serum LDH levels, and loss of CD26 and CD7 expression in the peripheral blood are poor rognostic factors in T-MF. Treatment-resistant tumors and nodules should be cautionary for T-MF. Patients with T-MF have a shortened survival. Some patients may respond to first-line treatments. However, the majority of patients who do not respond to first-line therapies also are unresponsive to second or third-line therapies. Allo-HSCT may be an alternative option in patients with T-MF.

Sonuç: İleri hastalık evresi, yüksek LDH düzeyi, perifer kan T hücrelerde CD26 ve CD7 kaybı kötü prognoz belirteçlerindendir. Tedaviye dirençli nodül ve tümörler T-MF açısından şüphe uyandırmalıdır. T-MF’de sağkalım kısalmıştır. Bazı hastalarda birinci basamak tedavilere iyi yanıt alınabilmektedir. Ancak birinci basamak tedavilere yanıtsız hastalar genellikle ikinci ve üçüncü basamak tedavilere de direnç gösterebilmektedir. Allo-HKHT, T-MF hastalarında alternatif bir tedavi yöntemi olarak kullanılabilir.

Keywords: Anaplastic, Transformation, Mycosis fungoides, Transformed, Allogeneic hematopoietic stem cell transplantation, Sezary syndrome

Anahtar Sözcükler: Anaplastik, Transformasyon, Mikozis fungoides, Transforme, Allojenik hematopoetik kök hücre transplantasyonu, Sezary sendromu

Address for Correspondence/Yazışma Adresi: Seçil VURAL, M.D., Ankara University Faculty of Medicine, Department of Dermatology, Ankara, Turkey Phone : +90 505 432 46 82 E-mail : secilsaral@gmail.com ORCID-ID: orcid.org/0000-0001-6561-196X

Received/Geliş tarihi: December 30, 2016 Accepted/Kabul tarihi: May 22, 2017

Vural S, et al: Transformation of Mycosis Fungoides

Introduction Mycosis fungoides (MF) is the most common subtype of cutaneous T-cell lymphoma (CTCL). Generally, MF has an indolent course with slow progression from patch/plaque-stage disease to cutaneous tumors [1]. However, in the case of largecell transformation (LCT), it is associated with an aggressive clinical course and poor survival [2]. Diagnosis of transformed MF (T-MF) is based on the presence of large cells (CD30 +/-) exceeding 25% of the infiltrate throughout the lesion or forming microscopic nodules of large cells [3]. Molecular studies have demonstrated that the largecell infiltrate in T-MF/Sezary syndrome (SS) represents evolution from the original clone [4]. Advanced stage of MF at the time of transformation and folliculotropism are suggested as the most important factors affecting survival [2]. Additionally, early transformation in MF lesions was described as a poor prognostic factor in previous studies [5]. Even though the CD30 expression is more common in advanced MF, in T-MF, it is reported as a favorable prognostic factor [6,7,8]. Risk factors associated with an aggressive course of T-MF are not well described in the literature due to the low incidence of MF/SS and thus T-MF. In different series, the incidence of T-MF has been reported to range between 8% and 55% among MF patients [3,5,9,10,11]. This study was designed to investigate the clinical, laboratory, and histopathological parameters associated with T-MF.

Materials and Methods We retrospectively evaluated all MF/SS patient records in a single reference center in Ankara, Turkey, from 2000 to 2014. Among all MF/SS patients, T-MF patients with at least one histopathologically confirmed biopsy were included in the study. For each case, clinical features were evaluated by three dermatologists and histopathological findings were reviewed by one pathologist who was an expert in this area. All patients were classified according to the International Society for Cutaneous Lymphomas and European Organisation of Research and Treatment of Cancer revised criteria of 2007 [12]. Staging included physical examination, blood cell count and chemistry, peripheral blood smear and flow cytometry, lymph node ultrasonography, and, in most cases, computed tomography scans of the abdomen, chest, and pelvis. Histopathology included one or multiple skin biopsies for all patients. In the case of clinically and sonographically significant adenopathy, a lymph node biopsy was performed. The accompanying prognostic factors were also analyzed: age, sex, age at diagnosis of T-MF, presence of folliculotropism in 36

Turk J Hematol 2018;35:35-41

skin lesions, CD30 expression in more than 75% of cutaneous neoplastic T cells, serum lactate dehydrogenase (LDH) levels, serum β2-microglobulin levels, and eosinophilia. The time interval between MF and T-MF, clinical stage at the time of T-MF, and survival were analyzed. Therapies were classified as first-, second-, and third-line treatments according to the 2014 National Comprehensive Cancer Network Clinical Practice Guidelines in Oncology [13,14]. Allogeneic hematopoietic stem cell transplantation (allo-HSCT) and autologous stem cell transplantation were evaluated separately. Response to treatment was evaluated as follows: complete response (CR), complete resolution of the disease; partial response (PR), at least 50% improvement compared with baseline; stable disease (SD), some improvement (25% to 50% improvement in lesions) plus reduction in the size of axillary and inguinal lymph nodes in the absence of significant evidence of disease; or progressive disease (PD), more than 25% increase in the number or size of clinically abnormal lymph nodes, or development of novel tumors or pathologically positive nodes or visceral disease [12]. Statistical Analysis The data obtained from patients were analyzed with SPSS 16.0. The Mann-Whitney U test, chi-square test, Spearman’s test, and Mantel-Cox analysis were used to compare variables. The Kaplan-Meier method was used to determine overall survival.

Results Clinical Data The disease stage and exact TNMB stages of patients, initial treatments, and follow-up data of each patient are summarized in Table 1. Durations between the diagnosis of MF and transformation and the follow-up duration are given in Table 2. The rate of T-MF was 10.2% (n=25) among all MF/SS patients (n=254). The median age at the time of MF diagnosis was 49 years (range: 26-76), whereas the median age at the time of transformation was 54 years (range: 30-78). The male-tofemale ratio was 2.6 (M/F: 18/7). Sex was not significantly related to survival (p=0.218). Patients’ age at the time of transformation was also not related to survival (p=0.697). Transformation was detected in 36% (n=9) of the patients at the onset of MF. The median time between the diagnosis of MF and transformation was 32 months (range: 0-192). Patients were followed for a mean of 39.4±17.1 months after transformation. Two of 25 patients with T-MF (8%) had early patch and plaque MF (stage IA: 1, stage 1B: 1). Twenty-three patients had advanced-stage disease [stage IIB (n=9, 36%), stage III (n=3, 12%), stage IVA1 (n=8, 32%), stage IVA2 (n=2, 8%), and stage

Vural S, et al: Transformation of Mycosis Fungoides

Turk J Hematol 2018;35:35-41

Table 1. Characteristics of patients with transformed mycosis fungoides. Diagnosis and stage

Sex and age

Initial treatment

Response to treatment

Follow-up (months)

Last follow-up

M 36

1st line (PUVA, IFN)

Complete remission

F 52

1 line (PUVA, INF, ECP, bexarotene)

Stable disease

IIB

M 58

1st line (PUVA, IFN, ECP, bexarotene)

Progression

IIB

M 78

1 line (PUVA, IFN, bexarotene, ECP)

Progression

IIB

M 48

1 line (PUVA, IFN)

Progression

IIB

M 61

1st line (PUVA, ECP, Roferon)

st st

IIB

M 56

1 line (PUVA, ECP, Roferon, bexarotene, local RT)

Progression

IIB

M 43

1st line (PUVA, Roferon, bexarotene)

IIB

M 40

1 line (PUVA, IFN, local RT)

IIB

M 48

1st line (PUVA, IFN)

Complete remission

IIB

F 30

1 line (PUVA, IFN, ECP, bexarotene)

Progression

III

F 50

1 line (PUVA, IFN)

Progression

st st

III

M 59

1st line (PUVA, IFN, ECP), 3rd line (CHOPx6)

III

M 75

1st line (PUVA, IFN)

IVA2

M 33

3rd line* (CHOPx6), 1st line (local RT)

Progression**

IVA2

F 69

1st line (PUVA, ECP, IFN)

Progression

IVA2

M 49

1 line (PUVA, IFN, ECP, HDAC inhibitor)

Progression**

IVA2

M 60

1st line (PUVA, IFN, bexarotene, ECP)

Progression**

IVA2

M 48

1 line (PUVA, IFN, ECP, HDAC inhibitor), 2nd line (gemcitabine)

Progression

IVA2

F 54

1st line (PUVA, IFN)

Progression**

IVA2

M 55

1 line (methotrexate, PUVA, IFN, ECP)

Progression

IVA1

F 51

1st line (PUVA, ECP, IFN, HDAC inhibitor, local electron beam radiotherapy)

IVA2

M 48

1st line (PUVA, IFN, ECP)

Progression**

Complete remission

IVA2

M 53

1st line (ECP, IFN)

Progression

Exitus

IVA1

F 48

3 line (CHOPx6)*

Progression

Exitus

*Before admission, **Patients referred for allogeneic hematopoietic stem cell transplantation due to progressive disease. ECP: Extracorporeal photopheresis, PUVA: psoralen ultraviolet A, IFN: interferon-alpha 2a, CHOP: cyclophosphamide, doxorubicin, vincristine, and prednisolone regimen chemotherapy, HDAC: histone deacetylase, CR: complete remission, PR: partial remission, SD: stable disease, PD: progressive disease; E: exitus.

IVB (n=1, 4%)]. Most patients had transformation only at a skin site (96%); in one patient skin and lymph, node transformations were detected simultaneously (4%). Furthermore, 32% of T-MF patients presented with a new or enlarging tumor accompanied by long-standing plaque lesions. Dermatological examination at the time of T-MF diagnosis for the rest of the patients revealed the following: two (8%) patients had long-standing enlarging tumors, four (16%) patients had a new tumor accompanied with erythroderma (one bullous), one (4%) patient demonstrated ichthyosiform erythroderma, three (12%)

patients had an enlarging plaque with erythroderma, three (12%) patients had long-standing plaques, two (8%) patients had newly scattered papules distinct from MF plaques, one (4%) patient showed an abrupt onset of multiple pink scattered nodules, and another patient (4%) had follicular papules associated with hair loss within the involved area (Figure 1). Histopathological examinations of the transformation site showed tumoral lesions in 18 (72%) cases and plaque lesions in seven (28%) cases. Lesion subtype (plaque or tumor) was not significantly correlated with survival (p=0.678). Less prominent 37

Vural S, et al: Transformation of Mycosis Fungoides

Turk J Hematol 2018;35:35-41

or focal epidermotropism was present in 15 (60%) of the 25 patients in our study, and only 2 (8%) patients had Pautrier microabscesses. Folliculotropism was observed in ten cases (40%) with LCT. In eight (80%) of them, there was progression under treatment, while in one (10%) patient PR to treatment and in 1 (10%) patient CR was observed. Folliculotropism was not correlated statistically with survival (p=0.568).

correlated with poor survival (p=0.017). Loss of CD7 expression (more than 40%) was significantly related to poor survival (p=0.001). Laboratory findings are summarized in Table 3. High serum LDH levels were correlated significantly with poor survival (p=0.000). There was a statistically significant relationship

Immunophenotype analysis of the skin biopsies showed that 24 (96%) patients had a CD3+CD4+CD8− T-cell phenotype and one (4%) patient had a double CD4+CD8+ T-cell aberrant phenotype. In most cases (88%), there was partial loss of one or more pan-T-cell antigens. Loss of CD7 expression was seen in 22 (88%) patients. CD30 positivity in more than 75% of all the large T cells was present in skin biopsies of five patients (20%). In the remaining 20 (80%) cases, CD30 staining was either completely negative or expressed by only a very few (<5%) large T cells. There was no statistically significant difference either in disease stage or treatment response among CD30-positive and CD30-negative patients (p=0.290, p=0.630). Twelve patients with early (<2 years, n=3, 12%) and concurrent (n=9, 36%) transformation were also evaluated separately for survival (p=0.582). Advanced disease stage at the time of transformation correlated with poor survival (p=0.003). In our study, among the deceased patients, 80% had stage IV disease, whereas only 20% of patients had stage IV disease among the surviving patients (p=0.002). During follow-up, 10 patients died of disease-related events (32%). Three (30%) of 10 patients who died in our study had SS, and the other patients’ stages were as follows: stage IIB (n=1, 10%), stage III (n=1, 10%), and stage IVA (n=5, 50%). The survival curve of the patients is presented in Figure 2. Mean survival time was 25.2±14.9 (2-56) months after transformation. Laboratory Findings Flow cytometry of peripheral blood showed an increased ratio of CD4/CD8 (>2) in 13 (52%) patients. The ratio was between 2 and 10 in ten (40%) patients and higher than 10 in three (12%) patients. The patients’ disease stages and CD4/CD8 levels showed a statistically significant positive correlation (p=0.038). Increased CD4+/CD26 cell ratio was significantly

Figure 1. Histopathologically confirmed transformed mycosis fungoides (T-MF) lesions in different patients: extensive tumoral lesions with anaplastic transformation on the trunk (a); resistant tumoral lesion with loss of hair on eyebrow (b); refractory plaque on forearm (c); erythrodermic patient with ichthyotic lesions on legs, consistent with T-MF (d); postinflammatory hypopigmentary areas from previous treated tumors and tumoral lesions with anaplastic transformation (e); plaques and tumoral lesions on gluteal region and legs of a patient receiving extracorporeal photopheresis, interferon psoralen ultraviolet A, and bexarotene (f).

Table 2. Clinical features of transformed mycosis fungoides patients.

Mean ± SD

Median

Minimum

Maximum

Age at MF diagnosis, years

49±11.95

Age at T-MF diagnosis, years

53.68±12.06

MF to T-MF duration, months

67.9±62.6

192

Survival, months

25.2±14.9

MF: Mycosis fungoides, T-MF: transformed mycosis fungoides, SD: standard deviation.

Vural S, et al: Transformation of Mycosis Fungoides

Turk J Hematol 2018;35:35-41

between elevated serum LDH levels and advanced disease stage (p=0.028). The disease stage and β2-microglobulin levels were found to be positively correlated with Spearman’s test (p=0.026, r=0.463). There was no statistically significant relationship between β2-microglobulin levels and survival (p=0.125).

Figure 2. Kaplan-Meier survival curve: survival in months after anaplastic transformation. Table 3. Laboratory findings of transformed mycosis fungoides patients. Laboratory findings

Normal

n (%)

Eosinophil count

21 (84)

4 (16)

LDH

14 (56)

11 (44)

β2-microglobulin

7 (28)

18 (72)

>10

11 (44)

3 (12)

CD26 loss

10 (40)*

13 (52)

CD7 loss

16 (64)**

9 (36)

CD4/CD8

Peripheral blood flow cytometry

High

*CD4+/CD7-, 40% or more, **CD4+/CD26-, 30% or more. LDH: Lactate dehydrogenase.

Treatment All patients received first-line therapy as a combination treatment of two or more of the following: psoralen plus ultraviolet, interferon-alpha, extracorporeal photopheresis, vorinostat, bexarotene, retinoid, low-dose methotrexate, local radiotherapy, or total skin electron beam radiotherapy. Of the 18 (72%) patients showing PD with first-line treatment modalities, 12 (48%) patients received either second- or thirdline treatments. Of these 12 patients, six (48%) received secondline treatments either for the induction of remission or in an attempt to decrease tumor burden before allo-HSCT. Secondline therapy included single-agent chemotherapy of either gemcitabine or pralatrexate in 5 (20%) patients to decrease the tumor burden before allo-HSCT. One patient had a lymph node biopsy consistent with concomitant natural killer cell lymphoma and received an Aurora A kinase inhibitor as second-line therapy following five cycles of multiagent chemotherapy. All of the patients’ treatment responses with second-line treatment were evaluated as PD. Seven (28%) patients received third-line therapy due to PD. Additionally, three (12%) patients had received multiagent chemotherapy before first- and second-line treatments before admission to our center. In all patients, the treatment responses of the third-line treatments were evaluated as PD. Five (20%) patients with PD underwent allo-HSCT and CR was achieved in 3 (60%) of them after the procedure. Two patients’ disease recurred 2 and three months after allo-HSCT, and these two patients died 9 and 11 months following transplantation, respectively. One patient in follow-up with complete remission died 24 months after allo-HSCT due to sepsis. Autologous stem cell transplantation was performed in one patient in 2000, and the patient died four months after the procedure due to disease progression. The outcome of patients with HSCT is given in Table 4.

Table 4. Clinical features and treatment results of the patients who had undergone allogeneic hematopoietic stem cell transplantation.

Type

Age

Sex

Stage

HSCT/HLA mismatch

Conditioning regimen

Follow-up after alloHSCT

Treatment response at last follow-up

Allo-HSCT

IVA

10/10

RIC (Flu+Cy+TBI)

21 months

Allo-HSCT

IVA

10/10

RIC (Flu+Cy+TBI)

41 months

Allo-HSCT

IIB**

10/10

RIC (Flu+Cy+TBI)

24 months

CR*

Allo-HSCT

IVA

9/10

MA (Cy+TBI)

7 months

Exitus (refractory)

Allo-HSCT

IVA

9/10

RIC (Flu+Cy+TBI)

11 months

Exitus (refractory)

Autologous

III

4 months

Exitus (refractory)

*Patient died due to sepsis without recurrence, **The patient’s stage was IIB at the time of transformation and progressed to stage IVA during follow-up. Allo-HSCT: Allogeneic hematopoietic stem cell transplantation, HSCT: hematopoietic stem cell transplantation, HLA: human leukocyte antigen, CR: complete response.

Vural S, et al: Transformation of Mycosis Fungoides

Discussion LCT of MF can occur at any stage of MF, and it has been associated with disease progression and poor outcome. Unfavorable prognostic factors for T-MF have been reported previously as advanced stage, presentation of MF with transformation, generalized skin tumors, increased LDH level, and use of combination chemotherapy [5,15]. CD30 expression in less than 10% of skin lesions is one of the poor prognostic factors [5,6,8,15]. On the other hand, in this study, high serum LDH levels, loss of CD26 expression of more than 30% in peripheral blood, and loss of CD7 expression were associated with poor survival among T-MF patients. LCT at initial diagnosis of MF or within two years has been associated with worse prognosis in several studies [3,5,16,17,18]. However, in some studies, including ours, the prognostic significance of early transformation was not validated [19]. Mean time between MF and T-MF diagnosis varies from 44 months to 6.5 years in reported studies [2,7,17,19]. In our study, this period was determined as 32 months. In previous studies, LCT of MF has been reported mainly in advanced disease. In a series with 22 T-MF patients, Arulogun et al. [17] reported that only 1.4% of early-stage MF patients developed T-MF, whereas this rate was more than 25% in stage 2B patients and more than 50% in stage 4 patients. Consistent with this study, LCT of MF was detected in 8% of cases in the early stage in our series. MF is a slowly progressive CTCL with an excellent prognosis, especially in early-stage disease. In the case of transformation, the prognosis of early-stage MF deteriorates significantly [20]. Still, previous studies have shown that patients with early (stage I-IIA) LCT have longer survival compared with patients with LCT in advanced disease (stage IIB-IV) [5]. Likewise, in our study, advanced disease stage at the time of transformation was significantly correlated with shorter survival. In different studies, extracutaneous disease (stage IV) was shown to be associated with poor prognosis [2,19]. In our study, a significant majority of the patients who died had stage IV MF. The mean survival time after LCT has been reported to be in the range of 2 to 36 months [2,3,4,5,7,9,10,17,19]. In our study, the mean survival time of the ten patients who died was determined as 25.2±14.9 (2-56) months. Transformed folliculotropic MF patients were previously found to have shorter survival time [2,21,22]. In one previous study, epidermotropism was detected in patients with LCT, although it was less prominent or focal [3]. In our series epidermotropism was present only in 60% of patients and it was less noticeable in histopathological examinations. According to a recent study, several clinical characteristics such as a new solitary nodule on MF plaques or rapidly presenting 40

Turk J Hematol 2018;35:35-41

scattered papules may be indicators of the development of LCT for dermatologists [15]. We would like to emphasize that transformation was also observed in treatment-refractory long-standing tumoral and plaque lesions, and in a patient with ichthyosiform erythroderma. For this reason, in addition to the cautionary skin findings mentioned before, reevaluation of treatment-resistant and unexpected lesions, especially in advanced-stage patients, is recommended. The treatment strategy is challenging in T-MF. It is important to note that, among our patients with advanced stages of T-MF, none had a CR to treatment under first-line therapies. Among patients receiving first-line therapy, 20% had either SD or PR with these therapies. Notably, all the patients who received second- and third-line therapies had PD. This finding highlights the refractory nature of T-MF. In fact, aggressive treatment strategies and multiple chemotherapies for MF result in a short period of CR, followed by an aggressive relapse [13]. Allo-HSCT is an emerging effective therapy in MF/SS, demonstrating a decrease in the relapse rate and an overall increase in diseasefree survival. It was reported that one year after allo-HSCT, 42% of patients remained in remission [23]. In our series, 60% of patients were in remission one year after transplantation. Transplant-related mortality and infections are significant factors decreasing the success rate of allo-HSCT. However, in selected patients with T-MF, allo-HSCT increases disease-free survival and thus the quality of life. Study Limitations A limitation of the present study was the small number of patients with T-MF, highlighting the rarity of MF/SS. A second limitation was the retrospective design of the study, which may have restricted retrieval of the data from patient archives.

Conclusion Unfavorable prognostic factors in T-MF include advanced stage, high serum LDH levels, and loss of CD7 and CD26 expression in T helper cells. In patients with treatment-refractory tumors and unusual lesions, a biopsy is warranted to exclude T-MF. Patients with T-MF have a short life expectancy. Patients may have CR, PR, or SD with first-line treatments, which underlines the value of less aggressive therapies. However, nonresponders usually do not respond to second- or third-line therapies. Allo-HSCT may be an alternative option for patients with T-MF. Ethics Ethics Committee Approval: Ankara University Faculty of Medicine Ethical Comittee (09/01/2017 number: 01-05-17). Informed Consent: Retrospective study

Turk J Hematol 2018;35:35-41

Authorship Contributions Medical Practices: E.A., S.V., B.N.A., H.Ş., N.P., A.O.H.; Concept: B.N.A., H.Ş.; Design: S.V., A.B.; Data Collection or Processing: A.B., N.P., E.A., S.V.; Analysis or Interpretation: A.B., S.V., B.N.A., H.Ş.; Literature Search: A.B., S.V.; Writing: S.V., A.B. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Willemze R, Jaffe ES, Burg G, Cerroni L, Berti E, Swerdlow SH, Ralfkiaer E, Chimenti S, Diaz-Perez JL, Duncan LM, Grange F, Harris NL, Kempf W, Kerl H, Kurrer M, Knobler R, Pimpinelli N, Sander C, Santucci M, Sterry W, Vermeer MH, Wechsler J, Whittaker S, Meijer CJ. WHO-EORTC classification for cutaneous lymphomas. Blood 2005;105:3768-3785. 2. Benner MF, Jansen PM, Vermeer MH, Willemze R. Prognostic factors in transformed mycosis fungoides: a retrospective analysis of 100 cases. Blood 2012;119:1643-1649. 3. Salhany KE, Cousar JB, Greer JP, Casey TT, Fields JP, Collins RD. Transformation of cutaneous T cell lymphoma to large cell lymphoma. A clinicopathologic and immunologic study. Am J Pathol 1988;132:265-277. 4. Wolfe JT, Chooback L, Finn DT, Jaworsky C, Rook AH, Lessin SR. Large-cell transformation following detection of minimal residual disease in cutaneous T-cell lymphoma: molecular and in situ analysis of a single neoplastic T-cell clone expressing the identical T-cell receptor. J Clin Oncol 1995;13:17511757. 5. Diamandidou E, Colome-Grimmer M, Fayad L, Duvic M, Kurzrock R. Transformation of mycosis fungoides/Sezary syndrome: clinical characteristics and prognosis. Blood 1998;92:1150-1159. 6. Talpur R, Jones DM, Alencar AJ, Apisarnthanarax N, Herne KL, Yang Y, Duvic M. CD25 expression is correlated with histological grade and response to denileukin diftitox in cutaneous T-cell lymphoma. J Invest Dermatol 2006;126:575-583. 7. Barberio E, Thomas L, Skowron F, Balme B, Dalle S. Transformed mycosis fungoides: clinicopathological features and outcome. Br J Dermatol 2007;157:284-289. 8. Greisser J, Doebbeling U, Roos M, Mueller B, Schmid M, Burg G, Kadin ME, Kempf W. Apoptosis in CD30-positive lymphoproliferative disorders of the skin. Exp Dermatol 2005;14:380-385.

Vural S, et al: Transformation of Mycosis Fungoides

Whittaker S, ISCL/EORTC. Revisions to the staging and classification of mycosis fungoides and Sezary syndrome: a proposal of the International Society for Cutaneous Lymphomas (ISCL) and the cutaneous lymphoma task force of the European Organization of Research and Treatment of Cancer (EORTC). Blood 2007;110:1713-1722. 13. Alberti-Violetti S, Talpur R, Schlichte M, Sui D, Duvic M. Advancedstage mycosis fungoides and Sezary syndrome: survival and response to treatment. Clin Lymphoma Myeloma Leuk 2015;15:105-112. 14. National Comprehensive Cancer Network. NCCN Clinical Practice Guidelines in Oncology. Fort Washington, NCCN, 2017. Available online at https:// www.nccn.org/professionals/physician_gls/f_guidelines.asp. 15. Talpur R, Sui D, Gangar P, Dabaja BS, Duvic M. Retrospective analysis of prognostic factors in 187 cases of transformed mycosis fungoides. Clin Lymphoma Myeloma Leuk 2016;16:49-56. 16. Diamandidou E, Colome M, Fayad L, Duvic M, Kurzrock R. Prognostic factor analysis in mycosis fungoides/Sezary syndrome. J Am Acad Dermatol 1999;40:914-924. 17. Arulogun SO, Prince HM, Ng J, Lade S, Ryan GF, Blewitt O, McCormack C. Long-term outcomes of patients with advanced-stage cutaneous T-cell lymphoma and large cell transformation. Blood 2008;112:3082-3087. 18. Scarisbrick JJ, Prince HM, Vermeer MH, Quaglino P, Horwitz S, Porcu P, Stadler R, Wood GS, Beylot-Barry M, Pham-Ledard A, Foss F, Girardi M, Bagot M, Michel L, Battistella M, Guitart J, Kuzel TM, Martinez-Escala ME, Estrach T, Papadavid E, Antoniou C, Rigopoulos D, Nikolaou V, Sugaya M, Miyagaki T, Gniadecki R, Sanches JA, Cury-Martins J, Miyashiro D, Servitje O, Muniesa C, Berti E, Onida F, Corti L, Hodak E, Amitay-Laish I, OrtizRomero PL, Rodríguez-Peralto JL, Knobler R, Porkert S, Bauer W, Pimpinelli N, Grandi V, Cowan R, Rook A, Kim E, Pileri A, Patrizi A, Pujol RM, Wong H, Tyler K, Stranzenbach R, Querfeld C, Fava P, Maule M, Willemze R, Evison F, Morris S, Twigger R, Talpur R, Kim J, Ognibene G, Li S, Tavallaee M, Hoppe RT, Duvic M, Whittaker SJ, Kim YH. Cutaneous Lymphoma International Consortium study of outcome in advanced stages of mycosis fungoides and Sezary syndrome: effect of specific prognostic markers on survival and development of a prognostic model. J Clin Oncol 2015;33:3766-3773. 19. Vergier B, de Muret A, Beylot-Barry M, Vaillant L, Ekouevi D, Chene G, Carlotti A, Franck N, Dechelotte P, Souteyrand P, Courville P, Joly P, Delaunay M, Bagot M, Grange F, Fraitag S, Bosq J, Petrella T, Durlach A, De Mascarel A, Merlio JP, Wechsler J. Transformation of mycosis fungoides: clinicopathological and prognostic features of 45 cases. French Study Group of Cutaneous Lymphomas. Blood 2000;95:2212-2218. 20. Herrmann JL, Hughey LC. Recognizing large-cell transformation of mycosis fungoides. J Am Acad Dermatol 2012;67:665-672.

9. Dmitrovsky E, Matthews MJ, Bunn PA, Schechter GP, Makuch RW, Winkler CF, Eddy J, Sausville EA, Ihde DC. Cytologic transformation in cutaneous T cell lymphoma: a clinicopathologic entity associated with poor prognosis. J Clin Oncol 1987;5:208-215.

21. Agar NS, Wedgeworth E, Crichton S, Mitchell TJ, Cox M, Ferreira S, Robson A, Calonje E, Stefanato CM, Wain EM, Wilkins B, Fields PA, Dean A, Webb K, Scarisbrick J, Morris S, Whittaker SJ. Survival outcomes and prognostic factors in mycosis fungoides/Sezary syndrome: validation of the revised International Society for Cutaneous Lymphomas/European Organisation for Research and Treatment of Cancer staging proposal. J Clin Oncol 2010;28:4730-4739.

10. Greer JP, Salhany KE, Cousar JB, Fields JP, King LE, Graber SE, Flexner JM, Stein RS, Collins RD. Clinical features associated with transformation of cerebriform T-cell lymphoma to a large cell process. Hematol Oncol 1990;8:215-227.

22. van Doorn R, Van Haselen CW, van Voorst Vader PC, Geerts ML, Heule F, de Rie M, Steijlen PM, Dekker SK, van Vloten WA, Willemze R. Mycosis fungoides: disease evolution and prognosis of 309 Dutch patients. Arch Dermatol 2000;136:504-510.

11. Cerroni L, Rieger E, Hodl S, Kerl H. Clinicopathologic and immunologic features associated with transformation of mycosis fungoides to large-cell lymphoma. Am J Surg Pathol 1992;16:543-552.

23. Duarte RF, Canals C, Onida F, Gabriel IH, Arranz R, Arcese W, Ferrant A, Kobbe G, Narni F, Deliliers GL, Olavarria E, Schmitz N, Sureda A. Allogeneic hematopoietic cell transplantation for patients with mycosis fungoides and Sezary syndrome: a retrospective analysis of the Lymphoma Working Party of the European Group for Blood and Marrow Transplantation. J Clin Oncol 2010;28:4492-4499.

12. Olsen E, Vonderheid E, Pimpinelli N, Willemze R, Kim Y, Knobler R, Zackheim H, Duvic M, Estrach T, Lamberg S, Wood G, Dummer R, Ranki A, Burg G, Heald P, Pittelkow M, Bernengo MG, Sterry W, Laroche L, Trautinger F,

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0498 Turk J Hematol 2018;35:42-48

The Effect of Bone Marrow Mesenchymal Stem Cells on the Granulocytic Differentiation of HL-60 Cells Kemik İliği Mezankimal Hücrelerinin HL-60 Hücrelerindeki Granülositik Farklılaşması Üzerine Etkisi Hossein Nikkhah1, Elham Safarzadeh2,3, Karim Shamsasenjan1, Mehdi Yousefi2,3, 4 5 Mozhde Mohammadian , Farhoud Golafshan , Aliakbar Movassaghpour1

Parisa Lotfinejad1,3,

Mehdi Talebi1,

Tabriz University Faculty of Medicine, Hematology and Oncology Research Center, Tabriz, Iran Tabriz University Faculty of Medicine, Drug Applied Research Center, Tabriz, Iran 3 Tabriz University Faculty of Medicine, Department of Immunology, Tabriz, Iran 4 Mazandaran University Faculty of Medicine, Amol Faculty of Paramedical Sciences, Sari, Iran 5 Hamline University Faculty of Medicine, Department of Biology, Minnesota, USA 1 2

Abstract

Öz

Objective: Mesenchymal stem cells (MSCs) are multipotent stromal cells that can differentiate into a variety of cell types. They control the process of hematopoiesis by secreting regulatory cytokines and growth factors and by the expression of important cell adhesion molecules for cell-to-cell interactions. This investigation was intended to examine the effect of bone marrow (BM)-derived MSCs on the differentiation of HL-60 cells according to morphological evaluation, flow cytometry analysis, and gene expression profile.

Amaç: Mezankimal kök hücreler (MKH) birçok hücre tipine göre farklılaşabilen multipotent stromal hücrelerdir. Hematopoez sürecini düzenleyici sitokinler ve büyüme faktörleri salınımı ile ve hücreler arası etkileşim için önemli hücresel adezyon moleküllerinin ifadesi yoluyla kontrol ederler. Bu çalışma da kemik iliği (Kİ) kaynaklı MKH HL-60 hücrelerinin farklılaşması üzerine etkisini morfolojik değerlendirme, akım sitometri ve gen ifade analizi yöntemleriyle araştırılması amaçlanmıştır.

Materials and Methods: The BM-MSCs were cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum (FBS). After the third passage, the BM-MSCs were irradiated at 30 Gy. To compare how the HL-60 cells differentiated in groups treated differently, HL-60 cells were cultured in RPMI-1640 and supplemented with 10% FBS. The HL-60 cells were seeded into six-well culture plates and treated with all-trans-retinoic acid (ATRA), BM-MSCs, or BM-MSCs in combination with ATRA, while one well remained as untreated HL-60 cells. The expression levels of the granulocyte subsetspecific genes in the HL-60 cells were assayed by real-time polymerase chain reaction.

Gereç ve Yöntemler: Kİ-MKH %10 fetal sığır serumu (FSS) içeren Dulbecco’nun modifiye Eagle ortamında kültür edildi. Üçüncü pasaj sonrası, Kİ-MKH 30 Gy ile ışınlandı. HL-60 hücrelerinin farklı şartlarda nasıl farklılaştığını karşılaştırmak için HL-60 hücreler %10 FSS eklenmiş RPMI-1640 ortamında kültür edildi. HL-60 hücreleri altı kuyucuklu plaklarda all-trans retinoik asit (ATRA), Kİ-MKH ve ATRA ile birlikte Kİ-MKH ile muamele edilirken, bir kuyucuğa sadece HL60 hücreleri kondu. HL-60 hücrelerinde granülosit alt gruplarına özgü genlerin ifade düzeyleri gerçek zamanlı polimeraz zincir reaksiyonu ile değerlendirildi.

Results: Our results revealed that BM-MSCs support the granulocytic differentiation of the human promyelocytic leukemia cell line HL-60.

Bulgular: Sonuçlarımız Kİ-MKH’nin insan promiyelositik lösemi hücre dizisi HL-60’ın granülositik farklılaşmasını desteklediğini gösterdi.

Conclusion: Based on the results of this study, we concluded that BM-MSCs may be an effective resource in reducing or even preventing ATRA’s side effects and may promote differentiation for short medication periods. Though BM-MSCs are effective resources, more complementary studies are necessary to improve this differentiation mechanism in clinical cases.

Sonuç: Bu çalışmanın bulgularına göre, Kİ-MKH’nin ATRA yan etkilerini azaltıcı ve hatta önleyici etkili bir kaynak olduğu ve kısa ilaç kullanımı süreçlerinde farklılaşmayı uyarabileceği sonucunu çıkarttık. Kİ-MKH etkili bir kaynak olsa da, klinik olgularda bu farklılaşma mekanizmasını iyileştirmek için destekleyici ek çalışmalara ihtiyaç vardır.

Keywords: Mesenchymal stem cells, HL-60 cells, Differentiation, Alltrans-retinoic acid

Anahtar Sözcükler: Mezankimal kök hücreler, HL-60 hücreleri, Farklılaşma, All-trans retinoik asit

Address for Correspondence/Yazışma Adresi: Ali Akbar MOVASSAGHPOUR, M.D., Tabriz University Faculty of Medicine, Hematology and Oncology Research Center, Tabriz, Iran Phone : +984 133 343 888 E-mail : movassaghpour@tbzmed.ac.ir ORCID-ID: orcid.org/0000-0002-6990-9260

Received/Geliş tarihi: December 27, 2016 Accepted/Kabul tarihi: June 12, 2017

Turk J Hematol 2018;35:42-48

Introduction There are different cell types of the osteoblast lineage in bone and the bone marrow, the most primitive of them being the mesenchymal stem cells (MSCs) [1,2]. MSCs can differentiate into several types of cells and produce important growth factors and cytokines [3,4]. MSCs are defined by the International Society of Cellular Therapy based on three properties: the adherence to plastic in standard culture; the expression of CD105, CD73, and CD90 and lack of expression of CD45, CD34, CD14 or CD11b, CD79α or CD19, and HLA class II; and differentiation potential into osteocytes, adipocytes, and chondrocytes [5,6]. These cells are involved in the regulation of hematopoietic precursor cell proliferation and differentiation [7,8]. All-trans-retinoic acid (ATRA) has a potential role in treating acute myeloid leukemia (AML) and some hematological disorders [9]. It has been recognized that ATRA induces the differentiation of myeloid leukemic cells through growth inhibition [10]. Many studies have reported severe adverse effects of ATRA. Therefore, novel therapeutic strategies need to be developed to decrease ATRA’s potential side effects and enhance the efficacy of this drug. One possible approach is the use of ATRA-based combinations that are more efficient than the single components [11,12,13]. The roles of the various cells in the bone marrow niche are unclear in the differentiation of hematopoietic stem cells, and MSCs, as the precursors of the cellular components, are important cells of the bone marrow niche [14]. To understand the precise interaction between MSCs and leukemic cells, in the current study we investigated whether MSCs affect the differentiation of HL-60 cells.

Materials and Methods Cell Culture Human promyelocytic leukemia cell line HL-60 (a kind gift from Dr. Abroun, Tarbiat Modares University, Tehran, Iran) was cultured in RPMI-1640 medium (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (HyClone, Logan, UT, USA), 100 U/mL penicillin, and 100 µg/mL streptomycin (Sigma, St. Louis, MO, USA). The BM-MSCs (Stem Cell Technology, Tehran, Iran) were cultured in low-glucose Dulbecco’s modified Eagle medium (GIBCO BRL, Gaithersburg MD, USA) containing 10% fetal bovine serum. Co-culture Experiments HL-60 cells (105 cells/mL) were seeded onto plates and treated with ATRA at a concentration of 5x10-7 M (Sigma-Aldrich) for 48 h. The co-culture experiments were performed in six-well plates including the HL-60 cells treated with BM-MSCs or those treated with BM-MSCs and 5x10-7 M ATRA together. Before coculturing with cancer cells, the BM-MSCs were irradiated at 30

Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell Differentiation

Gy when they reached 60% confluence. The HL-60 cells came into direct contact with the BM-MSCs. Morphological Study of Differentiated Granulocyte Cells To study the morphological changes, the HL-60 cells were treated with ATRA, BM-MSCs, or a combination of ATRA and BM-MSCs. After 48 h of incubation, the cells were stained with Wright-Giemsa stain and studied by light microscope. Flow Cytometric Assessment of Granulocytic Markers for Differentiation The HL-60 cells (1x106) of the different groups, the co-culture of the HL-60 cells with BM-MSCs, the HL-60 cells with BMMSCs and ATRA in combination, the HL-60 cells with ATRA as a positive control, and the HL-60 cells without additions as a negative control were harvested and incubated with FITClabeled anti-CD11b (Becton Dickinson, San Jose, CA, USA) for 30 min at 4 °C. The cells were then analyzed for the evaluation of CD11b expression (a myeloid differentiation marker) with a flow cytometer (Becton Dickinson). Real-Time Polymerase Chain Reaction The expression of the granulocyte subset-specific genes in the treated HL-60 cells was investigated by real-time polymerase chain reaction (RT-PCR) after an incubation period of 48 h. Total RNA was extracted using the QIAzol lysis reagent (QIAGEN, Germantown, MD, USA) according to the manufacturer’s instructions. The cDNA was prepared according to the instructions of the Revert Aid Single Strand Kit (Fermentas, Burlington, ON, Canada). The mRNA levels of PU.1, CD11b, lysozyme, C/EBP-ALPHA, C/EBP-BETA, C/EBP E, MPO, CD64, CD16, GCSFR, and cathepsin G were analyzed using qRT-PCR. The GAPDH gene was used as an internal control (Table 1). Statistical Analysis Data were reported as mean ± standard deviation and were analyzed using Graph Pad Prism v 5.00 (Graph Pad Software, Inc., La Jolla, CA, USA). Student’s t-test for single comparisons and twoway ANOVA for multigroup comparisons were used for analysis and p<0.01 was regarded as denoting statistical significance.

Results Flow Cytometry Confirmation of the Nature of the BM-MSCs To verify the mesenchymal nature of the BM-MSCs, the surface antigens were assessed by flow cytometry, including CD14, CD19, CD34, CD45 CD90, CD105, and CD73. The characterization experiments performed in our study demonstrated that the BM-MSCs were negative in the expression of the hematopoietic markers for CD14, CD19, CD34, and CD45, and they had positive expression for CD90, CD105, and CD73 markers (Figure 1). 43

Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell Differentiation

Turk J Hematol 2018;35:42-48

Table 1. Primers for real-time polymerase chain reaction. Gene name

Forward primer

Reverse primer

PU.1

GACACGGATCTATACCAACGCC

CCGTGAAGTTGTTCTCGGCGAA

CD11b

GGAACGCCATTGTCTGCTTTCG

ATGCTGAGGTCATCCTGGCAGA

Lysozyme

ACTACAATGCTGGAGACAGAAGC

GCACAAGCTACAGCATCAGCGA

C/EBP-α

AGGAGGATGAAGCCAAGCAGCT

AGTGCGCGATCTGGAACTGCAG

C/EBP-β

AGAAGACCGTGGACAAGCACAG

CTCCAGGACCTTGTGCTGCGT

C/EBP E

CCAGCCTCTGCGCGTTCTCAA

CAAGGCTATCTTTGTTCACTGCC

MPO

GAGCAGGACAAATACCGCACCA

AGAGAAGCCGTCCTCATACTCC

CD16

GGTGACTTGTCCACTCCAGTGT

ACCATTGAGGCTCCAGGAACAC

GCSFR

CCACTACACCATCTTCTGGACC

GGTGGATGTGATACAGACTGGC

Cathepsin G

CGACAGTACCATTGAGTTGTGCG

TTCGTCCATAGGAGACAATGCCC

MPO: Myeloperoxidase.

Figure 1. Flow cytometry analysis confirmed the mesenchymal nature of the bone marrow mesenchymal stem cells. The markers assessed by flow cytometry included CD14, CD19, CD34, CD45 CD90, CD105, and CD73. The experiments were done in triplicate. Morphological Changes of the Treated Cells To assess the morphological changes in the treated HL-60 cells, Wright-Giemsa staining was performed (Figures 2A-2D). The comparative study of the morphological changes in the HL-60 cells stained by Wright-Giemsa indicated that, in comparison to the control, the cells treated with ATRA and BM-MSCs individually 44

had induced granulocytic differentiation of the HL-60 cells (Figures 2B and 2C) and showed an additive effect when used with BM-MSCs in combination with ATRA (Figure 2D). While the control cells (Figure 2A) demonstrated typical morphology in the promyelocytic cells (a circular nucleus), the treated HL-60 cells exhibited a kidney-shaped nucleus and segmented nucleus and also had a reduced nuclear/cytoplasmic ratio.

Turk J Hematol 2018;35:42-48

CD11b Expression Increased in Treated HL-60 Cells In the treated HL-60 cells, an increase was observed in the percentage of CD11b marker expression, one of the main granulocytic differentiation markers measured by flow cytometry, after 48 h. Flow cytometry results displayed that the expression of the CD11b marker was 17.12%, 76.69%, 23.96%, and 96.4% in the untreated HL-60 cells, in the HL-60 cells treated with ATRA, in the HL-60 cells treated with BMMSCs, and in the HL-60 cells treated with a combination of BM-MSCs and ATRA, respectively (Figure 3). The expression of CD11b significantly increased in the HL-60 cells treated with the combination of BM-MSCs and ATRA compared to the HL-60 cells treated with ATRA alone or with BM-MSCs alone. Effects of BM-MSCs and ATRA on Gene Expression in HLA-60 Cells In the ATRA-treated HL-60 cells, there was a marked increase (p<0.05) in the gene expressions of CD11b, lysozyme, GCSFR, CD64, PU.1, and C/EBP-ALPHA from 1.00 to 8.33 (±0.07), 5.53 (±0.16), 3.36 (±0.12), 1.94 (±0.02), 1.26 (±0.04), and 1.11 (±0.02), respectively. There was no gene expression for C/EBP-BETA, C/EBP E, or CD16 (Figure 4). On the other hand, as revealed in Figure 4, in the HL-60 cells co-cultured with the BM-MSCs, there was significant increase (p<0.05) in CD11b, lysozyme, PU.1, CD64, and GCSFR expression levels from 1.00 to 2.2 (±0.07), 3.3 (±0.16), 1.23 (±0.02), 1.11 (±0.02), and 1.51 (±0.12), respectively, and there was no expression of C/EBP-BETA, C/EBP E, or CD16

Figure 2. BM-MSCs induced the granulocytic differentiation of HL-60 cells after 48 h of incubation and showed an additive effect with all-trans-retinoic acid (ATRA). The differentiation of the HL-60 cells was assessed by Wright-Giemsa staining: a) untreated HL-60 cells, b) HL-60 cells treated with ATRA, c) HL60 cells treated with bone marrow mesenchymal stem cells, d) HL-60 cells treated with ATRA and BM-MSCs. Magnitude: 100x.

Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell Differentiation

levels. In the HL-60 cells co-cultured with the combination of BM-MSCs and ATRA, the gene expression of CD11b, lysozyme, CD64, GCSFR, C/EBP-ALPHA, and PU.1 was markedly increased (p<0.05) from 1.00 to 12.26 (±0.07), 7.19 (±0.16), 1.92 (±0.02), 4.77 (±0.12), 1.31(±0.02), and 1.18 (±0.04), respectively. There was no expression for C/EBP-BETA, C/EBP E, or CD16 (Figure 4). The myeloid differentiation was characterized by downregulation of myeloperoxidase (MPO), a major protein expressed in myeloid cells. We assessed the mRNA level of MPO by RT-PCR after 48 h of treatment. The BM-MSCs, like ATRA, tended to decrease the MPO transcription (Figure 4).

Discussion MSCs can support hematopoiesis by producing soluble factor(s) and also by the expression of cell adhesion molecules that are important for cell-to-cell interaction [15]. MSCs have been the subject of particular interest in recent years due their great potential for treating various diseases, especially those related to immune system disorders. However, there are controversial opinions on the role of MSCs in malignancies [16,17,18,19]. In recent years, several groups investigated the possible role of MSCs in influencing the behavior of tumor cells [20,21]. These studies

Figure 3. The flow cytometric analysis of CD11b, a granulocytic differentiation marker, after 48 h: a) untreated HL-60 cells, b) HL60 cells treated with BM-MSCs, c) HL-60 cells co-cultured with all-trans-retinoic acid (ATRA), d) HL-60 cells treated with BMMSCs and ATRA. BM-MSCs and ATRA synergistically upregulated CD11b expression in cells treated with the combination of the two. The experiments were done in triplicate. 45

Nikkhah H, et al: BM-MSCsâ&#x20AC;&#x2122; Effects on HL-60 Cell Differentiation

Turk J Hematol 2018;35:42-48

Figure 4. Gene expression during differentiation of the HL-60 cells after 48 h: a) PU.1 gene expression, b) CD11b gene expression, c) lysozyme gene expression, d) C/EBP-alpha gene expression, e) myeloperoxidase gene expression, f) CD64 gene expression, g) GCSFR gene expression, h) cathepsin G gene expression. The experiments were performed in triplicate. *p<0.05. MPO: Myeloperoxidase, ATRA: all-trans-retinoic acid.

mostly focused on the proliferation and apoptosis of cancer cells, but little is known about the effect of MSCs in the differentiation of leukemic cells [22]. It has been shown that substances such as ursolic acid, 12-O-tetradecanoylphorbol 13-acetate, and 1,25-dihydroxyvitamin D3 [1,25(OH)2D3] inhibit the proliferation of and promote the monocyte/macrophage differentiation of AML HL-60 cells. A secosteroid, 1,25(OH)2D3 has a potential role in the differentiation of the cells of the myeloid lineage in vitro and ex vivo. This ability results in the use of 1,25(OH)2D3 to treat myelodysplastic syndromes or AML. However, 1,25(OH)2D3 leads to the partial differentiation of the hematopoietic blast cells and hypercalcemia, which is a limiting factor in its clinical application [23,24]. Differentiation therapy in APL patients with ATRA alone or in combination with chemotherapy has made great breakthroughs and results in high rates of complete clinical remission. However, it has potentially fatal side effects, such as retinoic acid syndrome and the development of resistance to this drug [13,25]. Repeated treatment with ATRA results in progressive resistance that it is attributed to the decrease of the ATRA serum level, which may 46

be caused by accelerated clearance [26]. The use of ATRA in combination is one possible method to increase the therapeutic efficacy of this drug. Therefore, increasing efforts have been focused on developing alternative differentiation-promoting therapeutic methods with fewer side effects [22]. MSCs possess great advantages in research and clinical applications because of their better expandability, sufficient supply, and painless collection process [27]. Previous studies have shown that ATRA induces morphological differentiation of HL-60 cells. The results from this study indicated that ATRA, BM-MSCs, and ATRA in combination with BM-MSCs promote the differentiation of HL-60 cells compared to untreated cells. It should be added that the HL-60 cells treated with both ATRA and BM-MSCs appeared more mature, presenting band-form nuclei and segmented nuclei, compared to cells treated with either ATRA or the BM-MSCs alone (Figure 2). Matching of the morphological and immunophenotypic data is critical, so immunophenotypic evaluations were performed. The proliferating HL-60 cells, in contrast to monocytes and

Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell Differentiation

Turk J Hematol 2018;35:42-48

neutrophils, do not express the CD11b marker, the b-subunit of integrin-aMb2 (also known as CD11b/CD18, MAC-1, or CR3). It was demonstrated that most HL-60 cells, following treatment with D3 (90% at 3-4 days) or ATRA (80% at 4-5 days), become CD11b-positive [28]. As shown in Figure 3, the morphological data were further confirmed by the results of the immunophenotyping of CD11b. After 48 h of treatment, the expression of the CD11b marker in the HL-60 cells co-cultured with BM-MSCs in combination with ATRA was higher than that in the HL-60 cells co-cultured with BM-MSCs or ATRA individually. Therefore, we concluded that BM-MSCs induce the granulocytic differentiation of HL-60 cells.

an additive effect when used in combination with ATRA. Consequently, our data highlight the critical role of BM-MSCs in the granulocytic differentiation of HL-60 cells and the use of BM-MSCs and ATRA in combination could be a novel therapeutic strategy for AML patients.

Our data described the changes in the gene expression pattern during the transformation of the proliferating HL-60 cells into mature cells. One of the important factors that regulate the differentiation of HSCs along the myeloid lineage towards granulocytes rather than monocytes is CCAAT-enhancer binding protein-alpha (C/EBP-ALPHA). Indeed, C/EBP alpha knock-out mice demonstrate an early block in granulocytic differentiation [29]. The results of this study indicate that the BM-MSCs enhance ATRA’s effect on the amplification of C/EBPALPHA transcription, but the BM-MSCs alone were upregulated without statistical significance. Our data also showed that the BM-MSCs and ATRA synergistically increased the expression of the CD11b and lysozyme genes.

Ethics

In this study, we found an increased level of gene expression of PU.1 in the three groups of experiments compared to the untreated cells. Interestingly, we observed no significant synergistic effect in the HL-60 cells treated with ATRA in combination with the BM-MSCs. PU.1 has a critical role in the growth and development of hematopoietic cells. Several studies reported that PU.1-deficient mice lack mature myeloid lineages [30,31]. Uchino et al. [32] reported that the expression of the G-CSF receptor, contrary to their hypotheses, was downregulated after treatment with ATRA. The G-CSF receptor is present in the progenitor cells in the bone marrow, which is involved in the differentiation of the granulocytes through induction of G-CSF [33]. In our study, ATRA upregulated the expression of the G-CSF receptor gene and the use of the BM-MSCs in combination with ATRA synergistically enhanced ATRA’s effect on the expression of this gene, which may demonstrate the critical role of the G-CSF receptor in the promotion of differentiation in promyelocytic leukemia cells. Furthermore, in line with our hypothesis, the treatment with ATRA downregulated the expression of the MPO gene, but the BM-MSCs in combination with ATRA did not have a synergistic effect on the expression of this gene.

Conclusion Our results demonstrated that BM-MSCs could promote the granulocytic differentiation of HL-60 cells and could elicit

Acknowledgments We would like to acknowledge the support of the Shahid Ghazi Hematology and Oncology Research Center and Hematology and Oncology Laboratory, Tabriz University Faculty of Medicine. We would also like to thank the Blood Transfusion Research Center of Tabriz.

Ethics Committee Approval: Tabriz University Faculty of Medicine, approval number (IR.TBZMED.REC.8204). Informed Consent: N/A. Authorship Contributions Concept: A.M.; Design: A.M., M.Y.; Cellular Analysis: H.N.; Molecular Analysis: E.S.; Data Collection or Processing: M.M., Analysis or Interpretation: K.S.; Literature Search: M.T.; Writing: P.L., F.G. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Kim YH, Yoon DS, Kim HO, Lee JW. Characterization of different subpopulations from bone marrow-derived mesenchymal stromal cells by alkaline phosphatase expression. Stem Cells Dev 2012;21:2958-2968. 2. Short B, Brouard N, Occhiodoro-Scott T, Ramakrishnan A, Simmons PJ. Mesenchymal stem cells. Arch Med Res 2003;34:565-571. 3. Delorme B, Chateauvieux S, Charbord P. The concept of mesenchymal stem cells. Regen Med 2006;1:497-509. 4. Beyer Nardi N, da Silva Meirelles L. Mesenchymal stem cells: isolation, in vitro expansion and characterization. Handb Exp Pharmacol 2006:249-282. 5. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop DJ, Horwitz E. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006;8:315-317. 6. Horwitz EM, Le Blanc K, Dominici M, Mueller I, Slaper-Cortenbach I, Marini FC, Deans RJ, Krause DS, Keating A; International Society for Cellular Therapy. Clarification of the nomenclature for MSC: The International Society for Cellular Therapy position statement. Cytotherapy 2005;7:393395. 7. Majumdar MK, Thiede MA, Haynesworth SE, Bruder SP, Gerson SL. Human marrow-derived mesenchymal stem cells (MSCs) express hematopoietic cytokines and support long-term hematopoiesis when differentiated toward stromal and osteogenic lineages. J Hematother Stem Cell Res 2000;9:841848. 8. Dazzi F, Ramasamy R, Glennie S, Jones SP, Roberts I. The role of mesenchymal stem cells in haemopoiesis. Blood Rev 2006;20:161-171.

Nikkhah H, et al: BM-MSCs’ Effects on HL-60 Cell Differentiation

9. Andreeff M, Jiang S, Zhang X, Konopleva M, Estrov Z, Snell VE, Xie Z, Okcu MF, Sanchez-Williams G, Dong J, Estey EH, Champlin RC, Kornblau SM, Reed JC, Zhao S. Expression of Bcl-2-related genes in normal and AML progenitors: changes induced by chemotherapy and retinoic acid. Leukemia 1999;13:1881-1892. 10. Tarantilis PA, Morjani H, Polissiou M, Manfait M. Inhibition of growth and induction of differentiation of promyelocytic leukemia (HL-60) by carotenoids from Crocus sativus L. Anticancer Res 1994;14:1913-1918. 11. Fenaux P, Le Deley MC, Castaigne S, Archimbaud E, Chomienne C, Link H, Guerci A, Duarte M, Daniel MT, Bowen D. Effect of all transretinoic acid in newly diagnosed acute promyelocytic leukemia. Results of a multicenter randomized trial. European APL 91 Group. Blood 1993;82:3241-3249. 12. Esser AC, Nossa R, Shoji T, Sapadin AN. All-trans-retinoic acid-induced scrotal ulcerations in a patient with acute promyelocytic leukemia. J Am Acad Dermatol 2000;43:316-317. 13. Frankel SR, Eardley A, Lauwers G, Weiss M, Warrell RP Jr. The retinoic acid syndrome in acute promyelocytic leukemia. Ann Intern Med 1992;117:292296. 14. Molaeipour Z, Shamsasanjan K, Movassaghpour AA, Akbarzadehlaleh P, Sabaghi F, Saleh M. The effect of bone marrow mesenchymal stem cells on vitamin D3 induced monocytic differentiation of U937 cells. Adv Pharm Bull 2016;6:23-29.

Turk J Hematol 2018;35:42-48

22. Chen F, Zhou K, Zhang L, Ma F, Chen D, Cui J, Feng X, Yang S, Chi Y, Han Z, Xue F, Rong L, Ge M, Wan L, Xu S, Du W, Lu S, Ren H, Han Z. Mesenchymal stem cells induce granulocytic differentiation of acute promyelocytic leukemic cells via IL-6 and MEK/ERK pathways. Stem Cells Dev 2013;22:1955-1967. 23. White SL, Belov L, Barber N, Hodgkin PD, Christopherson RI. Immunophenotypic changes induced on human HL60 leukaemia cells by 1α,25-dihydroxyvitamin D3 and 12-O-tetradecanoyl phorbol-13-acetate. Leuk Res 2005;29:1141-1151. 24. Zhang T, He YM, Wang JS, Shen J, Xing YY, Xi T. Ursolic acid induces HL60 monocytic differentiation and upregulates C/EBPβ expression by ERK pathway activation. Anticancer Drugs 2011;22:158-165. 25. Gallagher RE. Retinoic acid resistance in acute promyelocytic leukemia. Leukemia 2002;16:1940-1958. 26. Adamson PC, Boylan JF, Balis FM, Murphy RF, Godwin KA, Gudas LJ, Poplack DG. Time course of induction of metabolism of all-trans-retinoic acid and the up-regulation of cellular retinoic acid-binding protein. Cancer Res 1993;53:472-476. 27. Baksh D, Yao R, Tuan RS. Comparison of proliferative and multilineage differentiation potential of human mesenchymal stem cells derived from umbilical cord and bone marrow. Stem Cells 2007;25:1384-1392.

15. Smirnov SV, Harbacheuski R, Lewis-Antes A, Zhu H, Rameshwar P, Kotenko SV. Bone-marrow-derived mesenchymal stem cells as a target for cytomegalovirus infection: implications for hematopoiesis, self-renewal and differentiation potential. Virology 2007;360:6-16.

28. Drayson MT, Michell RH, Durham J, Brown G. Cell proliferation and CD11b expression are controlled independently during HL60 cell differentiation initiated by 1,25α-dihydroxyvitamin D3 or all-trans-retinoic acid. Exp Cell Res 2001;266:126-134.

16. Rhee KJ, Lee JI, Eom YW. Mesenchymal stem cell-mediated effects of tumor support or suppression. Int J Mol Sci 2015;16:30015-30033.

29. Dahl R, Walsh JC, Lancki D, Laslo P, Iyer SR, Singh H, Simon MC. Regulation of macrophage and neutrophil cell fates by the PU.1:C/EBPα ratio and granulocyte colony-stimulating factor. Nat Immunol 2003;4:1029-1036.

17. Tocci A, Forte L. Mesenchymal stem cell: use and perspectives. Hematol J 2003;4:92-96. 18. Porada CD, Almeida-Porada G. Mesenchymal stem cells as therapeutics and vehicles for gene and drug delivery. Adv Drug Deliv Rev 2010;62:1156-1166. 19. Uccelli A, Moretta L, Pistoia V. Mesenchymal stem cells in health and disease. Nat Rev Immunol 2008;8:726-736. 20. Ramasamy R, Lam EW, Soeiro I, Tisato V, Bonnet D, Dazzi F. Mesenchymal stem cells inhibit proliferation and apoptosis of tumor cells: impact on in vivo tumor growth. Leukemia 2007;21:304-310. 21. Dasari VR, Velpula KK, Kaur K, Fassett D, Klopfenstein JD, Dinh DH, Gujrati M, Rao JS. Cord blood stem cell-mediated induction of apoptosis in glioma downregulates X-linked inhibitor of apoptosis protein (XIAP). PLoS One 2010;5:e11813.

30. Scott EW, Simon MC, Anastasi J, Singh H. Requirement of transcription factor PU.1 in the development of multiple hematopoietic lineages. Science 1994;265:1573-1577. 31. Moreau-Gachelin F, Wendling F, Molina T, Denis N, Titeux M, Grimber G, Briand P, Vainchenker W, Tavitian A. Spi-1/PU.1 transgenic mice develop multistep erythroleukemias. Mol Cell Bio 1996;16:2453-2463. 32. Uchino Y, Iriyama N, Hatta Y, Takei M. Granulocyte colony-stimulating factor potentiates all-trans retinoic acid-induced granulocytic differentiation in acute promyelocytic leukemia cell line HT93A. Cancer Cell Int 2015;15:30. 33. Zeidler C, Welte K. Kostmann syndrome and severe congenital neutropenia. Semin Hematol 2002;39:82-88.

RESEARCH ARTICLE DOI: 10.4274/tjh.2017.0095 Turk J Hematol 2018;35:49-53

NPM1 Mutation Analysis in Acute Myeloid Leukemia: Comparison of Three Techniques - Sanger Sequencing, Pyrosequencing, and Real-Time Polymerase Chain Reaction Akut Miyeloid Lösemide NPM1 Mutasyon Analizi: Üç Tekniğin Karşılaştırılması/Sanger Dizileme, Pirodizileme ve Gerçek Zamanlı Polimeraz Zincir Reaksiyonu Dushyant Kumar1,

Anurag Mehta2,

Manoj Kumar Panigrahi1,

Sukanta Nath1,

Kandarpa Kumar Saikia1

Gauhati University Faculty of Medicine, Department of Bioengineering and Technology, Guwahati, India Rajiv Gandhi Cancer Institute and Research Centre, New Delhi, India

1 2

Abstract

Öz

Objective: Nucleophosmin-1 (NPM1) mutations have prognostic importance in acute myeloid leukemia (AML) patients with intermediate-risk karyotype at diagnosis. Approximately 30% of newly diagnosed cytogenetically normal AML (CN-AML) patients harbor the NPM1 mutation in India. In this study we compared the efficiency of three molecular techniques in detecting NPM1 mutation in peripheral blood and bone marrow samples.

Amaç: Nükleofosmin-1 (NPM1) mutasyonları tanı anında orta risk akut miyeloid lösemi (AML) hastalarında prognostik öneme sahiptir. Hindistan’da, yeni teşhis normal sitogenetiğe sahip AML (CN-AML) hastalarının yaklaşık %30’u NPM1 pozitiftir. Bu çalışmada periferik kan ve kemik iliği örneklerinde NPM1 mutasyonu saptamada kullanılan üç moleküler tekniğin etkinliğini karşılaştırdık.

Materials and Methods: In a single-center cohort we analyzed 165 CN-AML bone marrow/peripheral blood samples for NPM1 mutation analysis. About 30% of the CN-AML samples revealed NPM1 mutations. For the detection, three methods were compared: Sanger sequencing, pyrosequencing, and real-time polymerase chain reaction (PCR). Results: NPM1 exon 12 mutations were observed in 52 (31.51%) of all CN-AML cases. The sensitivity of Sanger sequencing, pyrosequencing, and real-time PCR was 80%, 90%, and 95%, whereas specificity was 95%, 100%, and 100%, respectively. The minimum limit of mutation detection was 20%-30% for Sanger sequencing, 1%-5% for pyrosequencing, and 0.1%-1% for real-time PCR.

Gereç ve Yöntemler: Tek merkezli bu kohortta, 165 CN-AML kemik iliği/periferik kan örneklerinde NPM1 mutasyon analizi yapıldı. CNAML örneklerinin yaklaşık %30’unda NPM1 mutasyonu saptandı. Mutasyonun taranmasında üç yöntem karşılaştırıldı: Sanger dizileme, pirodizileme, gerçek-zamanlı polimeraz zincir reaksiyonu (PCR). Bulgular: Tüm CN-AML olgularının 52’sinde (%31,51) NPM1 exon12 mutasyonları gözlendi. Sanger dizileme, pirodizileme ve gerçek zamanlı PCR’nin duyarlılıkları sırasıyla %80, %90 ve %95 iken, özgünlükleri %95, %100 ve %100’dü. Mutasyonun saptanmasında minimum limit Sanger dizileme yöntemi için %20-%30, pirodizilemede %1-5, ve gerçek-zamanlı PCR için %0,1-%1 idi.

Conclusion: The sequencing method, which is the reference method, has the lowest sensitivity and is sometimes difficult to interpret. Realtime PCR is a highly sensitive method for mutation detection but is limited for specific mutation types. In our study, pyrosequencing emerged as the most suitable technique for the detection of NPM1 mutations on the basis of its easy interpretation and less timeconsuming processes than Sanger sequencing.

Sonuç: Referans yöntemi olan dizileme yöntemi, en düşük duyarlılığa sahiptir ve bazen yorumlaması güçtür. Gerçek-zamanlı PCR mutasyon saptamada yüksek duyarlılığa sahip bir yöntemdir fakat özel mutasyon tipleri için sınırlıdır. Çalışmamızda, pirodizileme yönteminin kolay yorumlanması ve Sanger dizileme yönteminden daha az zaman harcanan işlem olması esasına dayanarak NPM1 mutasyonun saptanmasında en uygun teknik olduğu sonucuna varılmıştır.

Keywords: NPM1, Pyrosequencing, Acute myeloid leukemia, Mutation analysis

Anahtar Sözcükler: NPM1, Pirodizileme, Akut miyeloid lösemi, Mutasyon analizi

Address for Correspondence/Yazışma Adresi: Dushyant KUMAR, M.D., Gauhati University Faculty of Medicine, Department of Bioengineering and Technology, Guwahati, India Phone : +91 858 886 60 49 E-mail : anumehta11@gmail.com ORCID-ID: orcid.org/0000-0003-4255-8283

Received/Geliş tarihi: March 07, 2017 Accepted/Kabul tarihi: November 09, 2017

Kumar D, et al: NPM1 Mutation Analysis

Turk J Hematol 2018;35:49-53

Introduction

NPM1 Mutation Detection by Pyr Analysis

An increasing number of genetic abnormalities are revealed in acute myeloid leukemia (AML). Among these genetic alterations, potential prognostic genetic markers are the nucleophosmin 1 (NPM1) gene, FLT3 gene, and CEBPA gene [1]. Mutations in the NPM1 and FLT3 genes represent the most important diagnostic and prognostic indicators in patients with cytogenetically normal AML (CN-AML). NPM1 is a phosphoprotein that continuously shuttles between the cytoplasm and nucleus. Several functions for this protein have been described, including the binding of p53, the initiation of centrosome duplication, and ribosomal protein assembly and transport [2]. NPM1 mutations found in exon 12 code for the COOH terminal region. Frameshift mutations in the NPM1 gene result in an elongated protein that contains an additional nuclear export signal and leads to an abnormal cytoplasmic localization of the protein [3,4]. These mutations are involved in leukemogenesis and are detected in about 35%-60% of AML cases [5]. Six types of NPM1 mutation variants have been identified: NPM1 mutation A (c.860_863dupTCTG), mutation B (c.862_863insCATG), mutation D (c.863_864insCCTG), mutation I (c.863_864insTAAG), mutation J (c.863_864insCTTG), and mutation K (c.863_864insTATG). Mutation A (TCTG insertion) is the most commonly occurring variant, found in about 80% of all NPM1-mutated AML cases (Table 1) [3,5]. The effect of mutant NPM1 has been studied using gene expression profiling and studies revealed a distinctive signature of these mutations [6]. Many studies reported the prognostic significance of NPM1 mutation status in AML [7,8,9,10,11]. There are highly specific and sensitive molecular assays available for detecting NPM1 mutations, like Sanger sequencing, highresolution melting curve analysis, real-time polymerase chain reaction (PCR), and pyrosequencing (Pyr). In this study, we evaluated the utility of Pyr in the detection of NPM1 mutation detection and also compared it with Sanger sequencing and realtime PCR in terms of assay sensitivity, specificity, limit of mutation detection, turnaround time, and assay cost [12,13].

In the Pyr method for DNA sequence analysis, inorganic phosphate released in the course of nucleotide incorporation serves as the initial substrate in a sequence of four successive enzymatic reactions. This results in the emission of light, which functions as a signal that is proportional to the number of nucleotides incorporated. For NPM1 mutation analysis TTAACTCTCTGGTGGTAGAATG was used as a forward primer, biotin-ACATTTATCAAACACGGTAGG as a reverse primer, and TTTTCCAGGCTATTCAAGAT as the sequencing primer (Sigma-Aldrich, New Delhi, India). DNA (50 ng) was amplified using 400 nmol of forward and reverse primers in 25 µL of reaction mix with PyroMark master mix (QIAGEN). PCR conditions were as follows: initial denaturing at 95 °C for 15 min; 42 cycles of 95 °C for 20 s, 53 °C for 30 s, and 60 °C for 20 s; and final extension at 72 °C for 5 min. PCR products were electrophoresed on agarose gel to confirm successful amplification. The PCR products (10 µL) were then sequenced with the Pyr PyroMark Q24 system (QIAGEN).

NPM1 Mutation Detection by Pyr Analysis Using Ipsogen NPM1 MutaScreen Kit The Ipsogen NPM1 MutaScreen Kit (QIAGEN) combines two techniques to screen for the presence of mutations in the target gene. The real-time quantitative PCR (qPCR) double-dye oligonucleotide hydrolysis principle uses specific primers and an internal double-dye probe with a reporter and a quencher (FAM-TAMRA) for the amplification reactions. In addition, a 3’-end modified phosphate oligonucleotide is used that perfectly matches the wild-type NPM1 gene and does not allow polymerization. The Ipsogen NPM1 MutaScreen Kit detects total NPM1 (wild-type + mutated) and mutated NPM1 and separately identifies NPM1 Mut A, Mut B, and Mut D in genomic DNA. A sample of DNA of 25 ng was used in a final reaction volume of 25 µL. The PCR profile for Rotor-Gene Q (QIAGEN) was 50 °C for 2 min, 95 °C for 10 min, and then 40 cycles of 95 °C for 15 s and 60 °C for 90 s with acquisition performed at 60 °C. Analysis was performed as per the kit’s instructions.

Materials and Methods

NPM1 Mutation Analysis by Sanger Sequencing

A total of 165 CN-AML bone marrow aspiration or peripheral blood samples taken at the time of first diagnosis were included in this study from February 2014 to September 2016. Out of these 165 patients, 79 (47.87%) were male and 86 (52.12%) were female. Twenty cases (12.12%) were pediatric cases.

Analysis of NPM1 exon 12 mutations was done as described by Falini et al. [4]. A sample of DNA of 50 ng was amplified using an Applied Biosystems Veriti thermal cycler (Foster City, CA, USA) and purified PCR product was used for BigDye termination bidirectional sequencing. Results were analyzed using BioEdit sequence analysis software.

DNA Extraction Genomic DNA was extracted from the received samples using the QIAGEN DNeasy Kit (QIAGEN, Hilden, Germany) as per the manufacturer’s instructions. 50

Results NPM1 exon 12 mutation was observed in 52 (31.51%) of all CNAML cases. As expected, the percentage of the DNA samples in

Kumar D, et al: NPM1 Mutation Analysis

Turk J Hematol 2018;35:49-53

which mutations were detected varied and depended upon the method of detection used. NPM1 mutation analysis by Pyr had the highest likelihood of identifying a mutation in the NPM1 gene, followed by the NPM1 MutaScreen kit and direct sequencing (Table 2). However, on the basis of our evaluation criteria (Table 1), the most sensitive tool was the Ipsogen MutaScreen kit (95%), followed by Pyr (90%) and Sanger sequencing (80%). In terms of specificity, all three methods matched equally.

Discussion It has been found that 99% of all NPM1 mutations detected by Pyr have 4-base insertions at position 860 while the rest of the NPM1 mutations detected by Pyr were found as insertion at 862 and deletion at 863 and 861 [14]. We have examined the ability of three different methods to detect mutations in NPM1 gene exon 12 in 165 CN-AML samples. Bone marrow or peripheral blood samples with a minimum of 15% blasts were examined in this study. NPM1 mutations were found in 52 samples (31.51%), while 113 (68.48%) samples were found to be wild-type. Twenty-eight (53.84%) of the NPM1-positive patients were male while 24 (46.15%) were female. Seven (13.46%) of the NPM1-positive samples were from pediatric patients while 45 (86.53%) were from adults. Mutation type A was the most frequent mutation (~80%), followed by types B (12%) and D (6%). We also found one case of mutation type K (c.863_864insTATG) by Pyr (Figure 1). The sequencing method is considered the gold-standard technique for detection of somatic as well as generic mutations. Jancik et al. [15] compared the specificity, sensitivity, cost, and working time of five techniques

including Pyr, Sanger sequencing, and real-time PCR for KRAS mutations. Ogino et al. [16] stated that the Pyr assay to detect somatic mutations from formalin-fixed paraffin embedded tissue is more sensitive than Sanger sequencing. Tsiatis et al. [17] compared Pyr, Sanger sequencing, and melting curve methods for the detection of somatic mutations like KRAS, NRAS, and BRAF and demonstrated that Sanger sequencing specificity is generally high compared with other methods, but sensitivity has been reported to differ. Real-time PCR is the most sensitive method for detecting minimal residual disease [18], but it is limited to specific detection of mutations A, B, and D. In the case of limited mutation, we can synthesize primers and probes for other mutations as well, but it will add extra cost per reaction (Table 3).

Table 1. NPM1 mutation frequencies in de novo acute myeloid leukemia. NPM1 mutation type

Nucleotide Insertion

Frequency in de novo AML

Mutation A

c.860_863dupTCTG

~72%

Mutation B

c.862_863insCATG

~12%

Mutation D

c.863_864insCCTG

~4%

Mutation G

c.863_864insTTTG

<1%

Mutation I

c.863_864insTAAG

<1%

Mutation J

c.863_864insCTTG

<1%

Mutation K

c.863_864insTATG

<1%

Others

<1%

References

Figure 1. NPM1 mutation detection by pyrosequencing detection by pyrosequencing.

[3,5]

AML: Acute myeloid leukemia.

Table 2. Number and percentage of mutations detected by three different methods. Method

Mutations/Samples

Percentage

Pyrosequencing

52/165

31.51%

Ipsogen MutaScreen Kit

51/165

30.90%

Sanger sequencing

46/165

27.87%

Figure 2. A) NPM1 mutation detection by real-time polymerase chain reaction using Ipsogen MutaScreen Kit. B) Sanger sequencing. 51

Kumar D, et al: NPM1 Mutation Analysis

Turk J Hematol 2018;35:49-53

Table 3. Sensitivity, specificity, time, and monetary cost of pyrosequencing, real-time polymerase chain reaction, and Sanger sequencing. Monetary cost (per reaction)

Technique

Sensitivity*

Specificity*

Limit of detection* Detection of rare mutations Time

Pyrosequencing

90%

100%

1%-5%

Yes (can detect any mutation located between the primers)

2 days

2500 INR ($38)

Real-Time PCR Ipsogen MutaScreen Kit

95%

100%

0.1%-1%

1 day

4000 INR ($61)

Sanger sequencing

80%

95%

20%-30%

Yes (can detect any mutation located between the primers)

4 days

1500 INR ($23)

*From Jancik et al. [15]. INR: Indian rupee, PCR: polymerase chain reaction.

Pyr is easily capable of detecting PCR fragments that are 2550 bp in length while longer fragments may pose a problem [15,16]. In the case of NPM1, in which 99% of mutations occur at position 956 in exon 12 [14], with Pyr we were able to detect all types of mutations (Figure 1) with lower cost than real-time PCR and less time than Sanger sequencing (Figure 2). Recently nextgeneration sequencing (NGS) has become popular for detection of mutations in 50 genes to 100 genes simultaneously. NGS is the method to detect mutations down to the mutational burden of 1.25%. However, even though NGS is an accurate method, it is still costly and time-consuming compared with Pyr.

Conclusion In our study Pyr emerged as the most suitable technique for the detection of NPM1 mutations on the basis of its easy interpretation and less time-consuming processes than Sanger sequencing. However, the limit of mutation detection by realtime PCR is 0.1%-1%, the lowest of all three techniques, so realtime PCR is the best technique to determine minimal residual disease compared to Pyr, which has a limit of detection of 1%-5%. The Pyr assay can be considered as a better technique for NPM1 mutation detection. Ethics Ethics Committee Approval: This study was approved by the Gauhati University Ethical Committee with code number GUEC12/2015. Informed Consent: N/A. Authorship Contributions Concept: K.K.S., D.K.; Design: K.K.S., D.K.; Data Collection or Processing: D.K., M.K.P., S.N.; Analysis or Interpretation: D.K., K.K.S., A.M.; Literature Search: D.K., M.K.P., S.N.; Writing: D.K., M.K.P. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included. 52

References 1. Naoe T, Suzuki T, Kiyoi H, Urano T. Nucleophosmin: a versatile molecule associated with hematological malignancies. Cancer Sci 2006;97:963-969. 2. Zhao T, Zhu HH, Wang J, Jia JS, Yang SM, Jiang H, Lu J, Chen H, Xu LP, Zhang XH, Jiang B, Ruan GR, Wang DB, Huang XJ, Jiang Q. Prognostic significance of early assessment of minimal residual disease in acute myeloid leukemia with mutated NPM1 patients. Zhonghua Xue Ye Xue Za Zhi 2013;38:10-16. 3. Verhaak RG, Goudswaard CS, van Putten W, Bijl MA, Sanders MA, Hugens W, Uitterlinden AG, Erpelinck CA, Delwel R, Löwenberg B, Valk PJ. Mutations in nucleophosmin (NPM1) in acute myeloid leukemia (AML): association with other gene abnormalities and previously established gene expression signatures and their favorable prognostic significance. Blood 2005;106:3747-3754. 4. Falini B, Mecucci C, Tiacci E, Alcalay M, Rosati R, Pasqualucci L, La Starza R, Diverio D, Colombo E, Santucci A, Bigerna B, Pacini R, Pucciarini A, Liso A, Vignetti M, Fazi P, Meani N, Pettirossi V, Saglio G, Mandelli F, LoCoco F, Pelicci PG, Martelli MF; GIMEMA Acute Leukemia Working Party. Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype. N Engl J Med 2005;352:254-266. 5. Thiede C, Creutzig E, Reinhardt D, Ehninger G, Creutzig U. Different types of NPM1 mutations in children and adults: evidence for an effect of patient age on the prevalence of the TCTG-tandem duplication in NPM1-exon 12. Leukemia 2007;21:366-367. 6. Alcalay M, Tiacci E, Bergomas R, Bigerna B, Venturini E, Minardi SP, Meani N, Diverio D, Bernard L, Tizzoni L, Volorio S, Luzi L, Colombo E, Lo Coco F, Mecucci C, Falini B, Pelicci PG. Acute myeloid leukemia bearing cytoplasmic nucleophosmin (NPMc+ AML) shows a distinct gene expression profile characterized by up-regulation of genes involved in stem cell maintenance. Blood 2005;106:899-902. 7. Liu Y, He P, Liu F, Shi L, Zhu H, Zhao J, Wang Y, Cheng X, Zhang M. Prognostic significance of NPM1 mutations in acute myeloid leukemia: a metaanalysis. Mol Clin Oncol 2014;2:275-281. 8. Suzuki T, Kiyoi H, Ozeki K, Tomita A, Yamaji S, Suzuki R, Kodera Y, Miyawaki S, Asou N, Kuriyama K, Yagasaki F, Shimazaki C, Akiyama H, Nishimura M, Motoji T, Shinagawa K, Takeshita A, Ueda R, Kinoshita T, Emi N, Naoe T. Clinical characteristics and prognostic implications of NPM1 mutations in acute myeloid leukemia. Blood 2005;106:2854-2861. 9. Gale RE, Green C, Allen C, Mead AJ, Burnett AK, Hills RK, Linch DC; Medical Research Council Adult Leukaemia Working Party. The impact of FLT3 internal tandem duplication mutant level, number, size, and interaction with NPM1 mutations in a large cohort of young adult patients with acute myeloid leukemia. Blood 2008;111:2776-2784. 10. Becker H, Marcucci G, Maharry K, Radmacher MD, Margeson KM, Whitman SP, Wu YZ, Schwind S, Paschka P, Powell BL, Carter TH, Kolitz ZE, Wetzler M, Carrol AJ, Baer MR, Caligiuri MA, Larson RA, Bloomfield CD. Favorable prognostic impact of NPM1 mutations in older patients with cytogenetically normal de novo acute myeloid leukemia and associated gene and microRNA-expression signatures: a Cancer and Leukemia Group B study. J Clin Oncol 2010;28:596-604.

Turk J Hematol 2018;35:49-53

11. Boonthimat C, Thongnoppakhun W, Auewarakul CU. Nucleophosmin mutation in Southeast Asian acute myeloid leukemia: eight novel variants, FLT3 coexistence and prognostic impact of NPM1/FLT3 mutations. Haematologica 2008;93:1565-1569. 12. Falini B, Martelli MP, Pileri SA, Mecucci C. Molecular and alternative methods for diagnosis of acute myeloid leukemia with mutated NPM1: flexibility may help. Haematologica 2010;95:529-534. 13. Gorello P, Cazzaniga G, Alberti F, Dellâ&#x20AC;&#x2122;Oro MG, Gottardi E, Specchia G, Roti G, Rosati R, Martelli MF, Diverio D, Lo Coco F, Biondi A, Saglio G, Mecucci C, Falini B. Quantitative assessment of minimal residual disease in acute myeloid leukemia carrying nucleophosmin (NPM1) gene mutations. Leukemia 2006;20:1103-1108. 14. Schnittger S, Kern W, Tschulik C, Weiss T, Dicker F, Falini B, Haferlach C, Haferlach T. Minimal residual disease levels assessed by NPM1 mutationspecific RQ-PCR provide important prognostic information in AML. Blood 2009;114:2220-2231.

Kumar D, et al: NPM1 Mutation Analysis

15. Jancik S, Drabek J, Berkovcova J, Xu YZ, Stankova M, Klein J, Kolek V, Skarda J, Tichy T, Grygarkova I, Radzioch D, Hajduch M. A comparison of direct sequencing, pyrosequencing, high resolution melting analysis, TheraScreen DxS, and the K-ras StripAssay for detecting KRAS mutations in non small cell lung carcinomas. J Exp Clin Cancer Res 2012;31:79. 16. Ogino S, Kawasaki T, Brahmandam M, Yan L, Cantor M, Namgyal C, MinoKenudson M, Lauwers GY, Loda M, Fuchs CS. Sensitive sequencing method for KRAS mutation detection by pyrosequencing. J Mol Diagn 2005;7:413421. 17. Tsiatis AC, Norris-Kirby A, Rich RG, Hafez MJ, Gocke CD, Eshleman JR, Murphy KM. Comparison of Sanger sequencing, pyrosequencing, and melting curve analysis for the detection of KRAS mutations: diagnostic and clinical implications. J Mol Diagn 2010;12:425-432. 18. Falini B, Martelli MP, Bolli N, Sportoletti P, Liso A, Tiacci E, Haferlach T. Acute myeloid leukemia with mutated nucleophosmin (NPM1): is it a distinct entity? Blood 2011;117:1109-1120.

RESEARCH ARTICLE DOI: 10.4274/tjh.2016.0504 Turk J Hematol 2018;35:54-60

Incomplete Antibodies May Reduce ABO Cross-Match Incompatibility: A Pilot Study İnkomplet Antikorlar ABO Çapraz Karşılaştırma Uyumsuzluğunu Azaltabilirler: Bir Başlangıç Çalışması Mehmet Özen1, Önder Arslan6

Soner Yılmaz2,

Tülin Özkan3,

Yeşim Özer4,

Aliye Aysel Pekel5,

Asuman Sunguroğlu3,

Günhan Gürman6,

Ufuk University Faculty of Medicine, Department of Hematology, Ankara, Turkey University of Health Sciences, Gülhane Training and Research Hospital, Blood Bank Unit, Ankara, Turkey 3 Ankara University Faculty of Medicine, Department of Medical Biology, Ankara, Turkey 4 Ankara University Faculty of Medicine, Unit of Blood Bank, Ankara, Turkey 5 University of Health Sciences, Gülhane Training and Research Hospital, Clinic of Immunology and Allergy Diseases, Ankara, Turkey 6 Ankara University Faculty of Medicine, Department of Hematology, Ankara, Turkey 1 2

Abstract

Öz

Objective: Any erythrocyte transfusion among humans having type A or B blood groups is impossible due to antibodies causing fatal transfusion complications. A cross-match test is performed to prevent immune transfusion complications before transfusion. Our hypothesis is that the fragment antibody (Fab) part of the antibody (incomplete antibody) may be used to prevent an immune stimulus related to the complete antibody. Therefore, we designed a pilot study to evaluate the effectiveness of these incomplete antibodies using cross-match tests. Materials and Methods: Pepsin enzyme and staphylococcal protein A columns were used to cut anti-A and anti-B monoclonal antibodies and purify their Fab (2) fragments, respectively. An Rh-positive erythrocyte suspension with purified anti-A Fab (2) solution and B Rh-positive erythrocyte suspension with purified anti-B Fab (2) solution were combined correspondingly. Cross-match tests were performed by tube and gel centrifugation methods. The agglutination levels due to the anti-A and anti-B Fab (2) antibodies and their effects on the agglutination normally observed with complete antibodies were then measured. Results: No agglutination for the purified incomplete anti-A Fab (2) with A Rh+ erythrocyte and anti-B Fab (2) with B Rh+ erythrocyte combinations was observed in the tube cross-match tests. These agglutination levels were 1+ in two wells in the gel centrifugation cross-match tests. Fab (2)-treated erythrocytes were also resistant to the agglutination that normally occurs with complete antibodies. Conclusion: We determined that the Fab (2) fragments of antibodies may not only be used to obtain a mild or negative reaction when compared to complete antibodies, but they might also be used for decreasing ABO incompatibility. Incomplete antibodies might be a therapeutic option in autoimmune hemolytic anemia and they may also be used in solid organ or hematopoietic stem cell transplantation. Therefore, we have planned an in vivo study to prove these in vitro findings. Keywords: Transfusion medicine, Red blood cells, Complications, Humoral immune response

Amaç: Tip A ve B kan grubuna sahip insanlar arasında herhangi bir eritrosit nakli öldürücü transfüzyon komplikasyonlarına neden olan antikorlar nedeniyle imkansızdır. İmmün transfüzyon komplikasyonlarını önlemek için transfüzyondan önce çapraz karşılaştırma testi yapılır. Hipotezimiz komplet antikorla ilişkili bağışıklık yanıtını önlemekte antikorun fragman antikor (Fab) parçasının (inkomplet antikor) kullanılabileceğidir. Bu inkomplet antikorların etkinliğini değerlendirmek için de çapraz karşılaştırma testlerini kullanarak bir başlangıç çalışması tasarladık. Gereç ve Yöntemler: Anti-A ve anti-B monoklonal antikorlarını kesmek ve saflaştırmak için sırasıyla pepsin enzimi ve stafilokokal protein A kolonları kullanıldı. A Rh pozitif eritrosit süspansiyonu ile saflaştırılmış anti-A Fab (2) solüsyonu ve B Rh pozitif eritrosit süspansiyonu ile saflaştırılmış anti-B Fab (2) solüsyonu sırasıyla birleştirildi. Çapraz karşılaştırma testleri tüp ve jel santrifügasyon yöntemleri kullanılarak çalışıldı. Sonrasında anti-A ve anti-B Fab (2) antikorlara bağlı aglütinasyon düzeyi ve bunların komplet antikorlarla normalde gözlenen aglütinasyon üzerine etkileri ölçüldü. Bulgular: Tüp yöntemi ile yapılan çapraz karşılaştırma testinde saflaştırılmış inkomplet anti-A Fab (2) ile A Rh pozitif eritrosit ve anti-B Fab (2) ile B Rh pozitif eritrosit kombinasyonlarında aglütinasyon gözlenmedi. Jel santrifügasyon yöntemi ile yapılan çarpraz karşılaştırma testinde bu aglütinasyon düzeyleri her iki kuyucukta da 1 pozitifti. Fab (2) ile muamele edilen eritrositler komplet antikorla normalde oluşan aglütinasyona da dirençliydiler. Sonuç: Antikorların Fab (2) fragmanlarının sadece komplet antikorlara kıyasla daha hafif veya negatif reaksiyonu elde etmekte değil, aynı zamanda ABO uyumsuzluğunu azaltmakta da kullanılabileceğini değerlendirdik. İnkomplet antikorlar otoimmün hemolitik anemide bir tedavi seçeneği olabileceği gibi aynı zamanda solid organ veya hematopoeitik kök hücre naklinde kullanılabilir. Bu nedenle in vitro bulguları doğrulamak için in vivo bir çalışma planladık. Anahtar Sözcükler: Transfüzyon tıbbı, Alyuvarlar, Komplikasyonlar, Hümöral bağışıklık yanıtı

Address for Correspondence/Yazışma Adresi: Mehmet ÖZEN, M.D., Ufuk University Faculty of Medicine, Department of Hematology, Ankara, Turkey Phone : +90 536 275 00 74 E-mail : kanbilimci@gmail.com ORCID-ID: orcid.org/0000-0002-0910-9307

Received/Geliş tarihi: December 30, 2016 Accepted/Kabul tarihi: May 22, 2017

Turk J Hematol 2018;35:54-60

Introduction There are many blood groups used for the human population, including ABO, Rh, Kidd, Kell, Duffy, MNS, and Lewis. The ABO system is the most important of all blood groups in transfusion practice due to the reciprocal antibodies [1]. These antibodies consistently and predictably present in the sera of normal people whose erythrocytes lack the corresponding antigen(s) [2]. These antibodies may cause immediate lysis of donor red blood cells (RBCs) during ABO-incompatible transfusion and initiate fatal hemolytic transfusion reactions [1]. Typing and screening are the first steps of pretransfusion compatibility tests. These tests are used to define the patient’s ABO group and Rh type and to detect expected and unexpected antibodies in the patient’s serum. The cross-match is the final step of pretransfusion testing [3]. In this test, donor cells are combined with the patient’s serum and checked for agglutination, which would signify incompatible blood [4]. This process, also known as major cross-matching, serves as the last safeguard to ensure a safe transfusion [4,5,6]. Antibodies are also essential for humoral immunity [7]. Many antibodies have been shown to be primarily related to autoimmune diseases and such diseases are referred to as antibody-related autoimmune diseases [7,8,9]. Many of these diseases may disappear in the absence of certain antibodies [9]. All antibodies have two fragments. The antigen-binding fragment (Fab) binds to an antigen, and the crystallizable fragment (Fc) stimulates the immune system by activating the complement [10]. Additionally, macrophages or lymphocytes detect the Fc fragment of antibodies [11,12]. Therefore, the Fab fragment detects antigens and the Fc fragment stimulates the immune system. An antibody with the Fc part removed, in which only the Fab fragment exists, may be called an incomplete antibody. Papain or pepsin enzymes can be used in the fragmentation of antibodies and can produce Fab or Fab (2) fragments of the antibodies, respectively [13]. The effectiveness levels of Fab and Fab (2) fragments of an antibody are similar and they are interchangeable [14]. Our hypothesis is that incomplete antibodies may be used to prevent an immune stimulus. We designed a pilot study to examine the effectiveness of these incomplete antibodies in incompatible cross-matches due to ABO antibodies and we are presenting it here. Local ethics committee approval was obtained for this study.

Materials and Methods Anti-A and anti-B monoclonal antibodies (Eryclone, Verna Industrial Estate, Verna, India) were used for this study. First the pepsin enzyme was used to cut these monoclonal antibodies and staphylococcal protein A columns were used to purify their Fab (2) fragments. The Pierce™ F(ab’)2 Preparation Kit (Thermo

Özen M, et al: ABO Blood Group and Fab Antibodies

Fisher Scientific, Rockford, IL, USA) was used to produce the Fab (2) fragments from complete antibodies. This process was conducted according to the manufacturer’s instructions. After obtaining purified Fab (2)s, we began the second part of the study. During purification of Fab (2)s, the volume of the products changed. The ratios of the complete monoclonal antibodies to the standard erythrocyte solution for an optimal cross-match test were calculated according to the manufacturer’s instructions. We used these ratios for the anti-A or -B Fab (2) to the A or B Rh-positive erythrocyte solutions for the cross-match tests, respectively. After calculation, an anti-IgG cross-match card (Ortho-Clinical Diagnostics, High Wycombe, UK) was used for the compatibility tests. We combined 10 µL of A Rh-positive 5% erythrocyte suspension with 150 µL of purified anti-A Fab (2) solution in the same well to conduct a cross-match test in order to prove that the erythrocytes were covered with anti-A Fab (2). We also used 150 µL of complete anti-A antibodies for the positive control and 150 µL of phosphate-buffered saline (PBS) for the negative control. We incubated all cards at 37 °C for 10 min and then centrifuged them for 5 min. The negative controls lacked the complete and incomplete antibodies. We repeated the same process with complete and incomplete anti-B antibodies and the B Rh-positive erythrocyte suspension. In addition, we repeated these tests using Across Gel® Anti-Human Globulin IgG+C3d cross-match cards (Dia Pro, İstanbul, Turkey). We also evaluated agglutination levels when complete and incomplete antibodies were put in the same well at the same time, noting the amounts for A and B erythrocyte suspensions. We conducted an antibody titration test and repeated this last test with several ratios (32/1, 8/1, 4/1, 1/1, 1/4, and 1/16) for complete to incomplete antibodies when used simultaneously. Finally, we evaluated the reactions in all wells. We also performed a tube test to confirm the results of the card tests and to show whether incomplete antibodies inhibited normal agglutination with complete antibodies or not. First, we treated A Rh+ erythrocytes with anti-A Fab (2) and B Rh+ erythrocytes with anti-B Fab (2) in two separate tubes. We then added complete anti-A and anti-B antibodies to the respective tubes and mixed them. As a positive control, A Rh+ erythrocytes were treated only with complete anti-A antibodies and B Rh+ erythrocytes were treated only with complete anti-B antibodies in a tube without adding incomplete fragments. Consequently, there were no incomplete antibodies in positive control tubes. We then evaluated the agglutination levels in the tubes. In addition, we performed a flow cytometric analysis to prove the results of all these tests. The B Rh+ erythrocyte sample was transferred to a tube containing K3 EDTA and that tube’s contents were divided into four tubes. We mixed each tube with 55

Özen M, et al: ABO Blood Group and Fab Antibodies

one of the following: PBS, anti-B complete antibodies alone, anti-B incomplete antibodies alone, or a mix of anti-B antibodies (1:1 ratio for incomplete to complete). To label the erythrocytes, CD235a FITC (glycophorin A, BD Pharmingen, San Diego, CA, USA) and cytoplasm-staining nucleic acid dye 7-amino-actinomycin (7-ADD) (BD Pharmingen) were added to the tubes. The samples were analyzed using the FACSDiva software of the FACSCanto II model flow cytometer (BD Biosciences, San Jose, CA, USA). Viable erythrocytes were identified as cells stained positive with CD235a FITC and negative with 7-ADD. We evaluated 100,000 events per sample to show the erythrocyte agglutination levels in the tubes. Agglutination levels were calculated with the single-cell analysis and forward-scatter gating strategy [15].

Turk J Hematol 2018;35:54-60

The antibody titration test results are given in Table 1. Higher concentrations of complete antibodies (from 8 to 32 times more than incomplete antibodies) were associated with 4+ agglutination levels in simultaneous use on the cross-match card

Results For the card test, we observed a 1+ reaction for the purified incomplete anti-A Fab (2) and A Rh+ erythrocyte combination. However, we observed 4+ reactions for the complete anti-A antibody with the A Rh+ erythrocyte combination. No positive reactions were observed in the negative control wells. The test results were similar for the B Rh+ erythrocyte and complete anti-B or incomplete anti-B Fab (2) antibody combinations and negative controls (Figures 1 and 2).

Figure 2. Group B erythrocytes: T, with complete (total) antibody (4+ reaction); PBS, with phosphate-buffered saline (- reaction); Fab, with anti-B Fab (2) (- reaction); Fab+T: with anti-B complete (total) and anti-B Fab (2) simultaneously, 1:1 dilution (double reaction with 4+ and -). PBS: Phosphate-buffered saline, Fab: fragment antibody.

Table 1. Antibody titration tests on the immunoglobulin G cross-match cards according to the ratios for complete to incomplete antibodies added simultaneously.

Figure 1. A) Group A erythrocytes: Ai, with incomplete anti-A antibody (1+ reaction); A+, with complete anti-A antibody (4+ reaction); A-, with negative control (no reaction). B) Group B erythrocytes: Bi, with incomplete anti-B antibody (1+ reaction); B+, with complete anti-B antibody (4+ reaction); B-, with negative control (no reaction). 56

Complete/ Incomplete ratio

Group A erythrocytes

Group B erythrocytes

From 8/1 to 32/1

4/1

-/4+*

1/1

-/4+*

1/4

-/4+*

1/16

-/4+*

*Double population.

Turk J Hematol 2018;35:54-60

tests (Table 1). Lower ratios than 8/1 showed double population results when both complete and incomplete antibodies were simultaneously added to the wells before erythrocytes (Table 1, Figure 2). Increasing the amounts of incomplete antibodies did not cause any 4+ results if complete antibodies were not added to the wells. For the tube tests, we observed no agglutination for the A Rh+ erythrocytes and incomplete anti-A Fab (2) antibodies combination and the B Rh+ erythrocytes and incomplete anti-B Fab (2) antibodies combination in two separate tubes. There was also no agglutination when complete anti-A and anti-B antibodies were added to the respective tubes. No agglutination continued when the two tubes were mixed (Figure 3). Agglutination was present in the positive control tube that contained complete antibodies (Figure 4).

Ă&#x2013;zen M, et al: ABO Blood Group and Fab Antibodies

minimal or no agglutination in the card and tube cross-match tests. Minimal agglutination with Fab (2) parts was similar to the negative controls. These results come from the characteristic features of an antibody. The Fab part of an antibody binds to the antigen, and the Fc part of the antibody both starts agglutination and stimulates the immune system via activating the complement system and/or binding to Fc receptors of macrophages or lymphocytes [10,11,12]. Fc and its interactions with the Fc receptors of macrophages have a critical role and are required for antibody response [16,17]. Hemolytic disease of newborns is a good example of this pathologic mechanism of antibody response.

Flow cytometric analysis also showed similar results (Figure 5). Agglutinated erythrocytes expressed brighter CD235a positivity than non-agglutinated erythrocytes. Almost all erythrocytes were viable in the tubes. Erythrocyte agglutination levels were calculated as 0.9% for the PBS tube, 0.1% for the Fab (2) tube, 7.1% for the complete anti-B antibody tube, and 2.9% for the mixed tube (1:1, complete to incomplete antibody).

Discussion Although complete anti-A and -B antibodies cause strong agglutination, the Fab (2) parts of these antibodies caused

Figure 3. Group A and group B erythrocytes in the same tube incubated with incomplete anti-A and -B fragment antibody fragments and after addition of complete anti-A and -B to the medium. No agglutination.

Figure 4. Group A and group B erythrocytes in the same tube incubated with complete anti-A and -B antibodies. Positive agglutination. 57

Ă&#x2013;zen M, et al: ABO Blood Group and Fab Antibodies

Turk J Hematol 2018;35:54-60

purified Fab fragments of the anti-D antibody were studied for hemolytic disease of newborns because of their binding to Rh+ erythrocytes [19,20]. However, anti-D Fab treatment was not sufficient for being used for hemolytic disease of newborns due to its ineffectiveness [16]. This situation comes from the Fc part of the antibody. Removal of the Fc part of an antibody may result in ineffectiveness of the antibody when stimulating the immune system even if it binds to an antigen. Similarly, the digoxinspecific incomplete Fab antibody effectively binds to its antigen (Digifab). However, no significant immune reaction was reported in patients treated with this agent, probably due to the absence of the Fc part of the antibody [21].

Figure 5. Flow cytometric analysis with group B erythrocytes: a) with phosphate-buffered saline, 0.9% agglutination; b) with anti-B fragment antibody (Fab) (2), 0.1% agglutination; c) with complete anti-B, 7.1% agglutination; d) with anti-B complete and Fab (2) simultaneously, 2.9% agglutination. In this antibody-related disease, anti-D antibody treatment is used to prevent hemolytic disease of newborns [18]. Anti-D antibody drugs should be composed of complete antibodies to prevent competitive binding of Fab fragments [16]. In the past, 58

ABO incompatibility is an unavoidable clinical issue, and complications associated with ABO incompatibility should be managed and treated appropriately [22]. Hemovigilance procedures are recommended and used because of the potential for fatal complications following blood transfusion [23]. Although some procedures for treating ABO-incompatible blood transfusions are used, to the best of our knowledge, none of them are specific [24]. In our study, we showed that if erythrocytes are exposed to Fab (2) and complete antibodies simultaneously, complete antibody-associated agglutination ratios may decrease due to the coating of some erythrocytes with Fab (2) and others with complete antibodies. Therefore, we hypothesized that anti-A and anti-B Fab (2) antibodies might be a useful treatment for these patients and may reduce fatal complications. Competitive binding between complete and incomplete antibodies may reduce or eliminate the effects of complete antibodies [25]. No strong agglutination with high amounts of Fab (2) and insufficiency of low amounts of Fab (2) in preventing agglutination related to complete antibodies also supports our hypothesis. Similarly, anti-Rh antibodies are considered for use in preventing transfusion reactions in hemolytic disease of newborns and their effect is superior when they are used early after birth [26]. Our results could also be explained with the epitope-masking hypothesis [27]. When an epitope on an antigen is coated with an antibody, other antibodies cannot bind the same epitope. Therefore, if the first antibody did not start an immune response and occupy the epitope, the following antibodies will also not be able to cause an immune response. Our hypothesis may be stated as follows: the Fab (2) parts of the same antibodies may be used for masking the epitopes instead of other antibodies. Moreover, our findings may also help in universal group O RBC studies [28]. Instead of polyethylene glycol, Fab (2)s may be used in order to cover erythrocytes via coating surface antigens. However, our in vitro study needs to be supported with future in vivo animal studies for this use. Therefore, we are planning to conduct an in vivo study to prove the results of our pilot study. ABO incompatibility between the donor and the recipient can cause hemolysis in the recipient, especially when performing

Özen M, et al: ABO Blood Group and Fab Antibodies

Turk J Hematol 2018;35:54-60

hematopoietic and solid organ transplantations [22,29]. It also presents several challenges for hematopoietic stem cell transplantation [29]. During hematopoietic stem cell transplantation, transfused erythrocytes and other blood products change based on the donor’s and recipient’s blood groups, and such changes are not stable [30]. Irradiated, filtered, and leukocyte-depleted blood products are commonly used for blood transfusions [31]. Some hemolytic anemia patients also have auto-anti-A or auto-anti-B antibodies [32,33,34]. We hypothesize that the anti-A and anti-B Fab (2) antibody fragments presented here may be used to prepare suitable or alternative blood products for such patients in the future. Using Fab (2) fragments of antibodies, including those of other blood groups, may simplify current antibody screening and identification tests. In spite of the importance of these tests, due to problems originating from technical procedures and evaluation methods, these tests take time, postpone the use of blood products for patients, and sometimes result in inconclusive outcomes [35]. As we showed, seeing a double population in a well may help in the identification process of antibodies. ABO-incompatible solid organ transplantation presents other challenges, and some such transplants are currently impossible due to ABO incompatibility [22,36]. Solid organs contain ABO antigens that can cause incompatibility [22,36]. Immunoadsorption techniques are used to prevent the antibody-related immune response and to extend the survival of grafts and transplant recipients having ABO incompatibility [37]. Hyperacute rejection in solid organ transplants may also be reversed by using Fab fragments [38]. We hypothesized that the intravenous administration of anti-A and anti-B Fab (2) antibody fragments may also be applied in solid organ transplantation. Study Limitations Our study has some limitations. Our sole aim was to test our hypothesis that Fab (2) antibody fragments can be used to prevent an immune stimulus. All of the funds for this project were provided by the authors and our funds were not sufficient to fully complete the project. Although the results of cross-match tests and flow cytometric analysis were consistent, we were not able to evaluate all possible immune stimulus mechanisms associated with incomplete antibodies. In addition, we would have preferred to measure the levels of the Fab (2) antibody fragments and pepsin after completing the reaction, and also to measure the reaction in various environmental conditions, but we did not have sufficient funds to perform all these tests. It should also be noted that the weak positive reactions in group A or B erythrocytes with incomplete anti-A or anti-B antibodies in IgG cross-match card tests, respectively, may have originated from inadequate Fab (2) antibody fragment yields with pepsin and protein A columns in our study [39]. However, we cannot state a definite reason explaining these mild agglutinations in card tests as we could not

measure the levels of complete and incomplete antibodies in the products used for card tests. Higher agglutination results related to Fab (2) fragments by the gel centrifugation technique than tube tests may also have originated from its higher sensitivity in detecting agglutination [40].

Conclusion In this in vitro study, we showed that ABO incompatibility can be minimized by using Fab (2) antibody fragments of anti-A and anti-B antibodies. In vivo studies are needed to explore the potential therapeutic effects of these agents. Therefore, we have planned to start an in vivo study to prove these in vitro findings. Acknowledgments The authors declare no financial, consulting, or personal relationships with other people or organizations that could influence the work. There was also no scientific writing assistance or grant support or employment in this study. Ethics Ethics Committee Approval: Dumlupınar University Faculty of Medicine, Ethics Committee 04.05.2015 and approval number: 2015-KAEK-86/2015.04. Informed Consent: N/A. Authorship Contributions Surgical and Medical Practices: Y.Ö., A.A.P.; Concept: M.Ö., G.G.; Design: M.Ö., T.Ö., G.G., A.S.; Data Collection or Processing: T.Ö., M.Ö., S.Y.; Analysis or Interpretation: M.Ö., S.Y., Ö.A.; Literature Search: M.Ö., S.Y.; Writing: M.Ö., S.Y., Ö.A. Conflict of Interest: We report that Dr. Mehmet Özen has a patent pending (PCT/TR2016/050352). The other authors declare that they have no conflict of interest.

References 1. Harmening DM, Forneris G, Tubby BJ. The ABO blood group system. In: Harmening DM, (ed). Modern Blood Banking & Transfusion Practices. Philadelphia, F. A. Davis Company, 2012. 2. Blancher A, Klein J, Socha WW. Molecular Biology and Evolution of Blood Group and MHC Antigens in Primates, 1st ed. New York, Springer, 1997. 3. Makarovska-Bojadzieva T, Blagoevska M, Kolevski P, Kostovska S. Optimal blood grouping and antibody screening for safe transfusion. Prilozi 2009;30:119-128. 4. Petrides M. Pretransfusion compatibility testing. In: Petrides M, Stack G, (eds). Practical Guide to Transfusion Medicine, 2nd ed. Bethesda, American Association of Blood Banks, 2007. 5. Shulman IA, Nelson JM, Saxena S, Thompson JC, Okamoto M, Kent DR, Nakayama RK. Experience with the routine use of an abbreviated crossmatch. Am J Clin Pathol 1984;82:178-181. 6. Judd WJ, Fullen DR, Steiner EA, Davenport RD, Knafl PC. Revisiting the issue: can the reading for serologic reactivity following 37 degrees C incubation be omitted? Transfusion 1999;39:295-259.

Özen M, et al: ABO Blood Group and Fab Antibodies

7. Janeway CA Jr. How the immune system works to protect the host from infection: a personal view. Proc Natl Acad Sci U S A 2001;98:7461-7468. 8. Kamisawa T, Funata N, Hayashi Y, Eishi Y, Koike M, Tsuruta K, Okamoto A, Egawa N, Nakajima H. A new clinicopathological entity of IgG4-related autoimmune disease. J Gastroenterol 2003;38:982-984. 9. Ferraccioli GF, De Vita S, Casatta L, Damato R, Pegoraro I, Bartoli E. Autoimmune connective tissue disease, chronic polyarthritides and B cell expansion: risks and perspectives with immunosuppressive drugs. Clin Exp Rheumatol 1996;14(Suppl 14):71-80.

Turk J Hematol 2018;35:54-60

24. Aliç Y, Akpek EA, Dönmez A, Ozkan S, Perfusionist GY, Aslamaci S. ABOincompatible blood transfusion and invasive therapeutic approaches during pediatric cardiopulmonary bypass. Anesth Analg 2008;107:1185-1187. 25. Mijares A, Lebesgue D, Wallukat G, Hoebeke J. From agonist to antagonist: Fab fragments of an agonist-like monoclonal anti-β2-adrenoceptor antibody behave as antagonists. Mol Pharmacol 2000;58:373-379. 26. Chang TY, Siegel DL. Genetic and immunological properties of phagedisplayed human anti-Rh(D) antibodies: implications for Rh(D) epitope topology. Blood 1998;91:3066-3078.

10. Stigbrand T, Ahlström KR, Sundström B, Makiya R, Stendahl U. Alternative technologies to generate monoclonal antibodies. Acta Oncol 1993;32:841844.

27. Karlsson MC, Getahun A, Heyman B. FcgammaRIIB in IgG-mediated suppression of antibody responses: different impact in vivo and in vitro. J Immunol 2001;167:5558-5564.

11. Bussel JB. Modulation of Fc receptor clearance and antiplatelet antibodies as a consequence of intravenous immune globulin infusion in patients with immune thrombocytopenic purpura. J Allergy Clin Immunol 1989;84:566578.

28. Kruskall MS, AuBuchon JP. Making Landsteiner’s discovery superfluous: safety and economic implications of a universal group O red blood cell supply. Transfus Sci 1997;18:613-620.

12. Nardin A, Lindorfer MA, Taylor RP. How are immune complexes bound to the primate erythrocyte complement receptor transferred to acceptor phagocytic cells? Mol Immunol 1999;36:827-835. 13. Andrew SM, Titus JA. Fragmentation of immunoglobulin G. Curr Protoc Immunol 2001;2:2-8. 14. Kulberg AJ, Bartova LM, Evnin DN. Further studies of the adjuvant properties of homologous IgG split products: mode of action of F(ab’)2 and related fragments. Immunology 1978;34:199-206. 15. Won DI, Jung OJ, Lee YS, Kim SG, Suh JS. Flow cytometry antibody screening using pooled red cells. Cytometry B Clin Cytom 2010;78:96-104. 16. Rewald E. Are there options for donor-derived i.m. anti-D IgG preparations other than to prevent Rh(D) sensitization? The intravenous route. Transfus Sci 1995;16:383-389. 17. Yu X, Menard M, Seabright G, Crispin M, Lazarus AH. A monoclonal antibody with anti-D-like activity in murine immune thrombocytopenia requires Fc domain function for immune thrombocytopenia ameliorative effects. Transfusion 2015;55:1501-1511. 18. Altuntas N, Yenicesu I, Himmetoglu O, Kulali F, Kazanci E, Unal S, Aktas S, Hirfanoglu I, Onal E, Turkyilmaz C, Ergenekon E, Koc E, Atalay Y. The risk assessment study for hemolytic disease of the fetus and newborn in a University Hospital in Turkey. Transfus Apher Sci 2013;48:377-380. 19. Margni RA, Leoni J, Bazzurro M. The incomplete anti-Rh antibody agglutination mechanism of trypsinized ORh+ red cells. Immunology 1977;33:153-160. 20. Williamson RA, Persson MA, Burton DR. Expression of a human monoclonal anti-(rhesus D) Fab fragment in Escherichia coli with the use of bacteriophage λ vectors. Biochem J 1991;277:561-563. 21. Chan BS, Buckley NA. Digoxin-specific antibody fragments in the treatment of digoxin toxicity. Clin Toxicol (Phila) 2014;52:824-836.

29. Staley EM, Schwartz J, Pham HP. An update on ABO incompatible hematopoietic progenitor cell transplantation. Transfus Apher Sci 2016;54:337-344. 30. Worel N. ABO-mismatched allogeneic hematopoietic transplantation. Transfus Med Hemother 2016;43:3-12.

stem

cell

31. Özen M, Üstün C, Öztürk B, Topçuoğlu P, Arat M, Gündüz M, Atilla E, Bolat G, Arslan Ö, Demirer T, Akan H, İlhan O, Beksaç M, Gürman G, Özcan M. Allogeneic transplantation in chronic myeloid leukemia and the effect of tyrosine kinase inhibitors on survival: a quasi-experimental study. Turk J Hematol 2017;34:16-26. 32. Govoni M, Turbiani C, Menini C, Tomasi P. Anti-A autoantibody associated with immune hemolytic anemia. Vox Sang 1991;61:75. 33. Atichartakarn V, Chiewsilp P, Ratanasirivanich P, Stabunswadgan S. Autoimmune hemolytic anemia due to anti B autoantibody. Vox Sang 1985;49:301-303. 34. Aygun B, Padmanabhan S, Paley C, Chandrasekaran V. Clinical significance of RBC alloantibodies and autoantibodies in sickle cell patients who received transfusions. Transfusion 2002;42:37-43. 35. Özen M, Erkul S, Alptekin Erkul GS, Genç Ö, Akgül E, Vural AH. Therapeutic plasma exchange ameliorates incompatible crossmatches. Turk J Hematol 2016;33:356-358. 36. Rydberg L. ABO-incompatibility in solid organ transplantation. Transfus Med 2001;11:325-342. 37. Genberg H, Kumlien G, Wennberg L, Berg U, Tydén G. ABO-incompatible kidney transplantation using antigen-specific immunoadsorption and rituximab: a 3-year follow-up. Transplantation 2008;85:1745-1754. 38. Urbani L, Cardoso J, Soubrane O, Houssin D, Gautreau C. Fab fragments from intravenous immunoglobulin prevent hyperacute rejection in the guinea pig-to-rat combination without reducing hemolytic complement activity in rat serum. Transplant Proc 2000;32:2707-2709.

22. Simmons DP, Savage WJ. Hemolysis from ABO incompatibility. Hematol Oncol Clin North Am 2015;29:429-443.

39. Jones RG, Landon J. A protocol for ‘enhanced pepsin digestion’: a step by step method for obtaining pure antibody fragments in high yield from serum. J Immunol Methods 2003;275:239-250.

23. Vasudev R, Sawhney V, Dogra M, Raina TR. Transfusion-related adverse reactions: from institutional hemovigilance effort to National Hemovigilance program. Asian J Transfus Sci 2016;10:31-36.

40. Judd WJ, Steiner EA, Knafl PC. The gel test: sensitivity and specificity for unexpected antibodies to blood group antigens. Immunohematology 1997;13:132-135.

BRIEF REPORT DOI: 10.4274/tjh.2017.0112 Turk J Hematol 2018;35:61-65

Impact of Fluorescent In Situ Hybridization Aberrations and CLLU1 Expression on the Prognosis of Chronic Lymphocytic Leukemia: Presentation of 156 Patients from Turkey Kronik Lenfositik Lösemi Hastalarının Prognozunda Floresan İn Situ Hibridizasyon Aberasyonları ve CLLU1 Ekspresyonunun Etkisi: Türkiye’den 156 Hastanın Sunumu Ümmet Abur1,

Gönül Oğur1,

Ömer Salih Akar1,

Engin Altundağ1,

Huri Sema Aymelek1,

Düzgün Özatlı2,

Mehmet Turgut2

Ondokuz Mayıs University Faculty of Medicine, Department of Medical Genetics, Samsun, Turkey Ondokuz Mayıs University Faculty of Medicine, Department of Hematology, Samsun, Turkey

1 2

Abstract

Öz

Objective: This study evaluates the impact of CLLU1 expression and fluorescent in situ hybridization (FISH) analysis of a group of Turkish chronic lymphocytic leukemia (CLL) patients.

Amaç: Bu çalışma, bir grup Türk kronik lenfositik lösemi (KLL) hastasında CLLU1 ekspresyonu ve floresan in situ hibridizasyon (FISH) analizinin prognostik etkisini değerlendirmektedir.

Materials and Methods: A total of 156 CLL patients were analyzed by FISH method; 47 of them were also evaluated for CLLU1 expression. Results were correlated with clinical parameters.

Gereç ve Yöntemler: Yüz elli altı KLL hastası FISH yöntemiyle analiz edildi. Bu 156 hastanın 47’sinde ek olarak CLLU1 ekspresyonu incelendi. Sonuçlar klinik parametrelerle ilişkilendirildi.

Results: FISH aberrations were found in 62% of patients. These aberrations were del13q14 (67%), trisomy 12 (27%), del11q22 (19%), del17p (8%), and 14q32 rearrangements (20%). Overall del11q22 and del17p were associated with the highest mortality rates, shortest overall survival (OS), and highest need for medication. Homozygous del13q14, 14q32 rearrangements, and higher CLLU1 expression correlated with shorter OS.

Bulgular: FISH aberasyonu, hastaların %62’sinde bulundu. Aberasyonların dağılımı del13q14 (%67), trizomi 12 (%27), del11q22 (%19), del17p (%8) ve 14q32’nin yeniden düzenlenmesi (%20) olarak bulundu. En yüksek mortalite, en kısa sağkalım süresi ve en fazla ilaç kullanımı del11q22 ve del17p grubunda idi. Homozigot 13q14 delesyonu, 14q32 yeniden düzenlenmesi ve yüksek CLLU1 ekspresyonu olan hastalar kısa sağkalıma sahipti.

Conclusion: Cytogenetics/FISH analysis is still indicated for routine evaluation of CLL. Special consideration is needed for the poor prognostic implications of del11q22, del17p, 14q32 rearrangements, and homozygous del13q14. The impact of CLLU1 expression is not yet clear and it requires more data before becoming routine in genetic testing in CLL patients.

Sonuç: Sitogenetik/FISH analizi, KLL’nin prognostik değerlendirmesinde ve yeni genetik moleküler belirteçlerin belirlenmesinde halen etkili yöntemlerdir. del11q22, del17p, 14q32 yeniden düzenlenmesi ve homozigot del13q14’ün kötü prognostik etkisi gözden kaçırılmamalıdır. CLLU1’in KLL’de prognostik yeri tartışmalıdır. Çalışmamızda orta-kötü prognostik bir kriter olarak belirmesine rağmen, KLL’de rutin genetik testler arasına girebilmesi için daha fazla veri gereklidir.

Keywords: Chronic leukemia, Chronic lymphocytic leukemia, Cytogenetics/FISH, CLLU1

Anahtar Sözcükler: Kronik lösemi, Kronik lenfositik lösemi, Sitogenetik/FISH, CLLU1

Address for Correspondence/Yazışma Adresi: Ümmet ABUR, M.D., Ondokuz Mayıs University Faculty of Medicine, Department of Medical Genetics, Samsun, Turkey Phone : +90 362 312 19 19 E-mail : ummetabur@hotmail.com ORCID-ID: orcid.org/0000-0002-4811-9321

Received/Geliş tarihi: March 16, 2017 Accepted/Kabul tarihi: November 09, 2017

Abur Ü, et al: CLLU1 Expression and FISH Aberrations in CLL

Introduction The clinical manifestation of chronic lymphocytic leukemia (CLL) is variable. While some patients are asymptomatic for years, others show a rapid progression of the disease [1]. Recent identifiers of high-risk patients include chromosomal abnormalities, immunoglobulin heavy chain variable gene, ZAP70, CD38, β2 microglobulin and lactate dehydrogenase (LDH), and CLL upregulated gene 1 (CLLU1) expression [2]. The chromosomal abnormality rate in CLL is 30%-50%; this rate reaches up to 70%-80% with the fluorescent in situ hybridization (FISH) method [3,4]. FISH results have shown that del13q14 is correlated with good prognosis whereas del11q22 and del17p indicate poor prognosis [5,6]. Unfortunately, CLL is genetically heterogeneous. Recently relevant new genomic abnormalities such as NOTCH1 and SF3B1 mutations as well as BIRC3 disruptions have been described [7,8], but none of these genetic markers are unique to CLL. CLLU1 is defined as the first gene specific to CLL. The high expression level of CLLU1 seems to be unique in CLL [9]. However, its relevance to prognosis is still unclear. In this study, the distribution and prognostic impact of chromosomal aberrations via FISH as well as CLLU1 expression levels were analyzed in a group of North Anatolian CLL patients.

Materials and Methods Patients Interphase FISH analysis was applied to blood or bone marrow samples of 156 CLL patients. Of these, 47 were also evaluated for CLLU1 expression and compared with 35 healthy controls. Staging was done according to the modified Rai staging (MRS) system. The results of the β2 microglobulin, LDH, white blood

Turk J Hematol 2018;35:61-65

cell (WBC) count, and absolute lymphocyte count were grouped as high or low risk (Table 1). FISH data were categorized as group 1: del13q14, group 2: trisomy 12, group 3: del11q and del17p, and group 4: normal FISH results. Additionally, two groups were formed with 14q32(IGH) rearrangements being positive or normal. Interphase FISH FISH analysis was performed by directly labeled probes (Vysis/ Abbott Co., Abbott Park, IL, USA). A FISH panel of 5 probes (D13S319, LSI 13q34, LSI ATM, CEP12, LSI p53) was applied [10]. Seventy-one out of 156 patients were also tested by 14q32 break-apart probe. FISH analyses were conducted using an Olympus BX51 microscope equipped with a Progressive Scan Video Camera (Tokyo, Japan). Image analysis was carried out with CytoVision software (version 3.93; Applied Imaging, Grand Rapids, MI, USA). For each probe for optimization, a cut-off level was obtained by counting 300 cells. Results were considered clonal when the percentage of cells with any given chromosome abnormality exceeded the normal cut-off value.

CLLU1 Expression For the analysis of CLLU1 expression, RNA was isolated (QIAGEN, Hilden, Germany); cDNA was synthesized using a cDNA Reverse Transcription Kit (Ipsogen, QIAGEN). CLLU1 expression was tested by real time-polymerase chain reaction (Rotor-Gene Q, QIAGEN) using primers/probes previously defined (Ipsogen, CLLU1 Profile Quant Kit). Analysis was performed using the comparative Ct method of relative quantification with β2 microglobulin as an endogenous control. The CLLU1 expression levels were measured as fold upregulation in relation to normal patients’ cells and a

Table 1. Distribution of patients according to risk groups and chromosomal abnormalities (fluorescent in situ hybridization).

White blood cell count

Absolute lymphocyte count

b2 Microglobulin

Lactate dehydrogenase

Low

High

Low

risk

risk (<500 U/L)

Low

High

Low

High

risk

risk (≥50x103/µL)

risk (<30x103/uL)

risk (≥30x103/µL)

(<2300 g/ mL)

risk (≥2300 ng/mL)

del 11q22/del17p 12 (50%) (TP53)

12 (50%)

17 (71%)

7 (78%)

2 (22%)

del13q14

24 (65%)

13 (35%)

17 (45%)

15 (44%)

36 (95%)

2 (5%)

Trisomy 12

14 (65%)

5 (35%)

4 (21%)

10 (55%)

14 (74%)

5 (26%)

Normal

47 (79%)

13 (21%)

18 (30%)

32 (60%)

51 (88%) 7 (12%)

p-value

<0.05

FISH anomalies

(<50x103/µL)

FISH: Fluorescent in situ hybridization.

<0.05

>0.05

High risk (≥500 U/L)

Abur Ü, et al: CLLU1 Expression and FISH Aberrations in CLL

Turk J Hematol 2018;35:61-65

cut-off value was defined to separate high from low expression levels [11]. Statistical Analysis The chi-square test was applied to determine the relationship among clinical and laboratory parameters (LDH and β2 microglobulin, WBC, MRS, CLLU1 expression, and subsets of FISH abnormalities). Overall survival (OS) was tested by the KaplanMeier method. The survival curves were statistically compared using a log-rank test (p≤0.05).

Results Patient Population Of 156 patients, 103 patients were male. Ages ranged from 36 to 90 years (median: 68 years). In total, 37 patients died during the study. The median OS time was 101±12 months.

FISH results were correlated with MRS. The 11q22 and 17p13 deletions had an advanced stage (p<0.05), as well as higher WBC and absolute lymphocyte counts (p<0.05). No difference was observed within groups with respect to β2 microglobulin and LDH and initiation of therapy (p>0.05) (Table 1). Results of CLLU1 Expression CLLU1 expression represented a continuum ranging from 0.1 to 3900 and a median of 17.6-fold upregulation (Figure 1). In the group with high CLLU1 expression, survival time was twofold lower and the need for medication was twofold higher (p>0.05). High CLLU1 expression was associated with higher WBC count. Table 2. Frequencies of fluorescent in situ hybridization anomalies in chronic lymphocytic leukemia patients. Main FISH anomalies

Patient (n)

Percent (%)

Heterozygote del13q14

Results of FISH

Trisomy 12

FISH analysis detected aberrations in 96 patients (62%). The most frequent abnormality was del13q14 (67%), followed by trisomy 12 (27%), del11q22 (19%), and del17p13 (8%). The occurrence of del13q14 and del11q22 was the most frequent complex abnormality (Table 2). 14q32 rearrangements were detected in 14 of 71 patients (20%).

del11q22

del17p13

The shortest survival was observed with del11q and del17p and trisomy 12; the longest survival was with del13q14 and in normal patients (p>0.05). The need for medication was significantly higher for del11q22 and del17p (p<0.05). Homozygous del13q14 showed twofold shorter OS (p>0.05) and was categorized in the high-risk group (p<0.05) (Table 3). Positive 14q32 rearrangements showed a twofold increase in mortality and need for medication (p>0.05). They were categorized in the intermediate- to high-risk group (p<0.05).

Complex FISH anomalies del13q14 + del11q22 (most common) 9

Homozygote del13q14

del11q22 + trisomy 12

del13q14 + del17p13

del13q14 + trisomy 12

del13q14 + del13q34

del13q14 + del13q34 + del17p13

Homozygote del13q14 + del17p13

Total

100

FISH: Fluorescent in situ hybridization.

Table 3. Correlation of the genetic markers with overall survival and medication. Genetic markers

Overall survival (months)

No medication

Medication

Total

Normal

123±22 months

35 (59%)

24 (41%)

del11q22/del17p13

77±12 months

1 (11%)

8 (89%)*

Trisomy 12

74±7 months

12 (60%)

8 (40%)

Heterozygote del13q14

98±22 months

22 (58%)

16 (42%)

Homozygote del13q14

47±4 months

3 (50%)

High expression CLLU1 levels

48±3 months

13 (46%)

15 (54%)

Low expression CLLU1 levels

82±8 months

4 (21%)

15 (79%)

*p<0.05.

Abur Ü, et al: CLLU1 Expression and FISH Aberrations in CLL

Turk J Hematol 2018;35:61-65

Table 4. Comparison of prognostic markers in the group with high CLLU1 expression with the findings of previous studies. Overall survival

Need for medication

Advanced stage

High β2 microglobulin level

FISH anomalies

Age

Our study

Shorter (p>0.05)

High (p>0.05)

(p>0.05)

Buhl et al. [18]

Shorter (p<0.05)

High (p<0.05)

+ (p<0.05)

+* (p<0.05)

Chen et al. [20]

Shorter (p<0.05)

High (p<0.05)

(p>0.05) +* (p<0.05)

Josefsson et al. [11]

+ (p<0.05) (p>0.05)

Gonzalez et al. [19]

Shorter (p<0.05)

(p>0.05)

+ (p<0.05)

(p>0.05)

+ (p<0.05)

(p>0.05)

*del11q22 and del17p group correlation. NA: Not available, FISH: fluorescent in situ hybridization.

There was no correlation between CLLU1 expression and FISH anomalies, β2 microglobulin and LDH levels, or MRS (p>0.05).

Discussion Genetic markers have been major factors in the prognostic evaluation of CLL. The chromosomal anomaly detection rate with FISH is 70%-80% [3]. In our study, the FISH abnormality rate was 62%. Detected abnormalities include del13q14 (40%-60%), trisomy 12 (15%-20%), del11q22 (10%-20%), and del17p13 (5%-10%). Our study yielded a similar pattern. Survival was significantly shorter among patients with del11q12 and del17p13. Similar to the literature data, significant correlation was observed between these two deletions and poor prognosis [5,6,12]. In this study, patients with positive 14q32 rearrangements also had poor outcomes, as shown in some previous reports [13,14]. Few studies refer to homozygote del13q14, and its contribution to prognosis is unclear. Some have reported that homozygote del13q14 is associated with an advanced stage [15,16], while Puiggros et al. [17] noted the opposite. In our study, homozygote del13q14 was correlated with advanced stage and shorter survival. Previous studies reported that TP53, NOTCH, SF3B1, and BIRC3 mutations are accountable for poor prognosis [7,8]. The impact of CLLU1 expression as a new prognostic factor in CLL is unclear. In the present report, high CLLU1 expression indicated shorter survival and higher need for treatment. Similar results were observed in the literature [11,18,19]. In our study, there was no correlation between CLLU1 expression and FISH aberrations. Some have reported that patients with del17p13 and del11q22 have significantly higher levels of CLLU1 [11,18]. Chen et al. [20] noted the opposite. Buhl et al. [21] reported no increase in the level of CLLU1 in patients with trisomy 12; Gonzalez et al. [19] noted the opposite. There was no correlation between trisomy 12 and CLLU1 expression in our study (Table 4). 64

Figure 1. Levels of CLLU1 expression: a, b, d, g- patients; cstandard; e, f- healthy controls.

Conclusion A chromosomal evaluation is still needed for the genetic evaluation of CLL because it can identify unique translocations or aberrations in which breakpoints could lead to identification of new molecular markers. Application of a FISH panel including probes aiming to detect homozygous del13q14, del11q22, del17p, 14q32 rearrangements, and trisomy 12 should still be the routine. The impact of testing CLLU1 expression is not yet clear and there is a need for more relevant data. Ethics Ethics Committee Approval: This study had the permission of the Ondokuz Mayıs University Ethical Committee (approval number: 201/855). Informed Consent: It was received. Authorship Contributions Surgical and Medical Practices: G.O., M.T., D.Ö.; Concept: G.O., D.Ö., M.T.; Design: Ü.A., Ö.S.A., H.S.A.; Data Collection or Processing: Ü.A., E.A., Ö.S.A.; Analysis or Interpretation: Ü.A., E.A.; Literature Search: Ü.A., H.S.A., E.A., Ö.S.A.; Writing: G.O., Ü.A.

Turk J Hematol 2018;35:61-65

Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Gentile M, Mauro FR, Guarini A, Foà R. New developments in the diagnosis, prognosis and treatment of chronic lymphocytic leukemia. Curr Opin Oncol 2005;17:597-604. 2. Byrd JC, Stilgenbauer S, Flinn IW. Chronic lymphocytic leukemia. Hematology Am Soc Hematol Educ Program 2004;163-183. 3. Dicker F, Schnittger S, Haferlach T, Kern W, Schoch C. Immunostimulatory oligonucleotide-induced metaphase cytogenetics detect chromosomal aberrations in 80% of CLL patients: a study of 132 CLL cases with correlation to FISH, IgVH status, and CD38 expression. Blood 2006;108:3152-3160. 4. Shanafelt TD, Geyer SM, Kay NE. Prognosis at diagnosis: integrating molecular biologic insights into clinical practice for patients with CLL. Blood 2004;103:1202-1210. 5. Lai YY, Huang XJ. Cytogenetic characteristics of B cell chronic lymphocytic leukemia in 275 Chinese patients by fluorescence in situ hybridization: a multicenter study. Chin Med J (Engl) 2011;124:2417-2422. 6. Döhner H, Stilgenbauer S, Benner A, Leupolt E, Kröber A, Bullinger L, Döhner K, Bentz M, Lichter P. Genomic aberrations and survival in chronic lymphocytic leukemia. N Engl J Med 2000;343:1910-1916. 7. Puiggros A, Blanco G, Espinet B. Genetic abnormalities in chronic lymphocytic leukemia: where we are and where we go. Biomed Res Int 2014;2014:435983. 8. Stilgenbauer S, Schnaiter A, Paschka P, Zenz T, Rossi M, Döhner K, Bühler A, Böttcher S, Ritgen M, Kneba M, Winkler D, Tausch E, Hoth P, Edelmann J, Mertens D, Bullinger L, Bergmann M, Kless S, Mack S, Jäger U, Patten N, Wu L, Wenger MK, Fingerle-Rowson G, Lichter P, Cazzola M, Wendtner CM, Fink AM, Fischer K, Busch R, Hallek M, Döhner H. Gene mutations and treatment outcome in chronic lymphocytic leukemia: results from the CLL8 trial. Blood 2014:123:3247-3254. 9. Buhl AM, James DF, Neuberg D, Jain S, Rassenti LZ, Kipps TJ. Analysis of CLLU1 expression levels before and after therapy in patients with chronic lymphocytic leukemia. Eur J Haematol 2011;86:405-411. 10. Schoch C, Schnittger S, Bursch S, Gerstner D, Hochhaus A, Berger U, Hehlmann R, Hiddemann W, Haferlach T. Comparison of chromosome banding analysis, interphase and hypermetaphase-FISH, qualitative and quantitative PCR for diagnosis and for follow-up in chronic myeloid leukemia: a study on 350 cases. Leukemia 2002;16:53-59. 11. Josefsson P, Geisler CH, Leffers H, Petersen JH, Andersen MK, Jurlander J, Buhl AM. CLLU1 expression analysis adds prognostic information to risk prediction in chronic lymphocytic leukemia. Blood 2007;109:4973-4979.

Abur Ü, et al: CLLU1 Expression and FISH Aberrations in CLL

12. Ripollés L, Ortega M, Ortuño F, González A, Losada J, Ojanguren J, Soler JA, Bergua J, Coll MD, Caballín MR. Genetic abnormalities and clinical outcome in chronic lymphocytic leukemia. Cancer Genet Cytogenet 2006;171:57-64. 13. Pittman S, Catovsky D. Prognostic significance of chromosome abnormalities in chronic lymphocytic leukaemia. Br J Haematol 1984;58:649-660. 14. Cavazzini F, Hernandez JA, Gozzetti A, Russo Rossi A, De Angeli C, Tiseo R, Bardi A, Tammiso E, Crupi R, Lenoci MP, Forconi F, Lauria F, Marasca R, Maffei R, Torelli G, Gonzalez M, Martin-Jimenez P, Maria Hernandez J, Rigolin GM, Cuneo A. Chromosome 14q32 translocations involving the immunoglobulin heavy chain locus in chronic lymphocytic leukaemia identify a disease subset with poor prognosis. Br J Haematol 2008;142:529-537. 15. Stilgenbauer S, Sander S, Bullinger L, Benner A, Leupolt E, Winkler D, Kröber A, Kienle D, Lichter P, Döhner H. Clonal evolution in chronic lymphocytic leukemia: acquisition of high-risk genomic aberrations associated with unmutated VH, resistance to therapy, and short survival. Haematologica 2007;92:1242-1245. 16. Shanafelt TD, Witzig TE, Fink SR, Jenkins RB, Paternoster SF, Smoley SA, Stockero KJ, Nast DM, Flynn HC, Tschumper RC, Geyer S, Zent CS, Call TG, Jelinek DF, Kay NE, Dewald GW. Prospective evaluation of clonal evolution during long-term follow-up of patients with untreated early-stage chronic lymphocytic leukemia. J Clin Oncol 2006;24:4634-4641. 17. Puiggros A, Delgado J, Rodriguez-Vicente A, Collado R, Aventín A, Luño E, Grau J, Hernandez JÁ, Marugán I, Ardanaz M, González T, Valiente A, Osma M, Calasanz MJ, Sanzo C, Carrió A, Ortega M, Santacruz R, Abrisqueta P, Abella E, Bosch F, Carbonell F, Solé F, Hernández JM, Espinet B; Grupo Cooperativo Español de Citogenética Hematológica (GCECGH) and Grupo Español de Leucemia Linfática Crónica (GELLC). Biallelic losses of 13q do not confer a poorer outcome in chronic lymphocytic leukaemia: analysis of 627 patients with isolated 13q deletion. Br J Haematol 2013;163:47-54. 18. Buhl AM, Jurlander J, Geisler CH, Pedersen LB, Andersen MK, Josefsson P, Petersen JH, Leffers H. CLLU1 expression levels predict time to initiation of therapy and overall survival in chronic lymphocytic leukemia. Eur J Haematol 2006;76:455-464. 19. Gonzalez D, Else M, Wren D, Usai M, Buhl AM, Parker A, Oscier D, Morgan G, Catovsky D. CLLU1 expression has prognostic value in chronic lymphocytic leukemia after first-line therapy in younger patients and in those with mutated IGHV genes. Haematologica 2013;98:274-278. 20. Chen L, Li J, Zheng W, Zhang Y, Wu Y, Li L, Qian S, Xu W. The prognostic evaluation of CLLU1 expression levels in 50 Chinese patients with chronic lymphocytic leukemia. Leuk Lymphoma 2007;48:1785-1792. 21. Buhl AM, Jurlander J, Jørgensen FS, Ottesen AM, Cowland JB, Gjerdrum LM, Hansen BV, Leffers H. Identification of a gene on chromosome 12q22 uniquely overexpressed in chronic lymphocytic leukemia. Blood 2006;107:2904-2911.

BRIEF REPORT DOI: 10.4274/tjh.2017.0266 Turk J Hematol 2018;35:66-70

Glomerular and Tubular Functions in Children and Adults with Transfusion-Dependent Thalassemia Transfüzyona Bağımlı Çocuk ve Erişkin Talasemi Hastalarında Glomerüler ve Tubuler Böbrek Fonksiyonları Agageldi Annayev1,

Zeynep Karakaş1,

Serap Karaman1,

Altan Yalçıner2,

Alev Yılmaz3,

Sevinç Emre3

İstanbul University İstanbul Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey Düzen Laboratories, İstanbul, Turkey 3 İstanbul University İstanbul Faculty of Medicine, Department of Pediatric Nephrology, İstanbul, Turkey 1 2

Abstract

Öz

This study aimed at assessing renal functions in patients with transfusion-dependent thalassemia (TDT). Fifty patients and 30 controls were enrolled in this prospective study. Serum levels of electrolytes and albumin were measured by a spectrophotometer. Serum levels of cystatin-C and urinary levels of β2-microglobulin were measured by nephelometric method. Thirty-eight patients were receiving deferasirox and 8 were on deferiprone. Serum electrolytes and albumin levels of the patients were found to be within normal ranges. Urinary β2-microglobulin and serum cystatin-C levels were significantly higher in patients than controls. They did not significantly differ between the subgroup of patients on deferiprone and the control group, whereas they were found to be higher in patients using deferasirox compared to controls. Urinary β2-microglobulin levels significantly increased in patients who were receiving high-dose deferasirox compared to those who were receiving a daily dose of 15-20 mg/kg or controls. Subclinical renal injury may be present in TDT patients.

Bu çalışmada transfüzyona bağımlı talasemi (TBT) hastalarında böbrek fonksiyonlarının değerlendirilmesi amaçlanmıştır. Prospektif çalışmaya, 50 TBT ve 30 kontrol grubu dahil edildi. Serum elektrolitleri ve albumin düzeyleri spektrofotometre ile ölçüldü. Serum sistatin-C ve idrar β2-mikroglobülin düzeyleri nephelometrik yöntemle ölçüldü. Otuz sekiz hasta deferasiroks, 8 hasta deferipron alıyordu. Hastaların serum elektrolitleri ve albumin düzeyleri normal sınırlardaydı. İdrar β2mikroglobulin ve serum sistatin-C düzeyleri hasta grubunda kontrol grubundakilere göre anlamlı derecede yüksekti. Serum Cys-C ve idrar β2-mikroglobulin düzeyleri, deferipron kullananlar ve kontrol grubu arasında anlamlı farklılık göstermezken, deferasiroks kullananlarda kontrol grubuna göre daha yüksek bulundu. İdrar β2 mikroglobulin düzeyleri, yüksek doz deferasiroks alan hastalarda, 15-20 mg/kg/ gün deferasiroks alanlara veya kontrol grubuna göre anlamlı şekilde artmıştı. Transfüzyona bağımlı talasemi hastalarında subklinik olarak renal hasar mevcut olabilir.

Keywords: Thalassemia, Microglobulin, Cystatin

Anahtar Sözcükler: Talasemi, Tubulopati, Glomerulopati, β2Mikroglobulin, Sistatin C

Tubulopathy,

Glomerulopathy,

β2-

Introduction Iron accumulation may lead to renal damage in transfusiondependent thalassemia (TDT) [1,2]. Cystatin C (Cys-C), a small molecular weight protein, is filtered from the glomeruli, reabsorbed from the tubular cells, and metabolized from the kidneys. It is a good marker for glomerular filtration rate (GFR). β2-Microglobulin (β2MG), a single-chain, low-molecular-weight polypeptide, is filtered by the glomeruli, then reabsorbed and catabolized in the proximal tubular cells. Increased urinary

excretion of β2MG may demonstrate tubular dysfunction. Our study assessed kidney function in patients with TDT using serum Cys-C (SCys-C) and urinary β2MG (Uβ2MG) measurements in addition to routine tests, as well as the utility of these markers as indicators for early glomerulopathy and tubulopathy.

Materials and Methods Fifty patients with TDT, 25 under and 25 above the age of 18, have been followed since their childhood by the Thalassemia

Address for Correspondence/Yazışma Adresi: Serap KARAMAN, M.D., İstanbul University İstanbul Faculty of Medicine, Department of Pediatric Hematology and Oncology, İstanbul, Turkey Phone : +90 533 437 81 30 E-mail : drkaramans@yahoo.com ORCID-ID: orcid.org/0000-0002-7428-3897

Received/Geliş tarihi: July 17, 2017 Accepted/Kabul tarihi: July 28, 2017

Turk J Hematol 2018;35:66-70

Annayev A, et al: Kidney Functions in Transfusion-Dependent Thalassemia Patients

Center at the İstanbul Faculty of Medicine of İstanbul University. Twenty-two patients were male and 28 were female. The mean age was 18.4±11.8 years (range: 2-45). Thirty age- and sexmatched subjects were included in the control group. Ethical approval was granted by the institutional review board and patient consent was obtained. Serum electrolytes, urine calcium/creatinine (uCa/Cr) and fractional excretion of sodium (FENa), GFR, proteinuria, serum Cr, and albumin levels were measured and were compared to their reference ranges in the patient group. SCys-C and Uβ2MG levels in the patient group were compared to those of the controls and potential correlations between SCys-C or Uβ2MG levels and the severity of anemia, ferritin levels, and chelation therapy were also evaluated. Blood samples collected to measure SCys-C were cold-centrifuged at 4000 rpm for 10 min. A photometric analysis of serum albumin, urea, Cr, uric acid, and electrolyte levels was conducted. Ferritin levels were measured by the electrochemiluminescent immunoassay method. SCys-C and Uβ2MG levels were measured by nephelometry. Statistical analysis was done using SPSS 17.0.

Results No significant differences were found between the patients and controls in terms of age or sex (p>0.05). Demographic and clinical characteristics of the patients are summarized in Table 1. In the patients, serum Na, K, Ca, P, Mg, urea, Cr, and albumin were within normal limits. None of the patients had proteinuria. The mean uCa/Cr ratio was found to be higher than the normal level. Estimated GFR was elevated in the patient group (Table 2). SCys-C and Uβ2MG levels were higher in patients than controls (p=0.001, p=0.010) (Table 3). SCys-C was increased with age (r=0.376; p=0.007). No correlations were found between Uβ2MG levels and age (r=-0.186, p=0.217). Renal dysfunction was detected in 30 out of 50 patients. FENa levels were increased in 8 patients, while Uβ2MG and SCys-C levels were increased in 9 and 25 patients, respectively. In our study, renal involvement was observed in 54% of the patients under the age of 18 and 64% of the patients above the age of 18. No correlations were observed between the mean SCys-C and Uβ2MG levels and pretransfusion hemoglobin and iron load (p>0.05) (Figures 1 and 2). No correlations were found between SCys-C and ferritin levels. The assessment of the correlations between the Uβ2MG and ferritin levels in patients revealed that Uβ2MG levels were greater than in the controls, particularly in those who had a ferritin level of <500 ng/mL or >1000 ng/ mL (p=0.001). Although Uβ2MG levels were slightly elevated in the patients who had ferritin levels between 500 and 1000 ng/ mL, the difference between the patients and controls was not statistically significant (p>0.05).

The distribution of patients by their chelation therapy was as follows: 38 patients (75.5%) were on deferasirox (DFX); 8 (16.3%) were on deferiprone (DFP). Among the patients who were on DFX, 11 (31%) were receiving a dose of 15-20 mg/kg/ day, 13 (33%) were receiving a dose of 20-30 mg/kg/day, and 14 (36%) were receiving a dose of 30-40 mg/kg/day. When SCys-C concentrations were categorized by iron chelation therapy, there were no differences between the patients who were on DFP and the controls, while significant differences were found between Table 1. Demographics and clinical characteristics of the patient group.

Mean

Age

18.4±11.8 years

Pretransfusion hemoglobin (g/dL)

8.7±0.78

Serum ferritin (ng/mL)

1770.8±1883

TSH (mIU/L)

2.7±1.14

fT4 (pmol/L)

11.3±2.15

Age

<18 years

>18 years

Sex

Male

Female

Ferritin (ng/mL)

<500

500-1000

1000-2500

>2500

Chelator

Deferasirox

75.5

Deferiprone

16.3

None

8.2

Splenectomy

Yes

Osteoporosis

Yes

Liver iron concentration (mg/g dry weight)

7-15

>15

Non-MRI

Heart T2* (ms)

<10

10-20

>20

Non-MRI MRI: Magnetic resonance imaging.

Annayev A, et al: Kidney Functions in Transfusion-Dependent Thalassemia Patients

Turk J Hematol 2018;35:66-70

Table 2. Renal function test results in the patient group and reference ranges. Renal function tests

Mean ± SD

Min - Max

Reference ranges*

FENa

0.65±0.32

0.15-1.54

<1%

Na, mmol/L

137.8±2.04

135-142

136-145

K, mmol/L

4.65±0.5

3.8-5.3

3.5-5.1

Ca, mg/dL

9.39±0.56

8.1-10.9

9.2-11

P, mg/dL

4.7±0.79

3.2-6

3.4-4.2

Mg, mg/dL

1.1±2.3

1.1-2.3

1.5-2.5

uCa/Cr

0.22±0.11

0.1-0.4

<0.2

Urea, mg/dL

30.24±9.44

9-45

5-50

Cr, mg/dL

0.42±0.16

0.2-0.79

0.4-0.7

Albumin, g/dL

4.64±0.36

4.1-5.3

2.9-4.6

GFR, mL/min/1.73 m2, 2-12 years

216±57.2

90-302

113±27

GFR, mL/min/1.73 m2, 13-21 years (female)

213±65

99-213

126±22

GFR, mL/min/1.73 m2, 13-21 years (male)

206±20.8

110-300

140±30

GFR, mL/min/1.73 m2, >21 years

180±55

81-248

70-145

*Reference ranges of the Clinical Biochemistry Laboratory of the Faculty Medicine of İstanbul University. FENa: Fractional excretion of sodium, Ca: calcium, uCa: urine calcium Cr: creatinine, GFR: glomerular filtration rate, SD: standard deviation, min: minute.

Table 3. Serum cystatin-C and urinary β2-microglobulin levels in the patient and control groups.

Patient group (mean ± SD)

Control group (mean ± SD)

p-value

SCys-C, mg/L

0.75±0.12

0.66±0.09

0.001

Uβ2MG, mg/L

0.35±0.43

0.20±0.01

0.010

SCys-C: Serum cystatin-C, Uβ2MG: urinary β2-microglobulin, SD: standard deviation.

the patients who were on DFX and the controls (p=0.002) (Table 4). No correlations were found between DFX dosages and SCys-C concentrations. When urinary β2MG levels were categorized by iron chelation therapy, there were no differences between the patients who were on DFP and the controls, while significant differences were found between the patients who were on DFX and the controls (p=0.004) (Table 4). In the subgroup of patients on DFX, the assessment of Uβ2MG and SCys-C levels by DFX doses revealed that there were no significant differences between the controls and patients who were taking DFX at a dose of 1520 mg/kg, while statistically significant differences were found between controls and patients who were taking DFX at a dose of 20-40 mg/kg (p=0.011). Uβ2MG levels were increased with 68

increasing DFX doses. SCys-C levels were higher in all patient groups in comparison to the control group (p=0.013), but the difference was not dose-related.

Discussion In our study, serum electrolytes were within reference ranges, but FENa levels were elevated in 8 patients. In another study, FENa was elevated in 29% of 103 TBT patients [3]. Several studies have reported normal FENa levels [4,5]. In our study the Ca/Cr ratio was found to be higher than the upper limit of the normal range in 28% of the patients. Higher Ca/Cr ratios may be associated with tubular dysfunction as well as with impaired calcium homeostasis or bone disorders. In our study, osteoporosis was diagnosed in almost half of the patients. Some studies have reported high levels of Uβ2MG in patients with TBT [6,7,8], while other studies reported the opposite [5]. In our study, Uβ2MG concentrations in patients were significantly higher than in the controls. No significant differences were found between the controls and the subgroup of patients who were on DFP, whereas statistically significant differences were found between the controls and the DFX subgroup. Positive

Annayev A, et al: Kidney Functions in Transfusion-Dependent Thalassemia Patients

Turk J Hematol 2018;35:66-70

Table 4. The comparisons of urinary β2-microglobulin and serum cystatin-C levels between the control group and the subgroups of patients who were on chelation therapy with deferiprone or deferasirox. Deferiprone (n=8)

Deferasirox (n=38)

Controls (mean ± SD)

p-value*

p-value**

SCys-C, mg/L

0.73±0.09

0.75±0.13

0.66±0.09

0.002

Uβ2MG, mg/L

0.20±0.01

0.39±0.49

0.20±0.01

0.004

*p: DFP vs. controls; **p: DFX vs. controls. NS: Nonsignificant, Uβ2MG: urinary β2-microglobulin, SCys-C: serum cystatin-C, SD: standard deviation.

Figure 1. Correlations between pretransfusion hemoglobin and urinary β2-microglobulin and serum cystatin-C.

Figure 2. Correlations between heart T2* and Uβ2MG and SCys-C. Uβ2MG: Urinary β2-microglobulin, SCys-C: serum cystatin-C, MRI: magnetic resonance imaging.

Uβ2MG: Urinary β2-microglobulin, SCys-C: serum cystatin-C, Hb: hemoglobin.

>1000 ng/mL, whereas even though Uβ2MG levels were slightly

correlations between the Uβ2MG levels and DFX doses suggested

elevated in the subgroup of patients with ferritin between 500

that DFX might cause dose-dependent tubulopathy. Uβ2MG

and 1000 ng/mL, the difference between this subgroup and the

levels were significantly higher in patients than the controls,

control group was not statistically significant. No associations

particularly in patients who had ferritin levels of <500 ng/mL or

were found between Uβ2MG levels and iron load. 69

Annayev A, et al: Kidney Functions in Transfusion-Dependent Thalassemia Patients

GFR has been a commonly used method to measure kidney functions. In two studies, no significant differences were found in GFR between patients and controls [3,9]. In our study, GFR in the patient group was higher than the upper limit of the age-adjusted reference range. The routine markers of kidney function, including serum urea and Cr levels, were within normal limits in all patients, in line with similar studies in the literature [10,11,12]. Some studies reported higher SCys-C levels in patients with TBT [13,14,15]. In our study, SCys-C levels were found to be significantly higher in the patients in comparison to the controls. No differences were found between the patients who were taking DFP and the controls, while SCys-C levels were significantly higher in patients on DFX in comparison to the controls. No correlations were found between SCys-C or ferritin levels and pretransfusion Hb, liver, and heart T2* values, while SCys-C levels increased with age. Koliakos et al. [16] revealed that the urinary markers of tubular dysfunctions correlated positively with serum ferritin and liver iron deposition in patients with TBT. Papassotiriou et al. [17] detected elevated SCys-C in patients who received DFX at doses of 20-40 mg/kg/ day. Acute kidney injury has been reported in 40% of patients on deferoxamine [18]. None of our patients were taking deferoxamine during this study.

Conclusion In conclusion, patients with TDT may develop renal dysfunction. In follow-up, regular testing for early markers in addition to routine kidney function tests may be beneficial to prevent future severe kidney dysfunction. Ethics Ethics Committee Approval: İstanbul University İstanbul Faculty of Medicine (approval number: 07.03.2014/05).

Turk J Hematol 2018;35:66-70

References 1. Steinberg MH, Forget, BG, Higgs DR, Weatherall DJ. Disorders of Hemoglobin: Genetics, Pathophysiology, Clinical Management. 2nd ed. Cambridge, Cambridge University Press, 2009. 2. Musallam KM, Capellini MD, Taher AT. Iron overload in β-thalassemia intermedia: an emerging concern. Curr Opin Hematol 2013;20:187-192. 3. Mohkam M, Shamsian BS, Gharib A, Nariman S, Arzanian MT. Early markers of renal dysfunction in patients with beta-thalassemia major. Pediatr Nephrol 2008;23:971-976. 4. Aldudak B, Karabay Bayazit A, Noyan A, Ozel A, Anarat A, Sasmaz I, Kilinç Y, Gali E, Anarat R, Dikmen N. Renal function in pediatric patients with betathalassemia major. Pediatr Nephrol 2000;15:109-112. 5. Jafari HM, Vahidshahi K, Kosaryan M, Karami H, Mandavi MR. Ehteshami S. Major beta-thalassemia, use of desferiexamine and renal proximal tubular damage. Bratisl Lek Listy 2011;112:278-281. 6. Sadeghi-Bojd S, Hashemi M, Karimi M. Renal tubular function in patients with beta-thalassaemia major in Zahedan, southeast Iran. Singapore Med J 2008;49:410-412. 7. Mula-Abed WA, Al-Hashmi HS, Al-Muslahi MN. Indicators of renal glomerular and tubular functions in patients with beta-thalassaemia major: A cross sectional study at the Royal Hospital, Oman. Sultan Qaboos Univ Med J 2011;11:69-76. 8. Deveci B, Kurtoglu A, Kurtoglu E, Salim O, Toptas T. Documentation of renal glomerular and tubular impairment and glomerular hyperfiltration in multitransfused patients with beta thalassemia. Ann Hematol 2016;95:375381. 9. Kalman S, Atay AA, Sakallioglu O, Ozgürtaş T, Gök F, Kurt I, Kürekçi AE, Ozcan O, Gökçay E. Renal tubular function in children with beta-thalassemia minor. Nephrology (Carlton) 2005;10:427-429. 10. Smolkin V, Halevy R, Levin C, Mines M, Sakran W, Ilia K, Koren A. Renal function in children with beta-thalassemia major and thalassemia intermedia. Pediatr Nephrol 2008;23:1847-1851. 11. Lai ME, Spiga A, Vacquer S, Carta MP, Corrias C, Ponticelli C. Renal function in patients with β-thalassaemia major: a long-term follow-up study. Nephrol Dial Transplant 2012;27:3547-3551. 12. Almadzadeh A, Jalali A, Assar S, Khalilian H, Zandian K, Pedram M. Renal tubular dysfunction in pediatric patients with beta-thalassemia major. Saudi J Kid Dis Transpl 2011;22:497-450. 13. Economou M, Printza N, Teli A, Tzimouli V, Tsatra I, Papachristou F, Athanassiou-Metaxa M. Renal dysfunction in patients with beta-thalassemia major receiving iron chelation therapy either with deferoxamine and deferiprone or with deferasirox. Acta Haematol 2010;123:148-152.

Informed Consent: Patients consent was obtained.

14. Ali BA, Mahmoud AM. Frequency of glomerular dysfunction in children with beta thalassaemia major. Sultan Qaboos Univ Med J 2014;14:88-94.

Authorship Contributions

15. Hamed AE, Elmelegy NT. Renal functions in pediatric patients with betathalassemia major: relation to chelation therapy: original prospective study. Ital J Pediatr 2010;30:36-39.

Surgical and Medical Practices: Z.K., A.A.; Concept: Z.K., S.E.; Design: S.K., A.Y.; Data Collection or Processing: A.A.; Analysis or Interpretation: A.Y.; Literature Search: A.A., A.Y., S.K.; Writing: S.K., A.A., Z.K. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

16. Koliakos G, Papachristou F, Koussi A, Perifanis V, Tsatra I, Souliou E, Athanasiou M. Urine biochemical markers of early renal dysfunction are associated with iron overload in beta-thalassaemia. Clin Lab Haematol 2003;25:105-109. 17. Papassotiriou I, Margeli A, Hantzi E, Delaporta P, Sergounioti A, Goussetis E, Ladis V, Kattamis A. Cystatin C levels in patients with beta-thalassemia during deferasirox treatment. Blood Cells Mol Dis 2010;44;152-155. 18. Prasannan L, Flynn JT, Levine JE. Acute renal failure following deferoxamine overdose. Pedi¬atr Nephrol 2003;18:283-285.

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.2016.0262 Turk J Hematol 2018;35:71-72

Ascites in the Course of Plasma Cell Myeloma Complicated by AL Amyloidosis AL Amiloidoz ile Komplike Plazma Hücre Miyeloması Seyrindeki Asitler Jakub Debski1, Lidia Usnarska-Zubkiewicz1, Kazimierz Kuliczkowski1

Katarzyna Kapelko-Słowik1,

Aleksander Pawluś2,

Urszula Zaleska-Dorobisz1,

Uniwersytet Medyczny im Piastow Slaskich we Wroclawiu, Department of Hematology, Blood Neoplasms and Bone Marrow Transplantation, Wroclaw, Poland 2 Uniwersytet Medyczny im Piastow Slaskich we Wroclawiu, Department of Radiology, Wroclaw, Poland 1

A 60-year-old Caucasian male with plasma cell myeloma (PCM) immunoglobulin G (IgG) kappa, International Staging System stage 3, diagnosed 5 months ago, was admitted to the department of hematology due to progression of the disease. He had completed three cycles of chemotherapy comprising bortezomib, thalidomide, and dexamethasone; one cycle comprising vincristine, doxorubicin, and dexamethasone; and two cycles comprising lenalidomide and dexamethasone, without any clinically significant response. Three weeks before visiting the hospital, the patient also started complaining of progressive weakness, impaired respiratory function, and abdominal distension; an abdominal ultrasound at the time revealed hepatosplenomegaly with ascites, most likely associated with portal hypertension and protein disturbance, which initially he tolerated very well. Physical examination revealed crackles over the basal areas of the lungs, an enlarged spleen and liver, ascites (stage 2), and peripheral pitting edema. Bone marrow aspiration revealed that plasmacytes accounted for 58% of all nucleated cells. Laboratory tests revealed the following: serum monoclonal IgG, 88.4 g/L (normal: 8-17) and β2-microglobulin, 26.8 mg/L (normal: 1.09-2.53). An abdominal wall fat pad biopsy was positive for amyloid by Congo red staining; this correlated with elevated B-type natriuretic peptide levels (818.7 pg/mL; normal: 0-125). Peritoneal paracentesis was performed and 650 mL of red fluid was aspirated. Laboratory tests revealed a serum-ascites albumin gradient of 1.1 g/dL, with elevated lactate dehydrogenase. Microscopic examination of slide preparations revealed extensive monotonous infiltration by plasmacytes and plasmablasts with highly atypical nuclei

Figure 1. A) Microscopic evaluation of plasmacytes and plasmablasts in an ascitic fluid smear (modified Wright-Giemsa stain, 400x). B) Multiple myelomatous infiltrations of the peritoneal cavity (computed tomography scan, axial plane). C) Multiple myelomatous infiltrations of the peritoneal cavity (computed tomography scan, sagittal plane). and wide polymorphism; monoclonality (CD38+ CD56+ CD45+ CD138+ cyκ+) was confirmed by immunophenotyping (Figure 1A). Computed tomography of the abdomen and thorax revealed interstitial changes in the lower lobes of the lungs; pathological contrast enhancement of enlarged (up to 16-20 mm in diameter) paraaortic, paratracheal, and mediastinal

Address for Correspondence/Yazışma Adresi: Jakub DEBSKI, M.D., Uniwersytet Medyczny im Piastow Slaskich we Wroclawiu, Department of Hematology, Blood Neoplasms and Bone Marrow Transplantation, Wroclaw, Poland Phone : +48 71 784 2610 E-mail : jmdebski@gmail.com ORCID-ID: orcid.org/0000-0002-2944-0929

Received/Geliş tarihi: July 05, 2016 Accepted/Kabul tarihi: August 15, 2016

Debski J, et al: Plasma Cell Myeloma

lymph nodes; hepatosplenomegaly with ascites and dilatation of the portal venous system; multiple infiltrations of the abdominal wall (described as peritoneal carcinomatosis); focal osteolysis of the thoracic and lumbar vertebrae; and enlargement of the right ventricle (Figures 1B and 1C). This clinical presentation reflected aggressive features of advanced, chemoresistant PCM with coexisting AL amyloidosis. Due to the high level of monoclonal proteins in the serum, we performed plasmapheresis and implemented a salvage chemotherapy regimen based on bendamustine. However, despite intensive treatment, the patient died of disease progression. Ascites is an extremely rare extramedullary manifestation of a heterogeneous clinical entity such as PCM, although it is worth noting that it has a greater predilection for the IgA subtype than for IgG [1,2]. Similarly, as in the current case, the condition may have multifactorial etiology associated with PCM progression, i.e. infiltration of the liver, heart failure, renal failure, portal hypertension, amyloidosis, and, finally, peritoneal myelomatous deposits [3]. Despite multimodal treatment, including radiation therapy, plasmapheresis, systemic chemotherapy based on novel drugs, and hematopoietic stem cell transplantation, the

Turk J Hematol 2018;35:71-72

appearance of ascites heralds a dismal prognosis; median overall survival is usually no longer than 2 months [2,4]. Keywords: Myeloma, Amyloidosis, Ascites Anahtar SĂśzcĂźkler: Miyelom, Amiloidoz, Asit Informed Consent: It was received. Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Morgan D, Cieplinski W. Myelomatous ascites. Am J Med Sci 1985;290:159164. 2. Mitra S, Mukherjee S, Chakraborty H, Bhattacharyya M. IgG lambda myeloma presenting as plasmacytic ascites: case report and review of literature. Indian J Hematol Blood Transfus 2015;31:472-479. 3. Karp SJ, Shareef D. Ascites as a presenting feature multiple myeloma. J R Soc Med 1987;80:182-184. 4. Kyle RA, Gertz MA, Witzig TE, Lust JA, Lacy MQ, Dispenzieri A, Fonseca R, Rajkumar SV, Offord JR, Larson DR, Plevak ME, Therneau TM, Greipp PR. Review of 1027 patients with newly diagnosed multiple myeloma. Mayo Clin Proc 2003;78:21-33.

IMAGES IN HEMATOLOGY DOI: 10.4274/tjh.2016.0404 Turk J Hematol 2018;35:73-74

Pachymeningeal Involvement with Blindness as the Presenting Manifestation of Non-Hodgkin Lymphoma Hodgkin Dışı Lenfomada Başlangıç Bulgusu Olarak Körlük ile Birlikte Pakimeningeal Tutulum Charanpreet Singh1, Pankaj Malhotra2

Arjun Lakshman1,

Aditya Jandial2,

Sudha Sharma3,

Ram Nampoothiri2,

Gaurav Prakash2,

Postgraduate Institute of Medical Training and Research, Department of Internal Medicine, Chandigarh, India Postgraduate Institute of Medical Training and Research, Department of Internal Medicine, Clinical Hematology and Bone Marrow Division, Chandigarh, India 3 Postgraduate Institute of Medical Training and Research, Department of Pathology, Chandigarh, India 1 2

A 44-year-old female presented with fever for 6 months and gradual-onset progressive diminution of vision in both eyes for 1 month. On examination, she had enlarged cervical, axillary, and inguinal lymph nodes; hepatomegaly (7 cm under the right costal margin); splenomegaly (5 cm under the left costal margin); and bilateral renomegaly. Examination of the optic fundi (Figures 1A and 1B) showed bilateral disc edema (black arrowhead) with hemorrhages in the right eye (white arrowhead). Contrastenhanced magnetic resonance imaging of the brain (Figure 2A) was done, which showed pachymeningeal enhancement (white arrow). Histopathological examination of the excised cervical lymph node showed infiltration by atypical lymphoid cells, with immunohistochemistry suggesting diffuse large B-cell lymphoma

Figure 1. A) Right fundus photograph showing optic disc edema with multiple hemorrhages. B) Left fundus photograph showing large optic disc with blurred margins suggestive of papilledema.

(DLBCL)-activated B-cell-like. Microscopic examination of cerebrospinal fluid showed infiltration by malignant lymphoid cells (Figure 2B). A diagnosis of non-Hodgkin lymphoma-DLBCL with secondary central nervous system (CNS) involvement and bilateral grade 4 papilledema, likely due to pachymeningeal involvement, was made. The patient was started on systemic and intrathecal chemotherapy. CNS involvement with aggressive lymphomas is uncommon at initial presentation and usually occurs during relapse after primary therapy [1]. Ophthalmological abnormalities are usually

Figure 2. A) Contrast-enhanced magnetic resonance imaging of the brain showing patchy meningeal enhancement and thickening, suggestive of pachymeningitis. B) Cerebrospinal fluid cytology showing atypical lymphoid cells 2-3 times the size of normal lymphoid cells with prominent nucleoli.

Address for Correspondence/Yazışma Adresi: Pankaj MALHOTRA, M.D., Postgraduate Institute of Medical Training and Research, Department of Internal Medicine, Clinical Hematology and Bone Marrow Division, Chandigarh, India Phone : +91 386 280 38 08 E-mail : pgimerhemat@gmail.com ORCID-ID: orcid.org/0000-0003-1198-8491

Received/Geliş tarihi: October 12, 2016 Accepted/Kabul tarihi: November 15, 2016

Singh C, et al: Pachymeningeal Involvement with Blindness

attributed to the direct invasion of the optic nerve and ocular structures by the lymphoma [2], which was not seen in our case. Keywords: Non-Hodgkin lymphoma, Central nervous system involvement, Blindness, Papilledema Anahtar Sözcükler: Hodgkin dışı lenfoma, Merkezi sinir sistemi tutulumu, Körlük, Papilödem Informed Consent: It was received.

Turk J Hematol 2018;35:73-74

References 1. Gleissner B, Chamberlain M. Treatment of CNS dissemination in systemic lymphoma. J Neurooncol 2007;84:107-117. 2. Güler E, Kutluk T, Akalan N, Akyüz C, Atahan L, Büyükpamukçu M. Acute blindness as a presenting sign in childhood non-Hodgkin lymphoma. J Pediatr Hematol Oncol 2003;25:69-72.

LETTERS TO THE EDITOR Turk J Hematol 2018;35:75-93

Leukoagglutination, Mycoplasma pneumoniae Pneumonia, and EDTA Acid Blood Lökosit Agregasyonu, Mycoplasma pneumoniae Pnömonisi ve EDTA’lı Kan Beuy Joob1,

Viroj Wiwanitkit2

Sanitation 1 Medical Academic Center, Bangkok, Thailand Hainan Medical University, Hainan Sheng, China; DY Patil University Faculty of Medicine, Pune, India

1 2

To the Editor,

Keywords: EDTA, Leukoagglutination, Mycoplasma

We read the report “Peculiar Cold-Induced Leukoagglutination in Mycoplasma pneumoniae Pneumonia” with great interest [1]. Kubota et al. [1] reported an interesting patient with Mycoplasma pneumoniae pneumonia who had leukoagglutination. They noted that this is a rare condition. We agree that the patient had leukoagglutination and Mycoplasma pneumoniae pneumonia. Nevertheless, the leukoagglutination in this case may or may not have been due to Mycoplasma pneumoniae pneumonia. A common problem that might be forgotten is EDTA-induced leukoagglutination [2]. This basic laboratory interference phenomenon cannot be ruled out in the present case. As noted by Grob and Angelillo-Scherrer, EDTA-dependent leukoagglutination can be seen in healthy individuals and this is not related to Mycoplasma pneumoniae pneumonia [3].

Anahtar Sözcükler: EDTA, Lökosit agregasyonu, Mikoplazma Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Kubota Y, Hirakawa Y, Wakayama K, Kimura S. Peculiar cold-induced leukoagglutination in Mycoplasma pneumoniae pneumonia. Turk J Hematol 2017;34:354-355. 2. Anand M, Gulati HK, Joshi AR. Pseudoleukopenia due to ethylenediaminetetraacetate induced leukoagglutination in a case of hypovolemic shock. Indian J Crit Care Med 2012;16:113-114. 3. Grob AV, Angelillo-Scherrer A. Leukoagglutination reported as platelet clumps. Blood 2011;118:2940.

Address for Correspondence/Yazışma Adresi: Beuy JOOB, M.D., Sanitation 1 Medical Academic Center, Bangkok, Thailand Phone : +90 386 280 38 08 E-mail : beuyjoob@hotmail.com ORCID-ID: orcid.org/0000-0002-5281-0369

Received/Geliş tarihi: November 28, 2017 Accepted/Kabul tarihi: December 01, 2017 DOI: 10.4274/tjh.2017.0425

LETTERS TO THE EDITOR

Turk J Hematol 2018;35:75-93

Reply to the Authors: To the Editor, We thank Joob and Wiwanitkit [1] for their helpful comments regarding the cause of leukoagglutination in our case [2]. Although the underlying mechanism of in vitro leukoagglutination has not been fully clarified, leukoagglutination can be classified into two groups: (1) EDTA-dependent leukoagglutination, and (2) EDTA-independent cold-induced leukoagglutination [3,4]. As pointed out by Joob and Wiwanitkit [1], both EDTA and cold agglutinin (CA) may have been implicated in our case, although high-titer CA was detected, and numerous erythrocyte agglutinations were observed in the peripheral blood smear. Screening for CA has shown that low-titer CAs may be found in the serum of healthy adults [5]; this may suggest the possibility that naturally occurring CA is somewhat involved in EDTA-dependent leukoagglutination in healthy subjects. Nonetheless, when leukoagglutination occurs in an EDTA-anticoagulated blood sample, additional examination of the sample using other anticoagulants could be recommended to confirm the relationship between leukoagglutination and EDTA. Best Regards Yasushi Kubota, Shinya Kimura

References 1. Joob B, Wiwanitkit V. Leukoagglutination, Mycoplasma pneumoniae pneumonia and EDTA blood. Turk J Hematol 2018;35:75. 2. Kubota Y, Hirakawa Y, Wakayama K, Kimura S. Peculiar cold-induced leukoagglutination in Mycoplasma pneumoniae pneumonia. Turk J Hematol 2017;34:354355. 3. Goyal P, Agrawal D, Kailash J, Singh S. Cold-induced pseudoneutropenia in human immunodeficiency virus infection: first case report and review of related articles. Indian J Hematol Blood Transfus 2014;30(Suppl 1):148-150. 4. Lee JH. Neutrophil aggregation on the peripheral blood smear in a patient with cold agglutinin disease. Ann Hematol 2017:96:885-886. 5. Dacie J. Auto-immune haemolytic anaemia (AIHA): cold-antibody syndromes II: immunochemistry and specificity of the antibodies; serum complement in autoimmune haemolytic anaemia. In: Dacie J (ed). The Haemolytic Anaemias. Vol. 3. London, Churchill Livingstone, 1992.

LETTERS TO THE EDITOR

Turk J Hematol 2018;35:75-93

Cyclic Guanosine Monophosphate-Dependent Protein Kinase I Stimulators and Activators Are Therapeutic Alternatives for Sickle Cell Disease Siklik Guanozin Monofosfat Bağımlı Protein Kinaz I Uyarıcıları ve Aktivatörleri Orak Hücreli Anemide Tedavi Alternatifleridir Mohankrishna Ghanta1,

Elango Panchanathan1,

Bhaskar VKS Lakkakula2

Sri Ramachandra Medical College and Research Institute-DU, Faculty of Medicine, Department of Pharmacology, Chennai, Tamil Nadu, India Sickle Cell Institute Chhattisgarh, Department of Molecular Genetics, Division of Research, Raipur, Chhattisgarh, India

1 2

To the Editor, Sickle cell anemia (SCA) can lead to a host of complications, including hemolysis, vaso-occlusive episodes (painful crises), pulmonary hypertension, acute chest syndrome, and multiorgan damage. SCA has no widely available cure. Furthermore, the available treatments have unfavorable side effects, such as myelosuppression of blood cells from continuous use of hydroxyurea, iron overload from repeated blood transfusions, or immunosuppressive treatments required to sustain a bone marrow transplant. In patients with SCA, hemoglobin-induced damage of endothelial cells can lead to endothelial dysfunction due to the deficiency of nitric oxide (NO) [1]. NO is continuously synthesized by the endothelium to maintain vascular tone. The NO-soluble guanylate cyclase (sGC)-cyclic guanosine monophosphate (cGMP) signaling (NO-sGC-cGMaP) pathway is one of the three important signaling pathways that are regulated by NO in maintaining the vascular tone. NO stimulates sGC in the vascular smooth muscle cells to induce formation of cGMP. This produced cGMP causes stimulation of cGMP-dependent protein kinases (cGKs), which in turn stimulate voltagedependent ion channels. The cGKs are serene and threonine kinases, substrates for cGMP to elicit physiological functions. cGKs inhibit calcium release from the endoplasmic reticulum through the inositol 1,4,5-trisphosphate receptor-associated cGMP kinase substrate (IRAG) and alternatively activate myosinlight-chain phosphatase by inhibiting the MLC kinases, with both mechanisms resulting in smooth muscle relaxation [2]. Two types of cGKs have been revealed to date. Mammalian cGKs exist as two isoforms, cGKI and cGKII, which are coded by the prkg1 and prkg2 genes, respectively. In humans two isoforms of cGKI have been described, cGKI-α and cGKI-β, differing only in their N-terminal parts and generated by alternative splicing of a single gene. Northern blot analysis revealed that human cGKI-α mRNA was present in the aorta, heart, kidneys, and adrenal glands. In contrast, human cGKI-β mRNA was present only in the uterus.

In SCA, vascular tone control is compromised due to vasculopathy associated with hemolysis. As NO is considered beneficial, hydroxyurea and inhalational NO were administered to increase the bioavailability of NO, which raises cGMP levels [3]. Phosphodiesterases (PDEs) are enzymes that catalyze cGMP to GMP. Inhibitors of PDEs also increase cGMP levels by decreasing the degradation of cGMP. Inhibition of PDE9A enzyme with the specific inhibitor BAY73-6691 reversed the increased adhesive properties of neutrophils in sickle cell disease and increased production of the γ-globin gene (HBG) in K562 cells. Furthermore, sGC activators were suggested for treatment of sickle cell disease (Figure 1) [4].

Figure 1. Schema of the nitric oxide-soluble guanylate cyclasecyclic guanosine monophosphate-protein kinases I signaling pathway in the treatment of sickle cell anemia vasculopathies. NO: Nitric oxide, sGC: soluble guanylate cyclase, cGMP: cyclic guanosine monophosphate, cGKI: protein kinases.

LETTERS TO THE EDITOR

NO can lead to excess production of reactive oxygen species (ROS) and peroxynitrites. NO was also shown to induce cyclooxygenase and its isoforms, resulting in formation of prostaglandins, which leads to neuroinflammation [5]. NO also increases cGMP levels and leads to glutamate-induced toxicity resulting in neurodegeneration in the central nervous system (CNS) [6]. Furthermore, NO-dependent and NO-independent activators of sGC and inhibitors of PDEs tend to increase cGMP levels and similarly lead to glutamate toxicity and neurodegeneration in the CNS upon prolonged usage. The above-mentioned limitations show that there is a need for developing a potent drug similar to it with a safer pharmacological profile using the candidates of the pathway. Hence, another member of the same pathway, cGKI, can help as a therapeutic target, because cGK activity was reported to be spared on cGMP-dependent ion channels, which were shown to cause neurotoxicity [7]. cGKI activators that regulate IP3/IRAG calcium channels of the endoplasmic reticulum are therapeutically valuable and may change the phase of treatment. cGKI-β was reported to be abundant in platelets and inhibited platelet aggregation by decreasing intracellular calcium by blocking IRAG/IP3 calcium channels [8]. A study reported cGK’s regulatory role in stimulation of γ-gene expression of fetal hemoglobin [9]. Activators of cGKI may provide drugs with safer pharmacological profiles in the treatment of SCA vasculopathies and pulmonary hypertension. To date, S-tides have been reported as activator drugs produced as synthetic peptides stimulating cGKI-α [10]. New drug discoveries targeting cGKI-α and cGKI-β may ensure safer pharmacological drug profiles of the NO-sGC-cGMP-cGK pathway in the treatment of SCA.

Turk J Hematol 2018;35:75-93

Conflicts of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included.

References 1. Verma H, Mishra H, Khodiar PK, Patra PK, Bhaskar LV. NOS3 27-bp and IL4 70-bp VNTR polymorphisms do not contribute to the risk of sickle cell crisis. Turk J Hematol 2016;33:365-366. 2. Schlossmann J, Ammendola A, Ashman K, Zong X, Huber A, Neubauer G, Wang GX, Allescher HD, Korth M, Wilm M, Hofmann F, Ruth P. Regulation of intracellular calcium by a signalling complex of IRAG, IP3 receptor and cGMP kinase Iβ. Nature 2000;404:197-201. 3. Weiner DL, Hibberd PL, Betit P, Cooper AB, Botelho CA, Brugnara C. Preliminary assessment of inhaled nitric oxide for acute vaso-occlusive crisis in pediatric patients with sickle cell disease. JAMA 2003;289:11361142. 4. Sharma D, Potoka K, Kato GJ. Nitric oxide, phosphodiesterase inhibitors and soluble guanylate cyclase stimulators as candidate treatments for sickle cell disease. Journal of Sickle Cell Disease and Hemoglobinopathies 2016:JSCDH-D-16-00097. 5. Mancuso C, Scapagini G, Curro D, Giuffrida Stella AM, De Marco C, Butterfield DA, Calabrese V. Mitochondrial dysfunction, free radical generation and cellular stress response in neurodegenerative disorders. Front Biosci 2007;12:1107-1123. 6. Ghanta M, Panchanathan E, Lakkakula BVKS, Narayanaswamy A. Retrospection on the role of soluble guanylate cyclase in Parkinson’s disease. J Pharmacol Pharmacother 2017;8:87-91. 7. Li Y, Maher P, Schubert D. Requirement for cGMP in nerve cell death caused by glutathione depletion. J Cell Biol 1997;139:1317-1324. 8. Antl M, von Brühl ML, Eiglsperger C, Werner M, Konrad I, Kocher T, Wilm M, Hofmann F, Massberg S, Schlossmann J. IRAG mediates NO/cGMPdependent inhibition of platelet aggregation and thrombus formation. Blood 2007;109:552-559.

Keywords: Sickle cell anemia, cGK activation, Nitric oxide

9. Ikuta T, Ausenda S, Cappellini MD. Mechanism for fetal globin gene expression: role of the soluble guanylate cyclase-cGMP-dependent protein kinase pathway. Proc Natl Acad Sci USA 2001;98:1847-1852.

Anahtar Sözcükler: Orak hücreli anemi, cGK aktivasyonu, Nitrik oksit

10. Moon TM, Tykocki NR, Sheehe JL, Osborne BW, Tegge W, Brayden JE, Dostmann WR. Synthetic peptides as cGMP-independent activators of cGMP-dependent protein kinase Iα. Chem Biol 2015;22:1653-1661.

Address for Correspondence/Yazışma Adresi: Bhaskar VKS LAKKAKULA, Ph.D., Sickle Cell Institute Chhattisgarh, Department of Molecular Genetics, Division of Research, Raipur, Chhattisgarh, India Phone : +91 8224979600 E-mail : lvksbhaskar@gmail.com ORCID-ID: orcid.org/0000-0003-2977-6454

Received/Geliş tarihi: November 17, 2017 Accepted/Kabul tarihi: December 01, 2017 DOI: 10.4274/tjh.2017.0407

LETTERS TO THE EDITOR

Turk J Hematol 2018;35:75-93

Three Factor 11 Mutations Associated with Factor XI Deficiency in a Turkish Family Türk Bir Ailede Faktör XI Yetersizliği ile İlişkili Üç Faktör 11 Mutasyonu Veysel Sabri Hançer1,

Zafer Gökgöz2,

Murat Büyükdoğan1

1İstinye University Faculty of Medicine, Department of Medical Genetics, İstanbul, Turkey 2Medicana International Ankara Hospital, Clinic of Hematology, Ankara, Turkey

To the Editor, Factor XI (FXI) is a homodimeric serine protease, which is produced in the liver and circulates in the plasma complexed with high-molecular-weight kininogen. FXI plays an important role in the amplification of the initial coagulation response via a positive feedback mechanism for the generation of additional thrombin [1,2,3,4]. Congenital FXI deficiency is characterized by decreased levels or activity of FXI in the plasma and may cause an inherited bleeding disorder. The FXI gene is located on 4q3435 and consists of 15 exons. The index case was a 10 year-old-boy with bleeding diathesis (excessive bleeding after tooth extraction). His activated partial thromboplastin time (aPTT) was 84.3 s (normal range: 32-39 s), FXI activity was 0%, and he was diagnosed with FXI deficiency. His parents were related. The father had a mild bleeding tendency with prolonged aPTT (48.2 s). FXI activity was found to be 4%. The mother and the second child had no bleeding history with mildly decreased FXI activities (40% and 60%, respectively). We performed a mutational analysis for the whole family, including the patient’s grandparents. Genomic DNA was extracted from whole blood. All exons and approximately 25-bp exon-intron boundaries of the factor 11 (F11) gene were amplified using sets of designed primers. After polymerase chain reaction, the amplified fragments were sequenced. The patient and his father had a p.Ala109Thr (ENST00000492972.6, p.A109T, c.325 G>A, rs768474112) homozygous mutation for F11; the patient also had novel heterozygous p.I454T and p.Y472* mutations (Figure 1). The presence of a homozygous p.A109T mutation in the father and the index patient caused severe FXI deficiency. The mother and the second child had heterozygous p.I454T and p.Y472* mutations. As shown in Figure 2, p.I454T and p.Y472* heterozygosity moderately decreases the activity of FXI. In this family, we found two novel mutations, p.I454T and p.Y472*, associated with a homozygous p.A109T mutation. p.I454T is probably damaging with a PolyPhen score of 0.9. This is the first case reported in the literature with homozygous p.A109T. Previously, Guella et al. [5] reported a heterozygous p.A109T mutation in an Italian family with FXI deficiency. They

showed that exon-skipping had occurred due to a heterozygous p.A109T mutation and they explained that the unchanged enzyme activity was due to a non-sense mediated RNA decay mechanism. With this mechanism, due to p.A109T mutation, incorrectly spliced transcripts are not allowed to exit the nucleus to the cytoplasm. Our cases confirmed their results, such that a heterozygous p.A109T mutation did not affect enzyme activity; the enzyme activity of a person who has two heterozygous mutations (p.Y472* and p.I454T) is the same as that of someone

Figure 1. Electropherogram results.

Figure 2. Pedigree of the family. AE: Activity of the enzyme, +: heterozygous, ++: homozygous.

LETTERS TO THE EDITOR

who has three heterozygous mutations (p.A109T, p.Y472*, and p.I454T). However, when p.A109T was homozygous, like in our index patient and his father, the enzyme activity decreased by approximately 96% as shown in the pedigree. Another interesting point was the presence of a homozygous p.A109T mutation in the patient while his mother had no p.A109T mutation. This may be explained by a second-hit de novo mutation in the index case. Further expression studies evaluating the effects of these mutations will improve our understanding of the functional and structural features of the FXI enzyme. Keywords: Factor XI, Mutation, Family Anahtar Sözcükler: Faktör XI, Mutasyon, Aile Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships,

Turk J Hematol 2018;35:75-93

and/or affiliations relevant to the subject matter or materials included.

References 1. Thompson RE, Mandle R Jr, Kaplan AP. Studies of binding of prekallikrein and factor XI to high molecular weight kininogen and its light chain. Proc Natl Acad Sci USA 1979;76:4862-4866. 2. Geng Y, Verhamme IM, Smith SM, Sun MF, Matafonov A, Cheng Q, Smith SA, Morrisey JH, Gailani D. The dimeric structure of factor XI and zymogen activation. Blood 2013;121:3962-3969. 3. Kravtsov DV, Wu W, Meijers JC, Sun MF, Blinder MA, Dang TP, Wang H, Gailani D. Dominant factor XI deficiency caused by mutations in the factor XI catalytic domain. Blood 2004;104:128-134. 4. Whelihan MF, Orfeo T, Gissel MT, Mann KG. Coagulation procofactor activation by factor XIa. J Thromb Haemost 2010;8:1532-1539. 5. Guella I, Solda G, Spena S, Asselta R, Ghiotto R, Tenchini ML, Castaman G, Duga S. Molecular characterization of two novel mutations causing factor XI deficiency: a splicing defect and a missense mutation responsible for a CRM+ defect. Thromb Haemost 2008;99:523-530.

Address for Correspondence/Yazışma Adresi: Veysel Sabri HANÇER, M.D., İstinye University Faculty of Medicine, Department of Medical Genetics, İstanbul, Turkey Phone : +90 533 634 30 14 E-mail : vshancer@yahoo.com ORCID-ID: orcid.org/0000-0003-2994-1077

Received/Geliş tarihi: April 01, 2017 Accepted/Kabul tarihi: September 25, 2017 DOI: 10.4274/tjh.2017.0140

LETTERS TO THE EDITOR

Turk J Hematol 2018;35:75-93

Participation in Physical and Sportive Activities among Adult Turkish People with Hemophilia: A Single-Center Experience Türk Hemofili Hastalarında Fiziksel Etkinlik ve Sportif Faaliyetlere Katılım: Tek Merkez Deneyimi Arni Lehmeier1,

Muhlis Cem Ar1,

Sevil Sadri1,

Mehmet Yürüyen2,

Zafer Başlar1

İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Hematology, İstanbul, Turkey İstanbul University Cerrahpaşa Faculty of Medicine, Department of Internal Medicine, Division of Geriatrics, İstanbul, Turkey

1 2

To the Editor, Because of the increased bleeding risk, people with hemophilia (PwH) were advised to avoid physical activity (PA) until the 1970s [1]. However, with the advent of modern treatment modalities and regarding the numerous benefits that PA offers, currently PwH are encouraged to participate in PA and sports as much as possible [2]. Nevertheless, how physically active are adult PwH? This question has readily been studied in high-income countries with unrestricted access to coagulation factors [3], but facts are lacking about the awareness level on PA and its prevalence among adult hemophiliacs in developing countries, such as Turkey, where the market entrance of coagulation factors and the practice of prophylaxis have been relatively recent. In order to assess this question, 70 Turkish PwH with hemophilia A (84.3%) and B (15.7%) aged 19-61 years (mean: 38.0±11.8) were asked to complete a questionnaire that included questions on the sociodemographic characteristics and bleeding patterns of the patients, their attitudes towards exercise and sports, and their levels of involvement in PA. The study strikingly showed that Turkish PwH had a low level of awareness about PA. Less than one-fifth of the patients reported being sufficiently involved in PA. The level of involvement was highest (35%) in young adults (18-29 years) and lowest (0%) in patients aged 50-69 years (p<0.05). Conversely, in a German study [4], more than half of the adult hemophiliacs were very interested in exercise and sports. Although sportive activity is not equal to PA, German PwH seem to be more involved in an active lifestyle than Turkish patients. However, the present results might be associated with the severity of hemophiliac arthropathy, which is significantly more prevalent in older age groups (p<0.05). Despite the low awareness of PA, more than 40% of the patients met the current World Health Organization recommendations for PA [5], with young adults (65%) again being significantly more involved in physical activities than older PwH (23%) (p<0.05).

Our results indicate that most of the patients avoid sportive activities (60%). Those who are physically active reported preferring moderate-intensity PA like walking or climbing stairs, instead of vigorous-intensity activities. As expected, the level of sportive activity significantly declined with increasing age (p<0.05). What are the reasons underlying the low level of PA in adult PwH in Turkey? Pain, fear of being injured, and lack of motivation were the most frequently reported reasons for avoiding PA. This is not surprising, given the late implementation of prophylaxis in Turkey (in 2005) and the resultant high prevalence of hemophilic arthropathy among elderly Turkish PwH causing pain and immobility. A multidisciplinary approach for implementation of suitable/ safe physical exercises associated with less or no pain would help patients overcome the fear of being injured and thus increase their involvement in PA. The risk of injury can be minimized by following the recommendations for safe PA for hemophiliacs [6], which are often ignored, as shown by the patients (Table 1). In conclusion, a reasonable treatment program for hemophilia should include much more than just factor replacement. PwH should be educated on the positive impact of PA on their physical, social, and psychological well-being. Furthermore, they should be well instructed about the recommendations for safe PA and what happens if they ignore the safety issues. PA should be considered as an integrated part of modern hemophilia treatment, which requires the collaboration of experts from various scientific fields. Keywords: Hemophilia, Physical activity, Sports, Turkey Anahtar Sözcükler: Hemofili, Fiziksel aktivite, Spor, Türkiye Conflict of Interest: The authors of this paper have no conflicts of interest, including specific financial interests, relationships, and/or affiliations relevant to the subject matter or materials included. 81

LETTERS TO THE EDITOR

Turk J Hematol 2018;35:75-93

Table 1. Results of the questionnaire according to age groups. Variable